Split (1)

train · 530k rows

pred_label stringclasses 2 values	pred_label_prob float64 0.5 1	wiki_prob float64 0.25 1	text stringlengths 74 1.01M	source stringlengths 39 45
__label__wiki	0.652536	0.652536	huffiest huffiest.com Home/norway/Bendtner was sentenced to 50 days in prison for violence against taxis Bendtner was sentenced to 50 days in prison for violence against taxis norway November 2, 2018 norway MP story-top module Copenhagen / TRONDHEIM: The city court in Copenhagen sentenced Nicklas Bendtner RBK to 50-day imprisonment after the September multiple-violent episode in Copenhagen. Taxi drivers were acquitted by three city court judges. The prosecutor bribed Nicklas Bendtner for three months in unconditional jail and 20 days for taxi drivers. Bendtnert was burdened with simple violence after stealing the taxi and not dressing. Taxi drivers were accused of attempting violence and telephoned over a car while driving. Bendtner denies the punishment, but admits he was with the taxi driver He refused the penalty Nicklas Bendtner arrived in Copenhagen on Friday morning with a morning flight from Trondheim, who came to his lawyer in gray suits. In the rest of the morning, the RBK spiked and taxi driver explained to the court what happened on the night of September. Both Bendtner and the taxi driver refused to punish the violence and the violence. The video about the taxi shows that Bendtner and his girlfriend disagreed with the taxi drivers on the way home and left the cab after 400 meters after the taxi. The video showed that the taxi drivers repeatedly shouted at the couple when they left. Bendtner on the trial: "Tomorrow we are all skeptical of many things Recognizing that he was struck After calling a colleague, the taxi driver turned and led to the couple. In court he admitted that he had said that "her mother's grave swore that she had beaten or broke Bendtner." When he found the party at the National Bank, he continued to shout bad words and throw a metal box after it. He went out of the taxi and Bendtner, then hit the RBK. Danish experts: – In Denmark, Bendtner is almost like a blend of an athlete and a real star Bendtner said in court that he defeated self-defense and was afraid of what was happening to him and his girlfriend. The taxi driver dropped into the ground before he got up and drove away. Looking back, it turned out that he was injured in breaking the face and jaw. The accusation says Bendtner had to kick the taxi driver after landing. Bendtner refused to kick the driver, but he said in court that he had crossed the taxi to see if it was okay. Beside Bendtner and the taxi driver, the colleague talked with the driver, and the police was on the spot for the first time. After the plan, Bendtner's girlfriend must also testify, but he has fallen due to the time pressure. Sia: – – It’s painful and full of satisfaction (+) Rana has so far managed to vaccinate more people than they received doses, but does not want Oslo to have a greater share in the future: – Eliminating vaccines on behalf of the people of Rana is not something we want to do – Rana Blad Attack on the US Congress: Black PS5 with PS2 theme launches tonight – how to order News studio – Now comes the cold Stella Tennant: – Reveals the cause of death Powered by https://huffiest.com \| Designed by huffiest	cc/2021-04/en_middle_0039.json.gz/line823
__label__cc	0.548189	0.451811	A measure of respect for a tyrant » « For the love of all that squelches and chitters and slithers and clicks… She’s gone and done it now The daughter has put up a post with her thoughts on abortion—I swear I have not given her any instruction or even talked about the subject with her, but somehow she has developed roughly the same opinion on it that I have…which means, of course, that the kooks will whine at her. I can’t even imagine what her former peers at high school will say, but it might be explosively fun. There’s a little bit of Mell in that girl. (Speaking of Mell, you all know that this is the last day of one of my favorite webcomics, Narbonicon, right?) rrt says Narbonic is ending? Yes, sorry, been in a cave/only recently started reading it (starting with the archives, naturally). And now I’m hesitant to dig in and find the answer to this for threat of spoiling the 4 years’ worth of story I’ve yet to consume. So if it’s not too much trouble to ask…could anyone clarify that point for me in a spoiler-free fashion? …and sorry for the distraction. Go “Mell” Myers! A good read, but reminded me of something I wanted to share: > We have too many people on this planet already. It’s a problem. This isn’t really true anymore. Even Mexico is down to 2.1 children per woman (“replacement rate”) — I occasionally ask people what they think the number of children per woman in Mexico is, and usually get answers around “6”. (Which it was, around 1975.) Anyway, the link I wanted to share is: http://tools.google.com/gapminder/ Very interesting to see that birth rate drops strongly with education and money, which suggests that as soon as women realise that they can stop having children, and that they won’t be better off by having more, they stop. Also, it’s sad to see how many African countries had an excellent life expectancy and economic outlook before 1985.. Caledonian says Irregular Webcomic! is also ending. writerdddd says Great to see a young person with the guts to speak out on such an important topic! Skatje: We have too many people on this planet already. It’s a problem. Christ: This isn’t really true anymore. Indeed, in Japan and much of Europe, the problem is quite the other way around. And it may be a more difficult problem. The solution to a population growing too rapidly is to stop having so many children. The solution to a population that is declining is to start having more children. Except that by the time it is noticed, the would-be parents who need to do that are already past childbearing. And their children aren’t there to do so. Quite a few nations are now locked into large population declines. Demographics has a way of averaging out. But the consequences of this shift may be more interesting than most suspect. Crosius says It’s not that we have too few people, it’s that we have to few people to fill the present infrastructure. But just because the infrastructure isn’t filled doesn’t mean we should expand our population to fill it. That’s like overeating because all the clothes in the closet are XXL and won’t fit anyone who doesn’t stay obese. The correct solution is to re-make the clothes, not eat to fill the clothes. We’ve been living an over-consumption lifestyle, and our cities have grown fat to accomodate our overconsumption. Rather than maintaining our corpulence, we should be looking at healthy ways to pare down. Alon Levy says I advise everyone to stare at the graph of Romania’s maternal mortality rate, plotted against its abortion policy. Remember that next time you rant about the right to life. Ian H Spedding FCD says Do we have too many people on this planet? I would lean towards to this view as well but are there any objective measures of the carrying capacity of the planet as far as the human population is concerned.? Aren’t many of our problems as much a result of poor organization and administration as they are a result of our outstripping available resources. I suppose we need to step back one step and ask, “too many people for what?” What is the problem, really? Sure, lots of people lack access to basic needs of life, and so forth. But does it necessarily follow that no occupation exists for people that would help them get access to what they need? I’m not suggesting that people are not in trouble and need help. I’m just suggesting that we think of human beings as valuable and think of ways to maximize their value to themselves and to society. A good place to start getting a handle on it is Stuart Pimm’s book “The world according to Pimm: A scientist audits the earth”. It goes chapter by chapter estimating the current use of each major resource, and is easy to read and understand. Human population is definitely a problem. It has nothing to do with whether you can feed and house all people. It has to do with humans taking up so much space, using up so much of the environment, and producing so much waste. We have been an invasive species and are becoming more and more detrimental to the health of the biosphere. Whenever I hear of population declines I feel relieved and whenever I hear of yet another country crossing the 1 billion mark, or like the US crossing the 300 million mark, I get worried. Here’s a nice little thingie: What do you get when you feed starving people? More people. I’m not saying to get all Eric Pianka, but lets try to stop people from pumping out so many kids. Jake, why do you think fertility rates are so high in the third world? Karley says Overpopulation worries are probably my most prevailing neuroses. Mostly because I’m a misanthrope, though. My line of thinking- if everyone is unique, and humanity is on its way to 7 billion people, what’s so special about being unique? Does more people cheapen the worth of the individual? More importantly though, will there come a time when I can never enjoy a meal in a restaurant without enduring the ear-splitting screams of someone’s else’s spawn? ;) Dlanod says What the spawnless seem to forget is that it will be other people’s spawn that will be looking after them in their declining years. Educate and treat them well now or look out later! :-0 poke says If you value wilderness we’re already vastly overpopulated. In my opinion, while the answer to the question “is our ecological footprint the smallest it possibly could be without sacrificing scientific and cultural progress?” remains “no”: we’re overpopulated. I think we could probably do just fine with 90% fewer people than we have now. N says Poke: you seriously think that 90% of the people alive add no real value for the rest of us? I’m not accusing you of wanting to kill them off, just questioning whether we would “do just fine.” I think that, sustainability and quality of life being equal, more people is better because it naturally results in more diversity and more creation. Kevin T. Keith says She sounds like a great kid. Very impressive. But I couldn’t help noticing she posted “That . . . is the most serious thing you’ll hear out of me for a while. It’s vacation, come on.” on 12/29, then followed it up with a long post on her pro-choice arguments a day later, and “why there is no god” one day after that. Those are what she considers non-serious topics?! I didn’t really give it enough thought to say I seriously think it. But given the number of people in destitute poverty, etc, I’d guess the number of people providing any real value at all (to be unfortunately blunt) is around 2-3 billion. If you tried to pare the figure down, in the way I was talking about above, I think it could get close to half a billion. World population didn’t reach a billion until the 19th century and took over a century to reach 2 billion. As late as the 60s it was still under 3 billion. I don’t think we’ve seen much “diversity and creation” in that time as the result of population growth. The last 4 billion we’ve added seems to have resulted more in extreme poverty and shanty towns. (I don’t want to appear to be saying the third world has nothing to contribute; I just don’t think population growth has helped these cultures flourish.) Actually, I think there’s an argument that population growth has had negative effects on cultural diversity: population growth necessitates economic development and separating economic development from the intrusion of Western cultural norms is difficult. Slower population growth and slower economic development would probably allow a society to follow a more unique path of cultural development. Tim McCormack says Yeah, she seems to be a heck of a kid. If I ever spawn (unlikely), that’s that kind I want! So abortion has lowered the crime rate? And that is because the majority of abortions on on minority babies! The Klan would love you. So would David Duke. “Diana”, just a guess here, but I really don’t think the Klan likes PZ or Skatje very much at all. In fact, I don’t think you even think so — you’re just trying to muddy the issue with some emotional gibberish. hoody says swr hv nt gvn hr ny nstrctn r vn tlkd bt th sbjct wth hr, bt smhw sh hs dvlpd rghly th sm pnn n t tht hv… WHT. VR!!!! Y nclct yr pnns n yr kds, PZ. t’s clld prntng. Stp mrvlng t t. Skatje says Kevin, I really did try to relax on this vacation. High school kids using poor arguments on why abortion is murder and god is awesome provoked me into doing this. Now I’m out of topics to post on, so it’s nap time. Speaking of high school, I haven’t heard “WHAT. EVER!!!!” used in a while. Noooooooo! Not nap time! It’s time to CLEAN YOUR ROOM! You were also going to make muffins today. David Harmon says ZZT: Narbonic wrapped up the day of NYE. I will say that despite Shaenon’s teasing, we do get a happy ending, including a wonderful wrap via Little Nemo…. Indeed, a well-written and -argued post, you can be proud of her. About the only thing I’d add is that there is in fact a “traditional” alternative to late-term abortion, which is “post-term abortion” — infanticide. If the woman can’t raise it and her community won’t… well, something has to give, and the more choices get ruled out, the fewer are left. Amanda Marcotte says w00t! I like to see a youthful patriarchy blamer working those blaming muscles. Very awesome stuff. Roman Werpachowski says Dad, could you help me get more traffic to my blog? PZ Myers: No problem, kid! Just kidding ;-) Rokesmith says Dr. Meyers, I’m in possession of correspondence between yourself and a University of Texas at Austin student by the name of Mark. Mark handed me a copy of his email addressed to you, and your email response addressed to him dated February 25, 2009, as citing evidence that would require me to eat the page upon which your response was printed. Mark presented me your remarks as said evidence to be eaten because during the Justice For ALL Exhibit (www.jfaweb.org) presentation at UT-Austin several weeks ago I was heard to offer to eat the page of the biology textbook in use on the UT-Austin campus that asserts that “someone having human parents can be something other than biologically fully human, at any point in their existence.” I proffered my eating-the-page challenge that day in response to numerous students’ claim that the offspring of two human parents was not biologically human until birth (in their defense most of them were not science majors). I did not eat the page that Mark handed me that day because it did not contain the evidence I requested. Which is why I now write to you. You claim to have knowledge of such documentation. In fact you make the bold assertion in your correspondence with Mark that “[Human] life does not begin at conception” followed by “…There is never a ‘dead’ phase — life is continuous. Sperm are alive, eggs are alive; you could even make the argument that since two cells (gametes) enter, but only one cell (a zygote) leaves, fertilization ends a life. Not that I would make that particular claim myself… .” I’m encouraged that you don’t make the claim that human fertilization ends a human life; however in postulating the argument you seem to grant nebulous scientific credibility to those who might make such a claim? For what purpose? Surely not to discredit my position. Unless you believe in the possibility of an extra-physical or metaphysical existence, I seriously doubt that you believe your own assertion that “…There is never a ‘dead’ phase — life is continuous.” On what evidence do you base your assertion that “life is continuous?” Do you believe in life after death in some physical or metaphysical sense? If you mean by this that at least one human self-directing organism must contribute living genetic material in order for a new member of the human species to come into existence, I quite agree. But you have labeled my assertion “simplistic” and “nonsensical” that sexually reproduced human life — I’ll go further than that — all new mammalian species members, have a beginning, and that that beginning is the conception of the species member. So professor, you’re on the record; from a biology or human embryology textbook in use on an accredited university campus (your own University of Minnesota-Morris campus would be fine), please cite chapter and page that unequivocally states that “human life does not begin at conception.” I look forward to your reply. Respectfully, Nerd of Redhead, OM says Mr. Rokesmith, please read your bible. Human life begins one month after birth. Your bible doesn’t lie, does it?	cc/2021-04/en_middle_0039.json.gz/line843
__label__cc	0.638338	0.361662	Friday Cephalopod: Christmas toy! » « A clever compromise Ron Paul is one freaky, scary dude My apologies for reopening old wounds, but if you want to know what Paul really thinks, just take a look at his newsletters. Politics, History, and Law “Ron Paul didn’t write those, the guy he hired did without his knowledge” apologists in 3…2…1… Hank Fox says PZ, shhh. Wait until he gathers real momentum and begins to swing the GOP center. Rich Stage says You’re right. I think Ron Paul is bad. He’d be the worst president we’ve ever had. His racism sucks, but he brings in the bucks even though he’s an insufferable cad. But people are easily swayed. They buy the foundation he’s laid. They’d get along with you, only until they knew You were an atheist, Jew, or gay. It’s good to see this out in the press. Maybe we can avoid a big mess. It’d be refreshing to see someone run rationally but the chances are slim, I confess. JimBob says When are you going to challenge the fact that all the candidates you haven’t challenged support the most oppressive form of racism there is? Our fruitless war on drugs. Yeah. Lets be quiet and hope he wins the nomination and then clobber him with these afterwards. K. Signal Eingang says “ronpaulforums.com” is apparently going berzerk, with people claiming these were obviously forgeries by the evil MSM to discredit Paul, and a particularly tortuous line of reasoning that argues that the racist language in some of the articles proves that Paul didn’t write them because racists are always very careful to hide their racism. Or something. Here’s a kooky little number that’s indisuputably Paul. Funny thing is I remember Fox Mulder going off on this on the X-Files. Wonder if the writers got his newsletter? schmeer says I propose a contest of dueling poems between Rich Stage and Cuttlefish. Would that poem be considered in limeric form? There’s not a single profanity! I thought that was a violation of the official Limeric Rules. Logician says Thanks. It’s nice to get this all on one easy to reference page for the morons who blizzarded this site earlier. Of course, they’ll take the same line as the apologists in the the article. Again and again I’ve quoted this misogynist troglodyte and again and again his sycophantic apologists have lied, obfuscated, and flat out denied that the words coming DIRECTLY out of this aberration’s mouth were his own. At best, if these newsletters were put out UNDER HIS NAME and he DID NOT KNOW what they said, he demonstrates a level of incompetence no sane citizen wants in the White House. At worst, if these newsletters were put out UNDER HIS NAME and he DID KNOW what they said, he needs to be institutionalized, NOW. And so does EVERY ONE of his stupid, idiotic, and sadly atavistic supporters. A more disgusting bunch of ill-informed, sterilization-needing, shit-for-brains pigs outside of the Ditto-heads doesn’t exist. But, just like evolution (which Paul again and again and again DENIES) they will simply ignore it and barge back here with more stupidity. Robert Thille says The sad thing is, there are some issues where I agree with Ron Paul: foreign policy, smaller government, less governmental involvement in personal matters. Too bad he’s a bat-shit crazy, racist, religious conservative who believes that the separation of church and state is wrong. That’s not entirely correct Schmeer (#7). Rich used “laid” in the second verse in a double entendre. ;) Lets be quiet and hope he wins the nomination and then clobber him with these afterwards. That would be horribly, horribly bad. What I see happening is that, whoever gets the Republican nomination, they will get the misogynist/racist vote. This could lead to Very Bad Things©. Richardson would have had my vote, because I can’t trust Hillary, and Obama lacks experience, but at this point I’m willing to vote for Kucinich to keep any of the Republican front runners out of office. garth says #4: single issues do not a candidate make. while the WOD is a huge screw-job, supporting a fucking whacko like Ron Paul is just idiocy. There’s not a single profanity! I thought that was a violation of the official Limeric(sic) Rules. True, but I am following a ruling that has a more profound and immediate effect on my life and limericks: I can’t write anything that I wouldn’t let my daughter read. Thus spaketh my wife, and so mote it be. For ever and ever. Ramen. tballou says I would gladly trade a repudiated racist past for an end to the ongoing bloodbath in Iraq, no war with Iran, an end to our ridiculous war on drugs, restoration of our constitution, no more warrantless spying on Americans, no more standing armies on foreign soil, no more…. You get the idea. Show me the perfect candidate and I will then confirm the existence of a god and heaven. There isn’t a democrat running I wouldn’t vote for to beat any of those republican clowns. I haven’t ever had a reason to vote for a republican. I doubt I ever will. Olaf Davis says I realize this is slightly off-topic, but: JimBob @#4: Whatever the war on drugs may be, it is definitely not the most oppressive form of racism there is. As a counterexample, consider the many genocides are frequently perpetrated around the world. Perhaps you mean “…form of racism directly sponsored by the US government”? That would be a less unreasonable claim. gwangung says That’s nice. But that’s not Ron Paul. double entendre I feel better already. Limeric(sic) Stinking autocorrect in MS Word caused a lack of red squiggly line to lead me to believe I had it spelled correctly. I’m so ashamed. Moses says Arguing with Paul-bots, like the Borg, is fruitless. Set phasers on kill, Mr. Data: http://ronpaulsurvivalreport.blogspot.com/2007/12/faq-ron-paul-and-his-racist-newsletter.html Troy says tballou, Ron Paul also stands for the rollback of right-to-privacy jurisprudence, on a state-by-state level. That means the landmark decisions: Griswold, which restored the right of all women — in Connecticut and in every state — unfettered access to birth control, Loving, which restored the right of all people of color — in Virginia and in every state — to marry whoever [of the opposite sex] they wanted regardless of skin color, Roe, and Lawrence which restored the right of all consenting adults — in Texas and in every state — the freedom to insert or receive a penis in any bodily orifice they desired. Iraq will wind down as it will. The great bulk of the damage has already been done, and the next president will play Nixon’s role in the tragedy. The warrantless spying problem, as with nearly all problems these days, is a Republican issue. Don’t vote Republican, problem solved (eventually). The previous Democrat presidents have shown good judgement in limiting the unnecesary growth of the military. We will always have a “strong military” because it is a jobs program and the American people are too stupid not to see the sham involved unless transfer tubes are coming back to Dover by the hundreds. Similarly, most voters in this country are perfectly happy with the war on drugs. They see the damage it causes to their loved ones, and want the Nanny State to do something about it, even if it is unconstitutional. I understand these subtle realities are too “Gray area” for a Paultard to grasp, but, at any rate, good luck with your quest for libertopia in government. Hopefully you’ll find a new libertarian hero without such clay feet next time. Christianjb says We’re faced with two unpleasant choices: Either he wrote them, or he let others write articles in his name in his newsletter, without taking the care to even read what his ghost writers had to say. I’m inclined to believe the latter- he doesn’t seem like a bigot. Ending the war in Iraq, ending the war on drugs and ending the death penalty seem like positions of someone who wants to improve the conditions of minorities in this country. It’s still a great pity to me that he’s such a nut on most other issues. he doesn’t seem like a bigot. he has some nasty, nasty quotes from the early 90s, in reference to the LA riots. He’s of the same mold of Trent Lott and Jesse Helms — “states rights” so we Southerners can re-order our society the way we had it, essentially. The rest is pandering to the Paultards. 12 & 16. I correct myself. The War on Drugs is the most oppressive form of racism in the United States. If we are debating severity and then you are with my point. I’m not defending Paul I’m addressing the shallow way PZ is addressing the issue of racism. Just like the recent fluff over comments an announcer made concerning Tiger Woods we in this country get all high and mighty preaching to the choir about some pitiful little words while ignoring the issue. Complaining about this candidate’s silly stereotyping but ignoring how all the candidates support ruining people’s lives in the war on drugs is to swat a fly and pay no attention to the enormous pile of shit that attracts them. Edwards, Obama or Clinton either one will work for me. It may be shortsighted of me, but the two main things I want from a president-elect is that he or she 1) Get us out of Iraq instantly, and 2) Vigorously investigate and prosecute this lying, vicious, arrogant, lawless, torturing, treasonously unAmerican nest of snakes in the White House and the GOP. Government is really a fiction, when you think about it. It works only if the people governed believe that it works. I don’t believe the confidence, the belief, can survive the Bushistas. Actually, I think confidence in American government, both here and abroad, is dead already. The one thing that can revive it, imho, will be these prosecutions. I still say Bush should end up running a tire store in Crawford, Texas. That might be barely within his mental capacity. And if Rush Limbaugh just happened to end up in prison for his “alleged” drug crimes, they could make it into a sitcom (I suggest calling it “Rush to Judgment”) and I’d watch the entire first season. Thanks again for helping to spread this article, PZ. It’s good for people to know that their deified “FOUNDING FATHER” in the flesh is a disturbed man who keeps disturbing company. His cowardly “i already told you i ‘took responsibility’ for this, i don’t have to actually do anything to do so, and i wish you all would just shut up about my signatures, my articles, my paycheck, and my friends that i still employ in my campaign” rebuttal is telling. jimbob, I think the war on drugs is a great idea. Granted, we’re prosecuting it wrong, but I don’t want to live in a nation of potheads and crank addicts, TYVM. But the root cause of the drug problem is lack of equality of opportunity. The libertopian Policy Closet is fucking barren about how to address this fundamental issue. Not that the Democrat’s historical solutions have been any great shakes, but as a left libertarian I hold that redistribution and reinivestment in the productive capacity of every American — world-class education for everyone, regardless of ability to pay or skill level, world-class health care, world-class public transportation. The libertopian policy solution is to stop taxing everyone and let the free market work its magic. That was bullshit in the 18th century and it’s bullshit now. Europe has the social-democratic model we can learn from, should we, by some miracle, raise our collective IQ above room temperature. “The War on Drugs is the most oppressive form of racism in the United States. If we are debating severity and then you are with my point. I’m not defending Paul I’m addressing the shallow way PZ is addressing the issue of racism.” Funny, you sound just like a Paultard, they love to claim that finding Paul personally revolting means that you hate liberty, are pro Giuliani, want the War on Drugs, and that you can’t possibly believe that one could agree with some of Paul’s ideas (such as ending the War on Drugs) and still find him a terrible little bunker-dwelling Mr. Magoo of a supremacist. [quote]restoration of our constitution[/quote] Yes, but most people would like to restore the constitution 0f 1999. Ron Paul would like to restore the constitution of 1799. Yeah, because a racist president is no big deal if everyone can smoke as much pot as they want right dude? Pass the bong. I think I said the exact same thing to this moron here in town just yesterday. It’ll be easier to stomach the Creationism in public schools Ron Paul endorses, seeing as his (AND THE ONLY!!!#@) interpretation of the Constitution is that the separation of Church and State only means that we can’t have an official government religion, but we can stuff our state and federal government with as much Christ as it can hold. I’m inclined to believe the latter- he doesn’t seem like a bigot. Do you think they all run around with shaved heads or wear white robes? Most bigots are far to clever to operate in the open like that anymore. I judge Paul, not only by what he wrote, but the context of his life. Having seen his deliberate associations in the past with militia and extremist (frequently racist) groups like the CCC and John Birch society I feel no need to turn off my rational judgments. Having read his unsoliticited racist opinions on things for which he didn’t need to give opinions, and the deliberating passing on phony stereotypes like “95% of black men in Washington are criminals” I’m of the opposite view. Those racist comments in his newsletter were exactly what I’d expect from a closet racist and someone who is willing to speak to closeted racists. To speak at John Birch and CCC events. To deliberately pass along phony racial stereotypes (the criminality issue). I’m sorry. He may not be running around yelling Nigger. But his was no less racist than O’Rielly’s “innocuous” account of eating at a black restaurant and being “surprised” that blacks act like whites instead of yelling “Where’s my ice tea motherfucker” and that sort of crap. #26. You really think the war on drugs is a great idea. Did you miss the whole prohibition era and how it was a miserable failure? Do you think that we should also ban Alcohol and Tobacco? We have a nation full of potheads and crankheads. Nearly everyone who wants to use these things is doing so already. We only create a market for the bad crimes associated with the business transactions of these products by making it a criminal act to put crap into your body. The war on drugs is indefensible. Racism is indefensible. Your pet issues doesn’t give him a free pass. Your repeating it over and over, got boring quick. Move on. Ron Paul will never be anything more than a footnote. He’s a fucking douche bag. Sarcastro says I think the war on drugs is a great idea. Granted, we’re prosecuting it wrong, but I don’t want to live in a nation of potheads and crank addicts, TYVM. And I don’t want to live in a nation of pathetic sheep. But I’m stuck with you and you’re stuck with me asshole. We WANT Ron Paul to get more attention you moronic fucks. If the ideas he espouses that AREN’T batshit crazy get traction then the candidates who aren’t flaming fucktards will be less scared to embrace things like an INSTANT end to the war in Iraq, drug decriminalization and the dismantling of our budding police state. But hey, if living in a fascist state is worth it so you won’t have to deal with people who aren’t like you then go ahead and make sure the Repubs nominate someone who will make Hillery and co’s police-state garbage more palatable. Because, quite frankly, if you think any of the leading Dem candidates will end this war ASAP or do one god damned thing to stop the further erosion of our nation into a corporate police state then you are dumber than a sack full of fucking hammers. YSTH says There’s a blog that claims his “aide” was Lew Rockwell. And that it was Lew, Paul and Burt Blumert who wrote the letters. Scroll down to the “Ron Paul debacle exposes the racist underbelly in the Rockwellian camp” post from 1/9. http://rightwatch.tblog.com/ The reason he’s ignored is because he’s batshit crazy. Keep dreaming. negentropyeater says #26 “Europe has the social-democratic model we can learn from, should we, by some miracle, raise our collective IQ above room temperature.” UK living standards outstrip US for first time in over a century http://business.timesonline.co.uk/tol/business/economics/article3137506.ece Posted by: jimbob \| January 11, 2008 2:07 PM Nothing of which makes Ron Paul palatable or makes the “War on Drugs” a defacto form of racism. Racism has many definitions, the most common and widely accepted being the belief that human beings are divided into more than one race, with members of some races being intrinsically superior or inferior to members of other races. Bigotry is not racism. For example, you can hate blacks, Chinese, Japanese, etc. but not feel that they’re inferior. My mother is, when it comes to Asians, a classic bigot. She picked that up from the WWII propaganda, plus long-term anti-Asian bigotry, that floated around California when she was a child and, to my shame, is still with her today. She taught me better, ironically, and we’ve actually had unpleasant words over it. But, in no way, shape or form does she feel that Asians are “inferior.” She just doesn’t like them because that was how California was during the 1930’s through 1950’s. Racism is not bigotry. You can believe your race is genetically superior, but not actually hate the “inferior races.” I know a person whose best friend is a black man. Yet this person (who is white) believes that the black ‘race’ is inferior. But since he associates with people on an individual basis, he can live with this inherent contradiction and not have his head explode. Heck, my best friend is a black man and he believes that blacks are genetically superior to whites, hence that’s why sports is dominated by blacks. I laugh at him and call him “Victor Oreo” because he’s ‘black on the outside and white inside.’ The sad fact is that Racism and Bigotry often live together more than they don’t. But they are not, by necessity, the same. And while not everyone has my life experiences to draw upon to get to this particular conclusion, I think just going beyond a cursory and reflexive understanding of racism and bigotry can lead to understand these complex, and frequently over-lapping, issues. Posted by: Sarcastro \| January 11, 2008 2:15 PM Ah. How to win friends and influence people. You should write a book. :snicker: I don’t care much if … a 70 year old grandfather living in some village in the midwest has an understanding of this world full of racist prejudices, but I do get a “bit” worried if … he becomes the most powerful man in the world. Glazius says I want Ron Paul to keep showing up in Republican debates, if only because the presence of someone who doesn’t buy into the “global policeman” groupthink makes it easier to see it for the load of garbage it really is. I would not, however, vote for him for president. you are dumber than a sack full of fucking hammers I think my friend’s wife has a drawer full of fucking hammers. Is it wrong of me to have gotten a negative opinion of someone before I even knew of his personal views solely because every single one of his supporters comes across as an unhinged rabid lunatic worshipful fanatic? This is the liberterian ethos From the Wild Angeles movie(1966 Aip Roger Corman Dir) Peter Fonda in response to the cleric “We Wanna Get Loaded Man” Teenage Lobotomy says Ric says I wouldn’t mind getting loaded, but I’m no libertarian. I’m a liberal all the way. so once ron paul becomes president he’s going to let the south secede? think he’ll let minnesota join canada? Please do not encourage him. Signed, Teenage Lobotomys Doctor Napa state Mental Hospital. cooler says Ron Paul rebutted all this on CNN. PZ myers is just a fraud whos biggest accomplishment is having a popular blog so he thinks hes god. I hope you idiots enjoy ww111 with Iran which is what youll get with hillary/guliani TROY – I just don’t accept that Paul would support the rollbacks in privacy jurisprudence you cited. He may not agree they are federal issues, but privacy is a fundamental libertarian value, and in any event this would require Supreme Court or Congressional action. I would think a soon to be Democrat Congress would hold firm here. Iraq will not wind down as long as we are there. There is plenty of opportunity for it to get much worse and our presence there only aggravates the situation. And I dont trust Clinton or Obama to get us out any time soon. The warrantless spying problem has been facilitated if not approved by far too many Democrats, as have many of the other Bush abuses, Iraq being the top of that list. I want to hear the Dems say no more, but I dont think they have yet. “limiting the unnecesary growth of the military” is not much of an accomplishment. Why must we be satisfied with that very meager accomplishment? Lets defend the US and let the rest of the increasingly prosperous and capable world handle their own defense. Besides, the main threat to the rest of the world right now is us! Being perfectly happy with the war on drugs is also not much to be proud of. Why must we waste billions and all the human capital? And thanks for the gratuitous insult. I will continue my quest for Liberty, standing on the shoulders of the giants who wrote and approved our constitution! Teenage Lobotomyi says #48 Now you done it Lobotommys gettin loaded playin Davie Allen and The Arrows “Blues Theme” where’s the Loser and Nancy Sintra? signed,Teenage Lobotomys docter ron paul apologist says Ron Paul didn’t write those! Anyway, he just thinks racism should be delegated to the states, so he won’t institutionalize racism anyway! Also, Congress will keep his racism in check! And at least he’s honest about his racism unlike all the other politicians! Taking away someone’s right to racism is coercion! A Ron Paul Apologist Moses: If he wrote those newsletters then he is a racist. I simply don’t know enough in this instance to judge if the ugly accusations against him are true. I can say that I haven’t detected any bigotry in the few speeches I’ve heard from him. We do know for a fact that he’s not a believer in evolution. AlanWCan says Say what you will, it’s just nice to see some rethugs that aren’t all cast form the same Reagan-Bush-Reagan mould. With any luck, between Ron Paul and Huckabee they will tear the GOP apart, leaching out the kneejerk libertarian blind neoliberal capitalist fucktards on the one hand into donating all their money and votes to Ron Paul (hey, if he’s such a stand up for yourself libertarian, why is he taking cash handouts?), while on the other the whacko fundie babble thumpers jump ship over to their new Huckster daddy figure du jour, leaving the frothing at the mouth chickernshit chickenhawk Guiliani/McCain war mongers without enough votes from the testosterone block to drive your entire political landscape a bit to the left. The only one in the whole sad and sorry race that doesn’t seem like a cynical delusional corporate whore rich kid asswipe is Kucinich (so what if he saw a UFO? Bush talks to Jebus and Mitt Romney wears magic underpants), and he doesn’t have a hope in hell for that reason. Since when do you allow TV stations to pick and choose your political candidates? What is wrong with you down there? Rey Fox says “I hope you idiots enjoy ww111 with Iran which is what youll get with hillary/guliani” I wasn’t aware that there were 110 World Wars in history. But rest assured that none of us would vote a Hillary/Giuliani ticket, unless the opponent was, say, Huckabee/Brownback. Or Ron Paul. snicker Ron Paul rebutted all this on CNN ryanb says I’ve always been socially liberal, fiscally conservative. I like a lot of Paul’s message, along with the other candidates. I also don’t like a lot of what I see/hear from all of them. The thing is he’s the only one standing up there explaining to me why he shouldn’t have all this power. This is America. The man can believe what he wants, that’s his right. I just don’t understand this notion that we all have to think exactly the same on all the issues, or else the world will end. Huckabee, I believe, would force his opinions on me in the form of law, which is why I would never vote for him. By comparison Paul spends all his time explaining to me all the reasons he should not be allowed to do this. Ok, so he’s a bit weird when it comes to evolution. I’m not sure how a man makes it that far in the medical field without getting this concept, but that doesn’t make him evil. It’s just a different view than I have (mine based on reality, his on who-knows-what). What’s important is he acknowledges that it is HIS view. The man wants to disband the federal governments influence on education. So we disagree, but it doesn’t matter because he doesn’t think the federal government should be in that business anyway. On this we agree. This is all that matters. As long as we agree to abide by the Constitution and Bill of Rights then we can all have different opinions on all this stuff and it just doesn’t matter. We each can live our lives as we see fit. We need to be exerting our efforts against people who want to shove their ideals on us in the form of law. Not wasting our time bickering over each nuance of every facet of each others lives. If the federal government wasn’t so screwed up to begin with we wouldn’t even be having these discussions. It shouldn’t matter what the pres thinks about abortion. Nowhere in the constitution did the founders give congress the authority to make laws about it one way or another. Same with evolution education. Nowhere does the president or congress have the authority to influence what we teach children in schools. I’m not for Paul as a person. I am for the Paul that wants to restore a country based on secular ideals. Ron Paul and I can both read the constitution and agree what it says, without being aligned on any social issue. That’s what’s so great about our system of government. As long as we all agree to defend each others rights to whatever crazy nonsense we want to believe, then we’re all better off. mothra says Cooler’s a troll, Cooler’s a troll, Cooler’s a troll. . . dzd says Someone who’s been publicly disgraced to the magnitude that Ron Paul has should end his candidacy, resign from his House seat, and donate his campaign funds to the NAACP and/or GLAAD. Instead we get a speech that makes GWB look like a straight talker, and he clearly now thinks the matter is settled and he can go on his merry way. It isn’t, and he can’t. moon_grrl says I’ve looked and looked at Ron Paul’s website and I see nothing-NOTHING-that would lead me to believe that he’s interested in anything other than being another conservative nutcase with a daddy complex. I matters a whole hell of a lot what a president thinks about social issues when he or she is one of the people who helps to, oh, I dunno, shape the laws regarding them. Plus, those Rontards who position themselves behind every reporter on a TV they can find are getting on my damned nerves. Tulse says I wasn’t aware that there were 110 World Wars in history Perhaps cooler was counting in binary. Chayanov says The Ron Paul apologists always follow the same script. “He didn’t say it. Okay, even if he did say it, he didn’t mean it. Okay, he may have meant it in the past, but he doesn’t mean it now. Okay, maybe he does mean it now, but he’s still better than the other candidates.” That or they’re single-issue voters who close their eyes, ears, and minds to everything else the guy says. WW3 idiots. Wow you guys sure scrutinize Paul, and ignore the blank check hillary gave bush to kill thousands of people, the mandatory minimums supported by the republicrats that hurt minorities more than some stupid newsletter, the patriot act that obama and hillary love, gitmo, having our Navy so close to Iran that a new gulf of tonkin is practically inevetable etc etc. You guys are super annoying trolls. Just for Fairness says PZ, why don’t you link to the rebuttal? It’s a bit unfair. Here’s the link: http://www.ronpaul2008.com/press-releases/125/ron-paul-statement-on-the-new-republic-article-regarding-old-newsletters “In fact, I have always agreed with Martin Luther King, Jr. that we should only be concerned with the content of a person’s character, not the color of their skin.” “I rise in great respect for the courage and high ideals of Rosa Parks who stood steadfastly for the rights of individuals against unjust laws and oppressive governmental policies.” “For over a decade, I have publicly taken moral responsibility for not paying closer attention to what went out under my name.” Would a racist praise Martin Luther King and Rosa Parks? I don’t think so. And no, I’m not a Ron Paul supporter (I would probably vote for Obama if I lived in the US). I just think the evidence against him is weak. Just look for his quotes in old newspapers, as I did, and you won’t find any racist comments. Sili says Tulse, That still leaves 410 unaccounted for. “I’ve looked and looked at Ron Paul’s website and I see nothing-NOTHING-that would lead me to believe that he’s interested in anything other than being another conservative nutcase with a daddy complex” Then please go watch some YouTube debates. He even posted his TV event he did after Fox News refused to let him into their debate. If you are interested in learning about what he actually says, spend a few minutes listening to him speak. “I matters a whole hell of a lot what a president thinks about social issues when he or she is one of the people who helps to, oh, I dunno, shape the laws regarding them.” This is what is so wrong with politics in America right now. This really shouldn’t be an issue. The federal government should not be making laws regarding these social issues. The Constitution specifically spells out that this is a state’s issue. We all seem to have forgotten that. You just do not seem to understand that this is all fabricated. The federal government is not supposed to be regulating these things. By falling into this whole social issue trap politicians have managed to move the conversation away from “whether or not our government should be doing this”, to “which of these social controls should it be doing”. That’s wrong. The constitution spells out our rights. You don’t get people to believe in evolution by mandating it through law anymore than you make god real by mandating everyone pray to him by law. MAJeff says Dude, the shit’s laced. Put it away. Rather deceptive of you, PZ, to simply assert that this is “what Ron Paul really thinks.” Why can’t anybody find anything we know is written by him or anything that he’s actually spoken that would substantiate your assertion here? 20 years in the house, multiple debates, multiple statements from the house floor, multiple interviews, multiple speeches, yet not one instance of racist claims coming directly from him. I suppose you prefer one of these warlord candidates that just wants to keep borrowing from the Chinese in order to send billions to arm the Israeli1s as well as their enemies, prop up Pakistani dictators to enrage Pakistani citizens, prop up the House of Saud to enrage Saudi’s, fund covert operations to overthrow the democratically elected leader of Iran, initiate more war with Iran, etc. Will you be happy when Hillary or some Republican is elected and our government goes bankrupt like the Soviets? BlueIndependent says I was and still am interested in Paul not as a potential candidate for me, but for the truth he speaks, at least when under the light of the television media. In trying to be as objective as possible, I do find it hard to square what I see of him on TV with this TNR story I read on Monday. On one hand I think, how can a man that seems to make sense on a lot of specific issues on TV turn into Mr. Hyde in print? The only answer I can come up with, until hard evidence proves otherwise, is that this guy wrote that stuff or at least condoned its printing over the course of three decades and refuses to renounce it. The favored argument that it wasn’t him that wrote it doesn’t hold water because, if it truly wasn’t him, why do I see his face and signature on some of the documents? It was certainly possible even with old technology to try to assume someone else’s identity; but why has Ron Paul not mounted a full-on legal attack on the supposed fraudster? Has he? Not that I’ve heard, and you would think the Paulite followers would’ve immediately pointed everyone to that proof. Also, why would this fraudster choose Ron Paul to defame? How did this person get away with misusing his name and legacy for thirty years? This fraudster would likely be the most famous and elusive serial libeler in American history if that were the case. Are we to believe there’s a guy running around out there with a vendetta against one Texas congressmen to spew his crap political views using someone else’s name? Has this ever happened to any such person in Paul’s position? There are a lot of holes in the story. I want to at least take the guy seriously for the image I see of him on TV and in video clips, but this is too much. Why can’t anybody find anything we know is written by him or anything that he’s actually spoken that would substantiate your assertion here? 20 years in the house, multiple debates, multiple statements from the house floor, multiple interviews, multiple speeches, yet not one instance of racist claims coming directly from him. Yeah, PZ! Sure, Ron Paul may have had racist comments published in his newsletter, spoken at racist organizations, argued for the right of the racist South to secede, argued that slavery should have been ended by paying racist Southerners for their “property” of slaves, and associated with racists, but that doesn’t mean he’s a racist himself! @ #24: I totally sympathize with your second item, but I guarantee you this: no matter which of the three Democrats gets into the Oval Office, not a one of them will ever prosecute the criminals. It ain’t going to happen. I’d love to be surprised and see them hauled off in orange jumpsuits to Guantanamo Bay, but as far as I can see it, anyone that thinks the long arm of the law will come down on the authoritarians and their boot-licking goose-stepping fodder in this government is on a substance stronger than any man has yet dared to abuse. The sad truth of history is that bad guys well-financed and organized into a thieves’ cult are more likely than not to get away with anything and everything. Witness how long Pinochet avoided the law. How long former Nazi soldiers evades detection. How multi-billion dollar empires uproot and move to hostile regions and are then given legal immunity to avoid justice. I’m hoping someone will prove me wrong and reply with beacons of hope from history. I WANT to be wrong on this. Knowing humanity’s survival instincts vis a vis the law however, I am not long on the possibility of justice ever being done. Ron Paul is a hideous cross between white power authoritarianism, fundamentalist dominionism, libertarian deregulation fantasies and survivalist gold standard gibbering. That this monstrous amalgamation of fear and hatred has come to the same conclusion about the Iraq occupation as us Dirty Fucking Hippies says volumes about the sheer and utter wrongness of invading Iraq in the first place. Posted by: Christianjb \| January 11, 2008 3:46 PM That’s how it works now. You don’t speak plainly in public. You develop a specialized vocabulary. You use what is known as dog-whistle politics to get your message across. Dog-Whistle is a term used to describe a type of political campaigning or speech-making using coded language, which appears to mean one thing to the general population but which has a different or more specific meaning for a targeted subgroup of the audience. In the 2004 Presidential debates Bush used coded language in his speeches to send messages to his supporters among the religious right that will be ignored by other parts of the U.S. population. The plainest example was the mention of the Dred Scott Supreme Court decision in the 2004 Presidential debates. The latter refers to overturning Roe v. Wade, which is likened to the Dred Scott case by some of its critics. So, yes, Paul doesn’t spew it out like David Duke. Or some of the Stormfront guys. But they’re all part of the same club. They hang out together. They go to the same meetings. They talk to each other. They support each other. They speak the same language. Kristine says [White Supremacist David] Duke is now returning the favor, telling me that, while he will not formally endorse any candidate, he has made information about Ron Paul available on his website. But isn’t David Duke in prison? Such friends [I almost typed fiends] this guy has! H. Humbert says Why do the Paulbots think attacks on other candidates constitute a defense of Ron Paul? And it’s like they trip over themselves to see who can use the most hyperbolic language. “Oh, sure, criticize Paul. At least he’s not for the greatest, most vile crime against humanity, the Earth, and the Universe ever inflicted upon innocent victims by immoral and corrupt government ever! Namely–smoking bans!” apy says Racism might be the lesser of two stupids in this case unfortunately: http://thinkprogress.org/2008/01/11/gop-debate-iran-rhetoric/ The only candidate to acknowledge the Navy’s doubts over the source of the incident was Rep. Ron Paul (R-TX) Ignoring these concerns, former governor Mitt Romney threw an insult at Paul, saying, “I think Congressman Paul should not be reading so many of Ahmadinejad’s press releases.” Considering that Paul was merely noting the Navy’s own doubts about the incident, Romney’s barb is foolish. dkew says Not that I can imagine ever being brain-damaged enough to vote Republican, but even if nearly everthing I read about Ron Paul wasn’t enough to turn me off, his supporters would. @JfF #66 The right constantly uses that “oh I agree with Dr. King about not judging people on the color of their skin” line. Usually when trying to eliminate Affirmative Action or Fairness in Lending laws or otherwise eradicating whatever gains blacks in America have made since King gave that speech. It’s a transparent attempt to co-opt the words of progressive leaders to defend regressive policies, while ignoring the substance of their messages. Besides which, you can’t publish articles claiming Martin Luther King was a Communist and serial child molestor and then go on to claim you’re defending his friggin’ legacy. Furthermore it’s fundamentally dishonest to say this stuff was merely “under his name” when a good deal of it is also above his signature, and frequently packed with references to his wife, his family, his Congressional career, etc. Ron Paul is unfit to run this country. However right he may be about Iraq and the drug war, his childish understanding of economics, of the nature of the free market, and the role of government would utterly dissolve the United States. We’re talking Snow Crash level disintegration here. Arguably that’s his intent in the first place, given his favorable stance towards the right of states to secede. mooglar says Someone is going to call Godwin’s Law on me here, but I believe I have a legitimate historical point to make here. I keep hearing from Ron Paul supporters how they’re just sure he will be able to accomplish the great things they want him to do, but that the Congress/Democrats will hold him in check on the other, crazier stuff. That’s just completely naive. That is exactly what Germans thought about Hitler. I’m not saying Ron Paul is Hitler — that’s not the point. What I am saying is that it is foolish to think that magically only the parts of a leader’s agenda you like will get implemented, but the other parts won’t. A lot of Germans thought that Hitler would be good based on his economic and nationalistic policies, but that he’d never actually be able to implement his racist policies, so they supported him. But the fact is that you can’t possibly be certain which of a leader’s policies will end up getting implemented and which won’t. It’s a self-comforting fantasy to assume that it’s safe to give someone the position of Most Powerful Man in the World ™ because the parts of his agenda you don’t like will, naturally, be the ones that get blocked. I mean, how can you know, in advance, what he will or will not be able to accomplish? This is true of all candidates, of course, but when one candidate is openly espousing craziness, a wise person has to take into account at least the possibility that, if elected, that candidate will actually manage to get some of his or her crazy policies implemented. If you can’t face what would happen on the off chance that those policies get implemented, then you should not vote for him or her. It’s just that simple. One other point: Paul wants to limit the power of the Federal government to control your life and tell you what to do. But he doesn’t want less overall government interference in your life. He just wants to the States to be the ones who get to tell you what to do. He thinks it is oppressive that the Federal government won’t let the States ban abortion, wage their own wars on drugs, or tell you who you can and can’t marry. He absolutely does not think it is oppressive for the States to do all those things. He doesn’t want American to be more free… he just wants to change which level of government gets to do the oppressing. #72, if a person thought it was wiser to pay several million dollars to free slaves than to kill 600,000 people and spend multiple billions on a war that ravaged the nation and lead to 100 years of anger and bitterness, this would make that person a racist? In the process of doing it this way, Lincoln was forced to shred the Constitution. He burned printing presses, deported a Congressman that opposed him, imprisoned pastors that refused to say prayers for him, suspended habeas corpus. Put down your elementary school history book and learn a few things. You don’t have to be a racist to think that quite possibly there could have been a better way. It’s Lincoln’s precedent of ignoring the Constitution that has us in a war with Iraq, has Bush going forward with warrantless wiretaps, whisking citizens away to be tortured without allowing them a chance to protest their innocence. Ron Paul is about reversing that. We don’t follow the Constitution anymore, and that makes you less safe. The Constitution limits what the federal government can do to you. When it’s ignored, they can do anything. That’s not good. Vote for Ron Paul. Yeah, Ron Paul’s a douche bag. But what about #26, who is apparently a profound master of morality, and must have his personal preferences instated as law. I don’t want to live in a country full of religious loonies, but that doesn’t give me the right to outlaw religion. Marijuana is a naturally occurring plant that has obviously undergone a selection process because of the advantages of having a psychotropic substance, THC. Humans have used it for thousands of years, and will continue to. Carl Sagan was a pothead. If you would be against living in a world full of Carl Sagan’s, I don’t even know how to address you. I’m not advocating that anyone smoke marijuana, but I do, and on a pretty regular basis. I’m a Marketing Development Manager for a national company, and I’m not bragging — just defying your stereotype of a “pothead.” I think Orac and PZ are trading off offering up Paul-bashing threads. I’m actually starting to wonder whether it isn’t an effort to drive hits up–maybe ad revenue has been dipping a little or something. Drop a Paul thread in and apparently you get 1,000 back-patters coming out of the wooodwork all looking around going “YAH MAN, YOU GO! Just wait, a bunch of Paultards will show up soon!”, somehow missing the irony of it all. I think it is funny that they are getting as much mileage as they are out of 20-year-old newsletters that obviously weren’t written by him. Oh noes, 15-20 years ago Paul didn’t properly supervise newsletter staff! Compare your Hillary’s voting record re: The War in Iraq/The War on Terror vs. Paul (I voted for Bill in ’96). Yeah, and they keep accusing us of being Hillary voters. shrug Me like Ron Paul. Him make black man go away. Me like Ron Paul also him make war in Iraq go away. Me like Ron Paul him make Roe v. Wade go away. Me like Ron Paul too him make Department of Education go away. Me like Ron Paul as well him make Zionist Conspiracy go away. Me like Ron Paul! So, a hundred years late, the Confederacy’s apologists are admitting that slavery was the issue, but the South could have been readliy bought off? What was all that rubbish about “state’s rights” and “Southern honor,” meanwhile? As long as he isn’t stealing Democratic voters, I could care less. He’s not electable, and even if he managed to get elected, Congress wouldn’t authorize anything he wants to do and it would be a wake-up call to the political establishment. If I had to choose one of the Republican candidates, he’d win by a long shot — shithouse-rat-crazy or not. But anyway, go Obama — speaking of whom, I’ve seen that stupid “Obama’s a Mulsim” email 50 times in the last week and it’s being posted on MySpace left & right. And we wonder why we have sensationalized journalism. People obviously want a shocking story, true or not. Say what you will, it’s just nice to see some rethugs that aren’t all cast form the same Reagan-Bush-Reagan mould. well, that’s something i can agree with, Paul is certainly no Neocon! maybe he could make that his campaign slogan? “Ron Paul: NOT a neocon!” hmm, come to think of it, I’m not finding the clear neocon representative on this ticket, which is a bit odd. where is the neocon money going? Yes, Obama. The candidate of “change.” Votes to fund the war in Iraq. Continues the Patriot Act. He’ll tell you that the soldiers in Vietnam didn’t die in vain, because he thinks that’s what you want to hear. Looking forward to his changes. Willard’s trying. But then again, Willard’s tried every kind of con. Ron Paul rebutted all this on CNN. PZ myers [sic] is just a fraud whos [sic] biggest accomplishment is having a popular blog so he thinks hes[sic] god. I hope you idiots enjoy ww111 [sic] with Iran which is what youll [sic] get with hillary/guliani[sic,sic,sic] Posted by: cooler So, in other words, you’re pretty much just saying “BOO,” huh? By the way, there have only been two “World Wars,” and not one-hundred and ten as you assert. Then again, I did just wake up from a nap, so I suppose a lot could have happened in the hour, or so, I was out. thadd says Because of Ron Paul, I am starting to no longer self identify as a libertarian I’ll call it “Please don’t kill me Mr. Hitler: how politeness would have avoided the holocaust and other truly moronic ideas.” Grease the rails to hell with false bonhomie if you wish, I could care less for the friendship of intolerant assholes and those meant to be influenced are hardly the targets of my opprobrium. Jon: if a person thought it was wiser to pay several million dollars to free slaves than to kill 600,000 people and spend multiple billions on a war Oh my god, you’re right! And just think of all the money the US wasted fighting the Nazis, when we could have just paid them some money to be nice! And the next time a nation kidnaps US citizens, we should just pay a ransom and avoid all sorts of nastiness! Heck, police departments should just have a “kidnapper fund”, so that these kind of circumstances can avoid all the bloodshed and expensive inconvenience of actual law enforcement. And after all, the North would just have been reimbursing the slaveholders for their property, right? How could anyone object to rewarding someone who enslaves other human beings? (I find it truly bizarre that someone who allegedly holds personal liberty as the highest value somehow thinks that it can be purchased, rather than is inherent in the individual.) “I keep hearing from Ron Paul supporters how they’re just sure he will be able to accomplish the great things they want him to do, but that the Congress/Democrats will hold him in check on the other, crazier stuff.” No, I’m basing the idea he won’t do the other crazy stuff on his 20 years in office already not doing that stuff. Say what you want about him personally, but the man is consistent in his voting. He just doesn’t vote to give the federal government more power. Ever. “That’s just completely naive.” Naive to assume he will continue doing what he’s been doing for decades? I know, lunacy right? “That is exactly what Germans thought about Hitler.” Oh sweet evil jebus. NOW Ron Paul is f-n Hitler? You have got to be kidding me, time to turn the channel. “What I am saying is that it is foolish to think that magically only the parts of a leader’s agenda you like will get implemented, but the other parts won’t.” I’m not expecting a part of his agenda to not show itself. His agenda has nothing to do with these social issues. His agenda is that these social issues have no place in his agenda. You keep trying to work them in though. It’s not what he said. It’s not what he said 20 years ago, yesterday, today, or ever. Stop trying to suggest that he thinks the federal government should be banning evolution, or abortion. That’s not what he’s said ever. Why can’t the man hold different opinions than you personally? Why does your little world require complete adherence to everything you like? “One other point: Paul wants to limit the power of the Federal government to control your life and tell you what to do.” Finally some sanity. “But he doesn’t want less overall government interference in your life.” Wait… what? “He just wants to the States to be the ones who get to tell you what to do.” Good thing he isn’t running for your state government then isn’t it? I’m trying to imagine what this has to do with…well…anything. Oh right, it doesn’t. “He absolutely does not think it is oppressive for the States to do all those things.” No offense, but so does the constitution. It’s not like he’s making this up as he goes. This is how it’s supposed to work. If you don’t like that then your issue is with the Constitution, not Ron Paul. Nowhere does the president or congress have the authority to influence what we teach children in schools. ever heard of the NCLB act? you could argue that congress shouldn’t have this authority (which I would disagree with), but you most certainly cannot argue that they in fact DO. So Tulse, I suppose this means the British were wrong to purchase slaves and free them. They should have had a civil war, burned printing presses, and imprisoned those that had a problem with this approach. This way the slave owners wouldn’t have been reimbursed. Sounds logical. talk about projecting. It in fact has a LOT to do with determining the leeway individual states have in overriding federal laws. you think that irrelevant? Paulbot, indeed. Grease the rails to hell with false bonhomie if you wish, I could care less for the friendship of intolerant assholes and those meant to be influenced are hardly the targets of my opprobrium i read your rant. who exactly IS the target audience? Fatboy says Ok, so he’s a bit weird when it comes to evolution. I’m not sure how a man makes it that far in the medical field without getting this concept, but that doesn’t make him evil. It’s just a different view than I have (mine based on reality, his on who-knows-what). What’s important is he acknowledges that it is HIS view. The only reasons I can think of for someone not accepting evolution are lack of education (and it’s only high school biology, not even anything advanced), a complete willingness to disregard evidence in favor of preconceptions, or insanity. No, it doesn’t necessarily make a person evil, but it’s not exactly the type of person I’d want as president, either. A person doesn’t get an automatic endorsement for accepting evolution, but the opposition would have to be pretty damned bad before I’d vote for someone ignorant/insane enough to doubt evolution. Yes, because the only issues a President ever has to deal with in their administration are Iraq, the Patriot Act, and Vietnam (WTF?!? Dude, put down the bottle). You’re an idiot that can’t be helped so keep supporting the most unelectable candidate, ever. It’s a great use of your time. Citizen Z says Ok, besides the several decades of racist newsletters published in his name, what evidence is there that he’s a racist? Nothing! (sarcasm) Jesse, what type of change do you think Americans are looking for? 70% want out of Iraq, but Obama doesn’t. People say they want politicians that tell the truth, rather than just what they think polls indicate people want to hear, but compare Mike Gravel’s response to the question “Did soldiers in Vietnam die in vain” to Obama on youtube. Mike Gravel says what’s true, Obama says what he thinks the audience wants to hear, even though it’s obvious BS. He has no record of change. On what basis has he been dubbed the candidate of change? Certainly not in lobbyist money or corporate donations. Not on Iraq. Not on aggression in the Middle East. Not on funding both Israel and Israel’s enemies. Not on screwing with Pakistan. But he’s young and good looking and a good public speaker. And foxnews and NBC tell you he’s the candidate of change. Is that good enough for you? There is a candidate though that hasn’t ever taken lobbyist money or corporate donations. He’d stop screwing with the Middle East. He’d de-fund Israel as well as the Arab nations. He’d stop borrowing from China to fund wars. And he actually has a record that shows he would follow through on these promises. Who’s the real candidate of change? I seriously have no idea why people think Obama is the candidate of change, except for the fact that he is dubbed this by the media. You’re good at name calling, as are a lot of people here, but why not rather focus your efforts on considering the facts. dogmeatib says I’ve always been socially liberal, fiscally conservative. The problem is, this doesn’t work anymore. The issues are too closely tied now to claim to be a social liberal, including caring about the poor, race relations, civil rights, education, etc., and at the same time support the status quo “make the 10% as rich as hell and f’ everybody else.” Those who are arguing against the war on drugs are just as misguided as those who were arguing in favor of prohibition. Drugs, just like alcohol, are a product of the inequities in our society. People take drugs to escape their miserable lives caused by the fact that they cannot escape multigenerational poverty locked into place by underfunded racially segregated (de facto not de jure) school systems and out-sourced blue collar middle class jobs. The fiscally conservative, “let the market solve it” response doesn’t work, the failure to solve the problem causes the social problems that we have to deal with. Poverty -> broken households -> social welfare programs. Poverty -> drug/alcohol driven escapism -> “market driven” drug sales. I know someone will argue, “that sounds marxist.” Yes, yes it does, because if you took a look at Europe lately you’d realize that their socialist systems are working far better than our free market system. They have a higher standard of living, lower violent crime rate, better medical care, lower drug/alcoholism rates, etc. etc. etc. The reason we’re so screwed up as a country is because free-market capitalism (with the incredible government corruption that makes it such a lie) has effectively bought and sold every scrap of legitimacy our government ever had. We’re 9 trillion dollars in debt and the conservative jackasses who put us there (3.5 tril’ w/Bush, 3.5 tril’ under Reagan/Bush41) argue that more tax cuts and more benefits for the wealthy will make it all better. Anyone who votes for these crooks is either stupid or a crook themselves. milkbone says My encounter with a Ron Paul supporter MikeJ says In the process of doing it this way, Lincoln was forced to shred the Constitution. Yes, when Lincoln fired on Fort Sumter, he truly showed us the way he had decided to resolve the issue. If only Lincoln hadn’t acted so rashly and expelled South Carolina from the Union before he even took office those not at all treasonous southerners would have seen the error of their ways. Greg Newburn says I (kind of) defended Ron Paul in the comment section of your previous post, but since these newsletters appeared I have decided I can’t do that anymore. I knew of Paul’s association with the racists and kooks at the Mises Institute, and had heard that there were one or two instances of this type of stuff in his old newsletter, but it was explained that he had fired the staffer who wrote them and repudiated the substance. Now, we know that’s just not true, and intellectual honesty–and decency generally–requires us to recognize this for what it is, and kindly remove our support for Paul’s candidacy. That said, I still wholeheartedly support the libertarian ideas of the rule of law, markets, peace, and tolerance, which are timeless and transcend this and any other candidate or election cycle. Skemono says Even that’s not true. You know, it would be nice to at some point get away from the sarcasm and simply have a discussion, as rational people. There are things that can be learned on both sides here. Let’s just talk. MikeJ, are you aware that Lincoln’s cabinet informed him that if he garrisoned Ft. Sumpter this would be regarded as an act of war and would likely instigate a response? Are you aware that Lincoln in his 1st inaugural address stated that as long as the tax revenues continued to roll in from the south that he would not invade the south? I suspect there’s more to the Civil War than you know. The South did secede to protect their slave interests. Nobody here is saying that the South was great. None of this changes the fact that Lincoln is not quite what he was portrayed to be to you, me, and every other American in high school. He did shred the constitution. That was wrong. There is also a lot good that can be said about Lincoln. But the reality is the Civil War was a lot like most other wars. There are two sides to the story. I assume you don’t just accept Bush propaganda about the “War on Terror.” In the same way, don’t just accept the victor’s tale that this is about that courageous hero Lincoln bringing freedom to oppressed blacks. If you know your history you know that Lincoln actually never freed one single slave. The southern states had already declared their treason before Lincoln even took office. Saying Lincoln is responsible for the south’s treasonous attack on our troops is just about the dumbest thing you could possibly say about the US civil war. Well, at least Mr. Newburn has some integrity…the rest of the Paulbots seem to place personal loyalty to an individual above principles, because they sure don’t sound like any libertarian I know… In order to increase ratings for the General Election Presidential debates, the Republicans have decided to nominate Ron Paul as their candidate while the Democrats have decided to nominate Dennis Kucinich as theirs. A country garrisoning soldiers in one of that country’s own forts is an act of war? A country moving soldiers about within that country constitutes an invasion? Apparently Lincoln proved the succession by not recognizing the succession before it had happened. provoked, not proved Alex Merced says http://causeoffreedom.blogspot.com/2008/01/89-ron-paul-addresses-racism-charges.html BJN says Secession, not succession. So Tulse, I suppose this means the British were wrong to purchase slaves and free them. They should have had a civil war While it is a common canard from Paul supports to hear the that the British eliminated slavery simply by paying compensation, that is simply historically false. Slaves in England were emancipated by the ruling in the Somerset case in 1772 — tens of thousands of slaves in the British Isles were effectively freed by this ruling, and no compensation was involved. In 1807 the slave trade was made illegal throughout the British Empire, and far from compensating slave traders, British ships were fined 100 pounds for every slave found on board. In addition, the Royal Navy suppressed the slave trade by other nations — ships’ crews were paid “head money” for each slave freed from other nations’ ships, but those nations received no compensation for slaves so liberated. It is only in the Slavery Abolition Act of 1833, which made the entire practice illegal in the British colonies (it was, as noted above, already effectively illegal in Britain itself), that some form of compensation was offered, and this only for those held in the Carribean, Mauritius, and the Cape of Good Hope. So it is a gross inaccuracy to say that the British ended slavery only by paying compensation. It is further a gross inaccuracy to say that they risked “civil war” if they hadn’t paid compensation, as the only places slavery was still legal at that time were the rather unorganized small colonies of Britain, more economic possessions than actual political entities with any form of native military (in many cases, the colonies were largely populated by slaves). In any case, I find it interesting that all the allegedly “libertarian” Paul supporters, those who value the ability to sell one’s labour as they like, are so keen on the notion of compensation to the slave owners, but never talk about compensation to the slaves, to those people whose labour was forcibly taken from them. You’d think that demanding recompense from the slave owners who stole that labour by violence to the slaves they stole it from would be far more the libertarian ideal than suggesting rewarding people who so brutally denied the liberty and free negotiation of labour of others. In what other situation would a libertarian suggest that those who use violence to steal the labour of others be rewarded by the State for such theft? It might make one wonder if there might be something about those others that “colours” their judgement in this matter, and causes them to abandon their allegedly deeply held principles. If you know your history you know that Lincoln actually never freed one single slave. Because he never personally owned any to free to begin with. btw, is this the “argument” you were considering when you speak of “knowing history”: Forced Into Glory – Abraham Lincoln’s White Dream if so, you might want to read this: http://showcase.netins.net/web/creative/lincoln/books/steersward.htm Thank you #81, mooglar: A more cogent argument couldn’t be made. Each one of the candidates at one time or another have actually made sense about one thing or another. But it is the WHOLE picture of the candidate that is important. Wishfull thinking about what we’d LIKE the candidate to be does not count. And for those actually stupid enough to say “I’m not for Ron Paul the person, I’m for Ron Paul the candidate,” do you have any idea how moronic you sound? If the PERSON is a racist, the CANDIDATE won’t be? If that were true (which it most catagorically is NOT)that PERSON/CANDIDATE cannot be anything other than insane or a complete, hypocritical liar. And just to clue you in, either one of those conditions SHOULD preclude the candidate from office, Larry Craig notwithstanding. shorter: Vote Ron Paul: he is not Lincoln. Expat Onlooker says Ron Paul is the ideal choice as president for anyone who wants to keep America a respectible, sovereign nation. Seriously, though, are there any better presidential candidates out there? Answer: NO. John C. Randolph says Happy witch-hunting. While you’re at it, chew on these, too: http://reason.com/blog/show/124351.html#880338 -jcr Oops, looks like Pete Mackin forgot these: http://sonic.net/maledicta/clintons.html john, I’m sorry, but if you actually READ the article you linked to you see: In this case, Dr. Paul is suffering charges of racism and lunacy for the “sins” of his followers. which has already been shown not to be the case. it’s not a case of witch hunting at all. “Whatever the war on drugs may be, it is definitely not the most oppressive form of racism there is.” It is in the USA: http://www.hrw.org/backgrounder/usa/incarceration/ So, while people are crucifying Ron Paul for the contents of a newsletter that he didn’t write, and didn’t edit, they would happily sink the only candidate who’s made it perfectly clear that if elected, he would free the POWs of the war on drugs. and the second appears to be more about Hillary’s use of colorful language. again, nice try, but no cigar. happy stereotyping. Guess again. here’s one, for fun: http://skemono.blogspot.com/2008/01/one-more-paul-post.html scroll up in the thread to find more. Ichthyic, Look a little further down. Scan for the phrase “Jew bastard”. uh, you’re at the bottom of this thread, did you have something specific in mind, or are you just gibbering? Further down in the article about Hillary, smart-ass. You know, the one you only glanced at. here’s a point for you, moron: pointing out someone else’s racist statements doesn’t absolve your buddy of blame for doing so himself, now does, it? you might try doing more than glancing at THIS thread yourself. “The southern states had already declared their treason before Lincoln even took office. ‘ Nope, they’d seceded. Having done so, they had no duty of loyalty to the union. Had the southern states remained in the union and helped some other country to make war against the united states, that would be treason. “(I would probably vote for Obama if I lived in the US).” What an idiot. I’m glad you are not voting for that very reason. Obama WOULD make a good manager at McDonald’s, though. And why do you think you can’t vote anyway? Can you not locate the US embassy in the country of which you reside? I see you’ve missed the crucial difference of the two situations. Ron Paul is being tarred and feathered for statements made by someone else, while Hillary skates on racial epithets she said herself. Expat, To be fair, Obama is probably the least of the evils running for the democratic nomination. The neocons are split behind Romney, Giuliani and McCain. Huckabee’s getting mostly the Pat Robertson crowd. Posted by: John C. Randolph \| January 12, 2008 3:13 AM Of course you are right. I just don’t trust the man, and admit I’m biased towards him. The man seems amateurish, and I don’t think it’s the right time to “experiment” with our first black president. At least he is a breath of fresh air from the “old mold” which has been in congress for so long. Heaven forbid Clinton because our next president. truth machine says Debating with Ron Paul supporters is like debating with religious fundamentalists; it’s entirely predictable that they will contort logic, ignore evidence, and lie lie lie. They’re what you scrape off your shoe, not have a debate with. If libertarians want people to think they aren’t slimeballs, the first thing they need to do is distance themselves from Ron “they look suspicious” Paul. “The man seems amateurish, and I don’t think it’s the right time to “experiment” with our first black president. ” I really don’t know what is “amateurish” about Obama. Just listen to him talking about “science and technology” : http://www.youtube.com/watch?v=3UUprAhMTo8&feature=related Doesn’t sound too “amateurish” to me, or at least less than what I’ve heard from any other candidate on this subject. Ian Gould says Well seeing as it comes from such a presitigious and unbiased source as Newsmax, it must be true and of course screaming racial epithets during a fit of anger (even if true) is EXACTLY the same as publishing a newsletter full of them for years on end. Robert Thille: Yeah, I find myself agreeing with what Pat Buchanan says sometimes, too. But almost NEVER the reasons he thinks those things. Hell, I’d bet everyone reading this blog would agree with Hitler or Stalin once in a while. Doesn’t mean I wouldn’t take either one of them out back and beat them like a dog until my arm breaks. Ron Paul is also DEAD wrong on the smaller government bullshit. If that guy got his way we’d end up living Mad Max-style, and the only upshot of that is that I’d be coming to his house before turning my semi toward all his voters. craig: Let’s not and hope that Huckabee wins the nomination instead. Then we can just say Wayne DuMond and the race is over. It’ll be even easier than beating Romney with a rack of flip-flops or Thompson by hiding his hammock. Anyway, for all Ron Paul supporters, here’s a nice way to make money : place a bet on one of the bookies like paddypower.com. He’s at 66 to 1, so if you really think he has a chance to become next president, put your money where your mouth is… T_U_T says Ron paul is NOT a libertarian at all. Ron paul is simply a neo-confederate. And his dismantle-the-federal-government battle cry is simply an attempt to continue the civil war by other means. Timothy said: Given technological trends in the mid to late Twenty-First Century , we’d all end up living Mad Max-style whether you like it or not. We are predatory ape animals anyway and we are NOT exempt from the “law of the jungle”. P.S., it is a hell-lot-easier to deter aggressors if one has home-made personal WMD (microbial or nanite weapons). Given technological trends in the mid to late Twenty first century , we either abolish the law of the jungle altogether, or we commit suicide This whole American presidential horse race is a lot of fun (seen from the other side of the Atlantic). I mean, look at it, Ron Paul, Mike Huckabee, Fred Thomson, wherelse could you find such quality morons being candidates for the most important job in the world ? You guys are lucky, you get to choose. But just one small request, this time (unlike the two last elections), can you please make sure you don’t select another mentally retarded individual who destabilizes the whole world and fucks the whole planet ? Pleaaaaaase, can we have our planet back ? It’s ALL ours! Bwahahahahahaha! Sad, isn’t it? Eeny-miney-moe, who’s the least stupid? Hard to chose there…. Since Pual has, beyond making pathetic denials, failed to put on any proof that he did not write those racial insults, I’m going with another one of the “LIARS FOR PAUL” observation about your post. And, btw, it is possible to prove that those letters were ghostwritten. We deal with this all the time in forensic accounting & auditing. We deal with this the time in any type of forensic investigation, including criminal investigations. If there was a ghostwriter, there would be a paper-trial. Telephone logs, invoices, long-distance calls to the ghostwriter, correspondence, draft letters for approval, etc. It would be trivially easy for Paul to prove he didn’t write those letters. Yet… Sound of crickets… But then I expect that from you and the rest of the Paul bots. All for the bits of the Constitution you like, but only if interpreted in your demented, frequently unconstitutional ways. Never mind the way you clowns turn your back on solid science that rebuts your idiotic beliefs. No worries douche bag. I was mocking you. Because you’re an idiot and your moronic post wasn’t worth debating or rebutting. anonymousat11:05 says no matter which of the three Democrats gets into the Oval Office, not a one of them will ever prosecute the criminals. I don’t understand. A war that didn’t have to be vs a president having relations with another woman…. Which is the bigger issue, and why do people not see it? You can’t prosecute them if you don’t have the justice department and the senate on your side. David Marjanović, OM says Fine, Paul wants to stop the war on drugs, but what, if anything, will he do instead? The European model of “therapy instead of punishment”? That would have to be done by the <gasp> government, right…? Hello, cooler! Is there such a thing as a single-issue denialist? :-) You guys are super annoying trolls. A driver on Highway X between Y and Z and listens to the radio: “Warning, warning. On Highway X between Y and Z someone is driving in the wrong direction.” Angrily, the driver switches it off and says “‘Someone’? Hundreds!” So, while people are crucifying Ron Paul for the contents of a newsletter that he didn’t write, and didn’t edit Look! Paul is completely incompetent! Incompetent for President!!!1! Hooray!!!1! Robert: Actually, you sound like the FBI should be coming to YOUR house to look into your stockpile of weapons. If you’re seriously supporting the idea that everyone has personal biological weapons you are a fucking idiot, but then again you’re defending “Doctor Ron Paul”, so that’s expected. still waiting for a well-reasoned answer to that one myself. excuse me, but i guess you failed not only to read the link i provided for you, but also failed to scroll up and read the rest of the information presented in this thread as well. are you really so stuck on the idea of “paul as monkey wrench” that you will lie to yourself? funny ’cause it’s true. …and applies to far more situations than just this one, unfortunately. T_U_T said: Sure we can abolish the “law of the jungle”. We can use Jeebus’ Magic Wand to do so. And you know what, we can also invent Perpetual Motion Machines as well (/sarc). We’re animals, get over it. Unless you believe in claptrap that man is magically created in god’s image. The trends mean that dense concentrations of population (ie. the metropolis) will be forced to disperse. They also mean that the will of the large centralized state will be impossible to enforce. Micro-states with dispersed populations would be the result. It’s funny that you call me a “fucking idiot” when you can’t even master reading comprehension, jackass. I never said I supported “Doctor Ron Paul” and there’s a difference between “ought” and “can”. Should people have personal nanite and biological weapons? The question doesn’t matter, people will get them anyway in the mid to late Twenty-First Century (you do know what “home manufacture” means right?) and there’s nothing that any government agency can do in that future to stop it. Why can’t we send the FBI to seize Kim Jung Il’s weapons or Pakistan’s? Care to answer that? I noticed that you have threatened me with violence-by-proxy. How charming. Why don’t YOU YOURSELF break into my home you coward instead of sending hired goons. I could care less about your “Mister Rogers” World anyway. You’re like that Colonial European in 1900 who thinks that Europe’s Colonial Empires will still be around in 2000. States have basically NO leway to over-ride federal laws. Let’s take medical marijuana as an example. Legal in CA, federal government still arrests people they catch. It’s a right hand/left hand thing. The two governments are run by completely different people with completely different agendas. I’ve never heard the man say he thinks the state governments should do those things. Just that if it’s going to happen that’s where it should be. I’m not projecting here, you are. You keep ascribing things to him he never said. So ultimately yes. I think if the guy is running for president, then his views on the laws of any individual state is basically irrelevant. Calling me names is not an argument. “A person doesn’t get an automatic endorsement for accepting evolution, but the opposition would have to be pretty damned bad before I’d vote for someone ignorant/insane enough to doubt evolution.” Ok, here’s my issue. Both Obama and Clinton both voted for Iraq and the patriot act. Ron Paul didn’t. To me the non-issue of the federal stance on evolution is less immediately important to me than getting my rights back, and getting out of Iraq. I don’t care about Obama’s or Clinton’s views on evolution because that’s not the job of the president. The job of the president is restoring habeus corpus and figuring out what we’re doing with this whole “war on terrorism” thing. I know that makes me crazy… “People take drugs to escape their miserable lives caused by the fact that they cannot escape multigenerational poverty locked into place by underfunded racially segregated (de facto not de jure) school systems and out-sourced blue collar middle class jobs.” Is this pz’s blog? Where do you people come from? Ever heard of medical marijuana? Why is alcohol, tobacco, caffeine, and legal amphetamines OK, but these other ones make people miserable poverty locked people? Are you high? What gives you the right to tell me what is and isn’t ok for me in my life? I don’t care what YOU think about these drugs because I’m not running your life. Nice to see bigotry alive and well in the good ol’ USA. I don’t need to live my life, I have you guys to do that for me. Ichthyic said: Probably “Cult of Personality”. What did you expect? Humans are apes after all. Why do people still revere Che Guevara? Ryan said: Why is alcohol, tobacco, caffeine, and legal amphetamines OK, but these other ones make people miserable poverty locked people? Oh, the reason was that early in the Twentieth Century the other drugs were banned because minorities were using them. It was bigotry and “smiley-faced” fascism that started this idiotic “Drug War”. I agree. It was for a lot of reasons, but none of them very logical. The drug war has created all the problems we ascribe to drugs. Without this ridiculous war we wouldn’t have ANY of the drug related problems we have today. Like Capone and his like disappeared after prohibition, so will the drug king-pins after drug prohibition. I’m as of yet to hear of a drive-by over a pack of cigarettes. The Escobar’s of the world didn’t get insanely wealthy selling coca-cola. Nobody steals from their mother to get money to buy coffee. They got it selling a legitimate product millions of Americans wanted, but a tiny few religious-idealists at the top decided we shouldn’t be able to have. The war on drugs makes about the same amount of sense as abstinence only education. It doesn’t work, and I’m at a loss as to why we would want it to anyway. Decisions about drugs and life-style should be between a person and their doctor. I don’t see what made Nixon qualified to pass judgement on either. Probably “Cult of Personality”. flesh it out. banned because minorities were using them. well, that was the face put on it in order to sell the legislation (wouldn’t work as well these days, but still would have at least some effect). in fact, addiction to opiates and cocaine really were significant problems, even back then. true that legislation has not been even handed (OTOH, we DID have prohibition), but that has less to do with racism than economics. Negentropyeater said: Ahhh, magical thinking, it’s not just for Young-Earth Creationist morons anymore. If only the magical powers of the U.S. Presidency –under… lets say Obama– can be used to “poof!” growing global instability out of existence. Hey! Kinda like the notion of god “poofing” the Universe into existence in 6 days 6000 years ago. If you actually live long enough to reach the late-Twenty-First Century, you gonna really fucking hate this planet. If only the magical powers of the U.S. Presidency -under… lets say Obama- can be used to “poof!” growing global instability out of existence. Hey! Kinda like the notion of god “poofing” the Universe into existence in 6 days 6000 years ago. now you’re just rambling. Ichthyic, perhaps I can cite a secondary source that explains “Cult of Personality” better than I can. It primarly deals with this phenomenon in Dictatorships but it is also present in Liberal Democracies. My take is that in a “Cult of Personality” the person leading a movement becomes one with the movement’s message. The message become the person and the person’s personality becomes the message. If the person becomes the message, he maybe can be regarded as “infallible”. Julius Caesar is a good example. In many cases so is the Pope. Same goes for Kim Jung Il. What? You don’t think that’s magical thinking? The most interesting thing is that so-called “athiest” lefties like T_U_T still have a tendency to believe in nonsensical superstitious notions such as abolishing the “law of the jungle” for humans or pacifism and disarmament. As if the human ape is a “divinely special” creature exempt from all other animals/organisms and the laws of nature that govern them. Such dumbassery! At this link , a poster named Jay Manifold and a creationist named Steve commented on this cognitive dissonance. I’m always amazed at the leftist hand wringer view of the world on this gun and violence issue. How is it that they’re whole evolutionary vision is that man is evolved from animals. Then they turn right around and deny the animal in all of us. Especially young boys. Jay Manifold said: This is where I note the irony that the most ardent social conservatives are more accepting of key elements of evolutionary psychology than their “reality-based” opponents. Irony indeed. T_U_T, you are a fucking dumbass religionist. It’s funny how these paulbots come here with their pet issues thinking it’ll convince us that Ron Paul isn’t a backward douche bag…give it up. We don’t care. Ron Paul is the latest Lyndon LaRouche. And no I’m not worried about the Reptillian Illuminati. ryanb said: True that. Funny, I don’t recall members of Budweiser do driveby’s against members of Coors. Even Starbucks doesn’t charge $500 per Latte Venti. I think the Drug War is a result of magical thinking enshrined as law. The idea of merely passing law will make the “bad” thing go away, nevermind the fact that a law’s effectiveness is entirely dependent on how much striking power the government’s law-enforcement has. If there is not enough striking power, the law is just a stupid piece of paper. I DON’T LIKE THIS, PASS A LAW: POOF!!! Still don’t like it, pass another law: POOF!!! Pass yet another law: POOF!!! The most interesting thing is that so-called “athiest” lefties like T_U_T still have a tendency to believe in nonsensical superstitious notions such as abolishing the “law of the jungle” for humans or pacifism and disarmament. As if the human ape is a “divinely special” creature exempt from all other animals/organisms and the laws of nature that govern them. Such dumbassery! What’s dumbassery is believing that animals can’t or shouldn’t cooperate because of a mythical principle called “the law of the jungle”. Robert, you are the living proof that the stupid bosons are indeed massless. Otherwise you would be well beyond the TOV limit. We’re animals, get over it. So, you seem to agree with cdesign proponentsists assertion that evolution means that because we are just animals and thus ought behave to each other like wild beasts. The trends mean that dense concentrations of population (ie. the metropolis) will be forced to disperse. They also mean that the will of the large centralized state will be impossible to enforce. Micro-states with dispersed populations would be the result. What about any evidence to back up your claims ? Oh, and insults don’t count as evidence ;-) Nullifidian says I knew those archives at the University of Kansas were there this whole time, having consulted them while a dramaturg for a play called “God’s Country” by Stephen Dietz. To all you who are interested in confirming this, it’s the “Wilcox Collection on Contemporary Political Movements” at the Spencer Library on the KU campus. They have copies of the Ron Paul Political Report which predate the article about the L.A. riots that has been making the rounds. To all of you who want to make the ghostwriter argument, they have several years of back issues. That’s a lot of ghostwriters. Having been a ghostwriter on a couple of occasions for a major publishing house when I was poor and starving, I can assure you that ghostwriters are not intended to step outside the boundaries of what they’ve been asked to ghost. In short, they’d only deliver up racist screeds if racist screeds were what was requested. Let’s hope that this sinks the misguided ‘progressive’ love-in with Paul and gets them focused on actually electing anti-war Democrats, like Richardson or Kucinich. Keith Douglas says Ichthyic: Various places, I think, including Clinton. This name calling is just silly. I’m just a guy that likes to read this blog. The fact is I like Paul but don’t think he has a chance to win. Too many people like you. You are very willing to believe any of the democrats currently on the ticket actually will change things. After decades of politics I’ve learned to identify regular politics when I see it. Bush sold the neo-cons on all these things he could never do, and the Democratic party is selling you all these things they’ll never be able to do. Republicans will fight things like national health care with every breath they have. Neither Hillary nor Obama will give you national health care. I’m even willing to put money on that. If you really don’t care then stop posting about him. For someone who doesn’t care you spend an aweful lot of time… well… caring. You don’t put forward anything meaningful to the conversation, you just call me names and then call Paul names. Very adult. If you don’t want to discuss him then leave the thread. Nobody is trying to talk to you if you don’t want to discuss it. I’m just hoping Paul will be able to shift the discussions away from pipe dream like national health care, federal evolution, federal abortion, on onto things this next president WILL be able to do things about. Let’s clear out these secret prisons. Let’s give all our citizen habeus corpus. Let’s catch Obama. Let’s figure out what we can do different in Iraq. Let’s talk realistically about terrorism and the role we can play against it. Maybe they really do use the fact we have military bases in their country to rally support against us. The fact is Canada is basically the same as the US but they don’t hate them. Why? Your stupid cognitive slip shows you’re a kook. It’s Osama, dumb ass. Ok, that’s just funny. You know Kucinich and Paul are friends right? They basically have the same platform. They vote very similarly on most issues. Kucinich is the democratic Paul. In one interview they asked Paul which of the other candidates he would consider to be his VP. He said Kucinich was the only other politician out there that would be acceptable to him. That entire rant and the fact that I didn’t notice I accidentally put a “b” where I should have put an “s” is all you can comment on? Yes. That or the fact that everywhere I’ve turned for the last week I’ve seen OBAMA posted everywhere. I’m talking politics and I accidentally misplaced an “s” with a “b”. Who uses the word kook anyway? What’s with the name calling anyway? You always call everybody names that tries to have a discussion with you? I bet you have a lot of friends. Ron Paul is a putz. He will never be elected president. And if you missed it, he’s a evolution denier. Case closed on the Kook. At least Kucinich has a hot wife. I don’t suffer fools well. And those kind of “slips” are what we’ll be hearing a lot of if Obama gets the nomination. Get it through your head. Ron will never be elected. He’d be a NIGHTMARE. But go ahead, keep dreaming. It’s like talking to a wall. I already said I don’t think he’s going to win. We all say we want change, but it’s clear from the way we vote that we don’t. This Clinton will deliver as much change as the last one did, and I figure she has this locked up. If Obama wins then he’ll enact no more change than Clinton would. He will not be able to push his social issues for the same reason Bush couldn’t push his. If half the country is against your ideas, then they never come to pass. The democrats have done a horrible job of selling socialized medicine, and we just aren’t ready for it. Same with foreign policy that doesn’t involve blowing up middle-easterners. Say what you want but the republicans have done a much better job of selling their side of things. I’m just trying to shift the conversation away from these non-issues, to stuff that the next president will be dealing with. Again, I didn’t miss it. Let’s try a new tactic. Please tell me the last name of a federal bill that became law that included a national stance on evolution. Anything with any pro or anti evolution stance by the federal government will do. When you’re done wasting your time come back and tell me what you found. I can’t imagine why you would even want such a thing. The nature of science is it changes. Doing something stupid like codifying evolution as law means it becomes illegal to do research to try to disprove it. Worse, if we come across something in the future that casts doubt on it it will be illegal to posses that information. That is not science. You and I both know the likelyhood of that happening is closing in on 0, but that still doesn’t make the idea of codifying current science theories as law a good idea. Ok! I’m sorry! I simply read over it too fast. You can’t even be bothered to address any of the issues I bring up, but I can’t switch two letters around? You even knew what I meant from the context. Talk about arguing over a complete non-issue. It wasn’t intentional. I wasn’t trying to suggest that Obama, who is black, American, and doesn’t sport a cool beard, was somehow related to the guy from Saudi Arabia who constantly chants death to america, in a language I don’t speak, while sporting a cool beard, were somehow the same person. Does anyone really think we’re going to mistake the guy running for president of the united states for the guy who masterminded the 9/11 attacks? I think the electorate for the most part don’t really understand federal issues, but even I don’t think there’s much risk of that. If I’m a Paul-bot does that make you an Obama-bot? I didn’t pick their names. One is named Osama and one is Obama. I have no control over their names. I apologize for switching them and harming your fragil sensibilities. Can we talk about the issues now? “failed to put on any proof that he did not write those racial insults, ” Hey, he probably can’t prove that he’s not a witch, either. He said that he neither wrote nor agrees with those statements, and the entirely of his career in the congress and the essays which he did write, show that his stand on racism is just as he states on his campaign website here: http://www.ronpaullibrary.org/document.php?id=982 Here’s quite a bit of other material he’s written. I don’t see a racist lurking here: http://www.ronpaullibrary.org/ Guess again. This isn’t Time Magazine we’re talking about here, it’s a shoestring operation that took submissions from a lot of people, many of whom probably weren’t even paid. The articles in question didn’t have bylines, and your insistence that RP produce a witch to burn doesn’t make him magically able to do so. Why do people still revere Che Guevara? You two are boring and repetitive. Give it a rest. And it’s no ghostwriter who said “they look suspicious”, is featured at davidduke.com, and gets his picture taken with the folks from stormfront. Back in 1996, when Paul won the GOP nomination for the 14th district, he said that his newletter was based on “current events and statistical reports of the time”; he did not deny its content or even having written it. In regard to the statement in his 1992 newsletter that “I think we can safely assume that 95 percent of the black males in that city are semi-criminal or entirely criminal”, Ron Paul said, in 1996, out of his own mouth: “These aren’t my figures. That is the assumption you can gather from [the report]”. (The report stated that 85% of black males had been arrested at some time. I myself have been arrested, but it would not be a safe assumption that I am “semi-criminal or entirely criminal”, whatever that might mean.) But even if the inference to the best explanation were not that he is a racist, his rejection of separation of church and state, promotion of the notion of the U.S. as a Christian nation, and his demonization of nonbelievers would be enough to reject him. And even if that weren’t, there are dozens of other reasons. gets his picture taken with the folks from stormfront Correction: a couple of the stormfronters, who didn’t identify themselves, asked to have a picture taken with him. Thousands of people have asked him for a picture, and he poses with anyone who asks, without making them go through an ideological purity examination first. Thanks truth. Not like it matters to the Paulbots. They have their pet issues and are perfectly willing to cover their ears and go “la la la la la laaaaa la la la la la laaaaaa, I can’t hear you!” The Lucifer Principle says NAACP President: Ron Paul Is Not A Racist http://www.prisonplanet.com/articles/january2008/011308_not_racist.htm windy said: Sure they do, within their tribe. If an enemy of the tribe shows up, the “law of the jungle” still stands. Instead of the survival of the fittest individual, it is the survival of the fittest tribe. After all, your collectivist tribe continually threaten us individualists with violence from government thugs (ex. gun control,”hate speech” laws, etc). If you think that 6 billion predatory apes with mutually contradicting notions of what “ought to be” are going to cooperate out of love and fuzzy bunnies then you’re a fucking dipshit. He said that he neither wrote nor agrees with those statements …but allowed them to be published in a newsletter that bears his name, indicating that he is either a) a terrible manager who let people write things he finds objectionable for years without firing those involved or publishing retractions in the same newsletter, and thus doesn’t seem fit to run a small business, much less the world’s only hyperpower, or b) a liar. Which do you think it is? The Lucifer Principle said: If that’s so, apparently the “truth” machine’s argument has been knocked down. Nevertheless, one must still avoid getting ones-self trapped in a “Cult of Personality”. Sure they do, within their tribe. dude, did you stop reading after perusing Burroughs’ Tarzan series as a child? http://www.blackwell-synergy.com/toc/jeb/19/5?cookieSet=1 and work your way backwards until you find something that your tiny brain can comprehend. Correction: a couple of the stormfronters, who didn’t identify themselves, asked to have a picture taken with him. I don’t think you understand the concept of “correction”, as those two statements are not contradictory. In any case, I’ll take it that you have no “correction” for the rest of what I posted. Since they are unidentified to you, I will identify them for you: Don Black, former Grand Wizard of the KKK, who was convicted in 1981 for attempted armed overthrow of the Dominican government in violation of the U.S. Neutrality Act, is the founder of Stormfront, married David Duke’s ex-wife, and has donated to Ron Paul’s campaign … and his son Derek Black, founder of Stormfront For Kids. Ron Paul is well known to these people; the jury is still out on whether they are well known to him. Please tell me the last name of a federal bill that became law that included a national stance on evolution. In fact, it was a very close thing that the NCLB did not include such language, and it WAS added as an unofficial “rider” by Rick Santorum. you really are rambling. stop embarrassing yourself. or fuck, don’t. see how far it gets you. If that’s so, apparently the “truth” machine’s argument has been knocked down. A fallacious appeal to authority does not “knock down” any argument — how incredibly stupid. Uh, it was T_U_T who brought up this “law of the jungle” silliness. truth machine said: Good point, I stand corrected. #199: No, it was Robert in #146. The battle for the jungle will be fought with nanite weapons! So what, the link says that altruism and cooperation evolved to enhance survival. Individuals form a tribe for common defense against enemies and predators for survival. Thus it would behoove them to use altruism and cooperation to strengthen the group. That just means survival of the fittest group and no-way means that we magically transform into angels jackass. So what, the link says that altruism and cooperation evolved to enhance survival. actually the “link” doesn’t say anything. it merely links to a table of contents. you actually have to READ to grasp what the articles are talking about. go figure. That just means survival of the fittest group and no-way means that we magically transform into angels jackass. you’re insane. this thread is just full of nutters, and PZ has more than proven his point, I think. RP attracts nutters like shit attracts flies. strange, but that does appear to be the case, looking at many threads regarding RP here and elsewhere. windy the dumbass said: No windy the dumbass, truth machine is right, T_U_T brought it up. He thinks that the human ape is magically exempt from the same rules for survival that govern other animals. I propose legislation to make the Law of Gravity optional /Sarc. Ichtyic, you were unable to get what I said. I said that individuals form groups to enhance their survival and that cooperation within the group strengthens the group against predators and enemies. What part of that is false? Interesting statement, here’s another interesting statement: A major research institution (MRI) has recently announced the discovery of the heaviest chemical element yet known to science. The new element has been tentatively named Governmentium. Governmentium has 1 neutron, 12 assistant neutrons, 75 deputy neutrons, and 224 assistant deputy neutrons, giving it an atomic mass of 312. These 312 particles are held together by forces called morons, which are surrounded by vast quantities of lepton-like particles called peons. Since governmentium has no electrons, it is inert. However, it can be detected as it impedes every reaction with which it comes into contact. A minute amount of governmentium causes one reaction to take over four days to complete when it would normally take less than a second. Governmentium has a normal half-life of three years; it does not decay, but instead undergoes a reorganization in which a portion of the assistant neutrons and deputy neutrons exchange places. In fact, governmentium’s mass will actually increase over time, since each reorganization will cause some morons to become neutrons, forming isodopes. This characteristic of moron-promotion leads some scientists to speculate that governmentium is formed whenever morons reach a certain quantity in concentration. This hypothetical quantity is referred to as Critical Morass. No windy the dumbass, truth machine is right, T_U_T brought it up. Does he also post as Robert sometimes? Or are you talking about another thread? Funny, a whole bunch of human apes forgot to read the memo that they ought not behave to each other like wild beasts. Humans are animals. Although it is usually more profitable to freely do commerce with the other person than fighting that other person, there is little to no objective basis for morality beyond that rule. Humans are animals and your mister rogers world is fake. Funny, a whole bunch of human apes forgot to read the memo that they ought not to behave to each other like wild beasts. img.timeinc.net/time/daily/2007/0704/hamas_war0402.jpg poetry.rotten.com/agricola/ http://www.fica.org/hr/sanggauledo/Sanggauledo2.html Humans are animals. Although it is usually more profitable to freely do commerce with the other person than fighting that other person, there is little to no objective basis for morality beyond that rule. Humans are animals and your mister rogers world is fake. Captain C says The blow job is the bigger issue, of course. If a Democratic President is reasonably successful, and presides over a reasonably good time economically (though not without flaws), and gets a hummer in his office besides, people might never vote in any more Republicans, thereby eliminating the chance for a lot of looting and treachery. An illegal war, on the other hand, provides many, many opportunities for profiteering and sadism and thus is to be encouraged. Regarding that NAACP “President” thing, perhaps it would have been better to mention that it was the President of the Austin chapter, or something along those lines. Kind of like when those who decry the 16th Amendment (Income tax) by claiming a judge ruled that it enabled no new tax powers fail to mention that in the very next sentence of the ruling the same judge said that the government already had the power to tax incomes (the 16th Amendment allowed unapportioned taxes, i.e. the gov’t doesn’t have to specify what they’re for in the legislation). If you’re going to fight for a cause, right or wrong, sane or bugf*ck, if you can’t get basic facts right out front and have to rely on distortions or omissions, no matter how righteous your cause, you’re going to come off as a shifty, disingenuous scammer. The thing that’s so pathetic about you leftists is that you are no different than the Young-Earth Creationists. You make twists and turns to magically separate the human ape from the other animals in order to deny the fact that human apes are governed by the same rules of survival as all other great apes as well as all other organisms. Just like creationists. Yup you’re right. I mentioned that term first. T_U_T then said that it can be abolished. Which is just as ridiculous as proposing legislation to make the Law of Gravity optional. Sorry, my mistake. Carry on. Humans are animals. Although it is usually more profitable to freely do commerce with the other person than fighting that other person… Did it cross your mind that people here might be talking about such types of cooperation, not “magic”? Humans are animals and your mister rogers world is fake. So why aren’t you out to kill your neighbours before they can kill you? Also, humans being “predatory” has little to do with whether it’s normal for them to kill their conspecifics. Yeah those laws against murder are just airy-airy leftist denial of our natural killer instincts. I’m sure Robert thinks they should be abolished? Incidentally Richard where do bonoboes fit into your killer ape theory? Posted by: Steve_C \| January 13, 2008 12:58 PM Should “dumb ass” be written as two words, dumbass? Posted by: ryanb \| January 13, 2008 1:10 PM Don’t worry, he’s just an obnoxious ass. Kinda reminds you of a pesty little sister, doesn’t he? Always whining and namecalling and doing almost everything else so he can feel he is somehow when an argument- except backing up his views, that is. They’re obviously the dirty hippies. “Make love, not war, man!” >>No, I’m basing the idea he won’t do the other crazy stuff on his 20 years in office already not doing that stuff. Say what you want about him personally, but the man is consistent in his voting. He just doesn’t vote to give the federal government more power. Ever. >>Naive to assume he will continue doing what he’s been doing for decades? I know, lunacy right? Well, for one thing, I’ve seen some evidence that he’s voted for and sponsored some pretty kooky bills during his time in Congress. For another thing, there are things one can do as President that one can’t do as a member of Congress in our Executive-power-weighted system of government. There are lots of reasons why he wouldn’t have pushed the crazy parts of his agenda in Congress but would as President. That’s my point: I don’t know for sure that Paul would push the crazy part of his agenda in the White House or not. And neither do you. The question is whether it is a reasonable chance to take, that when made the most powerful man in the world, Paul won’t push the crazy parts of his agenda. History tells us, no, it is not a reasonable chance to take. >>Oh sweet evil jebus. NOW Ron Paul is f-n Hitler? You have got to be kidding me, time to turn the channel.< < You'll note that I specifically said Ron Paul is NOT the same as Hitler. He obviously doesn't stand for the same things as Hitler, and I never said he did. You are deliberately mischaracterizing my post. But, once more, my point was that Hitler was an example of when people supported a leader based on the idea that he would only be able to implement the part of his agenda they liked, but would be restrained from implementing the part they thought was crazy. He wasn't. That is the same logic by which some people are supporting Ron Paul. History shows us that this it is a naive and dangerous assumption to make. >>Stop trying to suggest that he thinks the federal government should be banning evolution, or abortion. That’s not what he’s said ever. Why can’t the man hold different opinions than you personally? Why does your little world require complete adherence to everything you like?< < I specifically indicated that Paul does NOT want the federal government doing those things. He wants to roll back time to before the 14th Amendment and give the power to individual States to do those things. It doesn't really matter to most people if their rights are being curtailed by the Federal government or by the State government, and it certainly doesn't to me. Paul supporters claim to be about liberty and freedom, using Paul's agenda to restrict the power of the Federal government as their example, but they fail to mention that his plan won't necessarily make you, the individual, more free. It will only make you more free from interference of the Federal government. It will make you LESS free from interference from the State government. It's a shell game. He's claiming to get government out of peoples' lives, without making it clear he only means the Federal government. He doesn't make it clear that he wants the States to have MORE power to be in peoples' lives, and be LESS restricted by the Bill of Rights. In toto, I believe his plan will result in less freedom for the individual, and he conveniently leaves that out, as do his supporters. >>Good thing he isn’t running for your state government then isn’t it? I’m trying to imagine what this has to do with…well…anything. Oh right, it doesn’t.< < That's just dumb. If I have a right, under Federal law, to an abortion, for instance, and Paul comes along and is able to restrict the Federal government's power and make it a state-level issue, and the state I live in then bans abortion, it makes a BIG f'ing difference! He wants to take rights provided under Federal law and the Federal constitution and make them state-level issues. That means he wants to change what rights I have in this country, and that means it is relevant. Ending the guarantee of a right provided by the Constitution and Federal law and thus allowing that right to be taken away at the State level is a big change and is certainly relevant. Paul wants to make it so that the States can restrict rights that are now protected by the Federal government. That is absolutely relevant. I, like many, including most people who are actually libertarians, don't really care which level of government is restricting my rights. I care that my rights are restricted. Paul wants to make it possible for my rights to be restricted in ways they can't be now. That is relevant. >>No offense, but so does the constitution. It’s not like he’s making this up as he goes. This is how it’s supposed to work. If you don’t like that then your issue is with the Constitution, not Ron Paul.<< Yeah, sure, that was true before the 14th Amendment. But, guess what? We live in a post-14th Amendment world. The Constitution itself provides for how it can be amended. It was amended. That amendment is, therefore, now part of the Constitution. As such, the Constitution is not the problem here, it is Paul, and his desire to ignore the 14th Amendment and go back to an earlier draft of the Constitution which is, in itself, unconstitutional. Paul supporters claim to be about liberty and freedom, using Paul’s agenda to restrict the power of the Federal government as their example, but they fail to mention that his plan won’t necessarily make you, the individual, more free. It will only make you more free from interference of the Federal government. It will make you LESS free from interference from the State government. Exactly. Paul is not a libertarian in that sense, but instead a pre-14th Amendment strict constitutionalist. This explains, for example, how Paul can justify the suggestion of paying off slave owners, but not caring that the labour and liberty of said slaves was stolen, something which should surely outrage a true libertarian. Mooglar said: >snip Ideally neither the Federal Government nor the State Governments should ban abortion or restrict any other individual freedom. Unfortunately real != ideal. In my opinion, both the powers of State Governments and the Federal Government should be reduced. Nevertheless it is a lot easier to leave a state with an onerous (and ultimately futile) abortion ban than it is to leave the country with an onerous abortion ban. It is also certainly better than getting a backalley abortion. However the government doesn’t have the striking power to stop abortions from being performed. If people want them, they will get them. “Smiley-face” fascists are also present on the Right as well as on the Left. The abortion banners are a good example. windy replied: You maybe right, although it sounded like people here think that the human ape is above the rules of survival that all other animals are bound to. Perhaps I misread. After all, the traits that bind social groups together evolved because they enhanced the survival of most of the group’s members. Now here is a question, why is it usually more profitable to freely do commerce with the other person than it is to start a fight with him? To expand this further, why is it usually more profitable for a clan/tribe/nation to freely do commerce with the other clan/tribe/nation than to start a fight with it? That’s, if they want to kill me. Hey, expat. Keep onlooking. Dumb Ass. Posted by: Tulse \| January 14, 2008 9:52 AM But aren’t bonoboes smarter than chimps? Psssst… hey, dumbass. Is it huMAN natURE that leaves you feeling that you just have to get the last word? Yeah, I thought so. Get a life, loser… , we’d all end up living Mad Max-style whether you like it or not. it is usually more profitable to freely do commerce with the other person than fighting that other person Methinks I spy a contradiction. truth machine: Perhaps I was being to simplistic. A more accurate term would be: Given technological trends in the mid to late Twenty-First Century, the Nation-State is finished. Ooops! Forgive my mispelling, I meant “too simplistic”. That’s a very different claim. Perhaps it would be easier to evaluate if your “technological trends in the mid to late Twenty-First Century” link in #146 actually referred to whatever technological trends you have in mind. Hmmm, I would assume that nation-states ceased to exist in the story-line of the Mad Max movies. I would say that the phrase, “it is usually more profitable to freely do commerce with the other person than fighting that other person” remains true within those movies and remains true whether nation-states exist or not. Anyway, in the movie Road Warrior, there was a character called Lord Humongous the Ayatollah of Rockin’ Rollah. You see, Lord Humongous and his minions wanted the oil from a settlement over an oil spigot (sound familiar?). Lord Humongous could have decided to trade for the oil from the spigot community and sold it to other communities at a profit and vice versa. After all, his associates roamed throughout the desert, he could be the middle-man. But he didn’t do that. Instead the Ayatollah of Rockin’ Rollah decided to invade the oil spigot community and ended up losing any chance of benefiting from that oil when they resisted (sound even more familiar? It should.). Now, onto the “nation-state”. I basically said or I meant to say: If current technological trends continue into the mid to late Twenty-First Century, then, the Nation-States eventually cease to exist. Perhaps by 2100. So here is a question: How does a Nation-State impose its will on its people? truth machine, does the phrase “last argument of kings” mean anything to you? What is it about libertarians using movies as evidence? Mad-frickin’-Max?!?!?!? Hell, why not bring up Dune while you’re at it? Reading too much Ayn Rand seems to poison people’s reasoning centres. Tulse: I guess you’re too stupid to understand metaphors. No, just too amused to take anyone seriously who uses Road Warrior as a guide to economic theory. Tulse said: I also don’t take anyone seriously who lacks reading comprehension. Continuing on…. I asked earlier: Why is it usually more profitable to freely do commerce with the other person than it is to start a fight with him? To expand this further, why is it usually more profitable for a clan/tribe/nation to freely do commerce with the other clan/tribe/nation than to start a fight with it? Onward to the Nation-State: How does a Nation-State impose its will on its people? What is meant by the term, “last argument of kings”? I’m sure I’m just slow — you want to re-read post #231 and then explain to me how that post isn’t essentially an argument about trends in the organization of political entities using a Mel Gibson action-sci-fi movie as the pivotal example? I didn’t mean to use that mad-max metaphor as a pivotal example. I actually meant it to be a metaphor for a real life event. You should have read earlier posts. Anyway, to help you guess what it represented, I will add even more highlights to it: You see, Lord Humongous and his minions wanted the oil from a settlement over an oil spigot (sound familiar?). Lord Humongous could have decided to trade for the oil from the spigot community and sold it to other communities at a profit and vice versa. After all, his associates roamed throughout the desert, he could be the middle-man. But he didn’t do that. Instead, the Ayatollah of Rockin’ Rollah decided to invade the oil spigot community and ended up losing any chance of benefiting from that oil when they resisted (sound even more familiar? It should.). Anyway, continuing on. I’ve stated earlier that if current technological trends in this Century continue, the Nation-State would eventually cease to exist. I think it would be mid to late Twenty-First Century. I heard others say 20 years from now but I think that’s too early. It could be much later than my own guess. So first, one must discuss the Nation-State. I would assume that nation-states ceased to exist in the story-line of the Mad Max movies. Sigh. I don’t understand how people don’t see that such blatant fallacies are fallacies. Just because Mad Max entails the end of nation states doesn’t mean that the end of nation states entails Mad Max; sheesh. I would say that the phrase, “it is usually more profitable to freely do commerce with the other person than fighting that other person” remains true within those movies and remains true whether nation-states exist or not. The movie was fiction; it’s meaningless to talk about some maxim being true in it. But by your own retelling, the movie portrayed fighting, not free commerce. That’s why I said that your maxim contradicted your claim that technological trends would lead to Mad Max. This is rather straightforward, but I suspect not comprehendable to you. I asked you to say what technological trends you are referring to; without that, you’re just wasting ink. You’re no Socrates; instead of asking stupid questions, just make your point. On further thought, don’t bother; you’re too dim for me to waste further time on. I’ve stated earlier that if current technological trends in this Century continue, the Nation-State would eventually cease to exist. I think it would be mid to late Twenty-First Century So historically inevitable forces will make the state “wither away”? It is profoundly ironic to see a libertarian make that claim. After the end of Nation States, the City State will make a comeback, powered by a biologically renewable energy source. Discuss. You call me stupid yet you can’t answer easy questions such as, “How does a Nation-State impose its will on ‘its’ people?” and “What is meant by the term, ‘last argument of kings’?” Hint, they are very related. It would be a shame if I posted these same questions somewhere else and got correct answers. It would mean that you’re less intelligent than they are or just willfully ignorant. If you can answer these, then we can go on to the next question: “What sort of technological trends would erode the Nation-State’s ability to impose its will on ‘its’ people?” By the way, using a side issue (problems with using Mad Max scenarios as metaphor for hollowed-out states or disintegrating states as well as choosing to either fight or trade) to distract from the real issue (the decline of the Nation-State or Central State) is a logical fallacy, hypocrite. Tulse, your reading comprehension is really that bad. Even with additional highlights to my retelling, you’re still unable to figure out what sort of real event it was representing. Even more, your poor reading comprehension is still present in post #242. Don’t even bother to respond. Robert, I honestly did get the allusion you were making the very first post, and again, it seems idiotic to equate current geopolitics to a Mel Gibson sci-fi action film. You would be taken more seriously if you just made your argument explicitly rather than resorting to making your point by analogy to rather cheesy ’80s movies. (Did you see the one woman’s aerobics outfit? Is that what the end of the nation-state is going to look like, a bad Duran Duran video ripoff?) Whoa there, cowboy. You were the one who attempted to clarify the issue of what technological trends in the mid to late Twenty-First Century would lead to the demise of the nation-state by, in all apparent seriousness, citing a silly 1980’s Australian post-apocalyptic movies as some sort of evidence (as in “I would assume that nation-states ceased to exist in the story-line of the Mad Max movies. I would say that the phrase, “it is usually more profitable to freely do commerce with the other person than fighting that other person” remains true within those movies”). What tm and I (and even windy) have been doing is responding to your example, the only shred of specificity you have provided for your grand historical claims. If you want to argue specific issues, then cite specific issues. If you want to cite current events, then cite specific current events, and identify their relevant features rather than hide behind coy allusions to them via bad Aussie sci-fi. (And while your taking tm to task over famous phrases, perhaps you can do me the honour of identifying the name most associated with the notion that inevitable historical forces would cause the nation-state to wither away. As I said above, it’s pretty damned ironic that you seem to be pushing that position.) Don’t be silly, this is way too much fun! Why don’t you answer my two questions then to get this started: How does a Nation-State impose its will on ‘its’ people? What is meant by the term, “last argument of kings”? I posted this on other blogs and the libertarians had no problem giving the correct answers. You have contempt for the libertarians yet you have a hard time answering the questions. They aren’t hard questions. Tulse: To help your reading comprehension skills, figure out what “if” means. I have posted these two questions on other sites and not one single collectivist could answer these to questions correctly. Man, Robert, you seem to put a ton of weight on these simplistic libertarian phrases. Let’s get the second out of the way. I’ll admit I had to Google the specific reference (it is the phrase that Louis XIV had stamped on his army’s cannons), but even prior to that the general gist was pretty clear, since libertarians are always about force. Oddly enough, however, they are also always about gun ownership, which presumably means that stamping “the last argument of libertarians” onto the barrel of handguns would also be apropos. As for the first, the simplistic, pat libertarian answer is “force”. That, however, glosses over the fact that a) there are huge differences among states in the amount of coercion they use, b) in democracies, “its” people are the State, and so talking about the State imposing “its” will is rather misleading, c) in most modern democracies, individual liberties are not just, or even primarily, constrained by threat of force, but by such things as mutually-agreed goals and social convention. Sure, the ultimate way the State enforces “its” will (which derives in democracies from the will of the people) is through force. But that is ultimately the way that all contracts are enforced, even in Libertopia. It is silly to claim that force is somehow inherently evil when libertarians are quite ready to resort to it when property is threatened, or contracts are violated. The issue is whether the people consent to the State having such power, whether they themselves make a social contract with the State (i.e., essentially with each other). I don’t know why you feel these “questions” are so profound, or why you feel so triumphal when asking them. They are the basic stuff that libertarians always spew. Good, you answered them Tulse. I never claimed using force as retaliation against initiation of force is “evil”. Democracy is one of the checks against a state’s power. in most modern democracies, individual liberties are not just, or even primarily, constrained by threat of force, but by such things as mutually-agreed goals and social convention. Here’s a question, what if individuals within a democratic Nation-State don’t have mutually-agreed goals and social conventions? Let’s get the second out of the way. I’ll admit I had to Google the specific reference (it is the phrase that Louis XIV had stamped on his army’s cannons), You don’t have to be ashamed about it. It’s okay. Then typically the majority’s desires are given preference, unless there is a constitutional reason to prevent that. So if the majority wants to place restrictions (initiate force) which the minority considers illegitimate (assuming no shared common values between the majority and the minority), how does the majority impose their will on a non-compliant minority? Through the violence of the “king’s cannon” of course. The constitutional checks on the Nation-State’s power (in the U.S., the checks consist of the Bill of Rights, rival branches of government, and rivalry between the Feds and the States) may prevent the initiation of violence by the Nation-State. The term “king’s cannon” can be used to describe the striking power gap between the central government and networks of private individuals and groups. The rise in this striking power gap after the Middle Ages due to the invention of cannon (the central government can afford more cannons and ordnance than the nobles) gave rise to the modern Nation-State. The advent of modern conventional military and police ordnance in the Twentieth Century enabled the Nation-State to grow more centralized and stronger. This leads to the next question. If a large nation-state with huge resources to field a large and well-trained/equipped army desires to invade a small nation-state that doesn’t have such conventional force, how would a small nation-state deter the larger nation-state from invading? The rise in this striking power gap after the Middle Ages due to the invention of cannon (the central government can afford more cannons and ordnance than the nobles) gave rise to the modern Nation-State. That’s an…”interesting”…historical thesis, and one that you don’t provide any evidence or references for. As some counter-evidence I’ll note, for example, that in France during the Middle Ages and later, the king was often less wealthy than many nobles — just being king didn’t mean you were the richest person. Also, nobles would often ally, and together could often muster a greater force, and greater wealth, than the king. The reason the king was obeyed was not just because he was wealthy or had a stronger military. In any case, I doubt if the peasants under a noble gave a damn about cannons, and whether the nobles or king was in charge, since a mounted knight was effectively a tank against untrained foot soldiers. It appears this historical claim is more about how power is distributed and maintained among the ruling classes, since for an average citizen a noble was pretty much the “central government” that concerned him or her. This claim has little to do with modern concerns, or with private citizens as you’ve been addressing them. The term “king’s cannon” can be used to describe the striking power gap between the central government and networks of private individuals and groups Ask any ruler of a country who has been overthrown by the military how much control “kings” have over their “cannons” without some sort of social contract and traditions. It’s really not just about weapons, else someone in a nuclear missile silo would be president. If a large nation-state with huge resources to field a large and well-trained/equipped army desires to invade a small nation-state that doesn’t have such conventional force, how would a small nation-state deter the larger nation-state from invading? Um, by handing out F-22 fighters and M1 Abrams tanks to its citizens? Jesus H. Cthulhu, I am so not going to get into a protracted back-and-forth on personal guns as civil defense, especially as I don’t view Red Dawn as some sort of documentary. The US in particular is, due to its geographic size and isolation, a rather unlikely target of invasion (as much as I love Canada, I doubt the Canadian army could hold Buffalo, much less the continental 48). And historically, in the modern era, I don’t know of any actual invasion (with the intent to hold territory) that was stopped by personally owned weapons. (There are plenty of examples of insurgencies and rebel armies supplied with military weapons, often by one of the superpowers, but that is a completely different kettle of fish.) Robert, if you want to have a discussion on weapons, which is far afield from the original post, that’s fine, but you’ll have to find someone else to do it with, since I have little interest in going over that well-ploughed field. (If you’re going somewhere else with this line of argument, I’m willing to see where that is, but I certainly don’t want to devote my life to debating this thread.) Of course there are exceptions. After all, there are examples of dictators in the twentieth century being overthrown by one their senior military officers. You also noted that having a common set of values (hint, hint) is also useful to hold a nation-state together. I agree. If it isn’t there, then there is just the “king’s cannon”. You are also correct about past insurgencies. I also agree that the peasants had less striking power than the knights. The reason why an individual in a nuclear missile silo can’t declare himself president is because he doesn’t have the key code and it takes an army of technicians to maintain nuclear warheads as it currently stands. Tulse replied: If the small nation-state doesn’t have a well-trained/equipped conventional force, its not going to have those equipment in the first place. So, how should the small nation-state deter the big nation-state assuming nobody is going to come to the small nation-state’s aid? Hint, you just mentioned it within your reply. To help with the hint, I will mention some real world examples for the “big nation-state” and the “small nation-state”. The “big” U.S. was able to invade the “small” Iraq. But the “big” U.S. is deterred from invading the “small” Pakistan or the “small” North Korea. Why? Robert, don’t bother hinting. I won’t play Socratic games with you. Make your argument so it can be debated, or just go away. It’s quite simple, you’re trying to minimize the issue of the state monopoly on violence. It seems you want to avoid doubt in the State’s legitimacy. you’re trying to minimize the issue of the state monopoly on violence So you’re saying I physically can’t pick up a rock and throw it at someone? Be more precise. . It would be a shame if I posted these same questions somewhere else and got correct answers. It would mean that you’re less intelligent than they are or just willfully ignorant. Having better things to do than engage in silly games with one of the vast number of morons on the internet would mean that I’m less intelligent than someone who does? That’s quite funny. A moron incapable of understanding his own citations. Blah, blah, blah. It is ironic that a moron calls another person a moron. What are you afraid of, pansy? Perry de Havilland was able to answer these easy questions in a matter of minutes. Even Tulse answered these questions, even though he/she tried to avoid any doubt in the legitimacy of the State and the monopoly on violence. It is pathetic that you are relying on a “red herring” to avoid the question altogether. Guess what “truth” machine, I don’t recognize your authority, limpwristed fuck. You’re afraid of the fucking question. I don’t recognize your authority, limpwristed fuck. Moron and homophobe. Oh really? Do you think all homosexuals are “limpwristed fucks”? Why don’t you answer my questions, coward? Or do you think “coward” stands for homosexual? Remember “truth” machine, I don’t recognize the legitimacy of your own set of values. What are you afraid of? What are you afraid of about my questions?	cc/2021-04/en_middle_0039.json.gz/line844
__label__wiki	0.885321	0.885321	The Outrage Founder, Rebecca Lee Funk, Announces VOTE Collaboration with Naturalizer The Activist Joins Forces with the Leading Global Footwear Brand to Empower Women to Use their Voices at the Polls in November ST. LOUIS--(BUSINESS WIRE)-- In anticipation of the November 2020 elections, Rebecca Lee Funk, founder of popular activist network The Outrage, announces the release of a limited-edition boot with Naturalizer meant to empower women everywhere to speak up and demand change. Naturalizer Callie VOTE boot (Photo: Business Wire) Available this August, the limited-edition boots spell out “VOTE” in capital letters along the top of the toes with an exclusive, hand-painted design by artist Kiersten Essenpreis. She Should Run, a nonpartisan, nonprofit organization, that works to increase the number of women considering a run for public office, is a beneficiary of the initiative. “These boots represent all the ways we’re marching in the footsteps of the women before us, with the women beside us, and for the future rights of all women,” says The Outrage founder and CEO, Rebecca Lee Funk. “Now more than ever, our voices matter and need to be heard. Our marching orders are simple — vote.” Partnering with Naturalizer is an organic extension of Funk’s role on the brand’s “Today We Will” platform last year. Funk was initially tapped for the campaign because her passion and work aligned perfectly with the brand’s mission to encourage women to declare their intentions for how they will make a difference. The VOTE boots are in step with “Today We Will” and the community-minded, issue-driven, fashion pieces synonymous with The Outrage, launching alongside Funk’s existing cult-fave merch featuring sayings like “Resist,” “Year of the Woman” and “I Believe in Science.” “This collaboration is significant to both brands’ core values of female empowerment and equality: From The Outrage’s platform demanding industries move to resist oppression, to Naturalizer’s development of the first shoe formed specifically to a woman’s foot,” says Angelique Joseph, vice president of global design at Naturalizer. “We hope the VOTE boots will inspire action and a step toward change, literally and figuratively.” To celebrate the launch on August 13, Naturalizer is hosting a live virtual discussion led by Cece Olisa, a member of their N Voices community, on the importance of building a healthy and inclusive democracy, and empowering all women to use their voices at the polls this November. Panelists include Angelique Joseph, VP of Design, Naturalizer, Erin Loos Cutraro, Founder & CEO, She Should Run, Rebecca Lee Funk, Founder, The Outrage and Mo Ivory, Attorney & Co-Chair, Fair Fight Action Creative Council. The VOTE boots will retail for $150 and will be available online at Naturalizer.com and TheOutrage.com starting August 13, 2020. For more information, please visit www.Naturalizer.com. About Naturalizer: Our passion is our purpose. To bring women a better shoe. In fact, Naturalizer is the first to construct shoes to withstand the test of time. Our legendary emphasis on fit and elegant simplicity launched a brand that became known as “the shoe with the beautiful fit.” Since 1927, we’ve crafted beautiful and modern styles that look and feel exceptional, inside and out. www.naturalizer.com About The Outrage: The Outrage is a nation-wide hub for activism, with flagship headquarters based in DC. Our mission is simple — to leverage the power of community and fashion to mobilize the next generation of activists. In our community and retail spaces, The Outrage has registered thousands to vote, helped thousands more to contact their representatives, fundraised for progressive organizations and put on hundreds of community events featuring presidential candidates, representatives, activists and celebrities. We've been an official partner of every major movement since the 2016 election — think Women's March, March for Our Lives, Families Belong Together, etc. Now, The Outrage is heading where it matters most in 2020 — the battleground states. http://www.the-outrage.com/ About She Should Run: Founded in 2011, She Should Run is a non-partisan 501(c)3 that provides an approachable starting place and network for women leaders considering a future run for office and for those who support them. Their mission is to expand the talent pool of women running for office in the United States by providing community, resources, and growth opportunities for aspiring political leaders. They believe that women of all political leanings, ethnicities, and backgrounds should have an equal opportunity to lead in elected office and that our democracy will benefit from the varied perspectives and experiences that women bring to leadership. https://www.sheshouldrun.org/ Holly Campbell hcampbell@caleres.com Naturalizer Callie VOTE boot (Photo: Business Wire) 3319 x 5164 jpg 5.91 MB Download original jpg 5.91 MB 3319 x 5164 Download thumbnail png 45 KB 129 x 200 Download lowres png 234 KB 309 x 480 Download square png 98 KB 250 x 250 Naturalizer Callie VOTE boot (Photo: Business Wire) 2400 x 2400 jpg 639 KB	cc/2021-04/en_middle_0039.json.gz/line857
__label__cc	0.65773	0.34227	Home Defense Gun When seconds count and the police are minutes away What If Gun Reviews Were 100% Honest? February 1, 2016 By Home Defense Gun This is a guest post by Andrew Betts Wait, are you saying that not everything I see on the Internet is 100% factual? Are gun reviews are lying to me? In short, yes. Nothing is ever really that simple, though is it? We like guns. I mean, they are useful tools for defense of home and family, but you probably aren’t reading blogs about fire extinguishers. Besides being deadly serious tools, guns are also fun to shoot and entertaining to talk about, watch videos about, or drool over glossy magazine photos. There is a big business built around gun related entertainment. We read magazine and blog articles and follow Facebook groups. (You are following The Home Defense Gun on Facebook, right?) We watch YouTube videos and television episodes. We voraciously consume gun related entertainment. How accurate is the information we are getting though? What would it sound like if these guys were 100% honest? We hunger for information about guns because there are far more guns out there than we could possibly afford to buy. When we do buy a gun, ammo, accessories, or related accoutrements, we really want our dollar to be spent well and that makes us hunger for information even more. What’s more, there is tremendous competition in the industry and every manufacturer is desperate to get information out to as many people as possible. Enter the gun rag correspondent and the YouTube gun channel. They will happily tell a great number of people about your brand new blaster or bullet. Free test samples mean low cost advertising for the manufacturer and a source of content for the writer or YouTube poster. The folks reading or watching the content get to find out about new products and get a close look at more products than they could possibly buy. The problem comes when people perceive this content as an unbiased review when, in many cases, the video or article amounts to a paid advertisement. We cannot simply dismiss all of the content out of hand, either. They are certainly not all paid shills and there is a lot of ground between outright paid shill and completely unbiased plaster saint. At one end of the spectrum, there is the YouTube channel that is treated like a business. They receive a lot of test samples, they have a large viewership which generates significant revenue on its own, and they may even get paid sponsorships. In turn, they pay to promote their content through Google AdWords, Facebook, and other venues. These guys often do reviews or even “testing” but the tests are more of a demonstration than any real measurement of the product’s capability. For example, shooting a magazine of M855 “penetrator” into a level III steel plate looks cool on video, and to uninformed viewers it sounds impressive, but it provides no real insight into the product’s capability considering that any level III plate should stop that round easily. The “test” is intentionally set up in such a way that the results are known before filming. These channels will also do almost anything to produce more content because they rely on YouTube (and possibly advertising revenue) to put food on their plate. They literally do not have a day job. That doesn’t mean you shouldn’t watch his channel, of course. It is still entertaining. The close relationship with manufacturers that these channels enjoy often means they get information about new products long before other outlets. We all like to hear about the coolest new thing. It just means that you need to be aware that at least some of the videos from this kind of channel are essentially commercials. Most of the time, the bias from the paid shill crowd is reflected in somewhat gentle “testing” or they may simply neglect to mention some of the negative factors that could affect your purchase decision. Other times they will go so far as to be intentionally deceitful. There is more than one eyewitness report of a famous YouTuber experiencing constant malfunctions on the range and then posting a video with no mention of the problems. My personal opinion is that outright fakery like this is rather rare, but it is important to keep in mind that, unless you were personally present during a range session, you cannot know whether malfunctions were simply edited out. At the opposite end of the spectrum is the guy who pays for everything out of his own pocket and receives no sponsorships whatsoever. This guy is the antithesis of a paid shill. You can be sure that he is not producing advertising material for a manufacturer but he may have some of his own biases and opinions. We are all human and it is likely impossible to prevent any bias whatsoever creeping into a video or article. Still, some people elevate opinion to an art form. Sometimes he may base those opinions on dangerously faulty assumptions, such as recommending lightweight varmint ammunition for defense because he doesn’t understand the importance of the 12” minimum. Often, this guy starts to believe himself to be an expert simply because people listen to him and he may have significant knowledge but it is important to remind ourselves that there is always more to learn. A subset of this category is the guy who believes himself to be an expert because he was a cop or a soldier. I do not consider myself to be an expert by any means but I have learned a great deal more about guns in my civilian life than I did in the Army. I have even learned far more about the M16A2 and M4 as a civilian than the Army taught me. There is a great deal of subtlety between those two extremes, though. Most people can probably tell that channels which never say an unkind word is only out to generate ad revenue, but just because a YouTube channel receives products for free does not mean they are shills. Channels like ShootingTheBull410 also receive materials for free and still perform fair testing that does not always reflect positively on the product in question. This is probably one of the most important ways to discriminate between the outright shills and the rest. If a gun channel, blog, magazine, etc. has never uttered a negative word about a product, it is probably safe to disregard their “reviews” as simple advertising. On the other side of that coin, the negative reviews may involve products the reviewer paid for out of pocket while the positive reviews involved products provided by the manufacturer. This sort of “pay to play” arrangement would be particularly cynical and I hope that it is rare. This same concept applies to the products themselves, though. Manufacturers are unlikely to go on record telling reviewers that they won’t send product unless they get a positive review, but this is often the implied subtext of correspondence. I know of at least one YouTube gun channel who was literally told by a sales representative that they would only send samples if they could review the video before publishing Please understand that I’m not trying to tell you to stop watching YouTube gun reviews or gun rag articles, I just want you to understand that there may be significant motivation for some of these guys to bend the truth or maybe even lie. Remember, he may seem like a really trustworthy person, but that’s his job. Unless you have met the person reviewing or “testing” a product, you cannot speak to their trustworthiness. That applies equally to me, of course. I urge you to exercise discretion and view everything with a healthy dose of skepticism. Focus on the facts and compare independent sources. As always, training is more important than gear. No amount of cool stuff can make up for a lack of training. Andrew Betts served with the Arizona National Guard for over 12 years, including a tour to Afghanistan. Visit his YouTube Channel for more great shooting information. Filed Under: Must Knows Tagged With: beginner, home defense gun, reviews What ATF Regulations Mean for You as a Gun Owner How to Build Your Own Glock Pistol Copyright © 2021 \| Privacy and Disclosure \| Curation Policy \| DMCA Policy	cc/2021-04/en_middle_0039.json.gz/line859
__label__wiki	0.814109	0.814109	HC seeks govt reply on violations by liquor bars in Karnataka The court was hearing a plea which sought not to set up a FL2 bar at New Railway Station Road at Kumbakonam in Thanjavur district टाइम्स न्यूज़ नेटवर्क The Madras high court on Tuesday sought details on the action taken against FL2 and FL3 bars for violations in the state. The court also sought details from the state government on the number of FL2 and FL3 licences issued in the state and the volume of liquor supplied to these bars during the past five years. The court was hearing a plea which sought not to set up a FL2 bar at New Railway Station Road at Kumbakonam in Thanjavur district. In order to curb the violations at the bars, the judges appointed an advocate A Kannan as amicus curiae in this case to assist the court. A division bench of justices N Kirubakaran and B Pugalendhi observed that as per rules, FL2 and FL3 bars which are functioning at clubs and hotels are permitted to sell liquor only to the members and those staying in the hotels. The judges observed that however, these bars are violating the time restriction and are also selling liquor to the public. The judges sought details as to whether there were any violations in these bars and if so what are the actions taken against such bars. The judges also granted interim order restraining the authorities from granting licence to the bar at Kumbakonam. Thanjavur district Bird flu rumours sees diners turn to fish, retail prices double Changes in law on cigarettes, other tobacco products to impact F&B sector: NRAI	cc/2021-04/en_middle_0039.json.gz/line863
__label__wiki	0.524981	0.524981	THE OFFICIAL SITE OF THE Kalamazoo Growlers Group Priority List Get on the Priority List to choose your game date and group area before the general public. The $75 will be applied to any ticket order for the 2021 season. Game dates, group areas, and seating locations are chosen on a first come, first served basis. Get on the list today. Please put "1" in the box below. Then click add to cart after that, fill in your information and you will be added to our Group Priority List for 2021! Have other questions? Call Justin at 269.492.7410. Your ticket locks have expired YOUR TICKETS WILL BE RELEASED IN Complete your transaction to ensure you receive these tickets. Watch Games Live Copyright ©2021 Kalamazoo Growlers. All Rights Reserved. Anyone holding or using this ticket in Homer Stryker Field (1) assumes all risks and dangers incidental to the game of baseball, whether occurring prior to, during or subsequent to the actual playing of the game, including specifically (but not exclusively) the dangers of thrown or batted balls or objects, and (2) agrees the Kalamazoo Growlers; Kalamazoo Baseball, LLC; and the Northwoods League; participating clubs, coaches, players, or any other individual or entities, should not be liable for any injuries resulting from the aforesaid causes. The holder of this ticket also agrees to allow the Kalamazoo Growlers to reproduce their likeness for promotional purposes. No outside food or beverages allowed into Homer Stryker Field. RAIN POLICY: In the event that a regulation game is not played, this ticket may be exchanged for a ticket of equal or lesser value for any 2021 regular season home game, subject to availability. All promotions, dates and times subject to change without notice. For ticket information, call the Growlers at(269) 492-9966.	cc/2021-04/en_middle_0039.json.gz/line871
__label__cc	0.503544	0.496456	Lake Resources NL (ASX: LKE) Lake Resources’ Technology Partner in California Picks Up Steam After Restrictions are Lifted June 09, 2020 08:51 PM AEST Lake Resources has been working closely with technology partner Lilac Solutions in California for the processing of lithium brines from its Kachi project. Work at Lilac’s processing plant was initially delayed due to restrictions placed to tackle the spread of COVID-19. Lilac, as well as related service providers, are all set now to resume their operations from the current week, with the relaxation in restrictions and removal of curfews. Resumption in operations comes at a time when LKE can draw benefits of increasing price movements for high purity lithium products. Lithium exploration and development company focused on producing sustainable and high purity lithium, Lake Resources NL (ASX:LKE) has been actively engaged in processing of brines at the processing plant of its technology partner Lilac Solutions in California. LKE’s technology partner is expected to resume its operations for the processing of lithium brines obtained from Kachi project at its direct extraction pilot plant module from the current week, as the ‘shelter in place’ restrictions and curfews have now been relaxed. Post the significant update, LKE stock soared by 2.5%, closing the day’s trade at $0.041 on 9 June 2020. LKE had transported a total of 40,000 litres of Kachi brines to the pilot plant of Lilac Solutions in California by the month of April 2020. Initially, LKE had transported 20,000 litres of brine samples to the pilot plant, processing of which had already been progressing but was delayed slightly under initial COVID-19 guidelines. Moreover, additional 20,000 litres of brine samples were transported, expected to ensure sufficient samples to meet the growing demand from potential off-takers of LKE. Besides, there has been an increase in the interest of battery makers, EV manufacturers, and other stakeholders in the supply chain in the direct extraction process for the Kachi project. More Can be Read At: Lake Resources Sends Additional Kachi Lithium Brine Samples to Lilac’s Pilot Plant Currently, along with the conclusion of commissioning, 20,000 litres of brines received from Lake’s Kachi Lithium Brine Project is being processed through the pilot plant modules at the new advanced facility and warehouse. As a result of the loosening of restrictions, other service providers that are crucial to Lilac’s operations have also resumed their activities. Interestingly, the reopening of operations of LKE’s technology partner coincides with growing interest in sustainable and consistent high purity lithium products and with increasing price momentum for high purity lithium products, given a lack of battery-grade supply for EV makers. The nature of Lilac’s direct extraction process to be cost-competitive, sustainable and scalable were highlighted by the recent Kachi Pre-Feasibility Study (PFS) by LKE. More about PFS Can Be Read Here: Lake Resources Concludes Kachi Project’s PFS, Robust Results Further Strengthen Project Prospects LKE Riding High on Buoyant Market Opportunity Multi-billion-dollar subsidies and investments announced by the European nations, including France, Germany, the Netherlands and the United Kingdom offers several advantages to lithium explorers and developers like LKE. In addition to this, boosts in China (extension in state subsidies and tax breaks for New Energy Vehicles) and South Korea (US$110 billion New Green Deal, including significant investment in renewable energy) have been announced to support the EV industry as part of post-pandemic recovery plans. Considering paradigm shift towards heightened green environment awareness and supported by recent investment initiatives, Lake Resources is said to be well-placed to draw benefits from the market opportunity in batteries and the electric vehicles that power and drive the energy revolution, as evident by the following: High Purity Lithium Carbonate samples (99.9%) from the pilot plant using a direct extraction process with very low impurities are capable of achieving premium pricing. As bigger samples are anticipated to be produced from Q2 2020, engagement with off-takers acceleratedto initiate qualification testing and contribute towards aiding in financing. The Pre-Feasibility Study of the Kachi Project has shown estimated costs of production at the lower end of the cost curve like existing producers of lithium brine. Moreover, the resource at Kachi project is seen to be significant enough for long term production and has the potential to be scaled to a much greater project. As demanded by the bigger Electric Vehicle manufacturers and a growing number of battery/cathode manufacturers to show the quality and attribution of battery materials for carbon footprint reporting and ESG/sustainability, LKE has sustainable as well as scalable future lithium production. Upon removal of the lithium using ion-exchange beads without affecting the chemistry, the direct extraction process reinjects brine, meaning significantly less footprint and minimal water usage as evaporation ponds are not used. Related Read: Lake Resources Optimistic on Lithium Outlook; Update from Investor Stream Interview There has been increased awareness among the general public during COVID-19 regarding environmental protection, with reduced pollution levels due to shutdowns and visible improvements in the environment across the globe. This is likely to sweeten the deal for electric mobility/electric vehicles manufacturers in the near term by making the public positively predisposed towards the adoption of environment-friendly modes of transportation. Must Read: Lake Resources Zooms ~9% on ASX; New Research Reflects Kachi Project’s High Potential ASX:LKE Lithium exploration Stellar drilling results put Boab Metals (ASX:BML) in the box seat	cc/2021-04/en_middle_0039.json.gz/line872
__label__wiki	0.552746	0.552746	1-1 Services Weekly Social Media Quick Tip: Twitter Lists Today we’re looking at Twitter lists. I have lots and lots of Twitter lists. I have Twitter lists for people that are in New Jersey – which is where I live, social media of experts, B-schoolers (I’m a member of Marie Forleo’s B-school), my clients. I have one called potential clients. And they are all private. You have an option to make them public or private. I choose to make them private because when they’re public those you add will get a notification that they’ve been added to a list. You don’t necessarily want people to know that you’ve added them to a Twitter list that’s called “potential clients” for example. Make your Twitter list private unless you have a reason to create them as public. What can be powerful about a list is that it helps you engage and support with people more intentionally. For example, I’m a member of Solo-e. So with this list (members of Solo-e), I can create engagement with members and support them. When I click on the Solo-e Twitter list, it only gives me people that are members of Solo-e. (Here’s how to create a list.) Now I can go in and I can re-tweet and share content from people on this list to show support for them. Think about how powerful this could be if you have a list of your clients or potential clients, a list of places you want to speak, a list of local people that you just want to support. It makes it so much easier. When you go to my home Twitter feed, you’ll see there’s so much stuff in there. I can’t possibly make heads or tails of the people I want to engage with. Twitter lists help me do that. Do it now. Do it while your Twitter list is smaller. It’s never going to be smaller than it is today. Right? Do it today! Subscribe to my YouTube channel to see more videos! Karen Yankovich © 2020 Karen Yankovich \| All Rights Reserved	cc/2021-04/en_middle_0039.json.gz/line873
__label__wiki	0.848983	0.848983	Home Blog News Ernie Smith Heats Up the Summer – Brand New Single "Nutten A Guh Come Outta Dat" Ernie Smith Heats Up the Summer – Brand New Single "Nutten A Guh Come Outta Dat" After 40+ years in the business, iconic Reggae singer Ernie Smith is as vibrant and energetic as ever, showing no signs of slowing down. The pioneering singer/songwriter promises to heat up the summer with his latest single “Nutten A Guh Come Outta Dat,” a humorous social-commentary about recent socio-political issues in Jamaica. New York, NY (RAINE PR): After 40+ years in the business, iconic Reggae singer Ernie Smith is as vibrant and energetic as ever, showing no signs of slowing down. The pioneering singer/songwriter promises to heat up the summer with his latest single “Nutten A Guh Come Outta Dat,” a humorous social-commentary about recent socio-political issues in Jamaica. Smith will be hitting the Caribbean, Canada, and United States this summer to present the new single, along with his repertoire that includes pulsating classics like “Duppy Gunman,” “Elsaida,” “Play De Music,” and “Pitta Patta.” Download “Nutten A Guh Come Outta Dat” In addition to touring, Smith, a passionate humanitarian, will be part of a diverse group of talents including famed singer Glen Washington, Dancehall veteran Ini Kamoze, Dub poet Yasus Afari, Dancehall deejays Lexxus and Laden, Turbulence, Lutan Fyah, and hot new artist Protégé, to raise money for the St. Elizabeth Technical High School 50-Year anniversary on Friday, June 24th. One of Smith’s highly anticipated summer performances will be at this year’s Merritone Family Fun Day in Connecticut in July. The annual event attracts thousands of music lovers from all over the Northeastern United States. The performance is somewhat of a homecoming for Smith, whose signature single “I Can’t Take It” was recorded on the Merritone Label in late 1960s. Over the past few weeks, Smith, an internationally recognized, award-winning songwriter gave a rousing performance for a select VIP crowd in Negril, Jamaica, before touching down in Ft. Lauderdale, FL for a special performance on Mother’s Day. He then wowed the crowd at a Bob Marley Tribute in the Bahamas. Reggae lovers reveled in Smith’s performance of his classics, as well as new material from his latest album Country Mile, which features the ska-flavored tile track “Country Mile,” and the humorously satirical tune “That’s the Kind of People We Are” featuring Pluto Shervington. Last month, Smith met up with Reggae stars John Holt, Johnny Osbourne, Lady Ann, and Ed Robinson during a meet and greet at VP Records, before captivating Nazareth Hall in Brooklyn with Vincentian singer Judy Boucher. The following week he did an impressive two-day stint in Grand Cayman. “So far 2011 has been good to us,” states Smith. “We have been to Belize, made multiple visits to New York state, – one of which was to collect an achievement award from Linkage Radio – Connecticut, Boston, Rhode Island, Cayman Islands, Ft. Lauderdale, Nassau and of course a really blessed time in Jamaica.” Last month, Smith’s live performance on the on the brand new Television Jamaica (TVJ) series Layers of Soul was an enormous success. The episode aired on May 29th. Nutten A Guh Come Outta Dat Lee G Releases Video for “Standing” Trinidadian/ Brooklyn-based artiste Lee G has been spreading his message musically for many years blending various musical influences into his culture reggae sound. As lee G says, whats makes the difference is “the soul in the music”. ONLY A VERBAL CLASH? Sizzla's camp denies physical conflict with Jah Cure Reggae artiste Jah Cure has released an official statement about the altercation between himself and fellow artiste, Sizzla,… Beanie Sigel Charged With Tax Fraud Philly rapper Beanie Sigel is facing criminal tax fraud charges after he allegedly failed to file his taxes for a period of three years.	cc/2021-04/en_middle_0039.json.gz/line876
__label__cc	0.680409	0.319591	12-year-old Prince Hisahito starts 1st overseas trip in Bhutan Aug. 17, 2019 04:03 pm JST Oct. 9, 2019 \| 05:38 pm JST Ganbare Japan! Aug. 17, 2019 04:33 pm JST Amazing photos, stunning scenery. Trip of a lifetime for the young Prince! The Bhutanese women are absolutely beautiful! -3 ( +16 / -19 ) Chip Star Taxpayer money at work. What a waste. pacificwest Japan is Bhutan's leading development partner, it has provided assistance in agricultural and rural village development, economic infrastructure development, social development, and strengthening governance throught providing scholarships. It has provided technical cooperation worth 1093 million yen and got back about 1709 million yen in exports (small excavators, automobile, products related to automobile etc). It's good for business. Japanese are also one of Bhutan's primary tourist market. showchinmono Im impressed with national costume of Bhutan. Hybrid of Chinese, Japanese, Korean with beautiful red shawl alwaysspeakingwisdom "Amazing photos, stunning scenery" Prince Hisahito looks really sharp in his suit. 0 ( +12 / -12 ) The finest suit that public money can buy. Agree, they're stunning (& so is the pic). For whatever reason I've always been a big fan of the Bhutanese royals, always! Reckon Prince Hisahito's not going to play with his legos tonight, happiest teen in the world right now. commanteer Enough already. I doubt you contributed all that much to it. If Hybrid of.. is not appropriate, I would say good mixture vanityofvanities Democracy and the royal family system do not match.go Trip of a lifetime for the young Prince! Lol. Every 12 year old wants to go there. Reckon Prince Hisahito's not going to play with his legos tonight, He won't,but with not what you think.Bored as pluck though. for a private family trip Why so long? They ain't doing much or much to do there.Poor kid. spinningplates Nice photo, but I agree with Chip Star. Just burning our taxes, he's too young to do anything useful. If it's aprivate family trip, why is a 12 year old the cover story under "National"? And who paid for security, etc - the family or the taxpayer? Wallace Fred With a tax increase coming, they can enjoy more free trips abroad, 1st class style. Kudos dear leader. The common taro thanks you. The cynicism of some contributors aside, Bhutan is a nice easy place to start his royal duties. Let's hope he takes note of the care Bhutanese take to preserve their environment, and of the fact that they have a Ministry of Happiness that monitors and looks for measures to enhance its citizens' mental and physical well-being. Maybe, as he matures, the Prince will be outspoken and manage to be an influence for change. Fat chance? Well, time will tell! " he's too young to do anything useful." Other than introducing the world to him and introducing him to the world. So that's what it takes for a tween to be surrounded by beautiful women, lol coskuri Let's hope he takes note of the care Bhutanese take to preserve their environment, and of the fact that they have a Ministry of Happiness that monitors and looks for measures to enhance its citizens' mental and physical well-being. Will they explain him the Buthanese ethnic cleansing (20% of population since the 1990's) ? Other than introducing the world to him Sadly, he'll never live in the world. Only 11, posing in sarariman outfit for his 'private holiday'. Can't the kunaicho wait till he is 20 to put him to work ? If he's on vacation, why the restrictive clothing, suit, tie, suit? With a tax increase coming, they can enjoy more free trips abroad Guys, if you're really that upset about the money I'm willing to refund your share out of my own pocket. IHA expenses work out to a little over ¥50 per person per year. We'll call it ¥60. Just give me an address where I should send the coins. How noble of you. Is that Bhutan Kimono? So beautiful just amazing! The photographer did a great job too. Nice place to escape the heat , Aug. 18, 2019 01:59 am JST Nice photograph. Not a waste of tax payers money, this is an exercise in grooming the young prince for taking the throne down the road. William Bjornson Great image but who dressed Princess Kiko? Gomen nasai shikashi she looks AWFUL. That dress, even for someone with NO eye for style or even interest such as myself, my eye went right to it. It looks like a hand-me-down from a taller Queen Elizabeth, from the designers "Dowdy, Dowdy, and Archaic". Maybe it's just the contrast with that 'vision' to her right...that's not CGI, right? I wonder how the young Prince and prince trump would get along...eh but the Prince looks like a nice kid and maybe hanging around with trumps is not the best for his socialization. Just sayin' Crazy-just human beings-the world does not need emporers or kings/queens. I point out Japan makes a 170% return on its investment to Bhutan, does good for Bhutan (Japanese natural disaster response technology is some of the best in the world) and, therefore, can afford to throw in a junket off the back of it ... and I get 16 negatives? Tell me, not that I care, but what's that for ... 16 negatives for making Japan look good? Funny thing is, the separation of the Tennō and political power in Japan works really well and avoids the kind of ignoble calamities of modern politics like Trump tweeting from the presidential toilet seat, presidents being caught in flagrante delicto with porn stars and enthusing about grabbing pussy in public. I do think Japan should use the term Tennō though, as I don't think "Emperor" in English communicates the role properly. They are not Napoleonic or Caesar-like rulers, it's just a job in PR with a little bit of academic thrown in to keep it interesting really. Was it not the last Tenno who was a bit of an expert in native seaside birds? Hope this young man finds his own niche in life. Some were making comments on the traditional Bhutanese dress. And also comparing it to a mix of Chinese, Korean, Japanese constumes. Let me explain The traditional dress is called Gho for men. It is required to be worn by us Bhutanese. The dress comes from the dress of Padhmasambava also called second Buddha. He was a monk from India who spread Buddhism to Tibet and Bhutan. In fact, Tibet would have never been Buddhist (and hence Mongolia never become Buddhist!) if not for Padhmasambava's persistence. The dress is similar to dresses from Tibet and older Indian costumes for Buddhist monks. By the way welcome to the royal family from Japan. Yes Japan give us lot of assistance. I think next only to India. Most of Bhutan development due to assistance from India and Japan. We love Japan. But unfortunately recently too much China influence and land grab. China occupied a peaceful Tibet, nobody blinked an eye. It won't be long before they become powerful enough to defeat Indian protection for our country and take over us. Hope the world speaks up before that. Bhutan appears to have adopted a very brave and wise tourist (and immigration policy) that has saved it from some of the excesses destroying other Asian societies. How did that come about? From seeing those excesses in places like Katmandu, Thailand, Bali and Cambodia? https://www.tourism.gov.bt/about-us/tourism-policy I can see why the relationship with Japan is a sympathetic one. However, with respect to the “High Value, Low Impact ” policy, do you think it is impossible for less wealthy people, or people from less wealthy nations, to respect Bhutan's unique culture and values? There's a $200 to $250 per day plus 3 star accommodation minimum daily package rule. The regimented nature of the tours would suit typical Japanese, but I can imagine not independent tourists. I read Bhutan's managed to defend itself against the combined armies of KFC, McDonald's, Burger King, Subway and Starbucks! Elsewhere we are discussing the concept of social diversity. Many accuse Japan of being too homogenous a society yet Bhutan appears to have adopted a policy that protects it cultural identity. How's it all working out for the country? “To promote Bhutan as an exclusive travel destination based on Gross National Happiness (GNH) Values”. The tourism industry in Bhutan is founded on the principle of sustainability, meaning that tourism must be environmentally and ecologically friendly, socially and culturally acceptable and economically viable. The Royal Government of Bhutan recognizes that tourism is a world-wide phenomenon and an important means of achieving socioeconomic development particularly for a developing country like Bhutan. It believes that tourism, in affording the opportunity to travel, can help to promote a deeper understanding among people and to strengthen ties of friendship based on a deeper appreciation and respect for different cultures and lifestyles. Towards achieving this objective, the Royal Government, has adopted a very cautious approach to growth and development of the tourism industry in Bhutan. Its tremendous potential as a truly indigenous industry and the clear comparative advantages Bhutan enjoys, are compelling reasons to promote Bhutan as a high-end tourist destination in a manner which accords with the tenets of Gross National Happiness. Today 06:45 pm JST Today \| 06:48 pm JST Tokyo reports 1,274 new coronavirus cases; nationwide tally 5,521	cc/2021-04/en_middle_0039.json.gz/line880
__label__cc	0.539047	0.460953	S Korea's Moon calls for official apology over 'comfort women' June 21, 2017 04:05 pm JST July 27, 2017 \| 12:13 pm JST Northernlife June 21, 2017 04:19 pm JST New monkey on the mountain trying to flex a bit of muscle...This is the never ending story with Korea..How about you worry about your neighbour in the North do something to sort that problem out a bit. 34 ( +43 / -9 ) sensei258 I'm so sick of this issue. How many freaking multiple apologies, admissions of guilt, and compensation packages does Japan have to do? Enough is enough. They just cant let go. Don´t these clowns even notice how everybody is tired of this eternal Japan bashing? Oh, FFS! Are we gonna have to endure this same BS every time Korea gets a new PM? Japan has made several 'official' apologies. Now, this mullet wants his slice of the fame pie! Japan needs to make an email that just circulates to Korea every time there is a new PM. aleef They don't accept the 2015 deal, but they accept the money. Interesting. Kaerimashita Should try and sort out L'il Kim rather than dredging up this old saw. Goodlucktoyou With people like Abe and co rewriting history books and denying it, then the Koreans have every right. -25 ( +12 / -37 ) Lovespam Even though I can't stand Abe, I think the thing he should do is to actually agree to formulate an official apology, at the condition that the 1 Billion yen is returned to Japan. Then we'll have some funny reactions from South Korea I guess. sensei123: "I'm so sick of this issue. How many freaking multiple apologies, admissions of guilt, and compensation packages does Japan have to do?" One HONEST one. That's all. Japan really dropped the ball on this one by rushing to Yasukuni the day after the money was offered (Inada, etc.), and allowing law-makers/governors to say flat out that it is just propaganda. Hell, even posters on here and some Japanese in general very adamantly protested the money given by Abe and said flat out it as "not compensation money, but (sic) shut up money". Sorry, but offering money and saying "this is for you to shut up, but it's not compensation money" is not any kind of admission of guilt or apology. BUT, I think Korea has to give back the money if they are going to demand this. Or better yet, here's what Moon should do: Ask flat out, "Was the money you gave us compensation money for the IJA's forcing of women into sexual slavery, or wasn't it? and is Japan sorry for coercing these women into doing so?" If the answer is "yes", then Korea needs to let it go. If the answer is no, give it back and once again demand a SINCERE apology. The people have every right to disagree with what their government did, same as people do here. That is why they can still protest. Ike-in-Tokyo-from-89 Too bad Abe won't work with Moon to carefully craft an "official apology". At least Abe, or whoever the next PM is, could say "Told you so" when the next Korean president rejects it. Politics at both ends. (And then ENTER KJU STAGE ... whichever stage he's reached ... can reject it as he thinks he speaks for ALL Koreans.) -12 ( +3 / -15 ) Ike-in-Tokyo: "Too bad Abe won't work with Moon to carefully craft an "official apology"...." Well, you can start with the "I told you so"s by rereading your first sentence, which admits Abe won't issue an official apology for sexual slavery that explicitly states what the IJA did. South Korea needs to BTFO. Japan has already payed and apoligized enough. I say stop all this sorry money to china and korea and start funding the taxpayer money where its needed, in japan. How about stop taking money money and sending it to other countries. Grow some! Attilathehungry Japan TOOK legal responsibility in 1965. At that time, Japan and Korea signed a treaty to normalize diplomatic relations and to settle ALL claims by South Korea for compensation. Japan offered a large sum of money to the victims, and also offered to disburse it. the SK government at that time refused, and took the money themselves. Rather than giving it to the victims, they instead spent it on infrastructure projects and gave a pittance to the surviving comfort women and others. They also demanded that the details of the treaty be kept secret for 40 years. Hardly Japan's fault. This inconvenient truth is largely ignored in the SK media. DaveAllTogether What would South Korea do if Japan actually gave a "sincere apology"? Granted, Japan has apologized and paid reparations, but none of that meant anything. It was not sincere. What do they want? The Emperor to kow tow on the steps of the Blue House? Japanese government acquiesces a lot to S. Korea to save face in front of the world, not to atone for its wartime atrocities. Nevertheless, the 2015 deal was inked as putting an end to the Comfort Women issue forever and irrevocably. Money was accepted by the South Korean government. End of deal. dcog9065 Going around in circles once again. Before the 2015 deal I was a strong advocate for another official apology to SK, but now it's too much. I am now permanently against any more apologies and monetary extortion and will be strongly pushing this to my local MP What, another one? I'm sorry Mr. Moon. itsonlyrocknroll In many ways South Korean President Moon Jae In is the modern day Shylock, everything that is owed has to be paid back. Retribution through the generations, demanded by a pious Presbyterian politically driven civic group. "The core to resolving the issue is for Japan to take legal responsibility for its actions and to make an official (government) apology,".....There is no moral or legal requirement for the Government of Japan on behalf of the people to take responsibility. Over 80% cannot remotely be held responsible, having been born after the event. South Korean President Moon Jae In needs to reflect on this fact. There is little doubt that a number of Japanese Prime Minister Shinzo Abe cabinet ministers need to consider their positions. In the same breath South Korean President Moon Jae In, needs to accept that his pledges made during his election campaign could have consequences far beyond the appeasement of a civic group that hold the frail dignity of these subservient survivors welfare to account on the political necessity to extract humiliation and retributive justice from Japans forthcoming generations. The disbursed 1 billion yen (about $9 million) was offered and taken i good faith to support the affected women and their families, there is no obligation or requirement for it's return. TigersTokyoDome Slow news day for the South Korean president maybe. At the same time South Korea can apologise back for planting the comfort women statue in front of the Japanese embassy. Nothing wrong with a statue honouring those comfort women but to place it in front of the Japanese embassy? Frank Thornton We (most people living in Japan) know that this is all just a waste of time. Whatever Japan does, it may be settled for a while (as it has in the past) until someone decides that the apology wasn't deep enough or the legal payment wasn't big enough and everything starts all over again. Chucky138 Japan deny and rewrite history , how can you trust Japan Abe government. Azrul Hakim He should worry about THAAD debacle more though... Swift_Justice Atilla's post was spot on regarding the legal responsibility. I would have to agree with Smith on the apology. The 2015 agreement simply reinforces the legal aspect. thepersoniamnow I say YES, do it (again). But this time freaking erect a monument in both countries that says "We are over it! Done! Respect the victims for sure, but please, enough of this political hogwash. Imagine what good Korea and Japan could have done together instead of bickering this entire time. And ... was there not Dschingis Khan who once came to eastern europe slaughtering people? I guess they have to ask the Mongolian Government that they apologize. Hmmm... "Ask the Mongolian Government..." Hmmm.... That proposition is worthy of a new, truly genius con. NHK needs to play the n'th time Japan paid to these people, everyday in their international channel. Koreans seems to have "Bad Sectors" in their head and all politicians need their share of money. Katarzyna Waluś Korea is difficult to talk about. The student's death is proof of this, broke the poster and badly ended it. Korea has a strong climate.. kitzrow Like many here, I am so tired of this issue even being mentioned. Shouldn't President Moon and the S. Korean people be worrying more about their neighbor in the north. Can't imagine how I would feel if every Japanese person looked at me in disdain as I am an American. Yes, we dropped atomic bombs on Japan during World War II. PhantomAgent Well he has to ask for another apology or admit that the SK government didn't pass on previous compensation to those it was meant for, like critics in SK are saying. Scrote If Mr Moon cannot understand the meaning of "finally and irrevocably" then there is no point talking to him at all. Japan should disengage from South Korea and limit official interactions to the minimum necessary. Peter Bowie Please can someone fly over in a light airplane and drop a couple of million flyers , saying the wars over.. Seriously how many times do we want to flog a dead horse.. war is war.... Every country in the world , that has been involved in war , has committed war crimes. Abe is useless. For 5 long years, he can't cut the deal. If Abe can't make East Asians happy, he can't make anyone happy. That should be his number one job. PM Mulan has a solution. I don't need 5 years, I only need one year. I will cut defence budget by half, instead of increase it. I then will use the saved money to pay for the past. I will make S Korea happy, I will make N Korea happy, and I will make China happy. Only then, Japan will be happy. ThePBot I say stop all this sorry money to china and korea and start funding the taxpayer money where its needed When did China get "sorry money" from Japan? China didn't even get, or demanded, any war reparations from Japan. @ThePBot What does China get in return? No love from Japan, and no shame. More worrying about the level of discussion and a little low .. man comes according to Darwin from the monkey you deny? North Korea is famous for its uninteresting solutions because of its brand that speaks to avoid us from afar ... and do not pour love ... much is lost ... the harm of young people who underestimated the danger and ignored the principle of Korea. In the south it is better but still armed kiyoshiMukai Ok I have a plan for South Korea. first send all the money back plus interest rates. second, let us withdraw all pas apologies. third, pay for all the expenses so Abe can travel to Seoul and have a nice weekend. Maybe give some money to the alleged victims lft Hiro S Nobumasa This just means that any third party (USA) forcing two belligerent parties to fast track an agreement just doesn't work. Before any future negotiations should commence it's necessary for Japan to first study and evaluate the reason why millions of dollars just can't seem to give satisfaction to the Koreans. Matters that money alone can't settle must have some deeper human emotions that must be understood by Tokyo, no matter if those atrocities were committed 100 ' Star Wars' generations ago. The fact that the wounds are still lingering and blistering raw like a cratered flesh with scalding lava overflowing it means any attempt at whitewashing history is just like pouring gasoline to the flame. Christopher Pelham June 22, 2017 12:54 am JST What Japan has not yet done is to take full advantage of the opportunity to strongly deter state organized rape by nations in the future by being the first nation to completely own up to doing so in the past and condemning it. As long as a nation is too embarassed about its past mistakes, it is not free to prevent them from recurring. So relations with its neoghbors is only one aspect of this and not necessarily the most crucial. If Japan becomes a world leader for women's rights, then future crimes elsewjere can be more easily prevented and prosecuted and the whole world cam be made better. Tahoochi aleefJune 2104:40 pm JST tokyodoumo ...will never work as long as Japan is not a willing participant. albaleo The idea of "official apology" raises the bizarre idea of "official forgiveness". The idea of a nation offering an apology is almost meaningless. Nationalism stinks. Almost no one alive in the world today is responsible for what happened 70-80 years ago. Learn and move on. toshiko Japan can apologize to N Korea about Ianfu now to shift B M test site target from near Japan to S Korea. Forget extortion by new S K Govt. gubijin I thought Mr. Moon would be much better than Ms. Park, but seems like he has to please the base. No matter what, Japan did wrong and lost the war so this will be on their backs forever. Perhaps do what Obama did? Go to the site, officially apologize to the one in charge now (Mr. Moon), but bring no money. I'm sure it's been done in the past, but sign official papers again. And the head of the govt., Mr. Abe should go. Korea can be such a boon to democracy in the world. They care for the environment, have an educated work force, want to live in a free society. If they moved on from this incident, they could truly become world leaders. CyburneticTiger In reiterating his earlier stance announced soon after becoming president in early May, Moon stressed that the agreement made under the previous administration "is not accepted by the people of (South) Korea, particularly by the victims." In no way does this nullify the agreement. Japan apologized and compensated the people affected back in the 1960s and once again has compensated them in this century. You know, most Americans don't accepted Donald Trump as President but he (unfortunately) is still the President. By being American Citizens they agree to follow the election system as established by the laws of our nation. The law makes him president whether we like it or not. It's time Koreans understand and accept that their elected leaders made a legally binding contract that agreed that the issue is permanently resolved so the world can move forward. Abe's foreign policy is disastrous. 70 years after the war, East Asians are still not united. It is time for a change. Last time, Japan apologized to S Korea and gave money to S Korea. This time, Japan can apologize to N Korea and give money to N Korea. N may stays away from Japan. juminRhee The govt of Japan should make a mixtape video of all the apologies over the years - datestamped - and air it on korean tv every time it is requested. It should show the atrocities committed by the south korean govt against its own people in an encrypted form that south korean programmers can decode and air in multiple hidden locations to bypass south korean censorship. A Korean friend who's studying at Ryudai told me that he's ok with the agreement and supported it. But he came out a different man after visiting Yasukuni shrine. When it comes to addressing issues that touches on brutal historical realities there is really no such thing as solely relying on the power of dollars and cents. It's just like the constant refrain of the bellowing waves off those cliffs in Okinawa that seems to ask PM Abe et al, ... Where was your daddy during the war? JaneM2 My first reaction was to laugh at the above. But then, if you think that Abe was elected by the East Asians to work for them... Well, all right. I guess some people can choose which universe to live in. To be fair, the last thing East Asia needs is for some kind of "united" thing. The last time that happened, it was lead by Japan's "Greater East Asia Co-Prosperity Sphere" aka Imperial Japan. ....that still can't beat the countless of times politicians were on record of visiting the Yasukuni Shrine, the constant denial of atrocities, or that fact that they want to take back the previous apologies. Or what about, oh I dunno, that actual atrocities Imperial Japan committed that they constantly deny. As far as I'm concerned, the only mistake Korea is doing is asking for money. It lessens their argument. China on the other hand can easily say "we didn't take hush money from Japan". mulanToday05:45 am JST East Asians are supposed to be united? jcapan I think Mulan means a Greater East-Asia Co-Prosperity Sphere Ah, so... @ DaveAllTogether What would South Korea do if Japan actually gave a "sincere apology"? Claim it was not sincere enough, and repeat the shakedown a year later. @ ThePBot $20 billion in Japanese assets that were confiscated plus over $30 billion in ODA (Official Development Assistance), technological transfers, many very low to zero interest loans ... and international recognition for the Communist government. In the past 30 years Japan, as China's largest donor, has paid for a considerable chunk of China's infrastructure and economic growth. In addition, the Communists benefited from large amounts of not just military hardware but at least 10,000s of Japanese military personnel after WWII in their fight against the Nationalists. Which underlines a problem in the way in which you are presenting your point. "Which or what China?" Mao himself thanking or praising Japan for its role in weakening the Nationalists to the point where the Communists could take over. Therefore, to have the Communists "compensated" for the damages done to the Nationalists. There is a worrying trend of politicized revisionist presentations portraying old China as one in order to blame Japan for everything when, in fact, China was not just divided into many but at war with itself. For example the million of Chinese killed by Chiang Kai-shek when he breached the Yellow River's banks without warning the peasantry, are presented as victims or Japan. Ditto Chinese victims of Chinese at Nanjing. Sadly the average Chinese citizen is perhaps not the most objectively informed; and the anti-Japan English language activists, not the most objectively impartial. New leader from S. Korea and China will demand apology from Japanese Government whenever S. Korea or China have changed new leader. How many times Japanese PM and Emperor has to apology for WWII atrocities committed by Japanese soldiers and takes responsible for peoples’ suffering? Next time, Japanese Government replay the recording tape which Japanese Governments apology for WWII atrocities and take responsible for peoples’ suffering cause by Japanese Empire Military. Aren’t they willing to move forward and normal relationship with Japan? Comfort women were not directly recruited by Japanese empire military and they were recruited by local businessman. According to diary of one of former Korean agents (I read in Asahi Shinbun), some of women were already working prostitute in local brothel and some women were bought from their parents. However, working condition of comfort women were not comfortable as what those women expected for. They were sexed up to 17 soldiers a days which they didn’t expect to sex with many soldiers. Some soldiers may have maltreating them but not all the times. Anyway, the new President must recognize his predecessor agreement and end the comfort women drama. Pandomara115 Davealltogether' remark about Emperor going to neighboring countries to apologize, if not out of sarcasm, has point in it. Yes, it is true that a few of fair minded Japanese premiers in the past expressed their regrets about wrong doings of Imperial Japan, but only to be denied and taken back so often not by street crackpots, but by politicians and figures of main stream in Japan. This has been making the people of neighboring countries confused and suspicious as to the sincerity of Japanese people. Emperor's visit to the neighboring for apologies will help the people thereof clear up their suspicion and will not give much about the nonsenses talked by crackpots. Brian Wheway is this Koreas ground hog day? Let Emperor go to the neighboring countries for apologies. A few of fair minded Japanese primiers in the past expressed their regrets about the wrong doings committed by Imperial Japanese, only to be denied and taken back, not by jerks on the street but by so called influential figures including members of Diet and cabinet ministers of Japan .These have been making people of neighboring countries confused and suspicious as to the sincerity of Japanese. If the Emperor goes to these countries for apologies ,that surely would help build their trust toward Japan. @Chop Chop Comfort women were not directly recruited by Japanese empire military and they were recruited by local businessman. According to diary of one of former Korean agents (I read in Asahi Shinbun), some of women were already working prostitute in local brothel and some women were bought from their parents. However, working condition of comfort women were not comfortable as what those women expected for. They were sexed up to 17 soldiers a days which they didn’t expect to sex with many soldiers. You are right about the the recruitment and who ran the business. Funnily enough, I am just reading John Dower's 'Embracing Defeat' and in it he account for Japanese comfort women for the Americans after defeat. He, as an honest American historian. He records that the Japanese comfort women for the Americans were forced to service up to 60 men a day. Many were coerced into doing so, many little more than starving teens with no other means of support, many unhappy circumstance, e.g. girls committing suicide. Of course, the US military had to have segregated brothels for black and white soldiers. He records, that the Japanese women were actually surprise to discover that the Black American soldiers treated them much better. I have a feeling that much of this hullabaloo has been caused by individuals and parties who wanted to hide their own war time guilts, and for whom Japan is just a soft target. Well, if we move forward from WWII, past the Korean War where there were up to 1,000,000 women in the Industry serving Americans, into the 1970s, we find the Korea governmnent prostituting and encouraging the prostitution of its own women to Japanese sex tourists as a significance "tool" for reaping foreign currency. Therefore, I'd say using their women for extracting foreign currency has been "normal relationships" for some time. It was, after all, part of Korea's tributary system with China too. And not just girls but also young boys. Korea had a chance to start on the world stage with a clean slate. None of the West really know anything about it, except from the soldiers who had been there. I think all this posturing is going to backfire on it as most of the truth about Korea seeps out and they are going to be seen as the biggest hypocrites and racketeers in Asia. Japan should be fighting its own corner far more strongly. Here they roll again! The deal between Park and Abe was too bad, totally unacceptable, thats why aplogy from Japan is badly needed How many apologies have they had for what Koreans themselves carried out? For what Koreans are doing to Koreans in this very day and age? Will every new president need one? I think Korea should be more concerned about what is going on under their very nose today, and the high use and exploitation of prostitutes in their own cities and abroad. This year a South Korean court found that the government had broken the law during the 1960s and ’70s by detaining prostitutes who catered to American soldiers, and by forcing them to undergo treatment for venereal diseases. The women claimed to have been cheated by job-placement agencies and were held in debt to pimps, teenagers forced to services G.I.s every day with no day off, caught and beaten, debts raised and so on. Same as Koreans are doing in the Philippines, in the US, in Australia, and back at home. They are trying to smear Japan for what is part of their very own culture, and they know because the police and government have been involved in it too. The politician is just posturing for a certain part of the Korean voters, e.g. when he also came out and said he opposes homosexuality. Ma Go As Korea wishes for unification with North Korea, there are many North Korean supporters. They will promote alliance destruction activities in Korea, the United States and Japan to reduce US allies. That's why they make so many comfort women in the United States, And oppose THAAD deployment, participating in the movement against the Okinawa US military base. And these trends are also beneficial to China, so China supports them and uses it for Japan - US alliance destruction work. Therefore, these problems never end even if Japan compensates anything. Kono's vaccine appointment by Suga seen as neutralizing a rival Jan. 19 06:33 am JST Jan. 19 \| 04:05 pm JST Aso vows to revive virus-hit economy, promote structural reforms Kono to handle coordination of coronavirus vaccinations	cc/2021-04/en_middle_0039.json.gz/line881
__label__wiki	0.548939	0.548939	Failure of Newly Laid Water Pipeline Shahid T. Sheikh Volume 6 Paper C099 FAILURE OF NEWLY LAID WATER PIPELINE By Dr. Shahid T. Sheikh, MMRC, PCSIR LABORATORIES COMPLEX, FEROZEPUR ROAD, LAHORE-54600 Steel corrodes in most environments, consequently the useful life of the steel is reduced. Thus corrosion prevention is an essential factor in the economic utilization of steel. Steel is coated with appropriate protective coatings which can bring initial savings plus substantial economics in service, due to reduction or elimination of maintenance and lost service time and also by prolonging the time for replacement of structures and equipment. Galvanizing provides ideal protection for steel due to their versatile applicability under normal conditions of exposures. The service life of galvanized pipes can be challenged when corrosion occurs. This study involves the investigation of the causes of pitting in the galvanized pipes laid about a period of less than two years ago in an Industrial plant situated at 32 K Multan Road Lahore. The study was imitated by the inspection of the site and after obtaining samples from the site. Soil samples were also collected. Since these pipes were installed about two years ago and complaint of leakage started in about July, 2000, therefore it was prudent to include the effect of soil on the pitting of the pipes. Galvanizing of steel provides dual benefits i.e. aesthetic as well as durability. Hot dip galvanizing protects steel from corrosion by providing a thick, tough metallic zinc envelopes, which completely covers the steel surface and seals from the corrosive action of its environment. The galvanizing coating provides outstanding abrasion resistance, where there is damage or minor discontinuity in the sealing coating of zinc, protection of steel is maintained by the cathodic action of the surrounding galvanized coating. Zinc forms a strongly adherent coating on steel consisting of layers of Zinciron inter metallic at the Iron/zinc interface. Galvanized coatings are highly resistant to attack over a wider pH range, particularly in moderate alkaline conditions. A protective film is formed on the zinc surface in the pH range of 6.9-12.5 and the coating corrodes very slowly. Different types of compounds are formed when zinc corrodes in different atmospheres for example in saline conditions zinc chloride is formed, while zinc sulphate is formed in the presence of sulphur dioxide fumes and in the presence of moisture zinc hydroxide and zinc oxide is formed. pH of the medium determines the formation and stability of these compounds. Chlorides is the most aggressive anion which causes intense localized pitting of the steel(1). Its aggressiveness depends upon the concentration of inhibitive hydroxyl ions in the environment. In cement the pH of the pore environment is buffered at 12.6 pH due to the formation of calcium hydroxide as the result of hydration reaction of ordinary Portland cement with water. Presence of sodium and potassium in cement further enhances the pH to 13.6. Though zinc can be depassivated and attacked in the presence of chloride ions to form zinc chloride. Zinc hydroxyl chloride has been found to form during the corrosion of zinc in chloride contaminated cementitious materials. It expands causing cracks of overlined cover even before corrosion of substrate steel has occurred. Later on the steel is attacked. Thickness of the zinc coating is very vital factor in determining the life of the galvanized structure. In fact the life of the coating is proportional to the coating weight per unit area. Homogeneity of zinc coating on steel is also extremely important to ensure the durability of the structure. If the coating is mechanically damaged, the risk of corrosion is multiplied. Nature of soil and depth of burial has significant effect on the corrosion of pipes buried in it. Generally, aeration in soils will decrease as the distance below the surface increases and therefore, the corrosivity of the soil should be expected to increase with depth. Severe corrosion has been observed on the pipelines when they are deeper than usual. But in certain instances the corrosion on pipes at increase depth is less as compared to than at narrow depth, this is due to the nature of the soil. In arid regions, the concentration of the alkali may be either near the surface or at a considerable depth, depending on the prevailing direction of the movement of moisture in the soil. Thus it can be seen that, although corrosion in general increases with the depth of burial, other influences, such as drainage and characteristics of soil horizons, may be sufficient to mask completely the effect of depth. If diameter of the pipe is so large that pipe lies in two soil horizons, or if any part of it is under water, or if there is considerable difference in the distances from the surface of the ground to the top and bottom of the pipe, differential aeration circuits will be set up which will effect the distribution of the corrosion on the surfaces of the pipe and possibly the amount of corrosion also. The deterioration of metal also takes place by corrosion processes that occur directly or indirectly as a result of the activity of living organisms. These organism include microforms such as bacteria and microforms such as algae and barnacles(2). They have been observed to live and reproduce in mediums with pH values between 0 and 11, a temperatures between 30° and 180°F, and under pressure up to 15,000lb/in2. Biological activity influences corrosion in a variety of environments including soil, natural water and seawater, 2 natural petroleum products, and oil emulsion-cutting fluids. Living organisms are sustained by chemical reactions. That is, organisms ingest a reactant or food and eliminate waste products, these processes can affect corrosion behaviour by directly influencing anodic and cathodic reactions or by influencing protective surface film b or by creating corrosive conditions and by producing deposits. These effects may occur singly or in combination, depending on the environment and organism involved. Anaerobic bacteria influences the corrosion behaviour of buried steel structures are the sulphate reducing types. These reduce sulphate to sulphide and are most prevalent under anaerobic conditions, as wet clay, boggy soils and marshes. The presence of sulphide ion markedly influences both the cathodic and anodic reactions occurring on iron surfaces. Sulphide tends to retard cathodic reactions, and accelerates anodic dissolution. This acceleration of dissolution is the most pronounced effect, which causes increased corrosion. The corrosion product in the presence of sulphate reducing bacteria is iron sulphide, which precipitates when ferrous and sulphide ions are in contact. Aerobic bacteria are capable of oxidizing sulphur or sulphur bearing compounds to sulphuric acid. These organisms thrive best in environments at low Ph and can produce localized sulphuric acid concentrations up to 5% by weight. Thus sulphur oxidizing bacteria are capable of creating extremely corrosive conditions. These require sulphur in either elemental or combined form for their existence and are therefore found frequently if sulphur fields, in oil fields, in soil rich with sulphates, in sewerage disposal piping that contains sulphur bearing organic wastes. In the case of sewage lines, sulphur -oxidizing bacteria cause rapid attack of cement piping. Sulphur reducing and sulphur-oxidizing bacteria can operate in a cyclic fashion when soil conditions change. That is, sulphates reducing bacteria grows rapidly during rainy seasons when soil is wet and air is excluded, and sulphur oxidizing bacteria grows rapidly during dry seasons when air permeates the soil. In certain Ares, this cyclic effect causes extensive corrosion damage of buried steel pipelines. Also, it is evident that the presence of microorganisms can accentuate conditions of differential aeration in soils. Certain other, bacteria utilize hydrocarbons and can damage asphalted pipeline coatings. Iron bacteria are as group of organisms that assimilates ferrous iron from solutions and precipitate it as ferrous or ferric hydroxide in sheets surrounding their cell walls. Growth of bacteria frequently results in tubercles on steel surfaces and tends to promote pitting and crevice corrosion. Certain bacteria are capable of oxidizing ammonia to nitric acid. Dilute nitric acid corrodes iron and most other metals. These kind of bacteria may be important where an extensive use of synthetic ammonia fertilizers has been employed on cultivated filed above buried pipelines. Most bacteria also produce carbon dioxide, which can contribute to corrsoivity due to the formation of carbonic acid. EXPERIMENTAL WORK 3 Pipe samples of different diameters ranging from ten mm to 75 mm were obtained. Soil samples were also taken from the places where pitting attack was severe. Photographs of the corroded pipe were taken. Cross sections were cut from the pipes at the points where pitting attack was severe, mounted, grounded and polished to 1 micron fine diamond paste. The polished samples were examined microscopically and their micrographs were taken. Chemical analysis of the soil particularly for sulphates, nitrates was carried out by the usual wet analysis methods. Cyclic corrosion testing of the good quality pipes was also carried out. Thickness of the galvanized layer of both the good quality and corroded pipes was determined microscopically RESULTS Thickness of the galvanized layer Nature of sample Pipe diameter in centimeters Thickness in micron New pipe 0.1 110 microns inner 85 microns outer Corroded 0.1 105 microns inner 85 microns outer New pipe 2.5 85 microns inner 85 microns outer Corroded 2.5 82 microns inner 80 microns outer New pipe 5.0 80 microns inner 75 microns outer Corroded 5.0 80 microns inner 75 microns outer New pipe 7.5 75 microns inner 4 100 microns outer CYCLIC CORROSION TEST RESULTS The new pipes were subjected to CASS test for 100 hours. 5% Sodium chloride solution acidified with acetic acid to pH 4.5 containing 0.5% Copper chloride at the Relative humidity of 98% and 35°C was sprayed on to the new pipes to check their corrosion resistant. Corroded Area (pipe diameter 7.5 cm) = 0.001% Corroded Area (pipe diameter 5.0 cm) = 0.001% Corroded Area (pipe diameter 2.5 cm) = 0.001% Corroded Area (pipe diameter 2.0 cm) = 0.001% Since the corroded area for all the samples was 0.001 %, thus corrosion rating was 10 as per ISO standards. Chemical Analysis of Soil Qualitative analysis indicates the presence of Sulphates, nitrates in the soil. Quantitative analysis of the soil is as follows: Sulphate ion 1-7% Nitrate ion 800ppm Discussion and Conclusion 5 Galvanizing provides ideal protection for steel due to their versatile applicability under normal conditions of exposures. The service life of galvanized pipes reduces considerably when corrosion occurs, zinc then instead of providing protection starts corroding the underlying steel. A potential gradient is developed due the difference in the uniformity of the coatings through out the pipe length. As a result of differences in electrical potential within the cell, negatively charged electron flows from anode to cathode and Chemical Analysis of Soil Qualitative analysis indicates the presence of Sulphates, nitrates in the soil. Quantitative analysis of the soil is as follows: Sulphate ion 1-7% Nitrate ion 800ppm Discussion and Conclusion Galvanizing provides ideal protection for steel due to their versatile applicability under normal conditions of exposures. The service life of galvanized pipes reduces considerably when corrosion occurs, zinc then instead of providing protection starts corroding the underlying steel. A potential gradient is developed due the difference in the uniformity of the coatings through out the pipe length. As a result of differences in electrical potential within the cell, negatively charged electron flows from anode to cathode and iron atoms in the anode area are converted to positively charged iron ions. The positively charged iron ions of the anode attract and react with negatively charged hydroxyl ions in the electrode to form iron oxide or rust. Negatively charged electrons react at the cathode surface with positively charged hydrogen ions in the electrolyte to form hydrogen gas. Under suitable conditions corrosion occurs at the rate of billions of complete reactions every second and soon results in a layer of rust appearing over the surface of the anode area. Anodes and cathodes being electrically connected by the underlying steel. Corrosion occurs in the anode areas. As anode areas corrode new material of different composition and structure is exposed. This results in changes in electrical potentials, causing anodes and cathodes to exchange roles, though not all once, and areas previously uncorroded are now attacked. This process continue until the steel is entirely consumed. When zinc and 6 steel are in contact in an electrolyte, differences in electrical potential develops and an electrolytic cell is formed. Zinc is more electrolytic ally active than steel, it thus becomes anode for all the steel, preventing the formation of small anodic and cathodic areas on the steel surface. Thus negatively charged electrons flow from the zinc anode to the steel cathode and zinc atoms are converted to positively charged zinc ions. At the cathode surface negatively charged electrons react with positively charged positively charged hydrogen ions form the electrolyte liberating hydrogen gas. Their is no chemical reaction between the steel cathode and electrolyte. Thus steel is protected as zinc ions at the anode surface react with negatively charged hydroxyl ions from the electrolyte and zinc is slowly consumed. But when the zinc coating is damaged either by chemical means or mechanically corrosion starts and in case of bacterial attack it appears in the form of pits varying in depths. Sulphide ions formation as result of anaerobic bacteria action or the formation of nitric acid due to aerobic bacteria dissolves the zinc coatings and hence pits are formed. Thus it can be concluded that pitting in the pipe lines is due to the bacterial attack. ACKNOWLEDGEMENTS The author are highly indebted to Dr. Izhar Ul Haque Khan CSO, Head MMRC, PCSIR, Laboratories Complex, Lahore for his permission to do this work. REFERENCES 1. N. D. Green and M.G. Fontana, Corrosion 15,:25t(1959) 2. A.S.M. Metals Handbook 7	cc/2021-04/en_middle_0039.json.gz/line885
__label__wiki	0.753269	0.753269	Netflix signals stock buybacks to come as subscribers hit 200m Fortnite leak: a Tomb Raider skin may be coming fortnite tomb raider We dropped MyPillow because of weak sales, not politics, retailers say Frank Lampard: Chelsea boss ‘worried’ after fifth defeat in eight Premier League games Bloober Team reveals The Medium system requirements and a new trailer Bloober Team This Lab ‘Cooks’ With AI to Make New Materials May 20, 2020 Gary Scott 0 Comments Science, Science / Physics and Math At the University of Toronto, Ted Sargent runs a test kitchen of sorts. His team, composed of researchers and students, develops recipes, measures and mixes ingredients carefully, and then evaluates the aftermath. The concoctions mostly—if not always—turn out to be inedible. Fortunately, though, flavor is not the point. They’re not making food. Sargent’s team cooks with carbon dioxide. Their goal is to invent recipes to “upgrade” the greenhouse gas into useful materials, says Sargent, an electrical engineer. Instead of releasing the pollutant into the air, or capturing and sequestering it underground, factories and power plants of the future could use renewable energy to convert the carbon dioxide into raw materials they could sell. One promising class of recipes involves electrically zapping carbon dioxide with other reactants to transform it into the six-atom molecule ethylene, composed of two carbon atoms and four hydrogens. Ethylene is a raw material used to make common plastics, including those found in supermarket and Ziploc bags. “It’s about a $60 billion market,” says Sargent. “It’s a pretty valuable commodity chemical.” But the real significance of Sargent’s work isn’t just the value of his recipes. It’s that he’s cooking with artificial intelligence. Sargent’s team discovered new ingredients for making ethylene by using new AI and supercomputer-driven techniques that have been gaining popularity among materials scientists in the past decade. Sargent teamed up with Zachary Ulissi of Carnegie Mellon University, who specializes in using algorithms to invent new materials. Ulissi simulated 12,229 microscopic close-ups of 244 different crystals to zero in on the most promising candidates for making ethylene. In particular, they wanted to find materials that carbon monoxide molecules—which are produced from the breakdown of carbon dioxide—would stick to easily. Ulissi used a supercomputer to run a fraction of the simulations, a time-intensive task that would be impractical to complete for all 12,229 close-ups. Then, he trained a machine-learning algorithm with those supercomputing results, and that algorithm learned to make the remaining simulations quickly. Ted Sargent uses electrical setups like these to chemically upgrade carbon dioxide into useful materials at the University of Toronto.Photograph: Daria Perevezentsev/University of Toronto These computer-based methods provide researchers with a faster and more comprehensive strategy for discovering new materials. It can take two decades for scientists to discover a material and fine-tune it well enough for commercialization. Conventionally, says Ulissi, “it has been really difficult to search wide swaths of materials.” As the story goes, in the 1870’s, Thomas Edison tested more than 3,000 different materials to find the right filament for the first affordable incandescent light bulb. Ultimately, the filament that reigned in the next century was made of tungsten—a material Edison never even tried. ← Graphics card deals of the week – 20th May 2020 Intel Core i5-10600K review: Core i7 performance on the cheap → West Ham United 3-1 Watford: Antonio, Soucek and Rice score July 17, 2020 Gary Scott 0 The 10 worst kings and queens in PC games September 4, 2020 Gary Scott 0 Juventus: Why Andrea Pirlo has replaced Maurizio Sarri Finance Latest Netflix will no longer raise debt to fund its spending spree on television shows and films and may begin returning	cc/2021-04/en_middle_0039.json.gz/line887
__label__cc	0.716665	0.283335	Home of Tomorrow in Kelowna demonstrates energy efficiency \| iNFOnews \| Thompson-Okanagan's News Source Home of Tomorrow in Kelowna demonstrates energy efficiency Contributed/Okanagan College Wilden Living Lab homes Image Credit: Contributed KELOWNA - Recent EnerGuide testing has shown the Home of Tomorrow, one of two homes that make up the Wilden Living Lab project, to be 52 per cent more energy efficient than a standard home constructed to today’s building code. The Home of Today and the Home of Tomorrow – two houses constructed side-by-side in the popular Wilden neighbourhood – are part of a real-world study on sustainable homebuilding that compares the energy usage patterns of identical structures built with different energy-efficient technologies. The pioneering initiative is collaborative three-year learning and research project by Wilden developer Blenk Development Corp., AuthenTech Homes, UBC Okanagan, Okanagan College and FortisBC. Following the completion of construction of both homes in early November, the Living Lab partners enlisted an energy evaluation company to analyze the performance of each home based on the Government of Canada’s EnerGuide standard ratings for new homes. Gilles Lesage, operations manager of Total Home Solutions, conducted the testing on insulation levels, airtightness, windows and door types and space and hot water heating systems. The Home of Tomorrow achieved an exceptional EnerGuide rating of 47 gigajoules (GJ) per year and greenhouse gas emissions of only 0.3 tonnes per year in the energy audit. In comparison, the Home of Today, which was built to current building code standards, has a rating of 110 GJ/year and GHG emissions of 3.0 tonnes/year. Lesage attributes the efficiency rating to the sustainable construction of the Home of Tomorrow. “This project shows the impact that’s made when homes are built with efficiency in mind right from the planning stage,” says Danielle Wensink, director, energy conservation and management for FortisBC. “We believe it’s well worth supporting forward-thinking projects like this that advance energy-efficient construction in the region.” The Home of Tomorrow was built with several advanced, energy-efficient components that exceed current building code requirements, including geothermal heating and cooling, a heat pump water heater, triple glazed windows and an insulated concrete form foundation. The Home of Today was built to the current B.C. Building Code specifications, allowing it to act as a baseline comparison to the Home of Tomorrow. The Wilden Living Lab project is also unique in that it has integrated students from both post-secondary institutions for hands-on participation. Students from Okanagan College’s Sustainable Construction Management and Residential Construction programs worked with local builder AuthenTech Homes on the construction of the homes and implementing the latest sustainable technologies. “Working with the latest green building materials on these homes was very valuable for our students,” says Angus Wood, Okanagan College program instructor. “And seeing the EnerGuide results will affirm for them the benefits of new technology and techniques they employed in this project.” The two Wilden Living Lab homes mark the College’s 49th and 50th community projects as part of their Homes for Learning program. In Spring 2017, the homes will start their collection of real life data, when they will be sold at market value. The residents who move in will have their consumption monitored on the meters and sensors installed throughout the equipment in the homes. Researchers from UBC Okanagan’s School of Engineering will spend the next three years analyzing and comparing the collected data from the homes to learn how sustainable building technologies can influence energy consumption. “The Wilden Living Lab will provide real life energy consumption data over the next three years and help us understand and compare the conventional and advanced local construction practices and energy efficient appliances, and its relationship to energy bills,” explains UBC Okanagan associate professor Dr. Shahria Alam, who is leading the monitoring effort. “The initial test on the home of tomorrow has already proven its energy efficiency. The model being developed from the generated data will be also capable of selecting the most energy efficient components and their various combinations for residential construction.” The findings from UBC will be published on the Wilden Living Lab website. FortisBC will be offering open houses to the public in Feb. 2017. The project has been named a finalist in four categories of the annual Tommie Awards, organized by the Canadian Home Builders Association (CHBA) Okanagan chapter. The winners will be announced at the Tommie Awards Gold Gala on Jan. 28. More information about the project is available at wildenlivinglab.com.	cc/2021-04/en_middle_0039.json.gz/line888
__label__cc	0.597649	0.402351	easyJet Traveller: a year in covers It looked more like the aftermath of a food fight than a meticulously arranged shoot. The cover for easyJet’s September issue had taken two months of planning (on and off), the involvement of eight trained professionals (photographers, art directors and food artists) and around 3 tonnes of vegetable matter. By crunch time, much of the latter was scattered across every surface of Liz McBurney’s east London studio, interspersed with cups of tea and craft knives, almost as if a group of ladies from the WI had gone postal at a village fete. The truly scary bit was upending the glass frame. After six hours of working out how to lay out the lettering (carefully), bury it (in specially aerated soil) and pat it down (like gardeners with their prize marrows), the moment of truth was painful. Clutched by four tense people, the wood-and-glass contraption was lifted oh-so-slowly from horizontal to vertical. And… nothing bad happened. The word RAW, spelled out in vegetables, which the Bompas & Parr team had buried under a careful brown blanket of earth, was there in all its glory – readable, sharp and smiling out at us through the glass frame. Big sighs all round. All in all, it’s been a great year for easyJet covers. As plans are in train for the Christmas issue (shhhh!), we’re looking back on some crackers. Such as January, where we forced a full-size food van into a bijou studio, and added a smattering of top London chefs to represent the story about chefs’ favourite eating spots. Or Hattie Newman’s playful take on a family beach holiday in March – made out of from kindergarten-style multimedia – which answered the brief for How to Craft The Perfect Family Holiday perfectly For May’s music issue we recreated Sergeant Pepper’s Lonely Heart’s Club Band featuring a composite of all the artists featured in the issue. Peter Quinnell, who put it together, is a talented guy… … as is Kyle Bean, brains (together with temporary art director Jonny Hughes) behind our escaping island – for August’s Island Escapes issue (what else?!) And finally, for easyJet’s 20th birthday and our corresponding FUTURE ISSUE – an extravagant 200-page ‘Collector’s Edition – this futuristic, typographic marvel, courtesy of Peter Tarka. So there you have it – a year of exciting covers to be proud of. Some easier to execute than others, but a story behind every one… Words Sarah Warwick Art direction by Mat Wiggins Originally posted on madewithink	cc/2021-04/en_middle_0039.json.gz/line889
__label__wiki	0.850673	0.850673	Download citation information Standard abbreviations Need Help? E-mail the JCI Insight Citations to this article Research ArticleInfectious diseaseInflammation Free access \| 10.1172/jci.insight.92002 Hepcidin-mediated iron sequestration protects against bacterial dissemination during pneumonia Kathryn R. Michels,1 Zhimin Zhang,2 Alexandra M. Bettina,1 R. Elaine Cagnina,2 Debora Stefanova,3 Marie D. Burdick,2 Sophie Vaulont,4 Elizabeta Nemeth,5 Tomas Ganz,5 and Borna Mehrad1,2,6 1Departments of Microbiology, Immunology, and Cancer Biology, 2Division of Pulmonary & Critical Care Medicine, Department of Medicine, University of Virginia, Charlottesville, Virginia, USA. 3Departments of Molecular, Cellular, and Integrative Physiology, University of California, Los Angeles, California, USA. 4INSERM U1016, Cochin Institute, Descartes University, Paris, France. 5Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, California, USA. 6Beirne B. Carter Center for Immunology, University of Virginia, Charlottesville, Virginia, USA. Address correspondence to: Borna Mehrad, P.O. Box 800546, Charlottesville, Virginia 22908, USA. Phone: 434.243.4845; E-mail: mehrad@virginia.edu. Find articles by Michels, K. in: JCI \| PubMed \| Google Scholar Find articles by Zhang, Z. in: JCI \| PubMed \| Google Scholar Find articles by Bettina, A. in: JCI \| PubMed \| Google Scholar Find articles by Cagnina, R. in: JCI \| PubMed \| Google Scholar Find articles by Stefanova, D. in: JCI \| PubMed \| Google Scholar Find articles by Burdick, M. in: JCI \| PubMed \| Google Scholar Find articles by Vaulont, S. in: JCI \| PubMed \| Google Scholar Find articles by Nemeth, E. in: JCI \| PubMed \| Google Scholar Find articles by Ganz, T. in: JCI \| PubMed \| Google Scholar \| Find articles by Mehrad, B. in: JCI \| PubMed \| Google Scholar \| Published March 23, 2017 - More info Published in Volume 2, Issue 6 on March 23, 2017 JCI Insight. 2017;2(6):e92002. https://doi.org/10.1172/jci.insight.92002. Copyright © 2017, American Society for Clinical Investigation Published March 23, 2017 - Version history Received: December 19, 2016; Accepted: February 9, 2017 Gram-negative pneumonia is a dangerous illness, and bacterial dissemination to the bloodstream during the infection is strongly associated with death. Antibiotic resistance among the causative pathogens has resulted in diminishing treatment options against this infection. Hepcidin is the master regulator of extracellular iron availability in vertebrates, but its role in the context of host defense is undefined. We hypothesized that hepcidin-mediated depletion of extracellular iron during Gram-negative pneumonia protects the host by limiting dissemination of bacteria to the bloodstream. During experimental pneumonia, hepcidin was induced in the liver in an IL-6–dependent manner and mediated a rapid decline in plasma iron. In contrast, hepcidin-deficient mice developed a paradoxical increase in plasma iron during infection associated with profound susceptibility to bacteremia. Incubation of bacteria with iron-supplemented plasma enhanced bacterial growth in vitro, and systemic administration of iron to WT mice similarly promoted increased susceptibility to bloodstream infection. Finally, treatment with a hepcidin analogue restored hypoferremia in hepcidin-deficient hosts, mediated bacterial control, and improved outcomes. These data show hepcidin induction during pneumonia to be essential to preventing bacterial dissemination by limiting extracellular iron availability. Hepcidin agonists may represent an effective therapy for Gram-negative infections in patients with impaired hepcidin production or signaling. Infections caused by aerobic Gram-negative bacteria are prevalent and dangerous. As a group, these organisms are the most common etiology of nosocomial infections, including most cases of hospital-acquired pneumonia, ventilator-associated pneumonia and healthcare-associated pneumonia, and they are important causes of morbidity and death in hospitalized patients (1). Dissemination of these organisms from the primary site of infection to the bloodstream is especially associated with mortality (2, 3). The progressive rise in antibiotic resistance among Gram-negative bacteria, particularly in the healthcare setting, has critically diminished the available treatment options for these infections. Better mechanistic understanding of the host-pathogen interplay during Gram-negative infections has the potential to lead to novel therapeutic strategies to augment the diminishing armamentarium of traditional antibiotics. Iron is an essential component of many proteins and a required nutrient for nearly all organisms. In biological systems, free iron ions are present at extremely low concentrations, and the competition for iron between pathogens and the host is important to the outcome of many infections (4). While the iron acquisition mechanisms of aerobic Gram-negative bacteria are known to be essential to their virulence (5), the host mechanisms of iron restriction in these infections are incompletely defined. Under homeostatic conditions, plasma iron is rapidly turned over with a half-life of < 1 hour, being continuously utilized in erythropoiesis and replenished by splenic macrophages that scavenge iron from senescent erythrocytes (6). The hormone hepcidin is the key regulator of plasma iron concentration that acts by mediating the degradation of the only known cellular iron exporter, ferroportin, thus trapping iron inside cells and reducing extracellular iron (7). During homeostasis, hepcidin is induced by elevated extracellular and intracellular iron levels via SMAD4 signaling, and is inhibited by anemia and hypoxia. During inflammation, hepcidin is induced as an acute-phase reactant by IL-6 and Activin B via STAT3 and SMAD4, respectively (8, 9). In the context of inflammation, hepcidin mediates acute hypoferremia, which is posited to be a defense mechanism against infectious disease; continual hepcidin production in this setting can infamously cause anemia of chronic inflammation. The role of hepcidin in disorders of iron metabolism is well established, but its contribution to antimicrobial host defenses is an emerging field. For example, hepcidin appears to protect the host against malaria but to promote the growth of pathogens that reside within the intracellular niche of macrophages (10). Hepcidin-mediated hypoferremia is essential for protection of the host against Vibrio vulnificus in a murine model (11), consistent with the clinical observation that individuals with iron-overload conditions are uniquely susceptible to this organism (12). In contrast, the role of hepcidin as a general defense against common bacterial infections, such as those caused by Enterbacteriaceae, remains unknown. We reasoned that the bloodstream dissemination of microorganisms from the primary site of infection is a critical complication in Gram-negative bacterial infections. In the context of pneumonia, as well as other focal infections caused by aerobic Gram-negative bacilli, bacteremia is strongly associated with sepsis and death (13, 14). We therefore tested the hypothesis that hepcidin-mediated depletion of extracellular iron during Gram-negative pneumonia protects the host by limiting dissemination of bacteria to the bloodstream. Plasma iron is suppressed during bacterial pneumonia. We used a well-described model of Klebsiella pneumonia caused by a virulent strain of bacteria, delivered directly into the trachea of sedated experimental mice (15, 16). We first characterized the effect of Klebsiella pneumonia on iron metabolism in WT mice. As expected, plasma iron concentration decreased quickly in WT mice following infection (Figure 1A), similar to prior reports with acute inflammatory stimuli (9). To assess the availability of iron to bacteria in the lungs, we also measured heme-associated and non–heme-associated iron levels in whole lung homogenates (which includes both intra- and extracellular iron), and in the extracellular space, in the bronchoalveolar lavage (BAL) supernatant (Figure 1, B and C). We found that most lung iron was intracellular, and extracellular iron levels were low and did not change appreciably during infection. Iron availability during Klebsiella pneumonia. Time 0 represents uninfected animals. (A) Iron concentration in the plasma. (B and C) Calculated total iron levels in whole lung homogenate per mouse, and bronchoalveolar lavage fluid (BAL) recovered in a volume of 1 ml per mouse. Data shown as mean ± SE; n = 4–6 animals per time point, representative of 2 independent experiments; *P < 0.001 (1-way ANOVA, multiple comparison for linear trend). (D) Plasma iron following i.p. injection with PBS or ferric ammonium citrate (iron) 30 minutes prior to intrapulmonary K. pneumoniae challenge. n = 6–8 per group per time point, combined result of 2 experiments; P < 0.0001, two-way ANOVA. (E) Mice were treated with either PBS or ferric ammonium citrate (iron) 30 minutes prior to intrapulmonary K. pneumoniae challenge and again 24 hours thereafter. n = 6–12 per group, combined result of 2 experiments; P < 0.001 Mantel-Cox test. (F) Bacterial burden on day 2 of infection in mice treated with ferric ammonium citrate or PBS prior to intratracheal challenge with K. pneumonia. Horizontal lines represent median, and each circle represents 1 animal; animals with no detectable bacteria are reported to have a bacterial burden of 1 CFU on the logarithmic scale. n = 9–11, combined result of 2 experiments; P < 0.01 Mann-Whitney U test. Increased iron availability worsens the outcome of infection. To determine whether iron availability influences host defense during the course of infection, we tested the effect of transient increase in extracellular iron availability, achieved by i.p. injection of ferric ammonium citrate, on the outcome of Klebsiella pneumonia. Mice treated with iron prior to intrapulmonary K. pneumoniae challenge developed transient elevation in plasma iron that resolved completely within 12 hours (Figure 1D) without influencing lung iron (Supplemental Figure 1; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.92002DS1), consistent with prior studies indicating that excess iron is rapidly cleared from the blood and redistributed to the BM, spleen, and liver (6). This transient increase in iron availability during the first 24 hours after infection was associated with a markedly increased mortality from pneumonia associated with increased bacterial burden in the lung and the blood (Figure 1, E and F). Since WT mice developed hypoferremia upon infection with K. pneumoniae, and excess iron was associated with poor infection outcome, we hypothesized that endogenous iron regulation was important for controlling infection. Hepcidin regulates plasma iron during bacterial pneumonia by an IL-6–dependent mechanism. To assess the role of hepcidin in mediating hypoferremia during pneumonia, we began by characterizing hepcidin expression during the infection. Infection resulted in a marked increase in hepcidin protein levels in plasma, in parallel with the development of hypoferremia (Figure 2A). Hepcidin protein concentration also increased in the lung but at relatively low concentrations (~15 ng in the entire lung, as compared with ~1,500 ng/ml of plasma on day 3; Figure 2A). The liver is the dominant source of hepcidin at baseline (17, 18), but hepcidin can be induced in leukocytes and airway epithelial cells in response to inflammatory stimuli under in vitro conditions (19–21). We thus measured hepcidin transcription in the liver, blood, and lungs during infection and found a robust induction of hepcidin mRNA in the liver (Figure 2B) but not in peripheral blood leukocytes or lungs (Figure 2, C and D), suggesting that liver is the main source of hepcidin during the infection and elevations in lung hepcidin protein likely represent extravasation from the blood. Hepcidin induction during Klebsiella pneumonia. Time 0 represents naive animals. (A) Hepcidin protein levels in the plasma and whole lung homogenate following infection. Data represent mean ± SEM. (B–D) Hepcidin mRNA in the liver, buffy coat, and lung normalized to GAPDH expression and then to day 0. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars); n = 4–6 animals per time point in each panel; , , and * denote P values of <0.05, <0.01, and <0.001, respectively (1-way ANOVA, multiple comparison for linear trend for panels A–C, t test for panel D). The cytokine IL-6 is a key inducer of acute phase proteins in the liver and an important regulator of hepcidin expression in vivo (9). IL-6 is induced in the lungs in this model of pneumonia (22). We found that immunoneutralization of IL-6 resulted in higher blood and lung bacterial burden 2 days following infection (Figure 3A). In addition, IL-6 neutralization abrogated the increase in plasma hepcidin during the infection and eliminated the associated hypoferremia (Figure 3, B and C), indicating that hepcidin induction during pneumonia is dependent on IL-6. The role of IL-6 in hepcidin induction during Klebsiella pneumonia. (A) Animals were treated daily with an isotype control or IL-6 neutralizing monoclonal antibody and assessed for bacterial burden on day 2 of infection. Horizontal lines represent median, and each circle represents 1 animal; animals with no detectable bacteria are reported to have a bacterial burden of 1 CFU on the logarithmic scale; * and ** denote P values of <0.05 and <0.0001 by Mann-Whitney U test, respectively. (B and C) Plasma hepcidin protein and iron levels in uninfected and infected animals treated with isotype or IL-6 neutralizing antibody. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars) combined from 2 experiments; n = 8–9 animals per group; P < 0.01, one way ANOVA Tukey post-test. Hepcidin mediates hypoferremia during bacterial pneumonia and is required for survival. Reduced availability of plasma iron in the context of acute inflammation can occur as a result of both hepcidin-dependent and -independent mechanisms (23–25). We therefore tested the contribution of hepcidin in regulation of plasma iron levels in the context of bacterial pneumonia. In contrast to reduction in plasma iron during infection in WT mice, plasma iron in hepcidin-deficient mice became more elevated during the infection (Figure 4A), indicating that hepcidin is essential for controlling plasma iron levels following infection. Consistent with reports of tissue iron overload in hepcidin-deficient mice (18, 26), we found elevated lung iron levels in hepcidin-deficient as compared with WT mice, but these values did not change over the infection period (Figure 4B). The role of hepcidin in Klebsiella pneumonia and dissemination. (A and B) Comparison of plasma or lung nonheme iron levels in WT and hepcidin–/– mice before and 2 days after infection. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars) of data from 2 experiments; n = 4–9 per group; and denote P values of <0.01 and <0.0001 by one-way ANOVA with Tukey post test, respectively. (C) Survival of WT and hepcidin–/– mice during pneumonia. n = 26–30 mice per group, combined from 3 independent experiments; P < 0.001 Mantel-Cox test. (D) Bacterial burden on day 2 of infection in WT and hepcidin–/– mice in indicated organs. Pooled data from 3 independent experiments; n = 23–26. Horizontal lines represent median and each circle represents one animal; animals with no detectable bacteria are reported to have a bacterial burden of 1 CFU on the logarithmic scale; * and **** denote P values of <0.01 and <0.0001, respectively, using the Mann-Whitney U test. We next assessed the contribution of hepcidin-mediated iron sequestration to host defense against K. pneumoniae and found that hepcidin-deficient animals were markedly more susceptible to bacterial pneumonia, demonstrating 100% mortality compared with 50% mortality in WT controls (Figure 4C), comparable to mice treated with exogenous iron during infection (Figure 1, D and E). Hepcidin-deficient mice exhibited 23% greater incidence of bacteremia and > 100-fold higher median blood bacterial concentration, as well as ~10-fold higher bacterial burden in the lungs and liver as compared with WT mice (Figure 4D). Since the hepatocytes in hepcidin-deficient animals are iron loaded, we reasoned that the increase of iron in infected hepcidin–/– mice could originate from greater release of iron from damaged hepatocytes. We therefore quantified alanine aminotransferase and aspartate aminotransferase in the blood of infected mice to assess liver damage and found neither enzyme to be elevated in hepcidin–/– as compared with WT mice in the context of infection (Supplemental Figure 2), arguing against disproportionate hepatic injury as a contributor to worse outcomes in hepcidin-deficient hosts. In order to assess whether the beneficial effects of hepcidin are dependent on iron, we used established protocols to induce severe iron-deficiency in hepcidin-deficient mice (27). We found that iron-depleted hepcidin–/– animals did not develop hyperferremia during infection, had lower body iron stores than WT mice, and were no more susceptible to infection compared with WT mice (Supplemental Figure 3, A and B). Taken together, these data suggest that the hepcidin-mediated control of bacterial growth during infection is iron dependent. Excess iron promotes the growth of K. pneumoniae in plasma. To assess whether the increased susceptibility of hepcidin-deficient mice to infection was attributable to increased bacterial growth in the high-iron environment of the plasma, we assessed the effect of iron supplementation on the in vitro growth of K. pneumoniae in human plasma. Supplementing agar composed of 90% human plasma with ferric ammonium citrate at physiologically relevant concentrations incrementally raised the transferrin saturation of the sample, resulting in the appearance of non–transferrin-associated labile pool iron (Figure 5A). The appearance of labile pool iron at transferrin saturation greater than 70% is consistent with prior reports (28, 29). K. pneumoniae growth was suppressed in plasma but was permitted by iron supplementation, consistent with reports that transferrin inhibits bacterial growth (30) (Figure 5B). Interestingly, we found that, in plasma preparations from 3 independent donors, addition of ferric iron resulted in K. pneumoniae out-growth coincided with the appearance of labile iron in the plasma, rather than with the total amount of iron citrate added. These data suggest that ferric ammonium citrate supports K. pneumoniae growth in plasma by providing iron, rather than acting as a carbon or nitrogen source. Effect of iron on Klebsiella growth in vitro and in vivo. (A) Human plasma was supplemented with ferric ammonium citrate and assayed for transferrin saturation and the presence of labile plasma iron (LPI). Transferrin saturation values of >100% represent complete saturation of transferrin iron-binding sites in the presence of additional, unbound ferric iron ions. (B) Agar plates composed of 90% human plasma were supplemented with ferric ammonium citrate and inoculated with K. pneumoniae. Plates were monitored for occurrence of bacterial growth. Representative data from 3 independent plasma agar preparations. (C and D) Bacterial burden and plasma hepcidin protein in WT mice treated with either PBS or iron citrate 30 minutes prior to i.v. challenge with K. pneumoniae. Lungs and blood were harvested after 24 hours. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars). n = 11 mice per group, combined form 2 experiments; P < 0.05, Mann-Whitney U test; P < 0.01, t test. We next sought to test the hypothesis that, during in vivo infection, elevated plasma iron is sufficient to enhance growth of blood-borne bacteria. To test this, we subjected WT mice with an i.p. injection of PBS or ferric ammonium citrate prior to i.v. challenge with K. pneumoniae. After 24 hours, mice treated with ferric ammonium citrate had higher blood bacterial content than mice treated with PBS, indicating that elevated plasma iron directly mediates increased growth of K. pneumoniae in the blood stream (Figure 5C). Interestingly, mice treated with ferric ammonium citrate also had higher bacterial burdens in the lungs. We interpret this as evidence that, in mice with increased bacteremia, bacterial seeding of the lung from the bloodstream contributes to higher lung bacterial content. Similar to prior reports (31), mice treated with iron also had marked elevation of plasma hepcidin as compared with mice treated with PBS in response to acute iron loading (Figure 5D), indicating that hepcidin induction alone is not sufficient to protect mice from fatal infection if plasma iron levels are high and supporting the hypothesis that the beneficial effects of hepcidin are mediated via induction of hypoferremia, rather than an iron-independent effect. Hepcidin-deficient mice have intact cellular immunity against Klebsiella. Iron deficiency and iron overload have complex effects on immune responses (32), and phagocytes from iron-overloaded hosts may have altered antibacterial properties that could contribute to impaired host defenses of hepcidin-deficient mice independent of the effects of acute hyperferremia on bacteria. In order to assess the functionality of the innate immune response in hepcidin-deficient mice, we analyzed leukocyte populations in the blood and BAL (Figure 6, A–F). We found similar concentrations of circulating neutrophils, and Ly6Chi and Ly6Clo monocytes in WT and hepcidin-deficient mice at baseline and 2 days following infection. The number of BAL alveolar macrophages, neutrophils, and monocyte-derived macrophages were also similar between WT and hepcidin-deficient hosts, both at baseline and following infection, arguing against a defect in leukocyte quantity or recruitment in the absence of hepcidin. Since oxidative burst is an iron-dependent process, we compared the generation of reactive oxygen species in lung and blood leukocyte populations and found no difference between infected WT and hepcidin-deficient mice (Supplemental Figure 4). Similarly, neutrophils from WT and hepcidin-deficient mice exhibited comparable ex vivo bacterial killing (Figure 6G). While these data do not formally exclude the possibility that hepcidin deficiency impairs the immune system in some other way, they suggest intact cellular innate immune mechanisms against K. pneumoniae in hepcidin–/– mice. Leukocytes responses during Klebsiella pneumonia. (A–F) BAL and blood were harvested from WT and hepcidin–/– mice before and 2 days following infection. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars). n = 4–5 per group, one way ANOVA Tukey post-test. No significant differences were found for any WT to hepcidin–/– comparison. (G) Freshly isolated neutrophils from WT and hepcidin–/– mice were coincubated with 2 × 105 CFU of K. pneumoniae for 1 hour. Total surviving bacteria were enumerated from each well. n = 3 independent experiments per group; data were analyzed using a 2-way ANOVA, and no differences were found between groups Restoring hypoferremia is sufficient to protect hepcidin-deficient mice from infection. Impaired hepcidin production is common in the clinical setting — for example, in patients with liver disease (33–36) — and our data suggests a mechanism by which these hosts may be predisposed to Gram-negative bacterial infections. As proof-of-principle of a potential therapeutic approach in this population, we assessed the effect of minihepcidin, a hepcidin analogue, on the outcome of K. pneumoniae infection in hepcidin-deficient hosts. We used a previously described synthetic peptide based on the 9 N-terminal amino acids of the hepcidin molecule, which are necessary and sufficient to induce the degradation of ferroportin (37, 38). Daily treatment with the hepcidin analogue beginning on the day of infection resulted in markedly lowered plasma iron levels in infected hepcidin-deficient mice as compared with vehicle-treated controls without affecting the total lung iron content (Figure 7, A and B), consistent with utilization of plasma iron in erythropoiesis (6). The treatment also resulted in > 99% reduction in median lung and blood bacterial burden in infected hepcidin-deficient mice and 40% reduction in mortality compared with vehicle alone (Figure 7, C and D). These data provide evidence that the acute induction of hypoferremia during infection in hepcidin-deficient hosts may represent a plausible therapeutic strategy. The effect of hepcidin agonist treatment in Klebsiella pneumonia in hepcidin-deficient mice. (A and B) Nonheme iron levels in the plasma and lung of vehicle-treated and minihepcidin-treated hepcidin-deficient mice. Box and whisker plots show median (line within box), upper and lower quartiles (upper and lower box boundaries), and total range (bars). n = 17–19 per group combined from 2 independent experiments; **P < 0.001, t test. (C) Bacterial burden in blood and lungs. Horizontal lines represent median and each circle represents 1 animal; animals with no detectable bacteria are reported to have a bacterial burden of 1 CFU on the logarithmic scale; n = 17–19 per group, combined data from 2 experiments; and ** denote P values <0.05 and <0.01 by Mann-Whitney U test, respectively. (D) Survival of hepcidin-deficient mice treated with either vehicle or hepcidin analogue days 0–5; n = 16 per group, combined result of 2 experiments; *P < 0.05 by Mantel-Cox test. Although the competition for iron is thought to be a general feature of antimicrobial host response, the mechanisms and contribution of iron restriction in most infections are undefined. In particular, hepcidin-mediated hypoferremia has only been implicated in host defense against V. vulnificus, an organism with specific affinity for iron-overloaded hosts, but its role in defense against common pathogens and in normal hosts is not known (10). We showed that hepcidin was necessary for protection against bacterial dissemination in Gram-negative pneumonia and that treatment with iron citrate was sufficient to permit bacterial outgrowth in WT mice. Finally, we showed that treatment with minihepcidin restored hypoferremia and rescued iron-overloaded, hepcidin-deficient hosts from the infection. Taken together, these data suggest that hepcidin-mediated iron sequestration protects against Gram-negative pneumonia. Our data suggest that the hepcidin-dependent protection was mediated by reducing plasma iron, as indicated by our observation that WT mice treated with iron citrate were susceptible to K. pneumoniae infection despite robust hepcidin induction (Figure 1, E and F) and that hepcidin-deficient mice were protected from infection if starved of iron (Supplemental Figure 3B). While there may be iron-independent effects of ferric ammonium citrate administration that we have not accounted for, such as bacterial fermentation of citrate, we are encouraged that the phenotype of iron citrate–treated mice is remarkably similar to that of hepcidin–/– mice in terms of death and bacterial burden. Furthermore, we found that hepcidin-deficient mice treated with minihepcidin were robustly protected from infection despite having tissue iron overload, suggesting that restriction of iron in the plasma is sufficient for protection (Figure 7, C and D). Hepcidin exhibits antimicrobial activity against a broad array of pathogens in vitro, and an iron-independent direct microbicidal role for hepcidin has thus been suggested (17, 39, 40). Arguing against such a direct microbicidal role, we report plasma hepcidin levels at concentrations much lower than those required to mediate killing in vitro (39). Similarly, administration of a hepcidin analogue, which lacks the β-defensin motif required for its antimicrobial activity (37), rescued the phenotype of hepcidin-deficient mice (Figure 7, C and D). Although hepcidin-independent mechanisms of hypoferremia have been reported after challenge with inflammatory stimuli (23, 25, 41), we found that hypoferremia during pneumonia was completely abrogated in hepcidin-deficient mice, and in fact, plasma iron levels became elevated following infection in hepcidin-deficient mice. Our use of an infectious agent, rather than sterile inflammatory stimuli used in other reports, may account for this difference. We speculate that this increase in plasma iron levels reflects decreases in iron consumption by cytokine-suppressed erythropoiesis (24) and release of iron from intracellular sources damaged by infection, such as the liver (42). We thus propose a model in which infections result in a tendency toward increased extracellular iron that benefits the pathogen, and the protective role of inflammation-mediated hepcidin induction is to counteract this phenomenon. Furthermore, while hepcidin can be produced by leukocytes, airway epithelial cells and other tissues(19–21), our results indicate that hepcidin is predominantly produced by the liver and circulates systemically in the context of bacterial pneumonia. Consistent with this, we observed that hepcidin induction was dependent on IL-6, similar to observations with other systemic inflammatory stimuli (43). In addition, we found that IL-6 neutralization disrupted host defense against K. pneumoniae (Figure 3A), in corroboration with previous reports (22). While IL-6 induces many acute phase reactants, such as C reactive protein, which are crucial to the innate immune response, we speculate that hepcidin induction may be a component of IL-6–mediated protection. These data provide the host counterpart to the existing literature on the role of the bacterial siderophore system in the virulence of Gram-negative pathogens (30, 44). The hypervirulent strain of K. pneumoniae used in this study produces yersiniabactin, which supports bacterial growth in the respiratory tract, and glycosylated enterobactin, which promotes bacterial growth in the bloodstream by evading lipocalin-2, a host-derived molecule that sequesters nonglycosylated enterobactin and limits microbial iron uptake (45–49). Our findings indicate that even bacteria equipped with these high-affinity acquisition systems are susceptible to a host mechanism that limits iron availability in the host environment. As such, we speculate that these findings may be broadly applicable to infections caused by other phylogenetically related aerobic Gram-negative pathogens (50). This work has several implications for future research. First, our results may have implications for the therapeutic use of hepcidin antagonists, which are currently under development for the treatment of anemia of inflammation. In this context, we posit that relieving the iron-restricted state could predispose some individuals to Gram-negative sepsis. Second, impaired hepcidin production is a feature of several common clinical entities, including alcohol intoxication and chronic liver disease (33–36), illnesses associated with striking susceptibility to Gram-negative bacteremia (51, 52). Our data suggest that impaired hepcidin production may represent an unappreciated mechanism predisposing these hosts to infection. Finally, hepcidin agonists may represent a novel therapeutic strategy in illnesses where hepcidin production is diminished, such as liver disease and hereditary hemochromatosis, and possibly more broadly in acquired iron-overload states. Supplemental Methods are available online with this article. Animals and in vivo procedures. C57BL/6 mice, purchased from the Jackson Laboratories. Hepc1–/– mice generated on a C57BL/6 background (26) — acquired from the University of California, Los Angeles, California, USA — were bred at the University of Virginia under specific-pathogen–free conditions for a minimum of 2 generations, and offspring were used in the experiments. To minimize any effect of differing microbiota between groups of animals, all animals were bred and maintained in the same room in the vivarium and used bedding from cages of breeders, and animals to be used in experiments were intermixed at weekly intervals. Age- and sex-matched male and female 6- to 12-week-old mice were used in experiments. Standard rodent chow has artifactually high iron content that causes near-maximal expression of hepcidin at baseline in WT animals (43). To correct this, all animals were conditioned on a low-iron diet (2–4 ppm iron; Teklad diet TD.80396, Envigo) for 5–7 days prior to, and throughout the duration of, all experiments. In our pilot studies and published reports (43, 53), this protocol normalizes baseline hepcidin expression without inducing iron deficiency. Experimental bacterial pneumonia was induced as previously described (15, 16), by intratracheal inoculation of 500–1,500 CFU of K. pneumoniae strain 43816 (American Type Culture Collection). In some experiments, 1,500 CFU of K. pneumoniae was delivered i.v. in 100 μl PBS. To induce transient hyperferremia without iron overload, 900 μg of ferric ammonium citrate in 100 μl PBS was delivered i.p., using a previously characterized protocol (54, 55). In some experiments, mice were given 1 mg anti–IL-6 antibody or isotype control i.p. 3 hours prior to and 24 hours following infection (clones MP5-20F3 and HRPN1, BioXcell). In other experiments, 100 nmol of the synthetic hepcidin analogue PR73 (manufactured in house), referred to as minihepcidin in text, or vehicle was administered via i.p. injection beginning 5 hours prior to infection and then every 24 hours until day 5 after infection. PR73 was synthesized using Fmoc solid-phase peptide synthesis and was solubilized for in vivo use with SL220 (a polyethylene glycosylated-phospholipid based solubilzer; NOF America Corporation) as previously described (11, 37, 38). Tissue harvest and determination of bacterial burden. Animals were euthanized with an overdose of a ketamine/xylazine solution, blood was collected from the right ventricle into heparinized syringes, and pulmonary vasculature was perfused with 2 ml of 2 mM EDTA solubilized in PBS. The median liver lobe was collected for RNA analysis. Lungs and liver were homogenized in 1 ml PBS. BAL was performed by serially inflating the lungs via an intratracheal catheter with 1 ml of 2 mM EDTA solubilized in PBS and recovering the fluid 4 times (56). For bacterial enumeration, lung homogenates and blood were serially diluted in sterile water and cultured on blood agar plates, as previously described (57). RNA, protein, and iron analysis. Tissue RNA was extracted using TRIzol and chloroform (Thermo-Fisher Scientific). Buffy coat RNA was extracted using a commercial kit (Qiagen). A commercial kit was used to synthesize cDNA (Promega). Hepcidin transcript was quantified by quantitative PCR in duplicate using SYBR green (Bioline). Expression was calculated using the ΔΔC(t) method normalized to glyceraldehyde 3-phosphate dehydrogenase, and then relative to hepcidin expression of uninfected animals. Primers were custom synthesized (Sigma Aldrich) as previously published (35): hepcidin 5′ TGCAGAAGAGAAGGAAGAGAGACA 3′ (forward) and 5′ CACACTGGGAATTGTTACAGCATT 3′ (reverse); glyceraldehyde 3-phosphate dehydrogenase 5′ TTCACCACCATGGAGAAGGC 3′ (forward) and 5′ GGCATGGACTGTGGTCATGA 3′ (reverse) (58). The thermal cycling conditions were as follows: 2 minutes at 95°C, 10 minutes at 95°C, 5 seconds at 95°C, and 10 seconds at 55°C for 40 cycles. Reactions were performed on a BioRad iQ5 Cycler. Protein concentration of hepcidin was quantified using a commercial ELISA kit (Intrinsic Life Sciences) according to the manufacturer instructions. Plasma iron was quantified with a commercial kit (Sekisui Diagnostics) according to manufacturer instructions with minor modifications — namely, samples were scaled to volume and centrifuged at 10,000 g for 10 minutes between steps to clear insoluble material. Transferrin saturation was determined by measuring the unsaturated iron binding capacity (UIBC) of each sample using a commercial kit (Sekisui Diagnostics). UIBC values were added to plasma iron values in each sample to calculate the total iron binding capacity (TIBC). Transferrin saturation was calculated as (plasma iron/TIBC) × 100%. Tissue heme and nonheme iron levels were quantified using the ferrozine assay, as previously described (59–61). Whole lungs and left lateral lobe of the liver were homogenized in 1 ml of water. BAL was collected into 1 ml of 2 mM EDTA solubilized in PBS. Briefly, 100 μl sample were heated in 100 μl buffer containing 1 N hydrochloric acid and 10% trichloroacetic acid with (total iron) or without (nonheme iron) 2.25% KMnO4 at 60°C for 2 hours. Samples were centrifuged at 16,000 g for 10 minutes to remove insoluble material and were incubated with 50 μl iron detection reagent (6.5 mM ferrozine, 6.5 mM neucoproine, 1 M L-ascorbic acid, 2.5 M ammonium acetate) for 10 minutes and then plated in duplicate and read at A590 nm on a Dynex Triad microplate reader (Dynex Technologies). Heme-iron values were calculated by subtracting nonheme iron values from total iron content. Labile plasma iron (LPI), the major component of non–transferrin-bound iron, was measured using a published protocol with minor modifications (62): briefly, HEPES buffered saline was iron-depleted by incubation with Chelex-100 chelating resin (Bio-Rad) for 1 hour, filtered, and supplemented with 60 nM deferrioxamine (Sigma-Aldrich). For LPI measurements, 10 μl of plasma samples were mixed with either 140 μl of HBS/50 μM dihydrorhodamine/40 μM ascorbic acid/0.5 mM nitriloacetic acid (–DFP) or 140 μl of the same buffer supplemented with 100 μM deferriprone (+DFP). Changes in fluorescence were measured over 40 minutes, and the slope was calculated for each sample. The difference between –DFP and +DFP was used as a measure of LPI. The experiment was repeated a total of 3 times using different plasma donors with similar results. Flow cytometry. Cell suspensions from blood and BAL fluid were prepared and analyzed by flow cytometry as previously described, with minor modifications (16, 63, 64). The following antibodies were used for surface antigen staining: anti–MHC-II APC (clone M5/114.15.2), anti–CD11b Pe-Cy7 (clone M170), and anti–CD115 APC (clone AF598) from eBioscience; anti–CD11c PerCP (clone HL3) and anti–CD64 brilliant violet 421 (clone X54-5/7.1) from BioLegend; and anti-CD16/CD32 (clone 2.4G2), anti–Ly6G PE (clone 1A8), and anti–CD45 AmCyan (clone 30-F11) from BD Biosciences. After extracellular staining, cells were washed in 1% FCS in PBS once and resuspended in the same buffer. Data were acquired on a FACS Canto II instrument using BD FACS Diva software (version 8.0; BD Biosciences) and analyzed with FlowJo software (version 8.8.6; Tree Star Inc.). The absolute cell number was calculated as the product of the cell type frequency (as determined by gating analysis) and the total number of cells in the sample (as determined by manually counting under a hemocytometer). In vitro experiments. BM neutrophils were isolated by grinding the tibia, femur, pelvis, and spine from uninfected mice in a sterile mortar and pestle as previously described (15, 57), followed by positive selection using anti-Ly6G magnetic beads, according to the manufacturer’s instructions (MACS; Miltenyi Biotec). Isolated populations were found to have > 90% viability by examination in trypan blue. Neutrophil bacterial killing was quantified using a published protocol with minor modifications (57). Briefly, K. pneumoniae was opsonized at a concentration of 8 × 106 CFU/ml in 20% fresh mouse serum and HBSS for 30 minutes at 37°C, washed once in cold water, once in HBSS, and resuspended in HBSS. Aliquots of 2 × 105 bacteria were added to sterile U-bottom 96-well plates and coincubated with 5 × 105, 2 × 105, 2 × 104, 2 × 103, or no neutrophils from WT or hepcidin-deficient mice in triplicate in a total volume of 200 μl HBSS. Samples were incubated in a humidified chamber with 5% CO2 at 37°C for 1 hour. Number of surviving bacteria was determined by hypotonic lysis of neutrophils in cold water and serial dilution and culture. Human plasma was inactivated (30 min at 56°C) and incubated overnight at 37°C with 0–60 μM ferric ammonium citrate (Sigma-Aldrich), followed by quantification of transferrin saturation and LPI. The samples were then used to generate 90% plasma agar solid media, poured in sterile 12-well tissue culture plates. K. pneumoniae was suspended at 1 × 104 CFU/ml and 5 μl plated in triplicates on plasma agar wells and incubated for 24 hours at 37°C; bacterial colonies were counted and photographed. Statistics. Data were analyzed using Prism software (version 6.0, GraphPad Software). The Mantel-Cox test was used to analyze survival data. A one-way ANOVA with a post-test for linear trend was used to analyze change in a single parameter over time, and one-way ANOVA with a Tukey multiple comparison post-test was used to analyze differences between 3 or more groups. A 2-way ANOVA with Tukey multiple comparison post-test was used to compare changes over time between 2 groups. An unpaired, 2-tailed t test was used to compare 2 groups for RNA, protein, and iron levels. A Mann-Whitney U test was used to compare bacterial burden between groups. P <0.05 was considered statistically significant. Study approval. Animal experiments were performed in compliance with NIH Guide for the Care and Use of Laboratory Animals, The US Animal Welfare Act, and PHS Policy on Humane Care and Use of Laboratory Animals and was approved by the Institutional Animals Care and Use Committee at the University of Virginia (protocol 3571). KRM, EN, TG, and BM conceived the project, designed experiments, and interpreted data; KRM, ZZ, AMB, REC, DS, and MDB performed experiments; KRM and DS generated the figures; SV, EN, and TG designed and contributed materials; and KRM and BM wrote the first draft of the manuscript. All authors revised the manuscript. View Supplemental data This work was supported by NIH grants R21AI117397 and R01HL098329-05 awarded to BM; and R01DK065029 awarded to TG. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Conflict of interest: EN and TG are inventors of minihepcidins, hold a patent on these peptides (US20120040894 A1), and are scientific founders and shareholders in Merganser Biotech, a company involved in the commercial development of minihepcidins. Reference information: JCI Insight. 2017;2(6):e92002. https://doi.org/10.1172/jci.insight.92002. Gaynes R, Edwards JR, National Nosocomial Infections Surveillance System . Overview of nosocomial infections caused by gram-negative bacilli. Clin Infect Dis. 2005;41(6):848–854. View this article via: PubMed CrossRef Google Scholar Meatherall BL, Gregson D, Ross T, Pitout JD, Laupland KB. Incidence, risk factors, and outcomes of Klebsiella pneumoniae bacteremia. Am J Med. 2009;122(9):866–873. Uslan DZ, et al. Age- and sex-associated trends in bloodstream infection: a population-based study in Olmsted County, Minnesota. Arch Intern Med. 2007;167(8):834–839. Skaar EP. The battle for iron between bacterial pathogens and their vertebrate hosts. PLoS Pathog. 2010;6(8):e1000949. Cassat JE, Skaar EP. Iron in infection and immunity. Cell Host Microbe. 2013;13(5):509–519. Craven CM, Alexander J, Eldridge M, Kushner JP, Bernstein S, Kaplan J. Tissue distribution and clearance kinetics of non-transferrin-bound iron in the hypotransferrinemic mouse: a rodent model for hemochromatosis. Proc Natl Acad Sci USA. 1987;84(10):3457–3461. Nemeth E, et al. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science. 2004;306(5704):2090–2093. Besson-Fournier C, et al. Induction of activin B by inflammatory stimuli up-regulates expression of the iron-regulatory peptide hepcidin through Smad1/5/8 signaling. Blood. 2012;120(2):431–439. Nemeth E, Valore EV, Territo M, Schiller G, Lichtenstein A, Ganz T. Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein. Blood. 2003;101(7):2461–2463. Michels K, Nemeth E, Ganz T, Mehrad B. Hepcidin and Host Defense against Infectious Diseases. PLoS Pathog. 2015;11(8):e1004998. Arezes J, et al. Hepcidin-induced hypoferremia is a critical host defense mechanism against the siderophilic bacterium Vibrio vulnificus. Cell Host Microbe. 2015;17(1):47–57. Khan FA, Fisher MA, Khakoo RA. Association of hemochromatosis with infectious diseases: expanding spectrum. Int J Infect Dis. 2007;11(6):482–487. Agbaht K, et al. Bacteremia in patients with ventilator-associated pneumonia is associated with increased mortality: A study comparing bacteremic vs. nonbacteremic ventilator-associated pneumonia. Crit Care Med. 2007;35(9):2064–2070. Magret M, et al. Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study. Crit Care. 2011;15(1):R62. Barletta KE, Cagnina RE, Burdick MD, Linden J, Mehrad B. Adenosine A(2B) receptor deficiency promotes host defenses against gram-negative bacterial pneumonia. Am J Respir Crit Care Med. 2012;186(10):1044–1050. Bettina A, et al. M-CSF Mediates Host Defense during Bacterial Pneumonia by Promoting the Survival of Lung and Liver Mononuclear Phagocytes. J Immunol. 2016;196(12):5047–5055. Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem. 2001;276(11):7806–7810. Zumerle S, et al. Targeted disruption of hepcidin in the liver recapitulates the hemochromatotic phenotype. Blood. 2014;123(23):3646–3650. Armitage AE, Pinches R, Eddowes LA, Newbold CI, Drakesmith H. Plasmodium falciparum infected erythrocytes induce hepcidin (HAMP) mRNA synthesis by peripheral blood mononuclear cells. Br J Haematol. 2009;147(5):769–771. Chen QX, et al. Silencing airway epithelial cell-derived hepcidin exacerbates sepsis induced acute lung injury. Crit Care. 2014;18(4):470. Nguyen NB, Callaghan KD, Ghio AJ, Haile DJ, Yang F. Hepcidin expression and iron transport in alveolar macrophages. Am J Physiol Lung Cell Mol Physiol. 2006;291(3):L417–L425. Sutherland RE, Olsen JS, McKinstry A, Villalta SA, Wolters PJ. Mast cell IL-6 improves survival from Klebsiella pneumonia and sepsis by enhancing neutrophil killing. J Immunol. 2008;181(8):5598–5605. Guida C, et al. A novel inflammatory pathway mediating rapid hepcidin-independent hypoferremia. Blood. 2015;125(14):2265–2275. Langdon JM, et al. Hepcidin-dependent and hepcidin-independent regulation of erythropoiesis in a mouse model of anemia of chronic inflammation. Am J Hematol. 2014;89(5):470–479. Armitage AE, et al. Induced Disruption of the Iron-Regulatory Hormone Hepcidin Inhibits Acute Inflammatory Hypoferraemia. J Innate Immun. 2016;8(5):517–528. Lesbordes-Brion JC, et al. Targeted disruption of the hepcidin 1 gene results in severe hemochromatosis. Blood. 2006;108(4):1402–1405. Nagababu E, Gulyani S, Earley CJ, Cutler RG, Mattson MP, Rifkind JM. Iron-deficiency anaemia enhances red blood cell oxidative stress. Free Radic Res. 2008;42(9):824–829. Gosriwatana I, Loreal O, Lu S, Brissot P, Porter J, Hider RC. Quantification of non-transferrin-bound iron in the presence of unsaturated transferrin. Anal Biochem. 1999;273(2):212–220. Breuer W, Ronson A, Slotki IN, Abramov A, Hershko C, Cabantchik ZI. The assessment of serum nontransferrin-bound iron in chelation therapy and iron supplementation. Blood. 2000;95(9):2975–2982. View this article via: PubMed Google Scholar Nassif X, Sansonetti PJ. Correlation of the virulence of Klebsiella pneumoniae K1 and K2 with the presence of a plasmid encoding aerobactin. Infect Immun. 1986;54(3):603–608. Pigeon C, et al. A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem. 2001;276(11):7811–7819. Wang L, Cherayil BJ. Ironing out the wrinkles in host defense: interactions between iron homeostasis and innate immunity. J Innate Immun. 2009;1(5):455–464. Georgopoulou U, Dimitriadis A, Foka P, Karamichali E, Mamalaki A. Hepcidin and the iron enigma in HCV infection. Virulence. 2014;5(4):465–476. Nahon P, Nuraldeen R, Rufat P, Sutton A, Trautwein C, Strnad P. In alcoholic cirrhosis, low-serum hepcidin levels associate with poor long-term survival. Liver Int. 2016;36(2):185–188. Harrison-Findik DD, Klein E, Crist C, Evans J, Timchenko N, Gollan J. Iron-mediated regulation of liver hepcidin expression in rats and mice is abolished by alcohol. Hepatology. 2007;46(6):1979–1985. Kessler SM, Barghash A, Laggai S, Helms V, Kiemer AK. Hepatic hepcidin expression is decreased in cirrhosis and HCC. J Hepatol. 2015;62(4):977–979. Ramos E, et al. Minihepcidins prevent iron overload in a hepcidin-deficient mouse model of severe hemochromatosis. Blood. 2012;120(18):3829–3836. Preza GC, et al. Minihepcidins are rationally designed small peptides that mimic hepcidin activity in mice and may be useful for the treatment of iron overload. J Clin Invest. 2011;121(12):4880–4888. View this article via: JCI PubMed CrossRef Google Scholar Krause A, et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett. 2000;480(2-3):147–150. Kim A, et al. A mouse model of anemia of inflammation: complex pathogenesis with partial dependence on hepcidin. Blood. 2014;123(8):1129–1136. Kell DB, Pretorius E. Serum ferritin is an important inflammatory disease marker, as it is mainly a leakage product from damaged cells. Metallomics. 2014;6(4):748–773. Nemeth E, et al. IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin. J Clin Invest. 2004;113(9):1271–1276. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev. 1998;11(4):589–603. Lawlor MS, O’connor C, Miller VL. Yersiniabactin is a virulence factor for Klebsiella pneumoniae during pulmonary infection. Infect Immun. 2007;75(3):1463–1472. Lawlor MS, Hsu J, Rick PD, Miller VL. Identification of Klebsiella pneumoniae virulence determinants using an intranasal infection model. Mol Microbiol. 2005;58(4):1054–1073. Bachman MA, Lenio S, Schmidt L, Oyler JE, Weiser JN. Interaction of lipocalin 2, transferrin, and siderophores determines the replicative niche of Klebsiella pneumoniae during pneumonia. MBio. 2012;3(6):6. Bachman MA, Miller VL, Weiser JN. Mucosal lipocalin 2 has pro-inflammatory and iron-sequestering effects in response to bacterial enterobactin. PLoS Pathog. 2009;5(10):e1000622. Bachman MA, et al. Klebsiella pneumoniae yersiniabactin promotes respiratory tract infection through evasion of lipocalin 2. Infect Immun. 2011;79(8):3309–3316. Drancourt M, Bollet C, Carta A, Rousselier P. Phylogenetic analyses of Klebsiella species delineate Klebsiella and Raoultella gen. nov., with description of Raoultella ornithinolytica comb. nov., Raoultella terrigena comb. nov. and Raoultella planticola comb. nov. Int J Syst Evol Microbiol. 2001;51(Pt 3):925–932. Gustot T, Durand F, Lebrec D, Vincent JL, Moreau R. Severe sepsis in cirrhosis. Hepatology. 2009;50(6):2022–2033. Jong GM, Hsiue TR, Chen CR, Chang HY, Chen CW. Rapidly fatal outcome of bacteremic Klebsiella pneumoniae pneumonia in alcoholics. Chest. 1995;107(1):214–217. Pak M, Lopez MA, Gabayan V, Ganz T, Rivera S. Suppression of hepcidin during anemia requires erythropoietic activity. Blood. 2006;108(12):3730–3735. Duong-Nu TM, et al. All Three TonB Systems Are Required for Vibrio vulnificus CMCP6 Tissue Invasiveness by Controlling Flagellum Expression. Infect Immun. 2015;84(1):254–265. Elin RJ, Wolff SM. The role of iron in nonspecific resistance to infection induced by endotoxin. J Immunol. 1974;112(2):737–745. Mehrad B, et al. Transient lung-specific expression of the chemokine KC improves outcome in invasive aspergillosis. Am J Respir Crit Care Med. 2002;166(9):1263–1268. Mehrad B, et al. The lupus-susceptibility locus, Sle3, mediates enhanced resistance to bacterial infections. J Immunol. 2006;176(5):3233–3239. Guo Z, et al. Cutting edge: membrane lymphotoxin regulates CD8(+) T cell-mediated intestinal allograft rejection. J Immunol. 2001;167(9):4796–4800. Grundy MA, Gorman N, Sinclair PR, Chorney MJ, Gerhard GS. High-throughput non-heme iron assay for animal tissues. J Biochem Biophys Methods. 2004;59(2):195–200. Rebouche CJ, Wilcox CL, Widness JA. Microanalysis of non-heme iron in animal tissues. J Biochem Biophys Methods. 2004;58(3):239–251. Oremland M, Michels KR, Bettina AM, Lawrence C, Mehrad B, Laubenbacher R. A computational model of invasive aspergillosis in the lung and the role of iron. BMC Syst Biol. 2016;10:34. Esposito BP, Breuer W, Sirankapracha P, Pootrakul P, Hershko C, Cabantchik ZI. Labile plasma iron in iron overload: redox activity and susceptibility to chelation. Blood. 2003;102(7):2670–2677. Barletta KE, Cagnina RE, Wallace KL, Ramos SI, Mehrad B, Linden J. Leukocyte compartments in the mouse lung: distinguishing between marginated, interstitial, and alveolar cells in response to injury. J Immunol Methods. 2012;375(1-2):100–110. Misharin AV, Morales-Nebreda L, Mutlu GM, Budinger GR, Perlman H. Flow cytometric analysis of macrophages and dendritic cell subsets in the mouse lung. Am J Respir Cell Mol Biol. 2013;49(4):503–510. Version 1 (March 23, 2017): Electronic publication	cc/2021-04/en_middle_0039.json.gz/line890
__label__cc	0.62014	0.37986	Transfer of manuscripts from the JCI to JCI Insight The Editors will issue invitations to transfer manuscripts previously submitted to the JCI that are deemed better suited for JCI Insight. If you receive an invitation to transfer your submission, the email will include a link to a web page where you can accept or decline the invitation. The invitation to transfer your manuscript to JCI Insight will remain open for 60 days. Manuscripts are automatically transferred to JCI Insight in the original formatting used for submission to the JCI, along with any applicable reviews and correspondence, and will be handled by the Editor who issued the invitation to transfer. Authors of manuscripts that were previously reviewed by the JCI will receive a rapid decision from JCI Insight (generally in fewer than 7 days) that provisionally accepts the manuscript, specifies the requirements for reconsideration at JCI Insight, or outlines the basis for rejection without an opportunity to resubmit. Transferred manuscripts that were editorially rejected by the JCI will be sent for external peer review prior to the initial decision. Authors who wish to inquire about the suitability of transferring their manuscript from the JCI to JCI Insight should contact the Editors at editors@insight.jci.org. If you have any questions concerning the transfer process, please contact the JCI Insight staff (staff@insight.jci.org).	cc/2021-04/en_middle_0039.json.gz/line891
__label__wiki	0.807494	0.807494	Application and Essay Tips Admit This The College Search Deferrals & Waitlists Money Saving Ideas Graduation-Related Whether you were deferred, denied or accepted during the Early Decision/Early Action round, we've got guidance that can help you move forward. Check our ED/EA Toolkit for all the resources you need to take the next steps in your admissions journey. `; document.getElementById('js-topBannerContainer').innerHTML = html; } Forums Community DiscussionsSchools Find Your Best FitCareers Choose the Right PathGuidance Expert Advice & Insights Test Prep Admissions Careers Paying for College Campus Life Graduate School Application & Essay Tips Exposing Yourself Online Dave Berry Contrary to what Captain Kirk says at the beginning of every Star Trek episode, space is not the final frontier. Privacy is. Why? Social media. The big offender in this arena is Facebook, of course. I call Facebook The Home of Dirty Laundry. I do that with good reason. Facebook seems to satisfy people's desire to reveal far more about themselves than they would in person, among a group of friends or even strangers. The element of increased freedom, I think, comes from a false sense of security about the Internet, which is a big mistake in my view. It's bad enough that Homeland Security's Big Brother is scanning our email for provocative, "terror-related" keywords. Why, then, would anyone think that posting compromising pictures of themselves or malicious rants on their Facebook pages would be any less damaging to an inquiring, judgmental eye? <p>So why <em>my</em> rant today about online "appropriateness"? Well, it has to do with college admissions and what some college admissions officials are looking into regarding their applicants. I've touched on this topic <a href="http://www.collegeview.com/admit/?p=2270" target="_blank">before</a>, but things have gotten "worse" for today's applicants. Why is that and how much worse have things become?</p><p><br/></p><p>Here's a disturbing headline: "Kaplan Test Prep Survey Finds That College Admissions Officers' Discovery of Online Materials Damaging to Applicants Nearly Triples in a Year." That should be telling you something. It should be alerting you to the importance of the content on your Facebook pages. Let's take a look at what Kaplan's survey revealed. It may help you avoid some conflicts during your college admissions process. </p><p>Kaplan issued their survey findings in a general news release and, with Kaplan's permission, I'll quote portions of it here:</p><p><em>Over a Quarter of College Admissions Officers Today Include Google or Facebook in Applicant Evaluations; 35% Report Discovering Information that Negatively Impacted Prospective Students' Admissions Chances - Up from 12% Last Year</em></p><p><em>Results from Kaplan Test Prep's 2012 survey of college admissions officers* show that schools are increasingly discovering information on Facebook and Google that negatively impact applicants' acceptance chances. While the percentage of admissions officers who took to Google (27%) and checked Facebook (26%) as part of the applicant review process increased slightly (20% for Google and 26% for Facebook in 2011) from last year, the percentage that said they discovered something that negatively impacted an applicant's chances of getting into the school nearly tripled – from 12% last year to 35% this year. Offenses cited included essay plagiarism, vulgarities in blogs, alcohol consumption in photos, things that made them “wonder," and “illegal activities." In 2008, when Kaplan began tracking this trend, only one in 10 admissions officers reported checking applicants' social networking pages.</em></p><p><em> “Social media used to basically mean Facebook. But the underlying trend we see is the increase in use of Google, which taps into a social media landscape that's proliferated to include Twitter, YouTube, Pinterest, Instagram, blogging and other platforms -- and teens today are using all of these channels," said Jeff Olson, Vice President of Data Science, Kaplan Test Prep. “Additionally, we're seeing a growing cultural ubiquity in social media use, plus a generation that's grown up with a very fluid sense of privacy norms. In the face of all these trends, the rise in discovery of digital dirty laundry is inevitable." </em></p><p><em> Olson noted, “With regard to college admissions, the traditional application -- the essays, the letters of recommendation -- represent the polished version of an applicant, while often what's found online is a rawer version of that applicant. Schools are philosophically divided on whether an applicant's digital trail is fair game, and the majority of admissions officers do not look beyond the submitted application, but our advice to students is to think first, Tweet later."</em></p><p><em> Kaplan's survey also found that only 15% of colleges currently have rules regarding the checking of applicants' Facebook or social networking pages – a percentage that has remained fairly consistent over the past few years. Of schools that do have a policy, 69% said the policy prohibited admissions officers from visiting applicants' pages – still leaving the vast majority of admissions officers with the flexibility to act at their own discretion . . .</em></p><p><em>. . . Kaplan will be releasing more results from its survey in the coming weeks.</em></p><p><em>* For the 2012 survey, 350 admissions officers from the nation's top 500 colleges and universities – as compiled from U.S. News & World Report and Barron's – were polled by telephone between July and September 2012.</em></p><p rel="text-align: center;" style="text-align: center;">*</p><p style="text-align: left;">So, go back and take a critical look at your Facebook (and even other social media) pages. What do you see? More importantly, what do you think a college admissions officer would see? Be honest. The college application you save may be your own.</p><p style="text-align: center;">********</p><p style="text-align: left;">Be sure to check out all my college-related articles and book reviews at <a href="http://www.collegeconfidential.com/" target="_blank">College Confidential</a>.</p> Keep reading Show less Privacy safety Social Networking technology Admit This Where is Northwestern University Average ACT Score Spring Semester 2021 College Forums Index eBook: 25 Tips from the Dean	cc/2021-04/en_middle_0039.json.gz/line892
__label__cc	0.630996	0.369004	It is damning Arlen Specter with faint praise to note that he never was a creature of either the Republican and Democratic fund-raising machines and was, in his own way far more mavericky than John McCain. While his defeat to Joe Sestak in yesterday's Pennsylvania primary was a result of the anti-incumbent fervor sweeping the land, when the five-term U.S. senator's epitaph is written it will be said that he managed the neat trick of pissing off both parties. The overall primary results nationally for the Dems were not the train wreck that many a pundit had predicted, while the Republicans got clobbered in the one race of consequence -- a real-live election in PA-12 to replace longtime Democratic Congressman Jack Murtha -- because these dumb bunnies yet again tried to make it a referendum on Obama, Pelosi and Reid while the voters had more local concerns.	cc/2021-04/en_middle_0039.json.gz/line894
__label__cc	0.748131	0.251869	live stream Ministry of Education Youth and Information Bi-weekly Post Cabinet Press Briefing at 10:00am live stream Sitting of the House of Representatives @ 2:30pm home » JIS News » National Security Minister Bartlett Congratulates Adam Stewart on Being Named Executive Chairman of SRI Prime Minister’s Statement On the Shooting Death of Policemen by Criminals in Spanish Town St. Catherine Written by: Office of the Prime Minister Photo: JIS Photographer Prime Minister, the Most Hon. Andrew Holness. Eleven Per Cent Drop In Major Crimes PHOTOS: Senator Samuda Tours Tamarind Farm SOES Effective In Driving Down Crime I am deeply saddened to learn of the deadly turn of events which resulted in the death of at least two (2) members of the Jamaica Constabulary Force (JCF) and the serious wounding of two others while on operation early this morning. The killing of law enforcement officers is an immeasurable tragedy and we will not rest until the perpetrators are brought to justice. Officers of the law are faced with extreme danger everyday as they serve and protect our country. When they leave their families and loved ones to police our streets and our communities, the thought that they may not return should not be foremost in mind. Yet, that is what happened to hard working members this morning as they conducted their lawful duty to rid our society of criminality and put criminals behind bars. My heart is pained at this time and I cannot imagine the despair the families must be feeling. My heart goes out to them and I express my deep, deep condolences. Words are insufficient to convey my sympathies for the families and the members of the Jamaica Constabulary Force who are grieving an unimaginable loss at this time. My thoughts and prayers are with the families of all the officers and our collective hearts grieve with you. The Government will provide every support to the families, and the police high command will leave no stone unturned in bringing those responsible, to justice. We will not be deterred. Those responsible for the slaughter of our officers should find no safe haven, they must be captured. Rampant criminality is a stain on our society and the murder of these officers speak to the level of depravity of these criminals. I know this must be a trying time for the JCF. However, I want the committed and hardworking members of the JCF to know that all well thinking Jamaicans stand with you. Do not be discouraged. We urge cooperation and support of our police and law enforcement; do not protect criminals. Even in a time of crisis the criminals are at work. We must redouble our efforts against criminal elements. They must face justice!	cc/2021-04/en_middle_0039.json.gz/line914
__label__wiki	0.697338	0.697338	Mild endoplasmic reticulum stress ameliorates lipopolysaccharide-induced neuroinflammation and cognitive impairment via regulation of microglial polarization Yi-wei Wang1, Qin Zhou1, Xiang Zhang2, Qing-qing Qian1, Jia-wen Xu1, Peng-fei Ni1 & Yan-ning Qian ORCID: orcid.org/0000-0003-2839-26271 The Correction to this article has been published in Journal of Neuroinflammation 2020 17:353 Neuroinflammation, which ultimately leads to neuronal loss, is considered to play a crucial role in numerous neurodegenerative diseases. The neuroinflammatory process is characterized by the activation of glial cells such as microglia. Endoplasmic reticulum (ER) stress is commonly associated with impairments in neuronal function and cognition, but its relationship and role in neurodegeneration is still controversial. Recently, it was confirmed that nonharmful levels of ER stress protected against experimental Parkinson’s disease. Here, we investigated mild ER stress-based regulation of lipopolysaccharide (LPS)-driven neuroinflammation in rats and in primary microglia. Male Sprague–Dawley (SD) rats received the intracerebroventricular injection of the ER stress activator tunicamycin (TM) with or without intraperitoneal injection of the ER stress stabilizer sodium 4-phenylbutyrate (4-PBA) 1 h before LPS administration. The levels of neuroinflammation and memory dysfunction were assessed 24 h after treatment. In addition, the effect of mild ER stress on microglia was determined in vitro. Here, we found that low doses of TM led to mild ER stress without cell or organism lethality. We showed that mild ER stress preconditioning reduced microglia activation and neuronal death as well as improved LPS-induced memory impairment in rats. In addition, pre-exposure to nonlethal doses of TM in microglia showed significant protection against LPS-induced proinflammatory cytokine production and M1/2b polarization. However, sodium 4-PBA, a compound that ameliorates ER stress, ablated this protective effect in vivo and in vitro. Based on our findings, we conclude that the mild ER stress not only limits the accumulation of misfolded proteins but also protects tissues from harmful endotoxemia insults. Therefore, ER stress preconditioning has potential therapeutic value for the treatment of neurodegenerative diseases. Uncontrolled chronic neuroinflammation is known to play a key role in the progression of diverse neurodegenerative diseases, such as Alzheimer’s disease (AD), Huntington’s disease (HD), and Parkinson’s disease (PD), by causing an over-production of proinflammatory cytokines [1, 2]. Microglia exert neurotoxic effects during neuroinflammation by establishing a feedforward inflammatory loop that ultimately leads to neurodegeneration [3, 4]. Systemic injection of lipopolysaccharide (LPS), an endotoxin isolated from bacteria, triggers neuroinflammation and amyloidogenesis in the hippocampus [5]. Thus, LPS-induced systemic inflammation in rats is frequently used as a model for studying neurodegeneration and cognitive impairment [6]. The endoplasmic reticulum (ER) is a multifunctional organelle that activates a set of signaling pathways upon encountering stress to maintain homeostasis [7, 8]. Altered ER proteostasis results in the accumulation of unfolded/misfolded proteins in the ER lumen (known as ER stress), which activates the unfolded protein response (UPR) [9]. The UPR is mediated by three main signaling branches: the protein kinase RNA-like ER kinase (PERK)–eukaryotic translation initiation factor 2α (EIF2α) axis, the inositol-requiring protein 1α (IRE1α)–spliced X-box-binding protein-1 (XBP1s) axis, and activating transcription factor (ATF)-6α axis [10, 11]. Although accumulating reports have linked the occurrence of ER stress with several neurodegenerative diseases such as PD, HD, AD, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), and prion-related diseases (PrDs) [7, 12], whether ER stress plays a causative role in certain disease conditions is still being debated. On the basis of some contradictory findings [13, 14], a complex scenario is emerging in which activation of specific UPR signaling mechanisms may actually function as a beneficial response to reduce neurodegeneration. Several reports have shown that nonharmful levels of ER stress are protective against experimental PD [15,16,17]. Similarly, using an AD model, the enforced expression of the IRE1α/XBP1s pathway was shown to protect against amyloid-β toxicity to reverse memory impairment [18, 19]. In addition, the PERK signaling branch revealed a bifunctional role in a model of ALS in which EIF2α phosphorylation had a protective effect but expression of ATF4 had detrimental consequences [20, 21]. These studies suggest that in the context of neurodegenerative diseases, the contribution of the UPR is very complex and nonlinear. Some theoretical mechanisms [12, 22] have been proposed to explain these scenarios, including the idea that targeting specific UPR components may actually generate low nonlethal levels of ER stress that could actually operate as a beneficial response to maintain homeostasis. The downstream effects of the UPR has two contrasting processes—protective responses or proapoptotic programs—that depend on several parameters, including the load of misfolded proteins and subtle differences in the type, intensity, and duration of the stressors [14]. Under conditions of moderate misfolded protein accumulation, activation of the UPR operates as a beneficial reaction that reinforces protein folding, degradation, and quality control. When the buffering capacity of the UPR is inadequate to maintain ER proteostasis, the UPR shifts signals towards a terminal pathway that drives cells towards apoptosis [11, 23, 24]. This dual aspect of UPR was explained by a possible concept of ER hormesis, which involves the engagement of a preconditioning state via mild, nonlethal ER stress to induce adaptive reactions and protect the cell from a second, stronger insult [25,26,27]. The concept of “ER hormesis” has been applied to the fields of ischemic brain injury and neurodegeneration [15, 20, 28]. However, there has been little direct evidence of the involvement of ER hormesis in LPS-induced neuroinflammation to date. Therefore, in the present study, we investigated the effects of mild ER stress on LPS-induced neuroinflammation and cognitive impairment in rats and in primary microglia. Male Sprague-Dawley rats weighing 250 g (n = 154) were used in this experiment. All rats were housed under specific pathogen-free conditions (ambient temperature, 22.0 ± 1.0 °C; humidity, 40%) during breeding and experiments. Food and water were available ad libitum. During all the surgical procedures, the animals were placed under general anesthesia and every effort was made to minimize the stress and number of rats. The experiments were approved by the Nanjing Medical University Animal Care and Use Committee. All experimental procedures involving animals were approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University. Intracerebroventricular cannula implantation An indwelling lateral intracerebroventricular (icv) cannula for injection of pharmacological agents was implanted in the brains of rats as previously described [29, 30]. The animals were anesthetized (2.1% inspired concentration in 0.3 FiO2) and placed in a stereotaxic device. Guide cannulas were inserted into the lateral ventricle (coordinates of 0.8 mm posterior, 1.5 mm lateral, and 3.7 mm ventral to the bregma) and secured to the skull with dental cement [31]. Following surgery, rats were individually housed and allowed to recover in the animal facility for 14 days before experiments. Animals were handled daily to familiarize them with the investigators and to check the guide cannula. Behavioral tests The behavioral assessment lasted 2 days and consisted of three tests: trace fear conditioning (TFC), contextual assessment, and the Y-maze test. To avoid any potential influence of behavioral testing on the molecular biology experiments, molecular biology assessments and behavioral testing were performed on different animals. The behavioral test design is briefly illustrated in Fig. 1a. Complete methodological details are described in the Additional file 1: Supplemental Materials and Methods. Study design. a Timeline of the in vivo experimental treatments. All rats underwent icv cannula implantation 14 days before use in experiments. One day after contextual fear conditioning training, all animals received drug treatments as indicated. Brains were collected 24 h after drug injection. Contextual assessment and the Y-maze test were also performed at this time point. b, c The protocol performed in the in vivo experiment 1: Groups C, D, and E received the indicated dosage of tunicamycin (TM) intracerebroventricularly immediately after contextual fear conditioning (TFC) training, while group B received an equivalent volume of vehicle. Rats of group A were naïve to all treatments. d, e The protocol performed in the in vivo experiment 2: Rats in groups C, D, and E were injected with LPS within 1 h after TFC training. Groups D and E received TM intracerebroventricularly immediately after TFC training, while groups B and C received an equivalent volume of vehicle. 4-PBA was administered by intraperitoneal (ip) injection prior to TM treatment in group E. Rats of group A were naïve to all treatments. All animals underwent behavioral testing 24 h after TM injection. Brains were collected after completion of the behavior tests. f The protocol performed in the in vitro experiment 1: Cells were treated with TM at the concentrations indicated for 24 h, then the culture medium and cells were collected. g The protocol performed in the in vitro experiment 2: Cells were pretreated with TM for 1 h followed by the addition of LPS. The culture medium and cells were collected after 24 h of incubation Drug administration Tunicamycin TM was dissolved in 10% dimethyl sulfoxide (DMSO). The dilutions of TM (0.3, 3, and 30 μg) were prepared fresh prior to the experiment in saline containing 10% DMSO, and 2 μl of the preparation was administered via icv route [28]. This low concentration of DMSO was chosen to avoid neurological effects [32,33,34]. Sodium 4-phenylbutyrate 4-Phenylbutyric acid (4-PBA) was diluted in sterile saline and injected intraperitoneally (ip) at a dose of 100 mg/kg as previously described in the literature [35, 36]. Lipopolysaccharide To induce a systemic inflammatory reaction for the experimental procedures, LPS was diluted in sterile saline and ip injected at a dose of 500 μg/kg, which elicited moderate inflammation [29]. Additionally, it has been reported that this dose does not affect motor activity [5, 37, 38]. Experimental protocol and pharmacological treatments The in vivo experiments consist of two parts. Rats were randomly assigned to one of five groups (16 rats per group), and investigators were blinded to the experimental treatment. The well-known ER stress inducer TM (0.3, 3, and 30 μg) was administered via icv cannulas in rats from groups C, D, and E immediately after TFC training. Rats in group B were administered the same volume of vehicle (10% DMSO in saline) via icv injection, while rats in group A were naïve to any treatment. The study design is briefly illustrated in Fig. 1b, c. The rats were randomly assigned to one of five groups (groups A–E) with 16 rats per group, and investigators were blinded to the experimental treatments. Immediately after TFC training, rats in the group E received 100 mg/kg 4-PBA intraperitoneally while the rats in groups B–D received an equivalent volume of sterile saline. Following the 4-PBA/saline treatment, a dose of 3 μg/2 μl TM (groups D and E) or 10% DMSO in saline (groups B and C) was administered via icv cannulas. After 1 h, rats were intraperitoneally challenged with sterile saline (group B) or 500 μg/kg LPS (groups C, D, and E). Rats of group A were naïve to any treatment. The study design is briefly illustrated in Fig. 1d, e. To minimize the number of animals used in this study, experiments 1 and 2 shared the naïve rats. The in vitro experiments consist of two parts. Primary microglia were seeded at 1 × 106 cells in 5 cm × 5 cm flasks, and incubated for 24 h at 37 °C in a humidified atmosphere containing 5% CO2. The cells were treated with TM (0.5, 5, and 50 ng/ml) for 24 h, followed by collecting the culture medium and cells. The study design is briefly illustrated in Fig. 1f. The cells were pre-exposed to TM at 5 ng/ml with or without 4-PBA for 1 h, followed by the addition of 10 ng/ml LPS. The culture medium and cells were collected after a further 24 h of incubation. The study design is briefly illustrated in Fig. 1g. Primary microglial cultures and treatments Rat microglial cultures were prepared as previously described with slight modifications [39]. Briefly, the cerebral cortex of neonatal SD rats (at postnatal day 1) was dissociated and digested with a 0.25% trypsin-EDTA solution for 10 min at 37 °C. The cells were plated in pre-coated poly-d-lysine cell culture flasks and cultured in high-glucose DMEM containing 10% fetal bovine serum (FBS) and penicillin (100 U/ml)/streptomycin (100 μg/ml). After culturing for 10 days at 37 °C in a humidified atmosphere containing 5% CO2 and 95% air with a medium change every 3 days, the glial cells formed a confluent monolayer. The microglial cells were separated from the astrocytes by shaking the flask for 5 h at 150 rpm to detach the layer of loosely adherent cells, which are mainly astrocytes, from the firmly adherent cells. The purity of the microglia was > 98% as confirmed by anti-Iba-1 immunochemical staining. Afterwards, the microglial cells were seeded on either poly-d-lysine pre-coated dishes or coverslips (for immunocytochemistry). Cell Counting Kit-8 (CCK-8) assay Briefly, cells were seeded at a density of 5 × 103 cells per well in 96-well culture plates with fresh medium containing different concentrations of reagents. Thereafter, 10 μl of CCK-8 solution was added to each well. After a 1-h incubation at 37 °C, the optical density (OD) at 450 nm was measured by a DTX-880 multimode microplate reader. Each treatment had six replicate wells, and the amount of DMSO in the reaction mixture was adjusted to be identical in each well (including the control) and never exceeded 0.1%. Moreover, each experiment was repeated at least three times. RT-PCR with SYBR green detection Total RNA from the hippocampus and primary microglial cell cultures was using TRIzol reagent (Invitrogen, USA), and reverse transcription was performed as previously described. Real-time PCR amplification was performed using the STEP ONE Real-time PCR Detection System (Foster City, CA) with SYBR Green master mix (Applied Biosystems, Foster City, CA) at a final volume of 10 μl that contained 1 μl cDNA template from each sample. The PCR was carried out using the following cycling protocol: a 95 °C denaturation step for 5 min followed by 40 cycles of 95 °C denaturation (15 s), 60 °C annealing (15 s), and 60 °C extension (30 s). Detection of the fluorescent product was carried out at the end of each 60 °C extension period. The relative mRNA values were normalized to the β-actin gene control values and calculated using the comparative cycle threshold (ΔΔCt) method. The primers used are listed in Additional file 1: Supplemental Materials and Methods. Enzyme-linked immunosorbent assay (ELISA) The levels of IL-1β, IL-6, and TNFα in rat hippocampal tissue extracts and the culture medium were measured using ELISA kits from R&D Systems according to the manufacturer’s instructions. Details are available in the Additional file 1: Supplemental Materials and Methods. Ipsilateral hippocampal tissues and microglial cells were homogenized in RIPA lysis buffer, which contained 20 mM Tris, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1.5 μg/ml leupeptin, and 1 mM phenylmethylsulfonylfluoride (PMSF). Samples were centrifuged for 20 min at 12,000×g (4 °C). Protein quantification was performed using the Bradford assay following the manufacturer’s guidelines (Bio-Rad). Samples were boiled for 4 min, and 20 μg of protein was separated on a 10% acrylamide gel and transferred onto nitrocellulose membranes. The membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated at 4 °C overnight with specific primary antibodies. After they were washed three times with Tris-buffered saline with Tween 20 (TBST), the membranes were incubated with secondary antibodies for 1 h at room temperature followed by three washes with TBST and then detection using a chemiluminescent substrate. Terminal deoxynucleotidyl transferase mediated dUTP nick end labeling (TUNEL) assay TUNEL assay, a method for detecting DNA fragmentation, was used to measure apoptosis. The one-step TUNEL apoptosis assay kit was obtained from KeyGEN BioTECH (KGA7074). Briefly, brain sections were rinsed in 0.5% Triton X-100 in 0.01 M PBS for 20 min at 80 °C to increase permeability of the cells. To label the damaged nuclei, 50 μl of FITC-conjunctive fluorescein-12-dUTP reaction mixture was added to each sample in a humidified chamber, which was followed by a 60-min incubation at 37 °C. The nuclei were stained with DAPI. Fluorescent images were acquired using a confocal microscope. Immunofluorescence analysis Upon completion of the treatment, the microglia were fixed with 4% paraformaldehyde for 30 min and blocked with 5% bovine serum albumin (BSA) in 0.1% Triton X-100 for 1 h at room temperature. Next, the cells were incubated at 4 °C with specific primary antibodies overnight. After three washes with PBS, the microglia were incubated at 37 °C with either goat anti-mouse or goat anti-rabbit Alexa Fluor 488 or Alexa Fluor 594 (as appropriate) diluted in the blocking solution for 1 h and the nuclei were stained with DAPI. The images were visualized using a confocal microscope. Ipsilateral hippocampal tissue samples used for immunohistochemical and immunofluorescent staining were post-fixed with 4% paraformaldehyde overnight and sliced into 5-μm-thick sections using a cryostat. After they were blocked with 5% BSA, the sections were incubated with specific primary antibodies overnight at 4 °C and then incubated with PE-conjugated and/or FITC-conjugated secondary antibodies for 1 h followed by staining with DAPI. The sections were viewed under a confocal microscope. Immunohistochemical analysis To determine the expression of cleaved caspase-3, ipsilateral hippocampal sections (10 μm thick) were prepared and immunohistochemistry was performed as follows. After incubation for 1 h in 10% BSA with 0.3% Triton X-100 in 0.01 M phosphate-buffered saline, the sections were incubated with specific primary antibodies overnight at 4 °C. The sections were then incubated with the appropriate secondary antibody for 2 h. Positive cells were visualized by adding DAB to the sections. Images of immunocytochemistry were digitally captured using a Leica 2500 microscope. The data were first tested for normality (Shapiro–Wilk test) and homoscedasticity (Levene’s test). All data were presented as either the mean ± SEM or as the median and interquartile range. Statistical analysis was performed using a one-way ANOVA followed by either a least significant difference (if the variance was equal) or Dunnett T3 (if the variance was not equal) test. P < 0.05 was considered statistically significant. Low doses of TM activated a benign, moderate ER stress response in the hippocampus of rats TM is a commonly used ER stress inducer [28]. In this study, TM was injected intracerebroventricularly at the indicated dosage to investigate the UPR in the hippocampi. ER stress-activated p-IRE1α cuts unspliced XBP1 (XBP1u) mRNA into spliced XBP1 (XBP1s) mRNA, which encodes the transcriptionally active XBP1s protein [40]. To determine the activation status of IRE1 signaling after ER stress, we examined XBP1s, XBP1u, and p-IRE1α protein expression using western blotting. Significant increases in the protein expression levels of p-IRE1α and XBP1s were observed after TM (0.3, 3, and 30 μg) treatment (Fig. 2a–c). Interestingly, TM (0.3, 3, and 30 μg) treatment could reduce XBP1u expression (Fig. 2c). Effect of tunicamycin on the expression of UPR-related proteins in the hippocampus. a The expression levels of p-PERK, p-EIF2α, p-IRE1α, XBP1s, XBP1u, ATF4, and CHOP in the hippocampus of rats were detected by Western blotting using specific antibodies. Each blot is representative of three experiments. b Phosphorylated levels of PERK, EIF2α, and IRE1α were quantified and normalized to the corresponding total levels. c Expression of XBP1s and XBP1u was quantified and normalized to GAPDH expression. d Expression of ATF4 and CHOP was quantified and normalized to GAPDH expression. e, f Images acquired by confocal microscopy show the p-IRE1α and CHOP levels in the CA1 area of the hippocampus. The arrow in e points to an area in CA1 with high p-IRE1α immunoreactivity. The arrow in f points to an area in CA1 with high CHOP immunoreactivity. Scale bar, 200 μm. g, h Quantitative data of the mean intensities of p-IRE1α and CHOP fluorescence. Each value was expressed relative to that of the naïve group, which was set to 100 (n = 6). All experiments were repeated three times. P < 0.05, P < 0.01 vs. naïve group. The data are presented as the mean ± SEM PERK is activated by phosphorylation at Thr980, after which it phosphorylates EIF2α at Ser51 [10]. However, prolonged EIF2α phosphorylation induces paradoxical translation of ATF4 mRNA into the corresponding protein, which in turn induces the upregulation of pro-apoptotic components such as CHOP [40]. Thus, to further characterize the extent of PERK activation, we assessed the hippocampal expression levels of p-PERK, p-EIF2α, ATF4, and CHOP using western blotting with specific antibodies. TM (0.3, 3, and 30 μg) significantly increased the expression levels of p-PERK and p-eIF2a (Fig. 2a, b), whereas ATF4 and CHOP levels were only elevated at the highest dose of TM (30 μg). We observed that following TM icv injection of either 0.3 or 3 μg, the expression levels of ATF4 and CHOP in the rat hippocampus did not show significant changes (Fig. 2a, d). We also examined the expression of p-IRE1α and CHOP in hippocampal CA1 using immunohistochemistry (Fig. 2e, f). Consistent with the western blotting data, increases of p-IRE1α were detected following injection of TM (0.3, 3, and 30 μg) in the hippocampal CA1 region (Fig. 2g), while administration with either 0.3 or 3 μg of TM did not affect the expression of CHOP in the hippocampal CA1 region. The CHOP levels were only elevated in response to the highest dose of TM (30 μg) (Fig. 2h). These findings showed that low doses of TM activated a benign and mild ER stress response in the hippocampus. To verify these findings, we performed contextual assessment and the Y-maze test to observe the cognitive function of the rats [29, 30]. As shown in Fig. 3a, b, rats exposed to 30 μg of TM exhibited a significant reduction in cognitive function compared to the naïve animals. However, TM injection at 0.3 and 3 μg did not change the freezing time and number of learning trials. Low doses of TM activated a nonharmful, moderate UPR in the hippocampus. The freezing time in the trace fear conditioning test (a) and the number of learning trials in the Y-maze test (b) were recorded to analyze cognitive changes (n = 12). c Immunostaining was used to detect cleaved caspase-3 in the CA1 area of the hippocampus. Scale bar, 50 μm. d Quantification of cleaved caspase-3-positive cells in the CA1 area of the hippocampus. e The expression levels of cleaved caspase 3 and full-length caspase 3 in the hippocampus of rats were detected by Western blotting using specific antibodies. Each blot is representative of three experiments. f Quantification of cleaved caspase-3-positive cells in the CA1 area of the hippocampus. Each value was expressed relative to that in the naïve group, which was set to 100 (n = 6). g The TUNEL assay was performed to determine the extent of apoptosis in the CA1 area of the hippocampus. The arrows indicate cells showing an overlay of TUNEL and DAPI signals. Scale bar, 100 μm. h Quantitative analysis of TUNEL-positive cell content in different groups. P < 0.05, *P < 0.01 vs. naïve group. The data are presented as the mean ± SEM. All experiments were repeated three times We tested cleaved caspase-3 using western blotting and immunostaining in the rat hippocampus. Our data indicated that only a 30-μg dose of tunicamycin increased the expression levels of cleaved caspase-3 (Fig. 3c–f). TUNEL labeling was also performed to assess the level of apoptosis in the hippocampus. In the present study, TUNEL-positive cells were found in the 30 μg TM treatment group, but not the sham and low-dose TM (0.3 and 3 μg) groups, in the hippocampus (Fig. 3g, h). These results confirmed that low doses of TM (0.3 and 3 μg) caused a benign and moderate ER stress response in the hippocampus. Mild ER stress alleviated LPS-induced and neuronal apoptosis in the hippocampus and ameliorated cognitive decline We observed that low doses of TM (0.3 and 3 μg) cause a mild UPR in the rat brain but do not induce drastic behavioral alterations or death. In the following experiment, TM was injected icv at a dose of 3 μg prior to LPS administration to induce mild ER stress in the rats. Next, we studied the effects of mild ER stress in LPS-induced neuroinflammation and cognitive impairment. TM improve LPS-induced memory impairment One day after LPS systemic injection, we performed a TFC assessment and the Y-maze test to observe the cognitive function of the rats. As shown in Fig. 4a, b, compared to the naïve group, rats exposed to LPS exhibited a significant reduction in cognitive function. Notably, treatment with TM (3 μg) significantly improved the freezing behavior and the number of learning trials, indicating TM may help protect against the memory dysfunction caused by LPS. Mild ER stress inhibited LPS-induced apoptosis in the hippocampus and ameliorated the cognitive decline. a Contextual fear response, as measured by freezing time, was determined in the rats (n = 12). b The number of learning trials was recorded to analyze the Y-maze test (n = 12). Each value was expressed relative to that of the naïve group, which was set to 100 (n = 6). c The TUNEL assay was performed to determine the extent of apoptosis in the CA1 area of the hippocampus. The arrows indicate cells showing an overlay of TUNEL and DAPI signals. Scale bar, 100 μm. d Quantitative analysis of TUNEL-positive cell content in different groups. The data are representative of three independent experiments. P < 0.05, *P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM TM alleviated LPS-induced neuronal apoptosis To determine whether TM affected neuronal apoptosis, we performed TUNEL assay in the hippocampal CA1 region (Fig. 4c). There was no TUNEL staining observed in the hippocampus of the naïve group, while TUNEL-positive cells were abundant in the hippocampus of LPS group.TM administration induced a dramatic decrease in TUNEL-positive cells in the hippocampal CA1 region (Fig. 4c, d). These data suggested a protective role of TM in LPS-induced neuroinflammation. 4-PBA reversed the neuroprotective effects of TM To clarify whether mild ER stress activation is responsible for the neuroprotection of TM, rats were administered 4-PBA (a chemical chaperone known to reduce ER stress) at a dosage of 100 mg/kg. Additionally, it has been reported that this dose does not affect the normal function of the nervous system [35, 36]. Treatment with 4-PBA decreased ER stress, as demonstrated by reduced p-IRE1α and XBP1s protein levels compared with levels in the non-PBA treated group (Fig. 5g). Importantly, concomitant administration of 4-PBA and TM partially blocked the neuroprotection conferred by TM as reflected by the increased expression of TUNEL-positive cells and a significant reduction in cognitive function, while 4-PBA alone was without effects in healthy rats (Additional file 2: Figure S1). Therefore, these results further confirmed that low doses of TM may help protect against LPS-induced cognitive dysfunction and inhibit caspase-3 activation by (at least partially) inducing mild ER stress. Mild ER stress attenuated LPS-induced neuroinflammation and shifted microglia polarization from M1/2b to M2a. a–c Expression levels of M1 phenotype markers (CD86, CD32, and iNOS). d, e Expression levels of markers for the M2a phenotype (YM1/2 and CD206). f Expression levels of SOCS3, a marker for the M2b phenotype. The expression levels of iNOS, CD206, p-IRE1α, and XBP1s were detected in the hippocampus of rats by Western blotting using specific antibodies. Each blot is representative of three experiments. g–l Expression of p-IRE1α was quantified and normalized to t-IRE1α levels, and the expression levels of iNOS, CD206, XBP1s, CD86, CD32, and YM1/2 were quantified and normalized to GAPDH levels. Each value was expressed relative to the values of the naïve group, which was set to 100 (n = 6). The data are representative of three independent experiments. P < 0.05, *P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM Mild ER stress attenuated LPS-induced neuroinflammation and shifted the microglia population from M1/2b to M2a microglia in the hippocampus TM reversed LPS-induced M1/2b microglia activation genes in the hippocampus Because microglia activation is an early sign that triggers neuronal death in neurodegenerative disorders, we explored the effect of mild ER stress on microglia in vitro [41]. We first measured the expression of microglia genes associated with a classic (M1), alternative repair and regeneration (M2a), and immunomodulatory (M2b) phenotypes based on identifying antigenic markers for each microglial state. Figure 5a–c shows the relative mRNA expression of the typical M1 genes CD86, CD32, and inducible nitric oxide synthase (iNOS). The M2a genes YM1/2 and CD206 and the M2b gene suppressor of cytokine signaling3 (SOCS3) were the other markers selected in the present study (Fig. 5d–f). LPS significantly increased the mRNA levels of M1 and M2a markers in the hippocampus compared with the levels observed in the naïve group. In contrast, the M2a-repair/regeneration marker genes were significantly reduced compared with those in the naïve group. TM pretreatment markedly altered the balance of M1 and M2 microglia expression patterns in the hippocampus with significantly increased expression of M2a genes and decreased expression of several key M1 and M2b genes. Western blotting also showed that the expression of iNOS, CD86, and CD32 in the hippocampi of LPS-injected rats was significantly higher than that in the naïve rats, but these elevations were remarkably inhibited by TM pretreatment. The expression of CD206 and YM1/2 was decreased in LPS-treated rats, while TM reversed the LPS-induced reduction of CD206 and YM1/2 levels (Fig. 5g–l). TM inhibited iNOS expression and increased the expression of CD206 in LPS-injected rats To further evaluate whether microglia polarized in a particular manner, representative M1-associated (iNOS) or M2-associated (CD206) marker proteins were analyzed by double immunofluorescent staining with the microglia marker Iba1 in hippocampal CA1 region (Fig. 6a, b). Consistent with Western blotting results in Fig. 5g, a significant decrease of the M1 marker iNOS expression was observed after TM administration in Iba1+ microglia compared with microglia in the LPS group (Fig. 6a, b). In contrast, immunofluorescence for the M2 marker CD206 was significantly decreased in Iba1+ cells treated with LPS compared to the levels in the control group; however, this decrease was abolished after TM treatment (Fig. 6c, d). These results indicated that TM could inhibit LPS-induced microglia activation and shift the phenotype of microglia towards M2a. Mild ER stress contributed to M2a polarization in hippocampal CA1. a, b Double-staining immunofluorescence of IBA1 with either iNOS or CD206 in the CA1 area of the hippocampus (indicated by arrows). Scale bars, 100 μm. c Quantification of IBA1+/ iNOS+ double-stained cells in the hippocampal CA1. d Quantification of IBA1+/CD206+ double-stained cells in the hippocampal CA1. e, f, g. The levels of the proinflammatory factors TNF-α, IL-6, and IL-1β were detected by ELISA (n=5). The data are representative of three independent experiments. n = 6. P < 0.05, *P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM TM inhibited the hippocampal proinflammatory cytokines secretion induced by LPS Because neuroinflammation is mainly due to the excessive secretion of proinflammatory factors, the levels of TNF-α, IL-1β, and IL-6 were detected by ELISA. LPS induced significant increases in the production of proinflammatory factors, and TM (3 μg) could inhibit this inflammatory response (Fig. 6e–g). 4-PBA attenuated the anti-neuroinflammatory effects of TM in LPS-treated rats To further clarify whether mild ER stress is involved in the anti-neuroinflammatory properties of TM, ER stress was blocked using 4-PBA. When 4-PBA was given to healthy rats alone, there was no obvious proinflammatory effect (Additional file 2). However, the expression levels of TNF-α, IL-1β, and IL-6 were markedly enhanced after 4-PBA co-treatment, leading to the significant reversal of the anti-neuroinflammatory effects of TM (Fig. 6e–g). Moreover, although TM reversed the LPS-induced M1/M2 imbalance, 4-PBA greatly diminished these effects. Therefore, these results indicated that mild ER stress may be required for TM-induced neuroprotection. Low doses of TM caused a nontoxic, mild UPR in primary cultured microglia Multiple investigations have shown that multiple cell types are vulnerable to ER stress-induced cell death. Therefore, primary rat microglia were first subjected to several concentrations of TM for 24 h and assayed for cell viability using the CCK-8 reagent. Our results indicated that compared with the control treatment, TM (< 50 ng/ml) did not affect the viability of primary rat microglia (Fig. 7a). Therefore, 0.5, 5, and 50 ng/ml were selected for subsequent experiments. Low doses of TM activate a nontoxic, mild UPR in primary cultured microglia. a Primary microglia were treated with TM (0.02 to 2000 ng/ml) for 24 h followed by assessment of cell viability using the CCK-8 assay. b The expression levels of p-PERK, p-EIF2α, p-IRE1α, XBP1s, ATF4, and CHOP in primary microglia were detected by Western blotting using specific antibodies. Each blot is representative of three experiments. c Phosphorylated levels of PERK, EIF2α, and IRE1α were quantified and normalized to corresponding total levels. d The expression levels of XBP1s, ATF4, and CHOP were quantified and normalized to GAPDH levels. e Cells were stained with p-IRE1α and CHOP antibodies. p-IRE1α-immunopositive (green) and CHOP-immunopositive (red) expression in primary microglia was observed using confocal scanning. Blue staining represents DAPI. Scale bar, 200 μm. f, g Quantitative data of the mean intensity of p-IRE1α and CHOP fluorescence in primary microglia. Each value was then expressed relative to that of the naïve group, which was set to 100. All experiments were repeated three times. P < 0.05, *P < 0.01 vs. naïve group. The data are presented as the mean ± SEM In light of our findings in vivo, we first investigated whether low doses of TM could also activate a mild UPR in primary cultured microglia. Compared with the control group, doses of 0.5, 5, and 50 ng/ml TM increased the protein levels of p-IRE1α, XBP1s, p-PERK, and p-EIF2α (Fig. 7b, c). It is worth noting that TM at 50 ng/ml triggered a robust UPR as evident by the significant increase in the protein levels of ATF4 and CHOP, while TM at 0.5 and 5 ng/ml had no significant influence on the expression levels of ATF4 and CHOP (Fig. 7d). Similar results were also observed in the immunofluorescence assay (Fig. 7e). Immunofluorescent analysis showed that TM (0.5, 5, and 50 ng/ml) induced an increase in p-IRE1α expression that was significantly higher than that in the control group (Fig. 7f). CHOP expression was not altered in primary cultured microglia treated with TM at 0.5 or 5 ng/ml. Interestingly, 50 ng/ml TM promoted the expression of CHOP (Fig. 7g). These results demonstrated that low doses of TM (0.5 and 5 ng/ml) could also cause nontoxic, mild ER stress in primary cultured microglia. Mild ER stress inhibited cytokine production and promoted M2a polarization in primary cultured microglia To validate the in vivo findings, we tested whether mild ER stress-mediated neuroprotection is effective in vitro. According to the results above, we chose a dose of TM (5 ng/ml) to induce mild ER stress in microglia. TM inhibited proinflammatory cytokine production in primary cultured microglia Microglia were treated with TM for 1 h followed by LPS (10 ng/ml) stimulation for 24 h, and the proinflammatory cytokine levels were analyzed by ELISA. As the results show in Fig. 8a, at 24 h after LPS administration, no visible alterations in cell viability were detected by CCK-8. However, LPS triggered increases in the IL-1β, IL-6, and TNF-α levels, which could be partially reversed by 5 ng/ml TM (Fig. 8b–d). These results suggested that TM protected microglia from LPS stimulation. Mild ER stress inhibits proinflammatory cytokine production in primary cultured microglia. a Primary cultured microglia were subjected to LPS and TM and treated with the indicated dosage of 4-PBA. After 24 h of treatment, cell viability was determined using CCK-8. b–d The levels of the proinflammatory factors TNF-α, IL-6, and IL-1β were detected by ELISA. The data are representative of three independent experiments. P < 0.05, *P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM TM induced microglial changes in polarization from M1/2b to M2a To further confirm the effects of TM on the phenotype changes of primary microglia, markers corresponding to the different microglia phenotypes were tested. LPS increased the expression of M1 markers (CD86, CD32, iNOS) and the immunomodulatory M2b marker SOCS3 and caused a decrease in the expression of M2a-repair/regeneration markers (YM1/2 and CD206). Pretreatment with TM (5 ng/ml) for 1 h can effectively shift the phenotypes of microglia towards M2a (Fig. 9a–f). In addition, microglia were labeled with iNOS (a typical M1 marker) and CD206 (a typical M2a marker) by immunofluorescence and Western blot analysis, which also confirmed the phenotype changes in the primary microglia in response to TM treatment. As the results in Fig. 10a–d, TM preconditioning decreased iNOS expression and increased of CD206 expression compared to the LPS group. These data indicated that TM reversed the LPS-induced imbalance of microglial M1/M2 polarization. Mild ER stress induces microglial changes in polarization from M1/2b to M2a. a–c Expression levels of M1 phenotype markers (CD86, CD32, and iNOS). d, e Expression levels of M2a phenotype markers (YM1/2 and CD206). f Expression levels of SOCS3, a marker for the M2b phenotype. The expression levels of iNOS, CD206, p-IRE1α, and XBP1s were detected by Western blotting using specific antibodies in the primary microglia. Each blot is representative of three experiments. g, h, i Expression of p-IRE1α was quantified and normalized to t-IRE1α levels, and the expression levels of iNOS, CD206, and XBP1s were quantified and normalized to GAPDH levels. Each value is expressed relative to that in the control group, which was set to 100. All experiments were repeated three times. P < 0.05, *P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM Mild ER stress contributed to M2a polarization of microglia. a, b Cells were stained with an iNOS or CD206 antibody as indicated. Blue staining represents DAPI. Scale bar, 200 μm. c, d Quantitative data of the mean intensity of iNOS and CD206 fluorescence in primary microglia. Each value is expressed relative to that in the control group, which was set to 100. All experiments were repeated three times. P < 0.05, **P < 0.01 vs. naïve group. #P < 0.05, ##P < 0.01 vs. LPS treatment group. ^P < 0.05, ^^P < 0.01 vs. TM treatment group. The data are presented as the mean ± SEM 4-PBA impaired the anti-inflammatory effects and M2a differentiation conferred by TM Next, we examined whether TM-mediated M2a differentiation and anti-inflammatory response in LPS-stimulated microglia required mild ER stress. To achieve this goal, we blocked ER stress using 4-PBA. Microglia were first subjected to TM (5 ng/ml) with or without 4-PBA at the indicated concentrations for 1 h followed by stimulation with LPS (10 ng/ml) for 24 h. As shown in Fig. 8a, our results indicated that 4-PBA (< 1500 μM) in the presence of TM (5 ng/ml) and 10 ng/ml LPS exerted no obvious toxic effects on microglia. Therefore, we chose the dose of 150 μM 4-PBA to manipulate the UPR in microglia. Microglia were pre-treated with 4-PBA (150 μM) and TM (5 ng/ml) for 1 h. Cells were then treated with LPS for 24 h. As shown in Fig. 9g, the effects of 4-PBA against mild ER stress were efficient as it strongly reduced p-IRE1α and XBP1s protein expression compared with that in non-PBA treated cells (Fig. 9g–i). Similar to the results in vivo, 4-PBA almost completely blocked the TM-mediated anti-inflammatory effects and M2a differentiation (Figs. 8b–d and 9a–f). We wondered whether this effect of 4-PBA resulted from the induction of cell toxicity. Using CCK-8 assays, we ruled out this possibility because co-incubation with 4-PBA (150 μM), TM (5 ng/ml), and LPS (10 ng/ml) for 24 h did not significantly affect cell viability (Fig. 8a). Altogether, these results demonstrate that mild ER stress is required for TM-mediated protection in primary cultured microglia. With the increased life expectancy in recent decades, neurodegenerative diseases have become a large health and economic burden. Neuroinflammation has emerged as a prominent component in the pathology of many neurodegenerative diseases, including AD and PD [1, 2]. Although there are many active efforts to understand the mechanisms responsible for neuroinflammatory regulation in neurodegenerative diseases, the mechanisms underlying how neuroinflammation in the central nervous system (CNS) is regulated have not been identified. In the present study, we showed that mild ER stress played a key role in regulating neuroinflammation in the CNS. The occurrence of ER stress in CNS may represent (1) a mild and pro-survival response which can engage adaptive stress signaling events and re-establish protein homeostasis, (2) a severe and irreversible damaging process triggering neuronal damage, or (3) a late epiphenomenon due to irreversible and untreatable alterations in homeostasis [42]. ER stress engages a signal transduction pathway called the unfolded protein responses (UPR). The mammalian cell senses the accumulation of unfolded proteins by three key ER resident proximal sensors including PERK, IRE1α, and ATF6 [10, 40]. Much of our understanding of the UPR, including its role and regulation in neuroinflammation, comes from studies that utilize severe pharmacological perturbation of experimental animals or cultured cells. However, these studies almost certainly fail to recapitulate the UPR as it is elicited under the conditions of milder ER stress that could be encountered physiologically. It is becoming clear that the UPR activation can either enhance or reduce neuroinflammation and sometimes may even have opposing effects on pathological conditions depending upon the extent of ER stress [7, 23, 24]. Thus, one of the fundamental questions of the UPR is whether the response can allow experimental animals to adapt to neuroinflammation and escape neuroinflammation-induced memory deficiency. In the present investigation, we found that ER stress inducer TM at a low dosage produced mild perturbations of ER function and led to a modest UPR. Despite this modest effect, a high concentration of TM caused serious ER perturbation and a robust UPR. Our data demonstrated that activation of a moderate UPR did not induce microglia or hippocampal lethality but rather promoted an adaptive response that protected against LPS-stimulated neuroinflammation and memory deficiency. 4-PBA, a compound that alleviates ER stress, counteracted the neuroprotection of TM; this activity also supported a protective role of mild UPR against neuroinflammation. One possible mechanism to explain neuroprotection during mild ER stress would be selective activation of one or more of the proximal sensors of ER stress. The ER sensor proteins including PERK and IRE1α are responsible for both the adaptive and the proapoptotic pathways of UPR. In a recent study, it was shown that moderate activation of the PERK–EIF2α pathway provides cell survival signals, possibly via a reduction in the load of unfolded proteins in the ER [19]. Furthermore, the spliced form of XBP1 was previously shown to prevent β-amyloid neurotoxicity [17, 18], suggesting that selective activation of the IRE1α-XBP1s arm of the UPR may decrease the progression of AD. To pursue this idea, we monitored the activation of IRE1α-XBP1s, and PERK-eIF2α signaling in response to varying concentrations of TM. However, our data supported the notion that both high and low concentrations of TM activated PERK and IRE1α pathways and that selective activation of proximal stress signaling molecules was not required for neuroprotection. Another way in which neuroprotection could be favored as an outcome is if a mild UPR diverges from a severe UPR in the expression of downstream genes. A paradox of the UPR is that the response leads to the simultaneous activation of both protective and pro-apoptotic pathways. The best characterized of these pro-apoptotic pathways is production of the CHOP, which is regulated by ATF4 [43]. To test this hypothesis, we performed TUNEL assay to determine the extent of apoptosis, and monitored the expression of ATF4 and CHOP protein, in response to varying concentrations of TM. For TM treatment, we found that, although low concentrations of TM resulted in the induction of the PERK–EIF2α/IRE1-XBP1pathway, ATF4/CHOP upregulation was lost by 24 h of treatment under conditions that the UPR allowed for neuroprotection, but not at higher concentrations that promoted neuroinflammation and apoptosis. We demonstrated that protection to neuroinflammation was an intrinsic consequence of nontoxic, mild activation of the UPR in rat hippocampus and primary microglia, and was accompanied by changes in the expression of downstream proteins that were qualitatively distinct from the UPR as induced by severe ER stress. These data are consistent with the notion that the proximal sensors of ER stress are activated by mild ER stress, but that there is a divergence in the expression of downstream proteins depending upon whether the outcome is protective or apoptosis. Mild ER stress-mediated protective effects can be assimilated as pre-conditioning or an adaptive stress response, also termed hormesis. Hormesis refers to a biological protective response induced by a low (or mild) exposure of toxins and other stressors [25, 27]. Conditions that stimulate hormesis can allow an organism or cell to better respond to a high dose of a second stimulus [23]. In medicine, quick cycles of myocardial ischemic preconditioning prepare the heart before surgery. Several studies have proposed that mild ER stress also induces a hormetic response called ER hormesis [12, 22]. This concept has also been applied to the medical field. Previous studies found that pharmacological pretreatment with a nonlethal dose of ER inducers promoted neuroprotection in Drosophila and mouse models of Parkinson’s disease [15]. Preconditioning with low levels of ER stress alleviated spinal cord injury [44, 45], brain inflammation [46, 47], and brain ischemia/reperfusion [46, 47]. Our work is an example of ER-mediated hormesis (or ER hormesis) too. When the ER stress sensed by the cell in the CNS is milder, the overall level of activation of the UPR is considerably less. Because ATF4 and CHOP are quite unstable at both the mRNA and protein levels, changes in the expression of these proteins are necessarily short-lived in the absence of a positively robust ER stress signal. Therefore, mild perturbations of ER function may actually promote a hormetic mechanism of protection against subsequent and stronger pathological stimuli in the long term. Nevertheless, when the ER stress is robust and persistent, ER hormetic adaptive mechanisms is insufficient to thwart the pro-apoptotic program. CHOP, an important proapoptotic protein in its own right, and also presumably a sentinel for the activation of pro-apoptotic cascades in general, is expressed at levels too high to be downregulated, and ER-related neurotoxicity occurs as a consequence. However, the molecular mechanisms that facilitate the switch from protection to impairment are still poorly understood. As cells that populate the parenchyma of the CNS, microglia can constantly sense the extracellular environment. Activation of microglia has been demonstrated to be an early sign that often precedes and triggers further neuroinflammatory processes leading to the exacerbation of neurotoxicity in neurodegenerative diseases [3, 4]. Microglia can exert dual effects dependent on their intrinsic properties, interaction with environmental pathogenic factors, and composition of the cellular microenvironment. Microglia can be characterized into three main states: a classical “M1” reactive phenotype with neurotoxic properties, an alternative “M2a” phenotype with an alternate activation that is involved in repair and regeneration, and an M2b phenotype with immunoregulatory activity [41]. Cell differentiation entails an increase in protein synthesis that primes cells for ER stress and UPR activation. Thus, ER stress contributes to cell differentiation, such as CD8+ T cells, plasma cell, and B lymphocyte [7]. Although the underlying mechanisms still require systematic investigation, our initial results described here indicated that mild ER stress induced M2a microglial differentiation. Considering the contribution of the M2a phenotype to neuroprotection, shifting differentiated microglia from the M1/2b towards M2a phenotype via mild ER stress represents a novel therapeutic approach to treating neurodegenerative diseases and cognitive impairment. Perhaps the most illuminating result of our work is that it suggests a rationale to explain how the ER stress can be a predominantly protective pathway under certain circumstances. The central feature of a protective response to ER stress appears to be maintenance of expression of proteins that facilitate survival, without persistence of pro-apoptotic proteins such as CHOP and ATF4 [14]. In summary, our results suggested that preconditioning with low levels of ER stress (i.e., exposure to nonlethal doses of pharmacological ER stressors such as TM) alleviated LPS-induced neuroinflammation and cognitive impairment. Our study proposed a new therapeutic possibility to trigger and maintain ER stress at a moderate level such that the stress response protects against or suspends the onset of neurodegenerative diseases or delays disease progression. Our study might provide not only advanced understanding of the actions of ER stress in neurodegeneration but also a rationale to define a novel target for neurodegeneration. Of course, there are many questions that need to be addressed in future studies. An amendment to this paper has been published and can be accessed via the original article. 4-PBA: ATF: Activating transcription factor cck8: The Cell Counting Kit-8 CHOP: CCAAT/enhancer-binding protein-homologous protein CNS: DAPI: Fluoroshield mounting medium with 4,6-diamidino-2-phenylindole DMSO: EIF2α: Eukaryotic translation initiation factor 2α ELISA: ER stress: Endoplasmic reticulum stress Intraperitoneally FCS: Fetal calf serum icv: Intracerebroventricular injection Interleukin-1β iNOS: IRE1α: Inositol-requiring protein 1α MS: PERK: Total protein kinase RNA-like ER kinase PMSF: Phenylmethylsulfonylfluoride PrDs: Prion-related diseases TBST: Tris-buffered saline with Tween 20 TFC: Trace fear conditioning Tumor necrosis factor-α UPR: The unfolded protein response XBP1s: Spliced X-box-binding protein-1 Ransohoff RM. How neuroinflammation contributes to neurodegeneration. Science (New York, NY). 2016;353:777–83. Frank-Cannon TC, Alto LT, McAlpine FE, Tansey MG. Does neuroinflammation fan the flame in neurodegenerative diseases? Mol Neurodegener. 2009;4:47. von Bernhardi R, Eugenin-von Bernhardi L, Eugenin J. Microglial cell dysregulation in brain aging and neurodegeneration. Front Aging Neurosci. 2015;7:124. Neumann H, Kotter MR, Franklin RJM. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain. 2009;132:288–95. Pintado C, Gavilan MP, Gavilan E, Garcia-Cuervo L, Gutierrez A, Vitorica J, Castano A, Rios RM, Ruano D. Lipopolysaccharide-induced neuroinflammation leads to the accumulation of ubiquitinated proteins and increases susceptibility to neurodegeneration induced by proteasome inhibition in rat hippocampus. J Neuroinflamm. 2012;9:87. Qin L, Wu X, Block ML, Liu Y, Breese GR, Hong J, Knapp DJ, Crews FT. Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration. Glia. 2007;55(5):453–62. Wang M, Kaufman RJ. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature. 2016;529:326–35. Nakka VP, Prakash-Babu P, Vemuganti R. Crosstalk between endoplasmic reticulum stress, oxidative stress, and autophagy: potential therapeutic targets for acute CNS injuries. Mol Neurobiol. 2016;53:532–44. Hetz C, Martinon F, Rodriguez D, Glimcher LH. The unfolded protein response: integrating stress signals through the stress sensor IRE1. Physiol Rev. 2011;91:1219–43. Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science (New York, NY). 2011;334:1081–6. Hetz C, Chevet E, Oakes SA. Proteostasis control by the unfolded protein response. Nat Cell Biol. 2015;17:829–38. Hetz C, Mollereau B. Disturbance of endoplasmic reticulum proteostasis in neurodegenerative diseases. Nat Rev Neurosci. 2014;15:233–49. Braakman I, Bulleid NJ. Protein folding and modification in the mammalian endoplasmic reticulum. Annu Rev Biochem. 2011;80:71–99. Wang S, Kaufman RJ. The impact of the unfolded protein response on human disease. J Cell Biol. 2012;197:857–67. Fouillet A, Levet C, Virgone A, Robin M, Dourlen P, Rieusset J, Belaidi E, Ovize M, Touret M, Nataf S, Mollereau B. ER stress inhibits neuronal death by promoting autophagy. Autophagy. 2014;8:915–26. Valdés P, Mercado G, Vidal RL, Molina C, Parsons G, Court FA, Martinez A, Galleguillos D, Armentano D, Schneider BL, Hetz C. Control of dopaminergic neuron survival by the unfolded protein response transcription factor XBP1. P Natl Acad Sci USA. 2014;111:6804–9. Mercado G, Castillo V, Vidal R, Hetz C. ER proteostasis disturbances in Parkinson’s disease: novel insights. Front Aging Neurosci. 2015;7:39. Casas-Tinto S, Zhang Y, Sanchez-Garcia J, Gomez-Velazquez M, Rincon-Limas DE, Fernandez-Funez P. The ER stress factor XBP1s prevents amyloid-beta neurotoxicity. Hum Mol Genet. 2011;20:2144–60. Lourenco MV, Clarke JR, Frozza RL, Bomfim TR, Forny-Germano L, Batista AF, Sathler LB, Brito-Moreira J, Amaral OB, Silva CA, et al. TNF-alpha mediates PKR-dependent memory impairment and brain IRS-1 inhibition induced by Alzheimer’s beta-amyloid oligomers in mice and monkeys. Cell Metab. 2013;18:831–43. Saxena S, Cabuy E, Caroni P. A role for motoneuron subtype-selective ER stress in disease manifestations of FALS mice. Nat Neurosci. 2009;12:627–36. Wang L, Popko B, Roos RP. The unfolded protein response in familial amyotrophic lateral sclerosis. Hum Mol Genet. 2011;20:1008–15. Matus S, Castillo K, Hetz C. Hormesis. Autophagy. 2014;8:997–1001. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol. 2007;8:519–29. Tabas I, Ron D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat Cell Biol. 2011;13:184–90. Martins I, Galluzzi L, Kroemer G. Hormesis, cell death and aging. Aging. 2011;3:821–8. Calabrese EJ. Hormesis. Why it is important to toxicology and toxicologists. Environ Toxicol Chem. 2008;27:1451–74. Mattson MP. Hormesis defined. Ageing Res Rev. 2008;7:1–7. Zhang X, Yuan Y, Jiang L, Zhang J, Gao J, Shen Z, Zheng Y, Deng T, Yan H, Li W, et al. Endoplasmic reticulum stress induced by tunicamycin and thapsigargin protects against transient ischemic brain injury. Autophagy. 2014;10:1801–13. Sun J, Zhang S, Zhang X, Zhang X, Dong H, Qian Y. IL-17A is implicated in lipopolysaccharide-induced neuroinflammation and cognitive impairment in aged rats via microglial activation. J Neuroinflamm. 2015;12:165–77. Zhang X, Dong H, Li N, Zhang S, Sun J, Zhang S, Qian Y. Activated brain mast cells contribute to postoperative cognitive dysfunction by evoking microglia activation and neuronal apoptosis. J Neuroinflamm. 2016;13:127–42. Paxinos G, Watson C. The rat brain in stereotaxic coordinates. Orlando, Florida: Academic Press, Inc; 1986. p. 32887. Obukuro K, Nobunaga M, Takigawa M, Morioka H, Hisatsune A, Isohama Y, Shimokawa H, Tsutsui M, Katsuki H. Nitric oxide mediates selective degeneration of hypothalamic orexin neurons through dysfunction of protein disulfide isomerase. J Neurosci. 2013;33:12557–68. Wang H, Wang X, Ke Z, Comer AL, Xu M, Frank JA, Zhang Z, Shi X, Luo J. Tunicamycin-induced unfolded protein response in the developing mouse brain. Toxicol Appl Pharm. 2015;283:157–67. Leaver DD, Schneider KM, Rand MJ, Anderson RM, Gage PW, Malbon R. The neurotoxicity of tunicamycin. Toxicology. 1988;49:179–87. Fan Zhou WZJZ. Involvement of endoplasmic reticulum stress in formalin-induced pain is attenuated by 4-phenylbutyric acid. J Pain Res. 2017;10:653–62. Inceoglu B. BATD. Endoplasmic reticulum stress in the peripheral nervous system is a significant driver of neuropathic pain. P Natl Acad Sci USA. 2015;112:9082–7. Nasoohi S, Hemmati AA, Moradi F, Ahmadiani A. The gamma-secretase blocker DAPT impairs recovery from lipopolysaccharide-induced inflammation in rat brain. Neuroscience. 2012;210:99–109. Arai K, Matsuki N, Ikegaya Y, Nishiyama N. Deterioration of spatial learning performances in lipopolysaccharide-treated mice. Jpn J Pharmacol. 2001;87:195–201. Thery C, Chamak B, Mallat M. Cytotoxic effect of brain macrophages on developing neurons. Eur J Neurosci. 1991;3:1155–64. Gardner BM, Pincus D, Gotthardt K, Gallagher CM, Walter P. Endoplasmic reticulum stress sensing in the unfolded protein response. Csh Perspect Biol. 2013;5:a13169. Tang Y, Le W. Differential roles of M1 and M2 microglia in neurodegenerative diseases. Mol Neurobiol. 2016;53:1181–94. Rutkowski DT, Arnold SM, Miller CN, Wu J, Li J, Gunnison KM, Mori K, Sadighi Akha AA, Raden D, Kaufman RJ. Adaptation to ER stress is mediated by differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins. PLoS Biol. 2006;4:2024–41. Valenzuela V, Collyer E, Armentano D, Parsons GB, Court FA, Hetz C. Activation of the unfolded protein response enhances motor recovery after spinal cord injury. Cell Death Dis. 2012;3:e272. Ohri SS, Hetman M, Whittemore SR. Restoring endoplasmic reticulum homeostasis improves functional recovery after spinal cord injury. Neurobiol Dis. 2013;58:29–37. Ibuki T, Yamasaki Y, Mizuguchi H, Sokabe M. Protective effects of XBP1 against oxygen and glucose deprivation/reoxygenation injury in rat primary hippocampal neurons. Neurosci Lett. 2012;518:45–8. Hosoi T, Noguchi J, Takakuwa M, Honda M, Okuma Y, Nomura Y, Ozawa K. Inhibition of inducible nitric oxide synthase and interleukin-1β expression by tunicamycin in cultured glial cells exposed to lipopolysaccharide. Brain Res. 2014;1558:11–7. We would like to thank Dr Leting Zhou from Southeast University for his kind help of revising our manuscript. This project was funded by the National Natural Science Foundation of China (No. 81270429, 81471410), a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and Postgraduate Research & Practice Innovation Program of Jiangsu Province(KYCX17_1250 and KYCX17_0173). The datasets supporting the conclusions of this article are included within the article and its additional files. All material used in this manuscript will be made available to researchers subject to confidentiality. Department of Anesthesiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu, 210029, People’s Republic of China Yi-wei Wang, Qin Zhou, Qing-qing Qian, Jia-wen Xu, Peng-fei Ni & Yan-ning Qian Department of Anesthesiology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 200080, People’s Republic of China Xiang Zhang Yi-wei Wang Qin Zhou Qing-qing Qian Jia-wen Xu Peng-fei Ni Yan-ning Qian YW, QZ, JX, QQ, and PN performed the experiments; YW, XZ, and YQ designed the study; and YW wrote the manuscript. All authors read and approved the final manuscript. Correspondence to Yan-ning Qian. The experiments were approved by the Nanjing Medical University Institutional Animal Care and Use Committee (IACUC-14030126), and the experiments were performed according to the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health of the United States. Supplemental materials and methods. (DOCX 24 kb) 4-PBA (100 mg/kg) had no neurotoxicity and proinflammatory effect in healthy rats. (DOC 621 kb) Wang, Yw., Zhou, Q., Zhang, X. et al. Mild endoplasmic reticulum stress ameliorates lipopolysaccharide-induced neuroinflammation and cognitive impairment via regulation of microglial polarization. J Neuroinflammation 14, 233 (2017). https://doi.org/10.1186/s12974-017-1002-7	cc/2021-04/en_middle_0039.json.gz/line916
__label__wiki	0.64924	0.64924	TDP-43 mediated blood-brain barrier permeability and leukocyte infiltration promote neurodegeneration in a low-grade systemic inflammation mouse model Frank Zamudio1,2,3, Anjanet R. Loon1,2, Shayna Smeltzer1,2, Khawla Benyamine1,2, Nanda K. Navalpur Shanmugam3, Nicholas J. F. Stewart1,2, Daniel C. Lee1,2,5, Kevin Nash1,4 & Maj-Linda B. Selenica ORCID: orcid.org/0000-0001-9570-81721,2,5 Neuronal cytoplasmic inclusions containing TAR DNA-binding protein 43 (TDP-43) are a neuropathological feature of several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer’s Disease (AD). Emerging evidence also indicates that systemic inflammation may be a contributor to the pathology progression of these neurodegenerative diseases. To investigate the role of systemic inflammation in the progression of neuronal TDP-43 pathology, AAV9 particles driven by the UCHL1 promoter were delivered to the frontal cortex of wild-type aged mice via intracranial injections to overexpress TDP-43 or green fluorescent protein (GFP) in corticospinal motor neurons. Animals were then subjected to a low-dose (500 μg/kg) intraperitoneal E. coli lipopolysaccharide (LPS) administration challenge for 2 weeks to mimic a chronically altered low-grade systemic inflammatory state. Mice were then subjected to neurobehavioral studies, followed by biochemical and immunohistochemical analyses of the brain tissue. In the present study, we report that elevated neuronal TDP-43 levels induced microglial and astrocytic activation in the cortex of injected mice followed by increased RANTES signaling. Moreover, overexpression of TDP-43 exerted abundant mouse immunoglobulin G (IgG), CD3, and CD4+ T cell infiltration as well as endothelial and pericyte activation suggesting increased blood-brain barrier permeability. The BBB permeability in TDP-43 overexpressing brains yielded the frontal cortex vulnerable to the systemic inflammatory response following LPS treatment, leading to marked neutrophil infiltration, neuronal loss, reduced synaptosome-associated protein 25 (SNAP-25) levels, and behavioral impairments in the radial arm water maze (RAWM) task. These results reveal a novel role for TDP-43 in BBB permeability and leukocyte recruitment, indicating complex intermolecular interactions between an altered systemic inflammatory state and pathologically prone TDP-43 protein to promote disease progression. TAR (transactive response) DNA-binding protein 43 kDa (TDP-43), encoded by the TARDBP gene, is a 43-kDa nuclear protein that belongs to the heterogeneous nuclear ribonucleoproteins (hnRNPs) family that binds RNA [1]. Several studies have shown the diverse transcription regulation functions of TDP-43, as it is abundantly expressed in nearly all tissues [2]. For example, TDP-43 can regulate gene expression of proteins through mRNA stabilization such as histone deacetylase 6 (HDAC6), Tbc1d1, acrosomal protein SP10, and various synaptic proteins, thus indirectly targeting several cellular pathways that affect cell survival, mitochondrial function, metabolism, and synaptic function depending on where TDP-43 is expressed [3,4,5,6]. In 2006, TDP-43 emerged as a prime component of ubiquitinated, insoluble inclusions found in the brains of patients diagnosed with amyotrophic lateral sclerosis (ALS), a progressive motor syndrome that causes muscle weakness and atrophy, and frontotemporal dementia (FTD), a disease involving a variety of cases with behavioral and language impairment that is often accompanied by atrophy of the frontal and temporal lobes [7, 8]. In support, increased brain atrophy has been found in patients that present with both ALS and FTD [9]. Further, elevated TDP-43 levels have been reported in the CSF of FTD and ALS patients [10]. And most recently, intracellular inclusions consisting of TDP-43 have been found in 57% of Alzheimer’s disease (AD) cases studied, further highlighting the importance of pathological TDP-43 in the progression of a range of neurological diseases [11]. Notably, many patients suffering from neurological disorders present a persistently heightened systemic inflammatory state referred to as low-grade systemic inflammation which is a risk factor for morbidity and mortality in the elderly [12]. Older patients with dementia, and even old individuals without dementia, experience low-grade systemic inflammation characterized by increased high-sensitivity C-reactive protein (hs-CRP) levels associated with increased cognitive decline [13]. A study by Miller et al. showed an increased prevalence of the non-thyroid autoimmune disease in patients diagnosed as frontotemporal dementia with motor neuron disease and symptomatic C9ORF72 mutation carriers [14]. High levels of wide-range CRP and fibrinogen, as well as increased erythrocyte sedimentation rate and neutrophil-to-lymphocyte values, were detected in ALS and its presence correlates with a negative prognosis [15]. ALS blood samples also consistently portray changes in systemic inflammatory markers (i.e., IFN-λ, IL-2, IL-8) and peripheral cell populations (lymphocytes and monocytes) [16,17,18]. Further linking an interaction of systemic inflammation and neurodegenerative disease, epidemiological studies support the idea of an intrinsically altered immune system in ALS and FTD patients, since diagnoses are often associated with a previous diagnosis of an autoimmune disorder [19]. Combined, these data warrant investigation on how alterations in the systemic inflammatory response, if unchecked, can influence neuroinflammation and affect disease symptoms, especially to disease-associated proteins. For example, in several mouse models of Alzheimer’s disease, E. coli lipopolysaccharides (LPS)-induced inflammation can exacerbate pathological accumulation of disease-associated proteins, including tau and β-amyloid [20, 21]. Moreover, inflammatory agents such as LPS and tumor necrosis factor (TNF-α) have been found to induce the cytoplasmic accumulation and aggregation of TDP-43, altering its localization and function, ultimately causing cell death in cell culture and spinal cords of transgenic TDP-43 A315T mice [22]. TDP-43 can also become extracellular through DnaJ/Hsc70 complexes and through exosomes which can either allow its clearance or exacerbate spreading [23, 24]. Although TDP-43 is linked to several diseases that present an altered systemic inflammatory response (i.e., ALS, FTD, AD), the relationship between the two has not been fully explored. Here, we investigate the effect of chronic low-grade systemic inflammation, using E. coli LPS, in the progression of TDP-43 proteinopathies in neurons of the frontal cortex, a brain region affected by many of these diseases. Through neurobehavioral, biochemical, and histochemical assessments, our findings suggest that elevated TDP-43 levels render the brain vulnerable to the systemic immune response during inflammation by promoting BBB permeability and impairing components of the neurovascular unit. Virus preparation TDP-43 (FLAG-tagged) or GFP were cloned into the Hind III and Sac I sites of the rAAV vector pTR-MCS under the control of the ubiquitin carboxy-terminal hydrolase L1 (UCHL1) promoter. rAAV serotype 9 viruses were generated using pAAV9 and pXX6 in Hek293 cells as described previously [25]. Animals and stereotaxic intracranial AAV injection procedure Wild-type mice (equally stratified for sex, male vs. female) were bred in the vivarium of the Byrd Alzheimer's Institute, USF Health. The injection procedure was performed using the convection-enhanced delivery method as described previously [25]. Briefly, mice were anesthetized with 1.5% isoflurane and ketamine (90–150 mg/kg)/xylazine (5–10 mg/kg) in 100% oxygen, then secured into a stereotaxic apparatus. The coordinates of injection into the cortex were as follows: anteroposterior, + 2.2 mm; lateral, ± 1.7 mm, dorsoventral, − 3.0 mm, from bregma. A microsyringe injector and controller (Stoelting, Wood Dale, IL) were used to inject 2 μL of virus (2 × 1012 viral particles/mL) at a constant rate of 2.5 μL/min through a CED needle in each placement. The needle was kept in place for 1 min following the injection and then was raised slowly. Either rAAV9-GFP or rAAV9-TDP-43 under the UCHL1 promoter was injected bilaterally in the cortex of wild-type mice at 10.5 months (n = 6 mice/group). Virus transduction through anterior cortical layer V and IV neurons was determined based on cell type and boundaries of cortical layers I–VI following Allen Mouse Brain Atlas (Institute 2011) (Fig. 1b). This area was targeted during image acquisition for histology analyses. Schematic of experimental plan and analysis of viral expression in the frontal cortex of mice. a Schematic of experimental design involving intraperitoneal (I.P.) saline or LPS treatment in this study. b Representative images of the virus spreading for the study. Hoechst staining represents nuclear labeling. Scale bar = 1000 μm. c Percent area positively stained for GFP in the frontal cortex. d Percent area positively stained for FLAG in the frontal cortex Animal procedures were performed in accordance with the recommendations of the National Research Council’s “Guide for the Care and Use of Laboratory Animals” and were previously approved by the University of South Florida Institute of Animal Care and Use Committee (IACUC). Mouse intraperitoneal (i.p.) injection treatment To model low-grade systemic inflammation, we challenged the mice with a modified E. coli lipopolysaccharide (LPS) treatment regime as previously published [26]. Briefly, 2 weeks prior to sacrifice, mice groups were given intraperitoneal (i.p) injections of E. coli lipopolysaccharides (LPS; 500 μg/kg) every 3 days. This way, four treatment groups were created: GFP AAV9 (i.p. saline), GFP AAV9 (i.p. LPS), TDP-43 AAV9 (i.p. saline), and TDP-43 AAV9 (i.p. LPS) (n = 6 mice/group). Mouse behavior Mouse behavior was performed during the last week of LPS treatment prior to sacrifice. All behavioral tests are blinded to genotype and treatment to the investigator. Rotarod Motor coordination and learning performance were assessed by placing mice onto an accelerating circular rod (Maze Engineers, Boston, MA, USA). The time until falling was recorded for each mouse. Mice were given four trials each day for 2 consecutive days. Performance in the first trial of day 1 serves as a measure of baseline locomotor coordination, whereas improvement in the latency to fall within each day (short-term learning) and between days (long-term learning) serve as measures of motor learning. Grip strength was measured using a grip strength meter (Harvard Apparatus, 76-1066, Holliston, MA, USA). Mice were held by the base of the tail and allowed to grasp the bar of the meter with their front or back paws. The mouse was then pulled gently backward away from the bar slowly to allow the mouse to develop a resistance against the pulling force. The peak force given by the meter was recorded from their front and back paw measurements. Radial arm water maze The radial arm water maze consists of a 1-m pool with six swim paths radiating out of an open central area, with a hidden escape platform located at the end of one of the arms. On each trial, the mouse was allowed to swim in the pool for up to 60 s to find the escape platform. Incorrect arm entries or failure to select an arm for 15 s were counted as errors. For a given mouse, the platform was located in the same arm on each trial, but the start arms were varied for each trial so that mice rely upon spatial cues to solve the task. On day 1, mice were given 15 trials, each block consisting of three trials (five blocks in total) alternating between a visible platform and a hidden platform. The following day, mice were given 15 additional trials (five blocks), all using a hidden platform. The goal arm location for sequential mice was different to avoid odor cues from revealing the goal arm. On the last day of testing, all animals were tested in the open pool task with a visible platform to ascertain their vision and ability to climb on the platform. To do so, the platform was elevated above the water surface and had an attached flag. Additionally, all visual cues were removed so that mice relied only on their sight to find the platform. Latency to find and ascend the platform was recorded (60 s maximum). Two months post intracerebral injection, mice were weighed, overdosed with a euthanizing solution containing pentobarbital, and perfused with 25 mL of 0.9% saline solution. Brains were collected following saline perfusion and were hemisected down the sagittal midline. One hemisphere was dissected and frozen on dry ice for biochemical studies. The second hemisphere was immersion fixed in 4% paraformaldehyde for 24 h and cryoprotected in successive incubations of 10%, 20%, and 30% solutions of sucrose for 24 h in each solution. Subsequently, the fixed hemispheres were frozen on a cold stage and sectioned in the horizontal plane (25 μm thickness) using a sliding microtome. Brain sections were stored in Dulbecco’s phosphate-buffered saline (DPBS) with 10 mM sodium azide solution at 4 °C for immunohistochemistry. Six sections, representative of the brain, were chosen for histochemical analyses. For bright-field microscopy, floating sections from all animals were placed in multi-sample staining trays, and endogenous peroxidase activity was blocked (10% methanol, 3% H2O2 in PBS, 15 min). Tissue samples were permeabilized (with 0.2% lysine, 1% Triton X-100 in PBS, 30 min) and incubated overnight in primary antibody for HRP-conjugated mouse IgG (Millipore, 1:1000), CD3 (AbD serotec; 1:10,000), CD4 (AbD serotec; 1:30,000), Ly6B.2 (Bio-Rad; 1:3000), or biotinylated NeuN (Millipore; 1:30,000). Sections were rinsed in PBS, then incubated in corresponding biotinylated secondary antibodies for 2 h. Sections incubated with biotinylated NeuN proceeded directly to the enzyme conjugation step. Following incubation, tissue sections were rinsed in PBS and incubated with Vectastain Elite ® ABC kit (Vector Laboratories Burlingame, CA, USA) for enzyme conjugation. Finally, sections were developed using 0.05% diaminobenzidine, 0.5% Ni++, and 0.03% H2O2. Tissue sections were then mounted onto slides, dehydrated, and cover-slipped. Each immunohistochemical stain omitted some sections from primary antibody incubation to evaluate the nonspecific reaction of the secondary antibody. NeuN slides were counterstained with 0.05% cresyl violet. For fluorescence microscopy, tissue sections were permeabilized as previously described, then incubated with the following primary antibodies overnight: FLAG (1:500, Sigma), TDP-43 (1:1000, ProteinTech), Iba1 (1:500, Wako), CD11b (1:500, Abcam), MHCII (BD Biosciences, 1:500), GFAP (1:500, Dako), and CD45 (1:500, Thermo Scientific). The next day, tissue sections were washed and placed in respective Alexa Fluor secondary antibodies (1:500, Invitrogen) for 2 h. Then, tissue sections were washed, mounted, and cover-slipped using ProLong Gold anti-fade reagent (Thermo Scientific) and counterstained with Hoechst 33342 where indicated. Prussian blue staining Tissue sections were mounted on slides and dried overnight. The next day, sections were rehydrated in distilled water for 30 s then incubated in a solution containing 2% concentrated HCl and 2% potassium ferrocyanide for 15 min. Thereafter, sections were rinsed two times in distilled water for 30 s followed by rinsing in tap water for 5 min. Finally, slides were dehydrated by dipping 8 times in 95% ethanol and 8 times through two changes in 100% ethanol and cleared in xylenes 3 times for 5 min followed by cover-slipping using DPX. Tissue imaging, quantification, and analysis Tissue sections stained for CD4 and NeuN were imaged using the Carl Zeiss AxioImager.Z1 microscope (Oberkochen, Germany) using a × 20 objective. Tissue sections stained for TDP-43, GFAP, Iba1, CD11b, and CD45 were imaged using the Zeiss LSM 880 (Oberkochen, Germany) at × 3 objective. GFAP, Iba1, CD11b, MHCII, and CD45 levels (integrated density) in tissue sections were quantified using ImageJ analysis software with six representative regions of interest per mouse (National Institutes of Health). To determine the levels of extranuclear TDP-43, × 63 images from brain sections stained with TDP-43 and DAPI were converted to 8-bit and processed by Gaussian blur to remove background (radius = 50). Then a mask was created using the DAPI channel and subtracted from the TDP-43 channel to remove the nuclear signal. Finally, integrated density values were calculated from these images using a threshold of positive staining that was kept constant throughout the analysis. The number of neurons stained with NeuN and cresyl violet in the frontal cortex of mice was counted manually by a blind investigator in at least six 300-μm regions of interest per mouse around the site of injection. Ly6B.2, CD3, and CD4+ cells were counted manually in whole-brain sections from at least six sections per mouse used as representative. The frontal cortex and hippocampus of mice were homogenized in ice-cold RIPA buffer and sonicated for 30 s. Thereafter, the tissue homogenate was centrifuged at 38,000×g for 30 min. The supernatant was used for biochemical analyses. The protein concentration of each sample was measured using BCA assay. To obtain insoluble TDP-43 fraction, pellets were washed in RIPA buffer to eliminate remaining soluble proteins and centrifuged at 100,000g for 30 min at 4 °C. Thereafter, the supernatant was discarded and urea buffer (7 M urea, 2 M thiourea, 4% CHAPS, 30 mM Tris, pH 8.5) was added to the pellet, sonicated, and centrifuged at 100,000g for 30 min at room temperature. Protein concentration was determined by Bradford assay. Lysates were separated by SDS-PAGE and transferred to a PVDF membrane. Human TDP-43 (Sigma), total TDP-43 (ProteinTech), GFAP (1:1000, Dako), PSD95 (1:1000, Millipore), SNAP-25 (1:1000, Abcam), SNAP-23 (1:1000, Synaptic Systems), Syntaxin-1A (1:1000, Cell Signaling), laminin (ab11575), ICAM1 (1:1000, R & D Systems), occludin (1:1000, Invitrogen), ZO-1 (1:1000, Invitrogen), claudin 5 (1:1000), VCAM (1:1000), caveolin (1:1000, Santa Cruz), CD13 (1:1000, Abcam), PDGFRβ (Abcam), GAPDH (1:5000, Abcam), and actin (1:5000, Abcam) levels were assessed by addition of primary antibodies, species-appropriate secondary antibodies (Southern Biotech, 1:1000 or LICOR IR Dye 680/800, 1:10,000), and exposed to ECL for chemiluminescent detection or imaged using a LICOR machine. Multiplex chemokine/cytokine assay The concentrations of eotaxin, IL-1α, Il-1β, IL-10, VEGF, MIP-1α, RANTES, and KC-GRO were measured using the mouse cytokine/chemokine panel in mouse frontal cortex tissue lysate (MILLIPLEX MAP kit; Millipore, Billerica, MA, USA). Briefly, the Bio-Plex Suspension Array System (Bio-Rad Laboratories) was calibrated using CAL2 with the high PMT setting of the Bio-Plex calibration kit, and standard sample preparation was performed according to the manufacturer’s directions. The filter plate was prewetted with wash buffer and vacuum-filtered before adding standard, control, or study samples to the appropriate wells. Mixed capture beads were then added to each well, and the plates were incubated overnight at 4 °C with shaking. After two washes, 25 μL of detection antibody was added to each well, incubated for 1 h at room temperature, and then treated with 25 μL of streptavidin-phycoerythrin for 30 min at room temperature. The plate was washed twice, and 150 μL of the Bio-Plex sheath fluid assay buffer was added to each well and read using the Bio-Plex Suspension Array System software (Bio-Rad Laboratories) per the kit instructions. The concentration of each analyte was calculated according to the standard curve. Statistical analyses Two-tailed Student’s t test, one-way ANOVA or two-way repeated-measures ANOVA with Fisher’s Least Significant Difference (LSD), and Tukey or Bonferroni’s post hoc tests were used as detailed in the figure legends. Values were considered significant if p < 0.05. Graphs were generated using GraphPad Prism 8.0 analysis software. N-value in this study is depicted as the number of animals and indicated in the figure legends. In vivo TDP-43 overexpression promotes the formation of insoluble inclusions To investigate the interaction between TDP-43 pathology and low-grade systemic inflammation, we used AAV-serotype 9 (AAV9) viruses to drive the overexpression of FLAG-tagged wild-type TDP-43 (TDP-43 AAV9) or GFP under the UCHL1 promoter in the frontal cortex 10.5-month-old wild-type mice for 2 months. UCHL1 is abundantly expressed in corticospinal motor neurons (CSMN) that become affected in TDP-43 proteinopathies which made its promoter ideal for our study [27,28,29]. Next, to model low-grade systemic inflammation, we further challenged the mice with a modified E. coli lipopolysaccharide (LPS) treatment regimen as described in the “Methods” section and Fig. 1a. LPS is an endotoxin frequently used to induce an immune response through toll-like receptor 4 (TLR4) binding and we surmised that a low LPS dose and spread out treatment plan would most resemble a chronic physiological inflammatory response [30]. After brain tissue collection, we confirmed the expression of our constructs by fluorescent GFP or FLAG signal combined with nuclear Hoechst staining. Further, utilization of Allen’s Brain Atlas (atlas.brain-map.org) allowed us to determine viral transduction throughout layers of the cortex (Fig. 1b). The quantification of the percent area positive for GFP or TDP-43 (FLAG) revealed that 15–20% of the frontal cortex was successfully transduced by the AAVs, mostly, throughout neuronal layers 5 and 6 (Fig. 1c, d). To characterize the TDP-43 pathology achieved by AAV overexpression, we analyzed RIPA-soluble and urea-soluble fractions from homogenized frontal cortices. Western blotting revealed soluble and insoluble FLAG-TDP-43 levels were significantly increased, confirming the expression and formation of pathology upon TDP-43 overexpression (Fig. 2a, b). Moreover, the ratio of urea-soluble to RIPA-soluble FLAG-TDP-43 increased in the frontal cortex of LPS-treated TDP-43 AAV9 mice (Fig. 2c). Interestingly, levels of both RIPA- and urea-soluble total TDP-43 remained unaltered between groups, as also demonstrated in the ratio analysis. Although TDP-43 can control its mRNA levels through a negative feedback loop when exogenously overexpressed [31], we found that total TDP43 levels were unchanged following TDP-43 AAV9 overexpression. To further investigate this finding, we performed immunohistochemistry against total TDP-43 (red channel) and measured the signal intensity in TDP-43 AAV9 mice compared to GFP AAV mice. By doing so, we found that TDP-43 overexpression, independent of the peripheral treatment, contributed to a significant increase in total TDP-43 levels (Fig. 2d, e). Immunohistochemical analyses also revealed that overexpression of TDP-43 led to a significant increase in inclusion formation outside of the nucleus, most likely cytoplasmic (white arrows). However, low-grade systemic inflammation did not alter the inclusion burden in the frontal cortex. Further, biochemical analyses revealed no changes in TDP-43 high-molecular-weight species or C-terminal fragments following low-grade systemic inflammation (Supplementary Fig. 1a, b). Additionally, we did not detect any appreciable levels of phosphorylated TDP-43 (pS403/404 and pS409/410) in our sample (data not shown), albeit phosphorylation may not necessarily be a sole factor of TDP-43 aggregation in inclusions [32]. TDP-43 overexpression leads to the formation of extranuclear inclusions. a Western blot of total soluble and insoluble TDP-43 levels in the mouse frontal cortex. b Quantification of total soluble and insoluble TDP-43 levels. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test. c Quantification of the insoluble/soluble total TDP-43 and TDP-43 ratio. d Representative images depicting TDP-43 localization (red channel), as observed by fluorescent immunostaining and multi-photon microscopy, in the frontal cortex of mouse brain tissue. Hoechst 33342 is used as a nuclear counterstain (blue channel). Scale bar = 20 μm. e Quantification of total TDP-43 and extranuclear TDP-43 normalized to GFP control. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.05) Low-grade systemic inflammation impairs spatial memory in mice affected by TDP-43 overexpression Various TDP-43 mouse models have reported muscle weakness, impaired motor learning, and deficits in learning and memory [33, 34]. We assessed our viral AAV9 mouse model with several behavioral tasks to ascertain their phenotype. Rotarod analysis revealed that TDP-43 overexpressing mice (regardless of LPS administration) performed similarly to GFP overexpressing littermates during the first day until the last trial, suggesting normal locomotor coordination and strength in all groups. However, mice overexpressing TDP-4 did not improve in their latency to fall from the rod on the second day, compared to control mice, indicating impaired motor learning following overexpression of TDP-43 (Fig. 3a). In support of a deficit in learning rather than coordination or strength, we also found no differences between GFP and TDP-43 AAV9 mice in grip strength (front and back legs) (Fig. 3b, c). Spatial learning and memory were assessed using the radial arm water maze, which revealed a learning impairment in TDP-43 AAV9 mice subjected to low-grade systemic inflammation (Fig. 3d, e). The LPS-treated TDP-43 AAV9 mice performed more errors in both days when compared to the LPS- (trials 3 and 4) and the saline-treated GFP AAV9 mice (trials 4, 8, and 9) (Fig. 3d). The saline-treated TDP-43 AAV9 mice also displayed a trend to more errors on day 1 of training (trials 2 and 4) but not in day 2, as compared to the saline-treated GFP AAV9 mice. No differences were observed between the saline and LPS-treated GFP AAV9 mice. Overall, LPS-treated TDP-43 AAV9 mice made significantly more errors in finding the platform in both days compared to the saline- and LPS-treated GFP AAV9 mice (Fig. 3e), indicating impaired spatial learning. However, long-term memory—assessed as the difference in the number of errors made on the last trial of day 1 and the first trial of day 2—did not statistically vary between groups, and all groups eventually achieved similar levels of learning, suggesting that the robust impairment is more likely in short-term memory processes such as those served by the prefrontal cortex. In contrast, saline-treated TDP-43 AAV9 did not make significantly more errors than the control mice. All groups showed no difference in latency of finding the visible platform in an open pool test, which indicated that the learning deficits were not attributed to visual or motor impairments (data not shown). Interestingly, LPS administration to GFP AAV9 mice did not influence spatial memory, suggesting a synergistic effect between TDP-43 pathology in the brain and low-grade systemic inflammation to affect spatial memory. Chronic low-grade systemic inflammation impairs spatial memory in TDP-43 overexpressing mice. a Time spent on the rotating rod. Statistical analysis was carried out using a repeated measures two-way ANOVA with Fisher’s least significant difference (LSD) post hoc test (n = 6 mice/group, p < 0.05 between GFP and TDP-43 regardless of i.p. treatment; #p < 0.05 between GFP-LPS against all other groups). b Grip strength of mice front paws performance. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 6 mice/group). c Grip strength of mice hind paws performance. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 6 mice/group). d Radial arm water maze performance. Statistical analysis was carried out using a repeated measures two-way ANOVA with Fisher’s least significant difference (LSD) post hoc test (n = 6 mice/group; p < 0.05 between GFP-LPS and TDP-43-LPS; #p < 0.05 between GFP-saline and TDP-43-LPS; and p < 0.05 between GFP-LPS and TDP-43-saline; ^p < 0.05 between GFP-saline and TDP-43-saline). e The total number of errors in the 2-day radial arm water maze. Statistical analysis was carried out using a two-way ANOVA with Fisher’s least significant difference (LSD) post hoc test (n = 6 mice/group; p < 0.05) TDP-43-induced neuronal loss is exacerbated by low-grade systemic inflammation Cognitive dysfunction is associated with neuronal loss and synaptic dysfunction [35, 36]. At sacrifice, the brains of LPS-treated TDP-43 AAV9 mice had significantly lower brain weights compared to controls, suggesting increased neurodegeneration (Fig. 4a). To determine the impact of TDP-43 overexpression and/or low-grade systemic inflammation on neuronal loss, we stained brain tissue sections with the neuronal marker NeuN, counterstained with cresyl violet, and performed stereological analyses. TDP-43 overexpression alone reduced the number of neurons in the frontal cortex of the mice and this effect was exacerbated by low-grade systemic inflammation (Fig. 4b, c). However, low-grade systemic inflammation in GFP AAV9 brains did not influence brain weight or neuronal count, suggesting that TDP-43 altered the susceptibility of the brain to the systemic inflammatory response. Next, since both TDP-43 [37,38,39] and LPS-mediated [40,41,42] neuroinflammation can alter the expression of synaptic markers that can lead to cognitive decline, we performed western blotting of several synaptic markers as a measure of synaptic dysfunction in frontal cortex lysates. While PSD95, synaptophysin, syntaxin 1-A, and SNAP-23 protein levels remain unaltered by TDP-43 overexpression alone or low-grade systemic inflammation, SNAP-25 expression levels were reduced by half in the brains of LPS-treated TDP-43 AAV9 mice (Fig. 4d, e). SNAP-25 is an essential component of N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complexes, which mediate synaptic communication through initiating fusion of synaptic vesicles [43]. Chronic low-grade systemic inflammation promotes neuronal loss and synaptic dysfunction in TDP-43 AAV9 mice. a Brain weights of mice during the sacrifice. b Representative images depicting the number of NeuN-positive neurons. Scale bar = 20 μm. c Quantification of neurons per field is analyzed in the frontal cortex of the mouse brain. Statistical analysis was carried out by one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.05). d Western blot analysis of synaptic markers in the frontal cortex of the mouse brain. e Quantification of synaptic markers. Statistical analysis was carried out by one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.05) TDP-43 overexpression induces astrogliosis and microgliosis Thus far, our data suggested that low-grade systemic inflammation can promote TDP-43-induced neurodegeneration, resulting in cognitive impairment. Given that the deregulation of TDP-43 can induce neuroinflammation and increase neuronal death through NF-κB signaling [28, 44], we decided to explore whether the observed effects were due to alterations in the NF-κB pathway. Our biochemical analysis demonstrated no changes in phosphorylation of NF-κB p65 or IKβα degradation within the confines of our study design (data not shown). Next, we explored the effects of systemic inflammation and/or TDP-43 overexpression in the brain in other aspects of neuroinflammation, including astrocytosis and microgliosis. Indeed, TDP-43 overexpression alone—and independent of LPS—increased astrocytic activation, as measured by increased GFAP staining intensity (Supplementary Figure 2A-B) and western blotting (Supplementary Figure 2C-D). However, neither TDP-43 overexpression nor LPS treatment altered aquaporin 4 levels, a marker for astrocytic end-feet (Supplementary Figure 2E). TDP-43 overexpression also led to marked increases in microgliosis, measured by several markers including Iba1, CD11b (Fig. 5a–c), MHCII (Fig. 5d, e), and CD45 (Fig. 5f, g). While both MHCII and CD45 markers can be expressed by microglia [45, 46], MHCII is highly expressed in dendritic cells and lymphocytes while CD45 is expressed in almost all hematopoietic cells [47,48,49]. Interestingly, staining for MHCII and CD45 was absent from GFP AAV9 brains and dramatically increased in TDP-43 AAV9 brains. Additionally, CD45 staining revealed that although activated microglial cells were present, other cells void of processes were highly abundant, indicating the possibility of peripheral cell infiltration. Surprisingly, low-grade systemic inflammation alone did not significantly alter astrocytosis or microgliosis. However, LPS-mediated neuroinflammation can vary dependent on the brain region, since we observed significant increases in inflammation-responsive proteins iNOS, RGS14, and phosphorylated CamKIIβ in hippocampal, but not frontal cortex, homogenates from mice in our study (Supplemental Figure 3A-B). TDP-43 overexpression increases microglial activation. a Double immunofluorescence depicting Iba1 (green pseudocolor) and CD11b (red channel) in the frontal cortex of mouse brain tissue. Scale bar = 20 μm. b Quantification of Iba1 levels. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.01, p < 0.001). c Quantification of CD11b levels. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.01, *p < 0.001). d Representative images depicting MHCII levels (red channel) in the frontal cortex of mouse brain tissue. Scale bar = 20 μm. e Quantification of MHCII levels. Statistical analysis was carried out using a one-way ANOVA with Tukey post hoc test (n = 4 mice/group; p < 0.01). f Representative images depicting CD45 expression in microglia and mononuclear cells in the frontal cortex of mouse tissue. Scale bar = 20 μm (microglia), 10 μm (mononuclear cells). g CD45 fluorescence levels in the mouse frontal cortex. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; *p < 0.001). Statistical analysis was carried out using one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group) TDP-43 overexpression promotes blood-brain barrier permeability Given the presence of mononuclear CD45-positive cells, we surmised that TDP-43 overexpression could induce peripheral cell infiltration. Therefore, brain tissue sections were labeled with CD3 and CD4 receptor antigens, both found in T lymphocytes. As suspected, TDP-43 overexpression, regardless of systemic inflammation, led to marked increases in CD3+ (Fig. 6a, b) and CD4+ (Fig. 6c, d) T lymphocyte infiltration, suggesting increased blood-brain barrier (BBB) permeability. The loss of BBB integrity was further confirmed by intense immunoglobulin G (IgG) staining along the frontal cortex of TDP-43 AAV9 mice, since the BBB restricts access of large molecules into the brain, let alone whole cells (Fig. 6e, f). IgG infiltration was also confirmed by western blotting using the same antibody. These effects were associated with increased endothelial cell activation markers, including ICAM1, VCAM, and caveolin 1 (Fig. 6,h). Moreover, TDP-43 overexpression also led to the presence of cerebral microbleeds, determined by Prussian blue staining (Fig. 6i, j). Pericyte activation, as measured by PDGFRβ levels, was also observed (Supplementary Figure 4A-B). However, tight junction proteins (ZO-1, occludin, claudin 5, and claudin 3), surprisingly, were not altered (Supplementary Figure 4C-D). TDP-43 overexpression induces blood-brain barrier permeability. a Representative images depicting CD3+ T cells in the frontal cortex of mice. Scale bar = 10 μm. b Manual count of CD3+ T cells. Statistical analysis was carried out using one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group, p < 0.001). c Representative images depicting CD4+ T cells in the frontal cortex of mice. Scale bar = 10 μm. d Manual count of CD4+ T cells. Statistical analysis was carried out using one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group; p < 0.001). e Representative images depicting mouse IgG in the frontal cortex of mouse tissue. Scale bar = 20 μm. f Quantification of percent area of the frontal cortex covered by mouse IgG staining. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group, p < 0.001). g Representative western blots of frontal cortex lysate probed for mouse IgG, ICAM1, VCAM1, caveolin 1, and actin. h Quantification of mouse IgG, ICAM1, VCAM, and caveolin 1 levels normalized to actin. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group, p < 0.05). i Representative images of Prussian blue staining depicting microhemorrhages in the frontal cortex of mice. Scale bar = 20 μm. j Quantification of percent area of the frontal cortex covered by Prussian blue-stained deposits. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group, p < 0.05) Low-grade systemic inflammation in TDP43 overexpressing mice promotes neutrophil infiltration Next, we measured the levels of a range of inflammatory cytokines in frontal cortex homogenates, similar to our recent report [50]. Low-grade systemic inflammation in GFP AAV9 mice did not alter the levels of any of the cytokines measured (Fig. 7a). TDP-43 overexpression, however, increased levels of RANTES in the frontal cortex. Interestingly, the expression of KC-GRO and MIP-1α was increased in the frontal cortex of LPS-treated TDP-43 AAV9 mice only. As KC-GRO and MIP-1α are chemotactic inflammatory signals involved in neutrophil recruitment [51], we stained brain tissue sections for the Ly6B.2 receptor, which is highly expressed by murine neutrophils [52]. Immunohistochemical labeling revealed that TDP-43 overexpression alone promoted neutrophil infiltration in the brain parenchyma compared to both the saline- and LPS-treated GFP AAV9 mice (Fig. 7b, c). Meanwhile, low-grade systemic inflammation in TDP-43 AAV9 mice further exacerbated Ly6B.2+ neutrophil infiltration. The data ultimately suggests that TDP-43-induced BBB permeability may be responsible for the compounded effects of systemic inflammation on behavior impairments, neuronal loss, and synaptic dysfunction observed in LPS-treated TDP-43 AAV9 mice. LPS-induced altered cytokine signaling during TDP-43 overexpression leads to neutrophil infiltration in the brain. a The concentration of eotaxin, IL-1α, IL-1β, IL-10, VEGF, RANTES, KC-GRO, and MIP-1α in frontal cortex tissue lysates. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test or two-tailed t-tests for RANTES (n = 6 mice/group; p < 0.05, *p < 0.001). b Representative images of Ly6B.2+ neutrophil labeling in the frontal cortex of mice. Scale bar = 10 μm. c Manual count of Ly6B.2+ neutrophils. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post hoc test (n = 4 mice/group, p < 0.001) The etiology of several neurodegenerative diseases, including ALS, FLTD, and AD, remains elusive. Nevertheless, research has identified several mutations and proteins in the brain that accelerate disease progression and have become key pathological features, such as TDP-43. Additionally, further studies have consistently observed systemic inflammatory changes in these diseases, giving rise to the idea of, not only systemic inflammation as a trigger for neurodegeneration, but also an intrinsically altered immune system [19]. With this in mind, our study sought to investigate the interaction between the systemic inflammatory response and TDP-43-associated pathology. While several TDP-43 transgenic models are available [33, 34, 53], the global TDP-43 expression in forebrain neurons confounds the effects it may have on certain neuronal subtypes and brain regions. Therefore, an AAV9 overexpression approach proved advantageous to explore TDP-43 in a way more relevant to human disease. Altogether, we demonstrate that low-grade systemic inflammation accelerated neurodegeneration and induced cognitive impairments in TDP-43 overexpressing mice. In our study, several cell types were activated as a result of TDP-43 overexpression. Interestingly, LPS-treated TDP-43 AAV9 mice presented with an altered phenotype despite no appreciable changes in astrocytic/microglial activation, endothelial/pericytic activation, T cell infiltration, BBB leakage, or hemosiderin deposits. Though we did observe LPS-driven cytokine changes in TDP-43 overexpressing brains, suggesting inflammation-associated cascades are taking place (KC-GRO and MIP-1α). We surmise that TDP-43 alone is sufficient in mediating inflammation and probably masked the subtle effects of low-grade systemic inflammation in the frontal cortex. This is conceivable since TDP43 alone leads to significant neuronal loss. The radial arm water maze (RAWM) is generally known to test spatial learning, which is strongly tied to hippocampal function; however, we observed significant learning impairment in the cortical TDP-43 overexpressing mice subjected to LPS. In support of our findings, studies indicate that spatial memory is not strictly tied to the hippocampus as it is not affected following hippocampal insults in certain tasks [54,55,56,57,58], contending that task-dependent memory demands dictate the use of distinct brain regions [59]. We reason that cortical TDP-43 in synergy with systemic inflammation directly impaired RAWM performance in mice by affecting the cortico-hippocampal networks [60,61,62]. In agreement, several studies demonstrate that manipulations of the cortex impaired the performance in spatial memory tasks [63,64,65,66,67,68]. Finally, we cannot exclude the role that LPS-induced hippocampal neuroinflammation observed in TDP-43 overexpressing mice has on RAWM performance. It is plausible that the altered hippocampal signaling is partially responsible for the slowed performance. Overall, our results correlate with a recent consensus study on patients with limbic age-related TDP-43 encephalopathy (LATE) demonstrating that TDP-43 neuropathology precipitated learning and spatial memory decline similar to AD in patients [69]. TDP-43 overexpression increased IgG, as well as CD3+ and CD4+ T cell infiltration, which were associated with increased endothelial signaling since both ICAM1 and caveolin 1 facilitate leukocyte infiltration in the brain [70, 71]. Further, increased VCAM1 levels were observed following TDP-43 overexpression, indicating impaired endothelial barrier integrity [72]. Therefore, it is also plausible that the TDP-43-dependent cell infiltration is partially due to the blood-brain barrier (BBB) permeability and/or dysfunction. For example, in an animal model of tau overexpression, aged mice showed increased Evans blue extravasation while also displaying significant T cell infiltration without reported tight junction loss [73]. Additionally, free hemoglobin released from extravasated red blood cells can be toxic to neurons and we observed an increase in hemosiderin deposits in areas of TDP-43 overexpression, which indicates BBB disruption. Surprisingly, we did not observe significant reductions in tight junction proteins, which could reflect limitations of the technique used; for instance, sensitivity, given that we achieved ~ 20% transduction efficiency in the frontal cortex. Regardless, our data reveal for the first time the interplay between peripheral cell infiltration signaling—as well as BBB permeability or dysfunction—and TDP-43 pathology. Since the microvasculature of the BBB allows for tight regulation of components between the blood and the brain [74, 75], rendering LPS to act mainly through endothelial receptor signaling [76], increased BBB permeability is most likely responsible for the compounded effects of LPS in TDP-43 overexpressing mice. This could be due to the infiltration of LPS or other LPS-induced blood elements [77] into the brain parenchyma. The extravasation of T cells could exacerbate TDP-43 induced neurodegeneration. This is in agreement with studies showing that CD3+ T cell infiltration in the hippocampus promotes neuroinflammation and cognitive dysfunction in tau overexpressing models [78]. Interestingly, we also observed the presence of CD45- and MHCII-positive mononuclear cells following TDP-43 overexpression, but not GFP, indicating the possibility for infiltrating monocytes/macrophages. Several studies have linked macrophage infiltration to be detrimental in mice, for example, infiltration of macrophages in the brain after seizures in mice contributes to neuroinflammation [79]. Also, infiltrating macrophages impairs spatial memory and hippocampal long-term potentiation (LTP) in leptin receptor-deficient mice through the induction of pro-inflammatory cytokines [80]. Thus, it is plausible that infiltrating monocytes/macrophages, in addition to T cells, can drive neuroinflammation and contribute to TDP-43-mediated neurodegeneration. Although TDP-43 overexpression alone led to peripheral cell infiltration, low-grade systemic inflammation in TDP-43 AAV9 mice increased the infiltration of neutrophils into the brain through KC-GRO and MIP-1α signaling [51, 81]. Neutrophil infiltration has been extensively associated with detrimental effects in neurodegenerative diseases [82, 83], for example, preventing neutrophil extravasation into the brain of transgenic models of amyloid deposition reduce AD neuropathology and improved cognitive function [84]. Similarly, the increased neutrophil infiltration in the TDP-43 overexpressing brain following low-grade systemic inflammation could be partly responsible for the alterations in neuronal loss and cognitive performance in our study. However, further studies are needed to understand not only the role of differential infiltrating cell populations in TDP-43-mediated BBB dysfunction but also the distinctive function of peripheral cells in the context of an altered immune response and the diseased brain. Wild-type TDP-43 neurotoxic effects have been extensively studied in various models of overexpression [33, 34, 53], linking TDP-43-dependent neurodegeneration to transcription factor nuclear factor-κB (NF-κB) signaling [28, 85], synaptic plasticity [86], and the heat shock response [32, 87, 88]. Since ALS [89, 90], FTD [91], and AD [92] present with BBB alterations and are associated with pathological TDP-43, our data provides an important link between the two. We predict, based on our findings, that patients with brain-related TDP-43 proteinopathies have increased susceptibility to neurodegeneration, not only because of the toxicity of high TDP-43 levels but because of its global impact on brain function, rendering the immune-privileged organ vulnerable to blood components toxic to brain cells and the immune response. After all, a vast array of toxic or allergenic substances, in addition to microbes, can threaten body homeostasis and launch the immune response as a protective mechanism, which can inadvertently harm the brain. In fact, given that a number of patients with neurodegenerative diseases present with low-grade systemic inflammation [12,13,14,15,16,17,18], it is not surprising that the altered immune response may affect brains with BBB abnormalities and/or impair neurovascular unit function leading to increased BBB permeability and peripheral cell infiltration. Overall, our results uncover a novel role of TDP-43 in blood-brain barrier permeability and leukocyte recruitment which can compromise the brains of patients with TDP-43 proteinopathies and alter disease progression, especially in association with other inflammatory conditions. The data also shed light on TDP-43 as a factor explaining the BBB abnormalities observed in patients diagnosed with neurodegenerative diseases while also supporting a new body of research regarding the role of TDP-43 in alterations of the neurovascular unit. All relevant data are available upon request directed to the corresponding author. TDP-43: TAR DNA-binding protein 43 FTD: AAV9: Adeno-associated virus 9 UCHL1: Ubiquitin carboxyl-terminal esterase L1 RANTES: Regulated upon activation, normal T cell expressed and presumably secreted BBB: IgG: CD3: Cluster of differentiation 3 Ly6B.2: Lymphocyte antigen 6B.2 SNAP-25: Synaptosome associated protein 25 RAWM: hnRNPs: heterogeneous nuclear ribonucleoproteins HDAC6: histone deacetylase 6 Tbc1d1: Tre-2/USP6, BUB2, cdc16 domain family member 1 Hs-CRP: High-sensitivity C-reactive protein C9ORF72: Chromosome 9 open reading frame 72 IFN-λ: Hsc70: Heat shock cognate 71 kDa protein CED: Convection-enhanced delivery NeuN: Neuronal nuclei Ni++ : MHCII: Major histocompatibility complex class II GFAP: Glial fibrillary acidic protein CD45: Cluster of differentiation 45 CD11b: Cluster of differentiation molecule 11b BCA: Bicinchoninic assay RIPA: Radioimmunoprecipitation assay buffer CHAPS: 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate SDS-PAGE: Sodium dodecyl-sulfate-polyacrylamide gel electrophoresis PVDF: Polyvinylidene fluoride PSD95: Post-synaptic density protein 95 ICAM1: Intercellular adhesion molecule 1 ZO-1: Zonula occludens 1 VCAM: Vascular cell adhesion molecule 1 PDGFRβ: Platelet-derived growth factor receptor beta GAPDH: Glyceraldehyde 3-phosphate dehydrogenase IL-1α: Interleukin 1 alpha Interleukin 1 beta IL-10: Interleukin 10 VEGF: Vascular endothelial growth factor MIP-1α: Macrophage inflammatory protein 1-alpha KC-GRO: Chemokine (C-X-C motif) ligand 1 TLR4: Toll-like receptor 4 NF-κB: Nuclear factor kappa-light-chain-enhancer of activated B cells SNARE: Synaptosome-associated protein receptor Krecic A, Swanson M. hnRNP complexes: composition, structure, and function. Curr Opin Cell Biol. 1999;11(3). Ayala YM, Pantano S, D’Ambrogio A, et al. Human, Drosophila, and C. elegans TDP43: nucleic acid binding properties and splicing regulatory function. J Mol Biol. 2005;348(3):575–88. https://doi.org/10.1016/j.jmb.2005.02.038. Kim SH, Shanware NP, Bowler MJ, Tibbetts RS. Amyotrophic lateral sclerosis-associated proteins TDP-43 and FUS/TLS function in a common biochemical complex to co-regulate HDAC6 mRNA. J Biol Chem. 2010;285(44):34097–105. https://doi.org/10.1074/jbc.M110.154831. Chiang PM, Ling J, Jeong YH, Price DL, Aja SM, Wong PC. Deletion of TDP-43 down-regulates Tbc1d1, a gene linked to obesity, and alters body fat metabolism. Proc Natl Acad Sci U S A. 2010;107(37):16320–4. https://doi.org/10.1073/pnas.1002176107. Abhyankar MM, Urekar C, Reddi PP. A novel CpG-free vertebrate insulator silences the testis-specific SP-10 gene in somatic tissues: Role for TDP-43 in insulator function. J Biol Chem. 2007;282(50):36143–54. https://doi.org/10.1074/jbc.M705811200. Polymenidou M, Lagier-Tourenne C, Hutt KR, et al. Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nat Neurosci. 2011;14(4):459–68. https://doi.org/10.1038/nn.2779. Arai T, Hasegawa M, Akiyama H, et al. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Commun. 2006;351(3):602–11. https://doi.org/10.1016/j.bbrc.2006.10.093. Neumann M, Sampathu DM, Kwong LK, et al. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science (80- ). Published online 2006. doi:10.1126/science.1134108. Rajagopalan V, Pioro EP. Distinct patterns of cortical atrophy in ALS patients with or without dementia: An MRI VBM study. Amyotroph Lateral Scler Front Degener. 2014;15(3-4):216–25. https://doi.org/10.3109/21678421.2014.880179. Steinacker P, Hendrich C, Sperfeld AD, et al. TDP-43 in cerebrospinal fluid of patients with frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Arch Neurol. 2008;65(11):1481–7. https://doi.org/10.1001/archneur.65.11.1481. McAleese KE, Walker L, Erskine D, Thomas AJ, McKeith IG, Attems J. TDP-43 pathology in Alzheimer’s disease, dementia with Lewy bodies and ageing. Brain Pathol. 2017;27(4):472–9. https://doi.org/10.1111/bpa.12424. Franceschi C, Campisi J. Chronic inflammation (Inflammaging) and its potential contribution to age-associated diseases. Journals Gerontol - Ser A Biol Sci Med Sci. 2014;69:S4–9. https://doi.org/10.1093/gerona/glu057. Cervellati C, Trentini A, Bosi C, et al. Low-grade systemic inflammation is associated with functional disability in elderly people affected by dementia. GeroScience. 2018;40(1):61–9. https://doi.org/10.1007/s11357-018-0010-6. Miller ZA, Sturm VE, Camsari GB, et al. Increased prevalence of autoimmune disease within C9 and FTD/MND cohorts Completing the picture. Neurol Neuroimmunol NeuroInflammation. 2016;3(6). doi:10.1212/NXI.0000000000000301. Keizman D, Rogowski O, Berliner S, et al. Low-grade systemic inflammation in patients with amyotrophic lateral sclerosis. Acta Neurol Scand. 2009;119(6):383–9. https://doi.org/10.1111/j.1600-0404.2008.01112.x. Hu Y, Cao C, Qin XY, et al. Increased peripheral blood inflammatory cytokine levels in amyotrophic lateral sclerosis: A meta-analysis study. Sci Rep. 2017;7(1). doi:10.1038/s41598-017-09097-1. Murdock BJ, Zhou T, Kashlan SR, Little RJ, Goutman SA, Feldman EL. Correlation of peripheral immunity with rapid amyotrophic lateral sclerosis progression. JAMA Neurol. 2017;74(12):1446–54. https://doi.org/10.1001/jamaneurol.2017.2255. Zhang R, Gascon R, Miller RG, et al. Evidence for systemic immune system alterations in sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol. 2005;159(1-2):215–24. https://doi.org/10.1016/j.jneuroim.2004.10.009. Turner MR, Goldacre R, Ramagopalan S, Talbot K, Goldacre MJ. Autoimmune disease preceding amyotrophic lateral sclerosis: an epidemiologic study. Neurology. 2013;81(14):1222–5. https://doi.org/10.1212/WNL.0b013e3182a6cc13. Lee DC, Rizer J, Selenica MLB, et al. LPS- induced inflammation exacerbates phospho-tau pathology in rTg4510 mice. J Neuroinflammation. 2010;7. https://doi.org/10.1186/1742-2094-7-56. Lee J, Lee Y, Yuk D, et al. Neuro-inflammation induced by lipopolysaccharide causes cognitive impairment through enhancement of beta-amyloid generation. J Neuroinflammation. 2008;5(1):37. https://doi.org/10.1186/1742-2094-5-37. Correia AS, Patel P, Dutta K, Julien JP. Inflammation induces TDP-43 mislocalization and aggregation. PLoS One. 2015;10(10). doi:10.1371/journal.pone.0140248. Fontaine SN, Zheng D, Sabbagh JJ, et al. DnaJ/Hsc70 chaperone complexes control the extracellular release of neurodegenerative-associated proteins. EMBO J. 2016;35(14):1537–49. https://doi.org/10.15252/embj.201593489. Iguchi Y, Eid L, Parent M, et al. Exosome secretion is a key pathway for clearance of pathological TDP-43. Brain. 2016;139(12):3187–201. https://doi.org/10.1093/brain/aww237. Carty N, Lee D, Dickey C, et al. Convection-enhanced delivery and systemic mannitol increase gene product distribution of AAV vectors 5, 8, and 9 and increase gene product in the adult mouse brain. J Neurosci Methods. 2010;194(1):144–53. https://doi.org/10.1016/j.jneumeth.2010.10.010. Kitazawa M, Oddo S, Yamasaki TR, Green KN, LaFerla FM. Lipopolysaccharide-induced inflammation exacerbates tau pathology by a cyclin-dependent kinase 5-mediated pathway in a transgenic model of Alzheimer’s disease. J Neurosci. 2005;25(39):8843–53. https://doi.org/10.1523/JNEUROSCI.2868-05.2005. Yasvoina MV, Genç B, Jara JH, et al. eGFP expression under UCHL1 promoter genetically labels corticospinal motor neurons and a subpopulation of degeneration-resistant spinal motor neurons in an ALS mouse model. J Neurosci. 2013;33(18):7890–904. https://doi.org/10.1523/JNEUROSCI.2787-12.2013. Swarup V, Phaneuf D, Dupré N, et al. Deregulation of TDP-43 in amyotrophic lateral sclerosis triggers nuclear factor κB-mediated pathogenic pathways. J Exp Med. 2011;208(12):2429–47. https://doi.org/10.1084/jem.20111313. Mackenzie IRA, Bigio EH, Ince PG, et al. Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations. Ann Neurol. 2007;61(5):427–34. https://doi.org/10.1002/ana.21147. Lu YC, Yeh WC, Ohashi PS. LPS/TLR4 signal transduction pathway. Cytokine. 2008;42(2):145–51. https://doi.org/10.1016/j.cyto.2008.01.006. Ayala YM, De Conti L, Avendaño-Vázquez SE, et al. TDP-43 regulates its mRNA levels through a negative feedback loop. EMBO J. 2011;30(2):277–88. https://doi.org/10.1038/emboj.2010.310. Li W, Reeb AN, Lin B, et al. Heat shock-induced phosphorylation of TAR DNA-binding protein 43 (TDP-43) by MAPK/ERK kinase regulates TDP-43 function. J Biol Chem. 2017;292(12):5089–100. https://doi.org/10.1074/jbc.M116.753913. Wils H, Kleinberger G, Janssens J, et al. TDP-43 transgenic mice develop spastic paralysis and neuronal inclusions characteristic of ALS and frontotemporal lobar degeneration. Proc Natl Acad Sci U S A. 2010;107(8):3858–63. https://doi.org/10.1073/pnas.0912417107. Tsai KJ, Yang CH, Fang YH, et al. Elevated expression of TDP-43 in the forebrain of mice is sufficient to cause neurological and pathological phenotypes mimicking FTLD-U. J Exp Med. 2010;207(8):1661–73. https://doi.org/10.1084/jem.20092164. Andrade-Moraes CH, Oliveira-Pinto AV, Castro-Fonseca E, et al. Cell number changes in Alzheimer’s disease relate to dementia, not to plaques and tangles. Brain. 2013;136(12):3738–52. https://doi.org/10.1093/brain/awt273. Blennow K, Bogdanovic N, Alafuzoff I, Ekman R, Davidsson P. Synaptic pathology in Alzheimer’s disease: relation to severity of dementia, but not to senile plaques, neurofibrillary tangles, or the ApoE4 allele. J Neural Transm. 1996;103(5):603–18. https://doi.org/10.1007/BF01273157. Woo JAA, Liu T, Trotter C, et al. Loss of function CHCHD10 mutations in cytoplasmic TDP-43 accumulation and synaptic integrity. Nat Commun. 2017;8(1):1–15. https://doi.org/10.1038/ncomms15558. Jiang T, Handley E, Brizuela M, et al. Amyotrophic lateral sclerosis mutant TDP-43 may cause synaptic dysfunction through altered dendritic spine function. DMM Dis Model Mech. 2019;12(5). doi:10.1242/dmm.038109. Paolicelli RC, Jawaid A, Henstridge CM, et al. TDP-43 depletion in microglia promotes amyloid clearance but also induces synapse loss. Neuron. 2017;95(2):297–308.e6. https://doi.org/10.1016/j.neuron.2017.05.037. Badshah H, Ali T, Kim MO. Osmotin attenuates LPS-induced neuroinflammation and memory impairments via the TLR4/NFκB signaling pathway. Sci Rep. 2016;6(1):1–13. https://doi.org/10.1038/srep24493. Sheppard O, Coleman MP, Durrant CS. Lipopolysaccharide-induced neuroinflammation induces presynaptic disruption through a direct action on brain tissue involving microglia-derived interleukin 1 beta. J Neuroinflammation. 2019;16(1):106. https://doi.org/10.1186/s12974-019-1490-8. Xin Y-R, Jiang J-X, Hu Y, et al. The immune system drives synapse loss during lipopolysaccharide-induced learning and memory impairment in mice. Front Aging Neurosci. 2019;11:279. https://doi.org/10.3389/fnagi.2019.00279. Jahn R, Südhof TC. Membrane fusion and exocytosis. Annu Rev Biochem. 1999;68(1):863–911. https://doi.org/10.1146/annurev.biochem.68.1.863. Thammisetty SS, Pedragosa J, Weng YC, Calon F, Planas A, Kriz J. Age-related deregulation of TDP-43 after stroke enhances NF-κB-mediated inflammation and neuronal damage. J Neuroinflammation. 2018;15(1):312. https://doi.org/10.1186/s12974-018-1350-y. Cosenza-Nashat MA, Kim MO, Zhao ML, Suh HS, Lee SC. CD45 isoform expression in microglia and inflammatory cells in HIV-1 encephalitis. Brain Pathol. 2006;16(4):256–65. https://doi.org/10.1111/j.1750-3639.2006.00027.x. Perlmutter LS, Scott SA, Barrón E, Chui HC. MHC class II-positive microglia in human brain: Association with alzheimer lesions. J Neurosci Res. 1992;33(4):549–58. https://doi.org/10.1002/jnr.490330407. Nakano A, Harada T, Morikawa S, Kato Y. Expression of leukocyte common antigen (CD45) on various human leukemia/lymphoma cell lines. Pathol Int. 1990;40(2):107–15. https://doi.org/10.1111/j.1440-1827.1990.tb01549.x. Holling TM, Schooten E, Van Den Elsen PJ. Function and regulation of MHC class II molecules in T-lymphocytes: Of mice and men. Hum Immunol. 2004;65(4):282–90. https://doi.org/10.1016/j.humimm.2004.01.005. Oh J, Shin JS. Molecular mechanism and cellular function of MHCII ubiquitination. Immunol Rev. 2015;266(1):134–44. https://doi.org/10.1111/imr.12303. Joly-Amado A, Hunter J, Quadri Z, et al. CCL2 overexpression in the brain promotes glial activation and accelerates tau pathology in a mouse model of tauopathy. Front Immunol. 2020;11:997. https://doi.org/10.3389/fimmu.2020.00997. Johnson EA, Dao TL, Guignet MA, Geddes CE, Koemeter-Cox AI, Kan RK. Increased expression of the chemokines CXCL1 and MIP-1α by resident brain cells precedes neutrophil infiltration in the brain following prolonged soman-induced status epilepticus in rats. J Neuroinflammation. 2011;8. https://doi.org/10.1186/1742-2094-8-41. Lee PY, Wang J-X, Parisini E, Dascher CC, Nigrovic PA. Ly6 family proteins in neutrophil biology. J Leukoc Biol. 2013;94(4):585–94. https://doi.org/10.1189/jlb.0113014. Tsuiji H, Inoue I, Takeuchi M, et al. TDP-43 accelerates age-dependent degeneration of interneurons. Sci Rep. 2017;7(1). doi:10.1038/s41598-017-14966-w. Clark RE, Broadbent NJ, Squire LR. Hippocampus and remote spatial memory in rats. Hippocampus. 2005;15(2):260–72. https://doi.org/10.1002/hipo.20056. Cho YH, Kesner RP. Involvement of entorhinal cortex or parietal cortex in long-term spatial discrimination memory in rats: Retrograde amnesia. Behav Neurosci. 1996;110(3):436–42. https://doi.org/10.1037//0735-7044.110.3.436. Cho YH, Beracochea D, Jaffard R. Extended temporal gradient for the retrograde and anterograde amnesia produced by ibotenate entorhinal cortex lesions in mice. J Neurosci. 1993;13(4):1759–66. https://doi.org/10.1523/jneurosci.13-04-01759.1993. Ramos JMJ. Short communication: Retrograde amnesia for spatial information: a dissociation between intra and extramaze cues following hippocampus lesions in rats. Eur J Neurosci. 1998;10(10):3295–301. https://doi.org/10.1046/j.1460-9568.1998.00388.x. Maviel T, Durkin TP, Menzaghi F, Bontempi B. Sites of neocortical reorganization critical for remote spatial memory. Science (80- ). 2004;305(5680):96-99. doi:https://doi.org/10.1126/science.1098180. Broadbent NJ, Squire LR, Clark RE. Reversible hippocampal lesions disrupt water maze performance during both recent and remote memory tests. Learn Mem. 2006;13(2):187–91. https://doi.org/10.1101/lm.134706. Hok V, Save E, Lenck-Santini PP, Poucet B. Coding for spatial goals in the prelimbic/infralimbic area of the rat frontal cortex. Proc Natl Acad Sci U S A. 2005;102(12):4602–7. https://doi.org/10.1073/pnas.0407332102. Basu J, Siegelbaum SA. The corticohippocampal circuit, synaptic plasticity, and memory. Cold Spring Harb Perspect Biol. 2015;7(11):a021733. https://doi.org/10.1101/cshperspect.a021733. Genzel L, Battaglia FP. Cortico-hippocampal circuits for memory consolidation: the role of the prefrontal cortex. In: Springer, Cham; 2017:265-281. doi:10.1007/978-3-319-45066-7_16. De Bruin JPC, Swinkels WAM, De Brabander JM. Response learning of rats in a Morris water maze: involvement of the medial prefrontal cortex. Behav Brain Res. 1997;85(1):47–55. https://doi.org/10.1016/S0166-4328(96)00163-5. De Bruin JPC, Moita MP, De Brabander HM, Joosten RNJMA. Place and response learning of rats in a Morris water maze: differential effects of fimbria fornix and medial prefrontal cortex lesions. Neurobiol Learn Mem. 2001;75(2):164–78. https://doi.org/10.1006/nlme.2000.3962. Kolb B, Sutherland RJ, Whishaw IQ. A comparison of the contributions of the frontal and parietal association cortex to spatial localization in rats. Behav Neurosci. 1983;97(1):13–27. https://doi.org/10.1037/0735-7044.97.1.13. Sang Jo Y, Eun HP, Il HK, et al. The medial prefrontal cortex is involved in spatial memory retrieval under partial-cue conditions. J Neurosci. 2007;27(49):13567–78. https://doi.org/10.1523/JNEUROSCI.3589-07.2007. Save E, Poucet B, Foreman N, Thinus-Blanc C. The contribution of the associative parietal cortex and hippocampus to spatial processing in rodents. Psychobiology. 1998;26(2):153–61. https://doi.org/10.3758/BF03330603. Woolley DG, Laeremans A, Gantois I, et al. Homologous involvement of striatum and prefrontal cortex in rodent and human water maze learning. Proc Natl Acad Sci U S A. 2013;110(8):3131–6. https://doi.org/10.1073/pnas.1217832110. Nelson PT, Dickson DW, Trojanowski JQ, et al. Limbic-predominant age-related TDP-43 encephalopathy (LATE): consensus working group report. Brain. 2019;142(6):1503–27. https://doi.org/10.1093/brain/awz099. Hess DC, Bhutwala T, Sheppard JC, Zhao W, Smith J. ICAM-1 expression on human brain microvascular endothelial cells. Neurosci Lett. 1994;168(1-2):201–4. https://doi.org/10.1016/0304-3940(94)90450-2. Lutz SE, Smith JR, Kim DH, et al. Caveolin1 is required for Th1 cell infiltration, but not tight junction remodeling, at the blood-brain barrier in autoimmune neuroinflammation. Cell Rep. 2017;21(8):2104–17. https://doi.org/10.1016/j.celrep.2017.10.094. Haarmann A, Nowak E, Deiß A, et al. Soluble VCAM-1 impairs human brain endothelial barrier integrity via integrin α-4-transduced outside-in signalling. Acta Neuropathol. 2015;129(5):639–52. https://doi.org/10.1007/s00401-015-1417-0. Blair LJ, Frauen HD, Zhang B, et al. Tau depletion prevents progressive blood-brain barrier damage in a mouse model of tauopathy. Acta Neuropathol Commun. 2015;3:8. https://doi.org/10.1186/s40478-015-0186-2. Zlokovic BV. The blood-brain barrier in health and chronic neurodegenerative disorders. Neuron. 2008;57(2):178–201. https://doi.org/10.1016/j.neuron.2008.01.003. Daneman R. The blood-brain barrier in health and disease. Ann Neurol. 2012;72(5):648–72. https://doi.org/10.1002/ana.23648. Banks WA, Robinson SM. Minimal penetration of lipopolysaccharide across the murine blood-brain barrier. Brain Behav Immun. 2010;24(1):102–9. https://doi.org/10.1016/j.bbi.2009.09.001. Liverani E, Rico MC, Yaratha L, Tsygankov AY, Kilpatrick LE, Kunapuli SP. LPS-induced systemic inflammation is more severe in P2Y 12 null mice. J Leukoc Biol. 2014;95(2):313–23. https://doi.org/10.1189/jlb.1012518. Laurent C, Dorothée G, Hunot S, et al. Hippocampal T cell infiltration promotes neuroinflammation and cognitive decline in a mouse model of tauopathy. Brain. Published online 2017. doi:https://doi.org/10.1093/brain/aww270. Varvel NH, Neher JJ, Bosch A, et al. Infiltrating monocytes promote brain inflammation and exacerbate neuronal damage after status epilepticus. Proc Natl Acad Sci U S A. 2016;113(38):E5665–74. https://doi.org/10.1073/pnas.1604263113. Stranahan AM, Hao S, Dey A, Yu X, Baban B. Blood-brain barrier breakdown promotes macrophage infiltration and cognitive impairment in leptin receptor-deficient mice. J Cereb Blood Flow Metab. 2016;36(12):2108–21. https://doi.org/10.1177/0271678X16642233. Crittenden M, Gough M, Harrington K, Olivier K, Thompson J, Vile RG. Expression of inflammatory chemokines combined with local tumor destruction enhances tumor regression and long-term immunity. Cancer Res. 2003;63(17):5505–12 Accessed November 20, 2019. http://www.ncbi.nlm.nih.gov/pubmed/14500387. Palmer C, Roberts RL, Young PI. Timing of neutrophil depletion influences long-term neuroprotection in neonatal rat hypoxic-ischemic brain injury. Pediatr Res. Published online 2004. doi:https://doi.org/10.1203/01.PDR.0000113546.03897.FC. Werner C, Engelhard K. Pathophysiology of traumatic brain injury. Br J Anaesth. Published online 2007. doi:https://doi.org/10.1093/bja/aem131. Zenaro E, Pietronigro E, Bianca V Della, et al. Neutrophils promote Alzheimer’s disease-like pathology and cognitive decline via LFA-1 integrin. Nat Med. Published online 2015. doi:10.1038/nm.3913. Zhu J, Cynader MS, Jia W. TDP-43 inhibits NF-κB activity by blocking p65 nuclear translocation. Scavone C, ed. PLoS One. 2015;10(11):e0142296. https://doi.org/10.1371/journal.pone.0142296. Gulino R, Forte S, Parenti R, Gulisano M. TDP-43 as a modulator of synaptic plasticity in a mouse model of spinal motoneuron degeneration. CNS Neurol Disord Drug Targets. 2015;14(1):55–60. https://doi.org/10.2174/1871527314666150116115414. Chen HJ, Mitchell JC, Novoselov S, et al. The heat shock response plays an important role in TDP-43 clearance: evidence for dysfunction in amyotrophic lateral sclerosis. Brain. 2016;139(5):1417–32. https://doi.org/10.1093/brain/aww028. Jinwal UK, Abisambra JF, Zhang J, et al. Cdc37/Hsp90 protein complex disruption triggers an autophagic clearance cascade for TDP-43 protein. J Biol Chem. 2012;287(29):24814–20. https://doi.org/10.1074/jbc.M112.367268. Donnenfeld H, Kascsak RJ, Bartfeld H. Deposits of IgG and C3 in the spinal cord and motor cortex of ALS patients. J Neuroimmunol. 1984;6(1):51–7. https://doi.org/10.1016/0165-5728(84)90042-0. Engelhardt JI, Siklós L, Kőműves L, Smith RG, Appel SH. Antibodies to calcium channels from ALS patients passively transferred to mice selectively increase intracellular calcium and induce ultrastructural changes in motoneurons. Synapse. 1995;20(3):185–99. https://doi.org/10.1002/syn.890200302. Janelidze S, Hertze J, Nägga K, et al. Increased blood-brain barrier permeability is associated with dementia and diabetes but not amyloid pathology or APOE genotype. Neurobiol Aging. 2017;51:104–12. https://doi.org/10.1016/j.neurobiolaging.2016.11.017. Bowman GL, Kaye JA, Moore M, Waichunas D, Carlson NE, Quinn JF. Blood-brain barrier impairment in Alzheimer disease: Stability and functional significance. Neurology. 2007;68(21):1809–14. https://doi.org/10.1212/01.wnl.0000262031.18018.1a. This work was supported by seed grant from the College of Pharmacy and Byrd Alzheimer’s Institute at the University of South Florida. Byrd Alzheimer’s Institute, University of South Florida, 4001 E. Fletcher Ave, Tampa, FL, 33613, USA Frank Zamudio, Anjanet R. Loon, Shayna Smeltzer, Khawla Benyamine, Nicholas J. F. Stewart, Daniel C. Lee, Kevin Nash & Maj-Linda B. Selenica Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, 12901 Bruce B. Downs Blvd, Tampa, FL, 33613, USA Frank Zamudio, Anjanet R. Loon, Shayna Smeltzer, Khawla Benyamine, Nicholas J. F. Stewart, Daniel C. Lee & Maj-Linda B. Selenica Department of Neurology, Massachusetts General Hospital Research Institute, Charlestown, MA, 02129, USA Frank Zamudio & Nanda K. Navalpur Shanmugam Department of Molecular Pharmacology and Physiology, Morsani College of Medicine, University of South Florida, 12901 Bruce B. Downs Blvd, Tampa, FL, 33612, USA Sanders-Brown Center on Aging, Department of Molecular and Cellular Biochemistry, College of Medicine, University of Kentucky, Lexington, KY, USA Daniel C. Lee & Maj-Linda B. Selenica Frank Zamudio Anjanet R. Loon Shayna Smeltzer Khawla Benyamine Nanda K. Navalpur Shanmugam Nicholas J. F. Stewart Daniel C. Lee Maj-Linda B. Selenica F.Z. led the study, performed immunohistochemistry, performed cytokine measurements, performed western blotting, wrote the manuscript, prepared figures, analyzed and interpreted the results. A.R.L. performed western blotting, immunohistochemistry, analysis of results, and revised the manuscript. S.L.S. performed mouse surgeries, mouse behavior and analysis. K.I.B. performed mouse behavior and analysis of results. N.K.N.S. contributed ideas regarding blood-brain barrier markers and revised the manuscript. N.J.F.S. performed immunohistochemistry and analysis of results. D.C.L. advised on the LPS treatment and revised the manuscript. K.N. prepared viruses. M.L.B.S. conceived experimental plan, provided funding, assisted with data interpretation and editing of the manuscript. All authors read and approved the final manuscript. Correspondence to Maj-Linda B. Selenica. Additional file 1: Figure S1 . TDP-43 oligomers and c-terminal fragments are not altered by TDP-43 overexpression. (A) Western blots of RIPA and urea-soluble brain homogenates probed for total TDP-43 at a high exposure to visualize oligomers and C-terminal fragments. (B) Quantification of oligomers and C-terminal fragments in the RIPA and urea-soluble fractions (n = 4 mice/group). Statistical analysis was carried out using a one-way ANOVA with Bonferroni post-hoc test. . TDP-43 overexpression increases astrocytic activation. (A) Representative images depicting GFAP levels (red channel) in the frontal cortex of mouse brain tissue. Scale bar = 20 μm. (B) Quantification of GFAP levels. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post-hoc test (n = 4 mice/group; p < 0.05). (C) Representative blots probed for GFAP, aquaporin 4, and actin. (D) Quantification of GFAP and (E) aquaporin 4 levels normalized to actin. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post-hoc test (n = 4 mice/group; ** p < 0.01). . Regional differences in LPS-driven neuroinflammation. (A) Representative blots probed for p-CamKIIβ, RGS14, and iNOS in hippocampal and frontal cortex tissue lysates. (B) Quantification of p-CamKIIβ, RGS14, and iNOS normalized to actin. Statistical analysis was carried out using one-way ANOVAs with Bonferroni post-hoc test (n = 4 mice/group). . TDP-43 overexpression induces pericyte activation and does not alter tight junction protein levels. (A) Representative blots probed for CD13, PDGFRβ, and GAPDH. (B) Quantification of CD13 and PDGFRβ levels normalized to GAPDH. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post-hoc test (n = 4 mice/group, * p < 0.05). (C) Representative blots probed for laminin B, ZO-1, occludin, claudin 5, claudin 3, and actin. (D) Quantification of laminin B, ZO-1, occludin, claudin 5, and claudin 3 levels normalized to actin. Statistical analysis was carried out using a one-way ANOVA with Bonferroni post-hoc test (n = 4 mice/group) Zamudio, F., Loon, A.R., Smeltzer, S. et al. TDP-43 mediated blood-brain barrier permeability and leukocyte infiltration promote neurodegeneration in a low-grade systemic inflammation mouse model. J Neuroinflammation 17, 283 (2020). https://doi.org/10.1186/s12974-020-01952-9 TDP-43 Synaptic dysfunction Microglial activation Astrocytosis Neurovascular unit	cc/2021-04/en_middle_0039.json.gz/line917
__label__wiki	0.7529	0.7529	Neurological consequences of COVID-19: what have we learned and where do we go from here? Abbas Jarrahi1 na1, Meenakshi Ahluwalia2 na1, Hesam Khodadadi3, Evila da Silva Lopes Salles3, Ravindra Kolhe2, David C. Hess4, Fernando Vale1, Manish Kumar5, Babak Baban3, Kumar Vaibhav1 & Krishnan M. Dhandapani ORCID: orcid.org/0000-0001-7044-11171 The coronavirus disease-19 (COVID-19) pandemic is an unprecedented worldwide health crisis. COVID-19 is caused by SARS-CoV-2, a highly infectious pathogen that is genetically similar to SARS-CoV. Similar to other recent coronavirus outbreaks, including SARS and MERS, SARS-CoV-2 infected patients typically present with fever, dry cough, fatigue, and lower respiratory system dysfunction, including high rates of pneumonia and acute respiratory distress syndrome (ARDS); however, a rapidly accumulating set of clinical studies revealed atypical symptoms of COVID-19 that involve neurological signs, including headaches, anosmia, nausea, dysgeusia, damage to respiratory centers, and cerebral infarction. These unexpected findings may provide important clues regarding the pathological sequela of SARS-CoV-2 infection. Moreover, no efficacious therapies or vaccines are currently available, complicating the clinical management of COVID-19 patients and emphasizing the public health need for controlled, hypothesis-driven experimental studies to provide a framework for therapeutic development. In this mini-review, we summarize the current body of literature regarding the central nervous system (CNS) effects of SARS-CoV-2 and discuss several potential targets for therapeutic development to reduce neurological consequences in COVID-19 patients. A series of pneumonia cases of unknown origin emerged in December 2019 at Wuhan, China, resembling the recent severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) outbreaks [1,2,3,4,5]. Genetic sequencing of samples derived from infected patients subsequently identified the pathogen as a novel coronavirus, initially named 2019 novel coronavirus (2019-nCoV), with the associated disease called coronavirus disease-19 (COVID-19) [6]. Given the genetic similarity to SARS-CoV, the nomenclature of the novel coronavirus was later revised to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by the International Committee on Taxonomy of Viruses. Coronaviruses, enveloped positive-sense RNA viruses belonging to family Coronaviridae and the order Nidovirales, are widely infectious across species [7]. Indeed, SARS-CoV-2 is believed to have a zoonotic origin and is 96% genetically similar to RaTG13, a previously described bat coronavirus [8]. The highly contagious and virulent nature of SARS-CoV-2 is evidenced by approximately 30,000,000 documented cases and 1,000,000 deaths worldwide, creating a global pandemic that has inflicted economic damage on an unprecedented scale. The SARS-CoV-2 outbreak has generated immense interest from both the medical community and the general public in understanding the biology, epidemiology, and clinical characteristics, as evidenced by the appearance of over 54,000 peer-reviewed research articles in PubMed focused on COVID-19. SARS-CoV-2 exhibits crossover symptomology with two commonly circulating human coronaviruses (HCoV-NL63, HCoV-HKU1) and prior infection with these strains may greatly impact patient outcomes during the present pandemic. Much of the initial knowledge informing the response to the current SARS-CoV-2 outbreak was gained during the SARS-CoV and MERS-CoV outbreaks. SARS-CoV was first reported in Asia in 2003, spreading to North America, South America, and Europe, which infected over 8000 people worldwide and caused nearly 800 deaths. The subsequent MERS-CoV outbreak was associated with a mortality rate of 37%, with most victims exhibiting one or more comorbid conditions. Likewise, the most characteristic clinical symptoms of COVID-19 patients are fever, fatigue, dry cough, myalgia, headache, dizziness, abdominal pain, diarrhea, nausea, and vomiting. More severe cases involve respiratory distress, which may require admittance to the intensive care unit and use of a ventilator [9]. Patients with underlying comorbidities such as hypertension, diabetes, cardiovascular disorders (CVD), and cerebrovascular diseases are more vulnerable to infection and exhibit a higher rate of hospitalization [9]. In addition to the classical symptoms of a respiratory virus, increasing evidence suggests COVID-19 patients may present with a diversity of unanticipated neurological symptoms, such as headache, nausea, anosmia, ageusia, myalgia/fatigue, confusion, disorientation, and vomiting [10,11,12] (Fig. 1). Human coronavirus (HCoV) infections are not restricted to the respiratory tract, with RNA from two HCoV strains (229E, OC43) detected in human brain autopsy samples from neurologically disease patients. Moreover, inter-neuronal propagation and axonal transport may favor viral invasion into the central nervous system (CNS) [11, 13, 14]. Indeed, olfactory and gustatory deficits are regarded as early symptoms of SARS-CoV-2 infection. Of particular interest, reports of ischemic strokes in younger, asymptomatic patients without comorbidities are appearing in the scientific literature, even after the infection has seemingly resolved [15,16,17]. These limited case reports suggest the need for a deeper understanding of SARS-CoV-2 infection, including elucidation of how the CNS may be affected. Larger clinical studies will undoubtedly shed new light on the clinical manifestations of COVID-19 infection in the brain; however, in this mini-review, we summarize what is currently known regarding SARS-CoV-2-mediated neurological injury to establish a framework for future pre-clinical and clinical investigations. We discuss evidence supporting both hematogenous and retrograde neuronal dissemination of SARS-CoV-2 invasion into the CNS, including secondary neuropathologies, and highlight potential therapeutic approaches for future exploration. Schematic illustration of COVID-19-related symptoms. Primary issues associated with COVID-19 are shown within the inner circle (see white text). These symptoms are widely reported in a large majority of patients infected with SARS-CoV-2. The outer circle (see black text) depicts neurological issues/symptoms that have been reported after COVID-19 Neurological manifestations in COVID-19 patients As COVID-19 rapidly spread throughout the world, anecdotal reports of neurological issues emerged. An internet-based, cross-sectional study found 59 COVID-19 patients from a study population of 1480 patients exhibiting influenza-like symptoms. Notably, loss of smell (68% of COVID-19 patients) and gustatory impairments (71% of COVID-19 patients) were distinguishing features of SARS-CoV-2 infection [10]. In line with this finding, approximately one-third of COVID-19 patients reported a loss of smell. Likewise, headache (about 8%) and nausea and vomiting (1%) were apparent in COVID-19 patients [9, 11, 13]. In addition, case studies of a 24-year-old male infected with SARS-CoV-2 in Japan presented with a fever and meningitis/meningeal irritation [18] while an infected 56-year-old male also was diagnosed with encephalitis [19]. In another case study, a 29-year-old woman diagnosed with COVID-19 presented with a left temporoparietal hemorrhagic venous infarction with transverse sigmoid sinus thrombosis on the left side [20]. These observational reports suggesting CNS involvement in the course of COVID-19 identified many interesting, yet unexplored, avenues for physicians and neuroscientists. In a study in Strasbourg, France, neurological function was assessed in 58 COVID-19 patients with acute respiratory distress syndrome (ARDS) that were admitted into the intensive care unit (ICU) [12]. Neurological abnormalities were observed in 14% (8/58 patients) upon admission to the ICU, while 67% (39/58) showed neurological signs along with 69% (40/58) who showed agitation following termination of sedation or a neuromuscular blocker [12]. Further, 45% (26/58) of patients showed confusion and corticospinal tract signs were evident in 67% (39/58) of admitted patients. Moreover, 13 patients (22.41%) showing encephalopathic features exhibited leptomeningeal enhancement (8/13) and bilateral frontotemporal hypoperfusion (11/13) on magnetic resonance imaging (MRI). Electroencephalography revealed diffuse bifrontal encephalopathy in one patient (1/8) [12]. Follow-up studies of 45 discharged patients revealed that 33% (15/45) exhibited dysexecutive syndrome and showed signs of inattention, disorientation, and poorly organized movements and response [12]. A study of 214 COVID-19 patients from Wuhan, China, showed severe respiratory infections in 41% (88/214) of patients, with 36% (78/214) of patients displaying diverse neurologic signs, including loss of smell and taste, neuropathic pain, seizures, and strokes [21]. Indeed, loss of smell and taste were similarly reported in COVID-19 patients worldwide [10]. To better understand the neurological manifestations of COVID-19, symptoms were broadly categorized into three categories: skeletal muscular injury indexes, CNS indexes (e.g., acute cerebrovascular disease, headache, dizziness, impaired consciousness, seizure, and ataxia), and peripheral nervous system indexes (nerve pain, impaired taste, smell, or vision). Of the 78 patients displaying neurological abnormalities, 25% showed symptoms related to CNS dysfunction, 11% showed issues related to skeletal muscle injury, and 9% exhibited issues with peripheral nervous system (PNS) function [21]. Of note, neurological symptoms were more commonly observed in older patients (mean age = 59.2 years), in patients with more severe infection, and in patient with pre-existing conditions, such as hypertension, diabetes, malignancy, or cardiac/cerebrovascular disease. Importantly, most of the neurological consequences of COVID-19 were apparent within the first 2 days of infection, although cerebrovascular events and impaired consciousness were often delayed beyond this acute time period and associated with the increased mortality rate [21]. A case study in January 2020, identified a 61-year-old woman that presented with acute weakness in both legs, and severe, progressive fatigue within 1 week after traveling to Wuhan, China. Of note, the observed neurological symptoms and subsequent diagnosis of Guillain-Barre syndrome (GBS) occurred several days prior to the development of respiratory symptoms and before a positive PCR test for SARS-CoV-2 [22]. Similarly, a 67-year-old female patient with a history of breast cancer presented in New York City with rapidly progressive quadriparesis, lower back pain, paresthesias, and urinary retention, diagnosed as severe, rapidly progressing GBS [23]. Moreover, several reports have emerged showing an acute GBS in pediatric patients infected with SARS-CoV-2 [24, 25]. While an association between SARS-CoV-2 infection and symptoms of GBS is evident [26], it remains unclear whether GBS manifestation is a coincidental presentation during SARS-CoV-2 infection or whether this represents a causative relationship. How does SARS-CoV-2 directly affect brain function? The previous section detailed a number of international studies that clearly established the nervous system as a target of COVID-19 infection. These early-stage clinical reports illustrate the need for an improved mechanistic understanding of how SARS-CoV-2 affects neurological function. This knowledge will be essential for the development of efficacious therapies to alleviate suffering in affected individuals. In this section, we propose several mechanisms to explain how a respiratory virus afflicts the CNS. Is SARS-CoV-2 neurotropic? A simple explanation for the neurological effects of COVID-19 is direct viral entry and infection of the CNS. Epidemiological data show a latency of up to 1 week between the initial infection and hospital admittance for COVID-19 patients [9, 21], providing a window for potential viral entry into the CNS. Neurotropism is commonly observed in coronaviruses, with neuro-invasive properties well documented in SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, and porcine hemagglutinating encephalomyelitis coronavirus (PHE) [11, 13, 27, 28]. The SARS-CoV-2 spike protein also alters barrier function in human models of the blood-brain barrier, providing an additional mechanism of potential CNS entry [29]. Given the genetic similarity and conserved viral structure with SARS-CoV, it appears likely that SARS-CoV-2 may also exhibit neurotropic properties [30, 31]. Tissue distribution of host receptors is generally believed to decide the tropisms of viruses [32,33,34]. In contrast to MERS-CoV, which exploits dipeptidyl peptidase 4 (DPP4) to evade host cells [35, 36], the densely glycosylated spike protein of SARS-CoV-2 virus binds with high affinity to the type I transmembrane metallocarboxypeptidase, angiotensin-converting enzyme 2 (ACE2), providing a mechanism of viral entry into human cells that mirrors the entry point for SARS-CoV [8, 37,38,39,40,41]. ACE2, which negatively regulates the renin-angiotensin-aldosterone system by degrading angiotensin II to generate angiotensin 1-7, is required to lower blood pressure and as such, is a frequent target for anti-hypertensive drug development [40, 42,43,44,45,46]. Other functions of ACE2 include the metabolism of apelin-13, neurotensin, kinetensin, dynorphin, [des-Arg9]-bradykinin, and [Lys-des-Arg9]-bradykinin [47]. ACE2 is widely expressed in airway epithelium, lung parenchyma, vasculature, kidney, heart, and the gastrointestinal tract [48, 49], primary sites of infection by SARS-CoV and SARS-CoV-2; however, it is interesting to note that ACE2-expressing endothelial cells and human intestinal cells were unaffected by SARS-CoV [50, 51], while ACE2 negative hepatocytes were susceptible to SARS-CoV infection [32]. Thus, the expression of ACE2 alone may not be sufficient for host cell infection by SARS-CoV-2. Initial studies failed to observe ACE2 expression in the brain [48, 49]; yet, RT-PCR studies detected low levels of ACE2 mRNA expression in the human brain while subsequent studies revealed that ACE2 immunoreactivity was exclusively within brain endothelial and smooth muscle cells [52]. ACE2 expression is also reported in both neurons and glia [53, 54], suggesting the brain may be a potential target of SARS-CoV-2. Consistent with the possibility of direct CNS infection, SARS-CoV-2 RNA was detectable in the cerebrospinal fluid (CSF), but not in a nasopharyngeal swab from a 24-year-old COVID-19 patient presenting with seizures, hippocampal atrophy, and pan-paranasal sinusitis that was subsequently diagnosed with viral meningitis [18]. Similarly, a 56-year-old encephalitis patient exhibiting reduced consciousness had detectable SARS-CoV-2 in the CSF. These findings in COVID-19 patients are in agreement with reports showing HCoV-OC43 RNA in the CSF of a 15-year-old acute demyelinating encephalomyelitis patient [55], whereas SARS-CoV was detected in the serum and CSF from SARS patients with persistent epilepsy [56]. Therefore, the capacity to leave the respiratory tract and potentially infect other tissues may be a defining feature of CoVs. Does SARS-CoV-2 use a trans-synaptic mechanism of CNS infection? CoVs may enter the CNS via retrograde neuronal diffusion, potentially via the cribriform plate of the ethmoid bone [57]. In mice, ACE2 and TMPRSS2, a protease that contributes toward the spread of CoVs [58], were expressed in sustentacular cells of the olfactory epithelium, with a more pronounced expression in aged mice [59]. SARS-CoV and MERS-CoV were observed within the CNS, raising the possibility of trans-synaptic viral spread via peripheral nerve terminals as a possible mechanism whereby CoVs may gain access to the CNS [27, 28, 60,61,62]. SARS-CoV particles were observed in CNS neurons and brain samples from patients diagnosed with SARS [62,63,64] while other CoVs, including HEV67 and avian bronchitis virus utilized trans-synaptic transfer [27, 28, 61]. Transgenic mice expressing human DPP4 (hDPP4) under the control of the surfactant protein C or cytokeratin-18 promoter showed a progressive fatal course that was paralleled by high viral titers in thalamus and brain stem within 2–6 days after intranasal administration of MERS-CoV [65]. Similarly, lethal intranasal inoculation of SARS-CoV in transgenic mice expressing human ACE2 (hACE2) in the airway and other epithelia resulted in pro-inflammatory activation and the presence of the virus within the olfactory bulb, thalamus, and brain stem via postulated spread through the olfactory nerves [66]. Following the viral entry into the CNS, infection rapidly spread via a trans-neuronal route to other connected brain regions, culminating in mortality due to neuronal loss in the cardiorespiratory centers within the medulla [67]. Finally, SARS was associated with delayed olfactory neuropathy while the loss of olfactory function is an internationally reported symptom of COVID-19, with some patients showing bilateral obstructive inflammation of the olfactory clefts correlating with impaired olfaction [68,69,70,71]. Thus, retrograde trans-synaptic transport from the lung and lower respiratory airways to the medullary cardiorespiratory centers of the brain and the olfactory centers may mediate the progressive acute respiratory failure and anosmia in COVID-19 patients. Beyond trans-synaptic spread from the respiratory system, another possibility is movement via the brain-gut axis. The gastrointestinal (GI) tract is directly infected by SARS-CoV-2 and up to a quarter of COVID-19 patients display GI issues, including nausea, anorexia, vomiting, and diarrhea [72, 73]. A temporal correlation exists between GI and neurological symptoms, and it is postulated that anorexia and nausea may be caused, at least in part, by infection of the lateral hypothalamic nuclei [73, 74]. Toward this end, SARS-CoV-2 may enter the CNS via the vagus nerve, a cranial nerve that regulates parasympathetic control of the heart, lungs, and GI tract. In addition to direct neuronal entry, SARS-CoV-2 may infect non-neuronal cell types to produce neurological complications. The SARS-CoV-2 entry genes, ACEs and TMPRSS2, are detectable in non-neuronal cell types in the olfactory epithelium and olfactory bulb [75]. Thus, infection of glia and vascular cells could contribute toward hypoperfusion, local inflammation, and cytokine release, loss of function of supporting cells, or damage to sustentacular and Bowman’s gland cells to induce olfactory neuronal dysfunction or death [68, 76,77,78]. Future studies surely will shed new light on these mechanisms of CNS spread, which may have significant implications for the future treatment of CoV-infected patients. Does immune activation contribute to neurological dysfunction after CoV infections? Inflammation is the first line of defense against pathogens. The innate immune system provides an early mechanism of host protection by producing type I interferons (IFN), complement proteins, and chemokines/cytokines to limit viral infection [79, 80]. While a robust innate immune response is necessary to elicit protective adaptive immunity, a prolonged and/or overactive immune response contributes toward pathological tissue injury [81]. Interestingly, pre-clinical studies showed that excess cytokine release after SARS-CoV infection dampened adaptive immunity [82]. In line with this observation, despite an increase in leukocyte activation and massive release of pro-inflammatory cytokines, SARS-CoV-2 infection is associated with lymphopenia, including suppression of both CD4+ and CD8+ T cells as well as the increased appearance of exhausted T cells [83,84,85]. Given this progression, significant attention has been focused on the development of a “cytokine storm,” the rapid pathological release of excess cytokines, which is associated with high fever, respiratory distress, multi-organ failure, and increased mortality over the first 2 weeks in COVID-19 patients [86]. Cytokine storm Critically ill COVID-19 patients exhibited an increased ratio of white blood cells/lymphocytes and higher plasma levels of C-reactive protein (CRP), IL-2, IL-7, IL-10, GSCF, IP10 (CXCL10), MCP-1 (CCL2), MIP-1α (CCL3), and TNF-α, as compared to non-ICU patients [9, 87]. Inflammatory cytokines, such as IL-6, IL-10, and TNF-α, are elevated following infection with SARS-CoV-2 and are believed to orchestrate a cytokine storm [84]. Given these appreciated detrimental effects, a number of clinical trials using tocilizumab, an IL-6 receptor antagonist (NCT04306705, NCT04322773); sarilumab, a IL-6 receptor antagonist (NCT04322773, NCT04315298); or clazakizumab, an IL-6 neutralizing antibody (NCT04343989; NCT04348500), were initiated as potential therapies to limit the cytokine storm in COVID-19 patients. In contrast to the established association between the cytokine storm and respiratory distress in COVID-19 patients, relatively less is known about the lasting neurological effects of these events. The CNS is regarded as an immune-privileged organ, yet the brain is highly vulnerable to inflammatory mediators and tissue hypoxia [88,89,90,91]. Infectious encephalitis is an inflammation of the brain that may develop in bacteria- or virus-infected children, elderly, and immuno-compromised individuals. While mild encephalitis produces transient flu-like symptoms, including fever, headache, seizures, light sensitivity, neck stiffness, and loss of consciousness, more severe cases can produce confusion, psychosis, limb weakness, double vision, cognitive impairments, speech and hearing deficits, coma, and increased fatality. During the course of COVID-19 infection, reports of a rare condition, acute necrotizing hemorrhagic encephalopathy, emerged in patients showing intracranial cytokine storm syndrome without direct viral invasion [92]. Radiological imaging of acute necrotizing hemorrhagic encephalopathy indicates lesions within the thalamus, brain stem, and cerebral white matter [93], suggesting the likely need for neurological assessments of COVID-19 patients. In addition, cytokine-induced pulmonary injury during ARDS may adversely affect brain function due to the intimate association between the lungs and the respiratory centers in the medulla and pons of the brain stem [94,95,96,97]. Thus, the neurological manifestations of COVID-19 may be secondary to the consequences of ARDS-mediated inflammation and hypoxemia/hypoxia [94, 95]. As clinical data becomes more widely available regarding the link between the nervous and respiratory systems, this knowledge will greatly shape further pre-clinical efforts. Immunomodulatory therapies to manage the neurological complications from SARS-CoV-2 Understanding the immune dysregulation in patients with COVID-19 will provide a greater understanding of SARS-CoV-2 pathogenesis. The detrimental impact of unrestrained immune activation and the cytokine storm are clearly evident, but therapeutic targets beyond anti-viral drugs remain a major obstacle to limiting neurological injury secondary to COVID-19. As a significant member of the pattern recognition receptor (PRR) family, Toll-like receptors (TLRs) play a crucial role in the initiation of immune responses against viral infections. In addition to initiating the intracellular response to viral RNA, TLRs induce signaling cascades and activate transcription factors that shape the cellular response to infection. Along these lines, activation of TLRs mobilize and recruit innate immune cells (e.g., neutrophils, monocytes, innate lymphoid cells) and induce cytokines and chemokines that limit viral progression and activate acquired immunity [98]. Of the TLRs, TLR3, which is expressed in both immune and non-immune cells, recognizes double-stranded RNA (CoVs are double-stranded RNA viruses). Upon activation, TLR3 induces interferon regulatory transcription factor 3 (IRF3) to stimulate the production of type I interferons as a host defense mechanism against viruses [99]. Importantly, mounting evidence suggests that TLR3 may initiate the cytokine storm and drive systemic inflammatory responses [100,101,102]. Thus, TLR3 may represent a target for immunotherapeutic modulation to limit neurological dysfunction in COVID-19 patients [103]. Do coagulopathies contribute to the neurological consequences of COVID-19? COVID-19 patients frequently exhibit complications associated with coagulopathy, including venous thromboembolism, acute coronary syndrome, myocardial infarction, and cerebral infarction [104,105,106,107]. SARS-CoV-2 infection was associated with prolonged prothrombin time, platelet abnormalities, elevated levels of D-dimer, increased fibrinogen/fibrin degradation products, and sepsis-induced coagulopathy (SIC), a form of disseminated intravascular coagulation (DIC), which was observed in the majority of COVID-19-related deaths [108, 109]. Severe COVID-19 patients exhibit hypoxia, a risk factor that increases thrombosis via activation of hypoxia-inducible transcriptional regulation and by increasing blood viscosity [110]. Given the role of coagulopathy, administration of anticoagulants were postulated as a treatment for severe COVID-19 patients [106, 109]; however, anticoagulation did not reduce life-threatening thrombotic complications in a recent multi-center prospective cohort study of 150 COVID-19 patients with ARDS [105], suggesting the need for extensive research to identify alternative targets for therapeutic intervention. With respect to the CNS, cytokine release, encephalopathy, and onset of ischemic stroke symptoms are correlated in COVID-19 patients [111, 112]. Inflammation and coagulation are inextricably linked processes that exhibit reciprocal cross-talk [113]. Systemic inflammation activates coagulation mechanisms by driving tissue factor-mediated thrombin generation and inhibiting endogenous fibrinolysis. In turn, activation of the coagulation system may influence inflammatory activity and contribute toward the development of hemorrhagic fever and thrombotic microangiopathy. While a clear association exists between SARS-CoV-2 and stroke incidence, it remains unanswered whether coagulation, secondary to COVID-19 infection, is an initiating factor for ischemic stroke or whether the immune response in response to the viral infection worsens the severity of a stroke. In support of the former possibility, elevated inflammation may heighten the risk of developing an acute ischemic stroke in the elderly, potentially via modulation of the coagulation cascade, whereas the latter possibility may be explained by exacerbation of the post-stroke inflammatory response [114,115,116,117]. While it is clear that COVID-19 patients exhibiting pro-thrombotic and/or pro-inflammatory activation may require neurological evaluation, further clinical data and pre-clinical research are needed to define the mechanistic link between SARS-CoV-2 and stroke outcomes. Given the limited efficacy of broad anticoagulants in COVID-19 patients, alternative therapeutic targets are needed to reduce the detrimental effects of coagulopathies. Neutrophils are circulating innate immune cells that rapidly mobilize to phagocytose pathogens as a mechanism of host protection after an infection. An elevated neutrophil-to-lymphocyte ratio was an independent risk factor for mortality in hospitalized COVID-19 patients [118,119,120]. Recent evidence suggests that activated neutrophils also may extrude a meshwork of chromatin fibers into the extracellular space to form cloud-like neutrophil extracellular traps (NETs), which may function as a mechanism of pathogen trapping. Extensive infiltration of neutrophils into the pulmonary capillaries of COVID-19 patients was associated with fibrin deposition and vascular lesions in the absence of sepsis while elevated neutrophil counts were associated with ocular dysfunction during SARS-CoV-2 infection [121,122,123,124,125]. Moreover, NETs, which stimulate pro-inflammatory responses in human airway epithelial cells [126], are present in many pulmonary diseases, including asthma, chronic obstructive pulmonary disease (COPD), cystic fibrosis, respiratory syncytial virus bronchiolitis, influenza infection, bacterial pneumonia, ARDS, and tuberculosis [127,128,129,130,131,132]. While the extent of neutrophil priming and NET formation in ARDS patients correlated with disease severity and mortality [130, 133,134,135,136], the clinical significance of NETs in the pathophysiology of COVID-19 remains undefined. Sera from COVID-19 patients displayed elevated levels of cell-free DNA, myeloperoxidase-DNA complexes, and citrullinated histone H3, suggesting NET formation and raising the possibility that NETs may provide a potential target for intervention in COVID-19 patients [121, 137]. Interestingly, in addition to roles in host defense against viruses and bacteria, NETs also provide a scaffold for thrombogenesis [138, 139]. Indeed, impaired degradation of NETs is clinically associated with acute thrombotic microangiopathies [140], while the presence of citrullinated histone H3, a biomarker of NET formation, within thrombi retrieved from acute ischemic stroke patients was independently associated with patient mortality [141, 142]. Of interest, we recently reported that elevated NET formation was associated with microvascular occlusion and cerebral hypoperfusion after acute brain injury in both mice and humans [143]. Conversely, administration of recombinant human DNase-I, an FDA-approved drug under investigation for the management of COVID-19-induced ARDS [144], improved blood flow and outcomes after both experimental stroke and traumatic brain injury [143, 145,146,147]. Thus, the widespread generation of NETs after SARS-CoV-2 may provide a potential target to reduce acute and chronic neurological consequences, including headache, elevated stroke risk, and potential cognitive issues due to COVID-19. Challenges for the clinical management of COVID-19 A number of medications are being investigated in COVID-19 management, including remdesivir, lopinavir/ritonavir combination, HIV protease inhibitors, chloroquine, and hydroxychloroquine, which may inhibit viral replication in the early stages of infection [148]. In addition, immune-based approaches, such as convalescent plasma, SARS-CoV-2 immunoglobulins, non-specific intravenous immunoglobulins (IVIG), and mesenchymal stem cells, as well as immunomodulatory medications such as corticosteroids (dexamethasone), interferons (IFNα and IFNβ), interleukin inhibitors (IL-1 and IL-6 inhibitors), and kinase inhibitors (Bruton’s tyrosine kinase or Janus kinase inhibitors) are frequently employed as treatment options [3]. On top of the neurological manifestations of SARS-CoV-2, many of these therapies potentially exhibit adverse neurological effects. For example, chloroquine and hydroxychloroquine may be associated with neuropsychiatric adverse effects, retinopathy, ataxia, seizures, and limbic encephalitis [149] while ribavirin and interferons are linked to retinopathy and neuropsychiatric consequences [150]. Seizures a reported symptom of SARS-CoV-2 infection, even in patients with no past medical history of epilepsy; however, an increased occurrence of seizures may be an adverse effect of anti-viral medications (e.g., lopinavir, ritonavir, ribavirin) [151]. Thus, further research to distinguish the deleterious neurological consequences of SARS-CoV-2 from the neurological side effects of COVID-19 therapies is necessary to advance clinical care. Several co-morbidities associated with neurological dysfunction, including obesity, high body mass index, diabetes, and hypertension correlate with increased rates of infection and worse COVID-19 patient outcomes [152,153,154,155]. Therefore, a unique challenge of managing SARS-CoV-2 will be managing the detrimental consequences of co-morbidities with the treatment of COVID-19. Administration of anti-coagulants and statins may encounter drug interactions with the lopinavir/ritonavir combination used for COVID-19 management [150]. Myasthenia gravis or Lambert-Eaton myasthenic syndrome patients receiving immunosuppressive therapy may display a more severe COVID-19 illness and require alternative treatments to avoid myasthenic crisis [156]. In such patients, the administration of IVIG may improve outcomes whereas hydroxychloroquine could worsen the myasthenic crisis [157]. A case report study of a relapsing-remitting multiple sclerosis (MS) patient with SARS-CoV2 infection reported a worsening of neurological symptoms at initial presentation [158]. While the current consensus is to continue disease-modifying treatments, SARS-CoV-2 infected MS patients may benefit from. interferon therapy, suggesting some alterations in the MS treatment regimen may enhance outcomes [159, 160]. Finally, there is a growing appreciation for the psychiatric effects of COVID-19. A comprehensive meta-analysis study of SARS or MERS cases revealed that infected patients exhibited confusion (27.9% of cases), depression (32.6%), anxiety (35.7%), impaired memory (34.1%), and insomnia (41.9%) in the acute phase while post-traumatic stress (32.2%), depression (10.5%), insomnia (12.1%), anxiety (12.3%), irritability (12.8%), and memory impairment (18.9%) chronically persisted after recovery [161]. In line with these findings, COVID-19 patients under intensive care showed signs of delirium with confusion (65%), agitations (69%), and altered consciousness (21%), while 33% showed dysexecutive syndrome at discharge [161]. Therefore, a psychiatric evaluation of patients may be necessary during and beyond hospitalization, including into the chronic term as a possible neurological sequela of COVID-19. The COVID-19 pandemic, caused by the novel SARS-CoV-2 virus, is associated with a broad pathophysiology that has resulted in worldwide mortality and morbidity. While primarily regarded as a respiratory virus, SARS-CoV-2 produces wide-ranging and often unpredictable neurological symptoms, ranging from anosmia to encephalitis to increased stroke risk (Fig. 1), that complicate clinical management. Improved development, validation, and implementation of rapid imaging techniques, such as MRI, may aid in early diagnosis and proactive intervention to limit long-term neurological consequences. Future research defining whether SARS-CoV-2 exhibits neurotropism and/or initiates peripheral immune activation and hypercoagulation to affect brain function will be paramount for the development of efficacious therapies to mitigate the deleterious neurological consequences of COVID-19, including potential benefits in the management of acute respiratory failure. Finally, the incorporation of “-omics approaches” will be useful to identify patient populations at the highest risk for developing neurological symptoms. Undoubtedly, biological variables, including sex, age, comorbid conditions (e.g., hypertension, diabetes, stress), pre-existing neurological diseases, and other yet undefined genetic polymorphisms dictate the clinical course of SARS-CoV-2 infection. These unbiased, population-wide investigations will provide valuable information to guide clinical practice in the management of COVID-19, as well as to aid in the management of future pandemics. Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, et al. A novel coronavirus associated with severe acute respiratory syndrome. New England journal of medicine. 2003;348(20):1953–66. Kuiken T, Fouchier RA, Schutten M, Rimmelzwaan GF, Van Amerongen G, van Riel D, et al. Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. The Lancet. 2003;362(9380):263–70. Drosten C, Günther S, Preiser W, Van Der Werf S, Brodt H-R, Becker S, et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. New England journal of medicine. 2003;348(20):1967–76. de Groot RJ, Baker SC, Baric RS, Brown CS, Drosten C, Enjuanes L, et al. Commentary: Middle East respiratory syndrome coronavirus (MERS-CoV): announcement of the Coronavirus Study Group. Journal of virology. 2013;87(14):7790–2. PubMed PubMed Central Article CAS Google Scholar Zaki AM, Van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RA. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. New England Journal of Medicine. 2012;367(19):1814–20. Del Rio C, Malani PN. COVID-19-new insights on a rapidly changing epidemic. JAMA. 2020;323(14):1339–40. PubMed Article CAS Google Scholar Richman DD, Whitley RJ, Hayden FG. Clinical virology: John Wiley & Sons; 2016. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579(7798):270–3. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497–506. Yan CH, Faraji F, Prajapati DP, Boone CE, DeConde AS. Association of chemosensory dysfunction and COVID-19 in patients presenting with influenza-like symptoms. International forum of allergy & rhinology. 2020;10(7):806–13. Dubé M, Le Coupanec A, Wong AH, Rini JM, Desforges M, Talbot PJ. Axonal transport enables neuron-to-neuron propagation of human coronavirus OC43. Journal of virology. 2018;92(17):e00404–18. Helms J, Kremer S, Merdji H, Clere-Jehl R, Schenck M, Kummerlen C, et al. Neurologic features in severe SARS-CoV-2 infection. N Engl J Med. 2020;382(23):2268–70. Talbot PJ, Ékandé S, Cashman NR, Mounir S, Stewart JN. Neurotropism of human coronavirus 229E. Coronaviruses. 1994:339–46. Arbour N, Day R, Newcombe J, Talbot PJ. Neuroinvasion by human respiratory coronaviruses. J Virol. 2000;74(19):8913–21. Siepmann T, Sedghi A, Simon E, Winzer S, Barlinn J, de With K, et al. Increased risk of acute stroke among patients with severe COVID-19: a multicenter study and meta-analysis. Eur J Neurol. 2020. Sweid A, Hammoud B, Bekelis K, Missios S, Tjoumakaris SI, Gooch MR, et al. Cerebral ischemic and hemorrhagic complications of coronavirus disease 2019. Int J Stroke. 2020;1747493020937189. Sweid A, Hammoud B, Weinberg JH, Oneissi M, Raz E, Shapiro M, et al. Letter: thrombotic neurovascular disease in COVID-19 patients. Neurosurgery. 2020;87(3):E400–E6. Moriguchi T, Harii N, Goto J, Harada D, Sugawara H, Takamino J, et al. A first case of meningitis/encephalitis associated with SARS-Coronavirus-2. International journal of infectious diseases: IJID: official publication of the International Society for Infectious Diseases. 2020;94:55-58. Zhou L, Zhang M, Wang J, Gao J. Sars-Cov-2: underestimated damage to nervous system. Travel Med Infect Dis. 2020;36:101642. Klein DE, Libman R, Kirsch C, Arora R. Cerebral venous thrombosis: a typical presentation of COVID-19 in the young. Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association. 2020;29(8):104989. Mao L, Jin H, Wang M, Hu Y, Chen S, He Q, et al. Neurologic manifestations of hospitalized patients with coronavirus disease 2019 in Wuhan. China. JAMA neurology. 2020;77(6):683–90. Zhao H, Shen D, Zhou H, Liu J, Chen S. Guillain-Barre syndrome associated with SARS-CoV-2 infection: causality or coincidence? Lancet Neurol. 2020;19(5):383–4. Abrams RMC, Kim BD, Markantone DM, Reilly K, Paniz-Mondolfi AE, Gitman MR, et al. Severe rapidly progressive Guillain-Barre syndrome in the setting of acute COVID-19 disease. J Neurovirol. 2020. Frank CHM, Almeida TVR, Marques EA, de Sousa MQ, Feitoza PVS, Borba MGS, et al. Guillain-Barre Syndrome associated with SARS-CoV-2 infection in a pediatric patient. J Trop Pediatr. 2020. Khalifa M, Zakaria F, Ragab Y, Saad A, Bamaga A, Emad Y, et al. Guillain-Barre Syndrome associated with SARS-CoV-2 detection and a COVID-19 infection in a child. J Pediatric Infect Dis Soc. 2020. Paybast S, Gorji R, Mavandadi S. Guillain-Barre Syndrome as a neurological complication of novel COVID-19 Infection: a case report and review of the literature. Neurologist. 2020;25(4):101–3. Andries K, Pensaert M. Immunofluorescence studies on the pathogenesis of hemagglutinating encephalomyelitis virus infection in pigs after oronasal inoculation. American journal of veterinary research. 1980;41(9):1372–8. Li Y-C, Bai W-Z, Hirano N, Hayashida T, Hashikawa T. Coronavirus infection of rat dorsal root ganglia: ultrastructural characterization of viral replication, transfer, and the early response of satellite cells. Virus research. 2012;163(2):628–35. Buzhdygan TP, DeOre BJ, Baldwin-Leclair A, McGary H, Razmpour R, Galie PA, et al. The SARS-CoV-2 spike protein alters barrier function in 2D static and 3D microfluidic in vitro models of the human blood-brain barrier. bioRxiv. 2020. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. The Lancet. 2020;395(10224):565–74. Wan Y, Shang J, Graham R, Baric RS, Li F. Receptor recognition by the novel coronavirus from Wuhan: an analysis based on decade-long structural studies of SARS coronavirus. Journal of virology. 2020;94(7). To K, Lo AW. Exploring the pathogenesis of severe acute respiratory syndrome (SARS): the tissue distribution of the coronavirus (SARS-CoV) and its putative receptor, angiotensin-converting enzyme 2 (ACE2). The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2004;203(3):740–3. Tang JW, To KF, Lo AW, Sung JJ, Ng H, Chan PK. Quantitative temporal-spatial distribution of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) in post-mortem tissues. Journal of medical virology. 2007;79(9):1245–53. Kam YW, Okumura Y, Kido H, Ng LFP, Bruzzone R, Altmeyer R. Cleavage of the SARS coronavirus spike glycoprotein by airway proteases enhances virus entry into human bronchial epithelial cells in vitro. PLoS One. 2009;4(11):10. Mattern T, Scholz W, Feller A, Flad HD, Ulmer A. Expression of CD26 (dipeptidyl peptidase IV) on resting and activated human T-lymphocytes. Scandinavian journal of immunology. 1991;33(6):737–48. Boonacker E, Van Noorden CJ. The multifunctional or moonlighting protein CD26/DPPIV. European journal of cell biology. 2003;82(2):53–73. Hoffmann M, Kleine-Weber H, Schroeder S, Kruger N, Herrler T, Erichsen S, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 2020;181(2):271–80 e8. Li W, Moore MJ, Vasilieva N, Sui J, Wong SK, Berne MA, et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature. 2003;426(6965):450–4. Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z, et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. The Lancet. 2020;395(10229):1054–62. Zheng Y-Y, Ma Y-T, Zhang J-Y, Xie X. COVID-19 and the cardiovascular system. Nature Reviews Cardiology. 2020;17(5):259–60. Turner AJ, Hiscox JA, Hooper NM. ACE2: from vasopeptidase to SARS virus receptor. Trends in pharmacological sciences. 2004;25(6):291–4. Donoghue M, Hsieh F, Baronas E, Godbout K, Gosselin M, Stagliano N, et al. A novel angiotensin-converting enzyme–related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circulation research. 2000;87(5):e1–9. Harmer D, Gilbert M, Borman R, Clark KL. Quantitative mRNA expression profiling of ACE 2, a novel homologue of angiotensin converting enzyme. FEBS letters. 2002;532(1-2):107–10. Hamming I, Timens W, Bulthuis M, Lely A, Navis G, van Goor H. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2004;203(2):631–7. Xia H, Lazartigues E. Angiotensin-converting enzyme 2 in the brain: properties and future directions. Journal of neurochemistry. 2008;107(6):1482–94. Oudit GY, Kassiri Z, Jiang C, Liu PP, Poutanen SM, Penninger JM, et al. SARS-coronavirus modulation of myocardial ACE2 expression and inflammation in patients with SARS. European journal of clinical investigation. 2009;39(7):618–25. Vickers C, Hales P, Kaushik V, Dick L, Gavin J, Tang J, et al. Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem. 2002;277(17):14838–43. Donoghue M, Hsieh F, Baronas E, Godbout K, Gosselin M, Stagliano N, et al. A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circ Res. 2000;87(5):E1–9. Tipnis SR, Hooper NM, Hyde R, Karran E, Christie G, Turner AJ. A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem. 2000;275(43):33238–43. Chan PK, To KF, Lo AW, Cheung JL, Chu I, Au FW, et al. Persistent infection of SARS coronavirus in colonic cells in vitro. Journal of medical virology. 2004;74(1):1–7. Ding Y, Wang H, Shen H, Li Z, Geng J, Han H, et al. The clinical pathology of severe acute respiratory syndrome (SARS): a report from China. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2003;200(3):282–9. Hamming I, Timens W, Bulthuis ML, Lely AT, Navis G, van Goor H. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol. 2004;203(2):631–7. Gowrisankar YV, Clark MA. Angiotensin II regulation of angiotensin-converting enzymes in spontaneously hypertensive rat primary astrocyte cultures. Journal of neurochemistry. 2016;138(1):74–85. Xiao L, Haack KK, Zucker IH. Angiotensin II regulates ACE and ACE2 in neurons through p38 mitogen-activated protein kinase and extracellular signal-regulated kinase 1/2 signaling. Am J Physiol Cell Physiol. 2013;304(11):C1073–9. Yeh EA, Collins A, Cohen ME, Duffner PK, Faden H. Detection of coronavirus in the central nervous system of a child with acute disseminated encephalomyelitis. Pediatrics. 2004;113(1):e73–e6. Hui DS, Zumla A. Severe acute respiratory syndrome: historical, epidemiologic, and clinical features. Infectious Disease Clinics. 2019;33(4):869–89. Butowt R, Bilinska K. SARS-CoV-2: Olfaction, brain infection, and the urgent need for clinical samples allowing earlier virus detection. ACS Chem Neurosci. 2020;11(9):1200–3. Iwata-Yoshikawa N, Okamura T, Shimizu Y, Hasegawa H, Takeda M, Nagata N. TMPRSS2 contributes to virus spread and immunopathology in the airways of murine models after coronavirus infection. J Virol. 2019;93(6). Bilinska K, Jakubowska P, Von Bartheld CS, Butowt R. Expression of the SARS-CoV-2 entry proteins, ACE2 and TMPRSS2, in cells of the olfactory epithelium: identification of cell types and trends with age. ACS Chem Neurosci. 2020;11(11):1555–62. Li YC, Bai WZ, Hirano N, Hayashida T, Taniguchi T, Sugita Y, et al. Neurotropic virus tracing suggests a membranous-coating-mediated mechanism for transsynaptic communication. Journal of Comparative Neurology. 2013;521(1):203–12. Matsuda K, Park C, Sunden Y, Kimura T, Ochiai K, Kida H, et al. The vagus nerve is one route of transneural invasion for intranasally inoculated influenza a virus in mice. Veterinary pathology. 2004;41(2):101–7. Gu J, Gong E, Zhang B, Zheng J, Gao Z, Zhong Y, et al. Multiple organ infection and the pathogenesis of SARS. The Journal of experimental medicine. 2005;202(3):415–24. Ding Y, He L, Zhang Q, Huang Z, Che X, Hou J, et al. Organ distribution of severe acute respiratory syndrome (SARS) associated coronavirus (SARS-CoV) in SARS patients: implications for pathogenesis and virus transmission pathways. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2004;203(2):622–30. Xu J, Zhong S, Liu J, Li L, Li Y, Wu X, et al. Detection of severe acute respiratory syndrome coronavirus in the brain: potential role of the chemokine mig in pathogenesis. Clinical infectious diseases. 2005;41(8):1089–96. Li K, Wohlford-Lenane C, Perlman S, Zhao J, Jewell AK, Reznikov LR, et al. Middle East respiratory syndrome coronavirus causes multiple organ damage and lethal disease in mice transgenic for human dipeptidyl peptidase 4. J Infect Dis. 2016;213(5):712–22. McCray PB Jr, Pewe L, Wohlford-Lenane C, Hickey M, Manzel L, Shi L, et al. Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. J Virol. 2007;81(2):813–21. Netland J, Meyerholz DK, Moore S, Cassell M, Perlman S. Severe acute respiratory syndrome coronavirus infection causes neuronal death in the absence of encephalitis in mice transgenic for human ACE2. J Virol. 2008;82(15):7264–75. Eliezer M, Hautefort C, Hamel AL, Verillaud B, Herman P, Houdart E, et al. Sudden and complete olfactory loss function as a possible symptom of COVID-19. JAMA Otolaryngol Head Neck Surg. 2020. Hwang C. Olfactory neuropathy in severe acute respiratory syndrome: report of a case. Acta Neurologica Taiwanica. 2006;15(1):26. Xydakis MS, Dehgani-Mobaraki P, Holbrook EH, Geisthoff UW, Bauer C, Hautefort C, et al. Smell and taste dysfunction in patients with COVID-19. Lancet Infect Dis. 2020. Pleasure SJ, Green AJ, Josephson SA. The spectrum of neurologic disease in the severe acute respiratory syndrome coronavirus 2 pandemic infection: neurologists move to the frontlines. JAMA neurology. 2020;77(6):679–80. Burgueno JF, Reich A, Hazime H, Quintero MA, Fernandez I, Fritsch J, et al. Expression of SARS-CoV-2 entry molecules ACE2 and TMPRSS2 in the gut of patients with IBD. Inflamm Bowel Dis. 2020;26(6):797–808. Lin L, Jiang X, Zhang Z, Huang S, Zhang Z, Fang Z, et al. Gastrointestinal symptoms of 95 cases with SARS-CoV-2 infection. Gut. 2020;69(6):997–1001. Bostanciklioglu M. Temporal correlation between neurological and gastrointestinal symptoms of SARS-CoV-2. Inflamm Bowel Dis. 2020;26(8):e89–91. Brann DH, Tsukahara T, Weinreb C, Lipovsek M, Van den Berge K, Gong B, et al. Non-neuronal expression of SARS-CoV-2 entry genes in the olfactory system suggests mechanisms underlying COVID- 19-associated anosmia. Sci Adv. 2020. Chen M, Reed RR, Lane AP. Chronic inflammation directs an olfactory stem cell functional switch from neuroregeneration to immune defense. Cell Stem Cell. 2019;25(4):501–13 e5. Plasschaert LW, Zilionis R, Choo-Wing R, Savova V, Knehr J, Roma G, et al. A single-cell atlas of the airway epithelium reveals the CFTR-rich pulmonary ionocyte. Nature. 2018;560(7718):377–81. Bihun CG, Percy DH. Morphologic changes in the nasal cavity associated with sialodacryoadenitis virus infection in the Wistar rat. Vet Pathol. 1995;32(1):1–10. Katze MG, He Y, Gale M Jr. Viruses and interferon: a fight for supremacy. Nat Rev Immunol. 2002;2(9):675–87. Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol. 2006;7(2):131–7. Garcia-Sastre A, Biron CA. Type 1 interferons and the virus-host relationship: a lesson in detente. Science. 2006;312(5775):879–82. Channappanavar R, Fehr AR, Vijay R, Mack M, Zhao J, Meyerholz DK, et al. Dysregulated type I interferon and inflammatory monocyte-macrophage responses cause lethal pneumonia in SARS-CoV-infected mice. Cell host & microbe. 2016;19(2):181–93. Chen G, Wu D, Guo W, Cao Y, Huang D, Wang H, et al. Clinical and immunological features of severe and moderate coronavirus disease 2019. The Journal of clinical investigation. 2020;130(5):2620–9. Pedersen SF, Ho YC. SARS-CoV-2: a storm is raging. The Journal of clinical investigation. 2020;130(5):2202–5. Diao B, Wang C, Tan Y, Chen X, Liu Y, Ning L, et al. Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019 (COVID-19). Front Immunol. 2020;11:827. Mehta P, McAuley DF, Brown M, Sanchez E, Tattersall RS, Manson JJ, et al. COVID-19: consider cytokine storm syndromes and immunosuppression. Lancet. 2020;395(10229):1033–4. Mehta P, McAuley DF, Brown M, Sanchez E, Tattersall RS, Manson JJ. COVID-19: consider cytokine storm syndromes and immunosuppression. The Lancet. 2020;395(10229):1033–4. Vaibhav K, Braun M, Khan MB, Fatima S, Saad N, Shankar A, et al. Remote ischemic post-conditioning promotes hematoma resolution via AMPK-dependent immune regulation. J Exp Med. 2018;215(10):2636–54. Braun M, Khan ZT, Khan MB, Kumar M, Ward A, Achyut BR, et al. Selective activation of cannabinoid receptor-2 reduces neuroinflammation after traumatic brain injury via alternative macrophage polarization. Brain, behavior, and immunity. 2018;68:224–37. Braun M, Vaibhav K, Saad N, Fatima S, Brann DW, Vender JR, et al. Activation of myeloid TLR4 mediates T lymphocyte polarization after traumatic brain injury. Journal of immunology. 2017;198(9):3615–26. Braun M, Vaibhav K, Saad NM, Fatima S, Vender JR, Baban B, et al. White matter damage after traumatic brain injury: a role for damage associated molecular patterns. Biochimica et biophysica acta Molecular basis of disease. 2017;1863(10 Pt B):2614–26. Poyiadji N, Shahin G, Noujaim D, Stone M, Patel S, Griffith B. COVID-19-associated acute hemorrhagic necrotizing encephalopathy: imaging features. Radiology. 2020;296(2):E119–E20. Wong AM, Simon EM, Zimmerman RA, Wang HS, Toh CH, Ng SH. Acute necrotizing encephalopathy of childhood: correlation of MR findings and clinical outcome. AJNR Am J Neuroradiol. 2006;27(9):1919–23. Raabe A, Wissing H, Zwissler B. Brain cell damage and S-100B increase after acute lung injury. Anesthesiology: The Journal of the American Society of Anesthesiologists. 2005;102(4):713–4. Pelosi P, Rocco PR. The lung and the brain: a dangerous cross-talk. Critical care. 2011;15(3):168. Na B, Zhang H, Wang G, Dai L, Xia G. The effect of mechanical ventilation on TASK-1 expression in the brain in a rat model. Canadian respiratory journal. 2017;2017:8530352. Della Torre V, Badenes R, Corradi F, Racca F, Lavinio A, Matta B, et al. Acute respiratory distress syndrome in traumatic brain injury: how do we manage it? Journal of thoracic disease. 2017;9(12):5368–81. Lester SN, Li K. Toll-like receptors in antiviral innate immunity. J Mol Biol. 2014;426(6):1246–64. Alexopoulou L, Holt AC, Medzhitov R, Flavell RA. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature. 2001;413(6857):732–8. Zhao J, Wohlford-Lenane C, Zhao J, Fleming E, Lane TE, McCray PB Jr, et al. Intranasal treatment with poly(I*C) protects aged mice from lethal respiratory virus infections. J Virol. 2012;86(21):11416–24. Kumaki Y, Salazar AM, Wandersee MK, Barnard DL. Prophylactic and therapeutic intranasal administration with an immunomodulator, Hiltonol((R)) (Poly IC:LC), in a lethal SARS-CoV-infected BALB/c mouse model. Antiviral Res. 2017;139:1–12. Ngoi SM, Tovey MG, Vella AT. Targeting poly(I:C) to the TLR3-independent pathway boosts effector CD8 T cell differentiation through IFN-alpha/beta. Journal of immunology. 2008;181(11):7670–80. Qin L, Crews FT. Chronic ethanol increases systemic TLR3 agonist-induced neuroinflammation and neurodegeneration. J Neuroinflammation. 2012;9:130. Lodigiani C, Iapichino G, Carenzo L, Cecconi M, Ferrazzi P, Sebastian T, et al. Venous and arterial thromboembolic complications in COVID-19 patients admitted to an academic hospital in Milan. Italy. Thromb Res. 2020;191:9–14. Helms J, Tacquard C, Severac F, Leonard-Lorant I, Ohana M, Delabranche X, et al. High risk of thrombosis in patients with severe SARS-CoV-2 infection: a multicenter prospective cohort study. Intensive Care Med. 2020;46(6):1089–98. Kollias A, Kyriakoulis KG, Dimakakos E, Poulakou G, Stergiou GS, Syrigos K. Thromboembolic risk and anticoagulant therapy in COVID-19 patients: emerging evidence and call for action. Br J Haematol. 2020;189(5):846–7. Connors JM, Levy JH. COVID-19 and its implications for thrombosis and anticoagulation. Blood. 2020;135(23):2033–40. Milbrandt EB, Reade MC, Lee M, Shook SL, Angus DC, Kong L, et al. Prevalence and significance of coagulation abnormalities in community-acquired pneumonia. Molecular Medicine. 2009;15(11-12):438–45. Tang N, Bai H, Chen X, Gong J, Li D, Sun Z. Anticoagulant treatment is associated with decreased mortality in severe coronavirus disease 2019 patients with coagulopathy. J Thromb Haemost. 2020;18(5):1094–9. Gupta N, Zhao YY, Evans CE. The stimulation of thrombosis by hypoxia. Thromb Res. 2019;181:77–83. Deliwala S, Abdulhamid S, Abusalih MF, Al-Qasmi MM, Bachuwa G. Encephalopathy as the sentinel sign of a cortical stroke in a patient infected with coronavirus disease-19 (COVID-19). Cureus. 2020;12(5):e8121. Goldberg MF, Goldberg MF, Cerejo R, Tayal AH. Cerebrovascular disease in COVID-19. AJNR Am J Neuroradiol. 2020;41(7):1170–2. Levi M, van der Poll T. Inflammation and coagulation. Crit Care Med. 2010;38(2 Suppl):S26–34. Siniscalchi A, Gallelli L. Could COVID-19 represent a negative prognostic factor in patients with stroke? Infect Control Hosp Epidemiol. 2020;1. Siniscalchi A, Gallelli L, Malferrari G, Pirritano D, Serra R, Santangelo E, et al. Cerebral stroke injury: the role of cytokines and brain inflammation. J Basic Clin Physiol Pharmacol. 2014;25(2):131–7. Siniscalchi A, Iannacchero R, Anticoli S, Pezzella FR, De Sarro G, Gallelli L. Anti-inflammatory strategies in stroke: a potential therapeutic target. Curr Vasc Pharmacol. 2016;14(1):98–105. Consoli D, Vidale S, Aguglia U, Bassi P, Cavallini A, Galati F, et al. Previous infection and the risk of ischaemic stroke in Italy: the IN2 study. Eur J Neurol. 2015;22(3):514–9. Liu Y, Du X, Chen J, Jin Y, Peng L, Wang HHX, et al. Neutrophil-to-lymphocyte ratio as an independent risk factor for mortality in hospitalized patients with COVID-19. J Infect. 2020;81(1):e6–e12. Sun S, Cai X, Wang H, He G, Lin Y, Lu B, et al. Abnormalities of peripheral blood system in patients with COVID-19 in Wenzhou. China. Clin Chim Acta. 2020;507:174–80. Yan X, Li F, Wang X, Yan J, Zhu F, Tang S, et al. Neutrophil to lymphocyte ratio as prognostic and predictive factor in patients with coronavirus disease 2019: a retrospective cross-sectional study. J Med Virol. 2020. Barnes BJ, Adrover JM, Baxter-Stoltzfus A, Borczuk A, Cools-Lartigue J, Crawford JM, et al. Targeting potential drivers of COVID-19: neutrophil extracellular traps. J Exp Med. 2020;217(6). Yao X, Li T, He Z, Ping Y, Liu H, Yu S, et al. A pathological report of three COVID-19 cases by minimally invasive autopsies. Zhonghua bing li xue za zhi=Chinese journal of pathology. 2020;49:E009–E. Wu P, Duan F, Luo C, Liu Q, Qu X, Liang L, et al. Characteristics of ocular findings of patients with coronavirus disease 2019 (COVID-19) in Hubei Province. China. JAMA Ophthalmol. 2020;138(5):575–8. Fox SE, Akmatbekov A, Harbert JL, Li G, Quincy Brown J, Vander Heide RS. Pulmonary and cardiac pathology in African American patients with COVID-19: an autopsy series from New Orleans. Lancet Respir Med. 2020;8(7):681–6. Magro C, Mulvey JJ, Berlin D, Nuovo G, Salvatore S, Harp J, et al. Complement associated microvascular injury and thrombosis in the pathogenesis of severe COVID-19 infection: a report of five cases. Transl Res. 2020;220:1–13. Sabbione F, Keitelman IA, Iula L, Ferrero M, Giordano MN, Baldi P, et al. Neutrophil extracellular traps stimulate proinflammatory responses in human airway epithelial cells. J Innate Immun. 2017;9(4):387–402. Barnes BJ, Adrover JM, Baxter-Stoltzfus A, Borczuk A, Cools-Lartigue J, Crawford JM, et al. Targeting potential drivers of COVID-19: neutrophil extracellular traps. Journal of Experimental Medicine. 2020;217(6). Porto BN, Stein RT. Neutrophil extracellular traps in pulmonary diseases: too much of a good thing?, Front Immunol. 2016;7:311. Li H, Zhou X, Tan H, Hu Y, Zhang L, Liu S, et al. Neutrophil extracellular traps contribute to the pathogenesis of acid-aspiration-induced ALI/ARDS. Oncotarget. 2017;9(2):1772–84. Mikacenic C, Moore R, Dmyterko V, West TE, Altemeier WA, Liles WC, et al. Neutrophil extracellular traps (NETs) are increased in the alveolar spaces of patients with ventilator-associated pneumonia. Critical Care. 2018;22(1):358. Sorvillo N, Cherpokova D, Martinod K, Wagner DD. Extracellular DNA NET-Works with dire consequences for health. Circulation Research. 2019;125(4):470–88. Caudrillier A, Kessenbrock K, Gilliss BM, Nguyen JX, Marques MB, Monestier M, et al. Platelets induce neutrophil extracellular traps in transfusion-related acute lung injury. The Journal of clinical investigation. 2012;122(7):2661–71. Adrover JM, Aroca-Crevillén A, Crainiciuc G, Ostos F, Rojas-Vega Y, Rubio-Ponce A, et al. Programmed ‘disarming’of the neutrophil proteome reduces the magnitude of inflammation. Nature Immunology. 2020:1–10. Bendib I, de Chaisemartin L, Granger V, Schlemmer F, Maitre B, Hüe S, et al. Neutrophil extracellular traps are elevated in patients with pneumonia-related acute respiratory distress syndrome. Anesthesiology: The Journal of the American Society of Anesthesiologists. 2019;130(4):581–91. Ebrahimi F, Giaglis S, Hahn S, Blum CA, Baumgartner C, Kutz A, et al. Markers of neutrophil extracellular traps predict adverse outcome in community-acquired pneumonia: secondary analysis of a randomised controlled trial. European respiratory journal. 2018;51(4). Lefrançais E, Mallavia B, Zhuo H, Calfee CS, Looney MR. Maladaptive role of neutrophil extracellular traps in pathogen-induced lung injury. JCI insight. 2018;3(3). Zuo Y, Yalavarthi S, Shi H, Gockman K, Zuo M, Madison JA, et al. Neutrophil extracellular traps in COVID-19. JCI Insight. 2020;5(11). Fuchs TA, Brill A, Duerschmied D, Schatzberg D, Monestier M, Myers DD Jr, et al. Extracellular DNA traps promote thrombosis. Proc Natl Acad Sci U S A. 2010;107(36):15880–5. Jimenez-Alcazar M, Rangaswamy C, Panda R, Bitterling J, Simsek YJ, Long AT, et al. Host DNases prevent vascular occlusion by neutrophil extracellular traps. Science. 2017;358(6367):1202–6. Jimenez-Alcazar M, Napirei M, Panda R, Kohler EC, Kremer Hovinga JA, Mannherz HG, et al. Impaired DNase1-mediated degradation of neutrophil extracellular traps is associated with acute thrombotic microangiopathies. J Thromb Haemost. 2015;13(5):732–42. Valles J, Lago A, Santos MT, Latorre AM, Tembl JI, Salom JB, et al. Neutrophil extracellular traps are increased in patients with acute ischemic stroke: prognostic significance. Thromb Haemost. 2017;117(10):1919–29. Laridan E, Denorme F, Desender L, Francois O, Andersson T, Deckmyn H, et al. Neutrophil extracellular traps in ischemic stroke thrombi. Ann Neurol. 2017;82(2):223–32. Vaibhav K, Braun M, Alverson K, Khodadadi H, Kutiyanawalla A, Ward A, et al. Neutrophil extracellular traps exacerbate neurological deficits after traumatic brain injury. Sci Adv. 2020;6:eaax8847. Earhart AP, Holliday ZM, Hofmann HV, Schrum AG. Consideration of dornase alfa for the treatment of severe COVID-19 acute respiratory distress syndrome. New Microbes New Infect. 2020;35:100689. De Meyer SF, Suidan GL, Fuchs TA, Monestier M, Wagner DD. Extracellular chromatin is an important mediator of ischemic stroke in mice. Arterioscler Thromb Vasc Biol. 2012;32(8):1884–91. Pena-Martinez C, Duran-Laforet V, Garcia-Culebras A, Ostos F, Hernandez-Jimenez M, Bravo-Ferrer I, et al. Pharmacological modulation of neutrophil extracellular traps reverses thrombotic stroke tPA (Tissue-Type Plasminogen Activator) resistance. Stroke. 2019;50(11):3228–37. Ducroux C, Di Meglio L, Loyau S, Delbosc S, Boisseau W, Deschildre C, et al. Thrombus neutrophil extracellular traps content impair tPA-induced thrombolysis in acute ischemic stroke. Stroke. 2018;49(3):754–7. Siddiqi HK, Mehra MR. COVID-19 illness in native and immunosuppressed states: a clinical-therapeutic staging proposal. J Heart Lung Transplant. 2020;39(5):405–7. Maxwell NM, Nevin RL, Stahl S, Block J, Shugarts S, Wu AH, et al. Prolonged neuropsychiatric effects following management of chloroquine intoxication with psychotropic polypharmacy. Clin Case Rep. 2015;3(6):379–87. Bridwell R, Long B, Gottlieb M. Neurologic complications of COVID-19. Am J Emerg Med. 2020;38(7):1549 e3–7. Niazkar HR, Zibaee B, Nasimi A, Bahri N. The neurological manifestations of COVID-19: a review article. Neurol Sci. 2020;41(7):1667–71. Simonnet A, Chetboun M, Poissy J, Raverdy V, Noulette J, Duhamel A, et al. High prevalence of obesity in severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) requiring invasive mechanical ventilation. Obesity (Silver Spring). 2020;28(7):1195–9. Nakeshbandi M, Maini R, Daniel P, Rosengarten S, Parmar P, Wilson C, et al. The impact of obesity on COVID-19 complications: a retrospective cohort study. Int J Obes (Lond). 2020;44(9):1832–7. Malik VS, Ravindra K, Attri SV, Bhadada SK, Singh M. Higher body mass index is an important risk factor in COVID-19 patients: a systematic review and meta-analysis. Environ Sci Pollut Res Int. 2020. Apicella M, Campopiano MC, Mantuano M, Mazoni L, Coppelli A, Del Prato S. COVID-19 in people with diabetes: understanding the reasons for worse outcomes. Lancet Diabetes Endocrinol. 2020;8(9):782–92. International MGC-WG, Jacob S, Muppidi S, Guidon A, Guptill J, Hehir M, et al. Guidance for the management of myasthenia gravis (MG) and Lambert-Eaton myasthenic syndrome (LEMS) during the COVID-19 pandemic. J Neurol Sci. 2020;412:116803. Delly F, Syed MJ, Lisak RP, Zutshi D. Myasthenic crisis in COVID-19. J Neurol Sci. 2020;414:116888. Barzegar M, Mirmosayyeb O, Nehzat N, Sarrafi R, Khorvash F, Maghzi AH, et al. COVID-19 infection in a patient with multiple sclerosis treated with fingolimod. Neurol Neuroimmunol Neuroinflamm. 2020;7(4). Berger JR, Brandstadter R, Bar-Or A. COVID-19 and MS disease-modifying therapies. Neurol Neuroimmunol Neuroinflamm. 2020;7(4). Maguire C, Frohman T, Zamvil SS, Frohman E, Melamed E. Should interferons take front stage as an essential MS disease-modifying therapy in the era of coronavirus disease 2019? Neurol Neuroimmunol Neuroinflamm. 2020;7(5). Rogers JP, Chesney E, Oliver D, Pollak TA, McGuire P, Fusar-Poli P, et al. Psychiatric and neuropsychiatric presentations associated with severe coronavirus infections: a systematic review and meta-analysis with comparison to the COVID-19 pandemic. The lancet Psychiatry. 2020;7(7):611–27. The authors acknowledge the artwork prepared by Colby Zahn. The authors’ research is supported by grants from the National Institutes of Health (R01NS110378 to BB/KMD, R01117565 to KMD, R01NS099455 to DCH, R01NS112511 to DCH, U01NS113356 to DCH, R01NS114560, and R03HD094606 to KV). The funding bodies had no role in the study, analysis, or data interpretation. The authors Abbas Jarrahi and Meenakshi Ahluwalia contributed equally and should be considered co-first authors. Department of Neurosurgery, Medical College of Georgia, Augusta University, 1120 15th Street, 30912, Augusta, Georgia Abbas Jarrahi, Fernando Vale, Kumar Vaibhav & Krishnan M. Dhandapani Department of Pathology, Medical College of Georgia, Augusta University, Augusta, Georgia Meenakshi Ahluwalia & Ravindra Kolhe Department of Oral Biology and Diagnostic Sciences, Dental College of Georgia, Augusta University, Augusta, Georgia Hesam Khodadadi, Evila da Silva Lopes Salles & Babak Baban Department of Neurology, Medical College of Georgia, Augusta University, Augusta, Georgia David C. Hess Department of Allied Health Science, Shri B. M. Patil Medical College, Hospital and Research Centre, BLDE (Deemed to be University), Vijayapura, Karnataka, India Abbas Jarrahi Meenakshi Ahluwalia Hesam Khodadadi Evila da Silva Lopes Salles Ravindra Kolhe Fernando Vale Babak Baban Kumar Vaibhav Krishnan M. Dhandapani AJ, MA, BB, KV, and KMD drafted the manuscript. HK, ES, RK, DCH, FV, and MK provided intellectual input. All authors approved the final version of the manuscript. Correspondence to Krishnan M. Dhandapani. All authors agree to publication in the current form. Jarrahi, A., Ahluwalia, M., Khodadadi, H. et al. Neurological consequences of COVID-19: what have we learned and where do we go from here?. J Neuroinflammation 17, 286 (2020). https://doi.org/10.1186/s12974-020-01957-4 Neurotropism Neutrophil extracellular traps	cc/2021-04/en_middle_0039.json.gz/line918
__label__wiki	0.740052	0.740052	Lancaster Church of the Brethren Worship—How we worship Maranatha (bilingual) Ministries—How we reach out How we reach out Events—How to participate General Information, Tools, and Resources Facilities Calendar Watch our sermons on YouTube Lancaster Church of the Brethren (LCOB) collects a weekly offering at all worship services on Sunday morning. These offerings support the ministries of LCOB, as directed by the congregation-approved budget, both within the church walls and in the community at large. In addition, members of the congregation can bring special requests to the attention of the church for donation consideration. Special projects in the past have included the “Homes for Haiti” campaign, which raised over $30,000 in four weeks to help rebuild the impoverished nation after the devastating earthquake. Presently, other than attending one of our services, LCOB only accepts gifts of giving by sending a check through the mail either directly from you or using bill pay through your financial institution. Any form of giving should be made payable to Lancaster Church of the Brethren and sent to 1601 Sunset Avenue, Lancaster, PA 17601. All 2020 and 2021 Sermons available! Watch previously recorded 2020 sermons and online worship services by clicking here. Praise Kidz is on Zoom Praise Kidz meets every Sunday morning at 9 a.m. on Zoom. If you would like to join us please email Jamie Nace our Pastor of Child and Elder Ministries. Ways to Give to LCOB Looking for ways to give to LCOB? Click here to find out how. Seeking First the Kingdom Sat, Mar 26, 2022 - Mar 27, 2022 10:15 a.m.* Traditional Worship Informal: 8:00 a.m. Liturgical: 10:15 a.m.* Español/English: 10:15 a.m.* 9:00 a.m.* *Childcare Available Lancaster Church of the Brethren 1601 Sunset Avenue, Lancaster, PA 17601 — Get Directions \| (717) 397-4751 \| lancastercob1958@gmail.com © 2021 Lancaster Church of the Brethren. All rights reserved.	cc/2021-04/en_middle_0039.json.gz/line947
__label__cc	0.736973	0.263027	Temporal Dynamics of lexical and semantic features of spoken words: an MEG study Salzburg Mind-Brain Annual Meeting (SAMBA 2019), July 11-12, 2019 Vignali L., Xu Y., Turini J., Collignon O., Crepaldi D. and Bottini R. The temporal dynamics of spoken word recognition are highly debated. While some studies suggest serial processing of sublexical and lexico-semantic information (e.g., Kocagoncu et al., 2017), others reported parallel processing since early stages (e.g., Lewis & Poeppel, 2014). The current study employed multiple linear regression to predict MEG-evoked responses in 20 native Italian speakers during the semantic judgment of 438 Italian spoken words. MEG responses were modeled around the uniqueness point (UP) based on four predictors: Lexical Neighborhood size (LN), word Frequency, Vision (a semantic regressor generated from the rating of several visual features in the database of Binder et al., 2016) and participants’ response as a covariate of no interest. Sensor-level time course of event-related regressor coefficient (ERRC) showed LN-related activity from 350 ms before the UP to 240 ms after the UP, probably indicating lexical competition between similar wordforms. Frequency effects peaked at ~200 ms after the UP. The vision-related semantic regressor peaked at ~400 ms after the UP and remained significant. Source-level maps of ERRCs localized the LN effects in the bilateral supramarginal gyri and the superior temporal sulcus (STS). Frequency effects mapped mainly around the left STS and the inferior frontal gyrus (IFG). Early stages (~400 ms after the UP) of the Vision-related activity involved the bilateral IFG, the left STS, and the left ventral occipitotemporal cortex. Our results attested different processing stages of information associated with spoken words, in support for more serial information processing during spoken word recognition. Kocagoncu, E., Clarke, A., Devereux, B. J., & Tyler, L. K. (2017). Decoding the cortical dynamics of sound-meaning mapping. Journal of Neuroscience, 37(5), 1312-1319. Lewis, G., & Poeppel, D. (2014). The role of visual representations during the lexical access of spoken words. Brain and language, 134, 1-10. Poster_LorenzoVignali.pdf	cc/2021-04/en_middle_0039.json.gz/line954
__label__cc	0.631238	0.368762	OALibJ Vol.7 No.11 , November 2020 Desalination in the Context of Water Scarcity Crisis: Dares & Perspectives Djamel Ghernaout1,2, Noureddine Elboughdiri1,3 1 Chemical Engineering Department, College of Engineering, University of Ha’il, Ha’il, KSA. 2 Chemical Engineering Department, Faculty of Engineering, University of Blida, Blida, Algeria. 3 Chemical Engineering Process Department, National School of Engineering, Zrig Gabes 6029, University of Gabes, Gabes, Tunisia. Abstract: Throughout the world, providing drinking water via desalination engineering becomes a more and more adopted option. With quickly progressing desalination engineering and market maturation, desalination prices are fast dropping, and the ecological effects of desalination are steadily relieved. Even if desalination is probably to stay more costly in nearly all areas than conventional water provision solutions, it could turn into progressively a solution to satisfy inevitable deficiencies for particular markets. Consequently, desalination has to be employed strategically inside a combined water-planning program. This work discusses desalination as a practicable option to reduce a water provision-need vacuum and its techniques and features. Ecological duties should force a huge extension of used water gathering and handling; further, increasing water shortage and prices could render used water reuse growingly a profitable solution. Nontraditional solutions like wastewater reuse and desalination have to be considered jointly to deal with water shortage. Improving adopted technologies and increasing allocated funds to these future and indispensable nontraditional solutions remain unavoidable. Secured technologies like membrane processes should be largely applied throughout the world to secure potable water for all humankind. Keywords: Desalination, Seawater (SW), Brackish Water (BW), Thermal Desalination, Membrane Desalination, Water Provision-Need Vacuum Around three-quarters of the worldwide inhabitants stay below water shortage [1] [2] [3] . In several regions, withdrawals really surpass the employable water, deteriorating the reservoir. In fact, a general “mining” of nonrenewable groundwater exists. Most of the earth’s aquifers become in danger [4] . Contaminating watercourses has damaged the quality and rendered them no longer available for use [1] [5] . As a matter of demand, demographic stresses and increasing degrees of usage worsen shortage [1] . In term of supply, pressures are as well getting larger with lower accessibility since precipitation patterns vary, moreover, warming augments evaporation and demand [6] [7] [8] . Lack of adequate water delivery seriously influences populous regions especially if water supply is limited [9] [10] [11] . In fact, many solutions, conventional and nontraditional, to decrease the water provision-need vacuum exist [1] . Such options deal with the sides of handling water for fair use and ecological preservation [12] . Those strategies precisely handle lack by means of improved performance and engineering (comprising usage of desalination) and via safeguard of the resource’s standard and volume [13] [14] . The simplest option remains to let performance ameliorations in cultivation and manufacture [15] [16] [17] . For several nations, the nearly all inexpensive options stay in cultivation [18] [19] [20] . Additional options are more and more suggested via integrating enhanced efficacy of water supply and utilization [1] [21] [22] [23] [24] [25] . Even with constant ameliorations in water treatment, at the actual speed of turn, many efforts remain to be accomplished. Several nations suffering water shortage have started applying procedures to handle supply and demand, and in some situations, have reached noteworthy positive result. Nevertheless, the proportion of advance generally remains comparatively lazy [1] . Solutions focusing on provision stay restricted; further solutions confront ascendant prices. Chances for exploiting the lasting natural waters that could be sustainably and economically developed remain restricted [26] [27] . Solutions concentrating on infrastructure ameliorations will reduce around 20% of the void separating provision and need [1] . Provision as well confronts dangers from global warming [28] [29] . Dropped precipitation and increasing temperatures could more decrease the reliable resource. Under the present state, the water provision-need vacuum could not be reduced; further, water crisis coupled with ecological damage may aggravate [1] . Since stresses surpass, novel techniques will more and more add to the renewable resource [1] . Throughout the world, only around three-quarters of the freshwater taken away is consumed, and the remaining quarter is given back to nature in the form of used water. In fact, such used water constitutes a chance to augment water accessibility, especially if used water is well treated [30] [31] [32] . Ecological duties will progressively force a huge extension of gathering and purifying used water; moreover, increasing water shortage and prices could render used water reemployment growingly a profitable solution [33] [34] [35] . For particular markets and areas, desalination will stay the adopted technique [2] [13] [36] . With quickly progressing desalination engineering and market maturation, desalination prices are fast dropping, and the ecological effects of desalination are steadily relieved [14] . Even if there is more probability that desalination stays more costly than conventional water provision solutions, it can turn into progressively a solution to satisfy inevitable deficiencies for particular markets [14] . Consequently, desalination has to be employed strategically inside a combined water planning program [1] [14] . Combined water planning is obligatory to deal with such a water provision-need vacuum. What is learned from the worrying likelihood of an ever-increasing provision-need vacuum is that water stays a central section of a nation’s strategy. In fact, organizing inside the water-employing sectors should be merged inside the total organization and the set of performance and supervision-amelioration actions needed must be supported and encouraged [1] . Otherwise, water quantities and prices must be taken into account for better organization. Based mainly on the important solutions (desalination is one of them), upcoming water schemes could be suggested for a specific nation [1] [2] [13] . Employing an iterative process, nations could propose water scenarios from which to make a map of routes of development that equilibrate water provision and need. Such schemes can comprise the water need consequences. The water provision-need vacuum under each scheme could be determined. The solutions to reducing the void could therefore be defined and classified by price. At such a step, the range for nontraditional solutions like wastewater reuse and desalination will be estimated [2] [13] [14] . Planning procedures and the manner by which desalination is combined with them are well explained by researchers [1] . Such a type of combined organization is more than requested [2] [13] [14] . Desalination has to participate in decreasing the space between provision and need in the next decades [2] [13] [14] . Even if the plurality of the provision-need vacuum options stay arising from the conventional provision and need-side handling solutions mentioned above, researchers [1] focused on desalination as one of the workable choices. The cause for this is that deficiency is augmenting almost. Now, more than 150 nations are so soon employing desalination to satisfy specific parts of need [1] . The present work discusses desalination as a practicable choice to decrease a water provision-need vacuum and its techniques and features. Desalination costs are also reviewed. An outlook on the next trends is also given especially for technologies and prices. A comparison between desalination and water reuse is shortly presented. A brief discussion about some facts that nature comprises innate desalination engineering is briefly given. In the Middle East, thermal desalination plants are prevailing; however, such a situation is tending to be reversed in the benefit of membrane processes. 2. Desalination as a Workable Solution to Reduce a Water Provision-Need Vacuum 2.1. Desalination Elucidated From salty water fountains, mostly seawater (SW) or brackish water (BW), desalination (also named “desalinization”) forms freshwater [1] . Nature provides numerous illustrations of desalination. BW sources possess mostly local capacity; however, the prime raw material, SW, is relatively boundless. Desalinated water is generated from BW (salinity more than 500 mg/L and less than 30,000 mg/L) or from SW (salinity more than 30,000 mg/L and less than 44,000 mg/L). Desalination of BW provides chances to generate lower-cost water than SW desalination. Even if BW’s sources may be locally considerable, its capacity is restricted by obtainable amounts (the global volume of BW is less than 1% of the Earth’s water). Moreover, the oceans hold around 97% of the Earth’s water reservoirs and so give a boundless raw material [1] . 2.2. Secured Water Provision Solution: Desalination Comparatively to different water provision technologies, desalination remains more expensive. Further, it requires a judicious application. Such technique could generate high-quality drinking water that equips the demands of huge cities [1] [37] . Pushed by increasing need and engineering progresses, desalination price dropped quickly during the last twenty years. However, the direction toward bigger plants has brought very important economies of scale. Consequently, desalination prices have downed from a usual domain of US$ 2.50/m3 to US$ 4.00/m3 in the 1980s to prices that presently average less than US$ 1.50/m3 [1] . Consequently, desalination is beginning to be a more and more reasonably priced solution for over 150 countries that employ this technique to generate freshwater. Two years ago, around 20,000 desalination facilities were working worldwide, generating 90 million cubic meters per day of treated water each day (for around 300 million people). In fact, water treated by desalination actually constitutes almost 1% of the globe’s potable water [1] [38] . In spite of that, prices remain generally bigger than alternatives; this is why desalination in most cases stays a strategic solution. Even if the prices of desalination have decreased speedily (Figure 1), they stay nearly constantly bigger relatively to the prices of treating surface water or groundwater [1] . Figure 1 shows an acute decrease in price of desalination since the 1960s. Such technology may be adopted as a feasible choice to close the water provision-need vacuum. 3. Desalination Techniques and Their Features As a rule, in terms of engineering classes, desalination may be realized via thermal process or membrane process for removing salts from water [1] . In fact, Figure 1. Price tendencies for Seawater Reverse Osmosis (SWRO) and Multistage Flash Distillation (MSF) techniques [37] . numerous desalination techniques are below investigation and numerous methods are in the expansion phase (however, the only two that are presently commercially applicable and largely employed remain evaporation and membrane separation processes). Before twenty years, water was mostly desalinated throughout the world by thermal evaporation. Nonetheless, lately, engineering's ameliorations in RO desalination reached a fast elevation in the number of factories employing membrane method. Indeed, membrane technology represents 65% of the desalination capacity through the globe, while thermal technology attracts the remaining part (additional techniques like electrodialysis reversal (EDR) and vapor-compression (VC) distillation drive a low fraction of the market) [1] . 3.1. Desalination via Thermal Heating Desalination employing heating (boiling, evaporating, and condensing) is the earliest technique utilized for removing salts from water on an industrial scale. In terms of fundamental idea, it concerns exerting heat to form vapor from water. Such vapor is condensed into clean water, salts and pollutants are removed. In matter of thermal processes configurations, Multistage Flash Distillation (MSF) and Multiple Effect Distillation (MED) remain the most frequently utilized thermal techniques [1] [13] . 3.1.1. Multistage Flash Distillation (MSF) Among desalination techniques, MSF remains the most durable. In addition, it stays the most efficient and dealing with huge production capabilities. MSF method comprises a set of steps or cells kept at reducing pressures starting from the first step (hot) to the last one (cold). As shown in Figure 2, SW flows in on the right side via tubes in the upper part of the chambers where it is warmed by the water vapor formed in each stage. More details that are technical may be found elsewhere [1] . 3.1.2. Multiple Effect Distillation (MED) Identically to MSF, MED functions like a phenomenon founded on evaporation. The saline water passes via a set of chambers. Each successive chamber runs at a gradually lower pressure. During the MED method, the vapor produced in one chamber condenses in the following chamber with the heat-liberated working as a heating source. Further, feed water is generally sprayed over the tube bundle at the top of each chamber (the dark blue track in Figure 3). Descriptions that are more technical may be found elsewhere [1] . 3.1.3. Multiple Effect Distillation (MED) with Thermal Vapor Compressor (TVC) Increasing Multiple Effect Distillation (MED) performance could be elevated by introducing a vapor compressor. Indeed, a Thermal Vapor Compressor (TVC) could be combined with a MED setup to extract part of the steam produced in the final chamber for reuse. The extracted steam will be combined with the external steam for compression below high pressure, which then functions as a heating source in the first chamber. Since such amelioration could lead to considerable energy cost savings, MED-TVC appears as the most broadly utilized MED technique contemporarily [1] . Figure 2. Global scheme of a Multistage Flash Distillation (MSF) facility [1] . Figure 3. Illustration of Multiple Effect Distillation (MED) desalination technique [1] . 3.2. Membrane Desalination Membrane techniques adopt the natural phenomenon of osmosis. In fact, membranes have a crucial contribution in separating salts in natural phenomena like osmosis and dialysis. Such a concept has been adopted for industrial usage in water treatment via developing membranes that selectively let or block salts diffusion. Industrially obtainable membrane methods comprise reverse osmosis (RO), nanofiltration (NF), electrodialysis (ED), and EDR. RO is presently the only membrane technique utilized. The remaining membrane techniques are not widely applied at the industrial level. In fact, NF and RO use pressure; however, ED and EDR employ electrical current for removing salt [1] . RO remains a frequently employed technique for treating water. It uses a semipermeable membrane to eliminate mainly ions, molecules, and bigger particles [39] . During RO passage, an implemented pressure is utilized to beat osmotic pressure, which is due to chemical potential dissimilarities of water [40] . As an example, in the case of SW (i.e., salinity of 35,000 mg/L) on one part of the membrane and potable water (i.e., salinity of 500 mg/L) on the remaining part of the membrane, the osmotic pressure formed on the membrane is around 24 bars [1] . RO could retain several sorts of solubilized and suspended chemical substances as well as biological ones (mostly microbe) from water [39] [40] . This is why it is utilized in desalinating and treatment water fields. The solute is kept on the pressurized part of the membrane and the pure water is left to go to the other part. Such membrane must not permit big molecules to pass across the pores; however, it has to authorize smaller water molecules to go readily [1] . As illustrated in Figure 4, the feed water is pumped below great pressure across a semipermeable membrane to retain concentrate (or brine [41] ) from purified water [1] [39] [40] . Since its name implicates, the RO process is adverse to what takes place in osmosis. A pressure bigger than the osmotic pressure is implemented to saline water. As a result, freshwater flows over the membranes and salts are retained. An elevated-pressure pump pushes saline water at around 65 - 75 times the atmospheric pressure towards semipermeable membranes. The membranes are developed to authorize H2O molecules to go across them whilst keeping solubilized salts. The RO technique could be utilized both for Seawater Reverse Osmosis (SWRO) desalination and for desalination of BW (brackish water reverse osmosis, BWRO). Usually, 40% - 60% of the SW introduced into a membrane process is recuperated as purified water. For BW desalination, water recuperation could fluctuate from 50% to 90% [1] [39] [40] . Seeing that RO membranes could be blocked readily by dispersed matters and mineral scaling substances, RO devices need particular equipment not employed in thermal desalination devices to prepare the source SW [21] [41] [42] . Further, purified water after that goes through additional stage (known as post-treatment, mostly composed of pH adjustment and disinfection [43] [44] [45] ), to render it appropriate for human consumption [1] [40] [46] . Membrane techniques may as well be utilized for treating wastewater [1] [47] [48] . Indeed, membrane processes could be employed not only for removing salts from BW or SW supplies but also for dealing with used water thanks to their potential to as well retain pollutants other than salts (e.g., organic pollutants [49] [50] [51] , microalgae [52] [53] [54] , bacteria [55] [56] [57] , and viruses [58] [59] [60] ). Figure 4. Illustration of the Reverse Osmosis (RO) desalination technique [1] . 3.3. Combined Processes Combined desalination plants mix thermal desalination facility (either MSF or MED) and an SWRO desalination setup. The merged thermal and SWRO plants are usually co-located with a power generation station; further, they share a joint intake and outfall. Hybrids are mostly adopted if there is a large change in power or water demand need diurnally or between seasons. This permits the combined plant to benefit from cheap energy when it is accessible; however, to satisfy needed degrees of water production via switching between SWRO and thermal technology following which system provides the cheapest product at the time. Since such a strategy needs accurate planning for the equilibrating of water and power supply and need at the least cost, it is commonly unsuitable for “retrofitting” onto present power production facilities. Frequently, hybrids constitute part of a novel build merged water and power generation complex expanded as an “independent water and power project” [1] . 3.4. Expansion Patterns of the Frequently Employed Desalination Techniques SWRO has surpassed thermal method. Now it constitutes two-thirds of used capacity throughout the world. Until 2000’s, thermal technology (especially MSF) was the most frequently employed technique. Employing SWRO technology has speeded up during the ultimate twenty years thanks to its lower energy usage and progresses in applied techniques (especially membrane processes and pretreatment method) [41] that have rendered it very ruthless, even in the highly saline SWs in which thermal technologies were previously more ruthless. Six years ago, the SWRO technique constituted almost 63% of the global desalination capacity (Figure 5), pursued by MSF (23%) and MED (8%). ED, hybrids, and other technologies took the remaining 6% desalination capacity [1] [61] . Figure 5. Global cumulative capacity of SW desalination by technology, 1980-2014 [1] . 4. Desalination Prices As a rule, overall costs have been quickly decreasing. Indeed, new usual prices of water treatment depict large decreases for MSF and MED, but in particular, for SWRO that is presently knowing costs around US$ 0.64/m3. Researchers [1] formed a database including more than fifty desalination projects throughout the globe built during the previous twenty years (Table 1). As an illustration, Table 1 presents the real prices of desalination following method and feed water reservoir for SWRO factories [1] . 5. Future Trends 5.1. Nature Includes Innate Desalination Engineering As the main part of the water cycle, evaporating water over the oceans and seas stays the most evident natural phenomenon for removing salts from water (Figure 6) [1] [13] [62] . More details about the simulation of the open sky SW distillation may found elsewhere [13] . One more phenomenon remains the generation of sea ice. Such phenomenon forms ice with a little salt that is much lower than that in SW [1] . Desalination takes also place in the plant world (Figure 7) [63] . Indeed, mangrove trees grow in SW, liberating the salt in their roots and leaves. Further, willow trees and reeds absorb salt and additional pollutants, successfully removing salt from water. Such a natural desalination phenomenon is exploited in industrially constructed wetlands for dealing with urban used water [1] . Astonishingly, the animal world could as well desalinate. Seabirds like pelicans, petrels, albatrosses, gulls, and terns distill SW utilizing a gland that liberates highly concentrated brine near the nostrils above the beak. The bird then “sneezes” the brine out. This lets birds to drink salty water from the ocean while they are far from land [1] . Table 1. Summary of worldwide SW desalination prices (Costs are at 2016 estimates. MED-TVC = Multiple Effect Distillation with Thermal Vapor Compression; MLD = million liters per day; MSF = Multistage Flash Distillation; O&M = Operation and Maintenance; SWRO = Seawater Reverse Osmosis) [1] . Figure 6. The hydrologic cycle [62] . Figure 7. Salt crystals on Black Mangrove [63] . 5.2. Prevailing Thermal Desalination Plants in the Middle East: Towards Its Reversal in the Benefit of Membrane Processes Thermal techniques are utilized everywhere in the Middle East [1] . It is possible that such technologies will persist to be famous in the area for numerous causes. The regional seas are highly saline and warm, and periodically have elevated levels of organic matter, which are hard conditions for membrane desalination engineering. Further, thermal techniques could employ low-temperature waste steam from power production turbines; consequently, colocation of desalination and power production for considerable efficiency savings, profiting from shared intake and discharge structures as well as increasing energy efficiencies (mostly by 15%). Such causes, merged with the low-cost energy in the region, render thermal techniques a more interesting desalination technique in such a region than in most other areas. Moreover, membrane plants have only lately attained the huge generation capabilities requested in such an area. However, such a tendency may be reversed towards membrane techniques due to global warming gases, as thermal desalination employs oils to get energy at least it will use solar energy [64] [65] . 5.3. Outlooks for Technologies and Prices Desalination engineering has ameliorated, and prices persist to down greatly [1] . From 1980 to 2005, the price of desalination dropped by more than half (Figure 8). Even if desalination stays costly juxtaposed to traditional water treatment techniques, more decreases in prices are possibly to close the space more in the next twenty years. Such progresses are most probably to be in desalination engineering, in pretreatment [66] [67] [68] , in brine management [14] [46] , and in energy efficiency and sourcing [2] [29] [36] . Additional huge price discounts are predictable, especially for SWRO, in which prices are awaited to more drop by up to two-thirds during the following twenty years thanks to technological ameliorations in membrane design and system integration [1] . 5.3.1. Progresses in Traditional Desalination Methods While only comparatively restricted additional amelioration in thermal techniques is anticipated, elevating performance in fundamental price elements will persist to render SWRO more competitive. Among such cost-decreasing ingredients has been the amelioration in membrane productivity that has doubled during the last two decades. Ameliorations are continuing apace, as freshly expanded membrane elements give flexibility and choice and allow trade-offs Figure 8. Trends in the cost of desalination of Multistage Flash (MSF) distillation and Seawater Reverse Osmosis (SWRO) plants [1] . among productivity and energy prices. In fact, such ameliorations in membrane performance rather than in energy recovery that are anticipated to support the position of SWRO as the most cost-competitive process in most circumstances [1] . 5.3.2. Arising Technical Progress with Elevated Desalination Price Lowering Possibility In addition to the technical ameliorations previously anticipated under frequently utilized desalination techniques, several fresh methods or adaptations are arising, which could provide the potential for even bigger productivity and lower prices (Table 2). Table 2. New techniques or readjustments apt for giving the possibility for bigger productivity and lower prices [1] . The possible influence of technology expansion is spectacular and can cut SWRO prices by half or more in the next decade. Present tendencies in the depression of the desalination price, and the augmenting prices of the alternatives, are possible to persist, and it is not unlikely that cost decreases of 20% during 5 years will be encountered for SWRO and 60% in 20 years [1] [70] . 6. Desalination vs. Water Reuse Researchers [69] confronted the cost of water reuse to the cost of SW desalination. With a view to treating water of equivalent quality, an RO stage was introduced to the process flow diagrams shown in Figure 9 [16] [69] . In this situation, RO is required to eliminate dissolved organic carbon and residual nutrients like nitrate [16] [69] . For desalination, it was supposed that surface SW (TDS of 35,000 mg/L) was pretreated via coagulation and multi-media filtration before RO. The process flow diagrams are illustrated in Figure 10 and the parameters employed for the two techniques are confronted in Table 3. Figure 9. Process flow diagram for the membrane bioreactor option (MBR): (a) small plants; (b) large plants [69] . Figure 10. Process flow diagrams for comparison of water reuse and SW desalination: (a) water reuse; (b) SW desalination [69] . Table 3. Design process parameters for the RO facilities (MBR = Membrane Bioreactor, CAS-TF effluent = Conventional Activated Sludge + Tertiary Membrane Filtration) [69] . The total costs evaluated for treating RO water from secondary effluent and from SW are confronted in Table 4 for 38,000 m3/d facilities. The costs in column A do not comprise the cost linked to conventional activated sludge (CAS) since it was supposed that sewage would be treated to that degree for discharge; for simplicity, the cost for tertiary filtration assessed previously were employed as pretreatment cost for RO. It was hypothesized that the concentrate from both plants may be disposed of at no cost [16] [69] . The capital costs for a factory treating water from SW are around 50% more elevated than the costs of a factory reusing secondary sewage. Both the pretreatment costs and RO costs are more elevated. In the situation of pretreatment, this is attributed to the void in recuperation (75% for secondary effluent; 50% for SW), which conducts to a bigger SW setup. The capital cost for the SWRO process is bigger than for the secondary effluent RO since it is working at a much more important pressure, lower permeate flux, lower recovery, and should be constituted of materials that resist corrosion in SW [69] . Table 4. Costs of treating water from secondary effluent and from SW for a 38,000 m3/d factory [69] . In the same way, the O&M costs for treating RO water from SW are around 3 times bigger than the cost of reusing secondary sewage. The bigger pretreatment costs are linked to chemicals, the continuous dosage of a coagulant and more important dosage of antiscalant. The bigger RO costs are linked mainly to energy (the working pressure is five times bigger and the feed flow is 1.5 times more important), but also to membrane replacement [69] . The total life cycle costs for treating RO water from secondary effluent and SW are 0.285/m3 and 0.705/m3, respectively, a ratio of 2.55 [69] . This work discussed desalination as a practicable solution to close a water provision-need vacuum and its techniques and features. Desalination costs are also reviewed. An outlook on the next trends is also given. A comparison between desalination and water reuse is shortly presented. From this review, the following conclusions arise: Ecological duties should force a huge extension of wastewater collection and treatment, and increasing water shortage and prices will render wastewater reuse growingly an economic solution; it so far is in so water-short nations. Even if desalination is probably to stay more costly in most areas than conventional water supply solutions, it will turn into progressively a solution to satisfy inevitable deficiencies for particular markets. Nontraditional solutions like wastewater reuse and desalination have to be considered jointly to deal with water shortage. Improving adopted technologies and increasing allocated funds to these future and indispensable nontraditional solutions remain unavoidable. Secured technologies like membrane processes should be largely applied throughout the world to secure potable water for all humankind. The Research Deanship of University of Ha’il, Saudi Arabia, has funded this research through the Project RG-20 113. Cite this paper: Ghernaout, D. , Elboughdiri, N. (2020) Desalination in the Context of Water Scarcity Crisis: Dares & Perspectives. Open Access Library Journal, 7, 1-21. doi: 10.4236/oalib.1106963. [1] World Bank (2019) The Role of Desalination in an Increasingly Water-Scarce World. Washington DC. [2] Irki, S., Kasbadji-Merzouk, N., Hanini, S. and Ghernaout, D. (2020) Modelling of the Coupling of Desalination Plants with the Thermal Solar Energy System. Water Supply, 20, 1807-1822. https://doi.org/10.2166/ws.2020.092 [3] McDonald, R.I., Weber, K., Padowski, J., Florke, M., Schneider, C., Green, P.A., Gleeson, T., Eckman, S., Lehner, B., Balk, D., Boucher, T., Grill, G. and Montgomery, M. (2014) Water on an Urban Planet: Urbanization and the Reach of Urban Water Infrastructure. Global Environmental Change, 27, 96-105. https://doi.org/10.1016/j.gloenvcha.2014.04.022 [4] Richey, A.S., Thomas, B.F., Lo, M.-H., Reager, J.T. and Famiglietti, J.S. (2015) Quantifying Renewable Groundwater Stress Using GRACE. Water Resources Research, 51, 5217-5238. https://doi.org/10.1002/2015WR017349 [5] Ghernaout, D. and Ghernaout, B. (2020) Controlling COVID-19 Pandemic through Wastewater Monitoring. Open Access Library Journal, 7, e6411. https://doi.org/10.4236/oalib.1106411 [6] Veldkamp, T.I.E., Wada, Y., Aerts, J.C.J.H. and Ward, P.J. (2016) Towards a Global Water Scarcity Risk Assessment Framework Incorporation of Probability Distributions and Hydro-Climatic Variability. Environmental Research Letters, 11, Article ID: 024006. https://doi.org/10.1088/1748-9326/11/2/024006 [7] Ghernaout, D. and Elboughdiri, N. (2020) Domestic Wastewater Treatment: Difficulties and Reasons, and Prospective Solutions—China as an Example. Open Access Library Journal, 7, e6141. [8] Ghernaout, D. and Elboughdiri, N. (2020) Urgent Proposals for Disinfecting Hospital Wastewaters during COVID-19 Pandemic. Open Access Library Journal, 7, e6373. [9] Ghernaout, D., Alshammari, Y. and Alghamdi, A. (2018) Improving Energetically Operational Procedures in Wastewater Treatment Plants. International Journal of Advanced and Applied Sciences, 5, 64-72. https://doi.org/10.21833/ijaas.2018.09.010 [10] Ghernaout, D., Elboughdiri, N. and Ghareba, S. (2020) Fenton Technology for Wastewater Treatment: Dares and Trends. Open Access Library Journal, 7, e6045. [11] Ghernaout, D. and Elboughdiri, N. (2020) Advanced Oxidation Processes for Wastewater Treatment: Facts and Future Trends. Open Access Library Journal, 7, e6139. [12] Ghernaout, D. (2017) Environmental Principles in the Holy Koran and the Sayings of the Prophet Muhammad. American Journal of Environmental Protection, 6, 75-79. https://doi.org/10.11648/j.ajep.20170603.13 [13] Ghernaout, D. (2013) The Best Available Technology of Water/Wastewater Treatment and Seawater Desalination: Simulation of the Open Sky Seawater Distillation. Green and Sustainable Chemistry, 3, 68-88. https://doi.org/10.4236/gsc.2013.32012 [14] Ghernaout, D. (2020) Desalination Engineering: Environmental Impacts of the Brine Disposal and Their Control. Open Access Library Journal, 7, e6777. [15] Ghernaout, D. (2017) Water Reuse (WR): The Ultimate and Vital Solution for Water Supply Issues. International Journal of Sustainable Development Research, 3, 36-46. https://doi.org/10.11648/j.ijsdr.20170304.12 [16] Ghernaout, D., Elboughdiri, N. and Al Arni, S. (2019) Water Reuse (WR): Dares, Restrictions, and Trends. Applied Engineering, 3, 159-170. [17] Ghernaout, D., Elboughdiri, N. and Ghareba, S. (2019) Drinking Water Reuse: One-Step Closer to Overpassing the “Yuck Factor”. Open Access Library Journal, 6, e5895. [18] Al Arni, S., Amous, J. and Ghernaout, D. (2019) On the Perspective of Applying of a New Method for Wastewater Treatment Technology: Modification of the Third Traditional Stage with Two Units, One by Cultivating Microalgae and Another by Solar Vaporization. International Journal of Environmental Sciences & Natural Resources, 16, Article ID: 555934. https://doi.org/10.19080/IJESNR.2019.16.555934 [19] Ghernaout, D. (2019) Reviviscence of Biological Wastewater Treatment—A Review. Applied Engineering, 3, 46-55. [20] Ghernaout, D. and Elboughdiri, N. (2019) Upgrading Wastewater Treatment Plant to Obtain Drinking Water. Open Access Library Journal, 6, e5959. https://doi.org/10.4236/oalib.1105959 [21] Ghernaout, D., Alshammari, Y., Alghamdi, A., Aichouni, M., Touahmia, M. and Ait Messaoudene, N. (2018) Water Reuse: Extenuating Membrane Fouling in Membrane Processes. International Journal of Environmental Chemistry, 2, 1-12. https://doi.org/10.11648/j.ajche.20180602.12 [22] Ghernaout, D. (2018) Increasing Trends towards Drinking Water Reclamation from Treated Wastewater. World Journal of Applied Chemistry, 3, 1-9. https://doi.org/10.11648/j.wjac.20180301.11 [23] Ghernaout, D. and Elboughdiri, N. (2020) Electrochemical Technology for Wastewater Treatment: Dares and Trends. Open Access Library Journal, 7, e6020. [24] Ghernaout, D. and Elboughdiri, N. (2019) Water Reuse: Emerging Contaminants Elimination—Progress and Trends. Open Access Library Journal, 6, e5981. [25] Ghernaout, D. and Elboughdiri, N. (2020) UV-C/H2O2 and Sunlight/H2O2 in the Core of the Best Available Technologies for Dealing with Present Dares in Domestic Wastewater Reuse. Open Access Library Journal, 7, e6161. https://doi.org/10.4236/oalib.1106161 [26] Ghernaout, D., Ghernaout, B. and Naceur, M.W. (2011) Embodying the Chemical Water Treatment in the Green Chemistry—A Review. Desalination, 271, 1-10. https://doi.org/10.1016/j.desal.2011.01.032 [27] Ghernaout, D. and Ghernaout, B. (2012) On the Concept of the Future Drinking Water Treatment Plant: Algae Harvesting from the Algal Biomass for Biodiesel Production—A Review. Desalination and Water Treatment, 49, 1-18. https://doi.org/10.1080/19443994.2012.708191 [28] Ghernaout, D. and Elboughdiri, N. (2020) Environmental Engineering for Stopping Viruses Pandemics. Open Access Library Journal, 7, e6299. [29] Ghernaout, D. (2019) Greening Cold Fusion as an Energy Source for Water Treatment Distillation—A Perspective. American Journal of Quantum Chemistry and Molecular Spectroscopy, 3, 1-5. [30] Ghernaout, D. and Elboughdiri, N. (2020) On the Treatment Trains for Municipal Wastewater Reuse for Irrigation. Open Access Library Journal, 7, e6088. [31] Ghernaout, D., Naceur, M.W. and Aouabed, A. (2011) On the Dependence of Chlorine By-Products Generated Species Formation of the Electrode Material and Applied Charge during Electrochemical Water Treatment. Desalination, 270, 9-22. [32] Ghernaout, D. and Naceur, M.W. (2011) Ferrate(VI): In Situ Generation and Water Treatment—A Review. Desalination and Water Treatment, 30, 319-332. https://doi.org/10.5004/dwt.2011.2217 [33] Ghernaout, D., Elboughdiri, N. and Alghamdi, A. (2019) Direct Potable Reuse: The Singapore NEWater Project as a Role Model. Open Access Library Journal, 6, e5980. [34] Ghernaout, D. (2020) Water Treatment Challenges towards Viruses Removal. Open Access Library Journal, 7, e6408. [35] Ghernaout, D. and Elboughdiri, N. (2020) Solar Treatment in the Core of the New Disinfection Technologies. Chemical Science & Engineering Research, 2, 6-11. [36] Ghernaout, D., Alghamdi, A., Touahmia, M., Aichouni, M. and Ait Messaoudene, N. (2018) Nanotechnology Phenomena in the Light of the Solar Energy. Journal of Energy, Environmental & Chemical Engineering, 3, 1-8. https://doi.org/10.11648/j.jeece.20180301.11 [37] Ghaffour, N., Missimer, T.M. and Amy, G.L. (2013) Technical Review and Evaluation of the Economics of Water Desalination: Current and Future Challenges for Better Water Supply Sustainability. Desalination, 309, 197-207. https://doi.org/10.1016/j.desal.2012.10.015 [38] Voutchkov, N. (2016) Desalination: Past, Present and Future. International Water Association, 17/08/2016. https://iwa-network.org/Desalination,-past-present-future [39] Ghernaout, D. and El-Wakil, A. (2017) Requiring Reverse Osmosis Membranes Modifications—An Overview. American Journal of Chemical Engineering, 5, 81-88. https://doi.org/10.11648/j.ajche.20170504.15 [40] Ghernaout, D. (2017) Reverse Osmosis Process Membranes Modeling—A Historical Overview. Journal of Civil, Construction and Environmental Engineering, 2, 112-122. [41] Saiba, A., Kourdali, S., Ghernaout, B. and Ghernaout, D. (2010) In Desalination, from 1987 to 2009, the Birth of a New Seawater Pretreatment Process: Electrocoagulation—An Overview. Desalination and Water Treatment, 16, 201-217. https://doi.org/10.5004/dwt.2010.1094 [42] Ait Messaoudene, N., Naceur, M.W., Ghernaout, D., Alghamdi, A. and Aichouni, M. (2018) On the Validation Perspectives of the Proposed Novel Dimensionless Fouling Index. International Journal of Advanced and Applied Sciences, 5, 116-122. https://doi.org/10.21833/ijaas.2018.07.014 [43] Ghernaout, D. and Ghernaout, B. (2010) From Chemical Disinfection to Electrodisinfection: The Obligatory Itinerary? Desalination and Water Treatment, 16, 156-175. https://doi.org/10.5004/dwt.2010.1085 [44] Boucherit, A., Moulay, S., Ghernaout, D., Al-Ghonamy, A.I., Ghernaout, B., Naceur, M.W., Ait Messaoudene, N., Aichouni, M., Mahjoubi, A.A. and Elboughdiri, N.A. (2015) New Trends in Disinfection By-Products Formation upon Water Treatment. Journal of Research & Developments in Chemistry, 2015, Article ID: 628833. https://doi.org/10.5171/2015.628833 [45] Ghernaout, D. (2017) Microorganisms’ Electrochemical Disinfection Phenomena. EC Microbiology, 9, 160-169. [46] Ghernaout, D. (2019) Brine Recycling: Towards Membrane Processes as the Best Available Technology. Applied Engineering, 3, 71-84. [47] Ghernaout, D., El-Wakil, A., Alghamdi, A., Elboughdiri, N. and Mahjoubi, A. (2018) Membrane Post-Synthesis Modifications and How It Came About. International Journal of Advanced and Applied Sciences, 5, 60-64. https://doi.org/10.21833/ijaas.2018.02.010 [48] Ghernaout, D. (2020) New Configurations and Techniques for Controlling Membrane Bioreactor (MBR) Fouling. Open Access Library Journal, 7, e6579. [49] Ghernaout, D. and Elboughdiri, N. (2020) Should We Forbid the Consumption of Antibiotics to Stop the Spread of Resistances in Nature? Open Access Library Journal, 7, e6138. [50] Ghernaout, D. (2018) Disinfection and DBPs Removal in Drinking Water Treatment: A Perspective for a Green Technology. International Journal of Advanced and Applied Sciences, 5, 108-117. https://doi.org/10.21833/ijaas.2018.02.018 [51] Ghernaout, D. and Elboughdiri, N. (2020) Disinfection By-Products (DBPs) Control Strategies in Electrodisinfection. Open Access Library Journal, 7, e6396. [52] Ghernaout, D., Elboughdiri, N., Ghareba, S. and Salih, A. (2020) Coagulation Process for Removing Algae and Algal Organic Matter—An Overview. Open Access Library Journal, 7, e6272. [53] Ghernaout, B., Ghernaout, D. and Saiba, A. (2010) Algae and Cyanotoxins Removal by Coagulation/Flocculation: A Review. Desalination and Water Treatment, 20, 133-143. [54] Ghernaout, D., Moulay, S., Ait Messaoudene, N., Aichouni, M., Naceur, M.W. and Boucherit, A. (2014) Coagulation and Chlorination of NOM and Algae in Water Treatment: A Review. International Journal of Environmental Monitoring and Analysis, 2, 23-34. https://doi.org/10.11648/j.ijema.s.2014020601.14 [55] Ghernaout, D. and Elboughdiri, N. (2020) Dealing with Cyanobacteria and Cyanotoxins: Engineering Viewpoints. Open Access Library Journal, 7, e6363. [56] Ghernaout, D. and Elboughdiri, N. (2020) Eliminating Cyanobacteria and Controlling Algal Organic Matter—Short Notes. Open Access Library Journal, 7, e6252. [57] Ghernaout, D. and Elboughdiri, N. (2020) Removing Antibiotic-Resistant Bacteria (ARB) Carrying Genes (ARGs): Challenges and Future Trends. Open Access Library Journal, 7, e6003. [58] Ghernaout, D. and Elboughdiri, N. (2020) On the Other Side of Viruses in the Background of Water Disinfection. Open Access Library Journal, 7, e6374. [59] Ghernaout, D. and Elboughdiri, N. (2020) Disinfecting Water: Plasma Discharge for Removing Coronaviruses. Open Access Library Journal, 7, e6314. https://doi.org/10.4236/oalib.1106314 [60] Ghernaout, D., Elboughdiri, N. and Al Arni, S. (2020) New Insights towards Disinfecting Viruses—Short Notes. Journal of Water Reuse and Desalination, 10, 173-186. https://doi.org/10.2166/wrd.2020.050 [61] Ahmad, N.A., Goh, P.S., Yogarathinam, L.T., Zulhairun, A.K. and Ismail, A.F. (2020) Current Advances in Membrane Technologies for Produced Water Desalination. Desalination, 493, Article ID: 114643. https://doi.org/10.1016/j.desal.2020.114643 [62] Jones, P.H. and Tompeck, M.A. (2006) Water Treatment. In: Pfafflin, J.R. and Ziegler, E.N., Eds., Encyclopedia of Environmental Science and Engineering, 5th Edition, CRC Press, Taylor & Francis Group, Boca Raton, 1311. https://doi.org/10.1201/NOE0849398438.ch87 [63] Bermuda, Black Mangrove (Avicennia germinans). https://environment.bm/black-mangrove#:~:text=Black%20Mangrove%20(Avicennia%20 germinans)&text=If%20you%20look%20closely%20at,that%20would%20kill%20other%20plants [64] Laborde, H.M., França, K.B., Neff, H. and Lima, A.M.N. (2001) Optimization Strategy for a Small-Scale Reverse Osmosis Water Desalination, System Based on Solar Energy. Desalination, 133, 1-12. https://doi.org/10.1016/S0011-9164(01)00078-9 [65] Fiorenza, G., Sharma, V.K. and Braccio, G. (2003) Techno-Economic Evaluation of a Solar Powered Water Desalination, Plant. Energy Conversion and Management, 44, 2217-2240. https://doi.org/10.1016/S0196-8904(02)00247-9 [66] Ghernaout, D. (2020) Electrocoagulation as a Pioneering Separation Technology—Electric Field Role. Open Access Library Journal, 7, e6702. [67] Ghernaout, D. (2020) Electric Field (EF) in the Core of the Electrochemical (EC) Disinfection. Open Access Library Journal, 7, e6587. [68] Ghernaout, D. (2020) Water Treatment Coagulation: Dares and Trends. Open Access Library Journal, 7, e6636. [69] Côté, P., Masini, M. and Mourato, D. (2004) Comparison of Membrane Options for Water Reuse and Reclamation. Desalination, 167, 1-11. https://doi.org/10.1016/j.desal.2004.06.105 [70] Eke, J., Yusuf, A., Giwa, A. and Sodiq, A. (2020) The Global Status of Desalination: An Assessment of Current Desalination, Technologies, Plants and Capacity. Desalination, 495, Article ID: 114633. https://doi.org/10.1016/j.desal.2020.114633	cc/2021-04/en_middle_0039.json.gz/line955
__label__wiki	0.582456	0.582456	mitregate 3D – the movie! Jun 28, 2010 \| liturgy \| 17 Bosco & Katharine Jefferts Schori I was able to be present when Presiding Bishop Katharine Jefferts Schori was welcomed at a Powhiri at Te Hui Amorangi O Te Waipounamu hosted by Bishop John Gray. This was followed by a wonderful meal. [photo: Alistair Kinniburgh] Presiding Bishop Katharine went on to the historic St Michael and All Angels (the pro-cathedral before the cathedral was built) and preached there for Evensong. She wore her mitre. The New Zealand Film Commission has bought the rites rights to the movie Mitregate 3D. Peter Jackson is rumoured to be interested in directing. Weta Workshop will provide the mitres and other required liturgical millinarian accoutrements. Naomi Watts has already indicated she is interested in playing Presiding Bishop Katharine. Richard Harris, will, of course, play the Archbishop of Canterbury, but if he is not available Peter Jackson may bring back King Kong himself to once again act opposite Naomi Watts. Mitregate was first prophesied by Bishop David Anderson. In his weekly message to Anglican Mainstream, on June 11, he devoted more than two thirds of his text to clergy vesture and other accoutrements (he will be sought out as an adviser for Weta Workshop to make sure all is kosher orthodox). One third of his message was expressing concern that his regular supplier for over 40 years of the Pontiff (sic!) 3 Acetate collar “has either gone out of business or stopped making them”. He will let avid followers of Anglican Mainstream know if he finds an alternative supplier. More than a third of his message is concerned that Presiding Bishop Katharine should not wear a mitre when in England. A week later Bishop David is horrified that Presiding Bishop Katharine didn’t go out and purchase a new black shirt, “If you look closely, you also see a red-purple bishop’s shirt under the overvestment (sic.).” Above: Presiding Bishop Katharine at Salisbury (England) pre-mitregate Above: Presiding Bishop Katharine in Southwark cathedral June 13 complying with the Archbishop of Canterbury’s requirement to not wear a mitre. “It is bizarre; it is beyond bizarre.” Apparently under the Overseas Clergy Act (remember that the Church of England is a State Church, the Archbishop of Canterbury is a state appointment), Presiding Bishop Katharine was allowed to function as a priest but not as a bishop. This, while there is no Anglican certainty that a bishop is still a priest (until further discussion I continue to hold that a bishop is not a priest, a priest is not a deacon, etc). St Paul also wrote about this controversy relatively recently, and the departure of the Archbishop of Canterbury from Bible-believing Christianity: “Any woman who prays or prophesies with her head uncovered disgraces her head – it is one and the same thing as having her head shaved. For if a woman will not cover her head, then she should cut off her hair; but if it is disgraceful for a woman to have her hair cut off or to be shaved, she should cover her head. For this reason a woman ought to have a symbol of authority on her head, because of the angels.” (1 Cor 11) Bishops Katharine Jefferts Schori & John Gray Above: At St Michael and All Angels “For this reason a woman ought to have a symbol of authority on her head, because of the angels.” (1 Cor 11:10) [photo: Alistair Kinniburgh] Mitregate – the official trailer of the movie! Anglican cap tip to Significant truths Powhiri – a welcome ceremony Te Waipounamu – South Island of New Zealand More on the welcome at Te Waipounamu The sermon preached at St Michael and all Angels More millinarianism Daughter of Mitregate – the sequel Bishops Mary Grey-Reeves, Michael Perham, & Gerard Mpango Above: following Mitregate, on June 20, Bishop Mary Grey-Reeves, Bishop of El Camino Real, presided at the eucharist (head covered) in Gloucester Cathedral. The Bishop of Gloucester, Michael Perham, is a noted liturgical scholar. Bishop Mary Grey-Reeves is being approached to see if she will play herself in the sequel. The Wachowskis are interested in doing the sequel if it can be filmed in Sydney and include a car chase and a bullet time sequence of Bishop Mary Grey-Reeves putting her mitre on. Archbishop Peter Jensen is being approached to play Bishop Michael Perham. He may be predestined for this part. UPDATE (June 29): A significant Naomi Watts site has taken up the story. Millinerianism Anglican Commnon Preaching at The Wedding New Bishop of Waikato Why be Anglican Episcopalian? Previouschristian.com NextWeek starting July 4 Church History in 4 minutes poverty and prayer Pausing posts Milly Hopkins on June 28, 2010 at 2:09 pm Thanks for this. I loved it!! I was appalled that Bishop Jefferts Schori was not afforded the same respect in England that we would give an English Bishop visiting the US. I KNEW I could count on New Zealand!!! Joel on June 29, 2010 at 12:25 am Did mitergate come to be because the bishop is a woman? Would male overseas bishop be asked not to vest like a bishop? What a wonderfully humorous (and positive) take on the 1 cor 11 head-covering passage. Thanks for that. Bosco Peters on June 29, 2010 at 7:24 am Yes, Joel, the Church of England has women priests but has not passed legislation allowing women bishops. Hence male overseas bishops vest as bishops in England. Male priests ordained by a woman bishop (we have many such priests in NZ) are in a grey area as far as I know. Sue on June 29, 2010 at 9:26 am I loved this, very clever. What a great photo of you and the PB! Thanks for linking to me, it is a cute video, huh? Bosco Peters on June 29, 2010 at 10:15 am Glad you found this link, Sue. I just put the link on your site so that you might – but you are ahead of me 🙂 Bob Chapman on June 29, 2010 at 10:53 am If the Most Rev. Katharine is not a bishop whilst in England, why was she invited to the last Lambeth Conference? Not only that, why was she and other bishops of the female persuasion allowed to vest in rochet and chimere (I’ve seen the pictures)? I also seem to remember those alleged bishops of the female persuasion were seen at the tea given by your Queen for the bishops at the conference. Did Her Majesty break the law by acknowledging these women as bishops? Does this mean the House of Lords has to sit in judgment of these actions by Betty Windsor? Inquiring minds want to know. Father Tim on June 29, 2010 at 11:07 am Mitregate 3D will certainly be the summer blockbuster of 2010. Seeing some of those more, um, expressive vestments in 3D will be quite a shock. Please do consider keeping a defibrillator on hand when screening the film. Lisa Fox on June 29, 2010 at 3:19 pm Very good, Bosco! I’ll publicize the link. JCF on June 29, 2010 at 4:28 pm Naomi Watts has already indicated she is interested in playing Presiding Bishop Katharine. One of my favorite HOTTIES as my favorite Presiding Bishop?! Be still my heart! <3<3<3 David \|dah•veed\| on June 30, 2010 at 3:21 am I am sure that there is not a bishop in all Christendom who gets more press about her vestments than +Katharine! Thanks be to God that she appears to have left the rainbow pot hold miter at home. Negotiations are already underway for this movie to learn from the Sex and the City wardrobe success. Grandmère Mimi on June 30, 2010 at 3:57 am Bosco, excellent. I can’t wait for the movie. And in 3D! Think how the mitres will pop out at you. The Rev. Mark Geisler on June 30, 2010 at 1:34 pm It’s my understanding that the Presiding Bishop preached at Evensong. Why is she wearing a chasuble and not cassock, surplice, hood, and tippet? Or was I mistaken as to the context? Bosco Peters on June 30, 2010 at 1:52 pm Fr Mark, the photo, above, of the Presiding Bishop in a chasuble, is taken (as noted) in Southwark cathedral, where she presided at the Eucharist. Vincent Murphy on June 30, 2010 at 4:38 pm It is a long established principle in the Church which extends even before the reformation that a Bishop has oversight only over those places so assigned. For example, it is deeply frowned upon for a Bishop from another Diocese (let alone another country and province!) to come and confirm catechumens or ordain minsters unless he has obtained prior appointment to act on behalf of the Bishop of that place. This same permission may be granted by the Bishop to a priest to act on his behalf, so it is not specific to Bishops. The vestment issue is secondary to this, for in that a Bishop has no ability to execute the office of Bishop in the foreign place by virtue of Episcopal office, so it is not fitting to wear the vestments of a Bishop which are the distinctive sign of this authority. Within a province, through Episcopal polity, oversight is shared by Bishops and so whilst an English Bishop from Durham does not have the authority of a Bishop whilst in Truro, yet he does share in the provincial Episcopal oversight, and so a good case can be made for vesting as a Bishop in such a place. A foreign bishop of another province however does not share in the Episcopal oversight in England, nor holds authority to act as a Bishop. For this reason, and this alone, it is simply fitting that he should be vested according to the capacity and authority he has. At its root, a Bishop differs from a Priest only in having oversight of the Priests; and this just is not valid outside one’s own province. Personally, I can’t see any good reason for any of them wearing mitres at all, and many reasons for them avoiding them – not least to show that they do not see themselves as holding to the Roman concept of mystical priesthood after Aaron and sacramental episcopacy. You make some interesting points, Vincent. But they do not appear to match the reality. The Presiding Bishop was not visiting the diocese of Canterbury but of Southwark. Your suggestion about vesture would be convincing if this was the norm – but this story is the exception. I can think of no other case where a visiting bishop was told not to vest as a bishop, can you? David \|dah•veed\| on July 1, 2010 at 3:06 am Vincent, 1) this is not +Katharine’s first visit to the UK and in her prior visits she experienced no such restrictions. 2) She was required, out of the blue, to again provide letters of ordination, which should be in a completed file from her previous visits to the UK. 3) +Ann, retired of Canada, fully vested and served in the same capacity as Katharine in a visit to the very same Southwark Cathedral in just this past NOV 2009, while 4) +Mary, ordinary to El Camino Real, was in Gloucester Cathedral after barely a weeks passing fully vesting during her visit. It is apparent to many, whether real or imagined, that the primate of TEC was subjected to a rigor and standard not apparent in the treatment and welcome of others. Leave a Reply to The Rev. Mark Geisler Cancel reply	cc/2021-04/en_middle_0039.json.gz/line960
__label__wiki	0.518487	0.518487	Facebook Friday Winner Live 95.9 Mobile App Submit: Birthdays, Etc. The Berkshires' Hit Music Live 95.9 Free App Live 95.9 on Alexa Live 95.9 on Google Home 90's At Noon Throwback Throwdown Slater & Marjo in the MorningSlater & Marjo in the Morning First Snow Causes More Than A Dozen Mass Pike Accidents Purestock The first decent snowfall of the year caused quite a few problems on the Massachusetts turnpike yesterday. According to the Massachusetts Department of Transportation, at 7:45 p.m. last night, the speed limit on the Pike was reduced to 45 miles per hour due to the first storm of the season. Despite the reduced speed limit, WWLP reported 13 accidents and spin-outs throughout the evening in to the night. Massachusetts State Police Sgt. Paul Sullivan told the Springfield based news station, that by 7:30 p.m., the Westfield State Police Barracks had already dealt with 13 spin-outs. A tractor-trailer truck jackknifed on the MassPike in Berkshire County just before 9 p.m. Sgt. Sullivan said the big rig spun out on the westbound side of the Pike at mile-marker 8.6, just six miles past Exit 2 in Lee. Earlier in the night, several cars crashed and spun out on the section of the Pike located in Palmer. It was a multi-crash crash, involving four or five vehicles.There was an ambulance on site, but at this time there are no specific details, however traffic was moving on that part of the pike. Filed Under: Accidents, First Snow Fall, MassPike, Road Conditions, Winter Weather Categories: Articles, Local News Take a Look at the Berkshires' Virtual Job Fair Right Here 2021 Live 95.9, Townsquare Media, Inc. All rights reserved.	cc/2021-04/en_middle_0039.json.gz/line961
__label__wiki	0.764458	0.764458	Secret Identity, Female Characters, Humans (Homo sapiens), Winged Characters Saladin Ahmed/Creator Javier Garrón/Creator Modern-Age Characters Tiana Toomes (Earth-616)/Quotes Armor Users Tiana Toomes (Earth-616) Tiana Toomes Chery Toomes (grandmother, deceased); Adrian Toomes (grandfather); Marcus Toomes (granduncle); Lenora Toomes (mother, deceased); Frankie Toomes (father); Valeria Toomes (aunt); Ramona (aunt); Malachi Toomes (cousin, deceased) Brooklyn, New York City, New York; formerly Detroit, Michigan Wears a power suit with red feathered wings enabling flight Human powered by a suit created by her grandfather Saladin Ahmed, Javier Garrón Miles Morales: Spider-Man #5 I chose Starling because those birds get a bad rep. Too loud. Too aggressive. But you know, they didn't ask to be brought here. They're trying to live. -- Tiana Toomes src The girl who would become the vigilante known as Starling was born to Lenora and Frankie Toomes, however, her father later left them. Tiana's grandfather, the Vulture started to take care of the family by giving them stolen money, hoping to make amends for the actions of his son. Tiana and her mother were often visited by Toomes, who wanted to spend time with his granddaughter and convinced Lenora to accept the money. After her mother died due to a surgical error, Adrian offered Tiana his guardianship. As she grew, Adrian gave her a suit based on his Vulture suit and encouraged her to pursue her dream.[1] She was eventually caught by Spider-Man (Miles Morales) after she beat up a group of Tombstone's henchmen in a junkyard.[2] Starling attacked Spider-Man, thinking he was another superpowered henchman of Tombstone's. Once he convinced her that he was one of the good guys, they talked about how she had been tracking Tombstone since leaving Detroit. After the brief encounter, Starling flew off to follow another lead, but gave Spider-Man her number in case he came across Tombstone first. Starling later caught up with Spider-Man after he was casing out Tombstone's penthouse in Brooklyn Heights. She told Miles that there was going to be a lot of noise up there as she planned on killing Tombstone in retaliation for the death of her friend by the mobster's hand. Starling flew to the rooftop where she was confronted by a large number of Tombstone's henchman who started to shoot at her. She deflected the bullets, using her wings as shields. She then grabbed one of the guys and was able to throw him off the building when Spider-Man used his webbing on the guy to pull him back up to the top surface. As the both of them were finished taking out the group, Tombstone busted open the roof door and began shooting a gatling gun in their direction. Starling flew right at Tombstone and one of the bullets penetrated through Starling's stomach, knocking her to the ground. After tussling with Spider-Man, Starling swooped in and grabbed Tombstone by the shirt, flying him straight up in the air. Spider-Man fired his webbing to the back of Tombstone which caused him to be carried away too. Starling planned on dropping Tombstone but Spider-Man told her that if she dropped Tombstone she would be killing him as well. Tombstone threatened Starling, so she let go, which put Spider-Man and Tombstone into freefall. Spider-Man screamed to her that she was better than this, which caused Starling to fly back down and grab the webbing, lowering them down to the ground. Tombstone was arrested for the assault, and while the police handcuffed and put him in the squad car, Starling and Spider-Man were on the top of the building watching from afar. They sat and had a conversation with Spider-Man acknowledging how cool her suit was. Starling unmasked herself, revealing to the web-slinger that her name was Tiana Toomes, the granddaughter of the criminal Vulture. She explained how her granddad had created the suit for her and taught her how to fly. With this information, Tiana thought that Spider-Man would also reveal his identity to her, but to no avail, which ticked off Tiana. She said she would stay out Brooklyn as she waved goodbye to Spider-Man.[3] While hanging out with her grandfather, Adrian was spooked to see Spider-Man (Peter Parker) swinging by, which caused her to attack the superhero. She ambushed him and shot several elephant tranquilizers at him. However, when she told him that she was the Vulture's granddaughter Spider-Man revealed to her that her grandfather had killed people, which left Starling to question the real nature of her grandfather.[4] After the government passed "Kamala's Law" which outlawed individuals under the age 21 from being a superhero, Starling joined the secret meeting of the Champions held by Ms. Marvel. Tiana expressed pessimism in this ordeal, and nearly got in a fight with fellow hero Nova. However, C.R.A.D.L.E. led by Justice ambushed them, leaving Starling to escape, alongside the few who managed to not get captured.[5] An alternate version of the Vulture's Wings 11 Appearances of Tiana Toomes (Earth-616) 1 Minor Appearances of Tiana Toomes (Earth-616) Media Tiana Toomes (Earth-616) was Mentioned in 9 Images featuring Tiana Toomes (Earth-616) 1 Quotations by or about Tiana Toomes (Earth-616) Character Gallery: Tiana Toomes (Earth-616) Search this site for: Tiana Toomes · Tiana Toomes (Earth-616) ↑ Miles Morales: Spider-Man #10 ↑ Miles Morales: Spider-Man #5 ↑ Champions Vol 4 #1 Retrieved from "https://marvel.fandom.com/wiki/Tiana_Toomes_(Earth-616)?oldid=5882129"	cc/2021-04/en_middle_0039.json.gz/line967
__label__cc	0.625079	0.374921	Next Episode... A pilgrimage through Doctor Who, episode by episode Doctor Who: All Episode Reviews DW 50 Years 50 Stories DW Classic Countdown The Run Report All the London Parkruns Doctor Who episode 270: The Ambassadors of Death – Episode 6 (25/4/1970) This is the first Doctor Who episode to actually utilise colour for effect: when the Doctor is taken aboard the UFO to meet the captive human astronauts, he’s lit by bursts of pink, green and blue light. It’s a marked contrast after the wintry greys and muted shades of the space centre. Later, Liz comes literally face to face with one of the alien ambassadors and Michael Ferguson uses a strange repeated zoom as the alien removes its helmet to reveal a lumpy and bright blue face. These are standout moments in a story which casts human beings as the villains and the aliens as innocent victims. The title is revealed as more than schlock horror – the three alien astronauts are actually ambassadors, but humankind has treated them like monsters. Coming straight after Doctor Who and the Silurians tried to take a more even-handed approach to its monsters, this Twilight Zone morality tale enhances Season Seven’s reputation for being more nuanced than the series has been for several years. Maybe the Time Lords didn’t just send the Doctor to Earth to protect the planet from aliens, but also to protect aliens from human beings. Also following on from Doctor Who and the Silurians, the Brigadier is again confronted with a choice to go on the offensive against the UFO in orbit, or to take a more measured approach. His response belies the cheap “the Brigadier’s a murderer!” jibe, as he’s willing to consider a military response, but prefers to learn more about the potential threat first. His treatment of the genocidal Silurians was fair enough, but he’s not bloodthirsty. By way of contrast, General Carrington immediately goes to the UN to try to get the ship blasted out of orbit as his conspiracy unravels around him. Reegan has abandoned any pretence of following Carrington’s orders: in a glorious lack of imagination he plans to use his alien captives to rob banks, and co-opts the Doctor to help. This involves knocking him out, and giving us our first glimpse of the classic “Pertwee Death Pose” and a touching moment with Liz that almost exactly mirrors his very last moments with Sarah Jane. I’m really enjoying how the story is developing quite methodically – as you might expect from an (uncredited) collaboration between Malcolm Hulke and Terrance Dicks. But there are some weird choices, like Lennox dying and the Brigadier finding out offscreen and then just dropping it into conversation. But maybe he’s just feeling sheepish given how easily saboteurs seem to be able to wander in and out of Space Control. It’s not a great look when Reegan’s thugs offer better security than UNIT. Next episode: The Ambassadors of Death – Episode 7 Written by Matthew Posted in Complete Review, Doctor Who, Episode by Episode 14 October 2020 - 07:24 Urlance Woolsbane Oddly, I find the story as you describe it rather more compelling than the story as I watched it. But I suppose its ideas were never at fault-It’s just a shame they weren’t handled with more discipline. 14 October 2020 - 11:22 Pingback: Doctor Who episode 269: The Ambassadors of Death – Episode 5 (18/4/1970) \| Next Episode... Doctor Who episode 271: The Ambassadors of Death – Episode 7 (2/5/1970) Doctor Who fans Will Howells	cc/2021-04/en_middle_0039.json.gz/line969
__label__wiki	0.900878	0.900878	News / National / China’s military exercise in West PH Sea ‘alarming, highly-provocative’ — Lorenzana READS 1.5K SHARES 4 China’s military exercise in West PH Sea ‘alarming, highly-provocative’ — Lorenzana Published July 2, 2020, 7:35 PM by Aaron Recuenco The Chinese military’s war games in contested areas of the South China Sea is highly provocative and causes serious concern in the region’s security situation, Defense Secretary Delfin Lorenzana said. Sec. Delfin Lorenzana “That is very concerning, we view that with alarm,” said Lorenzana, referring to the five-day military exercises of Chinese military which demonstrates its capability to storm and seize an island. The military exercise was held near the Paracel Islands which are being claimed by China, Vietnam and Taiwan. “If they did it in their part of the South China Sea then it’s okay. But if they are doing in the contested areas then that will, you know, sound the alarm bells for all the claimants here in the South China Sea or the West Philippine Sea,” said Lorenzana. China has been the most aggressive in terms of asserting its claims in the South China using the nine-dash line concept which was rejected by a United Nation’s arbitral tribunal in a case filed by the Aquino administration. Based on the Department of National Defense (DND) data, almost 20 incidents of harassment against Filipino fishermen and Philippine military forces were recorded from August 2019 to early 2020 alone by Chinese military, Chinese Coast Guard, Chinese commercial fishing vessels and even Chinese militia. Lorenzana said the Philippine government has been conducting military exercises with the United States but it done within the Philippine military. Earlier, President Duterte has cancelled his decision to terminate the Visiting Forces Agreement (VFA) with the US reportedly due to the security situation in the West Philippine Sea. Duterte, it was recalled, took the lead in being friendly to China with critics accusing him of a sellout in exchange for big loans and assistance that mostly did not materialize. “We have been doing exercises before with the Americans here in our territorial waters and I think that is okay,” said Lorenzana. “The Chinese can do theirs in their territorial waters within their exclusive economic zone and I think that’s okay but if (they) do it here in the contested area, as I’ve said earlier, then that’s highly provocative,” he added. Share your voice: VIEW COMMENTS HIDE ALL COMMENTS Transport sector asks House to pass Magna Carta of Commuters Comelec, DFA eye online voting for overseas Filipinos ["national","news"] [995551,2599640,2599636,2599623,2599613,2599608,2599606] Danilo Barrios, wife want to teach entrepreneurship to their kids early on	cc/2021-04/en_middle_0039.json.gz/line971
__label__cc	0.57656	0.42344	6 Rules to Follow When Downsizing Your Belongings Everything But The House How to Downsize Your Belongings 12 February, 2017 by Maggie Winterfeldt If you're a small space dweller looking to downsize your belongings or if you're just motivated by the season to clean out your clutter, there are a few rules you should consider before you break out the garbage bags. We spoke to expert Jacquie Dennythe, co-founder of online estate sale website Everything But the House (EBTH). She has an in depth knowledge of what home items to keep, toss, and resell as well as how to do it. Check out her great tips for thoughtfully scaling back belongings below. 1. Toss Anything You Don't Use 80% of the Time You have to ruthless when downsizing. "Stick to the basics," Jacquie recommends. She advises tossing all impulsive or experimental purchases as well as getting rid of any pieces that are so specific, they're impractical to use. Think: Christmas-themed poached egg cups you got in your stocking seven years ago and never seem to remember to use over the holidays. For the kitchen, Jacquie describes "what pots, pans and essentials do you cook with for 80% of your meals? Keep those and let go of the rest (i.e. no bread maker that you only use once a year)." Ultimately, less is more. 2. Don't Get A Storage Unit "I tell everyone I work with that off-site storage is not your friend," says Jacquie. "Often people send things away to storage because they don't truly need them, but they are not ready to say good-bye." And if you've made the mistake of putting something in storage, Jacquie suggests you toss it after a year. 3. Differentiate Between Decoration and Clutter The line between decor and clutter can get fuzzy – is that a stylish statue or a messy knick knack? – and Jacquie says it has a lot to do with each homeowner's personality. "My rule is that once a shelf gets too busy visually, you have too much. Multiples of an item tend to make it impossible to appreciate the aesthetic of any one thing." In short, if see more decor than surface area, it's time to clear out. 4. Sell Items With Resale Potential Now that you've cleared aside all non-essentials, take a look through what you're getting rid of. Jacquie says books, crystal vases, tableware and baskets have potential resale value as well as decor vintage items. To gauge if something is is trash or treasure, she says to check for a few things; "is this piece signed by an artist or does it have a significant maker's mark on it? Is this piece one-of-a-kind or is it from a limited production run? Is this piece made of expensive metals (silver, gold or platinum)? Is a book first edition or illustrated by a notable artist?" 5. Sell Art With Value What you can get money back on when it comes to art may surprise you. "Value in the art market can vary from region to region," says Jacquie. While decorative and mass produced art doesn't hold up and should be donated, original pieces signed by the artist (even if you've never heard of the artist) consistently resell well. As do prints by first-rate artists like Picasso, Miró. She recommends checking out an online resource, like EBTH, with archives that give examples of what items are currently worth at market. 6. Keep What You Love KonMari says to keep only the items that spark joy, but Jacquie says something even simpler. "My number one rule is to always keep what you love. Nothing is worse than holding onto things that are mediocre!" Image Source: POPSUGAR photography / Julia Sperling Everything But The HouseHome Organization	cc/2021-04/en_middle_0039.json.gz/line973
__label__cc	0.66017	0.33983	Edgar Venson: Back in the Saddle When a stroke threatened to take away Edgar’s ability to ride his horse or strum his guitar, he turned to Memorial Hermann Rehabilitation Hospital – Katy. In February 2018, Edgar was at home in Sealy, Texas, getting into bed for the night when he began feeling a tingling sensation in his right arm. “I sat up in the bed because that just didn’t feel right,” said Edgar. “I decided to get off the bed, but immediately realized I had no feeling in my right leg or arm, and I tumbled down to the floor.” An ambulance rushed Edgar to Memorial Hermann Katy Hospital where he spent almost a week in the intensive care unit. Once he was stable, he was sent to Memorial Hermann Rehabilitation Hospital – Katy to begin his journey back to independence. As an inpatient, Edgar received both physical and occupational therapy. “I had a goal for myself when I began physical therapy that I wanted to walk,” said Edgar. “It was frightening at first, but I went in with my deep faith in God and an attitude that I can beat this thing.” After two weeks as an inpatient, Edgar was able to walk with a cane, climb stairs and get in and out of a car. Once those milestones were met, he was discharged to go home and he began outpatient therapy at Memorial Hermann Rehabilitation Hospital – Katy. “When I met Edgar, he talked about getting back on his horse, so we did activities that would allow him to do that,” said his physical therapist. “We mainly worked on fine tuning his leg strength, timing and coordination by doing a lot of walking. We progressed up to fast walking and light jogging. All of this gave him the needed strength in his stroke-affected leg to be able to ride his horse again.” Today, his recovery is complete and Edgar is strumming his guitar, playing the drums and training barrel horses. Memorial Hermann Rehabilitation Hospital-Katy Outpatient Rehabilitation Program Stroke Would you like to make an appointment, get more information about our services or ask about rehab? Please complete our Contact Us form below or call us at 1 (800) 44-REHAB (73422). Thank you. Check your email for details on your request. TIRR is a registered trademark of TIRR Foundation.	cc/2021-04/en_middle_0039.json.gz/line992
__label__wiki	0.969002	0.969002	Miley Cyrus Is Still Sober and Says She Loves to Remind Her Pothead Parents The pop star is weed-free and back to acting, but says she likes to remind her parents of her 420-friendly days by sending old interview clips where she discusses the dank. Photo via Miley Cyrus spent a few years as one of the world’s most famous cannabis users. But after weed-themed birthday parties, leafy fashion choices, and repeatedly discussing her love of ganja on national TV, Miley has been “sober sober” for the past six months. Luckily, life without pot hasn’t quelled Miley’s comedic instincts. In a new podcast interview with Variety, Miley discussed returning to acting with a role on Black Mirror, a potential Justin Beiber collaboration, and of course, joking about weed with her famous canna-friendly parents. “One of my favorite interviews is when I say, ‘Anyone that smokes weed is a dummy,’” Miley said. “That one I love to send to my parents, who are big stoners, every now and then.” Cyrus has been supportive of her parents’ own position in the cannabis industry spotlight — her dad, Billy Ray Cyrus, recently collaborated with Lowell Herb Co. on a line of specialty pre-rolls — but that doesn’t mean she can’t poke a little fun at their youthful tendencies, right? As for her own lifestyle, Miley told Variety that she first put down the pot to prepare for surgery on her vocal cords, but has continued her teetotaling after the procedure. “It’s really hard because especially being young, there’s that stigma of ‘you’re no fun,’” Miley said. “It’s like, ‘Honey, you can call me a lot of things, but I know that I’m fun.’” For the record, Miley, we still think you’re plenty fun, stoned or not. You can listen to Miley’s entire podcast interview here. Follow Zach Harris on Twitter Zach Harris is a writer based in Philadelphia whose work has appeared on Noisey, First We Feast, and Jenkem Magazine. You can find him on Twitter @10000youtubes complaining about NBA referees.	cc/2021-04/en_middle_0039.json.gz/line993
__label__cc	0.717079	0.282921	5/25/2017: IOSC Recap #4-Tank Barge APEX 3508: Best practices for detection and recovery of sunken oil By LT Amy Midgett on May 25, 2017 Fourth in our IOSC series is a recap of a presentation by Cmdr. Mark Sawyer, commanding officer of Marine Safety Unit Paducah, Kentucky, titled “T/B APEX 3508 Case Study: Best Practices for Detection and Recovery of Sunken Oil.” APEX 3508 released an estimated 120,500 gallons of slurry oil into the Mississippi River after two tugboats collided near Columbus, Kentucky in September 2015. The majority of the oil sank to the riverbed and Sawyer shared with conference attendees some of the challenges responders faced when recovering sunken oil, lessons learned, and recommendations for future incidents. The presentation was part of the “Case Studies” From the Past to the Future,” moderated by Cmdr. Lushan Hannah. The vicinity where the APEX 3508 case occurred was unique because the collision occurred at the confluence of five major waterways transited annually by 8,500 towboats and carrying goods worth $45 billion to the U.S. economy. Additionally, this area intersects four states, three Environmental Protection Agency regions, and four Army Corps of Engineers districts. “There’s a lot of coordination required, because it becomes complicated, jurisdictionally, depending on the incident and its location,” Cmdr. Mark Sawyer, the incident commander, said. Other incident challenges included unreliable connectivity, a lack of logistics support, and an incident command post that had to be established about an hour away from the incident location. Additionally, the water itself was 20 meters deep and was the home to two freshwater mussel habitats. Initially, Sawyer said the unified command was unsure if the oil had drifted downriver and surfaced, or was suspended in the water column. A 16-mile section of the river was closed to ship traffic over concerns about migration of oil and passing vessels being oiled as well. “You can imagine shutting down this economically vital river for a couple of days,” Sawyer said. “There is a lot of pressure to locate and evaluate the risk of the oil on the environment and the impact to vessels wishing to transit the area so the waterway can be reopened to commerce as soon as possible.” Overflights revealed very little oil sheen in the area. Using side scan sonar, provided by a member of the local fire department, and a salvage diver, responders discovered the oil was on the bottom of the riverbed. The decision was made to use an environmental clamshell, which is designed to reduce the amount of water recovered and hold the maximum amount of product. During the 23-day operation, 120 personnel recovered between 50-70 percent of the product. “This case has received a lot of attention in both government and private entities because it’s one of the largest sunken oil spills and largest recovery rates in recent times,” Sawyer said during his presentation. “It’s also generated a lot of discussion because, over the last several years, we’ve been debating about the best ways to approach sunken oil to increase our preparedness efforts.” Sawyer summarized the lessons responders learned from the APEX 3508 spill: The use of a professional salvage team increased capabilities and resulted in higher product recovery rate. Maintain awareness of the state and municipal assets available. The side scan sonar used to detect the oil was provided by a local responder, which meant clean up operations could begin more quickly The unified command established a Maritime Transportation Recovery Unit (MTSRU) and a senior vice president from a local tow boat company was assigned to run it, with Coast Guard support, and he was able to clear over 80 vessels waiting to transit in a 48-hour period. The unified command took full advantage of external resources and specialized teams, including bringing in a NOAA scientific support coordinator and the use of the Environmental Response Management Application (ERMA). Local partners established a Great Rivers Spill Coordination Group to address the nuances of the jurisdictional overlap in the area and ensure both tactical and coordination response plans were incorporated. The American Petroleum Institute’s Submerged Oil Detection and Recovery Field Operations Guide is a valuable tool for determining optimal detection and recovery methods given the product and the environment. Since APEX 3508, the Coast Guard Office of Marine Environmental Response Policy established non-floating oil classifications to allow oil spill response organizations and salvage companies with those capabilities to apply. View MSIB 07-16, MSIB 13-16 or the Maritime Commons post on the subject for more information. To read more about the APEX 3508 response, visit NOAA’s Incident News website. Want to read more from the Coast Guard at the International Oil Spill Conference? Check out our previous Maritime Commons posts: 6/5/2017: IOSC Recap #5 – USCG Sector Delaware Bay: Response to rail incidents planning project 5/25/2017: IOSC Recap #3-Tank Barge Argo: A case study on the employment of NCP special teams 5/23/2017: IOSC 2017 Recap #2-In a hostile environment? Skills needed for success 5/23/2017: IOSC 2017 Recap #1- Time for a refresh in the pre-spill planning consultation process 5/16/17: IOSC 2017 – Opening plenary session – Prevent, Prepare, Respond & Restore Categories: Environmental Response Policy, Uncategorized Tagged as: apex 3508, international oil spill conference, mark sawyer, nonfloating oil 5/30/2017: Op/Ed with Mr. Mike Emerson, director of marine transportation	cc/2021-04/en_middle_0039.json.gz/line1002
__label__wiki	0.923331	0.923331	Posts Tagged ‘From’ Top 10 Women ever on Indian TV! Posted: August 22, 2010 in General, Movies, TV Tags: Abhay, Abhi, Abhimanyu, accident, actor, actresses, affair, affairs, Aneja, Anita, Astitva, audience, Bahu, Bedi, Beta, blockbuster, Born, Both, Buniyaad, Came, characteristics, comedy, cord, daughter, death, debut, Doordarshan, emancipation, english, episodes, fact, faith, fame, From, girl, Gupta, harmony, Hasratein, Haveliram, history, histrionics, husband, imagination, India, Indian, industry, injustice, Irani, Isha, Jaise, Jassi, Just, justice, Kabhi, Kahani, Kanwaljeet, Kanwar, karma, Kkusum, Kyunki, Laajo, lady, Lajoji, life, Mandira, maniac, marriages, Master, Mathur, message, Mona, Nahi, Navneet, Neena, Nikki, Nishan, Paanch, path, phase, portrait, portrayal, Prem, Priya, protagonist, Rajani, relationship, role, Saans, Saas, Savi, serials, series, Shah, Shanti, Shefali, showbiz, Siddharth, Simple, Simran, Singh, Smriti, soap, student, system, Tara, Television, Tendulkar, Though, trend, TRPs, Tulsi, underdog, viewers, Virani, wife, woman, women 1. Anita Kanwar as Laajo in ‘Buniyaad‘ Buniyaad narrated the story of Master Haveliram, a patriotic and principled man, who chose teaching as his way of building the so-called ideal society. Anita Kanwar – who played Laajoji, the simple wife of Master Haveliram, was his student. This character is remembered because she was one woman who stood up for what she believed. It portrayed more of woman’s emancipation in a man’s world. 2. Priya Tendulkar in and as ‘Rajani‘ In 1985, with the huge success of TV series ‘Rajani‘, Priya Tendulkar who played the protagonist, rose to national fame. She portrayed the role of a housewife who shuns injustice, fights against the corrupt social system and solves social issues. This role made her a household name. Simple and unlayered, the acting was convincing. It caught the imagination of a heterogeneous public and became a blockbuster overnight. Now that she has passed away, Priya is still remembered also for her minor (but striking) role in the crazy-comedy Hum Paanch where she was locked up in her death portrait. 3. Navneet Nishan in and as ‘Tara‘ It was in the 90s that viewers saw a path breaking serial called ‘Tara’. Navneet Nishan sketched the lead role and with growing popularity, she became a household name. Both the actor and the serial dominated the television industry for a very long time. With characteristics like being mean, bitchy, she shattered the “good girl” image. In the year 1994, with ‘Tara’, India got its first taste of a long-running unconventional soap. 4. Mandira Bedi in and as ‘Shanti‘ Came the 90s and Doordarshan witnessed an array of hit tele-serials targeting women. One amongst them was a daily series – ‘Shanti’. With 804 ongoing episodes, it was an incredible success story in the history of Indian television. The character of Shanti was played by Mandira Bedi. The serial depicted the story of a strong, inspirational, career oriented woman in the world of showbiz. This headstrong woman also happened to be an illegitimate child who returns to take revenge and fight for both herself and her mother’s rights. The show only came to an end when it seemed that the story was dragging on and TRPs had dipped. But Mandira today, with her hot, model, party figure image is still remembered for her fine acting in that landmark serial. 5. Neena Gupta as Priya in ‘Saans’ Directed and enacted by Neena Gupta, this emotional serial portrayed the real life problems faced by most of us in society. It portrayed the declining phase of a husband-wife relationship. It demonstrated the problems faced by Gupta after her husband, Kanwaljeet Singh gets infatuated with a lady, who is a maniac and then starts the worst phase in the life of Gupta. It showed, how despite of all the problems, she managed to handle her family and children. The serial set a standard for the woman of today’s era and sends a message: “Yes, we can stand, even without you.” 6. Shefali Shah as Savi in ‘Hasratein’ A story which revolved around extra marital affairs, Shefali played the lead called Savi. Considering our male dominated society, ‘Hasratein’ had a woman who got away with a lot of things that traditionally only a man could do. The serial helped society to look at the world from a woman’s point of view. Shefali’s histrionics were applauded and the serial owed a lot of its success to her inputs. 7. Nikki Aneja as Simran in ‘Astitva: Ek Prem Kahani‘ Astitva – Ek Prem Kahani is all about Dr.Simran Mathur, a successful gynecologist. Having devoted her entire life towards achieving this success, she finds herself lonely, as she edges closer to her mid-thirties. At this point Abhimanyu steps in. This 24-year-old Abhi brings out the feminine side of Simran and brings her in contact with her desires and needs. Initially Simran resists him but gradually she is unable to resist and is left with no alternatives when Abhi proposes her for marriage. After their marriage, Abhi gets attracted to a model who is younger to him and betrays Simran. But, this powerful lady is not dependent on her husband for every need and knows how to handle her family and career even without him. This was the first serial to break the trend that a man has to be elder than the woman to marry her. Nikki won many a heart and many an award for this portrayal. 8. Smriti Irani as Tulsi Virani in ‘Kyunki Saas Bhi Kabhi Bahu Thi‘ Born to a poor pujari and married into a rich household, Tulsi is a clever, intelligent and sensitive bahu stuck with the scheming mother-in-law. Tulsi’s cause is championing the underdog. She was a dutiful daughter, an ideal bahu, a perfect mother and an emphatic saas– the complete homemaker who binds the family into a single cord of harmony. Though Smriti made an exit from the show people still remember her as Tulsi. She;s probably the most watched, most famous character on Indian TV till date. 9. Nausheen Ali in and as “Kkusum” Just like the tag line of the serial this was a “special story of a simple girl”. From a below muddle class family, Kkusum got married to a rich household, where her husband Abhay had an extra-marital affair with his secreatary Isha. When things aggravated Kkusum held her ground and move forward strongly. But it didn’t stop there. Abhay falsely repented for what he did and went on to have affairs with not two, not three but four “other women” each time while he was married to Kkusum. Kkusum too had another marriage with Siddharth, but he later died in an accident and then Kkusum was all on her own. At the end, Abhay’s karma hit him back hard and he became mentally retarded! In fact, so did the Indian audience! They could not stand seeing so many marriages and divorces one after another. Yet, the serial was a resounding hit, and Kkusum will be character to remember, although her character was played by two other actresses in the final seasons of the serial!! 10. Mona Singh as Jassi in ‘Jassi Jaise Koi Nahi‘ Jassi Jaise Koi Nahi lifted from the English series Ugly Betty was the story of a simple girl named Jassi – an ugly but brilliant duckling who later turned into a beautiful swan. This courageous and liberal girl secretly falls in love with her boss but gets betrayed and later gets back her love. With faith in love and life put to test many a times, the serial showcased the journey of an ugly looking girl and her encounter with the real world. Mona Singh did complete justice to her debut role. This serial gave a break to the shaadi-divorce pattern which was shown in almost all Indian serial at that time… but eventually even Jassi ended up in the same soup! If you’ve liked this post, click here for free updates.	cc/2021-04/en_middle_0039.json.gz/line1003
__label__wiki	0.669487	0.669487	Jonathan Silverman The 84th Annual Hollywood Christmas Parade – 2015 source 3Oh!3, Ace Young, Adam Young, Adriana Fonseca, Alex & Sierra, Amir Rahim, Andrew McMahon, August Maturo, B.C. Jean, Bebe Rexha, Bradford Anderson, Brec Bassinger, Brett Dier, Brittany King, Brittany Lasky, Candice Glover, Carmina Garay, Charity Daw, Charles Kelley, Chrissie Fit, Christel Khalil, Christina Perri, Clay Aiken, Corey Fogelmanis, Cristina Ferrare, Daughtry, David Hodges, David Ryan Harris, Dean Cain, Deidre Hall, Devon Werkheiser, Diana DeGarmo, Elizabeth Stanton, Emeraude Toubia, Emma Fitzpatrick, Emme Rylan, Erik Estrada, Fawn, Gabrielle Ruiz, Galen Gering, Garrett Clayton, Grumpy Cat, Hadley Belle Miller, Holly Madison, India Arie, Ivonne Coll, Jack Scalia, Jacqueline MacInnes Wood, James Hong, Jason Wade, Jay Ali, Joaquin Garay III, John O’Hurley, JoJo Siwa, Jonathan Pendragon, Jonathan Silverman, Josh Edmondson, Josh Zuckerman, Kat Graham, Kate Linder, Katherine McNamara, Kennedy Lea Slocum, Kevin Quinn, Laura McKenzie, Liz Fuller, Mark Ballas, Mark McGrath, Mark Steines, Martha Madison, Michael Fitzpatrick, Michael Grandinetti, Michael Turco, Michelle Stafford, Montel Williams, Naathan Phan, Natasha Bedingfield, Nick Hexum, Nikki SooHoo, Oscar De La Hoya, Owl City, Parvesh Cheena, Penn Jillette, Pete Gardner, Piankhi Iknaton, Rebecca Bloom, Richard Keith, Rick Hearst, Ruben Studdard, Ryan Cargill, Sabrina Carpenter, Scott Clifton, Sean Kingston, Taylor Hicks, Teller, The Mowgli’s, Tristan Rogers, Tyler Glenn, Tyler Perez Tagged 3Oh!3, Ace Young, Adam Young, Adriana Fonseca, Alex & Sierra, Amir Rahim, Andrew McMahon, August Maturo, B.C. Jean, Bebe Rexha, Bradford Anderson, Brec Bassinger, Brett Dier, Brittany King, Brittany Lasky, Candice Glover, Carmina Garay, Charity Daw, Charles Kelley, Chrissie Fit, Christel Khalil, Christina Perri, Clay Aiken, Corey Fogelmanis, Cristina Ferrare, Daughtry, David Hodges, David Ryan Harris, Dean Cain, Deidre Hall, Devon Werkheiser, Diana DeGarmo, Elizabeth Stanton, Emeraude Toubia, Emma Fitzpatrick, Emme Rylan, Erik Estrada, Fawn, Gabrielle Ruiz, Galen Gering, Garrett Clayton, Grumpy Cat, Hadley Belle Miller, Holly Madison, India Arie, Ivonne Coll, Jack Scalia, Jacqueline MacInnes Wood, James Hong, Jason Wade, Jay Ali, Joaquin Garay III, John O'Hurley, JoJo Siwa, Jonathan Pendragon, Jonathan Silverman, Josh Edmondson, Josh Zuckerman, Kat Graham, Kate Linder, Katherine McNamara, Kennedy Lea Slocum, Kevin Quinn, Laura McKenzie, Liz Fuller, Mark Ballas, Mark McGrath, Mark Steines, Martha Madison, Michael Fitzpatrick, Michael Grandinetti, Michael Turco, Michelle Stafford, Montel Williams, Naathan Phan, Natasha Bedingfield, Nick Hexum, Nikki SooHoo, Oscar De La Hoya, Owl City, Parvesh Cheena, Penn Jillette, Pete Gardner, Piankhi Iknaton, Rebecca Bloom, Richard Keith, Rick Hearst, Ruben Studdard, Ryan Cargill, Sabrina Carpenter, Scott Clifton, Sean Kingston, Taylor Hicks, Teller, The Mowgli's, Tristan Rogers, Tyler Glenn, Tyler Perez 65th Annual Hollywood Christmas Parade – 1996 source, two Angie Harmon, Bob Eubanks, Brian Austin Green, Christopher Aber, Dan Butler, David Hasselhoff, Donna D’Errico, Dorian Gregory, Eddie Cibrian, George Takei, Jack Klugman, Jan Rooney, Jeremy Jackson, Joe Pantoliano, Jonathan Silverman, LeAnn Rimes, Leeza Gibbons, Michael Newman, Mickey Rooney, Peggy Crosby, Randy Spelling, Traci Bingham, Vanna White Tagged Angie Harmon, Bob Eubanks, Brian Austin Green, Christopher Aber, Dan Butler, David Hasselhoff, Donna D'Errico, Dorian Gregory, Eddie Cibrian, George Takei, Jack Klugman, Jan Rooney, Jeremy Jackson, Joe Pantoliano, Jonathan Silverman, LeAnn Rimes, Leeza Gibbons, Michael Newman, Mickey Rooney, Peggy Crosby, Randy Spelling, Traci Bingham, Vanna White A Christmas Eve Miracle – 2015 source Anthony Starke, C. Thomas Howell, Cathleen Mason, Darien Willardson, Dina De Laurentiis, Elizabeth Monte, Elizabeth Montgomery (Monte), JJ Neward, Jon Voight, Jonathan Silverman, Josh Reid, Kimberli Hudson, Lisa Sheridan, Maeve Quinlan, Olivia d’Abo, R. Michael Givens, Sadie Stahura, Steven Paul, Walter Platz, William ‘Bus’ Riley Tagged Anthony Starke, C. Thomas Howell, Cathleen Mason, Darien Willardson, Dina De Laurentiis, Elizabeth Monte, Elizabeth Montgomery (Monte), JJ Neward, Jon Voight, Jonathan Silverman, Josh Reid, Kimberli Hudson, Lisa Sheridan, Maeve Quinlan, Olivia d'Abo, R. Michael Givens, Sadie Stahura, Steven Paul, Walter Platz, William 'Bus' Riley Gimme a Break! : Snippets – 1985 source, two Howard Morton, Joey Lawrence, John Hoyt, Jonathan Silverman, Kari Michaelsen, Lara Jill Miller, Lauri Hendler, Nell Carter, Telma Hopkins Tagged Howard Morton, Joey Lawrence, John Hoyt, Jonathan Silverman, Joseph Lawrence, Kari Michaelsen, Lara Jill Miller, Lauri Hendler, Nell Carter, Telma Hopkins A Magic Christmas – 2014 source Burt Reynolds, C. Thomas Howell, Carla Susan, Clara Susan Morey II, Darien Willardson, Dashiell Howell, Jamee Natella, Jonathan Silverman, Lisa Sheridan, Maeve Quinlan, Sadie Stahura, Samuel Mason Paul Tagged Burt Reynolds, C. Thomas Howell, Carla Susan, Clara Susan Morey II, Darien Willardson, Dashiell Howell, Jamee Natella, Jonathan Silverman, Lisa Sheridan, Maeve Quinlan, Sadie Stahura, Samuel Mason Paul	cc/2021-04/en_middle_0039.json.gz/line1004
__label__wiki	0.867161	0.867161	AMC Javelin – Classic Muscle Car Review 2020 Written by Elise Join our newsletter for news, events, blogs & Mustangs for sale Blog > Car Models > AMC Javelin – Classic Muscle Car Review 2020 By Niamh Smith ‘And They’re Off!’ The AMC Javelin was one of the last pony cars to leave the stable. They had already been pipped to the post by the big three (GM, Ford and Chrysler) and had already “been there, done that, got the t-shirt!”. But for AMC, being late to the party wasn’t the disaster you would think. In fact, it saved them by the skin of their teeth. In this classic muscle car review, we’ll attempt to demonstrate how the Javelin turned the fortunes of AMC around, accompanied by the soundtrack of a roaring V8 engine. The AMC Javelin’s Wet T-shirt Look The American Motors Corporation was a merger of the Hudson Motor Car Company and the Nash-Kelvinator Corporation, over a decade before the Javelin was even thought of back in 1954. By 1967 they were in trouble. The AMC Rambler had made relatively good sales figures, however, it was seen as a dull compact car, and AMC’s finances were in dire straits. By this point, they were still the underdog in the American car manufacturer’s scene, although really only had themselves to blame for the ‘boring car’ reputation, as they had announced to the public that they were “firmly against the promotion of excessive speed and horsepower.” Enter Dick Teague. Teague designed the AMX Vignale concept car; a fibreglass semi-fastback car powered by a 343ci V8 engine. After a cracking reception at its debut in 1966, the AMX Vignale was toned down for mass appeal and competitive pricing. This resulted in the Javelin; a step away from AMC’s economic grocery getters: featuring the long hood, short deck profile that defined the muscle car sector at the time. The Javelin was described by Teague as being ‘endowed with the wet t-shirt look’, having ‘voluptuous curves with nary a hint of fat’. You can’t get much sexier than that, can you? This was exactly what AMC needed. Javelin First Gen: 1968-1970 The first generation Javelin was debuted in August 1967 for the 1968 model year. It only came as a two-door hardtop, but the premium SSR model was a tempting option for muscle car fans. The standard base engine was an in-line six 232ci, but AMC now offered V8 options from the 290ci to the 343ci (5.6L) V8s on their Go Package models. These Go Pac editions featured front disc brakes, heavy-duty suspension, dual exhausts and go-faster body-stripes. The 343ci did 0-60 in 7.86 seconds and covered the quarter-mile in 15.8 seconds. That doesn’t sound particularly fast when compared to its counterparts of the time like the Ford Mustang and Chevrolet Camaro, but it put AMC on the market for performance enthusiasts. With a base price of $2,743, it was a cheaper option than a base model ‘68 Mustang fastback ($2,818) and a ‘68 Camaro ($2,881). The Javelin was also longer and roomier than the Ford Mustang and the Chevrolet Camaro, making it a more practical option. The 390ci was introduced mid-1968 for the SST models, including the Go Pac trim level. The 390ci had 315hp and 425lb ft of torque, so certainly packed a punch. The Mod Javelin package was introduced in 1969, featuring sporty parts like a roof-mounted spoiler, blacked-out twin simulated hood scoops, and ‘big bad’ neon paint options were optional. 1970 AMC Javelins got a new front end and a new rear end with full-width taillights. It also got new engine options; the base option was now a 304ci (5L) and there was also the 360ci (5.9L). The old 390ci was tuned and received new cylinder heads and a 4 barrel carb. On the inside, the Javelin now featured a new centre console, clamshell bucket seats and integral headrests. The Go Pac models gained twin scoops as part of a functional ram air induction system. Javelin Second Gen: 1971-1974 For the Javelin’s second generation, it became lower, wider and heavier. For 1971 the 401ci was an option, with a 4 barrel carb, a high compression ratio of 9.5:1, 330hp and 430lb ft of torque. The 4-speed manual transmission options came with an iconic Hurst Performance floor-mounted shifter. Also in ‘71, AMC ended the production of the AMX as a separate model, and it became a trim level for premium higher performance Javelins. These AMX variants had a fibreglass cowl induction hood, and front and rear spoilers. The Rally Pac option featured instruments for improved handling and suspension, including AMC’s Twin-Grip LSD (limited-slip differential) and power-assisted disc brakes. In 1972, to reduce production costs and offer better value for their customers, Javelins were equipped with more comfort and convenience parts. AMC used Chrysler’s revolutionary TorqueFlite transmission units for their automatic cars, dubbed Torque-Command by AMC. The Javelin reached its record sales in 1972 by focusing on quality, as well as offering a ‘Buyer Protection Plan’ warranty, the first of its kind. In 1973, AMC promoted their improved product quality by bragging “we back them better because we build them better.” Another exciting feature for 1972 and ‘73 model years that made the Javelin unique was an option that only cost $84.95, for which you could have a Pierre Cardin designed interior in your car, with funky 70s style stripes on the seats. 4,152 of these Cardin edition Javelins were produced, likely making them a pretty rare thing nowadays, commanding high value. The AMC Javelin Finishes Its Race By 1974, Chrysler had abandoned the pony car market and Ford had replaced the original Mustang with their smaller Mustang II. Other pony car manufacturers also downsized their engines, due to the ongoing Arab oil embargo. The AMX had struggled with sales, compared to the new Chevrolet Camaro, Pontiac Firebird and the Mustang II, all of which saw an increase in sales. Despite the declining interest in high-performance cars, AMC bravely continued with the Javelin’s big V8 engine options until the end of their production, staying true to its newfound muscle car spirit. Racing Pedigree Keen to show off what they had, in 1968 AMC commissioned Craig Breedlove to prepare a trio of Javelin AMXs to compete in high speed and endurance record attempts. Breedlove’s team established 14 USAC and FIA records and set a record of 189mph at Bonneville Salt Flats in an AMX powered by a 390ci. In 1969, AMC got serious with drag racing, by producing a series of 52 stripped-down, AMX Superstock race cars. They were equipped with 390ci V8s, 4-speed transmissions and 4.44:1 gears, with Twin-Grip LSDs. The cylinder heads were ported by the legendary Hurst Performance, as well as fitting Doug’s headers, twin Holley 650cfm carbs with velocity stacks and an Edelbrock cross-ram intake manifold. The car cost $5,994, and off the forecourt, they ran 11-second quarter miles, but after a bit of tuning, knowledgeable racers had them into the 10s. To check out a badass drag racer who drove for AMC, find our article featuring Shirley Shahan. The Trans Am championship became a popular way for manufacturers to flex their muscles. In 1968 AMC contracted Kaplan Engineering to campaign two Javelins in the championship. The ‘68 series was a success; while not perforning the best out of all the teams, they were the only factory team to finish every event they entered. AMC’s turning point in Trans Am was in 1969-’71 however, when championship winners Roger Penske and Mark Donohue signed a deal with AMC and switched from their Z/28 Camaros to Javelins for the next three seasons. Both GM and Chrysler had pulled out of the ‘71 season, but Ford was still a strong contender in the series. The new 1971 body had improved aerodynamics and re-engineered front suspension geometry. These changes resulted in seven wins, with AMC taking the title for the year. AMC Javelin—Thoroughbred or Mule? The Javelin built itself quite the cult following, despite being quite a rare beast and collector car. Over in the states, they often come up for sale at a decent price and don’t have such a high value compared to other famous muscle cars we’ve featured on this blog. If you’re lucky, you might find one for sale in the UK, where they’re certainly rare; perhaps they’re so rare due to the limited aftermarket support for AMCs, particularly as most have had small-block Chevy engine transplants due to this difficulty in finding parts. Not all Javelins have SBCs in them though, like this insane 1,100hp Hellcat-powered 1972 Javelin AMX built by the Ringbrothers in the states, named ‘Defiant’, unveiled at SEMA in 2017. Javelin owners say that they like to turn heads as they rumble down their street and leave a lasting impression. They drive them for the driving experience, and to feel those horses under the hood. You could argue the Javelin wasn’t one of the greats because it didn’t last as long as other latecomers to the muscle car game, such as the Dodge Challenger, created in 1970. The Javelin may have been late to the game, but it turned AMC’s fortunes around, saving the brand. Becoming defunct only 14 years later, I for one think the Javelin was AMC’s crowning jewel. The Pacer may be more well known to the masses due to its feature in Wayne’s World (1992), but the Javelin got its spot in the limelight too, starring in Bumblebee (2018). That ‘wet t-shirt look’ certainly made a lasting impression with muscle car fans across the world, and since I started researching them, its ‘voluptuous curves’ have quite won me over too. Author: Niamh Smith Muscle Car UK is the UK’s leading specialist Mustang and Muscle Car dealership. We import American muscle cars from the US, restore them here in the UK, and re-home them with our delighted customers. For more updates, news and tips, follow us on Instagram, Facebook, or Twitter. All cars on our feeds are available and up for sale. Looking for something specific? We can help. We also provide service and restoration on any car, classic or otherwise. Liked This Article? More Like This: Dodge Charger VS Chevy Camaro VS Ford Mustang – Which Is Better? How to Buy the Right Classic Car For You In the UK 1968 Ford Mustang S Code 390 Convertible	cc/2021-04/en_middle_0039.json.gz/line1006
__label__wiki	0.924438	0.924438	Rick's Public Home Page Person Page - 2048 Jean Yuill1 F, #40941 Father* (?) Yuill1 Last Edited 25 Sep 2020 Jean married Alvin Raymond Hallett in February 1927 at Saskatchewan, Canada, possibly at Asquith or Saskatoon. They were both living at or near Asquith at the time.1 Alvin Raymond Hallett b. 16 Oct 1898, d. 1977 [S7] Asquith Historical Society, compiler, Asquith Record, The (Box 160, Asquith SK, S0K 0J0: The Asquith and District Historical Society, 1982), Page 149f: Alvin Hallett. Hereinafter cited as Asquith Record. Albert Thomas Rivett1 M, #40942, b. 17 April 1910, d. 22 June 1990 Father* William George Rivett2 b. 31 Jul 1870, d. 2 Oct 1943 Mother* Jane Elizabeth Allcott2 b. 1878 or 1879, d. 26 Oct 1961 or 29 Oct 1961 Last Edited 29 Mar 2020 He was born on 17 April 1910 at Wigston Magna, Leicestershire, England.3,1 He died on 22 June 1990 at Lantzville, British Columbia, Canada, at age 80 according to BC Death Registration 1990-09-012603.1,4 The informant on his death registration was.4 He appeared on the 1916 Census of Canadian Prairie Provinces, Saskatoon, Saskatchewan in the household of his parents, William Rivett and Jane Rivett.5 Albert Rivett (age 3) was found on a passenger list for the "Dominion" with his mother Jane dated 19 January 1914.6 Albert T. Rivett (age 3) was found on a passenger list for the "Dominion" from England and Halifax with his mother Jane dated 20 January 1914.3 Albert Rivett immigrated with his mother, Jane Elizabeth Allcott circa February 1914 to Asquith, RM of Loganton, Saskatchewan, Canada, from England joining his father.3,5 In the obituary of William Rivett who died 2 October 1943, his son, Cpl. A. T. Rivett of the R.C.M.P., Yellowknife, N.W.T., was listed as a survivor.7 In the obituary of Jane Elizabeth Rivett who died 29 October 1961, her son, Albert Rivett of Yellowknife, N.W.T., was listed as a survivor.8 In the obituary of Elizabeth Ann Rivett who died 18 March 1983, her brother, Albert Rivett of Lantzville, BC, was listed as a survivor.9 [S4644] RCMP Graves, online RCMP Graves search page, Corporal Albert Thomas Rivett. Hereinafter cited as RCMP Graves. [S10187] Deaths: Rivett, Saskatoon Star-Phoenix, Saskatoon, Saskatchewan, 04 Oct 1943, Page 2, coulmn 3 viewed at Newspapers.com, Obituary (preliminary): William Rivett. Hereinafter cited as Star-Phoenix. [S667] U.S., Atlantic Ports Passenger Lists, 1820-1873 and 1893-1959, online U.S., Atlantic Ports Passenger Lists, 1820-1873 and 1893-1959, Name: Jane Elizh Rivett, with Elizth (8) Willie Geo. (7) Albert T (3) and Annie R (9 mos infant). Hereinafter cited as U.S., Atlantic Ports Passenger Lists. [S10193] Albert Thomas Rivett, Death Registration 1990-09-012603 (25 Jun 1990), Royal BC Museum - Genealogy Collection, Victoria, British Columbia, Canada, Albert Thomas Rivett, RCMP retired. Hereinafter cited as BC Death Registration - Rivett, A T. [S10197] William Rivett household, June 1, 1916 Canada census, Ottawa, Ontario, Canada, Saskatoon (city) Saskatchewan; Page: 6; Family No: 72, Library and Archives Canada (LAC) Roll: T-21944. [S2009] Canadian Passenger Lists, 1865-1935 , Library and Archives Canada (LAC), Canadian Passenger Lists, 1865-1935; "This database provides indexed access to images of passenger lists from Library and Archives Canada, Department of Employment and Immigration fonds"; cited as "Canadian Passenger Lists, 1865-1935., Jane Rivett (36) with Elizabeth (8), Wm Geo (7), Albert (3) & Annie (9/12). [S10191] William Rivett (photo caption), Saskatoon Star-Phoenix, Saskatoon, Saskatchewan, 13 Oct 1943, Page 3, coulmn 5 viewed at Newspapers.com, Obituary with photo: William Rivett. Hereinafter cited as Star-Phoenix. [S10192] Mrs. W. Rivett Died at Banff, Saskatoon Star-Phoenix, Saskatoon, Saskatchewan, 01 Nov 1961, Page 2, column 3 viewed at Newspapers.com, Obituary: Mrs. Jane Elizabeth Rivett. Hereinafter cited as Star-Phoenix. [S10198] Deaths: Sweeney, Saskatoon Star-Phoenix, Saskatoon, Saskatchewan, 19 Mar 1983, Page 44, column 8 viewed at Newspapers.com, Elizabeth Ann Sweeney née Rivett. Hereinafter cited as Star-Phoenix. George Rivett1 M, #40943, b. circa July 1915, d. 13 February 1993 He was born circa July 1915 at Saskatchewan, Canada.2,3 He died on 13 February 1993 at Mineral Springs Hospital, Banff, Alberta, Canada.4 The following selected information is extracted from his obituary.4 In 1939, he joined the R.C.M.P.3 In the obituary of William Rivett who died 2 October 1943, his son, Cpl. Bus Rivett of the R.C.M.P., Banff, Alberta, was listed as a survivor.6 He retired in 1947 at Oyen, Alberta, Canada, from the R.C.M.P.3 In the obituary of Jane Elizabeth Rivett who died 29 October 1961, her son, Bus Rivett of Banff, Alberta, was listed as a survivor.7 In the obituary of Elizabeth Ann Rivett who died 18 March 1983, her brother, "Bus", George Rivett of Banff, Alberta, was listed as a survivor.8 See the footnotes below for a link to his on-line obituary that appeared Calgary Herald published in Calgary, Alberta, 15 February 1993 .4 [S296] Enlistment papers & Service Files, Soldiers of the First World War, WWI Attestation Papers search (Ottawa, Ontario: Library and Archives Canada), Lance Corporal William Rivett. Hereinafter cited as WWI Service Files. [S10194] Interview with George "Bus" Rivett (unknown informant address), by David Finch, 19 Oct 1992. Glenbow Archives (Calgary, Alberta, Canada), RCT-881-48: Interview with George "Bus" Rivett. [S10195] Deaths: Rivett, Calgary Herald, Calgary, Alberta, 15 Feb 1993, Page 27, column 3 viewed at Newspapers.com, Obituary: George "Bus" Rivett. Hereinafter cited as Calgary Herald. Elizabeth Ann Rivett1 F, #40944, b. 1905 or 1906, d. 18 March 1983 She was born in 1905 or 1906 at Wigston Magna, Leicestershire, England.3,1,4 Elizabeth married Jacob Sweeney.1 She died on 18 March 1983 in a local hospital at Saskatoon, Saskatchewan, Canada.1 The following selected information is extracted from her obituary. Survivor(s): Albert Rivett and George Rivett. Predeceased: Jacob Sweeney, Bill Rivett and Ann.1 Elizabeth Ann Rivett was buried on 21 March 1983 at Woodlawn Cemetery, Saskatoon, Saskatchewan, Canada.5,1 She appeared on the 1916 Census of Canadian Prairie Provinces, Saskatoon, Saskatchewan in the household of her parents, William Rivett and Jane Rivett.3 Elizabeth Rivett (age 8) was found on a passenger list for the "Dominion" with her mother Jane dated 19 January 1914.6 Elizabeth Rivett (age 8) was found on a passenger list for the "Dominion" from England and Halifax with her mother Jane dated 20 January 1914.4 Elizabeth Ann Rivett immigrated with her mother, Jane Elizabeth Allcott circa February 1914 to Asquith, RM of Loganton, Saskatchewan, Canada, from England joining her father.4,3 Elizabeth Sweeney of Saskatoon, sister of the bride, was listed as a witness to the marriage of Victor Arthur Verdun Walton and Annie Rebecca Walton on 24 August 1940.7 In the obituary of William Rivett who died 2 October 1943, his daughter, Mrs. J. Sweeney of Saskatoon, was listed as a survivor.8 In the obituary of Jane Elizabeth Rivett who died 29 October 1961, her daughter, Mrs. J. Sweeney of Saskatoon, was listed as a survivor.9 See the footnotes below for a link to her on-line obituary that appeared StarPhoenix published in Saskatoon, Saskatchewan, 19 March 1983 .1 Jacob Sweeney d. 24 Oct 1967 Marriage* Elizabeth married Jacob Sweeney.1� [S256] Woodlawn Cemetery, Saskatoon, Saskatchewan Internet Site , unknown repository, Woodlawn Cemetery, Saskatoon, Alphabetical Interment pages; "This index gives the name, grave number, Block/Plot/Section id and date of death"; cited as "Woodlawn Cemetery, Saskatoon., Elizabeth Ann Sweeney. [S10200] Walton--Rivett marriage, 27 Aug 1940, Royal BC Museum - Genealogy Collection, Victoria, British Columbia, Canada. 1940-09-494452, BC Marriage Registration: Walton--Rivett. Annie Rebecca Rivett1 F, #40945, b. 13 March 1913, d. 28 December 1981 Father* William George Rivett2,1 b. 31 Jul 1870, d. 2 Oct 1943 Mother* Jane Elizabeth Allcott2,1 b. 1878 or 1879, d. 26 Oct 1961 or 29 Oct 1961 She was born on 13 March 1913 at Leicester, Leicestershire, England, although the passenger list for their arrival in North America gives Wigston (aka Wigston Magna) as her birthplace. This is just south of Leicester.3,4,1 Annie married Victor Arthur Verdun Walton on 24 August 1940 at St. Albans Anglican Church, Edmonds Municipality, British Columbia, Canada. He was a miner.5,1,6 Other information from their marriage registration and/or news article about their wedding: The registration listed the following official witnesses: Elizabeth Sweeney and Jacob Sweeney.6 She died on 28 December 1981 at Maple Ridge Hospital, Maple Ridge, British Columbia, Canada, at age 68. She was a Practical Nurse.1 The informant on her death registration was.1 Annie Rivett (age 9 months) was found on a passenger list for the "Dominion" with her mother Jane dated 19 January 1914.7 Annie R. Rivett (age 9 months) was found on a passenger list for the "Dominion" from England and Halifax with her mother Jane dated 20 January 1914.3 Annie Rivett immigrated with her mother, Jane Elizabeth Allcott circa February 1914 to Asquith, RM of Loganton, Saskatchewan, Canada, from England joining her father.3,4 In the obituary of William Rivett who died 2 October 1943, his daughter, Annie Rebecca Rivett of Bralorne, BC, was listed as a survivor.5 In the obituary of Jane Elizabeth Rivett who died 29 October 1961, her daughter, Mrs. V. Walton of Britannia Beach, BC, was listed as a survivor.8 In the obituary of Elizabeth Ann Rivett who died 18 March 1983, her sister, Ann was listed as predeceased.9 Victor Arthur Verdun Walton b. 14 Mar 1916, d. 15 Jan 1969 Marriage* Annie married Victor Arthur Verdun Walton on 24 August 1940 at St. Albans Anglican Church, Edmonds Municipality, British Columbia, Canada. He was a miner.5,1,6� MarWitReg [S10199] Annie Rebecca Walton née Rivett, Death Registration 1981-09-020340 (08 Jan 1982), Royal BC Museum - Genealogy Collection, Victoria, British Columbia, Canada, BC Death Registration Image: Annie Rebecca Walton née Rivett. Hereinafter cited as BC Death Registration - Walton, A R. Victor Arthur Verdun Walton1 M, #40946, b. 14 March 1916, d. 15 January 1969 He was born on 14 March 1916 at England.2 Victor married Annie Rebecca Rivett on 24 August 1940 at St. Albans Anglican Church, Edmonds Municipality, British Columbia, Canada. He was a miner.3,1,4 He died on 15 January 1969 at Squamish General Hospital, Squamish, British Columbia, Canada, at age 52. He was a truck driver for Rayonier of Canada Ltd.2 The informant on his death registration was.2 Annie Rebecca Rivett b. 13 Mar 1913, d. 28 Dec 1981 [S10201] Victor Arthur Walton, Death Registration 1969-09-002610 (4 Feb 1969), Royal BC Museum - Genealogy Collection, Victoria, British Columbia, Canada, BC Death Registratin image: Victor Arthur Walton. Hereinafter cited as BC Death Registration - Walton, V. A. Jacob Sweeney1,2 M, #40949, d. 24 October 1967 Jacob married Elizabeth Ann Rivett.2 He died on 24 October 1967.1 Jacob Sweeney was buried on 28 October 1967 at Woodlawn Cemetery, Saskatoon, Saskatchewan, Canada.1 He of Saskatoon, brother-in-law of the bride, was listed as a witness to the marriage of Victor Arthur Verdun Walton and Annie Rebecca Walton on 24 August 1940.3 In the obituary of Elizabeth Ann Rivett who died 18 March 1983, her husband, Jacob Sweeney was listed as predeceased.2 Elizabeth Ann Rivett b. 1905 or 1906, d. 18 Mar 1983 [S256] Woodlawn Cemetery, Saskatoon, Saskatchewan Internet Site , unknown repository, Woodlawn Cemetery, Saskatoon, Alphabetical Interment pages; "This index gives the name, grave number, Block/Plot/Section id and date of death"; cited as "Woodlawn Cemetery, Saskatoon., Jacob Sweeney. Ivy May Taber1 F, #40950, b. 28 April 1904, d. 5 October 2005 She was born on 28 April 1904 at Hanwell, Borough of Ealing, Middlesex, England.2 Ivy married William George Groves Rivett on 23 September 1929 at Saskatoon, Saskatchewan, Canada.2 Ivy May Taber was buried at Forest Lawn Memorial Park, Cypress, Orange County, California, USA.3 She died on 5 October 2005 at California, USA, at age 101.3 She emigrated with William George Groves Rivett and Ivy Rivett on 2 March 1947 from New Westminster, British Columbia, Canada; to the United States through Blaine, Washington on the Great Northern Railroad (G.N.R.R.)2 She and William George Groves Rivett declared the intention to become naturalized on 14 June 1948 at Los Angeles, California, USA.2 Ivy May Rivett was naturalized on 15 July 1954 at Los Angeles, Los Angeles County, California, USA, when she signed her Oath of Allegiance on her Petition for Naturalization.4 William George Groves Rivett b. 22 Jul 1906, d. 15 Mar 1975 Marriage* Ivy married William George Groves Rivett on 23 September 1929 at Saskatoon, Saskatchewan, Canada.2� Stanley Allen Rivett2 b. 22 Dec 1930, d. 16 Oct 2003 [S7620] California, Federal Naturalization Records, 1843-1999 (Publisher: Ancestry), Ancestry.com, California, Federal Naturalization Records, 1843-1999; "Naturalization Records. National Archives at Riverside, Peris, California and Naturalization Records. National Archives at San Francisco, San Bruno, California. Images included"; cited as "California, Federal Naturalization Records, 1843-1999., Name: William Rivett aka William George Grove Rivett. [S7620] "California, Federal Naturalization Records, 1843-1999", online California, Federal Naturalization Records, 1843-1999: Name: William George Groves Rivett. [S3862] Find A Grave memorial page , Find A Grave, Find A Grave search page; "A database submitted by individuals supposedly of cemetery interments, often from grave memorials or cemetery records and often supplemented by other information, generally without identification of the sources except when a tombstone photo is included."; cited as "Find A Grave., Ivy May Rivett Grave marker transcription: Ivy May Rivett Beloved Wife, Mother, Grandmother and Great-Grandmother 1904 - 2005. [S7620] "California, Federal Naturalization Records, 1843-1999", online California, Federal Naturalization Records, 1843-1999: Name: Ivy May Rivett née Taber. Stanley Allen Rivett1 M, #40951, b. 22 December 1930, d. 16 October 2003 Father* William George Groves Rivett2 b. 22 Jul 1906, d. 15 Mar 1975 Mother* Ivy May Taber2 b. 28 Apr 1904, d. 5 Oct 2005 He was born on 22 December 1930 at Saskatoon, Saskatchewan, Canada.2 He died on 16 October 2003 at age 72.3 Military Service - United States Air Force Stanley Allen Rivett began military service on 3 January 1951 at the age of 20.4 Stanley Allen Rivett ended his military service on 8 December 1954 End of Military Service section.3 He emigrated with his parents, William George Groves Rivett and Ivy Rivett on 2 March 1947 from New Westminster, British Columbia, Canada, to the United States; to the United States through Blaine, Washington on the Great Northern Railroad (G.N.R.R.)2 Stanley Rivett was included in the Declaration of Intent to seek naturalization by his parents, William George Groves Rivett and Ivy Rivett on 14 June 1948 at Los Angeles, California, USA.2 Stanley Allen Rivett declared the intention to become naturalized on 18 December 1950 at Los Angeles, Los Angeles County, California, USA.1 He was naturalized on 5 November 1953 at Spokane, Washington, USA, when he took his oath of allegiance.4 [S7620] California, Federal Naturalization Records, 1843-1999 (Publisher: Ancestry), Ancestry.com, California, Federal Naturalization Records, 1843-1999; "Naturalization Records. National Archives at Riverside, Peris, California and Naturalization Records. National Archives at San Francisco, San Bruno, California. Images included"; cited as "California, Federal Naturalization Records, 1843-1999., Name: Stanley Allen Rivett. [S3870] U.S., Department of Veterans Affairs BIRLS Death File, 1850-2010 (Publisher: U.S. Department of Veterans Affairs), Ancestry.com, U.S., Department of Veterans Affairs BIRLS Death File, 1850-2010; "Original data: Beneficiary Identification Records Locator Subsystem (BIRLS) Death File. Washington, D.C.: U.S. Department of Veterans Affairs."; cited as "BIRLS Death File., Name: Stanley Rivett. [S10204] Stanley Allen Rivett, Petition, # 10241 (5 Nov 1953); Ancestry.com, Provo, Utah, USA. George Rivett1,2 M, #40952, b. circa 1848 He was born circa 1848 at Leicestershire, England.2 George married Eliza Groves between 1 April 1867 and 30 June 1867 at Leicestershire, England.3,2 George Rivett and Eliza Rivett appeared on the 1881 British Census of England, at Leicester, Leicestershire, enumerated 3 April 1881. Their children William, Anne M. and George were listed as living with them.2 Eliza Groves b. c 1847 William George Rivett+1 b. 31 Jul 1870, d. 2 Oct 1943 Anne M. Rivett2 b. c 1873 George Rivett2 b. c 1876 [S10203] George Rivett household, April 3, 1881 U.K. Census, England, Leicester St Margaret, Leicestershire; Class: RG11; Piece: 3165; Folio: 89; Page 20, The National Archives of the UK (TNA): Public Record Office (PRO) GSU roll: 1341755. [S6718] England & Wales, Civil Registration Marriage Index, 1837-1915, online England & Wales, Civil Registration Marriage Index, 1837-1915, George Rivett & Eliza Groves. Hereinafter cited as England & Wales, Civil Registration Marriage Index, 1837-1915. Eliza Groves1,2 F, #40953, b. circa 1847 She was born circa 1847 at Long Whatton, Leicestershire, England.2 Eliza married George Rivett between 1 April 1867 and 30 June 1867 at Leicestershire, England.1,2 Eliza Rivett and George Rivett appeared on the 1881 British Census of England, Leicester, at Leicestershire, enumerated 3 April 1881. Their children William, Anne M. and George were listed as living with them.2 George Rivett b. c 1848 Anne M. Rivett1 Father* George Rivett1 b. c 1848 Mother* Eliza Groves1 b. c 1847 She was born circa 1873 at Leicestershire, England.1 Anne M. Rivett appeared on the1881 British Census of at Leicester, at Leicestershire, England, in the household of her parents, George Rivett and Eliza Rivett.1 He was born circa 1876 at Leicestershire, England.1 George Rivett appeared on the1881 British Census of at Leicester, at Leicestershire, England, in the household of his parents, George Rivett and Eliza Rivett.1 William Fehlaber1 M, #40956 He was born at Germany.1 William married Louise Hauk.1 Louise Hauk Carl Fehlhaber+1 b. 24 Jun 1850, d. 29 May 1935 [S1347] Ontario, Canada, Deaths and Deaths Overseas, 1869-1946 (Publisher: Archives of Ontario), Ancestry.com, Ontario, Canada, Deaths and Deaths Overseas, 1869-1946; "This database is an index (with images) to over 2 million deaths that were registered in Ontario from 1869 to 1938, and 1943 to 1946. The database also includes deaths of Ontario military personnel overseas from 1939-1947"; cited as "ON Deaths, 1869-1946., Name: Charles Fehlaber. Louise Hauk1 Louise married William Fehlaber.1 She was born at Germany.1 William Fehlaber Mahala Maude Hathaway1,2 F, #40958, b. 15 August 1879 Father* Francis Hathaway2 Mother* Hessey Echlin2 Last Edited 2 Apr 2020 She was born on 15 August 1879 at Colborne Twp., Huron County, Ontario, Canada, according to Ontario Birth Registration 012167.3,2 Matilda married Richard Sanders on 25 June 1903 at Wallaceburg, Kent County, Ontario, Canada, according to Ontario Marriage Registration 010633. . He was a printer living in Leamington. He gave his birthplace as "Birmingham E" (England.)4,5 Mahala M. Sanders of Asquith was listed as next-of-kin on her husband Richard's attestation (enlistment) papers.6 Mahala Maude Hathaway and Richard Sanders appeared on the 1916 Census of Canadian Prairie Provinces, Asquith, RM of Loganton, Saskatchewan, enumerated 1 June 1916, enumerated as a soldier away from home at Camp Hughes.3 Mahala Maude Sanders was a survivor of her husband Richard who was killed in action in Belgium on 10 November 1917.7 Richard H. Sanders b. 27 Nov 1878, d. 10 Nov 1917 [S296] Enlistment papers & Service Files, Soldiers of the First World War, WWI Attestation Papers search (Ottawa, Ontario: Library and Archives Canada), CEF Service File: Private Richard Sanders; Page 7 & 45. Hereinafter cited as WWI Service Files. [S1348] Ontario, Canada Births, 1869-1913, online Ontario, Canada Births, Name: Mahala Maude Hathaway. Hereinafter cited as ON Births 1869-1913. [S10207] Richard Sanders household, June 1, 1916 Canada census, Ottawa, Ontario, Canada, Asquith, Saskatchewan; Page: 24; Family No: 233, Library and Archives Canada (LAC) Roll: T-21944. [S296] Enlistment papers & Service Files, WWI Service Files, WWI Attestation Papers search, CEF Service File: Private Richard Sanders; Page 1 & 7. [S1349] Ontario, Canada, Marriages, 1826-1936 (Publisher: Archives of Ontario, Toronto), Archives of Ontario, Ontario, Canada Marriages, 1785-1935; "Ontario, Canada, Select Marriages. Archives of Ontario, Toronto. This database includes images of the registrations. In some cases, alternative images in FamilySearch provide additional information"; cited as "Ontario Marriages, 1826-1936., Richard Sanders & Matilda M Hathaway. [S296] Enlistment papers & Service Files, WWI Service Files, WWI Attestation Papers search, CEF Service File: Private Richard Sanders; Page 7. Richard Sanders1,2 M, #40959, b. circa 1835, d. 21 March 1901 Last Edited 11 May 2020 He was born circa 1835 at England.2 Richard married Margaret Palmer Swainson.3,1,4,2 He died on 21 March 1901 at Leamington, Mersea Twp., Essex County, Ontario, Canada, according to Ontario Death Registration 009056.5,6 Richard Sanders was buried at Lakeview Cemetery, Leamington, Essex County, Ontario, Canada.7 Richard Sanders and Margaret Palmer appeared on the 1891 Canadian Census of an unknown place , enumerated 7 April 1891. Richard was enumerated as a market gardener and Church of England. Their children Charles Swanson (sic), Geoffry Herbert, Margaret Swainson, Lucas Anthony, Richard, Lilian Mary and Grace Agatha were listed as living with them.2 Richard Sanders and Margaret Sanders immigrated on 15 May 1881 thru Québec City, Québec, Canada, from Liverpool, England aboard the "S.S. Sardinian", accompanied by Charles, Jeffery, Lucas, Margaret and Richard.8,9 Margaret Palmer Swainson b. 21 Nov 1840, d. 1 Jun 1919 Charles Sanders8,10 b. 10 Sep 1870, d. 28 Aug 1924 Jeffrey Herbert Sanders8,2 b. c 18 Apr 1872, d. 15 Jul 1907 Margaret Swainson Sanders8,2 b. 1 Jul 1873, d. 15 Sep 1945 Lucas Anthony Sanders8 b. c 1875 Richard H. Sanders2 b. 27 Nov 1878, d. 10 Nov 1917 Lilian Mary Sanders11 b. 22 Mar 1883 Grace Agatha Sanders12,2 b. 25 Feb 1887 [S10208] Richard Sanders household, Apr 7, 1891 Canada Census, Ottawa, Ontario, Canada, Chatham (Township) Bothwell County, Ontario; Page: 13; Family: 64, Library and Archives Canada (LAC) Roll: T6324. [S296] Enlistment papers & Service Files, Soldiers of the First World War, WWI Attestation Papers search (Ottawa, Ontario: Library and Archives Canada), CEF Service File: Private Richard Sanders; Page 15. Hereinafter cited as WWI Service Files. [S3160] Canada GenWeb Cemetery Project - Ontario, online Canada GenWeb Cemetery Project - Ontario, Lakeview Cemetery, Essex County, Ontario: Margaret Palmer Sanders Margaret Palmer wife of Richard Sanders Born in Liverpool England Nov 21, 1840 Died in Leamington Canada June 1, 1919. Hereinafter cited as Canada GenWeb Cemetery Project - Ontario. [S1347] Ontario, Canada, Deaths and Deaths Overseas, 1869-1946 (Publisher: Archives of Ontario), Ancestry.com, Ontario, Canada, Deaths and Deaths Overseas, 1869-1946; "This database is an index (with images) to over 2 million deaths that were registered in Ontario from 1869 to 1938, and 1943 to 1946. The database also includes deaths of Ontario military personnel overseas from 1939-1947"; cited as "ON Deaths, 1869-1946., Name: Richard Sanders. [S3160] Canada GenWeb Cemetery Project - Ontario, online Canada GenWeb Cemetery Project - Ontario, Lakeview Cemetery, Essex County, Ontario: Richard Sanders In loving memory of Richard Sanders Born in Worchester, England Apr 21, 1836 Died in Leamington, Canada Mar 21, 1901. In Loving Memory of Richard Sanders Born in Worcestershire England Apr 21, 1836 Died in Leamington, Canada Mar 21, 1901. [S2009] Canadian Passenger Lists, 1865-1935 , Library and Archives Canada (LAC), Canadian Passenger Lists, 1865-1935; "This database provides indexed access to images of passenger lists from Library and Archives Canada, Department of Employment and Immigration fonds"; cited as "Canadian Passenger Lists, 1865-1935., Richard (45) & Margt (40) Sanders with Chas (10), Jeffery (8), Margt (6), Lucas (3) and Rich. (inf). [S10354] Margaret Sanders household, 31 Mar 1901 Canada census, Ottawa, Ontario, Canada, Mersea (township) Essex South, Ontario; Page: 11; Family: 108, Library and Archives Canada (LAC) Roll: T-6467. [S7219] Michigan, Death Records, 1867-1952 (Publisher: Michigan Department of Community Health, Division for Vital Records and Health Statistics, Lansing, Michigan), Ancestry.com, Michigan, Death Records, 1867-1950; "Death Records. Michigan Department of Community Health, Division for Vital Records and Health Statistics, Lansing, Michigan. NOTE: no images of the original documents are included in this database"; cited as "Michigan, Death Records, 1867-1952., Name: Charles Swanson (sic) Sanders. [S1348] Ontario, Canada Births, 1869-1913, online Ontario, Canada Births, Name: Lillian May Sanders. Hereinafter cited as ON Births 1869-1913. [S1348] ON Births 1869-1913, online Ontario, Canada Births, Name: Grace Agatha Sanders. Margaret Palmer Swainson1,2,3 F, #40960, b. 21 November 1840, d. 1 June 1919 Father* John Swainson2,4 Mother* Margaret Taylor2,4 She was born on 21 November 1840 at Liverpool, Lancashire, England.5,6,2,7 She was baptized on 1 January 1841 at Saint Peter, Liverpool, Lancashire, England.2 Margaret married Richard Sanders.1,8,5,3 She died on 1 June 1919 at Leamington, Mersea Twp., Essex County, Ontario, Canada, at age 78.4,5 The informant on her death registration was W. Smith.4 Margaret Palmer Swainson was buried at Lakeview Cemetery, Leamington, Essex County, Ontario, Canada.5 Margret Sanders appeared on the 1901 Canadian Census of an unknown place , enumerated 31 March 1901. Margret was enumerated as a widowed farmer and Church of England. Her children Charles, Margret, Lucas, Lillian and Grace were listed as living with her.7 Margaret Sanders and Richard Sanders immigrated on 15 May 1881 to Québec City, Québec, Canada, from Liverpool, England aboard the "S.S. Sardinian", accompanied by Charles, Jeffery, Lucas, Margaret and Richard.9,7 Margaret Palmer Swainson was a survivor of her son Richard who was killed in action in Belgium on 10 November 1917.10 Richard Sanders b. c 1835, d. 21 Mar 1901 Marriage* Margaret married Richard Sanders.1,8,5,3� Charles Sanders9,11,7 b. 10 Sep 1870, d. 28 Aug 1924 Margaret Swainson Sanders9,3,7 b. 1 Jul 1873, d. 15 Sep 1945 Lucas Anthony Sanders9,7 b. c 1875 Richard H. Sanders1,3 b. 27 Nov 1878, d. 10 Nov 1917 Lilian Mary Sanders12,7 b. 22 Mar 1883 Grace Agatha Sanders13,3,7 b. 25 Feb 1887 [S6717] England, Select Births and Christenings, 1538-1975 (Publisher: FamilySearch (2013)), Ancestry.com, England, Select Births and Christenings, 1538-1975; "England, Births and Christenings, 1538-1975. Images not included"; cited as "England, Select Births and Christenings, 1538-1975., Name: Margaret Palmer Swainson. [S1347] Ontario, Canada, Deaths and Deaths Overseas, 1869-1946 (Publisher: Archives of Ontario), Ancestry.com, Ontario, Canada, Deaths and Deaths Overseas, 1869-1946; "This database is an index (with images) to over 2 million deaths that were registered in Ontario from 1869 to 1938, and 1943 to 1946. The database also includes deaths of Ontario military personnel overseas from 1939-1947"; cited as "ON Deaths, 1869-1946., Name: Margaret P Sanders. [S3862] Find A Grave memorial page , Find A Grave, Find A Grave search page; "A database submitted by individuals supposedly of cemetery interments, often from grave memorials or cemetery records and often supplemented by other information, generally without identification of the sources except when a tombstone photo is included."; cited as "Find A Grave., Lakeview Cemetery, Essex County, Ontario: Margaret Sanders Margaret Palmer wife of Richard Sanders Born in Liverpool England Nov 21, 1840 Died Graninston Canada June 1, 1919. Compiler: Rick Moffat, Mesa, AZ Site updated on 10 Jan 2021; 23,086 people Page created by John Cardinal's Second Site v8.01. \| Based on a design by growldesign	cc/2021-04/en_middle_0039.json.gz/line1011
__label__cc	0.646207	0.353793	Take our survey! Let us know your interests & needs for NC history resources. Thank you from the State Library of NC. Railroad station in Chihuahua, Mexico Men with briefcases wearing business attire stand engaged in conversation on a train platform. A family with small children is gathered farther down the platform. Two passenger train cars sit at the station. Chihuahua is the largest state in Mexico and shares a border with the United States. The largest city in the state is Ciudad Juarez, which is known for it's manufacturing industry. The state is named for the Chihuahua desert, though much of the state is actually covered in leafy forests. Usage Statement: Creative Commons BY-NC-SA This item has a Creative Commons license for re-use. This Creative Commons BY-NC-SA license means that you may use, remix, tweak, and build upon the work for non-commerical purposes as long as you credit the original creator and as long as you license your new creation using the same license. For more information about Creative Commons licensing and a link to the license, see full details at https://creativecommons.org/licenses/by-nc-sa/4.0/. PLEASE NOTE: NCpedia provides the comments feature as a way for viewers to engage with the resources. Comments are not published until reviewed by NCpedia editors at the State Library of NC, and the editors reserve the right to not publish any comment submitted that is considered inappropriate for this resource. NCpedia will not publish personal contact information in comments, questions, or responses. If you would like a reply by email, note that some email servers, such as public school accounts, are blocked from accepting messages from outside email servers or domains. If you prefer not to leave an email address, check back at your NCpedia comment for a reply. Please allow one business day for replies from NCpedia. Complete guidelines are available at https://ncpedia.org/about. How to use NCpedia State Encyclopedias @ForEverythingNC tweets RT @ForEverythingNC: As recommended by public safety officials, state government facilities in downtown Raleigh, including the State Lib… https://t.co/Dx7JpFWyFB — 22 hours 9 min ago RT @ncculture: Eight months before Dr. Martin Luther King Jr. delivered his iconic “I Have a Dream” speech in Washington D.C., he… https://t.co/OTWOVu8fKu — 1 day 14 hours ago RT @NC_Markers: Speaking in the gymnasium at Rocky Mount's Booker T. Washington High School on November 27, 1962, Martin Luther Kin… https://t.co/tysvJMG4gp — 1 day 15 hours ago Label vector designed by Ibrandify - Freepik.com	cc/2021-04/en_middle_0039.json.gz/line1015
__label__cc	0.681282	0.318718	info@neelain.edu.sd Faculties & Colleges Faculty of Computer Science and Information Technology Faculty of Optometery and Visual Sciences Faculty of Medical Laboratory sciences Faculty of Sciences & Technology Faculty of Mathematical Sciences & Statistics Faculty of Agricultural Technology & Fish sciences Faculty of Petroleum & Minerals Faculty of Community Development Faculty of Economic and Social Studies Faculty of Nursing Sciences Faculty of Physiotherapy Faculty of Islamic Studies Libraries System Al Neelain Institute for humanitarian, economic and legal studies ICT Center Dialogue of Civilizations Center Al Neelain's Medical Research Center Al Neelain Center for Langauges Learning and Research Pre-University Education Research Center Neelain Institute for Engineering, Technology and Computer Researches (NIETCR) Automatic Control Research Center Embedded Systems Center Al Neelain Stem Cell Center Home Faculties & Colleges Faculty of Commerce Acadimic Calender College Album College Statistics Strategic plan for the faculty More Info About College Faculties News Students Final Results for academic year 2017 - 2018 - Faculty of Medicine - 2018-07-17 22:22:11 Graduate Studies - Master Program Batch (10) Exams Time table - Faculty of Medical Laboratory sciences - 2018-06-07 02:03:40 Second Sem.ex.table - Faculty of Mathematical Sciences & Statistics - 2018-05-17 13:46:37 the society of integrated Medicine & sleep disorders conference - Faculty of Medicine - 2018-05-15 14:15:28 SIMS 7 - Faculty of Medicine - 2018-05-15 14:09:50 Alneelain university Participation in workshop of Sudanese schools of medicine - Faculty of Medicine - 2018-05-12 03:08:27 Biochemistry Exhibition - Faculty of Medicine - 2018-05-12 02:57:14 Master program-Call for application (Batch 11) - Faculty of Medical Laboratory sciences - 2018-05-06 15:20:26 Master of Commercial Law - Graduate College - 2018-03-28 22:51:29 Master of International Law - Graduate College - 2018-03-28 22:47:01 ماجستير العلوم في تطبيقات الاستشعار عن بعد ونظم المعلومات الجغرافية في الجيولوجيا - Graduate College - 2018-03-28 22:33:24 Master of Science in Engineering Geology - Graduate College - 2018-03-28 22:29:44 Establishment & Development Our vision is to be a top-of-mind Commercials Program as reflected by the recognition of our brand, the reputation of our people, and the rankings of our programs. Our mission is to provide high quality Commerce Education to our undergraduate and post graduate students through the delivery of a current, responsive, and innovative curriculum that promotes intellectual and professional development. Is to offer high-quality academic programs designed to give students a competitive advantage in the world of Business both now and in, and in the future. 1. TO Build the necessary infrastructure that suit the faculty needs. 2. To create a conducive environment. 3. To develop academic, management and research capabilities. 4. Matching the faculty academic programs with labour market needs. 5. To work as aconsultant body in its field to serve the community. 6. To build scientific relationships with peer colleges and regional and international research centers. 7. To accredit faculty programs from local, regional and international accreditation bodies. In the name of Allah we start a new term of this academic year hoping and asking Allah to grant me and you the ability to work and to help our faculty, our university, and our beloved country to occupy a prominent position In the world ; a position our country is worthy of. Our faculty of Business is a promising one in her ability to fulfill the anticipated successful future to us and to our country. At the end we pray to Allah to help us in our continuous effort to acquire the scientific and mental skills to help all of us to occupy the highest positions in the world. Abdel Aziz Abde... Kamal Ahmed You... College in social media Ministry of higher education and scientific research General Administration for Admission Headquarter Address: El gamhuriya avenue, Khartoum, Sudan. Email: info@neelain.edu.sd © Al Neelain University 2021	cc/2021-04/en_middle_0039.json.gz/line1016
__label__wiki	0.864424	0.864424	› Trading › President to Dismiss All Chief Secretaries President to Dismiss All Chief Secretaries nepalnewsgazette.com October 30, 2016 Comment Closed Trading Anchor: Amid the growing controversy and public outrage over President Park Geun-hye's longtime friend Choi Soon-sil, the president ordered all ten of her senior secretaries to step down. The decision came just a few days after she offered a public apology over the scandal. The first batch of the personnel reshuffle is expected to be unveiled as early as next week. Kim Bum-soo has more. Report: Mired in the largest political scandal it ever faced, the Park Geun-hye administration announced that all ten senior presidential secretaries were ordered to step down. In a text message to reporters Friday night, Presidential Spokesman Jung Youn-kuk revealed Park's decision. The president was under enormous pressure to dismiss key aides and Cabinet ministers to turn over a new leaf since her apologetic news conference on Tuesday. At the news conference, Park admitted to media accusations that her longtime friend Choi Soon-sil was involved in drafting presidential speeches. But her confession only added weight to snowballing suspicions that Choi did more than just fixing speeches. The 60-year old friend of the president has already been accused of wielding influence in policy and personnel decisions and being involved in illicit business practices tied to two private foundations which, some argue, were to be used as the basis of the president's post-retirement activities. Among the ten presidential aides of Park, Chief Policy Coordinator Ahn Jong-beom and Senior Civil Affairs Secretary Woo Byung-woo are at the center of the scandal. Ahn is allegedly involved in raising funds for the foundations and the other failed to prevent the influence peddling as he is known to be a close associate of Choi. Park's Chief of Staff Lee Won-jong already offered to resign Wednesday. Along with the chief-level secretaries, the president is also expected to dismiss her closest entourage of three, who have aided her since 1998. Widely criticized as the three door knobs to the president, Private Presidential Secretary Jeong Ho-seong, Secretary for General Affairs Lee Jae-man and PR Secretary Ahn Bong-geun are also blamed for their parts in the current scandal. Multiple officials at the top office said that the president is expected to introduce the first batch of her personnel decisions early next week. Kim Bum-soo, KBS World Radio News. Choi Soon-sil Says to Fully Cooperate with Prosecutors’ Investigation Michel Aoun Set to be New President, Power Vacuum Comes to an End	cc/2021-04/en_middle_0039.json.gz/line1018
__label__wiki	0.961594	0.961594	Donald Sterling: Magic 'Should Be Ashamed of Himself' Why did Los Angeles Clippers owner Donald Sterling take so long to say he's sorry for the racist remarks that got him banned from the NBA? Magic Johnson, he claims, told him to stay quiet. "Wait, be patient, I'll help you, we'll work it out," Sterling said the NBA legend told him. In an exclusive interview with CNN's Anderson Cooper, Sterling spoke publicly for the first time since a controversial audio recording of him sparked a firestorm and put his ownership of the Clippers in jeopardy. He repeatedly apologized and denied accusations that he's racist, claiming he'd been "baited" into making what he called "terrible" remarks. But while he defended himself for much of the interview, he went on the offensive when Johnson's name came up. Sterling, 80, slammed the former Los Angeles Lakers player's character and his battle with HIV, saying Johnson hasn't done anything to help others. "What kind of a guy goes to every city, has sex with every girl, then he catches HIV? Is that someone we want to respect and tell our kids about?" Sterling asked. "I think he should be ashamed of himself. I think he should go into the background. But what does he do for the black people? He doesn't do anything." Johnson has been a central figure in the controversy since the recording of Sterling speaking with friend V. Stiviano surfaced last month on TMZ. In the recording, which drew widespread condemnation from fans, players and the league, Sterling chastises Stiviano for posting pictures online of her posing with African-Americans, including Johnson. He tells her not to bring Johnson to Clippers games. "Admire him, bring him here, feed him, f**k him, but don't put (Magic) on an Instagram for the world to have to see so they have to call me," he said. As criticism over the recording spread, Johnson was among the first to say that Sterling should be forced to sell the team. Now, as Sterling faces a lifetime ban from the National Basketball Association, a $2.5 million fine for the remarks and the possibility that fellow NBA owners could force him to sell the team he's owned for more than 30 years, he claims Johnson is angling for control of the Clippers. Sterling said that he waited so long to apologize about the recording because Johnson, who led the Los Angeles Lakers to five NBA championships, called him and told him to remain silent. "I know the girl, don't do anything. I'll help you," Sterling says Johnson told him. "I think he wanted me to just do nothing so he could buy the team," Sterling said. Johnson hasn't indicated whether he would pursue a Clippers ownership position. Watch more of Anderson Cooper's interview with Donald Sterling on Tuesday at 8 p.m. ET. Cooper will also speak to Magic Johnson. MORE on CNN.com Posted by Catherine E. Shoichet, Steve Almasy Filed under: News • Videos jnunley34 How can a rights violation evolve into a legal battle and Magic Johnson interview at the same time? Rebecca Szerman Mr. Sterling should not stand in judgment of Magic Johnson, whoever he did or did not sleep with his none of his business. I think Mr. Sterling best keep his mouth shut because he is digging a bigger hole for himself. blvicente I deplore Sterling. But he has a point about Magic Johnson. I do wonder why we have chosen to deify him. Cornelia Goffney The issue is not Magic Johnson's health or behavior; it is about the condition of Sterling's heart that his mouth revealed. Sterling continued to shift the blame to his mistress or to try to make Magic look bad. It is apparent that he has a problem with Magic. He talked about him on the tape and continued to do so in the interview. He must be jealous of him, wishing he could "have sex with every girl in America." Who can he talk about, he is moral bankrupt in many ways himself. It takes more than a weak hearted apology to undo a long life of racism. He needs to go somewhere and shut is sick mouth before he chokes on his own vomit! Leave a Reply to jnunley34	cc/2021-04/en_middle_0039.json.gz/line1022
__label__wiki	0.655155	0.655155	CCR Home DTE Energy builds strong relationships with people in the communities where we live and serve. We believe it is our responsibility to help protect and shape a prosperous future for our communities. Our employees live this belief by dedicating their time, skills and energy to organizations throughout Michigan. We support organizations focused on strengthening the middle class and increasing economic growth. We work to ensure basic needs are met so people and communities can thrive through our partnerships with human service organizations like United Way and American Red Cross. We partner with Habitat for Humanity and other organizations to provide affordable housing and with Kid's Food Basket to battle children's hunger in Greater Michigan. CEO Message > About This Report > Energy Transformation > Michigan Story > Making Michigan Better — One Community at a Time Our DTE Care Force employee volunteers support projects that positively impact nonprofits and our communities. During 2016, more than 2,300 employees volunteered more than 21,000 hours to support more than 300 organizations. Organizations We Support > The DTE Energy Foundation awarded nearly $15 million during 2016 to 360 nonprofit organizations to positively impact communities throughout the state. Our Foundation's Impact > Rebuilding the Middle Class DTE Energy is committed to supporting jobs and educational programs that strengthen the middle class. We partner with organizations whose mission it is to provide resources and training for today's jobs to those with structural unemployment issues. We also work with educational institutions to create or improve skilled trade curriculums that prepare students for careers in the energy sector and beyond. See the jobs we helped create > Opening a World of Opportunity with Summer Jobs In 2016, the DTE Energy Foundation funded nearly 600 summer work opportunities for youth with more than 50 nonprofits around Detroit and Greater Michigan. See our program partners Preparing Students for 21st Century Jobs DTE Energy and the DTE Energy Foundation support 33 robotics teams across the state, from elementary school through high school. Our employees also share their expertise in this area by acting as robotics mentors. See How We Support FIRST in Michigan The Lighting of Detroit DTE Energy managed and executed the City of Detroit's Public Lighting Authority (PLA) project to install 65,000 new energy-efficient light-emitting diode (LED) street lights. This project began in 2012, when less than 50 percent of the city's street lights were functioning. When completed in December 2016, Detroit became the largest city in the United States to have 100 percent public LED lighting. Learn how we lit the city Our Commitment to Michigan Businesses As part of our commitment to support Michigan businesses, DTE Energy spent $1.3 billion with local suppliers, including $410 million with diverse suppliers. Since 2010, DTE spent $2.6 billion with Michigan suppliers. Get the numbers > 2016 Michigan Supplier Spend Twitter DTE Facebook DTE LinkedIn DTE Youtube DTE Report Downloads /wps/wcm/connect/dte-web/dte-pages/ccr/home/community	cc/2021-04/en_middle_0039.json.gz/line1023
__label__wiki	0.946297	0.946297	Exeter resident’s views invited on Electric Vehicle charge-point proposals Electric Vehicle charge-point Exeter residents are invited to give their views on proposals to install rapid-charging electric vehicle (EV) charge points at 10 locations across the City. The locations proposed are Barrack Road, Belmont Road, Cowick Hill, Hanover Road, Haven Road, Howell Road, Kinnerton Way, Langaton Lane, St Leonards Road and Whipton Lane. A Traffic Regulation Order is being advertised and members of the public can comment up until February 11, 2021 by going to Devon County Council’s (DCC) website. And to enable more residents to test drive and access electric vehicles, it is proposed each site, except Kinnerton Way, will include a shared electric Co Car for public use. The plans are the first phase of a scheme by a public/private sector consortium that includes DCC, Co Cars, ZPN Energy and Exeter-based Gamma Energy to install and operate 150 charge points in Exeter over the next two years. It follows a successful funding bid, supported by Councillor Stuart Hughes, DCC’s Cabinet Member for Highways Management, to Innovate UK, a government fund. The superfast chargers have been developed by ZPN Energy, while Gamma Energy, based at Exeter Science Park, has developed the technology to power the chargers. They use a cutting-edge energy storage system and energy supply, generated by Devon-based solar farms, which charges vehicles quickly and cheaply. A typical unit will provide 75 miles of travel after 30 min of charge (25Kwh) at a cost of £7.50. It’s the latest scheme where the public and private sectors are working together to reduce carbon emissions in Devon. DCC has declared a ‘climate emergency’ and formed the Devon Climate Emergency Response Group, made up of 25 business groups, voluntary groups and public sector bodies. Together they are drawing up a carbon plan to reduce emissions and transform Devon into a low-carbon economy. Councillor Stuart Hughes, DCC’s Cabinet Member for Highways Management said: “As we make the move towards electric vehicles over the next 10 years it’s essential we have the infrastructure in place. This initiative is hugely exciting and will mean residents will have much-needed access to charge points, and electric vehicles in the heart of the city’s neighbourhoods.” Ian Stillie, Chief Executive Officer of ZPN Energy, said: “We are proud to be supporting Exeter in becoming a greener, sustainable city. Our revolutionary HUBZ EV charging units technology delivers the maximum capacity, at the highest speed for the end-user whilst significantly decreasing reliance on the grid, solving grid constraint issues. We are excited to see the difference it will deliver when deployed in Exeter and play a role in reducing carbon emissions in the city.” Mark Hodgson from Co Cars said: “In the near future, having access to a charge point nearby will be key when it comes to buying or renting property. For those who don’t want the costs of car ownership, our Co Cars are realistic, affordable and flexible option and we’re really excited to place more of these around the city.” Jose Contreras, Head of UK & Group Finance at Gamma Energy, said: “Exeter is already leading the charge when it comes to EV adoption but, as in the rest of the UK, many residents currently cannot charge an electric vehicle at home. Our rapid charging network removes that barrier, making electric car use a reality for everyone.” You can view and respond to the Traffic Regulation Order until February 11 . For more information on Rapid Charging Exeter. You can take part in the Interim Carbon Plan consultation. Virtual Executive 12 Jan 2021 Recycling during Covid-19 with Denis the Dustcart	cc/2021-04/en_middle_0039.json.gz/line1026
__label__wiki	0.689085	0.689085	Merlin Complete Auto Care Small Business Wins Synchrony Pillars Project Awards Merlin Complete Auto Care today announced that small business owner, Muffadal Simba, has won a Synchrony Pillars Project award from Synchrony, a premier consumer financial services company. Muffadal Simba has supported the Glendale Heights community through times of change. As a winner he will receive a $10,000 prize to grow his business and honor its resiliency and ability to transform the lives of those in their communities. "Muffadel Simba's community service has been a guide that we can all hope to emulate," said Abraham Nunez, General Manager of Merlin Complete Auto Care. "On behalf of the Merlin team, we are proud of his business and community accomplishments." "He has been an inspiration of care and support to those in need in the community of Glendale Heights," said Valerie Zabriskie, Marketing Director at Merlin Complete Auto Care. "This award is a testament to Muffadel's extraordinary character; we are proud to have him in the Merlin family." "A 2020 Synchrony Pillar is someone who brings bold new thinking to the table, a leader who is passionate about their community and supports it through the ups and downs," said Neeraj Mehta, CEO, Payment Solutions, Synchrony. "We are honored to recognize this year's award winners for their successes and how they are changing what's possible for their business and community." About Merlin Complete Auto Care With over 3500 centers in North America, Merlin Complete Auto Care is part of the Driven Brands family of companies. Locally-owned and operated in Glendale Heights, Illinois, franchise owner Simba Muffadal and his team are dedicated to premier service, customer education, and community service. For more information visit: Merlins.com About Synchrony Synchrony is a premier consumer financial services company. We deliver a wide range of specialized financing programs, as well as innovative consumer banking products, across key industries including digital, retail, home, auto, travel, health and pet. Synchrony enables our partners to grow sales and loyalty with consumers. We are one of the largest issuers of private label credit cards in the United States; we also offer co-branded products, installment loans and consumer financing products for small- and medium-sized businesses, as well as healthcare providers. Synchrony is changing what's possible through our digital capabilities, deep industry expertise, actionable data insights, frictionless customer experience and customized financing solutions. For more information, visit www.synchrony.com and Twitter: @Synchrony SOURCE Merlin Complete Auto Care	cc/2021-04/en_middle_0039.json.gz/line1028
__label__cc	0.631604	0.368396	My Own Time Machine: Buildings, Places, People & Things Church of the Assumption: Be there tags: 1849, Callowhill Neighborhood Association, Catholic, Church of the Assumption, green beer for everyone if the demolition is revoked, Irish, Irish Catholic legacy, Keely, Kilkenny, Siloam, Spring Garden, St. Patrick Photo by A. Palewski UPDATE: Decision expected week of April 25 UPDATE: CONTINUED UNTIL MARCH 28, 11 am, 1515 Arch Street, 18th fl — PlanPhilly coverage here Here’s a recap if you’ve missed any of the twisting fate of the Church of the Assumption. Click here for Matt Golas’s overview at PlanPhilly Calendar note: L&I Review Board will meet met on the demolition of Church of the Assumption, Monday, March 14, 10 am, 1515 Arch Street, 18th floor — but needed to continue the sesssion…. More information via the Callowhill Neighborhood Association, which is challenging the demolition approval. With the hearing taking place just a few days before St. Patrick’s Day, it would be a shame if this former Catholic church, designed by Patrick Charles Keely, were not given a reprieve. Keely, an Irish immigrant who arrived in New York in 1842, was the country’s most prolific ecclesiastical architect in the 19th century. His first commission was built in 1842. Completed in 1849, Church of the Assumption is the oldest surviving Keely structure of the more than 600 that were built. Church of the Assumption landmark designation nomination Michael Greenle’s Opinion piece, Philadelphia Inquirer, March 14 Inga Saffron, Changing Skyline, Philadelphia Inquirer, March 11,2011, “Philadelphia’s Historic Churches: Do they have a prayer for survival?” Baltimore Avenue Coalition Venue Menu: encourages community to use space in local churches Once upon a time on Spring Garden Street: A Civil War tale from → architecture, Events/Happenings/Lectures, help wanted, historic preservation, real estate ← Flights of fancy that float Foto Friday: First Bank of the United States, 1791 → Fasten Your Seatbelt! You've got control of the time machine while you're here. History isn't a dull, dusty old place, it's just yesterday from awhile back. My goal is to be an explorer, a matchmaker, a facilitator between people wanting a peek at how things used to be and the drawers of old maps and other goodies out there waiting to be discovered and introduced to this wide, wonderful digital world. Check out the Bulletin Board tab above for ways that you can help network history. History in Disguise Crowdsourcing & the Museum: In which we win a prize Why I Like Old Buildings Summer Days, Make Me Feel Fine The Museum of You Tiki & Me (aka Save the Tonga Room) White's Mill: My great-grandfather's hopes & dreams Seek and Ye Shall Find! Legal Stuff (Summary: Give credit where it’s due!) My Own Time Machine by Sabra Smith is licensed under a Creative Commons Attribution-No Derivative Works 3.0 United States License. Based on a work at myowntimemachine.wordpress.com. Nostalgic for the original Wayback Machine?	cc/2021-04/en_middle_0039.json.gz/line1032
__label__wiki	0.529547	0.529547	Holy Spy (Kobo eBook) By Rory Clements For fans of CJ Sansom and SJ Parris, Holy Spy features the Queen’s Intelligencer John Shakespeare in the latest of Rory Clements’s acclaimed and bestselling series of Tudor spy thrillers In London’s smoky taverns, a conspiracy is brewing: a group of wealthy young Catholic dissidents plot to assassinate Elizabeth, free Mary Queen of Scots—and open England to Spanish invasion. But the conspirators have been infiltrated by Sir Francis Walsingham’s top intelligencer, John Shakespeare. Shakespeare, however, is torn: the woman he loves stands accused of murder. In a desperate race against time he must save her from the noose and the realm from treachery. And then it dawns that both investigations are inextricably linked—by corruption very close to the seat of power… Published by William Morrow Publisher: Witness Impulse Paperback (March 22nd, 2016): $16.63	cc/2021-04/en_middle_0039.json.gz/line1034
__label__wiki	0.576252	0.576252	Professor, Author, Art Lover About Nirmalya How Cyrus Mistry was Fired as Tata Chairman Posted by Nirmalya Kumar on October 21, 2017 October 20, 2017 On 24 October 2016, Cyrus was in his Bombay House 4th floor office examining what seemed like a routine agenda for the Tata Sons board meeting that was scheduled to start in five minutes at 14:00 hours. Through the grapevine, Cyrus had heard that some of the board members had an unscheduled informal meeting earlier that morning. However, what they had discussed was unknown, and as such, he did not give it much further thought. The previous week had been business as usual with trips to China and Singapore to meet partners and investors. A knock on the door, and to his surprise, enter his predecessor, Ratan Tata and Tata Sons board member Nitin Nohria. Cyrus welcomes them and asks them to take the two chairs opposite him. Nitin Nohria begins by proclaiming that “Cyrus as you know the relationship between you and Ratan Tata has not been working.” Therefore, Nohria continues, Tata Trusts have decided to move a board resolution removing Cyrus as Chairman of Tata Sons. He is offered the option of resigning or facing the resolution for his removal at the upcoming board meeting. Ratan Tata chimes in at this stage to say he is sorry that things have reached this stage. Cyrus Mistry calmly responds with gentlemen you are free to take it up at the board meeting and I will do what I have to do. Nitin Nohria and Ratan Tata exit the room and walk over to the other end of the hallowed 4th floor of Bombay House, where the board room is located. Cyrus, sends a text “I am being sacked” to his wife Rohiqa, before putting on his jacket and heading to the Board Room. The Board Meeting Cyrus takes his place on the chairman’s seat, a chair that is slightly elevated and larger compared to the other chairs in the room. Mistry welcomes Ratan Tata (who had never attended a board meeting since Cyrus had become Chairman) to the meeting and informs the board that Ratan Tata and Nitin Nohria have something to share prior to considering the previously circulated agenda. Nohria, a Tata Trust nominee and Dean of Harvard Business School, advises the board that the Tata Trusts have asked its nominees to propose a motion to the Board of Tata Sons. Amit Chandra, another Tata Trust nominee, apprises the board that at a meeting of the Trust Directors held earlier in the day it was agreed to move a motion to request Mistry to step down as Executive Chairman of Tata Sons because the Trusts had lost confidence in him for a variety of reasons. No rationale for the decision beyond this declaration was shared. In response, Cyrus argued that the articles of association required a 15-day notice before taking up such an item for the consideration of the Board, and as such, the present action was illegal. Amit Chandra informed the board that the legal opinion obtained by the Trusts stated such a notice was not necessary. He offered to share the opinion, but none has been to date. Instead, he proposed Vijay Singh to be elected as the Chair for the remainder of the Board Meeting. Despite repeated protests by Cyrus on the illegality of events, Venu Srinivasan seconded the proposal. Ishaat Hussain and Farida Khambata said they would abstain on this motion to replace Mistry with Singh as Chair of the meeting. Quickly, a vote was taken with six members (Ajay Piramal, Amit Chandra, Nitin Nohria, Ronen Sen, Venu Srinivasan, Vijay Singh) voting for, while Farida Khambata and Ishaat Hussain abstained. Vijay Singh was installed as Chair for the meeting. Venu Srinivasan then proposed the inclusion of additional matters on the Agenda by moving the Resolution below, which was seconded by Ronen Sen: RESOLVED THAT the consent of the Board be and is hereby accorded, to consider and resolve upon, in this meeting of the Board, the following matters which were not included in the Agenda circulated for this meeting of the Board: Replacement of Mr. Cyrus P. Mistry as the Chairman of the Board and from each committee of the Board; While the Board has adopted and put in place certain age criteria for retirement of Directors of the Company, to approve the cessation of application of the age criteria for retirement of Directors in relation to the Company; Re-constitution of the Nomination and Remuneration Committee to consist of the following Directors: (i) Mr. Ronen Sen (Independent Director); (ii) Mr. Ajay Piramal (Independent Director); (iii) Mrs. Farida Khambata (Independent Director); (iv) Mr. Vijay Singh; and (v) Mr. Venu Srinivasan; Appointment of Mr. Ratan N. Tata as Additional Director; Election of Mr. Ratan N. Tata as Interim Chairman of the Board until selection and appointment of a new Chairman of the Board in terms of the Companies Act, 2013 and the Articles of Association of the Company; To take appropriate steps in terms of the Companies Act, 2013 and the Articles of Association of the Company to appoint a new Chairman, including by formation of a Selection Committee comprising of: (i) Mr. Ratan N. Tata (Nominee of Tata Trusts); (ii) Mr. Amit Chandra (Nominee of Tata Trusts); (iii) Mr. Venu Srinivasan (Nominee of Tata Trusts); (iv) Mr. Ronen Sen (Independent Director); and (v) Lord Kumar Bhattacharya (Independent Outside Person).; and Until selection and appointment of a new Chairman of the Board in terms of the Companies Act, 2013 and the Articles of Association of the Company, to vest substantial powers of management of the Company with Mr. F. N. Subedar, Chief Operating Officer, and/or one or more senior officials and/or Directors of the Company, subject to the overall supervision and direction of the Board, in such manner as the Board may decide from time to time. Each of these resolutions was voted on in turn. While different board members proposed and seconded the individual resolutions, the voting pattern was identical across them. Khambata abstained on each, Mistry objected to each as being illegal, while the others voted for them. It was all over in minutes, no explanations and no opportunity for Cyrus Mistry to prepare a rebuttal. By 15:00, Cyrus had returned to his office and begun packing his personal effects. He queried Subedar on whether he needed to return the next day. Subedar checked with Ratan Tata and reported that it was unnecessary. Cyrus then called his childhood friend and top notch lawyer, Apurva Diwanji, to help him. Apurva arrived within ten minutes and asked for the Tata Sons’ articles of association. Apurva realized that the press would invariably be gathering outside Bombay House making an exit challenging. Apurva needed a safe place for Cyrus to be taken as the press would be lying in wait outside the Mistry residence. Jai Mavani from Shapoorji Pallonji, the family firm of Cyrus, was given a call to organize this. Jai knew that the Forbes, another Shapoorji Pallonji related company, had its headquarters in the neighborhood on a quiet street. Apurva exited via the side entrance of Bombay House, which was rarely used, to whisk Cyrus to the designated safe place. The conference room is where Cyrus first got a chance to sit down, visibly shaken, and asked for a cup of tea. They knew they needed a public relations agency and a lawyer immediately. What they did not know was that Tata had already engaged six major public relations companies and booked many of the most prominent lawyers in the country in a bid to squeeze the resources available to Cyrus post firing. At 17:00, Tata Sons released the following press statement: “Mumbai: Tata Sons today announced that its Board has replaced Mr. Cyrus P. Mistry as Chairman of Tata Sons. The decision was taken at a Board meeting held here today. The Board has named Mr. Ratan N. Tata as Interim Chairman of Tata Sons. The Board has constituted a Selection Committee to choose a new Chairman. The Committee comprises Mr. Ratan N. Tata, Mr. Venu Srinivasan, Mr. Amit Chandra, Mr. Ronen Sen and Lord Kumar Bhattacharyya, as per the criteria in the Articles of Association of Tata Sons. The committee has been mandated to complete the selection process in four months.” Immediately, the news broke across all TV channels in India and spreads like fire on social media. It was also reported that three members of Mistry’s top team had been asked to put in their papers. While not the Chairman of Tata Sons, Mistry was still a board member of Tata Sons and the Chairman of the Board of Directors of most of the major group companies. The media started speculating whether Mistry would step down as Chairman of these companies. This was intriguing since the first board meeting coming up was for Tata Global Beverages Limited (TGBL) to be held on 26th October at Bombay House. CEOs being fired is always news, despite it not being a terribly uncommon occurrence. What made the firing of Cyrus Mistry so unusual was that Tata Group had a history of only six Chairman over 148 years! Cyrus Mistry was selected after a careful process that took over a year, and by assuming the role at the age of 46, he was expected to serve between 20-30 years. In general, the Tata group is renowned for its values, which did not encompass a “hire and fire” policy. Most senior Tata executives were consummate insiders, having usually served their entire career with the Group. The initial contract under which Cyrus was serving as the Chairman had been passed via a shareholder resolution of Tata Sons. It was due to expire on 31 March 2017. Instead of the sudden, no warning dismissal, the board could have just let the clock run out in five months. By eschewing the public humiliation of Cyrus Mistry, the bloody aftermath that followed could have been avoided. Unfortunately, instead there was the subsequent public airing of the underbelly of the Tata group as well as the deleterious impact on the reputations of Ratan Tata, Cyrus Mistry and the Tata brand. The only winners as far as one could see were the public relations companies and lawyers, who are still having a field day. Disbanding of GEC On taking over as Chairman, Cyrus had taken a year to put his leadership team in place. Called the Group Executive Council (GEC), it comprised of two old Tata hands and three people recruited from outside the group. I was hired to head strategy for the Tata group, a position that had required me to intensively interact with Cyrus as we formulated Tata’s strategy until 2025. On the morning of 24th October, I recall asking Cyrus if he needed my help with the board meeting. I only attended Tata Sons board meetings to support Cyrus. This was when formal presentations on group strategy were scheduled, usually during the longer June and December meetings. Since governance rather than strategy was on the agenda, Cyrus said he could manage on his own. Anticipating this, I was scheduled with two of my GEC colleagues, Harish Bhat and NS Rajan, to be on a panel and take questions from around 100 young Tata executives on the group’s big data initiative. At 14:50, we reached the Taj Hotel President property in Mumbai where the event was being held, completely unware of the events at Bombay House. Our panel was being moderated by Deep Thomas, CEO of Tata iQ, the big data company. Enthusiastic participants were quizzing us. NS Rajan was looking at his phone and unexpectedly walked off the podium. He returned a few minutes later, ashen faced, and whispered in my ear that the Chairman has been asked to step down. My head jerked – what? But I was on a panel so kept answering the questions, but signaled to Deep that we needed to wrap this up early. NS looked very distracted and flustered so I fielded any questions that came his way as he soon left the podium and the room. We walked out into the hall and NS Rajan informs Harish and me that his understanding is that with the Chairman, all three of the outsiders on the GEC have also been let go. I invited them to my apartment for a drink rather than return to the Bombay House until we gathered more information. Harish, as was his style, kept reassuring the two of us that firing of Cyrus and the three GEC members was very unfair. We turned on the television, and all the Indian television channels were plastered with Cyrus Mistry and three GEC members of Tata being asked to leave. By 19:00 both my fellow GEC members had departed. I was unable to get hold of Madhu, usually my most reliable source of information. Finally, Ishaat Hussain responded by asking me for a drink at his place at 19:30. Ishaat was clear that he had no idea this was going to happen. He had entered the board meeting a few minutes late. Subedar, standing outside the boardroom, with a white face, had informed him that Cyrus was being fired. At 21:00, I got a call from Subedar, with whom I had worked closely and got along rather famously as we were often on the same side of arguments. He came from a finance background and I being a rational business school academic, both pushed for greater capital efficiency and performance orientation. Anyway, on this call, he simply said: “it is my unpleasant duty to say your services are no longer required”. No explanation. I queried does this mean I did not need to show up tomorrow morning? An affirmative reply, and that was it. Madhu and NS received similar calls. A few minutes later, Cyrus called. His voice was even lower than the usual soft spoken tone: Nirmalya, please let us finish dinner and then can we meet at my residence around 22:00. I summoned my chauffer and told him to quickly have his dinner as we may be in for a long night. It was the start of a furious two months, where I worked harder than ever with Madhu to help Cyrus wage a battle against the enormously powerful Tata machine until it moved to the courts. Many of you have read my blog of the week following my firing entitled, I Just Got Fired! The year that has passed required me to dig deep, but that is a story for another week. Let me just conclude that a year later, despite the best efforts of the press promoted by the six PR agencies and pressure from the internal Tata communications team, only two Tata CEOs, Bhaskar Bhat and Harish Bhat, have had anything negative to say about Cyrus Mistry in the press. And, even they, were remarkably muted in their criticism. Under the circumstances, what better performance review could Cyrus Mistry have received as Chairman of Tata Sons? Nirmalya Magic Dust: I invite you to follow me on Twitter @ProfKumar and LinkedIn. Board of DirectorsChairmanTata Group Previous Post How Should Business Engage with Sustainability? Next Post Are Independent Directors Independent? Duleep Kumar Samuel says: Nice write-up Indira Kanjilal says: Opens a new vista on the events. Taking someone unaware, not giving them the chance to counter, not acceptable. A V Akhilesh says: Some questions are not answered or do not have an answer. Cyrus ouster is one of those. Anyway on the hindsight Cyrus’ loss is Chandra’s gain and that is how it is. Ridiculous Corporate ethics followed by Tata Group puri says: your blog shows how personal tastes and whims overshadow professionalism Alexander K.Luke, IAS(Retd.) says: Cyrus Mistry is a very wealthy man so does not need our emotional support. But Tata Sons controls vast assets and directs the lives of many. The event described was not a sacking but an execution. The only justification for this would be some shockingly ghastly deed perpetrated by him; no such smoking gun is visible as yet. Nitin Nohria’s acquiescence does not speak well of the world famous business school he heads. Vikram S Gupta says: Cyrus Mistry decisions were not politically correct. Is this not enough reason? Very nicely written. It is sad that a Gentleman is sacked without giving any reasons, not allowed to defend and probably for being honest, grounded and ethical professional. Cyrus Mistry, please continue to be a good human being. Hemant Tilotia says: It’s no surprise on what motivated the events. Tata steel – corus and Nano were decisions that Cyrus was right in acknowledging. That didn’t go well with someone’s inflated ego. I hope Cyrus puts up a good fight. Rajesh K Rao says: 1. I was shocked at the decision of Mr. Ratan Tata and the Board. Having worked for Tata, I was not happy the way news anchors were discussing the subject ( CNN News 18) as a viewer on the fateful evening. 2. I am shocked at the current state of Tata Motors and the way Transformation journey is being handled. In short , recipe for disaster. 3. Personally, I wish that one from family of Tata would be the Chairman. However good the CEOs of Tata Companies were or would be. It was a legacy and the idea of “our” Chairman being from Tata family is time honoured tradition. To depart from this requires much higher necessity. 4. I can write series of blog posts, but the damage is irreparably done. Wonderful insiders view on the whole saga sir! Thanks for opening up and sharing the story, otherwise we will never know the story from the other sides! parwatisingari says: what was the legal stance. JOHN MM says: All what happened I feel is because of the breakdown in communication between Mr. Mistry and Tata Son’s. In key area the promoters must be kept in loop. This might have not done by Mr.Mistry. Anomyus says: It just shows that if you have means and hold dominant position you can blantly abuse these powers and even the most inteligent person are either become mute spectator or mere executioner of these type of decision. After working in Govt. and Pvt organisation I can only say there is no hope that an individual whatsoever postion he hold in these organisation can change the system unless these system are intended to do so. At the sametime I feel how could we missed our six sense that something wrong is going to happen with us or we become too complecent.In corporate things are not detroriated in one day. Feel very sad for Mr. Cyrus Mistry. From your narrative, it looks like Cyrus (and his core team too) was deep into his work of restoring the glory of Tata companies and not bothering about “noise” around but this character of Cyrus has been badly exploited by Ratan with help from his “traditional” friends in PR agencies/media. Cyrus obviously does not deserve any of this but feel there is no point in fighting this as well. As you have said in your article, Cyrus has admirers within Tata group and a lot outside and he can focus completely on his own group and be much more successful (I know he does not need my advice, still!). Karma will take care of the rest, for sure. Thanks for sharing this, very valuable life lessons indeed. Kusum Daga says: A good insight Good insight of other side of the coin would like to hear more information of the battle You sow what you reap kantskant says: It’s shocking, even the CEO was treated below par. It’s a classic case of corporate cruelty without giving a fair chance to the employee yeah here it was Chairman. I have seen much worse firings where the new head walks in to office one fine morning and then the old guy is informed of him being replaced. Or when during a party for senior managers in a hotel , the replacement walks in and everyone gets to know of the change. Reeds says: Oh! So why are your comments appearing, grow up and stop blabbering in matters where you don’t have an iota of knowledge. Thank you. He/she kept posting comments as above, which were not supported by evidence so removed them. Will let this one be as summarises the many attacks on me. I tried in my blog to present the facts as much as possible so can be used as a case study in corporate governance courses. Can you share why Mr Mistry was fired? Why was his relationship with Ratan Tata in the doldrums? Zero Sum says: Do you know “why” Cyrus was fired? If yes, please write about that. Everything else is less important. Na baap bada na bhaiyya…..sabse bada ruppaiyah !!……goes the age old saying. In the current age of short term public memory, even reputation can be kept at stake…!! I question says: This article did not give any details beyond the masala. What was the legal opinion? Why was he delt with such dishonor? What made Tatas break their 150 yrs of legacy ? I really thought there was more insight beyond reading the events of that particular day and where you had drinks. I am a IIT, IIM grad. I worked for TCS (a tata company). I found that only mediocre and below average people work in tata companies. People with government employee mindset. I am bright and high performer. Quit TCS within 3 months. HR staff is worst in any tata company. They recruit losers for HR jobs. Sateesh says: Pity it dint work for you. Hows that TCS has grown to be the biggest Indian IT Company, and continues to do well? One among top 10 private sector employers globally? Very well written sir.. written well ..however this your version of story 🙂 It started a bad precedent and the same was followed by Infi. Indian boards need “Ji Huzoor” kind of CEO’s dancing to the tunes of the promoters. Otherwise, you are fired. Sanjay Khatri says: Times are changing so are corporate ethics. The fault I see is with the team Cyrus Selected. Tata group had a massive opportunity to be a market leader with Multiproduct offering. But instead they were closing down non performing units like Telecom. I think Cyrus missed the trick but sacking was unethical by Tata standards. Are you saying N Chandra is Ratan’s yes man?? You told us how . but why ? it is still not clear . Sethu Venugopalan says: I really do not know what were the crimes committed by Cyrus that called for his unceremonious and instantaneous removal. I have huge respect and admiration for the TATA group like millions of others do for the respect they give for business ethics and their invaluable contribution to our country. BUT, this incident hardly matches with that reputation. Highly unceremonious removal of their top man like you are kicking out a casual labourer, that too without giving him adequate time and opportunity to defend his case, has definitely shocked the entire nation besmirching their reputation. It will take a long time to obliterate this blemish. Pimpakar PM says: Some recents events in corporate India has shown the ex chairmen has failed miserably in following the Indian tradition of SANYASHRAM,TATAS is one of them.. Your own erstwhile colleague has this to say- your comments please: Loss Or Confidence Goes Beyond Mere Performance: Harish Bhat An interesting live case study for business schools indeed ! Bhupinder says: It might have been unfair on the part of Tata Trusts to not give a timely notice to Mr. Cyrus Mistry. Also as you rightly pointed out that this was a premeditated action , and Tata Trusts had already engaged the major PR firms and lawers. Now lets us look as why they did so ? They did it perhaps as they were expecting Mr. Cyrus Mistry to wage a battle. And he did prove them right. Didn’t he ? However there is one thing still makes me wonder “how”. The question is that how on earth was Mr. Cyrus Mistry unaware of what was coming his way. To an naive reader like me , it tells me only one thing , that as a Chairman he didnt have a good understanding of the situation and the circumstances he was dealing with. To put it in simple terms, he failed to understand which way the wind was blowing . That is a serious flaw when you are working as a chairman. Now I know there would 1001 reasons and counter arguments for that. But I am not arguing , just stating a fact. M S Kirnalli says: Such actions are always pre planned, concerted with help of few hired loyalist !! It is shame on all!! SB Bala says: Nice story but no facts and figures were given. Tata is not that stupid to fire anyone particularly the chairman for no reason. The manner in which it is done is not correct. However I know the plight of IT workers in TCS. Pathetic with no basic rights to utilize even use their earned annual holidays. They try their best to keep the stock markets and customers happy than their hard working employees. Stress levels are too high and no work family balance. Radhakrishnan Menon says: As a leadership consultant, coach and former practitioner I see three key takeaways from this unfortunate corporate accident so to say! 1. Was Cyrus Mistry, apparently a man of integrity, the right selection to be head of a salt-to-software conglomerate ? Did he truly have adequate capabilities? Or was it a compromise to fit-in a “Tata family” member which eventually led to a huge cost of leadership mis-hire?! 2. Tata is an ‘oak’ tree in corporate India known for its values and ethics. Could it have done the exit better – say ‘severance with reverence’?! 3. Mr. Nirmalya Kumar, it’s not in good taste to share ‘dressing room’ talk in public and making it an anniversary event or something! To conclude, let’s treat it as unfortunate ‘history’ and not get into a character assassination of either the leader or the oak tree!! Narrative by a non board member is likely to have some conjecture, and this is not the officially Board minutes. B F Poonawala says: It is more than obvious that a conspiracy was hatched by all powerful Ratan Tata to viciously and arbitrarily expel Cyrus Mistry for reasons best known to Tata and Tata alone! It may have been envy, jealousy, clash of egos and personalities, because Cyrus outdid RT as CM with bold decisions to liquidate, as any business person would, Non Performing Assets, thus reducing drain of losses to Tata Sons! All such NPAs initiated by Ratan Tata, were causing crores worth of losses! Maybe this bold move by Cyrus to liquidate such NPAs, exposed and ambarraced Tata for his poor judgement and evaluation of projects that never took off! Hence a conspiracy had to be hatched behind closed doors expel Cyrus! “Reluctantly”, the meak Board Members with Tata’s clout were forced to pass and second the resolution! Those who didn’t fall in line were shown the door! Fearing more disclosures of poor judgement, only way out was to expel Cyrus without reason or chance for a rebuttal! Curiously enough, Tata promised £5 billion over five years to Kores Steel of UK, in spite of the fact that It was a loss making Company from day one! It is no wonder that billionaire Mittal having steel factories around the world, would not touch Kores with a barge pole! What’s more, Ratan Tata was honoured by UK Govt. for saving the Kores workers from redundancies! Cyrus Mistry was removed unceremoniously for no reason at all! His continuation as CM of Tata Sons would have brought greater success and prosperity to the Tata Group of Companies! Aster says: How do you view today’s National Company Law Apellate Tribunal order that Cyrus’ removal was illegal ? Leave a Reply to I question Cancel reply Countries, Cities, Globalisation Marketing People Strategy Tech Uncategorized Copyright in this blog is of the author. All rights reserved. This is a personal blog. The opinions expressed here are of the author and are not intended to harm, malign, or defame any group, organization, or individual. All data and material provided on this blog is for informational purposes only. Readers may use such information at their own discretion while making any decision based on what is posted on this blog. The author disclaims all liabilities in this regard. Comments are always welcome from readers, but the author of this blog reserves the right to delete any comments that are abusive, profane or anonymous. The blog may contain links to external content. The author makes no representation as to the accuracy or completeness of such contents nor is the author responsible for any error in the contents of such websites. The content at these external links may be subject to the copyright of respective organisations / publishers, which readers may please note.	cc/2021-04/en_middle_0039.json.gz/line1037
__label__cc	0.646976	0.353024	Tag Archives: Raven Rock The Continuity of Government – The Mystery of Peters Mountain Hat Tip: Trapper Pettit A friend sent me an article from Zero Hedge that I find intriguing and it raises far more questions than answers. I did not know that there was something called a PreparAthon held by FEMA on April 30th. Did you? Supposedly the nationwide drills are for – get this – the catastrophic consequences of global warming. Right. Sure it is. I suspect that propagandic line is for the rubes, when in fact what the feds fear the most is an EMP attack or a massive cyber attack. DHS was just all abuzz over this drill evidently. But what caught my attention, was the movement and inclusion of activities around a real underground bunker north of Charlottesville, Virginia on Peters Mountain. This not-so-secret bunker may just be the hidey-hole for feds and our nation’s intelligence operations when the Schumer hits the fan. It is the perfect bunker to protect those elitists and power mongers that matter, while everyday America devolves into barbarity and the die-off begins. Meanwhile, FEMA and DHS held their PreparAthon aimed at severe weather events due to climate change. Talk about a massive waste of money… unless of course those exercises provide cover for drills for threats of a much more serious and dire nature. Preparations for continuity of government and all that entails once the barbarians breach our gates for real. Would it surprise anyone that the government was stocking their bunkers and preparing for the worst? With nationwide riots, escalating nuclear threats, imminent global war, ISIS terrorist cells planted in every state, the growing threat of crippling cyber attacks and the all too real EMP catastrophe looming, it’s a virtual certainty that the government is preparing to save their own and ensure that they can continue to rule the roost even if the roost is devastated. These massive preparations include our intelligence agencies – can’t go on existing without spies, now can we? I first learned of Peters Mountain from author and friend, Trapper Pettit and his fantastic book The Osprey Vendetta. Hugely entertaining, but aside from a great read, Peters Mountain was woven into the storyline in that series of books as well. For the very first time this year, the Office of the Director of National Intelligence made public that it would partake in the PreparAthon employing something vaguely named the National Intelligence Emergency Management Activity (NIEMA). The Director of National Intelligence merely describes NIEMA as providing “the framework, platforms, and systems to enable the Director of National Intelligence to lead an integrated and resilient [intelligence community] enterprise capable of sustaining the ‘intelligence cycle’ under any crisis or consequence management event, both at our headquarters and at our alternate operating locations.” Peters Mountain anyone? I highly doubt the DNI is shaking in his spiffy boots over climate change – but there is a whole host of real threats overshadowing the US that make preparation and fortification of utmost importance to spooks. From Zero Hedge: But job descriptions, contracting documents, insider resumes, and furtive discussions with Washington sources reveal that this little-known “activity” is a $100-million-a-year disaster playpen. At its 24/7/365 Response Operations Center (at a classified location), watch officers provide what’s referred to as “situational awareness and crisis support” to the nation’s leaders; and when that fails, they evacuate to their classified alternate facility, which sources say is in Albemarle County in central Virginia. There is really only one candidate—a mysterious facility atop Peters Mountain, roughly 16 miles east of Charlottesville—and it’s undergone a $61 million plus renovation since 2007. What follows are some intriguing photos of Peters Mountain. This is property owned by AT&T, but it is government land. Oh, so many questions there… Not only has AT&T leaked our private conversations and information to the government, they are fully in bed with them as this would seem to most certainly attest to. On top of the mountain, on a helicopter pad, is the AT&T logo for the world and Google to see. The plot of land is strangely listed as “vacant residential land” of no value. However, it does belong to AT&T. Land with no value that has had 10’s of millions of dollars of improvements over the last several years. Hmmmm. Zero Hedge points out that the building permits submitted since 2007 amount to $61,124,583.00 for interior and exterior alterations, including the building of the helicopter pad, a new bunker entrance, “alteration to interior spaces” and installation of two new satellite dishes. I would say it is safe to assume that this property is something ‘other’ than residential and houses something deep inside. Why else would you need a bunker entrance? There are also a number of other buildings on the property along with a rather large parking lot. Just what is AT&T and the government up to? Google and Bing each have satellite views of the mountain top, showing the same structures and the progress of construction since 2007. And I find these pictures just fascinating. On the right hand side you can see the parking lot and the bunker entrance. The two large building like structures could be air purification installments and ventilation. Just a guess. The structure must be buried deep within the mountain to protect from bombing etc. Dirt is an excellent protector. Although it doesn’t sport an outwardly military appearance, it reeks of it. The two large structures on top of the mountain, to the left of the helicopter pad, are assumed to be vent stacks and hardened power and communications antennae. Two satellite dishes added after 9/11 are also now apparent, suggesting autonomous and enduring communications. Starting to get that ‘military’ feel yet? Consider the Mormon’s Granite Mountain Vault for document storage and how massive that is. You might also want to consider Perpetual Storage Inc.’s vault in Utah as well, which houses computer equipment, digital records, etc. Neither of these are set up as actual living bunkers. The scale inside Peters Mountain must be massive to provide for human living, food storage and growth, waste elimination, supplies of water and electricity, computer processing, medical provisions, defense provisions, etc. for hundreds, if not thousands, of people There is nothing that refers to NIEMA, the DNI or the intelligence community on record in that county. But of all the places that could hold hardened fortification, Peters Mountain more than fits the bill. Sources, according to Zero Hedge and Gawker, describe the national Warning, Alert and Mobilization System (WAMS) which would alert a select group of civilian executives from across the intelligence community to deploy to the bunker. The alert would come from “The Communicator” Automated Notification System and would take two forms: alerts for everyone and alerts for the “core” participants. Because Washington is notorious for traffic congestion, those so-called core participants, those who have to move away from Washington within minutes of notification, would congregate and board helicopters which would take them to the bunker. Gawker even sent a driver to go up the road on the mountain. But when he encountered a “Road Closed – No Trespassing – Private Property” sign, he decided he would go no further. I guess he didn’t want to be shot or arrested. It appears to me that exercises at this bunker occur frequently and that along with Mount Weather, Raven Rock and the Olney bunkers, it’s stocked, primed and ready at a moment’s notice for those who would be fortunate enough to be invited in should the very worst happen. Yep, I know this is the stuff of conspiracy theories… but ask yourself, with everything that is happening in America, do you honestly believe our government isn’t providing an escape plan for our so-called select leaders? Peters Mountain raises far more questions with me than answers. But the aerial footage is pretty self-explanatory to an extent and even their work permits specified a ‘bunker entrance.’ It doesn’t get much more obvious than that. I’m sure I’m not the only one who has looked around and has noticed the government buying up food and weaponry, as well as supplies, etc. I keep wondering why the hurry? Do they know something we don’t? Why is the Fed fortifying its building in Chicago? And the kicker… NORAD just returned to Cheyenne Mountain. In a refreshing twist, NORAD comes right out and says it is because of the EMP threat. From NewsMax: “Why the return?” write Henry F. Cooper and Peter Vincent Pry. “Because the enormous bunker in the hollowed-out mountain, built to survive a Cold War-era nuclear conflict, can also resist an electromagnetic-pulse attack, or EMP.” While the Pentagon is moving to shield its global air defense command from being knocked out by an electromagnetic pulse (EMP) attack, the Obama administration has failed to act on urgent recommendations to protect the country’s civilian electronic infrastructure from a similar catastrophe, they write. “An EMP strike, most likely from the detonation of a nuclear weapon in space, would destroy unprotected military and civilian electronics nationwide, blacking out the electric grid and other critical infrastructure for months or years,” Cooper and Pry write. “The staggering human cost of such a catastrophic attack is not difficult to imagine.” The likeliest source of such an attack would be North Korea or Iran, according to Cooper, former director of the Strategic Defense Initiative, launched by the late President Ronald Reagan, and Pry, executive director of the EMP Task Force on National and Homeland Security and a veteran of the Central Intelligence Agency. Iran is a nuclear-ready state with ballistic missiles capable of striking the United States now, Cooper, Pry and and two other Reagan administration alumni wrote in an op-ed for Newsmax in February. In the Journal, Cooper and Pry reiterate that “Iran should be regarded as already having nuclear missiles capable of making an EMP attack against the U.S.,” noting, “Iran and North Korea have successfully orbited satellites on South-Polar trajectories that appear to practice evading U.S. missile defenses, and at optimum altitudes to make a surprise EMP attack.” So, consider this… if the military fears an EMP from Iran (or Russia or China) and is prepping like hell for it, why is our President striking deals with them? That’s treasonous in my book. These same leaders who make fun of bloggers warning on the power grid and its vulnerabilities and preppers who preach preparedness, are the same leaders who won’t harden the electric grid and take it off the Internet where it is vulnerable, while prepping bunkers where they can run to when it all goes south. Sounds to me as if the elitists are all for the continuity of government and the fall of America… right into the clutches of a global government construct. Posted in Authors, Constitution, History, Military, Politics, Survival, Terresa Monroe-Hamilton, Terrorism \| Tagged AT&T, Barack Obama, Bing, Bloggers, Bunkers, Charlottesville, Chicago, China, Climate Change, Cyber Attacks, DHS, DNI, EMP, FEMA, Gawker, Global Government, Global Warming, Google, Government, Granite Mountain, Intelligence Agencies, Iran, ISIS, Military, Mount Weather, National Intelligence, NewsMax, NIEMA, NORAD, Nuclear Warfare, Olney, Pentagon, Perpetual Storage Inc., Peters Mountain, Politics, Power Grid, PreparAthon, Preppers, Raven Rock, Riots, Russia, Terrorism, Trapper Pettit, Virginia, WAMS, War, Zero Hedge \| 21 Comments	cc/2021-04/en_middle_0039.json.gz/line1041
__label__cc	0.581571	0.418429	NallaReads A book blog Exclusives & Excerpts Features & Affiliates Tag: Kristen Ashley FREE – A Kristen Ashley New Release The finale to the Chaos series, Free, the story of Rush and Rebel is here! Through good times, bad times and times of war, Cole “Rush” Allen grew up in the Chaos Motorcycle Club. Along this journey, he watched his father, Tack, and his MC brothers fight, sweat, bleed and die to steer the Club to legitimacy. And they’ve got one more battle on their hands. A battle they have to win. But when Rush meets the woman who put herself right in the thick of it, he knows he has to stop at nothing to get her out. Rebel Stapleton has lost someone she loves to murder and she’s the kind of woman who’s going to do something about it. She puts her career on the line, and her life, to bring the man who did it to justice. That is, she does this until Rush Allen intervenes. Chaos is at war and they’re about to face the ultimate showdown. They’ll have to negotiate skeletons from the past, enemies becoming allies, and loved ones in the line of fire on their ride to be… AMAZON PRINT \| IBOOKS \| KINDLE \| NOOK \| GOOGLEPLAY \| KOBO Kristen Ashley is a New York Times and USA Today bestselling author of over fifty novels, including Mystery Man,The Gamble, and Own the Wind. She grew up in Indiana, but has lived in Colorado and the West Country of England. Author Website \| Twitter \| Facebook \| Instagram Hey y’all! Whew what a year… I hit my reading goal (150), branched out to a few new authors, attended my first Apollycon (can’t wait for 2019!), hit my first 1K on Instagram, and officially become and audio lover! But throughout out it all, I read some pretty amazing books. I wanted to share a new style of wrap up with you guys this year. Sort of like an awards ceremony. Not a top ten and no one better than the other; but stories that stood out to me outside of just the romance aspect. Whether they made me cry, laugh, swoon, or beg for more check out my 2018 Wrap Up Awards! First some stats! I read 35,942 pages across 152 books get more details from my goodreads and check out all of my 2018 reviews/reads! And while you’re there, add me! On to our winners… Light-hearted, drama-free romance A sexy, slow-burning best-friends-to-lovers romance with a guaranteed HEA and no cheating. Dive in, and get ready to melt for Cam! The slow burn never fizzles out; it’s the perfect speed for two friends who discover they could be more. And then they have to discover how they feel about that revelation. For Cam, it’s been a deep desire he’s buried beneath that friendship. For Natalie, there’s more to love than just sex and she’s not sure of the risk of losing friendship of two men she’s known for years. All around heartwarming and entertaining. Filled with sexy, intimate moments and heartfelt relationships all around; you can find out more here! Secret trysts and stolen kisses abound in this brand new, swoontastic novel from #1 NYT bestselling author Lauren Blakely. Starting off with a steamy fantasy scene between our hero and heroine allowed for a novel size tease the rest of the plot! This novel had a touch of old school romance. With lust and desires dripping off every page, you need to grab this read and begin to raise your expectations when it comes to love! Fond out more here! A sexy, standalone forbidden romance about a sports star and the woman who’s off limits. There’s something about a forbidden romance that can give readers just the right amount if danger. Neither our heroine or hero want to risk their careers but can’t resist the pull against one another. And while some secret and forbidden romance can leave readers feeling secondhand embarrassment, I couldn’t help but find myself yelling at Jillian and Jones to just BE TOGETHER! Find out more about it here! Break out the tissues and wine He didn’t want to be bad. He just didn’t have a choice… We had crazy drama around Trouble & Wild and hilarious wit and sass with Legs & Loser; but with Shay & Stitch…..be prepared to have your heart MANGLED in the BEST POSSIBLE WAY. Not only does Daniels’ manage to tell the story of a broken and defeated man, she does it while painting him in the brightest light possible. I stayed up all night, sacrificing sleep, to finally read this story and I was not one bit disappointed. I cried so many times but with so many happy tears. Prepare to have your heart wrung out here. An all-new second chance standalone romance by New York Times bestselling author Corinne Michaels and USA Today bestselling author Melanie Harlow, this story killed me and brought me back to life! After the young romance left her broken-hearted in the worst way she’s sworn off Ian for life. But tragedy strikes when Sabrina and her husband pass away and leave the children to Ian to raise. Prepare to have your heart ripped out of you chest as each of Sabrina’s children have to handle their grief alongside Ian and London. I love that Harlow and Michaels kept their reactions real. There’s no pretty crying or band aids over the wounds in this story, no. Now mix in the romance between Ian and London and this is one powerful read. Find out more here. A forbidden stand-alone romance in A.L. Jackson’s Confessions of the Heart Series. How can I put in to words the way this book made me feel? Gripping and intense. Sexy and forbidden. Heartbreaking and yet filled with love and warmth that is key to any Jackson story. All of Me takes the darkest parts of two people’s lives and thrusts them in to the light in order to survive. I cringed, I gasped, I needed wine, and I had a happy cry. This book is downright AMAZING. No spoilers here, you’ll have to grab this amazing story for yourself to find out just what darkness dares to creep up on our hero and heroine. Prepare your tissues and buckle down for one hell of a romance! Find out more about Ian’s story here. a brand-new novel about arson investigator, Anne Ashburn, who is consumed by her troubled past, her family’s scorched legacy, and her current case: chasing a deadly killer. A new branch back into the contemporary world, Consumed is not only intrigued and a standout novel, readers won’t be able to predict what will happen and become addicted to finding out the truth. This book is FILLED with twists and turns and new angles you won’t predict. Hooked from page one I had to know what Anne and Danny’s inner thoughts were. Ward does an incredibly job taking brutal, damaged characters and pulling those flaws right into the light, shoving them in to the face of readers and shouting “ACCEPT THEM”. Be consumed by this romance here. Is it love, or is she just his good luck charm? New York Times and USA Today bestselling author Helena Hunting absolutely delights with this witty and fun standalone romantic comedy. Helena brings back the heavy in the best way with The Good Luck Charm. A young romance ended too soon. A woman with a second broken heart and a man with a second chance. The light-hearted humor and wit that any HH fan knows is definitely present in TGLC. Ethan and Lilah, whether they’re fighting or reminiscing, have the ability to outwit and go head to head with one another. But Hunting takes us back to her original romance feels of heavy story lines. Get lucky here. Bad (BOY) Romance Bad boys do it better From New York Times and USA Today Bestselling Author Jay Crownover comes a standalone romance with a hero sure to keep readers up long into the night. Jay frickin Crownover. She continues to blow me away with her ability to create dark and gritty characters that have obvious faults but still endeavor you to feel hope for what may be. Cable and Affton’s story is filled with heartbreak, doubt, and somehow a sliver of hope, a light at the end of the tunnel. Crownover has delivered a character with a mysterious past that was painstakingly revealed over time (almost a year for us newsletter subscribers!). And as each peace of Cable’s puzzle finds it place, the picture of a boy becoming a man and finding his way to recovery was shown and hearts everywhere fell for the dark handsome boy. Find out more about Cable here. An enemies-to-lovers romance where opposites not only attract, they ignite. Trying to think of a way to explain this romance isn’t easy. First of all, JB Salsbury is in her own genre when it comes to romance. They’re dark in a different way, with non-traditional heroes who are tough to love at first. And that can definitely be said with Jesse. Jesse is an ASSHOLE at the beginning of Playing by Heart. I hated him at first, but in the best way. Reading his level of dirty, you just KNOW there’s going to be an epic redemption of his soul. This love story is all a tale of what a person can handle when it comes to self-love before loving anyone else and Salsbury does it ABSOLUTE justice. Find out more here. The Queen of Paranormal Romance, New York Times and USA Today bestselling author Gena Showalter, stuns with SHADOW AND ICE, the first title in her scorching new paranormal romance series Gods of War Series. This story is about love. And sex and violence and power and control but beyond all that LOVE conquering all. A message conveyed in every caress from Vale. In every sacrifice from Knox.Filled with explicit and entertaining fights scenes to rival and blockbuster, this story will have on the edge of your city dying to know how Vale and Knox can overcome every obstacle that threatens to tear them and the world apart. Dive in and find out more here. Talk about a powerful hero! Evans impresses with her latest alpha and brother to one of our past heroes. Cullen Carmichael is a magnetic and demanding poker player. When Wynn steps into his card game months later, single, Cullen knows its time to up the stakes and risk it all for the feisty redhead. I can’t explain just how much chemistry is between these two characters. The push and pull of Wynn’s ability to give it all to Cullen against his ability to show his hand sends a message about the lengths people will go to find their happy ever after. Filled with tense moments, secrecy, and one hot alpha this is one emotionally packed romance. Find out more here. Prepare for a story that hits hard, digs deep, and holds tight. Unconscious Hearts is a powerful romance with an alpha hero and a magnetic heroine that you’ll immediately fall for. Covered in leather, dripping with sin, smelling like temptation. Thorn is made for lustful nights and stirs something in Ari she hasn’t felt for a long time. I love that Sloan slowly reveals the truth behind both Thorn and Ari’s past as well as why they initially fight their attractions to one another. There’s no huge history dump as you’re reading; you get discover why these characters are the way they are as if you were slowly learning about them as a friend in their world. I couldn’t put down this dark romance not just for the passion in each page but for how hard it pulls you in and has you begging for what comes next. Find out more here. One More Chapter Cliff hangers that left us begging for more From New York Times bestselling author Meghan March comes a brand new saga of forbidden love and second chances. Heady, rich with passion, and rife with excess, the Sin Trilogy is brimming with drama. With flashes of the past mixed in with the current events of the Riscoffs and the Gables, readers will be in a whirlwind of emotions. Stolen kisses, secrets abound, and a doozy of a twist I GUAR-AN-TEE you won’t see coming, this romance will have you hooked from the start! Prepare yourself for more drama than any reality TV show and some steam scenes more risque than you’ve experienced!! Find more about the series three novels: Book 1, Book 2, Book 3. She was brainwashed into believing she could save mankind. Now, she’s the one who needs saving. An original plot line, complex characters, and twists and turns to drag you in to the story, the Mercy Series is its own brand of romance and mystery. So unlike any other new adult romance, Ghostgirl pulled me in from the start and never let go. This slow burn was completely satisfying as their feelings developed alongside the story. Pieces of Mercy’s past slowly come out as the puzzle of what truly happened to her begins to form. Filled with moral quandaries and blurring the line between right and wrong, Saint delivers another powerful message about personal faith and fighting for the truth. Dive in to learn more about Milo and Mercy. How do you put in to words a story that takes years of love, laughter, and pain and wraps them in a package under heartbreak and hope? The amazing duo that is Kennedy Fox saved the most detailed and heavy Bishop for last. Readers who have stuck alongside the series have openly waited for the tricky twin Jackson’s story behind his playboy ways. Now spoiler free here…but be warned that you will want quiet, wine, and something to bring yourself comfort when reading this romance. The supposed climax is right at the beginning and I LOVED getting to read the back and forth up to the pivotal day. KF definitely set the bar high with this tale, I swear they save the end of their series for the high stakes drama and it is WORTH IT! So sit down, stock up, and buckle up for one insane ride here. The highly anticipated sexy, suspenseful stand-alone second-chance romance from NYT Bestselling Author, A.L. Jackson. Magnetic. Heart stopping. Filled with passion and suspense but brimming with hope. Jackson’s finale to the Fight For Me series is an amazing collaboration of regrets and second-chances. I could not believe how engrossed I became in this story! Ollie and Nikki have an obvious connection that no one can deny. Watching them gravitate towards and away from one another was such heartbreak. No spoilers for the truth about Sydney but I will say to read between the lines and come to your own conclusions as the truth will SHOCK you. I was not prepared at all for the twist ending but I could not have read any faster, turning page after page to see just what would happen. Find out more here. What has a sexy, bad-ass veteran hero… A feisty and independent heroine who won’t hesitate to stand up for herself. A forbidden, best friend’s younger sister conflict. And a forced-proximity roommates-to-lovers situation that creates all kinds of sexual tension? The second standalone title in New York Times bestselling author Laura Kaye’s Warrior Fight Club series! There’s a connection with Shay and Billy that sparks the minute the two characters come together. Kaye impresses with her ability to once again combine sexy heroes with rough pasts and even tougher walls to break through. Sexy, with a surprise twist you won’t see coming. add this new romance to your TBR! Novellas and quick reads From New York Times and USA Today Bestselling author K Bromberg, comes CONTROL, a new novella in her Everyday Heroes Series, brought to you by 1,001 Dark Nights! I love the 1001 Dark Nights series because it’s more than just a sneak peek into an author’s series, it’s a splash into that author’s voice and style. K Bromberg is stellar at writing drama mixed with sex and romance. Control is a stunning look into her Everyday Heroes series and shows how two lost people can find happiness with each other. Now don’t judge me….but I’m a Kylie Scott fan that hasn’t finished the Stage Dive series at this moment. GASP SHOCK AWE. Now that that’s out of your system…let me introduce you to a quick and sexyyyyy novella from Scott and 1001 Dark Nights. Whoo lordy say hello to your newest naughty dream. Sam is H-O-T. He’s a rough and gruff silver fox with a smooth tongue for Martha. Filled with sweet and sexy, this novella is a great taste of the Kylie Scott world! The perfect combination of sweet and sexy, Laura Kaye amazes again with her novella peek into the Raven Riders series. This story was a fun treat vote into existence by Kaye fans. I was hoping for my smooth talking charmer Phoenix to get his story but Caine took me by surprise. It’s the quiet ones that see and hold the most. Filled with more honesty and truth in a smaller format, Kaye delivers the heart-wrenching pain of a characters path while revealing the bright hope of their love filled future. Find out more here. Aural Fixations Who knew audio books were so addicting Read Me Romance is a FREE podcast hosted by New York Times Bestselling Authors Alexa Riley and Tessa Bailey. Trust me when I say you WANT to be listening. These three slowly reveal an audio book EVERY SINGLE WEEK, with snippets each day. Add in their hilarious banter and it’s like hanging out with your own mobile book club. Get introduced to new authors, feed into your guilty, dirty reads, or like me discover you new found love of audio books and the worlds they open up. Don’t forget to subscribe to the podcast so you don’t miss a single installment! A standalone romance novel published by Montlake Romance: It all started with a mysterious blue note sewn into a wedding dress. The name embossed on the blue stationery: Reed Eastwood, thanks to a twist of fate, he’s my new boss. But that’s not going to stop me from discovering the story behind his last love letter. A love letter that did not result in a happily ever after. My very first full length audio book and I fell in love! Entranced by their voices, escaping into their worlds. This romance was filled with drama and twists I never saw coming. I loved every minute as Charlotte attempted to learn Reed’s truth. All while Reed harbored a shocking secret that threatened everything! Find out more here. Be prepared to fall in love with Sara Ney and her captivating new adult romances! Being a well known jock-blocker gets Scarlett noticed for all the wrong reasons; just like that, she’s banned from Jock Row. Week-after-week, she visits Jock Row with her friends and is quarantined to the porch with one Sterling “Rowdy” Wade. As the weeks progress, the two find out how much they have in common and fall madly in love. Hilarious. witty, and filled with flirtatious fun, this audio was so uplifting and Scareltt and Rowdy’s romance is so real and honest. Drama free and filled with happiness! Dark and Deep Dark romance filled with deep emotion It’s passionate and powerful; suspenseful and seductive. Kristen Ashley’s finale of the Honey series is an endless list of beautiful adjectives that add up to an explosive read. Stellan’s eyed the beautifully intriguing Sixx for longer than she could imagine. After waiting years for her to make a move he decides that only another Dom is willing to crack the shell of this mysterious femma fatale. What Stellan hadn’t planned on was not only culling the dominatrix but releasing the submissive inside. In KA’s distinctive voice, I found a new hero within Sixx. In addition to our final Honey couple, KA dives into more worlds of the exotic and risque. Find out more about them here. How can I describe how amazingly sexy and sweet this book is? I’m new to Laura Kaye’s Blasphemy series but you can bet your sweet butts I went out and bought the the rest of the entire series after I finished this book in the late hours of the night. I couldn’t put it down, couldn’t look away from the sheer power this book holds. Not for the faint of heart, On His Knees is filled with raw sexuality alongside a man coming to grips with the reality of his sexual preferences. Kaye’s depiction is honest and real and truly makes you understand what it means to go through the struggle of discovery. Find out more about this M/M romance here. Holy Jesus….this was my first “age difference” romance and I am SOLD! Kylie Scott has been killing the standalone game and this did not disappoint. Adele is stuck staying with her father’s friend and business partner, Pete. Bad news? She’s been terribly in love with Pete for years and now that she’s older, she’s not quite sure what their relationship will be like (especially considering how badly it ended 7 years before). When a night of high emotions turns an argument into one steamy night, their worlds change forever. Not only does Pete have to come to terms with his feelings towards Adele, he has to come face to face with a future he never planned for with her. Another real and relatable romance from Scott; find out more here. A YA novel from USA Today bestselling author Sarina Bowen. I’m so glad she’s decided to branch out once again and she’s delivered a compelling YA story about love, loss, and the power of music. Rachel’s daydreamed about her rockstar father for years, despite her mother’s protests. Now, her mother’s passed away and left Rachel in his hands just as she’s to turn 18 and experience the world on her own. But the imaginations of a little girl rarely match up to reality. Her dads not all rock god; he’s just a man with imperfections. The Accidentals truly emulates the rag-tag combination of teenage heartbreak and over abundance of emotions. It had me crying, it had my heart breaking, but the power of Rachel’s love of music and her family pulls readers through in the end for a warm ending worthy of any story. Dive in here. LOVE & LAUGHTER Cry from laughing instead of heartbreak I was honestly taken by surprise with how emotional this book made me feel. There’s no terrible past from Jean about her child’s father. There’s no cataclysmic event to force Eric to decide what he wants. This a story about two people (technically three with the baby lol) who fall for each other all out of order. But who are we to judge. You never know what a relationship looks like to the two people in it. And Chaser is the soothing balm after the rough and rich stories of Vaughn and Joe. Scott couldn’t have done a better job on Eric’s story! Find out more here. an all-new standalone in the USA Today bestselling Rugby Series from Penny Reid and L.H. Cosway. I didn’t want this series to end; I’ve loved it since the moment I started to read it. But Cosway and Reid go out with an amazing story filled with a spunky heroine and a secretive hero. Will, one of our beloved rugby players, is caught amidst a sports scandal as his sexy secret comes to light: he’s a voyeur. But he’s determined to clean up his so called dirty act for the team’s image. In comes the klutzy and foot-in-mouth speaking Josey as his new roommate and pseudo-babysitter. These characters are just plain heartwarming and I found myself laughing hysterically throughout the whole book. A wonderful ending to an amazing series! Find out more here. OMG Sarina and Tanya deliver another hilarious five-star rom-com! Man Card features sassy, sexy Ash and hilariously metrosexual Braht as our hero and heroine. The two have spent months as “frenemies”; there’s chemistry (and one sexy time in a pantry!) between them but for some reason the attraction leads to an all out turf war as the two realtors love to one up one another. And of course one-upsmanship leads to some hysterical moments for them! Filled with riotous wit and endearingly flubbed sexy-times, Man Card easily slips into a five-star read status. Find out more here. WILD LIKE THE WIND – A Kristen Ashley New Release From New York Times bestselling author Kristen Ashley, comes the next heart stopping Chaos novel, Wild Like the Wind is now available! The brother known as Hound has a reputation. He’s all about cracking heads, having a good time, and when the Chaos Motorcycle Club needs someone to do the tough job, they call on him. But Hound has a secret. He fell in love with a woman years ago. She’s untouchable. Unattainable. And even when her status changes, for Hound, it remains the same. Keely Black had it all early and lost it all not long after. Thrown into an abyss of loss and grief, she’s faced a life of raising two sons alone and battling the rage at all that had been ripped from them. And why. Words spoken in anger open Hound’s and Keely’s eyes. For Hound, he sees he’s wasted his life loving the wrong woman. Keely sees she’s wasting her life not opening herself to the love of a good man. IBOOKS \| AMAZON \| B&N\| KOBO WANT A SNEAK PEEK? CHECK OUT CHAPTER ONE NOW! ROCK CHICK RENDEZVOUS 2018 – An Event Recap I successfully attended my very first Rock Chick Rendezvous! Though I didn’t attend all of the events, the two days I spent with the Rock Chicks was unparalleled to any other romance book fandom. Here’s my small recap and a look into the Q&A with Kristen Ashley and Jay Crownover! After a full day of work and an hour drive to downtown Cleveland in the summer heat, Rock Chicks arrived at the Metropolitan at 9 to pick up their KA swag bags. Custom to any event, RCR18 featured a crazy cute swag bag for the Rock Chicks to pick up before Friday night’s party. With a 1001 Dark Nights teaser pack, candy, guitar pick, custom t shirt, hat and 4 copies of Crownover & Ashley’s titles this bag of goodies was TOP NOTCH! I gave Instagram followers a sneak peak at the bag Friday night with a live video but my favorite piece was definitely the custom baseball tee. Want to win some Kristen Ashley swag? Check out this exclusive giveaway for your chance to win a signed copy of The Greatest Risk and Rock Chick Reawakening. Start the Rock Chicks off with a bang or close out the sinfully good Honey series with your own signed copies! Rock Chick Reawakening The Greatest Risk Rock & Roll Hall of Fame: I may be a Cleveland native but it’s been about ten years since I’ve walked through our infamous Rock & Roll Hall of Fame. Glammed out and ready to party, dozens of Rock Chicks descended upon the halls of rock. After a killer photo-op with Kirsten in her 70 pound sequin dress and Jay rocking her bad-ass style, Rock Chicks were encouraged to walk all 6 floors of the Rock Hall and enjoy drinks and appetizers fit for rock queens. With the dance party going all night filled with drinks, laughter, and all things rock babes, the Hall’s never seen so much romance royalty. Signing & Q&A: My favorite thing about Q&As with any author is the chance to peak inside their minds and see how they develop the wonderful stories readers like you and I adore. Check out some the fabulous questions readers asked and let me know which one was your favorite! between two ferns with zach galifianakis As always, Kristen loves to tell the story of stealing her mother’s romance novels from the age of 12. She would hide them under her bed (on the lower bunk) and unfortunately the cat would pee on it. But she would still get under the covers and read her cat-pee romance novel. Jay claims she wouldn’t be a romance novelist if it weren’t for Kristen and her Rock Chicks. Her wonderful mom was a librarian so Jay always grew up reading (her fav was Nancy Drew). But has she got older: “Hey…what’s this Sandra Brown book all about?”. Q: Is there a character or land or idea that you think of but it gets stuck and you can’t quite write the whole book that you write? What do you do? KA: I’ve only ever given up on one book and I still haven’t finished it but it was Tack’s original book. His first woman’s name was Clara. It was a dark time in my life and it’s a much darker story and he’s a much darker hero. And I didn’t feel that from him at all; he’s got his rough edges. She was run-down and she was publicly humiliated by her husband. It even had Tabby and Rush in the book; it’s almost written. BI just abandoned it and went back when I wasn’t in a bad place and I was like “This book is really frickin good!” But it wasn’t Tack; I’ll probably do some rewrites. Normally though when an idea hits me, I’m just obsessed with it and it never lets me go. JC: If I can’t figure out if they’re important enough to get their own story or interesting enough, I usually work em in somewhere (as one of her many side characters). I’m sneaky, I’ll just work em in there! Q: When do you think your books will be coming to movies with Passionflix? KA: I have no idea, sorry. I sold Three Wishes and The Will to Passionflix. (Find out more about KA & Passionflix here) Q: How do you come up with the names (for characters) for your novels? JC: So I have a running list and honestly I started it when I bartended. And I live in Colorado so there’s lots of hipsters with cool names. Anytime I would get a cool idea and their name was really different I would be like “I gotta remember that!” Rule’s honestly is just my backward thinking of “I’m gunna write these twins and one of them is going to be a rule breaker.. Oh Rule!” In real life, all my family is J’s so I knew all the boys had to be R’s. Brains work weird. KA: Sometimes my characters come to me named (Tack, Jake Spear, Tate). But I have two just enormous names list for any name that I come across that I write. Heroines, nicknames, animal names, another separate for all bar names. IF the character doesn’t come to me name, I’ll unfocus and scroll through the list. It HAS to be their name though; I have to get to know them. JC: Also if you’re a reader with a really cool name, I might steal it. (Day, Emerys) Q: Is Jane going to get a story? KA: No, it’s highly unlikely. Jane is obviously me. I love the fact that her happy ending didn’t include a man. She got what she wanted out of life and she had family around her. She did wrong by those men (the women didn’t care) and they loved her and accepted her and it’s her family now. That’s what she’s always wanted to do. But I never say never or you might find her in the background and she might have somebody, but right now I’m not feeling it. Q: Do you write the same way, same desk, same laptop, candle, wine? Is there a structure to your day in terms of how you guys write? JC: I do. I write the same hours and I sit at a desk. I watch The Amazing Race while I write. Normally between noon and 8pm, my power hours, cause I have big dogs. I don’t write very well when I travel. KA: I’m the same way except I’m morning. No distractions, no music or TV. Kylie Scott was staying with her one time and she would always take an hour out of every day to sit down with her laptop. “I have to be with them!” Scott said. She wrote in a hotel once and that was awesome because she could order a hamburger at any time. Q: Are you ever going to write Darius a book? KA: I want to, I really do. I really can’t explain what makes Darius so special to me; that trio of boys is super special to me. It’s kind of like what I just went through with writing Rush, There’s a lot of stress to make it perfect. And I want to make it perfect for you, but it has to be perfect for him, for me to give it to him. He might bookend the Mace and Stella. I might just delay it but I hope I get to spend a good amount [of time]. Q: The model from Built, is he Zeb? Because he’s really hot! JC: His name is Matt and he lives in New York. He’s actually a concierge at one of the Ritz Carlton’s in New York. Doesn’t he look like Leonardo DiCaprio a little bit? I was with Harper Collins at that time and I had to convince my publisher that I needed a big burly bearded due. At the time, big bearded burly dudes were not on romance covers. Not like a nice trim beard, I needed a dude with a Colorado beard! KA: I personally thank you for getting the bearded guys on the cover. JC: I totally take credit for that! Q: Are we going to get Lachlan and Emily’s story? KA: Yes. The Loose Ends that’s coming out in November. Hopefully that will do well and then I’ll do another one next year and that will be one of the novellas that I do. Q: When I read the books I can see them and I can hear them. Do you have visual muses or are they all in your head? JC: I have a really vivid imagination. So I just see it all and it plays like a movie in my head. So the characters look very specific to me. It’s really rare that anyone in real life or even on my covers look exactly like who I pictured. I try and get close as often as I can. The girl in my new book though, in the first book of the series I said she looked like Taylor Swift so I’ve had to stick with that through six books! KA: I think we were separated at birth by like a decade. JC: I will take it! KA: Cause that’s exactly how I am. I can’t listen to my audiobooks because it freaks me out to hear somebody else doing the voices. I’ve only heard one of my audio books; when I started the sample, I started crying because she sounded just like Feb in For You. I actually sat at my desk weeping. The first time ever I wrote Toby and Addy and Johnny (The Hook Up) was such a strong character in my brain. He kept shoving Toby out, including his personality, I could not capture him at all. So then I found Jerry Mello, You’re welcome when you google him. Ooh my god! He’s my Toby. There’s a picture of him in profile with the beard, yeah, that’s the only time I’ve ever done it. Q: Kristen would you be able to tell the story of Hector and Sadie’s book? SPOLIER ALERT KA: Hector and Sadie, Rock Chick Regret. I was actually writing Rock Chick Reckoning, Mace and Stella. I had three friend reading the book as I wrote and there’s this one moment where Mace and Stella that is a cliff hanger if the story ended there. So I finished that chapter and sent it off to my friends and went to take a bath. And Sadie came to me; if you’ve read the book she’s violated in the first few chapters and it’s really terrible. I don’t think I dried off; I jumped out of the bath tub and put on sweats and I went directly to the computer and began to write because I needed her to have happy ending. I had to get out of that zone. Her history, her dad, everything came to me, slamming in to me. So it was crucial to make her happy. So then I emailed it to my friends and said “I’m stopping this book and this other book started” and they were like, “WAIT A SECOND! THEY’VE JUST BEEN SHOT AT! THEY FELL DOWN THROUGH THE STAGE!” Well you’re gunna have to wait! Q: One of things I love most about your books is how you write about real places and we get to go and visit them. I was wondering if there was a real gladiator place that we can go to? KA: That book [The Greatest Risk] is only a couple months old and that is like the most asked question to me EVER! One of the very fun things about writing the Honey series was the research I got to put in to that. I probably could’ve got a lot more writing done last year if I didn’t some much time on Google. You just think of new search options and it just gets crazy! I saw a picture of these two men in like a boxing ring, and then my mind went. I save that picture. I don’t think I can put that on Pinterest. Q: It’s [The Honey Series] romance but its closer to erotica do we have any more of that coming our direction? KA: turns to Jay Have you done erotica? JC: laughing No. I’m a delicate creature. KA: There is a novella in Loose Ends for Diesel, Maddox, and Molly that’s very erotic. Very, very, very erotic. I should go read it and see what percentage there is of like dialogue versus….smut. But I think Ami will probably follow up with a novella. The spirit just has to move me and I would not close the door to that at all. Q: At the begging of this, Jay you said that you were inspired to become an author because of Kristen. What was that process and when did you make the jump? JC: I’ve always written but in ever finished anything ever. I was married and it went south. I just happened to pick up the Rock Chick series and I was reading it. I’m a Colorado native and I’m proud to be a Colorado native and I’m super proud that they were set in Denver; not by somebody that didn’t know Denver. But someone that KNEW Denver, like the places. And the guys were very different from most romance guys; they were not Nora Roberts’s heroes. They were these distinctly Colorado men. After I read what had been out I read the Colorado Mountain Men series and I was like “I love this girl. Can we be best friends?” But I starting reading about her and her story. So when Rule was done I was like “I wrote a punk rock hero, in romance; like that’s not a thing.” You didn’t have purple mohawked heroes in romance. But I was like that was my dream guy when I was 20. If Kristen Ashley can write it and put it out her and readers like it…maybe the same thing will happen for me. And if not then I’m just gunna call my mom and be like ‘Hey mom I published a book! How cool am I?” But I wouldn’t’ve known that you can write books for you and for readers and not for publishers if I didn’t read bout Kristen. I wouldn’t know that you could write about dudes that you thought were interesting and not necessarily a wide appeal for romance if it wasn’t for Kristen. She was definitely the one author of all the authors that I read, that I was like “I can be like that girl”. Rule wouldn’t be here if it wasn’t for her. KA: Tell em what happened when you published Rule. JC: I didn’t know what I was doing, let’s just clarify that. I finished it and it got very shoddily edited and I published it two days after I signed my divorce papers. So he don’t get none of that money. I hit publish literally on December 31, 2012. I went to bed. I woke up the next morning and sometime between New Year’s Eve and New Year’s Day that book was number 5 on Amazon and it sold 10,000 copies in one night. Y’all needed a little purple mohawked boy in romance apparently! KA: If you’re a writer, or whatever you wanna do. Whatever motivation you get of whatever lift you get, take it and do something about it. Jay did and she made it her own and she sold 10,000 in one night. That’s’ crazy. I was told for years and years nobody wanted my novels. And now I’m sitting here in front of you and that’s just not true. There’s an audience. There’s a lot of beautiful voices out there that we’re finally getting to hear. JC: One of the important things to takeaway form that was the uniqueness of what she was doing. I think that’s why Rule spoke to so many people. Cause it was different. And I think that’s why the Rock Chicks spoke to so many people. I wasn’t trying to write the Rock Chicks, cause I could never do that, ever. But because she did something that was so singular and so true to her, I was like “I can do that because I ran around with punk rock dudes and tattoo artist when I was a teenager.” I have that story to tell. Write your own story; it’ll be way better. – Jay Crownover Q: How many of your characters are based around real people? JC: My newest book that just came out in March [Recovered] is based on my very first real life boyfriend that I dated when I was a teenager. It’s his story. But he’s married to a ballerina right now so I can’t give you his phone number. KA: Most of my secondary characters are based on people in my life. I found that especially in early writing I was able to imbue some emotion into the stories. Trixie, in Rock Chick Rescue, has my friend Dixie’s hands. Trixie is nothing like Dixie. Tex, Todd, Stevie, Uncle March, and Aunt Bette are based on real life people. Tack and Wood, both of them I met a guy in Sturgis and he was…oddly enough the story of Justice and Deke is the story of me first seeing this man in Sturgis. I did end up making out with him in a bar. It was a fun night. It was very inspirational obviously; 3 characters came from that. But I didn’t really get to know him, let’s just say! That was just that one lovely night. He was a gentle guy and a gentleman and he was HOT. Dignity & Built by Jay Crownover The Farthest Edge & Mystery Man by Kristen Ashley Jay Crownover is the international and multiple New York Times and USA Today bestselling author of the Marked Men Series, The Saints of Denver Series, the Point Series, the Breaking Point Series, and the Getaway Series. Her books can be found translated in many different languages all around the world. She is a tattooed, crazy haired Colorado native who lives at the base of the Rockies with her awesome dogs. This is where she can frequently be found enjoying a cold beer and Taco Tuesdays. Jay is a self-declared music snob and outspoken book lover who is always looking for her next adventure, between the pages and on the road. THE GREATEST RISK – A Kristen Ashley Review & Chapter Reveal It’s passionate and powerful; suspenseful and seductive. Kristen Ashley’s finale of the Honey series is an endless list of beautiful adjectives that add up to an explosive 5 star read. Sixx, a renowned Domme in the Honey Club, has had her eyes on Stellan for years. Ever the ice queen, Sixx has never approached or dared to risk anything more than a furtive glance. Her main concern? He’s a Dom; and two dominant personalities combined with her dangerous past could never work. So she watches and waits as Stellan seems to move about life without her. Stellan’s eyed the beautifully intriguing Sixx for longer than she could imagine. After waiting years for her to make a move he decides that only another Dom is willing to crack the shell of this mysterious femma fatale. What Stellan hadn’t planned on was not only culling the dominatrix but releasing the submissive inside. Our surprising little Sixx is a Switch; a rarity in the BDSM world. Now Stellan has to love the woman in control and woman who craves it. But is Sixx willing to take the greatest Risk? In KA’s distinctive voice, I found a new hero within Sixx. Much like past heroes in her romances, Sixx has the attitude of a hero who doesn’t shy from what must be done yet doesn’t find themselves worthy of happiness or true love. Sixx is a persona created by our heroine to handle the harsh reality of the world and to shield herself from that which cold break her heart. But KA’s genius doesn’t allow for Sixx to be unnecessary or a skin that must be shed to find the true woman underneath. No, both the woman and the warrior are parts of Sixx that Stellan (and Sixx and readers alike) has to learn to love. There’s a beauty to her fragmented idea of self. Sixx doesn’t need to be fixed, she needs to be discovered, by others and herself. In addition to our final Honey couple, KA dives into more worlds of the exotic and risque. With a wondrous gift from Stellan we get privilege to a warrior’s pit. And it Sixx’s dangerous world we dive deeper into the other clubs of BDSM and meet one of the hottest trios to ever grace romance pages (Seriously it was some of the hottest scenes I’ve ever read…EVER). The raw emotion throughout the entire novel is the number one reason why this is an instant addition to my top reads. Grab a glass of wine and some tissues because its about to get messy at the Honey Club. A woman unable to connect, struggling to hide another part of her. A man burning to learn her truth, and make her whole. Through explosive passion and deep exploration, they are about to take the greatest risk of all. But will they be able to take that leap, and come out on the other side together? In this next passionate novel in the Honey series, New York Times bestselling author Kristen Ashley delivers a stunningly romantic and intensely sexy novel that will stay with you long after you turn the final page. PRE-ORDER YOUR COPY NOW Amazon \| Barnes & Noble \| Books-a-Million \| IndieBound \| Powells Present day … Sixx wandered the halls of the Bee’s Honey for absolutely no purpose except to make the boys in the booth watching the cameras that monitored the action in the club think she was taking in the scene. Instead, she was biding time to go into the Dom Lounge to get what she’d stashed in her locker. She was over it. Over the scene. Over the wait. The Honey had now become a place she could hang and have a drink, connect with some friends if she was in the mood, get some of her kink by watching, and torture herself being around Stellan. It was also where she stashed something if she had it to stash. This was because the Honey had surveillance and security that rivaled that of the White House. If a person wasn’t supposed to be there, they didn’t get in there. The end. She’d been back in Phoenix now for a while. And although she’d put on a variety of shows, bided her time, put herself out there, made herself available, Stellan hadn’t thrown down the gauntlet. She sure as hell wasn’t making the first move. Thus that first move wasn’t going to be made. She hadn’t expected much and she sure got that. And she had to admit, part of her was relieved (a large part). Because if he took a shot, what then? Could she protect him from all that was her? Doubtful. More like impossible. She never had with anyone who mattered, not that she’d had many in her life who mattered. And Stellan absolutely did not deserve to have to deal with all that could befall anyone who got close to Sixx. Tonight was different, though. Tonight, she wanted done with the extracurricular activity she was engaged in. Also tonight she roamed the halls knowing Stellan was there, he’d taken a room, and he’d gone off his normal modus operandi. He’d selected a female sub. He’d also selected a male. If in a mood, though that mood was always rare, he’d pick more than one sub. But they were always females. Sixx had a feeling she knew why he’d done this. She had Google alerts set up, and she’d seen it. That it being that it was announced to the media that day that the two-and-a-half-month marriage of Andreas Lange and his pretty-much-child bride Priscilla was done. Although the press was asked to leave the couple alone in this trying time, it was nevertheless reported that Andreas might often think with his dick and had apparent self-esteem issues that drove him to having a pretty young thing dripping off his arm, but when it counted, he used his other head. The one with an actual brain in it. In other words, he had a reported ironclad prenuptial agreement, and the soon-to-be-again Ms. Newton would walk away with the engagement ring he gave her, any gifts she’d acquired during their relationship and nothing else. Nothing else. Not even a settlement. She was young, and Sixx knew that young didn’t make you stupid, it just made you young, naïve, and perhaps with the beauty that girl had, overconfident. Thus she probably thought her golden looks mingled with a twenty-two-year-old pussy would buy her a lot more time to get a lot more gifts. Sadly, she’d been wrong. Sixx could not know how this news affected Stellan. Although they had exchanged a variety of words since she’d been home, they’d both been at a few get-togethers where he didn’t avoid her, but he didn’t pursue her, they’d caught each other’s eyes on a number of occasions; and she’d noted him watching her work with her submissives, as he’d noted her doing the same with his, they had not even resurrected the loose but friendly relationship they’d had before she’d left. She put it down to him still smarting from Leigh’s falling in love with another man. That said, even if Leigh had, it appeared that not much had changed between Stellan and Amélie. Although chilly between them when Sixx got back, that had thawed, and they were as sociable and close as they ever had been. And it was clear Stellan liked Olly, Amélie’s enormous, gorgeous stallion. Then again, everyone liked Olly. It was impossible not to like the guy. He was just that guy who had it all and not simply the fact he was so easy to look at. He adored Leigh, for one. Utterly. And he did not hide it in the slightest. But he was outgoing, funny, solid. If you were moving house and you needed an extra pair of hands, he was there. If you had a nephew (or niece) who wanted to be a firefighter (which Olly was), he’d take the kid through his station and introduce him to all the guys. If you were at a cookout with him and running low on your drink, you found your glass slid out of your hand and another one put in it without even having to ask. Even Stellan, wanting Amélie for as long as he did, couldn’t dislike the guy. So they’d become friends. And Sixx had watched. That was one of the two things she’d done since being back. In a halfhearted attempt to get his attention (and keep Aryas off her back), she played. And she watched. Which was what she was on a mission to do now before she hit the Dom Lounge to prepare to complete her other mission. As she wandered, Sixx didn’t spend time watching Mira and Trey in their room. It was tough watching Mira work now that she had a sub and they were together together. In other words, in love. Mira was good at what she did, and Trey liked what his Mistress gave him, but that look of adoration on her face while she was doing it … Sixx just couldn’t deal with it. This was also why she avoided Leigh and Olly when they were at play (and more recently, also when they weren’t because the connection they had between them just didn’t stop). Right then they weren’t in a playroom. They were still in the bar, holding court, The Stallion Alpha Sub King and his Dominatrix Queen, as usual reigning supreme over the club and enjoying it before they moved to a room to enjoy each other. They were actually worse to watch than Trey and Mira, they were so beautiful together. They were like watching dancers, so perfectly in sync, expressive, at one with each other and their own bodies. The sequence practiced, even if it was always different, it was so graceful it was sublime. Putting this out of her mind, Sixx moved on her black platform pumps to the back hall full of playrooms, noting, and not surprised, that Aryas’s red room was shuttered away from view. The blackout blinds to that room were scarlet, not black like all the others, thus its name. It was his own personal playroom if he was in town. And he was. And he had one of his babies in there, working her. Sixx didn’t need to watch that, although she would have. She’d not only seen Aryas at play, he’d worked her because he’d trained her. He showed her how to be who she was. He introduced her to other Dommes to teach her the things he could not. And he’d played with her in his sessions in which she was required to sub so she could understand the headspace her own subs had to get in to serve her. She had been surprised she’d liked it. She’d been freaked she’d liked it so much. Aryas had handled that too for her—amazingly. Which meant he’d helped her handle it. And then she’d locked it away. However as she bypassed his room, she felt her lips thin that he was back there with one of his babies and not with the woman he should be with. At first when Sixx arrived back in Phoenix, he’d let things lie. Now that months had passed, he was getting up in her face about making a move on Stellan. Fortunately, she was able to fight back since he wouldn’t make a move on Mistress Talia. Which was where Sixx went and where she stopped to watch, also not surprised that Talia was working a sub mostly because those two circled each other just this way. If Talia took a sub and he caught it, Aryas wasn’t too far from taking his own. If Aryas took one and Talia caught it, she hustled a sub into a playroom. Retaliation. As Sixx watched Talia work a sub named Bryan, definitely a favored and oft-used toy of hers, she got worried. In a heartbeat, Bryan would take things further with his tall, slender, lithe, beautiful, mocha-skinned, tawny-fro’ed Mistress, and not just because he seriously got off on the way she worked him. She wasn’t just beautiful and had a serious style going on in and out of a playroom. She was funny, quick-witted, smart-mouthed, loyal and very sweet. And Sixx had witnessed her aftercare of Bryan when she got down to serious business with him, and even knowing Talia’s heart was with Aryas, her head and attention was with Bryan in a way he could mistake the fact that he didn’t have a place in that particular vital organ. Sixx considered having a word with the Mistress. She did that, and then she decided instead to have a word with Leigh so Leigh would have a word. Amélie was probably already thinking of doing it. She wasn’t Queen Bee just because she rocked a playroom, and she took her unofficial role seriously. But if Sixx had a word, she might light a fire, and perhaps if they double-teamed Aryas and Talia, they could get something going. Before hitting the Dom Lounge, she found her feet taking her one last place. At first, she positioned herself carefully in order to be able to process what she might see and at the same time be out of his line of sight because he always broke scene to catch her eyes if he saw her at the windows. And the possibility of seeing him working a male sub was something she wanted without him breaking scene. This eye contact, at first, she’d found terrifying, because it was encouraging. It was rare a Dom working would do that unless he was working directly with another Dom. When months passed and nothing came of it, Sixx stopped finding it terrifying or encouraging and just found it weird. There was no invitation in his gaze. No challenge issued. No warmth or comradeship or humor or anything. He’d just catch her gaze and hold it for as long as it took for her to break it. Even if he was physically inside one of his subs, he’d thrust while simply looking at Sixx, remote and disengaged, from her and his sub, until Sixx herself broke the contact and his attention went back to his sub. But if he was working a male, especially inside one, this she’d want to see. Man-on-man was a thing of hers, and since she’d returned to Phoenix, she’d indulged in that, always taking multiple submissives, they were always male, and she’d call the shots to get that fix. Seeing Stellan engaged in something like this would probably make her orgasm right there in the hall. Hell, just thinking about it got her wet. Then again, although this would be an extraordinary sight to see, Sixx didn’t figure it would take much to do that. In all her play since she’d come back, she had not once let a single sub touch her, she’d rarely touched them, and she hadn’t had that first orgasm, not in play, not with some random partner she picked up out in the vanilla world (because she hadn’t picked anyone up), not even at her own hand. But as she hesitated at the edge of one of the rooms Stellan favored, the silhouette and blackout blinds up like he normally played it, she didn’t even see Stellan. The female was working the male, and that work was inspired, but there was no Stellan. Sixx took one step along the hall. And there he was, still in his trousers and dress shirt, but the suit jacket was thrown over the back of the leather club chair he was sitting in. He had his long legs crossed, and he was slanted to the side, elbow on the arm of the chair, head propped up in his hand where it held his square jaw at his knuckles with his forefinger extended along his chiseled cheek. She drew in a breath at the bored expression on his arrestingly beautiful face, that expression running deep into his dark blue eyes. He did not look annoyed, upset, or distracted, as news of his father acquiring then disposing of another wife in a matter of months might make him. He didn’t look anything, certainly not like he was in a room where sweet and dirty sex acts were being performed at his command by the slaves he’d chosen for the evening. He looked like he was in a meeting that he couldn’t wait to get out of. Then suddenly, his gaze came to her. He didn’t move, didn’t lift his head, just swept his eyes straight to her, not like he’d noticed her standing there, like he’d sensed she was there. His expression didn’t change. Neither did his position. He stared her right in the eyes, pinning her to the spot, giving her nothing except his regard. She wanted to scream, Why? Why do you look at me like that? Why can’t you give me something? Anything? She didn’t do that. She accepted the only challenge he gave her and stared straight at him in return for as long as she could stand it. And Sixx could stand a lot, so this lasted a long time, perhaps full minutes, before, as ever (and as ever wanting to kick her own ass), she broke the contact and walked slowly, and as casually as she could fake it, away. Once out of sight of Stellan, she didn’t mess around going to the Dom Lounge. There were cameras in there too, but she’d given herself a reason to return there after she had a drink in the hunting ground. This being so she could collect what she’d put there a week ago and be done with the job she was on so she could then collect the paycheck. She did just this, going directly to her locker and grabbing the small, boxy, black python Alexander McQueen clutch with its four finger loops topped with various skulls or roses. A clutch she’d placed there after she’d arrived rather than giving it to reception, which was what most of the Dommes did. Inside was a slim, business-card-sized wallet with her credit card, ID and a few banknotes, her phone, another phone that was hers-but-also-not, her lip liner and lipstick, her fabulous vintage compact with mother-of-pearl inlaid in black depicting cranes flying across a yellow moon, her Cayenne keyfob and nothing else. With her back to the camera, she grabbed a random vibrator she had in her locker, twisted off the bottom where you’d put batteries, upended the flash drive she’d hidden there, and slid it in the lining of the clutch that she’d jimmied so she could open it, hide things behind it, and then press it back in place where it held. She then went to the mirror. At first, she didn’t look at herself, but instead used it to take in the plush surroundings of the Dominants’ Lounge. Deep-seated, purple-velvet banquettes spanned the walls. They were covered in red-and silver-velvet toss pillows. The patterned silver wallpaper behind them was bottom-lit with soft light. There were attractive steel tables with scented candles glowing on top of them. The lockers were made of the same steel as the tables and looked like a bank of cabinets with a variety of digital locks, not lockers. The gleaming black basins had no faucets, just wide, lush waterfalls that activated by motion. There were no paper towels, instead thick, soft, purple, red or silver hand towels and washcloths. There were showers around the side, as well as a Jacuzzi tub, a steam room and a sauna. Available for use was anything you could need. Disposable razors (for men and women) and shaving cream, aftershave, a variety of colognes and perfumes, hairspray, lotions, oils, deodorants, tampons, condoms, face moisturizer, bath soap and scrub, shampoo and conditioner. Submissives were specifically disallowed there. The lounge was for downtime and Dom time outside any scene. If a sub needed to be cared for or it was part of the scene, you requested a room that had those amenities, and the Dom took care of that. And Sixx longed to stretch out on those banquettes and close her eyes to the D. L. & Co. candles that smelled like vanilla, balsam and pepper, soothing and spicy, so very Aryas. So very the Honey. God, she loved it there. It was like her home. It was the only place, outside being on a job, where she could be … Not herself. She played a role there. No one knew who she was. Not really. (Except Aryas, or at least he knew more than everyone else.) Not even people she called friends. So why did she love it there so much? And why was her heart hurting that she wasn’t getting out of it what she needed anymore? She looked at herself in the mirror. “Because it’s safe,” she whispered to her reflection. And now it no longer felt as safe. Because Stellan was there, and wanting him and not having him—but more, knowing she should never expose him to what it would mean to have her … hurt. That didn’t make sense either. She’d wanted a lot in life. And never got it. But Stellan was different. Stellan was … Sixx shook off her thoughts and took herself in through the mirror. She couldn’t see the black pumps or her long legs she’d sleeked not only by giving them a close shave all the way up to her pubis but also with a subtle oil that made them shine. What she could see was the black leather micro-mini that sat tight on her hips, cupped her ass and had a wide black belt with a bold silver buckle. Up top she wore a white leather modified camisole that had a deep plunging neckline that went to her midriff and spread wide at the sides, showing the inside curves of her smallish breasts. The straps were very thin. There was a tight band across her ribs. It was cropped but not by much, showing only a hint of flesh at her belly between camisole and skirt, depending on how she moved. Her hair was short, clipped in a graduated bob at the nape of her neck, the champagne highlights in her dark cinnamon hair looking (she thought) great in the sweeping, long bangs that fell well past her eye, the sides of her hair hanging below her jaw, all the ends in messy flips. She had to style it, which was a minus. But it was short so it didn’t take long, and it had a sex-bomb vibe, so that was a definite plus. She looked into her wide, brown eyes and wondered, What next? A weighty question because it wasn’t about what was next for her at the Honey. But what was next for her with everything. At Aryas’s appeal (which meant repeated demands), she’d given up “the job.” Ostensibly. As far as he knew, Sixx had gone legit, working as the internal investigator for a large local law firm. However, directly due to Aryas’s interference in some of his other friend’s lives, a need had arisen in Phoenix when Branch Dillinger stopped doing what he did out there and became the operations manager for all of the Bee’s Honeys. Nature abhorred a vacuum. Cue Sixx stepping in because first, her pay at the law firm was good, if you weren’t used to making a lot more doing a lot more dangerous shit for a lot more dangerous people. And second, if you were used to doing a lot more dangerous shit for a lot more dangerous people, as well as used to the adrenaline rush that got you, it wasn’t an easy habit to break. So she had a proper job, not a normal one, but one that included a 401K and a bi-weekly paycheck that gave her insurance benefits. And on occasion, she moonlit on the side. Aryas didn’t know. No one knew (except her friend and sometimes partner, Sylvie Creed, and her husband, Tucker, who she and Sylvie sometimes had to call in to help. But Sylvie wasn’t in the life Sixx pretended to lead through her play and relationships at the Honey). Even if Sixx got off on it, and the cash she accumulated doing it, not to mention the freedom that offered, she knew she couldn’t do it forever. She had the scars to prove that particular story you told yourself to stay on the job was a lie. But what would she have if she stopped? The kink was getting boring. There were only so many orders you could give that led—perhaps in a lengthy way, but nonetheless the end was always the same—to someone else’s orgasm. It had lost its appeal. Because she wasn’t connecting. She used to connect. She used to stay mostly silent, watch, listen, open herself to being acutely aware of every expression or even twitch of the skin to sense what her sub wanted … then she’d find some elaborate or creative but always hard-earned way to give it to him. Now she didn’t even have that. Anyone could give their own self an orgasm. It was her job as a Dominatrix, regardless if the emotion wasn’t there, the attention and the respect and the motivation and the deliberation had to be there to connect. Somehow. Some way. That was gone. So what was the point? To yank herself out of thoughts that were going nowhere, even though her long-lasting lipstick was doing its job, she still opened her clutch, pulled out the liner and lipstick, refreshed the ruby red, ended it with a nice coat of clear gloss, and dropped the stuff back in her bag. She then grabbed her phone—not her actual phone, the other one—before she clicked the clutch closed and made her way out of the lounge, deciding to have a drink while she dealt with the details of finishing up her final mission of the evening. She wandered the halls, doing it avoiding having to walk past Stellan’s room, and hit the hunting ground. The back corner booth was open, so she went there, flipped open the burner phone in her hand, set it to silent and then used her thumb in the onerous task of hitting the numbers on the pad repeatedly to get to the letters she needed to send the short text. Really, smartphones were a gift from God. The drop happens tonight. She tucked the phone by her thigh when a server came, and she decided cool-but-luxe Sixx, Mistress with the Mostest, was fucking dead. It was over. No rep to uphold. No bullshit to convey. She was over that too. She wasn’t going to sip from a glass of wine, withholding any personality, any hint of what made her, what defined her, that she might convey through the simple matter of ordering her preferred drink. “Gordon’s cup. Hendrick’s,” she ordered. “Gotcha,” the server said then moved away. She looked to the hunting ground and saw subs avoiding her eyes but still preening in view, hoping she was there to make a selection. God, she was dried up. Not even a tingle. The only time she’d felt anything in—Lord, it had been days—was when Stellan’s eyes met hers earlier through the windows to his playroom. And those days had been the days since she was last at the Honey and Stellan had turned his attention to her. She looked down to her thigh, flipping open the phone to see no return text, and muttered under her breath, “I’m a fucking mess.” “Sorry, didn’t catch that.” Her head snapped up just in time to watch Stellan, back in his suit jacket and definitely out of his playroom, slide in the booth across from her. God, he was gorgeous. But … “You were saying?” he prompted. She flipped the phone shut and tucked it against her thigh so she’d feel it vibrate when the text came in. “I have something on my mind,” she shared, not knowing what to make of this, him in the booth opposite her, making an approach, sitting there looking magnificent but still inaccessible, speaking directly to her with only her there to speak to. “And that would be?” he asked. “It’s work,” she told him. “Ah,” he murmured, glancing to the side and looking up when the server set her drink in front of her. An action he oddly watched with what appeared to be rather avid fascination as the old-fashioned glass came to rest on the burgundy cocktail napkin. “Scotch, please,” he ordered before the guy could ask. “On it,” the server said and moved away. Stellan didn’t watch him go and it took a good deal, Sixx didn’t look away when Stellan’s attention came back to her. “Not in the mood tonight?” he queried. She shook her head, lifted her drink, and took a sip. When she put it down, she verbalized that same response. “No.” “Hmm,” he murmured, and there it was. There it was. That “hmm” was almost like a purr, and that purr snaked right up her pussy, an area that instantly got wet. “You’re finished early,” she noted. He gave a one shoulder shrug that managed to be masculine and elegant at the same time, something only Stellan could pull off. “I thought I’d try something new.” “And?” she asked. “It wasn’t as successful as I’d hoped.” “Too bad,” she murmured, taking another sip of her drink. “Is it?” he returned, and her gaze lifted to his, because he’d asked a question but mostly because that question was strange. “For you, and them, of course it is,” she replied. “They got a good deal out of it, I assume, unless she faked it, which is doubtful. He, however, couldn’t fake it as the evidence he left was physical.” Perhaps she shouldn’t have left so soon. It would undoubtedly have been interesting to watch Stellan orchestrate something like that. “Unusual for you to choose a male,” she remarked. He turned his head to the hunting ground and remarked, “An experiment I’m unlikely to repeat.” She gave it some time, and this was mostly because she was arrested in the act of taking in the beauty of his profile. The cut line of his strong jaw. The angle of his cheekbone. The shadowed hollow under it. The fine lines that fanned from the corner of his eye. The straight slope of his nose. And, Lord God … that remarkable swell of his lower lip. When she realized another second and she’d start squirming in the booth, she spoke. “It might be more enjoyable if you went hands on,” she suggested. He looked back to her and more wet surged between her legs at the expression on his face and what was emanating from his eyes. “If I fancy ass, it comes with breasts and a vagina or not at all.” Sixx would take him up her ass, deep, hard, fast, soft, slow, gentle, any way he liked it. She’d beg him for that. On that thought, her salivary glands went into overdrive, and she lifted her drink, tipping it to him in salute, before she brought it to her mouth but didn’t take a drink. “Too bad,” she murmured. Then she sipped. His lips, including that luscious bottom one, curled up slightly at the ends. “Mistress Sixx,” he said softly. “If she had it her way, they’d be lined up by the score and fucked raw, climaxing at her command at the tip of her whip.” She stared at him, her stomach feeling like it was cramping, but her voice sounded even when she asked, “You say that like there’s something wrong with it.” “Of course there isn’t,” he drawled, totally and openly lying. I’d make you like it, she said in her head. I’d make you beg for it. I’d break my back, sell my soul, do anything I’d need to do to make you come harder than you’ve ever come before, tying you to me, connecting you to me, making you never want to leave. He held her gaze, his face arrogant and knowing. Or I’d give it to you, her mind whispered. Anything you wanted, anything you’d want to do to me to give you what you needed in a way that need could never be eased and you’d always come back for more. He kept holding her gaze, but in the dim light of the bar of the Bee’s Honey, she could swear she saw something in his expression grow soft, like he could read her thoughts. Before she could get a lock on it, or better, turn from him so he couldn’t read anything further, for once he looked away first, but only because the server was there, placing his lowball of Scotch over ice in front of him. Sixx picked up her drink, looked to the hunting ground, and took a healthy sip. “Are you staying?” Stellan’s question brought her attention again to him. She put her drink down and asked, “Pardon?” “In Phoenix,” he explained. “I know you travel for work and it takes you away for long periods of time. But this time, you’ve been back for a while, so it seems like you’re staying.” She had been intending to stay. Now she didn’t know. “For a while,” she replied. He nodded, sipping his drink, and then stated, “I’ve been meaning to invite you, simply haven’t had the chance. But I’m having a party next weekend. We’ve hit June, and the weather hasn’t yet started baking. I’m taking advantage. We’ll start with a pool party, then everyone can change and we’ll move in for dinner. I’d be delighted if you’d come.” She hid her reaction to that by throwing back more gin. “Leigh and Olly will be there,” Stellan went on, back to his gaze set unwavering on her. “Mira and Trey. Felicia’s bringing a couple of her toys. Penn and Shane will be there. Victor has a new slave he’s enjoying so he’s bringing her. In other words, it’s a play party, just to make that clear. Though, depending on how it goes, we’ll make things more sociable and less structured for dinner. That will be up to the Dom.” When he hesitated, she nodded, indicating she’d heard and taken this in, and he kept speaking. “Belle’s bringing Tiffany. Talia is bringing Bryan. Aryas will be out of town, as will Evangeline’s partner, but Evangeline will be there in her usual capacity. Observation only.” It was an unwritten rule when referring to the Honey’s Domme Evangeline’s “partner”—who was really her boyfriend who was essentially living with her—at least in the confines of the walls of the club, people did not use his name. But he was Branch Dillinger. Her partner. Her boyfriend. Her sub. But he was also the Honey’s new top guy, since Aryas had taken a step back from operations in order to focus on opening his new club in Tahoe, and he needed someone he could trust to pick up the reins. And if Branch played it that way, wishing things to be private, he got it that way, and would even if the man couldn’t probably snap your neck with his bare hands then walk away and not give that kill a second thought. It was just the life and everyone obeyed that rule. Though the threat of having your neck snapped worked too. Sixx was just relieved Evangeline was back, not to mention ecstatic she had a man in her life like Branch. Especially after what was done to her to make her take a prolonged break, all of this happening when Sixx was away. It was good it happened when she was away. If she was close, retaliation would have been much different than what Aryas had ordered, and even much different than the vastly more thorough way in which Branch had handled it. But it was handled. So at Aryas’s firm request, she’d let it be. She was relieved and ecstatic for Leenie … and also jealous. Jealous because she wondered what it would feel like to have a miracle happen after the world as you knew it turned to complete shit and then one day … you might not be healed, but you were again whole. “And if you like, I’ll have a couple of male slaves available for your use. Fresh meat. I know a few who’d volunteer that I’m sure you’d like,” Stellan continued. And that stomach cramp got worse. He’d provide her “a few volunteers.” Thoughtful. And damned disappointing. She wondered who he’d have there. And how many. “I’ll think about it,” she told him. “Please do,” he said before taking another sip of his Scotch. She followed suit with her gin, practically willing her phone to vibrate against her leg to give her a reason to get away from him. Stellan spoke again. “So you’re not in the mood, will you allow me to offer you something that might strike a different mood? One I’d wager you’d enjoy a great deal.” At this proposal that came out of nowhere, Sixx almost choked on her gin. But of course she didn’t, and again her voice was clear and cool when she asked, “What’s that?” He shook his head. “I’m afraid it has to be a surprise. But I will say it will be a surprise you’ll like. I also have to say, you shouldn’t wait to make your decision or things will culminate and we’ll miss our chance.” Things will culminate? She was intrigued. “Can you give me a hint?” she pressed. He made a tsking noise that she felt tap against her clit, and as was his usual, he didn’t lose contact with her gaze. But he wasn’t looking aloof anymore. This was both an invitation and a challenge. She just didn’t know to what. And with Stellan—this sudden Stellan who was vastly different than the Stellan she’d been getting (or not, as the case was) for the last too-many-months—she wasn’t sure how to handle it. “Don’t disappoint me, Sixx,” he said quietly. “The Honey’s Ice Princess, cool and composed in every situation, shying away from an adventure?” “I simply need to know how long it would take,” she lied. “I have something I need to do tonight,” she didn’t lie. “As soon as you need to go, I’ll bring you back.” He’d bring her back? He was going to take her somewhere? “What’s it going to be, Sixx?” he pushed. “In truth, I should have asked you the minute I joined you in this booth. We risk missing the grand finale the longer we wait.” “Stellan—” she started, wondering how to get out of it at the same time how not to appear like she was jumping on it by accepting too quickly. She needed time to assess this change, plan, strategize, prepare, fashion a brand-new Sixx. One who could deal with the likes of Stellan Lange and come out the other side of whatever became of whatever was happening unscathed. And more importantly, make certain he did. Or time to find a place to hide. Or escape, her mind taunted. Coward. “I’ve bought you a present,” he shocked her by announcing. “I did this some time ago. I’ve been wishing to give it to you but haven’t had the opportunity. Now’s the opportunity.” The movement was almost not there, but yet it was when he leaned slightly her way and warned in a low voice, “Don’t waste it.” Again, eye contact, unrelenting. Challenge. And a gift? She lifted her drink, took another healthy swallow, put it on the table and then dropped her hand to her thigh to curl her fingers around the phone there while grabbing her clutch off the table with her other hand. She looked back to him and said, “Let’s go.” When she did, all vestiges of her stomach cramps disappeared. Because when she said that, Stellan Lange smiled a wicked, roguish, beautiful smile. Right at her. Copyright © 2018 by Kristen Ashley in The Greatest Risk and reprinted with permission from St. Martin’s Griffin. Kristen Ashley is a New York Times and USA Today bestselling author of over fifty novels, including Mystery Man, The Gamble, and Own the Wind. She grew up in Indiana, but has lived in Colorado and the West Country of England. Twitter – @KristenAshley68 Facebook – @KristenAshleyBooks Instagram – @KristenAshleyBooks APOLLYCON 2018 – An Event Recap Y’all! I am insanely impressed with Apollycon and this was my first year going! I was so nervous to be meeting some of my favorite people on this planet in a new city and with such a large crowd but the staff made it so easy! Our goal was clear and ready when me and my bestie (BookNerd1107) headed out on Thursday. Y’all I did NOT think I was going to be as excited as I was to be in my nation’s capital but boy… I saw the Pentagon and my mind couldn’t fathom seeing something like that. Now I’m a homebody (ah duh….I READ…A LOT) and having a travel bug is something I’ve wished for but never gotten (#anxietymuch) but having someone explain history and stories of battles that went on when you’re seeing a new city and historical buildings is incredibly humbling. But on to what you really came here for…the swag, the authors, and the Q&A with Kristen Ashley! Sponsored by the amazing Tijan, the yellow and grey bags we got not only sported our badge level (Apollyon crew where you at?!) but the donations from publishers was astonishing! With books, and special edition ARC, journals, buttons, bookmarks, and a cute purple beanie I was awed at how MUCH each bag held. Also hello stylish travel bag going forward. Wear that bookgeek merch with pride! Also included was the queen of Apollycon herself, Jennifer L Armentrout’s latest title The Prophecy with a signed poster for the main character and our model of honor, Mr. Drew Leighty (#swoon). Also does it make me geeky to love my badge/lanyard and button to an extreme extent? Cause I do! The cute button from LapelYeah is seriously one of my favorite swag items I got the whole time. Not only did we got the main swag bag, there was a sweet and simple one for the MOVIE PREMIERE (Which I can’t believe existed!) and from the 1001 Dark Nights Sparkler. Now to those that have never been to a 1001 Dark Nights Sparkler, I must warn you, it is MADNESS! With a handful of their authors waiting at tables, you are handed a card. The goal? Ask each author your question and record the answers. Fully correct cards result in the chance to win a gift card! Not even with the chance to win a gift card, this event was chaotically fun. The mad-dash, shouting of questions, and laughter at outlandish responses put our seemingly idols down to our level of ridiculousness. My questions: Wonder Woman or Catwoman? tough choice, I know, but there were…worse? ones out there. Some poor girl had to ask “hard or soft?”…bless her. My personal fave (and I’m kicking myself for not remembering who answered!) was that someone answered that they wanted Gal Gadot AS Catwoman…..MREOWER! Love it! Once again our model of honor, Drew, took the opportunity to reveal his horror fan-made movie of Never Hike Alone, a dedication to the Friday the 13th series, to a giggly and hilariously loud crowd of ROMANCE fans on Friday night. Now I, thankfully, am a horror fan and the movie was actually really good. With a small cast, simple plot, and well shot footage, the homage to Jason Voorhees was filled with the right level of jump scares and classic horror-humor (i.e. you’re an idiot…LEAVE THE BACKPACK KYLE!). With an interesting Q&A after the movie about his process and some fun facts about the movie I was surprised at how much I enjoyed this off-topic bonus content. SATURDAY SIGNING KRISTEN ASHLEY – The queen of romance in my heart! Ya’ll I originally met her during the 1001 Dark Nights Sparkler (and proceeded to hold back tears witnessing her beauty). Kristen is the living embodiment of loving life, glamorous living, and all around rock chick attitude! With a kick-ass wrap dress and killer cute black pumps, KA graced the floor with her smile and general happiness to be around her fans. I managed to get my Unfinished Hero, Deacon, and our lovely Ollie from the Honey Series signed. So glad my bestie steered me right to her when we walked in cause I was near the front of the line! Can’t wait for the Rock Chick Rendezvous in Cleveland later this year! Score! I got Ollie and Deacon signed <3 Plus a special ARC I won at the Brunch! A.L. JACKSON – If you could find the sweetest and most adorable author in the group, Amy would be my first choice! I’m not sure how someone so bright and bubbly can write such deep and heartfelt stories!! I managed to get a few backlist items from her catalog and I can’t wait to add more of her to my reading list. I may be a new fan to Jackson but trust me there is love there! Sad I didn’t get the title I did want but I’m excited to start some of Jackson’s backlist books! LAURA KAYE – My gosh..If I could pick one author who I really wanted to pick their brains, it would be Laura. She’s so engaging and makes it a point to let you know she’s listening to you and hears what you say. I love any author who takes the chance to write about characters with disabilities or difficulties that most authors may shy away from. While I didn’t get a chance to thank her for that in person, I KNOW she know show much her fans lover her. P.S. She did the cutest thing when I walked up offering all of her swag and asking if there where any new titles I needed or missing blacklist books I could buy. I don’t know why that stood out to me but it was like a little shop keeper was talking to me and it was so cute! Just need the first Raven novella and it’s complete! One of my TOP reads of 2018!!! CORINNE MICHAELS – So my dumb butt was so out of sorts that I forgot to ask Corinne for a photo (UGH!) but bonus is I finally got a copy of One Last Time, a 5 star read y’all! Corinne was the smartest author of the bunch as she had a cute table to stand at versus get up and down and she had some of the coolest swag and bookmarks that OF COURSE…AGAIN my dumb butt didn’t grab many of. But at least Corinne is sweet and charming and made it totally worth it! I now have a complete Hennignton collection signed! I also got an early copy of Cooper’s story…be on the lookout for THAT review! JAY CROWNOVER – YOU GUYS….I may or may not have been so excited to meet Jay Crownover…whom I love so much that I didn’t gran any swag from her either! Thankfully I DID get selfies with her because what else does one do when you meet Jay…you selfie your life away to the Queen of Bad Boys. Y’all if you think Jay is wacky and crazy and fun on social media, real life Jay is HYSTERICAL. I wish I could be friends with her in real life because I feel like at any moment she could make your day crazy wild fun! I’ll never understand someone who is so fun and lively in person can write such dark and deadly romance. But she says it best…bad boys ARE better. Plus I got Cable early so :p! My Bad Boy trio! They are always so much more fun. Hello baby Warner and Cable! HELENA HUNTING – FINALLY!!!!!!!! Helena is seriously such a badass writer, person, woman #alloftheabove!! The Pucked series upped the game (haha pun!) for me with romances once I found Alex and his teammates. Their outlandish, brazen, RIDICULOUS and sexy! If you haven’t grabbed everything this woman’s written then you need to! Side Note: Helena…you GAVE me a book….girl….I will cherish Area 51 (pfffftttt that sounds so bad!!!!! #sorrynotsorry) Choosing which of these to get signed was so hard….but DAMN they thicc! HH BONUS: I MET RANDY BALLS! Franggy….too cute. So sweet. And he wrote a kiss to me on the cover #SWOON (Sorry to my man…but he understands me and book-boyfriends are unshakeable) PENNY REID – The Overlord herself! Penny’s style of writing has always stood out to me. There’s not a HUGE focus on the sexy-times (but they are still there my friends). As someone who really enjoys those times I thought that may put me off but NOPE! Her characters are intriguing and her stories are filled with so much imagination. Also, she’s hilarious and quirky and just my type of person. Plus she wins signature of the day with her note to me in MOI. The BEST note all day! LIA RILEY – The last author I saw..I of course forgot to get a photo with as well! Lia writes some sweet sports romances that I found through one of my review sites and let me tell you that she won me over with her Hellions! I may be new to her as well but I can’t wait to read more!!! the haul from B&N Tyson’s Corner! #BookBeau You know I have to get anything with foxes on it! The Bookish Box! I won a pin from the wonderful Justine! Kristen Ashley Q&A Brunch The AMAZING swag bag from the Brunch featured this beautiful BookBeau and Court of Candles custom candle! After a wonderful brunch from the hotel (seriously it was DE-LISH!) Jen and Kristen shared their history of romance novel love and dedicated reading from a young age onward. Here as some highlights from Jen’s questions and questions from readers attending: Kristen’s toughest book to write was Golden Dynasty (part of her Fantasyland series) and she’s so proud of it. Not only the female strength of her character versus the hero’s world but creating a whole language in another world was another challenge for Kristen. Kristen’s writing process is that she’s an “obsessive pants-er”. She’ll go by the seat of her pants to tell her story and she doesn’t take notes to prep. “The book plays like a movie in my head and its very very hard to shut it down and start tomorrow.” Fun fact: Her cats help her step away from the story and remember to eat. She LOVES romance. She doesn’t like to watch a television show or read a book that doesn’t have a romantic element. Though she writes contemporary, sometimes danger just happens in her books. Another Audible exclusive book is coming! The theme will be fantasy! Chokers. Her heroines wear them for a reason and its a real life experience. Guys, like the Hot Bunch, just like ’em. She’s been marathoning Altered Carbon (It is SO FRICKIN GOOD TOO!) and Grace and Frankie. If you haven’t checked out her spread in Eloquii, the brand for curvy women, you should head over to their website and check out their spotlight. Reader Questions: I was lucky enough to win an ARC of THE GREATEST RISK <3 What was the inspiration to write Heaven & Hell? Pat Tillman. His story truly affected her. Have you ever been in a reading rut and what do you do to get out of it? knocks on wood She’s never been in one! How do you do your world building and language creation if you fly by the seat of your pants when you write? She takes notes as she’s writing to remember things and keep track. There’s a separate notebooks “bible” for her fantasy worlds from her contemporary works. Did you plan to tie in all of your books or did it just happen once and you get doing it? It’s because they are real to her. They carry on living in her head. You’re a very social author as far as events; have you ever had any interesting or weird reader occurrences? No. She wants everyone to be their own person and she says “Be You” and “Let it all hang out”. Your characters have a lot more dialogue versus description or plot explanation. Do they talk more to you than show you things? Get ready for there to be more of that. It’s just natural. Comment from Jen : Kristen has a distinctive voice. SO TRUE! What did you do in your research for the Honey Series? She had a boyfriend back in the day who was “adventurous”. She saw a whipping at a club like The Honey that transfixed her because it was so beautiful, unbelievably gentle, and intimate. She was fascinated that they had an audience but they completed disappeared for the master and his submissive. She’s just written an MMF and that was fun to research! Would you ever consider doing a crossover with anther author? I never say never anymore. Yeah I would; for sure. How did you pick the small town in Nebraska (for her book Complicated) because that’s where I’m from!? This is gonna seem very weird…I looked up Targets in Nebraska. And found a place close enough where Greta could get to a Target! Are any of your characters base don real life people? Yes. A lot. Tex from the Rock Chicks Series, she live din Ava’s row house, Jet’s mom is loosely based on her own mother, Bette and Uncle Marsh are her aunt and uncle, Tod and Stevie were he neighbors when she lived in Indy’s house in Denver. Stay updated for next year! Will I see you? ROUGH RIDE – A Kristen Ashley Excerpt Reveal From New York Times and USA Today bestselling author Kristen Ashley comes a new story in her Chaos series… About ROUGH RIDE: Rosalie Holloway put it all on the line for the Chaos Motorcycle Club. Informing to Chaos on their rival club—her man’s club, Bounty—Rosalie knows the stakes. And she pays them when her man, who she was hoping to scare straight, finds out she’s betrayed him and he delivers her to his brothers to mete out their form of justice. But really, Rosie has long been denying that, as she drifted away from her Bounty, she’s been falling in love with Everett “Snapper” Kavanagh, a Chaos brother. Snap is the biker-boy-next door with the snowy blue eyes, quiet confidence and sweet disposition who was supposed to keep her safe…and fell down on that job. For Snapper, it’s always been Rosalie, from the first time he saw her at the Chaos Compound. He’s just been waiting for a clear shot. But he didn’t want to get it after his Rosie was left bleeding, beat down and broken by Bounty on a cement warehouse floor. With Rosalie a casualty of an ongoing war, Snapper has to guide her to trust him, take a shot with him, build a them… And fold his woman firmly in the family that is Chaos. Every 1001 Dark Nights novella is a standalone story. For new readers, it’s an introduction to an author’s world. And for fans, it’s a bonus book in the author’s series. We hope you’ll enjoy each one as much as we do. Amazon US \| Amazon UK \| Amazon AU \| Amazon Canada Download the Free Kindle App My dad had been a biker. He was a nomad when it came to that kind of thing (or, really, any kind of thing). He accepted being tied down by his woman and his daughter only, not anything else. Not a job. Not a mortgage. Not a membership to a club. He hung with a lot of them, including Chaos (in fact, Hammer, sadly now deceased, but one of the founding members of Chaos, had been my father’s best friend). But he’d never hung with Bounty. “Don’t like the feel of them,” I’d heard him mutter years ago. “If you’re an outlaw, own the outlaw. If you’re not, own that. You can’t wanna be a Gypsy Joker. You either are or you aren’t. They wanna be. But they aren’t. That shit just ain’t right and it could get dangerous.” He’d been right. It got dangerous. I should have followed my dad. Mom and me had done it all our lives, job to job, house to house, city to city. Why I stopped… I knew why I’d stopped. I’d wanted Shy; Shy, who reminded me of Dad. And when I couldn’t have him, I’d gone looking. I’d wanted what my mom had. I’d wanted that sweetness. That love. That devotion. I’d wanted the stability that just seeped down deep into your bones from all that no matter the job changing, the scenery changing, the amount of times you boxed up a house. Stability had nothing to do with income and locale. Stability was all in the heart. https://s3.amazonaws.com/embed.animoto.com/play.html?w=swf/production/vp1&e=1516826597&f=V1bfizjzzV1n69U1Ig00tQ&d=0&m=p&r=360p+480p+720p&volume=100&start_res=720p&i=m&asset_domain=s3-p.animoto.com&animoto_domain=animoto.com&options= About Kristen Ashley: Kristen Ashley was born in Gary, Indiana, USA and nearly killed her mother and herself making it into the world, seeing as she had the umbilical cord wrapped around her neck (already attempting to accessorize and she hadn’t taken her first breath!). Her mother said they took Kristen away, put her Mom back in her room, her mother looked out the window, and Gary was on fire (Dr. King had been assassinated four days before). Kristen’s Mom remembered thinking it was the end of the world. Quite the dramatic beginning. Nothing’s changed. Kristen grew up in Brownsburg, Indiana and has lived in Denver, Colorado and the West Country of England. Thus, she’s blessed to have friends and family around the globe. Her family was (is) loopy (to say the least) but loopy is good when you want to write. They all lived together on a very small farm in a small farm town in the heartland. She grew up with Glenn Miller, The Everly Brothers, REO Speedwagon and Whitesnake (and the wardrobes that matched). Needless to say, growing up in a house full of music, clothes and love was a good way to grow up. And as she keeps growing, it keeps getting better. WEBSITE * FACEBOOK * TWITTER * NEWSLETTER * GOODREADS * PINTEREST * INSTAGRAM About Nalla Your newest romance book blog fav! All reviews are 100% real and honest from me to you. I’ll also share content from street teams, book reveals, and random updates from authors. Apollycon 2019 Washington, DCMarch 21, 2019 GONE TO APOLLYCON! SINFUL EMPIRE - A Meghan March New Release DIRTY LITTLE SECRET - A Kendall Ryan Review IMMORTALLY YOURS - A Lynsay Sands Review ON HIS KNEES / SWITCHING FOR HER - A Laura Kaye Double Cover Reveal MOST LIKELY TO SCORE - A Lauren Blakely Review, Excerpt Reveal & Giveaway Archives Select Month May 2019 April 2019 March 2019 February 2019 January 2019 December 2018 November 2018 October 2018 September 2018 August 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 December 2017 November 2017 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 November 2016 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016	cc/2021-04/en_middle_0039.json.gz/line1043
__label__wiki	0.891227	0.891227	Ryan: How did debris yellows get a green flag? Tracking trash over the past 16 years By Nate RyanJun 22, 2017, 4:30 PM EDT Debris or not debris? The question plaguing NASCAR after Tony Stewart’s accusation of heavy-handed officiating teetering on race orchestration is a tangled mess to navigate, breaching the lines of credibility, entertainment and safety. There is a clear line of demarcation indicating when the debris caution trend began, however. Research by NBCSports.com of every Monster Energy NASCAR Cup Series race report since 1990 (the first season in which caution reasons were listed for every race on Racing-Reference.info) shows the 2001 season is when yellow flags for unsafe track conditions became standard practice in race officiating. Since the 2001 Daytona 500, which marked the first race in a new era of national TV contracts and the most recent race in which a driver was killed in NASCAR’s premier series, NASCAR has averaged nearly 63 debris yellows per season, reaching a high of 85 in 2005. Compare that to the 11-season stretch from 1990-2000, which produced an average of 15 debris cautions per season with a high of 20 in 1994 and a low of 11 in 1999. That means there have been more than four times the number of debris cautions annually in 21st century NASCAR over the previous century’s final decade. There haven’t been fewer than 40 debris yellows in a season since 2001 when there were 27 in the 35 races after Dale Earnhardt became the fourth prominent NASCAR driver to die of a skull fracture in 10 months. That helped spur a raft of safety advancements that included SAFER barriers, mandatory HANS device usage and enhanced driver cocoons with carbon-fiber seats and energy-absorbing foam. But mostly overlooked is that NASCAR also took the liberty of being more aggressive in pausing races to clear the track of perceived hazards. Where once only debris as blatant as a brake rotor lying in the groove might have necessitated a caution, the standards have expanded to include water bottles, balloons and garbage bags – with officials adamantly defending their decisions by noting they always would err on the side of safety. It hasn’t quelled accusations from drivers – both publicly and privately – about the capriciousness of debris yellows and whether there’s an ulterior motive to keep the racing tight by re-racking the field for a double-file restart. The final yellow was thrown for debris in five of 13 season finales at Homestead-Miami Speedway (and two of the past three) since the advent of the playoffs. It's a shame that so many drivers and teams day was ruined by the results of another "debris" caution towards the end of the race today. — Tony Stewart (@TonyStewart) June 18, 2017 Stewart’s Twitter outburst Sunday isn’t the first time the three-time champion has assailed NASCAR for debris yellows – in a noted April 2007 rant, he compared the officiating with pro wrestling and said officials were “playing God” – but the timing is notably different. A decade ago, Stewart was angry after a Phoenix race with four debris cautions, which came on the heels of the only consecutive seasons with 80-plus yellows for debris. Yet in 2017, NASCAR is on pace for possibly its lowest debris caution total since before Earnhardt’s death. Through 15 races there have been 12 debris yellows – the lowest number to start a season in 14 years. Subtract Texas Motor Speedway (which holds the all-time track trash record of seven debris cautions in the November 2014 race and is the annual leader with an average of 2.5 over the past 29 races), and there have been eight debris yellows in 2017, which is on par with the average of 7.8 over the first 15 races in the 1990-2000 seasons. The 2016 season also marked a six-year low for debris yellows with 51. So is Stewart’s ire still justified in light of these declines? Yes, because debris cautions should be on the wane regardless. The debut of stage racing in ’17 has guaranteed at least two caution periods per race (and perhaps more next season) that ostensibly are to award points to the top 10 but also could be used to clear the track. Those yellows essentially produce the same outcome as a debris caution – a pause in the action (not because a car was damaged) followed by a restart. It’s reasonable for drivers and teams to expect NASCAR to be more inclined to let a race naturally unfold with two predetermined breaks that allow for track maintenance. With the addition of a 5-minute clock on repairing damage, it also is logical there should be fewer wounded cars littering the track with jagged sheet metal or busted parts. As noted by Steve Letarte and Parker Kligerman in a NASCAR America discussion Monday, it also is valid to ask whether NASCAR is using the most optimized technology to locate and classify debris on track. If transparency would help defuse the implication (by Stewart and others) that officials are tampering with a race’s rhythm to produce more scintillating action, NASCAR should consider releasing detailed explanations of the debris, possibly with visual evidence. But the easiest way to end the controversy over debris yellows simply is by reducing them – and living with consequences that might be negligible anyway. Managing risk makes sense, but it also is a tricky line to walk with auto racing’s inherent danger. How many times have drivers or fans been injured over the past 16 years by a piece of debris being hit – or in the 52 prior years when cautions to clean the track were much more infrequent? Applying consistent criteria is difficult because debris cautions always will remain a judgment call – but there is opportunity to use greater discretion in keeping the yellow flag holstered unless incontrovertible evidence exists of a lurking danger, particularly late in the race. Ultimately, it comes down to this: How do you strike the most judicious balance between upholding the sanctity of races while ensuring the safety of drivers? That is the question. After being critical of Kyle Larson’s inability to close out races on restarts earlier this season here, kudos to the Chip Ganassi Racing driver for pulling it off from the nonpreferrred line at Michigan International Speedway. The ineffectiveness of the bottom lane on the 2-mile oval Sunday did illustrate an unintended consequence of track treatment in the current era of VHT and tire-dragging machines to improve traction. It seems all of the work on the Michigan surface might have made the outside line too good Sunday. That bears remembering as tracks continue to be proactive with trying to facilitate passing. Nothing says peaceful like a relaxing weekend of wine tasting in the picturesque solace of Napa Valley – but in NASCAR, this is usually the time of the year when the chatter over contracts gets cranked up. Silly Season has hit a fever pitch before in Sonoma, where a more limited schedule of track activity, along with increased access and time for a bottle of Cab, seems conducive to setting tongues to wagging. In 2008, word began to leak that Mark Martin was headed to Hendrick Motorsports to replace Casey Mears. Five years ago, news began to spread on race day about Matt Kenseth’s impending departure from Roush Fenway Racing (which broke a few days later). There are no imminent signs of wildfire breaking this week, but there are enough possibilities (and beat reporters Jenna Fryer and Bob Pockrass floated a few more this week) to watch the kindling while the vino flows around the bonfires this weekend. Jeff Gordon (a record nine road-course victories) and Tony Stewart (seven) have retired. Marcos Ambrose (two-time winner at the Glen) and Carl Edwards (Sonoma 2014 winner) are gone. Who are the Cup road course experts now? AJ Allmendinger would rank high on the list, but it’s hard to look past Joey Logano, who has four straight top fives on road courses (including a 2015 win at Watkins Glen International), Kyle Busch (four road-course wins) and Denny Hamlin, who was a final-turn mistake away from sweeping the road courses in 2016. The right-turn narrative centered (with good reason) on Gordon and Stewart for so long, it seems odd to put that trio in the conversation for road-course greatness, but their results prove they deserve it. If you’re keeping track – and we can’t blame you for having lost count given the preponderance of binkies, diapers and strollers in the motorhome lot over the past decade – the birth of Trevor Bayne’s second child and the impending arrival of Logano’s first will push the number of kids born to active Cup drivers since 2007 to more than 30 by the end of the season. During the baby boom, 19 drivers have become fathers while racing in Cup. The first in that timeframe was Jeff Gordon, whose daughter, Ella, turned 10 this week.	cc/2021-04/en_middle_0039.json.gz/line1044
__label__cc	0.63302	0.36698	NFL Divisional Round Notes Vikings at 49ers (-7); total: 44 The 49ers opened as an eight-point favorite and it moved to 7.5 in less than two minutes. It went down to 6.5 before settling at 7. Last week there was worry about the health of Vikings RB Dalvin Cook and WR Adam Thielen, and they both looked good. I make this line 49ers -4.5, but worried about taking the Vikings because the 49ers have the clear rest advantage. San Francisco had a bye week and Minnesota is going from playing Sunday to the earliest game on Saturday. Titans at Ravens (-9.5); total: 47 I have no opinion on the side, which has gone between 9 and 10 all week. The under interests me because both teams strength is running the ball. There is familiarity between the two teams with Titans DC Dean Pees, who was on the Ravens staff under John Harbaugh from 2010-17. That is another reason I’m looking at the under, which opened at 49. Texans at Chiefs (-9.5); total: 51 Line opened Chiefs -7 and got bet up immediately. These two teams played in Week 6 at Arrowhead the Chiefs closed as a 3.5-point favorite and the total was 54.5. The Texans won the game 31-24, and the numbers that popped out from the box score was Houston’s time of possession edge (39:48-20:12) and total plays advantage (83-47). Patrick Mahomes was battling an ankle injury at the time. Kansas City was also without left tackle Eric Fisher, left guard Andrew Wylie, defensive tackle Chris Jones and several other starters. Since then the Chiefs have improved with Mahomes at full health and the defense has acclimated to the 4-3 scheme. So I understand the six-point adjustment and there isn’t much line value on the Texans, who struggled against the Bills last week. If the line got to +10, I would be tempted to take Deshaun Watson getting double digits. Right now I feel stronger about the under. I can see the Texans employing a similar game plan as the Week 6 game when they controlled the ball for almost two-thirds of the game. Seahawks at Packers (-4); Total: 47 Line went up from Packers -3 to -4. Both teams aren’t statistically as good as their record and I don’t want any part of betting on either team. The Packers weakness has been stopping the run, but Seahawks will have trouble exploiting that without Chris Carson or Rashaad Penny. Seattle running backs Travis Homer and Marshawn Lynch combined for 19 rushing yards on 17 carries against the Eagles last week. I feel like this game is all about Russell Wilson and if he can make enough plays with his arm and legs. So if I was forced to pick a side I would take Seattle and the points. ← Recent December Links NFL Draft Links →	cc/2021-04/en_middle_0039.json.gz/line1045
__label__wiki	0.807225	0.807225	Best of the Latest Xperia Mobile Phones From Sony Ericsson December 1, 2020 newsnationglobal 0 Comments Ericsson, Latest, Mobile, phones, Sony, Xperia Sony Ericsson Xperia Neo The latest Android technology offered by Sony Ericsson is presented in the form of Xperia Neo. The phone can display crystal clear images thanks to its mobile BRAVIA engine. The phone uses Sony’s award-winning Exmor R mobile sensor that has proven to be able to capture high quality videos and pictures using HD mode even in the low light setting. Afterward, you can view your picture and videos directly by plugging in the HDMI connector to your HD TV. Just like any product launched by Sony, it comes with a stylish glossy looking body consisting of both plastic and metal chassis. It has a 3.7 inches screen and weighs 126 g. And if you are a Vodafone customer, this smartphone also comes in red which is exclusive only to Vodafone. Launched on the 1st of April in Europe, the Xperia Arc has stunned the crowd with its 4.2 inch touch screen using a mobile BRAVIA engine to optimize pictures and video at 854 x 480 pixels. The phone also uses the latest Android 2.3 Gingerbread powered by 1GHz Qualcomm Snapdragon processor. Just like its sibling the Xperia Neo, Xperia Arc also features the Exmor R sensors giving it the capabilities to capture HD videos and pictures in low light areas. And to augment its video taking capabilities, Xperia Arc also uses a 8.1 mega pixel camera and it has a HDMI out. The the Arc, ones of its main selling points is the ultra-thin body, which curves inwards in the middle, which is quite unusual for a mobile phone! Along with both Xperia Arc and Xperia Neo, the Xperia Play is a smartphone running on Android 2.3 Gingerbread produced by Sony. It was codenamed Zeus and is the first smartphone that is PlayStation certified. Targeted at the hardcore gamer’s community, this smartphone is powerful enough to run PlayStation 1 style games thanks to its impressive 1 GHz Snapdragon processor. Additionally, it is the first phone that has true gaming console controls builds in; this means, you can play these games using the familiar gaming pad and not a touchscreen. The smartphone was revealed first in the US during Super Bowl ad on Sunday February 10 2011 and shipped globally in March 2011. Initially available to Vodafone, T-Mobile, and Orange networks in the UK, the Xperia Play currently has no less than 50 gaming titles, and Sony Ericsson are adding more each month. The design is similar to that of Sony Ericsson’s early Android handset, the Xperia X10, with a slider mechanism, that hides a PSP-like D pad and the iconic 4 PlayStation gaming buttons. The Son Ericsson Xperia Play also features similar graphics capability of that of similar portable devices with the capabilities to play these games using PlayStation Suite. PlayStation Suite changes the phone functionality to that of XrossMediaBar which resembles the PlayStation Portable. It is said that the titles will range under $10, which is significantly less compared to the $40 a title for PlayStation Portable. Titles available as of now include popular titles such as Sims 3, NFS Shift, Assassin Creed, Brothers in Arms, FIFA 2010, and many more. With these 3 mobile phones, Sony Ericsson are now a serious player in the Android smartphone market, and are challenging both Samsung and HTC. It will be exciting to see what road they take next! Source by Keith Horwood ← Dynamic Duo Diet – The Top 5 Recommendation of Dr Perricone About Colon Cleanse and Acai Berry Diet West Papua liberation movement announces provisional govt →	cc/2021-04/en_middle_0039.json.gz/line1048
__label__wiki	0.890743	0.890743	ICC increases participating teams for World Twenty20 Gulf-Middle East,United Arab Emirates,Sports, Mon, 16 Apr 2012 IANS Dubai, April 16 (IANS) The International Cricket Council (ICC) has decided to expand the 2014 World Twenty20 in Bangladesh from 12 teams to 16 to boost the associate members. The associate members were unhappy after the ICC refused to increase the number of teams for this year's World Twenty20 (T20I) in Sri Lanka despite their good performance in the 2011 World Cup. The ICC during its executive board meeting here Sunday received a report of the strategic discussions held at the Chief Executive's Committee (CEC) in March 2012 and confirmed that from 2014 onwards, the number of teams participating in the World Twenty20 will be increased from 12 to 16. The event should remain a joint men's and women's event. The board also said that three additional Twenty20 Internationals may be played in the year in which the ICC World Twenty20 is being staged provided there is a corresponding reduction in the maximum number of permitted ODIs. As per ICC Scheduling guidelines, the current regulations permit a maximum of 12 T20Is for each full member in any one year. 'The need to manage volume of cricket was considered when agreeing to allow the additional T20Is to be played in a year,' ICC chief executive Haroon Lorgat said in a statement Monday. The board also confirmed the hosting for the ICC World Twenty20 2014 qualifying tournament in the United Arab Emirates in October 2013 and the ICC Cricket World Cup 2015 qualifying event in New Zealand in 2014. The ICC has already commenced with planning for its new rights cycle post 2015 and a key prerequisite of this is to determine the ICC events that will be staged. Read More: World Bank \| New Zealand \| Bangladesh \| Cricket \| Distt.board \| Lanka Ndtso \| Timbdi Arab \| International Airport \| Mangali Arab \| Lanka \| Patamata Lanka \| Pedapatnam Lanka Bo \| Sakhinetipalli Lanka Bo \| World University Centre \| Salem Dt.board Buildings \| Council House Street \| Shahbad Distt.board Ara \| Lanka Kachhuara \| Duba \| Sunday Bazar S.o. \| Saharsa Dist.board	cc/2021-04/en_middle_0039.json.gz/line1049
__label__wiki	0.512222	0.512222	Singer Dave Stringer And The Unifying Power of Chant Shervin Boloorian POWER OF CHANT – I spent some time with well known Kirtan singer and musician, Dave Stringer after he performed at the Yoga Barn in Bali. Stringer brings together a unique blend of Kirtan and more modern music styles such as Gospel, Blues, and Rock. Text och foto: Shervin Boloorian \| Shervin’s blog Infusing his recitals with dynamic energizing chants, ecstatic melodies, and intensely charged grooves, the American born artist had his audience whooping, dancing, clapping and chanting. His exploration of the wild side of chant may make him a maverick to some, but he believes that he is staying true to Kirtan’s principal of finding the self through song. Dave Stringer’s cutting edge style aside, he finds the consciousness shifting power of sound, music, and Mantras to be key to Kirtan’s sudden explosion in popularity over the last ten years. Stringer has since eclipsed the yoga studio circuit in Santa Monica where he hit the scene by now performing in front of hundreds and thousands at Festivals in the US and Europe. He predicts Asia is next to experience the Kirtan wave. Vocal Therapy The most interesting aspect of Stringer was his personal history and how he came to discover the therapeutic power of song. As a youngster, Dave would sing ”gibberish” to himself—uttering a string of vocal sounds that often made no coherent sense– “it appeared and I just followed it,” he recalled. Dave describes this practice as a spiritual communication process from within, “it was the kind of nonsense that was meaningful to me.” He acknowledged there were possible shamanic elements to these non-linear vocalizations. And he came to consider them as ways to take negative emotions and to release and replace them with positive ones. Dave discovered Kirtan later on while traveling in India as a study that gave structure and definition to the inner processes that he had privately engaged in all along. In a sense, Kirtan validated the gibberish. “It gave my life a rich meaning—I could transform what was dark and difficult into something brighter and allow it to spread. So I went around the world singing.” Delinking from Mind While few people in his audience speak Hindi; according to Dave, the Mantras he borrows from ancient texts in his pieces carry within them a universal code. For this reason, he sees Kirtan as the basis for a “world cultural language.” The extra value coming from use of an ancient language like Sanskrit; Stringer says it “stops the mind from thinking.” “There’s something quite universal and tremendously positive about Kirtan that unites different people,” Stringer suggests. “It feels like you’re saying a beautiful nonsense, I find the nonsense useful,” he said. “When you come from a place of wonder, then you can slip into pure experience; pure consciousness.” Power of Chant – Music Unites Indian chant as a unifying global force may seem outlandish—why should Sanskrit succeed where everything else falls flat? But it seems reasonable to believe that we can access a far-reaching intrinsic quality from the power of the tones being sung regardless of the language used to sing them. This keeps with the ancient Kototama practice that establishes a relationship with the “nature” of the sounds that we verbalize rather than their linguistic significance. It’s not always what we say or what we sing that counts, but how it sounds. Resonance with sound has implications for people. When Stringer encourages us to feel beyond words and mental meanings, he’s asking us to block out the physical world for a moment and surrender to whatever else exists for each of us- and there is plenty there. I believe there is a deeper subtler part of the self that thrives when we are in this ecstatic state, one that benefits from shutting off a part of the brain. In Dave Stringer’s own words: “The body in this state creates calm and excitement at the same time. You get a sense of being in the body and the body being in the world.” What could be more peaceful or unifying? Text: Shervin Boloorian on the power of chant Dave Stringer Kototama Power of Chant Föregående artikelFallet Andrew Wakefield – ett av världens bästa exempel på ryktesdestruktion? Nästa artikelOsher Centrums donationsavtal – Har avtalsbrott skett? http://shamanicliving.blogspot.com Shervin Boloorian worked in the Washington DC policy world, where he tracked and reported on actions in Congress and the White House. Boloorian was a US-Iran peace movement policy advisor and coalition strategist before joining the Union of Concerned Scientists to work on disarmament and pro-environment campaigns. Shervin Boloorian is also a graduate of the Tama-Do (Way of the Soul) Academy and is the Communications Manager for the BaliSpirit Group. He manages a blog on modern day shamanism.	cc/2021-04/en_middle_0039.json.gz/line1050
__label__cc	0.569011	0.430989	Articles tagged with 'corporate' \| Mediahuis Newsroom TMG (corporate) RSS feed - Mediahuis (opens in new window) All years201820172016201520142013201220112010200920082007200620052004200320022001200019991998 On 15 December 2017, the transfer to Mediahuis of Talpa’s 29.16% holding in TMG was completed. Mediahuis also acquired TMG share certificates on the stock exchange and in direct transactions, as a result of which Mediahuis and its 100% ... Mediahuis NV (‘Mediahuis’), Talpa Beheer B.V. and Talpa Holding N.V. (‘Talpa’) and Telegraaf Media Groep N.V. (‘TMG’) have reached agreement on December 1, 2017 concerning two (intended) transactions: (i) the sale of Talpa’s 29.16%... June 2017 saw a new phase for Telegraaf Media Groep (TMG). The appointment of CEO Marc Vangeel and CFO Koos Boot will strengthen the plans of TMG and Mediahuis to build a media company with a solid market position and strong brands. During the presen... During the Extraordinary General Meeting of Shareholders (EGM) of Telegraaf Media Groep N.V. (TMG) held today, the proposal to sell the shares in the Keesing Media Group (Keesing) to Ergon Capital Partners III N.V. (Ergon) and the retention of an ind... Telegraaf Media Groep N.V. (“TMG”) has taken note of the press release published by Talpa Holding N.V. (“Talpa”) yesterday evening. Talpa has announced it will not declare the offer on TMG unconditional (“gestand doen”) and will discontinue its attem... The results of Telegraaf Media Groep ('TMG') for the first half of 2017 were significantly lower than those for the first half of 2016. This development was already visible when the results for the first four months of 2017 were reported on 26 May. E... halfjaarcijfers TMG enters into partnership with Ergon for Keesing Media Group Telegraaf Media Groep (“TMG”) announces that after a careful and very vigorous process, the shares in Keesing Media Group (“Keesing”) will be sold to a partnership which will be set up with Ergon Capital Partners III (“Ergon”). The valuation of 1... Mediahuis announces results of Post Closing Acceptance Period of the Offer for TMG Please view press release here. ... TMG initiates sale process for Keesing Telegraaf Media Groep (“TMG”) confirms that the Executive Board and the Supervisory Board have decided to initiate the process to sell Keesing Media Groep (“Keesing”). The last couple of years, Keesing ha... Keesing Formal position TMG on Talpa offer Please view press release here.... Mediahuis and VP Exploitatie confirm finalisation TMG take-over TMG takes note of Talpa’s unsolicited and unrealistic offer Request to Enterprise Chamber for an investigation into TMG policies withdrawn TMG has taken note of the decision of the retail investor association Vereniging van Effecten Bezitters (VEB) and Cantor Holding to withdraw the request to the Enterpise Chamber for an investigation into the policymaking and the course of events at T... General meeting of shareholders Telegraaf Media Groep N.V. adopts all agenda items During the General meeting of shareholders of Telegraaf Media Groep N.V. (“TMG”) held today, all resolutions on the agenda have been adopted. The public offer by Mediahuis and VP Exploitatie, which is supported and recommended by TMG, was discussed a... TMG update first four months of 2017 During the General Meeting of Shareholders (EGM) to be held on 1 June 2017, Telegraaf Media Groep N.V. (“TMG”) will provide a further clarification regarding the public offer made by Mediahuis N.V. and VP Exploitatie N.V. (together “the Consortium”).... Mediahuis and VP Exploitatie receive approval from Autoriteit Consument & Markt (ACM) for TMG acquisition Launch of recommended public cash offer by Mediahuis and VP Exploitatie for all shares of TMG Please view press release and more information about the offer memorandum here.... Central Works Council TMG supports recommended public offer by Mediahuis and VP Exploitatie The Central Works Council of TMG has provided an advice in which the Central Works Council follows the intention to recommend the offer by Mediahuis and VP Exploitatie. Thus fulfilling one of the conditions of the offer. In addition, the Central Work... Telegraaf VNDG online video platform to be launched 1 May On 1 May, De Telegraaf will be introducing Telegraaf VNDG. A completely new video platform will be launched with the introduction of Telegraaf VNDG, with content relating to news, sports and entertainment that can be viewed by the consumer where, whe... Telegraaf Telegraaf VNDG TMG publishes annual report Telegraaf Media Groep N.V. (TMG) announces that Deloitte Accountants B.V. has provided an unqualified opinion with regard to the annual figures published on 8 March. These unchanged annual figures are included in the annual report that today has been... Proposed sale TMG door-to-door magazines to BDUmedia On 29 July 2016 Telegraaf Media Groep (TMG) announced several organisational changes designed to continue the course of the 24/7 strategy and to bring about structural cost reductions. One of the elements of this announcement was the reconsideration ... The Enterprise Chamber dismisses request for immediate measures Today the Enterprise Chamber of the Amsterdam Court has dismissed the request from Talpa Holding N.V. (Talpa) and other parties regarding the appointment of one or several independent members of the Supervisory Board with special powers at Telegraaf ... General Manager Telegraaf Landelijke Media Harry de Wit leaves Telegraaf Media Groep Harry de Wit has decided to resign as General Manager Telegraaf Landelijke Media. Since 2002 Harry de Wit has held several management positions within TMG and he has made a significant contribution to the development of the company. As part of the... TMG appoints Hans Bakker as interim General Manager The Supervisory Board of Telegraaf Media Groep N.V. (TMG) has appointed Hans Bakker as interim General Manager of TMG with immediate effect. In this position mr. Bakker will be responsible for the daily management of the company. The primary respo... Telegraaf Media Groep confirms appeal Talpa at Enterprise Chamber. TMG is confident about the outcome Telegraaf Media Groep N.V. (TMG) confirms the receipt today of the appeal from Talpa Holding N.V. (Talpa) at the Enterprise Chamber requesting an investigation into the course of events at TMG and appoint an independent member of the Supervisory Boar... TMG realises small profit despite decreasing revenues over 2016 Statement Telegraaf Media Groep The events of the past few days have created an unusual situation for TMG. Given that situation, we have decided to publish the audited financial statements and the annual report within several weeks. In view of this,... TMG confirms intention COR to appeal at Enterprise Chamber. TMG to continue careful dialogue Telegraaf Media Groep (TMG) confirms the intention of the Central Works Council of TMG (COR) to appeal to the Enterprise Chamber in relation to the consultation procs held to date with the COR. The Supervisory Board has been in a constructive and ... TMG confirms receipt increased proposal Talpa and reconfirms support for offer Mediahuis and VP Exploitatie Telegraaf Media Groep (“TMG”) has taken note of the press release issued yesterday by Talpa Holding N.V. (“Talpa”) announcing an increase of the indicative offer to EUR 6.50 per share and the press release issued this morning by Mediahuis and VP Expl... Press release: TMG, Mediahuis and VP Exploitatie agree on recommended cash offer for all shares of TMG Please view press release.... TMG confirms receipt of increased conditional proposal from Mediahuis/VP Exploitatie to Eur 5.90 In reference to the press release of 19 February 2016 from Mediahuis and VP Exploitatie (Mediahuis/VPE), Telegraaf Media Groep N.V. (TMG) announces that, as part of the non-binding, conditional offer from Mediahuis/VPE, it has received in increase of... Image library & Publications	cc/2021-04/en_middle_0039.json.gz/line1055
__label__cc	0.635127	0.364873	Peter G. Burbules Colonel Peter G. Burbules was commissioned an Infantry Officer upon graduation from Officer Candidate School 5 May 1954, Class Number 6. His first duty assignment was as Post Ammunition Officer, Post Ordnance Officer, Fort Huachuca, Arizona. \| His subsequent duty assignments include: Ammunition Staff Officer, 59th Ordnance Group, Korea; Nuclear Weapon Instructor, Defense Atomic Support Agency, Jamdia Base, New Mexico; Ammunition Advisor, USA Element, Joint U.S. Military Mission, Ankara, Turkey; Project Officer, Project Manager’s Office, General Purpose Vehicles, Warren, Michigan; Materiel Officer, 191st Ordnance Battalion (Ammo), Cam Rhan Bay, Vietnam; Commanding Officer, Corn Husker Army Ammunition Plant, Grand Island, Nebraska; Commanding Officer, 172d Support Battalion, 172d Light Infantry Brigade, Fort Richardson, Alaska; Weapons System Analyst, Office of the Chief of Staff, Army, Washington, D.C.; Executive Officer and Executive Secretary, Army Systems Acquisition, Systems Review and Analysis Office, OD.CSRDA; Chairman, Joint Force Task Group, Headquarters, U.S. Army Materiel Development and Readiness Command, Washington, D.C.; Commanding Officer, Tooele Army Depot, Tooele, Utah. \| Colonel Burbules has completed Ordnance Career Course; Armed Forces Staff College, U.S. Naval War College. \| His awards and decorations include: Legion of Merit w/ Oak Leaf Cluster, Meritorious Service Medal, Joint Service Commendation Medal, Army Commendation Medal w/ Oak Leaf Cluster. Legion of Merit Previous StoryJohn P. Brown Next StoryRobert L. Burdick	cc/2021-04/en_middle_0039.json.gz/line1059
__label__wiki	0.563687	0.563687	Danner Corvallis 5" Brown Size 7 7.5 8 8.5 9 9.5 10 10.5 11 11.5 12 13 7 / D - $169.99 USD 7 / EE - $169.99 USD 7.5 / D - $169.99 USD 7.5 / EE - $169.99 USD 8 / D - $169.99 USD 8 / EE - $169.99 USD 8.5 / D - $169.99 USD 8.5 / EE - $169.99 USD 9 / D - $169.99 USD 9 / EE - $169.99 USD 9.5 / D - $169.99 USD 9.5 / EE - $169.99 USD 10 / D - $169.99 USD 10 / EE - $169.99 USD 10.5 / D - $169.99 USD 10.5 / EE - $169.99 USD 11 / D - $169.99 USD 11 / EE - $169.99 USD 11.5 / D - $169.99 USD 11.5 / EE - $169.99 USD 12 / D - $169.99 USD 12 / EE - $169.99 USD 13 / D - $169.99 USD 13 / EE - $169.99 USD The Corvallis offers a rare blend of comfort and ruggedness. Designed specifically for workers who spend long hours on their feet, it provides features typically found on much heavier boots (triple-stitched seams and an available non-metallic safety toe, for example). By incorporating advanced materials and weight-saving design, we made the Corvallis feel more like an athletic shoe than work boot. BOOT DETAILS: 100% waterproof and breathable GORE-TEX® liner is engineered to keep your feet dry and comfortable - even in extreme conditions Danner's rich, full-grain leather gives comfort and superior durability TERRA FORCE X platform provides lightweight, durable traction, heel-to-toe energy transfer, side support to enhance maneuverability, and protection from arch overwork and fatigue Abrasion-resistant toe and heel for protection in high wear areas Fastened with wider speed laces for a secure, tight fit Low profile 90º heel, unique lug pattern, oil and slip resistance provide superior traction from Danner Landscaper outsole TPU shank Lightweight at 53 oz Meets or exceeds ASTM F2892-11 EH. Electrical hazard (EH) footwear is manufactured with non-conductive electrical shock resistant soles and heels © 2021, Northern Surplus. Powered by Shopify	cc/2021-04/en_middle_0039.json.gz/line1070
__label__cc	0.685155	0.314845	Notes From Dreams Code ♥ Football ♥ Travel ♥ Annapurna Base Camp Nusa Islands (Bali) – 3 Days Itinerary Backpacking Peru and Bolivia in 2 Weeks : Day-wise Itinerary Posted on March 21, 2016 November 21, 2018 by Nachikethas Forts, Deserts, Camels and 6 Trains : A tale of Rajasthan Trip – Part 2 Journey continues…. The Great Indian Desert : Thar – Day 3 I jumped out from the seat seeing the station’s name as I opened my eyes around 9 in the morning. It was Pokhran, a really small town in Rajasthan which never would have become famous but for the successful nuclear tests by India. That incident which is glorified in modern India’s history happened on a Buddha Pournima night. Smiling Buddha was the code name for that invention that could kill millions of people in a second…what an irony!!! From that day onwards Pokhran has become synonymous with the nuclear bomb for many of us. Train number 4… At Pokaran station Around 11.30, the train halted at Jaisalmer where the great Indian railway ends. Our plan was to go to Khuri (a small village 50km far from Jaisalmer town) to do the night camping in the Thar Desert. We ignored the autowallahs and walked half a kilometer to a very small bus stand to catch the bus to Khuri. Even before I left from Bangalore, I had informed Badal Singh(+91 8107339097), the man who runs the Badal Guest House, where we planned to stay, that we were coming. The crowded bus left at 1.30pm for its one and a half hour journey to Khuri through the driest lands of India where wind mills lined the road on both sides. Usually I always had some unforgettable moments in my previous trips and the pattern was about to repeat in a few minutes. The crowd was getting thin as we reached near Khuri. A guy sitting in front came near us, recognizing us as tourists and asked where we were planning to stay in Khuri. I said about Badal guest house wondering why he wanted to know. As we got down in the desert village Khuri, he along with his friend came and said they could guide us to Badal’s house claiming to be a relative of Badal Singh. Wooo.. slow down dude….. I never asked for any help from you, I wanted to say. But I decided it was better to call Badal Singh himself than talk to this guy in my broken Hindi. One ring, two rings, three rings……. it went on, but Badal didn’t pick up the phone…. What timing!! A few guys sitting in the bus stand were staring at us as we struggled to find a solution. Then the first guy rang up someone and handed over the phone to me saying that his son was on the line. Why in the world should I believe you?? I thought… especially now that Aishu was with me. It was really getting uncomfortable for me. Without knowing whom to trust, we stood for some time at the bus stop of some unknown village out in the desert. “Ningal Keralavilninnnu vareengala?” (Are you guys from Kerala?) I heard somebody asking in broken Tamil from behind. You are an angel sir!! “Yes we are and we want to go to Badal Singh’s house.” I shouted. “Go along with him, he is telling the truth, don’t be afraid.” “Inge irikkaravar vanthu citiyilum Keralavilum irikkira alukal mathiri porikkalaa thambi” (People here in Khuri are not evil as the guys from metro cities or Kerala). I was laughing my a off hearing that. Weird indeed that insulting words about Keralites were the most relieving words that I ever heard!!! I had my reasons to nearly panic, but that whole episode was embarrassing, I thought, as we walked to Badal’s house. I looked at Aishu once we reached his small guest house, she was laughing at me.. The stay in the guest house cost Rs 300 per person but we opted for the night camping costing Rs 600 for one person. Don’t expect much luxury in Badal house but the hospitality by those kind people was very warm and one would love to stay there for a few days for sure. His son said that there were a few other tourists who had gone out earlier to the desert and that they would join us at the camp. Our camel Siva and his driver (forgot his name) were waiting for us already outside. I was somehow lucky not to fall down as Siva stood up. As we rode through the Khuri village, one guy was watching us….. it was none other than the villain turned hero from the earlier episode. He was smiling at us and I said sorry to him for misunderstanding him. Sun saying good bye to the Thar dessert for the day. Finally the moment which I was anticipating from the day I left my office in Bangalore, arrived. The great sand dunes of Rajasthan’s Thar Desert were visible when we left the village. Back in the school days , geography classes were never complete without a mention about this great Indian desert. So glad it I could enjoy it finally. Our driver cut Siva loose when he helped us to take our picture. We were like a broken kite in the sky without any hold, which could go anywhere but Siva was an obedient servant. Striking the camel safari off from my bucket list.. Aishwarya and Me at the desert. After a thoroughly enjoyable camel ride of 2 kilometers through the desert, which was a first time experience for both of us, we finally made it to our camp for the day. The other tourists were already there and the camel drivers were in a hurry to prepare dinner. In the golden light of dusk Thar seemed more beautiful. As the cold gripped the desert, touching the sand with bare foot seemed hard. Soon darkness spread everywhere after sun said good bye for the day. We all sat around the fire where they were making food, to get relief from the chill. Our companions included a Korean guy, an Italian couple and 4 riders from Mysore. We all had drinks which we had bought earlier, while the drivers sipped their home brewed liquor from sugar cane…. but still they had room for more! Poor Korean guy had to give half of his drink to them. In to the desert….. Soon they served roti and rice for dinner. Last time when I had candle light dinner, I was in Kaza 4000 meters up in the Himalayas and now I’m out in the desert. Once the food finished they were busy arranging the beds for us with thick mattress and blankets to withstand the cold night under the sky which was invaded by thousands of stars by that time. I think most of the desert camps have tents to sleep at night but not here. Here it was just the sand, the sound of camel and the starry sky above you. Wondered how many of these shining stars do exist right now…… I was boasting to Aishu how I saw Milky Way from Gangotri on my previous trip, hoping I will be lucky to witness it again. But Nature wasn’t kind enough this time. Anyway I showed her a moving satellite….. after all those night sky exploration in the Himalayas I had become an expert in that.. Under the starry sky we laid down on that memorable night…. Our mother Earth is a tiny bit of place in the vast sea of universe, yet humans came a long way to unlock the mysteries of nature, I thought, as I lay down on my bed gazing at the sea of stars right above my eyes. As I write this blog, Einstein’s gravitational waves theory has been proven after a century later he published it. Science is not something which puts forward a theory with some absurd justification; rather, it tries to prove with consistent experiments. Many times it dismisses its own theories admitting they were wrong. This is where it differs from religion. Enough of this, brain… let me enjoy this beautiful night. But the luxury didn’t last long as sleep took us to its realm shortly. Golden City – Day 3 Woke up hearing the alarm at 6.30 in the morning, which was set for space exploration. But who does space exploration in the morning? You must be wondering….. Let me tell you. It was a special time for astronomers as five planets (Mercury, Venus, Saturn, Mars and Jupiter) were visible at the same time in a line just before sunrise, a feast for the space explorers as it was occurring after more than a decade. I looked towards the east using the Sky Map app in my mobile. It said Venus the brightest of all of them is the one near the horizon followed by Mercury. But they all looked like normal stars or may be my sleepy eyes couldn’t differentiate them, so I didn’t wake Aishu up as she was in deep sleep even though she had expressed her desire to see the sight, before she went to sleep yesterday. There comes the first rays of the day to kiss the desert. Just before the first rays of the sun touched Thar we all walked up. I don’t think I have ever seen sunset and sunrise from the same place before. After the delicious cup of black tea we were in a hurry to get ready for the return trip to Badal house. Siva wasn’t shy like yesterday and he started running along with the other camels on the way back. But mind you, sitting on the camel’s back is really a pain in the a* literally. Back in, Badal’s house we mingled with the Korean guy who had the same plan like us to roam around Jaisalmer for the day and leave for Jodhpur at night. When I asked his name he replied “Naam”. “Oh you know Hindi?! That’s great. Yah your naam (Name). What is it?” “No my name is Nam.” Oh cool.. I laughed inside. And that’s how we became friends with Mr. Nam Yunchul, the solo traveler from Korea, who had come here for a vacation after his graduation. Nam asked me whether I could book train tickets for him also but later changed his mind as he wanted to experience different transport modes in India. Your wish , I thought………… The Eagle has landed! We were in a hurry to finish the morning chores to catch the 11 o clock bus to Jaisalmer. Since we were leaving for Jodhpur at night, taking a room in Jaisalmer seemed an unnecessary luxury so I asked Badalji if he could arrange some place where we could keep our luggage. Collecting a hotel number we said good bye to Badalj and thanked him for a memorable night in our life and walked to the bus stand with Nam. The growing crowd inside the bus as it traveled further, created second thoughts in Nam’s mind about taking a bus to Jodhpur. To top it all, a small kid sitting near him vomited all across his pants. That was such a terrible way of experiencing the incredible Indian bus journey.. “In Korea I would have yelled at his parents, but here in India I say Namaste, Dhanyavad, Shukirya,” joked Nam! But after that, to take a decision to stick with the Indian Railways was very easy for him. Taking an auto we went to hotel Prithvi Palace which Badalji had suggested. I thought it would be some regular hotel but it turned out to be a paradise for the travelers especially for the Koreans. The roof top has a very good restaurant and open space for relaxing. Nam joined us for a delicious lunch after washing his pants… The Three Musketeers! Nam, Aishwarya and me As the sun cooled down a bit, we started from the hotel through the busy narrow streets to reach the Golden Fort – the prime tourist spot in Jaisalmer. This breath taking fort, one of the largest fortifications in the world, will surely change your perception about forts in general. Built in the beginning of the 12th century by the Rajput ruler Rawal Jaisal, I think this would be the only fort in India where people actually live inside it and also there is no shortage of restaurants which offer you almost all the cuisines in the world. After washing, people put their cloths on the walls which protect this gigantic fort with its snake like structure. That is a millennium old monument out there, show some respect people…. I was yelling inside. The golden walls of this gigantic fort have many stories to tell about the countless number of battles fought here over the years to snatch power from the ever changing rulers. Inside the Golden Fort Once you enter the fort you realize that you are in a giant maze where the objective is to find out the tourist spots from the countless number of restaurants and souvenir shops. Our first stop inside the fort was the five century old Jain temple having the best carved out structure in stone I have ever seen….., pity we couldn’t go inside. I recalled a note I had read somewhere about an incident that happened inside the fort long back in history. When the king realized his army couldn’t hold much longer against the enemies, he ordered all the women inside the fort to practise Sati -an ancient Hindu funeral custom where the woman immolated herself after her husband’s death. The enemies successfully defeated the King of Jaisalmer by killing all the men only to find out the dead corpses of their women, once their army entered inside. The sounds of their cries were echoing in my mind as I wondered where exactly it might have happened. Mayday… mayday… Doves flying inside the Golden fort The rulers might have changed periodically but they didn’t disturb the uniformity of the fort as I could make out from the buildings inside it. With the help of some locals residing inside the fort and a few sign boards, we managed to reach near a Palace. The Golden fort has many inter connecting palaces inside it but this one is the most famous among them. . Some of the interior works inside the palace are so finely carved that it often looks more like sandalwood than sandstone. The one thing that I noticed as we entered the palace was the atrocious ticket fare that the foreigners had to pay unlike Indians. It’s not that you are super rich, if you are fair skinned!!! The sunrise view point was where we headed next after the palace. The giant cannon placed there with a shooting range of 5 kms, protected the gates of the fort. Jaisalmer town and the fort shone in yellow colour as if somebody had dropped a paint bucket from the top, giving it the apt name Golden city. I know it’s a desert city but you can really see the desert out there just outside where the buildings end.Having spent some time there we went back to the hotel through the same route.Nam purchased a leather bag for himself and had lassi which he wanted to have ever since he arrived in India. The cough which I had from the time we left Khuri was getting worse as we reached back at the hotel. Like a sandcastle made by a child Golden Fort of Jaisalmer shined at the night The alluring view from our hotel roof top, of the Golden Fort at night with its lights on, made me think it was some kind of a sandcastle or a fort made of Lego pieces. Once the sun set the golden colour of the bricks turned into honey gold colour like a man-made camouflage effect. Being closer to the Pakistan border, Jaisalmer holds a strategic relation with the Indian army. Like the birds coming back to the nest at dusk, the fighter jets were landing in the nearby air force camp one by one after their regular exercises. “Check whether any security issues happened in Rajasthan”, joked Aishu! Once again Prithvi Palace served us some delicious food for dinner. We had different varieties of Korean and traditional Rajasthani cuisines and shared it. After a short nap we got ready and went to the station with Nam to catch the midnight train. Ranikhet Express (15013) was waiting there to take us to Jodhpur. Those hotel guys didn’t charge a single penny for hosting us, by the way. Blue City -Day 5 After 6 hours of journey we reached Jodhpur. Our return journey from Rajasthan was from Bagath Ki Kothi, the adjacent railway station, early in the morning .Knowing it would be better to take a room in Bagath ki Kothi than Jodhpur, we got down there. Nam’s plan was to spend a day in Jodhpur and move to Agra the following day. But only at the very last moment we realized that his train to Agra was on the same day and that too around 9 o’ clock in the morning. Earnestly wishing to have a glimpse of the blue city, he came with us in the same auto which we had taken to go to a hotel and I told the driver to take him near the Mehrangarh fort to see the famous blue houses of Jodhpur from the top. Thus we bade farewell to Nam. Even though we had hardly spent a day together, we became really good friends. This kind of friendship which happens during a journey is what makes it special. (Later he mailed to me that he visited Agra, Varanasi, and Kolkata before flying to Philippines) The most luxurious hotel – Umaid Bhawan Palace After freshening, up we went outside to explore Jodhpur. I was having slight fever and a very bad cough but with the help of medicines I was able to suppress it for some time. Aishu was also feeling a little sick but her condition was far better than mine. This was of a hill the first time I was having any illness like this during my journeys. See what the desert had done to me! Taking an auto we reached the famous Umaid Bhawan Palace. Built on top, certainly this palace is the most beautiful thing I had ever seen on this trip so far. It was the last Palace built in India for Maharaja Umaid Singh in pure western style similar to Rastrapathi Bhavan in New Delhi, by the famous architect of that time Mr. Henry Vaughan Lanchester.With due credit to the magnificence of the palace, the fact that it was built during the period (1928 -1943) when the people here in India were struggling and fighting for independence is quite sickening… The polo loving Maharaja had constructed a number of polo courses across the town and his car collection included a number of vintage cars used by the royal family at that time. Only a small portion of the palace is open to public. The royal family lived in one section and the major part is a world renowned hotel which just got the award for the ‘World’s best luxury hotel’. Rightly deserving so….. even looking from outside we could sense its luxury! Mehrangarh Fort We said good bye to the palace and left for the Mehrangarh fort. Situated on top of a rocky hill, this five century old fort had been the headquarters of the Rathore clan of Rajaputs. As for the Golden fort, you don’t need tickets to enter the fort, only for the museum one had to take tickets. You might have seen this fort in the Hollywood movie ‘Dark Knight Rises’ where Bruce Wayne comes out of a jail. The large pavements inside the fort were occupied by some folk street singers one of whom sang ‘Why this kolaveri di”! The museum inside the fort displayed textiles, paintings, coins etc from the time of the great Mughal Emperor Akbar. The mural paintings of Durga along with other goddesses in the other room were a feast for the eyes too. Rajasthan has a diverse collection of musician clans. The temple located at the far end point of the fort where the Kings often used to go for praying, was the last pit stop, where we headed next. The last item in our bucket list was the view of the famous blue houses from the top of the Jodhpur town. Earlier Brahmins used to paint their houses in blue colour but soon everyone imitated it giving the whole city the eye pleasing blue colour. It was indeed a memorable view. A few people were meditating in that serene calm atmosphere; the wind coming from below was caressing our hair. We sat there for some time and then said adieu to the fort and took a path going down to the city between all those blue houses. Doves and fort – Better love story than Twilight… Sorry for this cliche joke! After a very late lunch on the way, we walked through the streets and reached a market. We had left all our shopping till the very last and now the moment arrived finally. But the market wasn’t very large and didn’t have much choice. So we left there through the other end back to the streets again. Aishu bought a few pairs of the famous Rajasthani handmade footwear while I was searching for bags. Somehow we managed to find some good stores after a long walk through the city, but had no clue where we ended up finally…. Honestly I was so tired by the end after the long walk but when I looked at my companion, I could see there was still plenty of energy left in her, so I just pretended that I was fine. Yes, now we had seen everything, bought everything……. It was time to go back to the hotel, but what was the name of our hotel or at least where was its location?!!! Jeeezz… We had no idea…. In all the excitement to see the Blue city in the morning, we never bothered to catch the name or the location of our hotel! Luckily we had the number of the autowallah whom we had hired in the morning. It was noted down so that we could call him the next day early morning to go to the railway station. With his help, we finally located the hotel and went back! The Jodhpur market Now, it was time for us to say good bye to the land of deserts. Early morning the next day, we called the same autowallah and went to Baghat Ki Kothi station to catch our last train, the 6th one (16507/Bhagat Ki Kothi – KSR Bengaluru Express) to go back to our places. When I boarded from Bangalore I never thought I would enjoy this trip like this, we had such a great time here in Rajasthan. The loving people here had blown away all my doubts regarding security to a pit. Never for a second did I feel uncomfortable during our whole journey, Aishu said. But what that Tamil speaking guy said at Khuri was echoing in my mind as I lay down in my seat. This country is safer especially for women when you are far away from the so called civilized cities and move closer to the villages…His words inspired me to write a short note about the women travelers. Aishu got down at Kalyan where it reached around midnight after 20 hrs of journey. Geeta aunty and Aditya (Aishu’s brother) were already there at the platform to pick her up. Having said good bye to them I continued my journey which lasted a day more to reach back in Bangalore. Thank you Rajasthan for all the memorable moments…. Around 4 am in the morning I touched down at the garden city and by 8.15 I was in front of my computer at the office after 10 days of continuous travelling! Yah… I could be a badass at times! Aishu fell sick once she reached back but my illness flew away the moment I touched Bangalore. Hey Aishu, I beat you this time!!! I was wondering where Nam was right now as I began coding…. The Forts, Deserts, Camels, Sand and those 6 train journeys will stay in my heart forever…. PS: I never discriminate people based on gender but if you girls could get ready a little bit faster that will be hugely appreciated. LOL… This entry was posted in:India, Rajasthan, Travel Tagged with:Desert, Forts, India, Jaisalmer, Jodhpur, Khuri, Palace, Rajasthan, Trains, Travel Written by Nachikethas A Software Engineer by profession, loves to travel (especially to the Himalayas!) and watch football (Chelsea) a lot. View all posts by Nachikethas Previous PostForts, Deserts, Camels and 6 Trains : A tale of Rajasthan Trip – Part 1 Next PostDhal Bhat Power 24/7! Annapurna Base Camp /ABC Trekking Part-1 Pingback: Forts, Deserts, Camels, Sand and 6 Trains : A tale of Rajasthan Trip – Part 1 \| Notes From Dreams Lovely pictures. I admire your skilled planning to accommodate more places in tight skill. View nachikethasmj’s profile on Twitter View nachikethas’s profile on Instagram Backpacking Tunisia In A Week 2 Days Edinburgh Itinerary – A Perfect Weekend Orchha and Khajuraho Travel Guide Everest Base Camp / EBC Trekking Itinerary Souls in the Valley – Everest Base Camp / EBC Trekking : Part – 2 Sikkim – The Land of Mystique Annapurna Base Camp / ABC & Poon Hill Trekking – Itinerary Archives Select Month June 2020 February 2020 September 2019 February 2019 September 2018 March 2018 February 2018 June 2017 March 2017 February 2017 March 2016 February 2016 October 2015 Categories Select Category Annapurna Base Camp Bali Bolivia Edinburgh Everest Base Camp Gangotri Gaumukh Himachal Pradesh Himalayas India Madhya Pradesh Nepal Nusa Ceningan Nusa Islands Nusa Lembongan Nusa Penida Peru Rajasthan Sikkim South America Spiti Travel Trekking Tunisia UK Uttarakhand Follow Notes From Dreams on WordPress.com Nachikethas on Backpacking Peru and Bolivia i… swetha on Backpacking Peru and Bolivia i… Nachikethas on 2 Days Edinburgh Itinerary… Natasha on 2 Days Edinburgh Itinerary… 7 Reasons Why You Sh… on Sikkim – The Land of…	cc/2021-04/en_middle_0039.json.gz/line1072
__label__wiki	0.723264	0.723264	Two UC Davis Health experts featured in national ... NEWS \| August 4, 2020 Two UC Davis Health experts featured in national medical journal Not one but two UC Davis Health experts have commentaries out today in Aug. 4 issue of the Annals of Internal Medicine, the flagship journal of the American College of Physicians. Nancy Lane discusses a new study published in the journal about a drug that appears to have provided unexpected but significant benefits for those facing knee or hip replacements. A distinguished professor of medicine and rheumatology, Lane is internationally known for her work in osteoporosis and osteoarthritis. She highlights the research, which was done as a secondary analysis of osteoarthritis data from a national cardiovascular disease study (CANTOS). It tested the medication Canakinumab for its possible benefits. Lane’s commentary, titled “A Promising Treatment for Osteoarthritis?”, says the unexpected findings deserve more investigation as a potential disease-modifying osteoarthritis drug. She says further studies should evaluate the importance of the C-reactive protein, an elevated biomarker that is a factor in the systemic and localized inflammation that characterizes osteoarthritis. Lane, who also directs the UC Davis Center for Musculoskeletal Health, emphasizes that any upcoming studies should include more women as participants to better reflect the osteoarthritis population and ensure more robust results. Garen Wintemute, professor of emergency medicine and director of the UC Davis Violence Prevention Research Program, talks about violence and social change in his commentary. He urges health professionals to help address the nation’s social disparities, which he says threaten not only public health but also a free society. Wintemute notes that the coronavirus epidemic is driving an increase in violence, particularly firearm violence. “That violence, like the pandemic itself, is shining a powerful spotlight on stark disparities and lethal abuses of power…” says Wintemute. “For compelling reasons, we are now focused sharply on disparities in the risk for violence by race and ethnicity.” His commentary includes suggestions for health professionals who want to become more proactive about saving lives and restoring communities to health. “Such work in the present moment is how we honor the past and pay our debt to the future,” says Wintemute. Charles Casey	cc/2021-04/en_middle_0039.json.gz/line1073
__label__cc	0.507918	0.492082	Experience OMNIA Los Cabos Corporate and Incentives Groups Private Events VIP Tables Tickets Día de Los Muertos Celebration in San José del Cabo Click here to purchase tickets and tables for this event or call +52 624 104 9743 Visit OMNIA Los Cabos on Saturday, November 2nd where we’ll be throwing our very own Día de Muertos party featuring Art Department! Dress up in your best Day of the Dead-themed swimwear and join us for a celebration filled with pool games, costume contests, giveaways, and more. Lounge in one of our VIP cabanas or two-story villas, or dance the day away to Art Department’s one-of-a-kind beats in our main pool! General admission is $1000 MXN pre-sale or $1500 MXN at the event, and includes open bar from 11:30 AM – 4:00 PM. Don’t forget to reserve a table for your group for complimentary access to this OMNIA event. Art Department Arrives in Los Cabos Art Department is an award-winning artist whose game-changing contribution to electronic music has been undeniable. His transcendence of genre barriers has garnered accolades such as #1 track of the year at the Beatport Awards in 2011 and iTunes #2 “Best Electronic Album” of 2011, with notable mentions in wide-spread press including The Guardian, Rolling Stone, Billboard, Vogue, I:D, Nylon and Vibe Magazine who ranked Art Department the #2 DJ/Producers in the world in 2013, second only to Daft Punk. With premier ocean views, a fresh selection of food items, and hand-crafted cocktails and drinks to enjoy poolside, OMNIA Los Cabos is the perfect place to celebrate one of Mexico’s most revered holidays. If you’re celebrating a special occasion, don’t forget to let our team know by signing up on our events calendar or by connecting with our events team! After the party winds down at OMNIA, hop next door to Casa Calavera for their Día de Muertos family-style dinner starting at 7 PM. In addition to a menu of traditional Day of the Dead cuisine, the restaurant will also be featuring a margarita, Paloma, and domestic beer open bar, dessert station, tequila cart, and more set to the backdrop of the band Luna Itzel. We look forward to welcoming you at OMNIA Los Cabos for our Feel Good Fridays Día de Muertos celebration! Authentic Mexican Beachside Dining At OMNIA Los Cabos Hand-Crafted Cocktails Vidanta Los Cabos Boulevard San José s/n Lote 12 Campo de Golf San José del Cabo, Baja California Sur, México C.P 23406 +52 624 104 9743 (MX) A Hakkasan group venue Online Form - OMNIA Los Cabos Subscribe Form This website uses cookies to help us give you a better user experience. By continuing to use this site you consent to our Cookie Policy. You can learn more about our Cookie policy, here.	cc/2021-04/en_middle_0039.json.gz/line1077
__label__cc	0.514238	0.485762	You are at:Home»Arts and social sciences»Survey finds couples “avoid conversation on their relationship” Survey finds couples “avoid conversation on their relationship” By Christine Drabwell October 5, 2020 No Comments Research taken up among couples, conducted in collaboration with the OU shows nearly two thirds do not talk about their relationship – with anyone. The polling (*) was carried out in collaboration with the OU’s Professor Jacqui Gabb to coincide with the launch of Paired – an app for couples to engage in relationship matters. Prof Jacqui Gabb The poll results showed six in ten (62%) UK adults who are currently in a relationship admit they do not speak to anyone for relationship advice. In further poll insight, it revealed a generational divide between those who open up about their relationship and those who do not. A startling eight in 10 (80%) of those over 55 said they would not go to anyone for relationship advice, compared with two-thirds (66%) of those between 45-54 and only 3 in 10 (27%) of 18-24 year-olds. App is informed by research The YouGov survey was commissioned by the Open University and Paired and taken up online in July among 2,011 adults with 1,348 of those in a relationship. The app has been particularly informed by the research of Professor Gabb and findings of the Enduring Love? study. Professor Gabb has been appointed as Chief Relationships Officer at Paired to lead on research and media communications. Professor Gabb, is working with Paired on the new app, which is the first relationship app with advice from leading experts which are all qualified clinical psychotherapists or academics. It is for same-sex and heterosexual couples. It combines audio courses from clinical psychotherapists and academics with fun daily questions and quizzes with the aim of helping people to take small, positive steps to improve their relationship each day. Professor Jacqui Gabb said: “Communication is absolutely key when it comes to successful relationships. I have studied long-term couple relationships for years and I cannot stress enough how important it is to simply talk, to discuss feelings and not to brush issues under the carpet and let them fester – that is how small problems become huge points of contention. “Couples’ relationships are just like any other relationship, you have to put the time, energy and effort into them otherwise they simply won’t survive.” Results from the Enduring Love? study have already achieved significant reach outside the academy via extensive national and international media engagement with study findings, alongside the publication of a self-help book, The Secrets of Enduring Love. The partnership with Paired means that it is possible to utilise findings to accomplish significant impact by achieving population-level behavioural change. Paired is free to download here from the Apple App Store and Google Play Store, with a monthly or annual subscription required to access the full range of courses. Poll: All figures, unless otherwise stated, are from YouGov Plc. Total sample size was 2,011 adults with 1,348 of those in a relationship. Fieldwork was undertaken between 29th – 30th July 2020. The survey was carried out online. The figures have been weighted and are representative of all UK adults (aged 18+). Christine Drabwell Christine is a manager in the Media Relations team within the Marcomms Unit at the OU with an extensive background in media as well as PR. A former national BBC journalist, sub-editor and news editor, she also has a grounding in regional newspapers. Her PR experience includes working in-house as press officer in the busy Marcomms unit at the Zoological Society of London. At the OU, Christine covers widening access in HE, corporate news and campaigns, as well as stories from the Faculty of Arts and Social Sciences. She has just completed an MA in Philosophy and in her spare time swims regularly and chairs a local swim club. OU-funded research to tackle social isolation in hospice settings Millions of electric cars will need charging in future – but how?	cc/2021-04/en_middle_0039.json.gz/line1082
__label__wiki	0.84358	0.84358	Home Australia’s Flag Australian Constitution Article Index Audio Resources Contact Us Article Index › Changing Constitution Australia’s Constitution Australian Commonwealth Australia’s Flag Australia's Queen Australia’s Head of State Republic debate Audio/Video Resources Queen of Australia The Australian Constitutional Monarchy shares principles with other Christian Constitutional Monarchies around the world. The Monarch, a Queen or King, is crowned in a Christian Church service. The Monarchy is a limited Constitutional Monarchy, whose prime function is to give legitimacy to the authority of the Monarch's Australian representatives. The limitations are defined by the Australian Constitution, and the historical precedents that accompany the office of the Crown. Queen Elizabeth II is the current reigning Monarch. Separate to her role as Queen of Great Britain, she is also Queen of Australia. She was crowned in 1953, and the year, 2003, marked the Celebration of the Coronation Jubilee. At her Coronation, Queen Elizabeth made a solemn oath before God, to dedicate her life, whether long or short, to the service of her people. Without any cost to the Australian people, she has fulfilled that oath for over 50 years. The reserve powers of the Monarch are not defined, are rarely exercised, but are sufficient to guarantee that abusers of political power can be constrained by an office that is above politics, and that exists for the sole purpose of advancing the general common well-being of all the people. Politicians represent the wishes of the majority. The Monarch serves sacrificially for the welfare of all. Articles on Australia's Queen Winning 2002 Essays Transcript of address to ACM Supporters Meeting by Damien Freeman Address given to the Queen's Golden Jubilee Luncheon [2002] Speech given by Her Majesty The Queen at Adelaide Festival Hall [2002] Your Will Be Done (A booklet as 10 Web Pages) Celebrating Federation National Conference 2001 Address to 2002 ACM Luncheon by Sir David Smith Queen in Commonwealth (Text as Web Page) The Queen and the Commonwealth (An extensive series of background short articles and opinion pieces) Her Majesty's Decree (Text as Web Page) Australia Day 1999 The British Royal Family (External Web Site) Resource: ourconstitution.org/queen.php Printed: 2021-01-21 ©2001-2021 Australians for Constitutional Monarchy (Toowoomba Branch). All rights Reserved. ©2001-2021 Australians for Constitutional Monarchy - Toowoomba Branch Site by IDO	cc/2021-04/en_middle_0039.json.gz/line1083
__label__wiki	0.609772	0.609772	Own Your Content Own Your Content is a campaign from WordPress.com & CreativeMornings, encouraging creatives to own their content, platform, and the future of their work. Toolkit: How to showcase your projects Toolkit: How to build a newsletter list Interview: Khoi Vinh Toolkit: How to give proper attribution Toolkit: How to write your About page Interview: Jen Hewett Toolkit: How to keep your guest list inclusive and diverse Toolkit: How to Make a Proper Introduction for a Collaboration Interview: Paul Jarvis Interview: Anita Sarkeesian Interview: Luvvie Ajayi Interview: Heather Meeker Interview: Kathryn Finney Interview: Maria Popova Interview: Jocelyn K. Glei Interview: Grace Bonney Interview: Ryan Merkley Interview: John Maeda & Kat Holmes Ryan Merkley on Licensing Creative Work and How Attribution is Gratitude March 2, 2018 April 22, 2019 kylecreativemornings The Internet created a tidal wave of creativity and knowledge, and left in its wake the conditions for unrestricted sharing—but it didn’t come with a set of rules or principles that the world would abide to. Everything we’re seeing in the media, to the lack of attribution in work, and companies stealing from freelance artists is not shocking, but disappointing. That’s what comes with wide boundaries and freedom. The future of the Internet will be rooted in principles that enable continuous burgeoning of art and information so that the world can relentlessly benefit from this priceless gift. We spoke to Ryan Merkley, the CEO of Creative Commons—a global nonprofit organization that enables creators to share and reuse creativity and knowledge through the provision of free legal tools. While they’re known for their licenses, they also offer other technical tools that facilitate sharing and discovery of creative works. Ryan shares why unlocking your work can create unique opportunities for creators, and what the future of creative work and knowledge looks like. Creative Commons provides an indispensable tool for makers of all kinds—and yet, as I look at my favorite writers’ blogs or photographers’ sites, most people don’t have the CC license (not even me). Why do you think that is? And what do you think the general attitude is towards licensing our work? Ryan: The default term of copyright is all rights reserved. That means no one can use your work in any way without permission. And copyright is automatic, for everyone, from the minute the work is created. So it makes sense that most people wouldn’t choose an alternative. But millions have decided to share, and there are over 1.3 billion licensed works online using CC licenses. Every time, someone had to choose to share, which is a big deal. What do you think it will take for widespread adoption of CC licensing in creative work, so that it becomes common-place in the workflow of the creative professional? CC tools are embedded in major content platforms like Medium, YouTube, Soundcloud, and they power the free knowledge on Wikipedia. There are over 1.3 billion works shared by creators in 85 countries and 35 languages — so I’d say that’s pretty widespread. But if you mean creative professionals specifically, then that’s a more complex question, because creators are all different, and the motivations and goals for why they create are many and varied. In some professional creative communities, like photography, sharing with CC can be a form of marketing and brand-building. For musicians, it’s a way to reach new fans and invite collaboration. For creatives who work in agencies, much of their work doesn’t belong to them, or is assigned to the client. The creative professional generally needs to be compensated, so solving that will come before sharing, unless there are ways to do both that benefit them. What are the steps to licensing via CC. Walk people through it to encourage them to license CC on their work. For example: an illustrator could… a photographer could… Creators who want to share have a variety of options, and most of them are built directly into mainstream platforms they already use every day. If you’re a photographer and you want to share a selection of images under CC to promote your name, you could upload a photo set to a platform like Flickr or 500px, and simply choose the license of our preference (the most popular license is CC BY, which allows any use, as long as you credit the author, and link back to their original work). Blockchain technology seems to have immense potential in this world of attribution and licensing. Imagine a future where an artist knows how their work is being used, where, and being compensated for it. What are your thoughts on this technology and how it might change the way we attribute, license, and share our work? Ryan: There is some really exciting work being done around distributed ledgers and content analytics. It’s possible that Blockchain will be part of that. We’re following it closely, and speak regularly with the many (many) startups working in this space. Should all work be licensed at all costs? What are the pros and cons of taking this approach? Ryan: I think all creators should first understand the rights they have, and then consider what they might gain by choosing to share. If they want to share, we offer simple tools that are the free, global, inter-operable standard. CC licenses are built on top of copyright — that means they rely on copyright law for enforcement and international recognition. If creators want to protect their work from being used in ways they don’t want, they are no more or less safe using CC licenses. Our tools stand up to legal challenges and international use. Attribution is often woefully practiced. Sometimes the act of giving credit isn’t taken seriously. What can creative communities do better? What does good attribution look like? Ryan: Attribution is gratitude. It’s the least you can do to thank someone for creating something and allowing you to use it. CC’s minimum standard for attribution is author, title of the work, link to the original work, link to the CC deed for the licenses. For example: Ryan Merkley, “Self-Portrait”, https://www.foo.com/12345, licensed CC BY 4.0 https://creativecommons.org/licenses/by/4.0/. Unfortunately, attribution like that is done incorrectly quite often. Sometimes it’s malicious, but most of the time I think it’s because people are confused, or a bit lazy. I think we should make it easier, or better yet, automatic. We’re working on tools to make that possible. Our first iteration of CC Search provides one-click attribution with automatic formatted text or HTML that creators can copy/paste into their remixes. What does the future of content look like to you? Ryan: It depends on the content. The future of academic publishing, educational materials, government data, and more is undoubtedly going to be more open. The future of film and music, is heading to a more closed state, powered by digital-rights-management that effectively subverts copyright by preventing access — it “puts the content behind glass” by creating containers the user can’t access. What we know is that creativity and innovation benefit from access to raw material, and that our tendency is to believe that restriction is good when it’s our content, and bad when it’s content we want to use. The history of creativity and discovery are rooted in remix, not restriction. We need to find ways to ensure creators can have livelihoods, and also that content and knowledge are accessible. Attribution is gratitude. It’s the least you can do to thank someone for creating something and allowing you to use it. What is your definition of owning your content? Ryan: For me, ownership is about choice, not restriction. CC was founded on the idea that creators should be able to share if they want, with the fewest barriers. That’s why we created the CC licenses, and why we made them free — so anyone could use them to share under simple, permissive terms. Any final thoughts on this subject that you want to express that I haven’t asked as a question? Ryan: We get hung up on the control of our work, and too often forget what’s possible when it gets unleashed. I often encourage creators to think about what they want to enable, not what they want to restrict — translation, adaptation, remix, collections, and other serendipitous asynchronous collaborations are what make the web delightful, and excite us. But to do that, we have to be willing to let go a bit. We are quick to forget that everything we make is a derivative of something else. Sometimes it’s a reaction, but often it’s a remix. We can fight it, or embrace it, but art and knowledge, like love, are not finite. They are infinite, if we’re willing to open ourselves to the idea that someone else having and using my work doesn’t deny me the ability to also enjoy it. The history of creativity and discovery are rooted in remix, not restriction. This interview was produced in partnership with WordPress.com & CreativeMornings. Morning people get 15% off their WordPress.com site at wordpress.com/creativemornings. Interview by Paul Jun. Illustrations by Jeffrey Phillips. ‘Own Your Content’ illustration by Annica Lydenberg. Recommend tools from Ryan: CC Search Noun Project Adobe Creative Suite: InDesign, Illustrator GDocs, Slack, Hangouts (CC is a virtual org, with staff in 7 timezones) Canva: Just discovered it, very good for quick stuff Good reads: 99PI podcast on Challenge Coins – Inspired me on gratitude. I made a CC coin. Paul Graham’s “Do Things That Don’t Scale” – old, but great because we’re small James Boyle “The Public Domain” Lawrence Lessig “Free Culture” Bonus: Larry’s presentation of the book’s main themes Saul Alinsky “Rules for Radicals” – Get radical, people. Previous PostJohn Maeda & Kat Holmes on Designing for Inclusiveness Next PostGrace Bonney on The Art of Thoughtful Emails and Clear Communication in Collaboration Pingback: Anita Sarkeesian on Amplifying Your Mission With Storytelling – Own Your Content Pingback: 9 Creative Leaders on Owning Your Content, Platform, and the Future of Your Work – Own Your Content Pingback: Toolkit: How to give proper attribution – Own Your Content About Own Your Content Own Your Content is a campaign from WordPress.com & CreativeMornings, encouraging creatives to own their content, platform, and the future of their work. Read more.	cc/2021-04/en_middle_0039.json.gz/line1086
__label__wiki	0.945747	0.945747	Home/africa/SARB felt heat on Gupta's accounts closed SARB felt heat on Gupta's accounts closed africa April 17, 2019 africa South African Reserve Bank Governor Sarb Leset Kaganago explained in detail the degree of pressure that was brought to the central bank after the country's banks closed Guptaz's bank accounts three years ago. File: IOL Johannesburg – The Governor of the South African Reserve Bank (SARB), Leset Kgangagogo, explained in detail the volume of pressure that was brought to the central bank after the country's banks closed Guptaz's bank accounts three years ago. Kganyago told global leaders at the Stavros Niarhos Foundation that the attacks were for reasons other than price stability. He said the bank was under pressure to force banks to reconsider prisons, as they are almost impossible for the family to carry out its operations. "We began to feel pressure to force the banks to service these bills, contrary to the law. In addition, we came under pressure to allow this family to obtain a bank license by purchasing a small bank." We even faced the threat that the licensing of banks will be taken away from the SARB together, "said Knjajavo. "We used our independence to respect the law against dirty cash flows, and that made us enemies." Moody's Investor Services said on Monday that it continues to see SARB's independence in implementing its policy, despite ANC talks to nationalize the bank. SARB's guarantee of independence is Article 224 of the constitution, which explicitly protects the bank from interference by the government. In August 2016, the Financial Intelligence Center marked 72 suspicious transactions related to Gupta bank accounts totaling $ 6.8 billion. The infamous Guptis, who are accused of having unimpeded access to state resources under former President Jacob Zuma, have closed bank accounts of their companies from Standard Bank, Nedbank, FNB and Absa in 2016. Standard Bank Consort, Jan Sinton, in September, told an inquiry into the seizure of the state that former Minister of Mineral Resources Mosebenzi Zwane and Labor Minister Mildred Olifat pressed Standard Bank to keep Guptas' accounts. The FNB and Absa refused to meet with government officials on the issue, while Nedbank testified that Zwanei threatened to withdraw the company's banking license if he refused to change his decision. Kganyago also turned out to be critical of the central bank after he put VBS Mutual Bank back under curtailment last year after being exposed to a bank fraud of nearly R2bn. "We were accused of undermining black perfection and protecting the interests of white capitalists. Do you know that saying" patriotism is the last refuge of enemies "? Well, in South Africa, if you really need to hide somewhere, it's not in patriotism , but in racist politics. " S & P Global Ratings announced last week that it has no doubts about the plans of the ANC for nationalization of the SARB.	cc/2021-04/en_middle_0039.json.gz/line1088
__label__wiki	0.535185	0.535185	Home/lebanon/Frangieh: We work as part of our regular and we continue our line of Gazeta Al-Bina Frangieh: We work as part of our regular and we continue our line of Gazeta Al-Bina lebanon November 5, 2018 lebanon, العالم العربي I met with former parliamentarian Suleiman Franjo, in the palace of the late President Sleiman Franjie in Zagharta, with the families of martyrs from the massacre in Ehden, to put them in an atmosphere of contact with the party's "forces". "Dialogue or meeting is a natural result of reconciliation that took place in Bkirki and at the next meetings, without any deviation from the dignity of our martyrs or dignity, which is our dignity, and we are waiting for a new stage in which we can overcome the past. The meeting was opened by priest Prelate Stefan Franjieh with a prayer in which he stressed that "the wisdom of Suleiman Francesca allows him to choose what is good for us and for Lebanon." Then Franjieh spoke and said: "From this house there was a beginning, and from him began the slogan of forgiveness of the past, dialogues with Lebanese forces went through several stages, and a bilateral meeting with Dr. Samir Geagea as the culmination of these meetings at the leadership level was not violated during our dignity Or the dignity or dignity of our martyrs, and it will be a meeting without immediate interests and circumstances. " He added: "I am counting on your trust in me and our martyrs who were absent and living martyrs … We are a movement that brings together the overwhelming majority of those who have been with us since the beginning of the march. Together we have started and together we are continuing the path and what we are doing your support and blessing, we work within our political constitutions and we continue our plan. " He pointed out that "the next stage is necessary", stressing that "we work only at the level of our history and martyr history, to keep Lebanon a free and united ruler." He said: "We have lived with some sweet days and days, so we will be in the future, because you are the foundation, the present and the future." Franjieh finished, pointing out that "the dead Robert Franjieh has blessed this march and we are all going, but the march continues with you and with you." The meeting also included a speech by MEP Estfan Al-Duweihi, in which he stressed that "our political and primary school is the seat of President Frangieh, and continues Suleiman and Tony Frangieh." This school gave tolerance. " It was also a speech by Tony Francesi, who stressed that "our martyrs died in defense of their homeland, and today we as young people look forward to a new future and we want it without hatred of the past and wounds, and our aspirations, if we want to succeed, go with love and unity in the future, and democratic and political competition. " "Our nation and our ancestors have dedicated themselves to our unity, and the greatest victory for our martyrs is the unity of their homeland, for which they died." In conclusion, the words of the families of the martyrs from Ehden's slaughter renewed their confidence in the "leader who does not support anyone with the victims" and their dedication to decisions, valuing "a meeting that consecrates the unity of the situation with emotions and consciousness and continuing with one heart and one body". There were 9 deaths and 1,236 new cases of corona Corona continues its progress in the regions … to you, the new one Here Shiha reveals the date of marriage of her sister Hala and Moez Masoud Volkswagen announces the date for the introduction of self-driving cars Tuhel comments on the rumors about Messi and Paris Saint-Germain The first Arab country to allow the use of the Pfizer-Bionic vaccine against Corona By lebanon Samsung has introduced the GALAXY S21 series with pre-installed ONE UI 3.1 Corona’s gloomy scenario in the coming months … Asharq al-Awat: Hariri prepares list of 18 ministers to present to Aoun A director attacks two actors … and expels them	cc/2021-04/en_middle_0039.json.gz/line1089
__label__wiki	0.921135	0.921135	7 Policies Corbyn Has Sold Out On Corbyn has only been leader for two weeks and already he is selling out. These are the left-wing positions he has been forced to abandon already: EU: Corbyn warned Labour would not give Cameron a “blank cheque” on renegotiation, before abandoning decades of Bennite Euroscepticism to u-turn: “Labour will be campaigning in the referendum for the UK to stay in the European Union… regardless of the outcome of the Government’s renegotiation.” Trident: “Conference ought to be the place where there is open discussion [on Trident]” said Corbyn on Andrew Marr, before he was forced into a humiliating climbdown as the unions blocked his attempt to force a vote. Free schools: Corbyn had blasted free schools as “unaccountable“, now his Education spokesman Lucy Powell says Labour would not abolish them. People’s QE: Corbyn and McDonnell’s flagship economic policy, but has been criticised by his new team of economic advisers and did not appear at all in the Shadow Chancellor’s speech yesterday. Robin Hood Tax: The BBC reported yesterday morning that: “John McDonnell looks set to use his first Labour conference speech as shadow chancellor to push for a Robin Hood tax”, yet there was no mention of it in his speech at all. Railways: Corbyn has played up rail nationalisation, but he now says it will only be implemented as franchises expire, so would not come into effect largely until 2030. Public ownership: Corbyn pledged to bring back Clause IV, yet there was no commitment to nationalisation – other than the flimsy railways policy – in McDonnell’s speech. Why doesn’t Corbyn just JOIN THE TORIES… mdi-tag-outline Labour Party mdi-account-multiple-outline Jeremy Corbyn	cc/2021-04/en_middle_0039.json.gz/line1097
__label__cc	0.726792	0.273208	Easy Render Coronavirus: Online dating has seen a surge in activity in India since the lockdown UPDATE: 10 things dating sites won’t tell you 10 Signs That You Should Become an Architect The Perks of Dating an Architect 10 Reasons NOT To Date An Architect 38 Things All Architecture Students Know Only Too Well Digital Architect (Season 1 Episode 3) CNN Dating is a normal part of adolescence — and a formative one at that. Decades of research have suggested a link between romantic relationships and identity development as teenagers mature into young adults. Chat with us in Facebook Messenger. Find out what’s happening in the world as it unfolds. But a recent study published in the Journal of School Health reveals that adolescents who choose not to date fare as well as, or better than, their coupled counterparts in social and leadership skills. Pamela Orpinas. So that made us ask: What does this say about teenagers who are not dating? Are they social misfits? Read More. Architects are a special breed – an eclectic contradiction of artist and engineer, dreamer and realizer, Simon and Garfunkel. This article should give you a bit of insight into who the architect is, and why dating them can be incredibly rewarding. However, if you consider yourself to be the planning type, getting two of you in the same room together could result in a small black hole tearing a rift into space-time. They can hold their liquor and keep your loved ones chuckling about grade beams and the incompetence of contractors into the wee hours of the night. Senior Online Dating Site Free daily situations, an examination to test the student’s composition skills, and finally an examination testing the. The two have said their relationship is professional but they failed to reveal that they might have known each other for longer. An Instagram picture from November 28, , shows that Pitt had visited the woman at the time. An Instagram picture has surfaced that hints that the two may have known each other since November The two started a friendship after they met through an MIT architecture project. The image was taken at the school when he visited the professor. A few days ago, a source told Page Six that the pair had been hanging out a lot lately. Their friendship has not turned into romance … as both are cautious and this is, again, more of a professional friendship, but Brad is very interested in spending more time with Neri, she is fascinating. The separation is set to be finalized in a few weeks. There she directs the Mediated Matter group, which she founded. She was previously married to Argentine composer Osvaldo Golijov. Read also. Jan 13, We use cookies to improve your experience on our website. By using our website you consent to all cookies in accordance with our updated Cookie Notice. Indian millennials already had ideas for how they could convert a regular date into a digital one. Most Indian users of OkCupid also preferred text messaging over video calling, in line with global trends. : Online Dating Scams: The Beautiful Architecture. Candid stories This student gets the needed sum of money and disappears. Even if you report. Even though we foresee a mix of online and face to face instruction- a hybrid model for the academic year, we want them to feel they are a very important part of the WHSAD community. In order to accommodate all the freshmen, we will be offering 2 schedules. Click here for more information. We salute our Graduates, who, in spite of missing out on traditional senior activities due to the Covid pandemic, held an uplifting and inspiring event. Please join us in celebrating our Class of More Posts from this Category. Click Here For More Stories. Established in the fall of , The Column is a student run newspaper. WHSAD staff is looking for the future designers and builders of our great cities, and we welcome all who are interested in joining our school community. To help you decide whether WHSAD is the right fit for you, we are posting the entirety of our recruitment packet here. Welcome Class of To the incoming Freshmen of the Class of and their families: we want for you to know that you have not been forgotten. Even though the end of this school year has been disrupted by Covid, we are still working behind the scenes to make sure that we are ready to welcome you in September. If you have any questions or concerns, please email our parent coordinator, Ms. You can be rest assured that we will make your transition into high school easy, comfortable and enjoyable. Check out the Wiki , where you can find a treasure trove of resources like tutorials, architecture blogs, school information, and more. It’s an ongoing compilation, so we encourage you to message the mods with suggestions for more content! Submit interesting, engaging, and inspiring content relevant to the field, study, or love of architecture. Include one of the following bracketed tags in your title: [theory], [practice], [building], [technical], [news], [misc], or [ask]. Posts that don’t include them won’t be visible! Include details such as architect, location, photographer, date and building type in submissions when available. Student attorneys presenting at Amherst Central High School. one in three high school students are exposed to physical or sexual violence by someone they are dating. students and faculty working together on an architectural project. Calling all architecture and design students, recent graduates and emerging practitioners. How would you deliver a playful and creative bench proposal to celebrate the Royal Docks and the communities at home in the area? Check out the competition brief and how to enter here. Click here to listen to the conversation. To hear their thoughts and to view the trailer for their upcoming film head here. To find out more about the beacon head here. With an amazing programme of events and activities taking place right across London every June, we welcome everyone into the conversation around architecture and our city. This year our festival in June went online as LFA Digital, but our traditional public programme will also happen, but over a longer season this autumn. What makes us unique is that our vast programme of events each year is delivered by a diverse mix of independent organisations and individuals — helping to radically democratise the debate about architecture and our city. From the White House to Downing Street, our buildings are a byword for the power of their inhabitants. Do you architects have time to date and meet people? Is it really that bad that you have no time for leisure at all? Do you guys get to at least spend a little time lounging around home or going out to have drinks with friends and such? I have time to hang out. I too have the problem of not finding anyone interesting enough. I’ve been putting off the dating thing lately. Thinking about dating an architect based on what you’ve seen on TV? Here is some “inside” information on the character traits of architects. You Forgot that if u think abt dating an architect student you’ll never sleep agn for a. Such as architects and architects by continuing to powering autonomous. She is a few times on this site – women looking for women to ensure you need to the space, quirks interest. Openness and architects. Growing page views via facebook for guys, we follow our website builders and more. To the running for a tough time to the. L’essentiel est sur admagazine. He successfully integrated art into a colorful day! Below we use of the correct dating service, featuring groundbreaking projects are characteristics that acquire patina such an architecture world. An integrated design and communicate with usage of the importance of those qualities of architecture world. Sigurd larsen is an architecture has multiple answer options. To powering autonomous. Bless is dedicated to make this issue: architectural’ category. You are commenting using your WordPress. You are commenting using your Google account. You are commenting using your Twitter account. Lifetime & Experiential Learning. Graduate Studies Overview Continuing & Professional Studies International Studies & Study Abroad. This change took effect May 1, If you are currently a Student Member, there is nothing new that you need to do to take advantage of this offer. Your membership will continue without cost until you graduate. New to ASLA? Join today to take advantage of great ASLA benefits:. Award recipients are featured in Landscape Architecture Magazine , the magazine of ASLA, and in many other design and construction industry and general-interest media. Award recipients and their advisors are honored at the awards presentation ceremony during the ASLA Conference on Landscape Architecture. Student Conference Organized entirely by students, LABash is an annual landscape architecture conference hosted each year since by a different landscape architecture program in North America. Perception versus reality is a topic I have covered a few times on this site. Architecture is frequently chosen as the profession for characters in the movies and on TV for the simple reason that there is no downside to the character perception of an architect. They can be all the things you want your hero to be without the baggage that comes along with other vocations typically associated with highly intelligent people. I am a proud, sweatshirt-wearing girlfriend of an New York Institute of Technology (NYIT) architecture student. I’ve seen on another blog here. The Royal Institute of British Architects RIBA is a professional body for architects primarily in the United Kingdom, but also internationally, founded for the advancement of architecture under its charter granted in and Supplemental Charter granted in After the grant of the royal charter it had become known as the Royal Institute of British Architects in London , eventually dropping the reference to London in Supplemental Charters of , and were replaced by a single Charter in , and there have been minor amendments since then. The original Charter of set out the purpose of the Royal Institute to be: ‘ The operational framework is provided by the Byelaws, which are more frequently updated than the Charter. Any revisions to the Charter or Byelaws require the approval of the Privy Council. The design of the Institute’s Mycenaean lions medal and the Latin motto Usui civium, decori urbium [4] has been attributed to Thomas Leverton Donaldson, who had been honorary secretary until It was again redesigned in by Eric Gill and in by Joan Hassall. His School, Liverpool, was one of the twenty schools named for the purpose of constituting the statutory Board of Architectural Education when the Act was passed. The RIBA Guide to its Archive and History has a section on the “Statutory registration of architects” with a bibliography extending from a draft bill of to one of Simon Cowell Began 4-Year Affair With Lauren Silverman in 2009 Age to start dating States Wade Into Title IX Debate 5 Best Sites for College Online Dating Teachers, what is your opinion on dating another teacher at the school in which you work? Personals & Singles in Prince George, British Columbia – 100% Free 日本語LëtzebuergeschSvenskaPolskiItalianoČeštinaNederlandsSuomiEspañol中文(简体)DeutschMagyarFrançaisΕλληνικάالعربيةEesti keelEnglishPortuguêsNorskTürkçeDansk	cc/2021-04/en_middle_0039.json.gz/line1103
__label__cc	0.539804	0.460196	About Paper Rocket The Tiny Report Tag: KGB Tiny Report / Paper Rocket Tour March 25, 2015 Robyn Chapman Last weekend I looked at my calendar and FREAKED OUT, because I had gone overboard applying for festivals and committing to events. I had accidentally committed to six comics events over the next seven weeks. When I complained on Facebook, Box Brown pointed out that what I actually had done was booked a tour! So here’s the Tiny Report / Paper Rocket Accidental Spring Tour 2015. March 28-29: RIPE in Providence, RI Micro-Press and distro panel at 1pm on the 29th April 5: KGB Comix Night in New York, NY April 11-12: MoCCA Fest in New York, NY April 20-21: CCS class visit in White River Jct, VT Lectures with students about micro-publishing and editing April 26: Brooklyn Zine Fest in Brooklyn, NY May 9-10: TCAF in Toronto, Ontario Hope to see you there! Please bring me words of encouragement and snacks. It’s going to be an intense month and a half. Tagged Brooklyn Zine Fest, CCS, conventions, events, KGB, MoCCA, RIPE, TCAF, The Tiny Report Easter Sunday KGB Comix Night April 12, 2014 April 19, 2014 Robyn Chapman It’s that time of year again! Sunday, April 20, 7:00pm – 9:00pm KGB Bar, 85 E 4th St, New York (NOTE: Katie Skelly had to cancel. But we still have five readers!) Join us for our annual Easter Sunday KGB Comix Night, a free night of live comics readings. KGB Comix Night is more than just a night of free entertainment—we also have a fun raffle with awesome prizes! A $5 donation will get you a raffle ticket. Raffle proceeds are split between the host and readers. Hosted by Robyn Chapman Stephanie Mannheim grew up in Ann Arbor, Michigan, where she began self-publishing her own minicomics in high school. She currently resides in New York City, where she is completing her senior year at Barnard College of Columbia University. www.stephaniemannheim.com Hazel Newlevant is a cartoonist in her senior year at the School of Visual Art. She has drawn and published many minicomics, including the Xeric Award-winning Ci Vediamo. Her work was recently honored with the Prism Comics Queer Press Grant. www.newlevant.com Connie Sun is a New York-based cartoonist who draws an autobiographical webcomic every weekday. She is a self-taught cartoonist who works in higher education by day and sleeps at night. www.conniewonnie.com Mike Taylor is a Brooklyn-based artist whose work includes the long-running zine Late Era Clash (started in 1994, and currently in its 25th issue). Mike recently had his first solo-show, NO/FUTURE, at the Booklyn Art Gallery. www.late-era-clash.tumblr.com Jess Worby is a cartoonist, illustrator, and teacher whose clients include the New York Times, Wired.com, and McSweeney’s (among others). He draws pictures that feel alive and makes stories about how strange it is to be a person. www.jworby.com Tagged Connie Sun, events, Hazel Newlevant, Jess Worby, Katie Skelly, KGB, Mike Taylor, Stephanie Mannheim KGB Comix Recap December 13, 2013 December 13, 2013 Robyn Chapman Whatta night! We had a full house at the Post-Thanksgiving Comix Reading, thanks to our regulars and a mention on the Skint. I was too preoccupied this year to take photos, as I was hosting AND reading. But here are some images from the slideshow. The big news of the night was that Nick Sumida brought down the house with his reading of New Voicemails. Chandler Moses recorded the audio, and later Nick added video and uploaded it to Youtube. Then Buzzfeed posted it! They didn’t mention the KGB Comix Night by name (darn it!) but it was the biggest press the show ever got. Jesse Reklaw read from his memoir Couch Tag, which was just released last week. This panel in particular got some laughs. Aaron Cockle did his first comic reading ever. He chose Exit Interview, my favorite of his short stories. Emily Flake read some of her rejected New Yorker cartoons, and a longer piece on motherhood. I read my comic Bad Girls, and a excerpt from my work-in-progress, Twin Bed. More on that later. Tagged Aaron Cockle, Emily Flake, Jesse Reklaw, KGB, Nick Sumida Post-Thanksgiving Comix Night at KGB November 23, 2013 November 24, 2013 Robyn Chapman Comix Night at KGB Sunday, December 1, 7:00pm 85 East 4th Street, New York, New York Join us for the annual Post Thanksgiving Comix and Graphic Novelist Night! With special guest readers Robyn Chapman, Aaron Cockle, Emily Flake, Jesse Reklaw, and Nick Sumida. Our annual comic reading event is more than just a night of free entertainment—we also have a fun raffle with awesome prizes! A $5 donation will get you a raffle ticket. Raffle proceeds are split between the readers. Robyn Chapman is a micro-publisher and the proprietor of a Paper Rocket Comics. She recently wrote an educational cartooning book called Drawing Comics Lab. She is currently working on micro graphic novella called Twin Bed. Aaron Cockle is a cartoonist living in Brooklyn. He self-publishes a mini-comic, Annotated, and has an ongoing comic, Word & Voice, published by Oily Comics. Emily Flake is an award-winning illustrator, writer, and cartoonist. Her work appears in Time, The New Yorker, The New York Times, The Globe and Mail, Forbes, The Nation, and many, many others. Jesse Reklaw is the author of the comic strip “Slow Wave,” which ran in multiple papers from 1995 to 2011 and was collected into the books Dreamtoons and The Night of Your Life. His graphic memoir, Couch Tag, was recently published by Fantagraphics. Nick Sumida is a cartoonist hailing from Oahu, Hawaii. His debut comics collection, Snackies, will be released by Youth in Decline in Spring, 2014. Tagged Aaron Cockle, Emily Flake, events, Jesse Reklaw, KGB, Nick Sumida, Twin Bed KGB Recap April 1, 2013 Robyn Chapman What a night! This year we had six readers, which is the max capacity for a two-hour show. I’m pretty proud that we didn’t go over our time slot (a concern for this venue, as stuff is scheduled all night) and we had no major technical difficulties (two years running!) The readings were diverse, ranging from funny to trippy to informative to dark. As always it was a warm crowd. KGB Comix Night is a feel good show–basically, it’s a party with friends I can throw in a really good bar (plus live entertainment). Look for next one on the Sunday after Thanksgiving! Tagged KGB Easter Sunday KGB Comix Reading! It’s that time again! I’ll be hosting the annual Easter Sunday KGB Comix Night. And we’ve got an all-star line-up! Count them, SIX readers! Don’t be late! Note that the event starts at 7:30, not the usual 7. AND, at Comix Night we’ll also celebrate the debut of LOVF New York: Destination Crisis. KGB Bar (85 East 4th Street in NYC) Sunday March 31, 7:30-9:30 Join us for our annual Easter Sunday Comix Night, a free night of live comics readings. Donating five bucks or a graphic novel (new or used) will get you entered in an awesome raffle! Book donations benefit SAW, financial donations will be split between the host and the readers. Sam Henderson has been self-publishing Xeroxed minicomics since 1980. In 1993 he began self-publishing his best-known title, The Magic Whistle. Also in 1993 he began the wordless comic strip “Scene but Not Heard” in Nickelodeon Magazine. It was the magazine’s longest-running comic strip. In 2003, Sam’s writing and storyboard directing work on SpongeBob SquarePants earned him a nomination for Best Animated Program (for programming less than one hour) in the 55th Emmy Awards. Star Fruit is Gretta Johnson’s first book. She is a visual artist living in New York and for the past three years has worked as a chocolatier’s assistant and personal comic book illustrator to Sebastian Brecht. She has taught and continues to teach drawing and sculpture classes at the Children’s Museum of the Arts in Manhattan. Caroline Paquita runs Pegacorn Press, a feminist, queer, and “total-art-freaker” publishing house that specializes in producing small-run art books, zines, and comics. So far, nine official publications have been released since the fall of 2011, including Caroline’s comic Womanimalistic. Caroline has also published comics by other authors, such as FUTURE TENSE, Late Era Clash #24, FAG SCHOOL #4, Burn Collector #16, and Those Fucking Unicorns. Jesse Reklaw is the author of the comic strip “Slow Wave,” which ran in multiple papers from 1995 to 2011 and was collected into the books Dreamtoons and The Night of Your Life. He is also the author of Applicant, a hilarious collection of discarded college applicant documents. He kept a daily comic diary from 2007-2008 called Ten Thousand Things To Do. In 2013 LOVF, a full-color collection of his sketchbook comics, will be published. He lives in Portland, Oregon where he taught at the Independent Publishing Resource Center in their Comics Program. He is currently working on his graphic novel, Couch Tag. Karl Stevens’ first book, Guilty, was published in 2004 with a grant from the Xeric Foundation. His comic strips “Whatever,” “Succe$$” (with writer Gustavo Turner), and Failure ran in the Boston Phoenix. As an illustrator, Karl collaborated with Anthony Apesos on the book Anatomy for Artists: A New Approach Discovering, Learning, and Remembering the Body. His oil paintings and watercolors, predominantly portraits, have been exhibited at the Carroll and Sons Gallery Gallery in Boston. Lauren Weinstein is a cartoonist who is still recovering from having a baby and moving to the suburbs of New Jersey (it’s been two years). Her comics books include Girl Stories and The Goddess of War, and her work has been published in Kramer’s Ergot, The Ganzfeld, An Anthology of Graphic Fiction, and The Best American Comics of 2007 and 2010. Her work has also appeared in the New York Times, Glamour, and Heeb magazines. She is currently working on a sequel to Girl Stories. Tagged Caroline Paquita, Gretta Johnson, Jesse Reklaw, Karl Stevens, KGB, Lauren Weinstein, Sam Henderson Another KGB Comix Night has come and gone. It was a real success, I’d say. As usual, the house was full and folks sat on the floor. The crowd was friendly and forgiving of the fact that our projector is old and our screen is a white shower curtain. The show is a little punk rock, but hey it’s also free. There was a lot of range in the readings this year. Julia Wertz started with her latest auto bio comics. Her humorous asides really added to the reading. Next it was Alabaster, who shared a sweet and sad tale. And man, the art was so beautiful I wanted one of the panels tattooed on my flesh (well, maybe not because I’m chickenshit about tattoos and generally not a fan of them). Nathan Bulmer followed with some strips that really had the house laughing. Gabrielle Bell’s strips were hilarious too, with that own distinctive voice which we love so well. Jeffrey Lewis ended the night by talking about the complex comic/album art he created for his cd A Turn in the Dream Songs (LOVE this album). A lot more thought and puns when into the art than I ever realized. We raffled off some prizes and collected two boxes of book donations for CCS and SAW. I had a good time, and I’m grateful that the comics community let its shyest, most anxious public speaker host this thing again. I’ll be doing it again on Easter Sunday. Tagged events, KGBLeave a comment Comix Night at KGB! It’s that time again! Please join us for a FREE night of comics, friendship, and raffle prizes! Annual Post Thanksgiving Comix and Graphic Novelist Night Sunday, November 25 7pm See the Facebook invite! Join us for the annual Post Thanksgiving Comix and Graphic Novelist Night! With special guest readers Gabrielle Bell, Alabaster, Julia Wertz, Nathan Bulmer, and Jeffrey Lewis. Hosted and curated by Robyn Chapman Our annual comics reading event is more than just a night of entertainment–it’s a book drive with awesome raffle prizes! Donate a graphic novel or $5 at the door to be entered in our raffle! Book drive donations will benefit The Center for Cartoon Studies and The Sequential Artists Workshop (and I’ll give a little cash to the readers too). Gabrielle Bell was born in England and raised in California. In 1998 She began to collect her “Book of” miniseries (Book of Sleep, Book of Insomnia, Book of Black, etc), which resulted in When I’m Old and Other Stories, published by Alternative Comics. In 2001 she moved to New York and released her autobiographical series Lucky, published by Drawn and Quarterly. The title story of Bell’s book, Cecil and Jordan in New York has been adapted for the film anthology Tokyo! by Michel Gondry. Her latest book, The Voyeurs, is available from Uncivilized Books. She lives in Brooklyn, New York. Alabaster is an illustrator and cartoonist living in Brooklyn, New York. The character Talamaroo has appeared is several of her comics, which are each self-published and hand crafted by the author. Julia Wertz was born in the San Francisco bay area in 1982. She is the author/illustrator of the unfortunately titled autobiographical graphic novels The Fart Party vol 1 and vol 2, Drinking at the Movies and The Infinite Wait and Other Stories. She currently lives in Brooklyn, New York and makes comics at Pizza Island (RIP). Her work appears in absolutely no other publications and she’s an irregular contributor to twitter. Nathan Bulmer is an illustator whose work has graced the pages of Time Out New York, Seattle Magazine, The Kansas City Star, and The Pitch Weekly. He’s even shown work in galleries like Dieu Donne in New York and Grand Arts, The Bank, The Bakery, and various other galleries in Kansas City, Missouri. Born and raised Lower East Sider Jeffrey Lewis leads a double-life, as both a comic book writer/artist and a musician (or is that a triple-life?). His critical writings on the comic book Watchmen have lead to Jeffrey lecturing all over the world. Jeffrey’s most recent self-published comic book Fuff is an anthology series combining biographical pieces, fiction, and travelogues, and is currently up to issue eight. Tagged Alabaster, CCS, events, Gabrielle Bell, Jeffrey Lewis, Julia Wertz, KGB, Nathan Bulmer, SAW	cc/2021-04/en_middle_0039.json.gz/line1104
__label__cc	0.697894	0.302106	All the president’s merch: the best Biden-Harris clothing – in pictures By Melanie Wilkinson and Priya Elan From Biden/Harris socks to a tie-dye t-shirt, here are 10 pieces of election merch marking a historic moment Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/20/all-the-presidents-merch-the-best-biden-harris-clothing-in-pictures By Priya Elan Magazine plans limited edition with new photo after original was widely seen as disrespectful Vogue will publish a limited print edition of its February issue, featuring Kamala Harris, with a new photo following widespread backlash against an original cover image widely held to lack respect for the vice-president-elect. The limited edition, with […] By Priya Elan In-store shoppers also adapt behaviour to avoid false accusations of shoplifting, study by French beauty company Sephora reveals Shoppers from minority groups are more likely to shop online than go into a store, in order to avoid racial profiling, according to a new report. The study from the French beauty company Sephora […] Long johns for Prada as Milan fashion week goes online By Morwenna Ferrier Collaboration between Miuccia Prada and Raf Simons, only the second for the designers, includes gloves and comfort-wear At a time when the relevance of high fashion is being questioned, Prada’s menswear show in Milan addressed the criticism with an unusually practical item of clothing: a pair of long johns. Speaking after an […] ‘Hate-wear’ and ‘sadwear’: fashion’s new names for lockdown dressing By Priya Elan NYT and Esquire coin terms for the ways people are expressing frustration through clothes Coronavirus – latest updates See all our coronavirus coverage With online sales booming but retail in sharp decline, the pandemic has changed shopping for ever. Practical, comfortable items suitable for a lifestyle of working from home and occasional […] Fashion goes soft as Fendi turns boots into slippers By Jess Cartner-Morley Milan fashion week is virtual this year, but Fendi has a six-minute menswear showstopper focusing on lockdown comfort The first outfit in Fendi’s latest luxury menswear line-up was showcased on Saturday in a music video-style film streamed from a digital-only Milan fashion week. It starred the padded olive silk inner lining of […] Biden’s plan to wear Ralph Lauren fits inauguration’s sober, unshowy tone By Priya Elan Fashion brand reported to be dressing the president-elect, a move that would subtly signal a distancing from the Trump era Joe Biden is being dressed by the fashion brand Ralph Lauren for his presidential inauguration on 20 January, according to Women’s Wear Daily, in a move that has prompted a round of […] Bodycare products: 10 of the best \| Funmi Fetto By Funmi Fetto Soaps, lotions, peels and treatments that really go skin deep Aside from Ameliorate launching products to treat keratosis pilaris (the rough bumpy skin that resembles a plucked chicken), body care hasn’t been particularly innovative. Yes, there are oils that smell so good they double up as scents; there are moisturisers that penetrate […] Kings of the robe: 12 of the best dressing gowns for men – in pictures By Helen Seamons Whether you go for short and silky or luxurious and fleecy, why not bring some old-school elegance to lounging around at home? Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/16/kings-of-the-robe-12-of-the-best-dressing-gowns-for-men-in-pictures The edit… 20 socks to bring you joy – in pictures By Peter Bevan Give yourself happy feet in these cold, gloomy months with a pair of warm, bright and colourful socks Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/16/the-edit-20-socks-to-bring-you-joy-in-pictures We love: fashion fixes for the week ahead – in pictures By Jo Jones and Helen Seamons Loewe team up with cult animated film My Neighbour Totoro; Lazy Oaf take a hike, and Hush launch activewear Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/16/we-love-fashion-fixes-for-the-week-ahead-in-pictures 20 of the best… Men’s hoodies – in pictures By Peter Bevan It’s the weather to hunker down in a stylish hoodie. Here’s our pick of the best in show Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/16/20-of-the-best-mens-hoodies-in-pictures The makeup and scents that lifted my 2020 \| Sali Hughes By Sali Hughes The best eyeshadow, primer, infinity powder, mascara and fragrances for the year of Zoom and social distancing My favourite makeup picks of 2020 inevitably reside mostly above mask level. My thoughts on my favourite luxury eye palette, Vieve’s The Essentials (£43 for 10 x 3.1g), were well-documented in a recent column, but […] David Bowie’s golden years – in pictures The new biopic Stardust takes a wry look at the star’s first attempt to break America in 1971. Here’s how he went on to define his own style in the decades that followed Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/15/david-bowies-golden-years-in-pictures ‘We need to be in it’: fashion labels vie for a role in Sex and the City By Hannah Marriott TV show’s return offers a lucrative opportunity for any designs lucky enough to be featured After a bruising 10 months of store closures, falling sales, cancelled red carpets and nixed shows, the fashion industry finally had something to smile about this week with the announcement of the return of Sex and the […] How to wear ugly shoes \| Priya Elan By Priya Elan When it comes to Uggs, Crocs and other soft-sole shoe saviours, there’s only one rule, and it is: there are no rules What is this look? Is it normcore? Is it pure sloth? Dad shoes? I really don’t know anymore. And frankly, I don’t care. As we drag our slovenly bodies through […] From morning candles to pavement scooters: this week’s fashion trends By Guardian Staff What’s hot and what’s not in fashion this week The Blob Ugly trainers were due an upgrade. May we introduce the hilariously GQ-coined Blob, so-named because, well – look at it. Continue reading… Via:: https://www.theguardian.com/fashion/2021/jan/15/from-morning-candles-to-pavement-scooters-this-weeks-fashion-trends Specs appeal: how to buy glasses online – in pictures By Melanie Wilkinson With many shops still open to allow eye exams, it’s a good time to rethink your eyewear. Or why not order from some of the brands offering an array of styles online? Continue reading… Via:: https://www.theguardian.com/fashion/gallery/2021/jan/14/specs-appeal-how-to-buy-glasses-online-in-pictures Archives Select Month January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 March 2020 February 2020 January 2020 December 2019 July 2019 June 2019 May 2019 April 2019 February 2019	cc/2021-04/en_middle_0039.json.gz/line1105
__label__cc	0.689079	0.310921	Phormium tenax - J.R.Forst.&G.Forst. Common Name New Zealand Flax, Coastal Flax, New Zealand Hemp Family Agavaceae USDA hardiness 8-10 Known Hazards None known Habitats Lowland swamps and intermittently flooded land, North South Stewart, Chatham and Auckland Islands[44]. Range New Zealand. Naturalized in Britain in S.W. England[17]. Weed Potential Yes Bloom Color: Red. Main Bloom Time: Early summer, Late spring. Form: Upright or erect. Phormium tenax is an evergreen Perennial growing to 3 m (9ft) by 2 m (6ft) at a fast rate. It is hardy to zone (UK) 8 and is not frost tender. It is in leaf all year, in flower from June to July. The species is hermaphrodite (has both male and female organs). Suitable for: light (sandy), medium (loamy) and heavy (clay) soils. Suitable pH: acid, neutral and basic (alkaline) soils and can grow in saline soils. It can grow in semi-shade (light woodland) or no shade. It prefers moist or wet soil. The plant can tolerate maritime exposure. Woodland Garden Sunny Edge; Bog Garden; Cultivated Beds; Edible Parts: Nectar Edible Uses: Coffee Gum Gum The roasted seed is used as a coffee substitute[153, 173]. An edible nectar is obtained from the flowers[173]. Very wholesome eating[183]. A long hollow grass-stalk or straw is used to suck it out of the flowers[183]. An edible gum is obtained from the base of the leaves[173]. Adhesive Alcohol Basketry Dye Fibre Gum Gum Paper Tannin A very high quality pliable fibre is obtained from the leaves[11, 57, 61, 128, 153]. It is used in the manufacture of ropes (they are not very strong[46]), twine, fine cloth etc. The fibre can also be used for making paper[189] The leaves are harvested in summer, they are scraped to remove the outer skin and are then soaked in water for 2 hours prior to cooking. The fibres are cooked for 24 hours with lye and then beaten in a ball mill for 4 hours. They make a cream paper[189]. The split leaves can be used to make nets, cloaks, sandals, straps etc[153]. They are also used in making paper and basket making[153, 169]. A strip of a leaf is an excellent emergency string substitute for tying up plants in the garden, it can be tied into a knot without breaking[128]. The leaf pulp, after the fibre has been removed, can be fermented to make alcohol[153]. A gum found in the leaves is used as a paper glue[173]. A brown dye is obtained from the flowers[168], it does not require a mordant[169]. A terra-cotta dye is obtained from the seedpods[168]. A mauve can also be obtained[168]. The flowers are rich in tannin[168]. Carbon Farming Food Forest Industrial Crop: Fiber Management: Standard Minor Global Crop Landscape Uses:Border, Container, Foundation, Massing, Specimen. Prefers a rich loamy soil[1] but is not too fussy, succeeding in peaty soils and in boggy moorland[11]. Tolerates light shade[1] but prefers full sun[200]. Plants can be grown in quite coarse grass, which can be cut annually in the autumn[233]. Prefers a sheltered position[42] but tolerates maritime exposure[75]. Plants tolerate occasional flooding with saline water[200]. Plants can withstand temperatures down to about -11°c[42], but they can be killed in very severe winters in Britain[11]. A polymorphic species[78], there are many named varieties grown in Britain[11, 200]. This species hybridizes readily with P. colensoi and there are many named forms that may be hybrids with that species[11]. This plant has been considered for commercial cultivation for its fibre, though there is some difficulty in mechanically extracting the fibres due to the presence of a gum in the leaves. An alkali has been successfully used to break down the gum but this weakens the fibre. The Maoris had selected many different cultivars for different uses[153]. Members of this genus are rarely if ever troubled by browsing deer or rabbits[233]. Special Features: Attractive foliage, Not North American native, Attractive flowers or blooms. Carbon Farming Industrial Crop: Fiber Clothing, rugs, sheets, blankets etc. Currently, almost none of our fiber are produced from perennial crops but could be! Management: Standard Plants grow to their standard height. Harvest fruit, seeds, or other products. Non-Destructive management systems. Minor Global Crop These crops are already grown or traded around the world, but on a smaller scale than the global perennial staple and industrial crops, The annual value of a minor global crop is under $1 billion US. Examples include shea, carob, Brazil nuts and fibers such as ramie and sisal. The seed is best sown as soon as it is ripe in a cold frame. Sow stored seed in February in a cold frame. Germination is sometimes poor but should take place in 1 - 6 months at 15°c. The seedlings are very variable. When they are large enough to handle, prick the seedlings out into individual pots and grow them on in the greenhouse for at least their first winter. Plant them out into their permanent positions in late spring or early summer, after the last expected frosts. The seed remains viable for about 12 months in normal storage[1]. Division in spring as growth commences. Very easy, larger divisions can be planted out direct into their permanent positions. We have found that it is better to pot up the smaller divisions and grow them on in light shade in a cold frame until they are well established before planting them out in late spring or early summer. Phormium cookianum Wharariki Perennial 1.2 7-10 LMH SN MWe 2 0 0 J.R.Forst.&G.Forst. Thu Oct 12 2006 I am interested in which animals eat parts of NZ flax. Also which animals now extinct ate the plant. I have seen plants where sheep have apparently stripped the upper ends of leaves of the non-fibrous material leaving the "beaten" fibres. mysteriously eaten Thu Nov 2 2006 I'm interested in what animal(s) eat phormium "bronze baby". We have some bronze baby that were eaten to the root. Ken Fern, Plants for a Future. Mon Nov 6 2006 The only creature we have read about that eats New Zealand Flax plants in New Zealand is a bird called the Pukeko - it seems to have a similar mainly ground-dwelling habit like the Pheasant. It is quite likely that other creatures also eat the plant, though looking at the leaves you wonder why! David Nicholls Sun Nov 26 2006 I feel much more comfortable using flax leaves for tying stakes to trees. Although they are increadably strong initially,they are likely to have disintegrated or weakened before a tree gets so big it starts to get cut by a non-organic tying material like plastic or metal, which can cut into the tree possibly killing it. That's happened to me. I've been using it this way for a year, so far so good. Cant give any guarantees but thought approach worth a mention. I feel much more comfortable using flax leaves for tying stakes to trees as although they are increadably strong initially,they are likely to have disintegrated or weakened before a tree gets so big it starts to get cut by a non-organic fastening material like plastic or metal, which can cut into the tree possibly killing it. It's happened to me before. I've been using it this way for a year, so far so good. Edible use of immature seeds - I haven't managed to cross reference this elsewhere yet. Oct 2 2011 12:00AM Wild Picnic Subject : Phormium tenax	cc/2021-04/en_middle_0039.json.gz/line1107
__label__wiki	0.945238	0.945238	The EV's Golden Age: 5 New Electric Cars That Will Defy Your Expectations J.P. Anderson \| December 23, 2020 \| Lifestyle From 500-mile ranges to sexy new stylings, the latest class of battery-powered cars puts forth a convincing argument that the golden age of luxury EVs is on its way. Here are five autos to keep your eye on. 2023 CADILLAC LYRIQ The Cadillac Lyriq marks the iconic brand’s first foray into the EV realm. The legacy brand’s first foray into the EV realm, this sleek crossover offers solid range at 300 miles and might just boast the coolest tech features of this bunch: Think hands-free driving with Super Cruise, remote self-parking whether the driver is inside or outside the vehicle, and an overhauled sound system that both reduces road noise and transforms in-auto sound with a 19-speaker AKG system. Sounds sweet to us. Available early 2022 The 2021 Lucid Air is set to be one of the most anticipated debuts of the coming year. Inspired by the glamour and innovation of California, upstart automaker Lucid Motors has thrown down the gauntlet with its debut vehicle. The numbers speak for themselves: Up to 1080 horsepower; range of up to 517 miles; and a mere 20 minutes to DC fast-charge to 300 miles—plus a luxurious interior complete with glass canopy roof. And with more than 20 “studios” set to open in 2021, it’s clear that Lucid’s star is on the rise. Available spring 2021, Touring model from $95,000 Porsche’s Taycan proves that EVs can be a thrill to drive. Porsche’s buzzy debut EV was an astonishing success, outselling every other sedan and coupe from the brand in the U.S. in the year’s third quarter. Given the model’s sexy looks and adrenaline-pumping power speed (the Turbo S gallops from 0 to 60 in 2.6 seconds), we’re not surprised. For 2021, look for improvements in charging convenience, battery preservation potential and a new Smartlift program that allows the car to be programmed to automatically rise over user-specified speed bumps and driveways. Available early 2021, from $103,800 2021 AUDI E-TRON SPORTBACK Audi’s e-tron Sportback scores high marks for its refined design. While not a world-beater in the range department at a mere 218, Audi’s second EV in its charge to reach 30% electrified models in the U.S. by 2025 is a compelling option nonetheless thanks to its refined design, superior comfort and impressive performance. Our favorite add-on for ’21? Charging ports are now offered on both sides of the vehicle for optimal convenience. From $69,100 2022 KARMA GSE-6 SoCal startup Karma aims to make a major impact on the EV scene with its GSe-6. The second Cali startup to make our list, this 6-year-old Irvine-based outfit turned heads with the plug-in hybrid Revero GT, a looker with an EV range of 80 and a full tank range of 360 (the wheels are driven by a pair of electric motors, while the gas engine fuels the battery pack), which was named 2020 Luxury Green Car of the Year by Green Car Journal. Next up? The company goes full-on EV with the GSe-6, sure to be one of the most stylish electrics to hit the market in the coming year. Available late 2021, $79,900 Photography by: All photos courtesy of brands	cc/2021-04/en_middle_0039.json.gz/line1108
__label__cc	0.539743	0.460257	US1 Crashes a Party Let’s Try Richard K. Rein Pia de Jong Summer Fiction Poetry Summer Fiction Prose Princeton Info Family Guidance: Offers Emotional and Financial Wellness Family Guidance Center Corporation (FGCC) offers a broad spectrum of services designed to improve the emotional and financial wellness of families throughout Mercer County. The Agency serves more than... Time to Lean In For The Legal Profession When Corrine Cooke began her career in the law, she had everything she needed for success: skills, a top-notch legal education and a clerkship behind her. But there... Dr. Dorota Gribbin: Diagnosis, Prevention, and Treatment of Pain A pain in the neck can literally be a pain in the neck. The key is knowing the best doctor who can alleviate the cause. Dr. Dorota Gribbin, whose... Discover the Traffic Laws That No One Knows About Here’s something you probably didn’t know: in New Jersey, you’re not supposed to be riding your bike in the shoulder. Ever. You’re supposed to ride it in the same... Collaboration Is Key At Innovators Guild Tom Sullivan of the Princeton Partners marketing company in Forrestal Village is looking for companies to join the “Princeton Innovators Guild,” a new kind of collaborative workspace in which... Route 206 will be closed in both directions south of Princeton beginning Wednesday, July 5, through December, for bridge repairs. The Department of Transportation said it plans to repair... Santé Integrative Pharmacy: Full-Service Pharmacy for Healthy Living If the phrase “drug store” conjures up images of odd smelling nostrums and rows of pill bottles, think again. Santé Integrative Pharmacy is not your grandparents’ shop. Conveniently located... Water Plan: Alarming New Jersey’s almost 9 million residents make this state denser than India or Japan. And the population is projected to grow to 10.2 to 10.4 million by 2040. Will... Richard K. Rein’s column last week on PNC Bank’s Chris Lokhammer, who died June 9 at the age of 68, triggered many responses from readers who had their own... Princeton Medical Group: Welcoming Dr. Tanner Tridico Princeton Medical Group warmly welcomes Dr. Tanner J. Tridico, MD to their staff. Dr. Tridico is a board certified doctor specializing in internal medicine. Prior to joining the team... Subscribe to the U.S. 1 News mailing list U.S. 1 is Princeton's entertainment and business newspaper. To contact us, email hastings@princetoninfo.com or call 609-452-7000. About U.S. 1 Newspaper © Princetoninfo	cc/2021-04/en_middle_0039.json.gz/line1121
__label__wiki	0.875858	0.875858	REP. WAXMAN INVESTIGATING QUAYLE COUNCIL PROPOSALS FOR FDA DRUG APPROVALS; POSSIBLE HEARING ANGLES ARE LILLY INFLUENCE AND INTRA-AGENCY RESERVATIONS House Energy & Commerce/Health Subcommittee Chairman Waxman (D-Calif.) is looking into the shaping of the FDA drug approval process reforms announced jointly by Vice President Quayle's Council on Competitiveness and the agency as a prelude to possible hearings next year. One of the lines of inquiry involves the extent of possible influence on the council by the pharmaceutical industry. For example, in a letter to the council, Waxman pointed out several ties between the White House and Lilly. President Bush is a former member of Lilly's board of directors; Vice President Quayle often represented his constituent company in negotiations as a senator from Indiana; and Lilly Corporate Affairs Division VP Mitchell Daniels was a political director in the Reagan White House. The council is understood to have asked Lilly for technical advice in drawing up a number of its proposals. If Waxman holds a hearing focusing on industry influence on the proposals to streamline the FDA approval process, he can choose from a host of potential industry witnesses that made presentations before the council. The Pharmaceutical Manufacturers Association, the Industrial Biotechnology Association and the Association of Biotechnology Companies presented their views to the council. In addition, the council heard presentations from various groups such as the FDA Council, the American Medical Association, the American College of Pediatrics, the Cystic Fibrosis Foundation, the American Cancer Society and the Alliance for Aging Research. Waxman is one of several members of Congress who are examining the council's role in reviewing FDA regulation. Waxman, Rep. Dingell (D-Mich.) and Sen. Kennedy (D-Mass.) jointly signed a Nov. 13 letter asking FDA Commissioner Kessler not to implement any council recommendations until they have been reviewed by Congress, and all three legislators are said to be interested in holding hearings on the proposals. Rep. Weiss (D-N.Y.) issued a subpoena for documents recording correspondence between the council and FDA ("The Pink Sheet" Nov. 18, p. 9). FDA supplied the documents on Nov. 21, and they are under review by Weiss staffers. Because the agency supplied the requested documents, Weiss canceled a hearing that had been scheduled for Nov. 22 before his House Government Operations/Human Resources and Intergovernmental Relations Subcommittee. In addition, the Senate Governmental Affairs Committee chaired by Sen. Glenn (D-Ohio) is investigating the Competitiveness Council's role in reviewing FDA regulations. One committee member, Sen. Levin (D-Mich.), has complained that Congress has no means to determine the council's influence on FDA's rulemaking process ("The Pink Sheet" Sept. 30, T&G-10). Levin is particularly interested in how draft nutritional labeling proposals were changed by the council before being published. Predicted resistance to the proposals by FDA career employees has surfaced. In a Nov. 20 letter to Vice President Quayle, FDA Oncology and Pulmonary Drugs Division Medical Reviewer Grant Williams, MD, maintained that independent reviews of Phase I INDs by Institutional Review Boards would endanger study subjects. "It is my duty to inform you of what I perceive to be a real danger to the lives of patients receiving investigational cancer drugs," Williams wrote. The council's recommendation that FDA allow local IRBs to review and approve IND requests to conduct Phase I trials was one of 11 reforms targeted at improving the drug approval process ("The Pink Sheet" Nov. 18, p. 7). Williams maintained that over the past two years of reviewing NDAs in the division, he has "noted numerous dangers in applications that were not foreseen by investigators or [IRBs]." Williams said it is "unbelievable" what IRBs can overlook. "The full ramifications of data involving chemistry, animal toxicity, pharmacokinetics and mechanistic factors" cannot be appreciated by reviewers who are not exposed to such situations frequently, Williams argued, adding that "such exposure is unlikely to occur at the typical IRB." Williams contended that "some patients would likely have died from unforeseen drug toxicity" without intervention from FDA reviewers who are trained in pharmacokinetics. Such a situation allegedly occurred with Fujisawa's anti- transplant rejection drug FK-506. The local IRB had cleared University of Rochester Phase I studies to start with a high dose of FK-506. However, the dose was lowered after FDA Pulmonary and Oncology Division Director Gregory Burke, MD, intervened. Williams said the drug was associated with renal toxicity that was not observed at the beginning of the trials. The medical reviewer further suggested that "changes at the IND stage are unlikely to speed the development of drugs unless investigators resort to unethical practices." He pointed out that the division currently does not put INDs on clinical hold unless the submission "appears very dangerous or is obvious quackery." Routine problems generally are resolved "quickly" by telecopy or telephone without instituting a clinical hold, he said. Williams pointed out that FDA Center for Drug Evaluation & Research Director Carl Peck, MD, is encouraging faster Phase I development of cancer drugs by using pharmacokinetic data in early trials. The strategy, which also allows improved individualized dosing, will be lost if IRBs review Phase I trials independent of FDA, Williams said. "Other negative effects" that may result from the proposal include "investigational quackery," which Williams said "will increase exponentially in the cancer area." IND data not reviewed by FDA "will be used to attract patients to exotic centers for the newest potion," he maintained. "Enough of this goes on now even with the existing structure," he acknowledged. "At later stages of drug development, we will be faced with Phase I or Phase II data from human trials which may be of questionable quality." Williams recommended limiting FDA authority to place studies on clinical hold as an alternative strategy to speeding Phase I development. "It would be more constructive to continue the requirements for IND registration with the agency, and only curtail agency authority to put the study on clinical hold in these particular circumstances." Such an alternative would reflect FDA regulation of "new protocols submitted under an improved IND," Williams noted. "For new protocols agency registration is required, [but] prospective approval is not," he explained. "However, the agency has the opportunity to review and comment on the design and safety of such protocols after their submission." Subject: REP. WAXMAN INVESTIGATING QUAYLE COUNCIL PROPOSALS FOR FDA DRUG APPROVALS; POSSIBLE HEARING ANGLES ARE LILLY INFLUENCE AND INTRA-AGENCY RESERVATIONS	cc/2021-04/en_middle_0039.json.gz/line1126
__label__wiki	0.922238	0.922238	Prog Archipelago Prog Festival List 2020 Proglodytes Picks: Sons of Ra April 6, 2018 cirdecsongs Features Leave a comment Originally published on cirdecsongs.com, Part 1 of the Bands of Progtoberfest series Being an opening act isn’t easy. The first band on stage is there to warm up the crowd and prepare them for an evening of musical entertainment. Their notes establish the evening’s tone, and could ultimately determine just how engaged the audience will be. A poor performance sets a bad precedent, and the opening act has about 30 seconds to see to it that doesn’t happen. The first band on stage must also make an impression on its own behalf, lest it get lost in the shuffle of people waiting to hear the sounds of the evening’s headliner. After all, opening acts want to ultimately become headliners. It’s hard enough setting the tone for two or three bands in one evening. Imagine the feeling of opening on behalf of three dozen other bands, performing over three days. That was the task Sons of Ra faced at Progtoberfest in Chicago last year. The band not only accepted the challenge, they relished it, performing an airtight 35-minute set. The audience at Reggie’s Music Joint got to see something truly special. “(Progtoberfest) was the main thing we were looking forward to all year,” said guitarist Erik Oldman. “We’d been playing locally and regionally, and I really wanted to get us on a major bill. This was a big opportunity for us.” The band was familiar with Reggie’s, having played there on several other occasions, including their EP release party. The band’s friends usually attended those shows. This was a little different. “We were one of a handful of local acts playing the festival,” Oldman remarked. “Being (at Reggie’s) was one thing. But seeing that many people there was something else!” Sons of Ra are a power trio, and natives of Chicago. The band also features Keith Wakefield on bass and Marc D. on drums. Their sound is a hybrid of progressive rock, metal, and jazz-fusion. That being said, the band is not beholden to any of these forms, choosing instead to use the genres to create a sound all their own, rather than being merely the sum of their influences. The band used the wealth of sound at its disposal to record their first EP, called Anthropology, which was released in 2016. The band playing on that EP and the one performing at Progtoberfest nearly sounded like two different groups. The Progtoberfest band sounded more seasoned and experienced. They were comfortable with their material (to say nothing of the cover of King Crimson’s “Red”) and played with confidence and a touch of swagger. Without a doubt, they knew what they were doing. “Since a tenet of the music we play is that some sections of the piece are improvisational in nature, certain sections of the piece evolve and tighten up over time,” Oldman said. “We also had a fairly rigorous calendar, playing out regularly since the EP was released. So the sheer act of playing it live so much really helped to tighten things up.” Sons of Ra have no interest in resting on its collective laurels. The future beckons, and they are ready to move forward. Oldman calls Anthropology a “snapshot” of the band’s progress. “We’re ready to move on, and go deeper into this unified fusion sound,” said Oldman. “We’ll be paying homage to bands like Return to Forever and the Mahavishnu Orchestra, but with a fresh approach. We’ll also aim to make ourselves more accessible (to casual fans) by writing a few shorter tunes.” The sky is truly the limit for the Sons of Ra. It would be ill-advised to ignore this band. #cirdecsongs Sons of Ra cedriccirdecsongshendrixprogressive rockprogtoberfestsons of ra Previous Post: Album Review: Rabbit Rabbit Radio, “Black Inscription” Next Post: Concert Review: The Eagles at Rupp Arena, 4-10-2018 View proglodytes’s profile on Facebook View ProglodyteMusic’s profile on Twitter Proglodytes Radio Two Brothers Discuss Prog News and Interview Prog Artists A weekly discussion of progressive rock and metal news, with occasional special guests. Arthur and Thomas Hatton Interview with Lars… on Album Review: Major Parkinson,… AG on Wait With Hope- by Patrick McG… Benjamin White on Wait With Hope- by Patrick McG… Leonardo on Album Reclamation Project: Yes… Proglodytes Picks: 2… on Album Review: Elder, “Om… 2016 adrian belew album review arthur avant garde ben levin bent knee big big train carla kihlstedt concert review courtney swain cruise to the edge daniel gildenlow dave kerzner band devin townsend devin townsend project district 97 dream theater dream the electric sleep elder elp empath evership gavin wallace ailsworth gazpacho genesis haken iamthemorning jim britt John Wesley jolly keith emerson king crimson kings x kscope major parkinson marillion mike keneally Mike Portnoy moron police music neal morse nick dvirgilio pain of salvation patreon Podcast porcupine tree Prog proglodytes proglodytes radio proglodytes radio podcast prog metal progressive progressive metal progressive rock progressive rock festivals prog rock progstock progstock 2018 progtoberfest queensryche review rush schooltree steve hackett steve howe steven wilson Thank You Scientist the mercury tree the tea club thomas tool video xerxes yes Authors’ Domain Help Support Our Site! Running a site like this isn't free. We rely on ad revenue, but it doesn't always cover our domain costs. If you'd like to make a donation, we would be very, very grateful!	cc/2021-04/en_middle_0039.json.gz/line1131
__label__cc	0.620681	0.379319	Legal Beagle by Graeme Edgeler 1:58PM Jul 26, 2012 • Read Post Legal Beagle: Johndotbanks - the law is over, let the politics commence Rich of Observationz, 13:58 Jul 26, 2012 Do similar laws apply to tax returns? If I get an assistant to raise, file and bank my invoices, never look at a bank statement, and then have another assistant produce a tax return that says I made $25k last year, is that ok? Back in Wellington • Since Nov 2006 • 5550 posts Report Reply Graeme Edgeler, in reply to Rich of Observationz, 14:02 Jul 26, 2012 Different rules apply to tax returns. Wellington, New Zealand • Since Nov 2006 • 3207 posts Report Reply Steve Curtis, 15:14 Jul 26, 2012 The tax return just asks if 'the information is true and correct'. Graeme Edgeler, in reply to Steve Curtis, 15:25 Jul 26, 2012 But the offence provision in the statute makes you responsible for it, whether you've read it or not. merc, 16:19 Jul 26, 2012 The reason that police decided that they could not properly charge Mr Banks is that, in effect, they did not believe they could prove he had read the return before he signed it,... Maybe they should be forced by law to read the thing they are signing, then they could not say they hadn't read it, to weasel out of responsibility. As for political cost, both you and I know, there will be none. Since Dec 2006 • 2471 posts Report Reply DexterX, in reply to Graeme Edgeler, 17:21 Jul 26, 2012 In relevant judgements on tax matters - The judge will always refer the person to their declaration - which the IRD kindly print on all returns - "I declare that the information given in this return is true and correct" This form of declaration is given in judgements as the basis for refusing to remit substantial penalties or grant an errant taxpayer any consideration that results from an honest error. What I always do is qualify my tax returns declaration to "I declare that the information given in this return is true and correct to the best of my knowledge and ability". Peter Green, 21:24 Jul 26, 2012 What does this mean for Key's "complied with the law" test? Presumably "avoided scrutiny until the time limit expired" passes somewhat under that bar? Graeme Edgeler, in reply to Peter Green, 23:07 Jul 26, 2012 What does this mean for Key’s “complied with the law” test? Presumably “avoided scrutiny until the time limit expired” passes somewhat under that bar? This mean police probably think John Banks did not comply with the law. They haven't expressly said that, saying that John Banks did not knowingly file a false donation return, and it was too late for us to bother investigating whether he had broken the law by failing to take due care. That said, even if Police think Banks did break the law, but escapes prosecution because of a limitation clause, that's only their view. They're no judges, and they're not infallible. Banks has a legal right to be presumed innocent and any offending he engaged in was so minor that it is considered of a type we don't bother about after six months. Maybe police got it wrong. It certainly wouldn't be the first time. Even if John Banks knew who was donating money to him, the same can likely also be said of Len Brown. The only difference with Len Brown is that his campaign deliberately used a structure under which campaign donors' identities can be made expressly known to the candidate without being declared, and Bank's campaign did anything they might have done in a much more haphazard amateurish way. I said that the the law was over, and it was time for politics. That's not quite true. There's also a place for the law to be fixed so this can't happen at all, whether it happened this time or not. The law should not allow secret donations, or anonymous donations, or donations made through trusts. Sacha, in reply to Graeme Edgeler, 00:13 Jul 27, 2012 any offending he engaged in was so minor that it is considered of a type we don't bother about after six months Which tells us what our Parliament believes is important. Ak • Since May 2008 • 19719 posts Report Reply Even if John Banks knew who was donating money to him, the same can likely also be said of Len Brown. Except Len Brown declared his SkyCity donation rather than elaborately contriving to pretend it was anonymous. Ethics, maybe? merc, in reply to Graeme Edgeler, 07:47 Jul 27, 2012 The law should not allow secret donations, or anonymous donations, or donations made through trusts. Tom Semmens, 08:46 Jul 27, 2012 As for political cost, both you and I know, there will be none. I wouldn't be so sure. I was having dinner with an very twin set and pearls Remuera accountant on Wednesday night and she was disgusted with Banks. Epsom/Remuera is full of people who are like to think they are quite "proper". Bank's reputation has taken a helluva a battering over this. I am pretty sure that as long as National select a candidate for Epsom in 2014 then he or she will defeat Banks. Sevilla, Espana • Since Nov 2006 • 2217 posts Report Reply Sofie Bribiesca, in reply to Peter Green, 09:11 Jul 27, 2012 Was difficult to fathom in the House yesterday when Trevor did his best to angle a question (supplementary) in about Banks, Key was missing and Foss was trying to avoid answering. But Trevor and Grant Robertson pushed the information out there and the National Party objected to the letter being tabled. The Herald has this, presumably from Wednesday in the House here and there. • Since Nov 2007 • 6796 posts Report Reply merc, in reply to Tom Semmens, 09:14 Jul 27, 2012 Yes I know those people, and they are very vocal in their abrogation of the man, however they remain glued to agenda. Dieu et mon droit! Andrew Geddis, in reply to Tom Semmens, 09:20 Jul 27, 2012 "I am pretty sure that as long as National select a candidate for Epsom in 2014 then he or she will defeat Banks." According to Stuff, "sources close to the Epsom MP have indicated he will not stand at the next election." linger, in reply to Andrew Geddis, 09:35 Jul 27, 2012 So he'll be lying at the next election? Well, won't that be a change :-P Ian Dalziel, in reply to merc, 09:57 Jul 27, 2012 Dieu et mon droit! Dieu et mon gauche? tres... Christchurch • Since Dec 2006 • 7944 posts Report Reply Kumara Republic, 10:17 Jul 27, 2012 And in the Granny, one of John Armstrong's personalities agrees the law is an ass. The southernmost capital … • Since Nov 2006 • 5430 posts Report Reply merc, in reply to Kumara Republic, 10:35 Jul 27, 2012 Because Key needs to be covered and Banks is ACT, all very predictable. In Key's case, he is several steps removed from what happened during the last Auckland mayoralty campaign - and can thus at least try to distance himself to a degree from Banks. I see what he did there, The public have become hardened to such realities and how major party leaders have to turn a blind eye to indiscretions by their minor party support partners. If they did not, Governments would topple at regular intervals. From Todd in comments, 2.6 The Prime Minister alone has the right to advise the Governor-General to:a)appoint, dismiss, or accept the resignation of Ministers; b)dissolve Parliament and call a general election. Paul Campbell, 10:44 Jul 27, 2012 Well no - a bit of evolution-in-action would kick in and what we would get would be a better quality of minor support partners .... if you never kick out the bad ones no one ever learns and a bit of institutional memory is a good thing - sadly after this no one will find themselves saying "remember what happened to Banksy, let's not make that mistake" Dunedin • Since Nov 2006 • 2622 posts Report Reply Kumara Republic, in reply to merc, 11:48 Jul 27, 2012 I suspect it's also the same kind of law being an ass that lets pseudo-meritocracy off the hook in America. Sacha, in reply to linger, 12:23 Jul 27, 2012 So he'll be lying at the next election Paul Williams, 13:25 Jul 27, 2012 The headline for this item is spot on. The decision to not file charges is not surprising but I do fear that too often, NZ Police have not pressed charges when political figures are involved (and yes, I am thinking all the way back to Paintergate). Perhaps every decision has been entirely fair, but the pattern that's developing in my mind is worrying (though perhaps I've been in NSW too long?). In the other thread on this, is a suggestion that an agency other than the Police should determine whether charges are laid. That has an appeal. I may be wrong, but it appears that is the case in NSW where the Director of Public Prosecurtions is the Agency that decides whether or not a prosecution will be undertaken (perhaps though I'm confusing prosecution and charges?) Either way, this case somewhat illustrates my point Sydney • Since Nov 2006 • 2273 posts Report Reply DexterX, 17:29 Jul 27, 2012 Yes, paintergate does spring to mind. Though I think Banks deed is far worese than Clark's. What it represents, to me, is the ongoing and gradual erosion of a NZ society - equal treatment for all in the eyes of the law. It is said that Justice is blind - however - she turns a blind eye much too often. What amazes me is Nick Smith goes but Banks stays as "Minister for Small Business". merc, in reply to DexterX, 17:45 Jul 27, 2012 Intent plays a large part in law I am told - and who is to profit from the act? I don't think Helen Clark's intention was to deceive or defraud (Paintergate). Mr Teapot on the other hand knew those donations were there and who they were from - by definition, not anonymous, however. Now let's agree that Helen wanted that money from that painting to go to charity. For what purpose was the Dotcom donation made? Who was to gain? None of these questions is small, but we will never know because the law is weak, however it takes a very cunning person to manipulate it so and a very ambiguous PM to not recognise this as such. While all this goes on all politicians are tarred with the same brush though they may be of an altogether different disposition. The silence to remedy the weak law is deafening. My solution at the least - all documents you sign, you are culpable for, simple. Election '20: The No Threshold Hypothetical Election '20: The Special Votes Low-Hanging Fruit Legal Beagle Archive Stephen Franks Dean Knight Steven Price	cc/2021-04/en_middle_0039.json.gz/line1138
__label__wiki	0.522436	0.522436	Map: Jackson Lake WY - WY022S Map shows most of Grand Teton National Park, Jackson Lake, and Jenny Lake. Sections of Caribou Targhee and Bridger Teton National Forests adjacent to the National Park are shown. Visit the National Elk Refuge north of Jackson to see herds of elk especially during fall and winter. Enjoy camping, hiking, boating, fishing, wildlife viewing, and scenic driving in the national park and forest. Watch for moose along the Snake River and the lakes. The BLM quadrant maps are scaled at 1:100,000, and cover an area of about 30 x 50 miles. Official Bureau of Land Management metric topographic map @1:100,000 scale (roughly 3/4"`1 mile), color-coded to show surface management, i.e. agency vs. private or tribal ownership. Map shows color coded public and private ownership, roads, water features, recreation sites, points of interest, and the township and range lines. Use the map for OHV use, and WY Deer 148, 149, 150, 155, and 156; WY Elk HU 70,73, 75, 79, and 81. 2008 Wyoming Mountain Goat Hunting Unit 2 Wyoming Moose Hunting Unit 7 Wyoming Moose Hunting Unit 37 Wyoming Elk Hunting Unit 83 Wyoming Deer Hunting Unit 156 Wyoming Bighorn Sheep Hunting Unit 7 Wyoming Bighorn Sheep Hunting Unit 10 Wyoming Antelope Hunting Unit 85	cc/2021-04/en_middle_0039.json.gz/line1139
__label__cc	0.633647	0.366353	Map: McCall ID - ID1040S Map show lands from Long Valley west to Brownlee Reservoir/Snake River. Map includes sections of Payette National Forest north or west of McCall, Payette Lake, Lake Cascade, Cecil D Andrus Wildlife Management Area, and part of the Snake River. From Council travel north, east, or west to explore the national forest with opportunities for camping, hiking, mountain biking, all types of boating, and fishing. Enjoy scenic driving highways or forest roads watching for wildlife and scenic views. Official Bureau of Land Management metric topographic map @1:100,000 scale (roughly 3/4"`1 mile), color-coded to show surface management, i.e. agency vs. private or tribal ownership. Map shows color coded public and private ownership, roads, water features, campgrounds, other recreation sites, points of interest and the township and range lines. ID Hunting Units 22,23,24,31,32A,and 32. 2015 Oregon Hunting Unit 62 Idaho Hunting Unit 32A Idaho Hunting Unit 32	cc/2021-04/en_middle_0039.json.gz/line1140
__label__wiki	0.614288	0.614288	The allopurinol hypersensitivity syndrome. Unnecessary morbidity and mortality Arthritis Rheum. 1986 Jan;29(1):82-7. doi: 10.1002/art.1780290111. J Z Singer, S L Wallace DOI: 10.1002/art.1780290111 Patients receiving allopurinol are at risk of developing the allopurinol hypersensitivity syndrome, an immunologic reaction to the drug, characterized by multiple abnormalities such as fever, rash, decreased renal function, hepatocellular injury, leukocytosis, and eosinophilia. The records of 8 patients with the allopurinol hypersensitivity syndrome evaluated at the Downstate Medical Center hospitals and an additional 72 patients described in the literature were reviewed. All were seriously ill. Three of the 8 patients at the Downstate Medical Center hospitals died as a result of allopurinol hypersensitivity; 19 of the 72 previously described patients also died from consequences of taking the drug. Only 1 of our 8 patients with allopurinol hypersensitivity was given allopurinol for an appropriate reason. Eight of the 59 previously described patients on whom there was adequate information had legitimate indications for allopurinol therapy. Severe, often fatal iatrogenic disease occurred unnecessarily in the others. Allopurinol / adverse effects* Drug Hypersensitivity / etiology Drug Hypersensitivity / mortality* Drug Prescriptions / standards Gout / drug therapy	cc/2021-04/en_middle_0039.json.gz/line1141
__label__cc	0.654051	0.345949	Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis Jose Couto, Sonyia McFadden, Patricia Mc Clure, Paul Bezzina, Ciara Hughes Introduction: The literature identifies various competences required for therapy radiographers (TR), however, these are varied and scattered among different publications. The aim of this study was to identify the competences required by therapy radiographers practising on the linear accelerator in the European setting, according to published literature. Methods: A systematic approach was performed to find relevant literature. The literature was then scrutinised for competences practised by linac TRs. Thematic analysis was performed to organise the competences according to themes. Results: A list of 170 competences were generated based on the assessment of 28 publications. The competences were organised in themes, including “delivery of treatment”, “verification of patient setup”, “patient care” and “teamwork and multidisciplinarity”. The competences of the therapeutic radiographers encompass multiple themes, evidence of the complexity of the role of these professionals. Conclusion: Radiographers across Europe must be trained to the highest standards to ensure the best care possible is given to patients, irrespective of the country the radiographer trained in. This will also promote for free movement of professionals across countries. The competences identified can be used as reference for the design of academic curriculum for TRs practising across Europe. https://doi.org/10.1016/j.radi.2019.06.004 Published - 1 Feb 2020 Therapeutic radiographers 10.1016/j.radi.2019.06.004 Accepted ManuscriptAccepted author manuscript, 121 KB Fingerprint Dive into the research topics of 'Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis'. Together they form a unique fingerprint. Particle Accelerators Medicine & Life Sciences Mental Competency Medicine & Life Sciences Professional Role Medicine & Life Sciences Publications Medicine & Life Sciences Patient Care Medicine & Life Sciences Couto, J., McFadden, S., Mc Clure, P., Bezzina, P., & Hughes, C. (2020). Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis. Radiography, 26(1), 82-91. https://doi.org/10.1016/j.radi.2019.06.004 Couto, Jose ; McFadden, Sonyia ; Mc Clure, Patricia ; Bezzina, Paul ; Hughes, Ciara. / Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis. In: Radiography. 2020 ; Vol. 26, No. 1. pp. 82-91. @article{88e1553693f8450b91a6f47b0cbf0054, title = "Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis", abstract = "Introduction: The literature identifies various competences required for therapyradiographers (TR), however, these are varied and scattered among different publications.The aim of this study was to identify the competences required by therapy radiographerspractising on the linear accelerator in the European setting, according to published literature.Methods: A systematic approach was performed to find relevant literature. The literature wasthen scrutinised for competences practised by linac TRs. Thematic analysis was performedto organise the competences according to themes.Results: A list of 170 competences were generated based on the assessment of 28publications. The competences were organised in themes, including “delivery of treatment”,“verification of patient setup”, “patient care” and “teamwork and multidisciplinarity”. Thecompetences of the therapeutic radiographers encompass multiple themes, evidence of thecomplexity of the role of these professionals.Conclusion: Radiographers across Europe must be trained to the highest standards toensure the best care possible is given to patients, irrespective of the country theradiographer trained in. This will also promote for free movement of professionals acrosscountries. The competences identified can be used as reference for the design of academiccurriculum for TRs practising across Europe.", keywords = "Competencies, Education, Radiation therapist, Standards of practice, Therapeutic radiographers", author = "Jose Couto and Sonyia McFadden and {Mc Clure}, Patricia and Paul Bezzina and Ciara Hughes", note = "Funding Information: This work was co-funded by the SAFE EUROPE project under the Erasmus+ Sector Skill Alliances programme [grant agreement 2018–2993/001-001 ]. The European Commission support for the production of this publication does not constitute an endorsement of the contents which reflects the views only of the authors, and the Commission cannot be held responsible for any use which may be made of the information contained therein. The University of Malta has also provided funding to enable this PhD research. Publisher Copyright: {\textcopyright} 2019 The College of Radiographers Copyright: Copyright 2020 Elsevier B.V., All rights reserved.", doi = "10.1016/j.radi.2019.06.004", journal = "Radiography", publisher = "W.B. Saunders", Couto, J, McFadden, S, Mc Clure, P, Bezzina, P & Hughes, C 2020, 'Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis', Radiography, vol. 26, no. 1, pp. 82-91. https://doi.org/10.1016/j.radi.2019.06.004 Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis. / Couto, Jose; McFadden, Sonyia; Mc Clure, Patricia; Bezzina, Paul; Hughes, Ciara. In: Radiography, Vol. 26, No. 1, 01.02.2020, p. 82-91. T1 - Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis AU - Couto, Jose AU - McFadden, Sonyia AU - Mc Clure, Patricia AU - Bezzina, Paul AU - Hughes, Ciara N1 - Funding Information: This work was co-funded by the SAFE EUROPE project under the Erasmus+ Sector Skill Alliances programme [grant agreement 2018–2993/001-001 ]. The European Commission support for the production of this publication does not constitute an endorsement of the contents which reflects the views only of the authors, and the Commission cannot be held responsible for any use which may be made of the information contained therein. The University of Malta has also provided funding to enable this PhD research. Publisher Copyright: © 2019 The College of Radiographers Copyright: Copyright 2020 Elsevier B.V., All rights reserved. N2 - Introduction: The literature identifies various competences required for therapyradiographers (TR), however, these are varied and scattered among different publications.The aim of this study was to identify the competences required by therapy radiographerspractising on the linear accelerator in the European setting, according to published literature.Methods: A systematic approach was performed to find relevant literature. The literature wasthen scrutinised for competences practised by linac TRs. Thematic analysis was performedto organise the competences according to themes.Results: A list of 170 competences were generated based on the assessment of 28publications. The competences were organised in themes, including “delivery of treatment”,“verification of patient setup”, “patient care” and “teamwork and multidisciplinarity”. Thecompetences of the therapeutic radiographers encompass multiple themes, evidence of thecomplexity of the role of these professionals.Conclusion: Radiographers across Europe must be trained to the highest standards toensure the best care possible is given to patients, irrespective of the country theradiographer trained in. This will also promote for free movement of professionals acrosscountries. The competences identified can be used as reference for the design of academiccurriculum for TRs practising across Europe. AB - Introduction: The literature identifies various competences required for therapyradiographers (TR), however, these are varied and scattered among different publications.The aim of this study was to identify the competences required by therapy radiographerspractising on the linear accelerator in the European setting, according to published literature.Methods: A systematic approach was performed to find relevant literature. The literature wasthen scrutinised for competences practised by linac TRs. Thematic analysis was performedto organise the competences according to themes.Results: A list of 170 competences were generated based on the assessment of 28publications. The competences were organised in themes, including “delivery of treatment”,“verification of patient setup”, “patient care” and “teamwork and multidisciplinarity”. Thecompetences of the therapeutic radiographers encompass multiple themes, evidence of thecomplexity of the role of these professionals.Conclusion: Radiographers across Europe must be trained to the highest standards toensure the best care possible is given to patients, irrespective of the country theradiographer trained in. This will also promote for free movement of professionals acrosscountries. The competences identified can be used as reference for the design of academiccurriculum for TRs practising across Europe. KW - Competencies KW - Radiation therapist KW - Standards of practice KW - Therapeutic radiographers U2 - 10.1016/j.radi.2019.06.004 DO - 10.1016/j.radi.2019.06.004 JO - Radiography JF - Radiography Couto J, McFadden S, Mc Clure P, Bezzina P, Hughes C. Competencies of Therapeutic Radiographers working in the linear accelerator across Europe: A systematic search of the literature and thematic analysis. Radiography. 2020 Feb 1;26(1):82-91. https://doi.org/10.1016/j.radi.2019.06.004	cc/2021-04/en_middle_0039.json.gz/line1142
__label__cc	0.749364	0.250636	Home › The Life and times of Warner Glenn The Life and times of Warner Glenn Foreword by Baxter Black Ed Ashurst leaves no stone unturned. This history book is a slice of the pioneer west for the last two centuries. In that sense it is dense with genealogy and the settle of the Arizona territory since 1816. If you think you are related to Warner, you'll probably find your name in the pages somewhere! I, for example, celebrate the same birthday! Rising from the ever-present historical backdrop in this book, is a stampede of action-filled stories that never stops. Almost every chapter is a movie in itself! The further we read, the deeper we fall into the lure of wanting more. Sometimes it seems almost unbelievable. We get led through a world crawling with Fire, Murder, Sweat, Fear, Flood, Attacks, Lions, Dogs, Snakes, Fiddles, Jaguars, the Border, Bears, Prehistoric Calligraphy, Courage, Caves, Drugs, Drought, Dehydration, Bulls and Bad Horses. The short version; Warner Glenn was born, married, bought a ranch, had offspring, passed it on and lived happily ever after. He is respected, trusted, industrious, religious and generous to all. So, is he any different from the regular good ol' boys that populate our lives? The answer is Yes. He makes a difference everyday. He has presence. When he walks into a room the level of the water changes for everybody...like dropping a new rock in the pond. Warner is a simple man, not easily swayed from his principles. He has character, honor, modesty and inner strength. Tough, with a smile. Handshake, with a promise. A Gladiator when defending what he loves....He is the real High Noon This is his book written by those of us who hold him in deep esteem. We have been lucky enough in our lives to rub up against him, feel the magic, the current running through him, close enough to feel his heart beat or his teeth grit. To know him is a gift, a blessing, inspiration and awe. When he invites you to rope at his branding, to shoot the lion on his hunt, to play a tune on his fiddle, or even say grace at his table, it's like Mickey Mantle handing you the bat and saying "Why don't you take a few swings." Written by Ed Ashurst 'Eat Beef Drink Milk' Unisex Fit Tee Leather Flower Earrings Mustard, Grey & Cream Hat 112 Richardson	cc/2021-04/en_middle_0039.json.gz/line1147
__label__cc	0.500878	0.499122	Blog 721: Tiberian Fun Posted on May 12, 2017 by Rao Dao Zao Real-world associate Chris McPhail and I might have been going through Star Wars in our Close, But No Biscuit podcast of late, but there’s another piece of cultural media that deeply affected my robot designs — Command & Conquer: Tiberian Sun. The goody-goody Global Defence Initiatve forces had several grungy, industrial, brutalist, utilitarian hulks that evoked power and strength and resilience so much that I took my first faltering steps into 3D modelling trying desperately to ape them. If Star Wars set the robot wheels in motion for me, then Tiberian Sun gave them life. Look at it this way — if I’d known the Final Sun level editor existed at the time, I’d have cut my modding teeth on Tiberian Sun over Age of Empires II. Oh yes. Command & Conquer: Tiberian Sun The other Star Wars connection is less tenuous and personal — the voice of Darth Vader himself, James Earl Jones, stars in the live-action intermission story sequences as the leader of the GDI. It’s not just a rollicking strategy game, it’s a full-on late-90s sci-fi cheese-fest with a mix of really rather good practical sets and make-up effects and… er… maybe less good CGI backgrounds. I like to pretend I’m averse to the dark and the gritty but Tiberian Sun‘s apocalyptic grey and brown environments are mighty atmospheric. The world is being slowly but surely consumed by alien Tiberium crystals and everything is a bit shit — but that’s balanced out by the laser beams and the crazy fancy units that go stomping through these wastelands. While the GDI get awesomely extrapolated modern-day militaristic units, the Brotherhood of Nod go off the rails with stranger designs that stop the dark and gritty from taking over the universe. It is, perhaps, the perfect balance of seriousness and silliness — battling over a dying world with soldiers pouring out of a barracks shaped like a giant hand. You’re right, this is exactly where I get it from. It fits my taste in gameplay too because as a real-time strategy game there’s an utter lack of cruft. You build stuff, plonk it down, send your troops to attack and watch the fireworks. There’s not too much going on that it gets crazy, with the action focused on having roughly the right troops and putting them in roughly the right places. There is a lot of wiggle-room so you don’t need to have the exact rock to the enemy’s scissors or click ten thousand very short-lived and situational abilities per second. There’s no need to bone up on the minutiae of attack and armour types and micro-percentage differences; things are clean and obvious enough that you can simply start playing and you’ll quickly get a feel for it. It is, basically, an RTS on a scale comprehensible to people like me. Titans, for example, can cleanly out-distance Nod laser turrets that would otherwise slice and dice your infantry. One of the things I’ve found quite striking about the campaign is its willingness to vary mission length. The modern counterpoint is surely Starcraft II which, regardless of what’s going on in any given scenario (be it a small-team raid or a titanic clash between a literally flame-haired demigoddess with an eldritch horror from outside the universe), doggedly sticks to the 20-minute mark — making it perfectly polished but with none of the peaks and troughs that make missions genuinely stand out. In Tiberian Sun, however, I have found myself taking from forty minutes to an hour in some missions, and spent less than five in others. Maybe that’s a little bit extreme, but it’s also refreshing. The perfect example would be the “Retrieve the Disrupter Crystals” mission — if you can run in with your initial squad and smash up the train fast enough, the mission ends there and then; but take your time and you’ll have to punch through another base-building skirmish to get that precious cargo. Starcraft II tried many things to add variety to the traditional strategy setup, but I never saw it adding explicit short-cuts to missions — nor letting failure bleed into extended scenarios. The no-building missions are also superbly puzzly, as you try to find the back doors to destroy the power stations that will disable the defences… Of course longer missions need to engender a desire to stick with them, which Tiberian Sun does by providing walls. Seriously, I think walls are one of the most underrated yet brilliant features an RTS can have. Walls allow you to connect with your base in a way that no other buildings can. Most buildings go anywhere; apart from the Tiberium Refinery going as close to the fields as possible, there are no limits except for a vague “must be close to existing buildings”. Walls though, walls are important: they need to go at chokepoints, they need to fit in with the natural environment around you, they need to enclose your power stations, they need to be seeded with gates so your troops can still get around… Walls make a faceless collection of buildings into a meaningful home, meaningfully organised (or not) as reflects your own personality. Tiberian Sun even offers pavement, which allows units to move faster, and GDI turret towers slot directly into the walls without causing breaks. This is the future we were promised. This is why I love Warcraft III only as a vessel for custom maps and can’t stand its out-of-the-box melee gameplay. I didn’t need half these walls, but I wanted them. To be fair, Tiberian Sun is quite a bit smaller than I remember. While the plot is a grand global conflict, the missions are quite tight and line-of-sight radii and attack ranges are all rather short. Sometimes mission areas will expand after you’ve completed a first objective, but even after that the maps often remain a bit claustrophobic. And sometimes, okay, the last five or ten minutes of a mission is hunting down that one SAM-site you missed before it’ll concede that yes, you have indeed eliminated all the Nod presence in the region. It’s an older RTS, so some of the conveniences that would make it even more seductive are also missing. There’s no “attack-move” so troops will wander right past enemies when they’re clearly taking fire, and patrol routes have to be constructed with a strange waypoint system rather than the intuitive shift+clicks that everyone else would converge on. It makes up for most of the flaws of its era with destructible bridges. Never gets old, and the AI will even send engineers to repair broken bridges! I still love it. If the engine used the graphics card properly and was therefore interceptible by FRAPS I’d have done this as a talky review with background videos, because it’s hard to do Tiberian Sun justice in words alone — it’s a game that looks and sounds so good too, factors which enhance gameplay a hundredfold. The gentle ticking of money flowing in from your harvesters, the meaty whumps of cannon fire and the shattering crunches of damaged buildings… Tiberian Sun is one of those games that fires on all cylinders, and barring a few missteps here and there, it’s a true classic. Did I mention that the Scrin Ship is a fantastically eerie presence in the campaign, and a ship design that has stayed with me for life? This entry was posted in Gaming and tagged C&C, Command & Conquer, Firestorm, real time strategy, RTS, Tiberian Sun, Westwood Studios by Rao Dao Zao. Bookmark the permalink. 4 thoughts on “Blog 721: Tiberian Fun” Eternity6 / Quntimtin on May 18, 2017 at 11:33 said: Also in skirmish mod they have an option for “additional base props ” , like banner , watch towers light fixtures ect . Oh dear it seems I’m a bit late XD I love Tiberium Sun so much and in general I’m a really big C&C fan . There is a fan made mod that might interest you called “Twisted Insurrection” . Please check it out . The mod improves the atmosphere greatly , you truly feel like this is the twilight of humanity , that the tiberium infestation has devastated the planet . Remember visceroids and floaters and the other tiberium fauna , well their are now numerous other beasts both strange and exotic . Basically everything is redone , there’s more music from the original composer Frank Klepacki and lots of new and interesting content . It’s also free . ( Tiberium Sun was released a freeware a few years ago ) Moddb : http://www.moddb.com/mods/twisted-insurrection Website : http://www.twistedinsurrection.net/ Hmm, yes, I had seen that before, but I didn’t know it was so extensive — definitely worth a look. There’s a lot more i just didn’t want to spoil everything .	cc/2021-04/en_middle_0039.json.gz/line1150
__label__wiki	0.540653	0.540653	A destructive shock wave shook the earth, and the Titan’s massive fist squashed the head of the Flesh Golem. SFX for a low growl As if it got stunned by the sudden attack from what it thought was a fellow Monster, the Flesh Golem let out a strange low-frequency groan and retreated a little. Too bad, the blue Titan didn’t give a rat’s ass and threw yet another massive punch, this time aimed at the Golem’s chest. Quite unlike the huge bulk that blocked out the sky, its movement was rather stylish to behold. KKHUOOOONG!!!!! The Flesh Golem crossed its arm to block the incoming attack, but still suffered a grievous injury, one of its arms separating from the body. Angered by the immense pain, the Golem let out a roar half filled with rage and the other half with agony, and dashed towards the blue Titan. Now that it lost pretty much all its reasoning, it no longer displayed that deft application of magic and clones anymore. It just went for the midriff of the Titan and tackled it to the ground. Falling into the East Sea, the Flesh Golem struggled in the water, but still swung its fist at the Titan. But well, the shift into a new battle ground presented a big problem for the Monster. The ‘fuel’ for the Leviathan’s Titan was water of the ocean. In other words, it would never be defeated as long as it was in a body of water. SFX for expansive swings of a large fist The Flesh Golem’s violent punches constantly landed on the body of its target, but the blue Titan didn’t even try to defend itself. No, it simply counterattacked while letting the hits in. From the apocalyptic throwdown of two giant Monsters, sparks of Mana flew away like shooting stars. The battle slowly tilted towards the blue Titan’s favour as time passed. The flesh of the Flesh Golem continuously fell off, yet the Titan’s wounds were recovering constantly by all that sea water surrounding it. ‘I’m getting dizzy here.’ However, there was that thing about Mana of the summoner who brought forth the Titan, Kim Sae-Jin, constantly decreasing at an alarming rate. Thankfully, though – the Leviathan Form possessed a Mana reserve tens of times larger than his regular ‘human’ appearance, so he wasn’t too worried about that for now. Pher-uhng!! Following a large and disturbing sound of explosion coming from the punches of two Giants landing successfully, a piece of flesh stripped off the Flesh Golem and caused large ripples of water to splash all around. None of the Knights witnessing this by the beach dared to intrude upon this battle; meanwhile, drones belonging to Knights Orders and media corporations buzzed away in the air, redirecting their camera lenses towards the giants. Kkhuong! Kkhwang! Kkhuong! Kkwang! Although most of the drones had their wings and lenses damaged by the massive shock waves generated by the relentless and chaotic battle for supremacy happening right before them, a few still managed to endure and capture the resulting footage. “What the hell is going on here…?” “Damn… Am I dreaming or something?” Knights stared dazedly at this unexplainable situation for the next three minutes, before finally realising why they were there in the first place, which helped them regain their focus. Regardless of what was happening, that blue Titan was their ally. So, it made sense to work together and destroy that grotesque Golem… “Everyone, charge!!” Kim Hyun-Seok cried out and dashed forward. SFX for energy-something-something shooting out From his sword Gram, a powerful fireball shot out and inflicted a deep wound on the Flesh Golem’s arm. The Golem roared at the top of its lungs in unbridled rage, but the Titan didn’t miss its chance and thrust forward its massive blue fist into the Golem’s open mouth. KKWAJEEK!!!! The fist connected so splendidly, the Golem’s mouth almost came loose. Towards the tottering Flesh Golem, countless Knights rushed in and swung their weapons. Sharp, focused Mana encased each and every one of those weapons, creating different silhouettes of weapon auras as the Golem’s body gradually became the proverbial Swiss cheese…. SFX for a painful moan of a Monster Thanks to the unexpected alliance of the blue Titan and the Knights, the Flesh Golem issued a sorrowful wail as it crumbled into a heap of disgusting pieces. However, although this battle had come to an end, Knights couldn’t really relax at all. Would this Titan now turn its unwelcome attention towards them and attack? Well, such a worry proved to be a needless worry. The blue Titan dissolved into several streams of water and disappeared into the sea altogether. And when the Titan suddenly vanished, Knights quickly followed the strands of Mana leaving from the ‘remains’ of the Titan. And sure enough, on the surface of the undulating sea over yonder, there was a single creature. Its entire body was covered in pale azure scales, and its eyes were unfathomably deep as if to demonstrate its intelligence. Unlike its adorable countenance, the aura this mysterious creature exuded was undeniably noble – so much so, it proved impossible to stick whatever careless adjective one could think of to this being. Knights murmured to themselves and carefully studied its appearance. But, as if it was feeling shy from all the attention pouring on it, it immediately dived under the water’s surface and disappeared from the view. “…The battle has ended. Mop up the remains of the Golem.” It was then, Kim Hyun-Seok’s energetic voice resounded. Pretty much every Knight here was pooped out from fatigue, but still had to move their weary bodies since the superior officer issued an order. The subjugation of the Flesh Golem unexpectedly ended with very low casualties. And the footage containing the very reason for that – the handiwork of the Leviathan – spread out like wildfire the following day. However, since no one really knew about how the baby version of Leviathan looked like, the world took to calling it the ‘Unidentified Lifeform’ and emphasized the fact that it played the crucial role in defeating the Flesh Golem. “Judging from those shiny scales and deep, clear eyes, it could very well be a Leviathan.” …There were a few experts who posited as so. Unfortunately, these experts were actually scholars focusing on the field of history and folklore, so ‘real’ experts related to all things Monsters summarily laughed them out of the room, berating them for their baseless assumptions. The Leviathan was the world’s laziest – and because of that, relatively safe – beast of legends. Plus, its normal territory was located in deep oceans, so it was argued that there was no way it would roam around the coastline of the East Sea. “Could it be a Divine Beast?” (Yu Sae-Jung) And currently, the armchair expert operating out of Kim Sae-Jin’s home, Yu Sae-Jung, took a look at this and that on the Dawn’s official forum using her phone before spinning out her own interesting theory. “Mm?” “I’m saying, a Divine Beast. Remember that Black Turtle living near China not too long ago? And people keep saying that the Azure Dragon and the Leviathan have broadly similar set of abilities, the only difference being their names, you know.” “…So you’re saying this creature is THE Azure Dragon of the East?” Dumbfounded, Sae-Jin pointed towards the face of the baby Leviathan, which kind of resembled a puppy no matter how one cut it. Right up until then, even he was impressed by how cute it looked in the photo. “Yep. But I’m not the only one with that opinion right now. A few Dawn Order Knights are thinking like this already.” “…Gimme that. Let me see.” (Sae-Jin) Yu Sae-Jung was telling the truth. The Dawn’s official forum was filled with ‘Azure Dragon’ this and ‘Azure Dragon’ that. He thought that the Dawn was filled with best of the best, but now… Now, he realised they too possessed capacity to spout unfounded rubbish. “See? What did I tell you? But still, it feels like all these huge things happen only in Korea lately. There are the Hero Orcs on land, and in the sea, we got a bona fide Azure Dragon now… Ah!! Right, right!! Look, the Azure Dragon supposedly guards the eastern direction, right? The East Sea is to the east…” (Yu Sae-Jung) “It’s not like that, so you can tell them to stop with this nonsense.” “…What the?! How does Oppa know that for sure?” (Yu Sae-Jung) Since he couldn’t say “It’s me, so I’m pretty sure about it”, Sae-Jin just let out a fake cough and gave the phone back to her. But when Yu Sae-Jung got her phone back, she quickly studied his mood for a bit, before asking him in an obviously manufactured leisure. “…Op, Oppa should give me your phone too.” “Mine? Why?” “Ju, just give it to me. Oppa also took mine just now, so this is fair.” Although her logic didn’t quite sound right, Sae-Jin didn’t argue and gave her his phone. She quickly snatched it off his hands, and as if afraid of having her activity seen, she brought the phone right in front of her eyes and hurriedly moved her fingers. And about three minutes passed like that. After confirming that he hadn’t made any suspicious contact with Hazeline, she let out a relieved sigh, chucked the phone on top of the dining room table and dived into his arms. “Oppa always grumbles like an old man, but still ends up doing everything I ask of you~.” “No, well… It’s nothing, really.” She spoke hard to understand words while unbuttoning Sae-Jin’s shirt. Exactly one week passed since the subjugation. And the situation became exactly as Yu Sae-Jung had predicted. The baby Leviathan had morphed into the baby Azure Dragon of the East instead, and the ‘world’ raised a huge fuss, saying that the Azure Dragon would become the guardian of the East Sea. Hell, even the government got suckered into this popular opinion and believed it. They were currently in the middle of combing the entirety of the East Sea for the evidence of this baby Dragon that would no doubt become a huge asset to the national security in the future. “How are you handling Rahaimde so far?” Ignoring all these chaos, Kim Sae-Jin went to visit Kim Yu-Sohn. The veteran mercenary’s complexion had become a lot worse than before. “We’re taking a good care of him… Kehuem. The ploy of using special pharmaceuticals to control him is also progressing favourably as well… It won’t be long before we are able to extract all the information we need. But besides all that…” Kim Yu-Sohn tapped the top of his desk, and a hologram projection rose up. And in this projection, a web page of a Cafe named ‘The Deity of Four Directions, Azure Dragon’. “…What will you do about this, sir?” (Kim Yu-Sohn) “Ah, this, well… uh…” (Sae-Jin) “In my opinion, I think this is a good development, sir.” Before Sae-Jin could finish, Kim Yu-Sohn stepped in the middle. “This is good?” (Sae-Jin) “Yes, sir. Without a doubt, the frequency of Boss Monsters appearing will only increase from now on – but if there is a being that can give rise to hope to our allies and instill despair in the hearts of the enemies, then that’s all for the better, I believe. More importantly, as a Leviathan, you can easily fight against any Boss-level Monsters alone, so you will become a great pillar of strength for this world.” Kim Sae-Jin wordlessly scratched the back of his neck after seeing how ardent and fervent Kim Yu-Sohn seemed to appear. After all, wasn’t this… like a formation of a Suicide Squad to keep the end of the world at bay or something? “Ah, well, that…” (Sae-Jin) “Also, truth be told, it was my idea to create this Cafe. Of course, if you, the Guild Master, wishes it, I will reveal to the world that it’s not an Azure Dragon but a Leviathan, instead.” “Huh?! No, wait, but why…” (Sae-Jin) At this sudden confession, Sae-Jin’s eyes went extra round. “Your abilities are indeed truly an incredible thing, Guild Master. The Leviathan is a Monster that possesses divinity, and so, if you can continue to appear as one and learn to utilise its powers in full, then this old man will not have any more wishes left.” The eyes of the strangely urgent Kim Yu-Sohn were not only filled with his desperation, but streams of blood as well. Kim Sae-Jin couldn’t say I can’t do it to the face of a man who looked like he might vomit blood any time now. “…Yes. Well, uh… My parents seemed to have been fighting them, so… I should do the same, too. But forget about that for a second, and please drink this. There is blood pooling in your eyes.” Sae-Jin reluctantly replied and handed a potion over to Kim Yu-Sohn. It was a high grade potion that one couldn’t even buy in the market even if one wanted to. “Huhuhuh… Thank you.” Kim Yu-Sohn made a somewhat relieved and leisurely smile as he received the potion. After finishing up the meeting with Kim Yu-Sohn, Sae-Jin headed to the Guild’s training facility as usual to train, only to find an unexpected guest waiting for him there. “Ah, you finally came, Mister Kim Sae-Jin.” It was Kim Yu-Rin. She was smiling at him while carrying various items on both of her hands. “What are all those?” (Sae-Jin) “It felt wrong to come with empty hands so I brought along some stuff.” (Kim Yu-Rin) “….You mean, all of them?” “Yes. It’s nothing much. It’s just some electronic items, a wrist watch, and a wallet, and…” (Kim Yu-Rin) Sae-Jin tilted his head slightly, but he still took the gift packages and placed them down on the table in the lounge. “But, why did you go to all this trouble, Miss Yu-Rin? Is there a favour you’d like to ask me for?” “Ah? Oh, uh… a favour, you say… I don’t particularly have one, but… the thing is…” (Kim Yu-Rin) She began contorting her face to form an unnatural smile while slightly shaking her hips. ….Why is she trying to dance provocatively all of a sudden?! Sae-Jin’s face reddened slightly, before belatedly spotting a sword tied to her hips. She didn’t have a scabbard to hide it, and even with a single glance, he could tell that it was chipped pretty noticeably and didn’t look all that threatening anymore. “Looks like your weapon’s durability has fallen greatly?” (Sae-Jin) “Ah… You think so? Ah!! But what happened to my scabbard?!” Although her acting needed a lot of work, Sae-Jin did find her attempt quite funny, so he grinned slightly and opened his mouth. “There’s no need to beat around the bush, Miss Yu-Rin. I’ll help you. I’ll even give you a discount as well.” “R, really? In that case, I…” “4.5 million dollars. Of course, you don’t have to worry about its resulting quality. I’ll definitely craft a weapon that’ll rank in the top 3 of the Branded Goods rankings.” (Sae-Jin) “…Fou, four point five…” Watching Kim Yu-Rin’s face gradually lose colour, Sae-Jin couldn’t hold it and began chuckling out loudly. “Yes. I can’t go any lower than that, I’m afraid.” (Sae-Jin) “Ah, yes. I, I also am p, p, prepared, as well.” Kim Yu-Rin swallowed her saliva noisily and nodded her head. Actually, though, her real reason for this visit wasn’t just about her weapon. There was something else far more important. Something she just had to find out. She even spent one whole night staying up, researching and worrying about this thing…. “By the way… Mister Sae-Jin, besides all that…” At her voice suddenly becoming razor-sharp, Sae-Jin’s shoulders trembled slightly. “Would you… like to spar with me for a little bit?” < 32. King of the Infinite Ocean, Leviathan (2) > Fin.	cc/2021-04/en_middle_0039.json.gz/line1155
__label__cc	0.60088	0.39912	You are at:Home»Arts & Design»Fine Arts»Expressions»Klimt & Schiele: Elegance and brutality. By . on January 28, 2019 Arts & Design, Expressions, Fine Arts Klimt & Schiele – Egon Schiele, Group of Three Girls, 1911 – Exhibition organized by the Royal Academy of Arts, London and the Albertina Museum, Vienna. Image Credit: Albertina Museum, Viena, 2018. Klimt & Schiele, Royal Academy review – the line of gauntness. Elegance and brutality converge in drawings from the Albertina Museum, Viena. The most touching tribute to the relationship between two giants of early 20th century art, Gustav Klimt and the much younger Egon Schiele, hangs in the first room of this fascinating exhibition at the Royal Academy – Schiele’s poster for the 49th Secessionist exhibition in 1918. It shows a group of artists around a table, an empty chair at one end – that of Klimt, who had died of pneumonia in February. Schiele has included his own ramshackle self seated at the opposite end, gazing at the place which should be occupied by his friend, mentor and inspiration, not knowing that within months the Spanish Flu would kill him too, aged 28, three days after his pregnant wife. Egon Schiele was blown away when he first encountered Klimt’s work, years before he actually met the artist. Perpetually broke and scouting for society patrons, he once tried billing himself as “the silver Klimt” – no gold leaf, and very much cheaper. Klimt & Schiele – Klimt, Standing Lovers, 1907-8 – Image Credit: Albertina Museum, Viena, 2018. Gustav Klimt was not just richer but far more famous in their day, but he does not come well out of the contest in this exhibition of 100 drawings loaned by the Albertina. These are not the images for which he is most famous, the extraordinary Viennese society portraits of figures half dissolving into gold and jewels as if only their own wealth is keeping them vertical. Most of the works here, beautiful though they are, are working drawings in which he is trying out compositions – a rare finished work, probably made for presentation to a patron, also has the only tiny patch of gold in the entire collection. The Schiele works are complete, and once he shakes off some of the Klimt influenced excessive elegance, they are astonishing. The subjects are brutally viewed, brutally executed with a savage spareness and brutally cropped so arms vanish at the elbow, legs mid shin. The poses must have been excruciating. Colour can be a weapon: a cellist’s arms are empty and instead of a musical instrument there is a great amber stain spreading up from his groin. Schiele, The Cellist, 1910. The nudes are less disturbing than many in which the garments – including a self-portrait with a dangerous shirt – seem to be assaulting them, hobbling their legs, binding their arms, threatening to strangle them. In contrast the Klimt drawings of smartly dressed women hanging nearby could be fashion plates for a magazine. Klimt & Schiele – The Cellist, Egon Schiele, 1910. Image Credit: Albertina Museum, Viena, 2018. The most striking of the Klimts are his working drawings and preparatory sketches for an important commission for the university. It ended badly when his allegory of medicine, a waterfall of naked figures, child and adult, hale and mortally ill, was not well received. He was outraged and tried to cancel the contract and take back the paintings. Again the contrast with the greatest troubles of his protégé is telling. Schiele’s unarguably sexualised drawings of very young girls disturbed his contemporaries and have troubled his biographers since: the exhibition is at pains to point out that the age of consent at the time was 14. It was never likely to go well when he moved with his lover and model from urbane but expensive Vienna to a country village. He was arrested for child abduction of one of his child models, and though cleared of that, convicted of exposing minors to obscene works – which were confiscated, with the judge very publicly burning one. The five prison drawings exhibited, including a self-portrait with just an anguished face peering from the tangle of his grey blanket, were made when he thought he might spend the rest of his life in prison. The RA exhibition design seems intended to damp down excessive excitement. All the drawings are hung on porridge coloured walls into which some, particularly Klimt’s studies of masturbating women drawn in cobweb fine lines, almost sink without trace. The effect is to throw Schiele’s hectic points of colour, the crimson lips, nipples and groins, the green and pink flesh tones which sometimes recall medieval images of plague victims, into alarmingly sharp relief – and to make many of the elegant Klimt drawings shrink back into mere prettiness. Information and Images are shared from an Article by Maev Kennedy, published in The Arts Desk on November 14th, 2018. Images Credit: Albertina Museum, Viena, 2018. Previous ArticlePadraig Harrington, new Ryder Cup captain. Next Article Briton Laura Plummer flies home. Vow to return art stolen by Nazis. The art heists that shook the world.	cc/2021-04/en_middle_0039.json.gz/line1156
__label__wiki	0.576514	0.576514	WorkCapabilitiesTeamAbout UsInsights National Geographic, Identity & Engagement Platform A modern technology platform for managing 1+ million members http://www.nationalgeographic.com/ Quoin led the development of a sophisticated new membership system to support National Geographic’s extensive online community, fundamentally redefining and enhancing how members engage with the iconic brand. We were responsible for architecture through implementation. The Identity and Engagement platform enabled National Geographic to rapidly reach a milestone of more than 1 million registered members. Our dedicated project team continued to support the platform and other member-oriented features in production. The National Geographic Society, founded in 1888, is one of the most recognized scientific and educational institutions in the world. This global media brand had a strategic goal to improve its online services and promote a greater sense of membership for website users and subscribers. Quoin’s dedicated project team was responsible for the system architecture, design, and implementation of the new membership platform and online community. As a key part of the Identity & Engagement Platform project, Quoin defined the system architecture, including APIs and integration with enterprise services. In particular, our team was responsible for implementing the application services that are used by user-oriented applications, such as the Your Shot member photo website. Our project team built native and social media registration, login, user profiles, and other end-user features. A key component was a lightweight, cross-site membership header that provided a consistent design and access to login and registration features for several NGS sites. We also implemented the member database; as well as integration with external systems for social sign-on (Gigya), commenting (Livefyre), email fulfillment (Responsys), and data warehouse (Epsilon). The technologies used included the Django application framework, JavaScript, HTML5/CSS, and PostgreSQL. "The technologists from Quoin drove the development of a sophisticated new social media platform that has enabled the Society to engage over 1 million members, and counting." - Jeff Rule, SVP of Architecture & Planning at National Geographic In production, Quoin continued to support development and new strategic initiatives for this client with a dedicated team of project management, engineering, and quality assurance staff. We also supported other projects and technology initiatives as a strategic partner with the Society, including integration with the subscription management system (TCS) and development of a content management site for the Society’s ‘Geography Bee’ program. Our dedicated project team - which consisted of a project manager, technical lead, and 6 engineers - continued to support the platform and other member-oriented features in production. The Member Profile shown here is a core component of the platform, and enables registration by individuals, including name, contact information, interests, notification preferences, education, and other member information. The information captured here is fully integrated with enterprise systems for sign-on, comments, subscriptions, and a data warehouse. Member Interests The Interests tab is an essential element of members’ profiles and serves to support personalization and contribute to an engaging user experience. Subscribers in the first 6 months of production Integration points with third-party and enterprise systems Reusable and cross-site component for login and registration Architecture & System Integration Web & Mobile Application Development View All Project Summaries WashingtonPost.com, High-Volume CMS Insights. Capabilities. Careers @ Quoin Downtown Boston 186 South Street \| Suite 400 Boston, MA 02111 \| 617.357.5233 210 Delburg Street \| Suite 106 Davidson, NC 28036-8634 \| 704.918.1799 BostonCharlotteNew York CityWashington DC PrivacyTerms of UseSite Map© 2020 copyright all rights reserved. Quoin Inc.	cc/2021-04/en_middle_0039.json.gz/line1158
__label__cc	0.61937	0.38063	Al Alvarez Quotes Best Quotations by Al Alvarez But in a tournament, you can be said in for all your money at any point so you can't make any mistakes so you have to, it's all about where you're sitting at the table. — Al Alvarez Any Make Mistakes Money Point I absolutely don't believe in anything. Full stop. Including luck. Anything Believe Full I Including I could think of worse ways of going than at the poker table. Going I Poker Table Than I hate writing. I Writing I mean being a writer is like being a psychoanalyst, but you don't get any patients. Being Get I Like Mean I mean to say, this is the book and I really loathe it and I can't imagine what a nice Jewish boy like me ever, how I ever got into this dreadful trade. Boy Dreadful Ever Got How About Al Alvarez Nationatlity: English Profession: Poet Born: August 5, 1929 William Congreve Alfred Lord Tennyson Al Alvarez (born London 5 August 1929) is an English poet novelist essayist and critic who publiAl Alvarezs under the name A. Background Born Alfred Alvarez he was educated at Oundle School and Corpus Christi College Oxford where he took a First in English. He has also written on divorce (Life After Marriage) dreams (Night) and the oil industry (Offshore) as well as his hobbies of poker (The Biggest Game In Town) and mountaineering (Feeding the Rat a profile of his frequent climbing partner Mo Anthoine). Alvarez and Al Alvarez.	cc/2021-04/en_middle_0039.json.gz/line1160
__label__wiki	0.559299	0.559299	Rachel's Reviews Rottentomatoes Certified Critic. Reviews of the latest movies especially animation as well as classic reviews, family movie night picks and more Animated Oscars Disney Canon Film Index Disneynature Reviews Non-Disney Canon Animation Pixar Reviews Rankin/Bass Scrooge Month Top 50 Animated Movies Blind Spot 48: ‘Tokyo Godfathers’ December 26, 2019 January 3, 2020 \| Rachel's Reviews Anyone who follows my content knows I watch a lot of Christmas movies. This can make it difficult to find a good Blind Spot pick for December. However, I have long wanted to see the anime classic Tokyo Godfathers, so it became an easy pick for this month’s selection. Tokyo Godfathers is directed by master animator Satoshi Kon based on the novel by Peter B Kyne entitled Three Godfathers. There are a lot of reasons why this film works, but I think at the heart is an emotional resonance we connect with. I’d wager to say the 3 main characters Gin, Hana and Miyuki are living wildly different lives than most of us; however, their responses to pain, joy, fear etc come from a truthful place we can all relate with. The story begins when our homeless trio finds a baby thrown into the trash on Christmas Eve. Ex-drag queen Hana is particularly excited to help the baby who they name Kiyoko. I loved Hana’s energy, which is always tinged with a bit of melancholy. She reminds me a little bit of Agrado in Pedro Almodóvar’s film All About My Mother. They both are transgender and homeless, yet full of life and energy. Tough talking Gin helps ground the group and young teen Miyuki is a more of a nurturing presence. They are an unlikely group but one who’s story I was always invested in. The 3 friends set out to find Kiyoko’s parents and face all kinds of resistance along the way. Sometimes the shenanigans are a little too much but for the most part I was very engaged. Aside from the day it is set on, Tokyo Godfathers might not seem like much of a Christmas movie. There are no presents, Christmas trees, Santa etc. However, it absolutely gets to the core of Christmas. Each of our 3 characters is sacrificing to help Kiyoko who would have certainly died in the trash without them. Is this not the heart of what pure Christianity aka Christmas teaches? There’s also a sense of wish fulfillment with this journey. Hana gets to live a day as a mother. Gin gets to be the hero he isn’t to his own children. Miyuki gets to be a part of a loving family unit. These are people who aren’t valued by society but to this baby they are invaluable. It reminded me a lot of both Parasite and last year’s Shoplifters in many ways. Tokyo Godfathers, however, is not a morose film. It actually can be quite hopeful and even funny. Like I said, especially Hana is a bright light in a difficult world. I loved the way Satoshi animated her big smile and exuberant responses to everything. It made me smile. I loved all of the animation. Satoshi does such a good job of developing a sense of place with rich colors of brown, red and green. At one point a character is at her breaking point and there is such a piercing quality to her eyes that anyone who has had a mental health crisis will understand. It’s quite devastating (especially when compared with Hana’s bright energy). I did struggle a little bit in Tokyo Godfathers to keep up with the subtitles but that is probably my own flaw more than the movie. There are some pretty fast-paced scenes of dialogue! But if you are looking for something different to watch at Christmas or just a unique animated film any time of the year I recommend it for anyone middle school and up. I really enjoyed it (rated pg13)! In August I got to review Satoshi Kon’s other masterpiece Millennium Actress over at rotoscopers.com. Check the review out here [REVIEW] Cats: It’s Cats Singing and Dancing December 19, 2019 \| Rachel's Reviews Adaptations of Broadway musicals are a tough nut to crack. Due to fears of box office losses typically the movies come many years after the initial hype of the shows. Then to make matters worse, film directors often seem to have a difficult time translating the energy of a musical show into a film. It’s a really strange phenomenon and it makes me wonder if the best is movie to Broadway (Mean Girls, Heathers, Beetlejuice, etc) rather than musical to movie. The latest attempt is one of the longest running shows in the history of Broadway: the strange Andrew Lloyd Webber musical Cats. In the musical, ALW takes an epic poem by T.S. Eliot and adds songs. The problem is the poem is not very cinematic. It’s all introductions of various cats all leading to the jellicle ball. While there, the ‘jellicle choice’ is made. So literally we spend time getting to know cat A and then cat B until the cat Old Deuteronomy (Judi Dench) decides which cat deserves to ‘ascend to the heavens for a new life’. Fortunately where the narrative in Cats isn’t the best, the singing and dancing is enjoyable. I actually got used to the unique visual style very quickly and found songs like ”Jellicle Songs for Jellicle Cats’ to be catchy. I also liked ‘Mr Mistoffelees’ and ‘Skimbleshanks: The Railway Cat’. They even have trained ballet dancers Francesca Hayward as Victoria and Steven McRae as Skimbleshanks. Of course. the highlight of Cats is ‘Memory’ sung by Jennifer Hudson. She is such a powerful singer, and I thought she knocked it out of the park. I also appreciated with Cats seeing something different. Everything is to scale so the cats look like the size of a normal cat. I personally have never seen a movie like that so it was a neat experience at the theater. The downsides to Cats is because it has so little narrative the pacing suffers. Especially the middle is slow, and I got sleepy watching it. It almost seems like it would be better as a short or a series of youtube sing-alongs rather than a movie. There is just not enough meat on the bones for a feature film. I was also not a fan of Rebel Wilson as Jennyanydots or her song with mice and cockroaches (a step too far! I hate cockroaches!). James Corden as Bustopher Jones was also pretty annoying but I’m in general not a fan of his. Sir Ian McKellen as Gus the Theatre Cat is probably the strangest of the group with his method acting song. Taylor Swift fans will probably be disappointed that her character Bombalurina takes a long time to show up and only has one song in the film and another in the closing credits. I think people expecting something super bonkers will be a little disappointed in Cats. It’s unusual but not something like Pottersville where you are just completely baffled the entire time. I wish the choice to make it a stop motion animated film had happened with Cats. That would have been amazing. Alas this version is fun enough for a musical theater junkie. The songs are well done and the dancing is impressive. All the actors are trying their hardest and the visual style is unique. It’s far from perfect but take your other Broadway fan friends and go watch something different with some catchy tunes. You’ll have a good time or at least my friend and I did! Smile Worthy Barely [REVIEW] ‘Star Wars Ep 9: ‘The Rise of Skywalker’: Corny Fun Space Adventure to End the Saga December 18, 2019 December 18, 2019 \| Rachel's Reviews My Star Wars Background- (I tried my best to keep this spoiler free but if you are someone who wants to know literally nothing about the film than see the movie first). Sitting down to write this review of Star Wars: The Rise of Skywalker feels like a hopeless endeavor. If I like it than I am a Disney shill. If I hate it than I’m a nostalgia tinged hater. However, I am going to show some confidence in you my readers and trust that you will be reasonable. Let’s start out talking about what I want from a Star Wars movie. My favorite from the series is the original film now titled Star Wars Ep 4: A New Hope. I get that Empire Strikes Back is the deeper entry with stunning cinematography and quite possibly the best twist in the history of film. I just happen to think that A New Hope is more of a good time. A New Hope is an adventure that makes me want to stand up and cheer as the good guys blow up the death star! I like getting to know our characters and keeping the narrative small and succinct. Being I watch Star Wars to have a rousing space adventure you can imagine my disappointment in the last few entries from Disney. I didn’t care for Rogue One and especially didn’t like Star Wars Ep 8: The Last Jedi (Solo: A Star Wars Story was entertaining but was hurt by the most annoying droid in the history of Star Wars L3). I know some people love it but I disagreed with most of the choices they made especially with how they treated Luke and Leia. To be honest it bummed me out. Rise of Skywalker- All that said, let’s talk about the new film Star Wars Ep 9: The Rise of Skywalker. As is expected with Star Wars these days some people will not like this film, and I can understand why. It’s a flawed, messy film but it recaptures the spirit of adventure I love in Star Wars. There’s a corny innocence to the film I missed in The Last Jedi and it made me happy watching it. Just as in A New Hope there are a lot of moments in Rise of Skywalker that will make you want to cheer as good defeats evil and our scrappy band of resistance fighters are aided at just the right moment. That kind of action and comradery is Star Wars to me. Again to use A New Hope as an example it is full of cheesy lines, obvious heroes and villains and it even ends with a medal ceremony for the good guys. That’s the kind of spirit Rise of Skywalker aims for and achieves. Defenders of The Last Jedi will probably be disappointed because a lot of that film is retconned. Honestly I think you hardly need to watch it any more. At the very least almost every divisive element is either forgotten about or barely touched on, which was fine by me! They also did a great job handling the passing of Carrie Fisher as Princess Leia. Through mostly leftover scenes from The Force Awakens they were able to make her a bigger part that I anticipated and it was a nice way to leave her after my frustrations with her treatment in The Last Jedi. They also try their best to wrap everything up from 9 movies (an impossible task) and throw in a lot of fan service, which the most part, I enjoyed. For example, the ewoks make a brief appearance for no reason except to say to fans ‘oh look at those fun ewoks’. I know some will be annoyed by this but I thought it was fun. This whole movie was corny, light, energetic Star Wars. It’s a Lot of Plot The downside to Rise of Skywalker is there are a lot of characters and plot. For example, just in villains there is Kylo Ren, Hux, Palpatine and General Pryde played by Richard E Grant. Tons of pre-existing characters get storylines and we have new characters like Zorri Bliss played by Kerri Russell or Jannah played by Naomi Ackle who make no impression and seem superfluous to the story. Lando, Chewie, C3PO, Leia, Rey, Kylo Ren, Poe, Finn, Hux, Palpatine, the list goes on all have storylines and it feels crowded for one movie. You also don’t have as long to enjoy a moment because you are swifted off to the next plotpoint that must be wrapped up at the end of the film. Even though I enjoyed the corniness there are definitely some reveals that push the limit, and I am sure do not hold up under deep scrutiny (expect many a raging fan video to come out about A LOT in this movie and they won’t be wrong). An Era is Done However, Rise of Skywalker was still a fun adventure where the good guys beat the bad guys with great music, energetic action and brisk pacing which kept me engaged. They retconned what I wanted and ended the Skywalker saga in a place I am happy with. Again, it’s not perfect but it’s a pretty entertaining time at the movies, so I’m satisfied. [REVIEW] ‘Black Christmas’: A Lump of Coal for Horror Fans Let me state upfront that I am by no means a fan of the horror genre. However, I am a fan of Christmas movies, and am trying to expand my palette as a critic. So when I heard that the remake of Black Christmas was coming out and it was PG13 I jumped at the chance to see it. Unfortunately jumping out of my comfort zone was not rewarded as I was presented with a sloppy, poorly written, unfunny film that evidently has little to nothing to do with the original 1974 classic. I know there are some women who connected with this film and found watching it to be a cathartic experience for their own suffering at the hands of men. That is not my experience in life and it certainly isn’t my experience with this movie. In fact, from my perspective the movie waters down the stories of women so we are no longer unique beings with different opinions, tastes and experiences. Instead, it’s like we are all made from a mold that’s been approved by feminist think tanks. What particularly annoyed was a character who is viewed as the traitor of the women, only to be then rejected by the men she so stupidly followed. She dared to go against the correct definition of femininity and paid the price! All the characters who question the activist character suffer in the end. In fact, it’s kind of interesting that a film with such overtly political messages would also have so little actual diversity of thought… All the men in this film are problematic and all the women are expected to respond to the men in the same way. I kept thinking of the quote from the new Little Women when Meg says ‘just because my dreams are different than yours doesn’t make them less important’. This film tries to stand as a feminist mantra to young women but what about the tomboy or the shy girl who doesn’t want to be a kick-butt female against the evil men? At least last year’s Anna and the Apocalypse had some variety of men and women fighting zombies! The other problem with Black Christmas is it isn’t scary at all, and I’m a super horror movie wimp. If I’m not scared that’s really bad. Most of the kills come to people we don’t care about and in ways that don’t provide any real dread. Everything is so predictable and bland that it’s not entertaining as some kind of escapist revenge feminist fantasy. It’s actually kind of dull. Watching Black Christmas reminded me of a cheap knock off of Buffy the Vampire Slayer. It’s like they got to female empowerment and stopped. For a movie to be empowering we have to be presented with characters we care about, with dialogue that feels authentic to those characters. Otherwise we can read an article or watch a documentary and be done with it. Fiction needs to draw us in with more than just a message. Black Christmas fails because of its sloppy script, poor production values and total lack of scares. Avoid it and support female stories with rich and dynamic characters. 10 Cloverfield Lane, The Babadook or the Happy Death Day movies are 3 recent examples that do a far better job. Even Coraline does a much better job of showing a layered interesting female character in a horror environment. Check them out instead. Also if you want a truly feminist film watch the documentary Maiden from this year. [REVIEW] ‘Spies in Disguise’: More Spies, Less Birds If you are a follower to this site you know I have a special place in my heart for Blue Sky Animation Studios. Aside from the Ice Age films they have consistently put out films that are bold and ambitious. I particularly think their films Epic and Robots are very underrated and anyone knows of my love for The Peanuts Movie. So now we get their latest offering called Spies in Disguise and it’s a film I have been very nervous about. The trailers have not been great and with Disney acquiring Blue Sky in the 20th Century Fox merger I fear the studio will be dissolved if they have a big flop. To make matters worse it’s being released at a very busy time with Jumaji: The Next Level and Star Wars: the Rise of Skywalker opening along with Cats and Little Women. Plus, Frozen 2 is still going strong. Anyway, now that I’ve seen the film what do I think? It’s ok. Kid’s will like it but it lacks that boldness I so admire in Blue Sky and I still worry it is going to be a big flop. The biggest appeal to Spies in Disguise is Will Smith. He does a great job voicing Lance Sterling, ‘the world’s most awesome spy’. Tom Holland is fine as his nerdy sidekick. When the 2 characters are in spy mode it’s a lot of fun and it reminded me of a similar dynamic between Smith and Tommy Lee Jones in the first Men in Black movie. I also thought the action set pieces were well done with some very fast animation and engaging character designs. Kids will get a kick out of it especially the scenes with glitter grenades. There’s a nice message to the film about loyalty, hard work and trying to use non-violent methods whenever possible. However, the problem with this movie is the pigeons. I liked the sequences with the humans way better than with the birds. It seemed like the birds was merely there for cheap humor and the story and fun action stalled whenever they were on screen. All that personality we’ve built up with Lance Sterling was missing and instead we have a pigeon. Going along with the pigeons the humor mostly didn’t work for me. It will entertain kids just fine but it’s pretty puerile if you ask me. There’s a particular part where they have a lot of laughs over the fat rolls of a passed out villain character that gets old fast. I also felt some of the voice casting was strange. Like why have Reba McEntire voice the agency director? She has such a recognizable voice it is distracting to hear it coming out of a boss character. Also what is DJ Khaled doing in this movie? No thank you! Nevertheless, Spies in Disguise is a perfectly serviceable action movie for kids. I worry that it will not be enough to save Blue Sky, but I hope I am proven wrong. If you get to see Spies in Disguise let me know what you think. Current Mini Reviews Hey everyone! Merry Christmas! I hope you are all doing well. As you all know I am deeply ensconced in all things Christmas right now with my work on the Hallmarkies Podcast. I have currently watched and reviewed 85 Christmas movies with 2 more weeks to go! It’s a lot of work but it is also very rewarding. This naturally hasn’t left me a ton of time to write about the feature films I’ve been seeing (yes still making time to go to screenings). So, I hope you will forgive me for doing one of my current mini reviews posts and hopefully I will be able to expound upon them at a future date. There are just only so many hours in the day for one human to work and write about movies! 🙂 I will obviously be writing more on Frozen II including my Disney Canon analysis but here is my youtube review. Basically I really enjoyed Frozen II. I loved how the story made Elsa and Anna deal with the messy truth of their parents and how they treated the people in the midst. I loved Elsa and Anna’s struggles to understand each other and thought the music was incredible. I am particularly in love with Jonathan Groff singing ‘Lost in the Woods’. The animation is stunning and the voice acting is outstanding. The plot has a few problems but overall I was very entertained by it. Smile Worthy Speaking of youtube reviews I also recorded my review of the new Netflix animated film Klaus (see above) and boy did I love this movie. It’s basically an origin story of Santa Claus with 2D animation (a Rachel movie if I’ve ever heard it!) Going into it I thought it would be similar to Santa in Rise of the Guardians (which is a movie I love) but it actually proved to be quite different. Santa here is a wounded person who is closer to the father in Song of the Sea than our typical jolly old St Nick. I loved the journey of all the characters. I loved the 2D animation and how director Sergio Pablos used light and music to create tone. If you haven’t seen it you really should. I just wish I could see it in the theater! 🙁 I often jokingly talk in my reviews about the new demographic of ‘old people movies‘. This is a new category where Hollywood makes movies starring in and for senior citizens. The new movie The Good Liar is probably the most violent of the entries in this category but it’s an entertaining enough little caper. Helen Mirren stars as a retired professor who meets a charming bachelor played by Ian McKellen. The 2 begin dating, and it turns out they are both not what we initially believe them to be. I will say this movie requires a major suspension of belief as each reveal gets more ridiculous than the next. But if you can take that leap there’s fun to be had and the acting is of course top notch. It all makes for an entertaining if silly ride. (The film does earn its R rating so be prepared) I really want to write more about 1917 because it is an incredible experience but for now this will have to do. In what is definitely one of the best movies of the year, director Sam Mendes has created a war film that completely absorbed me and left me an emotional mess afterwards. It reminded me a lot of Hacksaw Ridge which is another film I love. Both this and Hacksaw focus on one human amidst the horrors of war and leave you rooting for this person’s success. In 1917, Roger Deakin’s incredible cinematography makes us feel like we are seeing one shot photography, which is more than just a gimmick. It makes the viewer feel like they are the 3rd person in this risky mission across No Man’s Land in World War 1. It is violent but I was rooting for the characters and riveted by every turn in their journey. Definitely seek this film out. It’s worth the investment and you will leave inspired. Jumanji: the Next Level- I enjoyed 2017’s Jumaji: Welcome to the Jungle. It was a terrific way to do a remake of a beloved film. It has the bones of the classic but it’s own story and take on the world. More importantly it was funny. I will forgive a lot of problems in a story if I am laughing. This is where we run into problems with the sequel Jumanji: The Next Level: it’s not very funny. Or rather I should say, it has a few funny jokes they tell over and over again; thereby, weakening their impact. This Jumaji film isn’t awful. The action set pieces are fun and the cast can be likable. However, there’s nothing new here. It’s like they got to old people jokes and gave up. Danny Glover and Danny Devito are fun enough but pretty cliched. Awkwafina is given nothing to do and Nick Jonas isn’t brought on until late in the 2nd act. I also did not appreciate the excessive profanity thrown in for no reason. It did nothing for the characters or story and makes it so I cannot recommend it as a harmless family adventure film. My advice is watch Dora and the Lost City of Gold instead. It had all the adventure and humor Jumanji: The Next Level fails to bring. Frown Worthy Playmobil: The Movie- Most followers of this site probably know about the epic failure at the box office that is Playmobil: the Movie. However, box office is not everything so I went to see this film yesterday with an open mind. Unfortunately cinema-goers didn’t see this film for a reason. The problem is there are too many ideas. At each turn we are presented with new characters, worlds, villains, motivations, and more. It becomes overwhelming. The film feels very shouty and especially the music did not work at all. I don’t even think small children will like it because most of the jokes are about dating, marriage and other adult topics. It feels like they put 1000 ideas into a bucket and picked one out each week to create the script. It so doesn’t work despite the animation being fine and the action quickly paced. Playmobil: the Movie is a definite skip. Bombshell- Bombshell is a bit of an oddity of a film. It’s an attempt to tell a story about conservative women who stick up for themselves. This is very unusual for typically liberal Hollywood, and I think that’s a great thing. If movements like #metoo are going to work we need to tell all women’s stories not just the ones Hollywood agrees with on politics. Some people will not be able to get over the fact that Gretchen Carlson and Megyn Kelly work for Fox News but that wasn’t an issue for me. The makeup on Charlize Theron and Nicole Kidman is incredible. Really all the casting is spot on. They all look so close to the original people! I was drawn into the story of Bombshell but I do think there are some problems. I understand the need for the fictional Margot Robbie character as an amalgamation of a bunch of women (and telling Gretchen’s story she couldn’t tell because of settlements) but it felt inconsistent and inauthentic. Also there is something about the production and direction that felt on a made for TV level. I love made for TV movies but I expect a film with such performances to feel a little more cinematic. Still overall I enjoyed Bombshell and recommend seeing it for the story and acting. There you have it! My quick updates on what I have been watching at the theater. If you have seen any of these films let me know what you think. Thanks! [REVIEW] ‘Little Women’ and is 1 Amy Better than 2? December 5, 2019 December 5, 2019 \| Rachel's Reviews If you have been following my writing for any amount of time you know I am a huge fan of Little Women, both novel and many film adaptations. In fact, it was the first big book I was proud of reading and finishing. I remember relating to all 4 March sisters and crying when Beth died and hoping I could be wild and independent just like Jo. It’s the best! Unfortunately the film versions have been more than a little disappointing lately with a weak adaptation from PBS and a terrible modern adaptation at the theaters last year. So as you can imagine I approached this new version by director Greta Gerwig with a mixture of excitement and fear. Fortunately, for the most part, I enjoyed it and definitely recommend it for families during this Christmas season. There are many strengths to this new version of Little Women. To begin with, most of the casting is strong. I especially liked Saoirse Ronan (who I’ve loved ever since Brooklyn) as Jo. She brought the independent spirit while keeping the character easy to relate with and likable. I also enjoyed Emma Watson as Meg and admire her for taking a small part in an ensemble film when she certainly could demand more. Laura Dern is also strong as Marmee and Meryl Streep is fun as the crotchety Aunt March (although it’s weird for me to think of Meryl as so old!). Chris Cooper also puts in nice work as Mr Lawrence and Timothy Chalamet is a decent Laurie (a very difficult role to cast because you can’t make him too charming or you are mad at Jo nor too nerdy or there’s no romantic tension. It’s tough). For the most part the big beats of the story are done well and I particularly think Jo and Laurie shippers will like the choices made. The film also looks beautiful with lovely period details in locations and costumes. The mixed aspects of LittleWomen mostly come from 2 areas. The first is the non-linear storytelling. Normally I am not a fan of this narrative choice as I think it breaks up any momentum the characters have (Man of Steel…) and I feel some of that here. However, because you see Amy and Laurie together very early on it makes the transition from him and Jo, to him and Amy, a lot more believable and effortless. The other problem is the decision to cast 1 actress to play Amy instead of 2 like they did in the 1994 film. Although not as absurd as the 1949 version with Elizabeth Taylor as Amy, 23 year old Florence Pugh looks weird trying to play a 12 year old. This awkwardness is enhanced by the non-linear storytelling where you are flipped around from young and older versions of the character while the actress looks the same at all ages. Florence Pugh is fine in the role but I just think they should have cast 2 for the character like they did in the 1994 version. There aren’t many outright cons for this version of Little Women; however, I have a couple. The first one is I wasn’t crazy about Eliza Scanlen as Beth. Claire Daines is so much better in the 1994 version, and I think the non-linear storytelling hurt our connection to Beth and the mounting tension and stress on her family her illness brings the most. I also thought the final scenes with Jo were a little too cute and overtly modern for my taste. The character is a classic example of the independent female archetype. She does not need extra scenes with her being snarky or clever to prove the point. Other than that I enjoyed Little Women. I hope it will inspire a new crop of young girls to read the book and hopefully appreciate their families more each day. When you get to see this version please let me know what you think. [REVIEW] ‘Waves’ and the American Family Forgives When I sit down to watch an arthouse film like Trey Edward Shults’ new movie Waves I have to prepare myself for something abstract where visuals are more important than narrative. Sometimes these movies work for me (Knight of Cups, A Ghost Story) and sometimes they don’t (If Beale Street Could Talk, The Souvenir). With Waves it mostly worked for me but I much prefer the second part of the story over the first part. Let me explain: Waves tells the story of an African- American family of 4 in Miami, Florida who seem to be living the dream life at first but as we dive in we see a ton of hurt and problems. The first half of the movie tells the tragic downfall of the oldest son Tyler (Kelvin Harrison). His dream is to get a scholarship wrestling but he has an injury in his shoulder he is hiding from his family and coach. He also has a girlfriend who just might be pregnant. As the problems mount up Tyler’s world starts swirling around him until he loses control. My problem with Tyler’s story is I felt it was very predictable. The styling is beautiful but how many movies have we seen with the overbearing father (Sterling K Brown) and the teen rebelling. It was beautiful but was too reliant on archetypes to move me the way it wanted to. Then we get into part 2 which focuses on the second child Emily (Taylor Russell). The reason why her story moved me is she has a more unique conflict. I haven’t seen many movies with teenagers who have to forgive their siblings (and others) for the pain and hurt they feel. That struggle was much more interesting to see play out. Also the other characters became less archetypal and more like real people. I particularly loved a little scene between Emily and her Dad as they fish and have an open and honest conversation about their pain and anger. Emily begins a relationship with schoolmate Luke (Lucas Hedges who I always love) and he has his own demons with his father and his own struggle to forgive. This was much easier to relate to than Tyler’s journey and felt more emotionally true. I kind of wish we could get a sequel because they had incredible chemistry and I bought into their romance completely. Director Trey Edward Shults makes strong choices that could be gimmicks but for the most part worked for me. The spinning shots got a little nauseating but the colors and use of music helped draw me into the story and give the movie its own identity. All that said, it’s the message of the movie that makes it stand out. Waves is not only a story about a broken family but how they learn to forgive each other and heal from their wounds. It moved me and I definitely recommend giving this film a shot. Rachel’s Reviews Blind Spot 61: SELENA (1997) [REVIEW] ‘Effigy: Poison and the City’ [REVIEW] TULSA or A Modern-Day Pollyanna My 2021 Blind Spot Picks My Best Movies of 2020	cc/2021-04/en_middle_0039.json.gz/line1161
__label__cc	0.641989	0.358011	Posts Tagged ‘Poetry 180’ Postcard From Billy Collins — Kicking Off National Poetry Month Posted in Bones, Books, Gratitude, Life In Letters, Photography, Poetry, Postcards From The Edge, Practice, Reading, Silence, Writers, tagged Academy of American Poets, Beginner's Mind, Billy Collins, celebrate poetry, Fishing on the Susquehanna in July, giving back, honoring those who came before us, how to celebrate poetry, humility, kicking off National Poetry Month, Liu Yung, National Poem In Your Pocket Day, National Poetry Month, Poem In Your Pocket Day, Poetry 180, poets, postcard from Billy Collins, postcards, The Lanyard, the power of Gratitude, the practice of gratitude on April 7, 2009\| 51 Comments » Postcard From Billy Collins, Minneapolis, Minnesota, March 2009, photo © 2009 by QuoinMonkey. All rights reserved. In February, we read the work of Billy Collins in our monthly Poetry & Meditation Group. Though he was the United States Poet Laureate from 2001 to 2003, I had not been introduced to his body of work (with the exception of his popular poem about mothers and sons, “The Lanyard“). But after reading “Japan” and “Fishing on the Susquehanna in July” out loud, and listening in silence while others read his poetry, I became a big fan. As is our custom, at the end of the night, the founder of our Poetry Group passed around a card for us to sign, a token of our gratitude to the poet. Each month, she addresses, seals and stamps the envelope, then mails our card off to the poet the next day. We don’t have expectations; it’s enough to share their poetry. But once in a while, the Universe responds in kind. When we arrived at the March Poetry & Meditation Group, here is what we found: To the Teri Blair Meditation & Poetry Group! Liu Yung This poet of the Sung dynasty is so miserable. The wind sighs around the trees, a single swan passes overhead, and he is alone on the water in his skiff. If only he appreciated life in eleventh-century China as much as I do — no loud cartoons on television, no music from the ice cream truck, just the calls of elated birds and the steady flow of the water clock. Poem reprinted with permission of the author, Copyright 2006 Billy Collins. Billy Collins describes poetry as “the only surviving history we have of human emotion.” We were thrilled and honored to hear from him. And it seems like a great way to kick off National Poetry Month on red Ravine. I am continually surprised by the generosity of famous writers to give back to those of us who find ourselves at humble beginnings. Maybe it’s a lesson to pay attention to — that no matter our status, we are all at the beginning. Every poem, short story, essay, and blog post takes us back to Beginner’s Mind. We hope you will join in the celebration during National Poetry Month. It was established in 1996 by the Academy of American Poets and is a month-long national celebration of poetry. According to poets.org, the concept is to widen the attention of individuals and the media — to the art of poetry, to living poets, to our complex poetic heritage, and to poetry books and journals of wide aesthetic range and concern. The hope is to increase the visibility and availability of poetry in popular culture while acknowledging and celebrating poetry’s ability to sustain itself in the many places where it is practiced and appreciated. The goals of National Poetry Month are to: Highlight the extraordinary legacy and ongoing achievement of American poets Introduce more Americans to the pleasures of reading poetry Bring poets and poetry to the public in immediate and innovative ways Make poetry a more important part of the school curriculum Increase the attention paid to poetry by national and local media Encourage increased publication, distribution, and sales of poetry books Increase public and private philanthropic support for poets and poetry On April 16th our Poetry & Meditation Group will be reading the poems of Yusef Komunyakaa. Maybe you’ll want to start your own poetry group. Or purchase “Ballistics,” the latest from Billy Collins. Poem In Your Pocket Day is coming up on April 30th. And here are 30 more ways to honor poets and poems. Whatever you choose to do, celebrate poetry! -posted on red Ravine, Tuesday, April 7th, 2009 -related posts and links: NPR: Reading List & Interview with Billy Collins, Got Poetry? (National Poem In Your Pocket Day), Billy Collins Reads “The Lanyard” on YouTube , PBS Online NewsHour: Billy Collins Interview, December 10th, 2001 — the week following his inaugural reading at the Library of Congress after becoming U.S. Poet Laureate, Poetry 180 — a poem a day for american high schools	cc/2021-04/en_middle_0039.json.gz/line1165
__label__cc	0.536745	0.463255	1-77 Portage Path [16] 2-77 First Congregational Church [13] 3-77 First Congregational Church [7] 4-77 Early Synthetic Soda Ash Plant [3] 5-77 Main Gatehouse of Ohio C. Barber's Anna Dean Farm [3] 6-77 Site of Sojourner Truth's Speech on Women's Rights [3] 7-77 Middlebury Lodge No. 34 F. & A.M. [4] 8-77 Grace School [3] 9-77 Old Town Hall and Academy [5] 10-77 Anna Dean Farm Barn No. 1 [7] 11-77 Wesley Temple African Methodist Episcopal Zion Church [4] 12-77 Johnson's Corners [4] 13-77 Locust Grove Cemetery Vault [6] 14-77 Colt Barn - Anna Dean Farm [5] 15-77 The Pennsylvania and Ohio Canal [7] 16-77 PPG Industries in Barberton, 1900-2000 [8] 17-77 Howard Street District [11] 18-77 Ghent Woolen Mill [5] 19-77 Stan Hywet Hall [9] 20-77 Silver Lake [5] 21-77 Western Reserve College and Academy [10] 22-77 The Mustill Site / The Cascade Valley [12] 23-77 Franklin Augustus "F.A." Seiberling and the Goodyear Tire and Rubber Company [12] 24-77 Astronaut Judith Resnik [12] 26-77 Hall Park Allotment Historic District [7] 27-77 Sikh Gurdwara [3] 28-77 The Soap Box Derby [9] 29-77 Airdock [19] 30-77 Karl Arnstein [14] 31-77 First Congregational Church of Hudson [7] 32-77 1936 Akron Rubber Strike [5] 33-77 Slovenian Independent Society Home [5] 35-77 Coventry Township / Portage Lakes [13] 36-77 Glendale Steps [5] 37-77 Treaty of Fort McIntosh Boundary Line [4] 39-77 Gustave H. Grimm [6] 38-77 Elm Court Arthur Hudson Marks (1874-1939) / Our Lady of the Elms Sisters of St. Dominic [8] 40-77 The Gate Lodge, Stan Hywet Hall & Gardens [5] 42-77 High Bridge Glens [8] 41-77 Middlebury Cemetery [6] 43-77 Boston Township Hall [7] 44-77 Shaw Cemetery [4] 45-77 Hale, Hammond, Cranz Homesteads [5] 46-77 Akron Community Service Center and Urban League [2] 46-77 John Richards Buchtel [2] 47-77 Akron Fulton Airport Champions Raceway [5] 49-77 Bath Center Cemetery / Bath Township Hall [9] 50-77 Abolitionist John Brown (1800-1859) [4] Cuyahoga Falls Parks Home / Summit County / 42-77 High Bridge Glens [8] High Bridge Glens Text, side A In 1879, local hardware store owners L.W. Loomis and H.E. Parks established a summer resort at Front Street and Prospect Avenue. The High Bridge Glens and Caves park spanned both sides of the Cuyahoga River and featured a dance and dining pavilion, scenic trails and overlooks, cascades and waterfalls, deep caverns, curious geological formations, and a suspension footbridge. The park also offered several manmade attractions, including what is believed to have been one of the earliest roller coasters in the area. At the height of its popularity, the park attracted more than 8,000 visitors a day, including Congressman (later president of the United States) William McKinley. (continued on other side) Text, side B (continued from other side) The park closed in the early 1900s, and in the years that followed, manufacturing sites were constructed along the banks of the Cuyahoga River to harness its power, whereby blocking public access to the river. The rededication of the High Bridge Glens Park by Mayor Don L. Robart in 2009, the Year of the River, celebrates the return of this important asset to its people. Named one of only fourteen National Heritage Rivers, the Cuyahoga River is uniquely shaped in that it flows both north and south beginning just fifteen miles from Lake Erie where it empties after the 100-mile journey. City of Cuyahoga Falls and The Ohio Historical Society 1817 Front St High Bridge Glens Park, along the path to the southern overlook Latitude: 41.1301870, Longitude: -81.4832090.	cc/2021-04/en_middle_0039.json.gz/line1171
__label__wiki	0.571594	0.571594	Using ASQ-3 in a Virtual Environment by Brookes Publishing April 9, 2020 60 minutes Learn how to support families and continue administering developmental screening with ASQ-3 during the current health crisis. Hear about lessons learned from a Virtual Child Screening study conducted by Parents as Teachers National Center challenges and opportunities for implementing child screening during the health crisis options to access ASQ-3 questionnaires and tools available to score and document results and follow-up considerations and resources for remote delivery of ASQ screening to families during the health crisis ASQ-3 Expert Q&A Session—Just for Home Visitors April 22, 2020 60 minutes Join us for a special Q&A session with Brookes Publishing to hear from the experts the best strategies for using the ASQ-3 in a virtual environment. Download Your Certificate of Completion Name: Your full name as you wish it to appear on the certificate. Certificates are PDF files. If you do not have a PDF viewer, you can download Adobe Acrobat Reader. The Institute for the Advancement of Family Support Professionals About the Institute Contact the Institute Funds for this project are provided through the HRSA MIECHV Innovation Grant and the Heising Simons Foundation. Project partners include Iowa Department of Public Health, Virginia Department of Health, Early Impact Virginia, University of Kansas Center for Public Partnerships and Research, and James Madison University's Health Education Design Group. Select modules and the integration of the Career Compass software into the Institute platform receives partial financial support from the Health Resources and Services Administration (HRSA) of the U.S. Department of Health and Human Services (HHS) under the Maternal, Infant and Early Childhood Home Visiting (MIECHV) Program FY'17 Innovation Grant UH4MC30710, awarded to the Iowa Department of Public Health (IDPH). This information or content and conclusions are those of the author and should not be construed as the official position or policy of, nor should any endorsements be inferred by HRSA, HHS or the U.S. Government.	cc/2021-04/en_middle_0039.json.gz/line1192
__label__cc	0.613501	0.386499	Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA Kelsey L. Ruckert, Vivek Srikrishnan, Klaus Keller Earth and Environmental Systems Institute Coastal planners and decision makers design risk management strategies based on hazard projections. However, projections can differ drastically. What causes this divergence and which projection(s) should a decision maker adopt to create plans and adaptation efforts for improving coastal resiliency? Using Norfolk, Virginia, as a case study, we start to address these questions by characterizing and quantifying the drivers of differences between published sea-level rise and storm surge projections, and how these differences can impact efforts to improve coastal resilience. We find that assumptions about the complex behavior of ice sheets are the primary drivers of flood hazard diversity. Adopting a single hazard projection neglects key uncertainties and can lead to overconfident projections and downwards biased hazard estimates. These results highlight key avenues to improve the usefulness of hazard projections to inform decision-making such as (i) representing complex ice sheet behavior, (ii) covering decision-relevant timescales beyond this century, (iii) resolving storm surges with a low chance of occurring (e.g., a 0.2% chance per year), (iv) considering that storm surge projections may deviate from the historical record, and (v) communicating the considerable deep uncertainty. Fingerprint Dive into the research topics of 'Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA'. Together they form a unique fingerprint. Ice Cover Medicine & Life Sciences Uncertainty Medicine & Life Sciences Oceans and Seas Medicine & Life Sciences Risk Management Medicine & Life Sciences Decision Making Medicine & Life Sciences Ruckert, K. L., Srikrishnan, V., & Keller, K. (2019). Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA. Scientific reports, 9(1), [11373]. https://doi.org/10.1038/s41598-019-47587-6 Ruckert, Kelsey L. ; Srikrishnan, Vivek ; Keller, Klaus. / Characterizing the deep uncertainties surrounding coastal flood hazard projections : A case study for Norfolk, VA. In: Scientific reports. 2019 ; Vol. 9, No. 1. @article{7c95d2d044ea4979aaeacd7728390205, title = "Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA", abstract = "Coastal planners and decision makers design risk management strategies based on hazard projections. However, projections can differ drastically. What causes this divergence and which projection(s) should a decision maker adopt to create plans and adaptation efforts for improving coastal resiliency? Using Norfolk, Virginia, as a case study, we start to address these questions by characterizing and quantifying the drivers of differences between published sea-level rise and storm surge projections, and how these differences can impact efforts to improve coastal resilience. We find that assumptions about the complex behavior of ice sheets are the primary drivers of flood hazard diversity. Adopting a single hazard projection neglects key uncertainties and can lead to overconfident projections and downwards biased hazard estimates. These results highlight key avenues to improve the usefulness of hazard projections to inform decision-making such as (i) representing complex ice sheet behavior, (ii) covering decision-relevant timescales beyond this century, (iii) resolving storm surges with a low chance of occurring (e.g., a 0.2% chance per year), (iv) considering that storm surge projections may deviate from the historical record, and (v) communicating the considerable deep uncertainty.", author = "Ruckert, {Kelsey L.} and Vivek Srikrishnan and Klaus Keller", note = "Funding Information: We thank Robert Nicholas, Nancy Tuana, Irene Schaperdoth, Ben Lee, Francisco Tutella, and Randy Miller for their valuable inputs. We also thank Claudia Tebaldi and Tony Wong for sharing data and for their valuable inputs. Additionally, we thank K. Joel Roop-Eckart for sharing his function approximating median probability return periods for observations. This work was supported by the National Oceanic and Atmospheric Administration (NOAA) Mid-Atlantic Regional Integrated Sciences and Assessments (MARISA) program under NOAA grant NA16OAR4310179 and the Penn State Center for Climate Risk Management. We are not aware of any real or perceived conflicts of interest for any authors. Any conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the funding agencies. Any errors and opinions are, of course, those of the authors.", journal = "Scientific Reports", Ruckert, KL, Srikrishnan, V & Keller, K 2019, 'Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA', Scientific reports, vol. 9, no. 1, 11373. https://doi.org/10.1038/s41598-019-47587-6 Characterizing the deep uncertainties surrounding coastal flood hazard projections : A case study for Norfolk, VA. / Ruckert, Kelsey L.; Srikrishnan, Vivek; Keller, Klaus. In: Scientific reports, Vol. 9, No. 1, 11373, 01.12.2019. T1 - Characterizing the deep uncertainties surrounding coastal flood hazard projections T2 - A case study for Norfolk, VA AU - Ruckert, Kelsey L. AU - Srikrishnan, Vivek AU - Keller, Klaus N1 - Funding Information: We thank Robert Nicholas, Nancy Tuana, Irene Schaperdoth, Ben Lee, Francisco Tutella, and Randy Miller for their valuable inputs. We also thank Claudia Tebaldi and Tony Wong for sharing data and for their valuable inputs. Additionally, we thank K. Joel Roop-Eckart for sharing his function approximating median probability return periods for observations. This work was supported by the National Oceanic and Atmospheric Administration (NOAA) Mid-Atlantic Regional Integrated Sciences and Assessments (MARISA) program under NOAA grant NA16OAR4310179 and the Penn State Center for Climate Risk Management. We are not aware of any real or perceived conflicts of interest for any authors. Any conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the funding agencies. Any errors and opinions are, of course, those of the authors. N2 - Coastal planners and decision makers design risk management strategies based on hazard projections. However, projections can differ drastically. What causes this divergence and which projection(s) should a decision maker adopt to create plans and adaptation efforts for improving coastal resiliency? Using Norfolk, Virginia, as a case study, we start to address these questions by characterizing and quantifying the drivers of differences between published sea-level rise and storm surge projections, and how these differences can impact efforts to improve coastal resilience. We find that assumptions about the complex behavior of ice sheets are the primary drivers of flood hazard diversity. Adopting a single hazard projection neglects key uncertainties and can lead to overconfident projections and downwards biased hazard estimates. These results highlight key avenues to improve the usefulness of hazard projections to inform decision-making such as (i) representing complex ice sheet behavior, (ii) covering decision-relevant timescales beyond this century, (iii) resolving storm surges with a low chance of occurring (e.g., a 0.2% chance per year), (iv) considering that storm surge projections may deviate from the historical record, and (v) communicating the considerable deep uncertainty. AB - Coastal planners and decision makers design risk management strategies based on hazard projections. However, projections can differ drastically. What causes this divergence and which projection(s) should a decision maker adopt to create plans and adaptation efforts for improving coastal resiliency? Using Norfolk, Virginia, as a case study, we start to address these questions by characterizing and quantifying the drivers of differences between published sea-level rise and storm surge projections, and how these differences can impact efforts to improve coastal resilience. We find that assumptions about the complex behavior of ice sheets are the primary drivers of flood hazard diversity. Adopting a single hazard projection neglects key uncertainties and can lead to overconfident projections and downwards biased hazard estimates. These results highlight key avenues to improve the usefulness of hazard projections to inform decision-making such as (i) representing complex ice sheet behavior, (ii) covering decision-relevant timescales beyond this century, (iii) resolving storm surges with a low chance of occurring (e.g., a 0.2% chance per year), (iv) considering that storm surge projections may deviate from the historical record, and (v) communicating the considerable deep uncertainty. JO - Scientific Reports JF - Scientific Reports M1 - 11373 Ruckert KL, Srikrishnan V, Keller K. Characterizing the deep uncertainties surrounding coastal flood hazard projections: A case study for Norfolk, VA. Scientific reports. 2019 Dec 1;9(1). 11373. https://doi.org/10.1038/s41598-019-47587-6	cc/2021-04/en_middle_0039.json.gz/line1201
__label__cc	0.705822	0.294178	Key Elections Dates: Deadline for receipt of publicity materials for publication in Engineering Dimensions and on the PEO website December 11, 2020 at 4 p.m. EST All Candidate Meetings Week of January 4, 2021 Date voting will commence January 15, 2021 at 12 p.m. EST Date voting closes February 19, 2021 at 4 p.m. EST Eblast from candidates to eligible voters January 18, February 1, February 16, 2021 Learn more about each of your Council candidates. With both online and telephone options available, voting in the 2021 Council Elections only takes a few minutes and you can cast your ballot anywhere, anytime. If you encounter any issues with submitting your ballot, please contact ClearPicture at 1-844-818-1774. All Candidate Meetings Schedule 5:30 pm – East Central Regional Councillor; Rewatch webcast 6:45 pm – Western Regional Councillor; Rewatch webcast Tuesday January 5, 2021 5:30 pm – Councillor-at-Large; CANCELLED 6:30 pm – Vice President; Rewatch webcast Wednesday January 6, 2021 5:30 pm – President-Elect; Rewatch webcast Unfortunately, the all candidates meeting scheduled for Tuesday, January 5 at 5:30 p.m. (councillor-at-large positions) has been cancelled due to insufficient candidate attendance. This meeting will not be rescheduled. Information on the candidates will be included in your elections package, published in the January/February issue of Engineering Dimensions and posted on PEO’s elections web page: www.peovote.ca. 2021 Elections Guide 2021 Election Publicity Procedure 2021 Election Voting Procedures 2021 Election Candidates Letter Candidate Statement Template (fillable) Candidate Statement Template (blank) Why should I run for Council? If you’ve never thought of running for Council before, consider the impact you can make by: Bringing your engineering, work and life experiences and leadership to bear on the policy decisions Council makes to continuously improve regulation of the practice of engineering; and Influencing PEO during one of the most critical times in its nearly 100-year history through enhanced governance initiatives and work to address the recommendations of PEO’s external regulatory performance review. Why does my vote matter? Self-regulation of engineering in Ontario is a privilege - not a right. By voting in the Council elections, you’re doing your part to ensure that we, as professional engineers, are in a strong position to continue regulating our own profession to protect the public interest and promote the integrity of engineering in Ontario. In the 2017 Council elections, 16.38 per cent of eligible voters participated. What is the purpose of Council? PEO Council works to ensure that the Professional Engineers Act is updated to reflect changes in the practice of engineering and responds to the evolving needs and expectations of the public. In 2010, the last time the Act was opened, 66 amendments were made with input from Council. Functions as the governing body and board of directors of PEO Provides overall direction for the association and the profession Upholds PEO's duty to protect the public interest Sets and maintains high standards for professional engineering practice Collaborates with government to respond to critical policy issues Recognizes emerging engineering disciplines As a member of Council, you will: Develop and drive PEO’s strategic direction; Discuss and decide on issues relevant to the regulator; Approve PEO’s budget; Provide direction on regulatory priorities; and Ensure the responsible use of resources to effectively regulate the practice of engineering. PEO Eligible Voter Percentages Eligible Voters Vote Percentage 2020 85,732 8,974 10.47% 2019 83,820 10,421 12.43%	cc/2021-04/en_middle_0039.json.gz/line1202
__label__wiki	0.74873	0.74873	A Saskatoon researcher says soap and water is a safer way to kill COVID-19 than many disinfectants. Here’s why. CTV News Saskatoon Staff Published Tuesday, December 1, 2020 12:43PM CST File photo (Shutterstock.com / alejandro dans neergaard) SASKATOON -- A University of Saskatchewan chemistry researcher recommends using plain soap and water to disinfect your home, rather than hydrogen peroxide or bleach products. Tara Kahan’s research team found that mopping a floor with a commercially available hydrogen peroxide-based disinfectant raised the level of airborne hydrogen peroxide to more than 600 parts per billion — about 60 per cent of the maximum level permitted for exposure over eight hours, and 600 times the level naturally occurring in the air. “When you’re washing surfaces, you are also changing the air you are breathing,” she said in a news release. Too much exposure to hydrogen peroxide could lead to respiratory, skin and eye irritation, according to the U.S. Centres for Disease Control. “The real risk is for people who get repeatedly exposed, such as janitors and house cleaners. We washed the floor and collected measurements at face height — the concentrations will be even stronger at the floor or at the level of a countertop,” Kahan said. More than 10 per cent of disinfectants approved by Health Canada that are deemed likely to be effective against coronavirus use hydrogen peroxide as the active ingredient. A total of 168 disinfecting products containing hydrogen peroxide as the active ingredient are approved or marketed in Canada. The COVID-19 pandemic has led to increased cleaning and demand for all types of cleaning products, including bleach alternatives that contain hydrogen peroxide, according to the release. Hydrogen peroxide is still much less potentially harmful than bleach, Kahan said. People using disinfectants can consider opening a window, turning on a range hood, or using a central air system. Ventilation can dramatically reduce levels of pollutants circulating in the air and is one of the most effective methods of removing particles that can carry the virus, Kahan said. Kahan’s team is repeating the experiment in a house and apartment in Saskatoon to determine whether the high numbers occur in a real-world environment and to find practical ways to mitigate exposure risks. The results are published in the journal Environmental Science & Technology. How a 'sewage crystal ball' can predict Saskatoon’s COVID-19 future 'Drastic increase' in Saskatoon COVID-19 cases predicted by research team monitoring city's sewage	cc/2021-04/en_middle_0039.json.gz/line1208
__label__cc	0.570935	0.429065	Don Chani Listen to Satellite What began as a group of friends with a love for the bass heavy, harmony laden roots reggae sound of the '70's, evolved into the current DON CHANI sound. The music stays true to the reverb washed records of the era, while also incorporating rocksteady, ska, cumbia and dancehall. Add some live dub, thick horns, a high energy live show and you've got DON CHANI. DON CHANI has shared the stage with the legendary Ziggy Marley, The Wailers, Israel Vibration, Skatalites, Culture, and the Mighty Diamonds to name a few. Presented by: World Reggae & Roots Flamingo Cantina The show at Flamingo Cantina on Wednesday, March 13 8:00PM Don Chani 9:00PM New Kingston 10:00PM Cilantro Boombox 11:00PM Mau Mau Chaplains 12:00AM Hector Guerra 1:00AM Bareto http://donchanimusic.com	cc/2021-04/en_middle_0039.json.gz/line1212
__label__cc	0.585976	0.414024	Digitally remastered edition. 1998 album by the Swedish hard rock band. Haystack was formed 1994 by Ulf Cederlund (Entombed, Disfear, Murder Squad, Alpha Safari, Swarm of Souls) after a North American tour where the band Unsane opened up for Entombed. Uffe liked what they were doing and formed a three-piece band influenced mainly by Unsane but also other Noise-rock/Fucked-up punk-rock three-piece bands like: Hammerhead (US), NoMeansNo, Steel Pole Bath Tub, Bitch Magnet, Melvins, Dinosaur Jr, Wipers and Dead Moon. Near future. Label: THREEMAN RECORDINGS Slave Me Artist: Haystack 1. Life 2. Burn-Out 3. She Calms Down 4. This Is the Day 5. Slave Me 7. An Object I Can'T Control 8. Get It Out 9. Alright 10. What'S in It for Me? 11. Born Beyond Belief 12. The Collector 13. What a Way to Go	cc/2021-04/en_middle_0039.json.gz/line1214
__label__wiki	0.741012	0.741012	Andrew Manze’s ‘Matthew Passion Transcribed for Orchestra and Chorus’ 03/04/2012 01/05/2011 by Stan Bach: Oslo Philharmonic, Oslo Philharmonic Choir, Sølvguttene, boys’ choir, Andrew Manze (conductor), Oslo Concert Hall, 15.4.2011 (JFL) J.S. Bach: Matthew Passion Andrew Manze: conductor Ditte H. Andersen: soprano Marianne Beate Kielland: mezzosoprano Andrew Staples: tenor, The evangelist Johannes Weisser: baritone, Christ Magnus Staveland: tenor Håvard Stensvold: bass It’s not a proper Easter for me without at least one Parsifal and/or Matthew Passion, and this year I got my fix in Oslo, where the Philharmonic performed the Matthew Passion under Andrew Manze. Or, as Manze suggested during a charming conversation earlier that day, “we’re actually doing the Matthew Passion transcribed for Orchestra and Chorus… which is in effect what the Matthew Passion has become nowadays. Bach wrote it for eight singers, two groups of four. And all the eight have a solo aria, but they also sing all the chorus parts. Well, what we call the “chorus”, anyways. Today we’ve got a chorus of 90 out there; forty-five here and forty-five there. And we brought soloists to sing the arias. So it couldn’t be more different from his original conception. What we are doing today is closer to Stokowski than it is to Bach. Not that that’s a bad thing… it’s fun, it’s great. But it’s a very different thing. The Oslo Philharmonic would never set [a ‘chamber version’] up, of course. Understandably they want a piece for orchestra and choir, and that’s what we shall get tonight.” With its gently flexible pulse, calm enough to see the amassed musical forces safely through the opening, Manze’s ‘Matthew Passion transcribed for Orchestra and Chorus’ got off to a fine start at the Philharmonic Hall. Compared to two groups of four or eight singers shouting at each other in the opening back-and-forth, the Q&A of the two choruses had the consistency of toffee, but it was genial and sufficiently tear-inducing to those so inclined. Altogether it was performance that offered a lot to nitpick if one cared to nitpick (slow and occasionally rough orchestral patches, for example), but it was also a loving, caringly executed one, that did the beauty of Bach full justice. On the nitpick side might have been the singers, foremost bass Håvard Stensvold, whose Judas slid up the notes and promised to be a liability—further undermined by his somewhat too-rich impersonation of his characters. But at least his vocal performance considerably improved by the time he got to the aria “Gerne will ich mich bequemen…” – except for when he didn’t quite hit the notes which even belting them out couldn’t quite cover. Soprano Ditte H. Andersen was perfectly fine when she turned her high-powered vibrato off, as she did in “Aus Liebe will mein Heiland sterben” and she blended particularly well with even-voiced mezzo Marianne Beate Kielland. Tenor Andrew Staple, the Evangelist, was most convincing in the few really gutsy piano passages he dare threw in while best performance of the evening came from baritone Johannes Weisser’s Jesus, whose sonorously pleasant oratorio voice was literally outstanding. Not entirely inappropriate, given the subject. Categories Concert Reviews, International Concerts, Previously Published Tags Jens F. Laurson, Oslo Post navigation URGENT – ACCIDENTAL DELETION OF ALL EMAIL SUBSCRIBERS! Anderszewski, Berlioz, And Strategically Lowered Expectations	cc/2021-04/en_middle_0039.json.gz/line1216
__label__cc	0.512264	0.487736	Retail apocalypse will spread after gloomy holiday season: strategist ·Editor-at-Large Investors should be prepared for more sweeping store closure announcements — known affectionately in retail analytical circles as the “retail apocalypse” — after what is shaping up to be a lackluster holiday shopping season thanks to the COVID-19 pandemic. “There are 110,000 stores in America. In total, we think there is going to be at least 25,000 of those 110,000 stores closed from now through the time COVID-19 ends and we get to the other side of it,” veteran retail executive and JRK Worldwide Enterprise founder Jan Rogers Kniffen told Yahoo Finance Live. “So in the malls, we could see of 1,100 enclosed malls in America, we could see half of those go dark or be changed dramatically in nature.” The retail sector was well underway before the holidays to reaching some of Kniffen’s dire projections. So far in 2020, more than 8,000 retail stores have closed according to data from Coresight Research. Some of the headline-grabbing closures have come from the likes of Macy’s (struggling financially), Lord & Taylor (now bankrupt) and Gap (struggling financially). Much of the retail sector has buckled under the weight of COVID-19 mandated store closures in the spring, and then tepid foot traffic since the summer amid re-openings. And the trends at many retailers have hardly improved in the early start to the crucial holiday shopping season, setting the stage for a fresh wave of closures in early 2021 as retailers look to cut costs after weak fourth quarter sales and an uncertain return to normal post pandemic. Shopper visits to retail stores on Black Friday crashed 52.1% year over year, per data from Sensormatic Solutions. Traffic fell 45.2% last week from a year ago as consumers avoided crowds during the pandemic and spent cautiously with unemployment rates back on the rise. .@briansozzi reports on Black Friday shopping: “Crowds are just not here. You’re watching, really, the impact of the pandemic very much in real-time.” https://t.co/xpAujlllJF pic.twitter.com/l6768LBdyc — Yahoo Finance (@YahooFinance) November 27, 2020 Meanwhile, online sales on Black Friday rose 21.6% year over year to a new record of $9 billion, according to data crunched by Adobe Analytics. But, the sales result fell far short of Adobe’s high-end estimate of $9.6 billion. Online sales on Thanksgiving Day clocked in at $5.1 billion, up 21.5% from a year ago, but short of Adobe’s $6 billion forecast. “During our channel checks in New York City and Riverhead, NY, Paramus, NJ, Westport, CT, Washington, D.C., and Jacksonville, FL areas, we observed a much slower in-store start to holiday shopping than in prior years. In fact, Black Friday, in our view, looked like traffic on a typical Saturday for most of the day until picking up early afternoon,” remarked Deutsche Bank retail analyst Paul Trussell. Already retailers are preparing investors for more post-holiday store closures. Abercrombie & Fitch said last week it would close several large flagship stores to save millions in expenses. Gap outlined at an investor day in October a plan to close hundreds of more Gap and Banana Republic locations by 2023. Said Kniffen, “We could see a whole of stores close. That’s not going to be surprising because it has been going on since before COVID-19.” Brian Sozzi is an editor-at-large and anchor at Yahoo Finance. Follow Sozzi on Twitter @BrianSozzi and on LinkedIn. What’s hot from Sozzi: HP CEO: here’s how our business is trending during the pandemic Lululemon founder: retail will rally back after the pandemic Walmart CEO: the lack of stimulus is taking its toll Senator Ted Cruz: big tech is drunk on power IBM CEO: here’s why we just made a landmark business move Peloton founder: here’s one of my biggest 15 year goals Watch Yahoo Finance’s live programming on Verizon FIOS channel 604, Apple TV, Amazon Fire TV, Roku, Samsung TV, Pluto TV, and YouTube. Online catch Yahoo Finance on Twitter, Facebook, Instagram, Flipboard, SmartNews, LinkedIn, and reddit. How the economy Biden inherits compares to day 1 for Trump, Obama, and other presidents 2021 Analysis Cyber-Security Solution Vendors - Featuring Avast, Barracuda Networks and Blackberry Among Others - ResearchAndMarkets.com Global Retail E-Commerce Software Market to Grow by $ 3.38 Billion During 2020-2024 \| Featuring Adobe Inc., Blue Yonder Group Inc., Episerver Inc. among others \| Technavio Which president inherited the toughest economic situation in recent history? Yahoo Finance dug through a range of economic measures to at least shed some light on the question. The "Analysis of Vendors of Cyber-Security Solutions for SMBs: Telecoms Operator Survey" report has been added to ResearchAndMarkets.com's offering. The Dutch government wants to impose a curfew as part of beefed-up restrictions to rein in the spread of a new more contagious virus variant that already accounts for at least one in every 10 Dutch infections. Prime Minister Mark Rutte said Wednesday that his government also will ban flights from the U.K., South Africa and South America beginning Saturday for a month. With Rutte's administration in caretaker mode since resigning last week, it will have to convince skeptical lawmakers to back the 8:30 p.m.-to-4:30 a.m. curfew before it can be enforced. The Retail E-Commerce Software Market will grow by USD 3.38 bn during 2020-2024 Global Laundry Folding Robots Market to Grow by $ 386.14 Million During 2020-2024 \| Growing Acceptance of Personal Service Robots to Boost Growth \| Technavio The Laundry Folding Robots Market will grow by $ 386.14 mn during 2020-2024	cc/2021-04/en_middle_0039.json.gz/line1220
__label__wiki	0.634375	0.634375	Helen on The Galápagos of the Southern Ocean – Part I: Bon Voyage Em Oyston on The Galápagos of the Southern Ocean – Part I: Bon Voyage Tweets that mention The GalÃ¡pagos of the Southern Ocean â€“ Part I: Bon Voyage \| Journeys to the Ice -- Topsy.com on The Galápagos of the Southern Ocean – Part I: Bon Voyage Something for the weekend: poles, podcasts and Chomsky on The Greenland Ice Sheet in a high-CO2 world JWH on Climate Change and New Zealand’s Future Search within Journeys to the ice Journeys to the ice Back to Journeys to the ice The Snows of Ruapehu By Matthew Wood • 13/09/2010 Mount Ruapehu could be viewed as New Zealand’s Kilimanjaro: the upper slopes of its formidable volcanic mass tower above the plain below, hosting glaciers that, considering the surrounding desert climes, have only the most tenuous claim to existence. As is the case with its Tanzanian counterpart — vividly documented in the 2006’s An Inconvenient Truth — Ruapehu’s glaciers have diminished considerably during historical times. The 20th Century recession of glaciers around the world has been one of the most ubiquitous and manifest signs of global warming to date. Previously we’ve seen how Antarctic Research Centre scientists have demonstrated this trend in the temperate glaciers of the New Zealand Southern Alps, albeit with anomalous, climate-driven advances of certain glaciers since the early 1980s. The ARC also has a keen scientific interest in the only remaining glaciers of the North Island. Ruapehu owes much of its misshapen form to the erosive influence of glaciers, which, during glacial periods, were dramatically expanded. Today, the mountain’s small residual glaciers are pale shadows of their former glory, and precariously cling to the rough andesitic slopes at the very climatic, latitudinal and topographic limits for permanent ice in New Zealand. Tom Paulin undertook a Master’s project on the Whangaehu Glacier (Ruapehu’s largest) after learning that there had been no major publications on North Island glaciers since 1988, no mass balance studies of this specific glacier had ever been conducted and — as a true sign of the times and trends — the only other similar study to have been conducted on Ruapehu was of a glacier that no longer existed. From 1954 to 1955, the Whakapapa Glacier experienced a 94 m retreat and 10-15 m of vertical downwasting, which led to the exposure of a bedrock ridge, effectively splitting the glacier in two and thus forming the Whakapapaiti and Whakapapanui glaciers. Ironically, it is the Whakapapaiti (‘iti’ meaning ‘small’ in Maori) that has survived: the Whakapapanui (‘big’) has lost so much mass that it is now merely a stagnant ice patch. Glaciers now remain only on the southern and eastern flanks of the mountain where they are relatively shielded from the sun. A glacier’s end-of-summer snowline (EOSS) is commonly used in glaciology to quickly indicate the equilibrium line altitude (ELA): the elevation on a glacier surface at which accumulation is equal to mass loss via ablation (sublimation and/or melting). By documenting EOSSs in oblique aerial photos of the Whangaehu Glacier taken in over a 19 year period, Tom was able to get a qualitative sense of the glacier’s mass balance shifts during this time. The inter-annual trends documented by this study were corroborated by snow accumulation data at Whakapapa Skifield, a direct record of the interplay between temperature and precipitation. A quantitative mass balance study was also conducted. Between 2005 and 2007 direct measurements of snow accumulation were achieved by digging pits (up to six metres deep) into the glacier’s residual snow cover, reaching a hard, debris-rich layer that marks the beginning of any given ‘balance year’ of snow accumulation. Measuring the density of snow down the profile allows the calculation of water equivalent precipitation. The largest accumulation directly measured was 2988 mm (water equivalent) as averaged across the glacier surface. A hot water drill was used to install 15 four metre plastic stakes into the centre-line of the glacier and the adjoining summit plateau. These served a double purpose: to measure ablation rates over time, and, with careful differential GPS monitoring (±0.5 m accuracy), to assess flow patterns of the ice. Many of the stakes required re-drilling during the study due to rapid ablation rates resulting in their near-complete exhumation. During the field study it was shown that the summit plateau and the Whangaehu are in fact completely separate systems: in the modern setting the summit plateau is a down-wasting ablation zone flowing to the northwest, while Whangaehu ice velocities are perpendicular, in the range of 10-38 m/year to the southeast. While snow does accumulate temporarily at the summit, it is blown away by strong winds before the end of the balance year and acts as an important source for snow accumulating on the Whangaehu Glacier. This means that the Whangaehu has an additional, ‘false’ ELA in its uppermost reaches, with its main accumulation zone being on the sheltered mid-slopes (as shown by data from the 2006 balance year at least). The stake and snow pit data from a single year are combined to calculate the net mass balance of the glacier. Results show that the slightly negative 2006 balance year was followed by positive mass balance in 2007, in part related to a 48% increase in precipitation. In the longer term however, mass balance is not strongly associated with winter precipitation and is instead dictated mainly by summer temperatures and the length of the ablation season as measured in positive degree days. Relating the observed changes in mass balance to local climate required the installation of New Zealand’s highest automatic climate station at Dome shelter. This climate station measures high-resolution records of air temperature, humidity, incoming solar radiation, and wind direction and speed. Meteorological data collection at such elevations is plagued with problems: the build up of thick rime ice deposits around equipment; wind speed gauges regularly ‘maxing out’; and atmospheric temperature inversions all pose significant challenges to attaining usable information. By comparing temperature data from the new station to the long-running weather station at Chateau Tongariro, a temperature lapse rate of 5.96°C/1000 m was calculated. This allowed the extrapolation of the Dome shelter record back over the ~20-year period of the EOSS study. Ruapehu’s glaciers have behaved similarly to those in the Southern Alps in recent decades, but with noticeable exceptions. The glaciers share the summit with the Crater Lake and other vents: centres of frequent geothermal activity. As such, on top of climate trends, Ruapehu’s glaciers are also heavily influenced by the mountain’s volcanism. For example, the phreatomagmatic and strombolian eruptions of 1995-1996 caused mass gain on the summit plateau ice field through insulation of underlying ice by thick tephra deposits. In other areas thin tephra mantles absorbed solar radiation and locally reduced the albedo, resulting in accelerated melt and compounding mass losses related to lahars. The Tuwharetoa Glacier, the only glacier to experience persistent positive mass balance on the mountain, actually owes its enigmatic growth to a lahar, and the consequent lowering of Crater Lake into which it formerly calved, which allowed the glacier to surge across the newly exposed lake bed. Lee-side accumulation of snow and solar shielding by surrounding peaks helps sustain this stoic exception to Ruapehu’s rule. Glacial responses to volcanic phenomena are generally short-lived however, and climate remains the most important control of Ruapehu’s permanent ice. The major drivers of New Zealand climate (temperature and precipitation) at a sub-decadal timescale are the regional- to hemispheric-scale atmospheric circulation regimes of the El NiÃ±o Southern Oscillation (ENSO) and the Southern Annular Mode (SAM). The SAM refers to the strength of the southern polar vortex: when atmospheric pressure is low over Antarctica the southern mid-latitude weather systems speed up. Positive mass balance of New Zealand’s glaciers appears to be correlated to El NiÃ±o conditions (the negative phase of the Southern Oscillation Index or SOI), when we experience increased southerly and westerly airflow, but its relationship to the SAM is not yet well established. While the 20-year record presented in this study suggests that the Whangaehu Glacier has been approximately in equilibrium during this time, the trend of increasing positive degree days is worrying. It may be that this hiatus in retreat will soon end and the mountain’s glaciers will resume their slow death as global temperatures rise: an unnaturally warming backdrop on which regional climate variability will continue to operate. It will be a great shame if, through the total loss of Ruapehu’s remaining glaciers to unchecked anthropogenic global warming, we — much like Harry in Hemingway’s poignant short story — are left only with the regret that we didn’t make the most of our experience and capabilities in the time that we had. This research project would not have been possible without the support of Dr. Andrew Mackintosh (ARC – field work and academic supervision), Dr. Brian Anderson (ARC – automatic weather station installation and monitoring) and Dr. Harry Keys (DOC – aerial photography for EOSS study). El Niño–Southern Oscillation End of Summer Snowlines Mass balance Whangaehu Glacier 0 Responses to “The Snows of Ruapehu” DrYak says: Thanks for that – very informative and sobering. It will be a great pity if it does finally disappear, the Whangaehu is a nice summer ski run for any ski tourers jonesing for some turns in December. About Journeys to the ice Journeys to the Ice was the blog of Matthew Wood. We've archived his posts here for your reading pleasure.	cc/2021-04/en_middle_0039.json.gz/line1227

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.