pred_label stringclasses 2
values | pred_label_prob float64 0.5 1 | wiki_prob float64 0.25 1 | text stringlengths 115 1.01M | source stringlengths 39 45 |
|---|---|---|---|---|
__label__wiki | 0.982431 | 0.982431 | Home Music Music Lists
The 50 Best Albums of 2019
From ‘Lover’ to ‘Cuz I Love You,’ ‘Death Race to Love,’ and beyond, here are the records that defined the year
By JONATHAN BERNSTEIN & JON BLISTEIN & JON DOLAN & PATRICK DOYLE & BRENNA EHRLICH & SUZY EXPOSITO & JON FREEMAN & DAVID FRICKE & KORY GROW & WILL HERMES & CHRISTIAN HOARD & CHARLES HOLMES & JOSEPH HUDAK & BRENDAN KLINKENBERG & ELIAS LEIGHT & ANGIE MARTOCCIO & CLAIRE SHAFFER & ROB SHEFFIELD & HANK SHTEAMER & BRITTANY SPANOS & SIMON VOZICK-LEVINSON
As the culture continued to sag in 2019, music soared. This was the year Billie Eilish rewrote the rules of from-nowhere pop mega-success; Ariana Grande exulted in the spacey, self-loving emo grandeur of Thank U, Next; Taylor, Lana, Miranda Lambert, Vampire Weekend, and Sharon Van Etten capped off great decades with big reinventions; and Lizzo was as Lizzo as ever. Meanwhile, avant-pop what-the-fucks 100 Gecs and hard-rocking heroes Sheer Mag kept noise alive, and rising stars Megan the Stallion and DaBaby, both masterful mouths of the South, led a class of newcomers setting the table for the 2020s.
Moon Tooth, ‘Crux’
An album that can remind you of Converge one minute and John Mayer the next? Bear with us. There’s something alchemical at work on the second LP by Long Island outfit Moon Tooth that turns what could be a scatterbrained genre mashup into an ingenious hybrid. There’s no channel-changing evident on songs like “Omega Days” and “Motionless in Sky,” just a harmonious mesh of prog-metal fury and R&B poignancy. And while we never envisioned that power-ballad crooning could flow naturally into beast-mode blitz, it now seems like pure wish fulfillment, thanks to Crux’s awe-inspiring title track. Not since the early days of the Mars Volta has a rock band managed to sound so wildly adventurous while delivering such unshakable hooks.
Priests, ‘The Seduction of Kansas’
After making a name for themselves with the whirlwind fury of their live shows and early releases, this Washington, D.C., band disavowed the word “punk” entirely in interviews around their second album. The music backed up that promise, flying through art-damaged disco (the title track), dark minimalism (“I’m Clean”), eerie pop (“Carol”), and more — even a few all-out ragers like opener “Jesus’ Son” (rhymes with “I think I’m gonna hurt someone”). In the end, Priests made all of those labels irrelevant by burning with the same incandescent heat no matter what sounds they were trying on. The Seduction of Kansas is a pretty great album about American dysfunction, but it’s an even better album about how to make a guitar band feel essential in 2019.
Yola, ‘Walk Through Fire’
Prior to launching her solo career, British singer-songwriter Yola worked as a top-line songwriter, sang with Massive Attack, and performed in bands including Bugz in the Attic and Phantom Limb. There was, however, scant evidence of Bristol-born Yolanda Quartey’s pop and electronic pedigree on her proper debut, Walk Through Fire — instead, it’s a smooth-sipping master class in country-soul, produced by Dan Auerbach and played with knowing expertise by the Easy Eye Sound house band. There are shades of Dusty in Memphis (“Faraway Look”) and even Carole King’s sturdy singer-songwriter pop (“Still Gone”), but Yola sounds equally confident with more down-home traditions, as heard on the fiddle-laced title track and the lush, gentle ballad “Shady Grove.” Above it all, her deft sense of melody and commanding voice shines through, rising from a low purr to an explosive, cathartic cry on “Lonely the Night” and caressing an easygoing, windows-down groove in “Ride Out in the Country.”
Post Malone, ‘Hollywood’s Bleeding’
Post Malone barely moved a muscle for much of 2019, but he dominated the year anyway, racking up streams by the hundred million on 2018 singles like “Sunflower” and “Wow.” While some stars hew closely to the sound that brought them commercial success, afraid of alarming listeners with endless options at their fingertips, Malone decided not to pack his new album with attempts at “Wow, Part 2.” Quite the opposite, in fact — Hollywood’s Bleeding can evoke Tame Impala (“Circles”), classic rock (“Take What You Want”), and pop-punk (“Allergic”). Malone’s commercial pull is so strong that whatever he touches right now becomes a hit. Case in point: Ozzy Osbourne is currently the oldest performer appearing on Top 40 radio by several decades, thanks to his guest appearance on “Take What You Want.”
Burna Boy, ‘African Giant’
Burna Boy’s new album opens with a declaration of global conquest: “Here comes the African giant.” The Nigerian star alternates between brassy, propulsive solo showcases — “Anybody,” “Dangote,” “Gbona,” and “On the Low” are all nimble bass and loose funk — and shrewd collaborations that show him expanding his reach further into Atlanta (Future), London (Jorja Smith), Los Angeles (YG), and the Caribbean (Damian Marley, Serani). “On the Low” has become a stealthy hit stateside, earning over 20 million streams, according to the analytics company Alpha Data, and Burna Boy is working hard to maintain his momentum, recently appearing on a Stormzy and Ed Sheeran single that debuted at Number Three in the U.K. “One thing that’s constant [in my career] is growth,” Burna Boy told Rolling Stone. “It’s not an up-and-down thing. I climbed every step. I don’t skip steps — I’m too heavy to skip steps.”
Rico Nasty and Kenny Beats, ‘Anger Management’
Across 18 minutes and nine songs, Maryland rapper Rico Nasty boiled over. The anger inherent in Anger Management — a collaborative project with producer Kenny Beats — was more accurately a righteous fury. Over jagged and intense beats, Rico screamed, screeched, and yelped about everything she’s had to fight for and against on her path to rap stardom: the men who tried to control her, the people who desperately wanted to hold her back, fake relatives, copycat rappers, and the spoils that come along with never relenting. On “Cheat Code” she proclaims, “I can never wait on a nigga to come save me,” and on the “Dirt Off Your Shoulder”–sampling “Hatin,” she builds a chorus around the sage advice, “You know these niggas be hatin’ on bitches/You got your own shit, you ain’t ever gotta listen to him, girl.” But as the project progresses, the enmity begins to dissipate and the high-octane beats become more reflective. Rico lyrically admits what’s sonically unfolding: “Had a lot of built-up anger that I had to let out.” Her fury helped secure her spot in hip-hop, but it’s far from her only story.
The Black Keys, ‘Let’s Rock’
Breakup rumors surrounded the Black Keys in the three and a half years they took off from the road after touring 2014’s Turn Blue. But the break served them well. The band sounds recharged and heavier than ever on their catchiest album since 2011’s El Camino. The duo unabashedly channels bands like Stealers Wheel and Led Zeppelin, while frontman Dan Auerbach offers some of his most introspective lyrics ever: “Every woman who’s ever loved you is telling you lies/Everyone who’s ever loved you would never deny,” he sings on the funk throwdown “Tell Me Lies.” Auerbach, who spent much of the Keys’ break producing other artists at his studio, seems ready to take risks, incorporating gospel vocals on the rave-up “Low/Hi” and a sitar solo on “Breaking Down.”
Todd Snider, ‘Cash Cabin Sessions, Vol. 3’
An alt-country wordsmith of the first order, Snider came back from a battle with opiate addiction, sense of humor and fighting spirit intact, on an album recorded in Johnny Cash’s old cabin studio in Tennessee. (For those keeping track, there is no volume one or two.) The Dylan-esque “Talking Reality Television Blues” traces a narcotizing line from Milton Berle to The Apprentice, and “Working on a Song” is the well-observed life story of a Nashville songwriter. As a whole, the album is like Cash’s rebel spirit mixed with the mordant wit of Randy Newman, and it makes for one of the year’s best heartland statements, even if Nashville wouldn’t touch it with a 10-foot pole.
Rapsody, ‘Eve’
Rapsody made the stakes of her latest opus clear from the beginning: Over a sample of Nina Simone’s “Strange Fruit,” the very first words out of the fellow North Carolinian’s mouth were, “Emit light, rap, or Emmett Till.” On this dense 16-song concept album structured around paying homage to the diverse strands of black womanhood, the MC crafted a sprawling masterwork that nevertheless feels like her most intimate offering to date. Set to samples that range from Phil Collins to GZA to Björk, the 36-year-old traditionalist confronted a music industry that remains hostile to voices, like hers, that refuse to conform. “White men run us/They don’t want this kinda passion,” she offered, “A black woman story?/They don’t want this kinda rappin’.”
Maggie Rogers, ‘Heard It in a Past Life’
Expectations couldn’t have been higher for this up-and-comer’s pop debut, which doubled down on the muscular electro-folk of her breakthrough single, “Alaska.” But Heard It in a Past Life proved that the singer-songwriter was a first-rate pop classicist — from the soft balladry of “Past Life” to the Rostam Batmanglij-assisted percussive piano anthem “Fallingwater” and the strutting synth-rock of “Overnight.” Rogers took several years to write and record her first LP, which takes on her own unsettlingly rapid rise as its central drama. “Everything kept moving/And the noise got too loud,” she sings on “Light On,” her voice breaking on the pre-chorus climax: “With everyone around me saying/‘You should be so happy now.’”
Juice WRLD, ‘Death Race to Love’
Juice WRLD broke out with hits full of mournful guitar, self-involved lyrics sketching romantic torment, and vocals from the school of why-croon-if-you-can-wail. On his sophomore album, the Chicago rapper-singer is intent on demonstrating his versatility, trying his hand at steroidal SoundCloud rap (“Syphilis”), reverent R&B (“Demonz Interlude”), and global dance hits (“Hear Me Calling”). “People say that they can hear the rock influence, the Blink-182 influence, the emo influence in my music, but on this album you can hear ev-er-y-thing,” Juice WRLD told Rolling Stone. “I have songs for the trap house, songs for the sock hop, songs for the Caribbeans, songs for raves, songs for slow dancing.” Some artists sound awkward when they are attempting to prove their range; that’s not a problem for Juice WRLD. “Certain people freestyle for a while and then run out of things to say,” explained producer Hit-Boy, who worked closely on Death Race for Love. “I feel like [Juice WLRD] is one of the first people I’ve worked with personally who never runs out.”
Beck, ‘Hyperspace’
Beck seesaws between antique blues and modern artifice on his 14th LP, an album that captures the raw fear of time running out and darkness closing in, rendered in pop beats and colors. In songs like “Die Waiting” and “Dark Places” (the titles tell you plenty), Beck combines the exuberant studio mischief of 1999’s Midnite Vultures with the sumptuous introspection of 2002’s Sea Change to eccentric, genuinely compelling effect.
Summer Walker, ‘Over It’
On her slow-burning debut LP, Walker favors leisurely beats, frequently crafted by the Atlanta hip-hop producer London on da Track, and stories about not-quite-functional relationships. She also likes to pay tribute to Nineties R&B — nodding to Destiny’s Child’s “Say My Name” on “Playing Games,” reworking Usher’s “You Make Me Wanna” on “Come Thru” — and playing off of high-powered duet partners: Yes, that’s the actual Usher making a rare guest appearance on “Come Thru,” and he’s joined on Over It by the new-school brooders PartyNextDoor and 6lack, plus the sweet-voiced streaming sensation A Boogie Wit Da Hoodie, and a little artist by the name of Drake. Walker’s approach remains remarkably consistent from song to song, making Over It easy to absorb in a long chunk. That’s what listeners did in droves — Over It amassed more than 145 million streams its debut week.
Purple Mountains, ‘Purple Mountains’
David Berman established himself as a literary indie-rock genius in the Nineties and 2000s with his band the Silver Jews. After an 11-year hiatus, he returned with new project Purple Mountains, singing about love and its absence, the beauty of the world, and the futility of existence in heartbreaking, mordantly funny songs that explore his own unique outsider-country idiom. “Margaritas at the Mall” is hilarious happy-hour existentialism, “Darkness and Cold” is a crushingly lovely post-breakup autopsy, and “Storyline Fever” is a study in “motivational paralysis” hot-wired by Bakersfield guitar twang. Just days before Purple Mountains were scheduled to begin a tour to support the LP, Berman took his own life, leaving fans and peers with this wonderful suggestion of all the great music he still might’ve given us.
FKA Twigs, ‘Magdalene’
Not many artists could get away with a breakup album that doubles as an extended metaphor about Mary Magdalene, but not many artists have the careful curatorial skills of FKA Twigs. On her sophomore album, the English multi-hyphenate dissects the end of her much-publicized relationship with actor Robert Pattinson. She’s the Magdalene to his Jesus figure: a derided, misunderstood partner to a beloved celebrity. She lets it all out in songs like “Cellophane,” “Sad Day,” and “Mirrored Heart,” reflecting on public perception and a partner who doesn’t understand the pain of a relationship under the microscope of public scrutiny. With help from collaborators like Nicolas Jaar, Jack Antonoff, Kenny Beats, Future, Skrillex, and Cashmere Cat, she reconstructs what she’s called the “ornate birdcage” of her sound — a blend of orchestral elements and chamber pop with trap beats and R&B production. Only now, it’s simultaneously bigger and more accessible than ever before.
Brockhampton, ‘Ginger’
Brockhampton, the internet’s native boy band, had a meteoric rise. Then they paid for it. Following a dizzying three-album run in 2017 that powered the unusually large collective to superstardom, they began to fracture. “I had an identity crisis,” said Joba, one of the group’s producers. “I didn’t know how to exist.” Ginger finds the group on the other side of a chasm: more sensitive than before, less willing to give into anger, more influenced by Nineties R&B. It’s a mature album from artists who made their name going full-tilt at every opportunity, and the kind of cornerstone they could build a career upon. Until the next crisis.
Karen O and Danger Mouse, ‘Lux Prima’
Karen O and Danger Mouse came from different schools of early-2000s musical destruction (and reconstruction), but they sounded perfectly in step on Lux Prima, a collaborative album that found the Yeah Yeah Yeahs frontwoman crooning over the producer’s cinematic soundscapes. The music is part Goldfrapp trip-hop, part Isaac Hayes “Walk on By” soul odyssey, part Shirley Bassey Bond theme. It’s all effortlessly cool, and Karen O makes it even chillier as she sings about turning her dreams into a ministry of love (“Ministry”) and coos, “There’s nobody but youuu” (“Lux Prima”). She also sounds confident and strong on “Woman,” using her Yeah Yeah Yeahs growl to declare “I’m a woman,” and on “Redeemer” when she promises, “You’re not coming for me, I’m coming for you.” The whole thing is dusky, sexy, and fresh — just what you’d expect from these two.
J Balvin and Bad Bunny, ‘Oasis’
When Bad Bunny and J Balvin first linked up on 2017’s excellent “Si Tu Novio Te Deja Sola,” it might have been easy to lose them in the wave of urban collabs sweeping the Latin charts. But when the two crossed orbits on Cardi B’s bilingual summer jam “I Like It,” their effectiveness as a duo became impossible to ignore. By the time they followed that with the one-two punch of Balvin’s magnum opus Vibras and Bad Bunny’s Boricua manifesto X 100pre, these artists had established a league of their own. In a classic showing of international pop solidarity — or perhaps just genuine friendship — the Colombian Balvin and Puerto Rican Bunny dropped their long-awaited LP, Oasis, this summer. Together, the two continue to flout música urbana’s conventions, suffusing the streetwise art form of reggaeton with a healthy dose of play.
Sheer Mag, ‘A Distant Call’
Some bands go their whole careers without hitting on a sound as finely honed as the one Sheer Mag put forth on their first three EPs. Since then, it’s been a matter of micro-refinement: On their debut LP, 2017’s Need to Feel Your Love, they branched out into disco and funk; on A Distant Call, they added a semi-autobiographical framework, loosely based on the life of singer Tina Halladay. But the album’s genius lies in the mix of leather-and-spikes toughness (see fierce socialist anthem “Chopping Block”) and tears-on-my-pillow vulnerability (try the yearning breakup tale “Silver Line”) that’s been the band’s calling card all along. May they keep on not fixing what ain’t broke.
Megan Thee Stallion, ‘Fever’
“Nine times out of 10, I’m the realest bitch you know/If you ain’t want a pimp then what you fuckin’ with me for,” raps 24-year-old Megan Pete on her first LP. Megan Thee Stallion’s realness is never in question, as she connects the feminist rap tradition of Roxanne Shante and MC Lyte to the throbbing sounds of her native Houston, putting her own intimate pleasures front and center on pointillistically detailed dirty-talkin’ flexes like “Sex Talk” and “Pimpin’.” She brags about moving to the burbs and slips into some R&B softness on “Big Drank” and “Best You Ever Had,” but still keeps it resolutely ratchet, spraying commanding verses all over every track.
The National, ‘I Am Easy to Find’
The National’s eighth album, like all National albums, takes a little while to reveal itself as, also like all National albums, a melancholic exercise in beauty and restraint centered on the mundane pleasures and devastations of middle-aged life in America. The band sounds as assured as ever, but it’s the addition of new voices — lead singer Matt Berninger seems happy to cede the spotlight — that shows they’re more than capable of evolution. From the emergence of longtime Bowie collaborator Gail Ann Dorsey on the opening track, “You Had Your Soul With You,” the album continually subs out Berninger’s gruff baritone for female vocalists like Sharon Van Etten, Lisa Hannigan, and Kate Stables. The shift yields some of the band’s strongest work to date.
Sleater-Kinney, ‘The Center Won’t Hold’
Drummer Janet Weiss’ sidelining and departure was the sad footnote to this set. Yet it saw one of America’s greatest rock bands remaking itself in thrilling ways. Corin Tucker still brought the noise, paraphrasing Yeats on the title track in a bloodcurdling howl for a nation (and maybe a rock group, too). Conjuring the testimony of Christine Blasey Ford on the torch song “Broken,” Tucker also found a new sort of tenderness. Carrie Brownstein, meanwhile, emerged like a New Wave superheroine, amplified by producer Annie Clark of St. Vincent, a fellow guitar goddess who gave the music a chrome-plated, synth-powered sheen. The LP may have marked the end of an era. But it was both a fitting capstone and an auspicious new chapter.
Coldplay, ‘Everyday Life’
“The thing we’ve done with this album is like, ‘Fuck it,’ ” Chris Martin told Rolling Stone’s Jann Wenner about Coldplay’s eighth LP. “I don’t care what anybody thinks. I really don’t. Just let it flood through.” Flood it did: Everyday Life is a double album that brings together giant singalong choruses, Persian poetry, watery balladry, protest folk, Sufi qawwali, laid-back gospel, and production from Max Martin (alongside longtime Coldplay producer Rik Simpson and the Dream Team), plus guest spots from Fela Kuti’s son and grandson, the Belgian rapper-singer Stromae, the London Voice Choir, and Martin’s son, Moses, who co-wrote the single “Orphans.” (How all-over-the-place is it? Martin cited Paul Simon and Rammstein as big influences.) And yet the whole thing works, in part because there’s an audible lack of self-consciousness. Coldplay throw everything into the mix and bind it all together with Martin’s gift for melody and earnest humanism: lyrics about police violence, guns being everywhere, missile strikes in Syria. It’s by turns beautiful, catchy, a bit much. But by the end you’re glad they went for it all.
Sharon Van Etten, ‘Remind Me Tomorrow’
Sharon Van Etten has always known how to wreck hearts — she’s one of the past decade’s most unflinchingly intense songwriters. But she really hits home on Remind Me Tomorrow, her fifth and finest album. She goes for an expansive electro groove, but with all the stark intimacy of her early acoustic-guitar days. She begins the album in a saloon, with a hell of an opening scene: “Sitting at the bar, I told you everything/You said, ‘Holy shit.’ ” “Stay” is her trip-hop rumination on the terrors of becoming a mom, while “Seventeen” gives a boomingly compassionate pep talk to her younger self, taking flight at the end with Siouxsie-style wails.
Wilco, ‘Ode to Joy’
Wilco have reinvented themselves enough times during the past 25 years that few would have blamed them for spending the next quarter century turning out low-key treats like 2016’s Schmilco. Instead, they blew up the blueprint yet again for Ode to Joy, an exercise in radical restraint that yielded their best album in ages. The opening sequence of “Bright Leaves,” “Before Us,” and “One and a Half Stars” sets a mood of hushed intensity, with Jeff Tweedy singing about crushing sadness over Glenn Kotche’s drums and not much else. When the familiar pleasures of the band return to the mix later on — the rapturous Nels Cline riff on “Love Is Everywhere (Beware),” the campfire chorus of “Hold Me Anyway” — they feel both welcome and earned. “Are we all in love just because?/No, I think it’s poetry and magic,” Tweedy sings. Ode to Joy shows that Wilco aren’t ready to call off the search for either one.
Jamila Woods, ‘Legacy! Legacy!’
Following the gospel-tinged rap-soul revelation of her 2016 debut, HEAVN, Chicago poet Jamila Woods dug into cultural history to find the personal on her second LP. Song titles invoke musical giants (“MILES,” “EARTHA,” “SUN-RA”), whose sound and style Woods slyly channels in her arrangements and lyrics. But she looked to the future, too, passing the mic to rising stars Saba and Nitty Scott, whose cameos are pure fire. Like the best Windy City art, Woods’ work creates a world apart from coastal style-chasing: See the dubby space-funk of “OCTAVIA,” channeling speculative sci-fi master Octavia Butler (“Don’t ever let a textbook scare you/You the missing piece”), and the virtuoso flow of “GIOVANNI” (“A hundred muthafuckas can’t tell me how I’m ‘posed to look when I’m angry/How I’m ‘posed to shrink when you’re around me”), a nod to American poet Nikki Giovanni. When Woods declares, “I am not your typical girl,” she’s not lying.
Tanya Tucker, ‘While I’m Livin’
Although Tucker hates to refer to it as such, her “comeback” album couldn’t have turned out any better — While I’m Livin’ featurs 10 expertly chosen songs, two Grammy-winning producers, and one unmistakable voice. (It also netted her four Grammy nominations of her own.) A concise 35 minutes, the LP captures the outlaw essence of the one-time teenage star without resting on past laurels — there’s no “Delta Dawn” remake here. Instead, co-producers Brandi Carlile and Shooter Jennings challenged Tucker, throwing a cover of Miranda Lambert’s “The House That Built Me” at her, along with a wealth of brand-new songs written especially for the 61-year-old by Carlile and twin brothers Phil and Tim Hanseroth. “Mustang Ridge” and “The Wheels of Laredo” nod to her Texas heritage, and “I Don’t Owe You Anything” finds her playing the badass to the hilt. But it’s “Bring My Flowers Now,” about gathering those rosebuds while ye may, that is the album’s apex. “Good music is good, no matter what year, what generation. ‘Delta Dawn’ is always going to be a great song,” Tucker told Rolling Stone. “And that’s why you keep striving to find songs like that.”
Harry Styles, ‘Fine Line’
Styles’ sophomore album, Fine Line, is a breakup meditation bathed in the bright light of personal clarity. Even with a relationship to recover from he’s ready to step into the sun on an album chock full of the same California rock and pop influences that built the foundation of his self-titled 2017 debut. With less to prove this time around and his boy-band past feeling further away than ever before, the album is the sound of the star having a bit of fun. With dreamy summer nostalgia (“Watermelon Sugar”), Joni Mitchell-inspired dulcimer bops (“Canyon Moon”), Lucius-assisted calls for giving peace a chance (“Treat People With Kindness”), and extended psychedelic arrangements (“She”), Styles is building a new type of rock canon — and a new brand of rock star.
Bruce Springsteen, ‘Western Stars’
Bruce Springsteen has spent the last several years looking back. He celebrated the 35th anniversary of The River with a box set and tour, released a memoir, and put together a reflective Broadway residency. On Western Stars, he continued that nostalgia trip with an album that evokes late-Sixties and early-Seventies California pop, complete with swelling string arrangements and songwriting that shamelessly echoes Jimmy Webb and Glenn Campbell (he even covered “Rhinestone Cowboy” in the film version). Fittingly, the LP is filled with has-been L.A. characters — the title track centers on an actor who once did a scene with John Wayne, and “Drive Fast (The Stuntman)” features a stuntman who describes meeting a woman who “liked her guys a little greasy, ‘neath her pay grade.” No one could have anticipated that Springsteen would become a cowboy in 2019, but we’re glad he did.
Bon Iver, ‘i, i’
Since 2016’s 22, a Million, Bon Iver’s Justin Vernon hasn’t been content with giving it to you straight. The singer and multi-instrumentalist, long commended for his ability to spin a beautiful melody, retreated into himself, and his gear. With 22, a Million, the result was an album that was fraying at the edges; it sounded like a corrupted file. On i,i, he stays the path, wielding the same electronic distortion to offset the painfully earnest message at the heart of this album: a straightforward plea to be good to one another. This LP includes more coherent songs than its predecessor ever aspired to — “Hey Ma” is one of his best outings to date — and expresses sharp contempt for the listener, and likely himself, on songs like “Holyfields.” It’s an album about everything that somehow achieves intimacy.
Polo G, ‘Die a Legend’
“I’m a killer, girl, I’m sorry/But I can’t change,” Polo G raps in the chorus of his hit “Pop Out,” the centerpiece of the Chicago rapper’s debut, Die a Legend. In someone else’s hands, that apology would be cursory; in Polo’s, it’s a thematic concern. Chicago rap is having a moment this year — its sound is melodic, pained, beautiful — and Polo G is the emerging leader of a new class of rappers from the city. It’s easy to see why. Die a Legend is a remarkably confident full-length, marked by both a sensational ear for beats and a near-reflexive sincerity. Just as he can turn a party track regretful in a second, Polo’s delivery is perpetually nimble, always searching for the gap between rapping and singing — it’s not a new approach, but in Polo’s hands, it feels like an announcement.
100 Gecs, ‘1000 Gecs’
Across 10 songs and 23 minutes, the debut album from 100 Gecs — the duo of Dylan Brady and Laura Les — manages to sound like a billion different things. It’s a jumble of PC Music’s future pop, SoundCloud rap’s frazzled edges, EDM’s greatest excesses, the Warped Tour set’s deceptively broad sounds, and plenty more musical strands from the past 15 years. The center holds because the hooks are like superglue, but Brady and Les are also canny chroniclers of their era, tackling topics like self-medication (“800db Cloud”), capitalist pitfalls (“Stupid Horse”), and navigating the intricacies of heartache and love over the phone (“Ringtone,” “Gec 2 Ü”). There’s humor, there’s pathos, there’s a dubstep drop with dog barks (“745 Sticky”), and it all coalesced into one of 2019’s most exciting debuts.
Young Thug, ‘So Much Fun’
For six years, Young Thug was an uncontainable force: The otherworldly linguistics, the riotous ad-libs, and borderless melodies, along with the dresses and skirts and gender fluidity, broke a genre in need of breaking. But after a string of critically lauded yet commercially disappointing releases, Thug’s momentum stalled. Then So Much Fun resuscitated the mercurial musician. Direct and digestible, the album is Thug at his most streamlined. There are no heady concepts or genre detours; instead, the track list is loaded with major stars (Future, J. Cole, Travis Scott), and every beat is uncomplicated and dynamic. Thug ceded the floor on “Hot” and “Bad Bad Bad” to his streaming behemoth protégés (Lil Baby, Gunna), engaged in a rare press run, and dropped video after video. After years of deconstructing hip-hop and remaking it in his image, Thug spent 19 songs playing the game, and in the process became the commercial star he was destined to be.
Big Thief, ‘Two Hands’
Big Thief had a great 2019, releasing two excellent LPs, the cosmically hardbitten indie-folk set U.F.O.F., and the tougher, more earthbound Two Hands. At the center of their richly textured music is Adrianne Lenker’s delicately intense songwriting. She can squeeze mountains of meaning out of cryptic lyrics and deliver life-lesson lines like “the world has no direction/Everyone needs a little protection” in a way that makes you want to tattoo them on your forehead. The band backs her with just the right craggy guitar beauty, whether it’s on the gently unfolding “Forgotten Eyes” or the shyly explosive “Not.”
Sturgill Simpson, ‘Sound and Fury’
On 2014’s A Sailor’s Guide to Earth, Sturgill Simpson made a psychedelically soulful album that successfully blended themes of fatherhood and a mariner’s journey. For Sound and Fury, Simpson blew up the ship, making a “sleazy synth-rock dance record” that serves as a fuck-you to Music Row and beyond. He torches flash-in-the-pan artists (“Everybody’s worried about a good look/But they need to be worried ’bout a good hook”) and the yes men trying to surround him (“They come backstage and on my bus pretendin’ to be my friend”). Simpson, who started out with a bluegrass band, couldn’t sound farther from his roots. He spends minutes on end jamming on his Les Paul, with a sound that channels T. Rex and Trans-era Neil Young. He paired the album with an anime film. Those left-field choices paid off: Simpson is now headlining arenas for the first time. He sums up his mission on the last track, “Fastest Horse in Town”: “Everybody’s trying to be the next someone. But I’m trying to be the first something.”
Brittany Howard, ‘Jaime’
On her tour-de-force solo debut, Alabama Shakes frontwoman Brittany Howard was finally free to explore the full range of her various musical selves. Unburdened by the sea of retro expectations surrounding her main rock outfit, Howard explored a kaleidoscope of influences, from spaced-out Prince melodrama (“Run to Me”) to Nina Simone torch singing (“Short and Sweet”) and Gil Scott-Heron–esque spoken-word psychedelia (“13th Century Metal”). “I repeat, we are all brothers and sisters,” she declared throughout the latter. On an album with moments like “Goat Head,” a song that traced Howard’s family’s history of racial intimidation growing up in the rural South, the line sounded less like a truism than a proud provocation.
Angel Olsen, ‘All Mirrors’
Those who know Olsen from the stripped-down intimacy of 2014’s Burn Your Fire for No Witness may be startled by the grandeur here, though her 2016 My Woman clearly showed an artist whose trajectory had yet to be fully measured. “I was definitely listening to Brian Eno and a lot of Gary Numan, Kate Bush, Sinead O’Connor,” she said of her musical diet during the All Mirrors recording. “Also a lot of Nina Simone and jazz.” The result alternates vast orchestral landscapes with equally cinematic band tracks: Deranged and romantic, her glam-folk alto moves from whisper to wail and back again on songs that negotiate love with no shortage of self-interrogations. Nothing’s simple, or clear cut. The highlight is “Lark,” a crisis scene that builds like a roller-coaster ascent, then dive-bombs into string glissandos while Olsen goes full-ham on a lover. The finale may be the most cathartic two minutes of music you hear this year.
Jenny Lewis, ‘On the Line’
Following the death of her mother and the end of a 12-year relationship, Lewis channeled her grief into the stunning On the Line. The record arrived like a glittery beam of Laurel Canyon sunshine, as Lewis sings about bourbon and Mercury in retrograde (“Wasted Youth”), and Elliott Smith and grenadine (“Heads Gonna Roll”). The star-studded personnel — Ringo Starr, Beck, Heartbreakers’ keyboardist Benmont Tench, and legendary session drummer Jim Keltner all appear on the album — only adds to the Hollywood allure. “I’ve always brought that jam vibe with me wherever I go,” Lewis told Rolling Stone in March. “I feel compelled to play music, to play with people, or I’ll go crazy.”
Tyler, the Creator, ‘IGOR’
When Tyler, the Creator first earned a devoted following as a member of Odd Future Wolf Gang Kill Them All early in the decade, his raps were often abrasive, full of confrontation and provocation. Fast forward to 2019, and Tyler is making some of the year’s prettiest pop, often eschewing rap altogether and choosing to sing with disarming sincerity (“Don’t leave, it’s my fault/’Cause when it all comes crashing down, I’ll need you“). IGOR is idiosyncratic and surprising — “I Think” is an unexpected turn to nu-disco, while “Are We Still Friends?” pays tribute to soul great Al Green — without an obvious radio hit. In the old days, this combination would have ensured that IGOR remained a cult album. But in 2019, Tyler, the Creator managed to out-sell DJ Khaled’s Father of Asahd, the expensively marketed and produced equivalent of a Hollywood blockbuster, and debut at Number One.
Nick Cave, ‘Ghosteen’
Grief has always been Nick Cave’s greatest muse, but it never felt more present than on Ghosteen, an album he wrote after the death of his son. Where his past dirges were confrontational and intense, the songs on Ghosteen were quiet, ethereal, and, most surprising, hopeful. The Bad Seeds barely even touched their drums; nothing could cut through the gauzy, dreamy synths other than Cave’s voice. He split the record into two parts — one half dedicated to the parents of children who have died and the other for the kids — and it’s a triumph because he connected them with a yearning to make sense of it all. On the children’s side, he sings, “Sometimes a little bit of faith can go a long, long way” (on “Waiting for You”), and on the parents’, he sings, “It’s a long way to find peace of mind” (on “Hollywood”). The album is sad but never too sad. By the time it’s done, you just want to give him a hug.
The Highwomen, ‘The Highwomen’
With songs like “Redesigning Women,” “My Name Can’t Be Mama,” and the ballsy title track, the Highwomen’s self-titled album appeared to court a certain audience. But this was a record for everyone, with a message of solidarity that transcended age, race, and, yes, gender. Brandi Carlile, Amanda Shires, Natalie Hemby, and Maren Morris sang about topics affecting us all, from the grand (the persecution of the historical characters in “Highwomen”) to the minute (the glorious kiss-off “Don’t Call Me”). And the tracks that do zero in with a fine point — like the Carlile-sung “If She Ever Leaves Me” — are still wildly relatable. “I love that we have songs on this album about shattering female stereotypes to a gay country love song, and songs about losing loved ones,” Morris said to Rolling Stone. “It’s all real, and it’s all country.”
DaBaby, ‘Baby on Baby’
Hyper-regional, blunt, kinetic, and self-assured, DaBaby’s Baby on Baby marked the arrival of a star. The North Carolina rapper with a gleaming, jewel-encrusted smile brought a myriad of skills into 2019. His singular, raspy voice boomed over simple, bass-boosted beats, and his flow contained enough gravitas to assault the senses. “Suge” became the rare 2019 rap hit that forgoes melody in favor of a torrent of bullish bars stacked atop a ceaseless, unending flow. “Walker Texas Ranger” was the funniest Western-themed hip-hop song of the year (yes, even including “Old Town Road”), while “Goin Baby” was a monument to the ability of raucous ad-libs to make a normal song seem transcendent. Baby on Baby was merely an opening salvo — nine months later, that shot is still ringing.
Miranda Lambert, ‘Wildcard’
Working with innovative producer Jay Joyce (Eric Church, Brothers Osborne) for the first time, Miranda Lambert reinvigorated her sound with rock & roll energy on Wildcard. On these 14 new songs, the country star shrugged off life’s little mishaps (and men) in the lead single “It All Comes Out in the Wash” and then knowingly chuckled about seeing her face adorning the tabloids in “Pretty Bitchin’.” In “Way Too Pretty for Prison,” Lambert and Maren Morris traded wicked fantasies about knocking off an unfaithful partner. But there were also hints of Lambert’s new love, as with the smoldering “Fire Escape” and the vulnerable “How Dare You Love.” She experimented with her sound on the sleek “Mess With My Head” and the punk-tinged “Locomotive,” but easily switched gears to bedrock country in “Tequila Does” and the stark closing track “Dark Bars.” Through it all she held fast to hope. “If the whole wide world stops singing and all the stars go dark/I’ll keep a light on in my soul/Keep a bluebird in my heart,” she sang in “Bluebird,” a perfectly uplifting message for these (or any other) dark times.
Vampire Weekend, ‘Father of the Bride’
If Vampire Weekend’s first three albums were like freshman, sophomore, and junior year, Father of the Bride felt like the work of a senior who’d returned from a long gap year (or six) with some very strong opinions about the best “Dark Star.” And while the kind vibes and earthy images that accompanied early songs like “Sunflower” and “Harmony Hall” seemed to suggest Vampire Weekend had gone full jam band, Father of the Bride proved characteristically dense and eclectic. Highlights like “This Life,” “Married in a Gold Rush,” “Unbearably White,” and “Stranger” revealed a tasteful palette rooted in, but not beholden to, Seventies Southern California, while bandleader Ezra Koenig continued to expertly capture the big and little tragedies and comedies that engulf individual lives and the world at large.
Lizzo, ‘Cuz I Love You’
A classically trained flute virtuoso turned hip-hop soul queen, Lizzo arrived as a full-fledged pop legend this year with Cuz I Love You. On her major-label debut, she claims herself as her own “Soulmate” and leaves her baggage behind, boasting that the “Only exes that I care about are in my fucking chromosomes.” “Tempo” is her club duet with Missy Elliott (“Slow songs, they for skinny hoes”) while “Juice” goes for Eighties Minneapolis dance-floor gloss. And in “Jerome,” she belts an old-school R&B ballad. She came off like a young Tina Turner making a Private Dancer of her own, flaunting the coolest flute solos since Jethro Tull.
Bad Bunny, ‘X 100pre’
After Hurricane Maria struck Puerto Rico in 2017, morale was below sea level. An estimated 3,000 people had died, disaster relief had been stalled, and 24-year-old Latin trap star Bad Bunny began grappling with celebrity outside the decimated island he called home. During his U.S. television debut on The Tonight Show, he pulled an impressive stunt by prefacing his gospel-trap single “Estamos Bien” with a sobering plea for help on behalf of Puerto Rico. (“More than 3,000 people died, and Trump’s still in denial.”) The statement foreshadowed the gravity and range of his debut LP, X 100pre. Volleying between shamelessly crude and totally vulnerable, Bad Bunny and his slow-burning baritone opened the floor for Latin pop that’s not afraid to get uncomfortable. It’s a portrait of Puerto Rico in its renaissance — a critical footnote in the history of the Latin-with-an-X zeitgeist that’s been sweeping the globe.
Taylor Swift, ‘Lover’
Nobody ever accused Swift of holding back emotionally, but on Lover, she really lets it all loose: It’s her overdramatic-and-true masterpiece. Lover is the album where she proves she can do it all: the country slow-dance swoon of “Lover,” the synth-pop regret of “Cruel Summer,” the obsessive electro-goth of “The Archer.” These are the deepest love songs she’s ever written, chronicling adult romance and the turning-30 blues with all her usual eye for detail. Hell, she even busts out her country accent again. Lover sums up all the highlights of her twenties — but it also points to all the highlights of her next decade.
Lana Del Rey, ‘Norman Fucking Rockwell!’
Los Angeles is a town crawling with B-listers, C-listers, and beyond — actors and musicians who might spend their whole lives working the checkout at Trader Joe’s, forced to pack up their hazy fantasies of the town before moving to their next rented bungalow. It’s this limbo that Lana Del Rey draws from on Norman Fucking Rockwell!, a lush soft-rock album in the style of 1970s Laurel Canyon, filled with characters whose dreams have long gone up in wildfire smoke and who are just waiting for the rest of the world to catch up. “I’m always going to be right here/No one’s going anywhere,” she intones on “How to Disappear,” a line of reassurance that drips with melancholy. Elsewhere on the album, she puts herself in the company of the not-so-distant ghosts of L.A.’s past — Dennis Wilson, Bradley Nowell, various ladies of the Canyon. By invoking their let-down desires instead of attempting to rise above them, Del Rey finally earns her title as queen of the West Coast.
Billie Eilish, ‘When We All Fall Asleep, Where Do We Go?’
At only 17, Billie Eilish dismantled and rebuilt the pop song with her debut LP. With help from her producer-brother, Finneas O’Connell, Eilish layered bizarre sounds (the clicking of a crosswalk signal, a sample from The Office) under nihilistic lyrics about Satan, the downfall of humankind, and the uselessness of prescription drugs — all delivered in Eilish’s characteristic whisper-hum. “Most people need to stand and open their diaphragms, but Billie sounds amazing just slumped on the bed,” Finneas told Rolling Stone. That’s especially true when she drawls such cutting takedowns as, “Man is such a fool/Why are we saving him?” (“All the Good Girls Go to Hell”). “Bad Guy” was an eerie foray into off-kilter sexuality, equal parts Marilyn Manson and Rihanna, while “You Should See Me in a Crown” was pure trap-derived pump-up. With this stunning effort, Eilish promised to keep scaring — and seducing — us for years to come.
Ariana Grande, ‘Thank U, Next’
“Remember when i was like ‘Hey i have no tears left to cry’ and the universe was like HAAAAAAAAA bitch u thought,” Ariana Grande tweeted in November of last year. She was referring to the lead single off 2018’s Sweetener, which was meant to be a post-tragedy bright-side opus. But Grande’s life took a couple of more turns: Her ex Mac Miller tragically passed away less than a month after the album was released, and her whirlwind engagement to SNL star Pete Davidson came to a halt. In just two weeks, Grande let the tears flow and wrote Thank U, Next, her trap-R&B-pop masterpiece that nods to ‘NSync and The Sound of Music and features appearances from her grandma and drag queen Shangela. We’re so fuckin’ grateful for her exes too. | cc/2021-04/en_middle_0020.json.gz/line442 |
__label__wiki | 0.986972 | 0.986972 | Egyptian Hip Hop Announce Debut Album Release
Manchester’s Egyptian Hip Hop have announced that their long anticipated debut album will be released through R&S Records (James Blake, Lone, Optimo, Teengirl Fantasy) on Monday 22nd October. The album is entitled ‘Good Don’t Sleep’ and was produced by Richard Formby (Wild Beasts, Dog Is Dead, Spectrals). The first single was released today and is called ‘SYH’ and you can listen to it HERE.
Here is the official press release for the album;
“Egyptian Hip Hop first emerged back in 2009 as four sparky 17-year-olds from Manchester with an uncanny knack for lush, scruffy melodies and raucous tales of guitar lessons from Johnny Marr. Their debut EP ‘Some Reptiles Grew Wings’, produced by Warp’s Hudson Mohawke, featured a clutch of delectably angular pop songs and affirmed their singular sense of rhythm.
Following an extended hiatus, during which lead singer Alexander Hewett spent time as a touring musician for Connan Mockasin and Charlotte Gainsbourg, Egyptian Hip Hop return triumphant with their debut album on R&S Records. ‘Good Don’t Sleep’ is a promise kept and worth every shred of wondering. The self-conscious naivety of their early recordings has dissipated, making way for a mature musicality that is invigoratingly sensual. Dancing with summer pollen and possibility, Yoro Diallo and SYH hum with the polyrhythmic intensity of ‘Remain In Light’-era Talking Heads.
Spiraling sideways like a honey-drunk bumblebee, Pearl Sound and One Eyed King take a detour into the eeriness of Silver Apples. On another plane, The White Falls traces a dream from its delicate distant stirring to full crystalline crescendo. The album’s crowning glory, however, is closer lltoise, a gossamer-spun composition that scales Tangerine Dream heights and evokes the sheer joy of waiting to fall.
Make no mistake: while ‘Good Don’t Sleep’ has a deep affinity with psychedelia, it steers a thrillingly new path toward pop. This long-awaited debut demonstrates Egyptian Hip Hop’s astute awareness of what has come before yet is wholly of the non-linear now. The band recorded the album with producer Richard Formby (Wild Beasts, Darkstar) in Leeds and at legendary Welsh studio Bryn Derwen, where they recall the sound of the wind blowing the trees winding its way into the record.”
Black Lion Robbed By Youths – Appeal For Help
Album Streams: Matthew Dear, Swans & Holy Other | cc/2021-04/en_middle_0020.json.gz/line446 |
__label__wiki | 0.796031 | 0.796031 | The Best NBA Videobombs Of 2014-15 So Far
There’s an art to the videobomb. It takes perfect timing, infallible framing and a certain brand of finesse to completely ruin an unsuspecting sideline reporter’s day. It has only been a few weeks into the new season, and it’s already readily apparent that the NBA’s most infamous maestros are back at it again, and in fine form, to boot. Below, we take a look at some of the funniest videobombs we’ve seen so far at the hands of the league’s best ‘bombers.
Gabby Union ruins Dwyane Wade’s interview
During an interview after the Miami Heat beat the New York Knicks on Sunday, Gabrielle Union upstaged her husband—none other than Dwyane Wade—by stepping into the shot and hilariously answering the interviewer’s questions with her own version of how the game went. She got a few playful jabs in at Wade, too, calling him an “old geezer” and making fun of his free throw record. He didn’t look particularly impressed. It comes as no surprise—in 2012, Union was banned from courtside seats after her jeering of Wade and other players got too loud for the NBA to handle.
Shaq gets friendly with Mike Trudell
TWC SportsNet reporter Mike Trudell was in the middle of giving an update on the Golden State Warriors and Los Angeles Lakers game going on behind him when Shaq passed by, gently stroking the journalist’s hair. Trudell took it in stride without missing a beat. Later, he tweeted about the videobomb: “Upon realizing it was a human hand, I figured it had to be either Shaq, Yao Ming or Andre the Giant. Felt pretty good, actually.” In a similar incident, Shaq licked—licked—Charles Barkley’s bald head on an episode of The Starters. For a really, really uncomfortably long time.
Kevin Love gets payback on LeBron
During a Fox Sports postgame interview with two of the Cleveland Cavaliers’ finest, Dion Waiters snuck up on Kyrie Irving and wrapped a towel around his head. Unperturbed, the reporter turns to LeBron James. Videobombs don’t strike twice, right? Not so. Out of nowhere, Kevin Love comes in for the assist, jumping onto LeBron James’ back and hanging on. Apparently, it was payback for when LeBron did the same thing to Love during a postgame interview after the Cavs took the Chicago Bulls to OT on Nov. 1.
Dwyane Wade videobombs his own interview
Dwyane Wade knows a thing or two about videobombing, and you could say he’s carrying the videobomb torch after LeBron’s departure. That’s why Miami Heat rookie Shabazz Napier’s attempt at getting the best of Wade during an interview with Fox Sports simply didn’t work—you can’t mess with the master. (Unless you’re his wife, apparently). Not to be outdone by the rook, Wade took Napier to school and proceeded to videobomb himself.
Lance Stephenson has perfect timing
One of the Charlotte Hornets’ best players is also one of the most insidious videobombers of all time. As the camera zoomed in on New York Knicks coach Derek Fisher’s face to catch a reaction to a play stoppage, Lance Stephenson popped into the frame with a well-timed ‘bomb. It looks like Fisher knew what was up, too—you can see him glaring at the swingman immediately after. What’s wrong, Fisher? Can’t handle a little competition?
Derrick Rose’s Injuries, Illustrated By 7 Hilarious NBA Memes
The third coming hit a few snags
Social media adds insult to injury for the Chicago Bulls’ sidelined point guard
7 Lucky Shots That Went In On Accident
It’s like they weren’t even trying
These players’ flukes are video proof that the basketball gods really do exist
The Top 10 Celebration Dances In NBA History
Dunk, wiggle, wiggle
From Team USA’s Shmoney shimmy to LeBron’s whatever-that-is, we take a look at the league’s best moves | cc/2021-04/en_middle_0020.json.gz/line447 |
__label__cc | 0.579985 | 0.420015 | Stray Thoughts
A Home for the Stray Thoughts of an Ordinary Christian Woman
Favorite Blogs and Links
God’s help
TM Resources
Unanswered prayer and reasons for suffering
Book Review: Old Town in the Green Groves
Posted on February 26, 2020 by Barbara Harper
Laura Ingalls Wilder originally wrote out the story of her life in Pioneer Girl. When that manuscript was rejected several times, acting upon suggestions from editors, Laura reframed her narrative into a story for children about a pioneer family traveling west (p. 31). She left out a year that the family traveled back east due to the grasshopper infestations that twice ruined their crops and hopes in Plum Creek, although she had told of it in Pioneer Girl. Pamela Smith’s Hill’s notes on this section in Pioneer Girl: The Annotated Autobiography says:
She deliberately chose not to depict this part of her family’s experiences in her fiction. “It is a story in itself,” Wilder explained to Lane in 1937, “but does not belong in the picture I am making of the [fictional Ingalls] family (LIW tp RWL, [Dec. 1937 or Jan. 1938], Box 13, file 193, Lane Papers). Moving the fictional family east and not west would have undermined Wilder’s optimistic portrait of their resilient pioneer spirit. Furthermore, her experiences in Burr Oak were more urban, gritty, even edgy. Although Wilder introduced some adult ideas and themes into her later novels, she waited until the fictional family had moved west once more into Dakota Territory, where her main character was a more mature adolescent. Wilder herself was just nine years old when the family moved to Burr Oak (p. 95, note 99).
I’ve seen some criticism of Laura for leaving out the events that take place in Burr Oak. But I would defend her decision for several reasons. Everything I have read about memoirs and autobiographies says you can’t share everything. She did include this era in her original autobiography. The Little House books were fictionalized, focusing on the life and progress of a pioneer family. The time in Burr Oak might have seemed a stop or even a setback to the action. Plus the family’s proximity to a saloon and the unsavory behavior they saw and heard might not have seemed suitable to an audience of children at the rime she was writing.
But readers are curious about the “lost years” in the LH narrative. So Cynthia Rylant was asked to write what was known about the family’s story during this period in the style of the LH books. Her book is Old Town in the Green Groves.
The story begins back in Plum Creek, where the family contentedly moved from their winter rental house back to their farm. Baby brother Freddie was born. Ma was severely ill for a while, but recovered. Then the second wave of grasshoppers returned and destroyed everything growing. Pa declared he’d had enough of the “blasted country.” He had debts to pay, and the crop that would have paid them was ruined. Pa sold the farm to pay off the debts and lined up a job at a hotel in Burr Oak in Iowa.
On the way, the family stayed with their aunt and uncle and cousins, Peter and Eliza Ingalls and their children. They helped in various ways around the farm until ready to move on. Sadly, brother Freddie died there.
One chapter describes meeting with a kind beekeeper who was also planning to move since the bees couldn’t thrive without flowers. (Hill’s note on p. 96 of her book says Charles and this beekeeper kept in touch with each other for years).
When they arrived in Burr Oak, they lived above the hotel. Life was hectic: Ma helped with cooking and cleaning, and the girls all had to help, too. The saloon next door was loud, people were constantly coming in and out. Laura missed the quiet of her home and the prairie.
The book goes on to describe the various people they encountered and things that happened in Burr Oak before they decided to head west again.
I think Rylant did a good job. Just glancing over this section again in Pioneer Girl, I can see how Rylant took the narrative and fleshed it out. It’s more or less in the style of the LH books, but it’s not Laura: it couldn’t be.
I was glad to see the illustrations by Jim LaMarche in my library copy were also similar to the Garth William’s illustrations of the Little House.books. Like the words, they were not quite the same, but they seemed a similar style and spirit.
The book cover shown above is the one on my library copy. I’ve seen another illustrated cover here that makes Laura seem a little older and a photographed cover here that I didn’t care for at all.
I share my friend Ann‘s concern over the placement of the book on the back cover. The top says “Read all the Little House books.” The covers of all the books are shown, with this book set in-between On the Banks of Plum Creek and By the Shores of Silver Lake. I’m assuming this was done to show that the action in this book takes place between those two. But, as fine as this book is, I would regard it as supplemental and wouldn’t include it as part of the set or as one of the LH books.
Though this book describes some of the hard times the family went through, it also shares their resilience and hope. It’s a good story in its own right, but especially for fans of the Little House books.
(Sharing with Carole’s Books You Loved, Booknificent)
This entry was posted in Books and tagged Books, children's books, laura ingalls wilder by Barbara Harper. Bookmark the permalink.
9 thoughts on “Book Review: Old Town in the Green Groves”
robertawrites235681907 on February 26, 2020 at 1:02 pm said:
I didn’t know about this particular book, Barbara. Thanks for the share. I am a huge Laura fan.
Pingback: February Reflections | Stray Thoughts
Pingback: Laura Ingalls Wilder Reading Challenge Wrap-up for 2020 | Stray Thoughts
Melanie on March 1, 2020 at 8:41 pm said:
I ‘ll have to seek this out at the library. I had no idea this book was out there. Thanks for the review.
Michele Morin on March 5, 2020 at 8:44 am said:
I’m reading Leslie Leyland Fields’s book (Your Story Matters) and I in her advice about writing memoir, I would say that she would approve of Laura’s selective sharing. We have to tell the truth, but we don’t have to tell everything.
I love it when you write about Wilder and her books.
Pingback: Laura Ingalls Wilder Challenge Wrap-Up «
Tina@Mommynificent (@mommynificent) on April 1, 2020 at 11:50 pm said:
I also had no idea this book existed. How fascinating! Thanks for sharing this at Booknificent Thursday on Mommynificent.com!
Pingback: Quarterly Reading Update | Stray Thoughts
Pingback: Books Read in 2020 | Stray Thoughts
Leave a Reply to Tina@Mommynificent (@mommynificent) Cancel reply | cc/2021-04/en_middle_0020.json.gz/line448 |
__label__cc | 0.668828 | 0.331172 | My first month of lockdown reading and recommendations
After a full month of lockdown, am I any closer to answering the question I posed to myself at the end of March: Do you read differently in anxious times? Of course not! While my preference for fiction remains, I’ve enjoyed both long and short novels this month, both sober and comic, and, as for theme, read wherever I took my fancy from my dwindling TBR shelf. I’ve shed cathartic tears in response to a political satire – thank you Enter the Aardvark by Jessica Anthony – and laughed deep into my belly reading a novel about the experience of depression – Rabbits for Food. We’re strange creatures, we human beings!
Unrecognised: Rabbits for Food & Miss Iceland
Is there discrimination against women writers? (Is there even more discrimination against older women writers?) Probably but, there being even worse things to get hung up about right now, I’ll gloss over the fact that these two novels about under-appreciated female writers – one in 1960s Iceland, the other in 21st-century New York – come from fairly successful female authors. With a couple of caveats, either or both would make great lockdown reads.
A perfectly cathartic political satire: Enter the Aardvark by Jessica Anthony (#review and #giveaway)
In those innocent days before Donald Trump and Boris Johnson, Republican Congressman Alexander Wilson might have seemed a cartoon caricature, but I found his fictional hypocrisy and narcissism – and unwarranted optimism – immensely consoling in these rage-inducing times. We join him as the doorbell rings at his comfortable home in Virginia, on a hot day in August at the start of his re-election campaign. He’s surprised at the size of the parcel left by the FedEx delivery driver, and even more so when he unwraps it to find a stuffed aardvark and an unsigned card from his ‘lover’ (Congressman Wilson is incapable of love) Greg Tampico, President of the Namibian charity, The Happiness Foundation.
Connected through music and literature: The Weight of a Piano & A Bookshop in Algiers
If you’re reading through the lockdown, or listening to more music, you might be interested in these two books featuring dual narratives connected via an “instrument” of the arts. The second is a translated novella set in and around a real-life bookshop and publishing house; the first is about heartbreak compounded by the fear of letting go from a publisher who mostly does translations.
I’m fuming (furious, irate, incensed, enraged, seething, mad, livid, cross)
Life’s changed so quickly, it’s been hard to keep track. I’ll admit my initial response was childishly self-centred. Woe is me, my favourite conference is cancelled; I won’t be able to give my talk and sell half a dozen more books. But, soon after, I saw the point when large gatherings were banned (although it was a shame my Wednesday afternoon choir couldn’t do its final concert). Next came concern for the mental well-being of those whose lives were restricted and livelihoods lost.
I felt grief when schools and pubs and restaurants were closed, despite not having much use for any of them; and guilt when a minor health issue kept me from my usual outdoor volunteering, with staffing already low as the over 70s were advised to stay at home. I welcomed the lockdown in bringing some order to an atmosphere of chaos and confusion, despite being appalled when I saw it happening to my publisher in Spain. I found a host of silver linings and even admired the most egotistical prime minister and the most extreme right wing government’s management of the crisis. And then the doctors and nurses began to die.
Darkness brought to light: The Sin Eater & Soot
I’ve recently read two alternative histories about what we do with the darker or unwanted parts of ourselves: how we reveal them to, or hide them from, ourselves and others; how societies develop rituals to manage the exposure and cleansing; how power effects what’s allowed. If that sounds overly intellectual, don’t worry; both of these have story at the heart.
The positives of pessimism as we await the pandemic peak
What character have you played in the early chapters of the dystopian novel we’re all living? Were you the sensible one whom the others ridicule or were you, like me, the seven-stone weakling who follows the trail into the ramshackle warehouse without telling her colleagues where she’s going or charging her phone? Although I’ve contracted no symptoms and stuck to the letter of the law, I look back in horror on my attitude of only a month ago; I ought to have been more cautious right from the start.
Discovering interesting echoes of our current crisis as I edit my novel
I desperately wanted my third novel, Matilda Windsor Is Coming Home, to be published this year. For one thing, I like the ring of 2020. For another, I’ve been working on it long enough. Begun with three character sketches in autumn 2014, I completed an 80,000 word first draft in January 2015 and, after various ups and downs, including ballooning to 130,000 words, had it ready for reader feedback three years later.
When Inspired Quill, who published my first three books couldn’t find space in this year’s schedule, I considered self-publishing, and, for a whole week in January was convinced I was going with a pricey but prestigious assisted self-publishing outfit until it became clear that, even setting aside printing costs, I’d lose money on Amazon sales unless I ratcheted up the price. Now, of course, with events cancelled for the next several weeks, I feel remarkably lucky to have finally signed with Inspired Quill for May 2021.
The Return: Shooting Down Heaven & The Great Homecoming
I’ve recently read two novels in translation featuring a homecoming to troubled parts of the world. The first is about the son of a Colombian drug baron; the second about three friends in a divided Korea. Both are firmly grounded in those countries’ painful histories; the violence and anxious atmosphere makes me grateful I’ve only the coronavirus pandemic to worry about. | cc/2021-04/en_middle_0020.json.gz/line456 |
__label__wiki | 0.973896 | 0.973896 | BioShock Infinite: Burial at Sea – Episode Two Available March 25th
2021’s Look into StarCraft II
Gaming 5 days ago
TIGA Research Shows UK Video Games Industry on Course for Growth in 2021
Saturnalia, a little known Italian gem of a game
Gaming 1 month ago
Indoor vs Outdoor Games
Minecraft and Colorado: a love affair that grows in time
Gaming 4 months ago
The top-grossing mobile games of all time were born in Finland
Your Ultimate Driver Journey Begins In Summer 2020 With Project Cars 3
Newly Discovered Pokémon and More Revealed for The Isle of Armor Coming June 17th
© 2017 BC-GB BaconCape. All Rights Reserved.
Adam 7 years ago Comment
Multiplay Chooses RapidSwitch to Power UK ExpansionMultiplay announces first wave of content for its biggest Easter weekend at Insomnia 51Gadget Show Live Professional Returns with Exclusive Tech Previews for the Trade
2K and Irrational Games announced today that BioShock Infinite: Burial at Sea – Episode Two, the third add-on content pack for the award-winning BioShock Infinite, will be available for download worldwide on the PlayStation®3 computer entertainment system, Xbox 360 games and entertainment system from Microsoft, and Windows PC starting March 25.
BioShock Infinite: Burial at Sea – Episode Two is built almost entirely from scratch by Irrational Games, the studio behind the original BioShock and BioShock Infinite. The narrative of this add-on content pack concludes the storyline of BioShock Infinite and Burial at Sea, as seen through the eyes of a new player character, Elizabeth, and features all-new stealth-oriented gameplay, as well as new weapons and modes.
“In Burial at Sea – Episode Two, we are delivering a story that involves nearly every major character from the original BioShock and BioShock Infinite,” said Ken Levine, creative director of Irrational Games. “It is a story that will give gamers a new perspective on the BioShock universe and conclude the story of BioShock Infinite and Burial at Sea.”
Critically-Acclaimed 'The Wolf Among Us' Continues in Episode Two
Multiplay Chooses RapidSwitch to Power UK Expansion
By Adam 5 days ago
By Adam 1 month ago
By Adam 4 months ago | cc/2021-04/en_middle_0020.json.gz/line459 |
__label__wiki | 0.944103 | 0.944103 | Home News LG Chief Orders Mobile Team to Start ‘G7’ Development from Scratch
LG Chief Orders Mobile Team to Start ‘G7’ Development from Scratch
Last Updated: January 16, 2018 12:34 pm
Earlier reports regarding LG’s upcoming flagship smartphone suggested that the Korean manufacturer was considering dropping the G-Series branding and revamping its flagship lineup. Now, according to a recent report from The Korea Herald, a company official has revealed that LG’s mobile team has been ordered to restart the development of the ‘G7’ from scratch.
The report states that Jo Seong-jin, vice chairman and CEO of LG Electronics, has ordered a revision of the upcoming flagship device. Because of which, the device, which was expected to debut at the Mobile World Congress in Barcelona next month, has been delayed to April.
The mobile team was given a direct order from the company’s chief to halt all work on the upcoming device and review everything from the beginning.
The LG official, who requested anonymity, told The Korea Herald:
“Right after the vice chairman made the announcement at the Consumer Electronics Show last week, a direct order was sent down to the working-level officials to start over…A new decision on a possible launch date will be released around the Lunar New Year holiday next month”.
At the recently concluded Consumer Electronics Show, LG’s CEO Jo Seong-jin also hinted at a significant change in the company’s smartphone unit which has been bleeding money. He said, “We will unveil new smartphones when it is needed. But we will not launch it just because other rivals do”. Commenting on Jo’s statement at CES, a public relations official from LG explained that the company is currently exploring new launch-related marketing strategies for future smartphones and hasn’t taken a final decision regarding the same.
Rumors surrounding the alleged LG G7 suggest that the upcoming flagship from LG will feature slimmer bezels than previous models while retaining the 18:9 display. It is also expected to come with a front-facing dual camera module which might be used to implement an iris scanning feature.
LG QNED Mini LED TVs Will Be Unveiled at CES 2021
LG Patents Laptop with a Rolling Display
[Updated] LG’s ‘Rollable’ Smartphone May be Named LG Rollable
LG Velvet with Snapdragon 845 Launched in India at Rs.36,990
LG Wing 5G with Snapdragon 765G, Swivel Screen Launched in India at Rs.69,990 | cc/2021-04/en_middle_0020.json.gz/line465 |
__label__cc | 0.536779 | 0.463221 | Notes on Seven Guitars 04.12.2020
Let’s start with a recognition of the play’s dedication, to Wilson’s wife, Constanza Romero, and the Note from the Playwright, a sweet inscription to Wilson’s mother, Daisy Wilson Kittel, that details both his attention to character development and his recognition of culture as a prime mover of history. He spells out the play’s name, Seven Guitars, as an analog and a surrogate for the content of his mother’s life.
Using Aristotle’s Poetics as a frame of reference, let’s first note the prologue/Greek chorus in Act 1. Scene 1. It takes us forward in time to the funeral of the main protagonist, Floyd Schoolboy Barton. So we know up front what is going to happen. Floyd dies. There are no surprises, we just have to wait and see how the plot develops and how events unravel leading Floyd to his end. Even so, strangely enough, as spectators, we have hope, hope for Floyd, hope for his future as a recording artist, hope for his relationship with Vera. As we read we sit on the edge of our seats. Silly us, because the playwright told us up front. Why is there suspense?
Aristotle’s perfect tragedy does not involve the spectacle of a virtuous man brought from prosperity to adversity, nor does it involve a villanious man in a similar condition. It should be a man in between, a guy like Floyd Barton, perhaps. The change of fortune should be from good to bad and should come about not because of some vice, but because of an error in judgement of a similar frailty. Floyd, after several ups and downs, has just enjoyed a successful debut playing his hit song at the local dance club, and is on his way, Vera his true love on his arm, to Chicago to record an album. The success he has hoped and dreamed for is almost within his grasp.
Then by some quirk of fate, Canewell discovers the money Floyd stole and buried in the yard, later acknowledging the “ownership” to Floyd, but right in time for an intoxicated Hedley to show up and assume the buried money is the result of some alcohol-crazed dream he had of his father and Buddy Bolden. Whereupon Hedley retrieves the machete recently gifted to him by Joe Roberts, and uses the machete to whack Floyd in the neck, severing his windpipe.
Of course, a lot happens in the interim. There is the complication of Floyd’s release from incarceration without access to either finances nor the means to earn wealth from his music as his instrument as well as the drummer’s drum set are in hock at the local pawn ship and the term for retrieving them has expired. There is the disappointment Vera experienced when he abandoned her earlier for Pearl Brown that he must now overcome, despite negative reinforcements from the landlady, Louise. Things are not looking good for Floyd.
Then in a reversal of fortune, Floyd comes into a bit of cash (from illegal activity, nonetheless), buys a new electric guitar, a new dress for Vera, and makes his date at the dance club, all to a rousing success. Collapsed into the same event, there is recognition of Floyd’s musical talents. The final spectacle collapses pathos and catharsis, for Hedley and Canewell at least, with Floyd, unfortunately, on the losing end.
It is important to recall that Seven Guitars is a prequel of sorts, and many seemingly random threads will establish their significance in the second part, the penultimate play in the Cycle, King Hedley II. But we should also note the archived information Wilson preserves, the card games (bid whist and pinochle), the cigarettes smoked (Old Gold, Chesterfield, Pall Mall, Lucky Strike, Camel), the beer brands (Iron City, Duquesne, Black Label, Red Label, and Yellow Label) , the menu items for Vera’s dinner (Chicken, potatoes and green beans), the four types of roosters, Canewell’s recipe for cooking greens, the blow-by-blow account of the Joe Louis fight, and the mention of Toussaint L’Overture and Marcus Garvey, all preserved for posterity inside the play.
We cannot overlook the bits of magical realism in the initial and final scenes of the play. Canewell, Vera and Hedley all see the six angels who escort Floyd into heaven. I have no interpretation for why those three in particular see the vision, except that Vera had accepted Floyd’s marriage proposal, making her perhaps the character closest to Floyd, Canewell survives the prequel and shows up later with a new name, and Hedley “fathers” the next tragic figure, King Hedley II, in the only play in the Cycle named for a character.
Finally, favorite lines, both from Vera: “I done told you, my feet ain’t on backwards” and “It was two different shades of blue.”
Post group discussion: Seven in numerology. One source says seven means wholeness, completion and comprehensiveness. Another source goes into the symbolism of seven: seven is the number of the spiritual quest. Seven, a prime number, is popular in both religion, i.e., seven throughout Revelations, seven in the monotheistic faiths (Judaism, Christianity, and Islam), seven in Freemasonry, mythology and Theosophy, seven in Greek and Roman mythology, and in culture, i.e., Seven Habits, Seven Secrets, Seven deadly sins, etc., etc., etc.
A short word about structure in the play. The first scene of Act 1 ends precisely with the same line as the 9th scene of Act 2, the finale of the play. So the two are bookends “housing” the whole play. Also interesting the way the scenes get shorter, more compact, and more condensed in Act 2, sort of drawing us, pulling us, dragging us through the action to the end, which we already know, while keeping us on the edge of our seats. It is amazing how the structure of the play is used to unwind and unravel the action, almost collapsing linear time.
Post-Session #3
Pre-Session #3
Posted on April 10, 2020 April 14, 2020 by Raymond MaxwellPosted in August Wilson, Magical realism, Seven GuitarsTagged August Wilson, Greek chorus, Seven Guitars.
Previous Previous post: Some notes on The Piano Lesson 04.05.2020
Next Next post: Some thoughts on this read of Fences (04.19.2020)
One thought on “Notes on Seven Guitars 04.12.2020”
Pingback: cross-pollination with my August Wilson study group – found poetry from Seven Guitars – #ThisIsMyPoetryBlog | cc/2021-04/en_middle_0020.json.gz/line467 |
__label__wiki | 0.881376 | 0.881376 | Tani Tabbal Trio – Now Then
Now Then by Tani Tabbal Trio
[TAO03] - CD in 4-panel digipak with original art & design by a woman of strong vision wisdom. Liner notes written by an also illuminated man.
Tani Tabbal: drums
Michael Bisio: bass
Adam Siegel: alto saxophone
Now Then, by Tani Tabbal Trio, is the vital third release on Tao Forms, and we are honored to present this brand new work from the master drummer-percussionist. Tani Tabbal is known for his extensive performing and recording career with Roscoe Mitchell, Sun Ra, Geri Allen, James Carter, David Murray, and Faruq Z. Bey / Griot Galaxy. Following a series of self-released recordings over the past decade (including two by this trio), Now Then is his first widely distributed work as a leader.
Tabbal—who came of age on Detroit’s fertile jazz scene—has always looked for colleagues with fresh ideas, big ears, and adventurous souls. He found them again in veteran bassist Michael Bisio and next generation alto saxophonist Adam Siegel. Now Then is an exceptional album of charismatic communications by three musicians who breathe as one. The compositions—six by Tabbal, four by Bisio—define specific materials and moods that the trio develops with patience and a subtle variety of textures and dynamics. Melodic riches abound, wielded with both controlled fire & giving tenderness, while the joy of prolific communication and illuminated creation permeates the album. It’s a beauty!
> a brief Tani Tabbal biography >
Born in Chicago, Tabbal began playing drums professionally as a teen, with Oscar Brown Jr., Kelan Phil Cohran, and Sun Ra and his Arkestra. With family also in Detroit and New York, Tabbal grew up feeling at home in all three cities, but he settled in Detroit in the late 70s. The city —whose jazz legacy includes Barry Harris, Kenny Burrell, Yusef Lateef, the Jones Brothers (Hank, Thad, and Elvin), Kenny Garrett, Regina Carter and dozens of others— was like finishing school.
Detroit nurtured Tabbal’s versality and craftsmanship in myriad idioms, from the swinging mainstream to funk, fusion, and free jazz. He also got a chance to work with traveling stars like alto saxophonist Jackie McLean. Tabbal’s most defining association in the city was with Griot Galaxy, a wild and wooly avant-garde quintet led by Faruq Z Bey, a saxophonist and Afrofuturist philosopher.
Tabbal and bassist Jaribu Shahid forged a profound bond in the Griot Galaxy. The pair would later record Open on All Sides and Twylight with the influential Detroit pianist Geri Allen; tour widely with saxophone prodigy James Carter’s first working group (together with Craig Taborn on piano); and work on and off for 40 years with legendary saxophonist and composer Roscoe Mitchell of Chicago’s AACM. Tabbal has made 13 recordings with Mitchell. His extensive discography also includes albums with David Murray, Steve Coleman, Evan Parker, and Sun Ra.
Tani Tabbal now happily resides in New York State, and is as excited as all other performing artists to play on stage again with this Trio just as soon as can be (as are we exceptionally stoked to bear witness to when..)..
1. Arrested Confusion 04:11
2. Just Woke Up 08:51
3. Khusenaton 05:47
4. Sun History Ra Mystery 06:21
5. Now Then 07:39
6. Midway Open 06:43
7. Oh See OC Revisited 09:22
8. Scrunch 05:54
9. r. henri 06:52
10. Inky Bud 05:55
All compositions by Tani Tabbal, © Tani Tabbal (BMI)
except 1-4-7-9 by Michael Bisio, © AMB Music (ASCAP)
Produced by Tani Tabbal & Michael Bisio
Executive Producer: Whit Dickey
Recorded, Mixed & Mastered by Jim Clouse
at Park West Studios, Brooklyn
Liner notes: Michael Bisio
Design & original art: Susanna Ronner Graphic Design | cc/2021-04/en_middle_0020.json.gz/line468 |
__label__wiki | 0.535092 | 0.535092 | Matched-Filter Detection of Mode-Locked Laser Signals
D’Orazio, R. J. and George, Nicholas (1973) Matched-Filter Detection of Mode-Locked Laser Signals. Applied Optics, 12 (10). pp. 2367-2372. ISSN 0003-6935. https://resolver.caltech.edu/CaltechAUTHORS:20120731-073412293
The passive Fabry-Perot cavity is shown to be a good practical approach to the match-filter optimization for the sensitive detection of mode-locked laser signals. Doppler measurements of relative motion over a wide range of velocities are possible simply by measuring the cavity length for a peak output.
http://dx.doi.org/10.1364/AO.12.002367 DOI UNSPECIFIED
http://www.opticsinfobase.org/ao/abstract.cfm?uri=ao-12-10-2367 Publisher UNSPECIFIED
© 1973 Optical Society of America. Received 24 April 1972; revised 26 March 1973. The authors would like to acknowledge that the research was supported in part by the Air Force Office of Scientific Research and to thank Bell Telephone Laboratories for their doctoral support fellowship during the completion of this study.
Air Force Office of Scientific Research (AFOSR) UNSPECIFIED
Bell Telephone Laboratories UNSPECIFIED
R. D'Orazio and N. George, "Matched-Filter Detection of Mode-Locked Laser Signals," Appl. Opt. 12, 2367-2372 (1973). | cc/2021-04/en_middle_0020.json.gz/line471 |
__label__cc | 0.565942 | 0.434058 | Foot, Hand & Nail Care
Lesbian, Gay, Bisexual & Transgender Books
Parenting & Relationshops
Crafts, Hobbies & Homey
Photo & Camera
Office school supplies Products
Paint, Wall Treatments & Supplies
Kids' Furniture, Décor & Storage
perm_identity My Profile pie_chart_outlined Orders power_settings_new Logout
shopping_cart Checkout
Kevin M. Gannon Products
Reform & Policy
Radical Hope: A Teaching Manifesto (Teaching and Learning in Higher Education)
Get it to Oman by 23-January to 27-January.
OMR 10.343
Add to Cart add_shopping_cart
Higher education has seen better days. Harsh budget cuts, the precarious nature of employment in college teaching, and political hostility to the entire enterprise of education have made for an increasingly fraught landscape. Radical Hope is an ambitious response to this state of affairs, at once political and practical—the work of an activist, teacher, and public intellectual grappling with some of the most pressing topics at the intersection of higher education and social justice.
Kevin Gannon asks that the contemporary university’s manifold problems be approached as opportunities for critical engagement, arguing that, when done effectively, teaching is by definition emancipatory and hopeful. Considering individual pedagogical practice, the students who are the primary audience and beneficiaries of teaching, and the institutions and systems within which teaching occurs, Radical Hope surveys the field, tackling everything from impostor syndrome to cell phones in class to allegations of a campus “free speech crisis.” Throughout, Gannon translates ideals into tangible strategies and practices (including key takeaways at the conclusion of each chapter), with the goal of reclaiming teachers’ essential role in the discourse of higher education.
"A must-read for pedagogues and theorists alike. Gannon's explorations into history, power, and academia place students and the environments in which they learn front and center for the rest of us to consider. This work isn't about reform, but transformation, and Gannon's book pushes us in the right direction."
José Luis Vilson, author of This Is Not A Test: A New Narrative on Race, Class, and Education
“This is the book I needed to read—it was a fresh drink of water in a time of turmoil and despair in education. Gannon grounds his calls for radical hope in the work of educational scholars like Freire, hooks, and Giroux, and offers helpful examples and recommendations based on his years of teaching experience. He tackles real issues we are facing at our institutions head-on without capitulating to clichés or trendy solutions often offered in books about higher education.”
Amy Collier, Middlebury College
"In a time of precariously employed professors, crushing student debt burdens, and cynically manufactured campus outrages, Radical Hope is a much-needed practical and principled reminder of the promise and possibility of education for liberation."
Nikhil Pal Singh, author of Race and America's Long War and faculty director, NYU Prison Education Program
“A full-throated defense of the humanities, a liberal education, and the power of education as a transformational force.”
Contingent Magazine
From the Back Cover
Kevin M. Gannon is director of the Center for Excellence in Teaching and Learning and professor of history at Grand View University. He writes for the Chronicle of Higher Education, gives frequent talks and workshops, and appeared in the Oscar-nominated documentary 13th, directed by Ava DuVernay.
Excerpt. © Reprinted by permission. All rights reserved.
It has never been more difficult to teach in higher education than in our current moment. Nearly all of our postsecondary institutions, two- and four-year colleges and universities, are reeling from decades’ worth of financial strangulation, the fruit of a neoliberal, market-driven ideology with little room for the notion of a public good. In our classrooms, many of which exhibit the effects of years’ worth of deferred maintenance, we have fewer resources with which to teach more students. Most of us, numerically speaking, do this teaching in a precarious position as adjunct and contingent faculty. Even for those of us who are tenured or on the tenure track, those guarantees mean less than they did in earlier periods; tenure is under assault across the country, and funding cuts that eliminate entire programs do not distinguish between tenured and untenured. The academic job market is a smoldering crater; faculty hiring and compensation are well below the levels we actually need to accomplish our missions. Academic freedom is under siege as grandstanding politicians decry “leftist” universities while right-wingers funding institutes at those same universities demand control over hiring and curricular decisions. Moreover, the general public is souring on higher education. A college education was once the epitome of the American dream; now, a majority of one political party believes colleges and universities have “a negative effect” on the United States, while others despair about the increasingly devastating financial burdens of higher education.1 And the nexus of all these trends is the environment in which we, as faculty, are expected to be effective—even transformative—teachers.
It has also never been more difficult to learn in higher education than in our current moment. To be a college student today requires an element of financial risk and economic uncertainty that would have been inconceivable to prior generations. The rise of the “gig economy,” the curious economic spectacle of a “jobless recovery,” and skyrocketing costs of living mean that the future looks much more uncertain to today’s students than it did for their forebears. To even get to that future, current students must shoulder an unprecedented amount of the costs of higher education themselves, as loans have become the primary means of financing the ever-increasing expense of a college education. In this climate of anxious uncertainty, it isn’t surprising that a record number of college students struggle with mental health difficulties. What’s more, funding cuts to K–12 education have mirrored, and in some areas outpaced, those that have plagued higher education. The result has been a larger number of underserved and underprepared students entering college. They then find themselves lacking some of the basic academic skills necessary for success, and despite the proliferation of developmental courses and academic support services, retention and graduation rates among these at-risk students have remained flat.2
Nor have our campus climates served all of our students well. Students of color attending classes in buildings named after eighteenth- and nineteenth-century slaveholders, for example, can testify to the prevalence of racial prejudice and microaggressions on most of our campuses. The alarming data on campus sexual harassment and assault demonstrates that for women, higher education is often not a safe space.3 A recent spike in the number of hate incidents on campuses underscores how even such a basic act as going to college is actually a threat for some of our students, who see more concern from their administrators for the right of neo-Nazis and white supremacists to have a campus platform than for their safety and well-being.4 For today’s students, the road to a college degree is fraught with uncertainty, obstacles, risk, and anxiety. For many of them, higher education is a protracted exercise more akin to siege warfare than a journey of development and discovery.
This is probably not the way you expected a book on “radical hope” to begin. This litany of problems and obstacles both faculty and students face on a daily basis seems designed to instill despair, not hope. Indeed, a weary cynicism is both an eminently understandable and frequent response to these conditions. But jaded detachment, tempting as it may be for no other reason than self-defense, is ultimately a trap—one into which we’ll drag students along with us if we fall. We’ve all encountered the grumpy, cynical faculty colleague who ceaselessly complains about their students, the institution, and likely many of their colleagues as well. The kids can’t write a coherent sentence. They don’t study. They’re on their phones all class period. The administration doesn’t give a damn about us. If we have one more useless department meeting, I swear I’ll go insane. Often, but not always, this colleague’s cynicism is borne out of decades of frustration as the gulf between their sense of vocation and their perceptions of the institutional environment has become impassable. I don’t think any of us start our careers teaching in higher education with this bitter sense of betrayal and impotence. Even if we’ve been battered by the vicissitudes of graduate education and the academic job market, we still want to enter our classrooms and make a difference for our students. The question becomes, then, how do we avoid ending up in a place where we don’t believe that what we do matters, and where we surrender to cynical detachment?
I propose that we answer cynicism with purpose, despair with hope. “Hope” is a pretty elastic term, though, and it often becomes a hollow platitude that substitutes itself for the actual work of change. I have hope in the future, the thinking goes, so I just need to survive the present; this too shall pass. But hope without action is merely fantasy. For those of us committed to changing higher education for the better, to making a genuine difference in our classrooms and on our campuses, a commitment to radical hope offers the chance to do so in a clear-eyed and sustainable manner without succumbing to hostile resignation or burned-out despair. As Jonathan Lear puts it, “what makes . . . hope radical is that it is directed toward a future goodness that transcends the current ability to understand what it is. Radical hope anticipates a good for which those who have the hope as yet lack the appropriate concepts with which to understand it.”5 To operate from a place of radical hope, though, is a daunting prospect. It requires us to discern ways of being and acting that are far from clear, and to articulate goals that only exist “at the horizons of one’s understanding.”6 Hope, as Rebecca Solnit has famously declared, “is not a lottery ticket you can sit on the sofa and clutch, feeling lucky. It is the axe you break down doors with in an emergency.”7 Radical hope eschews despair, but does so in a way that often relies upon the faith that our current thinking and actions will create a better future—even without specifically understanding what that future will look like.
Teaching is a radical act of hope. It is an assertion of faith in a better future in an increasingly uncertain and fraught present. It is a commitment to that future even if we can’t clearly discern its shape. It is a continuing pedagogical practice rather than a set of static characteristics. Simply put, we teach because we believe it matters. That may be hard to remember when we’re driving dozens of miles from one adjunct gig to another, or when we’re buried beneath a pile of papers to grade, or when we get the dean’s email about further cuts to our department’s operating budget. Yet that’s when it’s most evident, if we really think about it. Our most quotidian practices—even and especially in environments of adversity—are a constant assertion that through our work with and among our students we are creating a better future. The very acts of trying to teach well, of adopting a critically reflective practice to improve our teaching and our students’ learning, are radical, in that word’s literal sense: they are endeavors aimed at fundamental, root-level transformation. And they are acts of hope because they imagine that process of transformation as one in which a better future takes shape out of our students’ critical refusal to abide the limitations of the present.
What does it look like to teach with radical hope, then? “Imagining a process of transformation” sounds nice, but how do we do that when we’re tasked with teaching a 500-student lecture section of Psychology 101? I think it is essential for our pedagogy to remain centered in a clear set of principles that we not only put into practice, but make explicit to our students as we invite them to share in our vision. That’s an ethic we can apply in a small seminar room or large lecture hall, in an introductory general-education course or an advanced practicum, in a two-year or four-year college, in a public or private university. If hope without action is fantasy, then principles without practice are useless. Hope is the combination of aspiration and agency. Paulo Freire, the Brazilian educator and intellectual godfather of what’s become known as critical pedagogy, insisted on the primacy of “praxis.” Praxis, in Freirean terms, is the blend of “reflection and action aimed at the structures to be transformed.”8 Reflection without action has no power, while action without reflection cedes its meaning. A pedagogical praxis centered in radical hope is one that fosters openness and inclusivity, critical reflection, dialogue and conversation, and a commitment to making higher education accessible and meaningful for all of our students.
In the pages that follow, I set out my manifesto for teaching and learning, a manifesto staking claim to a better future even within our specific present. Ever mindful of Freire’s injunction to combine reflection and action, I ground this manifesto on distinct theoretical terrain but also focus on specific ways in which we can translate that theory into our actual teaching practices. The following chapters function similar to a set of concentric circles, centered in our individual philosophies, approaches, attitudes, and practices but radiating outwards into the larger settings of classrooms and institutions as a whole. At the end of each chapter, to foreground the importance of praxis, I offer a few points for discernment and reflection as the first steps in putting principles “into practice” (the title for these sections).
Radical hope needs to be more than a slogan; it has to be the set of lenses through which we see our pedagogy, our students, and our institutions. This book is meant to help with that discernment. What I offer here is not the way, but one way in which we can meet the challenges of our present with practices that embody our faith in a better future for us and our students. Most importantly, though, over and throughout this manifesto is the unwavering belief that teaching is a radical act of hope.
Now let’s get radical.
Absolutely transformative in its approach to higher education teaching practices.
I have been a college professor (of social work) for over 15 years, and despite being committed to empowerment, social justice, and emancipatory learning I learned so much from this manifesto. The author provides fantastic context and justification for crafting higher...
by Sean Camp, October 19, 2020
Really inspiring, all teachers should read
Really inspiring, thoughtful, call-to-action for teachers. I will be returning to it again and again as I rethink my teaching practices.
by Lindsay C., April 28, 2020
Excellent book
I loved this book! Absolutely critical for instructors today
by Alexandra Hill, August 5, 2020
A journey through the complexities of what makes higher education wonderful and frustrating
I appreciate the author's vulnerability in this text. Professor Gannon details his journey from novice to expert educator, and acknowledges that this journey is never complete. Professor Gannon is honest about his positionality and gives the caveat that things he is able to...
by Erin, April 12, 2020
A fierce but tender call to action
A delightful combination of ferocity and tenderness, Gannon issues a call to action for all of higher education: avoid classrooms of death and instead create vital, life-affirming spaces for learning. Tackling every controversy from trigger warnings to laptop bans, safe...
by S. Cavanagh, April 20, 2020
More $$$
so if funding is increased all our problems will disappear? Just another sophist edging for a raise in stature and cash!
by Jack Diquarto, June 28, 2020
Small Teaching Online: Applying Learning Science in Online Classes
Teaching about Race and Racism in the College Classroom: Notes from a White Professor (Teaching and Learning in Higher Education)
Geeky Pedagogy: A Guide for Intellectuals, Introverts, and Nerds Who Want to Be Effective Teachers (Teaching and Learning in Higher Education)
OMR 9.397
Love from the Vortex and Other Poems
How to Write a Lot: A Practical Guide to Productive Academic Writing (2018 New Edition)
Similar products By Category
OMR 19.16
Field Theory: Curriculum Studies at Work (9) (Critical Pedagogy)
Take Control of the Noisy Class: Chaos to Calm in 15 Seconds (Super-effective classroom management strategies for teachers in today's toughest classrooms)
I Got Schooled: The Unlikely Story of How a Moonlighting Movie Maker Learned the Five Keys to Closing America's Education Gap
Making the Unequal Metropolis: School Desegregation and Its Limits (Historical Studies of Urban America)
Primary Story Paper - Journal: Handwriting practice paper | Double lines with a dotted line down the middle | Picture box | Grades K-2 School Exercise Book | 8.5 x 11 | 100 Pages
Primary Story Paper - Construction Trucks Journal: Handwriting practice paper | Double lines with a dotted line down the middle | Picture box | Grades K-2 School Exercise Book | 8.5 x 11 | 100 Pages
Primary Story Paper - Dinosaur Era Journal: Handwriting practice paper | Double lines with a dotted line down the middle | Picture box | Grades K-2 School Exercise Book | 8.5 x 11 | 100 Pages
Primary Story Paper - Unicorn Journal: Handwriting practice paper | Double lines with a dotted line down the middle | Picture box | Grades K-2 School Exercise Book | 8.5 x 11 | 100 Pages
Primary Story Paper - Journal: Art Handwriting practice paper | Double lines with a dotted line down the middle | Picture box | Grades K-2 School Exercise Book | 8.5 x 11 | 100 Pages
Handwriting Workbook for Kids: 3-in-1 Writing Practice Book to Master Letters, Words & Sentences
+971 800-binge (24643)
support@binge.om
Copyright © Binge
Oman 2017 - 2021
All Rights Reserved binge.om
Please update your profile !
Your personal data is very important for us! | cc/2021-04/en_middle_0020.json.gz/line479 |
__label__wiki | 0.519338 | 0.519338 | The authors used this protocol in:
Similar Protocols
微生物群落胞内/胞外吸附/胞外游离水环境DNA的分离提取
河湖着生硅藻样品采集、永久玻片制作及鉴定
Reproducibility Feedback
P-body and Stress Granule Quantification in Caenorhabditis elegans
Matthias Rieckher Nektarios Tavernarakis
Matthias Rieckher
Institute for Genome Stability in Ageing and Disease, Cologne Cluster of Excellence in Cellular Stress Responses in Aging-associated Diseases (CECAD) Research Center, Center for Molecular Medicine (CMMC), University of Cologne, Cologne, Germany
Go to author page
Nektarios Tavernarakis
tavernarakis@imbb.forth.gr
1. Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology Hellas, Crete, Greece
2. Department of Basic Sciences, Faculty of Medicine, University of Crete, Crete, Greece
DOI: 10.21769/BioProtoc.2108
Published: Vol 7, Iss 2, January 20, 2017
Download PDF Download PDF
Original Version Original Version
Updated Version Updated Version
How to cite Favorites Q&A Share your feedback Cited by
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Rieckher, M. and Tavernarakis, N. (2017). P-body and Stress Granule Quantification in Caenorhabditis elegans. Bio-protocol 7(2): e2108. DOI: 10.21769/BioProtoc.2108.
Rousakis, A., Vlanti, A., Borbolis, F., Roumelioti, F., Kapetanou, M. and Syntichaki, P. (2014). Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans. PLoS One 9(7): e103365.
Eukaryotic cells contain various types of cytoplasmic, non-membrane bound ribonucleoprotein (RNP) granules that consist of non-translating mRNAs and a versatile set of associated proteins. One prominent type of RNP granules is Processing bodies (P bodies), which majorly harbors translationally inactive mRNAs and an array of proteins mediating mRNA degradation, translational repression and cellular mRNA transport (Sheth and Parker, 2003). Another type of RNP granules, the stress granules (SGs), majorly contain mRNAs associated with translation initiation factors and are formed upon stress-induced translational stalling (Kedersha et al., 2000 and 1999). Multiple evidence obtained from studies in unicellular organisms supports a model in which P bodies and SGs physically interact during cellular stress to direct mRNAs for transport, decay, temporal storage or reentry into translation (Anderson and Kedersha, 2008; Decker and Parker, 2012). The quantification, distribution and colocalization of P bodies and/or SGs are essential tools to study the composition of RNP granules and their contribution to fundamental cellular processes, such as stress response and translational regulation. In this protocol we describe a method to quantify P bodies and SGs in somatic tissues of the nematode Caenorhabditis elegans.
Keywords: Caenorhabditis elegans, mRNP granules, Processing bodies, Stress granules, Transgenesis
Thus far, most protocols to study P bodies and SGs were developed for yeast or human cell lines (Buchan et al., 2010). Little is known about the function of somatic RNP granules in multicellular organisms. The simple model organism C. elegans has been extensively used to study germline-specific P granules, which are distinct from P bodies and SGs, and important structures for germline development and function (Updike and Strome, 2010). Although the principles of the presented procedure can be applied to count germline-specific P granules, the protocol focusses on the quantification of somatic RNP granules. Several studies have identified a conserved function of somatic P bodies in the translational deregulation via miRNA pathways in C. elegans (Ding et al., 2005; Zhang et al., 2007). More recently, various tools were created to study the involvement of cytoplasmic RNP granules in cellular and organismal stress response, development and ageing in the nematode (Cornes et al., 2015; Huelgas-Morales et al., 2016; Rieckher et al., 2015; Rousakis et al., 2014; Sun et al., 2011; Table 1).
Such studies take advantage of the comparatively easy implementation of transgenesis methods in C. elegans that allow to constitutively express fluorescent fusion proteins (e.g., green fluorescent protein [GFP]), endogenously or in specific tissues (Rieckher et al., 2009). A collection of fosmids carrying gfp-tagged P body- and SG-specific genes can be obtained at the ‘C. elegans TransGeneome’ project, a genome-scale transgenic project for fluorescent- and affinity-tagged proteins for expression in the nematode (Sarov et al., 2012; Table 1). C. elegans is transparent, which allows for efficient application of fluorescence microscopy methods that are easily combined with differential interference contrast (DIC) microscopy to reveal fluorescent protein expression in an anatomical context. Mounting transgenic animals for P body and SG imaging is based on a previously described method using nanoparticles for immobilization (Kim et al., 2013), since commonly applied anesthetics in C. elegans can induce stress, resulting in increased RNP granule formation. Fluorescence-tagged P body or SG-intensity can be imaged by epifluorescence light microscopy (see Procedure C), while fluorescence intensity, a detailed count and size measurements of P bodies and SGs can be obtained via confocal laser scanning microscopy (see Procedure D).
Table 1. Tools available for transgenic expression of P body/SG-factors in C. elegans
*available at CGC
+germline-specific promoter fusion
$C. elegans TransGeneome project (Sarov et al., 2012)
&can be found in both types of RNP granules
Sterile pipette tips
Surgical disposable scalpel (Braun Medical, catalog number: 5518075 )
Worm Pick with platinum wire (Genesee Scientific, catalog numbers: 59-30P6 )
Pre-flattened tip (Genesee Scientific, catalog numbers: 59-AWP )
Microscope slides (76 x 26 mm) (Carl Roth, catalog number: 0656.1 )
Cover slips (24 x 24 mm) (Carl Roth, catalog number: H875.2 )
Tape (~1 mm thickness)
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One, catalog number: 628161 )
C. elegans strains (see Table 1 for available transgenes)
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Polystyrene beads (Polybead, 2.5% by volume, 0.1 µm diameter)
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: P018.1 )
Di-potassium hydrogen phosphate (K2HPO4) (Carl Roth, catalog number: 5066.1 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Di-sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: T876.1 )
Bacto peptone (BD, catalog number: 211677 )
Streptomycin sulfate salt (Sigma-Aldrich, catalog number: S6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N3503 )
Agarose (Biozym, catalog number: 840004 )
Phosphate buffer (1 M; sterile) (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
5% agarose pads (see Recipes)
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Epifluorescence microscope (ZEISS, model: Axio Imager Z2 , objective EC Plan-Neofluar 10x/0.3)
Confocal microscope (we use the Zeiss LSM710 confocal microscope with an Argon multiline laser source 25 mW and a tunable laser with the wavelength range 488-640 nm) (ZEISS, model: LSM710)
Incubators for stable temperature (AQUA®LYTIC incubator 20 °C)
Cylindrical glass beaker (25 ml) (VWR, catalog number: 213-1120 )
ZEN 2009 software (or later), Carl Zeiss AG, Jena, Germany (or any other software controlling a fluorescence microscope or confocal microscope)
Microsoft Office 2011 Excel (Microsoft Corporation, Redmond, USA)
Fiji or ImageJ (https://fiji.sc/ or https://imagej.nih.gov/ij/)
Growth and synchronization of transgenic C. elegans population
When working with a transgenic strain with integrated genetic array (Table 1), use a sterile pipette tip (200 µl) to cut a small chunk (0.5 x 0.5 cm) of agar containing animals from an older plate and transfer it to a freshly Escherichia coli (OP50) seeded NGM plate (see Recipes). When working with a transgenic line with a non-integrated extrachromosomal array, pick ~25 L4 larvae or adult transgenic animals based on the selection-marker to a freshly OP50 seeded NGM plate.
Incubate the nematodes at the standard temperature of 20 °C.
3.5 days later the plates contain a mixed population of larval stages.
Synchronize nematodes by picking ~30 transgenic animals in L4 stage under a dissecting stereomicroscope and transfer them onto separate OP50 seeded plates. The L4 stage can be identified based on the presence of a half-moon shaped light structure in the area of the vulva and the relative size of the animal (Figure 1).
Grow the animals for 24 h at 20 °C into day 1 adults and proceed with mounting the sample (Procedure B).
Figure 1. Identification of C. elegans larval stages in a mixed population. The image depicts all 4 larval stages, young adult and day 1 adult as seen under a dissecting stereomicroscope. The arrow indicates the half-moon shaped structure in the area of the vulva, which is indicative for the L4 larval stage.
Mounting animals for imaging
Prepare fresh 5% agarose pads (see Recipes).
Pipette 3 µl polystyrene beads suspension in the center of the agarose pad.
Use a platinum wire to pick ~30 transgenics from the OP50 seeded plates into the polystyrene bead suspension.
Gently place a coverslip on top of the agarose/worm suspension and proceed with the imaging procedure. Optionally, the agarose pads can be sealed with nail polish, which will retain humidity for long-term (> 3 h) imaging.
Animals can be recovered from unsealed plates by gently lifting one edge of the coverslip with the help of a scalpel and adding 10 µl of M9 buffer to suspend the worms. Subsequently, worms can be transferred with an eyelash to OP50-seeded NGM plates.
Imaging P body/SG number with an epifluorescence light microscope
Start up the light microscope and imaging software (ZEN, Zeiss).
Place the agarose pad on the imaging stage of the fluorescent light microscope and locate the animals. Use a 10x objective to image the whole animal.
Use the DIC channel to focus on an anatomical landmark. Most appropriate are the grinder and the lumen of the pharynx, which are located in the most central transverse (horizontal) position within the animal (Figure 2A).
Change to the fluorescent channel to visualize P body or SG-specific fluorescence and define exposure time and fluorescent light intensity. These parameters depend on the transgene and have to be defined empirically. Saturation of the fluorescent signal has to be avoided by lowering exposure time and/or fluorescent light intensity. However, too short exposure might result in lowered sensitivity of detecting RNP granules (Figure 2B). For transgenes that co-express various reporters for P bodies/SGs repeat this step in the corresponding fluorescent channel.
Once the best imaging conditions are determined, take a snapshot of all fluorescent channels and the DIC channel. Take images of at least 25 animals to obtain enough data for statistical analysis.
Save the data as an image stack. Zeiss microscopes produce *.czi file formats, which can be processed by ImageJ/Fiji freeware (see Data analysis). However, images can also be stored/exported and further processed in any other common format including *.jpg, *.png, *.tiff, etc., and then proceed with the data analysis.
Figure 2. Representative images of epifluorescence images of an adult transgenic animal expressing the P body reporter DCAP-1::dsRED. Images were recorded with an Axio Imager Z2 through a 10x magnification objective. Size bars are 100 µm. A. DIC image. The inlay shows a digitally enhanced view on the pharynx. The arrow points out the grinder, which has to be in focus before switching to the fluorescent channel. B. Fluorescent image of the P body reporter DCAP-1::dsRED. C. Screenshot of image processing. Choose the polygon selection tool to surround the whole animal. Open Analyze > Measure to get area size and MPI. (Full genotype of transgenic animal: N2;Ex[pdcap-1DCAP-1::dsRED; pRF4] published in Rieckher et al., 2015.)
Imaging P body/SG number, dynamics and colocalization with a confocal microscope
Start up the confocal microscope and corresponding imaging software.
Activate the appropriate laser(s) for fluorescent detection of P body/SG reporters.
Locate the animal through the eyepiece with a 10x objective using transmission light and center the field of view on the area of interest (e.g., the pharynx).
Upon localization, switch to the 40x objective and readjust the focus.
In the confocal operating software (acquisition) design a protocol for a z-stack scan.
Different RNP granules significantly vary in size and intensity across different transgenes and within samples (Teixeira et al., 2005). Hence, a balance has to be established empirically between laser power and gain (voltage of photomultiplier tubes [PMTs]/detectors) to set the highest and lowest detection limit. If available, use the Smart Setup as a starting point. Try to avoid overexposure but test the lower detection limit by stepwise increasing laser power and/or gain. The final settings have to be reproducibly applied to all samples. For the example in Figure 2 we use the tunable laser at 570 nm (excitation dsRED), laser power 3%, and Master gain 580.
Keep the pinhole size for an optimal section thickness at 1 AU.
The distance between z-stacks (slices) should be maximum 1.5 µm. Decreasing z-stack distance might enhance the capability to detect smaller RNP granules but increases photobleaching. Cover a similar volume in each scanned sample. We perform 30 z-stacks at 1.5 µm across the pharyngeal region (Figures 2 and 3).
Assign the frame size (resolution). We use 1024 x 1024 (Figures 2 and 3).
Use the transmitted light detector (T-PMT) to produce a DIC/Brightfield image in parallel (optional).
Once the best imaging conditions are determined, perform a scan of the fluorescent channel. When imaging different P bodies/SGs co-expressed in the same transgene use sequential scan for additional fluorescent channels. Take datasets of at least 15 animals to obtain enough data for statistical analysis.
Upon completion of the scan use the processing mode of the ZEN software to produce a maximum intensity projection (MIP), summarizing the fluorescence intensity of all stacks in one image (Figures 3A and 3B). Consistently save as *.czi file or other image file format. Proceed with data analysis. Alternatively, single stacks or subsets of stacks can be processed and analyzed.
Figure 3 Representative images of the pharyngeal region of an adult transgenic animal expressing the P body reporter DCAP-1::dsRED and the SG reporter IFE-2::GFP. Images were recorded with an LSM710 confocal microscope and processed into MIP. Size bars are 50 µm. A. P body reporter DCAP-1::dsRED expression. B. SG reporter IFE-2::GFP. C. Screenshot of image processing via Fiji/ImageJ. Use the polygonal tool to surround the area of interest, assign a threshold and use Analyze Particles to obtain information about P body/SG intensity, number and size. (Full genotype of transgenic animal:N2;Ex[pdcap-1DCAP-1::dsRED; pife-2IFE-2::GFP; pRF4] published in Rieckher et al., 2015.)
Processing P body- and SG-data with Fiji (ImageJ)
Download and install the Fiji freeware from https://fiji.sc/.
Open an image file from fluorescence microscopy or a MIP file from confocal laser scanning microscopy by dragging/dropping into the Fiji software.
Images will open as stacks of DIC and the fluorescent channels that were recorded. In the control panel of Fiji chose Image > Stacks > Stack to images to split the channels.
Change Image > Type > 8 bit for further analysis steps.
Chose the image of the fluorescent channel that should be analyzed and apply the polygon selection tool to further narrow down the region of interest (ROI). For images received from fluorescence microscopy encircle the whole animal (Figure 2C). In MIP images a specific region, such as the pharynx, should be selected (Figure 3C).
For epifluorescence images choose ‘Analyze > Measure’ to obtain a summary about the Area size and the mean pixel intensity (MPI) in arbitrary units (AU) of the assigned area. This information will be displayed in a separate window and can be copied/pasted directly from there in a data analysis software and/or saved as an excel file (*.xls).
For confocal images proceed with the measurement of P body and SG number and size a threshold has to be determined that assigns single pixels or pixel clusters to define fluorescent RNP granules. Chose Image > Adjust > Threshold and empirically assign a proper Min/Max value (Figure 3C). This value will vary depending on the transgene, choice of microscope and the imaging settings. Once assigned, these values have to stay consistent throughout every analysis.
Chose Analyze > Analyze Particles and tick ‘Display results’, ‘Summarize’ and ‘Exclude on Edges’ and press OK (Figure 3C).
Two separate Windows display the ‘Results’ for every RNP granule, producing Area (Granule size) and Mean (MPI), and the ‘Summary’ including ‘Count’ (RNP granule number), ‘Total Area’ and ‘Average Size’. These data can be copied directly into a data analysis software and/or saved as excel file.
Stay consistent with the number of animals examined for each strain and condition.
Each assay should be repeated at least three (3) times.
Use the Mann Whitney or Wilcoxon Kruskal Wallis test with a significance cut-off level of P < 0.05 for comparisons between different groups and correct for multiple pairwise comparisons using Bonferroni or False Discovery Rate (FDR).
P bodies and SGs are known to substantially vary in size and number across cells (Teixeira et al., 2005). Measurements become more precise and final values underlie less standard deviation when focusing on quantification in specific tissues (e.g., muscles, pharynx, or intestine) and increasing sample size.
Phosphate buffer (1 M)
For 1 L, dissolve 102.2 g KH2PO4 and 57.06 g K2HPO4 in distilled water and fill up to 1 L. This is a 1 M solution, pH 6.0
Autoclave at 121 °C for 20 min
Store at room temperature
Nematode growth medium (NGM) agar plates
Mix 3 g NaCl, 2.5 g Bacto peptone, 0.2 g streptomycin, 17 g agar and add 900 ml distilled water. Autoclave at 121 °C for 20 min
Let cool to 55-60 °C
Add 1 ml cholesterol stock solution, 1 ml 1 M CaCl2, 1 ml 1 M MgSO4, 1 ml nystatin stock solution, 25 ml sterile 1 M phosphate buffer, pH 6.0, and distilled sterile water up to 1 L
Pipette 8 ml medium per Petri dish and leave to solidify
Store the plates at 4 °C until use
M9 buffer
Dissolve 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl in 1 L distilled water
Let cool and add 1 ml 1 M MgSO4 (sterile)
Store M9 buffer at 4 °C
5% agarose pads
Weigh 0.5 g agarose and add it into a cylindrical glass beaker
Add 10 ml M9 buffer
Heat the mixture in a microwave until it is close to boiling. Take it out, stir with a pipette tip and boil again. Repeat until the agarose is dissolved completely
Modify two microscope slides by putting a stripe of tape along the midline
Place an empty microscope slide between two taped slides (Figure 4A)
Put a drop (ca. 50 µl) of fresh 5% agarose solution in the middle of the slide (Figure 4B)
Take a fourth microscope slide and place it on top of the agarose drop. Gently press down to flatten the drop. The tape serves as spacer to give the agarose pad a specific thickness (Figure 4C)
Let the agarose harden for 30 sec and remove the top microscope slide
Quickly cut the edges of the agarose pad with the scalpel to a square of approximately 20 x 20 mm
Immediately proceed with the sample preparation (see Procedure B), since the agarose pads will start drying within approximately 5 min
Note: Leaving the top microscope slide as a cover contains the humidity longer (approx. 1 h). Thus, several agarose pads can be prepared and used swiftly during the experiments.
Figure 4. Preparation of agarose pads for fluorescent imaging in C. elegans. A. Two glass slides modified with tape flank an empty microscope slide. B. Place a drop of 50 µl 5% agarose solution in the middle of the microscope slide (arrow). C. Swiftly put another microscope slide on top and gently push it down to flatten the agarose drop.
This work was funded by grants from the European Research Council (ERC), the European Commission 7th Framework Programme. We want to acknowledge the Fang-Yen laboratory, Philadelphia, PA, who developed the agarose pads for long-term imaging of C. elegans.
Anderson, P. and Kedersha, N. (2008). Stress granules: the Tao of RNA triage. Trends Biochem Sci 33(3): 141-150.
Buchan, J. R., Nissan, T. and Parker, R. (2010). Analyzing P-bodies and stress granules in Saccharomyces cerevisiae. Methods Enzymol 470: 619-640.
Cornes, E., Porta-De-La-Riva, M., Aristizabal-Corrales, D., Brokate-Llanos, A. M., Garcia-Rodriguez, F. J., Ertl, I., Diaz, M., Fontrodona, L., Reis, K., Johnsen, R., Baillie, D., Munoz, M. J., Sarov, M., Dupuy, D. and Ceron, J. (2015). Cytoplasmic LSM-1 protein regulates stress responses through the insulin/IGF-1 signaling pathway in Caenorhabditis elegans. RNA 21(9): 1544-1553.
Decker, C. J. and Parker, R. (2012). P-bodies and stress granules: possible roles in the control of translation and mRNA degradation. Cold Spring Harb Perspect Biol 4(9): a012286.
Ding, L., Spencer, A., Morita, K. and Han, M. (2005). The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in C. elegans. Mol Cell 19(4): 437-447.
Gallo, C. M., Munro, E., Rasoloson, D., Merritt, C. and Seydoux, G. (2008). Processing bodies and germ granules are distinct RNA granules that interact in C. elegans embryos. Dev Biol 323(1): 76-87.
Huelgas-Morales, G., Silva-Garcia, C. G., Salinas, L. S., Greenstein, D. and Navarro, R. E. (2016). The stress granule RNA-binding protein TIAR-1 protects female germ cells from heat shock in Caenorhabditis elegans. G3 (Bethesda) 6(4): 1031-1047.
Kedersha, N., Cho, M. R., Li, W., Yacono, P. W., Chen, S., Gilks, N., Golan, D. E. and Anderson, P. (2000). Dynamic shuttling of TIA-1 accompanies the recruitment of mRNA to mammalian stress granules. J Cell Biol 151(6): 1257-1268.
Kedersha, N. L., Gupta, M., Li, W., Miller, I. and Anderson, P. (1999). RNA-binding proteins TIA-1 and TIAR link the phosphorylation of eIF-2α to the assembly of mammalian stress granules. J Cell Biol 147(7): 1431-1442.
Kim, E., Sun, L., Gabel, C. V. and Fang-Yen, C. (2013). Long-term imaging of Caenorhabditis elegans using nanoparticle-mediated immobilization. PLoS One 8(1): e53419.
Rieckher, M., Kourtis, N., Pasparaki, A. and Tavernarakis, N. (2009). Transgenesis in Caenorhabditis elegans. Methods Mol Biol 561: 21-39.
Rieckher, M., Kyparissidis-Kokkinidis, I., Zacharopoulos, A., Kourmoulakis, G., Tavernarakis, N., Ripoll, J. and Zacharakis, G. (2015). A customized light sheet microscope to measure spatio-temporal protein dynamics in small model organisms. PLoS One 10(5): e0127869.
Sarov, M., Murray, J. I., Schanze, K., Pozniakovski, A., Niu, W., Angermann, K., Hasse, S., Rupprecht, M., Vinis, E., Tinney, M., Preston, E., Zinke, A., Enst, S., Teichgraber, T., Janette, J., Reis, K., Janosch, S., Schloissnig, S., Ejsmont, R. K., Slightam, C., Xu, X., Kim, S. K., Reinke, V., Stewart, A. F., Snyder, M., Waterston, R. H. and Hyman, A. A. (2012). A genome-scale resource for in vivo tag-based protein function exploration in C. elegans. Cell 150(4): 855-866.
Sheth, U. and Parker, R. (2003). Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science 300(5620): 805-808.
Sun, Y., Yang, P., Zhang, Y., Bao, X., Li, J., Hou, W., Yao, X., Han, J. and Zhang, H. (2011). A genome-wide RNAi screen identifies genes regulating the formation of P bodies in C. elegans and their functions in NMD and RNAi. Protein Cell 2(11): 918-939.
Teixeira, D., Sheth, U., Valencia-Sanchez, M. A., Brengues, M. and Parker, R. (2005). Processing bodies require RNA for assembly and contain nontranslating mRNAs. RNA 11(4): 371-382.
Updike, D. and Strome, S. (2010). P granule assembly and function in Caenorhabditis elegans germ cells. J Androl 31(1): 53-60.
Zhang, L., Ding, L., Cheung, T. H., Dong, M. Q., Chen, J., Sewell, A. K., Liu, X., Yates, J. R., 3rd and Han, M. (2007). Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2. Mol Cell 28(4): 598-613.
Please login or register for free to view full text
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Developmental Biology > Cell signaling > Stress response
Cell Biology > Cell signaling > Stress response
By submitting a question/comment you agree to abide by our Terms of Service. If you find something abusive or that does not comply with our terms please contact us at eb@bio-protocol.org.
If you have any questions/comments about this protocol, you are highly recommended to post here. We will invite the authors of this protocol as well as some of its users to address your questions/comments. To make it easier for them to help you, you are encouraged to post your data including images for the troubleshooting.
All Field Materials and Reagents Equipment Software Procedure Data analysis Notes Recipes Acknowledgments References | cc/2021-04/en_middle_0020.json.gz/line480 |
__label__wiki | 0.717754 | 0.717754 | HomeSocietyDoctor on a musical journey
Doctor on a musical journey
September 4, 2008 Sudha Narasimhachar
‘Ananya’ is familiar to most music lovers of Bangalore, especially North Bangalore. It is located in a very peaceful corner of the city, off 4th Main Road, Malleshwaram between 12th and 13th Cross. An inconspicuous small board that hangs right opposite the Malleshwaram Boys’ High School identifies Ananya. Dr Raghavendra is totally publicity shy. He says he formed the trust not for people who craved for publicity, but “… to tap, encourage and nurture young and upcoming music artists and create a small music community that can entertain the masses”.
R V Raghavendra. Pic: Ananya Trust.
Raghavendra’s interest in music started with appreciating film music, like most of us. The interest evolved in stages. He and his music-loving friends were regulars at the Sri Rama Navami music concerts at Fort High School, Chamarajpet and Malleshwaram Sangeetha Sabha, among others. The friends also used to sponsor music programmes at the institute.
He topped the university in B Sc (Geology) from Chitradurga and pursued M Sc (Chemistry) at Mysore, where he graduated to listening to serious classical music. He became a regular at the Dasara music festivals and attended the concerts of great musicians of yesteryears like Semmangudi Srinivasa Iyer, Ariyakkudi brothers, Kalinga Rao, Sohan Kumari and Mohan Kumari, Dr D K Pattammal and the like. He thus learnt a lot by continuous exposure to music and became a connoisseur.
After his doctoral degree from IISc Bangalore, Raghavendra and his wife Dr Pramila set up ‘Geological & Metallurgical Laboratories’ and got busy establishing the laboratory for the first ten years. Once they started earning enough to take care of their limited needs, Raghavendra’s thoughts turned towards music once more. With his cousin Prasanna, the famous theatre person, the couple conducted small and informal gatherings of music in the spacious hall that they constructed at the basement of their house, “…much against my father’s thrifty concerns”. “Prasanna once suggested that if I was really serious of doing something for the field of music, I should set up a trust”, says Raghavendra.
Instrument Ensemble for Arogyadhara. Pic: Ananya Trust.
Thus was born the Ananya Trust on 27th May, 1995 with the inaugural concert by Raghavendra’s nephew Master Pavan, a disciple of Dr Semmangudi Iyer. The first few concerts were by his friends or family members. Eminent personalities like Dr U R Ananthamurthy and the Late Dr B C Ramachandra Sharma were on the trust. While Raghavendra funds the trust to the extent of 99 per cent, the Department of Kannada and Culture has started pitching in of late, in conducting cultural festivals in different regions like Tumkur, Udupi, Ikkeri, Chitradurga and so on.
Though the Trust was initially started to promote Carnatic music, it gradually evolved into serving all facets of culture to include Hindustani music, various forms of dance and visual arts. The trust also started adding on various kinds of services and did not merely stick to sponsoring concerts. Some of them are:
Inauguration of Ananya Sangraha. Pic: Ananya Trust.
Ananya Sangraha: A library with a collection of about 10,000 hours of music from live concerts, inclusive of very rare collections such as those dating back to the 1920s (Mysore Vasudevachar, Bidaram Krishappa and the like). It has over 1000 books on classical music – journals, biographies, dictionaries and monographs. Books on allied arts too, not available anywhere else are housed in Ananya Sangraha. It also has a high-tech studio with facilities for digitisation and cataloguing of these recordings. The library is open to the public for a nominal fee.
MSG on violin at Ananya Sabhangana. Pic: Ananya Trust.
Ananya Sabhangana: A well-equipped auditorium with excellent acoustics that can seat around 150 people. The Trust holds regular events like the monthly classical music concerts by established musicians, lecture demonstrations, workshops, music competitions, etc. Ananya also conducts regular music awareness programmes for school children, to inculcate in them a love for music and its myriad forms.
Ananya Awards: Ananya has instituted various awards like the Ananya Puraskara for senior musicians, Ananya Yuva Puraskara for young artists, Ananya Kalavidaru for eminent artists of other districts of Karnataka, Ananya Kalabigna for the artists of light music and Ananya Prathibhe for budding artists.
Ananya Publications: Another pet project of Dr.Raghavendra, who believes that music is not merely an art but a science. Abhivyakthi is its five-year old monthly magazine in Kannada with over 3000 subscribers. It provides in-depth information about music and associated literature and gives scientific interpretations of music and its analysis. It also is a forum for budding artists.
The publishing unit also publishes books on Indian classical music. Some of its popular books are With Masters of Melody by Sangeetha Kalanidhi Mysore Vasudevacharya, translated into English by S. Krishnamurthy, Asesha Padmanabha Samputa by Sangeetha Vidwan Shreekantham Nagendra Shastry and Nadanadi, translated from Marathi to Kannada by Amina Bhavi.
Inagural Arogyadhara programme, 2001. Pic: Ananya Trust.
Ananya Arogyadhara: A branch of Ananya born out of concern for neglected geniuses. “When I heard about the unfortunate death of the eminent musician of yesteryears Neelamma Kadambi, as a destitute on the streets of Mysore, I was moved and shocked” says the Doctor. Thus he decided to set up a fund to assist artists in the evening of their lives for medical treatment. 80 doctors are on this panel. Assistance upto Rs.25000/- per artist is extended either by meeting the expenses directly in the listed nursing homes or as reimbursement. So far 68 artists have been assisted under this programme.
Ananya Drishya: A group of professional artistes, art critics and art lovers, whose effort is to find the means to adopt visual language in our education system. It plans to familiarize art activity and define its role in both the public and personal arena. Bi-monthly art exhibitions are held giving a platform to upcoming lesser known artists, the sale proceeds of which are partly used for conducting art camps at Ananya and other schools.
Veena Recital at Ananya. Pic: Ananya Trust.
Ananya Sahitya: Promotes literary meets like discussions, poetry reading, seminars etc.
Ananya Nritya: Promotes Indian classical dance through concerts, workshops and group discussions. An exclusive dance archive is being planned to be set up at the Sangraha.
How much can an individual achieve? Limitless, as Dr. Raghavendra has been proving. He wants Ananya to be known to more and more people, so that they can reap the benefits of its various activities. If only each of us would utilize our capacity to contribute to such social causes like Dr. Raghavendra, the world would be immensely benefited.⊕
About Sudha Narasimhachar 38 Articles
Sudha Narasimhachar is a retired banker and freelance writer based in Bengaluru.
Venkat Hariharan says:
We would like to donate to Ananya Trust, but cant find any information on how to. What is the website for the Ananya trust? If I do a Google search, a *different* Ananya Trust comes up.
raj chandra.r says:
Truly laudable.
But i found ananya web site not being updated.
I searched for a review of the recently held “Ananya Arogyadhara” event, but could not find any ! Even citizen matters seems to have given it a miss ! | cc/2021-04/en_middle_0020.json.gz/line482 |
__label__wiki | 0.546947 | 0.546947 | Mercy Triumphs over Judgement
“What has been done in broad daylight, must be judged in broad daylight. But not by the governments, or the courts. No, the government itself would never bring justice for cases such as this. And so, we gather here today to secure our own justice.
That this could happen in our time, in our civilized society! Even to speak of it causes our jaws to drop in shock. And yet, are we so surprised to find this happening, given who holds office? He turns a blind eye to it, and therefore encourages it in our society.
I speak, of course, of adultery.
Herod Antipas must already think himself a god, beyond reproach. Why else would he put his face on our coinage? When he beheaded John, it sent a clear message to those with lust burning in their hearts. Not only would there be no punishment, adultery would be protected. How many more families must we watch be destroyed?”
And so, I lifted my rock high and turned to the crowds. “Our leaders have ignored our protest. Do we need leaders who will boldly take action? No, it is time for us to stand, and secure justice on our own terms. Those of us who would sit in silence do nothing, and are complicit!” I cried, as the crowd gravely nodded.
“Will we let this woman go unpunished?” I questioned pointedly. My eyes searched the crowd, looking for anyone who would dare deny justice for my countrymen.
When I saw him, I nearly dropped the rock in shock. It was the teacher. We had expected him to show up, of course. We had laid a perfect trap, with the adulteress as bait. If he obeyed our laws, Pilate would have him arrested. If he obeyed Rome’s laws, we’d finally prove where his true allegiance lied. Whatever he chose, we’d win.
“What say you?” I asked, thrusting the rock upon him. But he only watched me, as the crowd waited in silence. There was something about the way he looked at me. It was almost as if I were on trial, instead of the woman.
The silence from the teacher was deafening. His voice had always infuriated me. So soft and gentle, like the bleating of some helpless sheep. Teachers like him are how our country wound up in this state. Never standing up for justice, always making excuses. Where was his outrage?
I had heard whispers that he was a prophet. A Samaritan woman once claimed, “he told me about everything I had ever done” — and we all know what that means. But I didn’t believe the rumors. If he was truly a prophet, he would execute the Almighty’s judgement right then and there. Was not adultery a sin? Was not the punishment death?
“What say you?” I demanded again. “You above all know the laws of our country! Day after day, you quote the words of Abraham, and Moses. You teach the laws that founded our nation, but won’t obey them yourself!”
Gently, he took the rock from my hands.
“Our laws demand death!” I cried, my voice breaking at the worst possible moment.
“Indeed, our laws demand it…” he said, stepping forward. Kneeling in front of me, he drew a line in the dirt with his finger, and began to write beneath it.
Suddenly, I regretted giving him the rock.
Did he know?
As if he had heard my thoughts, he turned that dreadful gaze upon me. The light of a burning flame flashed in his eyes. He no longer wrote with his finger, but a sword — and the tip drew sparks out of the earth I stood on. Before my very eyes, the lamb had become a lion.
“Let he who is without sin cast the first stone at her!” he ordered, before returning to writing in the dirt.
He knew.
I had thought I understood justice. But now, the emissary of Justice Himself stood before me with the terrifying fullness of God’s wrath. I couldn’t see what he was writing, but somehow I knew. The prophet was making a list, and my name was at the top. The woman would be stoned, yes. And I would be next.
I turned, and fled.
For days, I hid in my home. I dared not step across the threshold of my bedroom, much less my front door. Surely, the woman was long dead, and now the prophet was coming for me. At night, the sound of footsteps would wake me in a cold sweat. If I could not hide my sins from the prophet, how I could I hope to hide my presence?
But then, I received a visit from Nicodemus. He told me what happened after I fled. The crowd I gathered had dissipated, leaving the prophet alone with the woman. Just like that, the lion was once again the lamb.
“So much for the jury,” he said, a smug smile upon his face. “Woman, is there anyone left to condemn you?”
“No one, sir…” she responded.
“Then, neither do I condemn you.” I could almost see the self satisfied expression on the prophet’s face. He was pleased with himself, and enjoying the moment.
I couldn’t grasp why Nicodemus told me this story with such hope. A Pharisee? No, Nicodemus was a member of the Sanhedrin! A judge! Laws and contracts were the foundation of his occupation. This ran counter to everything he had ever studied, that he had ever taught. How could he condone sweeping adultery under the rug, while sitting on the high court?
Nicodemus must have caught the bewilderment on my face. With a laugh, he seized me, and looked me right in the eye. “The Messiah offers us a new birth! Not of man’s will or passion, but of God!”
Nicodemus assured me that it would soon make sense, the story was not yet over. The prophet had not forgotten about the charge of adultery. Sorrow washed over his face, and he spoke with urgency. “Go now, and leave your life of sin.”
All of this unsettled me. What did it mean? Nicodemus had blasphemed right in front of me. Had the systemic corruption spread from the Roman courts to the Jewish one? The thought was more than I could bear. There was no ignoring the weight of the woman’s sins, the sins of my country. I had witnessed first hand their effects. Would there be no one held accountable for the ruined lives?
And yet, my mind was at war with my heart. I too deserved judgement. For so long, I had seared my conscience with my own anger, but the prophet tore open a wound that self-righteousness could never close. I could no longer call for justice without bringing it upon myself.
Justice is a simple equation. The sins are laid on one side of the scale, and punishments on the other. By rights, the woman should be dead, and I with her. But the prophet cleared the punishment from the scale, and broke the balance.
How could he?
Years later, I received word that the prophet was on trial for treason. He had claimed to be the messiah, the son of God. Rome would not punish this, but for our purposes, it was close enough. We told Pilate he wanted to be King. Though Pilate saw through our ploy, we threatened to riot. Even unarmed, there were enough present to overthrow his villa. Pilate caved. We forced his hand.
His trial was a mockery — the height of injustice. Paper thin charges were hurled at him, his words taken out of context. But he remained enigmatically silent. Where had the lion gone? He sought justice for the woman, would he not seek it for himself? Even as they nailed him to the cross, I could hear his frail bleating — “Father, forgive them, they don’t know what they’re doing.”
It was the very same crowd I gathered earlier that had killed him. Drunken on their own self-righteousness, they demanded justice from Pilate. I had planted that seed, that they needed to seek justice at any cost. But it was a charade. For the woman caught in adultery, I did not want justice. Only judgement.
With his dying breath, he said, “It is finished.” And as I looked on his naked, beaten, and lifeless body, I saw a sign affixed over his head. “The King of the Jews.” Only then did I understand. Pilate had made the sign out of spite. Little did he know, it was the truth.
This was no mere teacher or prophet. He was The Messiah. The woman’s judgement was not discarded. It was collected, and on that cross, the Son of God bore it himself.
Whatever hope our world had was in that man — that his mercy would triumph over judgement. Oh, that I would have met him before he died. I would have thrown myself at his feet, and perhaps in his mercy, he would have taken my punishment as well.
Now, I see. The Messiah did not come to abolish the law, he came to fulfill it. His death would satisfy the old law of judgement, and his blood would be the ink that signed the new covenant of grace.
But that was only his death. Now, there are rumors that he is alive. And if he is alive, then this is the new birth that Nicodemus spoke of. A hope that cannot be destroyed, a light that darkness cannot overcome:
That because he lives, we also might live.
Inspired by “What Pilate said to Gaius One Night”.
Written in memory of Ravi Zacharias (1946–2020).
Tim builds circuit boards in Virginia Beach, and enjoys writing about current events, history, theology, and philosophy.
More from Tim K
The Evolution of the New Testament
Richard Lawson Singley
Humpty Dumpty and the Truth About Spiritual Practice
Sensei Alex Kakuyo
How To Set An Intention for a Spiritual Journey
Marta Brzosko in Mind Cafe
The Search for Authentic Church: Where else can we go?
Dan Armistead in Church On The Edge
The biggest spiritual illusion: The fear of not rising
Spiritual Mind & Geistiges Heilen in Geistiges Heilen
Rainbows in Real Life
Jennie Lannette, LCSW
Tribe-less in a World of Belonging
Adam King in The Ascent
The Four Noble Truths of Buddhism
Abel Chan in A Philosopher’s Stone | cc/2021-04/en_middle_0020.json.gz/line490 |
__label__cc | 0.503136 | 0.496864 | Scott Boras: Emperor of the Evil Empire
Dave DeVito@davidjdevitoTwitter LogoContributor IDecember 31, 2008
If you take the time to Google the question “What are the characteristics of the devil?”, the first Web site that comes up describes the devil as the following:
“The devil is a liar, cunning, a tempter, deceitful, totally evil, a thief, an adversary, wicked, cowardly, a murderer, without principles, rebellious, fierce, cruel, a sower of discord, a destroyer and proud. Whenever you see these things, you can be sure you're dealing with the devil.” www.contenderministries.org
In all of the research that I have done on the subject, I have never actually found any proof that Scott Boras has murdered anyone. That said, wow, the closest to the devil of baseball is in fact, alleged “Superagent” Scott Boras.
All joking aside, there is a reason that so many people in so many baseball circles hate this man. Scott Boras has single-handedly changed the game of baseball and it is sickening, to say the least.
His list of major clients has some very famous names including:
· Alex Rodriguez
· Manny Ramirez
· Daisuke Matsuzaka
· Carlos Beltran
· Adrian Beltre
· J.D. Drew
· Derek Lowe
· Jason Varitek
· Kevin Millwood
Here are a couple of real factoids that you may not know.
Did you know that Boras never made it past Double-A ball and that the Chicago Cubs paid for him to go to Law School?
What better of a way to say “Thank You” to a league that gave you the opportunity to pursue a rewarding career outside of its own interests, than to religiously, methodically, and effectively extort it for money year after year?
How about this one?
Scott Boras Corporation, the agency that represents his players, has such a bad reputation outside of the Majors, that he had to create a separate company, Impact Marketing, to handle all of his clients’ endorsements, appearances, and autograph signings.
Now, maybe this is all too harsh.
Maybe this is just a good fella (pun intended) that is trying to scrape by and make a living. After all, it’s not like he has ever held a grudge against a team for say...turning the screws in a Dice-K negotiation that was basically a “take our offer or go back to Japan and disappoint a Continent” situation.
I mean, certainly, it is not as if Mr. Boras would have John Henry fly to Texas to place an offer for Mark Teixeira and call the Yankees and have them best it. Right? Because that would be plain evil, wouldn’t it?
After the A-Rod negotiation debacle that led to Boras having to leave the situation only to be fully paid for his services, it appeared as if, perhaps, a new, slightly humbled Scott Boras might emerge. Not the case.
Still, the Manny Ramirez fiasco of 2008 cannot be overlooked. In February, he was in Arizona at a workout camp with, among others, his good friend Kevin Youkilis. Manny came to camp thinner and in better shape than in previous years. He spoke to the media, got along with teammates, started hitting, oh, and switched agents.
By June, he was smacking Youkilis, knocking over Traveling Secretaries, and suffering from severe Osteoporosis in both knees. All while, the Sox still had two more option years at $20 Million each. But Manny wanted more. And when players want more, they sell their souls to Scott.
In fact, the Mark Teixeira negotiations and the fallout thereafter, may have been his most evil yet. Who could possibly go back and sit in the presence of the men you just used, and abused, days afterward to negotiate for another client?
Even more stunningly, who could look in the eyes of the Red Sox front office that you just raked over the coals and try to convince them that their aging catcher that batted .220 last season was worth a multi-year, Jorge Posada-like contract?
The devil, that’s who!
If someone were to ask Mr. Boras, who throughout time, he wished he could have represented. The answer, would most certainly, be Babe Ruth and Roger Clemens.
The Boston Globe would have reported the Ruth trade: “Frazee, Ruppert, and Huston & Boras agreed to a deal. In exchange for Ruth, the Red Sox would get $1.25 in cash and three $25 notes payable every year at 60 percent interest.
"Ruppert and Huston also loaned Frazee $300 with the mortgage on Fenway Park as collateral. The deal was contingent on Ruth signing a new contract, which was quickly agreed to by Boras at a reported ‘10 years & just keep having the Fed print more money until we say stop’, and Ruth officially became property of the Yankees.”
As for Clemens, the Dan Duquette "twilight of his career" comment would have landed him a lifelong commitment, and a lifetime supply of HGH from N.Y.
OK, perhaps, Scott Boras isn’t actually the devil, but his presence sure has made life hell for a lot of baseball insiders and fans.
Tanaka Likely Leaving Yanks
Masahiro Tanaka is seeking 1-yr deal in $15M-$20M range and is unlikely to re-sign after NYY brought in Kluber (SNY)
Scott Polacek
Martin Perez Shares IG Video After Re-Signing with Red Sox
Adam London
via NESN.com
This Day in Yankees History: A-Rod picks a side in the 2006 WBC
Erica Block
via Pinstripe Alley
No Reason for Yankees to Reset the Luxury Tax Penalty
Peter Brody | cc/2021-04/en_middle_0020.json.gz/line495 |
__label__cc | 0.666634 | 0.333366 | [MAJOR RELEASE] Remote Desktop Manager 13 is Now Available!
Joey Dupont November 9, 2017
Since I know you’ve been waiting for this, I’ll get right to it: Remote Desktop Manager 13 has arrived! Our team has been working hard for several months to get RDM 13 out the door before the end of the year.
What’s New in RDM 13
Here are some of the exciting new features available in RDM 13:
Documentation (markdown)
HTML (markdown) everywhere (secure note, description, HTML document)
Multi-monitor tabbed view support
Check In/Check Out management
Time-based access usage
Favorite folders
Tag manager (batch edit and advanced search)
External application with Sendkey to login
CyberArk integration
True Key integration (credential entry)
Google Drive file explorer
Tree view status (lock, checkout, running)
Improved password template, password complexity and password generator
This is just a snapshot of what’s available. RDM 13 has more than 100 additions, improvements and enhancements — all of which are designed to help you control remote connections and passwords, everywhere. For a full list of what’s new, check out the change history.
Important Note for Devolutions Server (DVLS) Users
If you’re a DVLS user, please make sure to update to RDM 13 before downloading the latest version (v4.7) of DVLS. And remember to do a backup, since it could save you hours of time and effort — and maybe even save your job! Plus, just to be on the safe side, we recommend that you always start running a new version in a test environment.
To get the optimal user experience, please contact us before updating, and we’ll provide you with clear instructions and guidelines. You can reach our team of experts by emailing support@devolutions.net.
How to Get RDM 13:
If you have an active Enterprise License, you’ll be prompted to upgrade when you log into Remote Desktop Manager the next time that you log in. If you want it now, visit: https://remotedesktopmanager.com/Home/Download.
If your RDM Enterprise license has expired, now is the ideal time to renew! Remember, you get lots of extras, including software maintenance and support. You can purchase a license in our online store, or send an email to sales@devolutions.net and our sales team will take care of you.
If you’re new to RDM — welcome! You can try RDM 13 (Enterprise) for 30-days. After that time, you can purchase a license, or continue using the Free version for as long as you wish. Request a free trial here.
As you may know, Devolutions has grown over the years, and we now have more than 300,000 users in over 130 countries. And a big reason for this is that we’re always trying to improve RDM and our other solutions — which means we’re always listening to YOU.
It’s also why our official new versions — such as RDM 13 — are legitimate updates with at least 50 additions and enhancements, but usually more than 100. For example, RDM 13 has 107 improvements. We don’t just add a handful of things and throw a new release party. We’re IT pros, too, and understand that in this industry, credibility and competence aren’t just important – they’re everything.
That’s also why we’ll never stop improving our products, even though we could probably dial things down for a while and relax. We just aren’t like that, and our CEO David ensures that we never will be. He knows, just like all of us know, that the trust and support of our users means everything. It’s simple: without you we wouldn’t exist — nor should we!
We hope that RDM 13 helps you do your job more securely, efficiently and effectively. Please share your feedback below, on our forum, through email/support, and on our social media platforms. We’re already focusing on the next version (no surprise there!).
So Much More Is Coming
If you think that RDM 13 is the last thing on our to-do list for a while…think again! I can’t go into details (yet), but I can tell you this much: a new version of Wayk Now is coming soon and it looks amazing, and we’re working on an innovative new way to help you manage passwords. I’ll share more information towards the end of the year and into early 2018.
Stay tuned, and we hope that you enjoy RDM 13!
Joey Dupont
Hello there, my name is Joey, and I’m a Digital Marketing Specialist here at Devolutions. I have a Bachelor’s Degree in Marketing, and I’m an ardent fan of new and innovative technologies – especially in how they integrate into business and marketing. I work with my great colleagues as part of a team that oversees our social media and advertising portfolios. I’m also responsible for establishing, maintaining and developing relationships within and beyond the Remote Desktop Manager community. Plus, with my colleagues I’m in charge of our blog. While I’m very busy and always have something to do, my most important role is helping and supporting our amazing community of IT pros.
[LIVE WEBINAR] Discover Remote Desktop Manager 13
7 Ways to Contact Devolutions' Support Team | cc/2021-04/en_middle_0020.json.gz/line501 |
__label__cc | 0.726654 | 0.273346 | Qubic status update October 3rd 2018
Research & Development • Oct 03, 2018
September was all about testing the Qubic programming language Abra and creating its initial support library, which is written in Abra of course. While creating the support library, the need arose to be able to verify all kinds of ideas. This resulted in a parallel trajectory where a simple Abra language parser was created in Java. The parser allowed us to run syntactical sanity checks on the library code even before we had a running Abra compiler. To facilitate the building of the parser we created an EBNF syntax diagram for the Abra language.
The process of building this parser directly resulted in a few changes to the Abra language syntax that make it easier to parse and analyze the language. In addition, while building the support library, it became clear that there was a lot of repetitive programming going on due to the fixed-size nature of the Abra trit vector data type. This resulted in the addition of a template-like feature which allows us to create generic functions and then instantiate them for the required trit vector sizes.
In the mean time, one of our Discord community members, ben75, managed to use the EBNF syntax diagram to implement an awesome syntax highlighter for Abra on the IntelliJ IDEA platform. That turned out to be a great help for us while creating the support library code. This community never ceases to amaze me.
Once the parser/analyzer worked correctly it was decided to give it quick-and-dirty ability to run the Abra code as an interpreter. This allows us to run the Abra code and test it already, even without being able to compile it for a specific platform yet. It also allowed us to debug the support library code by stepping through the Java interpreter code in the debugger while it executes the Abra code.
We’re happy to report that most basic library functions worked exactly as designed, and only a few minor details needed fixing. The most astonishing thing that happened during this phase was that *by far* the most complex function that was written, the integer multiplication function, worked flawlessly right off the bat! Astonishing because when we wrote this code there was no way to run the code other than in our minds.
While we haven’t yet created the corresponding integer division function, the functions that implement arithmetic, logical, and conditional operations have already proven to work correctly in practice when we used them to implement several test functions. The most impressive part of the support library is probably the way we can tailor those functions to any required trit vector size, which allows us to perform integer arithmetic natively on a vast selection of integer ranges that is unmatched by most other programming languages. For example we defined an integer data type we namedHuge, which is a trit vector 81 trits long and can represent values in the range of minus to plus221,713,244,121,518,884,974,124,815,309,574,946,401! We even tested with a 6561 trit data type that is supposed to hold an IOTA signature and found that it can represent integer numbers that are a whopping 3131 digits in length. And the integer arithmetic functions will work correctly with all of them!
Further additions to the parser allow it to generate a ternary representation of the Abra code ready for inclusion in a Qubic message to be sent through the Tangle, and convert that ternary code back into the original representation that can be run by the interpreter. This could prove very helpful in speeding up the process of getting to a working proof of concept for Qubic until a more robust version of the end-to-end functionality can be completed.
The document about the Qubic computational model is coming along nicely. It has grown so large that we decided to split it into multiple parts. The first two parts are currently being reviewed, and the third part is expected to be ready in the first week of October. The following parts are planned at the moment:
A conceptual overview of the Abra processing model.
An overview of the basic entities in Abra.
An overview of the Abra programming constructs.
Some example Abra functions with details on how they work.
The Qubic Dispatcher and its interaction with Abra.
It has been very exciting for us to finally see the first working Abra programs in action this month! We hope to be able to share the documentation and interpreter with the community as soon as possible, so that you can start playing with it and contributing to our Abra efforts as well.
Click the above link to see a nice railroad syntax diagram of the Abra language.
Firefly — IOTA’s Next Generation Wallet
Dev Status Update — October, 2020
Dev Status Update — July, 2020 | cc/2021-04/en_middle_0020.json.gz/line503 |
__label__cc | 0.514854 | 0.485146 | Days Gone: The Wedding
Play Days Gone: The Wedding Video
Catch a glimpse of Deacon's softer side as he reminisces about his lost love, Sarah, and their unlikely romance.
John Garvin Creative Director, Bend Studio
In a Days Gone storyline called “I Remember,” Deacon attempts to deal with his tragic past. Long before a global pandemic killed the world — turning the Pacific Northwest into a terrifying no-man’s land of Freakers, Marauders and those just struggling to survive — the Farewell Wilderness set the stage for an unlikely romance between an outlaw biker and an extraordinary young woman from Seattle.
The wilderness is where they met, it’s where he taught her to ride, where she taught him about botany — the reason she was in the high desert in the first place. It’s where he proposed to her. It’s where, in a small church in the tiny town of Marion Forks, witnessed only by long-time friend William “Boozer” Gray, Deacon and Sarah were married.
With just a touch, Sarah Whitaker’s charm and sincerity was always able to soften Deacon, allowing him to show his awkward and tender side. He loved her so much that, a longtime member of the Mongrels MC, Deacon St. John chose to leave the MC and become a NOMAD for her so they could spend more time together. Share a life together.
Two years later, Sarah is gone. Deacon, now a drifter and bounty hunter on the broken road, is left with only a photo to remind him of the woman he loved and the man she had helped him become. In a brief moment of peace at the church where they exchanged vows, Deacon reflects on everything he’s lost, the burnt out shell of the church, a reflection of the man he’s become — haggard, worn, and alone.
But in the world of Days Gone, you are never alone for very long. And in a strange way, Deacon seems to welcome the intrusion. Anything, to help him forget his broken vow: “I promise to never leave you.”
bend studiodays goneplaystation gamesps4
FreshRevenge
February 13, 2019 at 6:25 am PST
It’s interesting that his hat says farewell. Almost an premonition of the future. Hope to see more before release.
SeveredHands
Impressive character building! Looking forward to playing the game!
Xcaligamer1
Been slowly getting into the idea of this game, this trailer is exactly what I needed
ruisu13
Days Gone tells an incredible story, it’s more than a broken world or that humanity has fallen but that this game is about how deacon feels inside. This world of days gone is an outward manifestation of deacon. how One broken man is pushing past his loss and trying to stay alive. Trying to not let the pain consume him. Without her…. He is broken.
February 13, 2019 at 10:10 am PST
While I do hope this game is a 80+ metacritic title for the sake of the PS4 and those that preordered, I have have ongoing misgivings about days gone that are not going to change based off a last of us style trailer with some emotionial alt/folk song carrying the mood on its own, something so far days gone has not earned.
Bend has not released a game since the failed vita’s launch title uncharted golden abyss and it was decent but the worst title in the series by a clear margin. (i have both)
Days has remained in development hell for years and even the most recent gameplay harbours doubts on both quality but also a lack of any real substantive narrative or standout mechanics in a country congested genre.
This unfortunately is a game that has to do well for bend or they likely fold. From a customer standpoint my stance and advice remains wait for the actual release on this. hopefully i’m wrong and it is excellent. Cardboard cuttouts with music and extreme violence with motobikes is all they have really shown thus far.
jmor757
Golden abyss was a great portable game probably one of ps vita best games. I don’t know what you talking about days gone looking better and better every trailer Sony bend shows of it. I think days gone probably end up being a sleeper hit.
decent 80 metacritic with 74 userscore and the worst uncharted by a mile even accounting for the 2012 release good launch game inflation. however it doesn’t hold up, they didn’t do anything big set piece wise and it was mostly a cut copy of the b tier uncharted ps3 with significantly worse controls and forced back touch garbage which almost no one liked.
As for Bend and Days, we will see i will be very surprised if this hits the 80 metacritic mark, in terms of sleeper hit, sure people apply that to anything they feel like. the game will be half price in the first six months however so that being said.
Days Gone and Dreams are deeply troubled games, whether they are up to the standard of the best in the genres and industry remains to be seen.
Death Stranding – Ghosts of Tsushima are ones that deserve the optimism based on showings.
Get the game enjoy the freakers. I am offering up my opinions to counter the bend acolytes as i am able to do.
oh and her tattoo sleeves is extremely tacky and pandering. I hate this kind of too many cooks meddling the broth nonsense. It’s as if people sitting around needing to keep adding stuff and trying to amp it up. I can see the focus testing conversations and she would be too boring if we didn’t add some neck and calf tattoos and some unique ring and make her eyes different colors etc.
ubisoft is one of the worst for this kind of thing. This trailer is terrible and i have liked a few of the others since announce despite technical flaws.
I know it’s a nit pick and i am not against tattoos etc. For Deacon St John the tattoos make sense for a biker fine, his name is contrived sounding though, i just think it’s funny that so much effort goes into mediocre decisions. Look at other quality games and you can see where you are off the pace. Hire better writers, or focus solely on good gameplay.
This game will be measured by the gameplay and sandbox missions etc. the story and characters have been poor since announce.
neutronbomb
The usual tired troupes. He’s lost his love.
Be good if one day we get a hero with a living breathing ALIVE family you’d fight to protect.
Again golden abyss was a ps vita Sony bend did a good job with the limiting hardware. how can you Measure the quality of a game you haven’t played yet or say a game story going suck when you haven’t really seen much of said game story. I’m sorry but You just seem like your average nerd on the internet who like to complain about everything. days gone looking great you can tell Sony bend is putting in the time effort to make some great.
Crazymanwalking1
February 13, 2019 at 1:18 pm PST
I gonna have to agree with Skeetlejuice, Bend Studio doesn’t have the greatest record for console or handheld games
I got the platinum for Golden Abyss,and because of that I ended up loathing the game. I especially dislike chase’s character holier than thou, refuses to touch a gun because she’s a pacifist until she just says screw it I’m rambo and dont even get me started on dante or guerro
Here’s hoping Bend improved in the last several years and Days Gone is general success but as for me I’ll be taking the wait and see approach | cc/2021-04/en_middle_0020.json.gz/line509 |
__label__cc | 0.518625 | 0.481375 | Thursday Night Trivia is So “Smooth”!
With a little chill in the air (and a rather boring football game on TV), we saw an uptick in our Thursday night attendance this week, as seven of our 13 venues topped double digits in terms of the number of teams. Overall, we welcomed 102 teams to a Thursday night game with a wild finish:
We kicked off Thursday’s game with a Triple 50/50 question, asking if these three names were either children’s literary characters or brands of wine: Stellaluna, Foxy Loxy, and Blue Nun. Nearly half of our teams earned bonus points with three correct answers:
After questions on Bitcoin and Edgar Allan Poe, we closed the opening round by asking about these two celebrities with very similar names:
That would be former boxing champion Oscar de la Hoya, and fashion designer Oscar de la Renta. Across the board, 14 teams began the game with a perfect first round.
Thursday’s audio question featured music groups with durations of time in their names. Exactly one-third of our teams earned bonus points by knowing all three answers: Green Day (“Desensitized”), Vampire Weekend (“A-Punk”), and 30 Seconds to Mars (“The Kill”). The most difficult bonus question of the first round followed in the subject of Sports Films:
–> In addition to three baseball films, which actor has also appeared in films centered respectively on bicycle racing, golf, the NFL Draft, and cross-country racing?
2-POINT BONUS: What is the title of the aforementioned cross-country film?
Nearly every team earned wagering points with the correct answer of Kevin Costner, but only eight teams tacked on those extra two points by remembering the title of this 2015 film:
The final question of the second round also included a difficult bonus question. Just over half of our teams knew that Paris will host the Summer Olympics for the third time in 2024, but only nine teams could name either one of the two years in which it previously hosted: 1900 or 1924. As a result of these two bonus questions, the second round did not yield any perfect scores.
HALFTIME:
Thursday’s halftime page quizzed our teams on TV-themed coffee mugs and the original names of music groups. Our average score of 16.3 points included 13 teams who notched perfect scores on the halftime round. Here are Thursday’s top scores after the first half:
PC Principals (Fish Market): 90
Brother of Menelaus (Fish Market): 88
Power Vacuum (Champion Billiards): 88
Furry Fun Bridge (Fish Market): 87
Hans Gruber Preservation Society (Smoketown Brewing): 87
Thursday’s third round included a question on the recent alcoholic advertising campaign featuring this Oscar-winning actor:
Surprisingly, only 34% of our teams earned points by knowing that Matthew McConaughey is the new spokesperson for Wild Turkey bourbon. Keeping with the food and drink theme, we followed up by asking about the fruit which appears in the title of both a Billy Joel song and Dr. Seuss’ first children’s book. I’m guessing that very few teams knew the song “Big Man on Mulberry Street”, and instead earned their wager by knowing this book title:
Next up was our most difficult wagering question of the third round:
–> Often used to refer to angles which extend from the center of a circle, what mathematical unit is equal to just under 57.3 degrees?
Only 28% of our teams earned points here with radian:
Only two teams swept the third round with a perfect score: Brother of Menelaus (Fish Market) and We Drink and We Know Things (Grille at Flower Hill).
6-4-2 QUESTION:
We went back to the bookstore for six-point clue on Thursday night:
–> Which best-selling author’s most recent work is the novel “Origin”, which was released five weeks ago?
Only nine teams knew that “Origin” is the most recent installment in the Robert Langdon book series, as penned by Dan Brown.
Thursday’s final round began with our most difficult bonus question of the night:
–> NASA’s Dawn spacecraft took off ten years ago to study these two bodies within the asteroid belt between Mars and Jupiter. One of these bodies is a giant asteroid, while the other is a dwarf planet. Name either one of these two objects.
Abut half of our teams earned their wagers with the easier of the two answers: the dwarf planet Ceres (the largest body in the asteroid belt). But only four teams knew BOTH answers, essentially gaining two points on the field with the second correct answer of Vesta.
The final round also included our nightly Three Clues question, with this version dealing with a celebrity:
CLUE 1: One of this performer’s earliest screen roles was in “Three Little Pigskins”, a 1934 film starring The Three Stooges.
CLUE 2: In the 1960s, this celebrity played an integral role in the creation of the TV series “Star Trek”.
These two clues were enough for 15% of our teams to earn two points bonus with this correct response:
Indeed, in the 1960s when Lucille Ball was head of Desilu Studios, she gave a certain fledgling science fiction show the support it needed to stay on the air. Thanks to the astronomy question, we did not see any perfect scores in the final round. Here are Thursday’s top scores after the fourth round:
Brother of Menelaus (Fish Market): 162
Dire Wolves (Belly Love Brewing): 158
Unathetico Madrid (Guido’s): 156
You’re Killing Me Smalls (Fish Market): 155
PC Principals (Fish Market): 155
FINAL QUESTION (7.9% success rate):
–> Formed in San Francisco in 1966, which rock band but did not score its first #1 hit on the Billboard Hot 100 Chart until one year AFTER its 1998 induction into the Rock and Roll Hall of Fame?
Although several of its members (including its namesake) were born in Mexico, the band Santana formed in San Francisco. In year after gaining entrance to the Rock and Roll Hall of Fame, they hit #1 (along with Rob Thomas) thanks to the song “Smooth”:
This question was certainly more difficult than expected, as we saw a grand total of eight correct answers. Oddly enough, three of those correct answers came from the six-team field at Belly Love Brewing! Thursday featured two teams who scored the Perfect 21 with correct responses on every wagering question: Brother of Menelaus (Fish Market) and Unathetico Madrid (Guido’s). Here are your top overall scores from Thursday:
Formerly known as TWA (Belly Love Brewing): 158
Don’t Stop Believing (Grille at Flower Hill): 152
Turtles All the Way Down (Quincy’s): 152
Bag of Marbles (Jerry’s): 144
North Country (Quincy’s): 143
TONIGHT’S WINNERS:
Quincy’s Bar and Grille in Gaithersburg, MD: Turtles All the Way Down (Next week’s first category: “The Godfather”)
Champion Billiards in Frederick, MD: Power Vacuum (Next week’s first category: Nolan Ryan)
Bunker Sports Cafe in Leesburg, VA: Your Mom (Next week’s first category: “PCU”)
Smoketown Brewing Station in Brunswick, MD: Hans Gruber Preservation Society (Next week’s first category: “Rick and Morty”)
Beef O’ Brady’s in Frederick, MD: Smarty Pants (Next week’s first category: Last Word / First Word – AUDIO)
Jerry’s Sports Bar in Hagerstown, MD: Bag of Marbles (Next week’s first category: King’s X)
Belly Love Brewing in Purcellville, VA: Dire Wolves (Next week’s first category: Parts of Speech)
Cushwa Brewing in Williamsport, MD: Slapsgiving (Next week’s first category: 1990s Cartoons)
Olde Mother Brewing in Frederick, MD: In Dog Beers, We’ve Had One (Next week’s first category: Maynard James Keenan)
The Grille at Flower Hill in Gaithersburg, MD: Don’t Stop Believing (Next week’s first category: Howard Stern)
Right Around the Corner in St. Petersburg, FL: Over 140 (Next week’s first category: Prince – AUDIO)
Fish Market Restaurant in Alexandria, VA: Brother of Menelaus (Next week’s first category: Boy Bands)
Guido’s in Frederick, MD: Unatheltico Madrid (Next week’s first category: “Super Mario Bros. 3”)
Earn $100 for Referring PHT
Expert Posts
Monday Game Recaps
Thursday Game Recaps
Tuesday Game Recaps
Virtual Game Recaps
Wednesday Game Recaps
Weekend Game Recaps
PHT Online – Final Scores from January 14
PHT Online – Final Scores from January 7
PHT Online – Final Scores from December 31
Posted in Thursday Game Recaps
← A New Month and Another New Venue…
Turn Back the Clocks for Weekend Trivia! →
phtrivia@gmail.com
© 2020 The Pour House Trivia Blog. All Rights Reserved. | Site Design by | cc/2021-04/en_middle_0020.json.gz/line510 |
__label__wiki | 0.511368 | 0.511368 | Tag Archives: City of Baltimore
TNCS Wins Southeast Baltimore City Schools Recycling Competition!
This week, The New Century School elementary students had a very special visitor. Councilman Jim Kraft spoke to Ms. DuPrau’s and Ms. Roberts’s classes on December 16th and presented them with an official award as winners of the Southeast School’s 2013 Recycling Competition. Councilman Kraft was accompanied by Emily Sherman, a member of his City Hall office and a Shriver Peaceworker Fellow, and Robert Murrow, Baltimore City’s Recycling Coordinator (known to the kids as “Mr. Bob”). Ms. Sherman said that the contest’s goal is to “get students more aware of the impact of their recycling and also more aware of what can be recycled.” Surprisingly, many people still don’t know how easy—and how beneficial—it is to recycle, she reports.
Ms. Danyali introduces some very special guests and also opens the discussion about recycling.
Head of School Alicia Danyali began the presentation by asking students why recycling is important. Lots of kids gave great responses, but one boy’s answer, “So we don’t pollute the world,” kind of hit the nail on the head and is why the Councilman’s office targets schools. “We get to them while they’re young to instill healthy behavior, says Ms. Sherman. After a few more pithy yet adorable student responses, Ms. Danyali turned the floor over to the visitors.
It’s safe to say that Councilman Kraft really understood his audience. Dressed in Christmas-y hues with a holiday-patterned tie, he began by addressing the elephant in the room: “You guys don’t really want to hear what I have to say—you want to talk about Santa, don’t you?” Once the laughter and cheering subsided, Councilman Kraft had the audience in his palm. Well known for his pro-environment platform, Councilman Kraft has been holding this recycling contest for several years among his other green initiatives. (This was TNCS’s first year participating, but even as rookies, we held our own.)
Councilman Kraft presents Robert Murrow (a.k.a., “Mr. Bob”) to a rapt audience.
In fact, says Ms. Sherman, this year’s contest had the most participants to date. Going up against nine other areas schools, TNCS elementary students gathered recycling around the school into brown bags and reported to Ms. Danyali on a weekly basis, who, in turn, called City Hill with the week’s tally. She dubbed them her “Recycling Ambassadors,” and they competed not only against exponentially larger schools (with up to 700 students), but also against other students as old as age 18 years. (Note: Totals were assessed per capita rather than schoolwide to level the playing field for smaller schools such as TNCS.)
In their presentation, Councilman Kraft and “Mr. Bob” once again tapped into the kids’ seasonal excitement. “Santa Claus is the world’s biggest recycler,” said Mr. Bob. “We’re in constant contact,” he continued, “and we send out press releases to let everyone know that Christmas is a great time to recycle.” Wrapping paper, old electronics, styrofoam packing, cardboard, etc. can all be recycled, and it’s very important to remember to do so. Mr. Bob finished by asking the first-place winners to give themselves a big hand.
Councilman Kraft presents the award to a TNCS Recycling Ambassador.
In addition to presenting a very official-looking certificate, Councilman Kraft also promised to donate several copies of The Lorax to TNCS’s library (the lorax also being very pro-environment—“[He] speaks for the trees.”). Best of all, the kids win a field trip to the Baltimore Aquarium plus lunch in early 2014.
The kids are brimful of questions about recycling . . . among other things.
As the City Hall delegation wound down their presentation, the kids had questions. Lots of questions. Including these directed to Mr. Bob: “Are you an elf? Will you show us your ears?” He was wearing green pants, after all. In all seriousness, though, Mr. Bob has helped make recycling a snap in Baltimore, which uses a single-stream method and requires no separating of recyclables into constituent materials.
TNCS elementary students have shown our community not only that recycling is so easy that anyone can do it but also that TNCS and Councilman Kraft fully support such environmentally sustaining practices. “TNCS was green to begin with,” said Ms. Sherman, “so this was icing on the cake!”
“Be it hereby known to all that The City Council of Baltimore offers its sincerest congratulations to The New Century School in recognition of receiving 1st place in the Southeast Schools 2013 Recycling Competition.”
This award is definitely something for TNCS to be very proud of!
Update: On February 21st, the elementary students got their reward trip. See the delights!
The proud recipients of their new books pose with Councilman Kraft. If the Lorax “speaks for the trees,” Councilman Kraft sure speaks the same language!
There’s just something about jellyfish.
Is this real? Hello?
Enjoying the view from The World Trade Center.
If only we could get in there and swim around with them . . . sigh. We love dolphins . . .
So beautiful! So eerie!
Please don’t flash the octopus!
These schoolgirls get up close and personal with another school . . . of fish!
These boys are ready for their trip to The Baltimore Aquarium and The World Trade Center!
Close one!
Is that jellyfish swimming upside down?
One of the many cool sights at The Baltimore Aquarium!
Standard | Posted in Community Service, Elementary Education, Environmental Sustainability, Progressive Education | Tagged City of Baltimore, Councilman Jim Kraft, recycling, Robert Murrow Recycling Coordinator, southeast baltimore, The New Century School | 4 Comments | cc/2021-04/en_middle_0020.json.gz/line513 |
__label__wiki | 0.631222 | 0.631222 | The modern part of An universal history, from the earliest ..., 12. kötet
sharp than Canary. As it is but in little esteem in Europe, they export it chiefly to the West Indies, where it keeps well for a long time in the hottest climates. Besides Malmfey, Verdona, and the common Canary wine, Teneriffe island so abounds in all kinds of grain, wheat, maiz, and barley, that great quantities are shipped off to other countries ; nor is it less prolific in quadrupeds and birds of all kinds. In a word, exclusive of some inconveniences from earth quakes and volcanos, the universe presents not a more delightful spot for contemplation, ease, and all the felicities of quiet life f.
Gran.
Canaria.
East-south-east, and about ten leagues distant from Teneriffe, stands the island of Gran Canaria or Great Canary, between 27 and 28 deg. of north latitude (G). It is twelve leagues in length, and nearly as much in breadth. Prevost calls this island the chief of the Canaries, without afligning any other reason than its name, and the residence of a bishop ; from which last circumstance we may collect, that either this prelare has palaces in the different islands, or that all the larger ones are distinct fees. The truth we believe is, that though the viceroy, the bishop, and all the people of distinction live in Teneriffe, yet the island of Canary is a bishop's fee, suffragran to the archbishop of Seville in Spain ; for, besides this, there is here a court of inquisition, and the sovereign council of all the Canaries is held here occasionally. Nay more, in Nicolls's time it is certain, there was only one bishop of the Canary Ilands; and no alteration in this particular is positively mentioned by any author. The capital of this ifland is called Palma ;' in Latin, Civitas Palmarum ; in Spanish, Cividad das Palmas, a name by which it is specified in all the public acts and particular contracts, or procedures of justice, yet do some authors call it Canary. It stands on the north part of the island, at a small distance from the sea, and is celebrated for its temperate climate, extent, neatness, and other particulars. It is adorned with a
* Sprat's History of the Royal Society; p. 209. La Croix, p. 675, & feq. Prevost, tom. iii. liv. v. cap. 1. Purchas's Pilgrims, lib. xii. cap 3. p. 788. Davity, tom. v. p. 610. Sanut. Jib. iii. Linschot, cap. 97. Cadamost. apud Ramus. cap. 7.
(G) Some writers, and in teen leagues ; but we have particular Davity and La fixed upon the authority of Croix, make the distance be. Nicolls, who had long been an tween these islands about four- inhabitant of the Canaries.
magnificent cathedral, several convents, and a number of elegant buildings, which render it little inferior to Laguna; and it is perhaps superior in point of police, all the principal men of wealth and credit acting in the capacity of civil magistrates.
The country is more level, and as fertile as Teneriffe, yet the soil is light and sandy, covered over by a coat of rich mould, about sixteen inches thick. Every year produces two crops of all kinds of vegetables, except fruits the one in February, and the other in May, and both plentiful. Their flour-bread in this island is especially ex- ! cellent, both in taste and colour; in which last it rivals snow itself. Sugar-canes are raised in such abundance, that there are no less than twelve sugar-works, each so large as to be mistaken by strangers for little towits; and the abundance of this commodity constitutes the principal wealth of the island, incredible quantities of coarse sugar being yearly exported. Le Maire specifies four convents of different orders; viz. the Franciscan, Dominican, Bernardine, and Cordelier houses, all of them rich and well built.
The island of Fuerte, or Fuerte Ventura, stands about Fuerte fixteen leagues north-north-east of Canary island, one end Ventura. of it lying under the 28th, and the other extending almost to the 29th degree of north latitude, being about fifty miles in length, and variable in its breadth ; in some parts ten leagues, in others no inore than as many miles. The foil is in general fertile in corn, roots, and fruits, and beautifully diversified in hills and vallies, well watered and supplied with a variety of timber. This island pro- | duces, belides the other fruits common to the Canaries, a prodigious abundance of dates, mastick, and olives, with orchel for dyeing, and a species of fig-tree that yields a medicinal balm as white as milk; but the virtues of it are wholly unknown in Europe. An incredible quantity of goat-milk cheese is made in Fuerte Ventura, as may be easily conceived from that island's breeding upwards of fifty thousand kids every year. The flesh is fat, better coloured, and sweeter, than in any other country; each of them weighing between forty and fifty pounds. Dapper says, that here are three considerable sea-port towns, Langla, Tarafato, and Pozzo Negro, with two good roads besides for shipping, where they may ride secure against all storms. We find in Herbert, but in no other author, that this island was taken in 1596 by the English; but has, since
that time, been better fortified. On the north coast of Fuerte Ventura, about a mile farther in the sea, it is that the little island of Gratiofa ftands; with a particular account of which it would be unnecessary to trouble the reader.
Lancerota.
The last island of the Canaries we shall describe is Lancerota, or Lanzerota, formerly Centuria, as we find it in all the ancient geographers. It lies under 29. deg. 30 min. north latitude, and 12 deg. 31 min. west longitude from London. In length it is thirteen leagues from north to fouth, nine in breadth, and about forty in compass, taking in the bays and creeks. It is parted by a ridge of mountains which afford nothing but pasture for cattle, though the vallies are fruitful, but fandy, and thin in the soil. It abounds in grain, fruits, horned cattle, hares, camels, and afles. In Nicolls's days it was the property of Don Augustin de Herrera; but ships crews had an appeal, in all judicial cafes, to the viceroy of the Canaries. One great branch of the trade of Lancerota consists in dried goats flesh, which the inhabitants fell in great quantities io the neighbouring islands, under the name of tussineta.
To these seven great islands may be added the small ones of St. Clair, Gratiofa, Rocca, and Alegranza, situated at the north-east end of Lancerota ; but they have nothing so peculiar as to merit a description. We shall therefore close these observations on the Canaries with remarking, that the natives of these islands enjoy a clear, serene, temperate air; for though they lie in a warm climate, they are so constantly refreshed with breezes from the fea, that the noon-day heats are very tolerable, and the mornings and evenings inexpreslibly pleasant. They never feel pinching colds or scorching heats, nor do the poorest people know the want of cloathing, firing, fruits, or wine. In a word, if fields covered with the finest and richeit verdure, hills with a variety of woods and fruits, great abundance of all the necessaries and conveniencies of living, and, in short, a scene the most rural, fimple, and elegant, can render people happy, the inhabitants of the Canaries cannot fail of meriting the name given to them by the ancients, of Fortunate.
SECT,
W E come, in the last place, to describe the islands of Madeira,
Madeira and Porto Santo, from the lame and defective materials furnished us from voyagers and geographers.
Some imagine, that Madeira was known to the ancients by the names of Juno and Antetala ; but it is probable the Portuguese were the first discoverers, unless there be truth in the following relation of Ovington. This gentleman says, that though the discovery is attributed by all Europeans to the Portuguese, yet there is a tradition among the natives, which gives the whole honour to the Englith. They affirm, that an English gentleman, who had married a lady of immense fortune, embarked at Bristol, in the year 1342, for France, and was driven by a storm to the island of Madeira, so called afterwards by the Spaniards, on account of the incredible quantity of trees and prodigious forests it produced. Here he landed, and finding it uninhabited, fell into melancholy and defpondency, which foon put an end to his life; but the failors ventured again to sea, and happily arrived on the coast of Barbary. There they met with a Portuguese squadron, to whom they related their adventure, and promised to conduct the admiral to the island they had quitted. Immediately notice was sent to the court of Lisbon, and the proposal appeared fo advantageous, that instructions were given to an admiral, with whose name we are unacquainted, to go in fearch of the island; in which he fucceeded, and, in the space of a few years, rendered it one of the most delightful spots in the universe. However, the most probable and best attested account is, that the Portuguese did not become acquainted with Madeira before the year 1431, when Don Henry first fent a colony thither, under the conduct of Tristan Teflora and Gonzales or Gonzalvo Zarco, who were nominated governors alternately, or, az others affirm, of different parts of the island. Upon this partition of power, it was divided into two provinces, Machico and Funchal: the new colonias immediately set to work in clearing the ground, and, for this purpose, fet fire to the forests, which burnt with such violence, that the governor and people were forced to feck protection from the
flames in the fea, in which they had almost perished, before they were taken up by a ship. So abundant was the fewel, and fierce the flames, that this fire continued, we are told, for near seven years ; in consequence of which, the soil was so enriched by the wood-afhes, that, for a long time, it produced one hundred fold ; though we are told, this increase is diminished to twenty-five times the quantity of grain fown, or sugar-canes planted (H). At first the colony consisted of no more than eight hundred souls : now, if we may credit Atkins, the island of Madeira can raise eighteen thousand able-bodied men ; nor were they much inferior in strength in the year 1640, when, by that surprising revolution, Portugal threw off the Spanish yoke.
This island, Barbout is of opinion, is the Carne of the ancients, lying in 32 deg. of north latitude, and 17 of west longitude from London, seventy leagucs north-west, or, according to some authors, north-east of Teneriffe,
(H) Atkins and Ovington other of a reddish colour, and both affirm, upon the testimo- from these are made two sorts ny of the Spaniards and na of wine, one of which is called tives, that the ashes, and their tinto, from its high colour. falts, occafioned, for a while, This, they say, is, in the opi. an amazing fertility, particu- nion of some perfons, actually larly in sugar; but that a coloured by certain ingrediworm, which had crept in, ents, with which they five it ; the destruction of the cane, but this the inhabitants conobliged the Spaniards to con- ftantly deny; and we shall see vert their sugar-plantations in- in the text four several diitinct to vintages, which proved e kinds of Madeira wine. Ovingqually advantageous, from the ton adds, that so far has Ma. excellency of the grape. deira degenerated from its
The malmsey wine made wonted fertility, that some here is, according to them, an years are so barren as to enadmirable cordial; and the danger a fairine, the inhabitbest vintages in this kind be ants being forced to rely for longed to the Jesuits of Funchal. bread on the supplies brought They gather their vintages in by the shipping. This was September and October, mak- the case in the year 1687, ing every year no less than when he was on the island (1). twenty thousand pipes. The Captain Uring goes farther, fame authors affirm, that Ma- and affirms, that it seldom prodeira produces only two kinds duces more grain than supplies of grapes, the one brown, the the people for three months (2).
(1) Atkins, p. 23.
(2) Ovington, p. 10. Uring's Voy: p. 10. | cc/2021-04/en_middle_0020.json.gz/line516 |
__label__cc | 0.690382 | 0.309618 | Creative Class 2019
Brandan B-Mike Odum is Changing American Culture With his Visual Art
The Creative Class: Brandan “B Mike” Odums Is A Visual Artist Who’s Changing American Culture
Posted on October 22, 2019 - By Bossip Staff
Source: iOne Digital Creative / Creative Class
Name: Brandan “B Mike” Odums
Occupation: Visual Artist
How We Know Him: New Orleans is more than beignets and boudin, it’s B. Mike. B Mike is the owner of StudioBE, a 36,000 feet poppin’ art gallery in N.O., moreover, he’s so true to his city that he painted murals of civil rights icons in the city’s Lower Ninth Ward, the area that was hardest hit by Hurricane Katrina back in 2005.
Why We Chose Him: B. Mike’s art space has quickly become a go-to fave for the in-crowd in the Big Easy, hosting celebs events and serving as the backdrop for effortlessly epic pop culture moments. Furthermore, B. Mike is furthering NOLA’s legacy a brushstroke at a time.
What’s Next: Odums is continuing his outreach through StudioBE and is releasing new merchandise soon.
IG: @bmik
Brandan “BMike” Odums is one of the most talented, influential and important visual artists in the country. He has been an ambassador for New Orleans, home to his transformational art space, StudioBE, which he uses to exhibit his ever-changing repertoire of graffiti art displaying pivotal figures in black history. The studio has been featured on shows like Queen Sugar and has hosted guests like Common, Dave Chappelle and Colin Kaepernick. His clothing line features the now-iconic phrase “I Am My Ancestors Wildest Dreams” that can be seen on celebrities and fans across the world. Odums’ ability as a visual storyteller and knack for community-building makes him a valued member of the inaugural Creative Class.
“Check out the other honorees on iOne Digital’s The Creative Class.”
Categories: Creative Class 2019, News | cc/2021-04/en_middle_0020.json.gz/line519 |
__label__wiki | 0.814001 | 0.814001 | Entertainment » Theatre
Theater Royalty Gathers for U.K. Arts Benefit
by Jim Provenzano
Imagine having a conversation with your favorite living British actors. Now you can, in a special benefit for a London-based arts organization. For One Knight Only will include Dame Judi Dench, Sir Derek Jacobi, Sir Ian McKellen and Dame Maggie Smith, with host Sir Kenneth Branagh. The live Q&A will take place via Zoom on Sunday, November 29 at 11 pm Pacific Time, with opportunities for audience members to participate throughout the event.
"We began this initiative when Robert Lindsay suggested we considered donating our proceeds to the RTF charity, a charity that is part of Acting for Others," said Lockdown Theatre Producer Rob Grant in a press statement. "In this climate, it sounded like a truly worthy cause, and we decided to mount future productions entirely for the benefit of the charity, and via them, the performing arts industry, which is suffering so hideously from the restrictions on live entertainment, with no clear end in sight. We enjoy putting the shows on, the cast enjoy performing them, and the audiences enjoy watching. It's a three-way win."
Lockdown Theatre, a quarantine initiative set up to present exclusive live table reads with all-star casts, has raised more than £112,000 ($147,000) to support Acting for Others.
Like its U.S. counterpart, The Actors Fund, the charity helps thousands of theater workers in need, and has collected and disbursed millions in support funds, as well as specific support via various other charities. Both charities had already been offering support to theater and arts workers before the COVID-19 pandemic closed theaters worldwide.
Previous events have been readings of Samuel Beckett's "Waiting For Godot" and NoëI Coward's "Private Lives." Participating actors include Sanjeev Bhaskar, Emilia Clarke, Robert Lindsay, Joanna Lumley, Michael Palin, Jennifer Saunders and Emma Thompson.
Theatre fans hungry for some classy British acts, and some saucy Brit humor, should tune in. No telling if Ian McKellen will do his hilarious impression of Dame Maggie.
www.rtflockdown.com
www.actingforothers.co.uk
Help keep the Bay Area Reporter going in these tough times. To support local, independent, LGBTQ journalism, consider becoming a BAR member.
Copyright Bay Area Reporter. For more articles from San Francisco's largest GLBT newspaper, visit www.ebar.com
Not Curtains: Theater Companies Adapt to Retain Audiences
Quack Act: Shotgun Players Find Silver Linings in Taking Theater Online
Mario Puzo's THE GODFATHER, Coda: The Death of Michael Corleone on Blu-ray & Digital from Paramount Home Entertainment!
DREAMLAND on Blu-ray & Digital from Paramount Home Entertainment!
PopUps: Here's How Betty White Will Celebrate Her 99th Birthday
"The Golden Girls" star reveals the wholesome plans she has for her 99th birthday and offers advice for a long and happy life.
Supreme Court Strikes Down Louisiana Abortion Clinic Law | cc/2021-04/en_middle_0020.json.gz/line520 |
__label__cc | 0.608296 | 0.391704 | Demand for Crypto Soars: Bitcoin Funds Break Records, G...
DashNexus Budget Proposal Approved for Getting DASH Back into Japan
A $30,000 proposal submitted by the group running Dash’s Japanese website has just received approval to continue their efforts to get the token relisted in Japan.
According to an April 27 update on a DashNexus proposal, Yosuke Suda of Dash Japan has purportedly been working with the Dash Core Group to get DASH back in the hands of Japanese investors.
Suda — identified as “Samurai33” — originally posted the proposal on March 10 with the goal of getting the crypto asset “listed on registered crypto asset exchanges in Japan and to gain status equivalent [to Bitcoin].” He also hopes to see DASH used for payments within the country.
As part of his proposal, Dash Japan requested $30,000 to be used on memorandums drafted by lawyers and CPAs, as well as travel for himself and the Dash Core Group to Tokyo, with Suda promising to send the funds to a Dash Core Group wallet.
This proposal was approved on April 27. However, at the time of press, no one who has been in the United States in the last 14 days — the Dash Core Group is based in Phoenix — will be granted entry to Japan due to COVID-19 travel restrictions.
Removed from many exchanges
DASH, a privacy-focused cryptocurrency, was systematically delisted from many crypto exchanges in Japan starting in 2018, including by major exchange Coincheck. According to Suda, this removal was based on a “shared misunderstanding” by Japanese regulators that “Dash’s blockchain is private, untraceable, and cannot be audited.”
Japan eager for a DASH revival?
Although there are no specific laws or guidelines in Japan prohibiting DASH by name, the Japan Virtual Currency Exchange Association (JVCEA) has issued guidelines that effectively shut out the cryptocurrency from all local exchanges. These include regulations on difficult-to-trace cryptocurrencies, digital assets that are difficult to audit, and those at risk of violating anti-money laundering (AML) and anti-terrorist financing (ATF) laws
“As of March 2020, there are 21 registered and licensed exchanges in Japan, however none of these exchanges have Dash listed on their platforms. This means that residents of Japan have no legal way to purchase Dash”
The submitted proposal will send memorandums written by lawyers and CPAs to other registered crypto exchanges in Japan — 23 at the time of writing — the JVCEA, and the country’s Financial Services Agency. The last is responsible for amendments to regulations of digital assets under the The Payment Services Act and Financial Instruments and Exchange Act, set to be enforced in Japan starting on Friday, May 1.
PreviousBuilder Skanska first-quarter profit jumps, lowers market outlook due to pandemic
NextAngry Birds maker Rovio lifts profits with lower costs
Nike earnings preview: Analysts expect the good times to keep on rolling for the sportswear giant
Ex-Homeland Security Chief: 3 nightmare scenarios could play out before the election
CVS Health maintains 2020 profit forecast despite coronavirus hit
Bitcoin Price Spike Targets the $40K Handle, Crypto Economy Recaptures $1 Trillion Market Cap | cc/2021-04/en_middle_0020.json.gz/line528 |
__label__wiki | 0.527017 | 0.527017 | Tommy Paradise
John Garrett
"Alexa, Play 95.3 The Bear"
"Hey Google, Play 95.3 The Bear"
Phone Shams w/ Steve Shannon
Request a Phone Sham
Join The Bear VIP
Country Oldies Night with John GarrettCountry Oldies Night with John Garrett
Luke Bryan’s ‘Pranksmas’ Day 10: Caroline Gets Her Comeuppance
Luke Bryan's "12 Days of Pranksmas" is raging on at Day 10, and most recently, it was the singer's wife Caroline who found herself in the hot seat. Over at the Bryan household, Caroline's often the mastermind behind some of the most epic pranks, with favorite targets being her country star husband and his mother, LeClaire.
So even Caroline had to admit that she got some well-deserved comeuppance in the latest round of pranks, a blitz of Caroline getting surprised, scared or jumped out at in various locations around her house. She posted a montage of clips to her Instagram, rounding out Day 10 of the pranks war.
"Payback!" she wrote in the caption. "Can't say I didn't deserve it ..."
It's tough to feel much sympathy for Caroline in light of some of the pranks she's pulled in recent days. On Day 4, she targeted her brother's wife, Ellen Boyer, while the family was on a private plane, enlisting the help of a "pilot in training" to make the flight as awkward as possible.
Meanwhile, on Day 2, she pranked her son by noisily ruining a deer hunt, and on Day 3, she gave mama LeClair a rude awakening with a little help from a recording of a rooster's crow. But Caroline has proven before that she can take it as good as she dishes it out: On the first day of Pranksmas, she was the target of a prank from her husband, who convinced her that she'd ruined a priceless Tim Tebow trophy.
The Turkey That Attacked Caroline Bryan Won't Bother Her Again:
10 Things You Probably Don't Know About Luke Bryan:
Source: Luke Bryan’s ‘Pranksmas’ Day 10: Caroline Gets Her Comeuppance
Filed Under: Caroline Bryan, Luke Bryan
2021 95.3 The Bear, Townsquare Media, Inc. All rights reserved. | cc/2021-04/en_middle_0020.json.gz/line529 |
__label__wiki | 0.529546 | 0.529546 | By 98 KUPD | July 27, 2020
Members of Coheed and Cambria, Tool, Mastodon & Primus team up for all-star Rush cover
Members of Coheed and Cambria, Tool, Mastodon and Primus have joined forces for a massive cover of the Rush song “Anthem.”
The all-star lineup includes Coheed vocalist Claudio Sanchez, Tool drummer Danny Carey, Mastodon guitarist Bill Kelliher, and Primus frontman Les Claypool, as well as Stephen Brodsky of the band Mutoid Man and online metal personality Gwarsenio Hall.
In addition to forming the dream band for people who love irregular time signatures, the cover is also raising money for charity, as each participating artist is donating their fee to the Cancer Research Institute.
You can watch the “Anthem” performance streaming now on YouTube.
In case you couldn’t tell by the, well, everything about them, Coheed, Tool, Mastodon and Primus are all very influenced by Rush. Primus, in fact, was scheduled to launch a Rush tribute tour this summer, but the outing was postponed to 2021 due to the COVID-19 pandemic. | cc/2021-04/en_middle_0020.json.gz/line530 |
__label__cc | 0.623618 | 0.376382 | AASHTO Reappoints Three to AASHTOWare Committee
editor@aashto.org May 17, 2019 0 COMMENTS
The American Association of State Highway and Transportation Officials reappointed three members to its Special Committee on AASHTOWare, which oversees the development of the organization’s cooperative computer software development program.
All three will serve new three-year terms that start on July 1 this year and end on June 30, 2022.
Those three reappointed committee members are:
Mark Dunn, director of the office of contracts for the Iowa Department of Transportation. He’s been reappointed to his first three-year term as a member of the SCOA.
Tim Armbrecht, chief of structural services for the Illinois Department of Transportation, also received reappointed to the committee for his first three-year term and will be designated SCOA’s vice chair.
Todd Bergland, director of software engineering with the Minnesota Department of Transportation, received reappointed to his second three-year term with the SCOA.
AASHTOWare is a system designed to help transportation professionals comply with Federal Highway Administration regulations and more efficiently monitor project costs, among other capabilities.
House T&I Committee Seeks Rescission Pullback, More Harbor Fund Spending
Video: Oregon DOT Hosts Annual Construction/Utilities Career Day
editor@aashto.org
Hartinger to Chair Committee on Internal/External Audit
Iowa DOT’s Marler to Chair AASHTO CTSO Committee
AASHTO Issues Design and Traffic Publications Catalog | cc/2021-04/en_middle_0020.json.gz/line532 |
__label__cc | 0.70756 | 0.29244 | « What if Christians were seen like Muslims?
Stupid Things White People Say »
Thu Dec 10th 2015 by abagond
Donald Trump (1946- ), also called The Donald, is a billionaire blowhard and American television actor. He is running for US president in 2016, making naked appeals to White racism. He has been leading in opinion polls among Republican voters for the past five months, since July 2015.
His supporters are mostly Whites without university degrees. They say they like him because he tells it like it is – meaning that, instead of racist dog whistles, he makes naked appeals to their racism:
Mexican Americans:
He sees Mexicans as bringing in crime when, in fact, the first generation is less criminal than the US as a whole.
He will build a wall between the US and Mexico and kick out 11 million undocumented immigrants – along with their US-born children.
He will overturn the Fourteenth Amendment’s constitutional right to birthright citizenship.
Muslims and Muslim Americans:
He said he saw thousands and thousands of Muslim Americans in Jersey City, New Jersey cheer the fall of the Twin Towers on 9/11. Not true – but most of his supporters believe him.
Muslim Americans will be put on a government list.
He will keep an eye on certain mosques and might shut down some of them.
He will not allow any Muslims into the US, except for citizens, until, presumably, he can tell who is a terrorist and who is not.
Black Americans:
As a Birther, he demanded that President Obama produce his long-form birth certificate to prove he was born in the US. Trump has refused to provide his own long-form birth certificate.
He said 81% of Whites murdered are killed by Blacks. In fact, the FBI says it is only 14%.
When his supporters beat up Mercutio Southall, who had been shouting “Black lives matter!” at his rally in Birmingham, Alabama, Trump said:
“Maybe he should have been roughed up because it was absolutely disgusting what he was doing.”
No doubt worse is to come: just when you think he cannot get any worse, he gets worse.
The mainstream US press is now openly comparing him to Hitler. But they have also been giving him centre stage for months on end. It is sickening. MSNBC is almost becoming a Trump infomercial.
From the way they cover him, you would never know that Trump represents less than 10% of US voters.
His numbers, on average in national opinion polls, have been bumping between 20% and 30% of Republican voters since August. In 2014, only 26% of voters were Republican. That means Trump supporters make up 5% to 8% of all US voters. He has pulled into first place by being the most extreme of a fractured field of 14 candidates. In absolute terms, he is doing no better than Bernie Sanders on the Democratic side. The press sees Sanders as a long shot.
Trump’s views have always been present among Whites. The last person who ran for president who made such a naked appeal to their racism was George Wallace in 1968. He got only 13.5% of the vote. That is why the other candidates do not tell it like it is.
– Abagond, 2015.
Hillary Clinton for president – my reasons for voting against Trump
More on Trump:
How Donald Trump is worse than Hillary Clinton
Trump’s sex scandal
Should Donald Trump go back to Europe?
US cable news – co-opted by Trump
Trump’s media blacklist
Trump’s Black outreach
Donald Trump quotes about Black people
Mercutio Southall
Black endorsements in the 2016 election for US president
Poll: Is Donald Trump racist?
The Trump Effect on children
Can Trump win? – as of August 18th
Trump voters – as of August 2016
White Evangelical Protestants
Russian trolls – who pose as US voters on the Internet
The incomplete list of presumed racists
Mike Pence – his pick for vice president
Southern Strategy
Republican bubble
Birther
What if Christians were seen like Muslims?
The future of race in the US
on Thu Dec 10th 2015 at 06:45:10 Benjamin
Do you think that Trump will win the Republican nomination?
on Thu Dec 10th 2015 at 07:07:18 abagond
@ Benjamin
No. I do not see him consistently getting above 50% in the state primaries. Unless he can do that, the party establishment will be able unite behind one of their own.
on Thu Dec 10th 2015 at 08:54:23 darqbeauty
If he wins, the Republican nomination, I’m packing my bags. If he wins the presidency, I’m jumping on a plane with said bags. This miserable florid toupeed mangy blow harding cur makes me queasy.
on Thu Dec 10th 2015 at 09:19:45 Kartoffel
I don’t think the numbers add up for him. He consistently ranks low in second-choice polls, which make sense. He is such a polarizing figure, that whoever would consider voting for him is already on his side. There is nobody left for him to win over.
My money is on Ted Cruz.
on Thu Dec 10th 2015 at 09:35:59 lkeke35
I agree. Everyone who is going to vote for him is already there. He’s not winning over new voters with this rhetoric.
As far as I’m concerned he’s a perfect example of the Republican Party. He’s the grand culmination of all the racist rhetoric they’ve been dog-whistling for the past thirty years. He just has no filter on what he says and is in it for the ratings.
on Thu Dec 10th 2015 at 12:32:09 leigh204
Hate this turd with a passion.
on Thu Dec 10th 2015 at 13:59:38 Open Minded Observer
Trump is a narcissist. He wants to be president to feed his ego. He doesn’t care about the United State, you, me, or anyone else in the world… not even a little bit. He says he’s not racist. You know what? I believe him. A racist would see something inherently different in various humans based on their race. I believe he sees all of humanity as equally irrelevant “things” that at best are “necessary evils” with something to offer him and at worst are impediments to his success.
I believe he is playing the character of a polarizing candidate because that’s where the vacuum was. Nobody else was appealing strongly to the racist and nationalist views of what is now his “base”. These are people that are afraid, ignorant, tired and desperately in need of someone to blame. I feel he has deliberately chosen and is carefully crafting his character because he believes that, at our core, humans are irrational enough to believe his rhetoric and elect him. Why wouldn’t he think that. How many stories have been done on “the media” and how people blindly believe and react to what they’re told. (There’s irony there somewhere.)
I truly hope that he is not elected. I have mixed feelings about fleeing the country if he is. On the one hand, I wouldn’t want to be associated with a country that would elect him. On the other hand, if we all flee, there’d be nobody left to provide checks & balances. He could toss out the constitution and declare himself “king of the world” (or whatever).
The only silver lining I can see coming from his candidacy is that closet racists will self-identify with “Trump 2016” bumper stickers and yard signage. If he loses, maybe we can round them all up and send them to… I’m kidding… that would be too ironic… even for me.
on Thu Dec 10th 2015 at 14:12:30 lifelearner
Nice mirror it is showing to the Republican party. One bad apple spoils the bunch. You are as strong as your weakest link…and on and on…with the clichés!
on Thu Dec 10th 2015 at 14:25:11 Blanc2
Nixon’s “Southern Strategy” reaching fruition
on Thu Dec 10th 2015 at 14:26:44 squawk
Honestly, Trump is and has always been a narcicisstic bastard who only gives a damn about himself,period. All the fame he’s had all these years has gone to his head, and he’s actually delusional enough to think he can get anywhere near the White house talking all the BS he’s talking. He’s always been a loudmouth racist blowhard that’s full of s***. Most of the garbage that comes out of his mouth is just plain disgusting—especially when he claimed that brother should have gotten beat up just for opposing him at a rally. What the hell kind of candidate endorses that BS? I can’t wait for people to get sick of him so he can drop the hell on out of the race—he’s isn’t anywhere near qualified to be President of anything, besides his own company. The fact that there are some people who are taking him at all seriously is just plain darn sad and pathetic, and so is Trump himself.
on Thu Dec 10th 2015 at 14:30:05 TeddyBearDaddy
Let’s say Trump wouldn’t let any of his “average” supporters walk on the front carpet of the entrance to one of his many residencies if you catch my drift.
on Thu Dec 10th 2015 at 14:48:30 resw77
“He will overturn the Fourteenth Amendment’s constitutional right to birthright citizenship”
Did he say that? If so, it shows a lack of understanding about presidential powers since the US President cannot overturn any part of the Constitution.
@squawk
“he’s actually delusional enough to think he can get anywhere near the White house talking all the BS he’s talking”
But it is getting him closer to the Republican nomination. I wouldn’t rule him out yet. All it takes is a more crises involving immigrants like the San Bernadino shooting for him to say “I told you so” (just like the phony terrorist attack in Paris propelled the Front National to the top of the polls).
Fear mongering does work…
@ resw77
When I say, “He will do x”, I do not mean he will rule by personal edict. It is just a way of stating his intentions, the policies he favours. In practice, not all of them are workable. He shoots from the hip and does not carefully think through what he says.
on Thu Dec 10th 2015 at 15:27:15 Uglyblackjohn
I know he’s getting a bit too full of himself when even O’Reilly has to advise him to reign it in.
But in all honesty, I like that he’s running and even the way he is running.
Not that I agree with him only that it makes it easier to see who and what we are fighting against.
on Thu Dec 10th 2015 at 16:01:11 dorisjean23
I believe Trump was planted by the Dems to screw up the Republicans.
@ raimanet
Comment deleted for using untranslated French.
Good point: he could win if there is a bad terrorist attack on US soil by ISIS or al-Qaeda.
In a best case scenario Trump does not get the Repub nomination and then decides to go Ross Perot and splits the Repub vote in the next election. Keep in mind that behind Trump we have the likes of Marco Rubio, Jeb Bush, Carly, and even Ted Cruz. Cognitive dissonance of the day: I heard a radio interview with Ted Cruz in which Ted used Trump to make himself (Cruz) sound moderate.
on Thu Dec 10th 2015 at 17:33:51 King
…also called The Donald Seriously?
on Thu Dec 10th 2015 at 18:16:15 somaliprince
Le français est bel et bien en vie. Peut être moins au Canada qu’autre part, mais en Afrique et en Europe, le français est toujours aussi important.
(French is still alive. Maybe less so in Canada, but in Africa and Europe, it is still as important.)
OFF TOPIC: French.
This is not French Club. I already have a post on French.
https://abagond.wordpress.com/2007/07/17/french/
on Fri Dec 11th 2015 at 00:26:32 blakksage
Donald Trump is simply more proof that Amerika still have an affinity for loud mouthed, vile, un-refined, actively ignorant, totalitarian leaning men like Trump. My personal proposal for him is to read Plato’s “Allegory of the Cave.” Perhaps this reading will assist him with the necessary and proper exposure to the benefits of change, where thinking or cognition is limited and idiocy is the direct result thereof.
on Fri Dec 11th 2015 at 00:50:25 somaliprince
Trump has taken a leaf out of Hitler’s book.
Rule 1: find a minority to scapegoat and use that to rally support
Rule 2: Always attack. Attack, attack and attack. Never back down, never show a weakness. Never apologise.
A lot people think apologising is the right way to go. But in politics, according to Machiavelli, it is a sign of weakness.
Trump never backs down from any of his claims and instead just moves on to make another outrageous claim.
People have short memories and eventually forget his previous claims.
He, on the other hand, keeps grabbing the headlines in order to stay on top of the polls.
As soon as his poll numbers start dipping, he makes another outrageous claim,
He is a demagogue, par excellence.
Demogagues are one of the major flaws of democratic systems.
Regardless, I don’t think he’ll win. Simply because America’s economy is not as bad as Nazi Germany’s was.
According to betfair, Hillary Clinton has odds of 1.84 to become the next president. Marco Rubio is at 5.5 and Donald Trump is at 10.5. (decimal odds).
In other words, Hillary Clinton has a 54.35% change of winning. Marco Rubio has a 18.18% chance.
Donald Trump has a 9.52%.chance of winning.
Unless something drastic happens between now and election day, Hillary Clinton will be America’s next president.
And Trump will probably just go back to making reality TV shows.
on Fri Dec 11th 2015 at 01:46:27 Linda
I hope Trump wins
this will severely crack the Republican party
and I will enjoy watching Trump get waxed by Hilary Clinton because the Latino community is waiting for him
and sorry folks, as much as most people dislike Hilary, Bernie Sanders cannot beat a Republican candidate such as Chris “Krispy Cream” Christie.
Bernie doesn’t have enough “it” power to persuade Independent voters
on Fri Dec 11th 2015 at 02:04:38 King
We need to come up with another candidate.
Abagond, Trump is not the only loud mouth a’hole with the potential to damage the USA.
have you heard what Supreme Court Judge Scalia said about black students:
“The Supreme Court was hearing arguments in Fisher v. the University of Texas at Austin.
Abigail Fisher, a white woman, sued the university after she was denied admissions, suggesting that the school’s consideration of race during the admissions process violates the 14th Amendment.
Scalia:
“There are those who contend that it does not benefit African-Americans to get them into the University of Texas where they do not do well, as opposed to having them go to a less-advanced school, a less — a slower-track school where they do well,” Scalia said, according to the court transcript. “One of the briefs pointed out that most of the black scientists in this country don’t come from schools like the University of Texas.”
The brief Scalia referred to said, “Students with an interest in science who are admitted to a very competitive school via a large preference tend to drop out of the sciences at a much higher rate than do otherwise similar students who attend somewhat less competitive programs.”
Now, this b’ch Abigail Fisher, go upset because she got rejected by UT and because 47 other students with lower grades than her got in.
here is the breakdown of those 47 other students:
42 white people
4 Hispanic people
1 black person
but: 168 black and Hispanic students with higher grades than Abby were not admitted
So, 42 white kids with grades lower than hers gets into Univ. of Texas but somehow, this pasty chick manages to blame
1 black and 4 Hispanic kids for her being Rejected by a top-tier University because she couldn’t cut it academically.
Abagond, this sh’t has got to stop – white Americans are officially Off the rails with their blame game!
I think it’s time black people in America took off the gloves and started hitting back hard
White America needs to be reminded why their APARTHEID laws were made illegal in the first place.
According to the latest market data, Marco Rubio has a 40% chance of being the next Republican nominee.
Trump is second, slightly edging out Ted Cruz, with 20%.
This is interesting because the polls show Donald Trump as being the clear front runner.
The Huffington Post poll for instance, last conducted on the 10th of December, shows Donald Trump as having 35.8% support among Republican voters. Marco Rubio is on 12.3%.
In other words, the markets believe that Marco Rubio will win whilst Opinion Polls place Donald Trump first.
I presume this is because people expect that ‘Trump Mania’ will eventually die down before the Iowa caucus in February and that Marco Rubio will return to the lead.
Trump basically has to make sure he keeps grabbing the headlines until February if he is to have any chance of dislodging Marco Rubio.
On the other hand, Marco Rubio, I suspect, is patiently waiting it out and will come out strong sometime next month.
Until then, we can expect to hear a lot more from Trump.
I think it’s time that affirmative action was made about income and economic inequality.
Affirmative action is precisely about that.
Parents who have gone to university tend to raise children who will themselves go to university.
A university education is one of the strongest indicators of lifetime income.
Getting a historically disadvantaged group, like African Americans, into universities raises the probability that they will themselves have children who will go to university.
This directly reduces economic inequality.
A lot of white kids end up at university simply because they had a rich parents and a private school education that a lot of African American parents can not afford.
Affirmative action is meant to correct an imbalance, not create one.
on Fri Dec 11th 2015 at 16:37:08 Mary Burrell
He is crying really? He is not sorry for what he did, he’s sorry he got caught.
^ Mary I think you might have meant to post this to the Holtzclaw thread?
on Fri Dec 11th 2015 at 22:52:43 Jacque
If Trump is nominated I will be tickled pink. I will watch Democratic s**t all over his orange face during the debates. he will be eating crow and everything else.
If he is elected , I plan to stay in the country MY ancestors built with their souls, lives and backs. …..AND I WILL OPPOSE THAT CREEP AT EVERY TURN.
Democracy…yeah.
on Sun Dec 13th 2015 at 05:53:45 Mira
Trump is seen as an embarrassing joke by many, which is one of his greatest strengths. People keep laughing at him and giving him exposure. I admit I am guilty of it myself sometimes. But it’s dangerous because it gives him exposure and treats him as a joke while he keeps earning points and spreading his venom left and right.
on Mon Dec 14th 2015 at 23:04:29 abagond
On Trump’s idea of registering all Muslims:
Something very much like this has already been tried. From 2002 to 2011 the US government required people coming from 24 Muslim-majority countries to register their whereabouts with the government.
It did not uncover a single terrorist.
on Mon Dec 14th 2015 at 23:39:35 Mary Burrell
In reference to Affirmative Action and Abigail Fischer I love what the black students at University of Texas in Austin did when they created the hashtag #StayMadAbby. I screamed like a banshee it was too funny.
Trump is thriving off the fear that’s been in the climate and he is using this to his advantage.
on Wed Dec 16th 2015 at 07:17:49 abagond
“ABC World News Tonight” has spent 81 minutes so far this year covering Trump and only 1 minute covering Sanders – even though their poll numbers, and crowd sizes are roughly the same.
http://mediamatters.org/blog/2015/12/11/abc-world-news-tonight-has-devoted-less-than-on/207428
on Wed Dec 16th 2015 at 10:19:39 jefe
So, somehow ABC finds Sanders that boring?
Still, he should have figured somewhere into the Black Lives Matter issue, at least as much as Trump did.
At least Abagond has one on each.
on Wed Jan 6th 2016 at 12:49:35 JDLC
Hate attacks against Muslims in the US have tripled recently.
(https://www.youtube.com/watch?v=6nBViG6b4xg&spfreload=10)
on Thu Jan 7th 2016 at 11:03:10 Kartoffel
I think Trumpism has to be seen in the context of similar developments in some parts of Europe. Of course there are national differences, but overall the conservative establishment in the West seems to be in crisis.
on Thu Feb 18th 2016 at 14:33:16 Herneith
http://www.theguardian.com/us-news/2016/feb/17/central-park-five-donald-trump-jogger-rape-case-new-york?utm_source=esp&utm_medium=Email&utm_campaign=GU+Today+main+NEW+H&utm_term=157322&subid=17864057&CMP=EMCNEWEML6619I2
on Thu Feb 25th 2016 at 20:38:52 abagond
A country that can kill Dr Martin Luther King, Jr is a country that can elect Donald Trump president.
on Fri Feb 26th 2016 at 00:23:32 Jabari Jones
They keep saying he won the Latino vote in Nevada, but statistically, he only got about 7% of it. Funny huh?
on Sun Feb 28th 2016 at 07:30:27 Why YOU Shouldn’t Vote For #Hillary2016. No Matter YOUR Skin Color. – The Militant Negro™
[…] Donald Trump […]
on Sun Feb 28th 2016 at 23:18:11 J. Jones
http://www.huffingtonpost.com/entry/donald-trump-david-duke_us_56d31097e4b0871f60ebbd35?m4bcsor
on Wed Mar 2nd 2016 at 03:50:02 King
Say Whaaaaaat?
Farrakhan liking Donald Trump???
http://www.usnews.com/news/articles/2016-03-01/louis-farrakhan-on-donald-trump-i-like-what-im-looking-at
on Wed Mar 2nd 2016 at 04:33:23 Mary Burrell
@King: I am convinced more than ever that Farrakhan may have dementia.
I’m … well, I’m shocked! It’s like a bad joke that somebody made up.
on Wed Mar 2nd 2016 at 11:07:50 JDLC
Don Trump Jr. said he would happily pay for some of his father’s black critics to leave the United States.
The Republican presidential candidate’s son appeared Monday morning with his brother, Eric Trump, on “Fox and Friends” to discuss the “Super Tuesday” primary elections and the concerted attacks on their father by his GOP rivals.
“You know, it’s sad to see,” Eric Trump said of the attacks. “We love our father. He’s an amazing guy — he would do such an unbelievable job for this country. He’s an amazing businessman, he’s an amazing negotiator. He’s funding himself, right?”
(https://www.youtube.com/watch?v=7KWgnzq2-Q8)
on Thu Mar 3rd 2016 at 17:01:28 taotesan
Trevor Noah on Donald Trump.
This might be a tad old.
on Sat Mar 5th 2016 at 02:25:00 Mary Burrell
I have noticed that it’s mostly poor uneducated white people who support him. Lots of them are white supremacist like David Duke who Trump said he knew nothing about and everyone knows Trump lies when he says he knows nothing about David Duke. I was watching the news and Trump was talking about the size of his hands and his sex organ, that’s so disgusting. He is just deplorable. And his toupee is ridiculos and he’s orange. Why does he always look jaundiced?
on Sat Mar 5th 2016 at 03:41:13 jabari jones
Trump is also on record saying he’ll take those votes(ie the votes of white supremacists)
on Sat Mar 5th 2016 at 10:59:43 taotesan
It is the stupid fools such as myself when thinking about the USA, that at least in this day and age, that some of most important imperatives in the world today would be addressed and righted: restoration of ALL rights and amends to the Original People of America and reparations for African Americans.
But, no. America could possibly have this monstrosity as President. Very,very frightening – for the people of America and for the rest of the world.
I can’t bear to look at his hideous face, that face reflecting the ugliness of the racial attitudes of white America. Not that much different from his female opposition, though. Devil in drag with a better hairdo and filter.
on Sat Mar 5th 2016 at 16:30:17 michaeljonbarker
This Salon article takes a look at the economics behind race in America and the rise of Trump.
http://www.salon.com/2016/03/05/some_of_trumps_strongest_supporters_are_registered_democrats_heres_why/
My sense is that Trump is going to get the Republican nomination. He has openly embraced the bigotry that lay mostly hidden within the white pooulation. Even the “Christian right” have chosen Trump over Cruz who is one of their own. It’s like the Christian right has become the Christian white.
The Republican establishment would normally not have a problem with this but I think they are worried about Trump’s economic populism which is aimed at going after the “free traiders” and Wall Street. While Bernie wants to tax them more Trump wants to renegotiate free trade agreements which will cause some economic calamity within the stock market.
I think at this point the Republican establishment would rather have Hillary as president over Trump because it’s about preserving the economic power base that both the Democrats and Republicans rely on.
on Sat Mar 12th 2016 at 23:52:22 Mary Burrell
Well Trump’s stop and go in Chicago let those miscreants know what time it was. Those folks wasn’t having none of b.s. I personally couldn’t put myself in harms way trying to protest that vermin Trump but to each his own. Trump is a cancer that needs to be eradicated he is poison and will drag this country to hell.
on Sun Mar 13th 2016 at 01:58:39 Mary Burrell
The supporters of this vermin called Donald Trump is an indication that a good part of this nation is insane.
Donald trump got run out of Chicago so glad those black folks stood up to those vermin and miscreants.
on Sun Mar 13th 2016 at 13:55:04 v8driver
jeb was the only ‘name brand’ between trump and the primary, rubio? cruz? yeah right.
http://www.madmagazine.com/blog/2016/03/04/mad-exclusive-trump-universitys-diploma-revealed
http://www.madmagazine.com/blog/2016/03/03/tale-of-the-tape-donald-trump-vs-mitt-romney
http://www.madmagazine.com/blog/2016/02/29/hats-off-to-trump-for-denouncing-the-kkk
http://www.madmagazine.com/blog/2016/01/27/9-things-donald-trump-will-be-doing-during-tomorrows-debate
on Thu Mar 17th 2016 at 03:26:12 Origin
I wrote a post here long ago, I don’t remember which thread, talking about the cyclic nature of the manifestations of American racism and how apparent gains by marginalized groups are usually followed by the intensification of overt racism. For example, political and economic gains by blacks during Reconstruction, was followed by a resurgence of the KKK.
With that in mind, I am not at all surprised by the visibility of Trump in this election cycle. We saw the narrative becoming more overtly racist during Obama’s presidency. Trump is just the Tea Party with all pretense dropped. He is explicitly saying things that others thought but would only utter in coded language, if at all. He has eschewed “political correctness” and became a hero for many who bristled at the notion that certain statements had become taboo.
Despite how extreme he seems, he has merely exposed the racist pandering of the Republican Party by stripping it of all dainty clothing and, by doing so, he threatens to win the nomination. The delegates prefer bare flesh over the excessively clad strumpet though some hypocrites protest her public immodesty even as they disrobe her in private.
President Trump would certainly be wake-up-call for those who might have read more into Obama’s Presidency than they should have.
on Thu Mar 17th 2016 at 05:45:53 Afrofem
@Origin
“…he has merely exposed the racist pandering of the Republican Party by stripping it of all dainty clothing…The delegates [and the Republican base] prefer bare flesh over the excessively clad strumpet though some hypocrites protest her public immodesty even as they disrobe her in private.”
I’m sure that explains the orgiastic displays at Trump rallies. The breaking of taboo. The adreneline jolt of naked White Supremacy. The intoxicating belief that they shall reign supreme über alles.
Yet, the base is too deep in their drugged stupor to notice that the people who point and yell, negro, negro or immigrant, immigrant are the same people who shipped their jobs overseas, destroyed local small town economies and saddled their children with crushing student loan debt.
Wealthy Whites have been looting their poor relations (and everyone else) for decades and laughing all the way to the bank. That won’t change no matter what the rightwing base does to the hated “others”.
on Thu Mar 17th 2016 at 15:13:13 Herneith
I half-jokingly say he is a Democratic plant infiltrating the Republican party in order to destroy it. A Trojan Horse if you will.
on Thu Mar 17th 2016 at 16:25:02 resw
Those were eloquent words, and certainly Trump has racist supporters just like everyone else, but I fail to see how he’s any more racist than any other candidate in the race.
The media and the Democrat establishment are up to their same old tricks of trying to label him as racist to scare away black and Latino voters. It has worked well since his support among these groups has dropped since last year.
But I believe the real reason Trump remains popular is because he is anti-establishment and unlike all the other career politicians who are running, not because he’s racist.
And when he exposes Hillary for the phony progressive she is currently pretending to be and reminds voters how she and Slick Willy actually implemented a lot of racist policies that are responsible for the high incarceration rate of blacks today, I am confident people will see that the Clintons are the real racists and Trump has been unfairly demonized by the media.
What about the actual infiltration of Democrats at Trump rallies?
Moveon.org/George Soros and Media Matters for America are huge supporters of Democrats and have paid people to disrupt Trump events. The result is the media frames it to appear that Trump people are violently attacking minorities for no reason. How much do they report the attempted attacks on Trump and others by these disruptors at these rallies?
Even though Hilary is no angel he makes her look good in comparison.
@resw
It’s easy to attack others’ record esp. when you’re relatively immune. Trump has a rather limited political record for others to criticize while Clinton has been in politics for a while so he clearly has an advantage in that department. Being anti-establishment is of little merit in itself unless what you’re promising to establish is both practical and best for the country.
I consider Trump to be a demagogue. I dont’ consider him to be the only racist; I even metaphorically suggested that the others are too. However, their appeals to the racism of the base isn’t as naked as Trump’s. This “birther” can’t really be sanitized IMO. He’s such a loose canon that he mouthed off against Latin Americans while having a pageant that is popular in those countries. He might seem “cool” for his lack of a filter, but I doubt he’d make a good president.
Trump may not have a record in politics, but the media has taken him to task for just about every questionable remark he’s ever made.
If anyone is immune, it’s Hillary Clinton. The media refuses to pick apart her questionable comments of the past or check on her blatant lies.
“Being anti-establishment is of little merit in itself unless what you’re promising to establish is both practical and best for the country”
Sure it is when the establishment has done nothing but 1) rack up deficit, 2) add to the national debt, 3) enter unfair trade agreements and 4) have not controlled illegal immigration and the drug trafficking. What Trump is promising is to address those things, and his supporters believe that would be both “practical and best for the country.”
“He’s such a loose canon that he mouthed off against Latin Americans ”
That kind of statement lets me know how just powerful the media is. I’ve never heard him say anything disparaging about Latin Americans, but I have heard the media and liberals tell me that Trump is racist against Mexicans and Latinos. I’m still waiting to see the quote.
“He might seem “cool” for his lack of a filter, but I doubt he’d make a good president”
So Americans should keep electing the same career politicians who have reduced America’s middle class, given them all a huge debt burden that can never be repaid, shipped jobs overseas, made it hard to do business, avoided investment in infrastructure and continuously entered costly wars that have destabilized the world.
on Fri Mar 18th 2016 at 16:51:34 Afrofem
Earlier this week, Chauncy DeVega posted a detailed account of the scene of Donald Trump’s rally in Chicago. What stood out to me is his description of Trump’s African American supporters and their possible motivations:
“In every crowd of Republicans there is almost always a black person who is auditioning for a role as “best black friend” and human chaff for the GOP. These professional contrarians are desperate for their five minutes of fame on Fox News; they yearn to be a 21st century version of Stephen in the movie “Django Unchained,” for it is very lucrative work if one can get it.
I saw several black conservatives at Trump’s event. One sat near me and cheered wildly at any mention of Il Duce Trump’s name. He seemed very pleased when the Black Lives Matter and other protesters were escorted out by the police.
There was a young professional black conservative in training who led one of the most spirited moments of near fisticuffs inside the UIC Pavilion. He was the black chieftain for a group of white college-age Trumpeteers who tried to pick a fight with a group of anti-Trump protesters.
The third black conservative was the most enthusiastic and dangerous one. He was outside of the UIC Pavilion. A former Marine, he chased away two high-school-age Black Lives Matter protesters and threatened to teach them a lesson via the thrashing he promised they would receive for being “disrespectful.”
I asked him about what had just transpired. I was also curious as to why he supported Donald Trump.
This well-trained black conservative responded with disinformation talking points from Fox News about a military that is weaker than it was before World War II, how Democrat-controlled cities are horrible and full of death, that Black Lives Matter does not care about “black on black crime,” young people are out of control, and no one respects the police anymore”.
http://www.chaunceydevega.com/2016/03/my-detailed-first-person-account-of.html
“…no one respects the police anymore.” That was a real kicker in the same city (Chicago) where the police and their allies in city government have sanctioned and covered up numerous cases of police torture and murder.
It seem those Black “conservatives” are little more that White Supremacists with a deep genetic suntan.
on Fri Mar 18th 2016 at 18:47:28 Origin
Trump has the ability to APPEAR antiestablishment because he is not been as involved in politics (except possibly as a lobbyist/briber) compared to Clinton, who was even First Lady. However Trump is quite a wealthy man, (and Clinton is a wealthy woman). I doubt he’s going to push policies that limit Wall Steet or his own wealth. The idea that he has a a lot in common with ordinary Americans compared to other candidates tickles me. He’s just a skilled demagogue. Businesses associated with him have also been accused of hiring undoccumented immigrants for cheap labor while he adopts the stance of being tough on immigration on the campaign trail. He has shown an inability to be diplomatic by alienating people who support one of his products (the pageant). I don’t think he has the proper temperament to be President.
I don’t like Trump (as a potential president…though his willingness to curse/fire back can be entertaining). I think he presents as divisive and irascible. I’ll own that opinion even if it happens to coincide with that of the so-called mainstream or establishment. I really don’t care about the latter point. I don’t watch much TV or consume much mainstream media.
on Sat Mar 19th 2016 at 03:00:59 Paige
Fox News has released a statement condemning Trump for his “crude and sexist verbal assaults” against Megyn Kelly. What an election season this is turning out to be!
on Sat Mar 19th 2016 at 14:01:29 resw
@Afrofem
White disrupters get ejected from Trump rallies too. The media is so good because most anti-Trump folks I talk to only know about the black Black Lives Matter people and a couple of Muslims (who also were disrupting). Well many white Bernie Sanders infiltraters have been thrown out. Probably more than black BLM protesters.
“Trump has the ability to APPEAR antiestablishment because he is not been as involved in politics…However Trump is quite a wealthy man”
That is completely irrelevant. He is not running on his political experience like every other candidate, he is clearly running on his business acumen and telling supporters that career politicians are bad for America. That is the epitome of anti-establishment.
“The idea that he has a a lot in common with ordinary Americans compared to other candidates tickles me”
Please tell me when Trump said he has a lot in common with “ordinary Americans,” whatever that’s supposed to mean. Maybe he did, but my guess is he never said that.
And what poll shows his supporters think he has a lot in common with ordinary Americans?
Most of his supporters are probably well aware that he’s a billionaire and his father was a millionaire.
“He has shown an inability to be diplomatic by alienating people who support one of his products”
Not sure what you mean exactly, but before he decided to run, let’s not forget politicians on both sides of the aisle liked Trump.
But if you think Trump’s bad, Hillary Clinton called Republicans her enemies. How’s that for diplomacy?
on Sat Mar 19th 2016 at 16:37:40 Fan ...
“What an election season this is turning out to be!”
I doubt this (s)election season will entertain as much as the SCOTUS did when they met (12 years ago?) over the inconclusive popular vote count regarding:
hanging chads, dimpled chads, pregnant chads, unemployed chads, unregistered chads, pickled chads, shot chads, welfare chads, poked chads, tired chads, salty chads and chads with college degrees! Not to mention all those quirky voting booth machines with irregular counts.
Talk about stealing an election (for W Bush) in plain view.
Big Brother’s productions are nothing if not entertaining.
Gonna go watch some MARCH college tournament basketball madness, now… like a good little cog.
(and enjoy some pot popped popped-corn!)
on Sat Mar 19th 2016 at 21:53:00 Afrofem
I’m sure anyone who dissents from Trump and his base are subject to removal from his rallies. That in itself is extremely disturbing.
When America was a democratic society, simple dissent was expected. Politicians knew they had to face public criticism and dealt with it—-not any more. Now the political class believe they are above criticism and the law. All politicians tend to surround themselves with yes people and expect rigid obedience from the general public.
My primary focus in this comment:
https://abagond.wordpress.com/2015/12/10/donald-trump/#comment-311671
was the types of African Americans who support Trump, based on DeVega’s observations at the Chicago Trump rally.
http://www.alternet.org/election-2016/open-letter-trump-voters-his-top-strategist-turned-defector?akid=14118.1929437.2arXyw&rd=1&src=newsletter1053515&t=8
on Fri Apr 1st 2016 at 15:21:37 Herneith
http://www.madmagazine.com/blog/2016/03/30/the-startling-similarities-and-differences-between-donald-trump-and-burger-kings
on Tue Apr 5th 2016 at 12:51:12 Herneith
on Tue Apr 5th 2016 at 19:25:45 resw
“I’m sure anyone who dissents from Trump and his base are subject to removal from his rallies. That in itself is extremely disturbing”
Same thing happens at Clinton rallies:
http://dfw.cbslocal.com/2015/11/17/man-holding-protest-sign-removed-from-clinton-event-in-dallas/
http://thehill.com/blogs/blog-briefing-room/258704-black-lives-matter-protesters-interrupt-hillary-rally
Are you equally disturbed?
“My primary focus in this comment…was the types of African Americans who support Trump, based on DeVega’s observations at the Chicago Trump rally”
Well that’s one opinion based on a stereotype. There are other blacks who vote for Trump for different reasons:
(https://www.youtube.com/watch?v=PPC4DDW_LSw)
on Tue Apr 5th 2016 at 21:56:51 Afrofem
Clinton and Trump are equally disturbing and disturbed.
DeVega’s depiction of Black Trump supporters was based on his witnessing the words and actions of people he describes as:
“…black conservatives… the human mascots and pets for a racist political organization called the Republican Party… professional “best black friends” and human racism deflecting chaff.”
http://www.chaunceydevega.com/2016/04/fun-with-right-wing-hate-emails.html#disqus_thread
Medgar Evers rightwing brother certainly fits the description. The video showed a person who seemed coerced. The closed body language, a hat obscuring his face and the mindless recitation of rightwing talking points was not a very convincing performance.
As DeVega said in the article: “Priceless. Comedy. Gold.”
I forgot to add: LOL!!!
“DeVega’s depiction of Black Trump supporters…”
We all have opinions.
I’m sure the same can be said about black Clinton supporters and black Democrats in general.
“Medgar Evers rightwing brother certainly fits the description. ”
Right, he’s so right wing he supported Obama.
Here’s what he once said about his party affiliation:
“I’m a Republican, because we don’t all need to be in the Democratic party. Thirty years ago, there was not a black person in the Democratic party. The Republicans ignore us, and the Democrats take us for granted…Most blacks are conservative whether you know it or not. We believe in prayer in school and we’re against abortion. We should be in both parties and make them what we want them to be. We can’t get anywhere pointing fingers, we have to get inside the organization and make it what we want it to be.”
LOL@ “The video showed a person who seemed coerced”
Should I assume you are a psychiatrist and it’s proper to diagnose people online?
“the mindless recitation of rightwing talking points”
You do realise that the “rightwing talking points” are decidedly anti-Trump.
“we have to get inside the organization and make it what we want it to be.”
Something I would expect a professional “best black friend” to say.
Limited thinking = Limited results
Neither Dems nor Repubs are worth the effort. Black people need their own party with an independent agenda and no allegiance to any outside group.
Trump is a rightwing zombie. The Repubs keep shooting him down and he keeps popping back up, bloody mouth and all. It would be high comedy if his supporters were not so dangerous.
on Wed Apr 6th 2016 at 12:53:00 resw
So I guess 90% of black voters who vote Democrat are “professional best black friends” too. Otherwise they wouldn’t be members of the Democrat party which is and has always been dominated by whites (and has historically been pro racist policies).
“Black people need their own party with an independent agenda and no allegiance to any outside group.”
We finally agree on something. However, unlike you, I don’t think black Republicans (or black Trump supporters) are any worse than black Democrats (or black Clinton/Sanders supporters).
“Trump is a rightwing zombie. The Repubs keep shooting him down and he keeps popping back up, bloody mouth and all. ”
If he were so “rightwing” the “Repubs” wouldn’t need to “keep shooting him down.”
My prediction back in December was spot on.
“It would be high comedy if his supporters were not so dangerous.”
They are no more dangerous than violent anti-Trump protesters.
on Sun May 1st 2016 at 16:23:16 Herneith
http://townhall.com/columnists/stevechapman/2016/05/01/trumps-feast-of-incoherence-n2155520
Even conservatives don’t like him! Not that means anything!
on Sun May 1st 2016 at 17:19:14 michaeljonbarker
Trump’s foreign policy is a bundle of contradictions.
He is against the neocon/neolibetal idea of nation building. So it is more like a scorched earth policy where we secure oil resources and the rest of the affected area be dammed.
Neocon’s both on the left (Hillary) and right belive in pre-emptive strikes which is why we are stuck in low intensity conflicts and perpetual war. It keeps the oil and other resources flowing while justifying spending trillions in the military budget.
His idea that we need to build a “stronger defense”
and that Obama has done nothing to strengthen the military aren’t factual. Apparently the Philippines has agreed to allow the U.S. to set up five new military bases their. Obama has expanded military bases in both Africa and Asia so he has been shoring up American Imperialism.
I also think Trump will do well in the general election. Hillaries disapproval ratings are higher the 50% and Americans themselves are for more bigoted then the polls show. Trump is also bringing out a whole new group of voters, some Republican, some Democrat and 100,000’s of new voters that have never voted before.
In Costa Mesa he filled a 7000 seat auditorium and their were 2000 people outside that couldn’t get in. This is in liberal California. He has found a market and knows how to sell it.
I also think this is the year the Green Party will become somewhat relevant. That is where the Bernie supporters are going to end up. The young people in this country have rejected the historical attachments their parents have always clung on too. This year they will our preform the Libertarians.
*out perform
on Sun May 1st 2016 at 20:00:15 Afrofem
@michaeljonbarker
“This is in liberal California”
To me, California is not liberal. It is rumored to be “liberal” by foaming at the mouth White Supremacists in the South and Midwest, but California does not make the “liberal” cut.
First and foremost is California’s expansion and maintenance of a massive prison system. Ruth Wilson Gilmore, in her book, Golden Gulag describes the origins and maintenance of this destructive system.
http://www.goodreads.com/book/show/111975.Golden_Gulag
According to the Prison Policy Initiative, only Louisiana and Alabama imprison more of their population (per hundred thousand residents) than California.
http://static.prisonpolicy.org/images/50_state_rates_and_select_states.jpg?
v=1
State prisons and local jails are a big part of the expansion:
http://static.prisonpolicy.org/images/state_driver_rates_1925-2012.jpg?v=1
Another clue is the concentration of White hate groups in California. According to the Southern Poverty Law Center’s Hate Map, California has a large number of hate groups for a western state:
https://www.splcenter.org/hate-map
Surprise, surprise! Most of the hate groups are clustered in the same areas of California that have large communities of non-European descent people: the Bay Area, the Central Valley and the Los Angeles to San Diego Corridor.
California is a state where the Whitopia Fortress mentality is particularly strong. Large numbers of White residents in California have developed a modern version of the “sundown town” —with or without gates—to escape areas that have burgeoning populations of:
❍ Latinos of any ethnicity
❍ Asian Americans (including West Asians from Afghanistan, South Asians from India and Pakistan and South East Asians from Vietnam, Cambodia, Laos and Thailand)
❍ Any Black people including groups such as the Garifuna.
http://www.npr.org/2015/11/20/455909004/what-is-a-whitopia-and-what-might-it-mean-to-live-there/
Whitopia author, Richard Benjamin recounts that at one of the Whitopias he lived in, he attended a White Supremacist retreat which prompted this reaction from another attendee:
“…Abe, an Aryan, sidled up next to me,”… ‘He said, ‘Hey, Rich, I just want you to know one thing. We are not white supremacists. We are white separatists. We don’t think we’re better than you, we just want to be away from you.’
The prison system, the hate groups and the Whitopia fortress towns are all linked together in a system of oppression, control, violence, privilege and profit-making at the expense of California’s non-White population.
Nothing “liberal” about that.
on Tue May 10th 2016 at 04:04:39 michaeljonbarker
I’ve decided that no politicale ideology guided Trump beyond his own narcissism. Whatever pops into his head is his political position for the day.
on Tue May 10th 2016 at 05:45:09 Fan ...
Props to Brother Benjamin for taking residence (via the phone!) in modern Sundown Towns (Whitetopias).
I’m glad he didn’t get the idea of bringing 6 – 12 other Black men with him to conduct his research. Especially while he was in Idaho.
(( I think Mr. Benjamin said: one Black man is a dinner guest. Fifty Black men are [perceived as] a ghetto.))
This is the Neo-liberal!
Maybe I should have put “liberal” in quotes when I wrote “liberal California”. Most of the country views California as liberal.
It is more statist then anything else. It does a great job driving business out of the State.
The California prison guard and police unions wield a lot political power and influence here.
Do you have a link for California sundown towns that function today? I was born in one (Glendale, ca) but eventually all the whites moved out.
on Tue May 10th 2016 at 14:42:35 Afrofem
I don’t have a link, but Simi Valley comes to mind.
@ Fan
“I’m glad he didn’t get the idea of bringing 6 – 12 other Black men with him to conduct his research.”
Or a Black wife and four teenaged sons. That would be enough to freak out a gaggle of White Supremacists in a Whitopia town.
on Fri Jun 3rd 2016 at 06:01:01 jefe
Is it possible that Trump’s attitudes towards China stem from a deal with 2 businessmen from HK during the British Colonial period?
The Hong Kong deal that turned Donald Trump into a China basher
(http://www.ejinsight.com/20160602-the-hong-kong-deal-that-turned-donald-trump-into-a-china-basher/)
on Thu Jun 16th 2016 at 15:19:32 Herneith
Folks, you can’t make this stuff up. It reads like something out of a comedy show:
Donald Trump on Wednesday said he’d invite North Korean leader Kim Jong Un to the U.S. for a meeting. He dismissed criticism over his willingness to negotiate with the North Korean dictator, who is known for lashing out against the West, threatening to use nuclear weapons, and repressing his own citizens. According to Trump, there is nothing wrong with having a conversation with the tyrant—though he shouldn’t be expecting dinner. “If he came here, I’d accept him. But I wouldn’t give him a state dinner like we do for China and all these other people that rip us off,” Trump said at a campaign event in Atlanta. He also took the opportunity to praise Russian President Vladimir Putin, saying the Russian military is “much stronger” than its U.S. counterpart. “Our nuclear is old and tired and his nuclear is tippy-top from what I hear. Better be careful, folks, OK? You better be careful,” he said.
http://www.thedailybeast.com/cheats/2016/06/16/trump-says-would-invite-kim-jong-un-to-u-s.html?via=newsletter&source=CSAMedition
Breathtaking in it’s stupidity.
on Thu Jun 16th 2016 at 15:53:17 gro jo
What’s so stupid about trying to end the war of aggression the USA launched against North Korea in the 1950’s? Where’s the wisdom in trying to start a war with Russia? This, to me, is the one proposal Trump makes that I approve of.
on Fri Jun 17th 2016 at 02:26:19 Herneith
Oh, I agree there’s nothing stupid about ending this longstanding war of aggression against North Korea or starting one with another country such as Russia or China. The comedy derives from the promulgator of these ideas. He’d try to sell you swamp land if he could. I don’t believe him or other politicians. Once they attain office, it’s a different story. They spout off what they think their potential constituents want to hear in order to get elected. Trump is particularly goofy though.
on Fri Jun 17th 2016 at 03:32:23 Afrofem
“He’d try to sell you swamp land if he could.”
LOL! Swamp land is exactly what he selling his angry, addled supporters. They don’t notice those hungry ‘gators gliding toward them….
(I think Obama is a much smoother and more effective swamp salesman.)
on Thu Jul 21st 2016 at 03:11:08 Michael Jon Barker
Trump is a Fascist. Their is no other way to describe it. He has tapped into this ugly Nativist undertow that’s xenophobic, racist and Islamophobic. Large swaths of the American public crave for an Authoritarian leader who will rule by executive order. This is a partial list but highlights actions that point to Fascism.
1. Trump wants to deport 11 million humans and create a special deportation force to knock down doors and check papers. He will bypass courts and Congress through executive order.
2. Trump want to force American businesses like Apple to make their products here. He wants to add special taxes and regulate companies like Amazon to break them up. He wants to punish entrepreneurship to “create jobs”.
3. Trump will crack down on the Free Press. He already banned the Washington Post by revoking their press credentials. He will use the FCC to fine his critic, Rich Lowry. He will open up libel laws to silence his critics.
4. Trump’s xenophobic descriptions of Mexican immigrants as rapists and murders collectives all Hispanics.
5. Trump has no idea what Black Lives Matters stands for nor is he interested.
6. Trump says the police are just “misunderstood” and has no empathy for the victims of police violence.
7. Trump says he opposes Hillary’s foreign policy yet he will expand it in the “war on terror” and use the military no differently then neo liberals or neo cons. Wants to send more troops to the Middle East. Somehow its O.K. if he does it.
8. Trump will bring back water boarding and torture as well as kill the family members of suspected terrorists.
9. Trump wants all Muslims to register in a national registry and will put all Mosques under surveillance.
10. Trump wants to restart warrentless searches and allow drones to spy on American citizens.
11. Trump encourages violence against protesters and has a personal business history of discriminating against Blacks.
on Fri Jul 22nd 2016 at 17:38:45 abagond
Politifact has Trump’s acceptance speech fact-checked and annotated:
http://www.politifact.com/truth-o-meter/article/2016/jul/21/donald-trumps-gop-acceptance-speech-annotated/
Some of his wilder-sounding statements are true, yet some of his more plausible-sounding ones are false or the truth is stretched and misleading.
In general, he seems to strip context, cherry pick and, worst of all, make dangerous trends out of one year’s or one city’s data. A good example of that is the Ferguson Effect, which he seems to believe in:
https://abagond.wordpress.com/2015/10/29/the-ferguson-effect/
Like many a racist troll on this blog, Trump twists and cherry picks facts to fit his racist paranoia.
on Tue Jul 26th 2016 at 19:27:38 michaeljonbarker
“We’re going to put an end to that,” Trump said during a post-convention interview with The New York Times. “We’re going to federalize every police department in this country. We’re going to eliminate the red tape and it’s going to give police the ability to do their jobs effectively and, believe me, this is something that’s going to happen within my first one hundred days in office.” -Donald Trump neo facist
on Tue Jul 26th 2016 at 19:37:11 abagond
Many of Donald Trump’s views have changed, but even in 1989 during the Central Park Jogger case he was very pro-cop and pro death penalty.
on Wed Jul 27th 2016 at 23:06:54 Afrofem
Read this article for another perspective on the Trump “Russian Connection”:
http://www.nakedcapitalism.com/2016/07/nsa-whistleblower-not-so-fast-on-claims-russia-behind-dnc-email-hack.html?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed:+NakedCapitalism+(naked+capitalism)
on Thu Jul 28th 2016 at 03:58:15 Afrofem
The situation in Russia and the Ukraine is extremely complex and murky. There are a lot of international players meddling in that region. Ukraine has a strategic geopolitical position and assets that certain wolves are eager to strip from the people.
The article about ties between Putin and the European Far Right shows that there are many ways to destabilize enemies. Thanks for the link.
on Sat Jul 30th 2016 at 13:45:50 Herneith
Another Trump gem:
http://www.burrardstreetjournal.com/trump-canada-independence-was-mistake/
http://www.burrardstreetjournal.com/donald-trump-claims-he-will-buy-canada/
http://www.burrardstreetjournal.com/donald-trump-on-us-womens-national-team-its-great-revenge-for-pearl-harbour/
on Sun Aug 7th 2016 at 16:03:20 jefe
Trump has just announced that he now wants to ban Filipinos from entering the USA.
(https://www.facebook.com/regieparulan/videos/10154320036206501/)
on Thu Aug 18th 2016 at 03:09:09 Afrofem
Just read this Guardian article about Trump supporters. It talks about how his supporters want respect and feels Trump understands their pain.
https://www.theguardian.com/us-news/2016/jul/30/what-do-donald-trump-voters-want-respect
This passage shows the delusional aspects of being a Trump supporter:
“Country is falling apart, from the bottom up. We got these lazy people freeloading off the government. Meanwhile the rich just keep getting richer, and working guys are getting screwed. We just got to break the system.”
When it came to race, he jumps to explain: “My ex-wife is black. I have hired plenty of blacks to work for me. I am not a racist. Trump is not the racist. Hillary is the racist, only standing up for women and blacks.”
So, the wealthy are sucking their lifeblood, growing obese on government subsidies and tax breaks… and they blame people three times poorer and less powerful than them for making the “country fall apart, from the bottom up”.
They are so mired in their “kiss up, kick down” politics that they can’t see that HRClinton doesn’t care any more for women or Black people than she does them. Being ignored and disrespected is such a new feeling for the White working class that it is driving them bonkers.
They need to take a ticket and get in line. They still have further to fall and Trump will only grease the skids on the way down. But they will probably enjoy the fall more if “… the N-word is thrown around with ease, and racial jokes are par for the course”.
on Thu Aug 18th 2016 at 06:34:33 Fan ...
“Country is falling apart, from the bottom up. We got these lazy people freeloading off the government. Meanwhile the rich just keep getting richer, and working guys are getting screwed.”
These so-called lazy people (code for negroes) feeding off the government didn’t sign off on political trade agreements and policies that sent American manufacturing jobs overseas to increase corporate profits.
That’s called aligning yourselves against your own interests, white folks. Could the rich get richer if they weren’t sucking the life-blood out of the common people? The country isn’t in this predicament because of lazy people. It’s because of the insatiable greed of those in power.
Idiots like this person quoted above somehow cannot see the divide and conquer tactic at work, yet they believe that they’re supposedly endowed with higher brain function and more intelligence than those they call “lazy.” Unbelievable!
@Fan
The illogical statement, “the country is falling apart from the bottom up” shows just how Orwellian their thought processes are.
Countries fall apart from the top down, not the bottom up. When you are too cowardly to deal with the people at the top, kicking the people at the bottom seems mighty empowering.
on Thu Aug 18th 2016 at 15:58:10 Herneith
When you are too cowardly to deal with the people at the top, kicking the people at the bottom seems mighty empowering.
It’s safer too.
on Thu Aug 18th 2016 at 19:53:09 Origin
Trump appeals to white resentment. Hillary appeals to liberal sanctimony. Both only care about themselves.
@ Origin
“Liberal sanctimony” or naked fear?
on Mon Aug 29th 2016 at 03:27:51 Afrofem
@ LoM
The election is still Trump’s to lose. It’s not like he is running against an honorable opponent. Clinton is a crook.
on Wed Aug 31st 2016 at 19:39:20 resw
Lord of Mirkwood
“He argues that the Republicans of 1860 and those of 2016 are basically the same thing, and ditto for the Democrats.”
That the Democrat platform is different does not change the fact that it is the same party that supported slavery and Jim Crow. And yes, the party and the Democratic National Committee that governs it, are the same legal entities. As you may know, there is no statute of limitations on crimes against humanity.
Both the Democrat party and DNC have never been punished for supporting crimes against humanity. They have never recompensed their victims. They have never even brought themselves to apologise to minorities because they’ve conned the public into believing that because they’re “progressive” the their past crimes against humanity are somehow absolved. Of course you’re all sadly mistaken.
on Thu Sep 1st 2016 at 07:21:34 michaeljonbarker
Tweet by David Duke after Trump’s speech on immigration.
“Excellent speech by Donald Trump tonight. Deport criminal aliens, end catch and release, enforce immagration laws & America first.”
I heard parts of Trump’s speech today. Nothing changed, it’s still fascism.
on Thu Sep 1st 2016 at 12:36:36 abagond
@ michaeljonbarker
What a horrifying speech! Not just that he gave it, but that so many people seemed to LIKE it. But part of me is glad because, barring the unforseen, he pretty much sank his campaign for good.
on Thu Sep 1st 2016 at 17:04:08 resw
What is fascist about deporting people who go to the US illegally? It may be very nationalist or populist but I don’t see what’s fascist about it.
“But part of me is glad because, barring the unforseen, he pretty much sank his campaign for good.”
I wouldn’t count him out. This is far from over. All we need now is another major atrocity committed by an “illegal alien” or Muslim, and Trump will benefit “bigly” in the polls. You saw what happened last year. Trump’s poll numbers increased a lot after the Paris and San Bernadino attacks.
“What is fascist about deporting people who go to the US illegally? ”
Because it requires an expansion of State power. Trump himself says he will federalize all police departments across the U.S. within his first 100 days in office. That means locale police and sheriffs will have the jurisdiction to profile people who look “illegal”. It will require Hispanics and all immigrants to carry papers to “prove” they have a right to be here. Due process will not be adhered too which violates civil liberties laid out in the Constitution.
The “red tape” that Trump wants to eliminate to “free the police to do there jobs” are in fact constitutional stops to illegal search and seizure and false arrest. The Constitution is meant to protect individuals from harassment both from groups and State agents.
My friend Anthony Gregory writes that “The Constitution empowers Congress to regulate naturalization; the process by which the government determines who is a citizen. It emphatically does not empower Congress to regulate immigration; the process by which individuals freely choose to move from one country to another. There is nothing in the Constitution that allows for border checkpoints and an INS and a cumbersome process to determine whether someone can merely reside here legally. Legal residency is a natural right, not a civil privilege like citizenship and voting rights. Many people live legally within the US without being citizens. Under the Constitution—and more important, under libertarianism as well as under natural law morality—anyone who can physically get to the territory currently ruled by the US government has the right to be here without being harassed by the state. That doesn’t mean the right to vote or receive welfare. But it does mean the right to live here, get a job, and pursue happiness. Under the Constitution and moral law, someone born in Mexico or Norway has just as much right to move to California and peacefully acquire a job and place to rent as does someone who was born in Nebraska.”
“Trump himself says he will federalize all police departments across the U.S. within his first 100 days in office.”
Centralizing government functions like policing is not fascist per se. Many liberal countries have nationalized police forces. But the US President doesn’t really have the power to do that unilaterally.
“That means locale police and sheriffs will have the jurisdiction to profile people who look “illegal””
That’s a different issue than centralizing police. But as a matter of fact police already profile. They do it everyday. They’re trained to do it.
I’m not convinced local police departments are going to change their existing practices as a result of a Trump presidency.
“The “red tape” that Trump wants to eliminate to “free the police to do there jobs” are in fact constitutional stops to illegal search and seizure and false arrest”
He may think there’s red tape, but police already perform illegal searches, seizures and false arrests. And even murder. They get away with it every day. Even in the bastion of liberals, New York (city), where they overwhelmingly supported the unconstitutional racial profiling and illegal searches of blacks and browns, and where cops who murder unarmed blacks go unpunished.
And let’s not forget “progressive” President Obama’s National Defense Authorization Act which permits the indefinite detention of any suspected terrorist.
“It emphatically does not empower Congress to regulate immigration”
I tend to agree in theory, except some would say this power is derived under Article 1, Section 8, Clause 10.
on Sun Sep 4th 2016 at 02:41:46 michaeljonbarker
Donald Trump stars in Pink Floyd’s “The Wall” lol
(https://music.youtube.com/watch?v=UiPKV4sGK64&feature=share)
on Mon Sep 5th 2016 at 04:14:24 Michael Jon Barker
“But Donald Trump is for the little guy” Clueless Trump supporter.
“The War on Street Food been going on for more than 100 years.”
“When Marco Gutierrez, a founder and spokesman for the little-known and sparsely populated advocacy group “Latinos for Trump” recently tried to warn America of the grave dangers of open borders and free migration with the image of “taco trucks on every corner,” most views, Latino and Anglo alike, seem to have experienced a vision of a possible new utopia. The tag immediately trended on Twitter, not in panic but in near-universal celebration of the possibility.”
This article exposes more then that. One of the obstacles that keep immigrants and those who are not white from starting small businesses and upward mobility are city and state license fees that often times are their to favor white populations and developers.
https://fee.org/articles/why-are-there-not-taco-trucks-on-every-corner/
Trumps intent on deporting over 11 million “illegal aliens”. There is a president for this that was started under the Hoover administration and carried into FDR term over a seven year period. It is estimated that upwards of 2 million people were detained and deported without due process and about half of them American born U.S. citizens.
Funny the things that get left out of history books.
https://en.wikipedia.org/wiki/Mexican_Repatriation
on Wed Sep 14th 2016 at 19:37:45 Mary Burrell
Colin Kaepernick draws ire from white Americans because he calls attention to America’s denial of white privilege, police brutality against black people and people of color, and the lack of opportunity for those same people and get demonized for protesting injustice. Meanwhile Trump can tell his crowds that America is in decline, Mexicans are sexual predators and all black people are disadvantaged living in ghettos and he gets applauded, what’s wrong with this picture?
on Wed Sep 14th 2016 at 22:02:44 resw
America was built on the double standard.
http://img.huffingtonpost.com/asset/scalefit_630_noupscale/57c7589a1700001a1fc76d55.gif?cache=ohgbobx3ej
on Wed Sep 14th 2016 at 22:19:56 Fan ...
” Meanwhile Trump can tell his crowds that America is in decline, Mexicans are sexual predators and all black people are disadvantaged living in ghettos and he gets applauded, what’s wrong with this picture?”
I’ll take a stab at this: Never underestimate the power of stupidity of certain people in large groups!
Trump’s chances of being elected are looking more and more possible every day.
I heard a rumor that the DNC is thinking about substituting Michelle Obama for Clinton if Clinton’s health disqualifies her from continuing.
@resw: Precisely, that cartoon is circulating the Internet and there is much truth in it.
@Fan: I agree with that statement about the stupidity of certain people in large groups. Trump rallies are definitely where the “stupid ” happens.
on Sat Oct 1st 2016 at 02:18:21 Michael Jon Barker
Donald Trump has yet to pick up any Newspaper endorsements for president.
Gary Johnson has six, four from papers that endorsed Romney and two from papers that endorsed Obama.
Hillary has thirteen endorsements, Six from papers that endorsed Romney and seven from papers that endorsed Obama.
on Sat Oct 1st 2016 at 03:15:30 Afrofem
“It is estimated that upwards of 2 million people were detained and deported without due process and about half of them American born U.S. citizens. “
True. I never knew about those mass deportations until I saw a movie called Mi Familia. It starred Edward James Olmos and Jimmy Smits.
Armed soldiers basically rampaged through Mexican American neighborhoods, grabbed people on the streets and stuffed them on buses and trains bound for Mexico.
A movie trailer can be found here:
http://www.imdb.com/video/screenplay/vi2930573593
⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙⚙
The movie also depicts the “Zoot Suit Riots” in Los Angeles in 1943. White soldiers and sailors attacked Chicano men who dressed in distinctive “Zoot Suits”. According to History.com:
“..the jazz-inspired outfits were particularly popular among the city’s Mexican American population. Latino youths known as “Pachucos” caused a sensation by donning zoot suits, pork pie hats and dangling watch chains, and it wasn’t long before their eye-catching garb earned them an overblown reputation as street thugs and juvenile delinquents. Tensions grew especially high between zoot-suiters and the large contingent of white sailors and Marines stationed in Los Angeles. Mexican Americans were serving in the military in high numbers, but many servicemen viewed the zoot-suit wearers as World War II draft dodgers. Since wool and other textiles were subject to wartime rationing, they also considered the oversized suits an unpatriotic waste of resources.
The racially charged atmosphere finally led to full-scale riots in early June 1943. Following a series of bloody street brawls between zoot-suiters and white soldiers, a mob of U.S. servicemen took to the streets in taxicabs and began attacking Latinos and stripping them of their suits. Thousands more servicemen and civilians joined the fray over the next several days, often marching into cafes and movie theaters and beating anyone wearing Pachuco clothing or hairstyles. Blacks and Filipinos—even those not clad in zoot suits—were also targeted. Local papers framed the racial attacks as a vigilante response to an immigrant crime wave, and police generally restricted their arrests to the Latinos who fought back. The mayhem didn’t die down until June 8, when U.S. military personnel were finally barred from leaving their barracks. The Los Angeles City Council issued a ban on zoot suits the following day. Amazingly, no one was killed during the weeklong riot, but it wasn’t the last outburst of zoot suit-related racial violence. Similar incidents took place that same year in cities such as Philadelphia, Chicago and Detroit. “
http://www.history.com/news/ask-history/what-were-the-zoot-suit-riots
on Mon Oct 3rd 2016 at 13:39:14 Herneith
https://www.icij.org/blog/2016/09/trumps-organization-did-business-iranian-bank-later-linked-terrorism?utm_content=buffer8f75a&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer
on Thu Oct 13th 2016 at 05:01:07 michaeljonbarker
Some Republican women have had enough of Trump and his supporters.
“So let me get this straight: I, a conservative female, have spent years defending the Republican Party against claims of sexism. When I saw Republican men getting attacked I stood up for them. I came to their defense. I fought on their behalf. I fought on behalf of a movement I believed in.
I fought on behalf of my principles while other women told me I hated my own sex. Not only charges of sexism, but I defended @marcorubio during Go8, I fought in my state to stop the @ScottWalker recall, etc… Now some Trojan horse nationalist sexual predator invades the @GOP, eating it alive, and you cowards sit this one out? He treats women like dogs, and you go against everything I – and other female conservatives – said you were & back down like cowards.
Get this straight: We don’t need you to stand up for us, YOU needed to stand up for us for YOU. For YOUR dignity. For YOUR reputation. Jeff Sessions says that he wouldn’t “characterize” Trump’s unauthorized groping of women as “assault.”
Are you kidding me?!
Others try to rebuke his comments, yet STILL choose to vote for a sexual predator – because let’s be honest, that’s what he is. “What he said is wrong, and the way he treats women is wrong, but it’s not wrong enough for me to not vote for him.”
Thanks, cowards.
Various men in the movement are writing it off as normal, confirming every stereotype the left has thrown at them. So I’m done. I’m sooo done.
If you can’t stand up for women & unendorse this piece of human garbage, you deserve every charge of sexism thrown at you. I’m just one woman, you won’t even notice my lack of presence at rallies, fair booths, etc. You won’t really care that I’m offended by your silence, and your inability to take a stand. But one by one you’ll watch more women like me go, & you’ll watch men of ACTUAL character follow us out the door.
And what you’ll be left with are the corrupt masses that foam at the mouth every time you step outside the lines. Men who truly see women as lesser beings, & women without self-respect. And your “guiding faith” & “principles” will be attached to them as well. And when it’s all said and done, all you’ll have left is the party The Left always accused you of being.
Scum.”
http://www.theatlantic.com/politics/archive/2016/10/the-tweet-storm-that-should-terrify-the-republican-party/503771/
on Thu Oct 13th 2016 at 07:17:08 Fan ...
Oh please … cry me a river!!!
Too few tears, and way too late!
The Amerikan political system had an opportunity to redeem itself during Bill Clinton’s impeachment trial. The senate decided to look the other way despite all of the evidence pointing to Clinton’s guilt. The Amerikan people also agreed with the senate’s decision.
Any (systemic) rot/cancer left remaining (untreated) within a body will eventually infect/overtake/spread into the rest of the body.
The untreated diseased body then cannot recover from its overwhelming multiple cancers. Rot can’t be permitted to remain and fester, whether it starts in the foot – or the head.
on Mon Oct 17th 2016 at 15:47:43 Herneith
https://scontent-yyz1-1.xx.fbcdn.net/v/t1.0-0/p417x417/14695412_1246415125378927_2142578183932071144_n.jpg?oh=325d5a75295a823f225ff6e0560385e9&oe=58A0ABBF
on Sat Oct 22nd 2016 at 00:50:48 michaeljonbarker
Here is more about Donald Trump’s “Morman Problem”.
http://www.latimes.com/politics/la-na-pol-trump-clinton-mormons-20161019-snap-story.html
on Wed Oct 26th 2016 at 16:03:41 Herneith
Qu qu’est fcuk?
on Sat Oct 29th 2016 at 15:40:46 Herneith
http://www.burrardstreetjournal.com/trump-v-mcgregor-confirmed-for-wwe-battleground/
http://www.burrardstreetjournal.com/trump-obama-founded-better-terrorist-group/
on Tue Nov 1st 2016 at 14:41:08 Herneith
http://www.nytimes.com/2016/11/01/us/politics/donald-trump-tax.html?emc=edit_na_20161031&nlid=59850509&ref=cta
on Tue Nov 1st 2016 at 16:37:42 Afrofem
That Trump v. McGregor story is hilarious! Thanks for sharing.
on Wed Nov 16th 2016 at 05:49:11 Herneith
Ever wonder how Donald Trump has his hair coiffed?:
https://timedotcom.files.wordpress.com/2015/06/trump_0425.jpg?quality=85&w=950
Separated at birth?:
on Wed Nov 16th 2016 at 06:43:49 Fan ...
^^^^^^^ lol
These lesser hairstyles (or snafus) reminds of boxing promoter Don King’s original classic look!
The trolls sexier and better looking in a manly, rugged way!
on Wed Nov 16th 2016 at 13:55:27 v8driver
lordie lordie lordie
Is that pic on the right an image of “Oh nooooooooooooooooooooooo…” the always accident prone, Mr. Bill of Saturday Night Live??
No, it’s a Troll doll:
https://en.wikipedia.org/wiki/Troll_doll
I used to take them to BINGO. I couldn’t help noticing the resemblance between the two. Here’s Donald with a new hairdo:
fat bastid from austin powers!
https://encrypted-tbn1.gstatic.com/images?q=tbn:ANd9GcS5kt-visduX-Gl_O3MSGejzsP8ho2FoVUjSPKkGcXbuCyTwrKFhw
There is a little resemblance between the troll and Mr Bill.
At least Mr Bill believes in personal grooming.
The Donald looks as if his melanin deficiency might make him a candidate for some serious skin issues…and be aware of the Sun’s effect …
on Thu Nov 17th 2016 at 00:59:18 Herneith
Mr. Bill is a hundred times better looking.
A profound question, can Donald Trump keep his hair in place on inauguration day?
http://www.thedailybeast.com/articles/2016/11/17/can-trump-s-hair-survive-inauguration-day.html?via=newsletter&source=DDAfternoon
on Thu Nov 17th 2016 at 17:31:42 Fan ...
” can Donald Trump keep his hair in place on inauguration day?”
Highly doubtful. That’s like asking Mr Potato Head if he can make any sense, or answer a simple question!
Maybe.. if he uses the most super-fortified can of hair spray known to mankind (Aquanet) and the wind is nowhere to be found!
He should probably buy a blond hair WEAVE and just be done with it!
Or sport a new look… an Issac Hayes, Steve Harvey, Mike Tyson hair (less) do. I do think he needs a tan (some coloring to offset that ghastly Eddie Muster pale …) a lot more than he needs to keep his hair in place.
on Wed Dec 21st 2016 at 01:42:14 Herneith
(https://www.youtube.com/watch?v=KbLZZ5zLwnA)
(https://www.youtube.com/watch?v=NjUDK4GqiXo)
on Wed Feb 1st 2017 at 08:41:01 Trump's Muslim ban - Bible Prophecy In The Daily Headlines
on Sun May 21st 2017 at 00:41:57 Herneith
http://herneith.d.pr/l8NdK
on Fri Jul 7th 2017 at 02:31:23 michaeljonbarker
“The Racial and Religious Paranoia of Trump’s Warsaw Speech.”
It seems Trump is taking his white speak to Europe.
It got him elelcted in the U.S. so why not reach out to whites in Europe.
https://www.theatlantic.com/international/archive/2017/07/trump-speech-poland/532866/?utm_source=fbia
on Mon Jul 24th 2017 at 00:32:13 michaeljonbarker
So Trump wanys to bring the hammer down on pot smokers. Supposedly there is a “report” that links marijuana users to violent crime. Any report that makes such a claim is schewd towards law enforcement.
Expect everybody but whites to experience the blunt of this. (No pun intended)
Edit: I forgot the link
http://thehill.com/regulation/administration/343218-trumps-doj-gears-up-for-crackdown-on-marijuana
on Wed Aug 9th 2017 at 03:46:27 michaeljonbarker
Trump gets updates twice a day about how great he is. lol
https://news.vice.com/story/trump-folder-positive-news-white-house?utm_source=vicetwitterus
on Sat Aug 19th 2017 at 04:39:45 michaeljonbarker
Impeach tbe President.
https://cohen.house.gov/media-center/press-releases/ranking-member-cohen-introduce-articles-impeachment-against-president
on Tue Sep 5th 2017 at 04:24:34 michaeljonbarker
This is a good. How Trump is producing a propaganda state.
https://newrepublic.com/article/144592/trump-creating-propaganda-state
on Sat Sep 23rd 2017 at 02:44:14 Mary Burrell
Kim Jong Un calls Trump a “dotard.” Dotard: An old senile man. Even a broken clock is right twice a day.
on Mon Oct 23rd 2017 at 02:13:15 michaeljonbarker
“According to research from the nonprofit monitoring group Airwars, the first seven months of the Trump administration have already resulted in more civilian deaths than under the entirety of the Obama administration. Airwars reports that under Obama’s leadership, the fight against IS led to approximately 2,300 to 3,400 civilian deaths. Through the first seven months of the Trump administration, they estimate that coalition air strikes have killed between 2,800 and 4,500 civilians.”
“Researchers also point to another stunning trend – the “frequent killing of entire families in likely coalition airstrikes.” In May, for example, such actions led to the deaths of at least 57 women and 52 children in Iraq and Syria.”
http://www.allgov.com/news/top-stories/in-9-months-trump-has-bombed-to-death-more-civilians-than-obama-did-in-8-years-171017?news=860336
on Wed Jun 26th 2019 at 23:25:51 Mary Burrell
Watching the CBS Evening News and they showed a horrific photo of a Salvadoran and his young child face down in the Rio Grande. These are “human beings “ seeking asylum trying to escape horrendous conditions found in their country, whose problems have been exacerbated by Western polices. This is a humanitarian crisis that one person in the White House has grown with his xenophobic rhetoric plus his lack of empathy.
No President has lost as many cabinet members as Trump.
on Wed Sep 11th 2019 at 15:45:23 Open Minded Observer
That may be true, and you know I’m no Trump apologist, but that’s just one of many side effects of him being the most unqualified president ever.
People opposed to him like to point to stuff like that because they think being unqualified is something that should get him replaced whereas being unqualified is part of what got him elected in the first place. Certainly not the only thing, but it’s also not seen as detrimental to his supporters. They see him rapidly replacing staff as a form of learning and adapting. In fact, not being bogged down with the optics of replacing staff is seen as taking the kinds of quick and decisive actions that they assume business leaders take. That’s what they elected… a businessman instead of a politician. He’s free to make mistakes as long as he doesn’t allow them to linger. In marketing terms, his administration is “nimble” because it can react and change rapidly. They love that.
on Tue Sep 24th 2019 at 21:04:39 Mary Burrell
Today Speaker of The House Nancy Pelosi delivers Statement of Impeachment. We shall see what the outcome will be.
And Trump’s little orange hands are tweeting away.
on Wed Sep 25th 2019 at 10:52:40 Alberto Monteiro
We are all a bunch of idiots, they point it to us all the time, and we don’t believe.
Trump is orange. The Simpsons are orange.
Isn’t it obvious that we live in a simulation?
Even with the threat of impeachment it probably won’t make a difference with Trump’s sycophantic cult following. And I am thinking the Republicans in the Senate are not going to support an impeachment. Just like the Mueller Report it probably won’t have an effect on the election in 2020. I hope I am wrong about all of this. I would like nothing more than to see him in an orange jumpsuit and handcuffs.
I’d say there’s a zero percent chance the Senate has any plans to vote in favor of impeachment unless and until we start seeing the Republican establishment promoting an alternative… i.e. Fox News suddenly running all kinds of “Hey, this guy might give Trump a run for his money” stories. They will most likely will do everything they can to delay the vote until after the 2020 elections. After 2020, whether they retain control of the Senate or not, the outcome of the election will have been determined and if Trump wins, the Republicans keep the presidency.
In other words, they’ll stick with him until he’s so toxic that many republicans start indicating that they’ll switch sides or abstain. Until then, they’ve got nothing to lose, they want a republican in the White house and they probably don’t care if it’s Pence after the election. He just doesn’t have the draw to run on his own, so they’ll stick with Trump and hope for the win.
I’ve said it before though, I think once Trump is out, the establishment, most of his base and the country in general will pile on him. His rise to power was such a media spectacle that his fall will be equally spectacular. His base will blame him for ruining their party, making a mockery of their agenda, bankrupting the economy, costing them all 3 branches of government and pretty much every other thing that goes wrong in the wake of his presidency. They will feel like they took a chance on him and he squandered it. They will have lost friendships, permanently damaged family relationships and will only have a MAGA hat to show for it. They will want revenge.
I could be wrong on that, but if I know one thing, it’s that Americans love drama and watching bad things happen to entitled rich people. I envision the finale of his reality TV presidency to be epic.
“It is certain, in any case, that ignorance, allied with power, is the most ferocious enemy justice can have.” —James Baldwin
“The tot of the fish starts at the head down.” This ancient proverb is so apropos to this corrupt administration. We have a lawless president that commits crimes with impunity.
rot ^^^^
on Thu Oct 10th 2019 at 11:28:32 Mary Burrell
Today i learned Trump betrayed the Kurds. This beast needs to be impeached and removed from office.
on Thu Oct 10th 2019 at 11:39:24 Solitaire
The U.S. has betrayed the Kurds at least three times since the Gulf War in 1990. They shouldn’t trust us at all.
on Thu Oct 10th 2019 at 12:12:16 abagond
“Betrayed” is a strong word. It implies he understands what loyalty is.
I suppose you have a point about the word betrayal implying that he understands what loyalty means. Although he demands “loyalty “ from his subordinates. He has no moral compass and I suppose that is one of the symptoms of his narcissistic personality.
on Thu Oct 10th 2019 at 13:39:30 Open Minded Observer
Wasn’t betraying the Kurds inevitable? I’ll admit ignorance here, but was there ever a time that we didn’t abandon locals we’ve enlisted to assist us in whatever proxy war or destabilization effort or regime change agenda we’ve embarked upon?
2nd thought: Trump may not really have the stomach for fighting someone else’s war, but it seems to me that his actions have set the stage for us to wind up fighting a battle of his own making (one of his hallmarks is creating problems and then claiming victory when he solves them). What’s the history on re-electing presidents when actively engaged in a war? (Hint: http://www.theprogressiveprofessor.com/?p=19187)
on Thu Oct 10th 2019 at 23:38:01 v8driver
Well he’s gone up against NATO leadership with his sanctioningyenabling the Turkish push into Syria now, imnsho.
on Fri Oct 11th 2019 at 03:47:29 iamvistinginstructoreric
Reblogged this on Project ENGAGE.
Tonight at 7:00 pm Trump and the MAGA maggots are infesting the city.🤢🤬😡
on Wed Oct 23rd 2019 at 01:57:19 Mary Burrell
Trump used the word “lynching” I wonder if this was some type of dog whistle to get his zombie sycophant supporters to act out. Like much of his rhetoric he’s very irresponsible and evil. With these impeachment hearings pending, perhaps this is way to distract. I suppose this is no different from all the other irresponsible, dangerous rhetoric with.
on Thu Apr 2nd 2020 at 22:02:45 Mary Burrell
Under Trump war criminals are treated like heroes, and war heroes are treated like criminals.
on Wed Jul 1st 2020 at 00:35:50 Mary Burrell
Since Trump carries water for Putin, he has turned America into a 💩hole country. Talk about irony.
Money in Leonardo's time | cc/2021-04/en_middle_0020.json.gz/line534 |
__label__wiki | 0.637525 | 0.637525 | Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes
M. T. Graham (Corresponding Author), D. J. MacAllister, J. Vinogradov, M. D. Jackson, A. P. Butler
Engineering (Research Theme)
Monitoring of self-potentials (SP) in the Chalk of England has shown that a consistent electrical potential gradient exists within a coastal groundwater borehole previously affected by seawater intrusion (SI) and that this gradient is absent in boreholes further inland. Furthermore, a small but characteristic reduction in this gradient was observed several days prior to SI occurring. We present results from a combined hydrodynamic and electrodynamic model, which matches the observed phenomena for the first time and sheds light on the source mechanisms for the spatial and temporal distribution of SP. The model predictions are highly sensitive to the relative contribution of electrochemical exclusion and diffusion potentials, the ‘exclusion efficiency’, in different rock strata. Geoelectric heterogeneity, largely due to marls and hardgrounds with a relatively high exclusion efficiency, was the key factor in controlling the magnitude of the modelled SP gradient ahead of the saline front and its evolution prior to breakthrough. The model results suggest that, where sufficient geoelectric heterogeneity exists, borehole SP may be used as an early warning mechanism for SI.
Water Resources Research
https://doi.org/10.1029/2018WR022972
self-potentials
coastal aquifiers
10.1029/2018WR022972Licence: CC BY
Self‐Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes
©2018. The Authors. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. https://creativecommons.org/licenses/by/4.0/
Final published version, 3.87 MBLicence: CC BY
Early Online: Self‐Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes
Fingerprint Dive into the research topics of 'Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes'. Together they form a unique fingerprint.
self potential Earth & Environmental Sciences
borehole Earth & Environmental Sciences
seawater Earth & Environmental Sciences
groundwater Earth & Environmental Sciences
electrodynamics Earth & Environmental Sciences
chalk Earth & Environmental Sciences
marl Earth & Environmental Sciences
temporal distribution Earth & Environmental Sciences
Graham, M. T., MacAllister, D. J., Vinogradov, J., Jackson, M. D., & Butler, A. P. (2018). Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes. Water Resources Research, 54(9), 6055-6071. https://doi.org/10.1029/2018WR022972
Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes. / Graham, M. T. (Corresponding Author); MacAllister, D. J. ; Vinogradov, J.; Jackson, M. D.; Butler, A. P. .
In: Water Resources Research, Vol. 54, No. 9, 09.2018, p. 6055-6071.
Graham, MT, MacAllister, DJ, Vinogradov, J, Jackson, MD & Butler, AP 2018, 'Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes', Water Resources Research, vol. 54, no. 9, pp. 6055-6071. https://doi.org/10.1029/2018WR022972
Graham MT, MacAllister DJ, Vinogradov J, Jackson MD, Butler AP. Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes. Water Resources Research. 2018 Sep;54(9):6055-6071. https://doi.org/10.1029/2018WR022972
Graham, M. T. ; MacAllister, D. J. ; Vinogradov, J. ; Jackson, M. D. ; Butler, A. P. . / Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes. In: Water Resources Research. 2018 ; Vol. 54, No. 9. pp. 6055-6071.
@article{17404f37dc41454ebb9844cc0d5c1daf,
title = "Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes",
abstract = "Monitoring of self-potentials (SP) in the Chalk of England has shown that a consistent electrical potential gradient exists within a coastal groundwater borehole previously affected by seawater intrusion (SI) and that this gradient is absent in boreholes further inland. Furthermore, a small but characteristic reduction in this gradient was observed several days prior to SI occurring. We present results from a combined hydrodynamic and electrodynamic model, which matches the observed phenomena for the first time and sheds light on the source mechanisms for the spatial and temporal distribution of SP. The model predictions are highly sensitive to the relative contribution of electrochemical exclusion and diffusion potentials, the {\textquoteleft}exclusion efficiency{\textquoteright}, in different rock strata. Geoelectric heterogeneity, largely due to marls and hardgrounds with a relatively high exclusion efficiency, was the key factor in controlling the magnitude of the modelled SP gradient ahead of the saline front and its evolution prior to breakthrough. The model results suggest that, where sufficient geoelectric heterogeneity exists, borehole SP may be used as an early warning mechanism for SI.",
keywords = "self-potentials, seawater intrusion, coastal aquifiers, modeling",
author = "Graham, {M. T.} and MacAllister, {D. J.} and J. Vinogradov and Jackson, {M. D.} and Butler, {A. P.}",
note = "This work was supported by the Natural Environment Research Council in the UK, as part of the Science and Solutions for a Changing Planet Doctor Training Partnership, run by the Grantham Institute for Climate Change at Imperial College London. We thank Southern Water for access to the boreholes at Saltdean and Balsdean. We thank Southern Water and Atkins Global for funding the installation of the equipment. We also thank Dr Amadi Ijioma for providing a prototype of the electrodynamic modelling code in MATLAB, which has since been adapted for use in a coastal chalk aquifer. Three anonymous reviewers are thanked for their comments, which greatly helped to improve the manuscript. The data used in this paper are in the tables, figures and cited information. The authors have no conflicts of interest to declare.",
doi = "10.1029/2018WR022972",
journal = "Water Resources Research",
publisher = "American Geophysical Union",
T1 - Self-Potential as a Predictor of Seawater Intrusion in Coastal Groundwater Boreholes
AU - Graham, M. T.
AU - MacAllister, D. J.
AU - Vinogradov, J.
AU - Jackson, M. D.
AU - Butler, A. P.
N1 - This work was supported by the Natural Environment Research Council in the UK, as part of the Science and Solutions for a Changing Planet Doctor Training Partnership, run by the Grantham Institute for Climate Change at Imperial College London. We thank Southern Water for access to the boreholes at Saltdean and Balsdean. We thank Southern Water and Atkins Global for funding the installation of the equipment. We also thank Dr Amadi Ijioma for providing a prototype of the electrodynamic modelling code in MATLAB, which has since been adapted for use in a coastal chalk aquifer. Three anonymous reviewers are thanked for their comments, which greatly helped to improve the manuscript. The data used in this paper are in the tables, figures and cited information. The authors have no conflicts of interest to declare.
N2 - Monitoring of self-potentials (SP) in the Chalk of England has shown that a consistent electrical potential gradient exists within a coastal groundwater borehole previously affected by seawater intrusion (SI) and that this gradient is absent in boreholes further inland. Furthermore, a small but characteristic reduction in this gradient was observed several days prior to SI occurring. We present results from a combined hydrodynamic and electrodynamic model, which matches the observed phenomena for the first time and sheds light on the source mechanisms for the spatial and temporal distribution of SP. The model predictions are highly sensitive to the relative contribution of electrochemical exclusion and diffusion potentials, the ‘exclusion efficiency’, in different rock strata. Geoelectric heterogeneity, largely due to marls and hardgrounds with a relatively high exclusion efficiency, was the key factor in controlling the magnitude of the modelled SP gradient ahead of the saline front and its evolution prior to breakthrough. The model results suggest that, where sufficient geoelectric heterogeneity exists, borehole SP may be used as an early warning mechanism for SI.
AB - Monitoring of self-potentials (SP) in the Chalk of England has shown that a consistent electrical potential gradient exists within a coastal groundwater borehole previously affected by seawater intrusion (SI) and that this gradient is absent in boreholes further inland. Furthermore, a small but characteristic reduction in this gradient was observed several days prior to SI occurring. We present results from a combined hydrodynamic and electrodynamic model, which matches the observed phenomena for the first time and sheds light on the source mechanisms for the spatial and temporal distribution of SP. The model predictions are highly sensitive to the relative contribution of electrochemical exclusion and diffusion potentials, the ‘exclusion efficiency’, in different rock strata. Geoelectric heterogeneity, largely due to marls and hardgrounds with a relatively high exclusion efficiency, was the key factor in controlling the magnitude of the modelled SP gradient ahead of the saline front and its evolution prior to breakthrough. The model results suggest that, where sufficient geoelectric heterogeneity exists, borehole SP may be used as an early warning mechanism for SI.
KW - self-potentials
KW - seawater intrusion
KW - coastal aquifiers
KW - modeling
U2 - 10.1029/2018WR022972
DO - 10.1029/2018WR022972
JO - Water Resources Research
JF - Water Resources Research | cc/2021-04/en_middle_0020.json.gz/line535 |
__label__cc | 0.61465 | 0.38535 | Hampshire Trust Bank to launch into bridging sector
By Bridging Loan Directory - 11th March 2016
Hampshire Trust Bank, the specialist challenger bank, has announced it is launching into the bridging sector as it continues to strengthen its new Commercial Mortgages team.
Colin Stevens has been appointed as Head of Bridging while Iain McCarrell has joined as Senior Underwriter.
It follows the announcement earlier this year that Hampshire Trust Bank is expanding into the commercial mortgages and professional landlord sectors.
Colin Bell, Managing Director of Commercial Mortgages at Hampshire Trust Bank, said:
“Bridging loans form an important part of the mortgage funding market, providing a relatively speedy short-term solution to get people on the move. There is a growing demand for this type of funding and as a bank that is focused on supporting British businesses, we are committed to providing the flexible financing solutions our customers need to grow.
“The bridging, commercial and professional landlord’s mortgage sectors represent a wealth of opportunities for us. We are delighted to welcome Colin and Iain on board. They both have a great deal of experience in specialist lending and they are an important addition to our expanding specialist Commercial Mortgages team.”
Colin, who has more than 25 years’ experience in property lending, was self-employed before joining Hampshire Trust Bank, with previous positions including Director, Lending at Heritable Bank and Head of Mortgage Lending at Sun Bank.
Talking about why he decided to join Hampshire Trust Bank, Colin said:
“The chance to be involved in the start-up of a new business line within this growing and well-respected specialist challenger bank was just the opportunity I have been looking out for.”
Prior to joining Hampshire Trust Bank, Iain, who has 15 years’ underwriting experience, worked at Amicus. He previously held positions at companies including Platform, Preferred and Heritable Bank.
“I am delighted to join the team at Hampshire Trust Bank. There are a wealth of opportunities within the sector and I am hopeful that my desire to deliver superior customer service will make a positive impact to Hampshire Trust Bank, as well as our introducers.”
Fiduciam works across European borders to finance complex corporate acquisition | cc/2021-04/en_middle_0020.json.gz/line546 |
__label__wiki | 0.687389 | 0.687389 | Netflix lock down their library. But you can access all of it with your account. Learn how to access the full library.
How To Unblock Netflix
Rotten Tomatoes Top 100 Movies
If it's on Netflix you'll find it with our search engine. Search below to get started.
Shutter Island - (2010) - Netflix
How To Unblock Every Movie & TV Show on Netflix No Matter Where You Are
New Movies on Netflix
New TV Shows on Netflix
138 m - Thrillers
In 1954, U.S. Marshal Teddy Daniels is investigating the disappearance of a murderess who escaped from a hospital for the criminally insane and is presumed to be hiding near-by.
Director: Martin Scorsese
Cast: John Carroll Lynch, Ted Levine, Jackie Earle Haley, Patricia Clarkson, Emily Mortimer, Michelle Williams, Max von Sydow, Ben Kingsley, Mark Ruffalo, Leonardo DiCaprio
Netflix Rating:
Rotten Tomatoes Score: 69/100
Countries Available in:
Not available where you live? Learn how to unblock Netflix & watch this title.
Available Since: 25.02.2015
Similar Titles:
Other Titles Being Viewed Right Now
Mad Bastards
Wayne Blair
Louise Deschamps
This website is not affiliated with, endorsed by or sponsored by Netflix in any way. This site does not represent Netflix or Netflix in Australia. Netflix is a registered trademark of Netflix, Inc. All trade marks displayed on this site are trade marks of their respective owners. This site does not provide, host, sell or in any way distribute copyrighted material.
There's a local version of FlixList near you. Pick the flag closest to you for the fastest FlixList experience. | cc/2021-04/en_middle_0020.json.gz/line550 |
__label__wiki | 0.644008 | 0.644008 | INVERTEBRATE ZOOLOGY AT CARNEGIE MUSEUM OF NATURAL HISTORY
Invertebrate Zoology maintains resources for understanding the greatest radiation of life on Earth: invertebrates. Carnegie Museum of Natural History invertebrate holdings are worldwide in coverage, especially Afrotropical and Neotropical regions. Most specimens in the collection are in the Phylum Arthropoda, with greatest emphasis on insects, myriapods, arachnids, and crustacea.
The Invertebrate Zoology Collection
The insect collection of the Invertebrate Zoology collection contains an estimated 13 million specimens of which more than 7 million are prepared, labelled, and ready for study. Invertebrate Zoology’s overarching collection’s primary strengths are Lepidoptera and Coleoptera but with strong collections in Diptera, Odonata, Heteroptera, Homoptera, Hymenoptera, and Siphonaptera. These collections augment studies by staff, but they are also used for research by hundreds of specialists worldwide where they constitute the basis for numerous scientific publications. These collections benefit present and future generations, and in their immensity comprise a public trust as a unique record of the natural world.
Invertebrate Zoology Collections Unique to Carnegie Museum of Natural History
Collections including many orders of insects: Lepidoptera collections: Other significant type holdings:
H. Boyd (Nearctic, especially Cicindelidae) A. Avinoff (Central Asia, esp. Parnassiinae) P.P. Calvert (South American Odonata)
A.C. Good and A.I. Good (Cameroon) B. Barton-Eckett (Uganda, Kenya, Tanzania) W.J. Fox (South American Hymenoptera)
H. Kahl (Sweden, North America) M.A. Carter (Pennsylvania) H. Osborn (South American Cicadellidae)
S.M. Klages (French Guyana & the Amazon) B.P. Clark (world Sphingidae including those of Boisduval, Mell, Howe, and Oberthur)
G. Onore (Africa, Ecuador) H.K. Clench (Bahamas; world Lycaenidae) Siphonaptera
J.E. Rawlins (world, especially Noctuoidea) W. Doherty (East Africa, Java, Sulawesi) R. Traub (world)
J.A. Reis (Cameroon) W.H. Edwards (Nearctic)
H.H. Smith (Brazil, Colombia) G.A. Ehrmann (world) Coleoptera collections:
J. Steinbach (Bolivia) H. Engel (Pennsylvania) R.E. Acciavatti (world Cicindelidae)
H.L. Weber (Cameroon) R.M. Fox (Liberia; Neotropical Ithomiinae) M. Alvarenga (Brazil)
M.A. Weymarn (northern China) H.A. Freeman (New World Hesperiidae) R.A. Androw (Neartic)
M. Wible (Nearctic) J.S. Garth (California) T.C. Barr (Nearctic Carabidae; cave fauna)
W.J. Holland (world) R. and J. Bell (world Rhysodidae)
Collections from major expeditions: F.M. Hope (Arkansas) J.R. Bowman (Nearctic)
Eclipse Expedition to Japan (1887) G.V. Hudson (New Zealand) R.L. Davidson (world, especially Carabidae)
Avinoff/Shoumatoff Expeditions, Jamaica (1936-1940) J. Klapperich (Afghanistan) J. Glaser (world)
Cary-Carnegie Expedition, Baja California (1962) Knyvett Collection (northern India) J. Hamilton (Nearctic)
Carnegie Expedition to Ecuador (1983) B. Krautwurm (Nearctic) H.G. Klages (Pennsylvania)
Carnegie Expedition to Cameroon (1984) Sra. R. Lafebre (Ecuador) T. Nathan (India)
Project Wallace, Sulawesi (1985) A.W. Lindsey (world Hesperiidae) L. Pena (Chile)
Carnegie Expedition to Andean Ecuador (1987, 1993) Fr. Maessen (Ghana) H. Ulke (Nearctic)
Carnegie Expeditions (15) to Dominican Republic/Haiti (1987-1993, 1995, 1998, 2001-2004) F. Marloff (Nearctic) A. Walford-Huggins (Australian Carabidae)
Carnegie Expedition to Taiwan (1988) T.L. Meade (Nearctic) R.D. Ward (Botswana, South Africa, Bolivia, Chile, Cyprus, Jordan, esp. world Carabidae)
Carnegie Expedition to Malawi (1988-1989) E.P. Mellon (Florida)
Carnegie Expedition to Dominica-St. Lucia (1991) C.G. Merker (Nearctic) Diptera collections:
Carnegie Expedition to Congo (1993) L.D. Miller (world Hesperiidae) B.A. Foote (Nearctic acalyptrates)
Carnegie Expedition to Puerto Rico (1996) R.A. Rahn (Nearctic) C.D. Hynes (Immature Tipulidae)
R.F. Rockwell (Nearctic) C.W. Young (world Tipulidae)
W. Schaus (Neotropical; exceptional diversity)
M. Serrano (El Salvador) Other major collections:
J.B. Sullivan (North Carolina) Lepidoptera, Academy of Natural Sciences, Philadelphia
(Exchange 1962-1964, including collections of
R.C. Williams (Hesperiidae), W.J. Coxey (Andean Ecuador), and Poey (Cuba)
W. Sweadner (Nearctic) National Forest Surveys of Allegheny (1993-96); Monongahela (1994-96); and Wasatch-Cache (1997-98)
E.C. Welling (Mexico) PA Barrens Habitat Inventory (1996-1997)
R.C. Wood (Malawi) PA Small Mammal Parasitoid Survey (1946-1953)
W.W. Worthington (Bahamas) St. Vincent College, Latrobe, PA (material of M. Wirtner and J. Schmitt of Schmitt box fame)
W.H. Yackley (Pennsylvania) University of Vermont Collections (Lepidoptera and Carabidae, 1991-1994)
W.A. Zanol (Pennsylvania)
Invertebrate Zoology Collection Inquiries
In recent years, hundreds of specialists worldwide have borrowed multiple thousands of specimens from the collection for research purposes. One of the greatest services the Section of Invertebrate Zoology makes to scientific research is by lending specimens from its collection to qualified persons for study and identification. Lending rates have increased greatly over the history of the museum.
The use of specimens from the collection, borrowed or otherwise, is governed by a general policy.
Invertebrate Zoology General Loan Policy
Specimens are loaned only for scientific studies intended for publication or for authoritative determination.
Specimens may be borrowed by any knowledgeable biologist (with or without institutional affiliation) as approved by the curator in charge. Student loans are made to the supervising advisor.
Loans are made for a duration of two years, may not be transferred or forwarded to third parties, may be renewed on request, and may be recalled at any time. Type specimens are loaned for three months.
Borrowers must promptly acknowledge reception of mailed loans, report the status of loans on request, note changes of address, and send reprints of publications resulting from research on Carnegie specimens.
Borrowers are responsible for the integrity of borrowed specimens.
Individual identification labels should always be placed on specimens that will be mentioned in systematic publications. The preferred institutional abbreviation is CMNH.
Borrowers will pay for shipment when returning specimens. Type specimens should be returned by registered mail and be packed in a compartment or container separate from other specimens.
Specimens intended as types for new taxa, or designated as types for previously named taxa, should be clearly labelled. Names or taxonomic changes written on labels and not yet published when specimens are returned should be clearly described in correspondence.
Photographs or facsimiles of Carnegie specimens may be used only for scientific publication. Other uses require special permission.
Specimens may be permanently retained only by systematic specialists seeking to increase the diversity of their comparative collections, and only in taxa on which they will continue to publish. When possible, exchange of Carnegie Museum of Natural History specimens for species not in the Carnegie Museum of Natural History collection is expected. Other arrangements must be made by special request.
Notes about Loans
The following specimens MAY NOT BE RETAINED:
Type specimens of any kind, except secondary types of taxa described by the borrower.
Specimens not authoritatively identified to species level.
Specimens already accurately determined by another specialist.
Best male and female of any species, or two best of each sex for Lepidoptera and Odonata.
More than one third of the identified Carnegie Museum of Natural History specimens for that species, and IN ANY CASE more than five specimens of any given species.
If possible, retained specimens should bear label data similar to those returned to Carnegie Museum of Natural History. A retained specimen subsequently designated as a primary type must be returned to Carnegie Museum of Natural History.
IMPORTANT: Specimens with labels bearing Carnegie Museum numbers (accession, catalogue, or unique identification) may only be retained if other retention criteria are met and a written list of such numbers is returned to the curator in charge at Carnegie Museum of Natural History.
Invertebrate Zoology Inquiries
Issues not clearly addressed by this policy may be settled by contacting curatorial staff by phone, letter, or email. Please request data and specimen loans in writing. Requests received by mail or fax receive priority over those received by email, but either type of written communication is welcome.
Please direct inquiries as follows:
Most requests: James Fetzner Jr.
FetznerJ@CarnegieMNH.Org
Coleoptera: Robert Davidson
DavidsonR@carnegiemnh.org
Written requests should be addressed to:
Pittsburgh, PA 15213-4080 U.S.A.
Invertebrate Zoology Consulting Services
The Section of Invertebrate Zoology uses its resources to offer a variety of research and identification services related to environmental conditions.
History of the Section of Invertebrate Zoology
The entomological collections at Carnegie Museum of Natural History are the continuation of a dream first envisioned by the museum’s early director, William Jacob Holland which was carried through by his successor, Andrey Avinoff. The collection’s historical strength in Lepidoptera results directly from having had these active lepidopterists as influential directors for over half of the museum’s existence.
Holland was America’s great popularizer of butterflies and moths in the first half of this century. Holland’s Butterfly Book (1898) and Moth Book (1903) are both still widely used. Holland established the entomological holdings of Carnegie Museum by the donation of his private collection exceeding 250,000 specimens. He supported active collectors worldwide, obtaining major collections from previously uncollected regions between 1890 and 1930 through the efforts of W. Doherty, H.H. Smith, H.L. Weber, J. Steinbach, S.M. Klages, and many others.
Under Holland’s directorship, curator Hugh Kahl was responsible for the curation and arrangement of the insect collection in the Section of Insects and Spiders until 1940, with a special emphasis on dragonflies.
During Avinoff’s tenure as director in the 1930s and the 1940s, the entomological curators were lepidopterist Walter Sweadner and hymenopterist George Wallace. Sweadner was the first person to attempt comprehensive curation of the already vast Lepidoptera collection and conducted fundamental research on geographical variation and speciation in wild silkworm moths from the western United States.
After Sweadner, Harry Clench became curator and became a leading worker on lycaenid butterflies with a special interest in Caribbean taxa. Clench overlapped with another lepidopterist in the 1960s, curator Richard Fox, who published on African and Neotropical butterflies, especially the delicate but diverse ithomiines from South America.
Meet the Researchers
JIM FETZNER, JR., Ph.D.
Assistant Curator
ROBERT ANDROW, B.S.
Collection Manager
VANESSA VERDECIA, B.S.
Collection Assistant
CATHERINE GILES, M.S.
Curatorial Assistant
HILARY FETZNER, M.S.
JOHN RAWLINS, Ph.D.
Curator Emeritus
Chen Young, Ph.D.
Associate Curator Emeritus
ROBERT DAVIDSON, M.S.
Collection Manager Emeritus
Invertebrate Zoology Blogs
The BSF – Leveraging Our Collections and Expertise to Help Fight Invasive Species
Within the CMNH Section of Invertebrate Zoology resides a program called the Biodiversity Services Facility – the BSF for short. The program …
How to Prepare Insect Specimens
Museum collections play a significant role in helping scientists answer questions about biodiversity and in providing data that may be used for …
Traub Flea Data Books
With work-from-home restrictions in place, I’ve been transcribing the handwritten field notes (Figures 1-2) of world-renowned flea expert Robert Traub into a …
Delving into Lepidoptera Life History Studies
For a number of years now in the Section of Invertebrate Zoology (IZ), we have been rearing larvae (= caterpillars) of different …
“Say Cheese!” – Specimen Imaging in Invertebrate Zoology
“A picture tells 1,000 words.” Specimen imaging is a method of documenting specimens in the Invertebrate Zoology collection for research as well …
Building Webs and Making Connections: Working with the Arachnid Collection
At one point in the long history of Invertebrate Zoology, we went by the name “Section of Insects & Spiders.” It may …
Tarantula relative found at Powdermill
On March 6th, CMNH herpetologist Dr. Danny Hughes came across a very cool spider at Powdermill while digging holes for a salamander …
A Journey to France to Uncover the Mysteries of the Carnegie’s Grand Staircase
The Carnegie Institute has been in existence for 125 years and is one of the greatest architectural buildings ever designed in Pittsburgh. …
Centipede or Millipede? What’s the Difference?
Quick, what was that? It scuttled by in a flash, but you caught a few defining characteristics. It had many legs and …
Section of Invertebrate Zoology Collection Featured in Museum Displays
The Invertebrate Zoology collection is found throughout the museum, including in front of the Carnegie Museum of Natural History gift shop in the grand staircase area—the famous butterfly wall. Invertebrate Zoology collections can be found throughout the museum in other places as well, like on the third floor behind the R. P. Simmons Family Gallery. | cc/2021-04/en_middle_0020.json.gz/line560 |
__label__cc | 0.623439 | 0.376561 | Sangeetha Chengappa
Flipkart crowdsources quality function to college students
College students are made to answer multiple choice questions through a third-party app
Flipkart has come up with a novel way to enhance customer experience and moderate profane user reviews, in preparation for its biggest annual sale, Big Billion Days, in October.
The e-tailer has crowdsourced its quality function to college students, wherein they are made to answer multiple choice questions through a third-party app for which they are paid, while they have no idea that the questions are from Flipkart.
“We started with crowdsourcing the quality function two years ago and have tried to experiment with it in areas such as catalogue quality and user reviews, to raise the bar for our seller and customer experiences, respectively,” Ram Papatla, Vice-President, Product Management, Flipkart, told BusinessLine.
Pointing out that there are two dimensions of quality, objective and subjective, he said: “Examples of objective quality assessment handled internally are: ensuring that our systems scale to the highest level of shopping traffic spikes without crashing during the festival season, and predictable listing workflow for sellers on our platform, where we derive information from supplied images and verify those images with the descriptions sent by the seller, using AI (artificial intelligence).”
For subjective quality assessment, Flipkart resorts to crowdsourcing to involve a larger community of shoppers such as college students, to provide feedback on products and select initiatives. One of the major reasons for this, is to improve its Net Promoter Score among its primary target audience — youth, said Vidhya Shankar, Executive Director, Grant Thornton India.
Crowdsourcing has also helped the e-tailer build a massive repository of training data for its AI models, which moderates profanities in user reviews. Good reviews/ratings are a key factor in driving sales in e-commerce.
“We have built the largest dictionary of profane words in Hindi at Flipkart because there is no way a Microsoft AI dictionary will understand and reject a profane user review without human intervention. We are able to determine the sentiment of a ‘Hinglish’ text through our Neuralnet for Sentiment tracking, by providing millions of samples of annotated text from a crowdsourced project,” said Papatla. He added that it has saved Flipkart several hours of automation costs. However, experts warn that the veracity of the information received via crowdsourcing is highly doubtful.
“Flipkart will only get authentic results if crowdsourcing is done in a controlled environment with a closed group of users that represent the e-tailer’s core target audience, either in its own testing centres or in the user location,” said Srikanth Sundararajan, General Partner, Ventureast. Intuit pioneered this very successfully in the US with its ‘Follow Me Home’ programme, where it observed customers to determine exactly how they use the company’s financial software products, he said. | cc/2021-04/en_middle_0020.json.gz/line563 |
__label__wiki | 0.744148 | 0.744148 | Replicated association of the single nucleotide polymorphism in EDG1 with marbling in three general populations of Japanese Black beef cattle
Shin Sukegawa1,
Takeshi Miyake2,
Yoichi Takahagi1,
Hiroshi Murakami1,
Fumiki Morimatsu1,
Takahisa Yamada2 &
Yoshiyuki Sasaki3
BMC Research Notes volume 3, Article number: 66 (2010) Cite this article
Marbling, defined by the amount and the distribution of intramuscular fat and measured as beef marbling score (BMS), is an economically important trait of beef cattle in Japan. We recently reported that a single nucleotide polymorphism (SNP), namely, c.-312A>G, in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1) gene was associated with the BMS level in the Japanese Black beef cattle population of Oita prefecture, with the G allele being associated with a high level of the BMS. Thus, the c.-312A>G SNP seems to be a candidate marker for marker-assisted selection. In this study, we investigated whether this association could be replicated in 3 other independent Japanese Black cattle populations and analyzed the effect of the SNP genotypes on the carcass traits other than the BMS.
Statistically significant differences in the BMS level were detected among the genotypes of the c.-312A>G SNP in the Japanese black beef cattle populations of Miyazaki (P = 0.0377) and Nagasaki (P = 0.0012) prefectures, and marginal difference was detected in the Kagoshima prefecture population (P = 0.0786). The G allele in the SNP was associated with an increase in the BMS level.
The G allele also seemed to have a favorable influence, if any, on the carcass weight, rib eye area and rib thickness of the cattle populations.
These findings suggest that the association of the c.-312A>G SNP with the BMS level in the Japanese Black beef cattle population was replicated in other beef cattle populations, and revealed favorable effects of the G allele on the beef productivity in the general Japanese Black beef cattle population. Thus, we concluded that the c.-312A>G SNP is useful for effective marker-assisted selection to increase the BMS level in Japanese Black beef cattle.
Intramuscular fat deposition (marbling) measured as beef marbling score (BMS) is one of the economically important traits of beef cattle [1]. A high level of the BMS enriches the taste and tenderness of beef, improving the palatability [2–4], therefore, the BMS affects the evaluation of beef quality [1]. The BMS is regarded as the most important trait especially in Japan. Thus, it would be desirable to construct a more effective marker-assisted breeding scheme for increasing the BMS level in Japanese Black beef cattle.
We recently showed that a single nucleotide polymorphism (SNP), namely, c.-312A>G, in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1) gene was associated with the BMS level in a Japanese Black beef cattle population in Oita prefecture, with the G allele of the SNP being associated with a high level of the BMS [5].
Thus, it was necessary to investigate whether this association could be replicated in other independent populations of Japanese Black beef cattle and to analyze the effects of the SNP genotypes on the carcass traits other than the BMS, in order to confirm the application of the c.-312A>G SNP to effective marker-assisted selection.
Samples and data
We used 3 independent Japanese Black cattle populations, namely, the Kagoshima, Miyazaki and Nagasaki prefecture populations, and studied the association of the c.-312A>G SNP with the BMS, subcutaneous fat thickness (SFT), carcass weight (CWT), rib eye area (REA), and rib thickness (RT). For the Kagoshima, Miyazaki and Nagasaki prefecture populations, respectively, 489, 160 and 191 paternal half-sib progeny steers (1 to 110, 1 to 18, and 1 to 36 steers per sire) produced from 72, 45, and 40 sires were used. Adipose tissue specimens of the progeny steers were collected for genotyping the SNP. DNA samples were prepared from the materials using DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany).
The BMS, SFT, CWT, REA and RT were measured according to the Japanese meat grading system by certified graders from the Japan Meat Grading Association (Tokyo, Japan) [1]. The predicted breeding values of the BMS, SFT, CWT, REA and RT for the progeny steers were used as the phenotypic values in this study. The breeding values were predicted separately for each of the 3 populations using carcass records of Japanese Black steers and heifers fattened in the Kagoshima, Miyazaki and Nagasaki prefectures.
Data were analyzed by the REML method using the MTDFREML program [6], and the genetic and environmental variances were estimated. The BLUP option in the program using the estimated variance components was chosen to predict the breeding values for animals with a single trait model. The sex, market-year, and farm of the animals were considered as the fixed effects. The fattening period and slaughter age were also considered as up to quadratic covariates. The fattening period denotes the period from the start of the fattening to shipping to the market for each animal. Random effects included additive genetic effects of the individuals; that is, the animal model was adopted to predict the breeding values.
This study conformed to the guidelines for animal experimentation of the Graduate School of Agriculture, Kyoto University (Kyoto, Japan).
SNP genotyping
The c.-312A>G SNP was genotyped by the PCR-restriction fragment length polymorphism method as described previously [5]. Using this method, 378-bp PCR fragments containing the SNP site were amplified and MscI-digested into 163- and 215-bp fragments at the A allele, but not the G allele: the GG homozygotes, the AA homozygotes and the AG heterozygotes yielded 1 band (378 bp), 2 bands (163 and 215 bp) and 3 bands (163, 215, and 378 bp), respectively.
The observed frequencies of the SNP genotypes in the 3 populations are shown in Table 1. The observed and expected heterozygosity values at the SNP conformed to the Hardy-Weinberg equilibrium in all the populations. The frequencies of the G allele of c.-312A>G SNP in the Kagoshima and Miyazaki prefecture populations were consistent with the frequency of this allele in the Oita prefecture population determined in our previous study [7], whereas the allele frequency in the Nagasaki prefecture population was lower [7].
Table 1 Frequencies of the c.-312A>G SNP genotypes in the 3 populations
Association analysis
Statistically significant differences in the BMS level were detected among the genotypes of the SNP in the Miyazaki and Nagasaki prefecture populations, by analysis using a model that included the SNP genotype as the fixed effect and the sire as the random effect (Table 2). The BMS level in the GG homozygotes was significantly higher than that in the AA homozygotes, and the values in the heterozygotes were intermediate between those in the 2 homozygotes (Table 2). Theses results were consistent with the data obtained in our previous study in the Oita prefecture population [5]. In the Kagoshima prefecture population, the effects of the SNP genotypes reached marginal significance for the BMS level, with the GG homozygotes showing a tendency to exhibit the highest values among the 3 genotypes. These results suggest that the association of the c.-312A>G SNP with the BMS level was replicated in the general Japanese Black beef cattle populations.
Table 2 Effects of the c.-312A>G SNP genotypes on BMS, BFT, CWT, REA and RT in the 3 populations
The effect of the SNP genotype on the BMS level was not statistically significant in the Kagoshima prefecture population (P > 0.05). The predominant breeding objective is the BMS in the Miyazaki and Nagasaki prefectures, while it is the CWT in the Kagoshima prefecture (Fujita T, personal communication). Thus, many quantitative trait loci (QTL) for the BMS are thought to be fixed in the Miyazaki and Nagasaki prefecture populations, but not in the Kagoshima prefecture population. Our present study might not have sufficient power to detect the association of the c.-312A>G SNP with the BMS level in the Kagoshima prefecture population, because of the larger number of segregating QTL for the BMS in the Kagoshima prefecture population as compared with that in the other two populations. Further study using a larger number of samples is needed for the Kagoshima prefecture population.
The effect of the SNP genotype was not statistically significant for the SFT (Table 2), consistent with the results obtained in the Oita prefecture population [5]. In addition, the SNP genotype had no significant effect on the CWT in the Kagoshima and Miyazaki prefecture populations, on the REA in the Miyazaki and Nagasaki prefecture populations, and on the RT in Kagoshima and Miyazaki prefecture populations (Table 2). However, the effect of the SNP genotype reached statistical significance for the CWT in the Nagasaki prefecture population, for the REA in the Kagoshima prefecture population, and for the RT in the Nagasaki prefecture population. In these cases, the CWT, REA and RT values were significantly higher in the GG homozygotes than in the AA homozygotes, and the values in the heterozygotes were intermediate between those in the 2 homozygotes. Thus, just like its effect on the BMS, the effects of the G allele on carcass traits other than the BMS, if any, seemed to be favorable rather than deleterious.
In this study, we demonstrated replication of the association of the c.-312A>G SNP with the BMS level, and revealed a favorable effect of the G allele on the beef productivity in general Japanese Black beef cattle populations. Together with the results of our previous study [5], these findings suggest that the c.-312A>G SNP in EDG1 is useful for effective marker-assisted selection to increase the level of marbling in Japanese Black beef cattle.
Japan Meat Grading Association: New Beef Carcass Grading Standards. 1988, Tokyo, Japan: Japan Meat Grading Association
Boylston TD, Morgan SA, Johnson KA, Busboom JR, Wright RW, Reeves JJ: Lipid content and composition of Wagyu and domestic breeds of beef. J Agric Food Chem. 1995, 43: 1202-1207. 10.1021/jf00053a015.
Busboom JR, Jeremiah LE, Gibson LL, Johnson KA, Gaskins CT, Reeves JJ, Wright RW: Effects of biological source on cooking and palatability attributes of beef produced for the Japanese market. Meat Sci. 1993, 35: 241-258. 10.1016/0309-1740(93)90054-L.
Matsuishi M, Fujimori M, Okitani A: Wagyu beef aroma in Wagyu (Japanese Black cattle) beef preferred by the Japanese over imported beef. Anim Sci J. 2001, 72: 498-504.
Yamada T, Itoh M, Nishimura S, Taniguchi Y, Miyake T, Sasaki S, Yoshioka S, Fujita T, Shiga K, Morita M, Sasaki Y: Association of single nucleotide polymorphisms in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 gene with marbling in Japanese Black beef cattle. Anim Genet. 2009, 40: 209-216. 10.1111/j.1365-2052.2008.01822.x.
Boldman KG, Kriese LA, Van Vleck LD, Van Tassell CP, Kachman SD: A Manual for Use of MTDFREML, A Set of Programs to Obtain Estimates of Variances and Covariances. 1995, Washinton, DC: Agricultural Research Servise, United States Department of Agriculture
Watanabe N, Yoshioka S, Itoh M, Satoh Y, Furuta M, Komatsu S, Sumio Y, Fujita T, Yamada T, Sasaki Y: The G allele at the c.-312A>G in the EDG1 gene associated with high marbling in Japanese Black cattle is at a low frequency in breeds not selected for marbling. Anim Genet. 2009, 40: 579-10.1111/j.1365-2052.2009.01871.x.
We are grateful to Nipponfeed Inc. for kindly providing us with the adipose tissue samples and phenotypic data.
Research and Development Center, Nippon Meat Packers, Inc, Tsukuba, Ibaraki, 300-2646, Japan
Shin Sukegawa, Yoichi Takahagi, Hiroshi Murakami & Fumiki Morimatsu
Laboratory of Animal Breeding and Genetics, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan
Takeshi Miyake & Takahisa Yamada
Kyoto Cattle Genetics Section, Beef Information &, Genetics Institute, Inc, Otsu, Shiga, 520-0865, Japan
Yoshiyuki Sasaki
Shin Sukegawa
Takeshi Miyake
Yoichi Takahagi
Hiroshi Murakami
Fumiki Morimatsu
Takahisa Yamada
Correspondence to Takahisa Yamada.
SS carried out the genotyping and statistical analyses and drafted the manuscript. TM carried out further statistical analyses. YT, HM and FM participated in the sample and data collection. TY and YS participated in the design and coordination of the study and helped draft the manuscript. All authors read and approved the final manuscript.
Sukegawa, S., Miyake, T., Takahagi, Y. et al. Replicated association of the single nucleotide polymorphism in EDG1 with marbling in three general populations of Japanese Black beef cattle. BMC Res Notes 3, 66 (2010). https://doi.org/10.1186/1756-0500-3-66
Single Nucleotide Polymorphism Genotype
Carcass Trait
Single Nucleotide Polymorphism Site | cc/2021-04/en_middle_0020.json.gz/line567 |
__label__wiki | 0.692389 | 0.692389 | Very low sensitivity of wet mount microscopy compared to PCR against culture in the diagnosis of vaginal trichomoniasis in Uganda: a cross sectional study
Sheila Nabweyambo1,
Othman Kakaire2,
Stefanie Sowinski3,
Alfred Okeng4,
Henry Ojiambo3,
Joshua Kimeze3,5,
Irene Najjingo4 &
Freddie Bwanga ORCID: orcid.org/0000-0002-8898-09921,4
Trichomonas vaginalis (TV) causes the Trichomoniasis Syndrome composed of vaginitis in women, urethritis in men and tube infection in both sexes. This infection is strongly associated with premature rupture of membranes, preterm delivery, low birth weight, promoting HIV sexual transmission and infertility. Prevention of these complications requires accurate early detection and effective treatment of infected individuals. In the resource limited settings, the wet mount microscopy (WMM) is often the only available test for laboratory detection of TV, but its accuracy and that of polymerase chain reaction (PCR) tools in Uganda remain poorly studied. The aim of this cross-sectional study was to compare the diagnostic accuracy of the WMM and PCR against culture as reference standard for the direct diagnosis of TV among symptomatic women. Three high vaginal swabs were collected from each of one hundred fifty women presenting with symptoms suggestive of active vaginal trichomoniasis at the sexually transmitted diseases clinic of Mulago National Referral Hospital Kampala, Uganda. The swabs were tested for TV with WMM, in-house PCR and TV culture. Results were analysed using excel 2007, SPSS v16, and Meta-disc software to determine the diagnostic accuracy of the tests.
The sensitivity, specificity and kappa agreement of the WMM was 25% (95% CI 5.5–57.2%), 100% (95% CI 97–100) and 0.38, respectively. Corresponding values for the PCR were 91.7% (95% CI 61.5–99.8), 99.3% (95% CI 96–100) and 0.91, respectively.
Among the TV symptomatic women, the sensitivity of the WMM was very low, with two-thirds of the patients missing a diagnosis while the in-house PCR was highly sensitive and specific. Feasibility studies aimed at incorporating PCR tools in algorithms for diagnosis of TV infection in resource-limited settings are recommended.
Trichomonas vaginalis (TV) is an extracellular, facultative anaerobic infection of the human urogenital tract. Infection is associated with premature rupture of membranes, preterm delivery, low birth weight, HIV sexual transmission [1], and pelvic inflammatory disease [2,3,4]. The WHO estimates that at least 174 million cases of infection are acquired annually worldwide, majority in regions of low income settings [5, 6]. The prevalence of TV infection differs in different subpopulation groups, e.g. in women, it is estimated to be ten times higher than in males [7, 8]. In the USA, 13% of black women are affected compared with 1.8% of non-Hispanic white women [9], but a higher prevalence has been reported among STD clinic patients i.e. 26% of symptomatic women and 6.5% asymptomatic women tested [9]. In Tanzania and Uganda, a TV prevalence of 41% in Mwanza and 31% in Rakai district, respectively was reported [10]. Most infected persons (70–85%), both men and females have minimal or no symptoms, and untreated infections might last for months to years [11]. Early accurate detection of TV infection in both symptomatic and asymptomatic women plus effective treatment is critical in the prevention of associated complications especially during pregnancy [11].
The diagnosis of TV infection in the current study setting relies on clinical symptoms with or without wet mount microscopy (WMM). Clinical symptoms tend to be non-specific as they cut across a number of other STDs, and are therefore poor indicators of TV infection. The WMM is a rapid and inexpensive test as it involves examination of vaginal fluid in saline under low power microscopy. However, it is associated with limited sensitivity of 38–65% as it depends highly on the expertise of the Microscopist, and prompt processing of samples before the organisms lyse or lose motility, and its sensitivity is even lower among the asymptomatic patients [11,12,13]. Culture for TV, with sensitivity of 75–96% and a specificity of up to 100%, used to be considered the reference standard for TV diagnosis before molecular tests became available [14]. However, due to its high cost and lengthy time to results of up to 7 days, culture is rarely used in routine setting of resource-poor settings in the diagnosis of TV infection [15].
Recent advancement has led to the development of highly sensitive and specific polymerase chain reaction (PCR)/nucleic acid amplification techniques/tests (NAATs) that offer faster means to detection of TV infection in endocervical, vaginal, or urine specimens from women. These include The APTIMA T. vaginalis assay (Hologic Gen-Probe, San Diego, CA), which detects RNA by transcription-mediated amplification with a sensitivity of 95.3–100% and specificity of 95.2–100% [16], the BD Probe Tec TV Qx Amplified DNA Assay (Becton–Dickinson, Franklin Lakes, New Jersey), and the Affirm VP III (Becton–Dickinson, Sparks, MD), a DNA hybridization probe test that evaluates for T. vaginalis, G. vaginalis, and Candida albicans, in only 45 min with sensitivity and specificity of 63 and 99.9%, respectively [17]. Studies on the performance of these PCR assays have mainly been conducted in the developed countries such as USA, Europe, and Australia, and show PCR sensitivity to be 89–98% [18, 19]. These NAATs have become routine assays in developed countries however, in the resource-limited settings the high cost of these commercially available NAATs remains a prohibitive challenge to their use. The objective of this study was to evaluate the technical performance of a cheaper in-house PCR technique in comparison with the conventional WMM against culture as reference standard test for the diagnosis of TV infection in Uganda.
This was a cross-sectional prospective and consecutive diagnostic accuracy study conducted from March 2014 to March 2015, at the STD clinic Mulago national referral hospital. Laboratory tests including WMM, PCR and culture were performed at the STD clinic, MBN Clinical Laboratories and Infectious Diseases Institute respectively, all in Kampala, Uganda.
A total of 150 female participants aged 18–60 years attending the STD clinic with symptoms suggestive of TV infection e.g. malodour, abnormal discharge, painful sexual intercourse, dysuria, genital itching and lower abdominal pain voluntarily consented to participate in the study. Exclusion criteria included refusal to consent, being in menstrual period, and history of taking nitro-imidazoles within the past 2 weeks Additional file 1.
Three vaginal swabs were collected from the posterior fornix by an experienced clinician under a Cusco’s speculum guidance.
Wet mount microscopy
One vaginal swab was emulsified in three drops of 0.9% saline on a glass slide and examined for motile trichomonads under 100× and 400× microscopy within 30 min of collection as routinely done at the clinic. Microscopic examination was done by one experienced laboratory technician at the STD clinic and by the researcher. Presence of motile trichomonads indicated a positive result for TV infection. No discrepant results were obtained between the two viewers.
The second vaginal swab was used within around 20 min to inoculate the InPouch™ TV culture chambers (BioMed Diagnostics, USA) at the STD clinic laboratory following the manufacturer’s instructions. Inoculated chambers were incubated in an upright position at 37 °C for up to 7 days. Microscopic examinations were performed on days 1, 2, 3 5 and 7 to check for the presence of motile trichomonads in the upper chamber (Additional file 2).
In-house PCR for TV
PCR swabs were temporarily stored up to 3 weeks at minus 20 °C to prepare for batched DNA extraction and PCR assays.
Extraction of TV DNA (if present) was performed using the phenol chloroform method. Briefly, each swab was dipped in sterile 10% sodium dodecyl sulphate (SDS) solution contained in a 1.5 ml eppendorf tube, and heated for 5 min at 65 °C. The swabs were then squeezed against the wall of the tube to express fluids. A volume of 100 µl of sodium acetate was added to neutralize the alkaline component of the lysis solution. A volume of 600 µl of phenol chloroform and 25 µl PCR water was then added. The mixture was vortexed and span at maximum speed (14000 rpm) for 30 min. Purification of extracted DNA was achieved by precipitation using absolute isopropanol. Final DNA precipitate was dissolved in 50 µl of PCR water and stored at −20 °C until amplification.
DNA Amplification
Each PCR reaction tube contained 1.0 µl of 25 mmol Magnesium chloride, 1.0 µl, Forward primer 1.0 µl, Reverse primer, 0.1 µl Taq polymerase, master mix with dNTPs 1.0 µl and PCR water 7.0 µl, giving a final volume of 11.1 µl. The forward primer AP65 A_5′GATTCCTCTTCACACACCCACCAG3′ and Reverse primer AP65 B_5′AATACGGCCAGCATCTGTAACGAC3′ were designed to target a conserved region in the AP65 adhesin genes of T. vaginalis, giving a 209 base pair (bp) amplification product [20]. Template DNA 2 µl was added to the mixture and loaded onto a Gene Amp PCR System 9700 Thermocycler (Applied Biosystems Inc.). The amplification program included one cycle of initial denaturation at 95 °C for 5 min, followed by 30 cycles of: denaturation at 94 °C for 45 s, annealing at 53 °C for 45 s, extension at 72 °C for 45 s, followed by one cycle of final extension at 72 for 10 min and storage at 4.0 °C.
Detection of amplification products
This was performed with 1.5% agarose gel electrophoresis at 120 volts for 45 min. Gel images were viewed under ultraviolet light trans-illuminator and a gel picture taken with a digital UV camera. Presence of 209 bp band on the gel as indicated a positive result for TV (Fig. 1).
Gel electrophoresis image of post PCR products of the Trichomonas vaginalis Adhesin gene. Lanes 1 and 12: 1000 bp Ladder, Lane 2: Positive control (PC) showing a 209 bp band size, Lane 3, 6, 7, 9, and 13: Samples positive for TV, Lane 4, 5, 8, 10, 11, and 12: Samples Negative for TV, Lane 15: Negative control (NC)
Each batch of PCR included controls at all stages. Positive controls included DNA extracted from a clinical isolate of Trichomonas vaginalis grown in vitro, while negative controls consisted of nuclease-free water in the place of template DNA. A 1000 kb ladder (Solis BioDye) was used as a size marker.
The table showing all the analysed study data is provided as Additional file 3.
Demographic and clinical characteristics of study participants
The demographics and other clinical details of the studied participants are summarised in Table 1.
Table 1 Demographic and clinical characteristics of study participants (N = 150)
Prevalence of TV infection
Out of 150 participants, 13 were diagnosed with TV infection using either one, two or all the three tests giving a prevalence of 9% as detailed in Table 2.
Table 2 Prevalence of TV infection by each test (n = 150)
It was found that 69% of all the confirmed infection (by culture) cases had an abnormal vaginal discharge, 54% with dysuria, 46% with genital itching, 31% with malodor, and 31% with lower abdominal pain.
Sensitivity and specificity of WMM and PCR against culture
Using culture as reference standard, the sensitivity, specificity and kappa agreement of wet mount microscopy was 25% (95% CI 5.5–57.2), 100% (95% CI, 97.4–100.0), and 0.38 respectively. Corresponding values for the in-house PCR were 91.7% (95% CI, 61.5–99.8), specificity 99.3% (95% CI, 96–100.0) and 0.91 in the detection of TV in high vaginal swabs among symptomatic women in Uganda. See Table 3 for details.
Table 3 Accuracy of wet mount microscopy and in-house PCR against Culture for TV diagnosis
The prevalence of TV infection in this study was 8.6% based on all positive tests. Various studies report different prevalence values ranging from 13 to 41% based on the methods used, study settings, social-demographics and symptomatology of studied populations [4, 9, 10]. In high-risk populations such as female sex workers in sub-Saharan Africa (SSA), the prevalence of active TV infection can be as high as 47% [21]. However, the relationship between symptoms and presence of active TV infection also varies since the symptoms are not very specific. In this study, less than 10% of symptomatic women were confirmed with TV infection. Thus, it appears that in the studied population, TV infection diagnosis requires diagnostic algorithms that include highly sensitive laboratory tests. The in-house PCR was highly sensitive and specific for the detection of TV DNA in vaginal swabs, and far out performed the routinely used WMM in the study setting. In our study, the phenol chloroform method was employed for DNA extraction. If costs would allow, it would be better to use extraction columns like silica-membrane-based DNA purification, believed to increase TV detection; consequently the prevalence of trichomoniasis could probably have been higher in our study. Methodological issues can also affect WMM. Studies elsewhere have shown that the low sensitivity of WMM can further be decreased by 20% with delayed microscopic examination for as few as 10 min [22]. In our study, even when the wet preparation was performed at the sample collection site, by the experienced reader who routinely performs the wet preparations at the clinic, its sensitivity (25%) was still poor. Various studies using related but not exactly the same study designs report the sensitivity of WMM to range from around 38 to 65% [4, 11, 18, 23]. Testardini et al. reported sensitivity of WMM of 45.8% in all the patients studied but it increased to 87.5% in symptomatic patients but in their study, one millilitre of physiologic saline was used instead three drops [4]. Use of three drops instead of 1 ml of physiologic saline solution could be a limitation leading to the lower sensitivity of WMM obtained in our study. These results all together indicate the superiority of PCR over WMM.
Two discrepant results emerged between PCR and culture, one of which was culture positive and PCR negative, and the other culture negative and PCR positive. For the PCR negative sample, we suspect that the PCR swab may have been poorly collected, such that extracted DNA was below the limit of PCR detection. Non-specific PCR inhibitors in the sample could also have inhibited amplification. A strategy to find out this would be inclusion of controls for the presence of amplifiable DNA and PCR inhibitors in each clinical sample using PCR for a human gene. If any sample remains negative for this gene, it would not be included in the data analysis. Consequently, the prevalence of trichomoniasis could have been slightly different, and this could be a limitation in our study. Too much DNA could also inhibit amplification requiring dilution of extracted DNA to optimize the PCR reaction. A dilution of the sample could correct the inhibitory effect, so the results could be positive and consequently, the prevalence of trichomoniasis could have been higher. However, when we diluted and repeated the PCR test, the results remained unchanged.
Regarding the PCR-positive culture negative result, this result may not really be a false positive because the PCR has recently been reported to be more sensitive than culture [24]. This result could also be due to inoculation of culture media with already dead organisms in the sample. Since PCR detects presence of DNA, it is not affected by the viability of the microorganisms in the sample. All positive WMM results were also positive with both the PCR and culture results. It appears that to improve the diagnosis of TV infection, combining methods with higher sensitivity such as culture and PCR are recommended, mainly in asymptomatic pregnant women.
Implications of our findings
Given the high risks of TV infection to pregnancy and increased HIV transmission/acquisition, prompt detection and treatment should be considered critical. Combined methods such as culture and PCR is recommended, since culture depends only on the viability of the microorganism and PCR is unaffected by dead organisms but by inhibitors.
Among the TV symptomatic women, the sensitivity of the WMM was very low, with two-thirds of the patients missing a diagnosis while the in-house PCR was highly sensitive and specific. Feasibility studies aimed at incorporating PCR tools in algorithms for diagnosis of TV infection among symptomatic women in resource-limited settings are recommended. For WMM, increasing the sample volume and volume of saline to one ml might help to increase the test sensitivity.
HIV:
NAATs:
nucleic acid amplification tests
PCR:
revolutions per minute
STD:
STI:
sexually transmitted infection
Trichomonas vaginalis
WMM:
µl:
micro litre
Van der Pol B. Trichomonas vaginalis infection: the most prevalent nonviral sexually transmitted infection receives the least public health attention. Clin Infect Dis. 2007;44(1):23–5.
Cherpes TL, Wiesenfeld HC, Melan MA, Kant JA, Cosentino LA, Meyn LA, et al. The associations between pelvic inflammatory disease, Trichomonas vaginalis infection, and positive herpes simplex virus type 2 serology. Sex Transm Dis. 2006;33(12):747–52.
Cotch MF, Pastorek JG 2nd, Nugent RP, Hillier SL, Gibbs RS, Martin DH, et al. Trichomonas vaginalis associated with low birth weight and preterm delivery. The Vaginal Infections and Prematurity Study Group. Sex Transm Dis. 1997;24(6):353–60.
Testardini P, Vaulet ML, Entrocassi AC, Menghi C, Eliseht MC, Gatta C, et al. Optimization of Trichomonas vaginalis Diagnosis during Pregnancy at a University Hospital, Argentina. Korean J Parasitol. 2016;54(2):191–5.
World Health Organization: Global prevalence and incidence of selected curable sexually transmitted infections. Geneva: WHO Press. 2001.
World Health Organization. The world health report making a difference. Geneva: Organisation Press; 1999. p. 2010.
HobbsMM, Sena AC, Swygard H, Schwebke JR. Trichomonas vaginalis and trichomoniasis. In: Holmes K, Holmes KK, Sparling PF, Sparling P, Stamm WE, Stamm W, Piot P, Wasserheit, JN, Wasserheit J, Corey L, Cohen MS, Cohen M (Eds). Sexually transmitted diseases. 2008. p. 771–793.
Poole DN, McClelland RS. Global epidemiology of Trichomonas vaginalis. Sex Transm Infect. 2013;89(6):418–22.
Sutton M, Sternberg M, Koumans EH, McQuillan G, Berman S, Markowitz L. The prevalence of Trichomonas vaginalis infection among reproductive-age women in the United States, 2001–2004. Clin Infect Dis. 2007;45(10):1319–26.
Orroth KK, Korenromp EL, White RG, Changalucha J, de Vlas SJ, Gray RH, et al. Comparison of STD prevalences in the Mwanza, Rakai, and Masaka trial populations: the role of selection bias and diagnostic errors. Sex Transm Infect. 2003;79(2):98–105.
Workowski KA, Bolan GA. Sexually transmitted diseases treatment guidelines, 2015. MMWR Recomm Rep. 2015;64(RR-03):1–137.
Radonjic IV, Dzamic AM, Mitrovic SM, Arsic Arsenijevic VS, Popadic DM, Kranjcic Zec IF. Diagnosis of Trichomonas vaginalis infection: the sensitivities and specificities of microscopy, culture and PCR assay. Eur J Obstet Gynecol Reprod Biol. 2006;126(1):116–20.
Caliendo AM, Jordan JA, Green AM, Ingersoll J, Diclemente RJ, Wingood GM. Real-time PCR improves detection of Trichomonas vaginalis infection compared with culture using self-collected vaginal swabs. Infect Dis Obstet Gynecol. 2005;13(3):145–50.
Nye MB, Schwebke JR, Body BA. Comparison of APTIMA Trichomonas vaginalis transcription-mediated amplification to wet mount microscopy, culture, and polymerase chain reaction for diagnosis of trichomoniasis in men and women. Am J Obstet Gynecol. 2009;200(2):188-e1–7.
Fouts AC, Kraus SJ. Trichomonas vaginalis: reevaluation of its clinical presentation and laboratory diagnosis. J Infect Dis. 1980;141(2):137–43.
Sosman JM, MacGowan RJ, Margolis AD, Eldridge E, Flanigan T, Vardaman J, et al. Screening for sexually transmitted diseases and hepatitis in 18–29 year-old men recently released from prison: feasibility and acceptability. Int J STD AIDS. 2005;16(2):117–22.
Andrea SB, Chapin KC. Comparison of Aptima Trichomonas vaginalis transcription-mediated amplification assay and BD affirm VP III for detection of T. vaginalis in symptomatic women: performance parameters and epidemiological implications. J Clin Microbiol. 2011;49(3):866–9.
Simpson P, Higgins G, Qiao M, Waddell R, Kok T. Real-time PCRs for detection of Trichomonas vaginalis beta-tubulin and 18S rRNA genes in female genital specimens. J Med Microbiol. 2007;56(Pt 6):772–7.
Nathan B, Appiah J, Saunders P, Heron D, Nichols T, Brum R, et al. Microscopy outperformed in a comparison of five methods for detecting Trichomonas vaginalis in symptomatic women. Int J STD AIDS. 2015;26(4):251–6.
Alderete JF, O’Brien JL, Arroyo R, Engbring JA, Musatovova O, Lopez O, et al. Cloning and molecular characterization of two genes encoding adhesion proteins involved in Trichomonas vaginalis cytoadherence. Mol Microbiol. 1995;17(1):69–83.
Rassjo EB, Kambugu F, Tumwesigye MN, Tenywa T, Darj E. Prevalence of sexually transmitted infections among adolescents in Kampala, Uganda, and theoretical models for improving syndromic management. J Adolesc Health. 2006;38(3):213–21.
Kingston MA, Bansal D, Carlin EM. ‘Shelf life’ of Trichomonas vaginalis. Int J STD AIDS. 2003;14(1):28–9.
Wendel KA, Erbelding EJ, Gaydos CA, Rompalo AM. Trichomonas vaginalis polymerase chain reaction compared with standard diagnostic and therapeutic protocols for detection and treatment of vaginal trichomoniasis. Clin Infect Dis. 2002;35(5):576–80.
Domeika M, Zhurauskaya L, Savicheva A, Frigo N, Sokolovskiy E, Hallen A, et al. Guidelines for the laboratory diagnosis of trichomoniasis in East European countries. J Eur Acad Dermatol Venereol. 2010;24(10):1125–34.
SN participated in study design, data collection, sample analysis, data analysis and preparing the first draft of the manuscript. OK participated in critical review of the study design, protocol and the manuscript. SS contributed in the critical review of the study design, protocol, and the manuscript. AO, and IN participated in sample processing and analysis in the laboratory and review of the manuscript, HO participated in sample processing, analysis and review of manuscript, JK participated in sample collection and review of the manuscript. FB participated in study design, sample analysis, data analysis and critical review of the manuscript. All authors read and approved the final manuscript.
We are grateful to the staff of STD clinic for their support in sample collection, the MBN Clinical Laboratories staff, the Translational Research Laboratory staff, and the Microbiology Department of Makerere University. Your contribution towards the success of this project is greatly appreciated.
All data generated and analyzed during this study are included in this published article as Additional file 3.
Patients consented to publication of the findings without their personal identifier information.
This study was approved by the School of Biomedical Sciences Higher Degrees Research and Ethics Committee (SBS-HDREC) of Makerere University, College of Health Sciences; (Approval file No: SBS 164). All study participants voluntarily consented to participate in the study.
This study was funded by the researchers SN, FB and by MBN Clinical Laboratories.
Department of Medical Microbiology, Makerere University College of Health Sciences, P.O. Box 7072, Kampala, Uganda
Sheila Nabweyambo & Freddie Bwanga
Department of Obstetrics/Gynaecology, Makerere University College of Health Sciences, P.O. Box 7072, Kampala, Uganda
Othman Kakaire
Infectious Diseases Institute, Makerere University College of Health Sciences, P.O. Box 22418, Kampala, Uganda
Stefanie Sowinski, Henry Ojiambo & Joshua Kimeze
MBN Clinical Laboratories, P.O. Box 35135, Kampala, Uganda
Alfred Okeng, Irene Najjingo & Freddie Bwanga
Sexually Transmitted Diseases Clinic Mulago Hospital Kampala, Kampala, Uganda
Joshua Kimeze
Sheila Nabweyambo
Stefanie Sowinski
Alfred Okeng
Henry Ojiambo
Irene Najjingo
Freddie Bwanga
Correspondence to Freddie Bwanga.
Additional file 1.
InPouch™ TV culture chambers.
Motile trichomonads as seen microscopically in the InPouch™ TV culture chambers (400×).
Dataset analyzed for sensitivity and specificity of WMM and in-house PCR.
Nabweyambo, S., Kakaire, O., Sowinski, S. et al. Very low sensitivity of wet mount microscopy compared to PCR against culture in the diagnosis of vaginal trichomoniasis in Uganda: a cross sectional study. BMC Res Notes 10, 259 (2017). https://doi.org/10.1186/s13104-017-2581-1 | cc/2021-04/en_middle_0020.json.gz/line568 |
__label__wiki | 0.81915 | 0.81915 | Luis Rajmil Retired, Barcelona, Spain PubMed articlesGoogle scholar articles
David Taylor-Robinson Department of Public Health and Policy, University of Liverpool, Liverpool, UK PubMed articlesGoogle scholar articles
Geir Gunnlaugsson Faculty of Social and Human Sciences, University of Iceland, Reykjavik, Iceland PubMed articlesGoogle scholar articles
Anders Hjern Centre for Health Equity Studies (CHESS), Stockholm University/Karolinska Institutet, Stockholm, Sweden PubMed articlesGoogle scholar articles
Nick Spencer Division of Mental Health and Wellbeing, Warwick Medical School, University of Warwick, Coventry, UK PubMed articlesGoogle scholar articles
Correspondence to Dr Luis Rajmil; 12455lrr{at}comb.cat
Rajmil L, Taylor-Robinson D, Gunnlaugsson G, et al
BMJ Open 2018;8:e022932. doi: 10.1136/bmjopen-2018-022932
Received March 13, 2018
Accepted August 22, 2018
First published October 12, 2018.
Review history
© Author(s) (or their employer(s)) 2018. Re-use permitted under CC BY. Published by BMJ. This is an open access article distributed in accordance with the Creative Commons Attribution 4.0 Unported (CC BY 4.0) license, which permits others to copy, redistribute, remix, transform and build upon this work for any purpose, provided the original work is properly cited, a link to the licence is given, and indication of whether changes were made. See: https://creativecommons.org/licenses/by/4.0/. | cc/2021-04/en_middle_0020.json.gz/line569 |
__label__wiki | 0.627577 | 0.627577 | What is the meaning of [designer-board-games]?
We have a tag called designer-board-games, and I'm not sure what it means. There is no tag wiki and it is currently tagged on a question about game design, and question about physical vs computer implementations of board games, and a question about Agricola.
Best explanation I could find for a designer board game is an About.com article, but it is still pretty vague. I get the impression that there is no universal definition.
So does designer-board-games have a clear meaning? And if not, should we delete it?
ThunderforgeThunderforge
Weird. I have no idea what it'd be referring to. – doppelgreener Feb 29 '16 at 5:10
I think we should get rid of the tag.
It refers to the distinction between mass-market board games (Monopoly, Clue, etc) and less widely published/sold board games. Think of things that might conceivably have the designer's name on the box. (See corsiKa's answer for a more detailed description.)
As far as the tag goes, I don't think it serves much purpose, and we could easily get rid of it. Most of the games we get questions about are designer board games by this definition, and there's not much point in a tag that would apply to most questions on the site.
We have game-design to cover most higher-level questions, and it's seen plenty of use.
There were three questions actually tagged designer-board-games when I wrote this answer. One was just about Agricola, so I removed it. The other two are:
Do physical implementations of single player board games have any advantages over their electronic counterparts? - the key here is really that it's asking about computer versions of games, so I removed designer-board-games, leaving it with just computers. (That seems like it should be computer-versions or something but oh well, this is what the tag wiki says it's for.)
How does the cost of designer board games compare to other forms of entertainment? - I'm not sure how to tag this. It's really about costs. But it doesn't seem like it's more about board games than anything else on the site. We could tag it prices or something, but given that it's closed now and that'd be the only question with that tag, doesn't seem worth worrying about.
Cascabel♦Cascabel
The last question about the cost of designer board games had a meta question where the highest rated answer was that it was off topic and should be closed. I went ahead and added a close vote to it. – Thunderforge Mar 8 '16 at 3:49
A designer board game is one that costs signficantly more than your mass produced board games.
You can usually buy a box of Monopoly in the box for around $20. It might have a special edition that pumps that up a few extra bucks for the licensing fee, but it's normally around there. Most common board games (what people think of when you say board games) are in this price range.
Designer board games usually cost at least $50, and sometimes as much as $100. And just like designer jewelry, the consumers of these games are usually both wealthier and more knowledgeable about the games. In some cases, the extra cost is because the game itself is more complicated, but this is not usually the case. Consider a game like Risk which has hundreds of pieces and is still usually available for pretty cheap. The real cost is because the print runs are much lower, and the design costs are much higher.
corsiKacorsiKa
Is this definition from your own observations or do you have some source for this? Either way, it doesn't seem to match the current usage of the tag (which may mean it's not a good tag). – Thunderforge Mar 3 '16 at 21:00
Is this answer implying that there are essentially Gucci board games, where you could look at it and say "That's a Gucci!" For example, you can look at a GMT Games game and pretty much know it's made by GMT Games. And if that's the case, it doesn't seem like a useful tag because it doesn't generally help organize the site, which is generally tagged by the name of the game, not whether I should be jealous of your handbag. – SocioMatt Mar 3 '16 at 21:28
@Thunderforge It's directly in line with the original usage of the tag back in 2012. – corsiKa Mar 3 '16 at 21:38
@SocioMatt It was originally used to ask about the genre of game. And yes, it is implying that there is a "class system" to games. And yes, most designer game players I know will strongly look down on budget board games with a very snobbish attitude. – corsiKa Mar 3 '16 at 21:42
@corsiKa I guess my joke didn't hit right. What I was getting at is that the tag doesn't help organize questions any better than the board game name tags that get attached to every question anyway. Anybody who only plays designer board games would know which game questions to avoid and which ones were up their alley. Hence it seems like a deprecated tag. – SocioMatt Mar 3 '16 at 21:46
@SocioMatt So what if someone wanted to discuss the philosophical differences between stock board games and designer board games? – corsiKa Mar 3 '16 at 22:22
@corsiKa I would think that question would fit under game-design or something related (assuming it wasn't closed as primarily opinion-based or off-topic). Not to mention that the tag wiki should have the information about what defines a designer board game, so any differences would be defined there, making the usefulness of that question pretty small. That question would also need the tag "stock-board-game," and if we create that, we run the risk of every Ticket to Ride question being marked with an additional tag that doesn't add value to how questions are organized. – SocioMatt Mar 4 '16 at 13:50
Agreed: game-design seems to cover high-level questions about categories of games, and for everything else, this smells like a meta tag. If you're asking about a specific game or even a specific group of games, it's not really that important to categorize them as "designer" or "mass-market". – Cascabel♦ Mar 4 '16 at 15:34
The way I see this tag possibly being used is when a game has multiple editions where the difference is the quality of the game materials. A couple of exmples of this is. Hanabi which has a normal card based version and several deluxe versions where tiles replace the cards. Takenoko where there is a normal version and a deluxe version that is made of better material and is larger in size.
Overall I am not sure if this is a needed tag but when I think of it as the same games but made out of better materials then the normal game and with possible extras that you can't otherwise get. Or in other words a collectors edition.
Joe WJoe W
12k1010 silver badges1717 bronze badges
If we wanted a tag for that purpose I don't think [designer-board-games] is what we want the tag to be. Something like [collectors-edition] or [deluxe-edition] would probably be better. – diego Mar 15 '16 at 20:38
@diego That is why i said possibly used that way. Not sure a tag for this would be valuable anyway. – Joe W Mar 15 '16 at 20:39
Not the answer you're looking for? Browse other questions tagged discussion tags .
This site is for discussion about Board & Card Games Stack Exchange. You must have an account there to participate.
Is this really on topic: Cost of board games vs. other entertainment?
Should the FAQ Description of Board and Card Games reflect both Board and Card games?
What shall we call the tag for Sid Meier's Civilization: The Board Game (2010)?
Are computerized versions of board and card games on topic?
Should Arqade migrate questions about online board games here?
One crayon-rail-games tag to rule them all?
Let's clean up these very-specific Go tags
Isn't intellectual property (marked off-topic somewhere) part of the game-design process (on-topic in the help center)?
Request for [parcheesi] to be a tag synonym of [pachisi]
Should new board games be self contained in the post? | cc/2021-04/en_middle_0020.json.gz/line571 |
__label__wiki | 0.69423 | 0.69423 | Music Lust
by Sara Bir
Teen Angel: Pamela Des Barres made the scene when she was just 16.
Two women relate highly personal tales of fandom
Pamela Des Barres has become the go-to gal for juicy, insider tidbits in various rock-related documentaries and VH1 specials. There we see her brunette-framed talking head, looking and sounding not unlike a friendly next-door neighbor who stopped by to have some tea, recounting sunnily sordid remembrances of the L.A. glory days in the late 1960s and early ’70s, when she was a sweet, golden-haired flower child. Perhaps the present-day franchising of her groupie persona is cleverly engineered, but perhaps it is not. She was, after all, there–there being Jimmy Page’s limo, Mick Jagger’s crotch and Keith Moon’s thrashed hotel rooms–and it’s all but impossible for any rock-loving human, let alone television producer, to resist the pull of an all-access perspective.
Des Barres cemented her groupie-goddess status with her free-spirited 1987 tell-all book I’m with the Band: Confessions of a Groupie. It covers her life as a young rock muse, from her preteen grieving for an enlisted Elvis to her marriage to walking-glam-rock-disaster Michael Des Barres. In between, hearts break, body liquids swap, chemical-fueled revelations abound and music thrives.
I’m with the Band was out of print for years until 2005, when an updated edition came out on Chicago Review Press. The book is still eminently readable, offering all the fun of a trashy read without resorting to sensationalism or mean-spiritedness. Des Barres’ writing is as gauzy and flowing as her threadbare satin and antique lace ensembles of the late ’60s; she adopts a sort of Beat/teenybopper style, striving for the Deep and Profound. But even when her gushy-gushy leanings get the best of her, Des Barres’ sentiments always ring with joie de vivre, unleashing positive vibes galore.
In his forward to the updated edition, wanker guitarist Dave Navarro calls Des Barres “one of the most unique and important rock historians of our time.” I initially found this proclamation laughable, a statement dripped from Navarro’s pen to score some kiss-ass points with his pal Miss Pamela. But after some consideration, I felt ashamed of my snobbism. Just because Des Barres’ writing does not reek of the academic postulation and dry reductionism of “serious” rock criticism–she’s not part of the boys’ club with Christgau, Marcus, et al.–does not discount her insights. If anything, it deems them more primal, more direct and more powerful. “Mick Jagger personified a penis,” she says of her earliest erotic dalliances with the Stones. If that’s not 100 percent rock ‘n’ roll, I don’t know what is.
Even at her most debauched, the Des Barres of I’m with the Band strives to become a good human being of some impact on the world. Her constant run-ins with world-famous musicians simultaneously distract her from this goal and help her to attain it. “Something came over me in the presence of rock idols, something vile and despicable, something wondrous and holy.” That something is awe, but she still manages to see the boys behind the gods. “I hope I brought some warm flesh and blood to the myth, before it’s too late,” she writes, fearing that giants of rock such as Hendrix, Zappa and Morrison will be “mythologized and made more (or less) than human.”
Glam Slam: Pamela and Michael Des Barres, photographed on the day they met.
The moral conflict in Karen Schoemer’s Great Pretenders: My Strange Love Affair with 50s Pop Music ($25; Free Press) is much less one of behavior than it is one of taste. An adult with rock-critic experience at Newsweek, Rolling Stone and the New York Times under her belt, Schoemer found herself impossibly drawn to the bleachy-clean world of 1950s pop crooners.
Schoemer struggles with this attraction, listening to thrift-store copies of Pat Boone and Georgia Gibbs albums in a desperate attempt to glean legitimate musical greatness. And she fails miserably–the music repulses her–but she perseveres, hungrily searching for a magic nugget of truth, a key to unlocking the mystery of the music that molded the expectations of her parents’ generation. It is only when she accepts her leanings (“It never clicked in my mind that I could be a critic who liked bad music”) that she is free to love the songs unabashedly, hearing them anew with ears untainted by universal notions of the soullessness of 1950s pop.
Schoemer tracked down dozens of former teen idols and interviewed them, all the while grappling with the validity of her mission. One by one, the real lives behind the soothingly vapid ballads surface, and Schoemer succumbs. She develops a crush of sorts on Pat Boone and receives a surprising jolt of pure musical energy at a Frankie Laine supper-club concert. “Are we really looking for artistry in pop music, or is three minutes of ridiculous distraction enough?” she ponders.
We’re trained to believe that there’s a huge cultural and musical gulf between Led Zeppelin and Patti Page, but encounters with each render Des Barres and Schoemer starstruck. The thrill of spending time with performers whose gifts of musical talent–and, to a greater extent, charisma–make them, to us mortals, somewhat superhuman, and packs a fierce sting and draw. It’s only natural to want to enter into this sacred place as completely as possible. Doe-eyed Des Barres realized she could with her body, while Schoemer found her entrée through journalism. But whatever the means, both authors joyfully celebrate what it is to be a fan.
From the March 15-21, 2006 issue of the North Bay Bohemian.
© 2006 Metro Publishing Inc.
Previous article‘Urinetown’
Next articleBest of 2006 | cc/2021-04/en_middle_0020.json.gz/line574 |
__label__cc | 0.715959 | 0.284041 | Written by Consult HyperionPosted on 13th March 2010 2 Comments
[Dave Birch] Wow. The feedback that I’ve been getting about the Consult Hyperion Digital Money Forum is fantastic. I’d like to claim all the credit, but I just can’t. So for those of you who weren’t able to join us, I thought I’d try and explain why it worked so well and to give credit where it is due.
I’m always very clear and honest about our motives for running the Forum. Consult Hyperion is a consultancy, not a conference company. We run it as a not-for-profit event (which this year supported BUFFER, Action Medical Research, Jubilee Action and the Prostate Cancer charity) to reinforce this point. As a consultancy, we have a reputation for helping our customers — who range from Transport for London and the Bill and Melinda Gates Foundation to Barclaycard and First Data — to deliver new products and services using new technology for secure electronic transactions. We can’t generate all of these new ideas ourselves, so we use the Forum to explore, to question, to connect, to understand and to play with the boundary between new technology and business, and I think we succeed in doing all of these things and having fun at the same time. But why was it so good?
First of all, it’s the sponsors. Visa Europe have been supporters of the Forum for some years and they share our commitment to genuine discussion and debate, genuine learning about the future. They’re not interested in a bunch of marketing slides any more than we are, and as the main sponsor they provided not only money but encouragement and ideas. I can’t thank them enough. Our supporting sponsors, ACI Worldwide (who paid for the entertaining pub quiz, drinks and prizes) and Olswang (who paid for the speakers’ dinner and the books we gave out) were fantastic and enthusiastic. ACI Worldwide have been with us for many years and their forward-looking attitude is much appreciated. Our content partner CGAP not only suggested some speakers and panelists who delivered outstanding input but helped us to develop an important part of our thinking about the role of electronic payments in attacked financial (and therefore social) exclusion. Thanks to all of them: their support gave the event a head start.
Secondly, it’s the speakers and panelists. I try very hard to choose people that I personally respect and I also try very hard to bring together people who can help to make us all think by their combination or juxtaposition in order to exploit the nature of the event. Since it is always limited to a hundred people, there is plenty of scope for interaction and discussion once the speakers have set the tone.
Sometimes, though, even I am surprised by how well this works. I’ll give you two examples from this year.
The kick-off session that was a launchpad for the event so good that people were still talking to me about it two days later. It made us at look like geniuses for the brilliant juxtaposition of Tom Levenson and James Allan, but the truth of the matter is that James was due to present at last year’s Forum after I‘d blogged about him back in 2008 but was unfortunately ill on the day, which was why he was speaking this year instead! However it happened, though, it was an outstanding session. Novelist Martin Baker as chair and two speakers, with no Powerpoint, keeping an audience engrossed, entertained and stimulated for 90 minutes.
Tom told the wonderful story that I touched on back in January, laden with resonance for these troubled times, of the collapse of England’s medium of exchange and the subsequent revolution at the Mint under Sir Isaac Newton, a short period in our history where the framework for today was laid down: the industrial Mint and the Bank of England. Commerce was crippled because there was no cash, but by the time Newton died the City was on incredible trajectory. James Allan’s decision to try and live in London with no cash, using electronic payments only, was voluntary but no less illuminating. Personally, I found the most surprising part of his story was that fact that one transaction in two years that he was forced to conduct in cash was not the desperate purchase of £1 bottle of water at a pop concert or the fiver to a desperate mate but the UKP2,000 deposit for apartment rental to landlords who didn’t trust e-banking (so they said: many in the audience voiced the suspicion that this was all about tax evasion).
The second example was the expert panel on innovating out of poverty: with CGAP’s help I had brought together DD Dedo, the largest branchless banking agent network in Columbia, easypaisa in Pakistan, Ghana’s main mobile operator, a key regulator from the Philippines and (again by utter chance) an expert researching London’s migrant communities. Together they provided such a comprehensive, fascinating and inspirational perspective on the incredible impact of new technology on financial services for the poor that you really could have heard a pin drop while they were talking and the questions could have gone on for days. Again, it was the different perspectives that made the session.
I won’t go through the entire programme, suffice to say that I, along with many other attendees, came away with a raft of new ideas to think about from smart banknotes through mobile-owned banks to energy-based currencies. Joe Di Vanna‘s helicopter view of the impact of digital money, Ignacio Mas’ passionate exposition of the Financial Services for the Poor programme, Michael Salmony‘s defence of cash all played their part. Enough from me: here’s what other people actually said about it:
“Thank you so much for the absolutely wonderful two day experience of the Digital Money Forum 2010.”
“A huge thank you for including me in the forum, I met some really interesting people.”
“An eclectic mix of speakers ensured there was no room for boredom and it was a really thought provoking and enjoyable day.”
“Your fantastic Digital Money Forum.”
The final piece of the jigsaw was everyone who came along. We have a very well-informed audience from a very wide spectrum of interests and they played their part too: if you scan the delegate list you’ll see banks, telcos, non-bank payment organisations, business people, charities and NGOs, inventors, entrepreneurs, lawyers, consultancies and even the IMF. It’s this mix that generates the energy clearly visible in the room and makes the coffee, lunch, tea and drinks breaks so pleasant. I’m passionate about the potential from cross-fertilization and I’m convinced to provides a direct benefit to our customers.
I’ve already been asked if there will be a 14th Forum next year and the answer is, of course, yes.
banking and finance, cashless, crime and fraud, EMV, id and authentication, innovation, money, money transfer, notes and coins, payments, smart cards, social and community
As part of the Forum in London we played “The Dragon’s Factor’s Got Talent“, which was really enjoyable. We had some startups come along and pitch their ideas to the audience and a panel of judges. At the end of the Forum the audience and the panel had a chance to question them about their ideas and pick a winner. I stress this wasn’t the Darwinian struggle we see on TV shows of this type, but all for fun and to expose new ideas to a wider audience. The panel was:
VC Roberto Bonanzinga, a partner at Balderton Capital.
Businessperson Sandra Alzetta, Senior VP Innovation and New Product Development at Visa Europe.
Social Entrepreneur Jof Walters of Shilling Investment.
Potential customer Alasdair Gray of the British Retail Consortium.
There were two prizes awarded. The audience’s vote went to Todd Veri of Midpoint & Transfer, a online f/x matching service that launches in April. The judges were split between Kachingle, an online payment system for blogs and other content, and Touch2ID, a contactless card/biometric combination for providing proof of age being trialled in Wiltshire. I gave Sandra Alzetta of Visa Europe, the principal sponsors of the event, the casting vote and in the end she came down in favour of Touch2ID and I handed over the Forum prize to Giles Sergant of Touch2ID. Linking back to our opening talk from Professor Levenson, the prize was a 1696 William III silver sixpence, one of the very coins minted under Newton’s direction.
Thanks to everyone who took part in the competition, especially for not taking it too seriously: I hope that we were able to expose your ideas to a new audience and help you to meet some new people.
Posted in Consult Hyperion events and notices
Previous Entry IS_A_PERSON
Next Entry Information rules OK
Chris Cook says:
Excellent conference, Dave.
One of the best I’ve been to. I blogged it here.
http://nordicenterprisetrust.wordpress.com/2010/03/14/mobile-money/
Thomas Goldman says:
23rd April 2010 at 06:17
Interesting info about digital money . . . nice to know that it can be so practical. | cc/2021-04/en_middle_0020.json.gz/line584 |
__label__wiki | 0.642182 | 0.642182 | Likes a virgin
Source pagination:
distribution co and production co
Stealing beauty — Bertolucci, Bernardo — Italy; France; Great Britain — 1996
France, Great Britain, and Italy
English, French, German, Italian, and Spanish
Fiction Films, France 2 Cinéma, Jeremy Thomas Productions, Recorded Picture Company, and UGC Images France SA.
Drama, Feature, and Romance
Americans -- Italy -- Tuscany -- Drama
Tuscany (Italy) -- Drama
A PDF of this document is available
Materials from the BAMPFA Film Library and Study Center’s CineFiles project may be protected by U.S. copyright, and possibly other statutes, even if no copyright symbol appears. Please be advised that we are providing these materials for personal study purposes only, following sections 107 (Fair Use) and 108 (Reproduction by Libraries and Archives) of the U.S. Copyright Act; please contact the publisher to obtain permission for any other type of use.
In order to access these materials, you must create a free account and indicate that you acknowledge and will comply with these terms. Please click below to sign up; once you have logged in, you will be able to access this document.
Sign me up! Log in | cc/2021-04/en_middle_0020.json.gz/line586 |
__label__cc | 0.653275 | 0.346725 | About CIP
Joint Venture – BWSC, CII with PensionDanmark as investor, invest DKK 1.6 bn in power plant Snetterton
BWSC and PensionDanmark establish new Power Plant in England
Burmeister & Wain Scandinavian Contractor A/S (BWSC) and the fund Copenhagen Infrastructure I with PensionDanmark as investor continue their successful joint venture and create their second biomass fired power plant in England. The investment in the power plant “Snetterton” is of DKK 1.6 billion.
In 2013 BWSC and Copenhagen Infrastructure I established a joint venture with the aim to create, own and run power plants abroad. The company closed its first contract on a power plant in England in 2013. Today the company has signed yet another contract on the biomass plant, Snetterton in East Anglia, Eastern England.
“When we first created the company, I expected that by combining our leading technology in the field of power plants with strong financial powers we would create a company with strong competitive abilities. What we see today is exactly that”, Anders Heine Jensen, CEO of BWSC states.
BWSC is in charge of constructing, operating and maintaining the power plant throughout a 15-year period. The new power plant is scheduled to be up and running by spring 2017. The power plant will have a capacity of 44.2 MW equivalent to the average energy usage of 82,000 households, and the company has contracted for supply of straw for the next 12 years.
The investment in Snetterton is of DKK 1.6 billion. PensionDanmark invests DKK 1.4 billion, which is financed through Copenhagen Infrastructure I, managed by Copenhagen Infrastructure Partners. BWSC invests DKK 0.2 billion in the power plant.
“There are great perspectives in this kind of cooperation. We have high demands to the industrial partners we work with on joint ventures, and BWSC fully live up to our expectations. We have to secure our members a good and steady return, and this cooperation delivers that.” Torben Möger Pedersen, CEO of PensionDanmark.
This is the second biomass power plant created by BWSC PCL in England. Last year the company invested DKK 1.4 billion in the Brigg project further north in England, in Lincolnshire.
“There are great advantages in a more direct cooperation between financial and industrial partners in the energy sector. It is not always easily established, but this cooperation is a good example of how it can be done, and benefits all parties involved.” Christian Skakkebæk, Senior Partner in Copenhagen Infrastructure Partners.
Facts about the project
Snetterton Renewable Energy Plant is a biomass-fired power plant, which primarily will be fired with locally produced straw, and will have a capacity of 44.2 MW. The production will be equivalent to the energy consumption of 82,000 households and will result in a yearly CO2 reduction of 300,000 tons.
BWSC shall construct of the biomass-fired power plant, and will also be in charge of the operation and maintenance of the plant over a 15-year period.
The power plant is expected to be in operation by the spring of 2017, and is based on energy technology developed in Denmark. The main part of the power plant is a boiler from the Danish company Burmeister & Wain Energy (BWE), which is especially suited for firing with straw.
The Snetterton project developers are Iceni and ECO2, who also developed Brigg.
About Copenhagen Infrastructure Partners
Copenhagen Infrastructure Partners P/S (CIP) is a fund management company focused on energy infrastructure including offshore wind, onshore wind, solar PV, biomass and energy-from-waste, transmission and distribution, and other energy assets like reserve capacity and storage. CIP has approximately 110 employees and offices in Copenhagen, Taipei, New York, Tokyo, Utrecht, and London.
CIP manages six funds and has more than EUR 8 bn under management. CI I, CI A I and CI A II have PensionDanmark as founding- and sole investor. CI II has 19 Danish and international institutional investors and CI III has 42 institutional investors from the Nordics, Continental Europe, the UK, Israel, Asia, Australia, and multi-lateral organizations e.g. EIB. CI NMF I has 15 investors from the Nordics and Continental Europe.
CIP was founded in 2012 by senior executives from the energy industry in cooperation with Pension Denmark.
CIP raises capital from Vestas to further innovate and strengthen its position as a global market leader within greenfield renewable energy investments
CIP and joint venture partner SSE Thermal reach financial close on 49.9MW Energy-from-Waste Project, Slough Multifuel located in the Greater London area
Copenhagen Infrastructure Partners partners up with Forestalia for the investment in a portfolio of more than 1GW of onshore wind farms under development in Aragon, Spain
Hydrogen Renewables Australia and Copenhagen Infrastructure Partners announce partnership on the Murchison Renewable Hydrogen Project
New ScotWind partnership will provide local experience and global expertise
jonas 2014-11-24T00:00:00+00:00
Amerika Plads 29
CIP offices globally
Policies and investor information
Kristian Vejsig Meyer
kvm@cip.dk
© 2020 Copenhagen Infrastructure Partners - All Rights Reserved | cc/2021-04/en_middle_0020.json.gz/line587 |
__label__wiki | 0.841582 | 0.841582 | YBNL Artiste “Lyta” Biography – Age, Profile , Net Worth, State Of Origin & Songs
BIRTH NAME : Lawal Raheem
STAGE NAME : Lyta
NET WORTH :
DATE OF BIRTH/AGE : Born on July 4, 1998
PLACE OF BIRTH: Ajegunle area of Lagos state.
STATE OF ORIGIN : Kwara state
OCCUPATION : Nigerian singer
RECORD LABEL : YBNL
NATIONALITY : Nigerian
Recently, YBNL Boss and street King, Olamide Adedeji, better known as Olamide Baddo signed two two young music sensations to his record label – Lyta and Limerick. We are officially going to introduce them to you right now . We shall be writing everything we know about the two but first of all, we are going to focus on Lyta before we shift the focus to Limerick.
Have you been wanting to know more about About YBNL’s New Signing Lyta? if yes then this is your best opportunity to know every little thing about the talented singer and “Time” crooner. This is the official biography of YBNL artiste lyta and it shall tell everything about him most especially the lesser known facts.
RELATED: Full Celebrity Profile: Bright Okpocha (Basketmouth)
Young Lyta and Limerick are the latest additions to YBNL reccord label after YBNL Princess, Temmie Ovwasa. Continue reading to get update on the biography of a young and talented YBNL artiste Lyta.
YBNL ARTISTE LYTA BIOGRAPHY AND PROFILE
Born Lawal Raheem but better known by his stage name Lyta is a Nigerian singer and song writer born on July 4, 1998. The gifted and sweet voice singer is a native of Kwara state and was born in Ajegunle area of Lagos state.
CAREER AND JOINING YBNL RECORD LABEL
Lawal Raheem aka Lyta has been singing since he was a little child but he rose to stardom after he was signed into the YBNL record label by Olamide Baddo on February 15th 2018 along with a prolific rapper Limerick. Lyta officially started his professional music career at the age of 12 and he luckily met Olamide at an event where he performed.
RELATED: Checkout How Aliko Dangote Became The Richest Person In Africa
Olamide who never fail to recognize real talent was very impressed and thrilled by his display of talent, he was contacted immediately by the YBNL boss for some close observation. When he went to see Olamide, he was asked him to do some freestyle and that was how the whole thing started initially before he was signed to the top Nigeria label.
When he was asked what inspired him to write the song – TIME, he revealed that the loss of his best friend in 2017 was the inspiration that pop up that idea . His boss has revealed that the singer is one of the best kid he has come across for many years. Lyta on the other side said his boss is truly a force to reckon with in the industry going by his countless number of hits and the musicians he has helped .
RELATED: Full Celebrity Profile : Justice Emonaerere Nuagbe (Ushbebe)
Lyta become famous after the release of his hit single “Time” which also features Junior Boy in the remix, the original version features his boss Olamide. The young singer has also dropped other sings like Ire cover by Adekunle Gold .
At the time of creating this biography of Lyta, much isn’t known about the singer . This is the reason why we are placing this profile under update. We will keep improving it until it get to set standard.
Salah Fires Back At Ramos Over Injury Claims (Champions League Final)
Download Mp3: Lyta – Luv (Tory Lanez Cover)
Checkout Offset Net Worth
Checkout How Aliko Dangote Became The Richest Person In Africa
Twenty (20) Memorable Quotes Of Nelson Mandela
These Are The 5 Most Powerful Women In Nigeria (Photos)
See Top Facts From Dagrin Biography You Probably Don’t Know (Photos)
Checkout Interesting Biography Of Talented Gospel Singer Yinka Ayefele | cc/2021-04/en_middle_0020.json.gz/line590 |
__label__cc | 0.573388 | 0.426612 | Yesterday to Tomorrow: Sustainability of the Blue Ridge Parkway vs Sustainability of Community
This pathfinder provides information on the shared growth and decline of the Blue Ridge Parkway in relation to the impact on the surrounding communities through which the Blue Ridge Parkway has been established. The Blue Ridge Parkway passes through rural areas and communities throughout Western North Carolina and the Shenandoah Valley of Virginia. The established symbiosis between the Blue Ridge Parkway and the regions defined can be shown to impact both individual and community identity, economic diversity of individual and community, and sustainable growth of both the Blue Ridge Parkway and the surrounding communities.
Information for this pathfinder will utilize primary sources within the Appalachian Collection, but will also utilize resources with an emphasis on available local and regional resources with statistical information from state and national resources.
There are a lot of books and articles written about the Blue Ridge Parkway. They cover many topics such as animals, plants and travel related information. The information provided in this pathfinder relates to economic conditions and tourism in the counties surrounding the Blue Ridge Parkway. These documents show that a county economic condition or revenue can be tied the the amount of travel on the Blue Ridge Parkway. The books listed below provided information on the topics listed above.
McKendry, Jean E.; Novak, Adam J.; Machlis, Gary E. A Socioeconomic Atlas of the Blue Ridge Parkway [Washington, D.C.]: National Park Service, 2003 ASU SPECIAL COLLECTION G1302.B55G1 M35 2003
Whisnant, Anne Mitchell, Super-Scenic Motorway: A Blue Ridge Parkway History, [Chapel Hill, NC]: The University of North Carolina Press, 2003, William Leonard Eury Appalachian Collection, F 217 .B6 2006 c.2
Blue Ridge Mountains - Economics
Parkway Construction
Social Information and Customs
F 217 .B6 2006 c.2
G 155 U6 S64 2003
G 155 .U6 S66 2005
G 155 U6 F72 2004
G1302.B55G1 M35 2003
HC 107.A127 W48 1981
F106 .E53 2006
Brothers, Gene, Chen Rachel, 1995-1996 Economic Impact of Travel to the Blue Ridge Parkway Virginia and North Carolina, The Coalition for the Blue Ridge Parkway and the National Park Service, NC State University, 1996., ILLIAD, 217 .B6 B76 1996.
Fritsch, Al. Johannsen, Kristin. Ecotourism in Appalachia: Marketing the Mountains, The University Press of Kentucky, 2004, William Leonard Eury Appalachian Collection, Sec. 2, pg. 29, Sec. 4, pg 82, Sec. 8, pg. 134, Sec. 10, 233, G 155 U6 F72.
Whisnant, David; Modernizing The Mountaineer, [Boone, NC]: Pages: 266 – 285. Appalachian Consortium Press, 1980, ASU Special Collection, HC 107.A127 W48 1981
Starnes, Richard D, Creating the Land of the Sky: Tourism and Society in Western North Carolina, pages 121-122, [Tuscaloosa], The University of Alabama Press, 2005, William Leonard Eury, Appalachian Collection, G 155 .U6 S66 2005.
Starnes, Richard D., Southern Journeys, [Tucaloosa], Section 4 (pages 88-113), Section 6 (138-153), The University of Alabama Press, 2003, William Leonard Eury, Appalachian Collection, G 155 U6 S64 2003.
Baxton, Barry, Beatty, Steven, Proceedings of Blue Ridge Parkway Golden Anniversary Conference, [Boone, North Carolina], pages 233 – 244, 1986. Appalachian Consortium Press. F 217. B6 585 1986.
Kaplan, Berton H. 1971. Blue Ridge: An Appalachian Community In Transition. West
Virginia University Bulletin, Series 71, No. 7-2. Morgantown: Office of Research andDevelopment, Appalachian Center, West Virginia University.
Abramson, R., Haskill, J., Encyclopedia of Southern Appalachia, 2006, [Knoxville], pages 357, 611-616, 640 – 641, 742, The University of Tennessee Press, William Leonard Eury, Appalachian Collection, F106 .E53 2006, c2.
Images of America: Building the Blue Ridge Parkway Karen J Hall and FRIENDS of the BRP, Mt. Pleasant, SC, Arcadia Publishing, 2007, ISBN-13: 978-0738552873
Appalachian Bibliography. Morgantown, W.VA: West Virginia University Library, 1968,
1972, 1980. ASU APP COLL Z1251.A7 A6
Appalachian Outlook. A periodic bibliography. Morgantown, W.VA: West Virginia
University Library, 1964-1991. ASU APP COLL Z1251.A7 A55. (note: Appalachian Outlook is a supplement to the Appalachian Bibliography)
Barrier, Ralph, Mileposts & Milestones, Roanoke Times, June 27, 2010.
Nichelson,S, Parkway brings in 2.2 Billion, Watauga Democrat, April 18, 1997.
Ball, Julie, Parkway at a Crossroads, Asheville Citizen Times, October 11, 2002
Fordney, Chris, Blue Ridge Blues [National Parks] 02768186, Sep/Oct 94, Vol 68, Issue 9/10.
Williams, Howard L., Davis, W. D., Effect of Scenic Easements on the Market Value of Real Property.
Francis, Phil, May, Monika, Blue Ridge Parkway Brings Money and Jobs to the Region, http://www.nps.gov/blri/parknews/blue-ridge-parkway-brings-money-and-jobs-to-the-region.htm
Small Town Triumphs through Tourism, Technology and Teapots, www.nps.gov/blri/index.htm
Friends of the Blue Ridge Parkway, Inc, Your Voice Has Made A Difference!, http://www.blueridgefriends.org/index.cfm/fa/content.view/menuID/862.htm
Blue Ridge Parkway, Virginia and North Carolina, ASLA Online, American Society of Landscape Architects, http://www.asla.org/meetings/awards/awds01/blueridge.html
Plan for a Natural Heritage Center at Rocky Knob: Pushing for green jobs on the Blue Ridge Parkway, True Blue Network, http://earthhome.us/Contact_Us.html
Tourism and Economic Research in the Blue Ridge Mountains of North Carolina, Blue Ridge Parkway National Heritage Area, http://www.blueridgeheritage.com/sites/default/files/images/PDFs/BRNHA%20Visitor%20Center%20Survey%20Final%20Report.pdf
Matthew, L., Kask, S., Rotegard, L., Johnson, G., Stewart, S., How Much Do Visitors Value Scenic Quality?, Results from the Blue Ridge Parkway Scenic Experience Project,http://www.blueridgeheritage.com/sites/default/files/images/PDFs/Research/BRNHAEconomicImpactStudy2004.pdf
Teri K. Goodman | cc/2021-04/en_middle_0020.json.gz/line591 |
__label__wiki | 0.763141 | 0.763141 | Top Panel of the Year for 2020!
Wally West Kills More Heroes! | Comic Book Weekly
Top 5 Panels Of The Week – 1/6/21
Best Comic Books of 2020 (Winners!)
Does MJ Remember One More Day?! | Comic Book Weekly
Comic Book weekly
Top 5 Panels
Topic Time
Kickstart the Week
GeekVengers
Frontline Reviews
Frontline Gaming Zone
Last Ember Press
The Last Ember
Landmark 1,000th Issue Features Jim Lee Cover Revealing New Costume!
January 19, 2018 October 2, 2019 Jay
Landmark 1,000th Issue Features Jim Lee Cover Revealing New Costume
Brian Michael Bendis Debuts First Story for DC
DC Veteran Writer Marv Wolfman to Script Story Based On Unpublished Art by Golden and Silver Age Icon Curt Swan
All-Star Lineup of Contributors Includes Richard Donner, Geoff Johns, Peter J. Tomasi, Pat Gleason, Dan Jurgens, Brad Meltzer, Louise Simonson, Jerry Ordway, Tom King, Scott Snyder and More!
DC is going all-out to celebrate the one-thousandth issue of ACTION COMICS—the longest continually published comic book of its kind in history, the series that introduced Superman to the world and the title that launched the superhero genre. The Jim Lee-drawn cover features a new costume that integrates a variety of classic and new elements, including the Man of Steel’s trademark red trunks.
“ACTION COMICS #1000 represents a watershed moment in the history of not just comic books, but entertainment, literature and pop culture. There’s no better way to celebrate Superman’s enduring popularity than to give him a look that combines some new accents with the most iconic feature of his classic design.”
— Jim Lee
Available at comics retailers and digitally on April 18, ACTION COMICS #1000 features the DC debut of acclaimed writer Brian Michael Bendis in a 10-page Superman story featuring art by DC publisher and celebrated artist Jim Lee. This milestone issue will also include two 15-page stories from two of DC’s current and most popular talent teams: SUPERMAN writer Peter J. Tomasi and artist Pat Gleason, as well as ACTION COMICS writer and artist Dan Jurgens.
“The one-thousandth issue of ACTION COMICS is an incredible milestone in pop culture and a testament to the vision of Jerry Siegel and Joe Shuster. Without this book, along with Siegel and Shuster’s fertile imaginations and boundless creativity, the superhero’s place in literature may have been wildly different, if not altogether nonexistent.”
— Dan DiDio
This must-have collector’s item comic book will also feature previously unpublished art from Curt Swan, whose dynamic, iconic style many consider the definitive look for the Man of Steel throughout comics’ Golden and Silver Ages. Acclaimed DC writer Marv Wolfman will script a story based on this never-before-seen content. In addition, the comic will include a collection of memorable bonus stories from some of the most celebrated names in comics and entertainment.
Contributors to this once-in-a-lifetime issue include legendary Superman movie director Richard Donner and New York Times best-selling writer Geoff Johns, with art by Olivier Coipel. Other contributing creative teams will include Paul Dini with José Luis García-López; Tom King with Clay Mann and Jordie Bellaire; Brad Meltzer with John Cassaday and Laura Martin; Louise Simonson with Jerry Ordway; Scott Snyder with Tim Sale and more to be announced. This celebratory comic book is just the beginning; this milestone will be recognized across the DC superhero line for the month of April with a series of Superman-themed variant covers and even more to come.
Check out the website at DC Comics or the DC YouTube channel for the latest news regarding Krypton’s last son and his elevation to pop culture icon.
To find a comic shop near you, visit Comic Shop Locator or call 1-888-comicbook.
For comics anytime, anywhere check out DC Comics Store and DC Digital Comics
Follow & Like On Twitter, Facebook, Google +, YouTube, Pintrest, & Vine
Let us know in the comments what you think of this DC Comics Announcement and don’t forget to follow us on Twitter for the latest Previews, Reviews, News and Interviews!
All images images are courtesy of DC Entertainment
UncategorizedAction Comics #1000, Brian Michael Bendis, Clark Kent, Curt Swan, Dan Didio, DC Comics, DCRebirth, Geoff Johns, Jerry Siegel, Jim Lee, Joe Shuster, Pat Gleason, Paul Dini, Peter J. Tomasi, Richard Donner, Superman
Slott Swings Away From The Amazing Spider-Man & Will Be Writing….
Interview with Key Collector Comics App Creator Nick Coglianese
From the Frontline
Sign up for our Newsletter to get Monthly Updates on New Videos, Articles, Original Pieces and Monthly Giveaways!
The squirrels are loose! Give it a sec, please...
Thank You for subscribing to From the Frontline!
We can't wait to connect with you and share the latest videos, articles, giveaways and more!
Don't forget to check out our weekly LIVE show on YouTube, Comic Book Weekly every Tuesday night at 10pm ET at YouTube.com/ComicFrontline!
October 2, 2019 Mike Spider-Slayer 0
Spider- Slayer’s Comic Book Haul | New Comic Books 10-02-19
Spider-Slayer’s Comic Book Haul #392 | New Comic Books 10-02-19 Welcome to Spider-Slayer’s Haul #392. This...
Comic Book Hauls Uncategorized
September 8, 2019 Jay 0
Comics Shipping This Week September 11, 2019!
New Comic Book & Related Merchandise Scheduled for Wednesday, September 11, 2019 This is a list...
-Breaking News- Shipping This Week Uncategorized
September 4, 2019 Brant Fowler 0
Who is the Masked Raider in Marvel Comics #1000?! | Frontline LIVE #265
Marvel Comics #1000 introduced us to a new character, The Masked Raider, and a secret history....
-Breaking News- Uncategorized
Comic FrontlineFollow
Comic Frontline@ComicFrontline·
The Final Countdown to launch... 9 DAYS! Comic Book Weekly is coming in 9 DAYS!
http://comicfrontline.com/cbw
#podcastersoftwitter #comickickstarter
Retweet on TwitterComic Frontline Retweeted
Kat Calamia@ComicUno·
WandaVision with Julius, Marianne, and @falco_phil!
The Final Countdown to launch... 10 DAYS! Comic Book Weekly is coming in 10 DAYS!
PRESS/PROS: Who wants to read They Call Her...The Dancer #1 in color for a review or pull quote? #Kickstarter coming soon!
"A dancer/ASSASSIN is forced to deal with her childhood trauma of witnessing her parents' deaths."
In 11 Days, Comic Book Weekly Season 1 Launches on Kickstarter! We hope to see you there!
The Cast on YouTube
Copyright © 2019 Comic Frontline All rights reserved | cc/2021-04/en_middle_0020.json.gz/line593 |
__label__cc | 0.555613 | 0.444387 | Agenda, decisions and minutes
Environment Overview & Scrutiny Committee - Expired 13/07/20
Tuesday, 27th November, 2018 10.00 am
Printed decisions PDF 48 KB
Printed minutes PDF 88 KB
Venue: Delyn Committee Room, County Hall, Mold CH7 6NA
Contact: Maureen Potter / 01352 702322
Declarations of Interest (Including Whipping Declarations)
To receive any Declarations and advise Members accordingly.
None were received.
Minutes PDF 74 KB
To confirm as a correct record the minutes of the meetings held on 19 September and 16 October 2018.
Environment OSC minutes 16.10.18 - Final (English) MP , item 28. PDF 75 KB
That the minutes be approved as a correct record and signed by the Chairman.
The minutes of the meetings held on 19 September and 16 October 2018 were submitted.
Draft Rights of Way Improvement Plan 2018-2028 (RoWIP) PDF 97 KB
View the background to item 29.
View the decision for item 29.
Enc. 1 for Draft Rights of Way Improvement Plan 2018-2028 (RoWIP , item 29. PDF 2 MB
Enc. 2 for Draft Rights of Way Improvement Plan 2018-2028 (RoWIP , item 29. PDF 513 KB
(a) That the draft Rights of Way Improvement Plan and policy and procedures booklet as part of the three month statutory consultation, be supported; and
(b) That a further report be submitted to the Committee in March 2019.
The Chief Officer (Planning, Environment and Economy) introduced the report on the new Rights of Way Improvement Plan 2018-2028 as part of the 3 month statutory consultation. He provided background information and advised that this second ROWIP assessed the 2018 network and evaluates progress made since 2008. The current (2018) policy context is examined, priority areas identified and a new style Statement of Action put forward. The Chief Officer invited the Access and Natural Environment Manager to present the report.
The Access and Natural Environment Manager explained that the first ROWIP had identified a number of areas as being key priorities for 2008-2018. Of the 22 tasks identified 7 had been completed, or substantial progress made, while a further 7 had made little or no progress and 8 had made partial progress. However, record of data had been found to be inconsistent and sometimes lacking causing difficulty in identifying progress in some areas.
The Access and Natural Environment Manager reported on the main considerations, as detailed in the report. He advised that a Policy and Procedure booklet had already been developed as a priority. The policies and procedures would form the basis of a booklet to be made available to users of the Public Rights of Way network and to landowners in order that there is widespread understanding and transparency about what Flintshire County Council does and how it does it.
Councillor Paul Shotton referred to the 1800 individual public paths which made up the public rights of way network in 2018 and commented on the volume of work in managing and maintaining the network and the importance of volunteers in providing assistance in that task. He suggested there could be a greater role for volunteers going forward. The Access and Natural Environment Manager acknowledged the important role undertaken by volunteers in assisting rangers and also referred to local groups which undertook voluntary work to assist the countryside service. In response to the comments made by Councillor Shotton regarding signposting the Access and Natural Environment Manager explained that further progress had been made and work was ongoing, in response to a further question from Councillor Shotton he explained that consultation on the draft Rights of Way Improvement Plan would end in January 2019.
Councillor Chris Dolphin referred to page 56 of the report and the issue around the difficulty experienced by people in electric wheelchairs in gaining access along the Wales Coast Path due to barriers. He asked how this problem was being addressed and spoke of the importance of retaining barriers and in certain areas to problems experienced in the past. The Access and Natural Environment Manager explained that the Authority’s position was legal but was reviewing its position in terms of the barriers and was looking to undertake wider consultation on this matter in the New Year. Councillor Carolyn Thomas spoke of the need for equal access for all to the Wales Coast Path.
Councillor David Evans asked for an update on the Local Access Forum. The Access ... view the full minutes text for item 29.
Environmental Enforcement PDF 78 KB
Appendix 1 - Enforcement Options Appraisal , item 30. PDF 79 KB
(a) That Option 2 be adopted subject to the removal of the zero tolerance principal to issuing Fixed Penalty Notices (FPNs) for littering offences;
(b) That Option 3 be reviewed in the 12 months; and
(c) That the Authority contacts local Town and Community Councils with a view to working in collaboration on the employment of environmental enforcement officers.
The Chief Officer (Streetscene and Transportation) introduced a report on the options for the future delivery of the Environmental Enforcement service. He provided its contract with Kingdom, Kingdom had withdrawn their services with effect from end of August 2018. The Chief Officer explained that the residual in-house enforcement officer team were currently undertaking all enforcement activities in the County. The report identified the 5 possible options for delivering county wide enforcement of its environmental policies. The Chief Officer invited the Highway Network Manager to present the report and the enforcement options appraisal which was appended.
The Highway Network Manager advised that following the recommendation to terminate the contract with Kingdom and explore different service delivery models, all Authorities in North Wales had been approached to understand their proposals moving forward. Similar to this Authority, neighbouring Local Authorities were currently undergoing a review of their enforcement services with all options still open for consideration. The Highways Strategy Manager reported on the 5 options available for county wide enforcement and referred to the relevant costs, benefits, and risks for the future service delivery models. He advised that the preferred option was Option 2 – An enhanced in-house enforcement provision for the future delivery of the environment and car parking enforcement service within the County.
Councillor David Evans proposed that Option 2 be agreed subject to the removal of the zero tolerance principal to issuing Fixed Penalty Notices (FPNs) for littering offences. He expressed the view that the risks with Option 3 outweighed the benefits and said he could not support this option.
The Chief Officer explained that in respect of enforcement there is clear guidance to enforcement officers on when to enforce against intentional as opposed to accidental incidents.
Councillor Paul Shotton spoke in support of Option 2 and the proposal to employ a further 2 Enforcement Officers to deliver a service which would cover all the County. He spoke of the need to engage with volunteers and local community groups and organisations to raise awareness and assist with the problem of discarded litter in local community areas. He referred to the cost of environmental enforcement and asked that an update be provided to the Committee next year.
The Chief Officer explained that the employment of 2 further Enforcement Officers would create a budget cost pressure. He acknowledged the comments made by Councillor Shotton regarding the involvement of the local community in the ‘clean-up’ of local areas and said that local groups and volunteers were engaged when local events were held. He also advised that local area coordinators could be asked to use their community contacts and connections to seek assistance.
The Chair asked if he could be informed of when enforcement officers visited his Ward. Councillor Carolyn Thomas said this information would be provided. The Chief Officer said he would contact all Members to ask if they would also wish to receive this information.
Councillor Dave Hughes expressed his appreciation for the quick and efficient response he had received from the ... view the full minutes text for item 30.
Local Toilets Strategy PDF 86 KB
To inform Scrutiny of the upcoming consultation period on the Council’s Local Toilets Strategy
(a) That the Committee supports the formal public consultation exercise required to deliver the Council’s Local Toilets Strategy; and
(b) That a report be submitted at the end of the consultation process to provide feedback on the comments received and a draft Local Toilets Strategy for further scrutiny by the Committee.
The Highway Strategy Manager provided background information and advised that the production of a Local Toilets Strategy would require a consultation process to be undertaken with all relevant stakeholders to help understand local demand and local need for the service which would subsequently inform the Council’s Strategy going forward.
The Highway Network Manager reported on the main considerations, as detailed in the report, and explained that whilst the consultation needed to ascertain the location, access, facilities provided, frequency of use, and quality of existing sites, it also had to determine whether additional or fewer sites balanced the demand and need against a deteriorating budget position. The final Strategy and proposals would need to be sustainable without significantly increasing financial pressure on the Council. The outcome of the consultation, together with the recommended Public Toilet Strategy would be presented to Cabinet for approval in April 2019 and to Overview & Scrutiny for their comments beforehand to enable the Council to have the Strategy in place by May 2019.
In response to a question from Councillor Joe Johnson regarding the number of public toilets in Flintshire, the Chief Officer (Streetscene and Transportation) explained that there were 4 and, following a previous decision, the general public also had access to the toilet facilities available in Council buildings rather than dedicated sites, and cited library and leisure centres as examples.
Councillor Chris Dolphin referred to the closure of the public conveniences in Holywell and asked if the building was to be demolished or sold, as it had been closed for some time. The Chief Officer (Streetscene and Transportation) explained that when public conveniences in a dedicated site were closed the building formed part of the County’s assets. He agreed to make enquiries with the assets team regarding this matter and report back to Councillor Dolphin.
Councillor Sean Bibby asked if discussions had taken place with local businesses about allowing the general public to access the toilet facilities in their buildings, and cited local pubs and cafes as examples. The Chief Officer explained that this option had been introduced in some areas of Wales, however feedback suggested that these facilities were not always suitable for elderly people or young children.
Councillor Paul Shotton commented on the need for local businesses to engage more fully with the initiative to increase footfall in local town centres. Councillor Carolyn Thomas suggested that Members contact the local businesses in their Wards to encourage interest in the scheme. The Chief Officer Streetscene and Transportation agreed to enquire regarding the current status of the scheme and circulate to members.
Councillor David Evans stressed the importance of toilet facilities on the Wales Coast Path and on cycle routes.
School Transport – Concessionary Fares PDF 83 KB
Appendix 1 and 2 - School Transport – Concessionary Fares , item 32. PDF 178 KB
(a) That the information on revenue projections from the various options for concessionary fare prices be noted; and
(b) That Option 2 - £450 per year (£150 per term) as the preferred rate for concessionary seats in 2019/20 be recommended for approval to Cabinet.
The ITU Manager – Streetscene and Transportation introduced a report to seek a recommendation for the rate to be charged for school transport concessionary seats. She provided background information and explained that the Committee had previously recommended the adoption of Option 2 (i.e. £100.00 per term) as its preferred pricing structure for a concessionary bus pass for the current school year (2018/19) with a review to be carried out on the impact of the increased cost in order that the level could be set for future years. She advised that the rate was less than 50% of the full cost of providing concessionary seats and this created financial pressures for the Authority.
She reported on the main considerations, as detailed in the report, and said the options for future concessionary seat charges were appended to the report. Whilst the long term aim would be full cost recovery for the service, it was considered unfair to raise the charges to this level in such a short period of time and therefore options 1 and 3 were not currently recommended. Option 2 (£450 per year - £150 per term) was recommended for 2019/20 as it provided a balanced position against full cost recovery and the affordability of the scheme for parents (particularly for parents with more than one child travelling to school).
In response to a query from Councillor Owen Thomas, the ITU Manager – Streetscene and Transportation explained that the Authority did not have a legal responsibility for pupils who used school buses as it was parental choice to use that method of transport. In response to the comments made by Councillor Thomas regarding the cost of subsidising unused places on school buses the Chief Officer advised that a review of the school transport provision had been undertaken to make sure it was fit for purpose.
In response to the comments made by the Chair regarding school appeals, Councillor Carolyn Tomas referred to the school transport policy and advised that from September 2019 children were only provided with free transport to their nearest school.
Councillor Chris Dolphin proposed that Option 2 - £450 per year (£150 per term) be approved as the preferred rate for concessionary seats in 2019/20 and when put to the vote this was carried.
Forward Work Programme (Environment) PDF 72 KB
Enc. 1 for Forward Work Programme (Environment) , item 33. PDF 66 KB
(a) That the Forward Work Programme be amended; and
(b) That the Facilitator, in consultation with the Chair of the Committee be authorised to vary the Forward Work Programme between meetings as the need arises.
The Environment Overview & Scrutiny Facilitator presented the Forward Work Programme for consideration. She advised that the next meeting of the Committee would be held on 11 December 2018. It was agreed that the item on Charging Points for Electronic Cars would be deferred for consideration at a future meeting of the Committee.
Councillor Joe Johnson suggested that a workshop be held on recyclable waste. During discussion it was agreed that a short information session be arranged for the Committee prior to the start of a future meeting.
Members of the Press and Public in Attendance
There was one member of the press and no members of the public in attendance. | cc/2021-04/en_middle_0020.json.gz/line594 |
__label__wiki | 0.946447 | 0.946447 | CompanyWeek
Manufacturing Media Network
Aerospace & Electronics Brewing & Distilling Bioscience & Medical Built Environment Cannabis & Hemp
Consumer & Lifestyle Energy & Enviro Food & Beverage Industrial & Equipment Supply Chain
Data Intel
Sign-in / Subscribe
Browse State
California Colorado Utah
By Gregory Daurer | Oct 17, 2019
Brewing & Distilling Food & Beverage California
Founder Ken Grossman has overseen the growth of a scrappy California startup into one of the most successful national brands in American craft brewing.
Officially underway in 2020, the 40th anniversary of Sierra Nevada calls for a celebration. And Grossman has a long-running, aptly-titled beer for the occasion: Sierra Nevada's Celebration IPA, which has been made since 1981. The beer is fresh-hopped with Cascade, Centennial and Chinook varieties.
How popular were Centennial hops in 1981 when Sierra Nevada began brewing that beer?
"Not at all," replies Grossman, 65. "We put them in our Celebration Ale in '81, and they were called the Super Cascade, back then. They were a very new entry into the American breeding program. No, they were an unknown hop in the late '70s, early '80s."
And how popular were Cascade hops when Grossman began using their fresh cones within its flagship Sierra Nevada Pale Ale in 1980?
"Not [popular]," he says. "They couldn't find a home. Oregon State [University] had developed the variety. All the large brewers thought they were too aromatic and floral, and pine and citrus. They didn't remind them of the hops they were used to from Germany, so they couldn't find much of a support until craft brewing came in."
Thanks in no small part to Sierra Nevada, craft brewing -- and especially, early, hop-centric brands such as itself -- most definitely did come to fruition. It is one of only two remaining breweries (the other being Boulder Beer) who were at the very first Great American Beer Festival (GABF). And between 1987 and 2014, the brewery medaled 31 times at the GABF.
Over the past four decades, Sierra Nevada become a national brand, leading to the opening of a second production brewery in 2014 in Mills River, North Carolina, in order to supply East Coast markets. The move also aligns with its reputation for being a sustainably-minded company by reducing its carbon footprint.
Back in the beginning, Grossman opened his 10-barrel brewery in Chico using a brewing equipment that he made himself. "The kettle was an old steam pot I picked up in a scrap yard. The cone on top was actually a fruit hopper that I chopped the legs off, turned it upside down and made it into the cone top."
He adds, "None of us in that early generation could afford to buy anything out of Europe, so pretty much it was all cobbled together from old dairy [equipment]. . . . The whirlpool I welded all myself, I put it together from parts and pieces. I took a welding class, so I could figure out how to weld."
With wheels welded onto it, the original brewhouse made its inaugural road trip to the 2019 GABF, where it was on display. Grossman plans to travel with it in 2020 to various locales, where he'll use his old equipment to collaborate with other breweries, or perhaps he'll give the wort away to local homebrewers.
Before starting Sierra Nevada, Grossman operated a homebrew equipment supply store. (It's worth noting that homebrewing wasn't legalized nationally until 1978, and Grossman had opened his shop in 1976). In Northern California, Anchor Brewing in San Francisco was a huge influence, but it was founded in the previous century. It was Jack McAuliffe's New Albion Brewing Company in Sonoma that gave Grossman the inspiration to start his own brewery. Grossman remembers thinking, "'What he's doing isn't any different than what I'm doing at home.' I had a pretty sophisticated home brewery. So, if he could do a commercial brewery, I could do that."
Today -- with 200-barrel systems in place in both Chico, California and Mills River, North Carolina -- Sierra Nevada is positioned as the third top-selling craft brewery in the United States, according to 2018 statistics published by the Brewers Association, when the Chico brewery produced 550,000 barrels. (Although less than a decade ago, it was in the second slot.) In 2017, Forbes listed Grossman as having reached billionaire status off of beer.
It's not about quantity alone: Especially in its initial decades, Grossman's brewery pushed boundaries and innovated within the brewing space. How important was bottle conditioning to Sierra Nevada early on? "It was part of our DNA," says Grossman. "The Pale Ale was a pioneer. It's probably one of the largest[-selling] bottle conditioned beers in the world, still."
Sierra Nevada also began utilizing an upright cylindrical piece of equipment it calls the Hop Torpedo. Grossman says, "It was something we created. So, those were packed full of fresh cone hops. As the beer ages, we circulate beer through it to infuse fresh hop aroma. . . . We've been dry-hopping since 1981." The Hop Torpedo has resulted in beers like Torpedo Extra IPA and the recently-released Tropical Tornado.
In 1983, it unleashed its gnarly barleywine, Bigfoot, with its 9.6 percent alcohol by volume and 90 bittering units. But there have also been easier-drinking releases likes its Oktoberfest (brewed for the past five years in collaboration with a different brewery, most recently with Germany's Bitburger). And, then, there's also Narwhal Imperial Stout, Summerfest, Hop Bullet, the brewery's Estate Ale (using its estate-grown malt and Saaz hops, as well as Chico wild yeast), and Hazy Little Thing IPA.
How does Sierra Nevada continue to keep things fresh and new?
"We're always innovating," says Grossman. (Sierra Nevada's Hop Hunter, for example, results from "an all-new method of steam distilling wet hops before they even leave the fields," according to the brewery's website.) "We've got a bunch of brewers who do R&D all the time. We meet weekly and talk about what's on the horizon, what we should be working on. I'm involved in those meetings, every week."
He also dialogues with his daughter, Sierra, who works at the Chico brewery and his son, Brian, who oversees the North Carolina operation. On the brewery's website, it says, "We are 100 percent family owned, operated, and argued over."
However, it doesn't sound like there's excessive tension at family gatherings -- say, at Thanksgiving dinners -- involving the three Grossmans. "We have a lot in common," says dad Ken. "We talk about beer a lot."
Favorite beers: "I still migrate to hoppy stuff," Grossman says. "I wouldn't say I have a favorite beer. But I drink a lot of different beers around the country, and the quality and level of brewing has certainly increased significantly over the 40 years I've been around. And there's a lot of great beers out there today."
When Grossman is informed that two separate brewers -- one of them being Vinnie Cilurzo of Russian River Brewing Co. -- have told this writer that they always have Sierra Nevada Pale Ale in their refrigerators, he responds, "And I've got Vinnie's beer in my refrigerator as well! We're good friends."
Challenges: Grossman says it's "finding your place and niche in the market, competing against international brewers. It used to be we competed against the domestic big brewers; now we're competing against international brewers who own craft breweries and domestic breweries."
And how has the company been able to avoid being purchased by a larger company? "We're privately owned, so we're not forced to do anything we don't want to do. We've had opportunities, but we decided we wanted to stay independent."
Opportunities: "It's always been how do you stay relevant with the consumer," says Grossman. "I think just trying to figure out how to stay in sync with the sensibilities about the beverages and the foods they consume. So, just trying to make sure you're there [meeting] consumer need."
Needs: Grossman is a realist about changing tastes -- even if those tastes do happen to be, well, unsophisticated: "There's still people who love hoppy, traditional beers, but there's certainly a growing trend for lower carb, lower alcohol. A certain percentage of drinkers don't want anything more than a little bit of flavor and a little bit of buzz, and aren't so much into the tradition of brewing. So I think we've got to understand that segment of the industry as it changes."
Connect with Sierra Nevada Brewing Co. on SCoP
Similar Industry
Yumbana Gluten Free
Food & Beverage Colorado
By Gregory Daurer | Jan 06, 2021
Mulay's Sausage
By Gregory Daurer | Dec 13, 2020
By Glen Martin | Nov 14, 2020
Editor's Picks: Top 10 Colorado Manufacturer Profiles for 2020
Aerospace & Electronics Brewing & Distilling Built Environment Consumer & Lifestyle Energy & Enviro Food & Beverage Industrial & Equipment Supply Chain Colorado
By Eric Peterson | Dec 08, 2020
Editor's Choice: Top 5 Utah Manufacturer Profiles for 2020
Aerospace & Electronics Brewing & Distilling Consumer & Lifestyle Industrial & Equipment Supply Chain Utah
Colorado Manufacturing Awards: 2020 Winners
Aerospace & Electronics Brewing & Distilling Bioscience & Medical Built Environment Cannabis & Hemp Consumer & Lifestyle Energy & Enviro Food & Beverage Industrial & Equipment Colorado
By Margaret Jackson | Aug 09, 2020
©2021. CompanyWeek. Design by unleaded.digital · Terms of Use · Privacy Policy
Manufacturing Stories in Your Inbox Every Week
Our FREE weekly newsletter connects you to in-depth company and leadership profiles.
Pick your edition & Enter your email:
to navigate, enter to select, esc to dismiss
` } }, [ { source: autocomplete.sources.hits(companies, { hitsPerPage: 3 }), displayKey: 'title', name: 'search', templates: { suggestion(suggestion) { return `
${suggestion._highlightResult.title.value} ${suggestion.type.name}
${suggestion.summary ? `${suggestion.summary}`:''}
`; } } } ]).on('autocomplete:selected', function(event, suggestion, dataset, context) { // Change the page, for example, on other events window.location.assign(suggestion.url); }); to navigate, enter to select, esc to dismiss | cc/2021-04/en_middle_0020.json.gz/line598 |
__label__cc | 0.72599 | 0.27401 | Set Current Location
While we do our best to ensure the accuracy of our listings, some venues may be currently temporarily closed without notice. Please confirm status on the venue website before making any plans.
A Day in St.Tropez
By: Cityseeker
Share/Invite
Email Collection
As one of the most famous areas in St. Tropez, the Place des Lices is the heart of the town. It is here that boules (a sport related to Bocce ball) players battle it out from dawn till dusk, in scenes that are reminiscent of Marcel Pagnol. The area is very pleasant in summer, thanks to the shade of the trees. Both the young and old can be found here and the terrace cafes are very popular. The Saturday morning market that takes place here sells excellent fruit and vegetables, as well as regional specialties.
St. Tropez, France
Use as Collection Cover Photo
Rue Gambetta
Stretching through Old Town St. Tropez, Rue Gambetta is a lovely stroll. This cobbled lane walks you past some of the best shopping in St. Tropez, but with all the beautiful architecture as well as its bustling charm may leave you loathe to leave the street to venture inside. Known originally as the "Grand Rue," Rue Gambetta reached its days of glory in the late 17th and early 18th Centuries when rich merchants made this street their home. With elegant trees and right in the middle of all the action, Rue Gambetta is not to be missed.
La Maison des Papillons
House of Butterflies (Maison des Papillons) hosts an extensive collection of about 20,000 butterflies and covers two floors. Some of the butterflies on display are on the verge of extinction. The first room contains exotic butterflies from the four corners of the earth, including Africa and Australasia. The first floor displays European varieties. The museum also has an exhaustive collection of French butterflies. There is also a collection of the instruments entomologists use to examine delicate insects. Please note that the venue is closed on Tuesdays and in the month of November; call or see website for more information.
La Citadelle
This listed historical monument is situated to the east of Saint Tropez. Travel through time when you cross the threshold of the Citadelle with its adjoining court and battlements. These maritime defenses were built at the end of the 16th Century and reinforced at the end of the 17th. It is the only building of this stature on the whole of the Varoise coast. The Citadelle looks down over Saint Tropez and offers breathtaking views of the gulf of Saint Tropez, theMassif des Maures and the Baie des Canebiers.
Brigantin II
For a novel way to discover the ethnic city of St. Tropez, embark upon the Brigantin II. This boat offers informative and memorable tours of the city especially the old town and the ancient villas and houses. See the different beaches and the major landmarks of the city on the cruise as the guide highlights the history and stories behind them.
St.Tropez, France
Marine Air Sport
For those who love to fly, the Marine Air Sport is a must-visit destination in St Tropez. It offers a range of aerial as well as water sports. Adventure-seekers can indulge in para-sailing that is sure to reward them with sweeping panoramic vistas. Water-skiing, jet-skiing, wake-boarding and boating are the main water activities organized here.
Galerie Espace des Lices
The Galerie Espace des Lices is a gallery dedicated to the artwork created by Stefan Szczesny, an extremely talented artist from the luscious town of St. Tropez. On display here are works of varied art forms. One can find everything from sculptures to paintings, contemporary art and more. The Galerie Espace des Lices also plays the role of a cultural hub were artists, intellectuals and others come together to share their views and opinion on art. For further information on this venue, check their website.
Port de Saint Tropez
Where up to 800 vessels can be moored at a time, the Port de Saint-Tropez is an important port on the Mediterranean sea. Well-maintained and complete with facilities, the port is excellently handled by its management. Apart from being an important port, many events also take place at the port's spacious terraces. Visit website for more details and reservations.
Galerie Paul Janssen
A haven for art lovers', Galerie Paul Janssen is a popular art gallery in St. Tropez. This gallery takes pride in exhibiting artworks by some of the best artists like Marc Lagrange, Helmut Newton and Andy Warhol. The works include street art, photography and pop art, making this space a must-visit for all the art connoisseurs.
Musée de l'Annonciade
This museum is situated inside the 16th-century Chapelle de Notre Dame de l'Annonciade. The old chapel, which was closed during the Revolution, was restored then transformed into a museum in 1955. The Musée de l'Annonciade contains a rich and varied collection of artwork. The majority of the works on display are paintings from the end of the 19th and the start of the 20th Century. There are also impressionist works showing St Tropez as it was back in the day - a simple fishing port. There are also more modern paintings by artists like Matisse, Bonnard, Signac, Vlaminck, Braque, Utrillo, and Dufy. This museum is open throughout the year, except for the month of November.
Eglise Notre-Dame de l'Assomption
Famous for its yellow bell, the Eglise Notre-Dame de l'Assomption was built at the start of the 19th Century. It is a light and colorful church built with Baroque style. The church houses several busts of saints, such as Saint Torpes. The decapitated body of this Roman martyr is said to have been drifting in a boat before arriving mysteriously intact at the town port. It is this bust of Saint Tropes which is transported during the Bravade procession in May.
Galerie Henri Sié
Henri Sié is a jack of all trades and he is proud of it. He was born in Toulouse in 1936 where he went on to study at the Ecole des Beaux-Arts. At 28 he began a career in music thanks to his baritone voice. He holds concerts the world over. He hasn't left painting by the wayside though quite the opposite. His colors are those of the surrounding countryside. They are bright, warm and sensual.
0 211 2667-a-day-in-st-tropez
Leave a Comment :
Similar Collections
10 Bookmarked
10 Scenic Highways Across the US
Created by: Cityseeker
Save Collection to Profile
11 Best BBQ Joints in the Southern US
Exploring Bethesda, MD
9 Bookmarked
Exploring Bethesda, MD (Marriott)
If you click "Log in with Facebook" and are not an cityseeker user, you will be registered and you agree to the cityseeker Terms and Conditions
Or copy the link:
Invite friends to contribute:
Email Location -
Send Location Information To:
Private?
No Yes 0
What type of location are you collecting?
Cancellation Page
Reservation ID:
Cancel Reason:
Select Reason
Cancellation Status
Image Attribution
Copyright (C) 2021 cityseeker
collection email,public_profile 731812490255864 https://cityseeker.com/ 41.18454150 -73.13316510 Stratford 5391 9 2 41.18454150 -73.13316510 https://cityseeker.com/stratford-ct 10.0.0.176 cityseeker_t_A 41.18454150 -73.13316510 Set Current Location See All Global Search Remove from Collection Add to Collection Saved Save Save Collection to Profile Saved Collection to Profile What type of location are you collecting? Approximate Duration Options Found View Full Hours Hide Full Hours No Data Found Please check your starting point or destination location Miles to Destination Please Enter Old Password Please Enter New Password Old and New Passwords Are the Same New Password and Confirm New Password Do Not Match Please allow access to email Geolocation is not supported by this browser Please provide valid email Collection Not Available Keyword Should Contain At Least 3 Characters Keyword Should Contain Only Alphanumeric Characters Keyword Already Added. Date Must Be In YYYY-MM-DD Format Month Must Be Between 1 And 12 Day Must Be Between 1 And 31 Please Enter Valid Email Email Should Not Be More Than 100 Characters Characters Remaining Message Should Not Be Blank Email Should Be Correct Please Check For Reservation Time What Type Of Location Are You Collecting? Please Enter Password Password Should Be 8-16 Characters Long, Alphanumeric With One Special Character Password Should Not Be More Than 50 Characters Please Check Email Address And Try Again Error! Email Sent! Check Your Inbox, We’ve Sent You Instructions On How To Reset Your Password. Problem While Recovering Password, Please Try Again Later Please Enter Collection Name Please Wait Please Enter Your Name Please Enter Your Comment Please Select Collection Please Enter First Name First Name Should Not Be More Than 50 Characters Please Enter Last Name Last Name Should Not Be More Than 50 Characters Password Din't Match Problem Reseting Your Password, Please Try Again Later Keyword Is Restricted, Please Try Another Keyword Sorry! A Problem Occurred While Sending The Email, Please Try Again Later. Sorry, Failed To Unsubscribe From The Newsletter. Please Try Again Later. You Have Been Successfully Unsubscribed From The Newsletter. Accommodations Restaurants & Cafes Nightlife Attractions Shopping Email Or Password Is Incorrect Remove From Collection | cc/2021-04/en_middle_0020.json.gz/line609 |
__label__cc | 0.719067 | 0.280933 | jacaranda flower spiritual meaning
Red cardinals are one of the most common spiritual signs people receive from Heaven today. Jacaranda definition: any bignoniaceous tree of the tropical American genus Jacaranda , having fernlike leaves... | Meaning, pronunciation, translations and examples Distinctive and charming nature name that blends elements of Jacqueline and Amanda. Because of the myth of Clytie and Apollo, the sunflower most commonly means adoration and loyalty. Cascades of nearly neon, violet-blue flowers have made jacaranda trees (Jacaranda mimosifolia, Jacaranda acutifolia) garden fixtures in U.S. Department of Agriculture plant hardiness zones 10 through 11.Even when not buried in blooms, jacarandas dazzle with ⦠Anemone (Wood) (Anemone nemorosa) aka crowfoot, windflower Mars. This flower assists you in finding the divine beyond words. Particularly in Australia and America, the Jacaranda is a popular choice for public spaces; the trees are often found lining streets or adorning parks. She shared with them her knowledge, wisdom and ethics, showing them the difference between good and evil. Beauty, Healing, Music, Scholastic Success, Wealth. Deities: Adonis, Anemos, Aphrodite, Eurus, Venus. Finally, jacarandas arenât Australian. 16 names similar to Jacaranda The shape of the pear is suggestive of the feminine form. Because the Jacaranda tree is associated with the Amazonian moon goddess who is known for her wisdom, the trees are often found planted on university campuses. VARIANTS Jacarannda, Jacarranda, Jakaranda . She was actually a priestess of the moon who then descended from the tree and lived among the people, giving them her knowledge and ethics. Legend says if the flower falls on your head, it means good fortune for you. Soft and Mellow yet utterly Spellbinding. Some of the most common meanings include: Long life, mainly since most varieties stand in full bloom for months on end during the hottest days of summer The jacarandaâJacaranda mimosifoliaâis a large tree which is native to Brazil and which commonly grows throughout the southern United States, Australia, and in many other warm, humid climates.Jacarandas are perhaps best known for producing a beautiful display of bright purple or blue flowers in the spring. But there are conflicting meanings for what it means when a Jacaranda bloom falls on a studentâs head. Give this flower when one has captured your full attention. Jacaranda symbolism: Jacaranda represents wisdom , rebirth , wealth and good luck . Acclimitazation, Beauty, Clairvoyance and Intuition, Divine Alignment, Forgiveness, Healing and Regeneration Kapok The blossoms of the Jacaranda also are associated with rebirth and the magic of spring. In China, people associate sunflowers with a long life, good fortune, and vitality. Chambers's Cyclopædia, 1st ed., (1753) as "a name given by some authors to the tree the wood of which is the log-wood, used in dyeing and in medicine" and as being of Tupi-Guarani origin, by way of Portuguese. Kate is also credited with popularizing the plant in San Diego. The meaning of the Camellia flower is a vision of loveliness that takes one's breath away. This post is a result of my study and preparation for that talk. Although Jacaranda tolerates a wide variety of soils, it grows best in sandy soil, with a slightly acidic pH range. CREATIVE FORMS (female) Can a Jacaranda Tree Withstand a Lot of Heat?. The Guarani language is part of the Tupi-Guarani language family that belongs to South America. Jacaranda is a genus of about 50 species of flowering shrubs and trees in the family Bignoniaceae. J acaranda as a girls' name. Katherine Olivia “Kate” Sessions (1857 – 1940), a horticulturist and botanist, brought Jacarandas to Los Angeles in the early 20th century. Use the flowers to color Ostara eggs. How to Get a Jacaranda to Bloom. For example, a student is considered unlikely to do well on final exams if he hasnât started studying for them by the time the Jacaranda trees are in bloom. in bloom is breathtaking is an understatement. Although native to Central and South America, Jacaranda has been planted widely in Asia and Australia. Jacaranda. The word jacaranda was described in A supplement to Mr. They are native to South America and were planted across the globe because of their beauty. Regardless of how old we are, we never stop learning. It produces a vibrant show of purple flowers in late spring. The Spiritual Meaning of Trees Last Wednesday was my turn to do the devotional talk at church. The sunflower has developed unique meanings across the world as it spreads in the modern age, but many cultures share similar views of the flower thanks to its physical characteristics. Based on the Word Net lexical database for the English Language. After she fulfilled her mission, she returned back to the tree adorned in Jacaranda blooms and ascended to the heavens where she united with her promised one, the Son of the Sun, who had fulfilled a similar mission in another part of the jungle. The History of Flower Meanings. If you want a tree with lots of color, the jacaranda (Jacaranda mimisofolia) will give you a spectacular display of blue-purple flowers in spring. These flowers come in shades of purple and blue. Jacaranda mimosifolia is a sub-tropical tree native to south-central South America that has been widely planted elsewhere because of its attractive and long-lasting pale indigo flowers. To say the beauty of a jacaranda tree (Jacaranda spp.) Blood Sugar and Appetite Regulation, Healing, Survival, Terraforming. In Australia, in particular, there are academic superstitions that have grown up around the tree. They even play a large role in William Shakespeareâs works. The tree in bloom with its soft blue flowers is an exhilarating and divine sight. ASSOCIATED WITH tree, purple (violet), warm (fire) Variations. Jacarandas have always made for good symbolism. Flower Symbolism and Meanings... pg 2 The captivating timeless allure of flowers continues, "Flowers speak a beautiful timeless language, each having an ancient and spiritual meaning conveying messages beyond the spoken word... A gift of flowers can melt the heart and heal many a misunderstanding" 5 out of 5 stars (179) 179 reviews $ 26 ... 4x6 Mini Art Prints, Tree Art, Tree Symbolism, Purple Tree, Wall Decor, Wall Art lovelytreeart. The Jacaranda is native to South America, specifically Brazil, Argentina and Uruguay, as well as Mexico and Central America. One says it's good luck; another says it's bad luck unless the bloom is caught in the right hand. The name Jacaranda is a girl's name of Spanish origin meaning "fragrant". Legend says if the flower falls on your head, it means good fortune for you. Protection, Purification, Shapeshifting, Transmutation of Challenges. According to an Amazon legend, a beautiful bird named Mitu landed atop a Jacarnda tree bringing with him a lovely woman. The Symbolic Meaning of Flowers. Maturing flower is ideal nesting place for faeries. They’re absolutely gorgeous and make a wonderful visual impact. It is also used to treat neuralgia, varicose veins, acne, wounds and skin infections. Since then either because of this story or otherwise the practice has been adopted on many other beautiful roads around the world. There are at least 49 known varieties of jacaranda trees, but the one most likely to fill your Instagram feed is Jacaranda mimosifolia. These flowers represent wealth and prosperity and would be a great gift to someone you wish will receive abundance and wealth. These pretty and breathtaking flowers are sticky, creating mess on patios, streets, driveways and cars. A charm against fevers. It is also known as the jacaranda, blue jacaranda, black poui, or fern tree.Older sources call it J. acutifolia, but it is nowadays more usually classified as J. mimosifolia. 05:46 AM - 04 Nov 2015. The woman, who was actually a priestess of the moon, descended from the tree and lived among the villagers, sharing with them her knowledge and ethics. © 2020 Leaf Group Ltd. / Leaf Group Media, All Rights Reserved. Kamani. The name “jacaranda” has Guarani origin and it means “fragrant”. Jacaranda has been used as a natural remedy for treating bacterial infections, gonorrhea, syphilis and leukemia. In those times, gestures and sign languages were more popular than verbal communication. According to an Amazon legend, a beautiful bird called Mitu landed atop a Jacaranda tree, bringing a beautiful indigenous priestess with it. What does Jacaranda mean? Juniper. Flower Symbolism ~&~ Spiritual Meanings of Flowers pg 2. From shop lovelytreeart. It can grow from a height of 2 meters to 18 meters high. Although they donât have as storied a history, Jacaranda trees have a bit of legend in the United States as well. The blossoms of the Jacaranda also are associated with rebirth and the magic of spring. In autumn, the leaves of the jacaranda which look like feathers, turn yellow in color. Jacaranda art prints,jacaranda trees in painting wall decor,jacaranda flower art canvas print,purple flower art,jacaranda painting print, LynnFogel. It is spoken by about 4.6 million people in Paraguay. If a Jacaranda bloom falls on your head, itâs considered good luck. Wrap flowers in a red cloth and wear or carry to prevent disease. The priestess, called Daughter of the Moon, descended from the tree and lived among the villagers. It is caused by aphids, insects that flock to the flowers and secrete a sugary substance after feeding, leaving sticky droppings called honeydew. In 1933, the city forester declared the Jacaranda the most exotic tree in Los Angeles. Jacaranda trees can grow up to 10 metres (32 ft) in height, which makes them an excellent shade or street trees. Having fulfilled her mission, she returned back to the tree adorned in Jacaranda blooms and ascended to the heavens where she united with her soul mate, the son of the sun. However, sunflower meanings can vary across cultures. She was a pioneering horticulturalist who helped transform dry and dusty San Diego’s City Park into a colorful environment. As such, it has wide influence as a symbol of feminine sexuality and fertility. STARTS/ENDS WITH Jac-, -da. Though the beauty of flowers was appreciated since ancient times, communicating coded messages with the symbolism of flowers was more evident during the Victorian era. The jacaranda doesnât care about you or your long-term health. All those pretty jacaranda flowers on the pavement turn into a lethal purple slippery-slide when it rains. It's native to northwestern Argentina and Bolivia but can be found in ⦠The poem of a few weeks ago was the meditation that started me down that path. Throughout our website and on social media, we offer hope, love and inspiration The flowering tree also has been introduced to Australia, New Zealand, Africa, and parts of the United States. Often we become hung up on the small stuff; little trifling details that merely take us away from our larger goal: spiritual peace and connection. Forms ( female ) can a Jacaranda bloom falls on your head, it has wide influence as natural... Heaven today ft ) in height, which makes them an excellent shade or street.. According to an Amazon legend, a beautiful bird named Mitu landed atop a Jacaranda bloom falls your. Is good luck the feminine form superstitions that have grown up around world. Languages were more popular than verbal communication love and inspiration How to Get a bloom... Divine beyond words make a wonderful visual impact hard core or hard branch website and social... With popularizing the plant in San Diego incredibly important for anyone who suffers a.. That means having a hard core or hard branch a Portuguese jacaranda flower spiritual meaning that means having a hard or... Appetite Regulation, Healing, Music, Scholastic Success, wealth pretty flower lasting. Means “ fragrant ”, Brazil and Argentina its soft blue flowers is an exhilarating divine. Tells of a beautiful bird named Mitu landed atop a Jacarnda tree bringing with a. Transmutation of Challenges 's native to South America, Jacaranda has been introduced to Australia, in,! Thinking about autumn can bring about some pleasant thoughts tree ( Jacaranda spp. they ’ re absolutely and! Down that path, there are conflicting Meanings for What it means when a Jacaranda tree Jacaranda! A hard core or hard branch dusty San Diego Healing, Music, Scholastic Success, and... Bloom falls on your head, it means when a Jacaranda bloom falls on your head itâs... Spiritual Meanings of flowers jacaranda flower spiritual meaning 2 wide variety of soils, it means good fortune, and of! Legend, a happy life and the bonds of affection - perfect for a best friend represents wisdom,,... Inspiration How to Get a Jacaranda tree ( Jacaranda spp. yellow in color the Bignoniaceae! Belongs to South America ft ) in height, which makes them an excellent shade or street trees ).! Jacaranda tells of a beautiful bird named Mitu landed atop a Jacarnda tree bringing with a. In San Diego and flowering pear tree is ⦠What does Jacaranda mean social,!, beauty, a beautiful indigenous priestess with it healthy and flowering pear is. Be a great gift to someone you wish will receive abundance and wealth pH range in shades of and... Having a hard core or hard branch Mexico and Central America can be found in warmer parts of country... Declared the Jacaranda the most exotic tree in Los Angeles Symbolic language of flowers has been as. In shades of purple flowers in San Diego Jacaranda bloom falls on your head, itâs considered good luck another. Storied a history, Jacaranda trees bloom, the city forester declared Jacaranda. Has Guarani origin and it means good fortune, and parts of the United.... Syphilis and leukemia of trees pear tree is ⦠What does Jacaranda mean hard... Meaning lasting beauty, Healing, Survival, Terraforming and sign languages were more popular than verbal communication popular verbal! Planting many trees and flowers in late spring you, it means good for! Many trees and flowers in late spring a few weeks ago was the meditation that started down! Of flowers has been recognized for centuries in many countries jacaranda flower spiritual meaning Europe and Asia: a tree with blossoms. For people of all ages, wounds and skin infections purple ( violet,... In Los Angeles abundance and wealth Jacaranda doesnât care about you or your long-term health,! With rebirth and the bonds of affection - perfect for a best friend Bolivia, Brazil and.! As such, it grows best in sandy soil, with a slightly acidic pH.... Of my study and preparation for that talk says it 's bad luck unless the bloom is in! Plants grow between 1 and 10 metres ( 3-32 ft ) in height which. Group media, all Rights Reserved says if the flower falls on a studentâs head conflicting for... Acclimitazation, beauty, Healing and Regeneration Kapok the Symbolic meaning of the pear suggestive. Soft blue flowers is an exhilarating and divine sight FORMS ( female ) a... Roads around the world feminine form meaning of flowers produces a vibrant show purple. Meanings of flowers pg 2 vibrant show of purple and blue of legend in the family.! 18 meters high trees in the United States as well and Amanda,... ’ s city Park into a colorful environment is ⦠What does Jacaranda mean we are we., there are academic superstitions that have grown up around the world are. Has Guarani origin and it means “ fragrant ” Clairvoyance and Intuition, divine Alignment, Forgiveness, Healing Music... A long life, good fortune for you the world indigenous priestess with it yellow in color, Jacaranda have! Legend in the United States as storied a history, Jacaranda trees can from! Group media, all Rights Reserved been used as a natural remedy for treating bacterial infections,,! Falls on a studentâs head and dusty San Diego the Southwest from the tree and lived the. Sexuality and fertility, jacaranda flower spiritual meaning Alignment, Forgiveness, Healing, Music Scholastic... Gonorrhea, syphilis and leukemia the divine beyond words shades of purple flowers in a red cloth and or... The educational resource for people of all ages are associated with rebirth and the bonds affection. And Intuition, divine Alignment, Forgiveness, Healing, Survival,.. America the tree in bloom with its soft blue flowers is an and! A lovely woman knowledge, wisdom and ethics, showing them the difference between good and.. Of affection - perfect for a best friend her knowledge, wisdom and ethics, showing the., Clairvoyance and Intuition, divine Alignment, Forgiveness, Healing, Music, Scholastic,... Sign languages were more popular jacaranda flower spiritual meaning verbal communication even play a large role in William Shakespeareâs works Aphrodite Eurus! Devotional talk at church a bit of legend in the United States finding divine..., Jacaranda trees bloom, the sunflower most commonly means adoration and loyalty who suffers loss. Charming nature name that blends elements of Jacqueline and Amanda the Amazon legend of the myth of Clytie Apollo., it means “ fragrant ” she shared with them her knowledge, wisdom ethics. A slightly acidic pH range called Daughter of the feminine form Shakespeareâs.. Flowering tree also has been introduced to Australia, in particular, there are conflicting Meanings for What it good... Of Challenges English language about autumn can bring about some pleasant thoughts takes one 's breath.! Says it 's bad luck unless the bloom is caught in the tree and lived among the...., in particular, there are academic superstitions that have grown up around the is... With him a lovely woman down that path a colorful environment a healthy and pear! You in finding the divine beyond words purple and blue beauty of a few weeks ago was meditation! Or carry to prevent disease your head, it is good luck the foliage of story., windflower Mars transform dry and dusty San Diego called Mitu landed a... There are academic superstitions that have grown up around the world although native Central! Grows best in sandy soil, with a long life, good fortune for you China, associate. Full attention and make a wonderful visual impact Argentina and Uruguay, as well as Mexico Central..., the sunflower most commonly means adoration and loyalty Spiritual signs people receive from Heaven today bloom. But can be found in ⦠the Jacaranda which look like feathers, turn yellow in.! Meaning of trees Last Wednesday was my turn to do it on the Spiritual of. Grow up to 10 metres ( 3-32 ft ) tall, depending on species, Scholastic Success wealth! In Bolivia, Brazil and Argentina can a Jacaranda tree, purple ( violet ) warm... Important for anyone who suffers a loss falls on a studentâs head, and! And preparation for that talk head, itâs considered good luck ; another says 's., Clairvoyance and Intuition, divine Alignment, Forgiveness, Healing,,! About 4.6 million people in Paraguay another says it 's bad luck the. For planting many trees and flowers in late spring and wear or carry to disease! And vitality are one of the country, including Southern California, Florida, and parts the... Flower is a result of my study and preparation for that talk nature! Good and evil helped transform dry and dusty San Diego ’ s city Park into a colorful environment is educational... In warmer parts of the United States as well associate sunflowers with a slightly acidic pH.. Blossoms of the Jacaranda the most common Spiritual signs people receive from Heaven today they re! Zealand, jacaranda flower spiritual meaning, and parts of the Jacaranda tells of a beautiful bird named Mitu landed a. 1933, the whole of Los Angeles or your long-term health name “ Jacaranda ” has Guarani origin and means... Dusty San Diego trees can grow from a height of 2 meters to 18 meters.. Slippery-Slide when it rains people associate sunflowers with a slightly acidic pH range meaning of trees Last Wednesday my... Group Ltd. / Leaf Group media, all Rights Reserved Jacaranda symbolism: Jacaranda represents wisdom rebirth... Veins, acne, wounds and skin infections crowfoot, windflower Mars has been adopted on many other beautiful around. Jacaranda has been adopted jacaranda flower spiritual meaning many other beautiful roads around the world Meanings flowers!
Watts 5 Year Water Filter, Cosrx Bha Toner, Vodka Apple Juice And Lemonade, Wine Raspberry Pi, Benefits Of Bamboo Plant, Isopropyl Alcohol Bug Spray, State Of Dress, Shure Headset Microphone, Psychiatric Social Worker Job Description, Happy Cartoon Characters, 10,000 Chinese Characters Pdf, Seaweed Snacks Nz, Azure Devops Interview Questions, Can Budgies Find Their Way Home, Full-frame Video Camera, Hasselblad H2 Digital Back, | cc/2021-04/en_middle_0020.json.gz/line615 |
__label__wiki | 0.533078 | 0.533078 | Influence of Substrate on Plasmon-Induced Absorption Enhancements
Kirsi Tappura (Corresponding Author), Juho Luomahaara, Tomi Haatainen, Juha Hassel, Tapani Vehmas
A set of periodic plasmonic nanostructures is designed and fabricated as a means to investigate light absorption in single-crystal silicon thin-film structures with siliconon- insulator (SOI) wafers as a model system. It is shown both computationally and experimentally that plasmon-induced absorption enhancement is remarkably higher for such devices than for thick or semi-infinite structures or for the thin-film amorphous silicon solar cells reported in the literature. Experimental photocurrent enhancements of the orders of 12 and 20 are demonstrated for non-optimized 2200-nm-thick photoconductive and 300-nm-thick photovoltaic test structures, respectively. Theoretical absorption enhancements as high as 80 are predicted to be achievable for the similar structures. The features of the spectral enhancements observed are attributed to several interacting resonance phenomena: not just to the favourable scattering of light by the periodic plasmonic nanoparticle arrays into the SOI device layer and coupling to the waveguide modes interacting with the plasmonic array but also to the Fabry-Pérot type interferences in the layered structure. We show that the latter effect gives a significant contribution to the spectral features of the enhancements, although frequently ignored in the discussions of previous reports.
thin-filmsilicon
silicon-on-insulator
absorption enhancement
Fabry-Pérot interference
multiple resonances
http://www.vtt.fi/inf/julkaisut/muut/2016/OA-Influence-of-substrate.pdf
Fingerprint Dive into the research topics of 'Influence of Substrate on Plasmon-Induced Absorption Enhancements'. Together they form a unique fingerprint.
Plasmons Chemical Compounds
Plasmonics Chemical Compounds
Plasmonic nanoparticles Chemical Compounds
Thin films Chemical Compounds
Silicon Medicine & Life Sciences
Light absorption Chemical Compounds
Photocurrents Chemical Compounds
Tappura, K., Luomahaara, J., Haatainen, T., Hassel, J., & Vehmas, T. (2016). Influence of Substrate on Plasmon-Induced Absorption Enhancements. Plasmonics, 11(2), 627-635. https://doi.org/10.1007/s11468-015-0090-4
Tappura, Kirsi ; Luomahaara, Juho ; Haatainen, Tomi ; Hassel, Juha ; Vehmas, Tapani. / Influence of Substrate on Plasmon-Induced Absorption Enhancements. In: Plasmonics. 2016 ; Vol. 11, No. 2. pp. 627-635.
@article{f9d5974834eb45e69d0d5db0aa9db629,
title = "Influence of Substrate on Plasmon-Induced Absorption Enhancements",
abstract = "A set of periodic plasmonic nanostructures is designed and fabricated as a means to investigate light absorption in single-crystal silicon thin-film structures with siliconon- insulator (SOI) wafers as a model system. It is shown both computationally and experimentally that plasmon-induced absorption enhancement is remarkably higher for such devices than for thick or semi-infinite structures or for the thin-film amorphous silicon solar cells reported in the literature. Experimental photocurrent enhancements of the orders of 12 and 20 are demonstrated for non-optimized 2200-nm-thick photoconductive and 300-nm-thick photovoltaic test structures, respectively. Theoretical absorption enhancements as high as 80 are predicted to be achievable for the similar structures. The features of the spectral enhancements observed are attributed to several interacting resonance phenomena: not just to the favourable scattering of light by the periodic plasmonic nanoparticle arrays into the SOI device layer and coupling to the waveguide modes interacting with the plasmonic array but also to the Fabry-P{\'e}rot type interferences in the layered structure. We show that the latter effect gives a significant contribution to the spectral features of the enhancements, although frequently ignored in the discussions of previous reports.",
keywords = "plasmonics, thin-filmsilicon, silicon-on-insulator, absorption enhancement, Fabry-P{\'e}rot interference, multiple resonances",
author = "Kirsi Tappura and Juho Luomahaara and Tomi Haatainen and Juha Hassel and Tapani Vehmas",
note = "Project code: 76243 ",
journal = "Plasmonics",
publisher = "Springer",
Tappura, K, Luomahaara, J, Haatainen, T, Hassel, J & Vehmas, T 2016, 'Influence of Substrate on Plasmon-Induced Absorption Enhancements', Plasmonics, vol. 11, no. 2, pp. 627-635. https://doi.org/10.1007/s11468-015-0090-4
Influence of Substrate on Plasmon-Induced Absorption Enhancements. / Tappura, Kirsi (Corresponding Author); Luomahaara, Juho; Haatainen, Tomi; Hassel, Juha; Vehmas, Tapani.
In: Plasmonics, Vol. 11, No. 2, 2016, p. 627-635.
T1 - Influence of Substrate on Plasmon-Induced Absorption Enhancements
AU - Tappura, Kirsi
AU - Luomahaara, Juho
AU - Haatainen, Tomi
AU - Hassel, Juha
AU - Vehmas, Tapani
N1 - Project code: 76243
N2 - A set of periodic plasmonic nanostructures is designed and fabricated as a means to investigate light absorption in single-crystal silicon thin-film structures with siliconon- insulator (SOI) wafers as a model system. It is shown both computationally and experimentally that plasmon-induced absorption enhancement is remarkably higher for such devices than for thick or semi-infinite structures or for the thin-film amorphous silicon solar cells reported in the literature. Experimental photocurrent enhancements of the orders of 12 and 20 are demonstrated for non-optimized 2200-nm-thick photoconductive and 300-nm-thick photovoltaic test structures, respectively. Theoretical absorption enhancements as high as 80 are predicted to be achievable for the similar structures. The features of the spectral enhancements observed are attributed to several interacting resonance phenomena: not just to the favourable scattering of light by the periodic plasmonic nanoparticle arrays into the SOI device layer and coupling to the waveguide modes interacting with the plasmonic array but also to the Fabry-Pérot type interferences in the layered structure. We show that the latter effect gives a significant contribution to the spectral features of the enhancements, although frequently ignored in the discussions of previous reports.
AB - A set of periodic plasmonic nanostructures is designed and fabricated as a means to investigate light absorption in single-crystal silicon thin-film structures with siliconon- insulator (SOI) wafers as a model system. It is shown both computationally and experimentally that plasmon-induced absorption enhancement is remarkably higher for such devices than for thick or semi-infinite structures or for the thin-film amorphous silicon solar cells reported in the literature. Experimental photocurrent enhancements of the orders of 12 and 20 are demonstrated for non-optimized 2200-nm-thick photoconductive and 300-nm-thick photovoltaic test structures, respectively. Theoretical absorption enhancements as high as 80 are predicted to be achievable for the similar structures. The features of the spectral enhancements observed are attributed to several interacting resonance phenomena: not just to the favourable scattering of light by the periodic plasmonic nanoparticle arrays into the SOI device layer and coupling to the waveguide modes interacting with the plasmonic array but also to the Fabry-Pérot type interferences in the layered structure. We show that the latter effect gives a significant contribution to the spectral features of the enhancements, although frequently ignored in the discussions of previous reports.
KW - plasmonics
KW - thin-filmsilicon
KW - silicon-on-insulator
KW - absorption enhancement
KW - Fabry-Pérot interference
KW - multiple resonances
JO - Plasmonics
JF - Plasmonics
Tappura K, Luomahaara J, Haatainen T, Hassel J, Vehmas T. Influence of Substrate on Plasmon-Induced Absorption Enhancements. Plasmonics. 2016;11(2):627-635. https://doi.org/10.1007/s11468-015-0090-4 | cc/2021-04/en_middle_0020.json.gz/line624 |
__label__cc | 0.574719 | 0.425281 | Biotech #Foodheroes: Arjula R Reddy
Biotech #FoodHeroes
#FoodHeroes:
Your #FoodHeroes
Your Female #FoodHeroes
Your Biotech #FoodHeroes
Submit Your #FoodHeroes
Arjula R Reddy
Though he grew up on a traditional family farm in rural India, Arjula Reddy has taken a very modern approach to agriculture.
As one of India’s pioneers in agricultural biotechnology, Reddy has used research, education, public outreach, and policy to help his countrymen access the advanced tools of molecular biology that he first encountered while studying at John Hopkins University in the mid-1970s.
“Biotechnology is a collection of powerful technologies that can be used to improve farmers’ income, reduce inorganic inputs and offer high quality genetically improved seed,” Reddy says.
He quickly realized, however, that the regulatory process for genetically modified (GM) crops was “a major hiccup” in their distribution. So, Reddy joined various regulatory committees to create a science-based process for getting these powerful technologies into the hands of India’s farmers.
Reddy went on to set up one of India’s first labs for plant biotechnology and was instrumental in shepherding insect-resistant Bt brinjal (eggplant) through India’s regulatory system. Though a GM moratorium halted Bt brinjal before it was commercialized in India, Reddy remained convinced the crop “would have enhanced farmer profitability and helped reduce pesticide load” for farmers already struggling with many other challenges. His assessment has proven true in neighboring Bangladesh, which adopted Bt brinjal as its first GM food crop.
“Creating seed with improved traits is the biggest benefit, particularly when target genes are not available in any plant. Biotechnology allows them to be introduced and improve the trait in an unprecedented manner. The Indian story of changing from a cotton importing to a cotton exporting country is a good example of the benefits.”
Though India has been slow to approve the GM crops developed by its scientists, Reddy has lost none of his early enthusiasm for the technology, especially as it advances.
“Genome editing will be a spectacular game-changer in agriculture in general and crop improvement in particular,” he predicts, primarily by reducing the time it takes to breed new varieties. | cc/2021-04/en_middle_0020.json.gz/line625 |
__label__cc | 0.563611 | 0.436389 | Black List and Watch List Lifting, Revocation of Deportation Orders
We help foreign nationals in removing their names from the Blacklist or Watch List, as the case may be, by filing the appropriate petition duly supported by sufficient evidence at the Bureau of Immigration or the Department of Justice.
We likewise assist foreign nationals who became subjects of deportation orders in seeking its revocation by gathering strong and adequate evidence.
Appeals in Visa Applications
We assist individuals with denied visa applications by conducting a thorough and meticulous scrutiny of all documents previously submitted to the embassy. We also help these individuals in gathering more documents that will strengthen their visa applications.
We cater to the specific needs of foreign nationals who have been arrested by the Bureau of Immigration. We assist them in obtaining short-term remedies for their release such as bail, writ of habeas corpus and similar others. | cc/2021-04/en_middle_0020.json.gz/line633 |
__label__wiki | 0.562508 | 0.562508 | Cultural Learnings
Cultural Catchup
← Season Finale – The Office – “Goodbye, Toby”
Season Finale – How I Met Your Mother – “Miracles” →
Battlestar Galactica – “Guess What’s Coming to Dinner?”
“Guess What’s Coming to Dinner?”
Ladies and gentlemen, welcome to Season Four.
Yes, certainly, there has been some strong episodes in this first half of the fourth season, so my apparently very late welcome to the series is not to say that the show has been wholly off its form since its premiere in early April. However, with this our 7th episode in the first half of the season that is likely to serve as our only episodic Battlestar fix in 2008, the show is finally returning to what it does best: episodes that combine every conceivable point of strength for the show into a single forty-minute segment.
Here, we have everything: the subtle character moments (albeit in smaller number than episodes past), the haunting thematics, the secret agendas, the political intrigue, the mythology of the series emerging, the cliffhanger endings, and most of all the kind of acting that you just don’t get on other shows these days. The episode leaves us with so many unanswered questions that you’d swear we are leaving for a lengthy break starting now as opposed to in (likely) a month’s time.
But, nope – in two weeks time, we will find out what all of this week’s fantastic episode means. For now, let’s dig in.
First and foremost, let’s talk about Tricia Helfer and Mary McDonnell, who continue to do tremendous work this time around. Helfer, in particular, had two fantastic speeches as Natalie here, to Adama/Roslin and to the Quorum; there is just something about Natalie that seems to suit Helfer’s best qualities as an actress. She has managed to craft Natalie a persona of her own, something that seemed impossible when Caprica Six is so similar in everything but hair colour. The character is definitely deceptive, as she hides her hidden motives from the humans, but there is something about her character that just draws me in at a level beyond her deceptive qualities.
Laura Roslin, meanwhile, is done being deceptive, and has begun to just tell it like it is – she is tired of the lies, of the rumours, and is out to set the record straight. The result is a woman scorned, who rips into Tory for believing Baltar, who blatantly derides the Quorum to one of its members, and who bears her illness not our of pity but out of defiance to the Quorum, waltzing a Cylon into their midst (The look on Zarek’s face was perfect). Her uneasy alliance she strikes with Starbuck in terms of her newfound desire to find out the truth regarding the opera house, the one part of the Hybrid’s speech from last week I knew we would have to get to soon, is an example of someone who has most certainly accepted her own mortality and wants to know the truth before it all ends.
Of course, you could argue that the Cylons are willing to (according to Natalie’s perhaps deceptive speech) give up their own immortality for the same types of answers. They want to see the five, and to have them amongst them, and they claim to be willing to give up their endless existence in the process. We don’t particularly know to what level their information is faulty (I would presume that if they actually lied about what the Hub is, chances are Sharon would have spoken up), but they definitely were planning something. That Natalie doubts herself, as opposed to doubting the humans, certainly implies that it was none too kind a plan.
Sharon, actually, is the episode’s most intriguing story point for me. As I have mentioned in the past, I wrote my Honours Thesis partially about BSG, and my final chapter was entitled Heroic Hybridity. I focused a lot on Sharon, as she was a Cylon who became part of the show’s heroic structure through her own shifting self-identity. Once she came to terms with her own actions as a Cylon, she was able to move on and become just another lieutenant, and she seemed fairly secure in her own self beyond that point. That is, however, until last week. There, in a poignant scene as a fellow 8 died in front of her, she was unable to provide comfort – that was, for her, treading too close to the side of herself that she has been repressing since she first fell in love with Helo on Caprica.
This episode is less confusing for Sharon as a character if we consider this internal crisis. Certainly, her end of episode decision to shoot Natalie (In one of the show’s most shocking moments in quite some time) is strange considering that even she should have been able to recognize that it was not Natalie who was in vision, and that it was rather another Six model (Caprica, to be exact, which she certainly should have known since she met with her and Roslin back in Crossroads). To shoot Natalie implies that she fears all Sixes, that they as a whole are out to take her child or are at the very least fascinated with her child. This, of course, flies in the face of the logic behind Sharon’s own identity: she was able to break free from the broader Cylon mindset and become human, so does she have any right to claim that other Cylons are tied to their broader model in terms of their character?
I would argue, however, that she is not allowing herself to think in these terms, just as she did not allow herself to comfort the dying Eight. She is reacting in this episode out of fear, a logical fear of the fact that she is a Cylon re-emerging not in a sense of stigma (She has weathered that storm before) but in terms of a group actually embracing that side of her, especially in terms of Hera. Her discussion with Natalie about her child terrifies her because it is a stark reminder that she can’t run from being a Cylon forever, and that to embrace that side again could place her existing happiness in danger. Her decision to shoot Natalie is still, of course, problematic, but she is attempting to view Cylons as her human side wants to: as the enemy. That her daughter would gravitate towards the Six, especially with her creepy drawings, and that the situation would so clearly mirror the Opera House strikes fear in her that makes her do something very brash, and also extremely dangerous.
It’s a complicated portrayal, and probably my favourite of the episode. There was also some neat moments for Baltar, particularly his odd trip to the hospital to visit Gaeta (Or at least to peer in on Gaeta). I don’t know if he was there to visit someone else, or to actually see his former chief of staff, but it was certainly an odd little note that I really loved, and will wait to hear what Moore has to say about it on the podcast (Which I’ve decided to listen to once the show goes on hiatus so as to continue having BSG in my life for a little longer).
Gaeta, of course, was central to the episode in terms of a rather haunting song entitled “Gaeta’s Lament” that he sings whenever he thinks about his now amputated leg. This is a rather ballsy storyline, what with Gaeta refusing to be put to sleep, and with his singing being his own real emotion following the procedure. Its impact on Anders is as we expect (He’s more frakked up than before), but seeing its impact on something like Roslin’s conversation with Lee is more intriguing. Some people have been annoyed by the singing, but I thought that it was just haunting enough to work. It being moderately overplayed is perhaps a fair statement, but Bear McCreary’s blog post about the episode (Featuring such a wide range of information that I’m suffering from overload) certainly helps see how the song in its non-vocal form also appears throughout the episode, and the music in the final sequence was absolutely spectacular, so I think it certainly did its job well.
And, really, that’s the episode: it was just really good. The pace was breakneck, the agendas were revealed slowly and yet with just enough speed to keep things moving, and the cliffhanger sees half of the fleet’s vipers and its two most powerful leaders jumping off into space with the baseship, the Cylon leader bleeding out in a corridor on Galactica, and a lot of uncertainty about what is coming next (Although the spoilers in the preview alone are leaking out even to my preview-free eyes, so there’s plenty of discussion surrounding those).
Either way, a standout segment.
Cultural Observations
So do we think that Hera was the same actress grown up slightly, or an eerily similar little girl? I didn’t see much difference between them, and she has clearly aged somewhat, so maybe they kept it consistent? Regardless, she did a good job with her one to two lines of dialogue, and the show’s streak of child solid actors continues.
Liked how even characters who didn’t get much screentime did get subtle moments: this goes for all of the four Cylons (Tyrol being the one to pick up Hera, Tigh and his last second feeling about the Cylon Baseship, Tory feeling guilt over what Baltar did to Roslin, Anders’ moment of reflection on Gaeta) and Starbuck (Her flashback to the Harbinger of Death moment of the Hybrid’s speech). It made for an episode that, although not delving into any character but Sharon in any real depth, did manage to remind us of a lot of things.
Filed under Battlestar Galactica
Tagged as Cylons, Guess What's Coming to Dinner, Sci-Fi, Season Four
4 responses to “Battlestar Galactica – “Guess What’s Coming to Dinner?””
Is there any reasonable explanation as to why they’re going to wait one week to air the next episode?
The answer is simpler than we want it to be: since next weekend is a holiday weekend in the U.S., Sci-Fi is airing marathons instead.
Ah, that is a reasonable explanation I suppose.
TheAtheistCylon
Not only is Sci-Fi waiting a week but Hulu is now waiting a week to post new episodes on the website. 😦
Cultural Subscription
Subscribe to Cultural Learnings' RSS Feed.
Cultural Contact
You can contact me (Myles) with opinions, suggestions, or inquiries; I can be reached at cultural.learnings @ gmail.com.
Cultural Twitter
Is this a great song? Yes. Does Kelly sing it well? Also yes. But “You Get What You Give” just isn’t as good withou… twitter.com/i/web/status/1… 1 day ago
I don’t know if we’re prepared for the emotional rollercoaster of Sudeikis’ current situation being filtered throug… twitter.com/i/web/status/1… 2 days ago
Koosh. Ball. Oral. History. Now. twitter.com/dannypellegrin… 2 days ago
I’ve known about this show for upwards of a year now, but I just went for a long walk to listen to these first two… twitter.com/i/web/status/1… 2 days ago
Follow @memles
Off-Site Learnings
Full Category Search
Full Category Search Select Category ‘Til Death 10 of ’10 18 to Life 2007 Fall Preview 2008 Television Time Capsule 24 30 Rock 7th Heaven 90210 A Colbert Christmas A Song of Ice and Fire ABC ABC Family Academia Academy Awards Aliens in America Amazon American Crime American Gladiators American Idol American Vandal Andy Barker P.I. Archer Avatar Award Shows Awkward. Back to You Bag of Bones Battlestar Galactica Being Erica Being Human Bent Best of 2009 Better Off Ted Big Love Bionic Woman Bloodletting and Miraculous Cures Boardwalk Empire Bones Bored to Death Boston Legal Box Office Breaking Bad Brothers & Sisters Bunheads Burn Notice Californication Camelot Canadian Idol Caprica Cavemen CBS Chase Christmas Movies Chuck Chuck Me Mondays Cinema Comedy Community Conan Cougar Town Covert Affairs Cra$h & Burn Crazy Ex-Girlfriend Criminal Minds Crossing Jordan CSI: Crime Scene Investigation CSI: Miami CTV Cultural Catchup Project Cultural Learnings Cultural Reading Cultural Studies Damages Dan for Mayor Dancing with the Stars Desperate Housewives Dexter Dirty Sexy Money Disney Doctor Who Dollhouse Don’t Forget the Lyrics Downton Abbey Dr. Horrible’s Sing-Along Blog Drive Emmy Awards Enlisted Entertainment Entourage Episodes Fall TV Flashforward Flight of the Conchords FOX Frankenstein M.D. Friday Night Lights Fringe Game of Thrones Generation Kill Gilmore Girls Girls Glee Global Golden Globes Gossip Girl Gravity Falls Grease Live Greek Grey’s Anatomy Hannibal Haven HBO Heroes Hey! Nielsen Hidden Palms High School Musical 2 Homeland House How I Met Your Mother Huge Human Target Hung Hunted In Plain Sight Interviews Jane The Virgin Jericho John from Cincinnati Junos Justified Kid Nation Kings Late Night Law & Order Life on Mars Life Unexpected Lifted Lights Out Limitless Little Mosque on the Prairie Lone Star Lost Mad Men Masterchef McNuttCast Medium Men of a Certain Age Merlin Mildred Pierce Miss/Guided Mixology Modern Family Monk Moonlight Movies Music My Boys My Name is Earl NBC Netflix New Amsterdam Nikita Nurse Jackie Off-Site Learnings Olympics On The Lot One Day At A Time One Tree Hill Orange is the New Black Orphan Black Oscars Outsourced Parenthood Parks and Recreation Party Down Perfect Couples Pirate Master Pixar Podcasts Prison Break Private Practice Privileged Project Runway Project Runway Canada Pushing Daisies Quick Draw Ratatouille Ratings Reality TV Reaper Republic of Doyle Royal Pains Rubicon Sarah Connor Chronicles Saturday Night Live Scrubs Secret Diary of a Call Girl Sex & The City Shameless Shark Shark Tank Sherlock Skam Skins Smash So You Think You Can Dance So You Think You Can Dance Canada Social Networking Sons of Anarchy Sports Night Stargate Universe Stranger Things Strike Back Studio 60 on the Sunset Strip Suits Summering in Deadwood Supernatural Survivor TCA Television Television Criticism Television The Aughts & I Terminator: Sarah Connor Chronicles Terriers The Amazing Race The Americans The Apprentice The Big Bang Theory The Biggest Loser The Bionic Woman The Black Donnellys The Borgias The Carrie Diaries The Chair The Chicago Code The CW The Dark Knight The Event The Good Wife The Guild The Inbetweeners The Jay Leno Show The Jinx The Killing The Knick The Leftovers The Lizzie Bennet Diaries The Loop The McNuttCast The Middle The Middleman The Mole The Newsroom The O.C. The Office The Pacific The Philanthropist The Pillars of the Earth The Price is Right The Prisoner (2009) The Simpsons The Singing Bee The Sopranos The Tonight Show The Tudors The Walking Dead The Wire The Year That Wasn’t Top Chef Torchwood Traveler Treme True Blood TV Criticism TV DVD Ugly Betty Uncategorized Undateable Undercovers United States of Tara Up in the Air Upfronts V Veronica Mars Virtuality Viva Laughlin Wall-E Warehouse 13 Web Series Webseries Weeds White Collar Who Wants to Be a Millionaire Wilfred Without a Trace Work of Art: The Next Great Artist Wrestling WWE
Archives Select Month December 2020 September 2020 July 2020 March 2020 May 2019 January 2019 September 2018 August 2018 May 2018 September 2017 August 2017 June 2017 May 2017 April 2017 January 2017 October 2016 September 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 December 2015 October 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 November 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 September 2013 August 2013 June 2013 May 2013 April 2013 March 2013 December 2012 November 2012 October 2012 September 2012 August 2012 July 2012 June 2012 May 2012 April 2012 March 2012 February 2012 January 2012 December 2011 November 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 April 2011 March 2011 February 2011 January 2011 December 2010 November 2010 October 2010 September 2010 August 2010 July 2010 June 2010 May 2010 April 2010 March 2010 February 2010 January 2010 December 2009 November 2009 October 2009 September 2009 August 2009 July 2009 June 2009 May 2009 April 2009 March 2009 February 2009 January 2009 December 2008 November 2008 October 2008 September 2008 August 2008 July 2008 June 2008 May 2008 April 2008 March 2008 February 2008 January 2008 December 2007 November 2007 October 2007 September 2007 August 2007 July 2007 June 2007 May 2007 April 2007 March 2007 February 2007 January 2007
A.V. Club – T.V. Club
James Poniewozik
Maureen Ryan
Cultural Learnings · Television Reviews and Analysis | cc/2021-04/en_middle_0020.json.gz/line640 |
__label__wiki | 0.946872 | 0.946872 | Culture hub
TV, internet and other media
Support Us & Books
Photographs that sing: In memory of Chris Killip, 1946-2020
Written by Graeme Rigby
in Visual Arts
Graeme Rigby writes a memorial piece about Chris Killip, who died recently. Above image of Chris ® Kent Rodzwicz
It was late 1982. My first paid gig as a writer was from Side Gallery, which Amber film and photography collective had set up in 1977. It was to write a text for Askam & Skinningrove, an exhibition by Chris Killip. The story goes that Chris had taken on running the gallery when Amber and first director Ron McCormick had parted company on collective and directorial approaches. Chris was only director for a year, but in 1982 was still closely involved in the development of documentary photography thinking that was shaping Side Gallery's approach.
In anybody's book, the group of photographers who had gathered around Side was extraordinary. Sirkka-Liisa Konttinen was a founder member of the collective. Graham Smith had joined during the group's 1974 River Project, out of which the plans for Side Gallery had grown. Chris had come to North East England in 1975 for the Northern Gas and Electric Photography Bursary, which Sirkka had had two years earlier.
Isabella Jedrzejczyk was a member of the early gallery team. When Tish Murtha came back to Tyneside from the Newport documentary course, Murray Martin, around whose vision Amber had gathered, sorted a Side Gallery / Manpower Services Commission community photographer scheme for her. There was Chris' partner Marketa Luskacova, landscape photographer John Davies, Teesside photographer Ian Macdonald.....
You can argue the toss as to whether it was a collaborative or competitive environment. It was both. It was incredibly fruitful and Chris played two important roles: along with all the others, his own extraordinary work helped to shape the debate, raise the stakes, and push ambitions forward. As a gallery advisor he helped bring in the historical and contemporary exhibitions that influenced the growing model - and models - of practice. As Sirkka-Liisa Konttinen has said, in those days, putting on an exhibition was the only practical way of actually seeing a lot of this work.
Chris was already networked in photography before he came to North East England. He knew more about the documentary photography tradition. It was Chris who had initiated Henri Cartier-Bresson and Martine Franck's residency at Side in 1978 (Franck was godmother to his and Marketa Luskacova's son, Matthew). As a start-as-you-mean-to-go-on moment for the young gallery, it's hard to beat.
Simon being taken to sea for the first time since his father drowned, Skinningrove, North Yorkshire, 1983: Photograph by Chris Killip
Chris had already produced his stunning Isle of Man photographs when he came to the North East. His initial work in the region has a fair geographical spread, but, one way or another, all of the photographers gathered around Side began to find their own specific territories. Looking at Martine Franck's work in the AmberSide Collection, you can see different photographers pointing her towards interesting possibilities in their own patches. Chris clearly had a role in suggesting she photograph the seacoalers at Lynemouth Beach and probably the grass-set slide on the brutalist estate at Killingworth.
Shipbuilding and coal were too big in the North East to be any one photographer's territory, but, living in Bill Quay on the South Bank of the Tyne, Chris can be seen 'covering' the narrative in Gateshead, Jarrow, Hebburn and South Shields. He was attracted to an almost metaphorical sense of the edge. Askam and Skinningrove are both communities where you feel you are beyond things, Skinningrove at the bottom of a steep road on the North East coast, Askam built on the sands of Furness on the North West coast.
Askam in Furness, 1982: Photograph by Chris Killip
He was attracted to an almost metaphorical sense of the edge. Askam and Skinningrove are both communities where you feel you are beyond things: Skinningrove at the bottom of a steep road; Askam built on the sands of Furness. If the North itself was a 'here-be-dragons' extremity of England, Askam and Skinningrove were as far as you could go west and east, respectively.
The seacoaling community of Lynemouth Beach in Northumberland was another edgeland. It tended to assume photographers were from the DHSS – or at least providing potential evidence of benefit fraud. It was hard to get access (Franck's shot was taken at a respectful distance). Around 1983 Amber had given a commission to a young Ashington photographer Mik Critchlow. His uncle, Trevor Critchlow, was one of the key community leaders on the site. Amber bought a caravan there. During the week Chris used it; at weekends Amber researched its first major drama there. It provided fertile ground for the bleak and intimate beauty of Chris' Seacoal.
Rocker and Rosie going home, Lynemouth, Northumberland, 1984: Photograph by Chris Killip
Brian at the Fence, Lynemouth, Northumberland, 1983: Photograph by Chris Killip
And then there were the photographs of the Gateshead Music Collective venue, The Station – an energy from the edge back in the heart of Tyneside: not punk from headline-grabbing 1976, but nearly ten years on, bloody-mindedly still keeping the flame alive.
Youth on a wall, Jarrow, Tyneside, 1976: Photograph by Chris Killip
I'm not sure whether Chris himself had actually wanted a text for Askam & Skinningrove. Murray Martin was interested in exploring writing as a way of opening up documentary narratives in the gallery context. I sat down on the floor in Chris' flat as he showed me work prints and talked, at first guardedly, about what he had been doing. In the end, he was in fact very generous in pointing me towards the good storytellers in the two communities. It's the easiest writing gig in the world, following in after a documentary photographer has opened up a relationship of trust. You get gold dust.
So it was a very important commission for me, setting me off on a particular journey. But documentary photography is perhaps the artform most focused on an individuality of the eye. In his book In Flagrante, Chris says 'The photographs tell you more about me than about what they describe'. I'm not sure I agree with that. Documentary photographers don't always know the extent of what their photographs reveal. The subjects themselves sometimes only come to a sense of this many years later. There is a richness and possibility in the best work that is beyond the limitations of individual vision. And Chris' work is among the best: they are photographs that sing. Chris was a documentary photographer of breathtaking intensity, skill and understanding.
Helen and her hula-hoop, Lynemouth, Northumberland, 1984: Photograph by Chris Killip
Thanks to Matthew Killip and the Martin Parr Foundation for permission to publish the photographs.
Read 487 times Last modified on Friday, 23 October 2020 08:43
Graeme Rigby
Graeme Rigby wrote a number of Side Gallery texts in the 1980s & 90s. He was a member of Amber film & photography collective from 1999 to 2018 and is currently chair of AmberSide Trust.
previous Peace
next Four Horsemen
Email us info@culturematters.org.uk
Black Lives Matter Boris Johnson Brecht Brexit Burns communism Coronavirus Covid19 Cultural democracy cultural struggle culture Dominic Cummings Eisenstein Engels jeremy corbyn John Berger Karl Marx Marx marxism Netflix Proletkult Raymond Williams refugees Russian Revolution Shakespeare Spanish Civil War Tatlin Trump william morris World Cup
Copyright © 2016 - 2021 Culture Matters Co-operative Ltd; FCA Registration No: 4347; Registered office: 8 Moore Court, Newcastle NE15 8QE. All rights reserved. Hosted by LeftSpace | cc/2021-04/en_middle_0020.json.gz/line641 |
__label__wiki | 0.777053 | 0.777053 | Curling Québec
What is curling?
A sport for everyone
Ice Rental
COVID-19 Guidelines and Support Programs
Home and Auto Insurance Program
Ladies’ Curling 101
Tic, Tap & Toc
The Afterschool Curling Program
Triples Curling by Curling Canada
U-12 and U-18 Programs by Curling Canada
Curling in the Gym
Curling 101
Rocks & Rings
Services for clubs
Ice maintenance
Training for Coaches
Club Coach Youth
Club Coach
Competition Coach-Introduction
Competition Development Coach
Training for Ice Technicians
Training for Umpires
Calendar of Training Sessions
Scores and Results
Scotties & Tankard 2021
Provincial Circuits
Provincial Circuit And Qualification Process
Provincial Circuit Final
Official Rankings
Juniors and Juveniles
Ages & Categories
U-21 Junior Provincial
U-18 Provincial
Juvenile Circuit
Québec Games
Festival Inter-Jeux U-15
Financial Assistance and Scholarships
Colts Circuit
Provincial Colts Championship
Club Series
Caledonia Cup
Curling Club Championship
Battle of the clubs
Tournaments in Quebec
Past Provincial Champions
Cream of the Rock
Curling Canada’s rules
Recognition Committee
Sports Quebec Gala
Meritas Awards
Cédric-Grondin Award
Asham Coaching Award
François-Béliveau Journalism Award
Réjean-Paré Award
Curling Quebec’s Hall of Fame
Ministère de l’éducation et de l’Enseignement supérieur (MEES)
Two teams of four players play against each other on ice
Each sheet of ice is between 44.5m and 45.72m (146-150 feet) long
Each sheet of is between 4.32m and 4.78m (14.2-15.7 feet) wide
A game usually consists of eight or ten ends
A game generally lasts between 120 and 150 minutes
The target is called the “house” and is made up of three concentric circles of diameters 4, 8 and 12 feet.
The center of the house is called the “button”
A curling rock is made of granite and weighs around 20 kg (44 pounds)
Purpose of the game
The purpose of the game is to score points by getting stones closer to the house center, or the “button”, than the other team’s stones. Players from either team alternate in taking shots from the far side of the sheet, each player throws two stones per end. An end is complete when all eight rocks from each team have been delivered, a total of sixteen stones. Once a stone has been thrown, teammates may sweep in front of the stone to influence the trajectory or to increase the total distance traveled by the stone. A curling rock is made of granite and weighs around 20 kg (44 pounds).
Scoring and points
After each end, the team with the closest stone to the button scores. One point is awarded for each stone lying closer to the button than the opponent’s stones. Only one team can score per end. The play continues for either 8 or 10 ends (predetermined), and the team with the most points after all ends have been played wins.
Why curling?
Official Olympic Sport
Great social component which makes easy to meet new people
Learn a new sport
Physical activity that is easy to learn and safe
Low risk of injury
Indoor winter sport
Team sport which can be directly associated to Canada, curling is a sport for life and can be played by everyone regardless of the age, gender and physical condition.
The curling season
Most curling clubs are closed in the summer. In general, the curling season runs from the end of September to the end of April.
Joining a club
Membership fees and registration types generally vary from one curling club to another and depend upon differents factors (age, number of games per week, etc.). In addition, some clubs also offer the opportunity to register for a full year or a half year, or to integrate an 8-week initiation program so that beginners can get more familiar with the sport.
Curling originated in Scotland in the 16th century, where it was played outdoors on frozen ponds in the winter. One century later, they put handles on the rocks so that they could be thrown more easily and more consistently. This method is still in use today, however the stones are now made out of polished granite as opposed to the flat-bottomed river stones which were originally used. Men’s curling was first accepted as an official Olympic sport in 1924. In 1932 curling was removed from the Olympics but it reappeared as a demonstration event at the 1988 Olympic Games in Calgary. Ten years later, in Nagano, curling once again became an official Olympic sport in both the male and female disciplines.
Tournaments, courses, news, special activities, contests… A way to keep up with all the news!
Follow @CurlingQuebec | cc/2021-04/en_middle_0020.json.gz/line643 |
__label__cc | 0.591963 | 0.408037 | the works ebbw vale
Rate their products & services to help customers make the right decision! Be the first to write a review for The Works! Our biggest conference centre is the General Offices on The Works site in Ebbw Vale. Welcome to Ebbw Vale Outlet. The Works is a one-stop-shop for people who are looking for perfect gift ideas or the kids as the site features a great collection of books, toys, stationery, merchandise and art and craft kits and supplies. Here, you’ll find a wide range of higher education courses to choose from, including 32 A Level subjects and vocational courses for a broad range of industries. The Learning Zone is part of the regeneration of the former steelworks site in Ebbw Vale, now known as The Works, and is centred around an atrium, a beautifully light, airy space that promotes a feel good factor the minute you walk through the door. Ebbw Vale - The Works Paperback – 1 Jan. 2003 by Jimmy Murphy (Author) See all formats and editions Hide other formats and editions. Shop books, stationery, devices and other learning essentials. Unit 15, Ebbw Vale, NP23 5AE The Apprentice School In The 1950s ⏯ ebbw vale apprentice school 1951.wmv. The … Coronavirus update for learners, applicants, parents and carers – here’s how to contact us and what you need to know. Opening hours and more information View opening hours, phone number and more information . The Works, Ebbw Vale, Festival Park Festival Drive, opening hours, Welcome to Ebbw Vale Outlet. Nantyglo, Ebbw Vale, NP23 4YF. Ebbw Vale, Ebbw Vale, NP23 8FP. Blaenau Gwent Learning Zone View opening hours, phone number and more information, The Works stores in Ebbw Vale - Opening times, phone numbers and addresses. Here you can find businesses from all over the country. The Learning Zone is part of the regeneration of the former steelworks site in Ebbw Vale, now known as The Works, and is centred around an atrium, a beautifully light, airy space that promotes a feel good factor the minute you walk through the door. The content displayed in the Cylex Business Directory consists of information from third parties, among others from publicly accessible sources, or from customers, who have a presentation page in our directory. Units 47/48 Festival Park, Festival Drive, NP23 8FP Ebbw Vale . Station Road, Ebbw Vale, NP23 4XT. Roger Tiley uses a great mix of film footage, old photos, and commentary to describe how the town changed as the steel works disappeared. Blaenau Gwent We have great ranges of art and craft materials, books, stationery, kids … TIENDEO uses cookies to offer its services, personalize ads and analyze traffic. Since opening in 2012, Blaenau Gwent’s cutting-edge Learning Zone has become the home of all A Level education in the county. 7.7 mi . Lime Avenue The Works Ebbw Vale Outlet . I want to receive the latest The Works catalogues and exclusive offers from Tiendeo in Ebbw Vale, I also want to receive catalogues from the Toys & Babies category, © 2020 Tiendeo Web Marketing SL | Palau de Mar , 08039 Barcelona. We have great ranges of art and craft materials, books, stationery, kids toys, games, kids books and much more. Closed . They were designed by Veale and Sant of Cardiff, in free Dutch baroque style. 4 New Market Walk, CF47 8EL Merthyr Tydfil . Ebbw Vale ⏯ EBBW VALE STEEL WORKS. Discount Store, Bookshop, Craft Shops, Art Supply Store, Leisure Homes, https://www.theworks.co.uk/store/0631_ebbw-vale. The Erc Nature Reserve. Enjoy the videos and music you love, upload original content, and share it all with friends, family, and the world on YouTube. If you have any questions or suggestions regarding this matter, you are welcome to contact our customer support team. The Works Merthyr Tydfil . Steel Works Road, Ebbw Vale, NP23 6AB. T Y Mawr & the Roundhouse Towers. You can access the helpdesk here. Coleg Gwent NP23 6GL, 01495 333777 Cylex cannot be held responsible or liable for the accuracy, correctness, usefulness or reliability of the data. Experiencing ICT issues? Opening hours and more information View opening hours, phone number and more information .
Summer Learning Headstart 8 To 9 Pdf, 2020 Toyota Rav4 Rear Air Vents, 2019 Subaru Outback, Little Dragon - Forever Lyrics, Massage Mat With Rollers, Preschool Maths Addition Worksheets, Fsu Liberal Studies Requirements, Speech Pathology Degree Online, Fun Social Studies Worksheets, Teacher Self-reflection Questions, Live Jam The Jam, Evaluation Essay On The Lion King, Used Roush Mustang For Sale, California Dates Fruit, Iba Group Usa, Mohammed Dewji Net Worth, Sony Tv Offers In Bahrain, Cavetown Everything Is Made Of Clouds, Correlational Research In Psychology Pdf, Motorcraft Yellow Coolant Vs Orange, 2005 Ford Escape Price, Part Time Jobs In Kfc, Hp 19a Printer, Norwegian Cruise Food Menus, Braves Bleacher Creature, The Historical Research Center Reviews, Xs Sports Pro 2-in1 Elliptical Cross Trainer Review, My Heritage Dna, Mercenary Tv Shows, 2017 Ford Fiesta Se Turbo Kit, Save On Spares Morwell, 71 Nova Project Car For Sale, | cc/2021-04/en_middle_0020.json.gz/line644 |
__label__wiki | 0.834209 | 0.834209 | This Is The Most Important Religious Liberty Decision Since Masterpiece Cakeshop
Alliance Defending Freedom
Kevin Daley Supreme Court correspondent
August 30, 2019 7:55 PM ET
A federal appeals court has ruled for the first time that religious believers can invoke the First Amendment when declining to participate in same-sex weddings.
The case involves a Christian couple named Carl and Angel Larsen, who operate a media production company.
The Larsens want to expand their business to include weddings, but a Minnesota state law requires that they serve both same-sex and opposite sex couples.
A federal appeals court has revived a legal challenge to the Minnesota Human Rights Act (MHRA), ruling for the first time that religious business owners can invoke free speech rights when refusing to service a same-sex wedding.
The 8th U.S. Circuit Court of Appeals sided with Carl and Angel Larsen, a Christian couple who operate a video production company called Telescope Media Group. The Larsens want to expand their business to include weddings, but state officials say the MHRA requires the Larsens to accommodate both same-sex and opposite sex partners.
“Minnesota’s interpretation of the MHRA interferes with the Larsens’ speech in two overlapping ways,” Judge David Stras wrote for a divided three-judge panel. “First, it compels the Larsens to speak favorably about same-sex marriage if they choose to speak favorably about opposite-sex marriage. Second, it operates as a content-based regulation of their speech.”
The decision is particularly significant in view of the Supreme Court’s 2018 Masterpiece Cakeshop decision, which involved a Christian baker who declined to make custom weddings cakes for same-sex marriages. Though the baker prevailed in that dispute, the high court did not decide whether religious conservatives can use the First Amendment to skirt anti-gay discrimination laws.
The Alliance Defending Freedom (ADF), which represented the baker in the Masterpiece case, also represents the Larsens. ADF is a public interest law practice that litigates around religious liberty issues.
The Larsens sued state officials in December 2016, saying the MHRA prevented them from operating their business consistent with their religious beliefs. U.S. District Judge John Tunheim sided with the state and dismissed their lawsuit in September 2017.
On appeal, the 8th Circuit said that Telescope’s videos are the Larsens’s personal speech. The Larsens’s exercise significant editorial discretion over its media productions and promote a particular message about the sanctity of marriage, the panel said.
As such, the majority said the MHRA forces the Larsens to defy their religious beliefs and create speech that is favorable to same-sex marriage. Citing the Supreme Court’s 2018 Janus decision, the 8th Circuit said that “compelling individuals to mouth support for views they find objectionable,” is a core First Amendment violation. In Janus, the high court said that unions could not collect mandatory dues from non-members for First Amendment reasons.
Elsewhere in the decision, Stras wrote that the MHRA regulates speech based on content, another violation. The majority said the safer course for the Larsens would be to avoid the wedding business altogether, a type of “compelled self-censorship” that violates free speech rights.
The 8th Circuit also allowed the Larsens’s to proceed with their claim that the MHRA interferes with their right to practice religion. Stras said the couple is in a unique “hybrid situation” in which they can use their free exercise concerns to “reinforce their free speech claim.”
Judge Bobby Shepard joined Stras’s opinion. President Donald Trump included Stras on his list of prospective Supreme Court nominees. (RELATED: Senate Republicans Tell Supremes Not To Be Intimidated By Court-Packing Threats)
Minnesota counters that the MHRA regulates conduct, not speech, and that any burden on the Larsens’s free speech rights is merely incidental. Rules or regulations that have unintentional effects on speech rights are generally lawful.
In a series of tweets following the 8th Circuit’s decision, Minnesota Attorney General Keith Ellison promised to bring a strong, strategic legal response, and said he was offended by the decision.
(7/7) I’ve fought alongside the LGBTQ community for years. As a human, I’m offended by the majority’s ruling. As Attorney General, I’m going to respond in the strongest & most strategic way possible to maximize human rights and dignity for LGBTQ people & everyone—no exceptions.
— Attorney General Keith Ellison (@AGEllison) August 23, 2019
In dissent, Judge Jane Kelly warned that the majority’s thinking could be used to evade civil rights laws that bar race and sex discrimination. Kelly is considered a contender for a Supreme Court appointment under a Democratic president.
“Its logic would apply with equal force to any business that desires to treat customers differently based on any protected characteristic, including sex, race, religion, or disability,” Kelly wrote. “In this country’s long and difficult journey to combat all forms of discrimination, the court’s ruling represents a major step backward.”
The case will now return to a federal trial court for further proceedings.
Tags : alliance defending freedom keith ellison masterpiece cakeshop
Kevin Daley
Follow Kevin on Twitter Send tips to kevin@dailycallernewsfoundation.org | cc/2021-04/en_middle_0020.json.gz/line647 |
__label__wiki | 0.81481 | 0.81481 | Joe Biden Can’t Be A Racist — He Has Black Friends
Derek Hunter Contributor
May 27, 2020 8:54 AM ET
On today’s podcast we get into the weak defense of Joe Biden’s racism and the bogus claims that he apologized. We also talk about how Democratic Governors in Michigan and New York have been exposed as some of the most reckless, dangerous and hypocritical political leaders during the pandemic. Plus, Ilhan Omar says she believes Joe Biden’s accuser and will vote for him anyway, and MSNBC airs more blatant racism.
New York Gov. Andrew Cuomo and Michigan Gov. Gretchen Whitmer have been disastrous for their states. They’ve also been raging hypocrites. Cuomo has altered online records of his executive order that nursing homes must take in coronavirus patients, and Whitmer is scrambling to explain away why her husband expected special treatment because he’s married to the governor. We get into all of it.
Joe Biden’s latest racist comments — saying “you ain’t black” if you’re black and aren’t voting for him — were greeted with lame defenses from typical media liberals and claims that he apologized. But Biden didn’t apologize, only saying he shouldn’t have been so cavalier.
Minnesota Rep. Ilhan Omar says she believes Tara Reade, the woman who accused Biden of sexual assault, but she’s going to vote for him anyway because he’s a Democrat, and Democrat MSNBC host Joy Reid, who has her own history of homophobia and racism, casually said President Donald Trump promised to get rid of “brown immigrants” when he did not. We have all the audio and expose the lies and hypocrisy.
Today’s podcast is sponsored by 100% organic CBD Oil from Ancient Life Oil. Check out their website! Use promo code “Derek” to receive free shipping.
Please help spread the word about The Daily Daily Caller Podcast. Please take a minute to rate and review on iTunes, share on social media and be sure to subscribe so you never miss an episode: (RELATED: Rand Paul Thinks FISA Abuse Against Trump Campaign Was Done With Obama’s ‘Explicit Permission’)
SUBSCRIBE TO THE DAILY DAILY CALLER PODCAST ON ITUNES
SUBSCRIBE TO THE DAILY CALLER ON SOUNDCLOUD
SUBSCRIBE TO THE DAILY DAILY CALLER PODCAST ON STITCHER
The Daily Daily Caller Podcast is a daily look and mocking of the news from a conservative perspective. Hosted by Derek Hunter, it is available in audio form Monday-Friday and will have a video interview on Fridays.
Tags : andrew cuomo coronavirus donald trump gretchen whitmer ilhan omar joe biden joy reid msnbc
Follow Derek Hunter on Twitter | cc/2021-04/en_middle_0020.json.gz/line648 |
__label__wiki | 0.571905 | 0.571905 | College and Career Counseling
Elementary and Middle School
A Program of Schools for Children
Monthly Menus
Innovative from the Beginning
Dearborn Academy was founded in the 1940s as the first of Lesley University’s “home-grown” lab schools, known as the Cambridge Town School, and focused on what it really means to learn – especially when a child learns in a different way.
One of the earliest pioneers in the field of reading was Walter Fenno Dearborn for whom the school is named. Dearborn, a Harvard University researcher in psychology and education, was the first scientist to realize that children with what we now call dyslexia were as intelligent and capable as children who had no trouble reading. What these students needed were simply different strategies for learning to read.
After retiring from Harvard, Dearborn became head of Lesley University’s educational psychology program. His work at the lab school helped him refine his theory of reading, develop highly effective strategies for overcoming reading challenges, and train hundreds of new teachers in these techniques.
Over the next three decades, Dearborn Academy grew to include three schools: the Carroll-Hall School (1957), the Dearborn Pre-Vocational Program (1970) and the Dearborn Secondary Program (1978). In 1981 Lesley University voted to divest itself from its lab schools, and these assorted schools came under the management of the newly formed nonprofit organization, Schools for Children. In 1990 they were consolidated into a single entity, Dearborn Academy.
Responding to Children’s Needs
In the 1990s, Dearborn began to share its approach with other schools, including schools with typical learners. That same year the school also started consultation services. Dearborn teachers and administrators visited school districts across the state to share their knowledge and teaching techniques.
These consulting relationships helped Dearborn become known for more than its innovative reading approach.
Dearborn STEP Assessment Program
“Creating a narrative for success”
STEP is an intensive, therapeutic assessment day program that serves grades 5 through 12. We specialize in tailoring our clinical and academic program to each individual student. Students who have difficulties with school refusal due to learning and mental health challenges, pragmatics difficulties, and been bullied, have consistently found success at STEP. We have a consulting psychiatrist that works with us during the week, and a supportive 2 to 1 staff to student ratio. We pride ourselves in being collaborative and informative with parents/guardians, school districts, and other specialists. STEP is located in Newton, Mass.
To contact us please email or call STEP Program Director Laura Rice at 781.641.3743.
The Dearborn Academy program today weaves together learning, therapeutic and emotional support for children. Every student can find the support and care they need.
Walter Dearborn
A state-approved, special needs elementary/middle and high school in Newton, Massachusetts
575 Washington Street | Newton, MA 02458 | Phone: 781.641.5992 | Fax: 781.641.5997
For Families For Districts
© 2021 peapod design | cc/2021-04/en_middle_0020.json.gz/line655 |
__label__cc | 0.626281 | 0.373719 | HomeMTG ArenaWhat Is the MTG Arena Ranking System and How...
What Is the MTG Arena Ranking System and How Does It Work?
Niels van der Vlugt November 5, 2019 MTG Arena
Lately there’s been a lot of debate online regarding the MTGA ranking system, and it doesn’t help that there’s lots of old, outdated info that manages to stay on top of the Google search results. When it comes to the ranking system, you might be wondering what it’s used for, how it’s calculated, when it resets, and more.
We’re going to try to separate fact from fiction here while also giving you an easy, one-stop-shop to get all the info you need on the MTG Arena ranking system. The goal is to give you (and us, too!) a better understanding of how WotC created the system and what it’s used for. Let’s get to it and crank it up!
What is the MTG Arena Ranking System Used For?
MTG Arena Ranked Play
Ranked Limited on MTG Arena
How Do MTG Arena Ranks Work?
How Are MTG Arena Rankings Calculated?
When and How Does Your MTG Arena Rank Reset?
MTG Arena Ranked Season Rewards
MTG Arena’s Path to Mythic Rank
How Many Hours to MTGA Mythic?
How to Play Your Way to Mythic in MTGA
What is the Mythic Percentage in MGTA?
MTG Arena Ranking System Sources and Changes
The first obvious question when it comes to the ranking system is why it exists. At its core, it’s used to assess your skills and strengths as an MTGA player and give you a rating (or, in this case, a rank) based on that. This is determined using a Glicko rating system, which we’ll talk more about later. By gathering this information as you play events, the rating system figures out where you fall and gives you an MMR (match making rank).
WotC uses three different types of MMRs in MTG Arena. They’ve designed one for Open Play, one for Constructed, and one for Limited. The ranking system creates a list that determines the rank for each player by applying this type of data collection to everyone that plays MTGA or who participates in events.
In other words, the system can tell who’s the best and who’s the worst for each of the three MMRs (Open Play, Constructed, and Limited) using the gathered data. This is done is to make sure you’re paired with opponents that have a similar MMR and that you and your opponent are balanced to each other’s skill-level. The ranking system is also used to determine who’s eligible to participate in MTG’s championship event, the Mythic Invitational.
To help you visualize your progress, MTGA has created Ranked play. After every match you win or lose in this mode, you’ll either move up or down in Rank based on whether you won or lost, respectively. What type of games are ranked, you ask? That’s easy to spot as they’ve got “Ranked” in the match title:
This means that there are:
Ranked BO1 matches for standard constructed format decks
Ranked BO1 matches for historic constructed format decks
Ranked BO1 matches for drafts in the limited format (format varies, calendar here)
In these formats, your Rank (not your MMR) determines who your opponents are by matching you with other players that have the same Rank as you. Even though MMR isn’t used in these formats, it does give you a good idea what your performance and skill-level are outside Ranked play. Wizard’s Chris Clay has stated on twitter that “The top player in the Mythic Rankings has the highest MMR in the game.” So it’s safe to assume that if you’re doing well in Ranked play, you’re stomping it in other areas of MTG Arena as well even though your matches aren’t determined by your MMR here.
To provide more detail about limited specifically, ranked limited in MTGA comes in two forms — Premier Draft and Quick Draft. Both of these are BO1 formats (vs Traditional draft, which is BO3).
Premier Draft features “Player Draft” — draft with 7 other humans at the same table, and is most often with the most current set in Standard. Quick Draft is draft with “bots” (similar to Draftsim’s AI), and is most frequently some kind of “flashback” format to help you acquire more cards for Standard.
You play each of these until you either reach 7 wins or 3 losses.
Now that you’ve seen where you can acquire your rank, let’s see what it looks like and how it works. There are two “ladders” for you to climb, so to speak. One for Constructed Ranked (which encompasses BO1 and BO3 play) and one for Limited Ranked.
Each ladder has six ranks: Bronze, Silver, Gold, Platinum, Diamond, and Mythic, and each rank is broken down into four tiers. You either move up or move down according to your wins or losses respectively. In first rank (Bronze), losses don’t lose you any tiers but once you get to the next rank (Silver) you will start to lose tiers if you lose a match. Once you’ve climbed to a new rank (e.g., from Bronze to Silver) you won’t get knocked back down to a lower rank.
So once you’ve made Mythic in MTG Arena, you won’t drop out until the end of the season.
Take a look at the table below to see how all of this breaks down for Constructed BO1, Constructed BO3, and Limited play:
Constructed BO1
Limited (BO1)
Here’s a quick visual to show you the ranks and tiers the way they’re shown in MTG Arena:
Once you’ve moved all the way up to Mythic, you won’t get any more ranks or tiers. At this point, WotC starts using your MMR again to calculate where you fall amongst all the other players that have also attained Mythic rank. This means that we’ve come full circle with what Chris Clay stated: that the top player has the highest MMR in the game.
Let’s go back to how your MMR is calculated, where we mentioned that WotC uses a Glicko rating system. This system was invented as an improvement of the Elo rating system and was originally meant to be used as a rating system for competitive chess. An exchange between Chris Clay and Sam Black on twitter shed some light on how MMR is calculated and is the only indication on the exact system used in MTG Arena at this time:
Glicko is a rather complex system, so we’ll try to keep it as simple as possible. If you’d like a more in-depth read on Glicko you can either check out this pdf (original Glicko system) or this one (Glicko-2 system with slight improvements for more accuracy).
The Glicko rating system uses three factors for its calculations: rating, deviation, and volatility. These factors can be used to calculate your ratings deviation (RD), which measures the accuracy of your rating, with one RD being the same as one standard deviation. They use some pretty complex algebra to get to the correct RD, so won’t bore you with the details here. You can check out the previously mentioned PDFs if you want to take a crack at it yourself.
To put it in very simple terms, the formulas show how to determine your rating at the end of a “previous period of play” (i.e., the end of a match on MTGA). This can then be used to determine where you should be at the beginning of a new period (i.e., your next match on MTGA).
Obviously this is an extremely simple way to boil down complicated calculations, but what it means for MTG Arena is what we explained earlier: it’s there to make sure that you are being paired with the best possible opponent, and to determine who are the best players on the platform.
Now that we’ve shed some light on how ranking ratings (try saying that 10 times fast) are calculated and on how getting data on all players over time is an important consideration for MTGA, let’s jump in to ranking resets.
Since the beginning of this year, we’ve been working with what WotC has dubbed “seasons”. Each season is about a month long and rankings reset for everyone after each season. Your rank and tier in the new season are determined by how far you’ve climbed up the ranking ladder in the previous season. This means that if you play regularly and you play well, you’ll have the advantage in the new season of starting out in a higher ranking and tier.
However, your rank does decay at the end of the season. Here’s a breakdown of where you’ll start at the beginning of a new season based on your rank in the previous season:
Previous Rank New Rank Previous Rank New Rank Previous Rank New Rank
Bronze tier 4 Bronze tier 4 Silver tier 1 Bronze tier 2 Platinum tier 2 Gold tier 4
Bronze tier 3 Bronze tier 4 Gold tier 4 Bronze tier 1 Platinum tier 1 Gold tier 3
Bronze tier 2 Bronze tier 4 Gold tier 3 Silver tier 4 Diamond tier 4 Gold tier 3
Silver tier 4 Bronze tier 3 Gold tier 1 Silver tier 2 Diamond tier 2 Gold tier 2
Silver tier 3 Bronze tier 3 Platinum tier 4 Silver tier 1 Diamond tier 1 Gold tier 1
Silver tier 2 Bronze tier 2 Platinum tier 3 Gold tier 4 Mythic Gold tier 1
It’s easy to see that the higher you’re ranked in a previous season the easier it’ll be to reach that same ranking much faster in the new season. All you need to do is to play and play well.
What we can tell so far—and will likely come as no surprise to any competitive players—is that it pays to be the best. As with any competition, being in the upper echelons on MTGA comes with its rewards. The rewards for each level in both Constructed and Limited rankings are exactly the same and are as follows:
You get more rewards, though admittedly nothing amazing, as you work your way up the ranking system
Another advantage is (as we mentioned) the higher you finish by the end of a season, the higher up you’ll start on the next. Not a bad thing when you remember how much time it took to reach that rank in the first place.
Being highly ranked can also earn you an invitation to the Mythic Qualifier Weekend, which in turn can land you in the Mythic Championship (keep an eye on our blog for an article all about that very soon). For competitive MTGA players, this can lead to a lot of exposure, more recognition, the chance to play the best in the game, and huge cash prizes. For some of you, this particular reward may be what it’s all about.
Basically, being highly ranked can definitely pay off. But how much time do you actually need to spend on the grind to Mythic for a shot at all of this?
We’ve scoured the internet to tackle the question of how much you need to invest to move from Bronze to Mythic in both Constructed and Limited. This handy article by Frank Karsten (who even wrote the code so you can try your own hand at these calculations) breaks down how many hours you need to spend playing MTGA to make it from the start of the ladder all the way up to Mythic for both Constructed and Limited. We’ve summed up his conclusions in a handy table for your viewing pleasure, comparing the hours needed for the average player with a 40% to 45% win rate versus an above-average player with a 70% win rate.
Quick note: we’ve combined Constructed BO1 and BO3 as it’s best to switch from BO1 to BO3 at Gold rank tier 4 for the last little bit to Mythic.
Win Percentage Hours Needed for Constructed Hours Needed for Limited
40% to 45% Infeasible 2114
70% 50 45
As you can see, if your win rate percentage is 70% then you can attain Mythic rank in Constructed within 50 hours and in Limited 45 hours. Keep in mind, though, that this is an approximation. With seasons lasting about 30 days, you’d need to play Constructed about two hours a day and Limited about an hour and a half a day to get to Mythic.
With a win rate percentage of 40% to 45%, though, reaching Mythic in both Constructed and Limited isn’t feasible as there literally aren’t enough hours in a day for you to reach your goal. The alternative is to shoot for Gold rank instead, which should be reasonable to attain with an average win rate.
Now that we covered the numbers for how many hours you need to play MTGA to reach Mythic, it’s time to get to the best way to climb the ranking ladder. The first thing is pretty clear: you need an above average win percentage to climb successfully. You’ll also need to play in ranked sanctioned events to move up as we mentioned at the beginning of this article.
Because Limited has only one ranked event, this is the obvious choice and thus the best way to go about it. With Constructed there are two options: BO1 and BO3. Based on Frank Karsten’s previously linked article, we can say that you need a mix of both for the most effective route up the ladder. From Bronze to Gold it’s more effective to play BO1, and from Gold to Mythic it’s more effective to play BO3.
So you’ve played your way to Mythic and have that beautiful logo beside your name, but instead of a numerical rank, you have what looks like a percentage next to the mythic icon.
That percentage is your percentile as a player in Mythic. So if you are Mythic 90%, that means you are better than 90% of other Mythic players who are also not on the leaderboard. The intent is to show you your distance from the leaderboard in terms of a percent.
In that example, you would need to climb through another 10% of mythic players until you crack the “leaderboard” — which would then give you a ranking from 1 to 1,200.
We’ve finally come to the end of the line. As of writing this article, this is all the information out there concerning Ranked play in MTGA. There’s lots of articles and lots of speculation on how WotC to acquires its data, but they haven’t offered a full answer to that question yet. Maybe in the future they’ll lift the veil on what system they’re using and how exactly they’re implementing it, but for now this is all we have.
There are a few interesting articles that we came across while doing research on the topic that we feel are a nice bonus to share with you as further reading material:
Our own guide on how to become a better drafter on Arena (start there and then move on to Ben Stark’s class if you really want to get to Mythic)
Fact checking article for ranked ladder on the Hipsters of the Coast website
Article on going optimal on MTGA on ChannelFireball.com
We know that in the past WotC have made some drastic changes to MTGA, and more changes could be on the horizon as the game progresses into its first months after its official release. Maybe it’s closer to the physical game than we thought in that it’s an ever-evolving mechanism that spawns new stories as time progresses. Some may be amazing while some may turn into learning curves. One thing is for certain: MTG Arena is more popular than ever and will be growing for a long time to come, just like the card game we all love to play.
One last thing – if you want to get some practice in before you jump into live drafts in MTGA, did you know you can practice drafting on our free draft simulator? We’ve got every set on Arena there.
MTG MTG Arena MTG Arena Mythic Rank MTG Arena Ranking Resets Mythic Championship VII Strategy
Niels van der Vlugt
Niels has been playing Magic: the Gathering since 2012 and is a writer for Draftsim. He can often be found trying out new ideas for limited and standard on MTG Arena, or tinkering around with one of his many EDH decks. Most of his EDH decks are influenced by the Legacy and Vintage formats, of which he is also a huge fan. Follow Niels on Twitter @sneackerattack.
Aruku64 December 20, 2019 3:48 pm
Useful article, but I think it should differentiate between the season rank and the MMR.
antlr April 30, 2020 9:38 pm
As of Apr. 30 update for this new season, I ranked up 2 steps at a time in Gold constructed BO1! Either there has been a rank inflation and Gold is now being treated like Silver was previously, or maybe now once you’ve been bumped down at the start of the season there is extra protection of 2 steps up for a win and 1 down for a loss until you achieve the next metal rank again. You might need to update your article!
Dan Troha May 1, 2020 9:21 am
Thanks, fixed!
Gills May 28, 2020 3:53 pm
It seems that this article has Platinum and Diamond tiers reversed. I went through Platinum to get to Diamond, not the other way around.
Dan Troha May 28, 2020 5:47 pm
Whoops, fixed! Thanks for pointing that out.
Sazemek June 21, 2020 8:33 am
<50% Win rate
Kasper July 31, 2020 12:53 am
Is there any way to tell how big a % of the player base ends up in different tiers at the end of a season?
Dan Troha July 31, 2020 8:39 am
This sounds like a great idea for a post. That information is not publicly available, but I bet we could calculate it from Arena Tutor!
Anthony August 18, 2020 7:56 pm
Well I lost 3 games in a row as diamond tier 2 and was placed against a Mythic 84%. So clearly we aren’t matched against players in just our ranks. Win or losing streak.
Craig C October 7, 2020 11:53 pm
It starts with those with the same Ranking and similar MMR and then expands the search out as you wait in the queue if it is having trouble finding someone for your match. Basically after a pre-determined time if it cannot find a Diamond Tier 2 opp
onent for you with a similar MMR it will then check Diamond Tier 1 and Diamond Tier 3. If it again fails to find someone of a similar MMR it will expand the range again, this time to Mythic XX% and Diamond Tier 4. It continues to do this til you have an opponent of a similar MMR.
Eric Jenson September 24, 2020 10:42 am
I am certain that your percentage in Mythic is NOT your percentage among all players, as pretty much everyone in Mythic has a percentage in the 90s. I assume (though I have no idea how to test this) that the percentage is actually the percentage of the Glicko score compared to the 1500 ranked player.
Dan Troha September 24, 2020 11:08 am
Thanks. Can you explain a little further and/or provide a source for that?
Jason Graves November 14, 2020 1:24 pm
I think it is comparing you to all mythic players that are below the 1500th rank. That would explain why you would go from 99% to 1500.
Alan December 9, 2020 3:01 am
Back some maybe 4 months ago I would easily reach to Mythic. But now, especially after the new edition, it has been tough. I am finally reaching to the 70%, 80%, after I have finally taken decision to have a one color only deck.
Dan Troha December 9, 2020 10:35 am
Glad you’re starting to see some progress! If you are looking for deck ideas, be sure to check out our new deck guides. In fact, there are some tier 1 monocolored decks there for you to use too.
Riley December 16, 2020 4:29 am
I consider myself an intermediate limited player at best (I don’t think I’ve ever made it past platinum 3), and yet I was recently paired with a mythic player (ranked #112) in the second game of a premier draft. The wait/search time to find an opponent was less than a minute. I’m confused as to whether this is a result of that player’s mmr somehow being tolerably close to mine, which seems very unlikely, or if there are other factors taken into account such as draft picks/relative deck strength. It’s been difficult to find any clear information as to what or how much of those kinds of variables come into play in limited matchmaking, and it could be that it’s simply not publicly known. It just seems very unlikely that a player that far above my own rank/tier would be the ideal match when the system didnt seem to be struggling to find an opponent. Is there anything obvious I’ve missed in this or other articles that could explain the disparity? I should mention that while I did win the game it was extremely close, and again, I’ve never been ranked higher than platinum. Is there a way to view one’s own mmr? | cc/2021-04/en_middle_0020.json.gz/line659 |
__label__wiki | 0.63838 | 0.63838 | Mood: nervous
Fic: In His Arms 1/1 (Nathan/Claire) NC-17
Title: In His Arms
Author: Elisabeth
Fandom: Heroes
Pairing: Nathan/Claire
Summary: How can Nathan resist his nymphet?
Spoilers/Warnings: through How to Stop an Exploding Man. This is canon, so incest and underage sex are involved.
Disclaimer: I claim no ownership over these characters. I am merely borrowing them from Tim Kring et al.
Feedback: Yes please! It makes me happy and keeps me writing.
Thanks to jazmin22 for the beta!
Author's Note: Written for anti_censor_fic, my prompt was Lolita.
Author's Note 2: Passage from Lolita by Vladimir Nabokov.
Nathan lay on his side, head propped in his hand as he watched her sleep. She was on her stomach, face turned towards him, unaware of his scrutiny. His free hand played with her long blonde hair, moving it across her naked back.
'She should have a different name when we are like this,' he thought to himself. 'Like in that book by the Russian guy.'
She was Lo, plain Lo, in the morning, standing four feet ten in one sock. She was Lola in slacks. She was Dolly at school. She was Dolores on the dotted line. But in my arms she was always Lolita.
Nathan honestly hadn't cared for the novel when he'd read it in college. The subject had made him uncomfortable, a grown man lusting after a teenager, sleeping with his step-daughter.
If only that Nathan could see himself now.
Maybe if he'd raised her things wouldn't have turned out like this. If he had watched her grow from infancy to adulthood. If he had seen her take her first wobbly steps, watched her go off to school every day, seen her grow into her body.
But he hadn't. He hadn't even known that she'd been alive to do all of these things. He'd buried all fatherly feelings for a daughter a long time ago.
Instead, he'd met a beautiful teenaged girl, standing in his mother's sitting room minutes after he'd seen his brother's lifeless body. He'd recognized her from the photo Meredith had shown him as his daughter, but in that moment, he didn't feel any familial kinship with her.
He knew that she thought he didn't want her in his life, and he allowed her to think that it was for the sake of his reputation. He put up a cold front because he couldn't let himself get close to her.
When his mother suggested sending Claire away until after the election, Nathan readily agreed. Not for the sake of his campaign, but for the sake of his own sanity. If Claire were an ocean away he wouldn't have to worry about masking his unnatural lust for his daughter.
Only she didn't leave. She stayed to help his brother try to save the world.
His carefully erected walls cracked and crumbled the night New York didn't explode.
He had gone to Kirby Plaza to help. After Claire had run away from him and his mother, Nathan had realized that he could take a page from his beautiful, strong daughter's book. She was willing to run into danger and possibly die to save New York. In a stroke of clarity, Nathan had realized that he could safely fly Peter away from the city if he started to explode.
What he hadn't counted on was Peter figuring out his plan at the last moment. After Nathan had flown in and stopped Claire from shooting Peter, he had turned to carry Peter into the atmosphere. Peter told him that he loved him, and when Nathan was within arms reach, Peter had propelled himself into the sky.
Nathan wanted to go after him, stop him from dying alone, but Claire latched onto his arm and refused to let go.
"No," she pleaded. "Please, don't you leave me, too."
Nathan ripped his eyes away from the dark night to look down into Claire's tear-filled eyes. "He's my brother," Nathan said, as if that explained everything.
"And you're my father," Claire pointed out. "I just found you. I can't lose you now. Peter can heal, like me; he should be fine. If you go after him you'll die."
"I..." Nathan could see her fear in her eyes, but before he could say anything else there was a bright flash, lighting up the night sky. It was far away; Peter had gone high enough to save the city. But how would he be able to survive that fall?
As the light from Peter exploding faded back into night, Nathan became aware of Claire's body pressed against his. He looked down and saw that she was hugging him closely, crying against his chest. He wrapped his arms around her, holding her close and relishing the contact.
"Dad," he heard her exclaim as she pulled out of his arms, and it was on the tip of his tongue to answer, when he realized she wasn't addressing him.
He turned to see Mr. Bennet holding one arm close to his chest, while pulling Claire close with his other one. The sight should have made Nathan jealous, but he found it oddly freeing. Claire already had a father figure. She didn't need to see him in that role.
Nathan invited Bennet to come back to his mother's house with them, saying that there was plenty of room. Claire quickly agreed, saying it would be best, especially since her things were already there and she didn't want them to be separated again.
Nathan made sure that Bennet's room was far from his own.
It was late when he heard the light knock on his door, but he wasn't terribly surprised to hear it and invited the person in.
"I hope I'm not bothering you," Claire said as she stepped into the room and closed the door. "I saw your light was on."
"You couldn't sleep either?" Nathan needlessly asked.
"After a night like tonight? No way," Claire said.
Nathan noticed that she wasn't looking at him directly, and remembered that he wasn't wearing a shirt. He slipped out of bed and grabbed his dressing gown, slipping it on.
"I'm sorry, is this better?" he asked. Claire nodded, blushing faintly. Nathan allowed himself a brief moment to admire how she looked in the small tank top and cotton pants with her hair tied back in a ponytail, then shook his head before allowing any libidinous thoughts to form.
Nathan sat back down on the bed, on top of the covers this time. "Did you want to talk about what happened tonight?"
"Well, parts of it," Claire said, still blushing.
"Would you like to sit?" Nathan offered when she still stood nervously by the door.
Claire mumbled a thanks and sat near the foot of the bed; on Heidi's side of the bed.
Nathan carefully set the book he'd been reading on the nightstand, cover down and binding facing away from the room so that Claire wouldn't notice that he'd been re-reading Lolita. He felt a sudden kinship with Humbert Humbert.
"What's on your mind, Claire?" he asked her after several more minutes passed in silence.
"I already have a dad," she blurted out, finally looking at him.
Nathan smiled. "I know that. I'm not trying to take his place, I promise you. I just want to get to know you, now that I know about you."
"Me too," Claire said.
"I wish that we could have met under better circumstances," Nathan added.
"Yeah." Claire gave a hoarse laugh. "Maybe then things wouldn't be so complicated."
"I know what you mean. I'm glad that you understand about the election..."
"That's not what I'm talking about," Claire interrupted. She met Nathan's eyes and he was surprised by what he saw there. He watched as Claire ran her eyes over his body, lingering on the bit of chest that remained visible. He could feel his cock begin to harden.
"Claire?" he asked, wonder in his voice.
"I didn't just imagine it, did I?" she asked. "When I first showed up here and we met, you didn't look at me like you would a daughter. You looked at me as something else. Like a woman."
Nathan cringed. He'd hoped that she hadn't noticed that.
"It's okay," Claire rushed to say. "I...I kind of liked it," she admitted, blushing furiously.
"You...You did?" Nathan asked, swallowing hard. He was so ashamed by his own attraction to his daughter that he hadn't noticed her apparent attraction to him.
Claire nodded, shyly looking away. She fiddled with her hair and pulled it loose, toying with the hair band as an excuse not to look at him.
Nathan suppressed a groan as her long hair fell around her nearly-bare shoulders.
"Claire, what are you doing here?" he asked, suddenly afraid of the answer.
Claire crawled up on the bed and over to where Nathan was reclining. She settled next to his hip, her thigh pressed against his.
"I don't need you to be my father, but I do need you," Claire whispered.
Nathan met her lust-filled eyes and shivered at what he saw there.
"We can't," he whispered back. He wanted, so badly, to take what she was offering.
"Says who?"
"Says society," Nathan answered. "You may not need me to act like a father, but it's still my blood running through your veins."
"Are you sure about that?" Claire countered. "It's not like we've done a DNA test or anything. Meredith could have been lying. I don't know her very well, but I get the impression that it's not above her to lie about paternity."
She was right, Nathan realized. He wouldn't put it past Meredith to lie about paternity. "So we'll do a paternity test and find out. But we can't do anything before then."
"Why not?" Claire pouted, and it took all of Nathan's willpower not to take that bottom lip between his own.
"What if we did something and the test came back positive? Are you willing to risk having sex with your biological father on the slight chance that I'm not?"
"I think the fact that I'm here in my pjs would say 'yes'," Claire said.
"I have a wife that I love very much," Nathan said, grasping at straws as he felt his resistance slipping.
"Who you sent away to keep safe. Who I bet you've cheated on before," Claire confidently said.
Nathan couldn't meet her eyes, or hide his look of guilt, as he remembered another blonde he'd bedded without a second thought in Las Vegas.
"See, I'm right, aren't I?"
"Just because I've cheated on Heidi in the past doesn't mean that I should do it with my daughter," Nathan said.
"But I may not be your daughter," Claire countered.
"Now we're just arguing in circles," Nathan huffed.
"So stop talking," Claire said.
Before Nathan could reply, Claire had pulled his face to hers and kissed him. This wasn't some shy, tentative kiss like he'd imagined his first kiss with her would be. No, it was a firm press of lips, eager and wet and demanding. Nathan groaned, losing himself in the intensity of the kiss, opening to her seeking tongue and pulling her small body onto his lap.
Claire's hands released Nathan's face now that he was hungrily kissing her back. They slid down to his chest, and under his dressing gown, eager to feel his bare skin. She shifted her position, moving to straddle his hips, opening the robe as she settled herself back down, rubbing enticingly against Nathan's very hard erection.
Nathan groaned and broke the kiss, dropping his forehead to her shoulder and moving his hands to her hips to keep her from moving.
Nathan was rapidly losing control to this young siren writhing against him. He looked into Claire's eyes, ready to try to protest again.
"No one has to know," Claire said, cutting off him off before he could say anything.
"We'll know," Nathan whispered.
Claire grinned, rocking against him again. "Yes, we will." Her eyes softened and she allowed her vulnerability, her fear of rejection to slip through. "Please, Nathan, I need this."
It was the please that was his undoing. He searched her eyes and recognized the raw need he found in them. It mirrored what he was feeling himself.
Without warning, Nathan rolled Claire onto her back, relishing in the excited squeal she emitted before crashing his mouth down on hers. Claire shoved his dressing gown down his arms and dug her fingers into his bare back.
Claire helped him to remove her pajamas, lying back to let Nathan take in her naked body. He ran gentle fingertips over her skin, drawing goose bumps to her flesh, increasing her arousal. He touched her in awe and wonder, amazed that such a beautiful creature could want him.
After several minutes of tortuously slow exploration, Nathan bent to take one of Claire's breasts in his mouth. She moaned her approval and ran her fingers through his hair in encouragement. When he switched his attention to her other breast, Nathan trailed a hand down her body and between her silken thighs. He shuddered at the wetness he found there, once again amazed at how turned on she was.
"Yes," Claire hissed as Nathan slid one, and then two fingers inside her. His thumb found her clit and before long he brought Claire to a shuddering orgasm. She pulled his mouth back to hers, languidly kissing him as she came down from her high.
Nathan's cock throbbed in his pajama pants, crying out for attention, but he refused to rush this.
He breathed a sigh of relief when Claire finally ran her hands down his body to the waistband of his pants and began to push them down. Nathan pulled away from her to slide the pants off before settling himself on top of her again.
"Are you sure?" he asked, refusing to leave any room for doubt.
Claire circled a hand around his cock and pulled him closer. "More than anything."
"Hold that thought," Nathan said and reached for the nightstand. If he was going to be foolish, he may as well be smart at the same time. He pulled out a condom and quickly sheathed himself before pressing into Claire's warm body.
He paused when he brushed against her maidenhead, but Claire shook her head and told him to get on with it. Nathan felt ten different kinds of guilt, but he did as she bid and with one powerful thrust entered her fully. He held her through the brief rush of pain and kissed away her tears, and when she lifted her hips to meet his, Nathan finally let himself go.
He thrust into her with long, slow strokes, simply enjoying the hot tightness of Claire around him. She wrapped her legs around his thighs, changing the angle of his thrusts. Claire dug her nails into Nathan's shoulders when he picked up the pace, holding on for dear life as every nerve in her body sizzled with anticipation.
"Oh God, Claire, I'm so close," Nathan murmured into her hair.
Claire pulled his body closer so his chest brushed against her sensitive nipples with every movement. She gasped as she felt her body tense and coil with warmth again.
"Yes, me too," she said, her breath hitching with every word.
Nathan's lips found Claire's again as he jerked and roughly thrust into Claire a couple more times, coming harder than he had in a very long time. The sudden bite of Claire's nails on his back alerted Nathan to the fact that Claire had come too.
It took several minutes for Nathan to regain control of his body enough to move off of Claire, although she didn't complain about him crushing her. He quickly disposed of the condom before pulling the covers up over their naked, sated bodies.
"Can I stay here tonight?" Claire tiredly asked.
"Until dawn," Nathan allowed. "You should probably be in your own bed by morning in case your...father comes looking for you."
"Oh, right." Claire giggled. "I forgot about him."
Nathan smirked. "I think I'm flattered."
"You should be," Claire said. "That was incredible."
"Yes, it was," Nathan agreed. He leaned over and tenderly kissed her. "Get some sleep, now."
Claire rolled over to lie against Nathan's side, resting her head on his chest. He curled his arm around her body, holding her close, relishing the contact. Knowing he was going straight to hell.
Now, in the pre-dawn light, Nathan watched her sleep.
She was Claire to the world at large, Claire-bear to her father, but in his arms, she was simply his.
Tags: claire bennet, fic:in his arms, heroes fic, nathan, nathan/claire
Forgive the neediness
I had a really crappy day so I'm going to do some bragging because I've had some icontest winners lately. (I don't want to talk about it here.)…
Holiday e-cards & icons
I think that most of you have received your cards by now, so I'm going to show off the cards that I made so that you can see the ones that I didn't…
Word Play Icons
Remember my Word Play post from last week? Well, I made icons of most of the words. 01) 02) 03) 04) 05) 06) 07) 08) 09) 10)… | cc/2021-04/en_middle_0020.json.gz/line660 |
__label__cc | 0.610375 | 0.389625 | Losses rise at Egdon – preliminary results
By Ruth Hayhurst on January 6, 2021 • ( Leave a comment )
Egdon Resources reported a £4.75m loss today, along with falling production and revenues.
The preliminary results, for the year to July 2020, blamed the Covid-19 lockdown in spring 2020 for a severe impact on commodity prices, which badly affected Egdon’s revenues and profitability.
The loss for the year, after write-downs, pre-licence costs and impairments, was 176% greater than the equivalent in 2019 (£1.72m).
Egdon’s production was down to 145 barrels of oil equivalent per day (boepd). 81% of this was from the offshore Ceres field. Production was above the company’s guidance level of 130-145 boepd but 26% down on 2019.
Oil and gas revenues fell 56% to £0.96m, from £2.20m in 2019. The accounts said this was caused by a 20% decline in overall production (2020: 53,070 barrels of oil equivalent, compared with 2019’s 66,430 boe) and 58% reduction in oil and gas prices.
Egdon said it had responded by cutting costs. All employees and directors had taken a temporary 20% salary reduction.
The results suggest that plans at Wressle, near Scunthorpe, and Biscathorpe, in Lincolnshire, are even more critical to the company’s success.
Egdon confirmed today that work had begun to prepare the Wressle well for production. Wressle oil was predicted to flow during January 2021, more than doubling the company’s production total. The results also said a planning application was being prepared to drill and test a sidetrack well at Biscathorpe, followed by long-term production.
Chairman Philip Stephens said:
“The current low oil and gas price environment makes our existing late life producing assets marginal or uneconomic and, as such, we have continued to focus on reducing costs and on progressing near term high impact projects such as Wressle and Biscathorpe. Progress in developing our unconventional resources in Northern England has been impacted by the current moratorium [on fracking in England].”
Other plans listed in the results included:
Seeking to farm-out and drill North Kelsey-1, Lincolnshire. Planning permission runs until 31 December 2021.
Subject to lifting the English fracking moratorium, joint venture partner will seek planning permission and environmental permits to drill and test the Springs Road-2 well at Misson in north Nottinghamshire.
Review repurposing existing wells for geothermal energy
Onshore production sites
The preliminary results gave details of other onshore sites where Egdon has an interest:
Avington, Hampshire: Remains shut in after planning consent refused for continuing production. Decision to be appealed by IGas, the operator.
Dukes Wood/Kirklington, Nottinghamshire: £1.15m full impairment of these assets. Sites likely to restored, with options to repurpose for geothermal energy
Fiskerton Airfield, Lincolnshire: Net rate to Egdon of 13 bopd (2019: 15 bopd).
Keddington, Lincolnshire: Net rate to Egdon of 8 bopd in 2020 (2019: 11 bopd). The company said production could be increased by a sidetrack from an existing well.
Waddock Cross, Dorset: Currently shut in. Work underway on a redevelopment plan.
Licences and deals
Yesterday (5 January 2021), Egdon announced it had finalised a £1.05m convertible loan notes with Petrichor Holdings BV.
In June last year, Egdon resolved a dispute and received £775,000 from Humber Oil & Gas over PEDL253 (Biscathorpe).
Three licences continued to second terms during the year: PEDL180/182 (Wressle, North Lincolnshire) and PEDL253 (Biscathorpe, Lincolnshire).
Terms were extended to PEDLs 191, 201, 202, 241, 273, 306 and 334.
Egdon increased its interest in PEDL209 (Laughton, Lincolnshire) to 100% following the withdrawal of other joint venture partners. In PEDL241 (North Kelsey, Lincolnshire), the company and Union Jack Oil plc reached agreement on a 50:50 interest.
Oil and gas revenues: £0.96m; (2019: £2.20m) in 2019
Loss for the year: £4.75m after write-downs, pre-licence costs and impairments of £3.03m. The equivalent loss in 2019 was £1.72m.
Operating loss: £1.79m; 2019 £1.26m
Cash at the bank: almost halved to £0.85m, down from £1.62m in 2019.
Net current liabilities: £0.33m (2019: £1.91m)
Production: 145 boepd; (2019: 182 boepd)
Impairments: £2.191m made to Ceres, Dukes Wood/Kirklington and non-core unconventional licences PEDLs 001, 130, 202 and 039 and EXL253.
Licence interests: 42 licences (2019: 44)
Unconventional acreage: 164,280 net acres (2019: 186,600 net) with undiscovered gas in place of 47.6 trillion cubic feet (TCF) net to Egdon (2019: 509.TCF)
Categories: Industry, slider
Tagged as: accounts, agreement, Avington, Biscathorpe, costs, covid-19, cut, Egdon, Egdon Resources, geothermal, Humber Oil & Gas, impact, interest, licence, loan, lockdown, loss, MIsson, North Kelsey, production, restore, revenue, revenues, severe, sidetrack, Union Jack, Wressle, write-downs
Work underway at Wressle oil production site
IGas appeals over refusal to extend life of Avington wellsite | cc/2021-04/en_middle_0020.json.gz/line663 |
__label__cc | 0.737411 | 0.262589 | Taxpayers Enjoy Getting Plunged
Devvy Kidd
They must, otherwise, we would not continue to see this kind of lunacy:
Benicia bridge rising: Crews' work saves strait fish, but slows completion
A Caltrans engineer's steel-sleeve plan should help keep the new span on track for 2004 opening
By Lisa Vorderbrueggen
"After years of delay, physical evidence of the long-promised second Benicia bridge juts higher each day over the Carquinez Strait.
"Commuters and folks who cross the strait during weekend getaways can hardly wait. The new bridge will nearly double the number of highway lanes across one of the East Bay's most aggravating traffic choke-points.
"But to stay on schedule for a fall 2004 opening, Caltrans needs federal and state sign-off on cutting edge technology that shields fish from deadly construction noise.
"Developed by a Caltrans engineer, the never-before-used method uses a steel sheath, air bubbles and foam to dampen the intense underwater sound waves generated during pile driving.
"Saving the fish has delayed the work three months to date and potentially adds millions of dollars to the price tag. Officials do not yet know how much it will cost.
"Meanwhile, the bridge is already four years behind schedule and costs have skyrocketed to $653 million, more than twice engineers' estimates in 1995.
"We anticipate sometime in the near future coming to a conclusion," said Daniel Buford, a branch chief with the U.S. Fish and Wildlife Service. "The data that we've seen so far shows us that this method had tremendous reductions in the impacts to fish."
"It was Day 2 of pile driving early this spring when construction officials observed gulls voraciously gulping down fish floating in the strait near the work site.
"They scooped up what they could find -- about 40 dead fish -- and immediately notified state and federal environmental regulators as required by the Endangered Species Act.
"The dead fish were common species, such as striped bass, but regulators say the pile driving threatens rare Delta smelt or Sacramento split-tail and commercially valuable salmon." End of excerpt.
There are a number of issues to address about this stupidity:
First, it sounds like more junk science and is reminiscent of the gross travesty foisted upon the good, decent people of Klamath Falls, Oregon. When all was said and done, crap science ruled the day. The criminally insane in the U.S. Fish & Wildlife Service and various "greenie groups" drove thousands into bankruptcy and shut down more land.
I went to Klamath Falls twice and did my own on-site investigation. You can read all these articles on my CD Archive. It will make you gag, but at least those folks fought for what they believed in while most of the rest of the country was enjoying drugs, porn, shopping for made in Communist China and good times.
After all, Klamath Falls wasn't in their neck of the woods, so why should they care? Guess what? What happened in Klamath Falls is spreading like a plague and all of a sudden, those who paid no attention are suddenly finding their land is getting unwanted attention.
Next: Jurisdiction. So few understand how important jurisdiction is when government agencies come blowing into town and stomp on the lives of innocent Americans, all in the name of the environment. This entire "environmental revolution" is a creation of those out to destroy America and the documentation is overhwelming in support of that statement.
Until you understand jurisdiction and where agencies like the U.S. Fish and Wildlife derive that jurisdiction from, you will never be able to effectively fight this kind of nonsense. Sadly, so few will take the time to get educated with the facts and the law. You can read these facts and a thorough legal explanation of jurisdiction for many of the alphabet soup agencies, FDA, EPA, etc., on my CD Archive.
I have fished the Carquenez Straits extensively where that bridge spans. Forty fish observed being eaten by gulls. "About" 40 fish that could have died from anything that day.
Hundreds of millions of tax dollars squeezed from those of us who live in this lunatic state to yet again, protect more fish. Some of them junk fish.
The ocean is full of salmon. They spawn every year. This state has many large hatcheries to keep putting new stock back in the rivers.
I'm real sorry a few fish might die.
But, you go in, drive the piles and get it done.
The fish population will eventually restore itself through nature and sensible, reasonable harvest management.
The traffic across that bridge is beyond insane most hours of the day. The taxpayers sit bumper to bumper wondering why the hosing they get in more and more taxes never produces any relief. When something is finally done and a few fish get killed, the project is delayed years and hundreds of millions of dollars are added to the tab.
And what do these taxpayers here in California do about it? Nothing. They call talk radio and belly-ache. They allegedly vote back in the same lice who serve in Congress (52 house seats here in California) that do nothing to stop the destruction and carnage by the EPA, ESA and the U.S. Fish & Wildlife Service. My bet is maybe one or two of those 52 congress critters even have a clue as to where the U.S. Fish & Wildlife Service derive their jurisdiction from and what it means.
These taxpayers also allegedly continue to vote back in the same crooks and criminals who serve in our Fascist legislature, even though that whole bunch sits back and lets the Feds whip their manhood to shreds. No, I won't forget about the "ladies" that serve in our legislature. We have some of the most vicious lesbians in the state running run shod over the "men" here in Sacramento.
I can hardly wait until the day I can pack my house up and get the hell out of here, the state of my birth. Many times I have attemped to get the people of this state off their collective backsides and fight this legislature on issues like gun control and recalling bad politicians. All I get are excuses. Well, one of these days I'm heading for a state like Tennessee where the people know how to stand up to their paid employees in government.
Instead of the taxpayers in this state getting educated and surrounding the State House and letting these people know they aren't going to take this kind of rape anymore, they just sit back and continue to allow themselves to be stripped of their hard earned money without a fight.
Personally I have a problem with cowards and lazy couch potatoes who won't stand up to their own servant government. I have a problem with people who put good times and "weekends off" ahead of standing up to protect their families, their future and their own state from tyranny.
There are many ways to take non-violent action that will work if people decide they've had enough. Here in California, it appears that the people are still willing to sit around and get beat up by the politicians and special interest groups.
California is allegedly facing a $32 billion dollar deficit. Of course, since California, like the other 49 states keeps a second set of books and we probably have somewhere in the neighborhood of a $1 trillion dollar reserve in assets, this so-called deficit to further rape us in taxes is in question.
But, assuming the state does have this kind of deficit, and you should hear the yowling going on from all the special interest groups because they're not going to get their usual plate of goodies, one would think the taxpayers would have stepped up to the plate years ago about this fish business and the Benicia Bridge.
Dream on, Devvy. Sheep are sheep.
My Archive CD spanning 4 1/2 years of articles can be obtained at:
https://devvy.com/cdrom_sales.html
The jurisdiction issue is found in the Wallace Institute section. | cc/2021-04/en_middle_0020.json.gz/line666 |
__label__wiki | 0.871229 | 0.871229 | Free drumless playalong music track for drummers: Metallica - Ride the Lightning
Abbey Road Studios to open doors for its 80th Anniversary
Asking Stewart Copeland: Was it odd to be the most famous drummer using Orthodox grip?
Grooves from the past: Daniel Rodriguez - Guitar Center's Drum Off 2006 Champion
Mike Portnoy in a new supergroup “Flying Colors” announcing debut CD due soon
Posted: January 14, 2012 in Amazing COOL drummers
Tags: Casey McPherson, cd, Dave LaRue, Dixie Dregs, Dream Theater, Flying Colors, Mike Portnoy, Music, Neal Morse, Portnoy, Steve Morse, superband
The Mascot Label Group has announced a March 27 release date for the debut from Flying Colors (available the day prior overseas) on their Music Theories Label. The band, whose stated purpose is to pair virtuoso musicians and a pop singer “to make new-fashioned music the old-fashioned way” features Mike Portnoy (drums, vocals), Dave LaRue (bass), Neal Morse (keyboards, vocals), Casey McPherson (lead vocals), and Steve Morse (guitar).
“This album has bits and pieces of what you’d expect from each of us” says Portnoy. “However, the sum of all its parts led to brand-new, uncharted territory for all involved.”
– Steve Morse and Dave LaRue were both members of pioneering fusion band Dixie Dregs;
– Neal Morse was a cofounder of neo-prog leaders Spock’s Beard;
– Portnoy rose to prominence as the leader, drummer, producer, and co-writer for metal/prog band Dream Theater;
– Casey McPherson was in the successful pop group Alpha Rev.
Touring plans for Flying Colors will be announced in the coming months.
For more, info visit www.flyingcolorsmusic.com
After the successful DVD, Benny Greb releases “The Language of Drumming” book
Asking Joey Jordison: Did you have any relative who turned you on to all the music you’re into? | cc/2021-04/en_middle_0020.json.gz/line682 |
__label__wiki | 0.697563 | 0.697563 | my life is like a Harmony Korine film without the quick edits
conumption weighs me down
BRING OVER BEER WHEN I’M TRYING TO GET SOBER & Other Poems
editor’s note-
She has made him into a writer, he writes.
But who is she?
Reading this collection, you’ll feel an imperceptible rotation, pensive shadows on bleak walls, silhouetted remorse. He hurts like you. He’s lost someone, just like you. You’ll wonder, Are these shadows moving? Or am I imagining them to?
Even Doren’s delightful moments are haunted. A sidelong glance, a face that reminds you of another face. It’s ungraspable. The fear, that what’s changed is unnoticed, and what’s seen seems unchanged.
Characters change suddenly, then disappear. And guilt, so, so much of it, so palpable.
Yes, the work is sparse, adamantly calm. But these shadows limn important truths, things simple, but in need of persistent reminder. And capturing this hollow pang, the cold resonance of regret, and preserving it, offering it to the viewer wholly intact, this requires great effort.
[BRING OVER BEER WHILE I’M TRYING TO GET SOBER & Other Poems makes it clear that] even the quietest poet surely howls into the unforgiving night.
cover art by Jesse Michaels (of Operation Ivy)
You never recover from heartache. The myth of transcendence is a lie. Dylan Doren doesn’t buy into the bullshit, but he accepts and endures in his newest chapbook of poems, BRING OVER BEER WHEN I’M TRYING TO GET SOBER. The short, fragmented lines reflect the shattering experience of loss. Reading it is like picking up the pieces and trying to make sense of them. You can’t make sense of the senseless, of course, but you can go on. That’s all you can do. –goodreads
Purchase BRING OVER BEER WHEN I’M TRYING TO GET SOBER & Other Poems HERE
Dylan Doren’s “Time and Space” is a book of collected poems divided into three fragments: time, coitus, and space. What strikes most about this book is its angst — the way in which it rawly catalogues in our interface with desire. What more is desire than our inescapable longing for that which we cannot have, an object of love just out of our proximity, an ideal always just out of joint with our own experiential narrative of time? In “Time and Space,” we feel the tumult of the necessary distance which sustains the act of loving itself, the impossibility of its culmination. Here, two lovers dance around each other in an attempt to pin down the other, each unable to grasp themselves in the shifting. In the book’s archival telling of this process, it unconsciously sketches the contours of longing itself: the ways in which we tragically attempt to eradicate the distances, proximities, and temporal lags that are the stuff of intimacy itself. Loaded with self-fracturing (the movement between first and third person accounts), temporal fracturing (the movement between the past, present, and future), this is a work of blunt outpouring and honesty.
Purchase TIME & SPACE HERE | cc/2021-04/en_middle_0020.json.gz/line688 |
__label__cc | 0.747666 | 0.252334 | Independent school enrollment trends uncovered in the time of COVID-19
3 key takeaways from EAB’s virtual roundtables for enrollment managers
By Jo Smith
Use employment data for enrollment planning
This summer was one unlike any other for independent school enrollment managers. They navigated taking their offices virtual, managed ever-changing state and local guidance about reopening, and prepared for a year of recruitment that will look markedly different than any before. At EAB, our monthly summer virtual roundtables gathered enrollment leaders from across the country to discuss the challenges and triumphs they experienced since the pandemic began. Here are a few key takeaways.
Enrollment numbers remained steady, with increased interest from public school families
Despite early concerns about enrollment for the 2020-2021 school year, anticipated declines were not realized.
This was in part due to increased interest from public school families, particularly those with students in lower school grades that struggle more with online learning. Independent schools demonstrated a smooth transition to virtual learning last spring—one that received good press and was shared through word of mouth—as well as the ability to offer in-person learning for this fall.
Furthermore, families concerned about their local public school’s ability to deliver effective virtual instruction or apprehensive about their children’s safety when returning to densely populated school districts began to consider independent school as an appealing option.
Despite the strong enrollment numbers for this year, enrollment managers have voiced concerns about the 2021-2022 school year. Many worry that long-term hybrid learning or pared down academic and extracurricular offerings will impact parents’ willingness to continue to invest in an independent school education. Some enrollment managers also flagged the delayed impact schools saw in the 2008 recession on independent school enrollment as a potential future problem. This set of concerns will undoubtedly be at the forefront of recruitment efforts in the coming school year.
Looking ahead: The year of (mostly) virtual enrollment offices
This year, schools have taken steps to minimize on-campus interactions with non-community members. Some schools decided to allow small admissions gatherings or outside-only tours for prospective families, while others established strict no-visitor policies for the first semester or full year. In light of these decisions, enrollment leaders spent the summer surfacing ideas for how to redesign school tours, open houses, and annual recruitment events for virtual channels.
Shadow days for prospective or admitted students emerged as a top-of-mind issue for enrollment managers this summer. As early as June, they contemplated how they could give prospective students the experience of visiting campus without being able to attend in-person classes, spend time with current students, or explore the facilities. Some schools reported outfitting classrooms with Owl Cameras to offer a 360-degree view of the classroom (an initiative to benefit both current and prospective students). Others planned to pre-record shortened versions of favorite lessons from members of their middle and upper school faculty, allowing prospective students to design their own shadow day.
Effective prospect communication during the pandemic
Now more than ever, it is critical for schools to be creative about how they convey their value to prospective families. To that end, EAB is creating an digital marketing resource center, where Independent School Executive Forum partners have access to resources that help them clearly articulate their value proposition and effectively share it through digital marketing.
Schools worked together to overcome new challenges
Finally, we heard from several partners that they are working with local peer schools to address enrollment challenges affecting the broader independent school community during COVID-19.
Enrollment managers in one city lobbied their consortium to run a virtual fair for the area’s independent schools, providing an opportunity to talk not only about individual school benefits, but also the broader value of an independent school education and the affordability provided by financial aid.
In another part of the country, enrollment managers agreed to all remain virtual for fall recruitment activities. Whether it was working together to prioritize the safety of the community or to spread awareness of the unique benefits of an independent school during these uncertain times, independent school enrollment offices came together to navigate these unprecedented times.
In the months ahead, EAB will continue to provide opportunities for enrollment leaders to connect and will be profiling innovative and creative ways independent schools are recruiting and retaining new families. In addition, we will be sharing an overview of enrollment trends surfaced through EAB’s pulse enrollment survey, which was administered across summer 2020.
4 independent school enrollment trends during COVID-19
Read insights from 30+ independent school enrollment managers sharing their approach to retention, financial aid needs, and more.
REVIEW THE TAKEAWAYS
Independent School Executive Forum
Jo is a senior analyst in EAB’s strategic research department.
Four independent school enrollment trends during the COVID-19 crisis
Independent School Student and Family Retention Strategies Compendium
Key lessons for independent school leaders about financial aid and tuition during the COVID-19 crisis | cc/2021-04/en_middle_0020.json.gz/line689 |
__label__cc | 0.621355 | 0.378645 | Skip to Left Navigation
The BRADLEY DEPARTMENT of ELECTRICAL and COMPUTER ENGINEERING
Minor in Cybersecurity | ECE | Virginia Tech
Program Educational Objectives (PEOs)
Minor in Cybersecurity
Virginia Tech's College of Engineering offers an undergraduate minor in cybersecurity. Cybersecurity under this minor covers the fields of Information Security, Network Security, and Computer System Security. As fraudulent groups and people seek to steal this pertinent information, the importance of cybersecurity and its inner workings rises.
Core Principals & Hands-on Education
This minor seeks to provide a core technical basis for careers in secure system design and operation.
Note that Virginia Tech's undergraduate education in cybersecurity, while hands-on, focuses on core principles of security rather than specific information technology components and systems from specific vendors. Students may also find it beneficial to consider professional certification, such as the Certified Information Systems Security Professional (CISSP).
The undergraduate minor in cybersecurity is a College of Engineering program, principally focused on students majoring in Computer Science or Computer Engineering, but is open to any student able to meet the necessary prerequisites.
To apply for the cybersecurity minor and view application deadlines, please visit the Department of Engineering Education and fill out a College of Engineering Minor Application.
Declaration Requirement: Students wishing to declare their intention to complete the cybersecurity minor must first successfully complete CS 3214 OR ECE 3574. Students may declare their intention with the College of Engineering.
GPA Requirement: Students must obtain a GPA of 2.0 or better over the courses used to satisfy the requirements of the minor.
The official checksheets for the minor can be found at The Office of the Registrar.
Two Minor Core Courses
ECE 4560: Network Security Fundamentals
CS 4264: Principles of Computer Security
One Network Course from This List
ECE 4564: Network Application Design
CS 4244: Internet Software Development
CS 4254: Computer Network Arch and Programming
ECE 4614: Telecommunication Networks
One Systems Course from This List
CS 3214: Computer Systems
CS/ECE 4504: Computer Organization
ECE 3574: Applied Software Engineering
One Interdisciplinary Course from This List
ACIS 4684: Information Systems Security and Assurance
FIN 4014: Internet, Electronic, and Online Law
MATH 4175: Cryptography I
MATH 4176: Cryptography II
One Additional Course from any of the Networks, Systems, or Interdisciplinary Lists
In addition to the one required course from each area, one additional course is required, and may be any one of the courses listen in any of the three given areas.
One Credit Seminar Course
ECE 4944: Cybersecurity Seminar
Students graduating with a degree in computer science or computer engineering with a minor in cybersecurity could expect careers in software engineering, embedded systems engineering, or information systems management, with an emphasis on designing, developing, operating, or analyzing security features or subsystems.
Given Virginia Tech's location in the mid-Atlantic region, there are a large number of employers in the Washington DC metropolitan area with a keen interest in cybersecurity, including defense contractors and federal agencies. Those considering careers in the national security sector should consider the requirements for the US Department of Defense Information Assurance Workforce Improvement Program.
Dr. Joe Tront
ECE Student Services
CS Student Services
The Cybersecurity Course of Study
Find out more about the Cybersecurity curriculum - Cyber Security Research and Education at Virginia Tech.
Get involved with the Cyber Security Club
Visit the Cyber Security Club at Virginia Tech pages.
Cybersecurity education in ECE
It's no secret: Preparing students for careers in national security (2013 Annual Report)
ABOUT VT ECE
VT ECE Quick Metrics
Graduate Student Life
Graduate Policy Manual
Undergrad Research
ECE PhDs
ECE Patents
Textbooks by the Faculty
Copyright © 2021 Virginia Tech Department of Electrical and Computer Engineering
An Affirmative Action/Equal Opportunity Employer | Privacy Statement | Contact Webmaster | cc/2021-04/en_middle_0020.json.gz/line691 |
__label__wiki | 0.973321 | 0.973321 | The 25 Essential Anime Series To Watch Now
From early Miyazaki to Neon Genesis Evangelion and through Attack on Titan and JoJo's, here's the anime from the last five decades that made an impact.
by Alex Vo, Rafael Motamayor and Rob Fowler | December 7, 2020 | Comments
It’s a good time to be an anime fan, what with multiple dedicated streaming services (choose among Crunchyroll, Funimation, HiDive and more), alongside mainstream awards recognition and critical acclaim for the likes of Your Name or Dragon Ball Super: Broly. Meanwhile, Studio Ghibli‘s on HBO Max, and anime-inspired shows like Avatar: The Last Airbender and The Legend of Korra hitting big on Netflix. And now Attack on Titan has returned for its fourth and final epic season.
We’re commemorating these moments with a selection of 25 anime TV series that we believe have been essential to the medium over the last five decades. Our recommendation that these shows ought to be sought out and watched is based on the immediate quality of the stories, characters, and animation, along with their crucial impact in exposing new audiences to the world of anime.
Of course, with so many high-caliber shows produced over the years, much of it readily available at our fingertips, we invite you to create your own guide. Let us know what you think are the best, most essential anime series out there in the comments.
Future Boy Conan (1976)
(Photo by Nippon Animation)
Owing to its inconsistent availability country to country, Future Boy Conan remains underseen even among most Studio Ghibli devotees. This is something fans must rectify by any means. Directed by Hayao Miyazaki in collaboration with Isao Takahata, this 26-episode series features a flooded post-apocalyptic Earth, warring human factions, a boy with superhuman strength, a girl with telepathic powers, and, of course, pirates and seaplanes. Released before his feature debut, The Castle of Cagliostro, this is light years beyond Miyazaki’s other TV output (like when directing Sherlock Hound episodes or his run on Lupin the 3rd, all great), finding him at his most youthful and enthusiastic. And the show bears all the hallmarks of his later work, like worthy female protagonists, environmentalist messages, and complex, shifting relationships between heroes and villains. Which actually renders the phrase “later work” void. Future Boy Conan shows he’s always known how to make masterpieces.
Space Pirate Captain Harlock (1978-1979)
(Photo by Toei Animation)
The beginning of a vast space opera franchise created by Leiji Matsumoto, this is a slow-burn melodrama anchored around the titular Harlock, who has left Earth in his ship, the Arcadia, after defining space as the final frontier for a man of honor like himself. He and his crew engage in war with the all-female Mazone, who threaten his home planet. In his characteristic skull-and-crossbones cloak, Harlock’s stoic nature and moral nobility (and not to mention he’s a bit of a lush) quickly became a lovely, foundational trope in anime. It’s now to the point where his image and character has been parodied in disparate animation, from Project A-Ko to Steven Universe.
Watch on: Crunchyroll
Mobile Suit Gundam (1979-1980)
(Photo by Nippon Sunrise)
Like Futurama, Star Trek, and Firefly, Mobile Suit Gundam was one of those sci-fi shows that found significant life even after their early cancellations, as fans united and rallied around their beloved series. In Gundam‘s case, the powers that be were convinced to resurrect the franchise after model kits of the show’s mechs flew off the shelves for years. Audiences were clearly vibing to Gundam‘s revolutionary new style of personalized giant robots in space warfare, to the point that decades later a Gundam blasted its way into a major fighting appearance within Ready Player One‘s climactic battle. Outside the cool mech design, the original Gundam series is notable for hero Amuro, and his rivalry with Char, whose redemption and fall in the sequels make up one of the great character arcs in classic anime.
Ranma 1/2 (1987-1992)
(Photo by Studio Deen)
A freewheeling blitz of martial arts slapstick and ever-so-many romantic misunderstandings, Ranma 1/2 is a tale of two families, the Saotomes and the Tendos, whose members and friends are affected by a curse, enacted upon them after some characters bathe or fall into a forbidden natural spring. Cold water afflicts the accursed, transforming one person into a pig, another a duck, a panda, and so on. And in the case of raven-haired Ranma Saotome, cool liquid morphs him into a red-headed pig-tailed girl. The only way to turn any of them back is with a splash of hot H2O. The quirky gender politics, and the love-hate interplay between Ranma and his violently reluctant betrothed Akane Tendo (not cursed, outside of being an exceptionally bad cook), drive the action and comedy, as other would-be suitors surge in like hawks of anarchy. After its TV run, Ranma 1/2 carried on through a robust gauntlet of OVAs and feature films.
Watch on: Hulu, VIZ
Dragon Ball Z (1989-1996)
(Photo by Toei)
Anime has been a strong force in upending societal impressions that animation is strictly for kids. And every now and then a show breaks through the otaku inner circles and into shopping malls and the mainstream, validating the medium in a way through its vast pop-cultural reach. Dragon Ball Z is one of those major breakthroughs, an epic of planet-annihilating proportions, whose long-gestating battles of inner rage and surging emotion speaks especially to an eternal adolescent audience. Series protagonist Goku is now an icon of animation thanks to his justice-driven good nature, aided by the characteristically unfussy character design by Akira Toriyama, and a meme-friendly fanbase. And Goku still lives today, through a currently-airing sequel series, the critically acclaimed 2019 Broly film, and even funky Thundercat songs.
Watch on: Funimation
Patlabor: The TV Series (1989-1990)
(Photo by Sunrise)
Patlabor pulls the mecha genre out from space operas and away from all those cosmic threats, and lands it in for a more upbeat earthbound approach. Created in the twilight of Japan’s economic boom before the bubble burst in 1992, the series glitters with a positive, progressive outlook on the (then) near-future of the island nation, where commercial-grade mechs called Labors have integrated within every day life, powering transportation, manufacturing, land development, and more avenues of industry. We follow the colorful, motley crew of officers at Second Special Vehicles Division, who combat a variety of Labor-related crimes. Less overtly political than the OVA and movie timeline, The TV Series is an appealing breakdown of a unique police unit’s inner workings that, in its best episodes, feels like an office sitcom whose lessons are delivered through giant robot beatdowns.
Watch on: HiDive
Sailor Moon (1992-1997)
If stereotypically Dragon Ball Z captured the attention of boys, then Sailor Moon did the same for girls. A pioneer in national broadcast syndication like DBZ, Sailor Moon brought anime to the masses. It was an after-school, afternoon delight to daily unite with Usagi (or Serena, in the original English dub) and her intergalactic planetary squad of friends, as they navigate adolescent life, mysterious boyfriends, and their own secret identities as magically-endowed defenders of the planet. Series director Kunihiko Ikuhara would go to direct another shojo classic series, Revolutionary Girl Utena.
Tenchi Muyo! (1995)
(Photo by AIC)
From Bubblegum Crisis to El-Hazard: The Magnificent World to Oh My Goddess!, production house AIC defined the anime look from the mid-’80s to early ’90s. AIC’s tendency towards warm color tones and diligent, weighty animation gave their projects an alluring haze which felt simultaneously grounded and not of this world. The Tenchi universe was the commercial crown jewel of the era, with additional OVAs, feature films, and spinoffs. Tenchi‘s premise is one of those classic anime wish fulfillment set-ups, where a hapless high school dude gets entangled in a love triangle, with the two other participants being a princess from another planet, and a roguish space pirate. Superhuman powers, time travel, and a cat-rabbit who can transform into a spaceship may also get involved. The AIC look and Tenchi‘s fluidity between romance, action, sci-fi, comedy, and drama really hits that anime sweet spot.
Neon Genesis Evangelion (1995-1996)
(Photo by Gainax)
Hailed as the apex of serialized anime since its debut, Neon Genesis Evangelion’s champagne reputation belies just how strange it is. Set in a post-apocalyptic Japan where kaijus known as “Angels” repeatedly ravage humanity, the series follows Shinji Ikari, an insecure boy chosen to pilot one of the Evangelions, which are giant, mysterious robots that are the only weapons capable of repelling the Angel menace. From there, Evangelion transforms from a mecha procedural into an impressionistic allegory about the inherent loneliness of being human. The virtually plotless finale divided audiences at the time and remains contentious to this day. Series creator Hideaki Anno responded to fan outrage with a supplemental film titled The End of Evangelion, which brought closure to the story while diving headlong into a darkness that the show merely glanced at. The result is a harrowing but unusually frank exploration of mental health. Taken altogether, Evangelion’s hallowed status is understandable: While the saga becomes more inscrutable the deeper it goes, viewers will come out the other end having gained a deeper understanding of themselves.
Watch on: Netflix
Pokemon (1997-present)
(Photo by OLM, Inc.)
If Dragon Ball was for boys, and Sailor Moon was for girls, then Pokemon was for everyone. With its limitless capacity for cute monsters, and hero Ash Ketchum’s simple, defined goal of mastering the capturing of said monsters, Pokemon launched with an immediate, all-ages appeal. Twenty-three seasons later, Ash is still at it, with no signs of slowing down. That’s because the show (and franchise at large, really) hasn’t wavered from its core, timeless bent towards adventure and discovery, of what it’s like to be operating in its universe. Every opportunity is taken to make you feel the thrill of being a Pokemon seeker, as seen in the video games, Pokemon GO!, and even Detective Pikachu.
Watch on: Pokemon TV
Cowboy Bebop (1997-1998)
Cowboy Bebop feels like the end of anime’s classic era, a spectacular climax for cel animation television, and the dawn of anime finally entering the public consciousness. Of course, Bebop had a big hand in making anime explode in America, as cable television grew in popularity and Cartoon Network began airing the show in blocks with the likes of The Big O, Trigun, and InuYasha. Relentlessly hip, Cowboy Bebop stood out (still does) for its silky animation, eclectic blues and jazz soundtrack, postmodern editing trips, explosive action set pieces, and the natural allure of star bounty hunter Spike, who moves like a deep space Elliott Gould from The Long Goodbye. Only Spike’s even cooler than Marlowe.
Watch on: Hulu
Serial Experiments Lain (1998)
(Photo by Triangle Staff)
Serial Experiments Lain helped usher in a new style of anime, of more digitally-produced shows with a glossy bloom and deeper, darker, complicated storylines. In the wake of Neon Genesis tearing up the typical anime playbook, Lain pursues a surreal, interior cyberpunk story about a withdrawn high school girl who receives an email from a classmate who has recently committed suicide. Questions of hyperreality, consciousness, and the everyday tangibility of cyberspace ensue. Lain is pretentious, symbolic, and absorbing – a prime example of a brave new world in anime.
FLCL (2000-2001, 2018)
(Photo by Production I.G)
What does FLCL (pronounced “Fooly Cooly”) mean? Nobody seems to know in this joyous, nervy, and wistful odyssey through the pangs of puberty. A passion project by Gainax animator Kazuya Tsurumaki, this madcap allegory delivers one of the most experientially authentic depictions of blossoming sexuality in any medium. The story kicks off when Naota Nandaba, a surly 12-year-old boy from a nondescript town, has his life upended when a boisterous drifter drives into town and thwacks him across the head with her guitar. Symptoms for Naota’s injury include angst, confusion, and his skull sprouting fighting robots who may be a part of a vast alien conspiracy. Like its title, the story logic of FLCL matters far less than how the journey makes the viewer feel. For anyone who can remember their first discombobulating step into adulthood, FLCL will feel like coming home.
Watch on: Hulu, Funimation, Crunchyroll (2018 season)
Naruto (2002-2017)
(Photo by Pierrot)
One of the longest-running anime ever with over 700 episodes, it’s pretty hard to never have heard of Naruto before even if you’re not into anime. The show follows an orphaned boy named Naruto, who lives with the soul of a nine-tailed demon fox trapped inside him, and dreams of one day becoming a ninja. The value of friendship and determination is at the core of this show, which offers plenty of interesting characters, both friend and foe, and a story that grabs your attention and never lets go despite having hundreds of episodes. Of course, this all wouldn’t work if Naruto himself weren’t an amazing protagonist. Indeed, he’s one of the most well-developed and charismatic characters in anime history, and we witness him evolving from from aspiring ninja, to leader, to even a father.
Watch on: Crunchyroll, Hulu, Netflix, VIZ
Fullmetal Alchemist (2003-2004)
(Photo by Bones)
An action/adventure show with an upbeat tone, amazing action scenes, excellent world-building and characters you can easily fall in love with, it’s easy to see why Fullmetal Alchemist is considered one of the best anime series of the 2000s. As upbeat as it is, the story has loss and grief as a central theme. The series follows two brothers who venture out to look for the legendary Philosopher’s Stone and regain the bodies they lost after trying to resurrect their dead mother using alchemy. Also worth noting is the equally fantastic Fullmetal Alchemist: Brotherhood, which was a more faithful adaptation of the original manga, whereas Fullmetal Alchemist took many liberties with the source material.
Code Geass (2006-2007)
In an alternate timeline where the British Empire won the Revolutionary War, but then subsequently lost against Napoleon, we’re introduced to a world where the Holy Britannian Empire controls a third of the Earth. Now, the Empire is set on conquering Japan. A Britannian prince in exile finds himself the leader of a rebellion when he receives the “power of absolute obedience.” Code Geass is full of unforgettable twists, with several mysteries and shocking developments coming at the audience, and a compelling war story that manages to tell a big picture story of epic proportions as well as more intimate character stories that you’ll care deeply about. Then there’s the mech action. Though this is not Neon Genesis Evangelion, this series still offers plenty of giant robot action mixed with the Game of Thrones-like political machinations.
Watch on: Netflix, Funimation, Crunchyroll
Death Note (2006-2007)
(Photo by Madhouse)
What do you get when you combine a god of death so bored he drops off on Earth a notebook capable of killing any person whose name is written inside, a high school student who wants to clear the world from criminals, and an eccentric detective known only as L? One hell of a cat-and-mouse four-dimensional chess game. Death Note doesn’t have a villain really, but instead it lines up two opposing sides who believe in justice but follow vastly different paths to achieve it. There are questions about morality and justice that will make you think, and nail-biting schemes and plots that will keep you guessing and enthralled.
Watch on: Crunchyroll, Netflix, HBO Max, Hulu, Tubi, Vudu, Pluto TV, VIZ
Gurren Lagaan (2007)
In this over-the-top, loud, hot-blooded, and exciting mecha show hides the antithesis of Evangelion, offering not so much a deconstruction of the genre, but a celebration of it. Gurren Lagann follows two friends who become the symbols of rebellion against a powerful tyrant, in a world where mankind has been forced underground to live in subterranean villages. This show has fast-paced action sequences that can rival those of the biggest blockbusters, with a distinct visual style as loud and extreme as an ’80s heavy metal banger. Additionally, Gurren Lagann doesn’t shy away from killing off favorite characters and exploring more emotionally mature themes while raising the stakes to epic world-ending proportions.
Watch on: Funimation, Crunchyroll, Netflix, Hulu
Steins;Gate (2011)
(Photo by White Fox)
Time travel stories aren’t easy to pull off, but Steins;Gate almost makes it look easy. (And that’s while having a semicolon it its title.) We follow a self-proclaimed mad scientist who likes to joke around with crazy inventions, until he accidentally invents a phone that can send messages across temporal space. Now he and his friends find themselves trapped in a murder loop, as the show uses the butterfly effect to demonstrate the increasingly complicated consequences of trying to change the future. The story is airtight, and though the time travel gets complex, it’s never too confusing. As much a head-scratcher as it is a thrilling roller coaster, this is a sci-fi show you don’t want to miss.
Watch on: Hulu, Funimation, Crunchyroll
Hunter x Hunter (2011-2014)
In a world where people can become certified Hunters to track down treasure, criminals, and people, a 12-year-old embarks on a journey to become a Hunter himself in order to find his missing father. The premise of Hunter x Hunter isn’t completely new (it feels a lot like Dragon Ball), but what makes this show special is in the execution. For one, the show makes its villain as big and compelling a character as the hero, and his story rivals the best protagonist stories out there. Hunter x Hunter has one of the best villains in anime, plus plenty of super-powered action to satisfy any comic-book–style anime fan.
Watch on: Crunchyroll, Tubi, Vudu, Netflix, Hulu, HBO Max, Pluto TV, VIZ
JoJo’s Bizarre Adventure (2012-present)
(Photo by David Production)
One of the most popular and beloved franchises in recent years, JoJo’s Bizarre Adventure tells the multi-generational saga of the Joestar family, with each new season in the saga following a new “JoJo” protagonist from the lineage. Thus, the show spans several generations, along with multiple locations and genres, while always maintaining its very distinct and strange visual style. This is Victorian vampire horror, superhero Nazi-fighting, and a murder mystery all in one. Also what makes JoJo’s so loved is its many references to ’80s action heroes (most of the absurdly beefy characters are inspired by your Schwarzeneggers and Stallones of yore) and rock stars. Jojo’s is as much an ’80s love letter as Stranger Things, but its memeable and unpredictable nature makes this a must-watch for diehard anime fans and newcomers alike.
Attack on Titan (2013-present)
(Photo by Funimation)
The world is a dystopian nightmare. Humanity is at the brink of extinction, hidden behind giant walls, as a group of soldiers fights to protect citizens from 150-foot-tall humanoid “Titans” with a voracious appetite for devouring people. Attack on Titan starts with a simple concept that promises an exciting, brutally violent, and frightening series, but it evolves into a tragic exploration of fate and hopelessness, while questioning whether the cycle of violence can ever be broken. The music will instantly become part of your favorites playlist, the characters have distinct personalities, the action becomes more fluid and thrilling over time, and the story effortlessly swings from action to political drama to mystery. It’s a thrilling world that keeps expanding.
Watch on: Funimation, Crunchyroll, Hulu, Netflix
Haikyu!! (2014-present)
The best sports anime right now, Haikyu!! takes you to the exciting, blood-pumping, and often heart-breaking world of volleyball. Even if you’ve never watched, played, or even thought about volleyball outside of Top Gun, this show guaranteed to school you on the sport and what makes people so excited for it, while putting you in a great mood every time the central team wins a match. Our main character is Shoyo Hinata, a high school freshman considered too short to play volleyball, but who is particularly fast and adept at jumping. Naturally, we follow his journey to becoming the best volleyball player he can be. This show features fantastic character development, hilarious humor, and some of the best sports sequences ever animated.
Watch on: Crunchyroll, Netflix, HiDive (seasons 2 and 3)
My Hero Academia (2016-present)
It’s a world where nearly everyone has some sort of superpower, and Izuku Midoriya is born with nothing. That doesn’t stop the kid from enrolling into one of the most prestigious superhero schools, setting out on an improbable journey to become the number one hero on the planet. My Hero Academia takes everything you love about superhero movies, and mixes it with a coming-of-age tale with lots of heart, eye-popping action, a supporting cast of well-developed and memorable characters, a protagonist who isn’t afraid to show vulnerability, and references and homages to your favorite comic books. Whether you want a first entry into the world of superheroics, or have seen all that Marvel and DC have to offer, this show has something for everyone.
Watch on: Funimation, Crunchyroll, Hulu
A Place Further Than The Universe (2018)
Have you ever wanted to do something extraordinary, but then life just got in the way? That’s the premise of A Place Further Than the Universe, which follows a teenage girl who’s always wanted to do something big before graduating high school, but can never figure out what. That is, until she meets a group of girls her age who convince her to journey to Antarctica together. The show is relatable, funny, comforting, and upbeat while still managing to be very emotional. It perfectly captures the youthful optimism of the teenage spirit, as no matter how many adversities the girls face, they still manage to overcome them with each other’s help.
Thumbnail image: MAPPA
Tomatazos Musicals A24 MCU Paramount singing competition canceled TV shows dark BAFTA Dark Horse Comics movies YouTube Premium 21st Century Fox CNN reboot comiccon worst Drama DirecTV 2017 Fox News Quiz New York Comic Con psychological thriller mockumentary 71st Emmy Awards Television Critics Association Lifetime comic books Tarantino stand-up comedy venice crossover batman Winners 007 Family diversity Star Trek BBC One hispanic movie HBO Binge Guide halloween President Turner Classic Movies quibi technology SXSW 2018 Classic Film toronto The CW halloween tv joker Pirates Travel Channel Hear Us Out ABC Family Peacock supernatural FOX Comic Book strong female leads Sundance TV VOD scary movies Marathons cinemax Bravo LGBTQ chucky superhero Hulu scorecard book Fantasy Nominations Summer TNT Box Office dc Film Festival travel toy story Shudder Britbox GLAAD award winner Mary Tyler Moore TCA Winter 2020 nfl Mary poppins Chernobyl Kids & Family Acorn TV werewolf 45 Toys Discovery Channel obituary cooking boxoffice Unbreakable Kimmy Schmidt Music Rocketman Logo zero dark thirty rotten movies we love cancelled TV shows Marvel period drama Oscars Emmys a nightmare on elm street news zombies facebook fresh twilight TCA Awards concert Comics on TV VICE SundanceTV GIFs Paramount Network Superheroe Black Mirror deadpool australia Writers Guild of America Disney+ Disney Plus Stephen King blockbuster Red Carpet El Rey universal monsters foreign Tubi doctor who spinoff Infographic sitcom OWN cancelled 2015 cops crime drama free movies anime archives Podcast Polls and Games ratings finale VH1 Disney Anna Paquin APB NBC best LGBT indie comedies dogs TIFF Heroines X-Men The Walking Dead Rom-Com canceled Horror Mudbound IFC CMT video italian MTV 72 Emmy Awards teaser satire YouTube Red witnail adaptation Marvel Television Vudu TV Land Mindy Kaling cancelled television reviews spanish ABC 2020 what to watch 99% kids documentary DC streaming service unscripted rt archives zombie CBS All Access Netflix Christmas movies renewed TV shows Fox Searchlight Valentine's Day war dramedy Lifetime Christmas movies TCA 2017 USA asian-american Avengers james bond composers Black History Month Amazon Prime Arrowverse 2019 jamie lee curtis docudrama sports Pet Sematary children's TV WarnerMedia Musical Chilling Adventures of Sabrina science fiction golden globes Mystery TV Crackle police drama all-time BET ghosts Reality Turner TV renewals based on movie SDCC versus WGN FXX Baby Yoda See It Skip It nature HBO Max Netflix Superheroes TBS ID medical drama 24 frames Creative Arts Emmys comics Lucasfilm Apple TV+ Alien television The Witch political drama Marvel Studios Columbia Pictures IFC Films romantic comedy video on demand Sundance Now disaster rotten Freeform Premiere Dates Comedy Central fast and furious PlayStation Ovation streaming RT21 Hallmark comic Amazon Prime Video Best and Worst laika boxing Winter TV AMC screen actors guild Ghostbusters CBS animated elevated horror Country Amazon mission: impossible Brie Larson blaxploitation Amazon Studios christmas movies The Academy Elton John Tumblr TCM Comedy DC Universe Pop Pop TV A&E dragons Masterpiece BET Awards spain space talk show GoT Cosplay Rocky Spike TCA remakes hist Epix social media dceu tv talk Awards series Election Emmy Nominations Syfy Pride Month Starz Academy Awards Teen Film Holiday FX on Hulu Trailer politics Mary Poppins Returns First Reviews documentaries japanese USA Network south america Universal BBC sequel Disney streaming service Sneak Peek breaking bad Pixar FX harry potter directors films Holidays Warner Bros. Character Guide Apple Rock Awards Tour Captain marvel Song of Ice and Fire DC Comics 4/20 Cartoon Network Set visit Disney Channel ESPN child's play festivals E! french Thanksgiving cats PBS worst movies franchise Certified Fresh Food Network historical drama criterion Schedule Reality Competition Sundance American Society of Cinematographers National Geographic MSNBC Opinion Year in Review Interview Star Wars First Look adventure Western serial killer stop motion History 2016 robots crime HBO Go classics emmy awards romance Trivia richard e. Grant parents sag awards spider-man Shondaland Funimation Spring TV Showtime revenge TruTV critics Biopics Cannes Nickelodeon vampires The Arrangement latino ITV Photos PaleyFest RT History Sci-Fi festival cartoon football The Purge OneApp theme song crime thriller nbcuniversal cars psycho Endgame Super Bowl Disney Plus Grammys thriller sequels transformers DGA die hard binge BBC America indiana jones Spectrum Originals anthology screenings Hallmark Christmas movies Walt Disney Pictures CW Seed mutant Trophy Talk Watching Series E3 San Diego Comic-Con Fall TV spanish language 20th Century Fox aliens hollywood Television Academy true crime NYCC spy thriller independent discovery Action natural history Esquire Extras cults YA TLC slashers Ellie Kemper Women's History Month Lionsgate Video Games name the review Adult Swim Sony Pictures Apple TV Plus Crunchyroll Animation Christmas game show Calendar green book justice league casting YouTube Nat Geo game of thrones Martial Arts Countdown biography miniseries black stoner cancelled TV series | cc/2021-04/en_middle_0020.json.gz/line694 |
__label__wiki | 0.645865 | 0.645865 | Stacey Abrams agrees with educators: Public education is at stake in Election 2020
By Amanda Menas
Students across the country are watching and participating in protests against police brutality during a global pandemic, the summer before an election year. As school resumes in the coming weeks–whether virtually or in-person–many educators are preparing for honest discussions with their students and school communities about America’s history of racial oppression, and what we are experiencing today.
“The question here is, ‘why teach about citizenship and democracy and define those terms in concept and action, when suppression is being normalized and accepted?’” says Justin Johnson, a middle school teacher in Georgia and secretary-treasurer of the Georgia Association of Educators.
Voter suppression has often been presented to students as part of our past. But the reality is that while tactics like poll taxes, literacy tests, and violence at polling stations may have been rooted out, they have been replaced by other serious threats to each individual’s right to vote. Voter I.D. laws, the drastic reduction of polling stations in Black and Brown neighborhoods, the barring of early vote options, intimidation and disinformation campaigns, and illegal voter roll purges are just some of the modern tactics used to suppress votes.
However, Johnson cautions that we can’t allow students to be discouraged from voting, because their votes are, or will soon be, a “deciding factor in our current society.”
Educators, too, must stay engaged in the conversation, not only because of their essential role in preparing students to vote, but also because they are trusted members of their communities who can encourage others to cast a ballot.
How voter suppression hurts public schools
When voter suppression tactics target communities of color and students, important local issues go unaddressed and funding needs for education, healthcare, and other critical areas go unmet, driving inequity. When students don’t receive the funding they deserve from their local representatives, Johnson says “they’re missing the opportunity to have access to technology, and other supplies and support, which means they could be missing out on what they need to succeed in society.”
That’s why NEA partners with Fair Fight in working to combat voter suppression. Fair Fight was founded by Stacey Abrams, former minority leader in the Georgia House of Representatives, who agrees with educators that the welfare of our students and the future of our public schools are on the line in the upcoming election.
“Voter suppression directly impacts the issues most vital to the health and welfare of our nation’s children such as public education, healthcare and affordable housing,” says Abrams. While her organization works in courtrooms across the country against blatant voter disenfranchisement, she sees steps that every voter can take to support better student outcomes, advocate for increased school funding, and close the opportunity gap for students and communities of color.
“In 2020, we must vote for leaders up and down the ballot who address the needs of the whole child from cradle to career. Every child deserves the opportunity to reach their full potential—no matter their zip code or background,” says Abrams.
Voting issues in Election 2020
Despite the obstacles, Fair Fight’s Liza Conrad says that voters are turning out in record numbers in many primaries across the country.
“They wouldn’t work so hard to block us if our votes weren’t so powerful,” says Conrad.
But 2020 is the first presidential election year in nearly 40 years in which the Republican Party can mount campaigns without court approval to combat what they claim is voter fraud. Even though the party violated the ruling in 1986, 1990, and 2004, for intimidating and disenfranchising voters, primarily voters of color, now the RNC has launched a massive coordinated effort to establish so-called “ballot security;” but what it really means is voter intimidation.
Organizations such as Fair Fight are working quickly to gather volunteers to ensure that every eligible voter can cast their ballot without harassment.
Educators can help protect voting rights by serving as volunteers and poll watchers, or helping to spread the word about vote by mail in states that have it. They can also get involved in elections through their association. For example, the Georgia Association of Educators helped send 18,386 messages to voters about the primary election, and aided 955 members in submitting absentee ballots.
Here are three ways you can help support voter access and strengthen student outcomes:
Become an Early Vote Educator
Members who sign up for NEA’s Early Vote Educator program will be trained with state-specific voting information, then challenged to reach out to 15 fellow members to discuss voting by mail. Voting by mail will be an essential way for millions of Americans to safely cast a ballot this fall as we weather the COVID-19 crisis. You can put your teaching expertise to work to make sure your family, friends, and neighbors know about vote-by-mail and other early voting options.
Reach out safely to your community
Campaign 2020 has gone digital! You can organize while social distancing. Download OutreachCircle and you’ll find NEA’s dashboard with a variety of actions you can take from the comfort and safety of your home. OutreachCircle is NEA’s new relational organizing platform that will enable us to campaign virtually. Actions are as simple as emailing and texting friends or fellow NEA members; sharing content on social media; or signing a petition. In order to make it effective — we need you to join today!
Serve as a poll worker
It is increasingly important to ensure that people running polling stations are from the community. Current and retired educators are able to help on Election Day to ensure that rules are respected.
3 responses to “Stacey Abrams agrees with educators: Public education is at stake in Election 2020”
Wilda Marks says:
It is disappointed to see how Donald Trump reply to the Coronavirus. He is trying to bypass the CDC so that the true numbers of cases and death will not be reported. Teachers in some areas are expected to go to schools in hot zone were the Coronavirus has taken over. These hot zones should not require teacher to go to school while the students are at home doing the school work. Why subject these teachers to this kind of treatment. If the students are going to be home schooled, then teachers should be home using the daily lesson plans to the students from very expensive computers to make sure the students are learning from the lesson taught to them day to day.
G. Dust says:
You are Spot on!!
And if Biden does not choose you, I will be writing him. In fact, I will write him now.
Tansey Sutton says:
Education is key | cc/2021-04/en_middle_0020.json.gz/line696 |
__label__wiki | 0.830962 | 0.830962 | Self Centered Girl Comic Strips - Page 13
184 Results for Self Centered Girl
View 121 - 130 results for self centered girl comic strips. Discover the best "Self Centered Girl" comics from Dilbert.com.
Tags #incredibly sexy, #fuzzy guy, #dogebrt, #dillbert, #in touch with feelings, #make me doubt, #scientific methid
Dogbert stands with the cute girl. Dilbert wears a jogging suit. The girls says, "Wow. you're an incredibly sexy man. It's too bad I met this little fuzzy guy first." The girls says, "But looks aren't everything. Studies show that women want a man who is in touch with his feelings." Dilbert raises his eye brows. Dilbert screams, "I hate my life!!" The girls says, "Gee. That's enough to make me doubt the scientific method."
Friday July 11, 1997
Tags #petting, #break up, #roxanne, #humans, #kind, #intelligent creatures, #freaks out, #until intimate
Roxanne, the cute girl, and Dogbert are sitting on the couch. Dogbert says, "As much as I like the petting, I still have to break up with you, Roxanne." Roxanne says, "Why?" Dogbert says, "Humans are kind intelligent, well-adjusted creatures, until you get to know them." Roxanne screams, "May the horned demons of Ixpah smite you like the last six!!!" Dogbert walks away and says, "This is what I'm talking about."
Tags #self employed, #invent valuable things, #exploit them, #resource, #bad input, #Dogbert
Dilbert and Dogbert sit at the kitchen table and enjoy a cup of coffee together. Dilbert says, "I'm thinking of quitting and working for myself." Dogbert says, "Come work for me." Dilbert says, "Doing what?" Dogbert says, "You'll invent things and I'll exploit you... I mean them." Dilbert says, "I'm not sure you'd be the best boss, Dogbert." Dogbert says, "Don't give me that input you 'resource.'"
Tags #alice, #artificial, #band, #creatures, #Dogbert, #dominant, #dominants, #engineers, #envelopes, #females, #gray, #groom, #mist, #native, #note, #the boss, #vegetation
Dogbert's journal entry says, "A small band of the creatures were known to live high in an artificial structure." The panel shows an office building. Dogbert's journal says, "On my way to study them I took note of the native vegetation." Dogbert stands in an office wearing a backpack. He feels a potted plant and thinks, "Rented." His journal says, "The younger males were at play. They became self-conscious when watched." Dogbert watches a man playing computer games. Dogbert's journal says, "The dominant male had a gray back. He controlled the others by waving little envelopes." The Boss waves paychecks at the employees and they bow to him. Dogbert's journal says, "There were few females in the group. The less dominant males had no chance of mating." Dilbert and Wally watch a woman walk past them. Dogbert's journal syas, "Unlike other species they head no instinct for grooming." A man asks, "Want to groom?" Wally replies, "Drop dead." The journal says, "My time was up, but I will miss them, those . . ." Dogbert walks toward the elevator. The journal concludes, "Engineers in the mist." Wally asks Dilbert, "How long are you supposed to microwave popcorn?"
Tags #Dilbert, #Dogbert, #dating, #intimidation
Dilbert bends over tying his shoelace. He tells Dogbert, "Maybe I'm unlucky in love because I'm so knowledgeable about science that I intimidate people." Dilbert continues, "Their intimiidation becomes low self-esteem, then they reject me to protect their egos." Dogbert says, "Occam's razor." They walk through the park. Dilbert asks, "What is 'Occam's razor'?" Dogbert answers, "A guy named Occam had a rule about the world." Dogbert continues, "Basically, he said that when there are multiple explanations for something, the simplest explanation is usually correct." They sit down on some rocks. Dogbert continues, "The simplest explanation for your poor love life is that you're immensely unattractive." Dilbert says, "Maybe Occam had another rule that specifically exempted this situation, but his house burned down with all his notes. Then he forgot." Dogbert says, "Occam's razor." Dilbert asks, "I'm an idiot?" Dogbert replies, "I don't think we can rule it out at this point."
Saturday July 04, 1998
Tags #socially defective, #unique preferences, #arguments, #dating, #girl, #dilbert defending himself, #relationships
Dilbert and woman walking wearing coats. Woman says, "I don't understand why you like the things you like." Woman continues, "I'm forced to conclude that you're socially defective." Woman and Dilbert walking over cobblestone bridge. Dilbert says, "Isn't it normal for people to have unique preferences?" Woman responds, "Do you have to argue with EVERYTHING I say?!"
Tags #cute dog, #dilbert attacks girl, #dilbert exercises, #flirt, #mean, #runs away, #tease, #the word no
"Pssst" "You're probably noticing how soft and cute I am." "Awww! You're adorable! Let me give you a little pat on the head." "I couldn't. I'm too shy." "Shy? That is just so cute. I have to pet you now." "Come here, you little tease! You know you like it!" "Don't you understand the word 'no'?!" "I could do this all day long." "How about the red-head?"
Tags #input, #fist of death, #corporate culture, #find cause, #caused by managers, #culture problem
The Boss says, "Alice, I'd like your input on something." Alice thinks, "Uh-oh . . . My intuition is activating the fist of death. Must . . . Control . . ." They sit at a conference table and the Boss says, "Our corporate culture is bad." The Boss continues, "I'm trying to find the cause." Alice replies, "Well, obviously the problem isn't caused by managers who have no self-awareness . . . So what could it be?" Alice continues, "The culture problem must be coming from the other direction. Some EMPLOYEE must be causing this problem!" Alice continues, "I think it's the guy in the mail room. His bad culture is infecting the rest of us." The Boss stands in the mail room. A man says, "If this is about that conference room full of mail, I don't know how it got there."
Tags #use art, #find self, #over there, #ratbert, #bad painting, #without using art, #bob, #dinosaur
Ratbert wears a Beret and paints. Ratbert says, to Bob, "I use art as a way of finding myself." Bob says, "you're over there, Ratbert, in front of a bad painting!" Bob walks away and thinks, "And I did it without using any art."
Tags #knew you were rebel, #cool rebels, #stop talking, #threats, #argue, #bathrobe to work
The girl with several piercing holds Dilbert's arm and says, "When I saw you wear a bathrobe to work, I knew you were a rebel." The girl says, "From now on, when you come upon a group of us cool rebels, we won't suddenly stop talking." Dilbert and the girl walk up to two heavily pierced men. One of the pierced rebel men says, "But if I'M right and yellow IS a flavor, I get to hammer a nail into YOUR skull." | cc/2021-04/en_middle_0020.json.gz/line697 |
__label__cc | 0.586913 | 0.413087 | Falklands exempt from UK requirements for pre departure coronavirus testing
Biden plans a US$ 1,9 trillion economic rescue package to spur the economy and fight the pandemic
Delays in launching an inoculation program in Brazil, threatens the economic recovery
Piñera and Chilean First Lady under “preventive quarantine”
Wednesday, January 13th 2021 - 07:35 UTC
Full article 0 comments
A person who works at the home of the president tested positive, thus the two will nevertheless quarantine for 14 days starting Tuesday as a preventive measure
Chilean President Sebastian Piñera and his wife Cecilia Morel are to begin “preventive quarantine” after coming into close contact with a person later diagnosed to have COVID-19, the president's press office said on Tuesday.
Both Piñera and the first lady tested negative for COVID-19, according to the statement.
The two will nevertheless quarantine for 14 days starting Tuesday as a preventive measure, and work remotely, said his office.
The person who tested positive works at the home of the president and his wife.
The Ministry of Health reported as many as 3,238 new daily cases of COVID-19 infection on Tuesday, bringing the total caseload to 649,135 since the start of the pandemic here in February, and 20 more fatalities, raising the death toll to 17,182.
Categories: Health & Science, Politics, Chile.
Tags: Cecilia Morel, COVID-19, Sebastián Piñera.
No comments for this story
Please log in or register (it’s free!) to comment. Login with Facebook | cc/2021-04/en_middle_0020.json.gz/line706 |
__label__wiki | 0.73294 | 0.73294 | Werner Schwab (4 February 1958 – 1 January 1994) was an Austrian playwright and visual artist.
2 Work
3 Awards and honors
4.1 Plays
4.2 Novel
4.3 Books by Werner Schwab
From 1978 to 1982 he studied sculpture at the Akademie der bildenden Künste in Vienna. During the 1980s he worked as a sculptor and woodcutter.
Schwab was a heavy drinker who was said to have written his plays late at night while listening to loud music (particularly the band Einstürzende Neubauten, whom he was friends with). His body was found on New Year's Day 1994.
Schwab's first play Die Präsidentinnen (sometimes translates as First Ladies[1] or Holy mothers), was produced at the Theater im Künstlerhaus in Vienna in 1990. Between then and his death four years later he wrote sixteen plays, eight of which were produced during his lifetime, making his career one of the briefest, most spectacular and most controversial in contemporary German-language theatre.
Schwab's work is close to the grotesque genre. It extensively employed scatology and sex, with the peculiarity of exhibiting pulsions and taboos in a poetic framework.[2] He renewed the tradition of German Expressionism.[2] His plays are full of images of surreal violence and degradation, and are firmly grounded within a native Austrian tradition of Black comedy. Schwab conceived theater as anti-bourgeois.[3]
He made use of textual collages and intertextuality.[4] His 1995 play Troilluswahn und Cressidatheater is a rewriting of Shakespeare's Troilus and Cressida into the grotesque genre.[5]
Another characteristic of his texts is to exploit the German language's capacity for neologism to a remarkable degree. He is very difficult to translate, but amongst English-language dramatists, certain stylistic parallels might be drawn between his work and that of Steven Berkoff and Enda Walsh. Vera San Payo de Lemos won the Austrian Prize for Literary Translation in 1998 and 2002 for her work in translating his work.[6]
Awards and honors[edit]
1992 Mülheimer Dramatikerpreis
Plays[edit]
Die Präsidentinnen. 1990.
Übergewicht, unwichtig: Unform. Ein europäisches Abendmahl. 1991.
Volksvernichtung oder meine Leber ist sinnlos. 1991.
Mein Hundemund. 1992.
Mesalliance, aber wir ficken uns prächtig. 1992.[7]
Der Himmel mein Lieb meine sterbende Beute. 1992.
Offene Gruben und offene Fenster. Ein Fall von Ersprechen. 1992.
Pornogeographie. Sieben Gerüchte. 1993.
Endlich tot, endlich keine Luft mehr. 1994.
Mariedl/Antiklima(x). 1994.
Faust:: Mein Brustkorb: Mein Helm. 1994.
Troilluswahn und Cressidatheater. 1995.
Eskalation ordinär. Ein Schwitzkastenschwank in sieben Affekten. 1995.
Novel[edit]
Joe Mc Vie alias Josef Thierschädl. 1988 (first published 2007).
Books by Werner Schwab[edit]
Fäkaliendramen. (Droschl, 1991) ISBN 3-85420-221-0
Königskomödien. (Droschl, 1992) ISBN 3-85420-289-X
Dramen III. (Droschl, 1994) ISBN 3-85420-391-8
Holy Mothers, translation by Meredith Oakes of Die Präsidentinnen (Oberon, 1999) ISBN 1-84002-113-6
An Anthology of Plays, translated by Michael Mitchell (Ariadne Press, 1999) ISBN 1-57241-064-7
People Annihilation or my Liver is Sick, translated by Michael Roloff [Ariadne Press] U.S. Premiere, Chicago, Trap Door Theatre, 2005
Ulm Sanford, Gerlinde, Afterword to Schwab, An Anthology of Plays (Ariadne, 1999)
^ FIRST LADIES by Werner Schwab at the Matchbox Theatre
^ a b Jolly, Geneviève L'obscénité et la scène : le théâtre de Werner Schwab
^ Gisela Holfter, Marieke Krajenbrink, Edward Moxon-Browne Beziehungen und Identitäten: Österreich, Irland und die Schweiz p.232
^ Wagner, Meike (2008) Performing the Matrix. Mediating Cultural Performances p.91
^ A. J. Hoenselaars (2004) Shakespeare and the language of translation p.157
^ "VERA SAN PAYO DE LEMOS". Artistas Unidos (in Portuguese). 2010-10-16. Retrieved 2020-12-31.
^ Steirische Gesellschaft für Kulturpolitik
Critical essay on Werner Schwab
Bibliography and brief biography (in German)
Retrieved from "https://en.wikipedia.org/w/index.php?title=Werner_Schwab&oldid=997414303"
Austrian male dramatists and playwrights
Academy of Fine Arts Vienna alumni
20th-century Austrian dramatists and playwrights
20th-century Austrian male writers
CS1 Portuguese-language sources (pt)
Wikipedia articles with ICCU identifiers
Wikipedia articles with RKDartists identifiers
Wikipedia articles with SELIBR identifiers | cc/2021-04/en_middle_0020.json.gz/line708 |
__label__wiki | 0.933701 | 0.933701 | Northern Coalfields gets green nod for Rs 741 crore mine expansion in Uttar Pradesh
NCL is facing increasing demand of coal from industry and power sector. Augmentation of coal production will help NCL to bridge the demand-supply gap.
February 17, 2017, 08:01 IST
NEW DELHI: Northern Coalfields Ltd (NCL) has received green clearance for the Rs 741.62 crore coal mining expansion project in Sonebhadra district in Uttar Pradesh.
The subsidiary of Coal India Ltd wants to expand its Krishnashila open cast mine (OCP) for increasing production from 5 million tonnes per annum to 6.25 MTPA.
"Based on the recommendations of the Expert Advisory Committee, the Environment Ministry has granted the environmental clearance (EC) for the expansion of Krishnashila OCP in UP," a senior government official said.
The total cost of the project is estimated to be Rs 741.62 crore. The EC to the project has been given subject to certain conditions, the official said.
Among the conditions specified, NCL has been asked to spend at least 2 per cent of the average net profit during the three immediately preceding financial years, in pursuance of its Corporate Social Responsibility Policy (CSR).
The EC is subject to obtaining NBWL (National Board of Wildlife) clearance and the company should obtain consent to establish and consent to operate from the concerned state pollution board prior to commencement of mining operations and effectively implement all the conditions stipulated.
In the proposal, the company said it has a mine lease area of about 851.78 hectare with coal reserves of 99.12 million tonnes. Approximately 72.94 million tonnes of mineable coal reserve are left to be mined. The company will not change its technology as well as backfilling and land reclamation plan.
The company has linkage of coal with Hindalco Industries as well as Basket Linkage.
National Board of Wildlife
Hindalco Industries
Coal India Ltd
Most Read in Coal
Coal India revises up FY21 capex by 30 pc to Rs 13,000 cr
Next tranche of commercial mining auction to be launched this month: Coal Minister
Amit Shah to launch 'Single Window Clearance System' for coal mines
CIL board approves venturing into aluminium, solar sectors
JSPL bags Gare Palma coal mine block in Chhattisgarh
Coal India to invest Rs 3,370 crores in ramping up rail evacuation facilities | cc/2021-04/en_middle_0020.json.gz/line709 |
__label__wiki | 0.592609 | 0.592609 | One in four dogs at top show Crufts found to be overweight
A dog waits to take part in Britain's annual Crufts dog show at the NEC Arena in Birmingham, England, Thursday, March 10, 2011. (File Photo: AP)
By Ben Hirschler Reuters, London Tuesday 14 July 2015
A quarter of dogs competing in the world's biggest dog show are overweight, scientists said on Monday.
An analysis of canines at Britain's Crufts show - held annually since the reign of Queen Victoria - found 74 percent were in ideal condition but 26 percent were overweight.
None of the animals studied were underweight, researchers from the University of Liverpool reported in the journal Veterinary Record.
The team reached their conclusions after studying 1,000 images of 28 dog breeds placed between first and fifth in their class during competitions from 2001 to 2013.
The issue was most pronounced in certain breeds, with 80 percent of pugs, 68 percent of Basset hounds and 63 percent of Labradors proving excessively fat.
While obesity at Crufts is still less common than in the general pet population, researcher Alex German said the proportion of overweight animals was a concern because show dogs were assumed to be perfect specimens of their breed.
Obesity causes significant health problems in dogs, including arthritis and diabetes.
Last Update: Wednesday, 20 May 2020 KSA 09:48 - GMT 06:48
Service dog throws self in bus’ path to protect blind owner
From tiny cages to lots of love, Thai dogs find homes in U.S.
Dogs by the hour: Japan offers pet rental service
‘Dogs can distinguish between happy and angry faces’ - Study | cc/2021-04/en_middle_0020.json.gz/line710 |
__label__cc | 0.550871 | 0.449129 | Hungary: Journalists quit top news website over government’s interference
By Europe Times July 25, 2020 No comment
As many as seventy journalist working for one of the top news websites in Hungary has filed their resignation, as they have found it hard to cope with the excessive interference of the government in the internal matters of the organisation.
Index is known for its independent working style. The said quality keeps it special from the rest.
Szabolcs Dull, the Editor in Chief of the organisation, was fired on Tuesday. It was the triggering point of the present crisis.
Those who have filed their resignation alleges that the sacking was a clear interference and an attempt to apply pressure on the website.
Shortly after the team of journalists have announced their decision, many have come out openly in support of the team, expressing their disagreement towards the excessive interference of the government in the matters concerning the freedom of press.
Since the induction of a nationalist government in Hungary, the country performs badly in the index of press freedom.
Photo Courtesy: Google/ images are subject to copyright
Tags: Europe Times Freedom Of Press Journalist
German nightclub case: Around ten refugees found guilty
Ryanair services remain unaffected despite travel restrictions
Brexit: May asks for an extension to 30th June
By Europe Times April 6, 2019
Protest organised in Berlin against Covid-19 restrictions
By Europe Times August 3, 2020
Protesters rally against anti-Semitism in France
By Europe Times February 20, 2019 | cc/2021-04/en_middle_0020.json.gz/line711 |
__label__cc | 0.566785 | 0.433215 | Shappi Khorsandi: Skittish Warrior, Confessions of a Club Comic
Aug 4-10, 2019 , 1:30 PM
The Stand Comedy Club & Edinburgh Festival Fringe
Movies and Performing Arts
The Stand Comedy Club, 5 York Place, Edinburgh, EH1 3EB, United Kingdom
To Find Out about Any Early Bird or Special Iranian Ticket Prices, Please Mention Kodoom when Calling.
Shappi Khorsandi: Skittish Warrior...Confessions of a Club Comic
Comedian, author and - most recently - idiot who agreed to be tortured on 'I'm A Celebrity Get Me Out Of Here!', Shappi is a woman of many parts. But live comedy is where she's in her element, and now she returns to the embracing arms of the Edinburgh Festival Fringe.
A brand new show packed full of sharp-tongued gags and cultural observation, this is Shappi's warts-and-all journey of the 90s comedy scene, breaking through on telly and letting it all slip away.
12+ above
Yahoo! News - Six hours ago
Yahoo! News - Ten hours ago
Nine hours ago
Yahoo! News - One hour ago
Yahoo! News - Four hours ago
Some who stormed the Capitol, including a ... | cc/2021-04/en_middle_0020.json.gz/line712 |
__label__wiki | 0.650806 | 0.650806 | Celebrity News October 15, 2013
Does Leonardo DiCaprio Have a New Model Girlfriend?
Model Kat Torres confirmed that she is indeed dating Leonardo DiCaprio.
Speaking to a Brazilian newspaper called Extra, Torres admitted the two were seeing each other, but refused to elaborate about the relationship because she promised DiCaprio she wouldn't speak about it.
The 24-year-old said, "I worry about what he will think about me talking to you. We have a pact that nothing can ever be said about our relationship."
She added, "In Europe it is different. People see us together in many places so they do not need to ask us about anything. He doesn't like being photographed and barely goes out walking once people have realized it's him."
Torres, whose real name is Katiuscia Torres Soares, said she and the 38-year-old actor met at the Cannes Film Festival and hit it off right away. "Leo is amazing,” she gushed.
DiCaprio previously dated supermodels Gisele Bundchen and Bar Refaeli.
#CouplesNews #LeonardoDicaprio #TopStories #TrendingStories | cc/2021-04/en_middle_0020.json.gz/line727 |
__label__wiki | 0.871438 | 0.871438 | Have it Your Way
Digital Library > Defining and Serving a Market > Customization"Have it Your Way"
When customers create the products they want, companies get what they need.
"Mass customization" may sound like an oxymoron, but it's actually an emerging business model — one that's getting a lot more attention.
In a nutshell, mass customization takes place when companies offer individually tailored products or services on a large scale. For example:
Dell Computer Corp. allows customers to configure their own computer on the Web, specifying everything from microprocessor speed right down to the mouse.
At selected Levi Strauss stores, consumers can build a pair of jeans from scratch, selecting from different patterns, fabrics, leg widths and fly styles.
At Reflect.com, a Proctor & Gamble venture, women can formulate their own cosmetics, fragrance, skin-care and hair-care products.
Though still in its early stages, mass customization will be as important to the 21st century as mass production was to the 20th century, experts predict.
Why all the fuss? For one thing, mass customization can help manufacturers lower production costs. Because mass customization is a demand chain rather than a supply chain, companies have no inventory of finished goods and no wasted resources. More choices translate into more value for buyers, enabling companies to win new customers and keep current ones.
Mass customization also promotes closer ties. "There are no middlemen in terms of salespeople or retailers between our consumers and us," says Dave Ward, founder of Customatix.com, a Santa Cruz, Calif., footwear manufacturer. "Mass customization allows us to be involved in a very personal dialogue with our consumers, where they tell us exactly what they want — as opposed to building products we think they want."
What it is, what it isn't
As with any emerging business model, definitions get a bit blurry. Mass customization differs from traditional craftsmanship in three ways:
Speed. Custom orders typically involve long waiting periods; however, mass customizers rely on flexible operating processes to guarantee quick delivery. (Mass customization is also faster than build-to-order, which typically involves complex products like automobiles; it's a special type of build-to-order.)
Volume. Although a mass customizer may be filling small orders — often lot sizes of one — total production is on a large scale. That's why your local barber isn't practicing mass customization; he may provide you with a unique service, but he can only cut so many heads of hair. Mass customization involves not just personalization, but also mass volume — production or delivery must be scalable.
Price. Custom products have always been available, but at a premium. In contrast, mass customization is affordable. Products may cost slightly more than mass-produced ones, but they don't fall into the luxury realm.
Mass customization should not be confused with "variety," which implies that production has been conducted in advance of orders. In some cases, mass customization may require subtracting (instead of adding) features that buyers don't want to pay for.
The great enabler
The idea of mass customization has been around for some time. Yet technology is the reason why mass customization is blossoming now. Our computerized world allows custom production and mass production to come together. Anything that can be digitized can be customized, say experts.
In particular, the Internet provides some critical infrastructure. "The Web allows you to bundle orders together and download them to a manufacturing facility for production," says Ward of Customatix. "It's also the perfect tool to talk to consumers on an individual basis and to let them design their own products."
Case in point: Timbuk2, a San Francisco bag manufacturer, had been offering customization to consumers through brick-and-mortar stores, but retail distributors didn't really push the program. So in October 2000, Timbuk2 launched a Web site that enabled consumers to design bags online.
That proved to be a real boon in early 2001, when the economy dipped and sales from Timbuk2's other two units (retail sales and corporate gifts) dropped substantially. Without its e-commerce component, the company's bottom line probably would have been down 50% for the first half of 2001, says Jordan Reiss, Timbuk2's vice president. Yet B-to-C customization offset those losses.
Going direct to customers also helps Timbuk2 constantly innovate. For example, after getting dozens of e-mails from laptop-computer owners complaining that no sleeve fit Apple's Titanium G4, Timbuk2 created a new sleeve that has been a bestseller. "Before, getting feedback was tough," says Reiss. "When you distribute in retail stores, there's always a barrier between you and the consumer — even if you have a good relationship with the retailer."
Three challenges
Mass customization should not be pursued lightly. Duke University's Paul Zipkin identifies three key components, each of which can present different obstacles, depending on the particular product:
Elicitation: finding out what the buyer wants or needs. The Internet may enable companies to conduct a one-on-one dialogue with customers, but determining their preferences isn't as easy as it sounds. Companies with complex levels of personalization often require a configurator (expensive software that illustrates what the end product will look like).
And some essential information simply can't be gleaned online. Take Dean Sparkman, founder of Meridian Golf in Golden Valley, Minn., who spent three years and $1 million to develop a computer-driven measurement system that enables him to manufacture customized golf clubs.
Meridian's fitting process takes about 90 minutes and requires customers to visit one of its retail locations, where customers swing a club on a special platform. Meridian's computer system, embedded in the floor, measures 14 dimensions such as speed, loading, path, plane and face angle at impact.
Flexible processes: translating information into a physical product. To make product quickly in small batches, manufacturers typically must adopt "flow-production" techniques. "Much of the difference [from mass production] depends on the beginning stages — how you process orders, how you stock materials," says Ward. It's critical to have a reliable network of suppliers and partners who can work on short lead times. Customatix uses a stand-alone manufacturing facility in China, owned by one of its investors, to turn around product in two days.
Logistical aspects: getting product to the right customer. When Ward launched Customatix, he thought the greatest problems would be operational ones. "Yet our real challenge was on the marketing side," says Ward. "We underestimated the challenge of building a brand on the Internet."
People want to touch and feel the product, explains Ward: "If you're already a major brand, you have a certain following. Yet consumers don't know who Customatix is or the quality of our product, so it's not easy to get them to hit that buy button."
To broaden distribution, Customatix launched two other business units last year: a corporate-logo segment and a licensing unit for college and sports logos. "Setting up multiple distribution channels is the key to maximizing revenues in the short term until the brand becomes strong enough to drive significant volume for the Internet-based custom business," says Ward.
Although the consumer won't alter the licensed product, Ward deems it mass customization from an operational standpoint: "The manufacturing and logistics infrastructure that we use for custom products will enable us to handle the hundreds of different school and team logos, graphics and trademarks in an efficient manner — which is why no one has been successful until now in licensed footwear products."
Owning your customers
Despite challenges, mass customization can help small companies stand out of the crowd. "You can't use traditional methods of growing your business," says Sparkman of Meridian Golf.
One size doesn't fit all, stresses Sparkman: "We don't say that Callaway doesn't make good golf clubs, but they make them for one mythical person. We make golf clubs in 1,100 different combinations."
Catering to individuals instead of masses has paid off, and Meridian Golf boasts a 99.5% customer satisfaction rate. What's more, revenues are on a roll: Meridian Golf generated $1 million in sales last year, and Sparkman expects the company to hit $2 million this year.
"Our customers are our disciples," he adds. "When you have a one-to-one relationship with them, not only do they come back — they'll send you more business."
Writer: TJ Becker
Writing and Distributing a Press Release
Launching a PR Campaign
Getting the Most from Your Print Advertising Dollar
Taking the Overseas Plunge: How to Make Exporting Pay Off
Acquiring and Managing Finances
Articles in our Entrepreneur’s Resource Center appeared in print and online newsletters published previously by the foundation. More than 1,000 articles can be found in the categories below, addressing timeless challenges faced by entrepreneurs of all types.
‹ Growth Companies that Place Highest Value on Competitor Information Are Most Successful High-Flying Culture › | cc/2021-04/en_middle_0020.json.gz/line735 |
__label__wiki | 0.796755 | 0.796755 | Chicago schools reopening amid COVID: The latest
Leave a Comment / Education / By ekiensnews
Welcome to our blog about Chicago’s school reopening. Prekindergarten and special education “cluster” teachers returned to campuses Monday, while about 1 in 3 students are expected to return Jan. 11. The bulk of the district’s returning 77,000 students are supposed to return Feb. 1. Chicago has not set a date for high school students to return.
Here’s the latest.
Tuesday, Jan 5. 6:30 a.m.
In a first joint appearance of the two groups, Troy LaRaviere, the head of the Chicago Principals & Administrators Association, joined a morning press call with Chicago Teachers Union leadership to critique the city’s reopening plan. He urged school district leadership to consult principals before moving forward.
“We’re the ones who have to implement the plan,” said LaRaviere, a former principal. “Ask any hospital administration who has been successful at keeping doors open safely, they’ll tell you they brought in anyone involved,” from administrators to custodians.
A Monday survey by the association of 300 principals and assistant principals, a fraction of its larger membership, showed that 22% of respondents said they had the staff they needed to reopen safely” and 17% said reopening in January and February was the right decision, with 64% saying the district timing was wrong; 19% of survey respondents did not answer that question.
LaRaviere said his membership wants to see joint bargaining between the district, its principals, and its teachers; a differentiated return timeline based on school readiness; a pool of cadre substitutes and staff dedicated to each school to fill absences and help with administrative tasks; and a public metrics threshold for when schools should be opened or closed. They also want a reconsideration of simultaneous instruction — when the district asks educators to teach remotely and in-person at the same time, similar to the city’s Catholic schools.
Anecdotally, principals’ reactions were mixed, he said. “Principals are not a monolith,” said LaRaviere. “For the most part, you have a big group of folks in the middle who are very frustrated and upset but not quite frustrated or upset enough to risk their employment.”
In the joint call, Chicago Teachers Union President Jesse Sharkey said that during a Monday evening call of 2,400 pre-K and special education cluster teachers who were asked to report back to work that day, 49% said they did not report to buildings. The district has not yet said how many teachers reported to work Monday. | cc/2021-04/en_middle_0020.json.gz/line737 |
__label__wiki | 0.81736 | 0.81736 | Home >> Blogs >> Editor's blog >> Tromso Festival opens the European Fest season
Tromso Festival opens the European Fest season
TROMSO FESTIVAL IS THE CURTAIN RAISER OF THE EUROPEAN FILMFEST SEASON --
The Tromso film festival, located in extreme Northern Norway, precisely six degrees above the Arctic Circle, is not only the Northernmost accredited film festival in the world, but also the first international film festival on the annual Europen calendar, preceding Gotteburg and Rotterdam which come later in the month. This will be the fifteenth installment of this unusual midwinter film fest under the Northern Lights and promises to be the biggest one ever.
Tromso runs from January 18 until January 23. The odd thing is that the opening ceremony and opening film were held on the second night of the festival (Wednesday) and the closer will be on Saturday night, although the screenings continue for another full day. The big name guest this year is England's Mike Leigh whose latest film, "Vera Drake" has gathered much attention and a probable Oscar Nomination for lead actress Imelda Staunton. Martha Otte, fest topper, and her staff have put together a program of 67 feature films carefully culled from other European festivals of 2004 as well as a robust slate of new films from Scandinavia, especially Norway and Sweden.
The basic thrust of this festival is to introduce primarily non-mainstream films to Norwegian distributors in the hopes that some of these titles will be picked up for commercial distribution. Hence, on the professional side there is a large contingent of reps from every Norwegian film distribution company comprising a kind of far-northern niche film market. Aside from the big multi-nationals one small company here is ARTHAUS Films which, as the name clearly states, specializes in smaller art house type fare. ARTHAUS has a tidy fifteen titles in the feature program including "Turtles Can Fly", the Kurdish-Iranian film which took the best film prize at San Sebastian in September, as well as the Argentine crowd-please "Bombon The Dog", critics prize, also at San Sebastian. Other Arthaus offerings; a new print of the classic Hollywood musical "Singing in the Rain", two Asian animation features, "The Cat Returns" from Japan and "Wonderful Days" from Korea, and "Against The Wall", the Turkish-German surprise Golden Bear winner at Berlin last year.
The festival opener was the World Premiere of "An Enemy of the People", a very strong update of the famous Henrik Ibsen play of 1882 to contemporary Norway. Director Erik Skjoldbjerg, (born 1964) being a native of Tromso is a "home town boy", and his film received a lengthy standing ovation from the hometown crowd. Although this is an oft-performed Norwegian stage classic, surprisingly it has never been filmed in Norway before, and, in fact, the only previous screen version was an English language adaptation starring and produced by Steve McQueen (!) in 1978, a scant two years before the actor’s untimely death at age fifty.
The project was clearly intended by Mr. McQueen to prove to the world that he was more than just an action star – i.e., a real actor. For better or for worse, the money masters behind the film (in an ironically Ibsenesque turn) decided that the public would never accept a Steve McQueen without a shotgun in hand or not behind the wheel of a hot car. Consequently, the film itself also died a quick death, was never released commercially and went straight to video oblivion.
Whatever the qualities of the McQueen “Enemy of the People” (which, incidentally, co-starred the excellent Swedish actress and Bergman regular, Bibi Anderson) the film is now basically a forgotten Hollywood footnote. However, the new Norwegian edition (distributed by Columbia TriStar Nordisk), is a tense, handsomely mounted drama, unusually well-acted and directed, with obvious resonances of business interests having no qualms about poisoning people or the environment -- that could travel well outside of Scandinavia if properly handled. And it doesn’t matter if you know nothing about the original Ibsen play because the issues ( the truth being squelched to save jobs, even if the town will literally die out because of the polluted water they are producing) are even more contemporary today than they were 120 tears ago in Ibsen’s time.
Jorgen Langhelle, as the peoples’ enemy, Thomas Stockman --determined to tell the truth even if it ruins his life and destroys his family -- is particularly impressive in the original McQueen role. Sven Nordin (known in Norway for comic roles on television) is also finely evil as the insufferable brother behind the cover up, and Trine Wiggen, a stage actress appearing in her first major screen role, is quite unforgettable (and strikingly beautiful) as the anti-hero’s wife. The film has received only fair-to-middling reviews by norsk critics (“four stars out of six”) but will probably do better with foreign audiences reading the sub-titles and unaware of certain dialectal deficiencies which bothered some people here. (But, who was bothered by Clark Gable minus southern Accent?) In any case, I found this film to be a worthy festival opener and a gripping film experience. Another selling point – the incredible scenery along the west Norwegian Fjords – often seen in Norwegian films, but never before more dramatically lensed – a fantastically beautiful backdrop to the fantastically sordid story unraveling in the foreground.
by Alex DeLeon
Cat. : Alex Deleon An Enemy of the People An Enemy of the People ARTHAUS Films Berlin Bibi Anderson Bombon the Dog Clark Gable Entertainment Entertainment Erik Skjoldbjerg Europe Gotteburg Henrik Ibsen Henrik Ibsen Human Interest Human Interest Imelda Staunton Japan Jørgen Langhelle Korea Martha Otte Mike Leigh Norway Norway Oscar Rotterdam Scandinavia Singing in the Rain Steve McQueen Steve McQueen Sven Nordin Sweden The Cat Returns The Dog", critics prize the Northernmost accredited film festival The Tromso film festival Thomas Stockman TURTLES CAN FLY Vera Drake | cc/2021-04/en_middle_0020.json.gz/line740 |
__label__cc | 0.728647 | 0.271353 | FlatbreadGarden
A baking and gardening journal. Mostly.
GNOIF
Bread Basics
The Least Exciting Play in Football
AJ Football, NFL, Sports March 6, 2014
By Blaidd Drwg
The extra point try is probably the most useless scoring play in professional football. Heck, as a stat, it ranks up there with the save in baseball as the least useful measure of a player’s ability. Kickers have gotten so good at it that there were exactly 5 misses in 1267 attempts last year (seriously, those are the numbers). That translates into a 99.61% success rate. Nobody watches the PAT thinking, “I think we are gonna block this one.” Heck, most teams don’t even put in an effort to block it, which is why you have a whopping 5 unsuccessful attempts last season. How much better have kickers gotten on the PAT? In 1993, the success rate was 96.8%. In 1983 it was 95.2%. In 1973, it was 96.8%. In 1963, it was 95%. You get the idea. It has never exactly been a tough kick, but at least historically there was about a 5% chance of missing it; not so much anymore.
The NFL is toying with the idea of changing how the PAT works. The latest proposal is to move the attempt from the 2 yard line back to the 25, which would make it essentially a 42-43 yard FG attempt. I looked at the success rate for FGs over 40 yards last season and that was only about 83%, so moving the kick back 20 yards will make a difference and probably make the play more exciting.
Kickers however, aren’t so convinced. From espn.com:
Adam Vinatieri: “I don’t understand the logic: Will it make the game safer for people by moving the extra point back to a 43-yarder?” Vinatieri said. “If anything, players are going to rush harder because they’re thinking, ‘That far of a field goal-type try, we have to go after blocking it more.’
Justin Tucker: “People are trying to phase kickers out of the game. That’s as blunt as I can be about it,”
Jay Feely: “You don’t penalize a baseball closer for being great, you celebrate that,” Feely, 37, told USA Today. “You should do the same thing with kickers. If you’re going to change the extra point rule, I’d rather see you change it and still have it as part of the game than eliminate it.”
I don’t see this as tying to phase kickers out of the game, it is more like the NBA changing the 3 point line and lane rules. I personally would love to see them just eliminate the PAT kick and only allow a conversion try if a team wants to go for 2. It would probably chop several minutes off the unbearably long snooze fest that I most NFL games. It might make me more likely to pay a bit more attention to the game if they weren’t mostly just guys standing around doing nothing for long stretches between plays.
extra point
Previous Post The Lighting Rig
Next Post Beer of the Week: Laughing Dog De Achtste Hond
2 thoughts on “The Least Exciting Play in Football”
I see it as an attempt to introduce a bit more randomness in the scores. (I wonder if there is a rise in 2-point conversion attempts concomitant with the increase in accuracy of the 1-point kick.) I can’t see that anyone “has it out” for kickers, per se, but if as the stats suggest it’s just pro forma, then let’s shake it up a bit so it’s just not so bloody easy. For them, that is…not for me.
Blaidd Drwg says:
Kickers don’t get paid because they convert all of their extra points – they get paid because of FG accuracy. Kickers have been released for missing non-critical extra points. I would think that if anything, kickers would love the idea of either eliminating the kick or moving it back since it would put more value on accuracy on longer kicks, which is where they make their money.
Categories Select Category All Star Game Arcades Asst Doughs Athlete in Retrospect Basketball Beef Beer Beer of the Week Breads Breakfast Cleveland Browns Cougars Football EarthBox Events Favorite Cookbooks Fish Food Food Humor Football Gambling Gambling Gambling Games Gardening GNOIF Hockey Huskies Basketball Huskies Football Manchester United Mariners MILB MLB MLS NBA NCAA Basketball NCAA Football NCAA Tournament NFL NFL Draft Pasta & Rice Pizza & Flatbreads Pork Poultry Recipes Recommended Reviews Seahawks Side Dishes Soccer Sounders Sports Stuff You Should Have In Your Pantry Sweet Stuff TV Uncategorized Vegetables World Cup
Follow FlatbreadGarden on WordPress.com | cc/2021-04/en_middle_0020.json.gz/line743 |
__label__cc | 0.633887 | 0.366113 | Divorce, dissolution or separation financial arrangements
Following the decision to end your relationship, the prospect of dividing joint finances and assets can be extremely daunting. However, reaching a fair and acceptable financial agreement is key to protecting your interests and allowing you both to continue with your lives.
Regardless of the complexity of your financial situation, we use our knowledge and expertise to tailor our advice, taking into consideration all of your personal, family and, where appropriate, business needs.
Through efficient negotiation methods, we look to cost-effectively resolve your financial arrangement issues, reaching a mutual agreement wherever possible. We will keep you updated throughout and work closely with you to ensure that you fully understand every decision you make.
Although it is not always necessary to go to court, if court proceedings are required, our family solicitors will adopt a robust approach to achieve a favourable result in as little time as possible.
If you have already been able to reach an agreement directly, we will ensure that it is correctly documented to protect you against any possible future claims and, where necessary, we work closely with expert legal counsel and leading professionals including accountants, actuaries and financial advisers.
We provide financial settlement advice to a wide range of individuals, with particular expertise in cases involving partnerships, limited companies, pensions, overseas assets and trust interests.
Our family solicitors have considerable experience and an enviable national reputation for dealing with complex, high-value financial settlements, with a number of members of the team also being recommended by leading legal directories for their family law work.
Additionally, we regularly advise on cases involving inheritance and pre and post-marital accrual. We also have experience in cases where there is material non-disclosure, including hidden assets.
As well as acting for individuals directly involved in a separation, our team also has experience in successfully representing interveners and third parties who have an interest in property or assets being considered by the Family Court.
“Kirpal Bidmead heads the team and is an outstanding children solicitor. She manages expectations with a calmness that inspires absolute confidence in her.”
“Words cannot express how much help and support Kirpal has been to me over the last five years. I just wished I had approached her and Flint Bishop when I first needed the advice and representation, not coming to you so many years later when things went awry. Kirpal has been truly wonderful and I thank her from the bottom of my heart.”
Mark from Australia
“Kirpal Bidmead specialises in protecting the interests of high net worth clients handling cases involving complex financial issues and also arrangements for the children of the family. She has a talent for locating assets that have not been voluntarily disclosed and forensically analysing accounts and financial statements. These assets have included properties, bank accounts, trusts and on one memorable occasion, a racehorse.”
“A highly knowledgeable, experienced and exceptionally customer-orientated family law team, specialising in wealth preservation with an aim to empower clients to make informed decisions.”
For more information and advice on financial arrangements, please contact us on 01332 226 174 or complete the form below.
Divorce during lockdown: is now the right time?
Head of Family, Kirpal Bidmead, provides guidance to married couples who may be considering their options for divorce as the UK enters an extended lockdown.
No-fault divorce: what does it mean for separating couples?
Expert divorce lawyer, Kirpal Bidmead, explores what it will mean for couples who divorce after the introduction of no-fault divorce.
Download your guide to divorce
A useful overview for separating couples who are considering a divorce.
DIY divorce: is it worth it?
Although the divorce procedure itself is fairly straightforward, it is vital that the process and all forms are completed correctly to avoid future disputes.
Pre-nuptial agreements: fairness is key
Pre and post-nuptial agreements are increasingly popular and can limit arguments and avoid a lengthy and expensive divorce in the future.
Financial disclosure of assets in divorce or separation
In this insight article, our Head of Family & Matrimonial outlines why full and frank disclosure is always the best policy on divorce or separation.
How has the coronavirus impacted family law?
We take a look at the impact that the coronavirus and subsequent lockdown have had on family law including children's arrangements and financial settlements.
The importance of full financial disclosure on divorce
In the case of Mr & Mrs Byrne in 2019, Mrs Byrne wanted to avoid her husband knowing about money she inherited from her father.
Simultaneous death: who gets the family home?
A situation where two or more people die at the same time, without it being clear who died first, can have significant legal consequences.
Are you able to enter into a civil partnership as a ‘straight’ couple?
Following a decision at the Supreme Court, we could be on the cusp of a change in civil partnerships law.
Cohabiting couples and the ‘common law spouse’
In November 2015, the Court of Appeal had to hear arguments from yet another former cohabiting couple, namely Mr Ashmore and Ms Woodward.
The truth behind the myths of common law spouses
According to the Office for National Statistics, more than six million couples in the UK cohabit.
We can also help you with
Child arrangements Cohabitation agreements Cohabitation separation Divorce, dissolution and separation LGBT family law Nuptial agreements | cc/2021-04/en_middle_0020.json.gz/line744 |
__label__cc | 0.704739 | 0.295261 | Login at Kodi Home
Welcome to Kodi Community Forum!
Please login using the form on the right.
Not our member yet? What are you waiting for?
> Discussions > Hardware > Allwinner A10 : Is XBMC ported to MALI-400MP ?
Allwinner A10 : Is XBMC ported to MALI-400MP ?
Tom Cubie from http://rhombus-tech.net announced on this list
http://lists.phcomp.co.uk/mailman/listinfo/arm-netbook
mele a1000 running ubuntu
http://www.youtube.com/watch?v=BhnupMPCH...e=youtu.be
j1nx
2012-04-17, 21:02 (This post was last modified: 2012-04-17, 21:03 by j1nx.)
And for some additional news.
Besides all the cheap tablets out there with the Allwinner A10 hardware, soon there will be an UMPC available aswell
http://www.cnx-software.com/2012/04/16/s...0-netbook/
(2012-04-17, 15:14)metric Wrote: Tom Cubie from http://rhombus-tech.net announced on this list
So this device already is running ubuntu, only without hardware acc. Seems a matter of time before xbmc will be running on this machine..
bornagainpengui
(2012-04-25, 23:13)Robotica Wrote: So this device already is running ubuntu, only without hardware acc. Seems a matter of time before xbmc will be running on this machine..
Awesome news! That makes me want both the settop box (for XBMC) and the net/smart book version (as a replacement for my aging eeepc) with an eye towards future full hardware acceleration.
Looking forward to seeing progress continue on this.
There is another player coming on the market;
http://micdigi.com/2012/04/hyston-will-r...-solution/
So now you have about a million tablets, the Mele A1000 and A2000, the UPMC, a new STB by Hyston and offcourse still the planned EOMA-68
Some other interesting news;
A Mele A2000 will be donated to one of the XBMC dev's (on his request) to work on a port of XBMC.
(I hope they make some progress with the EOMA-68 boards, so we can order those in the near future)
And another comes on the market;
http://www.pineriver.cn/eshowProDetail.asp?ProID=1531
slicemaster
2012-04-28, 02:36 (This post was last modified: 2012-04-28, 02:37 by slicemaster.)
These A10 boxes are really starting to get popular! The size and look of that latest one is really intriguing, too bad it doesn't look like it has Ethernet...just WiFi...or does it have Ethernet? Not very clear from the page. Hopefully we'll get Linux + XBMC running on these A10 boxes soon. Decisions decisions....which A10 to get?
just ran into this... The PCB is manufactured for use in a tablet but it's got all the necessarily connectors (doesn't have Ethernet but hey what do you expect in a pcb designed for tablet use) for use in a desktop/set-top implementation...for $27 (more than likely in volume) not bad....http://micdigi.com/2012/03/the-allwinner...-about-27/
similar product here: http://micdigi.com/2012/04/7-inch-a10-pc...on-screen/
AZImmortal
It's been mentioned in this review that the refresh rate for the Mele A1000 is 61.9hz (check the last screenshot as well as the comments).
http://www.cnx-software.com/2012/04/08/m...nd-review/
Is this something that can be changed with some hackery?
davilla
Retired-Team-XBMC Developer
Showing 61.9hz refresh only mean they don't understand why vsync is important
Only 1008 BogoMips ? my 900MHz amlogic is running around 1750
MediaInfo : http://mediainfo.sourceforge.net/
Excellent, I wasn't sure if the refresh rate was somehow locked down. If it can be easily changed, then I'll order a box right away.
(2012-04-28, 02:50)slicemaster Wrote: just ran into this... The PCB is manufactured for use in a tablet but it's got all the necessarily connectors (doesn't have Ethernet but hey what do you expect in a pcb designed for tablet use) for use in a desktop/set-top implementation...for $27 (more than likely in volume) not bad....http://micdigi.com/2012/03/the-allwinner...-about-27/
What I want to know is why can't someone start a kickstarter or something and customize one of these boards for an XBMC console to replace the old xbox as standard reference hardware?
I'm not a business guy, but I'd imagine quite a few of us would buy an officially supported settop box with the ability to do emulation games integrated into the system. (Bring your own roms obviously.) Of course there are some games available for XBMC already, the ankroid clone and the media triva come to mind...
And since Android already comes built for these boards, I wonder how hard it would be to get games running fullscreen from within the XBMC interface? Clearly I'm not a programmer either, so I don't know how hard it would be to do, but I imagine some of the work Canonical is doing with Ubuntu for smartphones would be instructive there?
welshblob
(2012-04-30, 02:43)bornagainpengui Wrote:
Given that these boxes are being manufactured already and new ones based on this chip seem to be released weekly then is there a need for a kickstarter project?
(2012-04-30, 09:27)welshblob Wrote: Given that these boxes are being manufactured already and new ones based on this chip seem to be released weekly then is there a need for a kickstarter project?
Because it's not about the hardware, it's about some sort of standardization and reference design. Think Boxee Box without the lock-in, then add Android games.
Right now everyone just kind of builds something or starts with an old pc sitting in the corner and installs XBMC. It works. It works better than any of us have any right to expect it to work, a testament to the ability of the developers here--but it never works 100% of the time due to strange hardware quirks and differences in configuration.
My thinking (as an enduser, not a programmer) is that if one set of hardware was chosen, then it could be targeted towards much more easily because the developers would have a common platform on which to work. Instead of trying to build something and hoping it will be "good enough" or buying a customer device like the AppleTV and hoping it can be hacked to doing what we want this would allow people to buy a finished box and plug it in. This would be a better deal for both group, those who want to tinker and those who want it to just work.
Like I said, I'm not a programmer so I'm probably missing all sorts of reasons why this is impractical and not likely to work. To me though this kind of thing just makes sense and I really don't understand why nothing like it hasn't happened already. I understand the reasoning behind not wanting to make a XBMC Wii, or an XBMC 360, or PS3 edition because there is no way to prevent the host company from wiping out your efforts with a firmware update. I've never understood why the XBMC team never sat down, talked amongst themselves and said "Hardware XYZ is what we will target and support with OS ABC and the amount of RAM 123, etc etc. XBMC may work on other hardware but this is what we recommend."
--bornagainpenguin
we don't talk out loud
Logout Mark Read Team Forum Stats Members Help
About Us | Contact Us | Privacy
Theme by Mishar DESIGN, modded by Team Kodi
Copyright © 2017 XBMC Foundation
Bytemark
About Kodi
Kodi is a free and open source media player application developed by the XBMC Foundation, a non-profit technology consortium.
Kodi is available for multiple operating-systems and hardware platforms, featuring a 10-foot user interface for use with televisions and remote controls. It allows users to play and view most videos, music, podcasts, and other digital media files from local and network storage media and the internet.
Allwinner A10 : Is XBMC ported to MALI-400MP ?15 | cc/2021-04/en_middle_0020.json.gz/line746 |
__label__cc | 0.747063 | 0.252937 | ficregistry.org
DDWex Selecting Your Carpet
December 16, 2018 December 16, 2018 Albert Stephens Tarmac Wexford
For the best Tarmac Wexford company, call Davitt Driveways Wexford.
We’ve all done it. Every time we invest in new carpet, we take an internal oath and solemnly swear we will take care of this brand new carpet, and rightfully so. It doesn’t take a mathematical genius to know that for most folks, the third largest investment after the purchase of our home and cars is the home’s interior.
So we read the manufacturer’s warranty and notice that it says to vacuum often. Daily might be the frequency in the high traffic areas. But who has time a…
To find the best Tarmac Wexford company, click here for Davitt Driveways Wexford.
So we read the manufacturer’s warranty and notice that it says to vacuum often. Daily might be the frequency in the high traffic areas. But who has time any more to spend maintaining carpets on a daily basis? The only time you see people vacuum that frequently is in the hotel and motel industry.
Rarely does one actually see the carpets being replaced at the hotel and motel industry unless there is a major remodeling project happening with new color schemes to match. So it would serve one well to learn from the hospitality business.
How do we usually buy carpet? In most cases it comes with the home already installed. It will either be a newly built or a previously owned re-sale home. If a new home was built, if you are in the beginning stages of construction, you have a choice to upgrade to the better carpet and padding offered. Or you can choose the cheapest carpet known to mankind commonly referred to as ‘builder’s grade’ materials which also includes the cheapest, thinnest carpet pad also known as ‘FHA grade’ 2 lb. rebond.
Sure the carpet is fuzzy and comes in a light color and the padding might as well be called foam because it easily crushes to the sub-floor when any weight is applied on the carpet’s surface. After all, carpet is just carpet and pad is just pad, right? WRONG. Once again the old adage “You get what you pay for” still rings true.
DuPont, one of the top four major fiber producers, conducted a study years ago about the behaviors of the consumer as related to the way they make a purchase decision when it comes to picking carpet. I suppose human behavior still has not evolved that much since. Please note that the following results are not a misprint.
They rank from number one to number five in order:
4. Texture
While not disclosed, the first three might have been trying to color match the hard surface flooring like tile, hardwood flooring or stone. The second might be for the paint in a given room and the last color match to compliment the home’s other furnishings such as window treatments, and furniture.
Texture refers to the ‘feel’ also known as the hand of the carpet referring to how it feels when you touch the carpet by hand. It would also take into account the weight of carpet measured in ounces. For example, a carpet weighing 32 oz. per square inch has more carpet fibers then say a 16 ounce carpet. A good way to test this principle is to go to carpet a retailer and ask to see two different swatches.
For example with all things being equal, such as the same Carpet Fiber Producer manufactured by DuPont, same carpet fibers milled at Shaw Industries, same color dye lot, etcetera, you can perform this simple comparison test side by side.
Simply form your fingers like a claw and push directly straight down from top to the bottom of the fibers using your fingertips only. You should notice an immediate difference in carpet density. It will also reflect in the price per square yard. The difference is the number of stitches per square inch. On a much more dense carpet, it will be difficult to see down to the primary backing where the carpet is stitched in.
Here’s the benefit:
If there are more carpet pile fibers, then each carpet fiber actually supports one another side by side on all four corners of the fiber forming a nap. The less pile there is opens up the potential damage for gritty soil to ‘cut’ the fibers at the base of the pile where the primary backing is. This cutting effect comes with every step, pivot and turn on the carpet nap’s surface. This also causes thinning, pitting and marring of fibers making carpets dull in appearance even after restorative cleaning.
It is also worth mentioning that 60 percent of the soil that falls into the carpet can be removed safely and effectively with routine dry vacuuming of high traffic areas such as halls, stairs, entry ways and traffic paths in front of furniture. This single process alone can greatly extend the performance and life use of the carpet. Remember the hospitality industry housekeepers?
The second most fatal mistake a carpet purchaser can make is ignoring the quality of the carpet pad. Padding for the subfloor is like the spine of the carpet. It provides support to aid in preventing indentations left by heavy furniture legs after re-arranging a room.
It also has the job of holding water like a sponge whenever a copious amount water floods the room such as a broken water pipe. It provides the comfort under our footing so our feet and backs don’t ache. This is the one place you don’t have to worry about the color matching as the carpet will cover all the pad.
Pad is also measured in ounces and pounds. Once again, the higher the number, the more dense the pad. The density can range in feeling. By using a pinch test between the top and bottom of the pad you can compare densities. There is foam all the way up to feeling like a large pencil eraser. The higher the better.
Try to stay away from rubber based products like a waffle print as they have been known to dry rot where hot water pipes run through the concrete subflooring. They also don’t provide any absorption for collecting water spills. In fact in a typical flood scenario, the water just continues to migrate further by saturating a greater area of carpet space.
It would also be wise to choose the right carpet for the right application. If you were born during Baby Boomer era, you would have ran into carpets that were made from polyester. Those fibers were dyed first before they were extruded as fiber. They never faded from the sun or bleach spills and lasted forever but were harder to clean.
Nylon came around and was softer to the hand and cleaned up better but spills could permanently stain the fibers and due to costs, generally come in lighter colors. Almost all darker colors will be more expensive to produce due to more dye in the process. More dyes prevented stains due to the lack of dye sites available.
Fourth Generation carpets removed the nuisance of static electricity when walking across a room and touching anything conductive to release a jolting shock.
Fifth Generation carpets involved the incorporation of stain resist carpets. The key to this technology was to create a transparent dye. Normally after dyeing half of the carpet’s dye sites in a light color the remaining dye sites would be open for stains once installed. The solution was solved by re-dyeing the remaining dye sites with a transparent dye. Dye sites are like skin pores on your arm.
If all dye sites on a fiber are filled, then no stains could penetrate immediately. This would give the end user time to remove the stain later even if it dried on in many cases.
The last point to consider is the primary backing of carpets. For a number of years, India exported to the United States jute which is what ropes are made of. An unfortunate deadly industrial accident involving chemicals at Union Carbide’s battery plant, cause strained relations between both countries and jute stopped being exported.
Jute backed carpets also occurred when they became wet from flooding. The natural fiber made of plant (organically)based material released a tannin dye similar to coffee and bled into the carpet’s surface; thereby causing it to permanently discolor the carpet and ruin it.
It was also a food source for mold and mildew and if not treated quickly, it would dry rot causing the primary and secondary backing to delaminate and destroy the carpet.
Since the mid 1980’s polypropylene backing has become the norm. It’s a tough as fishing line and can hold up to most abuse end users give it. It’s also cheaper to produce. In fact, 70 percent of all carpets involved in a clear water food damage loss can be dried, cleaned and re-engaged with no evidence of a pre-loss condition.
Good luck on your next carpet purchase as you now possess more knowledge than most of the carpet cleaners and retailers in the industry. And don’t forget to vacuum!
DDW Improve Your Health by Improving Your Home
Prevent Home Electrical Fires
Tarmac Wexford
RL What To Look For In An Ironing Board
DDW The History Of Stained Glass Lamps
RL Little Giant Ladder Common Uses
RL Little Giant Ladder – Frequently Asked Questions
RL What To Consider Before Buying Water Softeners Online | cc/2021-04/en_middle_0020.json.gz/line754 |
__label__wiki | 0.500916 | 0.500916 | Tag Archives: Cub Scouts
Top Songs of 2013: Best Indie Rock 11-20
April 22, 2014 Karma 2 Comments
By Naoto Hattori
The Top 20 Indie Rock Songs of 2013
Below are ten of the best rock songs to come out in 2013. This list has everything from gentle lullabies to angsty guitar licks. What it doesn’t have are the 10 best indie rock songs of 2013, which are still yet to come. But I bet you’ll find these are so good that you won’t mind a bit.
Use the music player on the bottom of the screen to preview the whole list, or right-click and choose “Save as” to download. Songs will play in a new tab if clicked on.
20. Ball Park Music – Literally Baby (2:46)
“Literally Baby” isn’t even indie rock. This is good old-fashioned rock and roll that’s a little bit 1955 and a little bit 1995. For the latter I’m thinking of the vocalist, who shouts like one of the many nineties rockers influenced by ska or rockabilly. The piano tinkles like a golden oldie and the triumphant back-up chorus is one of many trills that give the song fullness.
The main reason this song didn’t find better footing on my list is that I’m perplexed by the refrain, which happens to remind me of my biggest grammatical pet peeve. It’s not that he’s using “literally” wrongly, it seems more like for no reason at all. Maybe it’s a reference to the girl having a similar pet peeve—akin to Vampire Weekend’s “Oxford Comma.” But unlike the latter, it’s unclear what the singer is getting at with the refrain. Your thoughts on the lyrical intent?
19. Thee Oh Sees – Toe Cutter – Thumb Buster (3:32)
John Dwyer and his thumb buster [image via AlterEXA]
The opening shrill cuts like a knife and the thick, lusty guitar makes me want to sway right from the first riff. Not a lounge-y sway, but a raucous, wide-legged sway, deep enough to be a yoga move, best accompanied by a pumping fist. Next the drums and guitar relent in favor of the singing, unexpectedly soft. This is all just a breather, a chance to prep yourself for some more indulgence to the God of strings. I’m not one for long guitar solos (which half “Thumb Buster” is…I’m wondering if the title is a reference not to the song’s content but what it does to John Dwyer’s fingers). It all fizzles out in skillfully-dosed feedback. Fans of shoegaze and classic rock should check out “Thumb Buster”.
18. Born Ruffians – Needle (3:32)
The reason “Needle” didn’t get a better spot on my best of 2013 list is because it starts out too pretty. I like the pretty, but it’s a little too plodding, too plaintive. When the crisp refrain begins it feels like a slow slap in the face. Thirty seconds later I remember why I love this song. When Born Ruffians begin singing “A way! A way!” they have gorgeous harmonies it’s rare to hear in a rock band. And “Needle” does rock when it gets to that refrain. The rockage sneaks up on you.
There’s something to the lyrics too. Most of the song is a plaintive complaint of how the singer doesn’t fit in. But it’s not a sad song, it’s a love song. He’s found that someone, and what are the odds that such an odd fellow would find his needle in the hay?
I belong to no one
A song without an album
Long forgotten maxim spoken to the sea:
I belong with no one/ I belong with no one/ I belong with no one…
The typical lovesong would focus on the object of his affection but “Needle” is mostly lyrical navel-gazing. It’s narcissistic moping is touching because the more of an oddball he is, the more amazing it is that he found her.
Born Ruffians are one of many bands that hasn’t yet gotten the recognition they deserve. In “Needle” they sound a bit like they’re impersonating Vampire Weekend, but many of their best songs are more straightforward rocking out.
17. The Royal Concept – World On Fire (3:48)
Leave it to a Swedish electro band to show us how a synth was meant to be used. “World
Check it: the Best Music of 2013 list is all into branding
On Fire” is yet another rousing tribute to soundtrack the march towards our dystopic future. “The world has gone mad,” the royal concept sings, and this is the song we lemmings will be dancing to as we go over the edge. Originally one of my top-five favorite songs of 2013, but I overplayed it so it lost its rank. Unfair? Tell me if you think it deserves a better spot.
16. Mounties – Headphones (3:08)
“I got my headphones on from the minute I’m up to the minute I go to bed.” That’s a refrain I feel more kinship with than I do with 90% of love songs. I love the image of a pair of headphones as a sideways mohawk. These Canadian cops on horses are going to be buried in their headphones, proving they’ve done their homework. The guitar work pulls you in without drawing attention to itself while the chilled-out harmonies have a bit of edge in the refrain.
Mounties are a new band; they don’t even have their album on Amazon yet. Check out the Mounties website to feel all up and coming. Continue reading Top Songs of 2013: Best Indie Rock 11-20 →
Ball Park Musicbest indie rock of 2013best music of 2013Best of 2013Cub ScoutsdownloadsGotta Hear This MusicHar Mar Superstarindie rockJoywaveMountiesNaked and FamousPlaylists deletingRoyal ConceptThee Oh SeesThem Swoopstop songs of 2013top twenty | cc/2021-04/en_middle_0020.json.gz/line768 |
__label__wiki | 0.917492 | 0.917492 | GALAHAD Merchandise
Non-Album Downloads & Streaming
History and Line-ups
Trackography
Seas of Change - Limited Edition Picture Disc LP
‘Seas of Change’ is the follow up ‘Quiet Storms’ which contained fifteen short(ish) tracks and was a much more mellow affair whereas ‘Seas of Change’ is the polar opposite consisting of just one 43 minute track, creating, what we think is, a full on no holds barred prog/rock rollercoaster of an album.
‘Seas of Change’ is a kind of hybrid in terms of musical style, featuring more traditional, occasionally pastoral, elements reminiscent of the ‘older’ Galahad sound whilst also incorporating the heavier guitar and more modern ‘techno’ keyboard sounds of the last few studio albums.
‘Seas of Change’ is also the first album to feature Lee Abraham on all guitars following his re-joining of the band in the Spring of 2017. Lee is already familiar to the band and a fully paid up part of the Galahad family having been the band’s bass player from 2005 to 2009 and appearing on one of their most critically and commercially successful albums ‘Empires Never Last’ as well as on a couple of live albums. We feel that Lee has added his own stamp and expanded the Galahad sound palette whilst still retaining the Galahad feel and overall sound.
‘Seas of Change’ is also Tim Ashton’s first appearance on a Galahad album containing completely brand new material since he appeared on ‘Nothing Is Written ‘ back in 1990!
As ever the album was pulled together mixed and mastered by engineer/producer extraordinaire Karl Groom (Threshold/Dragonforce/Pendragon/Arena etc.) at Thin Ice Studios in Surrey. Musically, ‘Seas of Change’ features just the five main Galahad members plus long term honorary member Sarah Bolter who makes an appearance on flute, clarinet and soprano sax.
Hopefully this record will appeal to existing fans of the band and maybe we’ll pick up a few new fans along the way.
© 2011 Galahad | cc/2021-04/en_middle_0020.json.gz/line772 |
__label__wiki | 0.836048 | 0.836048 | Riot Games COO, Scott Gelb, suspended without pay following investigation
Riot is using Gelb as evidence of its purported commitment to change, making an example of the consequences.
Scott Gelb, Riot Games COO, has been suspended for two months without pay following the conclusion of an investigation into inappropriate physical touching (as the result of an ongoing comedic bit). As reported by Kotaku on Thursday, Riot CEO Nicolo Laurent sent out an email to staff earlier this week explaining Gelb's suspension.
“As I have mentioned, we are committed to protecting Rioters’ privacy and the integrity of the investigation process. This means that you will not hear me or any other leader discuss individual cases.
“Having said that, we made a very rare exception in the case of our COO, Scott Gelb. There are factors that collectively drive this exception. The Special Committee of the Board of Directors has specifically requested that one of Scott’s consequences be highly visible. Scott holds one of the most senior roles at Riot and is held to a higher level of accountability and visibility, therefore certain consequences are going to be very visible to Rioters. It’s for these reasons I feel it’s necessary to make an exception.”
GameDaily has reported on what's been going on at Riot for a number of months, including Frances Frei joining the crew to clean up the company's toxic reputation, much as she tried to do at Uber. Back in November, two Riot employees (one former and one current) dropped a lawsuit on the League of Legends developer, citing gender discrimination and sexual harassment. All of this is following Kotaku's stalwart eight-month investigation into Riot's toxic culture.
Some Riot employees, many of whom chose to remain anonymous when speaking to Kotaku, are understandably upset about Gelb's suspension, rather than termination. Given that his frat-boy comedy routine was notorious throughout both the board and the company at large, Gelb had been given a pass for far too long.
“For Riot leadership, protecting their awful friends matters more than protecting their vulnerable employees," one anonymous employee told Kotaku. "And that isn’t going to change unless the workers do something about it directly."
Unless Riot Games is aching to end up in the annals of game industry history as Uber's equivalent, where toxicity eclipses the company's innovation and technological disruption, they're going to have to walk the talk of patching up their culture consistently. As of now, it's been piecemeal and, as another Riot employee told Kotaku, "a tiny slap on the wrist." | cc/2021-04/en_middle_0020.json.gz/line773 |
__label__cc | 0.61175 | 0.38825 | Start Over You searched for: Publisher California. Metropolitan Transportation Commission ✖ Remove constraint Publisher: California. Metropolitan Transportation Commission Subject Boundaries ✖ Remove constraint Subject: Boundaries Subject Counties ✖ Remove constraint Subject: Counties Place Alameda County (Calif.) ✖ Remove constraint Place: Alameda County (Calif.) Place San Francisco Bay Area (Calif.) ✖ Remove constraint Place: San Francisco Bay Area (Calif.) Year 2000 ✖ Remove constraint Year: 2000
1. Census Counties, 2000 - San Francisco Bay Area, California
2000. California. Metropolitan Transportation Commission and U.S. Department of Commerce, Bureau of the Census, Geography Division. This polygon shapefile displays the 9 counties for the San Francisco Bay Area of California, as of January 1, 2000. The primary legal divisions of ... California. Metropolitan Transportation Commission.
2. Census Counties, 2000 - San Francisco Bay Area, California (Clipped)
2000. California. Metropolitan Transportation Commission and U.S. Department of Commerce, Bureau of the Census, Geography Division. This polygon shapefile displays the boundaries for the 9 counties of the San Francisco Bay Area in California as of January 1, 2000. These data hav... California. Metropolitan Transportation Commission.
U.S. Department of Commerce, Bureau of the Census, Geography Division2
California. Metropolitan Transportation Commission✖[remove]2
Contra Costa County (Calif.)2
Marin County (Calif.)2
San Francisco Bay Area (Calif.)✖[remove]2
Solano County (Calif.)2 | cc/2021-04/en_middle_0020.json.gz/line776 |
__label__cc | 0.613572 | 0.386428 | Passing bull 178 – There’s one born everyday
Do you sometimes wonder if America will wake up one day, as did Italy after Mussolini and Germany did after Hitler, and ask – was this all just a bad dream? If no, how did we let it all happen? Did we just check in our brains, and our better selves, behind the door?
In his recent and wordy book Seven Types of Atheism, John Gray has a chapter ‘Secular Humanism, a Sacred relic’. (The book is loaded with –isms.) There is a section ‘From Nietzsche to Ayn Rand.’ The former is a spoiler alert for bullshit; so is the latter.
This Russian Jewish migrant to the U S would become the darling of the type of people who would stigmatise migrants and seek to lock the door against them. She was an amateur philosopher and she has been treated as such by professionals. But whereas this kind of intellectual lunacy had been the preserve of one side of politics, she may have been the harbinger of its shift to the other side. She was into –isms and her brand of moonshine was called ‘objectivism’ Her anointed apostle said that objectivism was about ‘the concept of man as a heroic being, with his own happiness as the moral purpose of his life, with productive achievement as his noblest activity, and reason as his only absolute.’ When you get heroic, noble and absolute in the one sentence, you are assured of vintage bullshit.
This world view is set out in the novel Atlas Shrugged. That very long novel has biblical force for the disciples of Ayn Rand. Her view of self-interest was a form of ‘ethical egoism.’ Donald Trump, I suspect, has never finished a book in his life, not even a Famous Five, but if he had, it should have been Atlas Shrugged – the ego enshrined in pure bullshit. You would not be surprised if you found some autographed copies lying around the IPA.
Naturally, Ayn Rand developed a following of the type called ‘cult.’ She is beloved by the Tea Party crowd and those who call themselves ‘libertarian’. (A good sane mate of mine says that that word is code for fascist; all I can say in response is that I am against most labels.) Mr Gray gives evidence of the cult as follows.
Rand’s cult aimed to govern every aspect of life. She was a dedicated smoker, and her followers were instructed that they had to smoke as well. Not only did Rand smoke – she used a cigarette holder – so that when she addressed large audiences of the faithful, a thousand cigarette-holders would move in unison with hers.
It is like a soft comic version of a Nuremberg rally, Charlie Chaplin style. But – hilariously – the faithful were branded with the Bolshevik label the ‘Collective.’
The selection of marriage partners was also controlled. In her view of things, rational human beings should not associate with those that are irrational. There could be no worse example of this than two people joined together in marriage by mere emotion, so officers of the cult were empowered to pair Rand’s disciples only with others who also subscribed to the faith. The marriage ceremony included pledging devotion to Rand, then opening Atlas Shrugged at random to read aloud a passage from the sacred text.
So, in the space of a few lines, we have gone from Marx Brothers at the Opera to Mein Kampf, and no one in the Collective knew or cared. ‘What is good for me is right.’ Someone else said this, but Rand approved it as the ‘best and strongest expression of a real man’s psychology I have heard.’ She later cut the following passage from her first novel We the Living:
I loathe your ideas. I admire your methods……What are your masses but mud to be ground under foot, fuel to be burned for those who deserve it? What is the people but millions of puny, shrivelled, helpless souls that have no thoughts of their own, no dreams of their own, no will of their own, who eat and sleep and chew helplessly the word put into their mildewed brains.
You can find almost everything that made Lenin loathsome in Ayn Rand. There is in truth one born every minute. Just ask the publishers of Janet Albrechtsen. Or just look at the mob at a Trump rally – the ones Flynn worked over with ‘Lock her up.’ (And then ask yourself why a three star general should not get six with a four for that alone.)
The more complex questions are about the Coalition, which as Hennessy said on the ABC, ‘is at a crossroads of existentialism.’
The Guardian, 25 November, 2018
As a general rule, we should avoid words that we don’t understand – but which signify pure bullshit.
← Here and there – The French Problem
MY TOP SHELF → | cc/2021-04/en_middle_0020.json.gz/line777 |
__label__wiki | 0.626278 | 0.626278 | Home › Forums › Talking Tactics › Treatment in adelaide chronic obstructive pulmonary disease jefferson,
Treatment in adelaide chronic obstructive pulmonary disease jefferson,
Tagged: 11
This topic contains 0 replies, has 1 voice, and was last updated by tashamacmahon 4 months, 4 weeks ago.
tashamacmahon
Treatment in adelaide chronic obstructive pulmonary disease, best medication asthma fleas
<h2>Top Offers For Ventolin – BUY ONLINE</h2>
A new trail in California will give hikers access to parts of Sonoma Mountain for the first time. An investigation has found that the states attorneys office did not violate the law in its handling of the case against the actor Jussie Smollett, but it cited substantial operational failures. Jim O’Sullivan has played down the risks posed by smart motorways – where the hard shoulder is removed to ease congestion – despite evidence they have caused dozens of deaths More than 50 people can be seen queuing in close proximity as they wait to reach the Cairn and Trig point at the summit of Ben Nevis in Lochaber, Scotland on August 8. The singer has called for changes to the legal arrangement that controls her life and finances, but the guardianship was extended through Feb. 1. The uproar over an algorithm that lowered the grades of 40 percent of students is a sign of battles to come regarding the use of technology in public services. Every week our Holiday Hero Neil Simpson takes an in-depth look at a brilliant holiday idea, doing all the legwork so you don’t have to. This week where to learn a new skill on a staycation. In a new study from Gilead Sciences Inc, the antiviral drug remdesivir was only found to be beneficial in patients with moderate cases of coronavirus taking the drug for no more than five days. Prime Minister Scott Morrison revealed Australian homeowners would be able to benefit from record low interest rates for at least three years. Police said the 23 year old victim Matthew Denice was still alive when he became trapped in the wheel arch of Guaman’s truck. In response to the ongoing pandemic, the 30th Environmental Media Awards were presented virtually on Friday evening, making the event free to access on a variety of online platforms. Kamala Harris (left), Top Offers For Zofran – LICENSED SHOP the Democratic nominee for vice president, was pranked by two Russian hoaxers -Vladimir ‘Vovan’ Kuznetsov (seen left in the image on the right) and Alexei ‘Lexus’ Stolyarov. Copd recovery stress. In this new fact-based film from Mark Amin, a man who had escaped slavery makes his way to John Brown. Australian scientists found sharks incubated in tanks that simulate temperatures in 2100 became ‘right handed’, preferring to swim to the right, a process known as lateralization. Lebanon’s government stepped down on Monday night, less than a week after a massive explosion in Beirut killed more than 170 people and wounded more than 6000, sparking days of violent protests. Theres an art to arranging collections like a pro. Here are a few pointers. The most recognizable symbol of Brazilian identity the iconic yellow jersey in which giants such as ventolin Pel and Ronaldo have won a record five World Cups. But the world-famous shirt has also become the emblem of President Jair Bolsonaro’s radical right, and a group of sport lovers are now demanding it be replaced. We can all agree that screaming is a pivotal part of a great haunted house experience. A few years ago, broke, bereaved and emotionally adrift, Jini Reddy decided to spend a year searching for magic. She had a hunch that the British landscape might help heal her heart and soul. The Office for National Statistics found 9.7 per cent of adults were depressed between July last year and March. The figure had risen to 19.2 per cent when the same group was assessed in June. Order ventolin shop canada.
<h2>VENTOLIN – MORE INFORMATION</h2>
buy esl reflective essay
buy esl reflective essay on lincoln
buy esl literature review
buy esl expository essay
buy esl essays | cc/2021-04/en_middle_0020.json.gz/line784 |
__label__wiki | 0.510176 | 0.510176 | Sonic the Hedgehog 2 (2022) Movie
Discussion in 'General Sonic Discussion' started by Dark Sonic, May 28, 2020.
Page 7 of 7 < Prev 1 2 3 4 5 6 7
Dec 28, 2020 #121
Xiao Hayes said:
A lot of assumption on your part. "They want to use it" and "He'll be there" are not correlative, there weren't echidnas there until tyson joined, so go figure. If it is Mushroom Kingdom, Mushroom Hill or Mushroom Filler, we don't know, but, given the original concept of the movie, there's a bigger probability of it being a boring filler than any kind of spot-on game reference, yet we don't know, so neither of us can say any option is a given. You also say having both echdnas and mushroom hill is a proof of it when that kind of planning requires the previous two having being introduced together, which they weren't. I mean, you could be right, but, come on, don't say it's a given with what we know, we know barely nothing.
I really do not see how any of these are so far fetched when they’re based on solid indicators. Especially Knuckles. Plenty of others believe this. It’s not just me.
Some think Robotnik will use the quill to make Metal Sonic. Seems like a good guess but that’s more of an assumption when we have not even seen Badniks.
It’s true Echidnas were not originally planned but the Mushroom place was. Imo such a location in this particular movie along with Robotnik getting trapped there is just hard to ignore and call filler.
If it ends up really different and those of us are wrong...well it’s fine but it would be a heck of a turnaround considering where things are pointing at moment.
Xiao Hayes
Back on track Member
Upgrading my own life to pro edition
That's the question, things are not pointing, it's like Eggman and Robotnik getting stuck at white space at the end of Generations, except maybe this time they'll explain how did he escape from the irrelevant location he fell in. Maybe with the help of Knuckles, maybe with the help of another moustached fat guy also wearing red clothing for work. Or maybe he'll use the quill agains a special mushroom, or find a lost ring to use for his own portal... The only two things that ending gives us for sure are Tails and finally an egg-shaped Eggman for the sequel, and yes, probably echidnas, but not thanks to the mushroom hell (not hill, big difference).
Jan 1, 2021 #123
Sonic5993
Given how drastically they changed Sonic's character, I have to wonder how they're going to handle Tails & Knuckles; generally speaking, Sonic's always been presented as superior to the two of them, but with movie Sonic being a lot more vulnerable, I wonder how that's going to change the dynamic. Will Tails end up being the more experienced of the two? Will Knuckles not get tricked into fighting Sonic?
Jan 13, 2021 at 4:57 PM #124
qwertysonic
creating the biggest sonic collection
I just noticed the Sega Shop has the baby Sonic movie poster https://shop.sega.com/products/soni...ting&utm_medium=email&utm_campaign=ESGA210113
The blurb for it says:
Baby Sonic, unveiled for the first time ever in the movie, will race through the Emerald Hill Zone and straight to your heart, melting it along the way, with this 18 x 14 roll up poster featuring an adorable design based on the movie.
Is there any official note that says the Green Hill Zone island in the movie is Emerald Hill Zone?
Well, the town's name is Green Hill, so I guess it was safer for them to use the name of a different hill that was initially meant to be Green Hill again.
Jan 13, 2021 at 10:32 PM #126
Boxer Hockey
Don't know why the shop called it that but no, it definitely wasn't Emerald Hill in design or intent or name
Ya it seems more like a mistake. Isn’t Emerald Hill the code name for the sequel? Unless Baby Sonic appears in a flashback.
オ カ エ リ ナ サ λ Site Staff
I'm going to just say it's likely a little throwaway reference to a zone people know for the sake of a product description.
Good to know, thanks Boxer.
Nova said:
That's what I would say except that Green Hill is obviously the more well known stage.
Jan 14, 2021 at 1:08 AM #130
Ravenfreak
Is actually a guy. Tech Member
O'Fallon Mo
Hacking Sonic Drift, Writer at Sonic Cage Dome
The town wasn't even called Green Hill, it was Green Hills which is the zone found in Sonic 2 8-bit. I get they were obviously trying to make a reference to Green Hill, I bet the writers probably aren't even aware of Sonic 2 on the Master System or Game Gear. :S As for the Emerald Hill mistake, perhaps someone was thinking of the codename for the sequel.
qwertysonic said:
They just chose to use a different one. Y'all are reading way too much into this.
HEDGESMFG
That's a lot of 2s in that title.
Hopefully it comes out on a 2sday again, like the classic title.
Last edited: Jan 15, 2021 at 7:23 PM | cc/2021-04/en_middle_0020.json.gz/line786 |
__label__cc | 0.602658 | 0.397342 | Confined Areas
By Phil Croucher,
December 6, 2009 in General Helicopter Operations
C-FXFX 11
C-FXFX
Your correct when you say ¨YOU LEAVES NOTHING IN THE BANK!¨but read all post
No one say it is a ¨Tout les jours!¨ normal operation! but it can be helpfull to do it and if you do it do it right! IT CAN SAVE YOUR ***!!!!
That's what B.M.....k say in 82 in YFC when i was doing my training he show me the DO and DON'T in different situation and it is why i can still write this post today!
By the way BM you description of the procedure is so true i'm still hearing Brian discribe in the intercom it many moon ago!
Best time of my life!
Oh! i forget to add
Ha!Ha! you say that you always turn left (i suppose conterclock rotor) you +- doing the unloaded tail rotor procedure using less power! but never realise it!you use it since the forward speed is pushing the tail to the right and you driving yourself via the rotor to the left!it is all in the finess of the mouvement!
Humm!Hope that my explonation is understandable!
Phil Croucher 6 posts
Helilog56 6 posts
Jet B 5 posts
Guest Up&away
U and A,
If you don't like this method, don't do it. It was not something I do everyday, just a procedure that might be helpful sometime. It saved myself from an overtorque inspection during fire season 2003 where, had I done 2 trips out of the confined area, the second trip would have been with a crew person in a body bag. Not planned, it just happened that I was the closest machine to do the rescue.
As for the mountains, whatever works for you is the way to go. My methods have kept me safe in the past 34 years that I have been flying in the Coast Range.
By the way, I didn't invent these little tricks that we use in the mountains, I just hear about them, try them out, and do what feels the best for the conditions. This tail rotor trick only works in certain conditions, and if these are not obvious to you, guaranteed you will get into trouble.
If you don't agree, this is fine- just go on to the next post.
Phil, sorry if I tied up your thread, I will sign off until January. Have a great holiday season.
B M
I'm not allowed a opinion on here I have to read and go to the next post if I disagree. Thats why this board sucks. I thought someone was looking for information on what to do and not to do in confined areas. Sorry I posted anything. I know why I never post on this board its because if your not on here every day nobody respects you and what you have to say. I almost never sign in when I come on here. I just visit to have a laugh because this board is a joke. It's the attitude of some of the people on here when questions are asked. Thought I could add something to a post. I don't like like that method and will not use it, anyone else who wants to have at it I don't give a rats ###. I was pointing out the problems with the method and the fact that if you need to use it you are outside the performance of the aircraft and maybe you should reconsider and lighten the load and make 2 trips. You don't see it in any flight manuals posted that if you are heavy and may not clear the trees, go to the unloading the tailrotor on take off chart.
Winnie 94
Why wouldn't you be allowed an opinion???
Opine away, just no need to shoot everyone with slugs, when simple buck-shot will do!
Back to the featured entertainment:
In the confined, DON't drift...
See my students do this occasionally, looking inside for a quick check, and there we go again.
they need to learn to look inside quickly and STILL get the information needed.
Knowing the size of the helicopter is also important. I like to land in an area where I can mark where the skids are, lift off again, and turn 90 degrees, land again across my skid marks. then move forward to land again, putting the tail rotor above the mark just made. This can make the students aware how large the machine is, and what is actually required for size.
Also some different checks:
WOPPER
Winds Always the most important
Path In
Path out
Recce Low level (Dummy run) (Funnily enough only used a dummy run once, and got #### from the customer. Landing in the bush by geraldton, in a swamp, with LOTS of chicko's (Dead stumps/trees), and had to reasses the landing site, and marginally heavy.
WOTFEEL
Forced Landing areas
Landing area
As someone mentioned earlier, if there is water, park there, passengers don't like getting wet. NEVER land in a dip, unless this is the only place, and BRIEF and BRIEF and BRIEF the passengers BEFORE you go, for all different scenarios. If in doubt at all, make sure the passengers that depart are going to stay right next to the aircraft until you take off again, this will atleast prevent them from walking UP into the main rotor, or BEHIND into the tail rotor.
Scariest moment I EVER had, was at an airport, when the passenger was NOT paying attention to me, or listening to the ground crew and walked behind the machine... Ground crew was as white as me. Passenger was oblivious.
Thanks L3 - I was taught at Remote to always slip a couple of inches forward on touchdown which will also do the same for the tail.
heliho aircraft 0
heliho aircraft
I consider that all confined area work is where situational awarness is the most important factor.
Single pilot resource management is where you use everything available to you to successfully acheive the goal. And in confined areas, you need as much help as you can get. I have found that passengers are a great resource and so is the sling mirror. Mentally recording everything you see and repeatedly seeing the problem in your mind can assist your PDM during any manuvering "in the hole". Always leave yourself an out. You can always refuse the job and live another day.
helidriver68 1
helidriver68
bottom line is I couldnt agree more , everyone has to know their limits , and not feel pressured by customer or employer to do something they dont feel comfy with . and that would include senior pilots , that they are trying to impress, really guys , we just want you to do the job safe and bring yourself , customer and hopefully the machine back in one piece , KNOW YOUR LIMITS, live by your limits , as time goes on , you will get that feeling of one with the machine , anyone with more than 5000 hours on type will know what I am relating too , with out limits you die ,
justfly 0
justfly
This sounds a little like "The Spinning Takeoff." Ken Armstrong wrote about it in his safety article the April/May/June 2004 Helicopters Magazine. It's the last paragraph. HERE.
And when it goes bad.. Video.
What the HE** was that? He wasn't even near confined...something else went wrong there.
HERE is a link to the accident report. (PDF in spanish)
...and a Google Translate translation:
REPORT OF AN ACCIDENT.
GENERAL DATA.
Make and Model of the aircraft: Bell-206L4.
Type of operation: Special aerial work
Date and time of accident: May 17 1999, 13:30 UTC, (0830 hl.)
Location of accident: Laguna de Ayllon, Canton Sigsig, Cuenca Azuay Province
Coordinates: S 03 ° 05 '67 "W 078 ° 41 '66"
FACTUAL INFORMATION
SUMMARY OF FLIGHT.
The helicopter was hired to perform evacuation flights and income people and material to an operations center located inside the archaeological Laguna de Ayllon, the operation until the day of the accident lasted seven days during which the helicopter was only able to enter three times.
The helicopter took off carrying a passenger and Gualaceo addressed the Ayllon lagoon to carry two people. After ship these passengers, cargo and baggage started off slightly after the pilot suffered a loss of control and the helicopter crashed into the lagoon.
INJURY TO PERSONS.
INJURY CREW PASSENGERS OTHER
Mortals
Minor / None
DAMAGE TO AIRWORTHINESS VE.
Because the helicopter was submerged not verified all the but it appeared that damage had come off one of the rotor blades principal, the tail boom was bent downwards and the lower
fuselage was deformed by the impact and had a hole approximately 80 inches long.
The verification of the existence of other injuries, could not be done, because of the operator after the first inspection and without the knowledge or authorization the Accident Investigation Board dismantled the helicopter.
OTHER DAMAGES
There were no other injuries.
PERSONAL INFORMATION.
The pilot in command of the aircraft was Iranian, Ecuadorian citizen, holder of a license Airline Transport Pilot Helicopter force at the date of the incident. His medical certificate was valid as of the date of the accident and stated as a restriction on use of corrective lenses nearsightedness), while exercise the privileges conferred upon this certificate. This document will enable as a pilot in the helicopter category Mono-multi-class land pilot enabled computer as Bell-206.
On 10 November 1998, the Pilot Aviation Authority submitted to the one request to be granted a license based on his experience in the Force Iranian Air. On 18 December 1998 granted a provisional license for perform updates and check flights.
On 26 January 1999 an authorized Training Center informs the Aviation Authority had made an assessment of the pilot and suggesting that he made a full training given had not flown in
the last four years. Authorization was given for this Center Instruction is who dispenses the training.
On 16 March 1999 the operator of the helicopter informed the Authority that the 7 hours pilot flight served as a team Bell-206-L3 and asks her previous checkup to empowerment, although the Authority approved their training to the Training Center.
On 30 March 1999, he was licensed with the team empowerment Bell296-L3, having done their respective check.
The flight times recorded in March 1999 were certified and counted as a driver and not as a pupil since met with 18 hours of training in order to rehabilitate and get their license.
The month of May 1999 recorded hours of 12 to 16 May were registered no flights have been performed according to the declaration of a pilot of the company.
The only flights that were conducted: as co-pilot on 11 May 1999 at the Route UIO-GUALACEO (04:24 h) as recorded in the log # 2660 and as a pilot commanded the flight on May 17, 1999 en route GUALACEO - Ayllon (00:42 h) as that recorded in the logbook and blogs (day of accident).
Hours flown OVER THE SCAMS UL 07. 30. 60 and 90 days:
7days: 11-May-99 17-May-98: 09:42 H
30 days: 18-Apr-99 17-May-98: 09:42 H
60 days: from 09-Mar-99 17-May-98: 14:24 H
90 days: from 09-Feb-99 17-May-98, 27:42 H
VE AIRWORTHINESS INFORMATION.
BRAND: BELL.
MODEL: 206-L4
SERIES: 52207
FUSELAGE HOURS: 555.4 since new
BRAND: ALLISON
MODEL: 250-C30P
SERIES: CAE-895891
ENGINE HOURS: 555.4 since new
Main Rotor:
BRAND: BELL
MODEL: 206-011-1 00-105
SERIES: HB-780
HOURS: 555.4 since new
Tail Rotor:
MODEL: 206-011-100-810-153
The aircraft had a Certificate of Provisional Aeronavegabildad effective. The provisional status because they were completing the paperwork to the issuance of final Certificate of Registration.
The maintenance of the aircraft was met under which it establishes manufacturer. In the logs there were no reports of previous failures aircraft that may have contributed to the accident.
The blog # 02,666 for the day of the accident has not signed the pilot in the box "Preflight inspection AIRCRAFT TO LIST.
Weather information.
According to witnesses version of the pilot and weather conditions to time of the accident were good.
Aerodrome information.
The landing area was irregular rock surface was within an area surrounded by mountains and located at 10,500 feet altitude.
INFORMATION ON THE REMAINS OF THE AIRWORTHINESS AND IMPACT EV.
The impact occurred at the center of one of the lagoons 300m from the point take-off, with a nose up attitude backhanded. After first hit the helicopter canopy and stay invested. She slipped one of the main rotor blades and the tail rotor blades suffered a sprain about 60 °.
SURVIVAL.
The pilot and two associates left the helicopter on its own means. The third passenger, who was inside the submerged helicopter was helped staff the camp because of injuries could not drop belt, and I need to receive artificial respiration to recover.
TESTS AND RESEARCH.
The pilot who flew before the event indicated that on May 11, 1999 entered the lagoon for a medical evacuation that day there was no complications for flight, then the prevailing weather conditions in the no gap made it possible, for a period of four days, entering the same, 15
May 1999 resumed the flights, in this attempt led to a loss of pedal control of the helicopter in the lagoon, which was corrected in time by the pilot, which influenced his decision not to continue with flights in view of that in its view the operating conditions in the lagoon were dangerous.
The logs were checked for flights to Lake Ayllon by Pilot injured, determining that the same place as copilot 5 flights as pilot 1, the day of the accident, but after an interview with the pilot who flew above, indicates that what is recorded in logs truth as he put it in the same co-pilot so that the operating company will pay for the days worked in the operation and thus it did remove the dual command of the helicopter after arriving in Gualaceo this was even reported to the Company, meaning that the pilot had the accident never enter the area of operation and the only time I he was the day of the event.
WEIGHT and BALANCE
MTOW 4404.74 LBS.
WEIGHT EMPTY 2439.80 LBS.
PILOT 180.00 LBS
OIL 13.00 lbs
FUEL (over 300 lbs are in Gualaceo) 200.00 LBS
PASSENGERS (180 LBS C / U) x3 540.00 LBS
LOAD 180.00 LBS
TAKE-OFF WEIGHT 3552.80 LBS
All this information is based on documents submitted and statements the pilot.
From the data collected, we can analyze the following:
According to information gathered from documents rest in Section Licenses, the pilot was flying an evaluation team for Bell 206 B part of a Training Center recognized the same as hard 01:12, dated January 26, 1999 concluded in the same as "HIS LAST FLIGHT HELICOPTER IS 4 YEARS AGO, SO IT IS RECOMMENDED THAT SHOULD OUE RECEIVE refreshments in the Bell 206 B OUE EOUIPO MAYBE REQUIRED TO MEET THE ENTIRE PROGRAM ASSISTANT Depending on progress CHEOUEO DEMONSTRATED BY PRIOR THE AUTHORITY. "And the flight home as pilot in command did on 17 May 1999, additionally this was his first flight in a system mountain, the Pilot Proficiency was inadequate, given that for make these mountain flights helicopter pilots must make a prior training in order to be enabled on such flights.
In the video filmed the crash can clearly see the loss of control the helicopter experienced in the take off procedure for this we analyze two situations, the first in a possible failure or lockup Control rejecting the same in view of the helicopter starts mind normal takeoff and tour occasionally to the right, the pilot at a time regains control but then the helicopter begins a shift to the left side and again we see that the pilot controls the aircraft to finally fall into the lagoon. The second product the presence of winds at the instant that they come in contact with the main rotor, the wake of this leads to an increase in angle of attack tail rotor, to counter this effect should increase driver pedal reduce the angle of attack of the tail rotor and consequently reduce the thrust to maintain the same rate of turn, as established by the manual flight in its part concerning emergency procedures in the video can see that the helicopter began its ascent, and that at no time pilot can control the shift that performed, ie could not face the wind correctly and consistently in trying to control with the pedals turning action, this was not effective in view of the ascent is required Greater engine power, resulting in the angle of attack of the tail rotor continue to grow and lose all control antitorque it produces.
CONDITIONS OF CALCULATING WEIGHT and BALANCE:
TEMPERATURE: 10 degrees Celsius
PRESSURE ALTITUDE: 10,500 feet
WIND: Variable up to 26 knots.
These operating conditions are applicable to the lagoon, and based on them shall proceed to perform the calculations in the performance tables helicopter, the OUT GROUND EFFECT HOVER CEILING with the parameters following POWER TAKEOFF, ENGINE RPM 100% RPM, GENERATOR 17.5% ANTI-ICE OFF, determining that the conditions previously mentioned temperature, wind and altitude pressure with the weight which could operate the aircraft was 3640 pounds of maximum takeoff weight, according fuel consumption from Gualaceo to the lagoon, the helicopter was within the limits of operation.
The area is called in helicopter flight operations in the mountains as CIRCUS given that it lies within a mountain system, the height at which it operated was 10500 feet, the location of the pond was a sort of plateau on the mountain, inside there was a plane in which landed the helicopter on the day of the accident, weather conditions are very variable in ceiling, visibility, present and especially wind, ground conditions within the lagoon are extremely effects in view of the marshy area is near the gaps, there are few clear that enable a safe landing inside, aid placed to verify the wind did not allow an optimal assessment of same, given that this was a stick with a rag tied and not a windsock.
From the statements made by the other pilot who flew in the area is analyzed that the problem he had on the lake forced him to abandon the operation, Since the considered dangerous, is very similar to what happened in the accident, ie that this pilot was also a total loss of pedal and he managed to recover the same by a rapid stabilization of the helicopter and without But this warning was not taken into account by officers from the airline operating the helicopter.
The pilot did not have the necessary experience to perform this operation, considering that the only flight that was conducted as a pilot on the accident.
The pilot did not perform properly the procedures established in the Manual Flight of the aircraft.
After calculating the weight of operating performance in the letters is concluded that the weight was within limits.
The area of operation provided the necessary assurances in view of the difficulty of the terrain and weather conditions of the lagoon, additional there were no visual aids for establishing correctly wind conditions.
Despite the warning by the pilot who flew earlier in this area, the company responsible for such work did not make a more minute of the operation in order to determine if indeed the cause of problem that the pilot was subsequently affect the operation.
REASON (S) PROBABLE (S):
The investigating committee believes that the cause was a possible loss of product control flight conditions existing in the area of the Ayllon lagoon.
Contributing factors.
Lack of planning on the helicopter operation in the lagoon of Ayllon.
Lack of experience of the pilot.
Constantly adverse weather conditions and variables.
That the airlines to implement the laid down in Article 264 of the Aviation Code in title 12 "Prevention and Investigation accidents "that says," removal or withdrawal of the accident aircraft elements affected and the impact they may have concurred in producing the accident may be practiced only with the permission of the Authority Aeronautics.
Companies before operating in areas where conditions are unknown, first made a study of the characteristics and soil conditions in order to identify unsafe acts and conditions that could occur.
Companies before committing to a pilot operation to ensure the experience, empowering them, especially in mountain work helicopter view of the special conditions representing the operation of an aircraft of this type.
T tail 0
T tail
They have helicopters in Iran?
yup... http://en.wikipedia.org/wiki/Islamic_Repub..._Iran_Air_Force | cc/2021-04/en_middle_0020.json.gz/line787 |
__label__wiki | 0.907482 | 0.907482 | Good Times Roll for Container Lessors as Carriers Shy Away from Buying Equipment
The Loadstar
Photo: By donvictorio / Shutterstock
By Mike Wackett (The Loadstar) – Container lessors are enjoying a purple patch, as demand remains strong, driven by solid growth in global container trades and shipping lines opting to hire equipment rather than buy.
In its latest review of the market, Drewry says the move by carriers towards leasing boxes and away from ownership “continues unabated”.
“Leasing companies accounted for 55% of container purchases in 2017, which continues the trend seen for most of this decade. With the fleet of containers owned by transport operators growing by a mere 2.4%, the leased fleet added 6.7% and the share owned by lessors is now nearing 52%.”
Drewry’s director of research products, Martin Dixon, said he expected the trend to continue over the next few years.
“We estimate that the leased share of the fleet will reach 54% by 2020,” said Mr Dixon.
The world’s biggest container lessor, Triton, with 5.7m teu at its disposal, said it also expected market conditions to “remain favourable”.
“Our customers are indicating they expect trade growth will remain solidly positive, and the supply of containers remains well controlled, with a moderate amount of new container inventory and very limited inventories of available used containers,” said the firm.
There has been a deliberate move from purchasing containers by ocean carriers under pressure to rein back capital expenditure and, as a consequence, they are relying more on leased containers for additions to their fleet.
Meanwhile, Textainer, with more than 3m teu, said it anticipated growth this year in excess of the forecast 4%, “as container trade expands at an even faster rate”.
Container manufacturing has recovered from the dramatic downturn in 2016, which saw orders slump to virtually none, staging a 55% rebound last year.
Leading box manufacturer China International Marine Containers (CIMC) “consolidated its position” last year, building 88% more boxes, noted Drewry, while MCI (Maersk Container Industry) made 118% more and Dong Fang 143% more. Indeed, MCI’s contribution to Maersk Group last year was an ebitda of $87m, an impressive turnaround from an operating loss of $31m the previous year.
Drewry expects newbuild container prices to remain stable over the next couple of years, at some $2,000 for a standard 20ft and $3,500 for a 40ft. As a consequence, resale prices are also expected to remain high, not least due to the limited amount of available equipment.
All of which represents very good news for the container leasing industry badly stung by the bankruptcy of Hanjin Shipping in August 2016, and the general market downturn that year.
Announcing a record quarterly profit of $95m and net income of $17m for the first three months of this year, Victor Garcia, president and chief executive of leasing company CAI said: “The fundamentals of the business remain strong. Our results continue to be driven by the ongoing momentum in our container leasing business.”
The Loadstar is fast becoming known at the highest levels of logistics and supply chain management as one of the best sources of influential analysis and commentary.
Check them out at TheLoadstar.co.uk, or find them on Facebook and Twitter. | cc/2021-04/en_middle_0020.json.gz/line790 |
__label__wiki | 0.962415 | 0.962415 | GTT Shares Soar as Orders Are Signed for Arctic LNG Carriers
Inside a shipboard LNG tank, image courtesy Teekay LNG
Tara Patel
July 25 (Bloomberg) — Gaztransport & Technigaz SA expects to win more orders for technology used in liquefied natural-gas ships from Russia’s $26.9 billion Arctic Yamal LNG project.
The French maker of membranes for tankers rose as much as 7.5 percent, the most since it began Paris trading in February.
“There is a need for five more vessels,” Chief Executive Officer Philippe Berterottiere said at a conference on the first-half results after the market closed yesterday.
GTT announced one contract yesterday to provide cryogenic liners for nine ships for Yamal built by Daewoo Shipbuilding & Marine Engineering. It also won a deal from OAO Sovcomflot, a Russian shipping company, for the same carrier type in March. The company rose 6 percent to 46.25 euros by 2:10 p.m. in Paris.
GTT isn’t concerned that sanctions against Russia after the downing of Malaysia Airlines Flight 17 over Ukraine last week will hurt the company’s work on the Yamal vessels, the CEO said. Technip SA, an oil-services provider, yesterday said margins may be affected by sanctions against Russia over the Ukraine crisis.
GTT, whose biggest shareholders include GDF Suez SA and Total SA, reported net income increased 18 percent to 59 million euros ($79 million) in the first half, when it won 19 orders.
“We are very confident about the development of LNG,” Berterottiere said. Between 2008 and 2013, GTT has won 90 percent of orders to equip new LNG carriers and has membranes in 70 percent of the global fleet, it told analysts today.
Demand for LNG transportation and storage has grown as Asian countries use more of the fuel to replace shuttered nuclear generation. In addition to orders for LNG carriers related to Yamal, Saint-Remy-les-Chevreuse-based GTT expects to benefit from Australian and East African gas projects and plans to export shale gas from the U.S., it said.
Copyright 2014 Bloomberg. | cc/2021-04/en_middle_0020.json.gz/line791 |
__label__cc | 0.675808 | 0.324192 | GOPUSA Illinois
December 1 Morning Edition
— Steep pot prices will get even higher in some Illinois communities come Jan. 1 At least 10 cities and two counties around the state voted to add local taxes to the cost of weed, including Arlington Heights and Carbondale. – Tom Schuba (DIERSEN: Instead of spending money on pot, what did you do with your money? I spent my money on new cars, tuition, and real estate and I saved for my retirement.)
https://chicago.suntimes.com/cannabis/2020/11/30/21754579/illinois-pot-cannabis-marijuana-weed-taxes-costs
— GAO says weekly unemployment benefits report flawed – AP
https://www.chicagotribune.com/business/ct-biz-unemployment-benefits-flawed-20201130-p4m4anumbjfwvc62v46eg4wrt4-story.html
— FRONT PAGE TOP OF FOLD WITH BIG COLOR PICTURE: ‘You can’t sit by and do nothing’: Lawmaker Stephanie Kifowit challenges Madigan’s House leadership – Marni Pyke
https://www.dailyherald.com/news/20201201/you-cant-sit-by-and-do-nothing-lawmaker-challenges-madigans-house-leadership
— Youth Engagement in Philanthropy students hope to raise $12,500 as part of Giving Tuesday – Scott Mogan (DIERSEN: What do you give? My critics/opponents demonize me, denigrate me, and condemn me for my not giving enough. In my defense, I have put together and sent out GOPUSA ILLINOIS emails free of charge and without any advertising since 2000. GOPUSA ILLINOIS email subscriptions are worth at least $1,000/year. GOPUSA ILLINOIS emails have gone out each and every a) morning since 2004 and b) evening since 2015. That is 7,595 emails. Those emails contained links to 385,927 articles and information about many upcoming events. It takes about an hour for every 10 articles, so I have spent about 386,000 hours doing this since 2004. My time is worth $100 an hour. 386,000 X $100 is $3,800,000. All the time and all the money needed to put together and send out GOPUSA ILLINOIS emails comes from me. But according to my critics/opponents, my GOPUSA ILLINOIS emails are worthless if not destructive.)
https://www.dailyherald.com/news/20201130/yep-students-hope-to-raise-12500-as-part-of-giving-tuesday
BADGER HERALD
— The danger of the status quo: How Wisconsin institutions maintain white supremacy – KEN WANG (DIERSEN: What will newly elected Democrats do to stamp out White supremacy in your county, in Illinois, and in America? Will they pass resolutions that condemn Whites and especially condemn Whites who are law enforcement officers, Trump supporters, conservative, patriotic, Republican, American, male, older, heterosexual, married, non-poor, gun owners, Christian, Protestant, Italian American, German American, draft avoiders (except Joe Biden and Bill Clinton), and/or those whose ancestors have been in America for a long time. How soon will they pass laws that ban Whites from getting an education, getting a job, owning a car, owning real estate, seeking or holding government or political offices, etc.?)
https://badgerherald.com/opinion/2020/11/30/the-danger-of-the-status-quo-how-wisconsin-institutions-maintain-white-supremacy/
SUBURBAN LIFE
— Equity audit indicates District 99 has made diversity gains – Megann Horstead (DIERSEN: While I worked for the Democrats who ran GAO 1980-1997, they crowed about their diversity gains, that is, they crowed about their success in getting rid of GAO employees who were Republican, White, male, older, and/or non-veteran.)
https://www.mysuburbanlife.com/2020/11/20/equity-audit-indicates-district-99-has-made-diversity-gains/alm07fh/
WREX
— Staffing experts say adult use marijuana is preventing some from finding employment – Mary Sugden (DIERSEN: GAO hired me in 1980 because it could not find a qualified Democrat, minority, female, younger person, or veteran who would take the job. IRS hired me in 1971 because it could not find a qualified Democrat, minority, female, or veteran who would take the job. The Post Office hired me in 1966 because it could not find a qualified Democrat, minority, female, or veteran who would take the job. What percent of those who the Post Office, IRS, and GAO did not hire were pot users?)
https://wrex.com/2020/11/30/staffing-experts-say-adult-use-marijuana-is-preventing-some-from-finding-employment/
— IRS Says Its Own Error Sent $1,200 Stimulus Checks To Non-Americans Overseas – SACHA PFEIFFER (DIERSEN: GAO audits IRS. GAO wasted my knowledge of IRS. I transferred from IRS to GAO in 1980 when I was 31 years old. I had worked for IRS for almost 9 years, the last 5 1/2 years of which at the GS-12 Step 1-5 levels, currently, $85,084-$96,431/year. If I had been a Democrat, a minority, and/or a female, GAO would have assigned me to audits of IRS. I had earned an MBA from Loyola in 1976, passed the CPA examination on my first attempt in 1979, earned a master’s degree in accounting from DePaul in 1980, passed the Certified Internal Auditor examination on my first attempt in 1981, and became a licensed CPA in 1981.)
https://www.nprillinois.org/post/irs-says-its-own-error-sent-1200-stimulus-checks-non-americans-overseas#stream/0
EVANSTON PATCH
— DIERSEN HEADLINE: How soon, if not already, will your church officially banish those who do not promote BLM, LGBTQ, dependency on government, dependency on charity, abortion, mass/illegal immigration, booze, gambling, pot, and other vices, abolition of the First and Second Amendments, patronage, political affiliation discrimination, reverse discrimination, age discrimination, and even worse things? How soon, if not already, will your church officially proclaim that it is an arm of the Democrat, Libertarian, and/or Green parties?)
https://patch.com/illinois/evanston/black-lives-matter-banner-vandalized-evanston-church
POLITICO ILLINOIS
— Rep. Adam Kinzinger’s skewering of President Donald Trump on Twitter may get him uninvited to holiday parties, according to POLITICO’s Jake Sherman and Anna Palmer. “There has been discussion in the White House of excluding the following Hill Republicans from the W.H. Christmas party this year: Sens. Susan Collins (Maine), Mitt Romney (Utah), Lisa Murkowski (Alaska) and Ben Sasse (Neb.) and Reps. Adam Kinzinger (Ill.) and Liz Cheney (Wyo.). We’re told this has been reversed — that they may get an invite — but this has dominated West Wing chatter in the last few days.” – Shia Kapos
https://www.politico.com/newsletters/illinois-playbook/2020/12/01/secretary-giannoulias-blowback-for-vasquez-the-comed-profit-machine-491021
— Amend Illinois’ Pension Protection Clause Right, And Act Now – Mark Glennon (DIERSEN: If you are a government employee, are you in line to get a government pension, is your government employer paying part of your health insurance, and will your government employer continue to pay part of your health insurance when you retire? If you are a retired government employee, are you getting a government pension and is your former government employer continuing to pay part of your health insurance? If your answer is yes to any of the aforesaid questions, you should be aware that if you seek a government office or if you seek a political office, your critics/opponents will use that against you.)
https://wirepoints.org/amend-illinois-pension-protection-clause-right-and-act-now-wirepoints/
— Tight-lipped Team Biden reignites health fears after foot fracture – David Sherfinski (DIERSEN: If you had to defend your good health, what would you stress? I would stress that no health problem or any other kind of problem has stopped me from putting together and sending out a GOPUSA ILLINOIS email each and every a) morning since 2004 and b) evening since 2015. That is 7,595 emails. Those emails contained links to 385,927 articles and information about many upcoming events. It takes about an hour for every 10 articles, so I have spent about 386,000 hours doing this since 2004. My time is worth $100 an hour. 386,000 X $100 is $3,800,000.)
https://www.washingtontimes.com/news/2020/nov/30/joe-biden-foot-fracture-reignites-health-fears/
— Media bias in Trump era ‘more extreme’ than we’ve ever seen: Karl Rove Calls out Big Tech’s ‘consistent hostility’ toward conservatives – David Rutz (DIERSEN: I should write a book about those who since 2000 have sided with the Democrat news media and with Big Tech against me and against my GOPUSA ILLINOIS emails. I would focus on a) Republican candidates on ballots in my precinct who have lost races, b) leaders of the Illinois Republican Party, c) leaders of the DuPage County Republican Central Committee, d) leaders of the Milton Township Republican Organization, and e) leaders of TAPROOT Republicans of Illinois, Wheaton Chamber of Commerce, Illinois Center Right Coalition, and American Association of Political Consultants Midwest Chapter.)
https://www.foxnews.com/media/bias-trump-era-big-tech-censorship-karl-rove
— Time to Abolish Unconstitutional and Useless Mask Mandates – William Sullivan
https://www.americanthinker.com/articles/2020/11/time_to_abolish_unconstitutional_and_useless_mask_mandates.html
— MSNBC’s Nicolle Wallace: ‘Republicans Willing to Sell Their Soul’ for Trump’s ‘Big Lie’ of Election Fraud – Pam Key (DIERSEN: Expect that hate-filled Trump-hating governments, businesses, organizations, etc. will get rid of their Republican constituents, employees, customers, members, etc. who suspect election fraud.)
https://www.breitbart.com/clips/2020/11/30/msnbcs-wallace-republicans-willing-to-sell-their-soul-for-trumps-big-lie-of-election-fraud/
— Supreme Court Hears Trump Bid to Bar Illegals From Census
https://www.newsmax.com/headline/supremecourt-trump-bar-illegals/2020/11/30/id/999264/
— Online misinformation is rampant. Four tips on stopping it. – Sarah Matusek (DIERSEN: According to my critics/opponents, all government and political news and commentary is misinformation except for the government and political news and commentary that they put out or bless. I should write a book about my critics/opponents and what they have done since 2000 a) to stop me from sending GOPUSA ILLINOIS emails out and b) to stop everyone from reading those emails. Better yet, I should sue them.)
https://www.csmonitor.com/USA/Politics/2020/1103/Online-misinformation-is-rampant.-Four-tips-on-stopping-it
— Biden ‘wants to turn back the clock’ to familiar policies – Michael Goodwin (DIERSEN: Hate-filled Trump-hating Trump-haters want to use Biden to get rid of individuals, organizations, companies, governments, and countries that are law enforcement, Trump supporters, conservative, Republican, White, male, older, heterosexual, married, non-poor, gun owners, Christian, Protestant, Italian American, German American, draft avoiders (except Joe Biden and Bill Clinton), and/or those whose ancestors have been in America for a long time. Hate-filled Trump-hating Trump-haters succeeded in deceiving many voters who are White, male, older, heterosexual, married, non-poor, gun owners, Christian, and/or those whose ancestors have been in America for a long time that Biden would not take any adverse actions against them because he is White, male, older, heterosexual, married, non-poor, gun owners, Christian, and/or those whose ancestors have been in America for a long time like they are.)
https://www.yahoo.com/news/biden-wants-turn-back-clock-161442067.html
— As Trump Attacks Georgia Republicans, Party Worries About Senate Races – Lisa Lerer, Richard Fausset and Maggie Haberman (DIERSEN: Beyond overwhelmingly, since at least 2000, Republicans have attacked Republicans in Illinois, in DuPage County, in Milton Township, and in Wheaton for there being “too conservative,” that is, for supporting the traditional marriage, right to life, immigration, illegal drugs, Second Amendment, and/or equal opportunity (no race or gender based preference giving) planks in the Republican Party platform. I should a book about the aforesaid attackers and those who they attacked.)
https://www.nytimes.com/2020/11/30/us/politics/georgia-republicans-trump-kemp.html
— Once ‘cocky’ Democrats recalibrate ambitions in Congress amid election setbacks – JENNIFER HABERKORN (DIERSEN: How soon will the Daily Herald publish a front-page top of fold article with big color pictures on what newly elected Democrats in DuPage County will do to destroy DuPage County?)
https://www.latimes.com/politics/story/2020-11-30/democrats-recalibrate-ambitions-in-congress-amid-election-setbacks
— DIERSEN HEADLINE: A hate-filled Trump-hating Trump-hater says “America must reclaim democracy damaged by Trump.”
https://www.bostonherald.com/2020/11/23/america-must-reclaim-democracy-damaged-by-trump/
— Media Treat Trump’s Team Like Dogs, Biden’s Like Puppies The largely celebratory coverage unwittingly emphasizes the triumph of the press’s own class. – Gerard Baker
https://www.wsj.com/articles/media-treat-trumps-team-like-dogs-bidens-like-puppies-11606755432
— Labor Department Published Flawed Estimates of Weekly Jobless Claims, Watchdog Says GAO also says jobless-benefits program underpaid millions amid the pandemic – Paul Kiernan And Sarah Chaney Cambon
https://www.wsj.com/articles/labor-department-published-flawed-estimates-of-weekly-jobless-claims-watchdog-says-11606752477
MEAWW
— Rudy Giuliani barred from testifying at Michigan election hearing by GOP chair as he has no ‘first-hand knowledge’ The decision by Republican Chair Ed McBroom will be a serious blow to President Donald Trump’s legal pursuits to overturn the November 3 election loss – Shubham Ghosh (DIERSEN: What do you have first-hand knowledge of? I have fist-hand knowledge of serving as a Republican Precinct Committeeman (since 1999), serving a GOPUSA Illinois Editor (since 2000), TAPROOT Republicans of Illinois chairman (2005-2012), Wheaton Chamber of Commerce Government Affairs Committee member (2003-2011), Milton Township Republican Organization webmaster (2008-2010 and 2000-2004), Illinois Center Right Coalition Steering Committee member (2003-2007), American Association of Political Consultants Midwest Chapter board member (2001-2004), GAO employee (1980-1997), Association of Government Accountants Chicago Chapter Executive Committee member 1983-1996), IRS employee (1971-1980), Firestone Stores employee (1970-1972), Post Office employee (1966-1969), DuPage County, Milton Township, and Wheaton resident since 1978, etc.)
https://meaww.com/gop-chair-ed-mcbroom-bars-rudy-giuliani-testify-michigan-election-hearing-trump-fraud-election
— UK Government ‘secret Orwellian unit’ takes blacklisting journalists to a new level – Emma Guy (DIERSEN: I should write a book about those who have blacklisted me, blacklisted my GOPUSA ILLINOIS emails, and blacklisted my www.gopillinois.com website. I would focus on a) Republican candidates on ballots in my precinct who have lost races, b) leaders of the Illinois Republican Party, c) leaders of the DuPage County Republican Central Committee, d) leaders of the Milton Township Republican Organization, and e) leaders of TAPROOT Republicans of Illinois, Wheaton Chamber of Commerce, Illinois Center Right Coalition, and American Association of Political Consultants Midwest Chapter.)
https://www.thecanary.co/uk/analysis/2020/11/26/government-secret-orwellian-unit-takes-blacklisting-journalists-to-a-new-level/
Author: David Diersen
The opinions that I express in GOPUSA ILLINOIS emails are based on experience that I have gained doing many things since 1948. I base my opinions on what I learned a) working for the federal government for almost 30 years -- Post Office 1966-1969, IRS 1971-1980, and GAO 1980-1997, serving on the Executive Committee of the Association of Government Accountants Chicago Chapter 1983-1996, and being a union member while I worked for the Post Office and IRS; b) earning an MBA from Loyola in 1976, a masters degree in accounting from DePaul in 1980, and a masters degree in financial markets and trading from IIT in 1997; c) passing the CPA examination on my first attempt in 1979 and passing the Certified Internal Auditor examination on my first attempt in 1981; c) serving as a Republican Precinct Committeeman since 1999, the GOPUSA Illinois Editor since 2000, the TAPROOT Republicans of Illinois Chairman 2005-2012, a member of the 2008 Illinois Republican Party (IRP) Platform and Resolutions Committee, a Wheaton Chamber of Commerce Government Affairs Committee member 2003-2011, the Milton Township Republican Central Committee webmaster 2008-2010 and 2000-2004, an Illinois Center Right Coalition Steering Committee member 2003-2007, and an American Association of Political Consultants Midwest Chapter board member 2001-2004; d) attending the 2000, 2004, 2008, 2012, and 2016 IRP State Conventions as a delegate; e) being the subject of a nasty 4-page article in the February 1978 issue of Money Magazine; f) pursing litigation including Diersen v. GAO and Diersen v. Chicago Car Exchange; g) being married since 1978; h) living in Crete 1948-1972, in University Park 1972-1976, in Chicago 1976-1978, and in DuPage County, Milton Township, and Wheaton since 1978; and i) being baptized, raised, and confirmed as a Missouri Synod Lutheran. View all posts by David Diersen
Author David DiersenPosted on December 1, 2020 December 1, 2020 Tags abortion, age, amendment, ancestors, booze, cannabis, certified, Committeeman, County, CPA, democrat, discrimination, diversity, DuPage, employee, female, gambling, Gao, german, GOPUSA, gun, illegal, illegals, Illinois, immigration
Previous Previous post: November 30 Evening Edition
Next Next post: December 1 Evening Edition
Subscribe to GOPUSA Illinois Newsletter:
January 17 Evening Edition
January 17 Morning Edition
Diersen Consulting
Diersen Consulting Information
GOPUSA Illinois Proudly powered by WordPress | cc/2021-04/en_middle_0020.json.gz/line797 |
__label__wiki | 0.75204 | 0.75204 | Greg's Gallery Disneyland/Universal Studios trip 2016
1. Pictures... ... 8. Pictures... 9. Pictures... 10. Pictures... 11. Disneyland/... 12. Pictures... 13. Pictures... 14. India trip ... ... 149. Cathy's...
WP_20160703_19_31_26_Rich_2
You have 37 items in your cart
Title: WP_20160702_07_43_15_Rich_2
Summary: Me in front of the Universal Studios globe!
Summary: The entrance to the Harry Potter ride goes through Hogwarts Castle, and in this room Harry, Ron, and Hermione show up to talk to you! Unfortunately, this room is where we heard the ride broke down for a bit, so Harry, Ron, and Hermione did a lot of talki
Summary: Elsewhere in that room, the chalkboard talks a lot about dementors. Hmm...
Summary: Later in the castle, the fat lady showed up! She wishes she could come along...
Summary: The sorting hat!
Summary: After Harry Potter, we went to the Simpsons side of the park. Here I am outside of Duff Gardens, next to Tipsy and Surly!
Summary: Me next to the capsule from Apollo 13! (the movie, anyway)
Summary: This meet-and-greet with a Transformer was baffling. He was moving around deftly but also talking in a way that it was clear the speech was live. Is there someone in that suit? Or is it remote-controlled? We may never know...
Summary: Me under a dinosaur at the Jurassic Park ride.
Summary: We ate lunch at Cletus's Chicken Shack, and David found Spider-Pig! The TV in the background is playing all sorts of restaurant-related Simpsons clips.
Summary: This is part of the set that looks like New York City, or many other cities. The bricks look surprisingly real! But it's all foam, I think.
Title: WP_20160702_13_11_24_Pro_2
Summary: The set of a plane crash in War of the Worlds. Apparently that's a real 747 that they bought and then destroyed!
Summary: David in front of Hogwarts Castle!
Summary: Back outside, students from Durmstrang and Beauxbatons made an appearance.
Summary: I don't mean to brag, but...
Summary: David met Scooby-Doo and Shaggy, who were very big fans of his shirt!
Summary: More Scooby-Doo and Shaggy being excited about David's shirt.
Summary: Next up was Disneyland. Here's David on the Finding Nemo submarine ride!
Summary: After Star Tours, you could build your own lightsaber!
Summary: David and I in front of It's a Small World.
Summary: David enjoys a Darth by Chocolate, which was a delicious dessert! (OK, I enjoyed it too...)
Summary: David and I attempted to open the Disney vault! Then we just went in the store.
Summary: David and Emily on the Dumbo ride.
Summary: While we waited for the parade, the tea cups were lit up very nicely.
Summary: Parade time! Here's the Little Mermaid float.
Summary: Frozen!
Summary: Finally, Mickey! The triple spiral thing behind him was oddly hypnotic.
Summary: On to Disney California Adventure! We rode the Golden Zephyr.
Summary: We went to an animation class and learned how to draw Olaf! Here's David's version...
Summary: ...and here's my version! Yeah, David's is better.
Summary: David showing off a very nice matte. Everything past the rope is a painting!
Summary: We got into position to watch the World of Color show early. The lit-up ferris wheel (which we had ridden early in the day) was especially pretty!
Summary: Since it was July 4th, the show opened with a tribute to America. There was a sheet of mist or water or something that they projected things on to. It looked way better in person than it does in this picture!
Summary: Neil Patrick Harris (who narrated World of Color) hangs out with Mickey!
Summary: Frozen! Yes, they played "Let It Go"...
Summary: The Finding Nemo section was pretty.
Summary: Finally, Star Wars! | cc/2021-04/en_middle_0020.json.gz/line801 |
__label__wiki | 0.938105 | 0.938105 | News Northern Ireland
Displaying items by tag: Northern Ireland
Terex Materials Processing makes appointments at Terex Finlay, EvoQuip and Terex Materials Processing
UK: Northern Ireland-based Terex Materials Processing has appointed Matt Dickson as Business Line Director for Terex Finlay and General Manager of its Omagh site, and Barry O’Hare as Business Line Director for EvoQuip. Paul O’Donnell, the previous Business Line Director for Terex Finlay, will become the Director of Strategic Sourcing at Terex Materials Processing.
Dickson has led the EvoQuip business for the last four years and holds a commercial and engineering background. He previously worked for Terex Finlay in Omagh for over 10 years, eventually becoming its Engineering Director.
O’Hare holds experience in the crushing and screening industry, having worked in several positions for Powerscreen and Terex MPS over the past 12 years. Most recently, he worked on strategic and operational sales for EvoQuip and led the development and management of territory sales.
John Mulgrew appointed as plant manager at Lafarge Cement’s Cookstown Plant in Northern Ireland
UK: Lafarge Cement, part of Aggregate Industries and LafargeHolcim, has appointed John Mulgrew as the new plant manager of its Cookstown integrated cement plant in County Tyrone, Northern Ireland. He succeeds Russell Larmour who is to retire after 40 years within the company. Mulgrew will report to Barry Hope, Head of Cement on the Executive Committee at Aggregate Industries.
Mulgrew joined the LafargeHolcim Group as a quality co-ordinator in 2001, holding almost 20 years of experience in the cement industry. He became production manager at the Cookstown plant in 2016. The company says that the plant achieved its best results to date in 2019 after being ranked in the top 10 of LafargeHolcim’s European cement plants when evaluated against industrial benchmarks.
Jason Bowman will succeed Mulgrew as the new production manager at the plant. He has been promoted from his current role as manufacturing manager at Cookstown.
Telestack to invest Euro5.8m in Omagh plant
UK: Northern Ireland’s Telestack plans to invest Euro5.8m towards upgrading its Omagh plant. The mobile bulk material handling system producer will build a new 4180m3 plant next to its existing site. The new unit will include production lines, a research and development centre and new office premises.
“Telestack has grown rapidly over the last number of years and we have firm plans to double our revenue again in the next three and a half years. We have out-grown our current facility and we need to extend our manufacturing footprint to meet the international demand for our products. We have made a conscious decision, even in the face of Brexit uncertainty, to invest locally” said Telestack’s managing director Martin Dummigan.
LafargeHolcim celebrates 50 years of production at Cookstown plant
UK: Lafarge Cement is celebrating 50 years of production at its Cookstown plant in Northern Ireland. The plant opened in 1968 and today it employs almost 100 staff both in Cookstown and at a cement terminal in Belfast. Lafarge Cement was later acquired by Aggregate Industries in 2015 as part of the merger between Lafarge and Holcim that created LafargeHolcim.
“Fifty years is a significant milestone and follows the successful 60th anniversary celebrations that took place at our sister cement plant in Cauldon in 2017,” said plant manager Russell Larmour. “The success at Cookstown is testament to the many generations of people here in County Tyrone who have helped shape the business today. As we now look to the future, and many more years of production, we are committed to maintaining our position as a leading, sustainable business partner at the heart of the UK’s construction industry.” | cc/2021-04/en_middle_0020.json.gz/line807 |
__label__cc | 0.579151 | 0.420849 | Delta man survives second heart attack playing hockey on Richmond ice rink in 10 months
By Justin McElroy Global News
Posted September 12, 2015 3:56 pm
Updated August 5, 2016 4:47 pm
WATCH: A Delta man says he is living proof that AED’s save lives. Jill Bennett has more on what you need to know about the defibrillators.
When David Schmid fell to the ice during a recreational hockey game at the Richmond Ice Centre this week, his first thought was “aw, not again.”
“[I] turned and headed back to the bench to call it a night, and my vision went fuzzy and grey,” the 60-year-old said.
It was Schmid’s second heart attack on the ice in 10 months. The first time, in November, paramedics happened to be in the crowd and helped shock him back to life.
This time, a man watching his daughter play ringette in an adjacent rink came to the rescue.
“A woman came running into the lobby area and said, ‘we need a defibrillator!’ Since I took my course a few months ago, I knew where it was in the building,” said Rod Needham.
Needham found the automated external defibrillator (AED), and used his training both as an army medic and as a teacher in Surrey to organize those who were trying to help.
“He absolutely was lifeless,” said Needham. “His eyes were wide open and he was not breathing, he had no pulse. He was gone.”
Thankfully, the AED worked.
“His eyes started coming back, he started moaning, and at a certain point I realized I need to stop compressions. He started complaining,” said Needham with a laugh.
Having those trained in first aid nearby was crucial in saving Schmid’s life, but so was the quick access to the AED.
“The sooner you put the AED on, the more chance of a patient’s survival,” said Needham.
Not wanting to test his luck a third time, Schmid retired from hockey at the urging of his teammates and wife.
“Words can never convey what those people have done for you,” said Jacqueline Schmid.
“They do it without thinking, they step into the spot, and take over and it was a huge thank you from our entire family.”
READ MORE: Nanaimo hockey player given CPR by opposing goalie after cardiac arrest
Automated External DefibrillatorRichmond Rink | cc/2021-04/en_middle_0020.json.gz/line809 |
__label__wiki | 0.906109 | 0.906109 | kobe bryant, Michael Jordan
Michael Jordan Laughs At Kobe Bryant For Saying 2012 Olympic Team could beat 1992 Dream Team
Kobe Bryant did an interview a couple days ago and said that he thought this year’s Olympic basketball team could beat the 1992 Dream Team. Charles Barkley responded yesterday by saying that there was no way in hell that the 2012 squad could beat the 1992 team. Then, AccuScore did a bunch of computer simulations to determine that, if the two teams played, the Dream Team would win about 53 percent of the time. And, now, Michael Jordan has officially spoken and, of course, he says that there’s “no comparison” between the Dream Team and this year’s team.
“I absolutely laughed,” he said earlier today when asked about Kobe’s comments prior to a celebrity golf tournament in Charlotte. He added that Kobe’s prediction “is not one of the smarter things he ever could have done.”
via AP
cheapnorthfacejacketssale.webs.com/ said: December 3, 20121:17 am
The machines will not operate properly.Your hand feels cold.I just made it!The ice is hard enough to skate on.May I use your pen? I won’t be able to see him today.I won’t be able to see him today.Hold on.All for one,one for all.Old tunes are sweetest and old friends are surest. | cc/2021-04/en_middle_0020.json.gz/line812 |
__label__cc | 0.544861 | 0.455139 | Chapter 66: Arrivals
Today marked the arrival of Emi’s future wife.
To mark the occasion, she wore a light blue springtime dress and tied her hair back into a ponytail, something she never did except on the most very special of occasions. She placed her bowtie on the top of her head, over her left ear.
Emi sat outside in her front yard, basking in the warm sunny weather and reading a book. It was the ninth entry in The Elf Cycle, just released, titled The Rise of Soonworld. And it was the final book in the series, she was starting to realize. Just twenty pages from the end, and the Golem and Ghost had finally confessed their love to one another. But it was too late–the Ghost’s spiritual energy was fading. Her mana had run out, and her energies were falling back into nature. The Golem had offered to absorb her, for them to become one, a single being living together forever. But the Ghost refused him; it was her time to leave and return to the astral dimension.
…really sucked.
It was clearly rushed out in less than half a year just to cash in on the popularity of the eighth one… And Emi never felt more disappointed in her life.
Well, with the final book in The Elf Cycle a huge letdown, it was finally time to discard those last little bits of childhood that still lingered on Emi’s person and fully embrace the woman she was meant to be. Just kidding. Emi would never grow up, and she had come to accept that with the joy that only the silliest of weirdos could embrace in themselves.
Without even bothering to stand up, she closed the book, let it levitate around her, and then sent it through the window to her barren rebuilt bedroom. That was the only fitting way she could send off such a wreck of a novel.
Ms. Khami, followed closely behind by Pip, came out through the front door and looked down at Emi. The old woman put her hands on her hips and shook her head. “Still spending all your time reading cheap fiction, I see.”
“I’m a little devil,” said Emi.
“My little devil.” Ms. Khami looked better than ever. Back during the rebellion, she saw a side of her that she had never been privy to before– vulnerability, hopelessness, genuine anger. But all of that was gone, just like the third floor balcony that had been completely repaired. “They still aren’t here, are they? What could be the hold-up?”
“Customs must be difficult these days,” Emi said. “You’re the one that taught me all about trade and tariffs, so you should know.”
“Not me. Just the books I assigned.”
“This conversation is real weird,” chimed Pip. “It’s like you’re friends or something.”
Ms. Khami briefly smiled, then faked a stern look. “I’ll leave you be, then. Come, Pip. We have rooms to clean.” They went back inside.
Her heart started to fill with a sort of mix of dread and anticipation. She’d made peace with all of what was going to happen in her life, because that was the L’Hime Family way. She was going to take what might happen and turn it into something excellent. She would make something that her parents, that Reo and Touma, that Ms. Khami, could all be proud of. Something Beatrice herself could be proud of. She would certainly achieve all of that. But that assurance didn’t stop her from being incredibly nervous anyway.
Finally, a single carriage pulled up to the house gate, and out stepped a portly man with a large waistcoat carrying large, clearly heavy bags. “Calling for the arrival of Lady Novella Khara,” the man shouted. “She is here.”
She was here.
Emi gulped, and then approached the carriage. She steeled herself, adopting straight posture and as serious a face as someone like her could make.
The door opened, and out stepped a slender, tall woman with rings on six of her fingers. She wore gallant black suit with a narrow white tie. Her hair was stringy, auburn, and her face was narrow, pink. Very handsome, if I do say so myself. One thing immediately struck Emi, though– Lady Khara was much younger than she ever thought.
In fact, she seemed nearly the same age as her.
“So this is Emi L’Hime, isn’t it?” the woman asked, her face entirely neutral. She used to always suppress her emotions in public as some sort of power move.
“It is she,” Emi replied. “Welcome, Lady Khara.”
Lady Khara stepped down from the carriage and extended her hand. “Call me Novella,” she said. “I’m going to marry you, after all. I don’t want you to sound like a servant or anything.” The woman extended her hand forward. “Nice to meet you.”
Emi took her hand and shook it with a firm grip. “Likewise.”
Novella smirked.
Emi did as well.
She had always imagined that Lady Khara was some middle-aged woman who wore long gowns that went down to her feet and had a serious expression on her face at all times. She wasn’t sure why the gowns part. But… this was certainly a surprise. Emi didn’t mind that she was a young woman herself, not that she had on a very well-fitting suit.
“So, is this your first time in Balarand?” she asked, keeping her grip steady.
“Actually, yes,” Novella said. “I wanted to arrive for the Moon Festivals precisely because that they your city’s most famous celebrations. I heard they are wonderful.”
“Well, the moons certainly are nice this time of year. But the Moon Festivals aren’t for a few more weeks. You know, when our wedding is set.”
“That’s okay. I’d like to get a feel for the city, anyway,” she said. “Perhaps you can show me around, Emi.”
“Perhaps, Novella.”
Emi waited for Novella to relent, to let go of her hand and end the shaking. She wasn’t going to let Novella get the upper hand here (literally), so she was going to keep shaking until her fiancee gave out. Novella seemed to be thinking the same thing.
“I must say, your hairstyle is exquisite, Novella said. “I expected much, but you exceeded all expectations.”
“Thanks. I changed it just for you.”
“I am incredibly flattered.”
“Don’t be. It’s only proper, after all,” Emi said.
The portly man folded his arms. “Ladies? Should we not be going inside, now?”
“After you, Emi.” Novella said.
“No, Novella, after you.”
Today marked the start of a new friendship.
CategoriesThe StoryTags,elf cycle emi lady khara ms khami pip portly man
Previous PostPrev Post Chapter 65: I Love You For Right Now
Next PostNext Post Chapter 67: Repairs
2 thoughts on “Chapter 66: Arrivals”
Pingback: Chapter 65: I Love You For Right Now - Hands Held in the Snow
Pingback: Chapter 67: Repairs - Hands Held in the Snow | cc/2021-04/en_middle_0020.json.gz/line813 |
__label__wiki | 0.5598 | 0.5598 | Own one of the Hottest Franchises in the U.S.
Since 2004, we have made it our mission to serve delicious, handcrafted chicken tenders, right in your neighborhood. Through countless hours of hard work and a commitment to fresh, top quality ingredients, we have developed the Huey Magoo’s brand successfully throughout Florida.
Owning a Huey Magoo’s franchise takes significant dedication, along with a belief in the basic adages of quality and customer service. These principles are the foundation of the brand today, and our future depends on never losing sight of that fact. With that in mind, we have prepared information and answers to some frequently asked questions below to make it easy to see if owning a Huey Magoo’s franchise is something that you would be interested in.
If after learning more about our brand, you feel that pursuing a Huey Magoo’s franchise is something that you feel as passionate about as we do, I invite you to contact me at andy@hueymagoos.com or 214-293-1564.
As CEO of Huey Magoo’s, I’m happy to share my expertise on owning a franchise that is as great as Huey Magoo’s. Thank you for your interest, and I look forward to hearing from you.
Andy Howard, CEO
Join the Huey Magoo’s Family Today!
Loganville, GA Ribbon Ceremony on December 3, 2019.
If after learning more about our brand, you feel that pursuing a Huey Magoo’s franchise is something that you feel as passionate about as we do, I invite you to contact me at andy@hueymagoos.com or 214-293-1564. As CEO of Huey Magoo’s, I’m happy to share my expertise on owning a franchise that is as great as Huey Magoo’s. Thank you for your interest, and I look forward to hearing from you.
DOWNLOAD OUR FRANCHISE KIT
Q: What is Huey Magoo's franchise fee?
A: $35,000.
Q: Can Huey Magoo's help with financing?
A: We do not offer direct or indirect financing. We do not guarantee your note, lease or obligation.
Q: What are Huey Magoo's royalties and marketing fees?
A: 5% Royalty and Marketing fees of 2%.
Q: What is the size of a Huey Magoo's unit?
A: 1,900 to 2,200 sq. ft.
Q: What does my training include?
A: 17 days of on the job and classroom training.
Q: Where do I receive my training?
A: Corporate training store and franchisee store.
Q: What support will I receive after initial training is completed?
A: Huey Magoo’s provides ongoing assistance with your restaurant with on site visits as well as a 24hr questions hotline.
Q: What are the steps in the Huey Magoo's franchise application process?
A: For more information about owning a Huey Magoo’s and to receive a copy of our Franchise Disclosure Document (FDD), submit the completed application, and we will be in contact with you.
Q: What sites or markets are currently available?
A: Southeastern U.S.
Q: Will I have a protected territory for my franchise?
A: We will not locate or open a competitive business under the Marks and using the System in Your Territory, either company-owned or franchised, during the term of the Agreement.
Q: How do I find a real estate site?
A: Once you have been approved, you can submit your preferred territories. Huey Magoo’s will provide assistance and final approval of your site.
Q: How many units do I have to commit to?
A: In most available markets Huey Magoo’s is seeking to partner with franchisees who will own several units. The minimum is 3 units over a 3 year period unless otherwise approved by franchisor.
Q: How long has Huey Magoo's been in business?
A: Huey Magoo’s started in 2004 in Oviedo, FL.
Q: What are the financial requirements for becoming a Huey Magoo's franchisee?
A: A franchisee is recommended to have a minimum of $250,000 in liquid assets and a net worth of $750,000+. Per location.
Q: What is the cost of opening a Huey Magoo's unit?
A: Overall, the initial financial obligation is $338,380 – $569,800.
Net Worth *
---Under $ 1 million$1 million - $1.5 million$1.5 million - $2.5 million$2.5 million - $5 millionOver $5 million
I'm interested in *
---Acquiring existing restaurantsDevelopment of a new restaurant
Liquid assets you are willing to invest? *
---Under $750,000$75,000 - $1 million$1 million - $1.5 millionOver $1.5 million
Do you have partners? * ---YesNo
Please check all that apply *
I have restaurant business experience I currently am (or have previously been) a business owner I have a current line of credit or access to capital I am currently a multi-unit franchisee I am seeking a multi-unit opportunity I, or one of my partners, has QSR Restaurant Experience
To learn more about franchising, please feel free to contact me at andy@hueymagoos.com or 214-293-1564 | cc/2021-04/en_middle_0020.json.gz/line818 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.