pred_label
stringclasses 2
values | pred_label_prob
float64 0.5
1
| wiki_prob
float64 0.25
1
| text
stringlengths 115
1.01M
| source
stringlengths 39
45
|
|---|---|---|---|---|
__label__cc
| 0.536067
| 0.463933
|
Poincare was the new Copernicus
A reader comments:
Max Born was Minkowski’s assistant, and had studied the papers of Lorentz and Poincare, but never heard of Einstein until 1907, when Professor Loria from Crackow came to Gottingen for a visit, and was told by Professor Witkowski “A new Copernicus is born! Read Einstein’s paper!”. Loria and Born went to the library, found a copy of vol 17 of the 1905 An der Phy, and read the paper. Born later wrote: “Although I was quite familiar with the relativistic idea and the Lorentz transformations, Einstein’s reasoning was a revelation to me… which had a stronger influence on my thinking than any other scientific experience”.
A Copernicus analogy for relativity was first used in Poincare's long 1905 relativity paper:
We cannot be satisfied with simply juxtaposed formulas which would agree only by a lucky stroke; it is necessary that these formulas are so to speak able to be penetrated mutually. Our mind will not be satisfied before it believes to see the reason of this agreement, at the point where it has the illusion that it could have predicted it.
But the question can still be seen form another point of view, which could be better understood by analogy. Let us suppose an astronomer before Copernicus who reflects on the system of Ptolemy; he will notice that for all planets one of the two circles, epicycle or deferent, is traversed in the same time. This cannot be by chance, there is thus between all planets a mysterious binding.
But Copernicus, by simply changing the axes of coordinates regarded as fixed, destroyed this appearance; each planet does not describe any more than only one circle and the durations of the revolutions become independent (until Kepler restores between them the binding which was believed to be destroyed).
Here it is possible that there is something analogue; if we admit the postulate of relativity, we would find in the law of gravitation and the electromagnetic laws a common number which would be the speed of light; and we would still find it in all the other forces of any origin, which could be explained only in two manners:
Either there would be nothing in the world which is not of electromagnetic origin.
Or this part which would be, so to speak, common to all the physical phenomena, would be only apparent, something which would be due to our methods of measurement. How do we perform our measurements? By transportation, one on the other, of objects regarded as invariable solids, one will answer immediately; but this is not true any more in the current theory, if the Lorentz contraction is admitted. In this theory, two equal lengths are, by definition, two lengths for which light takes the same time to traverse.
Perhaps it would be enough to give up this definition, so that the theory of Lorentz is as completely rejected as it was the system of Ptolemy by the intervention of Copernicus. If that happens one day, it will not prove that the effort made by Lorentz was useless; because Ptolemy, no matter what we think about him, was not useless for Copernicus.
What is Poincare saying here?
Lorentz invented relativity as an electromagnetic theory. Poincare showed in this paper that the same principles could be applied to gravity and everything else.
There are two obvious explanations for this coincidence: (1) gravity and everything else have an electromagnetic origin; or (2) relativity is really a theory about our methods of measurement.
These two explanations are as different as Ptolemy and Copernicus.
Lorentz tried to explain everything in terms of electromagnetism. Poincare was not saying that Lorentz was wrong or useless, but rather claiming to have a distinctly superior interpretation of relativity.
The latter explanation is what is now accepted. The core of relativity is that it is a spacetime theory, and it redefines what we mean by measuring space and time.
Einstein does not say anything like this until several years later. Poincare was the first to make relativity a spacetime theory, and Minkowski popularized it in 1908.
Update: I further explain the Poincare Copernicus analogy in the comments below.
Labels: Einstein, history, relativity
CFT May 15, 2017 at 2:49 PM
measuring space and time is not the problem with relativity. The problem is orienting time orthogonally to x,y, an z spatially as if it was another spatial dimension, and then claiming it means something. It does not.
Time is not in an orthagonal relationship with spatial dimensions in any way, and comparing three dimensional space to timeless gridded rubber sheets where nothing can interact (as per the model) makes no sense whatsoever unless you are somehow viewing the gridded space time from a three dimensionally external to the model (which is where exactly??), and suggesting there is a 'down' gravitationally speaking in order to pretend the model represents an actual mechanism for how gravity works or how things can move in relation to the modeled gravity. Space time is a contrivance to side step the issue Einstein did not want to deal with, that we have no idea of how gravity affects mass, we only know that it does affect mass.
MD Cory May 18, 2017 at 3:57 AM
"Space time is a contrivance"
It's mathematics that is a contrivance. Poincare was right that relativity can even be conceived of in flat space. See David Hestenes and geometric algebra.
"Lorentz invented relativity as an electromagnetic theory. Poincare showed in this paper that the same principles could be applied to gravity and everything else."
Couple of errors: (1) Lorentz showed in 1904 how Lorentz invariance could apply to everything (except gravity), not just electromagnetism, (2) Poincare didn't add anything of substance to Lorentz, except to correct the charge transformation, and Poincare's idea that gravity could be made compatible with special relativity turned out to be wrong.
"Poincare was not saying that Lorentz was wrong or useless, but rather claiming to have a distinctly superior interpretation of relativity."
No, he says that perhaps someone will come along some day and give a coherent account of all these phenomena in terms of some new kinematic framework. Actually, in a paper published the previous year BEFORE Poincare's paper appeared, someone had already done just that.
"The core of relativity is that it is a spacetime theory, and it redefines what we mean by measuring space and time."
Right. This is described with amazing fullness and maturity for the first time in Einstein's 1905 papers, in the year preceding the publication of Poincare's Palermo paper.
"Einstein does not say anything like this until several years later."
As Prof Witkowski said "Read Einstein's paper! A new Copernicus is born!" You should take his advice. Pay special attention to the Kinematical Part, but don' neglect the Electromagnetic part, because it includes the new dynamics as well.
"Poincare was the first to make relativity a spacetime theory..."
That's not entirely true. Physics has always worked in 4 dimensions, three space and one time. If you mean a transformation that mixes space and time coordinates, this was not Poincare's invention, it was being done by Larmor, Lorentz, and others around the year 1900. If you mean the recognition that the coordinate systems related by Lorentz transformations are actually the inertial coordinate systems, this was implicit in Lorentz's 1904, but by his own admission he didn't recognize it, and neither did Poincare, who even to the end of his life was still talking about the ether frame and violations of action-reaction and generally failing to grasp the dynamical basis of the relativistic kinematics. Lorentz, Minkowski, and everyone else (including Poincare, if Moszkowski's report is to be believed) all credited Einstein with "the step". That's why Born was speaking for his whole generation when he said reading Einstein's 1905 (even after reading Lorentz and Poincare) was a revelation, and had a greater effect on him than any other scientific experience.
Roger May 28, 2017 at 6:02 PM
You persist in arguing that Poincare did not understand relativity, even tho he got everything right ahead of Einstein. Now you say that when Poincare boldly claimed a new theory like Copernicus, and he was just predicting Einstein's paper!
I don't know anyone can believe anything so ridiculous. Can you give any other example, in the history of science, where someone said all the right things in a huge breakthru, and yet did not understand what he was doing?
Yes, Poincare's Palermo paper was published a few month's after Einstein's famous paper, but Einstein's library had a copy of Poincare's summary a couple of weeks before Einstein's submission. Poincare may have influenced Einstein, but there is no chance Einstein influenced Poincare.
Yes, Lorentz had the essence of relativity, and important early work was done by FitzGerald, Larmor, and others. Poincare advanced the theory in 1905 by making it explicitly a spacetime theory, adding gravity, and showing the covariance of Maxwell's equations.
I will address your other points in a separate post.
"You persist in arguing that Poincare did not understand relativity, even tho he got everything right ahead of Einstein."
But Poincare didn't get everything right. In fact, he failed to get the single most important thing, which is that the inertia of energy implies that inertial coordinate systems are related by Lorentz transformations. To the end of his life, Poincare continued to say momentum conservation was violated unless we assign the missing momentum to the ether, which he rightly dismissed as cheating (since the ether is undetectable). He also consistently failed to grasp the full extent of the kinematic consequences of the Lorentz transformations.
"Now you say that when Poincare boldly claimed a new theory like Copernicus, and he was just predicting Einstein's paper!"
You are grossly misreading his words. He has not described a new kinematics based on a new understanding of the relationship between inertial coordinate systems, rendering all the relativistic effects trivial (as Einstein had done in his paper of the previous year), he merely comments that something analogous to Copernicus' revolution might occur, and Lorentz's theory would be overthrown as surely as was Ptolemy's, but Poincare surely never claimed to be overthrowing Lorentz's theory. You are falling prey to the tendency to retroactively view things, and read into them more than is really there. Poincare had most of the pieces of the jigsaw puzzle, but didn't put them together - something Einstein had already done.
"Can you give any other example, in the history of science, where someone said all the right things in a huge breakthru, and yet did not understand what he was doing?"
That's isn't what happened in this case. Poincare didn't say all the right things, he said some wrong things, and omitted many more things, and to the end of his life continued to espouse an etherist interpretation and the use of Galilean transformations for the true space and time.
"Yes, Lorentz had the essence of relativity..."
But you were saying Lorentz was Ptolemy, remember?
"Poincare advanced the theory in 1905 by making it explicitly a spacetime theory..."
He continued to espouse the ether, and even continued to argue that everything was electromagnetic. Any mathematician would see the invariants associated with the Lorentz transformations, the hyperbolic rotations, etc. Also, note that Einstein's 1905 said the LT's form a group, so it should be called the Einstein group, not the Poincare group.
"...adding gravity..."
He did not add gravity correctly. Gravity is incompatible with global special relativity.
"...and showing the covariance of Maxwell's equations"
Lorentz showed this in 1904, and Einstein showed it more simply in 1905. Crediting the to Poincare in 1906 is just silly.
Roger May 29, 2017 at 10:55 AM
Poincare very clearly says that his formulas have two interpretations: Lorentz's electromagnetic interpretation and a new one where the transformations would be due to our methods of measurement. The latter is another way of saying that it is a spacetime theory. Einstein says nothing like this.
You say "Poincare surely never claimed to be overthrowing Lorentz's theory."
Poincare does say that in the latter interpretation, "the theory of Lorentz is as completely rejected as it was the system of Ptolemy by the intervention of Copernicus." He adds that Lorentz's theory would not be useless, just as Ptolemy's theory was not.
Again, Einstein says nothing like this, and does not reject Lorentz in any way.
The closest Einstein comes is to claim that he has a better understanding of the aether and local time, but he does that by misrepresenting Lorentz.
You keep saying that Poincare was wrong about things. Even if so, I am sure you know that Einstein was wrong about a few things also. But tell me this: Did Einstein ever point out any of these supposed Poincare errors?
Considering how aggressively Einstein tried to claim credit for himself, it is not plausible that he would have passed up an opportunity to show that he had some superior understanding of relativity to Poincare's.
As for the aether, I am sure you realize that relativity allows choosing a frame. Everyone chooses frames, including Einstein. Poincare sometimes called his frame the aether frame, or something like that. He also argued that the aether was undetectable. There is nothing incorrect about this. I guess you don't like his terminology, but there is nothing mathematically or physically wrong with his analysis.
I will address the Lorentz group separately.
You say "Poincare does say that in the latter interpretation, "the theory of Lorentz is as completely rejected as it was the system of Ptolemy by the intervention of Copernicus."
But that is a lie. As you know very well, the quote is
"Perhaps if we were to abandon this definition [of
LENGTHS, not of time], Lorentz’s theory would be as fully overthrown as was Ptolemy’s system by Copernicus’s intervention. Should that happen some day, it would not prove that Lorentz’s efforts were in vain..."
I'm sorry, but it just isn't worth the effort to chase after you, correcting such blatant lies and mis-representations. Poincare has not described a new interpretation (and the hint he gave was wrong), he merely ruminates on the possibility of one. Saying it has something to do with how we measure things is a far cry from Einstein's 1905 paper founding special relativity.
I see it says "comment will be visible after approval". If this means censorship has been turned on, I'm out.
Roger May 31, 2017 at 11:27 PM
A couple of your comments got flagged as spam. I do not know why. I only censor spam, and I am glad to have someone prove me wrong about something.
I don't see you can say I was lying. I posted the whole quote. Go ahead and give me your own interpretation of it. When he says "explained only in two manners", isn't one of those manners like Ptolemy and one like Copernicus? Just what are those two manners, if you deny that Poincare described a new interpretation of relativity?
Roger June 1, 2017 at 12:07 AM
I realize that it appears that I turned on comment moderation just to block a comment accusing me of lying. No, that is not correct. Google hosts this blog, and I have comment moderation turned on only for older postings and what Google says is spam. Occasionally a legitimate comment gets flagged as spam, or I slow to approve a comment on an old post. But any non-spam comment to a recent post normally appears right away, with no moderation.
> I don't see you can say I was lying. I posted the
> whole quote."
The problem wasn't the original quote, it was the later mis-quote when you said Poincare said "the theory of Lorentz is as completely rejected as was the system of Ptolemy by the intervention of Copernicus." That's not what he said, and this isn't just a nit. Everyone knows Poincare (like several others) stood on the precipice of special relativity, and the question is, did he cross over? The actual quote shows that he did not even claim to have crossed over, but your mis-quote suggests that he was claiming to have found the Copernican model and over-thrown Lorentz's theory. I think it's important to not base our views on mis-quotes.
> Go ahead and give me your own interpretation of it.
My "interpretation" is just the literal one, which is the only one consistent with the contents of the paper. He notes that Lorentz's equations apply to electromagnetism, but in order to explain complete relativity Lorentz allowed for the possibility of other forces (and Poincare knew there must be other forces), and Lorentz assumed [not derived] that those other (unknown) forces are also Lorentz invariant so they propagate at c.
Now, Poincare scratches his chin and says this reminds him of how the constant "365 days" shows up in the descriptions of all the wandering patterns of the planets in Ptolemy's model. Hmmm... Maybe some say we will discover a way of looking at Lorentz's theory that makes the appearance of c in all these forces not just a coincidence, but a result of how we measure things. Maybe if we reject Lorentz's view that the length of an object is proportional to the time it takes for light to traverse it, would have such a new way. Hmmm... If that day ever comes, maybe Lorentz will be overthrown, etc.
Well, it should go without saying that comments such as this do not amount to a discovery of the kinematics of special relativity. Indeed, even the little hint about rejecting the light-based definition of distance was wrong. The key was to clearly identify Lorentz's auxiliary coordinates (including the auxiliary time coordinate) with the inertial coordinates, i.e., to completely discard the Galilean transformation and replace it with the Lorentz transformation for inertial coordinate systems. Neither Lorentz nor Poincare ever embraced this. Even at the end of his life, Poincare still regarded Einstein's (and Minkowski's) switch to a Lorentzian-based spacetime as just a convention, and not a very appealing one at that. Born reports that at the end of Lorentz's life he was still of the same opinion. It was psychologically very difficult for men of that generation to make "the step".
Roger June 2, 2017 at 11:43 PM
But why would Poincare say all that about a new Copernicus, unless he had some Copernicus-like theory in mind? I cannot make any sense out of your explanation (or any given by anyone else either).
As I see it, when he says "give up this definition", he is referring to the definition of measurement by comparison to "objects regarded as invariable solids", or meter sticks. By "the current theory", he means his own Palermo version of relativity, where length is defined by time and c.
I realize that is not the most recent definition in the text, so the grammar is clumsy. But the previous paragraph is about giving up one definition in favor of a second definition, so when he then says "give up this definition", I think he means the former definition, not the latter.
Here is the distinction that I think he is making.
In the Lorentz/Ptolemy theory, moving meter sticks are contracted, and do not show their true length. They cannot be used in the simple measurement definition.
In the Poincare/Copernicus theory, moving meter sticks are not contracted. They just look shorter, due to our methods of measurement.
In the Lorentz/Ptolemy theory, the apparent contraction might be caused by distortions in the electromagnetic fields holding together the meter stick.
In the Poincare/Copernicus theory, the apparent contraction is something happening in spacetime itself, and not electromagnetism.
In short, the Lorentz/Ptolemy theory is an electromagnetism theory, and the Poincare/Copernicus theory is a spacetime theory.
Poincare goes on to give a 4D presentation of relativity, and the Lorentz symmetries applying to electromagnetism or gravity or presumably anything else.
Einstein does not make this distinction at all.
Not only does Einstein fail to make the Copernicus interpretation, he rejects it years later.
In 1911 someone asserted that Lorentz and Einstein had different interpretations of the length contraction, and Einstein denied that there was any such difference.
Einstein was not the aether slayer
Einstein did not find the group or covariance
Early work did not credit Einstein
Contributing to the debasement of truth
The conceptual penis as a social construct
Quantum computers are just around the corner
New laws to allow questioning school science
Philosopher disses black hole paradox
Einstein and Minkowski lied about Poincare
Seeking that deeper concept
New Einstein Genius TV show
What a Modern-Day Witch Hunt Looks Like
Anumeric people cannot count nuts
Bell did not show nonlocality
|
cc/2021-04/en_middle_0071.json.gz/line2935
|
__label__wiki
| 0.591014
| 0.591014
|
Browse: Home » 2014 » November » Are Parents Liable For Their Children’s Online Pranks?–Boston v. Athearn
Are Parents Liable For Their Children’s Online Pranks?–Boston v. Athearn
November 13, 2014 · by Venkat Balasubramani · in Content Regulation, Derivative Liability, Publicity/Privacy Rights
Dustin Athearn, who was 13, decided to “have some fun” at a “friend’s” expense. He did what any modern teenager does to poke fun at someone: he created a fake Facebook page in their name. Along with a friend Melissa, Dustin created an email address for his target, Alexandria Boston, and using this, created a Facebook account in Alexandria’s name.
shutterstock / durantelallera: Vintage Retro Clipart : Lol, Man Laughing Out Loud
He used a picture he took of Alex for the profile photo, but altered it using a “Fat Face” application.
The fake profile then issued friend requests to many classmates, who accepted. Dustin and Melissa also posted items to the account while posing as Alexandria. Some of the posts were graphically sexual, racist, or otherwise offensive (and false).
Alex suspected that Dustin was behind this based on the profile picture Dustin used. Alex, along with her parents, approached the school principal. The principal investigated and suspended Dustin and Melissa for two days for their actions. Dustin’s parents were also informed. The parents disciplined Dustin by “forbidding him for one week from seeing his friends after school,” but otherwise did not take any action. Significantly, they did not force Dustin to remove the Facebook page, which stayed up for almost a full year following the suspension. The page was finally taken down after the Bostons filed their lawsuit. Alex sued Dustin and his parents. In the lawsuit, Dustin’s parents were granted summary judgment.
Parental liability for Facebook use: Under Georgia law, negligence of the child is not typically imputed to the parent. While the parent can be held liable under a “failure to supervise” theory, this duty exists where the child engages in conduct which poses an unreasonable risk of harming others. The key question is forseeabilty. The court says whether the activity posed an unreasonable risk is ordinarily a question for the jury. The parents argued that the unreasonable nature of Dustin’s conduct was not apparent until they received notice from the principal, and thus they shouldn’t be held liable for failing to supervise prior to receipt of the notice (at which point it was too late). The court says even assuming this is true, they had a continuing duty to supervise, and Dustin’s actions (i.e., the page) continued to cause harm even after receipt of the notice.
Landowner obligation to remove content on their property: The Bostons also argued that Dustin’s parents had an obligation to remove defamatory content that existed on their property. This argument fails. Setting aside the interesting question of where particular content is “exhibited,” the court says that there’s no evidence in the record that Dustin’s parents had the ability to remove the content in question. The court does cite to evidence in the record that the Bostons contacted Facebook and were advised that only the person who signed up could take the content down. For some reason this does not translate into an ability to remove the page on the part of Dustin’s parents.
So many interesting cases arise at the intersection of kids, fake Facebook profiles, and negative content. One wonders whether pre-Facebook/MySpace this dispute would have just lived and died in the hallways. On a related note, Dustin is lucky his local prosecutor did not take a look at this on a morning where he or she was feeling particularly zealous. Similar conduct has landed more than one minor in criminal trouble. [Eric’s comment: this looks like the kind of behavior regulated by California’s e-personation crime. And also see the In re Rolando S case, misapplying criminal identity theft law to an analogous situation.]
The court does not mention Section 230 here, and that’s one question this brought to mind. Employers have benefited from Section 230, with most courts saying they can’t be held liable for content their employees post online. (See Eric’s post on Miller v. FedEx that canvasses the cases, including Delfino v. Agilent.) This case on its face raises a Section 230 defense. The Bostons’ claim seeks to hold Dustin’s parents liable for content Dustin posted, the parents provided or enabled internet access, the claims seek to hold the parents liable as publishers or speakers. It’s unclear as to whether the Bostons could have gotten around it using some creative “failure to discipline” theory similar to the one a minority of courts (such as Espinoza v. County of Orange) have allowed.
The court’s resolution of the landowner’s obligation to remove property was wonky. This claim also raises a possible Section 230 issue (a variation on Blockowicz, where a plaintiff sought to enforce a takedown via an injunction on an absent party). Setting this aside, couldn’t the parents just have forced Dustin to remove or de-activate the page? It seems awfully hands-off to say that because someone contacted Facebook and was told that only the account-holder could take down the page, this meant that the parents did not have an obligation to do anything further.
Eric’s Comments: I agree with Venkat that this ruling raises more questions than it answered. There are operational questions, such as: Why didn’t the parents force Dustin to remove the page if they couldn’t do so directly? Why did it take Alexandria’s parents 11 months to get Facebook’s intervention? Under what circumstances can we treat bad online behavior as a real property-based harm? (My answer would be never, but we get surprisingly few cases exploring that question).
Then there are questions about the page’s effects. How much legally recognizable harm did the page really cause? How much incremental harm was caused by the ongoing availability of the page? The court does note:
Facebook’s records showed that, months after Dustin’s principal notified the Athearns that Dustin had been disciplined for creating the unauthorized account, the fake persona continued to extend or accept requests to become Facebook Friends with additional users and that other users viewed and posted on the unauthorized page until the day before Facebook deactivated the account
But how much of this post-discipline activity should have been ignored due to Section 230? (i.e., the “other users…posted on the unauthorized page”).
I also have questions about the right policy solutions for disciplining teenagers. Are lengthy court battles an appropriate resolution to incivil teenager online hijinks? The impersonation prank was stupid and cruel, but the “punishment” of a multi-year civil lawsuit may be disproportionately harsh compared to the “crime.” The flagship case highlighting that dilemma is the tragic DC v. RR case.
Finally, there are doctrinal questions, such as the role of Section 230. Personally, I’m not troubled by the inapplicability of Section 230 to the parent-child relationship, just like I’m generally OK with Section 230’s inapplicability to employer liability for employees’ actions within the scope of employment. Nevertheless, parental liability for their childrens’ actions should be highly constrained under default law, and the rest of the ruling could be read to support a conclusion that ordinarily parents shouldn’t be liable for their children’s thoughtless online behavior.
Case citation: Boston et al. v. Athearn et al., A140971 (Ga Ct. App. Oct. 10, 2014)
Other coverage: WSJ; Randazza
Conviction for Posting Pages From Teenager’s Diary Via Mail and Facebook Partially Reversed
First Amendment Precludes Disorderly Conduct Conviction for Ranting on Police Department Facebook Page
Want To Encourage Gossipy Content Online? Go For It–Jones v. TheDirty (Forbes Cross-Post)
Criminal Cyberbullying Statute Violates First Amendment–New York v. Marquan
Stalking Conviction For Friending a Prosecutor’s Facebook Friends?–State v. Moller
Revenge Porn/Cyberstalking Conviction Doesn’t Violate First Amendment–US v. Osinger
Dead Sea Scrolls Impersonation Case Convictions Partially Affirmed
Minnesota Supreme Court Reverses Conviction for Assisting Suicide Online
Twibel Ruling: Tweeting That Someone is “Fucking Crazy” is Not Defamatory
Revenge Porn Prosecution Stumbles In New York
Revenge Porn Threat Justified Injunction
Two Student Threat Cases Illustrate Gross Disparity in Treatment of Student Speech
Revenge Porn Plot Leads To Criminal Conviction–New York v. Piznarski (Forbes Cross-Post)
Ill-Advised Student YouTube Video Leads to Conviction For Misusing Computerized Communication System–In re Kaleb K.
Calling Out Scraper for “Stealing” Data Is Not Defamatory – Tamburo v. Dworkin
Creating Parody Social Media Accounts Doesn’t Violate Computer Fraud & Abuse Act – Matot v. CH
Another Case Involving School Discipline for a Violent Post on a Social Networking Site — Wynar v. Douglas County School Dist.
High Schooler’s Facebook Post Can Constitute the Crime of Menacing – In re P.T.
← Manuel Noriega Loses Right of Publicity Suit Against Activision (Guest Blog Post)
Bad Idea: Overdisclosing People’s Positive STD Status–Doe v. Successfulmatch →
|
cc/2021-04/en_middle_0071.json.gz/line2937
|
__label__wiki
| 0.655684
| 0.655684
|
IJL Inspired
About IJL
Blog, Industry, News
‘Pink Star’ Diamond Hits Record Breaking Auction Price
by David Brough
• April 5, 2017 April 5, 2017 • 3 Comments
The world record price of U.S.$71 million achieved by the 59.60-carat Pink Star diamond at Sotheby’s auction in Hong Kong, was a bargain for the buyer, Chinese jeweller Chow Tai Fook.
The oval Pink Star smashed the record price for any diamond sold at auction following a brief bidding battle on April 4.
The justification for such a price is rarity and beauty. Fancy vivid pink diamonds of such weight and clarity are extraordinarily rare, leading some commentators before the auction to predict a price in excess of $100 million for the Pink Star, on which Sotheby’s placed a pre-sale estimate in excess of $60 million.
Read more: Why the Synthetic Diamond Market Hinges on Clever Promotion
A deal for The Pink Star fell through at a Sotheby’s auction in Geneva in 2013 after the buyer defaulted on a price of $83 million.
Sotheby’s agreed to share ownership of the piece last year in a partnership with New York-based manufacturers Diacore and Mellen Diamonds. The auction house’s annual report in February 2014 recorded the diamond’s inventory value as $72 million.
So a price tag of $71 million looks like a good value deal for Chow Tai Fook, who will surely now get lots of mileage and branding value by exhibiting the stone, before possibly selling it in a few years’ time to a fabulously wealthy collector, probably from Asia.
No one expects the jeweller to sell it on immediately. Chow Tai Fook has renamed the stone The CTF Pink.
“Buying a stone like this creates a new brand for yourself,” said Tobias Kormind, managing director of online diamond jeweller 77Diamonds.
The previous world record-holder for a diamond sold at auction was the 14.62-carat Oppenheimer Blue, which fetched $57.5 million at a Christie’s auction in Geneva last May.
Read more: What Do Customers Look for in Luxury Brands in 2017?
It was no coincidence that the auction of the Pink Star was held in Hong Kong, rather than in Geneva, New York or London.
Asian buyers have figured prominently in purchases of magnificent rare diamonds in the past few years, such as Hong Kong property tycoon Joseph Lau who bought the Blue Moon for a then world record price of $48 million in 2015.
The Pink Star’s failure this time to reach the price it commanded at the 2013 auction, may be due to a view that the stone was ‘burnt’ by its previous exposure, as some top tier collectors will only buy stones the first time they appear on the market.
Perhaps its colour was not strong enough to maximise its appeal to collectors. However, the extraordinary unique qualities of the Pink Star, now The CTF Pink, are not in any doubt: internally flawless fancy vivid pink diamonds of this size are extremely rare.
Read more: Trump Era Brings Spark Back to Gold Investments
The diamond’s record price also pales in comparison to prices achieved at the top end of the art market in recent years.
Some commentators believe prices achieved for rare diamonds have the potential to close the gap with the art market, but others say the possibility of a future discovery of a significant mine will keep a lid on the top end of the diamond market.
IJL is #withyou sharing market updates and news that’s challenging the global view of the jewellery and watch industries.
Images courtesy of Sotheby’s
Market News Pink Star sothebys
David Brough
David Brough is IJL’s Precious Metals and Gems Editor. David is Co-Founder and Editor of digital magazine Jewellery Outlook and writes monthly precious metals and gemstones Market News for Retail Jeweller magazine. He was a Reuters correspondent and editor for more than 30 years, including 16 years as a foreign correspondent, and covered commodity markets extensively. David won the United Nations A.H. Boerma Award in 2002-3 for his reporting on hunger issues. He graduated from St. Andrews University in Scotland with a MA (Hons) in Economics and French, and has a Certificate in Financial Markets from the Securities Institute of Australia. He speaks fluent French, Spanish, Portuguese and Italian.
Previous: How Jewellery Brands Can Get the Most out of Their PR Investment
Next:7 Tips On Boosting Sales With Images On Instagram
Pingback: ‘Pink Star’ Diamond Hits Record Breaking Auction Price | Trending Jewellery
Pingback: The Pink Star- April Birthstone Diamond | Owen & Robinson
Pingback: Is Now the Time to Invest in White Diamonds? | IJL Blog
IJL, International Jewellery London, Bright Young Gems, Diamond Club, Editor's Choice and the KickStart logo are trade marks of Reed Exhibitions Limited. The PIPR logo is a trade mark of Reed Exhibitions Limited and Royds solicitors. Reed Exhibitions is a trade mark of RELX Group plc. RELX Group and the RE symbol are trade marks of RELX Group plc, used under license.
|
cc/2021-04/en_middle_0071.json.gz/line2940
|
__label__cc
| 0.683822
| 0.316178
|
Imagine with Me: A With Me in Seattle Novel (Unabridged)
From New York Times best-selling author Kristen Proby comes an all-new novel in her beloved With Me in Seattle series!
Shawn O’Callaghan loves his job as a screenwriter almost as much as he loves his family. But this latest project could quite possibly test his patience beyond anything he’s ever had to endure. Generally unflappable, the author he’s thrown into the trenches with pushes every button he has. Sometimes twice. And it doesn’t help that he can’t stop thinking about her in ways that are anything but professional. But how can he help it? The redhead is gorgeous beyond reason - and utterly infuriating.
Best-selling author Lexi Perry is finally about to leave her mark on the world; after all, seeing her dark and dangerous words brought to life is a dream come true. Until she meets the man who is supposed to make that happen. From the minute they laid eyes on each other, it was clear there would be tension, but she had no idea how much until they got down to business. He obviously doesn’t understand her vision. Though she’s having trouble lately too, given all she can picture is what he looks like under his clothes and imagining what it would sound like if he talked dirty to her in that sexy Irish lilt of his.
If they can find a way to meet in the middle, this movie could be one for the ages. As could their love.
Tim Paige, Emma Wilder
Ampersand Publishing, Inc.
Dream with Me: With Me In Seattle, Book 13 (Unabridged)
You Belong With Me: With Me In Seattle, Book 14 (Unabridged)
Enticing Liam: A Big Sky Novel: The Big Sky Series, Book 2 (Unabridged)
Wonder with Me: 1001 Dark Nights (With Me in Seattle Novella) (Unabridged)
Enchanting Sebastian: Big Sky Royal, Book 1 (Unabridged)
|
cc/2021-04/en_middle_0071.json.gz/line2942
|
__label__wiki
| 0.621279
| 0.621279
|
Victory: An Island Tale
levels of shrouded billiard-tables, a white form heaved up from two chairs on which it had been extended. The middle of the day, table d'hôte tiffin once over, was Schomberg's easy time. He lounged out, portly, deliberate, on the defensive, the great fair beard like a cuirass over his manly chest. He did not like Davidson, never a very faithful client of his. He hit a bell on one of the tables as he went by, and said in a distant, Officer-of-the-Reserve manner:
“You desire?”
The good Davidson, still sponging his wet neck, declared with simplicity that he had come to fetch away Heyst, as agreed. "Not here!"
A Chinaman appeared in response to the bell. Schomberg turned to him very severely:
“Take the gentleman's order.”
Davidson had to be going. Couldn't wait-only begged that Heyst should be informed that the Sissie would leave at midnight.
"Not-here, I am telling you!" Davidson slapped his thigh in concern.
“Dear me! Hospital, I suppose.” A natural enough surmise in a very feverish locality.
The Lieutenant of the Reserve only pursed up his mouth and raised his eyebrows without looking at him. It might have meant anything, but Davidson dismissed the hospital idea with confidence. However, he had to get hold of Heyst between this and midnight.
"He had been staying here?” he asked. “Yes, he was staying here."
"Can you tell me where he is now?” Davidson went on placidly. Within himself he was beginning to grow anxious, having developed the affection of a selfappointed protector toward Heyst. The answer he got was:
"Can't tell. It's none of my business,” accompanied by majestic oscillations of the hotel-keeper's head, hinting at some awful mystery.
Davidson was placidity itself. It was his nature. He did not betray his sentiments, which were not favourable to Schomberg.
"I am sure to find out at the Tesmans' office,” he thought. But it was a very hot hour, and if Heyst was down at the port he would have learned already that the Sissie was in. It was even possible that Heyst had already gone on board, where he could enjoy a coolness denied to the town. Davidson, being stout, was much preoccupied with coolness and inclined to immobility. He lingered awhile, as if irresolute. Schomberg, at the door, looking out, affected perfect indifference. He could not keep it up, though. Suddenly he turned inward and asked with brusque rage:
“You wanted to see him?"
"Why, yes,” said Davidson. “We agreed to meet
"Don't you bother. He doesn't care about that
“Doesn't he?"
“Well, you can judge for yourself. He isn't here, is he? You take my word for it. Don't you bother about him. I am advising you as a friend."
"Thank you,” said Davidson, inwardly startled a the savage tone. “I think I will sit down for a mo ment and have a drink, after all.”
This was not what Schomberg had expected to hear He called brutally:
"Boy!"
The Chinaman approached, and after referring hin to the white man by a nod the hotel-keeper departed muttering to himself. Davidson heard him gnas) his teeth as he went.
Davidson sat alone with the billiard-tables as i there had been not a soul staying in the hotel. Hi placidity was so genuine that he was not unduly fret ting himself over the absence of Heyst or the mys terious manners Schomberg had treated him to He was considering these things in his own fairly shrewd way. Something had happened; and he wa loath to go away to investigate, being restrained by : presentiment that somehow enlightenment would come to him there. A poster of "Concerts Every Evening,” like those on the gate, but in a good stat of preservation, hung on the wall fronting him. H looked at it idly and was struck by the fact—then no so very common—that it was a ladies' orchestra "Zangiacomo's eastern tour-eighteen performers. The poster stated that they had had the honour o playing their select repertoire before various colonia
cellencies, also before pashas, sheiks, chiefs, H. H the Sultan of Mascate, etc., etc.
Davidson felt sorry for the eighteen lady-per formers. He knew what that sort of life was like, th sordid conditions and brutal incidents of such tour
led by such Zangiacomos who often were anything but musicians by profession. While he was staring at the poster, a door somewhere at his back opened, and a woman came in who was looked upon as Schomberg's wife, no doubt with truth. As somebody remarked cynically once, she was too unattractive to be anything else. The opinion that he treated her abominably was based on her frightened expression. Davidson lifted his hat to her. Mrs. Schomberg gave him an inclination of her sallow head and incontinently sat down behind a sort of raised counter, facing the door, with a mirror and rows of bottles at her back. Her hair was very elaborately done with two ringlets on the left side of her scraggy neck; her dress was of silk, and she had come on duty for the afternoon. For some reason or other Schomberg exacted this from her, though she added nothing to the fascinations of the place. She sat there in the smoke and noise, like an enthroned idol, smiling stupidly over the billiards from time to time, speaking to no one, and no one speaking to her. Schomberg himself took no more interest in her than may be implied in a sudden and totally unmotived scowl. Otherwise the 'very Chinamen ignored her existence.
She had interrupted Davidson in his reflections. Being alone with her, her silence and open-eyed immobility made him uncomfortable. He was easily sorry for people. It seemed rude not to take any notice of her. He said, in allusion to the poster: "Are you having these people in the house?”
She was so unused to being addressed by customers that at the sound of his voice she jumped in her seat. Davidson was telling us afterward that she jumpe exactly like a figure made of wood, without losing he rigid immobility. She did not even move her eyes but she answered him freely, though her very lip seemed made of wood.
“They stayed here over a month. They are gon now. They played every evening."
“Pretty good, were they?”
To this she said nothing; and as she kept on stai ing fixedly in front of her, her silence disconcerte Davidson. It looked as if she had not heard himwhich was impossible. Perhaps she drew the line a speech at the expression of opinions. Schomber might have trained her, for domestic reasons, to kee them to herself. But Davidson felt in honour oblige to converse; so he said, putting his own interpretatio on this surprising silence:
“I see—not much account. Such bands hardl ever are. An Italian lot, Mrs. Schomberg, to judg by the name of the boss?”
She shook her head negatively.
“No. He is a German really; only he dyes his hai and beard black for business. Zangiacomo is his bus ness name.”
“That's a curious fact,” said Davidson. His hea being full of Heyst, it occurred to him that she mig! be aware of other facts. This was a very amazin discovery to any one who looked at Mrs. Schombery Nobody had ever suspected her of having a mind, mean even a little of it, I mean any at all. One wa inclined to think of her as an It-an automaton, a ver plain dummy, with an arrangement for bowing th
|
cc/2021-04/en_middle_0071.json.gz/line2945
|
__label__wiki
| 0.797366
| 0.797366
|
More Wild Bison Killed in "Hunt," Harassed in Hazing Operations
Stephany Seay, Dan Brister: (406) 726-5555
West Yellowstone & Gardiner, Montana - Montana's zero-tolerance policy against the country's last wild bison resulted in another bison death and increased bison harassment activities over the weekend by hunters and government agents.
On Friday in West Yellowstone, a 14-year-old girl killed a wild buffalo less than half a mile from Yellowstone National Park. The buffalo was shot just yards from the Duck Creek Bison Trap, on the private property of Dale Koelzer, a landowner who hosts the Department of Livestock (DOL)-run bison trap. On Thursday, Buffalo Field Campaign representatives witnessed DOL agents off-loading a semi trailer full of hay at the property where no cows or horses live.
"Are DOL agents using this enormous amount of hay to lure hungry buffalo into unwelcome territory so that they can invite so-called hunters to shoot them like fish in a barrel? " questioned Stephany Seay, a coordinator with the wild bison advocacy group Buffalo Field Campaign. "Or are the livestock inspectors gearing up for a heavy season of capturing the country's last wild bison just as soon as their canned hunt is over?"
The Buffalo Field Campaign opposes Montana's bison hunt because wild buffalo have no protected habitat in Montana and are never allowed in the state without being captured, slaughtered, shot, or harassed.
Regardless of Montana's so-called fair chase bison hunt being in full swing, on Saturday in Gardiner, National Park Service (NPS) employees forced an estimated 70 wild buffalo back into Yellowstone National Park (NPS). Today the NPS conducted another hazing operation, staunching the natural migration of about 15 more wild bison. These operations are taking place simultaneously with the State's hunt, just miles away from where hunters are "stalking" their prey.
"The National Park Service is mandated to protect our national treasures," said BFC's Mike Mease, "Yet they are buckling to livestock interests and lending a hand in the destruction of the last wild buffalo in America."
The wild buffalo harassed by the NPS were underway with their annual migration, which is blocked by private land owned by the Church Universal & Triumphant (CUT). In 1998 the federal government spent 13 million U.S. taxpayer dollars specifically to purchase conservation easements that would allow wild bison and other migratory species to access these and other areas of critical habitat near Gardiner. Wild bison are singled out, harassed and slaughtered for using this critical migration corridor.
The state justifies its lack of bison tolerance on the unfounded fear that bison may transmit brucellosis, a European livestock disease, to cattle. There has never been a documented case of wild bison transmitting brucellosis to livestock. All fifteen bison hunted this year have been bulls, which pose no risk of transmitting the bacteria.
A total of eighteen wild bull bison have been killed in Montana this fall. Fifteen have been shot by Montana hunters, two by Montana's DOL, and another was shot by a Yellowstone National Park ranger inside the Park. In the past ten years Montana and the federal government have killed 2,475 wild Yellowstone bison, more than half of the existing herd.
The Buffalo Field Campaign and other wild bison advocates will hold a press conference in Helena, Montana on Thursday, December 15, 2005, from 2:00-3:00 p.m. A detailed advisory will be sent out prior to the event.
Buffalo Field Campaign is the only group working in the field, everyday, to stop the slaughter of the wild Yellowstone buffalo. Volunteers defend the buffalo on their native habitat and advocate for their protection.
|
cc/2021-04/en_middle_0071.json.gz/line2967
|
__label__cc
| 0.701005
| 0.298995
|
Tag Archives: coffee tablet book
EIGHT ways to do justice to a lifetime of photography
Posted on January 16, 2013 by Frank B. Edwards
Canadian photographer Pat Morrow has travelled the globe in pursuit of adventure over the past 40 years. Along the way, he:
became the 132nd person to summit Mount Everest,
set the standard for climbing the highest mountain on each continent (AKA The Seven Summits) and,
won more than a dozen national awards for his photos and videography.
Frank and Pat taking a break from photo editing. 2012.
Recently, Pat launched a new adventure by collaborating on a stunning iBook about Mount Everest with fellow mountaineer Sharon Wood and me. (I’ve been a friend of Pat’s since our earliest magazine days when I was at Canadian Geographic and he was a rookie freelance photographer.)
The result — Everest: High Expectations — is a beautiful iBook especially produced for Apple’s iPad. It’s loaded with 145 photographs as well as a half dozen video and audio clips. And also 50,000 words.
Here are 8 reasons why we embraced the concept of the new “coffee tablet” book.
The iPad’s Hi-Def retina display gives photographs an almost Continue reading →
Posted in ebooks, i-books, Illustrated books, Non-fiction | Tagged Canadian Geographic, coffee tablet book, Everest, High Expectations, iPad, Pat Morrow | 2 Replies
If you are looking for links to press releases, backgrounders and news coverage of Bungalo’s exploits, this is the place to start.
You can get background on author/illustrator John Bianchi here. Sadly he passed away on April 21, 2017.
You can find our Everest: High Expectations backgrounder here. It’s full of information about the book, the authors and our exciting new world of coffee tablet books.
Click on an image if you want hi-res photos of Everest’s cover and author pictures.
Everest: High Expectations hi res cover.
Sharon Wood and Pat Morrow, 2012.
Pat Morrow, Everest summit, 1982.
Sharon Wood, Everest summit, 1986.
Frank B. Edwards (publisher) and Pat Morrow, 2012.
Our first multi-touch ebook for the iPad is Everest: High Expectations by Pat Morrow and Sharon Wood.
Link to Everest: High Expectations on iTunes here to download a FREE preview or purchase the book for use on your Apple iPad.
This richly illustrated adventure ebook (for the iPad only) tells the gripping story of two Canadian climbing expeditions that captured the attention of the mountaineering world in 1982 and 1986 — written by two climbers who reached Everest’s summit in distinctly different ways.
Only $9.99 for one of the best illustrated iBooks of the year. Available only on the Apple iPad. The iPad’s hi-res retina display brings the photographs alive.
Combining a powerful yet intimately told story with 150 colour photos, maps, archival video and audio recordings, “Everest: High Expectations” sets a new standard for illustrated books as it chronicles both Canadian expeditions’ quest to put a new route up the world’s highest peak. This is one of the world’s first major ebooks developed exclusively for the iPad, using Apple’s new iBook Author software.
In 1982, a team of Canada’s best climbers confidently trekked to Everest through Nepal’s post monsoon rains. Within a month, four people were dead and half the climbers had returned home. The much-diminished team salvaged the expedition by putting six climbers on the summit via the traditional South Col route but its mission was incomplete.
Four years later, a second team returned to make mountaineering history. Not only did the 1986 Canadian Everest Light Expedition establish a new route on Everest without Sherpa support, but it also put the first North American woman on top. Despite several subsequent attempts, that route (via Tibet) has never been repeated.
Packed with 50,000 words, 140 hi-resolution photographs, slide shows, archival video and audio clips, maps and resources — all in 142 pages. The Apple iPad brings them to life. Find your link to the book on iTunes here.
This book, co-written by international adventure photojournalist Pat Morrow and alpine guide Sharon Wood, provides a fascinating insiders’ look at an era when climbing with style was more important than “peak bagging” and Everest was only approached after a long mountain-climbing apprenticeship.
“High Expectations” delivers classic high-altitude drama — a near miss in a massive avalanche, speedy alpine-style ascents from the South Col to summit, a risky nighttime descent of the Hornbein Couloir, a fiery gas explosion in a tent and weeks battling jet stream winds in an atmosphere starved of oxygen.
Optimized for Apple’s high definition retina display on its new generation of iPads.
Both authors make candid observations on how their lives were affected by the Everest experience and offer frank assessments of the change in attitude today toward Everest and climbing standards.
This multimedia Everest book marks the 30th anniversary of Morrow’s summit. It is truly a classic.
(Follow this link to buy Everest: High Expectations for your iPad on iTunes — or preview it for FREE.)
Read Sharon and Pat’s assessment of their climbs in this 2012 interview in The Globe and Mail here. They talk about how different things have become now that commercial expeditions have access to Everest and inexperienced, untrained adventure tourists can buy their way onto the peak.
Listen to the recent Vancouver Sun interview with Pat here. It’s excellent!
Visit Pat Morrow on Facebook here.
|
cc/2021-04/en_middle_0071.json.gz/line2968
|
__label__wiki
| 0.922874
| 0.922874
|
Governments And Tech Giants Join Hands Against Covid-19 Misinformation
Misinformation and conspiracy theories around Covid-19 vaccinations will not attempted to ne dispelled by tech companies including Facebook, Twitter and Google together with governments including the United Kingdom and Canada.
Standards for tackling misinformation across the various digital platforms and how organizations accountable for their failure to do so can be held responsible is being worked out by the new working group which was formed by the British fact-checking charity Full Fact.
“Bad information ruins lives, and we all have a responsibility to fight it where we see it,” said Full Fact’s chief executive, Will Moy. “The coronavirus pandemic and the wave of false claims that followed demonstrated the need for a collective approach to this problem.
“A coronavirus vaccine is now potentially just months away. But bad information could undermine trust in medicine when it matters most, and ultimately prolong this pandemic.”
The Department for Digital, Culture, Media and Sport of the UK amd Privy Council Office of Canada are also part of the partnership in addition to the three technology companies. Fact-checkers from South Africa, India, Argentina and Spain, the Reuters Institute for the Study of Journalism, and the journalism non-profit First Draft are also part of the efforts.
Facebook will provide the initial funding support which will be used by Full Fact to draft the initial framework for January 2021. Facebook and Full Fact have also worked together on previous occasions. The fact-checking partner for Facebook’s anti-misinformation programme in the UK was Full Fact.
“Working together to tackle misinformation is really important, especially bad content around the Covid-19 pandemic right now,” said Keren Goldshlager, the head of integrity partnerships at Facebook.
“We’ve seen huge value in partnering with over 80 independent fact-checkers globally to combat misinformation in 60 languages. We welcome this effort to convene more tech companies, fact-checkers, researchers and governments to discuss and develop new strategies, so that we can work together even more effectively in the future.”
Even before the imminent introduction of a Covid-19 vaccine has increased the importance and urgency of the issue, a challenge for social networks also long existed with respect to vaccine misinformation. Even though Facebook’s founder, Mark Zuckerberg, led a $3bn charitable effort to “cure all diseases”, anti-vaccination content was freely allowed by Facebook for years. The social me3dia company relented slight in March 2019, with the banning of anti-vax ads including misinformation about vaccines. And then the platform banned all anti-vax advertising in October this year except for those that carried a political message.
But the platform still allows “organic content” which are posts and groups advocating against vaccines. There is no explicit ban on misinformation in that category even though the social media can flag content for review by third-party fact-checkers.
Serious action against vaccine misinformation is being taken by YouTube only6 recently. A ban aimed specifically on misinformation about Covid vaccinations was announced by Google’s video-sharing site YouTube this October after a week of policy changes on the issue being announced by Facebook.
(Adapted from TheGuardian.com)
23 November 2020 in Companies, Consulting, Global perspectives, Publications, Technologies.
Ads Discouraging Vaccination Banned On Facebook
Non-compliance to British laws will attract fines on social media companies
Amazon And Apple Not Part Of French Initiative Of Setting Global Principles For ‘Big Tech’
← Local foothold and international development: winning strategies for European cooperatives
White House Vaccine Chief Says First American Could Get Vaccinated On December 11 →
|
cc/2021-04/en_middle_0071.json.gz/line2969
|
__label__wiki
| 0.649233
| 0.649233
|
Do Hoang Hanh
Contact Hanh
Hanh brings over a decade of experience in marketing and business administration at various Vietnamese companies to her role managing operations in the BGA representative office in Hanoi.
Before joining BGA, Hanh worked as marketing communication manager at Nhat Nguyet Import-Export Company, one of the leading import/export companies in the garment and textile industry, from 2012 to 2015. She developed and managed the execution of the company’s marketing programs, including media campaigns, events, marketing materials and digital marketing activities.
Hanh was also experienced in marketing and business administration at the Vietnam International Bank and Vinaphone between 2003 and 2012 at various executive positions.
Hanh graduated from the University of Westminster with a master’s degree in marketing communications. She also earned a bachelor’s degree in planning and economics from the Vietnam National University of Economics.
Prior Professional Experience
Marketing Communications Manager, NhatNguyet Import- Export Joinstock Company (Jun 2012-Mar 2015)
Senior Staff at Branch Transformation Roll-out Department, VIB Vietnam International Bank (Jun 2011-May 2012)
Staff at Business and Marketing Department, Vinaphone (Sep 2015-Jun 2006)
Functional Expertise
Administrative & Management
University of Westminster, London (2007-2008)— Master of Marketing Communications
National Economics University (Sep 2001-Jun 2005)— Bachelor of Planning and Economics
ASIA STREET
Asia-Pacific Beyond COVID
BGA Brainstorm
BGA In The News
© 2021 BowerGroupAsia | Privacy Policy | Cookie Declaration |
|
cc/2021-04/en_middle_0071.json.gz/line2973
|
__label__wiki
| 0.940417
| 0.940417
|
Kashmir people vote in local polls amid cold and security
SRINAGAR, India — Hundreds of thousands of people in Indian-controlled Kashmir voted Saturday amid tight security and freezing cold temperatures in the first phase of local elections, the first since New Delhi revoked the disputed region’s semiautonomous status.
Nearly 6 million people across the region’s 20 districts are eligible to elect 280 members of District Development Councils in a staggered eight-phase process that ends Dec. 19.
Authorities deployed thousands of additional soldiers in the already highly militarized region to guard the vote. Government forces laid razor wire and erected steel barricades on roads around many of the 2,146 polling stations set up for the first phase.
Election Commissioner K.K. Sharma appealed to residents to cast their vote and “participate in the biggest festival of democracy.” Officials said voter turnout was about 52% out of the eligible 700,000 voters for Saturday’s ballot.
As standard protocol for the coronavirus pandemic, authorities placed hand sanitizers, face masks and thermal scanners at the polling stations, where voters cast their ballot in freezing cold across the region.
India says the polls are a vital grassroots exercise to boost development and address civic issues and will uproot corruption from the region. Separatist leaders and armed rebel groups that challenge India’s sovereignty over Kashmir have in the past called for a boycott of elections, calling them an illegitimate exercise under military occupation.
Indian Prime Minister Narendra Modi’s Hindu nationalist Bharatiya Janata Party has fiercely campaigned for the election in the Muslim-majority region in a bid to replace local Kashmiri pro-India parties that had formed an alliance.
The Kashmiri alliance has vigorously opposed Modi’s government after it revoked the region’s semi-autonomous status in August last year, annulled its separate constitution, split the area into two federal territories — Ladakh and Jammu-Kashmir — and removed inherited protections on land and jobs.
The Indian government imposed sweeping restrictions, ranging from curfews to communications blackouts, arrested thousands, including pro-India Kashmiri leaders opposed to the move and enacted new laws in measures that triggered widespread anger and economic ruin.
The current voting is part of a three-tier process in which residents directly elect their village representatives, who then vote to form development councils for clusters of villages called “Block Development Councils.” Members for the larger, third and top layer “District Development Councils” are also directly elected by the residents.
The elected members have no legislative powers and are only responsible for economic development and public welfare of the region.
Officials are also simultaneously conducting the election for hundreds of vacant seats in village councils that remained uncontested during 2018 polls.
The BJP has a very small base in the Kashmir valley, the heart of the decades-old anti-India insurgency, but has significant support in four Hindu-majority districts in the Jammu area.
The Kashmiri alliance has accused the government of interfering with their campaigning, a charge denied by the Election Commission.
The alliance also accused authorities of putting its top leader Mehbooba Mufti, a former top elected official and ally of Modi, under house arrest on Friday. Police denied Mufti was restricted to her home.
Waheed Ur Rehman Parra, Mufti’s colleague and a candidate in the election, was arrested by India’s National Investigation Agency on Wednesday for alleged links with Kashmir’s main rebel group.
Many of the 296 candidates up for election Saturday have been lodged in hotels because of security concerns. In the past, militants have targeted candidates.
Some Kashmiris view the polls cynically as a move to create a new political elite loyal to the Modi government.
“This is an ideological vote,” said Najeeb Khan, a voter in Srinagar, the region’s main city. “People are considering it a referendum against the BJP.”
Kashmir is divided between India and Pakistan and both rivals claim the region in its entirety. Rebels have been fighting against Indian rule since 1989. Most Muslim Kashmiris support the rebel goal that the territory be united either under Pakistani rule or as an independent country.
New Delhi calls Kashmir militancy Pakistan-sponsored terrorism. Pakistan denies the charge, and most Kashmiris call it a legitimate struggle for freedom.
Tens of thousands of civilians, rebels and government forces have been killed in the conflict.
Aijaz Hussain, The Associated Press
(Bloomberg) -- Oil extended losses in Asia on a stronger dollar and a still-surging coronavirus after slumping the most in almost four weeks on Friday following the release of disappointing U.S. economic data.Futures in New York fell below $52 a barrel after tumbling 2.3% on Friday. The dollar held gains Monday after advancing last week, reducing the appeal of commodities like oil that are priced in the currency. Chinese economic growth and industrial production data released Monday came in ahead of estimates, helping oil to pare losses slightly.Covid-19 continues to spread rapidly, complicating the global recovery in energy demand. The U.S. is on track to reach 400,000 deaths before President-elect Joe Biden’s inauguration on Wednesday, while the U.K. is closing its travel corridors with countries around the world as cases spike.Crude still managed to eke out a small gain last week, helped by a rebalancing of commodity indexes and the promise of more U.S. stimulus spending. However, the rally that started in early November and has pushed oil to the highest in almost a year looks to be stalling amid a worsening short-term demand outlook.The dip in prices on Friday was a “breather” for a market that has rallied strongly, said Howie Lee, an economist at Oversea-Chinese Banking Corp. “Biden’s inauguration will be the focus of markets this week, particularly on how quickly he can roll out his fiscal stimulus plans.”Libya’s oil output, meanwhile, has dropped by about 200,000 barrels a day after the closure of a leaking pipeline. The decline underscores how difficult it is for the country to maintain production after almost a decade of civil war.See also: President Biden Won’t Unlock a Wave of Iranian Crude: Julian LeeThe worsening short-term outlook is being reflected in oil’s futures curve. Brent’s prompt timespread is 1 cent a barrel in contango -- a bearish structure where near-dated prices are cheaper than later-dated ones -- after being as much as 16 cents in backwardation earlier in the month.For more articles like this, please visit us at bloomberg.comSubscribe now to stay ahead with the most trusted business news source.©2021 Bloomberg L.P.
Gold Extends Decline on Dollar Strength as Stimulus Faces Debate
(Bloomberg) -- Gold extended declines on a stronger dollar and the currency’s outlook, while investors assess the timeline for the U.S. stimulus package.Former Federal Reserve Chair Janet Yellen is expected to affirm the U.S.’s commitment to market-determined exchange rates when she testifies on Capitol Hill Tuesday, and she will make clear the U.S. doesn’t seek a weaker dollar for competitive advantage, according to a report from the Wall Street Journal citing people familiar with the preparation. The dollar has climbed in the past two weeks.Yellen’s confirmation hearing as Treasury secretary is scheduled for Jan. 19 in front of the Senate Finance Committee, the day before President-elect Joe Biden is sworn into office.Bullion has dropped about 4% this year as U.S. Treasury yields and the dollar advanced. Still, the metal is staying above $1,800 an ounce and is expected to receive support from massive stimulus packages from central banks and governments. Biden is pushing for quick congressional action on his economic relief plan, but he risks slowing it down with a federal minimum-wage increase that Republicans and business groups have long fought.Meanwhile, as the U.S. death toll from Covid-19 neared 400,000, Anthony Fauci, the nation’s top infectious disease expert, said that Biden’s promise of delivering 100 million vaccine doses in 100 days is “absolutely a doable thing.” Vaccinations in the U.S. began Dec. 14 with health-care workers, and so far 13.7 million shots have been given, according to a state-by-state tally by Bloomberg News and data from the Centers for Disease Control and Prevention.Spot gold fell 0.5% to $1,819.77 an ounce by 9:03 a.m. in Singapore after falling 1.1% last week. Silver and palladium and also declined while platinum was little changed.For more articles like this, please visit us at bloomberg.comSubscribe now to stay ahead with the most trusted business news source.©2021 Bloomberg L.P.
|
cc/2021-04/en_middle_0071.json.gz/line2986
|
__label__wiki
| 0.893644
| 0.893644
|
Non-Traditional Investments
CConfederations Cup
Confederations Cup Preview: Russia vs Portugal
byCalcio Insider
Russia will be hoping to clinch qualification to the semi-final stage of the Confederations Cup when they take on Euro 2016 winners Portugal in their second game in Group A. The 2018 World Cup hosts were largely unscathed against a lacklustre Newcastle outfit last time around, and this enabled them to cruise to a 2-0 victory over the All Whites.
On the other hand, Portugal could not produce a similar result versus Mexico as a late Hector Moreno goal levelled scores at 2-2 amid the disappointment of skipper Cristiano Ronaldo. Portugal had a bizarre group stage exit in their previous World Cup, and they will be hoping to step up the gas against a relatively inexperienced Russia defence.
Roman Shishkin, Viktor Vasin and Fyodor Kudryashov have just 31 caps between them, and these stats could be simply overtaken by Portugal’s Pepe, who is on 83 caps for his nation. Despite this, Portugal looked surprised by Mexico’s resilience last term, and they will have to guard against complacency once more against their European counterparts.
Players to watch for:
Cristiano Ronaldo (Portugal): Ronaldo has had a lot going around him in recent days. The Portuguese hero has been alleged of tax fraud by Spanish authorities, and this has urged him to consider his Real Madrid future ahead of the transfer window. Nevertheless, his country needs him the most on Wednesday with Andre Silva not quite the force without the talismanic captain.
Fyodor Smolov (Russia): The Krasnodar striker is the number one option for Russia amid the injury absence of Artem Dzyuba, and he dually delivered with the second goal in the 2-0 win over the All Whites. The Portugal backline has remained solid with Pepe and Jose Fonte in the middle, and the 27-year-old would need some assistance from the creative players including Denis Glushakov and Aleksandr Golovin.
Russia are often a hit and miss on the global stage, but they remain a capable force in their home nation. The match could be leaning towards another draw for Portugal unless Ronaldo sparks to life.
Russia 1-1 Portugal
Image – Getty
Calcio Insider
Arsenal at risk of losing Alex Oxlade-Chamberlain
Opinion: Manchester United should take advantage of Ronaldo's availability
Opinion: Germany prove their mettle in the Confed Cup
Germany became the first European nation since France to lift the Confederations Cup after the beat Chile by…
Confederations Cup Preview: Mexico vs New Zealand
North American champions Mexico will look to make strides towards the Confederations Cup semi-finals when they take on…
Confederations Cup: Group B review
The Confederations Cup Group B did not present any surprises as Germany and Chile scrapped through to the…
Confederations Cup Preview: Portugal vs Chile
Portugal versus Chile in the Confederations Cup semi-final promises to be one of the tightest contests in the…
Confederations Cup Preview: Portugal vs Mexico
Euro 2016 champions Portugal will take on the CONCACAF Cup winners Mexico in the second game of the…
Confederations Cup Preview: Germany vs Chile
World Cup holders Germany face off against Copa America champions Chile in the final of the Confederations Cup.…
© Copyright 2019 Calcio Insider. All rights reserved.
Bankrupty
Estate Wills & Trusts
|
cc/2021-04/en_middle_0071.json.gz/line2989
|
__label__wiki
| 0.965126
| 0.965126
|
Search calgarysun.com
Share this Story: Province readies 400 more COVID-19 ICU beds as death toll hits 500
Province readies 400 more COVID-19 ICU beds as death toll hits 500
'I would hope we never have to utilize that number of beds — it would result in stopping not just elective surgeries but move to more urgent surgeries to be postponed to get to that level of beds,' Hinshaw said
Alberta’s chief medical officer of health Dr. Deena Hinshaw provided, from Edmonton on Monday, November 23, 2020. Photo by Chris Schwarz/Government of Alberta
With COVID-19 cases continuing to surge in Alberta and the virus’s death toll hitting 500, the province is readying 400 more ICU beds to handle the expected growth in serious infections, the province’s top doctor said Wednesday.
Alberta hospitals have also exceeded a benchmark of 70 full acute-care COVID-19 beds, with 71 patients on Wednesday — an increase of five over Tuesday.
Province readies 400 more COVID-19 ICU beds as death toll hits 500 Back to video
Crossing this threshold means “we’d be crossing into territory where we’d be impacting other patients’ care,” said Alberta’s chief medical officer of health Dr. Deena Hinshaw.
“Unfortunately, the way that (extra) space is made available is winding down care for people who can wait a little longer for it,” she said.
Hinshaw said it’s hoped most of those beds will never be needed, nor will the mass redeployment of staff, and that new public health measures announced by the province Tuesday would help prevent that.
“I would hope we never have to utilize that number of beds — it would result in stopping not just elective surgeries but move to more urgent surgeries to be postponed,” she said.
Numerous elective surgeries in Edmonton have already been postponed amid a spiking number of COVID-19 patients in the province’s hospitals, which now number 355, an increase of seven from Tuesday.
Some physicians say the health-care system, particularly in Edmonton, is already in crisis due to the added weight of COVID-19 infections.
“We’re seeing some alarming situations in our hospitals … this is a real concern,” said Dr. Tehseen Ladha, a pediatrician with a background in public health.
She said the added measures to reduce the virus’s spread aren’t enough, and forecast a difficult Christmas season.
“They will slow down the rate of spread, but it’s too little too late,” said Ladha.
On Monday, Peter Lougheed Centre ICU physician Dan Niven said if the current COVID-19 trends continue in the province, ICU beds could be triaged, or prioritized.
On Wednesday, the province reported another 1,265 cases and nine deaths, bringing the total number of fatalities to 500 – 188 of those in the Calgary Zone.
The province has recorded 200 of those deaths in the past month alone.
Among the latest fatalities was a woman in her 50s with pre-existing conditions in the Edmonton zone.
The number of new daily cases now consistently exceeds 1,000, with the positivity rate from testing currently around eight per cent — eight times the level in the spring.
On Tuesday, Premier Jason Kenney announced a new suite of measures and restrictions in a bid to halt the rapidly worsening COVID-19 onslaught.
Those measures include a ban on private indoor social gatherings, tighter limits on retail and church occupancy, and mandated online instruction for junior and senior high school students beginning Monday until Jan. 11.
Dining out must be confined to family groups, while funerals and weddings are limited to 10 attendees with no receptions and retail outlets are limited to 25 per cent legal capacity.
There is still no provincewide mandatory mask order, but they must be worn in all workplaces in the Calgary and Edmonton areas.
On Wednesday, NDP health critic David Shepherd demanded the government reveal what recommendations Hinshaw presented to cabinet members before their decision, suggesting the government was playing politics with its restrictions.
“It’s obvious that the small package of half-measures Kenney announced (Tuesday) were all that he could convince the extremist fringe of his caucus to accept,” said Shepherd.
“Albertans have the right to hear Dr. Hinshaw’s unfiltered, professional advice, and judge Kenney’s decisions for themselves.”
He questioned what went into the government’s restriction exemptions, saying the source of more than 80 per cent of newer COVID-19 cases aren’t known, since contact tracing is no longer being done on infections older than 10 days.
“Kenney did not base these exemptions on data, because that data doesn’t exist,” Shepherd said. “He failed to prepare Alberta’s contract tracing system for the second wave.”
David Shepherd, NDP Opposition critic for health, responds to the release of the UCP government’s review of Alberta Health Services on Monday February 3, 2020. Photo by Larry Wong /Postmedia
On Wednesday, Hinshaw refused to reveal what measures she recommended or were rejected, only saying she received an appreciative hearing from lawmakers.
“I’m grateful my recommendations have always been respectfully considered in these decisions … my recommendations were a broad range of options and were respectfully considered,” she said.
She also said the new steps “will impact transmission” but are dependent on widespread compliance, adding the effects won’t be fully clear for another three weeks.
The fact contact tracers are unable to track all cases “makes it more challenging to understand with any granularity where they’re coming from … we do have that challenge of our own local data being impacted” when formulating policy, said Hinshaw, adding steps are being taken to increase that workforce.
Beginning Wednesday, the province also imposed further restrictions on public access to acute-care settings with virus outbreaks, with those admitted to hospital or in emergency care limited to one visitor, as are those in maternity care and end-of-life situations.
Those in pediatric or critical care are allowed two designated visitors.
Twitter: @BillKaufmannjrn
Calgary Sun Headline News
Sign up to receive daily headline news from the Calgary SUN, a division of Postmedia Network Inc.
The next issue of Calgary Sun Headline News will soon be in your inbox.
Follow the Calgary Sun
© 2021 Calgary Sun, a division of Postmedia Network Inc. All rights reserved. Unauthorized distribution, transmission or republication strictly prohibited.
|
cc/2021-04/en_middle_0071.json.gz/line2990
|
__label__wiki
| 0.758886
| 0.758886
|
Home CBJ News Friends of Sharphill Wood reassured over new housing estate in West Bridgford
CBJ Top Story
Friends of Sharphill Wood reassured over new housing estate in West Bridgford
A conservation group which protects a West Bridgford woodland has been reassured after a meeting with builders about plans to develop the surrounding area.
The Friends of Sharphill Wood met with Bovis Homes to discuss how they were going to protect the area when work takes place to build a new housing estate.
Talks took place yesterday to discuss the situation amid fears any development would impact on the woodland.
But Friend’s secretary, Bill Logan, hailed the meeting as a success and said Bovis Homes has reassured the group over several key issues.
He said: “Bovis confirmed that they would put up a post and rail fence surrounding the wood, which we are extremely happy about.
“They also said they would build a cycle path to the east and north of the wood, stopping cyclists from having to cross through it,” he added.
The Friends of Sharphill Wood carry out jobs such as planting hedges, tidying litter and protecting plants and animals within the wood.
Despite assurances in some areas, Mr Logan said not all of the groups concerns had been addressed.
He revealed that plans to build extra entrances had not been finalised, with Mr Logan saying he believed extra gates would make it easier for people to enter the wood.
He said:”A gate would create a corridor for people to use, rather than allowing them to enter wherever they feel like.”
During the meeting, plans over a community park and providing sheds for the group were also discussed.
Friends of Sharphill Wood is now working with Bovis to create an information pack for residents.
Previous articleReview: A Series of Unfortunate Events
Next articleNow it’s January, is it still a new you?
|
cc/2021-04/en_middle_0071.json.gz/line2992
|
__label__cc
| 0.5793
| 0.4207
|
A Proposed Correlation between the Perception of Paranormal Manifestations and GOES System Magnetometer Data
February 1, 2014 admin Leave a comment
Download PDFDownload
By Robert Bradley, Research Coordinator, Center for Paranormal Research and Investigation
For thousands of years humans have reported paranormal manifestations such as seeing/hearing ghosts, being touched by an invisible entity, anomalous smells, etc. Because these perceived manifestations are seen, heard or felt, a physical environmental change should have occurred. While examining environmental data surrounding these perceived manifestations, a correlation between them and GOES (Geostationary Operational Environmental Satellite) system magnetometer data was observed. It was observed that when the magnetometer intensity readings were increasing over time, very few manifestations were reported. When the magnetometer intensity readings were decreasing, however, many more manifestations were reported. During subsequent data collection excursions, this correlation seemed consistent throughout. A project was launched to analyze historical GOES system magnetometer data versus perceived manifestations over the last 3 years. The analysis of this data included calculating the slope of the curve of the GOES data at the time when a manifestation was perceived. The results indicated the correlation existed over the time period analyzed. Anecdotal evidence also seems to indicate that perceived manifestations may be of a more intense nature if the slope of the tangent to the curve when it is decreasing is much steeper. However, more work needs to be performed before conclusions can be made regarding intensity.
For thousands of years humans have reported paranormal phenomena such as seeing or hearing ghosts, being touched by an invisible entity, anomalous smells, etc. Because these perceived manifestations are seen, heard or felt, a physical environmental change should have occurred. While examining environmental data surrounding these perceived manifestations, a correlation between manifestations and GOES (Geostationary Operational Environmental Satellite) system magnetometer data was observed. The GOES system supports weather forecasting, severe storm tracking, and meteorology research and consists of several geosynchronous satellites and ground-based elements. The satellites are stationed above several locations around the Earth along the Equator. The one of interest in this project sits at 75 degrees W longitude at an altitude of 22,240 statute miles (GOES 13). This satellite covers East Coast, USA (figure 2 and reference 4). The magnetometer data was obtained from data compiled by NOAA from magnetometers on the satellite (figure 3). These magnetometers’ purpose is to monitor the Earth’s geomagnetic field and its variations (reference 3).
It was observed that when the magnetometer intensity readings (in nano Tesla or nT) were increasing over time, few manifestations were reported. When the magnetometer intensity readings were decreasing, however, many more manifestations were reported. During subsequent data collection excursions, this correlation seemed to exist throughout. A project was then launched to compare reports of perceived manifestations to the corresponding point on the GOES East Coast magnetometer data where the slope of the tangent line to the curve at the point in question was calculated.
Multiple excursions over time were made to locations where perceived paranormal manifestations (visual and audible) were reported along the East Coast, USA over a period of three years. Any perceived manifestations during the excursions were noted as to type, date and time. GOES magnetometer data for the East Coast (GOES 13) was then obtained from the GOES Data Access website (reference 2) for comparison. The times of perceived manifestations were then converted to UTC time to match the time zone of the GOES magnetometer readings. The slope of the tangent line for points of interest on the magnetometer data curve was then calculated and examined for magnetic field (nT) increase or decrease over time. The Microsoft Excel Slope Function was used for this calculation. Forty perceived manifestation times and forty points on the curve around the time of interest for each manifestation were used in the slope calculation. Time periods when manifestations did not occur were not included in this experiment.
Data in Table 1 is only for detected manifestations. Time periods where manifestations were not detected are not included. Magnetometer data collected is in nano Tesla (nT) and is the average total magnetic field reading from all three axes of the instrument (table 2). Negative slope values indicate downward trends in the curve. Positive slope values indicate upward trends in the curve
The curve created using GOES magnetometer data mimics a Sin wave in appearance with magnetic field intensity (nT) increasing and then decreasing over time. However, while the curve seems to be regular and predictable for the most part, as in any Sin wave, there are times when magnitude and frequency can change drastically very quickly (figure 1). These aberrations are not predictable, but seem to affect the reports of manifestations. The general predictability of the Sin function, though, may indicate a reason that many reports of manifestations happen at specific times at night or in the very early morning hours, especially if no curve aberration occurs.
During times when audible or visible manifestations were perceived, calculated slopes on the corresponding GOES magnetometer data indicated a mostly downward trend in intensity. During each date when manifestations were perceived, there was much time when nothing at all was perceived. For example, on 7/18/15 we were on location from 6pm until 4am the next morning with only 6 instances of perceived manifestations. This seems to show that perceived manifestations are more likely to occur when the calculated slopes indicate a downward trend in magnetic field intensity, though they could still occur less frequently when the calculated slope indicates an opposite trend. This seems to hold true during times of abnormal dips and spikes in the curve.
Anecdotal evidence also seems to indicate that manifestations may be of a more intense nature if the slope when magnetic field intensity is decreasing is more negative. However, more work needs to be performed regarding the intensity to increased negative slope correlation. More work also needs to be performed regarding perceived manifestations at locations other than East Coast, USA to see if the correlations still exist elsewhere using different GOES locations and to the time of day of reported manifestations. Finally, more work needs to be performed to compare results to magnetometer data outside the Earth’s magnetosphere to determine whether the effect is solar or terrestrial in nature.
Sources of error in this experiment could be associated with improvements in data collection over the time period reviewed and the time format for when the perception of manifestations occurred (hh:mm). For future work, the time format for data collection should be as precise as possible (hh:mm:ss.x) to match the time format used in the GOES data and data collection techniques should be consistent during the entire data collection period.
http://www.swpc.noaa.gov/products/goes-magnetometer
http://www.ngdc.noaa.gov/stp/satellite/goes/dataaccess.html
http://www.goes-r.gov/spacesegment/mag.html
http://www.nasa.gov/feature/goddard/nasa-celebrates-contributions-to-40-years-of-noaagoes-satellites
Figure 1 – Example GOES Magnetometer Curve Over Time (reference 1)
Figure 2 – GOES Locations (GOES WEST=15, GOES EAST=13) (reference 4)
Figure 3 – GOES Magnetometer (reference 3)
Table 1 – Slope Calculations
Date __ Time __ Time Zone __ UTC Date __ UTC Time __ Type __ Slope
3/1/2014 __ 8:51pm __ EST __ 3/2/2014 __ 1:51am __ A __ -122.68
3/2/2014 __ 2:51am __ EST __ 3/2/2014 __ 7:51am __ A __ 243.4745
6/21/2014 __ 8:05pm __ EDT __ 6/22/2014 __ 12:05am __ A __ -397.987
6/21/2014 __ 10:57pm __ EDT __ 6/22/2014 __ 2:57am __ V __ 261.2105
6/22/2014 __ 1:03am __ EDT __ 6/22/2014 __ 5:03am __ A __ -131.397
6/22/2014 __ 2:05am __ EDT __ 6/22/2014 __ 7:03am __ A __ 55.40351
7/19/2014 __ 7:44pm __ EDT __ 7/19/2014 __ 11:44pm __ A __ -192.338
7/19/2014 __ 9:58pm __ EDT __ 7/20/2014 __ 1:58am __ A __ -466.047
7/20/2014 __ 2:10am __ EDT __ 7/20/2014 __ 6:10am __ A __ 109.2283
7/20/2014 __ 3:04am __ EDT __ 7/20/2014 __ 7:04am __ A __ -66.34
10/18/2014 __ 8:51pm __ EDT __ 10/19/2014 __ 12:51am __ A __ -576.705
10/18/2014 __ 10:46pm __ EDT __ 10/19/2014 __ 2:46am __ A __ -38.304
2/21/2015 __ 7:06pm __ EST __ 2/22/2015 __ 12:06am __ A __ -2270.66
2/21/2015 __ 8:33pm __ EST __ 2/22/2015 __ 1:33am __ A __ -802.924
3/21/2015 __ 9:18pm __ EST __ 3/22/2015 __ 2:18am __ A __ 90.232
3/21/2015 __ 11:33pm __ EST __ 3/22/2015 __ 4:33am __ A __ -142.777
7/18/2015 __ 9:35pm __ EDT __ 7/19/2015 __ 1:35am __ A __ -66.33
7/18/2015 __ 10:07pm __ EDT __ 7/19/2015 __ 2:07am __ A __ 147.5342
7/18/2015 __ 10:56pm __ EDT __ 7/19/2015 __ 2:56am __ A __ -173.511
7/18/2015 __ 11:07pm __ EDT __ 7/19/2015 __ 3:07am __ V __ -178.251
7/18/2015 __ 11:09pm __ EDT __ 7/19/2015 __ 3:09am __ A __ -82.4767
9/26/2015 __ 7:28pm __ EDT __ 9/26/2015 __ 11:28pm __ A __ -1426.66
9/26/2015 __ 9:55pm __ EDT __ 9/27/2015 __ 1:55am __ A __ 267.2164
10/10/2015 __ 9:49pm __ EDT __ 10/11/2015 __ 1:49am __ A __ -11275.7
10/10/2015 __ 9:59pm __ EDT __ 10/11/2015 __ 1:59am __ A __ -642.874
10/24/2015 __ 5:51pm __ EDT __ 10/24/2015 __ 9:51pm __ A __ -6380.77
10/24/2015 __ 8:32pm __ EDT __ 10/25/2015 __ 12:32am __ A __ -3407.73
2/28/2016 __ 3:10am __ EST __ 2/28/2016 __ 8:10am __ A __ -93.2336
2/28/2016 __ 3:22am __ EST __ 2/28/2016 __ 8:22am __ A __ -435.963
Table 2 – Example Raw GOES 13 Magnetometer Data (time_tag = date/time, HT_2=nT)
time_tag __ HT_2
00:00.2 __ 88.06
00:07.9 __ 88
Posted in: Academic
← Deathbed Visions
Bacon’s Castle – 3/1/14 →
|
cc/2021-04/en_middle_0071.json.gz/line2993
|
__label__cc
| 0.725263
| 0.274737
|
My grandma lived on an island and the only way to reach her cottage was over a long causeway. But every childhood visit was heightened by the expectation of making it across. High tide, bad weather, jellyfish blooms-well not really but in my imagination they swarmed-rendered crossing the causeway impassable as it lay beneath the murk of the sea.
Causeways link two distinct places, island to island, island to mainland, one land mass to another. But unlike bridges they are far more vulnerable to the elements and forces of nature. If the tide was high it was a long wait in the car until the cold grey waters of East Anglia receded enough so we could cross.
Sometimes the links between thoughts and actions are firm and definable like bridges. You can cross back and forth as you please. But sometimes they are like navigating causeways. You have to wait for conditions to be right.
The desire to cross a predictable bridge with swift passage from A to B is strong, well-trodden, easy. But so often these aren’t the roads we face. The times we are in find me waiting for the tide to go down and to be accepting of that. Around me are the flat damp mud flats of the mainland, across the causeway and through the jellyfish is the light of a cottage.
I’ll get there but it’ll take a bit longer than expected. ©
December 30, 2020 by charliearchbold Bridges, Causeway, COVID19, Decision Making, Family, Hope, Positivity, Resilience
|
cc/2021-04/en_middle_0071.json.gz/line3002
|
__label__cc
| 0.72624
| 0.27376
|
TravelBuddee.com
Travel Marketplace for Peer to Peer Local Guides (Buddees) & Tour Services in Asia
Cruise & Shore Excursions
Nature and Treks
Tour Guide Tools
Find a Buddee (Guide)
Langkawi, Kedah, Malaysia – Archipelago of 99 islands in the Andaman Sea
Langkawi, Kedah, Malaysia is an archipelago of 99 islands in the Andaman Sea. Kedah is the most north-western region of Malaysia and shares the same border with Thailand. Of the 99 islands, five of them are only visible and accessible…
travelbuddee November 5, 2016 October 26, 2016 Destinations, For Families, Home, Islands and Beaches, Kedah, Malaysia, Resorts, Travel Stories
Pulau Tioman, Pahang, Malaysia – One of the most beautiful islands in the world
Pulau Tioman, Pahang, Malaysia is about 56 kilometres Southeast of the state. Tioman is the largest island that forms part of the volcanic group of islands known as the Seri Buat Archipelago. Other islands off Mersing also forms part of…
travelbuddee November 2, 2016 October 26, 2016 Destinations, For Families, Home, Islands and Beaches, Malaysia, Pahang, Resorts, Travel Stories
Four Iconic Tourism Highlands, Pahang, Malaysia
Pahang is the largest state in Malaysia. There are various natural attractions, making it a favourite state to visit. It is known for its tourism highlands and pristine forests. The oldest rainforest in Malaysia, Taman Negara, together with other natural…
travelbuddee October 26, 2016 October 21, 2016 Destinations, For Families, Home, Malaysia, Nature and Treks, Pahang, Travel Stories
The French Colmar Tropicale Resort, Bukit Tinggi, Pahang, Malaysia
Bukit Tinggi, Pahang, Malaysia is amongst the newest Highlands in Malaysia. Located on the Titiwangsa Range, it is at an altitude of 800 to 1000m. Travellers can enjoy the cooling weather of about 20 degrees annually, making the hill an…
travelbuddee October 24, 2016 October 17, 2016 Destinations, For Families, Home, Malaysia, Nature and Treks, Pahang, Resorts, Travel Stories
Fraser’s Hill, Pahang, Malaysia – Holiday Retreat & Highland Resort
Fraser’s Hill, Pahang, Malaysia is another favourite highland resort on the Titwangsa Ridge. Known as Bukit Fraser by the locals, the hill has an elevation from 1200m to 1500m. Named after Louis James Fraser who discovered Fraser’s Hill as a…
Cameron Highlands, Pahang, Malaysia – Agriculture Highland of Malaysia
Cameron Highlands, Pahang, Malaysia is one of the most visited Highlands in Malaysia. Located on the Titiwangsa Range, the resort is about 1500m above ground. As a result, the temperature here can drop to 16 degrees at certain times. Weather…
travelbuddee October 17, 2016 October 17, 2016 Destinations, Farm Visits, For Families, Home, Malaysia, Nature and Treks, Pahang, Resorts
Five Natural Attractions, Selangor For Nature Lovers
Selangor, enclaves Malaysia’s capital, the Federal Territory of Kuala Lumpur. It is one of the most developed states in Malaysia due to its proximity to KL. Although Selangor is a metropolitan city, you are still able to find parcels of…
travelbuddee October 11, 2016 October 17, 2016 Destinations, Home, Malaysia, Nature and Treks, Selangor, Travel Stories
Broga Hill, Selangor – A Hill Covered with Lalang Grass
Broga Hill, Selangor is a small hill that is about 400 metres high. The climb to the top of the hill is relatively easy, taking between 30 minutes to an hour. However, it is steep and challenging, enough to get…
travelbuddee October 7, 2016 October 17, 2016 Destinations, Home, Malaysia, Nature and Treks, Selangor, Travel Stories
Kanching Falls, Selangor – Seven-Tier Cascading Falls in Templer’s Park
Kanching Falls, Selangor is a series of seven tier cascading falls inside the 500 hectares Kanching Recreational Rainforest. Its address is 1,48000 Rawang, Selangor, Malaysia. It is only a 30-minute drive from Kuala Lumpur. The proximity to the city makes…
Paya Indah Wetland, Selangor – Beautiful Swamp & Wetland
The Paya Indah Wetland, Selangor was a tin and sand mine previously. Its address is Km 4, Jalan Dengkil-Banting, 43800 Dengkil, Selangor. In 1997, the mining activities stopped. Restoration converted the area into a nature park. Paya Indah means beautiful…
travelbuddee September 30, 2016 September 28, 2016 Destinations, Home, Malaysia, Nature and Treks, Selangor, Travel Stories
Sign Up For Latest News, Updates & Offers From TravelBuddee
Tour or Free and Easy in Singapore || Travel Choices
Short Singapore Guide to Bukit Timah Railway Tracks
Navigating through Singapore
Chicken Rice in Singapore, Local Food Tips
13 Ideas for the Perfect Malaysia Weekend Trip
monthly archives Select Month March 2019 (1) February 2019 (1) August 2018 (1) June 2018 (4) May 2018 (8) April 2018 (1) September 2017 (1) June 2017 (3) February 2017 (2) January 2017 (2) December 2016 (3) November 2016 (8) October 2016 (9) September 2016 (8) August 2016 (10) July 2016 (11) June 2016 (10) May 2016 (11) April 2016 (8) February 2016 (2) January 2016 (1)
Agriculture tourism beach buddee tools Bukit Pasoh Cameron Highlands Cherating Chinatown Culture Family family travel Farms festivals Gunung Lambak Heritage how-to Islands Jinrikisha Station Johor Khao Yai kota tinggi Malacca Malaysia Mersing Museum nature Outdoor Pahang Penang Port Dickson relaxation Resort Selangor shophouses shopping singapore singapore river Singapore tour Taman Negara Terengganu thailand themepark tour guide travel blog travelbuddee UNESCO
Copyright © 2021 TravelBuddee.com. Theme by Colorlib Powered by WordPress
(C) Buddee Inc Pte Ltd
|
cc/2021-04/en_middle_0071.json.gz/line3017
|
__label__cc
| 0.584424
| 0.415576
|
Staff and Student News
Sarah Turner on BBC R4 New Year’s Eve
Sarah Turner will talk about her film Public House on BBC Radio 4 on New Year’s Eve.
First broadcast on 20 November, A Vision on Peckham Rye, in which Sarah Turner, Director of Research in the School of Music and Fine Art, talks about recreating Blake’s ‘Vision of Angels’ for her Grierson award nominated film Public House, will be repeated on BBC Radio 4 on New Year’s Eve, a prime slot.
The programme also features Dulwich Folk Choir performing music composed for the film by SMFA’s Director of Marketing and Recruitment and Music Lecturer, composer Duncan MacLeod.
The broadcast is available now on i-player.
Further information on Public House can be found on the SMFA webpages.
This entry was posted in Campus online, Medway Student, Student Guide on 19 December 2016 by Wendy Raeside.
Kent-wide NHS Research Day 2017
NHS research & development departments from across Kent will be hosting a health research event – sponsored by KentHealth – at Woolf College on Canterbury campus on 13 January 2017.
The Kent-wide Research Day aims to celebrate health research taking place across Kent. The programme for the day, which runs from 09.00-17.00, includes plenary sessions, presentations and workshops. Lunch and refreshments will be provided.
The day is free to attend, but places are limited. To register, please click on this Eventbrite link.
If you have any questions, email r&doffice@medway.nhs.uk
Heide Kunzelmann on BBC Radio 3
Dr Heide Kunzelmann, Lecturer in German in the Department of Modern Languages, will feature on the BBC Radio 3 programme Free Thinking at 22.00 on Thursday 5 January 2017, exploring the writing and politics of Karl Kraus (1874-1936).
Free Thinking is a series of interviews, talks, debates, drama and live performance with contributions from leading thinkers, artists, scientists and writers. The episode on Karl Kraus is part of Radio 3’s Breaking Free series of programmes exploring the music and culture in Vienna.
Heide joins presenter Philip Dodd, American author Jonathan Franzen (The Kraus Project, Picador, 2014) and novelist Lawrence Norfolk to discuss Karl Kraus, whose artistic achievements include 700 one man performances of works by Brecht, Goethe, Shakespeare and others, plus performances of Offenbach’s operettas, accompanied by piano and singing all the roles himself; whose magazine Die Fackel published Oskar Kokoschka, Adolf Loos, Heinrich Mann, Arnold Schanberg, August Strindberg and Oscar Wilde and whose support for other artists included assisting Frank Wedekind in staging his controversial play Pandora’s Box.
In 1915 Kraus began writing a satirical play about World War One called The Last Days of Mankind which mixes dialogue drawn from contemporary documents with fantastical expressionist scenes of apocalypse.
The programme will be available after it has been broadcast on the BBC’s iPlayer.
This entry was posted in Campus online on 19 December 2016 by Wendy Raeside.
Staff discounts now available at Get Your Tech
Did you know that you can now buy Apple Products with educational discounts for personal use?
The University’s Purchasing team have forwarded a special discount offer for Kent staff, from Stone Computers, suppliers of Apple products to Kent.
Stone Computers’ dedicated Staff Portal allows you to buy MacBooks, iPads, iPhones and accessories at exclusive educational rates and are up to 10% cheaper than you’ll find on the High Street.
To take advantage of the Apple Educational discounts, you’ll need to register at www.getyourtech.co.uk. Once registered, you’ll have access to the full range of Apple devices, as well as laptops and tablets from Acer, Toshiba, Lenovo and Samsung.
Kent researchers’ study makes journal cover story
Researchers at the University have had their study featured on the front cover of the journal Organic and Biomolecular Chemistry.
The current issue of the journal, published by the Royal Society of Chemistry, features research by a University team led by Dr Alison Edwards of the Medway School of Pharmacy (MSP) and Dr Simon Holder of the School of Physical Sciences.
The researchers looked at peptide mimic systems and their ability to selectively bind metal ions. They carried out extensive work to characterize this phenomenon, and the resulting paper was entitled Selective complexation of divalent cations by a cyclic α,β-peptoid hexamer: a spectroscopic and computational study.
MSP is run jointly by Kent and the University of Greenwich. The full list of study authors were: E De Santis and A A Edwards (Medway School of Pharmacy, universities of Kent and Greenwich); B D Alexander (University of Greenwich); S J Holder (School of Physical Sciences); A -S Biesse-Martin (Université Clermont Auvergne, Université Blaise Pascal); B V Nielsen (University of Greenwich); D Mistry and L Waters (University of Huddersfield); G Siligardi and R Hussain (Diamond Light Source Ltd); S Faure (CNRS, France) and C Taillefumier (CNRS, Université Clermont Auvergne, Université Blaise Pascal).
University supports the Homeless at Carol Service
The total amount raised (including the tax refund element) for the homelessness charity Porchlight at the University Carol Service, held on 13 December in Canterbury Cathedral, was £2,425.90.
Thanks to all who contributed, and to the 192 students whose active participation as singers, readers and stewards helped to make the occasion such a success.
Dr Stephen Laird
Donations for Christmas Day event for students on campus
Each year hundreds of students stay on campus over the festive break, away from their families and friends.
To help them feel festive this Christmas, a group of postgraduate students from the Kent Graduate Student Association are organising a day of Christmas fun and food on the Canterbury campus on 25 December, as well as a New Year’s Eve event on 31 December.
These two events are being wholly organised, hosted and led by students in Woolf College and are open to all students on campus to attend. Whilst the students have the food planned, any decorations, Christmas crackers or anything else you or your departments would be happy to lend/donate to make the students Christmas a bit more festive and fun, please email Tom Ritchie.
Internationalisation Forum 2017
We are delighted to announce that the annual Internationalisation Forum will be taking place on Wednesday 18 January 2017 in the Darwin Conference Suite from 09.30-12.30. The event will start with refreshments at 09.15.
The purpose of the event is to share details about Internationalisation activity at Kent, and to allow colleagues from across the University to meet and exchange ideas.
All staff are invited to attend. The Programme will be published shortly and you can register your attendance on the Events webpages.
We very much look forward to seeing you at the Forum.
New chapters on the history of the short story
Two members of the Department of Comparative Literature have just been published in the new collection The Cambridge History of the English Short Story (Cambridge University Press, 2016), edited by Dominic Head from the University of Nottingham.
Both Dr Axel Stahler, Reader in Comparative Literature, and Dr Paul March-Russell, Specialist Associate Lecturer in Comparative Literature, have contributed chapters. The collection is the first comprehensive volume to chart the origins and evolution of the English short story to the present day. Written by international experts in the field, it covers numerous transnational and historical connections between writers, modes and forms of transmission.
Axel’s chapter, entitled ‘Stories of Jewish Identity: Survivors, Exiles and Cosmopolitans’ focuses on the British Jewish short story in English, which in the past has suffered a surprising lack of recognition.
The chapter by Paul March-Russell is entitled ‘Frontiers: Science Fiction and the British Marketplace’. Not only does the short story lie at the intersection between high and low culture, between the little magazine and the mass-market periodical, as Tim Armstrong has observed, but so too does science fiction.
For more details, please see the publisher’s website.
This entry was posted in Campus online, Student Guide on 16 December 2016 by Wendy Raeside.
Graduation Launch 2017
Final year students at the University of Kent are formally invited to attend the 2017 Graduation Launch event which will be held at both the Canterbury and Medway campus.
These Graduation Launch events will take place on the 18 January in Medway and 20 January in Canterbury and will cover topics such as:
– What to expect from your graduation
– What you need to do before your graduation
– Recent Kent alumni and where they are now
– Which date and time you will be graduating!
This will be the official release of your graduation date which will not be available until this time, so we highly recommend that you attend!
We look forward to seeing you at the Launch!
Event links:
Medway Graduation Launch 2017
Canterbury Graduation Launch 2017
This entry was posted in Medway Student, Student Guide on 16 December 2016 by Annabel Chislett.
Statement on email sent 12.15pm – 14 January 2021
Kent Sport – Tips on how to stay active during lockdown
Financial support during Covid
Professor appointed editor in chief of a new journal
Draft Climate Change Action Plan consultation
Hello Kent
Medway Student
Student covid
|
cc/2021-04/en_middle_0071.json.gz/line3021
|
__label__cc
| 0.729487
| 0.270513
|
Ministry of Skill Development & Entrepreneurship Launches SkillsBuild Platform in Collaboration with IBM
Directorate General of Training (DGT), under the aegis of Ministry of Skill Development & Entrepreneurship (MSDE), today announced the launch of SkillsBuild platform in collaboration with IBM. As part of the programme, a two-year advanced diploma in IT, networking and cloud computing, co-created and designed by IBM, will be offered at the Industrial Training Institutes (ITIs) & National Skill Training Institutes (NSTIs). The platform will be extended to train ITI & NSTI faculty on building skills in Artificial Intelligence (AI). SkillsBuild offers digital learning content from IBM and partners such as CodeDoor, Coorpacademy and Skillsoft.
The digital platform will provide a personal assessment of the cognitive capabilities and personality via MyInnerGenius to the students. They will then learn foundational knowledge about digital technologies, as well as professional skills such as resume-writing, problem solving and communication. Students will also receive recommendations on role-based education for specific jobs that include technical and professional learning.
Speaking about the collaboration, Dr. Mahendra Nath Pandey, Minister of State for Skill Development & Entrepreneurship said, “Our Government is using technology effectively for benefiting the public and for bringing innovations in welfare schemes. We understand the importance of AI and the role it can play in improving many lives. I extend my gratitude to IBM for this collaboration in empowering students with new-age capabilities and professional skills. This initiative will help the youth to scale themselves as per the changing market trends.”
“Technology is constantly evolving and making our lives easier and better. It is imperative that we make the most of it and especially when it comes to skilling our youth. Technology helps in better, more efficient training as it brings with better assessment and outcomes. I look forward to see the outcome of this program and its further expansion towards positively changing the lives of our youth,” Dr. K.P. Krishnan, secretary, MSDE said at the time of formally launching the program.
“Our collaboration with MSDE will help the next-gen to compete in the global economy. Skills are the new currency and this program will address industries’ constant struggle for job-ready individuals. The platform will help students develop the technical and professional skills needed for competitive “new collar” jobs. SkillsBuild platform will reinforce IBM’s commitment in enabling life-long learning in India and aligning with Skills India initiative by Government of India,” says Chaitanya Sreenivas, Vice President and HR Head, IBM India Pvt. Ltd.
We are constantly introducing programs aimed at skilling the youth in this technological age and hand holding them to match their capabilities with the needs of the industry. This collaboration is a step in the same direction and will surely suit the industry requirements. DGT is committed to digitally revolutionize the vocational training system in India and partner with industry leaders to provide the apt industrial exposure to the youth.” said Mr.Rajesh Aggarwal, Director General, DGT about the partnership.
This initiative is part of IBM’s global commitment to create a job-ready workforce and to build the next generation of skills needed for new collar careers. The platform is deployed with the support of leading NGOs like Unnati and Edunet Foundation. IBM Volunteers along with the NGOS will offer students personalised coaching and experiential learning opportunities. IBM joined hands with Ministry of Skill Development & Entrepreneurship (MSDE) in early 2018 to launch a first-of-its kind ‘New Collar Curriculum. Post the successful completion of the course, in September 2019, 19 students were offered a five month paid internship at IBM.
Boeing Marks a Decade of Research and Technology P...
Yes Bank Launches YES Fintech Developer, India’s L...
Accenture Expands Cybersecurity Capabilities with ...
ICAT is Organizing NuGen Mobility Summit – Disrupt...
The Wildlife Conservation Society (WCS, New York) ...
Hero Motocorp Launches India's First BS-VI Motocyc...
Domino’s Launches a New Brand Campaign - ‘Dil, Dos...
ABB Uses Artificial Intelligence to Revolutionize ...
23 Year Old With Congenital Heart Defect Undergoes...
upGrad Receives Accreditation by National Skill De...
Cloudera Enterprise Data Platform Available on Mic...
Showing Robots “Tough Love” Helps them Succeed, Fi...
Unity Technologies Unveils the 3rd Edition of Unit...
Abbott Announces Discovery of New Strain of HIV, K...
United Technologies Partners with Girls Who Code t...
Mumbai Fintech Hub (MFH) and Fintech Convergence C...
Layoff: How tech-driven processes are improving jo...
Covestro Launches its 4th Edition of #STEM4Girls i...
Hero Motocorp Unveils The Xtreme 1.R Concept at EI...
ITC Earns the Highest Global Recognition for Water...
Vertiv Introduces Universal Rack Power Distributio...
Startups to Create 50 Lakh Jobs by 2025: Nasscom P...
TechGig is Organising a Career Fair for Women Tech...
Eaton India Inaugurates Own Manufacturing Facility...
Analytics Vidhya to Organize Third Edition of Data...
Asus ROG Emerges as No. 1 in the Gaming Category, ...
Bentley Systems Announces New iTwin Cloud Services...
Gartner Unveils Top Predictions for IT Organizatio...
Ministry of Skill Development & Entrepreneurship L...
Dr Agarwal’s Eye Hospital Expands its New Facility...
Trade & Investment Between Turkey & India Set to ...
Airtel Home Broadband Gets a New Brand Identity wi...
ACT Fibernet Extends Partnership with Chennaiyin F...
TLC to Premiere Emmy Award-Winning ‘Project Runway...
What You Need to Know About the Google Chrome Vuln...
Columbia Pacific Communities Unveils its TV Ad cam...
|
cc/2021-04/en_middle_0071.json.gz/line3023
|
__label__wiki
| 0.822567
| 0.822567
|
11 May 2017 15:54 IST
Being a banker doesn’t suit the RBI
Resolving bad loans is a messy affair, it’s a job best left to empowered bank boards
Such has been the concern over banks’ rising pile of bad loans and historically low credit growth, that the Centre’s new ordinance has mostly found optimists lauding it as a path-breaking move.
Under normal circumstances, the ordinance that essentially empowers the Reserve Bank of India to micromanage bank decisions on resolution, would have bankers and critics of the old school crying foul.
But these are extraordinary times that call for extraordinary measures. True, despite the relentless effort of the central bank to put banks’ affairs into order through various tools to resolve stressed assets, there has been little progress on the ground.
Toss in restructured loans, and the tally of stressed assets could well be upwards of ₹10 lakh crore.
Last ditch effort
The ordinance which empowers the RBI to set up oversight panels to look into loan recasts, is being viewed as a desperate, last throw of the dice. With the RBI forcing all lenders to come on board with debt restructuring, the resolution could after all pick up pace. But will banks that have now been stripped of their decision-making authority be able to take key decisions on lending henceforth? Most importantly, will the RBI be able to act as a prudent and independent regulator after it muddies its hands in the mundane affairs of banks?
Why did things have to come to such a pass that the regulator has been forced to don overalls and dirty its hands on the shop floor? The RBI has been active in prodding banks to clean the NPA mess starting with the Joint Lenders’ Forum, and the SDR and S4A schemes. Realising that banks were chary of even recognising non-performing loans, the regulator brought in the asset quality review (AQR) in FY16.
The AQR was touted as a major clean-up activity, one that would allow banks to start off on a clean slate. Forgotten were the important issues of inadequate credit appraisal systems and shoddy lending practices that caused the problem in the first place.
Where the buck goes
But the mess, as it appears, did not end with AQR. Private banks which got off with a shorter AQR list, had some catching up to do.
Realising that there were still divergences in asset classification and provisioning compared to its norms, the central bank last month issued a circular requiring banks to make suitable disclosures pertaining to FY16.
Axis Bank now says that loans to the tune of an additional ₹9,478 crore should have been declared as NPAs in the FY16 fiscal itself; the bank had reported gross NPAs of ₹6,087 crore only as of FY16. According to the ICICI Bank management, the RBI assessed incremental bad loans to the tune of ₹5,100 crore as part of this exercise. The two banks explain the under-disclosure in FY16 saying that they accounted for the same during FY17, before the RBI issued its directive last month.
The fact that the RBI had to issue so many directives and circulars on the operational front alone highlights the critical governance issues at banks.
The RBI will now step into banks’ shoes to clean up the bad loan mess. The fact that it will — under the authorisation of the Centre — instruct banks on how to tackle specific accounts raises questions on the central bank’s autonomy. The preamble to the RBI Act 1934 indicates two core functions of the RBI — issue of currency and monetary authority. The legal mandate for other key functions and responsibilities comes from specific statutes — The Banking Regulation Act 1949, The Foreign Exchange Management Act 1999, The Payment & Settlement Systems Act 2007.
In 2011, the then governor of RBI, Duvvuri Subbarao, in one of his speeches had clarified that the RBI has not been accorded autonomy under the statute.
The RBI Act lays down that the Centre may give directions to the RBI, after consultation with the governor, in the public interest. In reality however he re-iterated that the RBI operates with a functionally autonomous mandate and there has been no instance so far of the Government exercising its reserve powers to issue a directive.
That was then. The Centre’s demonetisation move changed that. Questions about the RBI’s independence and credibility have been raised since then. According to the two new insertions in the Banking Regulation Act — 35 AA and 35 — the Centre can authorise the RBI to issue directions to banks on resolution of stressed assets. Remember, these sections will stay in the Act much after the NPA problem is resolved.
Can the RBI still carry on with its implicit ‘autonomous’ image after it involves itself with bank decisions? Unlikely, as these provisions can be called upon by the Centre or the RBI any time, not necessarily in dire times.
Most of the past lending decisions leading to the NPA mess reek of political compulsions. It needs to be seen if the RBI can ring-fence its directives on resolution from political interference.
Time to dissolve BBB
Rather than mollycoddling banks and finding quickfix solutions to tackle bad loans, kick-starting reforms to improve bank governance would have been the right way to deal with the issue at hand. Sometime back, with the constitution of the Banks Board Bureau chaired by CAG Vinod Rai, expectations ran high of a drastic overhaul in governance of PSBs.
But after a year of coming into being, BBB has proved to be damp squib, thanks to the Centre’s unwillingness to let go. The BBB’s latest recommendations mooting a new Governance, Reward and Accountability Framework for PSBs could well be a non-starter.
The PJ Nayak committee had envisaged granting more autonomy to bank boards. As a first step, the Centre would do well to reduce its stake.
There is an urgent need to professionalise and depoliticise the governance structure. After all, when the economy picks up, banks will have to get on the lending bandwagon.
And to avoid repeating past mistakes, empowering bank boards will be critical.
That is the way to go rather than for the regulator to get into an operational role in banks.
|
cc/2021-04/en_middle_0071.json.gz/line3024
|
__label__cc
| 0.549995
| 0.450005
|
Cameron Fields
Sixers Wire
Warriors Wire
Toledo Blade
July 23, 2017 Cameron Fields
Track and Field: Ohio earns heap of personal records at Bob Davidson Spring Kickoff
Photo taken by EMMA HOWELLS
Chanda Cuckler jumps a hurdle during the second heat of the women’s 100 meter hurdles during the 2016 All-Ohio Track & Field Championship. Cuckler placed third with a time of 14.29. (FILE)
Ohio’s athletes earned a heap of lifetime personal records and seasonal personal records this weekend.
The Bobcats traveled to High Point for the Bob Davidson Spring Kickoff, and they achieved 12 lifetime personal records and 21 season personal records. The Bobcats placed eighth overall among a field of 16 schools, achieving a score of 55.5.
The Bobcats’ solid outing began Friday when senior sprinter Olivia Mayfield achieved a lifetime personal record in the 100 meter. Mayfield placed fifth in her heat with a time of 12.34 seconds.
Mayfield also achieved a lifetime personal record in the finals of the 200-meter dash. She placed fourth in her section with a time of 25.60. For her success, she was named a coaches’ pick for the meet.
Though Mayfield had success on the track side of the team, sophomore thrower Gaza Odunaiya had success in the field. Odunaiya achieved a lifetime personal record in the hammer throw, placing fifth with a throw of 52.14 meters. Odunaiya was named the field team’s coaches’ pick.
In addition, the 4×400 meter relay squad — Marissa Handel, Rebekah Markovitz, Kaitlyn Logan and Emily Deering — placed second in their race, finishing in 3:57.61, a season personal record.
Before this weekend’s meet, coach Clay Calkins said the team needed to improve upon its indoor season. Track isn’t a sport in which a specific play can affect the meet.
Either an athlete does or doesn’t do well, and that success is based on that athlete’s training. Many athletes achieved personal records, which is something the Bobcats can use for confidence as the season continues.
With a solid showing at High Point, perhaps the Bobcats’ training is translating to competition, even with a short transition to the outdoor season.
The Bobcats will look to continue to improve next weekend as they travel to Raleigh, North Carolina, to compete in the Raleigh Relays.
@CameronFields_
cf710614@ohio.edu
Clay Calkins
Emily Deering
Marissa Handel
Rebekah Markovitz
Published by Cameron Fields
View all posts by Cameron Fields
Previous Women’s Basketball: Ohio loses 74-65 to Penn State in WNIT, but shows effort
Next Football: Keevon Harris set to return after injury-plagued first season
|
cc/2021-04/en_middle_0071.json.gz/line3028
|
__label__wiki
| 0.531787
| 0.531787
|
Advances in Brief
PSGR, a Novel Prostate-specific Gene with Homology to a G Protein-coupled Receptor, Is Overexpressed in Prostate Cancer
Linda L. Xu, Bennett G. Stackhouse, Kim Florence, Wei Zhang, Naga Shanmugam, Iasbell A. Sesterhenn, Zhiqiang Zou, Vasantha Srikantan, Meena Augustus, Viktor Roschke, Kenneth Carter, David G. McLeod, Judd W. Moul, Dan Soppett and Shiv Srivastava
Linda L. Xu
Bennett G. Stackhouse
Kim Florence
Naga Shanmugam
Iasbell A. Sesterhenn
Zhiqiang Zou
Vasantha Srikantan
Meena Augustus
Viktor Roschke
Kenneth Carter
David G. McLeod
Judd W. Moul
Dan Soppett
Shiv Srivastava
DOI: Published December 2000
PSGR, a new prostate tissue-specific gene with homology to the G protein-coupled odorant receptor gene family, has been identified. Here we report the characteristics of the predicted protein sequence of PSGR and its prostate tissue specificity and expression profile in human prostate cancer and matched normal tissues. Using multiple tissue Northern blots from over 50 different tissues, PSGR expression was restricted to human prostate tissues. Paired normal and tumor specimens from 52 primary prostate cancers, obtained by laser capture microdissection or manual microdissection, were analyzed for PSGR expression by semiquantitative and real-time PCR assays. The differential expression of PSGR between normal and tumor tissues was highly significant (P < 0.001), and 32 of 52 (62%) matched prostate specimens exhibited tumor-associated overexpression of PSGR. Of note, there was very little or no expression of PSGR in many normal specimens in comparison with the generally high expression of PSGR seen in matched tumor specimens. In situ hybridization assays showed restricted PSGR expression in the epithelial cells of the normal and tumor tissue sections. Restricted expression of PSGR in prostatic epithelial cells, overexpression of the PSGR in a significant percentage of prostate cancers, and the predicted protein sequence of PSGR with seven transmembrane domains provide a foundation for future studies evaluating the potential of PSGR as a prostate cancer gene expression marker and the utility of PSGR protein as a novel target for developing immunotherapeutic strategies for prostate cancer.
CaP 4 is the most common malignancy in men in the United States and the second leading cause of cancer mortality (1) . The serum PSA or HK3 test has revolutionized the early detection of CaP (2) . Due to the prostatic epithelial cell-specific expression of PSA, it is also of value as a biomarker for disease remission/progression after treatment (2) . Although PSA is effective at identifying men who may have prostate cancer, it is often elevated in men with benign prostatic hyperplasia, prostatitis, and other nonmalignant disorders (2) . Therefore, identification of additional prostate cancer-specific molecular markers, especially those exhibiting tumor-associated overexpression, is needed to refine the diagnosis as well as prognosis for CaP. It is also recognized that early detection of CaP presents new challenges with respect to predicting the clinical course of the disease for the individual patient (2) . The wide spectrum of biological behavior exhibited by prostatic neoplasms calls for the identification of novel biomarkers that may be able to distinguish a slow-growing cancer from a more aggressive cancer with a potential to metastasize (2) . Prostate cancer-associated molecular genetic alterations are being unraveled by using various strategies including: (a) analyses of genes commonly involved in human cancer; (b) positional cloning of putative genes on frequently affected chromosome loci in CaP; and (c) gene expression profiling of normal and tumor tissues from individuals with prostate cancer (3, 4, 5) .
The discovery of additional prostate-specific genes has also resulted in enthusiasm for evaluating their potential utility in the diagnosis and prediction of disease progression of CaP. HK2, another member of the kallikrein gene family, is currently being evaluated for this role in CaP (6) . Increased expression of PSMA has been correlated with more aggressive disease (7) . CaP-associated expression of PSMA is also being evaluated for imaging of prostate cancer by radiolabeled anti-PSMA monoclonal antibodies (7) . Furthermore, promising immunotherapy approaches are being pursued using PSMA peptide (8) . Recent gene discovery approaches have led to the identification of several new prostate-specific/abundant genes, such as NKX3.1 (9) , prostase (10) , prostate stem cell antigen (11) , TMPRSS2 (12) , STEAP (13) , PDEF (14) , PART-1 (15) , HOXB13 (16) , DD3 (17) , PCGEM1 (18) , and PMEPA1 (19) , that exhibit diverse characteristics.
In this report, we describe the discovery of a new prostate-specific gene, PSGR, a member of the G-protein coupled OR family that maps to chromosome 11p15. The most striking aspects of PSGR characterization are its highly prostate tissue-specific expression and its tumor-associated overexpression. The predicted protein sequence of the PSGR revealed seven transmembrane-spanning domains with homology to G protein-coupled receptor odorant receptors. Tumor-associated overexpression and the prostate tissue-specific nature of PSGR, a G protein-coupled trans-membrane receptor, suggest its potential as a novel target for immunotherapeutic strategies of prostate cancer.
Identification of PSGR.
PSGR was identified as a prostate tissue-specific cDNA, HPRAJ during a search of the expressed sequence tag database at Human Genome Sciences using approaches that previously led to the identification of NKX3.1 (9) .
Analysis of Tissue-specific Expression of PSGR Using MTN Blots.
Multiple tissue Northern blots containing mRNA samples from 23 human tissues and Master dot blots containing mRNA samples from 50 different human tissues (Clontech) were hybridized with the[α -32P]dCTP-labeled 513-bp PSGR cDNA fragment, which was amplified from a PSGR cDNA clone using primers 5′-GCCACCTGTGTGCTTATTGGTATCC-3′ (sense) and 5′-GACACAATAGGAGTGCGAGAGGACATTG-3′ (antisense). As an internal control, GAPDH probe was used to hybridize all of the blots.
Prostate Tissue Specimens, Pathological Evaluation, and Microdissection.
Matched prostate cancer and normal tissues were derived from radical prostatectomy specimens from 52 prostate cancer patients treated at Walter Reed Army Medical Center (under an institutional review board-approved protocol). All radical prostatectomy patients in this study are enrolled in the Department of Defense Center for Prostate Disease Research Triservice Multicenter Longitudinal Prostate Cancer Database. The genitourinary pathologist (I. A. S.) was present in the operating room to immediately accept the prostate gland from the urologists. If a palpable tumor was present, the surface overlying it was painted with black ink, and a wedge from the center was immediately embedded in Tissue-tek OCT (Miles Inc. Diagnostics Division, Elkhart, IN) and frozen at −70°C. Sextant 14-gauge true cut biopsies were also obtained on each case and processed similarly. Sextant biopsies include apex, mid, and base of the right and left lobes of the prostate performed ex vivo. The volume of biopsy specimens was about 1 × 0.5 × 0.5 cm3. Ten-μm frozen sections were prepared and archived at −70°C. One set of slides was stained with H&E and read by the pathologist (I. A. S.) to define tumor cells. The frozen sections on slides were dissected using laser captured microdissection (35 pairs) according to the protocol provided by the manufacturer (Arcturus Engineering, Mountain View, CA) or manual microdissection (17 pairs). Total RNA was prepared from harvested normal and tumor prostate epithelial cells as described previously (20) . The expression of PSGR was correlated with clinicopathological features of the patients.
RT-PCR Assay.
Total RNA (100 ng) was reverse transcribed into cDNA with a RNA PCR kit (Perkin-Elmer, Foster, CA), and one-tenth of the reverse-transcribed product from each sample was used for PCR to amplify PSGR and a housekeeping gene, GAPDH. The primer sequences for amplification of PSGR were the same as those described above. The conditions of PCR for each gene were optimized to analyze the amplified product in the linear range of amplification by adjusting amplification cycles for each set of primers. The optimized PCR condition for amplifying PSGR was 36–42 cycles of 94°C for 30 s, 68°C for 30 s, 72°C for 30 s. The expression of GAPDH was used as an internal control for RNA input (20) . Expression of GAPDH and PSGR was analyzed simultaneously with the same batch of cDNA. Other controls for the RT-PCR assays included PCR amplification of the RNA samples without reverse transcription. Four randomly selected RT-PCR products of the PSGR were sequenced to confirm their identity as PSGR. The computer-stored images of ethidium bromide-stained agarose gels were analyzed by densitometry of the bands with NIH image processing software. The results of PSGR gene expression were presented as relative expression by using the ratio of the intensities of PCR product of PSGR to that of GAPDH. PSGR expression was further quantified as differential expression between tumor (T) and normal (N) tissues as follows: (a) overexpression in tumor tissue (T > N), 1+ (1.5–5-fold), 2+ (6–10-fold), 3+ (11–20-fold), and 4+ (>20-fold) increased expression as compared with matched normal tissue; (b) reduced expression in tumor tissue (T < N), 1− (1.5–5-fold), 2− (6–10-fold), 3− (11–20-fold), and 4− (>20-fold) decreased expression as compared with matched normal tissue; and (c) no change (T = N), the difference in PSGR expression between tumor and normal tissue was <1.5-fold. No detectable PSGR expression in one of the specimens of tumor/normal pairs was scored as 4+ for increased expression or 4− for decreased expression.
RNA from paired normal and tumor specimens from 8 of the 52 patients was also analyzed by real-time RT-PCR using the 7700 sequence detection system (PE Applied Biosystems, Foster, CA). Real-time RT-PCR was conducted using 10 ng of total RNA from paired normal and tumor samples. PCR primers for PSGR were CATGGCCTTTGACCGTTATGT: GCCAATCTGGGCTGTTACTGTAT using a FAM-labeled probe (ACCCACTGCGCCATGCTGCA). 18S rRNA was detected as internal control. Reverse transcription reactions were carried out at 48°C with or without Moloney murine leukemia virus reverse transcriptase for 30 min. PCR reactions were performed in 25 μl volumes containing the manufacturer’s recommended buffer supplemented with 8% glycerol, 0.4% Tween 20, and 0.05% gelatin. Paired quadruplicate samples (one lacking reverse transcription and triplicates with reverse transcription) were heat-denatured for 10 min at 95°C and then amplified using either the 18S or PSGR probe primer combinations. Amplification consisted of 40 cycles using a melting (15 s, 95°C) and annealing/extension (60 s, 60°C) step. Results were plotted as average cycle threshold (cT) values for each triplicate sample minus the average triplicate values for 18S rRNA. Differences between tumor and normal samples were calculated using the formula 2exp(cTtumor − cTnormal) and expressed as fold change in expression.
In Situ Hybridization of PSGR in Prostate Tissues.
A 513-bp PCR fragment (nucleotides 298–810; Fig. 1 ⇓ ) was amplified from the cDNA clone of PSGR and cloned into a PCR blunt II-TOPO vector (Invitrogen, Carlsbad, CA). Digoxigenin-labeled antisense and sense riboprobes were synthesized using an in vitro RNA transcription kit (Boehringer Mannheim, Indianapolis, IN), and a linearized plasmid with PSGR gene fragment as templates. The hybridization was performed as described previously (19) . The slides were evaluated under an Olympus BX-60 microscope.
Characterization of PSGR cDNA sequence. A, nucleotide and predicted amino acid sequence of PSGR. The potential initiation methionine codon and the translation stop codon are indicated in bold. The transmembrane domains are underlined. B, multiple alignments of the predicted protein sequence of PSGR and other human GPCRs shown as a phylogenetic tree. The right part shows the GenBank accession numbers and the name of those genes (the accession number of PSGR is AF311306).
PSGR Is a New Member of G Protein-coupled Olfactory Receptors.
Analysis of the 1474-bp PSGR cDNA sequence (Fig. 1A) ⇓ , previously named as HPRAJ, revealed an ORF of 963 bp nucleotides encoding a 320-amino acid protein with a predicted molecular mass of 35.4 kDa. The PSGR ORF revealed intriguing homology (∼50% identity and ∼70% similarity) to the G protein-coupled odorant receptor family. Specifically, the analysis of PSGR with Dnastar software showed the closest similarity of PSGR to a human OR gene, HPFH1OR, which was mapped to the β-globin gene cluster on chromosome 11p15.5 (Fig. 1B ⇓ ; Ref. 21 ). Furthermore, PSGR ORF exhibited almost complete identity to a rat cDNA sequence (accession number AF079864) in the NCBI GenBank. 5 A protein motif search using ProfileScan 6 indicated the existence of seven trans-membrane domains between amino acid residues 24–293 that are characteristic of GPCRs. Chromosomal mapping assigned PSGR to 11p15 (data not shown), one of the regions of GPCR clusters.
Prostate Tissue-specific and Epithelial Cell-restricted Expression of PSGR.
The distribution of PSGR mRNA in normal human tissues was examined by Northern blot analysis. Of the 23 different human tissue mRNAs analyzed, a ∼2.7-kb mRNA transcript specifically hybridizing to the PSGR cDNA was detected only in prostate tissue (Fig. 2A) ⇓ . Two independent experiments revealed identical results. Further analysis of RNA Master blot containing RNA from 50 different human tissues confirmed the prostate tissue specificity of the PSGR gene (data not shown). Among the prostate cancer cell lines analyzed, weak expression of PSGR was detected in LNCaP cells by RT-PCR and Northern hybridization (Fig. 2B) ⇓ . In situ RNA hybridization analysis of PSGR expression in prostate tissues revealed that expression of PSGR was predominantly localized to epithelial cells of the prostate gland (Fig. 2C) ⇓ . Therefore, a comprehensive expression analysis of PSGR in human prostate tissues revealed prostatic epithelial cell-specific expression of the PSGR.
PSGR expression by Northern hybridization and in situ hybridization analysis. A, multiple tissue Northern blots were hybridized with an[α -32P]dCTP-labeled PSGR cDNA fragment. A 2.7-kb mRNA transcript specifically hybridizing to PSGR cDNA was detected only in prostate tissue. B, PSGR expression in prostate cancer cell lines. Eight μg of polyadenylated RNA were used to make the Northern blot. The blot was hybridized with[α -32P]dCTP-labeled PSGR probe. The samples are RNA from PC3 cells (Lane 1), LNCaP cells cultured in androgen-free medium for 5 days and then stimulated with R1881 at 10−8 m for 24 h (Lane 2), and LNCaP cells processed as described for lane 2 but without R1881 stimulation (Lane 3). C, in situ hybridization analysis. A and B show the hybridization signal with PSGR antisense riboprobe in benign and malignant prostate tissues from the same patient. C shows a similarly processed hybridization with sense PSGR riboprobe. The arrow shows the restricted expression of PSGR in glandular epithelial cells.
PSGR Expression in Prostate Cancer.
Fig. 3 ⇓ shows a representative semiquantitative RT-PCR analysis of PSGR and GAPDH. The overall expression pattern of the PSGR gene is shown in Table 1 ⇓ . Comparison of PSGR expression between normal and tumor tissues revealed overexpression in 62% of tumor specimens (32 of 52 specimens), decreased expression in 11.5% of specimens (6 of 52 specimens), and no change in 27% of specimens (14 of 52 specimens). The cumulative PSGR expression level in tumor tissues (0.4350 ± 0.4987) are significantly higher (P = 0.001) than that in normal tissues (0.1636 ± 0.2843). Quantitative RT-PCR of eight pairs of tumor and normal tissue analyzed by Taqman procedure revealed tumor-associated overexpression in 7 tumors consistent with the semiquantitative RT-PCR (data not shown). As a complement to RT-PCR, PSGR expression was also analyzed by in situ RNA hybridization in selected specimens. Of the 10 cases analyzed, 7 showed significantly elevated expression of PSGR in malignant prostate epithelial cells as compared with adjacent benign cells (Fig. 2C) ⇓ . Thus, using three different methods, we have confirmed overexpression of PSGR in prostate cancer. Preliminary analysis of PSGR expression did not show a significant correlation with specific clinicopathological features (such as pathologic and clinical stage) (data not shown). A larger study of whole mount prostate specimens is in progress for further investigation of this issue.
PSGR expression in primary prostate cancer specimens by RT-PCR. Representative RT-PCR products of tumor and adjacent normal tissues were analyzed on agarose gel. Lanes 1–9 represent PCR results of paired normal and tumor tissues from the same patient. NC, no reverse transcription (control); N, normal prostate tissue; P, prostatic intraepithelial neoplasia; T, prostate tumor tissue.
PSGR expression status in prostate cancer
PSGR expression in 52 matched prostatic cancer (T) and normal tissues (N) was analyzed by RT-PCR. The results were represented as differential expression in T and N as described in “Materials and Methods.” T > N, overexpression in tumor tissue, graded as 1+ (1.5–5-fold), 2+ (6–10-fold), 3+ (11–20-fold), and 4+ (>20-fold) increased expression as compared with matched normal tissue; T < N, reduced expression in tumor tissue, graded as 1− (1.5–5-fold), 2− (6–10-fold), 3− (11–20-fold), and 4− (>20-fold) decreased expression as compared with matched normal tissue; and T = N, similar expression in tumor and normal tissue, refers to the difference of PSGR expression between tumor and normal tissues as <1.5-fold (graded as 0).
Recent gene discovery efforts in prostate cancer have been instrumental in the identification numerous new prostate-specific genes. The biological and biochemical characterization of these genes has a significant impact in understanding the role of these genes in prostate biology. Furthermore, potential utilities of prostate-specific molecules as biomarkers of prostate cancer onset/progression and as a cancer vaccine target are obvious in a clinical setting. PSA (or HK3) as a biomarker for prostate cancer is a success story in human cancer, despite certain limitations. The identification of additional biomarkers that are not only prostate specific but are also overexpressed in cancer will be of special interest. Genes such as TMPRSS2, STEAP, PDEF, DD3, and PCGEM1 (12, 13, 14 , 17, 18) represent efforts in this direction. Here we report novel observations on the identification of a putative GPCR with a remarkable prostate tissue specificity showing tumor-specific overexpression in a large percentage of tumors. The homology of PSGR to the G protein-coupled odorant receptor genes is particularly intriguing because odorant receptors are almost exclusively localized in nasal epithelium. It is important to note that GPCR genes belong to the largest “gene family” in the human genome, and it has been argued that odorant receptors have emerged directly for GPCRs and that any GPCR has the potential to become an OR at a given point in evolution (22) . In addition to nasal epithelium, odorant receptor genes have been detected in testis, and their functional relevance remains unclear (23) . This is the first documentation of the prostate-specific expression of a gene with OR homology. Therefore, pending experimental validation, PSGR should be considered a GPCR and not an OR. Future studies are required to determine the biological significance of the OR-like genes in prostate and testes. PSGR expression also appears to be tissue context specific because we were unable to detect PSGR expression in a number of cultured primary prostate cancers cells or immortalized cell lines and established metastatic prostate cancer cell lines. However, weak expression of PSGR was detected only in LNCaP prostate cancer cells. In this regard, it is important to mention that expression of several prostate-specific genes including PSA is often lost during cell culture condition. Another important finding relates to a highly significant overexpression of PSGR in prostate cancer cells. Of note also is the restricted expression of PSGR in epithelial cells of the prostate gland. In summary, we have demonstrated prostatic epithelial cell-restricted expression of PSGR, and tumor cells exhibit significantly increased expression of this putative seven-transmembrane GPCR. However, it is not yet clear how PSGR overexpression may play a role in the process of tumorigenesis. GPCR may play important roles in cell signaling and cell proliferation (24) . Therefore, future experiments will focus on the biological function of PSGR in tumorigenesis of CaP. Membrane localization of the PSGR makes PSGR protein an attractive target for immunotherapy approaches and antibody-based imaging of metastatic prostate cancer. It also will be very important to determine the signals transduced by PSGR in the prostate gland, and future studies will address these issues.
We thank Roger Connelly for performing the statistical analysis.
The opinions and assertions contained herein are the private views of the authors and are not to be considered as reflecting the views of the US Army or the Department of Defense.
↵1 Supported in part by a grant from the Center for Prostate Disease Research, a program of the Henry M. Jackson Foundation for the Advancement of Military Medicine (Rockville, MD), funded by the United States Army Medical Research and Materiel Command.
↵2 Present address: Avalon Pharmaceuticals, Gaithersburg, MD 20878.
↵3 To whom requests for reprints should be addressed, at the Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, 1530 East Jefferson Street, Rockville, MD 20852. Phone: (240) 453-8952; Fax: (240) 453-8912; E-mail: ssrivastava{at}cpdr.org
↵4 The abbreviations used are: CaP, carcinoma of prostate; PSA, prostate-specific antigen; GPCR, G protein-coupled receptor; OR, odorant receptor; HK, human kallikrein; PSMA, prostate-specific membrane antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-PCR; ORF, open reading frame.
↵5 Internet address: www.ncbi.nlm.nih.gov.
↵6 Internet address: http://www.ch.embnet.org/cgi-bin/TMPRED.
Landis S. H., Murray T., Bolden S., Wingo P. A. Cancer statistics. CA Cancer J. Clin., 49: 8-31, 1999.
Pannek J., Partin A. W. Prostate-specific antigen: what is new in 1997. Oncology (Basel), 11: 1273-1278, 1997.
Augustus M., Moul J. W., Srivastava S. The molecular phenotype of the malignant prostate Srivastava S. Henson D. E. Gazden A. eds. . Molecular Pathology of Early Cancer, : 321-340, IOS Press Amsterdam 1999.
Issacs W. B., Bova G. S. Prostate cancer Vogelstein B. Kinzler K. W. eds. . The Genetic Basis of Human Cancer, : 653-660, McGraw-Hill Companies, Inc. New York 1998.
Bussemakers M. J. Changes in gene expression and targets for therapy. Eur. Urol., 35: 408-412, 1999.
Young C. Y., Seay T., Hogen K., Charlesworth M. C., Roche P. C., Klee G. G., Tindall D. J. Prostate-specific human kallikrein (hK2) as a novel marker for prostate cancer. Prostate, 7: 17-24, 1996.
Fair W. R., Israeli R. S., Heston W. D. Prostate-specific membrane antigen. Prostate, 32: 140-148, 1997.
Murphy G. P., Tjoa B. A., Simmons S. J., Jarisch J., Bowes V. A., Ragde H., Rogers M., Elgamal A., Kenny G. M., Cobb O. E., Ireton R. C., Troychak M. J., Salgaller M. L., Boynton A. L. Infusion of dendritic cells pulsed with HLA-A2-specific prostate-specific membrane antigen peptides: a Phase II prostate cancer vaccine trial involving patients with hormone-refractory metastatic disease. Prostate, 38: 73-88, 1999.
He W. W., Sciavolino P. J., Wing J., Augustus M., Hudson P., Meissner S. P., Curtis R. T., Shell B. K., Bostwick D. G., Tindall D. J., Gelmann E. P., Abate-Shen C., Carter K. C. A novel human prostate-specific androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer. Genomics, 43: 69-77, 1997.
Nelson P. S., Gan L., Ferguson C., Moss P., Gelinas R., Hood L., Wang K. Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostate-restricted expression. Proc. Natl. Acad. Sci. USA, 96: 3114-3119, 1999.
Reiter R. E., Gu Z., Watabe T., Thomas G., Szigeti K., Davis E., Wahl M., Nisitani S., Yamashiro J., Le Beau M. M., Loda M., Witte O. N. Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proc. Natl. Acad. Sci. USA, 95: 1735-1740, 1998.
Lin B., Ferguson C., White J. T., Wang S., Vessella R., True L. D., Hood L., Nelson P. Prostate-localized and androgen-regulated expression of the membrane-bound serine protease TMPRSS2. Cancer Res., 59: 4180-4184, 1999.
Hubert R. S., Vivanco I., Chen E., Rastegar S., Leong K., Mitchell S. C., Madraswala R., Zhou Y., Kuo J., Raitano A. B., Jakobovits A., Saffran D. C., Afar D. E. STEAP: a prostate-specific cell-surface antigen highly expressed in human prostate tumors. Proc. Natl. Acad. Sci. USA, 96: 14523-14528, 1999.
Oettgen P., Finger E., Sun Z., Akbarali Y., Thamrongsak U., Boltax J., Grall F., Dube A., Weiss A., Brown L., Quinn G., Kas K., Endress G., Kunsch C., Libermann T. A. PDEF, a novel prostate epithelium-specific Ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J. Biol. Chem., 275: 1216-1225, 2000.
Lin B., White J. T., Ferguson C., Bumgarner R., Friedman C., Trask B., Ellis W., Lange P., Hood L., Nelson P. S. PART-1: a novel human prostate-specific, androgen-regulated gene that maps to chromosome 5q12. Cancer Res., 60: 858-863, 2000.
Sreenath T., Orosz A., Fujita K., Bieberich C. J. Androgen-independent expression of hoxb-13 in the mouse prostate. Prostate, 41: 203-207, 1999.
Bussemakers M. J. H., Van Bokhoven A., Verhaegh G. W., Smit F. P., Karthaus H. F., Schalken J. A., Debruyne F. M., Ru N., Isaacs W. B. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res., 59: 5975-5979, 1999.
Srikantan, V., Zou, Z., Petrovics, G., Xu, L., Augustus, M., Davis, L., Livezey, J. R., Connell, T., Sesterhenn, I. A., Yoshino, K., Buzard, G. S., Mostofi, F. K., McLeod, D. G., Moul, J. W., and Srivastava, S. PCGEM1: a novel prostate specific gene is overexpressed in prostate cancer. Proc. Natl. Acad. Sci. USA 97: 12216–12221, 2000.
Xu L. L., Shanmugam N., Segawa T., Sesterhenn I. A., McLeod D. G., Moul J. W., Srivastava S. A novel androgen-regulated gene, PMEPA1, located on chromosome 20q13 exhibits high level expression in prostate. Genomics, 66: 257-263, 2000.
Xu L. L., Srikantan V., Sesterhenn I. A., Augustus M., Dean R., Moul J. W., Carter K. C., Srivastava S. Expression profile of an androgen regulated prostate specific homeobox gene NKX3.1 in primary prostate cancer. J. Urol., 163: 972-979, 2000.
Feingold E. A., Penny L. A., Nienhuis A. W., Forget B. G. An olfactory receptor gene is located in the extended human β-globin gene cluster and is expressed in erythroid cells. Genomics, 61: 15-23, 1999.
Dryer L., Berghard A. Odorant receptors: a plethora of G-protein-coupled receptors. TiPS, 20: 413-417, 1999.
Vanderhaeghen P., Schurmans S., Vassart G. Specific repertoire of olfactory receptor genes in the male germ cells of several mammalian species. Genomics, 39: 239-246, 1997.
Daub H., Weiss U. F., Wallasch C., Ullrich A. Role of transactivation of the EGF receptor in signaling by G-protein-coupled receptors. Nature (Lond.), 379: 557-560, 1996.
Thank you for sharing this Cancer Research article.
You are going to email the following PSGR, a Novel Prostate-specific Gene with Homology to a G Protein-coupled Receptor, Is Overexpressed in Prostate Cancer
Message Subject (Your Name) has forwarded a page to you from Cancer Research
Message Body (Your Name) thought you would be interested in this article in Cancer Research.
Cancer Res December 1 2000 (60) (23) 6568-6572;
NIMA-Related Protein Kinase 1 Is Involved Early in the Ionizing Radiation-Induced DNA Damage Response
Conditional Expression of K-ras in an Epithelial Compartment that Includes the Stem Cells Is Sufficient to Promote Squamous Cell Carcinogenesis
Crucial Role of Phospholipase Cε in Chemical Carcinogen-Induced Skin Tumor Development
Show more Advances in Brief
|
cc/2021-04/en_middle_0071.json.gz/line3031
|
__label__cc
| 0.651541
| 0.348459
|
Associate Patient Service Specialist- Heart & Vascular Institute (Franklin, TN)- PRN Days- VUMC
Associate Patient Service Specialist- Heart & Vascular Institute (Franklin, TN)- PRN Days
Provides service to patient either pre-appointment, during or post appointment with regular guidance. Responsibilities may include inbound/outbound telephone calls, cash management, appointment scheduling, process of insurance updates and patient check in/out.
View how Vanderbilt Health employees celebrate the difference they make every day:
*US News & World Report: #1 Adult Hospital in Tennessee and metropolitan Nashville, named to the Best Hospitals Honor Roll of the top 20 adult hospitals, 10 nationally ranked adult specialty programs, with 3 specialties rated in the top 10 nationally, Monroe Carell Jr. Children's Hospital at Vanderbilt named as one of the Best Children's Hospital in the nation, with 10 out of 10 pediatric specialties nationally ranked.
*Healthcare's Most Wired: Among the nation's 100 "most-wired" hospitals and health systems for its efforts in innovative medical technology.
*Becker's Hospital Review: named as one of the "100 Great Hospitals in America", in the roster of 100 Hospitals and Health Systems with Great Oncology Programs and to its list of the 100 Hospitals with Great Heart Programs.
*The Leapfrog Group: One of only 10 children's hospitals in the to be named at Leapfrog Top Hospital.
*American Association for the Advancement of Science: The School of Medicine has 112 elected fellows
*Magnet Recognition Program: Received our third consecutive Magnet designations.
*National Academy of Medicine: 22 members, elected by their peers in recognition of outstanding achievement
*Human Rights Campaign Healthcare Equality Index: 6th year in a row that Vanderbilt University Medical Center was a Leader in LGBTQ Healthcare Equality.
|
cc/2021-04/en_middle_0071.json.gz/line3033
|
__label__wiki
| 0.812168
| 0.812168
|
myChattState
ChattSync
Tigerpedia FAQs
Parking Decal
WAWL
TigerWeb
Chattanooga State Community College
ChattState on Instagram
ChattState on Facebook
ChattState on Twitter
ChattState on YouTube
Alumni/Donors
Chattanooga State Supports Reconnect to Workforce Partnership
November 24, 2020 | Betty A. Proctor | Internal Press Release
The Reconnect to Workforce Partnership between the Tennessee Reconnect program and the Department of Labor and Workforce Development states that its mission for unemployed Tennesseans will be to focus on education as their job, according to Tennessee Governor Bill Lee.
Chattanooga State’s Tennessee Reconnect program has already served more than 2,000 adult students since its premiere in 2018. This fall, more than 900 adults qualified for Tennessee Reconnect and are on their way to a new career with little or no college debt.
Here, Tennessee Reconnect students share their experiences:
“Without the Reconnect Grant, none of this would’ve been possible. As a single mom, I did not have the extra funds to pay for classes, books, gas back and forth to school, as well as school materials.” – Morgan Devoren, age 24
“Programs like TN Reconnect are critical for providing equal opportunity across all demographics. It is incredibly user friendly. The support and communication can alleviate a lot of the stress of returning to college.” – Jeremey Mathis, age 32
“I know that when I graduate, I will have the knowledge to succeed in my career of tourism management. At the moment, I'm unsure whether I want to start my own attraction or advance within a company, but I do know that Chattanooga State and the TN Reconnect program have made it possible for me to achieve these goals.” – Natasha Zelsdorf, age 25
With federal unemployment benefits funded by the CARES Act ending soon, now is the time to plan your future. Governor Lee notes with over 250,000 available jobs in Tennessee, the Reconnect to Workforce Partnership will remove barriers so Tennesseans can acquire the skills needed to acquire a high-quality job.
Marsha Barker, Chattanooga State’s adult services director, is available to answer your questions about the Tennessee Reconnect program and guide you through the application process. “With the Reconnect to Workforce Partnership, there has never been a better time for unemployed Tennesseans to further their education,” states Ms. Barker. “Whether you’re a new or returning student, you have an opportunity to receive a college degree, tuition-free. TN Reconnect covers tuition and mandatory fees for up to five years.”
Register now for an online Information session to fit your schedule throughout December via Webex at chattanoogastate.edu/tnreconnect or call (423) 697-3346 with questions. Classes begin mid-January.
Wednesdays, December 2, 9 or 16 @ 2:00 p.m.
Thursdays, December 3, 10 or 17 @ 5:30 p.m.
Saturdays, December 5 or 12 @ 11:00 a.m.
Mondays, December 7 or 14 @ 5:30 p.m.
Fridays, December 11 or 18 @ 11:00 a.m.
Filter Archives
College Advancement
External Press Release
Faculty Fellow
Internal Press Release
- Any -College AdvancementExternal Press ReleaseFaculty FellowFaculty SpotlightInternal Press ReleaseStaff SpotlightStudent Success
Chattanooga State Campuses
Dayton Site
Dayton, TN 37321
4501 Amnicola Highway
Kimball Site
Kimball, TN 37347
Chattanooga State does not discriminate on the basis of race, color, religion, creed, ethnicity or national origin, sex, disability, age, status as a protected veteran, or any other protected class. See our full statement at chattanoogastate.edu/eeo-statement.
Consumer Information | Title IX | Work at ChattState | Accreditation, Legal, TBR | Accessibility Policy | How Do I Report | Report Website Issue | Privacy Policy | Student Right-to-Know Policy | Log In
|
cc/2021-04/en_middle_0071.json.gz/line3038
|
__label__wiki
| 0.839455
| 0.839455
|
What does the term “Chinese” mean?
The Wikipedia article on Chinese says that many varieties of Chinese are mutually unintelligible. That is, I can't just learn "Chinese" and speak "Chinese" with anyone living in China or Taiwan.
What does the term "Chinese" mean? What makes a variety of Chinese count as Chinese, and what makes a non-Chinese language count as non-Chinese?
Andrew GrimmAndrew Grimm
Mandarin is the official language and the majority of Chinese people speak it, even if it's as their second language. There is an entire family of related but very different languages which are all "Chinese language(s)", but I would just stick with learning Mandarin from a practical standpoint. – Stumpy Joe Pete Apr 6 '20 at 18:29
user3306356 provided a good answer for the language, but you need to know that written Chinese and oral Chinese can be quite different.
A Mandarin speaker might say yī, a Cantonese jat1, and a Hokkien chit, but all three will understand the character 一 "one". -- from Wikipedia
Also I want to answer more on the Cultural aspect. For Chinese as in Chinese people, that's really complicated.
Historically, the Chinese culture influenced many others such as Japanese, Korean, Vietnamese, etc. so you may see Chinese characters, traditional clothing and buildings in their culture. The modern China split into different "areas" (I can't say country because it surely will stir up a political debate), mainly mainland China and Taiwan which ruled by 2 different political parties, the Communist Party from mainland calling itself the "People's Republic of China" and Kuomintang (the Nationalist Party) stayed in Taiwan calling themselves the "Republic of China". There are also Hong Kong and Macau, I recommend to watch "Are Hong Kong & Macau Countries" on YouTube for a better understanding. These four areas have different cultures while the core is the same. Most Chinese there use Mandarin while "dialects" are also used (some see those dialects as separate languages. Spoken Cantonese being one which used by people from Hong Kong, Macau and many from southern China.) There are also Tibet and other "minorities" which got their own dialects/languages.
For "some" ("many" depends on your view) people from Tibet, Hong Kong, Macau and Taiwan, they think they are culturally different and should be called differently (e.g. Hongkonger, Taiwanese), so Chinese, AFAIK, are mainly refer to mainland Chinese while it can also refer to ethnic Chinese in some occasions.
edited Oct 4 '14 at 5:25
Andrew Grimm
Pete C.Pete C.
I would say, so-called, Chinese is what we would call Modern Standard Mandarin (MSM) but can also include all dialects/topolects.
Although there should be a standard, it seems that all dialects/topolects (I.e.: any language spoken in China and it's territories - no matter it's origin) can be considered as Chinese "languages".
Chinese, in general, should just be the same as Mandarin. Whereas Chinese languages could include any language spoke in China and all of it's territories.
You are making it a bit complex. Chinese is a language that Chinese people speak. The standard Chinese is called mandarin or 普通话。Besides mandarin, there are many dialects in Chinese.
answered Apr 1 '15 at 6:05
JennyJenny
Not the answer you're looking for? Browse other questions tagged terminology or ask your own question.
What is the term for these piles of tiles on top of a roof?
Is the potholing term for 天坑 sinkhole?
What does 防海固圉 mean?
what's the term for “tone contour”?
How do I translate the definition of the mathematical term “Latinity” into Chinese?
What is the term little meatballs (referring to spoiled kids)?
What does “Fangcang [hospital]” mean?
How can I say “grade on a curve”?
What is the Chinese term for “architrave”?
Is there a Chinese term for dramatic irony?
|
cc/2021-04/en_middle_0071.json.gz/line3041
|
__label__wiki
| 0.978077
| 0.978077
|
End poverty by giving the poor cash?
If you’ve been following my recent posts and papers on giving cash to the poor, three things that may interest you:
First, we’ve put out a 3-page policy note with the World Bank on one Uganda cash transfer program. Here is an IPA policy note on a second study, of cash transfers to poor women in Uganda.
Second, today the New York Times Economix blog posted excerpts of an interview with me about both experiments on giving cash to the poor.
Last, in a strange coincidence of timing, yesterday the FAI blog posted excepts of a similar interview from last year.
57 thoughts on “End poverty by giving the poor cash?”
James_Tierney on June 20, 2013 at 10:59 am said:
@cblatts Too lazy to look through all of your links but I’m guessing this one is on there somewhere? http://t.co/BgyWvkIHXs #TeachEcon
AHAkramLodhi on June 20, 2013 at 10:59 am said:
RT @cblatts: End poverty by giving the poor cash? http://t.co/TvlpmHOx8x
glassmanamanda on June 20, 2013 at 11:02 am said:
stevept on June 20, 2013 at 11:06 am said:
Data4Dev on June 20, 2013 at 11:07 am said:
RT @cblatts: End poverty by giving the poor cash? http://t.co/CUqSoZCsx2 and 3-pager summary on cash transfers http://t.co/R7PcwsDo92
bj_pittman on June 20, 2013 at 11:15 am said:
k_wilson on June 20, 2013 at 11:18 am said:
changingview on June 20, 2013 at 11:48 am said:
ollybuston on June 20, 2013 at 11:50 am said:
End poverty by giving the poor cash? http://t.co/9AhdjMxsGc -interesting evidence from @cblatts via @bj_pittman
donnasthill on June 20, 2013 at 11:54 am said:
octavio_medina on June 20, 2013 at 12:08 pm said:
Un programa que entrega dinero sin contrapartidas a pobres en Uganda tuvo bastante éxito. Más aquí, por @cblatts http://t.co/2RTf0j1r0s
ramonmateoes on June 20, 2013 at 12:12 pm said:
RT @octavio_medina: Un programa que entrega dinero sin contrapartidas a pobres en Uganda tuvo bastante éxito. Más aquí, por @cblatts http:/…
PixelRobot on June 20, 2013 at 1:50 pm said:
MarionOuma on June 20, 2013 at 2:28 pm said:
fuller_brandon on June 20, 2013 at 6:16 pm said:
End poverty by giving the poor cash? http://t.co/Vus0Mo2636 via @cblatts
eebernstein on June 20, 2013 at 9:30 pm said:
fp2p on June 21, 2013 at 2:24 am said:
Just give ’em the money. The @cblatts #cashtransfer machine rolls on with interviews in NYT & more http://t.co/s3bkXYWn9H
jamespearse on June 21, 2013 at 2:30 am said:
Fascinating reading @fp2p @cblatts and a subject I’ve been researching recently from the perspective of the telecommunications industry.
NonoDevRookie on June 21, 2013 at 2:50 am said:
End #poverty by giving the poor cash? http://t.co/VVyEGWBnq1
cblatts on June 21, 2013 at 3:13 am said:
RT @fp2p: Just give ’em the money. The @cblatts #cashtransfer machine rolls on with interviews in NYT & more http://t.co/s3bkXYWn9H
ericpgreen on June 21, 2013 at 3:28 am said:
tgsmitty on June 21, 2013 at 3:28 am said:
a_aboagye on June 21, 2013 at 3:47 am said:
gforgues_puccio on June 21, 2013 at 5:18 am said:
End poverty by giving the poor cash? http://t.co/LMG1L1vMcx
James Manley on June 21, 2013 at 7:52 am said:
Hey Chris. Congratulations on the successful study and all the coverage!
Again, though, I’d just like to highlight that cash to the poor is no panacea. I’m not arguing with your results: it sounds like straight transfers are very successful in improving earnings and giving some people a leg up out of poverty. However, we find that the many cash transfer programs we examined had, on average, essentially no effect on child nutritional status. (http://www.sciencedirect.com/science/article/pii/S0305750X13000934) We hypothesize that while healthy children certainly need food, cleanliness, sanitation, and good feeding practices are as important as having more food around. So should we “just give money”? Depends on the context!
bexband on June 21, 2013 at 12:51 pm said:
RT @cblatts: End poverty by giving the poor cash? http://t.co/KyHBx7Y39x and 3-pager summary on cash transfers http://t.co/o5eTbcYreQ
UNDP on June 21, 2013 at 2:05 pm said:
Can we end poverty by giving the poor cash? See what @cblatts has to say: http://t.co/mjvIc9Uf5m #EndPovertyFriday
Yonatheezus on June 21, 2013 at 2:10 pm said:
RT @UNDP: Can we end poverty by giving the poor cash? See what @cblatts has to say: http://t.co/mjvIc9Uf5m #EndPovertyFriday
UtilityAccount1 on June 21, 2013 at 2:12 pm said:
UNDP_Kosovo on June 21, 2013 at 2:15 pm said:
Can we end poverty by giving the poor cash? See what @cblatts has to say: http://t.co/f0LW9Nls2L #EndPovertyFriday #Kosovo
WintherI on June 21, 2013 at 3:00 pm said:
End poverty by giving the poor cash? http://t.co/hc9SHxmXwI
kin21 on June 21, 2013 at 3:34 pm said:
OIbhagui on June 21, 2013 at 3:58 pm said:
@UNDP @cblatts #EndPovertyFriday that’s when you’ll realise that a lot of poverty has to do with attitudes
raychipf on June 21, 2013 at 3:59 pm said:
@UNDP @cblatts Is it sustainable?
afrocomplete on June 21, 2013 at 4:05 pm said:
@OIbhagui @UNDP @cblatts Sustainable development, women and youth empowerment are the fastest ways to end world poverty. #progress #news
NiliMajumder on June 21, 2013 at 4:17 pm said:
GustavoUB on June 21, 2013 at 5:09 pm said:
createchangenow on June 21, 2013 at 7:15 pm said:
RT @undp: Can we end poverty by giving the poor cash? See what @cblatts has to say: http://t.co/7QttvYZOjt #EndPovertyFriday
dewihut on June 21, 2013 at 9:16 pm said:
LawyerParamjeet on June 22, 2013 at 1:32 am said:
@UNDP poverty can end only by making people play a productive role in an economic set up @cblatts
benita_rowe on June 22, 2013 at 2:27 am said:
beatetrankmann on June 22, 2013 at 4:34 am said:
@UNDP @cblatts yes we can, and reduce inequality. Just give cash to the poor!
@UNDP @cblatts yes we can, and reduce inequality too. Just give cash to the poor!
ComplaymentdO on June 22, 2013 at 6:38 pm said:
End poverty by giving the poor cash?: If you’ve been following my recent posts and papers on giving cash to th… http://t.co/rzI2OvSvZS
Oxfam on June 24, 2013 at 2:31 am said:
Fighting #poverty via #cashtransfers: @cblatts makes the case(s) http://t.co/dSFZsKNt32 ht @fp2p
OxfamScotland on June 24, 2013 at 2:33 am said:
RT @Oxfam: Fighting #poverty via #cashtransfers: @cblatts makes the case(s) http://t.co/dSFZsKNt32 ht @fp2p
OxfamIndonesia on June 24, 2013 at 2:38 am said:
dumfriesnw on June 24, 2013 at 2:48 am said:
matthieunappee on June 24, 2013 at 3:13 am said:
citizenpen on June 24, 2013 at 3:15 am said:
RT @Data4Dev: RT @cblatts: End poverty by giving the poor cash? http://t.co/CUqSoZCsx2 and 3-pager summary on cash transfers http://t.co/R7…
aid_leap on June 24, 2013 at 3:21 am said:
@cblatts NYT piece on cash transfers http://t.co/s8hBmDClVN getting picked up elsewhere too http://t.co/wKu5Yp9gqI
O4Dev on June 24, 2013 at 3:47 am said:
pantel81 on June 24, 2013 at 4:16 am said:
CABird6 on June 24, 2013 at 5:13 am said:
Oxjam_Leeds on June 24, 2013 at 9:10 am said:
s8mb on June 24, 2013 at 3:32 pm said:
Ending Poverty by Giving the Poor Money http://t.co/NiBJAec9FX and more: http://t.co/wMnwAAbF2M
|
cc/2021-04/en_middle_0071.json.gz/line3043
|
__label__wiki
| 0.565138
| 0.565138
|
Christopher Barzak
One for Sorrow
The Love We Share Without Knowing
Birds and Birthdays
Before and Afterlives
Wonders of the Invisible World
The Gone Away Place
Meanwhile, back in Japan
Posted by Christopher Barzak in Japan, Magazines, Publishing, SF, Translation July 7, 2008
But before I go, my Japanese mom sent pictures of the new issue of Hayakawa SF in Japan, which features stories by Barth Anderson, Ekaterina Sedia, Benjamin Rosenbaum, Holly Phillips, Alan Deniro, and myself. Here are pics of the magazine, and also the illustrations for Alan’s story, Tetrarchs (originally published in Strange Horizons), and my story, The Guardian of the Egg (originally published in Salon Fantastique and then reprinted here, too, at The Journal of Mythic Arts). Art the illustrations way cool? If you’re in Japan, get a copy and let me know what you think of the issue. 僕は早川SFが大好き！
Yoshio
July 7, 2008 at 3:00 pm ∞
The editor of that particular issue, Mr. K., says he loves yours the most. He also wonders if it was inspired by an old Japanese rakugo story, Atamayama (Head Mountain) in which a guy has a tree on his head and people love it. When it becomes so popular, people have a lot of parties around the tree and become bothersome to him. He is very upset and eventually tears down the tree. There grows a pond after the hole and he regrets that act when he becomes lonely. Eventually he throws himself in that pond and kills himself. Rakugo is one of our most popular traditional performing arts, telling some comical stories before the audience in a rakugo theater. There’s an animation of that story, too, by one of our famous short animation artists, but I forgot his name.
Anyway it is a good story and I love working on it.
Your translator,
I’m so honored the editor liked my story best, Yoshio. It wasn’t inspired by the rakugo story you mentioned, but I did go look up that animated version of the story on YouTube after you described it, and it’s WONDERFUL! I can really see how Mr. K wonders about a possible connection. What inspired me to write “The Guardian of the Egg” was a painting by Leonora Carrington called “Baby Giant”. I can’t find a good image of it on the internet right now, but it’s used as the cover of her surrealist novel The Hearing Trumpet so you can get an idea of what it looks like by looking that up on Amazon.com. I saw that painting years ago and was immediately captured by it, and knew I had to write a story about it. “The Guardian of the Egg” is that story. I’m amazed at the similarities with the rakugo story, though. I loved that little animated film. Thanks for telling me about it. I might never have come across it otherwise!
fusakota
July 7, 2008 at 10:21 pm ∞
Ogawa-sensei,
That animation artist is Yamamura Koji and he made “Atamayama” in 2002.
And it is said that Rakugo Atamayama is from Yoshida Kenko’s “Tsurezuregusa ” Step 45, ” Horiike no Sojyo”
That is written in about 1330, Kamakura Era.
Barry Goldblatt Literary
Guess I’m going to have to become a stamp collector. twitter.com/ursulakleguin/… 2 days ago
Mariah Carey is working for the future of humanity at this moment. 2 weeks ago
Spending the last moments of 2020 with RuPaul's DR in the background. About a queen's performance, Michelle V. said… twitter.com/i/web/status/1… 2 weeks ago
Follow @Cbarzak
Previous Journals
JournalScape
Blogging Ohio
← Out of here
Atama Yama →
|
cc/2021-04/en_middle_0071.json.gz/line3045
|
__label__wiki
| 0.757293
| 0.757293
|
Featured Artist: Kellyn Scheel
Kellyn Scheel has gone through trial and error to find the perfect creative outlets that allow her to express her diverse artistry
Sukhman Sahota and Rachel Ellisen|October 21, 2020
The stylus is an extension of her right hand, carefully articulating her thoughts. Slick pen lines and intentional colors fill those creative thoughts and pixels on her iPad. As the music on her speaker starts to pick up speed, so does her pen. It becomes a routine, her intricate, creative thoughts start to take shape on digital paper and her mastery starts to show. Within a few hours, the playlist comes to an end and she steps out of her creative realm to look at the piece that made itself.
Because of the artistic influence of family members, Kellyn Scheel, a Paly sophomore, started her creative journey at a young age. Scheel’s father, brothers and cousins are all musicians. By observing and learning from them, Scheel developed a strong connection with music at a young age.
Seeing how [her brothers] could really put their feelings into music was really inspiring to me I found that same thing in art, and that’s where their influence came from. ”
— Kellyn Scheel
At first, her brothers wanted her to pursue music, but Scheel was inspired by a different part of the music industry, the posters.
“I found [the posters] really interesting as a kid because I would sit in the music room with [her brothers], and I would listen and play their music. I could just see how the music would relate to the posters and how everyone is just expressing themselves,” Scheel said.
Scheel found the same passion that her brothers had for music, in art. Scheel’s grandmother was a professional artist, mainly doing oil and acrylic paintings. Under her guidance, Scheel was able to develop her art.
“From a very young age, she started just painting with me for fun because she used to do that with all my siblings,” Scheel said. “I started out learning the basics by doing the mini landscapes and little things that she would set up for me.”
Scheel continued to have art lessons with her grandma, eager to learn the various elements of art.
“[My grandma] was super excited to have a kid who was interested in art because none of my siblings were really that into it,” Scheel said. “From then on, I fell in love with it, and I started taking art lessons outside of [my grandmother] and I’ve just continued ever since.”
“Crepuscular Light”
Scheel and her grandma continued to have art lessons, but when it came to their respective styles, they were polar opposites.
“[Her art] is mostly based on painting; she does oils and acrylics, landscapes, still lifes and sometimes portraits, and I have kind of gone abstract,” she said. “As I grew up, I started to become more interested in music-related art, like when people do album covers, and that are more surreal instead of realistic.”
Once she found her art style, Scheel needed to find a place to express her surreal and colorful visions. With the help of her grandma and teacher, Ms. Atkinson, an art teacher at Paly, she was able to experiment with several styles of art — collages, painting, drawing — until she landed on digital art.
I just put on some music and drew, and I feel it [the music] represents my imagination, like everything coming out of it at once. ”
“I started talking to our teachers at Paly and they were starting to teach classes that kind of revolved around digital art as it’s evolving now,” Scheel said.
Last year, Atkinson noticed how Scheel enjoyed different mediums and thought digital art would be right for her. Ms. Atkinson suggested she get an iPad to practice her digital art skills and test out different applications, so Scheel did just that and fell in love with it.
“I just put on some music and drew, and I feel it [the music] represents my imagination, like everything coming out of it at once,” Scheel said.
Scheel’s favorite digital piece is a drawing of a hand holding a lighter releasing a flame of doodles. “It’s a mix of realism and surrealism…I like how [the hand] contrasts with the background,” Scheel said. “But the most fun part…was drawing all the doodles coming out of it because I didn’t have a plan, I just kind of let all my thoughts flow.”
“A Colorless Ease”
Scheel knows that there are many new ways to pursue digital art and hopes to find a job after college that has art integrated into it. Whether that be advertising or design, she just wants to be able to create art in her future. Scheel knows that art will constantly be in her life, either that be going to college or working, art will find its way into every aspect of Scheel’s life.
“Art is just something that brings me joy in life and that’s all I really want in the future,” she said, “[doing] anything that just lets me be expressive and creative would resonate well with me.”
To commission art from Kellyn Scheel, contact her at:
digital art skills for graphic design
the purchase of existing art pieces or custom art pieces and designs
Sukhman Sahota, Creative Adviser
2018-2019 - Staff Writer
2019-2020 - Social Media Manager
2020-2021 - Creative Adviser
Hear more about me!
Rachel Ellisen, Staff Writer
Some hobbies I have are baking, playing lacrosse, traveling, taking photos, and spending time with friends. I joined C Mag...
Palo Alto High School's Arts and Culture Magazine
C Magazine • © 2021 • FLEX WordPress Theme by SNO • Log in
|
cc/2021-04/en_middle_0071.json.gz/line3049
|
__label__cc
| 0.648041
| 0.351959
|
Your guide to Naas: Canals and colourful stories a stone's throw from everything
Plus one very, very big ball.
thejournal.ie & KBC Neighbourhood Guides
Your Neighbourhood is a new series of local area guides from TheJournal.ie, presented by KBC. We’re bringing you the best of city neighbourhoods combined with the latest property data.
NAAS TODAY IS almost a byword for the commuter town. If you’ve driven into or out of Dublin from pretty much anywhere, you’ve seen signs to Naas. Kids around the country know it by the giant ball on the motorway.
Historically speaking, it’s always been a place with a lot going on. At its heart is an old town centre with a medieval core. Its Irish name, Nás na Ríogh, means ‘meeting place of the kings’ and the town has a long and what you might call ‘colourful’ story. It hosted several horrible massacres, multiple instances of abducted royal wives, and a particularly nasty battle in the 1798 Rebellion – as well as meetings of the medieval parliament.
Geographically, the Naas of today has been shaped extensively by commuters. It was home to Ireland’s first motorway – the M7 Naas Bypass, opened in 1983 to deal with traffic problems that drove pollution levels higher than Dublin’s. And the town has seen explosive growth in recent decades as new housing developments attract young families working in the capital.
But far from being a dormitory town, Naas remains very much a living urban space with an active community life. It sits just south of the M7 – north-east of Newbridge and south-west of Celbridge – and is often grouped with Sallins, just across the motorway.
Take me there! OK, here you are on Main Street at the heart of the old town.
So what’s the big draw? A family-friendly town just 15 minutes’ train journey from Dublin with phenomenal transport links. Not just A Nice Place To Shop, as the sign had it, but well supplied with all kinds of amenities. Plus only a stone’s throw (in driving terms, anyway) from Kildare Village, Newbridge, the west Dublin shopping centres, and also the Blessington Lakes and Wicklow mountains for a bitta nature.
#naas
A post shared by @ dangermse on Jan 13, 2018 at 7:56am PST
What do people love about it? Naas is “a large town with a small town’s character,” says a spokesperson for Naas Tidy Towns.
It is very personable and has fantastic clubs and societies. There are numerous golf courses within a 15 kilometer radius, there are two racecourses, a racetrack, and it has its own hospital. There are excellent bars, restaurants, hotels and the local theatre has some really good shows. Every year the Punchestown festival brings a great sense of occasion.
And… what do people NOT love about it? Despite the bypass, the traffic can still be an issue.
One drawback is the traffic. Naas was the first town in Ireland that required a bypass. That bypass was upgraded 12 years ago and is being upgraded again this year.
What’s the story with house prices? Above the national average, but on the whole way cheaper than buying in Dublin. The average asking price in Naas is just over €302,000 – roughly €100k less than the average in the capital.
Nostalgia #naas #evening #town #street #lights #ireland #wanderlust #traveling #mindfulness
A post shared by Nick Batalis (@nickbatalis) on Jan 9, 2018 at 2:11am PST
How long will it take me to get into Dublin? If you’re commuting to Dublin, the drive is just over an hour outside peak times. Buses will get you there in 45 minutes if the gods smile upon you.
On the train, however, it’s a different story: just over a quarter of an hour into Heuston Station if you pick the right train.
Where should I get lunch? PS Coffee Roasters is an independent coffee shop run by two brothers on Poplar Square, which also serves salads and an appetising range of baked goods.
Perfect way to recover from a morning gym session 😊#foodporn #veggielove #saladlove #coffeelover #psroasters
A post shared by Róisín Ní Mhurcú (@roisinnimhurcu) on Sep 23, 2016 at 10:20am PDT
Alternatives: Urban Kitchen do a fine range of fresh salads. For something a bit fancier, try the Candied Walnut for Sunday lunch or a solid early bird deal.
And what’s my new local? Tommy Fletcher’s on Main Street is an old-school pub with a notoriously old-school proprietor – famous for once allegedly threatening Ronnie Wood, and possibly the rest of the Rolling Stones, with expulsion if they kept singing in the bar. Keep the tunes to a minimum and you’ll be OK.
#pints #naas #fletchers
A post shared by Eugene Delaney (@delooneyeuge) on Jul 23, 2016 at 2:29pm PDT
Alternatives: Kavanagh’s is a local institution with a beer garden and a varied clientele. If you’re looking for something fancier, the Lock 13 gastro pub in Sallins has a selection of good craft beers and food to match.
Schools and supermarkets? Naas is home to one of the world’s largest Tescos (OK we’re making that up, but it’s very big) just by the motorway. There’s also a big SuperValu at the station and another in the town; two each of Lidl and Aldi; and another Tesco too. Basically if you’re looking for groceries Naas has you sorted.
There are nine primary schools: Naas Convent (Catholic, mixed); St David’s (Church of Ireland, mixed); Scoil Chorbain (Catholic, boys); An Linbh Iosa (Catholic, mixed); Scoil Bríd (Catholic, mixed); Killashee (multidenominational, mixed); Gaelscoil Nas na Riogh (interdenominational Gaelscoil, mixed); Naas Community (multidenominational, mixed); and in Sallins, St Laurence’s (Catholic, mixed).
There are four secondary schools: Coláiste Naomh Mhuire (Catholic, girls); Gael Cholaiste Chill Dara (Catholic Gaelscoil, mixed); Meánscoil Iognáid Ris (Catholic, boys); Naas Community College (multidenominational, mixed); and Piper’s Hill College (interdenominational, mixed).
Anything else I should check out? The walk along the towpath is an underappreciated local option, says the aforementioned Tidy Towns rep. Look out for the wildlife:
One of the hidden gems in the town is the lovely walk that exists from the harbour along the canal. Along this tranquil stretch there exists a colony of otters and every once in a while a kingfisher will appear.
A post shared by Luiz Oliveira (@luiz.oliveira7) on Dec 29, 2017 at 7:19pm PST
OK, I’m sold. Give me one piece of Naas trivia to impress a local. The Perpetual Motion sculpture looks like concrete, but it’s actually a huge nine-metre-wide hollow steel ball, with a 50mm layer of concrete sprayed around the outside to simulate a road surface.
(There are persistent rumours among local kids that someone got trapped inside it. This, to the best of our knowledge, is not true.)
Do you live in Naas? Share your opinion in the comments!
|
cc/2021-04/en_middle_0071.json.gz/line3054
|
__label__cc
| 0.637131
| 0.362869
|
Bible Belles Launches Final Book in H.E.A.R.D. Series – “Deborah: The Belle of Leadership”
Mar 15, 2018 | Arts & Entertainment
Encinitas, CA, March 15, 2018 –(PR.com)– Bible Belles, a Christian publishing company, is excited to announce the release of the fifth and final book in its H.E.A.R.D. series, "Deborah: The Belle of Leadership." The Deborah book concludes the 5-book adventure series with Rooney Cruz as she learns about female heroes of the Bible, including Hannah, Esther, Abigail, Ruth, and now Deborah.
With the angel Mari by her side, Rooney Cruz learns that God has given her four real superpowers: Prayer, Patience, Bravery, and Loyalty. Her transformation into a superhero is almost complete, but one power is missing. As Rooney watches Deborah rise up and lead an entire nation to victory, Rooney realizes that true leadership means inspiring others and working together. In this final book in the series, Rooney learns that God is calling her to lead.
Will she be ready to answer the call? Come along with our heroine, Rooney Cruz, as she becomes the greatest superhero of all – a Bible Belle!
“Bible Belles has become more than a business,” said co-founder Erin Weidemann. “For us, as parents of a young girl, it is personal. We are particularly aware of the challenges girls face today, and as we look forward to the release of 'Deborah: The Belle of Leadership' it is our continued prayer that these books will help young girls everywhere learn to see their real value and beauty in the Lord.”
In an effort to give our daughters positive role models, Erin and Brent Weidemann created the Bible Belles series. Erin’s life experiences as a five-time cancer survivor, wife, and mother inspired her to create a brand focused on inspiring girls and women of all ages to fulfill their destiny, redefine the world’s messages of beauty and worth, and promote positive, powerful female role models in Scripture and modern culture. The Bible Belles series uses five remarkable women from the Bible – Hannah, Esther, Abigail, Ruth, and Deborah – to teach young girls how to feel confident about their worth, bodies, and purpose in today’s messy and challenging world. Erin Weidemann authored the series, and the couple partnered with a Disney animator to illustrate the books.
Purchase "Deborah: The Belle of Leadership" online ($14.99) or for a limited time only, buy the 5-book bundle for $59.95 (retail value: $75.00). Together, let's help every girl become the hero she was created to be!
Bible Belles is honored to be partnering with World Vision to support its mission of helping children around the world. For every Deborah book purchased, Bible Belles and World Vision will donate a Bible Belles book to a girl living in an under-resourced community in the United States.
For more information or to schedule an interview with the Bible Belles team, contact Laura Blank ([email protected], 646-245-2496).
About Bible Belles
Bible Belles is a multimedia publishing company dedicated to changing girls' lives through the female heroes of the Bible. The world has a lot to tell our kids about beauty. The world is wrong, but it is loud. The Bible Belles show our kids that real beauty makes a different kind of noise. For more information, visit us online at www.biblebelles.com.
About World Vision
World Vision is a Christian humanitarian organization dedicated to working with children, families, and their communities worldwide to reach their full potential by tackling the causes of poverty and injustice. World Vision serves all people regardless of religion, race, ethnicity or gender. For more information, please visit www.worldvision.org.
Keylight Communications
Laura Blank
PreviousGrossmont Center to Host Annual Bunny Hut
NextDouglas Vermeeren’s Personal Power Mastery Program Rated Among the Top 3 Self Development Programs Worldwide
“PIXEO” – Available April 2018 in the Apple App Store
Grossmont Center to Host Annual Bunny Hut
NC Motivational Speaker Kelly Swanson Featured in Reality TV Show Airing October 6, 2017
OSA Supports the 35th America’s Cup as Official Audio & Video Contractor
|
cc/2021-04/en_middle_0071.json.gz/line3059
|
__label__wiki
| 0.647032
| 0.647032
|
Posh Box Fashion Opens Its Doors in a Shipping Container Retail Center
Mar 9, 2018 | Lifestyle
Box Office Warehouse Suites is the Business Center to be at in Fort Worth
FORT WORTH, TX, March 09, 2018 /24-7PressRelease/ — It’s no secret, shipping containers are being converted into business spaces worldwide and the nation has taken notice. While major cities such as Los Angeles, California and Las Vegas, Nevada have already adapted to the shipping container movement, Fort Worth, Texas is making quite the statement.
As one of the nation’s fastest growing counties, Tarrant County is giving business owners and residents a lot to talk about. It is growing and it is happening rapidly. One drive down interstate 35 and commuters will notice a line of chain restaurants and merchants, so what room does that give startup businesses to actually start up? One major development that is opening its doors in spring of 2018 is Box Office Warehouse Suites, a new design district that has used over 150 converted shipping containers to offer competitive rates in a prime real estate developing area. As a neighborhood retail center and business space, Box Office Warehouse Suites is the ideal concept for North Fort Worth. The flexibility this design district provides has allowed businesses such as Posh Box Fashion to make the conversion from an e-commerce business to a brand with an actual store front.
Earlier this year, Posh Box Fashion announced that they were official tenants at Box Office Warehouse Suites. Posh Box is the first tenant to sign a lease and move in to the retail aspect this design district presents. Owner and founder of Posh Box says her design inspiration comes from multifarious sources. She finds inspiration while traveling, from different cultures, textiles, shapes, colors and just normal every day life.
While searching for retail space for lease in the Fort Worth area, the owners of Posh Box came across the then developing container business park. Call it fate or destiny, but Posh Box found the perfect business home at Box Office Warehouse Suites that remains true to its brand. The name Posh Box was inspired by life abroad. The designer’s style was often described as being chic or posh. Posh Box was the perfect name for this clothing brand, it lets the consumer know that the brand offers good fashion taste, even in a smaller and untraditional boutique space. The gal behind the clothes says “as a brand, we offer trendsetting quality garments at an affordable price. We represent a wide range of strong women who are not afraid to take control, live in the moment and support each other and our differences. We strive to offer a fashion forward brand that is both, trendy and classic. We carry affordable women’s clothes in sizes XS to 3X.”
One of the ultimate decisions when making Box Office Warehouse Suites the storefront this brand deserves was that the overall concept was exactly what the owners were looking for. “We were familiar with shipping containers being converted into retail or living spaces that were also environmentally friendly. Box Office Warehouse Suites intrigued us most by the build outs and finishes that are modern while still holding the containers characteristics. It was also serendipitous in how our ‘Box’ names aligned.”
Make sure not to miss the grand opening of Posh Box fashion and shop their online store in the meantime. Posh Box will be making a debut at the Graffiti and Street Art Festival on March 17, 2018 that will be held at Box Office Warehouse Suites. Tickets to the event can be purchased on Eventbrite.com.
About Box Office Warehouse Suites
Box Office Warehouse Suites of Fort Worth is an innovative commercial real estate development in the fast-growing Alliance / Golden Triangle area north of Fort Worth. It offers tenants exceptional value and the ability to add square feet to their space in small increments. For more information, visit BoxOfficeWarehouseSuites.com or their Facebook page. To inquire about leasing, contact Jim Eaton at (817) 439-3224 or [email protected].
About RDS Real Estate
RDS Real Estate is a leader in commercial real estate lease properties and has excellent Tarrant County office space for lease, warehouse space and retail space for rent throughout Tarrant County, including but not limited to: Fort Worth, Haslet (Blue Mound/ Alliance Area), Arlington, Kennedale and Haltom City and Denton. RDS Real Estate owns and manages more than one million square feet of commercial property in Tarrant County, Texas.
About Pox Box Fashion
Posh Box Fashion is influenced by the movement of time. Fashion is in a constant change and they like to keep relevant in their designs. Design inspiration comes from the past, the current and the future of fashion. As a brand, Posh Box Fashion offers trendsetting quality garments at an affordable price. They represent a wide range of strong women who are not afraid to take control, live in the moment, and support each other and our differences. Shop their online collection at www.poshboxfashion.com.
PreviousCharles & Colvard Collaborates with Leading Points to Launch Exclusive Program for Military Customers
NextMyRegistry.com Names Melissa Feemster VP of Business Development
America’s First Line of Luscious Butter Improvements Made with Fair Trade USA and Rainforest Alliance Certified Palm Fruit Oil
Latinas Contra Cancer will host a National Latino Cancer Summit in San Francisco, CA
San Francisco Dentist, Dr. Ben Amini, Warns about the Link between Common Oral Bacteria and Colon Cancer
Empire Express
|
cc/2021-04/en_middle_0071.json.gz/line3060
|
__label__cc
| 0.63915
| 0.36085
|
Thoughts on the universe
← Confidentiality – the enemy of trust?
The new organisational model? →
30/12/2011 · 1:24 pm
On the death of Gaddafi
The night before last I was reading Wolf Hall by Hilary Mantel about Thomas Cromwell in the reign of Henry VIII and there was a passage describing the execution of monks by evisceration and burning. It also described the crowd watching the events. I caught myself reflecting on how we had moved on as a human race and feeling relieved that we could no longer contemplate public condonement of such cruelty. As I traveled home, however, I was confronted with images of Gaddafi being beaten and shot in the stomach and head despite pleading for his life and my heart went out in pain to him.
On the one hand I have to appreciate the skill of Life for me personally, highlighting to me, “You think we have evolved and are no longer capable of such cruelty? – Try this!”. I realised Life was saying: Careful! – no complacency, no expectations. I recognise also the symmetry; Gaddafi who was responsible for the death and torture of many is “hoist by his own petard” and has to experience at a personal level the suffering he inflicted. Perhaps, if we believe there is some continuation beyond death, this is part of the learning. I am also struck by the elegant design of Life; those in the west who were left uncomfortable by the images were left without any moral ground to stand on because of the powerful symmetry with the assasination of Osama Bin Laden. Even intelligent and compassionate friends of mine were able to justify the assasination of Bin Laden; in their view there were some people who were exceptions to the normal moral code, indeed in the USA, there was huge public celebration.
Many would say that it is progress that individuals like Bin Laden, Gaddafi and Saddam Hussein are no longer alive but I wonder instead if we have missed the point and squandered an opportunity for real progress. When I was in my teenage years I began an interest in Nelson Mandela and his life. At the time, it was difficult to envisage how change in the apartheid regime could be brought about without violent revolution. Yet South Africa made a peaceful transition. It came about through Nelson Mandela’s willingness to take a different approach. Which of us could have endured more than twenty-five years in prison without some instinct for revenge or retribution? Yet, from Life’s perspective you can see that the scale of the transformation he was going to make required a similar transformation at an individual level. Twenty-seven years of imprisonment, looked at another way was twenty-seven years of meditation and personal development. It was his crucible where he was confined in such a way that all he could work on was himself. The result was that he came out of prison saying “peace, truth, reconcilliation, love” and meant it. In one fell swoop he prevented anyone else being able to justify acting on feelings of retribution and revenge and he allowed the whole nation to take an evolutionary step.
Albert Einstein famously said that you cannot solve the problems of today at the level of thinking that created them. We talk much about regime change in cases like Libya and Iraq, yet to replace a regime based on power and violence by using power and violence is no change. Nelson Mandela’s approach and that of the Dalai Lama with China suggest a different way, to genuinely change regime by evolving beyond the “us and them” mentality which created these oppressive regimes.
The young teenager who killed Gaddafi was hoisted on shoulders brandishing his gun. How sad that someone else now, will have to live with the responsibility of having murdered someone who was pleading for mercy and the rebels have founded a new regime whose seed point is violence and retribution. As has been the case in Iraq and Afganhistan, the real work of evolution has not started yet and the West has responsibility for it’s complicit role in perpetuating the belief that power and violence are the ultimate currency in resolving difficulties. We think there can be no compromise in dealing with people like Gaddafi and Saddam Hussein yet really there can be no compromise in dealing with our own capacity for violence and lack of compassion. Imagine how all our hearts would have felt had they resisted the instinct for revenge.
In Greek tragedy, there was the concept of Miasma – that the sins perpetuated by heroes like Oedipus infected everyone. The Greeks recognised in their tragedies that these miasma were not unavoidable, they sprung from the missed opportunities to stop negative chains of events. Time and again, individuals had opportunities not to act but were not conscious enough or brave enough to resist their instincts or fears. Thus the miasma was perpetuated. It is easy to look back and think that such Greek tragedies belong to a different age yet they are just as real today and our opportunities to prevent the miasma of individuals like Gaddafi and Saddam Hussein being perpetuated is there to be seized as individuals like Nelson Mandela show us. To see how strongly this miasma penetrates our culture, you only have to watch films such as Avatar (which was hailed as breaking the mould) or most Hollywood action films. The plot is the same, there are the “good guys” who are victims of some more powerful oppressor (the “bad” guys). The good guys then set about defeating the bad guys by becoming even more violent than they are and destroying them. By the end, the reality is that the roles have switched and the oppressors have become the victims and the victims the oppressors. They are indistinguishable yet we are expected to triumph in the violent success of the “good guys” and feel it is positive because they are the “good guys”. It is really the triumph of the old adage that “might is right”. If our modern myths (films) are reflecting this then is it any surprise we are still playing it out in society?
I think behind the scenes though the real evolution is taking place and individuals like Simon Baron-Cohen, who wants to change our concept of “evil” to “lack of empathy” and his book “Zero degrees of Empathy” do show how we might begin to evolve away from this black and white, us and them style of thinking about the world. His aim is that instead of demonising regimes such as the Nazis in the second world war and feeling that we could never be like that, instead we would work on seeing the lack of empathy that caused it and recognising the potential for this in all of us.
The I-Ching teaches that we are “all one in our hearts”. To watch a vulnerable and defenceless Gaddafi being beaten and shot is to watch ourselves. Can we have compassion for a man who was so fearful and lacking in compassion that he could cause the deaths of thousands? If not, then how are we any different and how can we hope to evolve?
Filed under On Life the Universe and Everything
The Nature of Reality
The Changing Structures of our Lives
A new consciousness?
Is Brexit important?
On Life the Universe and Everything
Thoughts on the universe · This is a blog about some ideas concerning the universe; it is informed by my experience of the I-Ching and Astrology, by my involvement with people like Chrissy Philp and by my work coaching leaders in large organisations.
|
cc/2021-04/en_middle_0071.json.gz/line3070
|
__label__cc
| 0.64806
| 0.35194
|
Home ■ Space ■ The Sun has seasons, too, scientists discover
7 April 2015 /
The Sun has seasons, too, scientists discover
The Sun undergoes a seasonal variability with its activity waxing and waning over the course of nearly two years, according to a new study by a team of researchers led by the US National Center for Atmospheric Research (NCAR).
This behaviour affects the peaks and valleys in the approximately 11-year solar cycle, sometimes amplifying and sometimes weakening the solar storms that can buffet Earth’s atmosphere.
The variations appear to be driven by changes in the bands of strong magnetic fields in each solar hemisphere. .
“What we’re looking at here is a massive driver of solar storms,” said Scott McIntosh, lead author of the new study and director of NCAR’s High Altitude Observatory.
“By better understanding how these activity bands form in the Sun and cause seasonal instabilities, there’s the potential to greatly improve forecasts of space weather events.”
These variations can be likened to regions on Earth that have two seasons, such as a rainy season and a dry season, McIntosh said.
The study is published this week in Nature Communications.
Related reports here, here and here.
Campfires on the Sun
Evolution of an unusual monster galaxy
Looking at the sea, then the sky
Ageing chimps value old friends
|
cc/2021-04/en_middle_0071.json.gz/line3072
|
__label__cc
| 0.533687
| 0.466313
|
Posts Tagged Eddy Brimson
Interview with Eddy Brimson
August 19, 2019 at 9:59 am · Filed under Drama, EdFringe2019, Edinburgh Fringe Festival ·Tagged Eddy Brimson
Eddy Brimson as Joe in Naughty Boy
Eddy Brimson is currently performing in Naughty Boy at the Edinburgh Fringe.
1) You have written about football hooliganism in the past; how did that equip you to create the character of Joe? Is he perhaps based on, or in part on, a particular individual that you encountered in this world or is he a product of the parts of several different people?
I have written a few books on football fan culture and the violence that can go with it. Back in the late ’70s and early 80’s I was involved in the darker side of football and so I have a good knowledge of the subject. The books blew open the stereotypical view of what a football hooligan was and his background and so they made quite a stir. This play has been adapted from the book I’d written, which I will now release as an audiobook post Festival. There is quite a lot of personal experience in the character as well as attitude. I hope the political side of Joe comes across. he is definitely a man of the people, or the cogs, as he puts it. There is a lot of Them against Us in his thinking. There is a political edge to his outlook on the world.
2) Previously, you’ve worked in comedy. What inspired you to venture into the rather dark world of Joe?
I am a full-time comedian, I’ve been pro for 17 years and I’m very lucky to be so. I think that if you are a creative person you need to test yourself. And this has been one hell of a test.
3) Joe expresses the view that violence makes him feel truly alive. Can you explain why Joe feels this way? How did you understand his motivation to participate in violence?
Violence sets Joe free from the weights life places upon his shoulders. In such moments nothing else matters, he feels truly himself and so that is the motivation that drives him.
4) Joe seems to hold ‘normal’ life and people in contempt. Why do you think that is? Does he see himself as better than them?
Joe holds those that follow the herd in contempt. He despises those that just follow trends as he feels they have just given in and handed themselves over to being what those he sees as controlling us want rather than who they truly want and should be.
5) How important is being part of a group for Joe?
I think being part of the group reassures Joe that he is not alone. That said, he is a violent man, and a violent man will always find a fight alone or not.
6) What sort of reaction and feedback have you been getting from audiences?
The play has exceeded all expectations. I’ve never attempted anything like this before and the kind words on my ability to pull it off, both from punters and reviewers are really encouraging. Whoever, the most important thing for me is the writing. People seem to really like and understand it. That is just amazing.
7) Where next with “Naughty Boy”? Do you plan on performing it elsewhere? Is it a genre that you would continue next year at The Fringe with another show or repeat?
I would love to tour this, and a few offers have been made and so fingers crossed. My next aim is to record the audiobook. That’ll be a good 4 hours plus so it’ll take a while to knock that into shape as the play has evolved and that will affect the style of the book, and then who knows. Next year seems a long way off but it has been such a great experience that I am already tempted, which means I’ll be back. Maybe something lighter next year.
8) What other projects are you working on just now?
As I’ve said, the audiobook and seeing about a tour for the play will be top of the list as I need to keep the momentum going. I’d love to get an agent for the acting and writing side of things as well. Aside from that, it’ll be back on the road doing the stand-up with a tour of Asia to look forward to in October, which’ll be nice …. Onwards
Tickets for Naughty Boy can be purchased here
The Counter Culture review of Naughty Boy is here
Eddy Brimson was interviewed by Pat Harrington
#edinburghfringe2019 #edinburghfringe
August 4, 2019 at 8:49 am · Filed under Drama, EdFringe2018, Edinburgh Fringe Festival ·Tagged Eddy Brimson
Eddy Brimson as Joe
Gilded Balloon Patter Hoose, Edinburgh
3 Chambers Street, Edinburgh, EH1 1HR
Aug 4-12, 14-26
Suitability: 16+ (Restriction)
Eddy Brimson plays Joe, a football hooligan, in this thought-provoking one-man show. Joe is a man who is forthright about the excitement and energy of violence. Joe only feels truly alive when he is indulging in violence. Violence fills an empty space for Joe and enables him to believe that he is different from the rest of a constrained, boring society. Brimson does not shy away from describing the violence initiated by or directed at Joe and his gang over a weekend fueled by alcohol and anonymous sex.
This show is challenging and gives a glimpse into another life, a life Joe exhorts you to admire and adopt.
You can buy a ticket here: https://tickets.edfringe.com/whats-on/naughty-boy
#edinburghfringe2019
Austerity Pleasures
August 23, 2014 at 7:02 am · Filed under Comedy, Edinburgh Fringe Festival, Uncategorized ·Tagged Ben Morgan, Declan Kennedy, Eddy Brimson, Robyn Perkins
Venue: Espionage, Kasabar, Victoria Street
Until 24th August
This free, hour-long lunchtime show features Ben Morgan, Robyn Perkins and Declan Kennedy along with a guest appearance by Eddy Brimson, who was there to give a taster of his own show.
In common with most of the smaller shows at the Fringe, the cast have to turn their hands to publicising the event so as I walked down Victoria Street I was handed a leaflet by Robyn, (who was pleased to hear that I was planning to attend), and having crossed the street to the venue I was shown to the lounge by Ben, where the audience were gathering before the performance room becoming available.
First on was Ben, who made use of an envelope marked ‘EMERGENCY JOKES’ whenever he felt audience attention was flagging, although his act flowed well and his punning went down well with the audience.
Next, Robyn spoke about her transition from coming to the UK from the USA to gaining British Citizenship and the quirks involved in the process.
The third member of the cast was Declan Kennedy, who invoked a bit of audience participation by getting half of the audience to call out “SAY” and the other to call “TON”. Taken together, the audience ended-up calling out something that sounded scarily like “Satan”, which, Declan explained, he hoped would alarm people sitting in the floor above!
In the final minutes of the show, Eddy Brimson gave a preview of his own show “Windy Piss”. Hopefully another member of the Counter Culture team will be able to attend and review Eddy’s show as from the taster we got it sounds well worth a look.
This was the third year that “Austerity Pleasures” has featured at the Fringe and hopefully it will be back again next year. While it was seldom laugh out loud funny, it more than made up for this by having some thoughtful, intelligent observations. The performers were likeable and there seemed to be a good rapport between them and the audience.
Reviewed by Andrew Hunter
|
cc/2021-04/en_middle_0071.json.gz/line3074
|
__label__cc
| 0.648201
| 0.351799
|
Miss Marple: The Secret of Chimneys – Agatha Christie – PBS NEW Masterpiece Mystery!
As the title of this Cozy Mystery site entry says: Miss Marple Series V is back – with a NEW 90 minute episode: The Secret of Chimneys. And, if you are ANYTHING like me, you are probably ready for your “dose” of Agatha Christie via the good folks of British television and PBS. (Thank goodness PBS still airs our favorite British mysteries… now that other channels like A & E no longer do so!)
Anyway… tomorrow, Sunday, June 20, PBS will be airing the NEW Miss Marple Masterpiece Mystery! : The Secret of Chimneys.
Now for the bad news >>> The Secret of Chimneys is one of Agatha Christie‘s earliest mystery books. That, in itself, is not the bad news. But, the fact that it was written in 1925, five years before the first Miss Marple mystery book (Murder at the Vicarage) is.
The Secret of Chimneys is the first mystery in Agatha Christie’s lesser-known Superintendent Battles Mystery Series, which is made up of five mysteries. Superintendent Battles is a Scotland Yard man, definitely not an older, knitting-needles-wielding spinster! Because of this, I cannot be sure what part Miss Marple (played by the talented actress Julia McKenzie) will actually play in the episode. It’s anyone’s guess as to how much actual screen time Miss Marple will have, and also, how much of the screen time will be taken by Superintendent Battles.
Hmmm… It does seem a shame that with so many Agatha Christie Miss Marple mysteries available, recently several NON Miss Marple books have been made into Miss Marple movies. Oh well… I am just going to look at this from the glass-half-full perspective and simply ENJOY this show, regardless of what liberties the producers have made!
15 Comments - Click Here to Read the Comments or to Add Another
Jim Lacey says
When Christie adapted her novels for the stage, she sensibly eliminated characters, including Poirot, I believe, in one instance. BBC tends to add characters, which combined with short takes, enigmatic images, and muffled speech, tends to make the mystery a question not of who-done-it but of what is going on!
Tori Lennox says
I’m just about on the verge of signing up for Netflix just so I can see all the Brit mysteries, like Midsomer Murders, A&E and Biography refuse to air anymore. And I’m looking forward to tonight’s Miss Marple.
Tori, I forgot that Biography used to air some of the British mysteries!
What’s with the honchos in charge of A & E and their sister channel Biography?!?
Duane says
Where is the mansion used in “Chimneys?”
Danna, do you think we are in the wrong demographic or are they just idiots running those stations? I did the same thing, Tori, and am enjoying the choices I have on Netflix. BBCAmerica has even changed their lineup to some shows that are not enjoyable. They must please someone but WHO?
Alfred says
Tori, I have been watching a lot of the Miss Marple Mysteries on youtube.com It is neat watching them there – only thing – each segment is 10 minutes long but no commercials and you can pause them if you need to get up. You might try it out .
Duane,
I just posted a new entry with the answer to your question about the mansion used in The Secret of Chimneys…
(After I posted it as an answer, I saw that it was absolutely way too long.)
Clarissa at MMT says
I was a bit disappointed at how much the plot was altered in the Marple Chimneys. I was prepared for some alteration, with the addition of Miss Marple. But, no Superintendent Battle? Really? And look WHO did it (I won’t say)? But, please!
If they want to invent more Marple’s, why not just do it and say so. You know, “based on characters created by Agatha Christie.”
All that aside, the story taken by itself was good, and I did enjoy it for what it was. It just wasn’t “The Secret of Chimneys.”
This was another bastardization of Agatha Christie. First, the original work did not feature Miss Marple. Second, the original plot was almost totally changed. Did someone just make it up or did the script borrow the plot from some other Christie work? The plot thickens!
I heartily concur with Warren and Clarissa. This is one of my favorite Christie books, and they trashed it. Inserting Miss Marple was one thing but changing the identity of the murderer? And omitting some major plot points? The book is a classic golden age spy mystery, complete with Balkan princes. Do yourselves a favor like I did the next day: go back and read (or reread) the original!
Jim, Clarissa, Warren, & Jane…
I am simply going to insist that my husband find a two-hour block so that we can watch this Miss Marple episode.
You all have my curiosity piqued!
Danna, it clocked in at just under 90 minutes, so you won’t need to set aside two hours. And if you’re a fan of “Eastenders,” see if you can spot the actress who played femme fatale “Cindy Beale. ” Hint: she’s no longer a blonde.
My husband and I watched the show last night… more on that later…
I have never seen an EastEnders show, but I did recognize the actress from Ballykissangel – the very talented Dervla Kirwan, who played Assumpta Fitzgerald. I did, however, look up the Cindy Beale character… and was surprised that Michelle Collins was so convincing as Treadwell (the housekeeper) in this episode, after you mentioned that she played the femme fatale in EastEnders…
I have to agree that I enjoy the Joan Hickson Miss Marple shows the most. However, I have to say that this episode of Mystery was still good in my opinion.
If you can get over the fact that the story is not a Miss Marple Agatha Christie story, I think it is still a fine example of the cozy mystery genre. Miss Marple in the show is pretty consistent with the Miss Marple in the true Christie stories. And many elements of the story as presented are similar to and true to the spirit of real Agatha Christie stories.
In my opinion, the show was somewhat better than other contemporary cozy mystery type shows such as the latest Midsomer Murder episodes or even the latest Foyle’s War episodes (ok – I know that Foyle’s War is probably a “Police Procedural” and not a cozy under the more restricted definition of “cozy”) – but you know what I mean, I hope.
While I agree that the tv version is not true to Ms. Christie’s story, I enjoyed it. It certainly takes a different twist than the book. I would love to see a tv version more true to Ms. Christie’s with the Balkan prince and all the spy intrigue but I do have to say that I think the Masterpiece Mystery version is more plausible. When reading Chimneys, I felt it contained an awful lot of coincidences. But then one must suspend one’s skepticism with most cozies.
|
cc/2021-04/en_middle_0071.json.gz/line3075
|
__label__cc
| 0.664087
| 0.335913
|
Maulana Wahiduddin Khan is an Islamic spiritual scholar who has adopted peace as the mission of his life. Known for his Gandhian views, he considers non-violence as the only method to achieve success.
CPS International, the Centre for Peace and Spirituality, as is apparent from its name, is an organization, which aims to promote and reinforce the culture of peace through mind-based spirituality.
A peace mission requires dedicated volunteers, so we welcome you to become an Ambassador of Peace! Take the message of peace to the people around you. Read the Manifesto of Peace.Join us now!
Live Talk every Sunday (Urdu) 10.30 am IST : Facebook LIVE YouTube Channel
For attending the Sunday Class at CPS Centre, New Delhi, please write at info@cpsglobal.org
To receive updates on WhatsApp, follow the link https://wa.me/919999944118 save the number to your contacts and share with us your name and location
Join Maulana Wahiduddin Khan's official YouTube Channel, follow the link youtube.com/cpsinternational
Welcome to CPS International
Books & Audios
Books Maulana Wahiduddin Khan has made it his mission to present Islamic teachings in the style and language of the post-scientific era. Rediscovering Islam himself from its original sources, he has authored over 200 books on Islam.
Qurani Irshadat
Qurani Afkar
Azmath-e-Khudawandi
Qanun-e-Fitrat_Ko_Janiye
Jiskhushi Ki Hamein Talash Hai
Kitab-e-Zindagi(Dhivehi) Download
Deeni Taleem (Telugu) Download
Hayat-e-Tayiba (Telugu) Download
Sacha Raasta (Telugu) Download
Nare Jahanum (Telugu) Download
QT Daily Quote & Archives
Maulana Wahiduddin Khan | ...
1-Discovery-of-God-Filipino
Explore Islam Dawah Leaflets (Filipino)
QT News and TV
Maulana Wahiduddin Khan's talk at Jamia Millia Islamia
CPS Founder Maulana Wahiduddin Khan delivered a talk on 'Islam and the Modern Age' at Jamia Millia Islamia, New Delhi, 17 August 2016. The Chief Guest on the occasion...
E TV Urdu
Lecture by Maulana Wahiduddin Khan
Zee Salam
Question and Answer Session by Maulana Wahiduddin Khan
front Quran Section
The Quran has been preserved for all eternity. As it is the word of God, it is a book for all human beings Read the Quran in your language! English, Urdu, Hindi and Arabic.
We call upon all our brothers and sisters to help us achieve this Global Initiative of taking message of God to every household. You can be a part of Quran distribution Project by sponsoring Quran. The cost of one copy of the Quran is Rs 20.
To get your free copy of the Quran, please give us your details here.
QT Weekly blog & Archive
SOME MAKE THEMSELVES, OTHERS MAKE HISTORY
Maulana Wahiduddin Khan | Speaking Tree Weekly Blog | Jan 11, 2021 There are two types of people in this world–the self...
Voice of Nature
At times our conviction in God weakens. Then the physical and mental shocks in his life serve as a reminder of God,...
QT Photo Gallery and Mind Speak
Inter-Faith Dialogue
Media Interaction
Rajiv Gandhi Sadbhavna Award
With the Presidents
Maulana Wahiduddin Khan's
CPS is the place where I was introduced to my Creator, where I got to know about the purpose of my life, why I was born and what will happen to me when I will die. It has changed my life and made me a positive person. Navdeep Kapur
front magazines
Spirit of Islam is a magazine for the discerning individual, who stops to contemplate the myriad multitude of choices available, before deciding on a course of action. It aims at helping individuals discover answers to questions on life.
To give full expression to positive ideas, Maulana Wahiduddin Khan established the Islamic Centre at New Delhi in 1970. Subsequently, in 1976, he launched the voice of the mission, Al-Risala – the monthly magazine.
QT Faq and Archive
What is Repentance?
Maulana Wahiduddin Khan I Quora
When man does something wrong, he feels...
|
cc/2021-04/en_middle_0071.json.gz/line3076
|
__label__cc
| 0.572257
| 0.427743
|
The Cramer Institute MN
Home Why Us Mission The Sandbox Contact Us About the Founders
The Loveless Executive
by Ruth Ann Cramer
We considered “The Open Door” as a name for our home of Christian healing in Northern California, but decided on Casa del Christo Rey, to lift up Jesus Christ as the center of our mission. The Open Door (and its concept) quickly became our nickname. No money changed hands; we were not credentialed for professional services, so all was voluntary. Christo Rey was supported by Matthew’s salary, and donations of foodstuffs and clothing from supporters.
News of our open door policy soon spread, and people were brought or sent to us by city, county and state agencies; parole, police, health services and more. We learned we could handle, at most, 20 live-ins at one time; and sleep 45-50 on a weekend retreat.
Image by Unknown
Late one lovely, cool, Northern California evening, the “joint was jumpin’!” at Casa del Christo Rey. As we made our rounds to lock up entry doors on the main floor, the front entry bell jangled — not a polite “in case you’re still up” tinkling, but an aggressively rapid “I’ll push this darn button until you answer!” — ding-dong, ding-dong, ding-dong, ding-dong. The Casa was full up with live-ins, so with cautionary determination, I girded myself to say “no” as I approached the door.
Surely, no Casa door had yet swung open to reveal such a sight as met my weary eyes that late night!
Backlit and framed in the archway, a tall, dark and devastatingly handsome gentleman (though not as handsome as Matthew) in a show-stopper, three-piece, black Armani suit and tie topped by a black Barsalino fedora, promptly stepped his sizable Gucci shoes across our threshold.
“I’m told I don’t know how to love!” he preempted. “I’m also told, you people are the best in the area to teach me, so I’m moving in with you.”
With that, he hefted his black alligator briefcase and its matching valise, past me. Before we could tell the man he could not move in, he’d marched his long legs up the front staircase and picked out “his” bed.
An executive with a top legal position in a powerful international company, David’s demeanor and black, foreign-made sports car, impressed our awed guests by his importance. But, unlike the others who relished telling and hearing what mental, emotional, spiritual or criminal reasons accounted for their presence, he shared nothing of himself, his background or present circumstances.
Nine days passed with his infrequent attendance at meals, ostensibly due to the demands of his executive position. We’d been praying for him; waiting on the Lord for discernment of what might have caused his self-described inability to love.
When we believed the Lord had given us meaningful insight, we decided it was time I share with David our concern for him, and our deep sense of how his quest to learn how to love might be realized. So, I stopped David on his way out the next morning and invited him to sit for a moment.
David was apprehensive and agitated as he joined me in the parlor. I said we’d been praying for him; that we believed the Lord had given us spiritual discernment concerning him.
“How could you know anything about me?” he squawked. “I’ve deliberately told you nothing!”
I explained spiritual discernment to him; The Holy Spirit shared wisdom and insight with us because we needed spiritual discernment in order to care for those who came in sincerity, asking for our help.
David indicated, rather crudely, it wasn’t fair; he hadn’t asked God to speak to us about him! Nevertheless, he had just enough pride to be curious; and ordered me to tell him what God said.
Fortifying myself, I offered for his consideration: “You hold within your mind and heart, your emotions and will, a very deep, very strong, block to loving. You’ve erected a wall that allows no love to come in, no love to go out.”
“You’ve been talking to my ex-wives!” he exploded.
After assuring him we’d talked to no one, and had no knowledge he was, or had ever been, married, I said I’d received spiritual words of knowledge he’d been deeply hurt. In retaliation to being hurt, he’d set up a huge block, an impermeable wall, in fact.
He was clearly irritated; but encouraged by the Holy Spirit, I questioned David as much as he’d allow. Finally, after my prayer and prodding, he remembered, quite bitterly, that at age sixteen and a sophomore, he’d fallen hard for the high school beauty queen, age eighteen and a senior. She cruelly rebuffed him in front of his peers. He said, with some pride, that he’d since hardened himself to that kind of sensitivity. He’d made sure no female ever “affected” him again.
I shared what the Holy Spirit taught us can happen in people, mentally, emotionally and spiritually, when they’re hurt — that I discerned he’d erected a huge block when he was rejected and humiliated at age sixteen; and the block to love stood fast.
Knowing that many of those wounded in this way often make profoundly destructive vows, I asked him what he thought and did after being humiliated. He replied, rather dramatically, “I vowed to myself, no female will ever get to me again.”
No wonder his three marriages (each with children) had failed!
I told him his relationships would keep on failing until the block, forged by his inner vow, was broken and removed! If he wanted to learn how to love (his stated reason for coming to live with us), he must forgive the beauty queen and his friends who jeered him, renounce his vow and demolish the wall he’d built and reinforced.
Then, with God’s help and healing, he must forgive his ex-wives, ask their forgiveness, in person if possible, and again, open himself to risk. I assured him Our Lord, in His Infinite goodness and generosity, stood ready to bring him all the healing, strength, wisdom and courage he so badly needed to love, and let himself be loved.
Instead of receiving this Good News, this glorious message of grace and mercy with joy and thanksgiving to God, he grew even angrier.
He towered over me, yelling, “I came here to learn how to love! If I’d known I was going to be psychoanalyzed, I’d have paid a professional $350 an hour to do so!” He stormed to his room, packed his bag and stomped out; fired up his Porsche and roared off. His tires screeched and motor raced for blocks. I cringed, knowing the Senator next door and the Lieutenant Governor the third house down might soon be “turning us in”.
I called Matthew at work. “David left, saying that if he’d wanted to be psychoanalyzed, he’d have paid his shrink $350 an hour to do so.”
Matthew, always quick with a quip, said, “Is it too late? Quick, run after him! Tell ‘im, “Wait! We’ll charge! We’ll charge!”
We recall this story with some humor mixed with a deep sadness. Almighty God, Creator of all, offers freely to all His children, a lifetime’s worth of mercy and healing. But many times, His gifts are considered . . . worth . . . little or nothing. Worth nothing, because they . . . cost . . . nothing.
God held out all the healing and wisdom needed to bring David a happy and fulfilled life, but David had chosen to trust only in what he could pay for.
At a deeper level, this story is similar to the “Zombie” story. We’ve seen through inner healing ministry to many, that a more hidden and insidious cause of serious dysfunction and need for human healing, is the deep, inner vow made in response to being hurt, humiliated, rejected, betrayed, abandoned and so on.
Forgotten and veiled, but secretly and aggressively active in our psyche, hidden vows can form deeply held paradigms that direct our lives through reactions and decisions. We want to respond with love and care (as the Zombie and Executive so longed). Instead, we find ourselves afraid or unable to feel, care, love or empathize as we wish — or as we know we should — because God asks it of us.
This story highlights how important it is to bring before Our Lord, any and all areas in which we have difficulty, weakness, or needs for healing. As we listen for His Word and Holy Spirit, He brings to our awareness any hidden vows or self-promises we may have made.
When, with God’s help, we renounce those vows, break them and choose to do the “God thing”, we’ll find ourselves freed from heavy bondage; and opened to receive the grace, wisdom and strength of the Holy Spirit.
Then, true life, our life of love in Him, is released to live, love and reign!
We value feedback. Please send us a note! • Privacy Policy
© Copyright 2017, The Cramer Institute of Minnesota
We'd like to notify you of new postings in the Sandbox, and other Institute news. Please join our list. We don't share it with anyone.
|
cc/2021-04/en_middle_0071.json.gz/line3077
|
__label__cc
| 0.735685
| 0.264315
|
cURL and libcurl, Development, Open Source
curl is C
March 27, 2017 Daniel Stenberg 29 Comments
Every once in a while someone suggests to me that curl and libcurl would do better if rewritten in a “safe language”. Rust is one such alternative language commonly suggested. This happens especially often when we publish new security vulnerabilities. (Update: I think Rust is a fine language! This post and my stance here has nothing to do with what I think about Rust or other languages, safe or not.)
curl is written in C
The curl code guidelines mandate that we stick to using C89 for any code to be accepted into the repository. C89 (sometimes also called C90) – the oldest possible ANSI C standard. Ancient and conservative.
C is everywhere
This fact has made it possible for projects, companies and people to adopt curl into things using basically any known operating system and whatever CPU architecture you can think of (at least if it was 32bit or larger). No other programming language is as widespread and easily available for everything. This has made curl one of the most portable projects out there and is part of the explanation for curl’s success.
The curl project was also started in the 90s, even long before most of these alternative languages you’d suggest, existed. Heck, for a truly stable project it wouldn’t be responsible to go with a language that isn’t even old enough to start school yet.
Everyone knows C
Perhaps not necessarily true anymore, but at least the knowledge of C is very widespread, where as the current existing alternative languages for sure have more narrow audiences or amount of people that master them.
C is not a safe language
Does writing safe code in C require more carefulness and more “tricks” than writing the same code in a more modern language better designed to be “safe” ? Yes it does. But we’ve done most of that job already and maintaining that level isn’t as hard or troublesome.
We keep scanning the curl code regularly with static code analyzers (we maintain a zero Coverity problems policy) and we run the test suite with valgrind and address sanitizers.
C is not the primary reason for our past vulnerabilities
There. The simple fact is that most of our past vulnerabilities happened because of logical mistakes in the code. Logical mistakes that aren’t really language bound and they would not be fixed simply by changing language.
Of course that leaves a share of problems that could’ve been avoided if we used another language. Buffer overflows, double frees and out of boundary reads etc, but the bulk of our security problems has not happened due to curl being written in C.
C is not a new dependency
It is easy for projects to add a dependency on a library that is written in C since that’s what operating systems and system libraries are written in, still today in 2017. That’s the default. Everyone can build and install such libraries and they’re used and people know how they work.
A library in another language will add that language (and compiler, and debugger and whatever dependencies a libcurl written in that language would need) as a new dependency to a large amount of projects that are themselves written in C or C++ today. Those projects would in many cases downright ignore and reject projects written in “an alternative language”.
curl sits in the boat
In the curl project we’re deliberately conservative and we stick to old standards, to remain a viable and reliable library for everyone. Right now and for the foreseeable future. Things that worked in curl 15 years ago still work like that today. The same way. Users can rely on curl. We stick around. We don’t knee-jerk react to modern trends. We sit still in the boat. We don’t rock it.
Rewriting means adding heaps of bugs
The plain fact, that also isn’t really about languages but is about plain old software engineering: translating or rewriting curl into a new language will introduce a lot of bugs. Bugs that we don’t have today.
Not to mention how rewriting would take a huge effort and a lot of time. That energy can instead today be spent on improving curl further.
If I would start the project today, would I’ve picked another language? Maybe. Maybe not. If memory safety and related issues was the primary concern I had, then sure. But as I’ve mentioned above there are several others concerns too so it would really depend on my priorities.
At the end of the day the question that remains is: would we gain more than we would pay, and over which time frame? Who would gain and who would lose?
I’m sure that there will be or it may even already exist, curl and libcurl competitors and potent alternatives written in most of these new alternative languages. Some of them are absolutely really good and will get used and reach fame and glory. Some of them will be crap. Just like software always work. Let a thousand curl competitors bloom!
Will curl be rewritten at some point in the future? I won’t rule it out, but I find it unlikely. I find it even more unlikely that it will happen in the short term or within the next few years.
Discuss this post on Hacker news or Reddit!
Followup-post: Yes, C is unsafe, but…
C89cURL and libcurlvalgrind
Previous Postcurlup 2017: curl nowNext PostYes C is unsafe, but…
29 thoughts on “curl is C”
Anders Nygård says:
That book cover, pure nostalgia
Andreas Bogk says:
Being able to compile to C is probably good enough. See https://project-everest.github.io/ for a project attempting just that.
Daniel Stenberg says:
I wouldn’t call it “good enough” but I’ll agree that for other languages that’s an interesting “middle way” that might not require too much dependencies to get installed everywhere but generated code are usually (much) harder to read than carefully crafted hand-written code and debugging such code bases where nobody is truly familiar with the C code (since all developers would use the higher level language) would also be far from easy.
It’s actually not too bad to read, see https://github.com/mitls/hacl-star/blob/master/snapshots/hacl-c-experimental/SHA2_256.c for a sample. And you’d debug problems on a source level, of course, not on the C level.
But you need to be able to debug it everywhere, so if the source isn’t there you debug the generated code. I’ve worked on some projects that used generated code in my days, and maybe they were bad examples but they did not reach the level of comfort for me as a “run the real language” do.
Chris Short says:
Thanks for maintaining and enforcing a standard. It’s good to know the reasoning behind these things driving projects.
Ady says:
Just curious, what doesn’t work with C99 nowadays?
Not even Windows has supported C99 for more than a few years in Visual Studio. But sure, one of these days I think we can move up to C99…
Roman Hargrave says:
GCC and Clang do, so that really just means that its Windows lagging behind. Its a bit disingenuous to say “not even Windows” as if Microsoft are always first to the table with this.
I said “not even windows”, because that’s a huge platform and their primary C compiler didn’t support it until recently. They do now. And sure, gcc and clang do and were available, but limiting builds on windows to those compilers is very restrictive.
Joe P says:
I just poked around at a few source files for curl really quick, and the code quality looks pretty good. It doesn’t fall into the C trap where there’s this idea that variable names have to be as short as possible. When they are shortened, they are variable names that most C programmers would understand like “len” and “ptr”
If the code base was a mess to where I couldn’t figure things you, then yes, you should refactor or rewrite. For code like this, I don’t think it’s necessary, and I don’t blame anyone for acting conservatively.
Securing Apps says:
Ultimately no new developer will be able (or wish) to maintain the project without jeopardizing security: more architectures to address, e.g. ARM64, and fewer skills on low level memory management. Meaning less and less workforce to implement new features.
In theory good automated tests should allow a painless refactoring (yes I do agree with Uncle Bob), and by extension rewriting it to a safe language.
Abhijit Chowdhary says:
I too really like C, but because it allows for a lot of unsafe behavior, you have to treat it differently than other languages. It’s a trade-off whenever you want to work close to bare metal. However especially in open source with many eyes on the project, I think its a good choice even if you had to rewrite today.
Markus Kitsinger says:
Part of the reason I started writing libdynvol in C is because I saw how curl was written and I thought to myself, “Look at this. Look at how beautiful and elegant the code is. I can see why everyone and their grandma’s dog’s fleas use curl now.”
Recently, though, I’ve come to the realization that if I’m going to ever finish this project without losing what little bit of my mind I have left, I need to do the bulk of it in C++, not C.
Benjamin Brown a.k.a. foolsh says:
Hey good read, I have that book!
Erkin Alp Güney says:
Why C89, not C11?
We use C89 for maximum portability. C99 is slightly nicer but it isn’t that different and frankly people very rarely even ask about us switching the required version.
C11 is ISO. All five major compiler vendors now implement it.
I would have thought C is exactly the right language to choose for something like Curl. It is when I see CRUD apps written in C that I start to worry.
Isn’t curl by definition a CRUD app, or at least a CRUD client?
curl -X …
Povel Vieregg says:
I don’t think it is given that translating your code produces more bugs. Depends on the process and the language you are going to. I rewrote a program from Objective-C to Swift and while not without problems it made me catch quite a lot of bugs without even running the program. The compiler caught all sorts of issues that the Objective-C compiler couldn’t.
You might consider SaferCPlusPlus[1]. It allows you to achieve memory safety by replacing C’s unsafe elements (pointers and arrays mostly) with safe, compatible substitutes. It requires a modern C++ compiler, but doesn’t require the adoption of any C++ paradigms. Your code could remain mostly unchanged.
Adopting SaferCPlusPlus is straightforward, involving what might be described as a glorified “search-and-replace” action. A tool to mostly automate the task is in early development. But even doing it manually would be much less effort than a rewrite in another language.
Some other features:
– no additional dependencies, the library is basically a bunch of header files written in pure, portable C++
– can be “disabled” (i.e. elements aliased back to their native counterparts) with a compile-time directive
– can be adopted completely incrementally (i.e. partially converted code continues to build and run just fine (and receive the corresponding partial safety benefit))
– minimal runtime overhead [2]
[1] https://github.com/duneroadrunner/SaferCPlusPlus
[2] https://github.com/duneroadrunner/SaferCPlusPlus#simple-benchmarks
It would be really wonderful if curl could implement a [potentially optional compile-time flag for a] “jail” mechanism to increase security.
These seem to work quite well.
http://undeadly.org/cgi?action=article&sid=20151013161745
“First of all, on the positive side, privileges separation, chrooting and the message passing design have proven fairly efficient at protecting us from a complete disaster. [The] Worst attacks resulted in [the] unprivileged process being compromised, the privileged process remained untouched, so did the queue process which runs as a separate user too, preventing data loss… This is good news, we’re not perfect and bugs will creep in, but we know that these lines of defense work, and they do reduce considerably how we will suffer from a bug, turning a bug into a nuisance rather than a full catastrophe. No root were harmed during this audit as far as we know.”
This could be done by installing curl setuid to root. Upon launch, curl forks, and the network-facing process could chroot() to /var/empty, then setuid() to nobody.
The pair of curl processes then coordinate the activity, and the process touching the user’s files doesn’t directly access the network.
This would be a “nice to have” option that might get picked up by many distros that repackage your work. It’s certainly a popular configure option for OpenSSH.
Feel free and welcome to join in and drive the discussion for that within the project! But libcurl is the larger product we provide and that’s a library and I don’t see how we can practically make that run in any sort of jail for users…
Pascal Bourguignon says:
“Everyone knows C” This is plain wrong. A lot of programmers believe they know C, but actually they don’t know anything about it. (Hence the lot of bugs produced, and if they really knew it, they’d choose another programming language).
“C is not a safe language” This is wrong too. Granted, there are a few features that are unsafe in C, but it is the C implementations that are unsafe actually, providing unsound and unchecked environments.
cd says:
I completely sympathise. I write scientific and engineering applications. The bulk of our code is written in C – yes even the front end user interfaces and logic (it is a pain to develop and maintain). If we were doing it from scratch today we’d probably look at something like C++ or Java for the GUI, house keeping and front-end systems. But the project has been going for nearly 30 years’ now and it would be crazy to start thinking of migrating to another language. Besides, we’d still probably use C for all the numerical implementations and quant libraries.
You make a good point regarding trends too. Originally all our 3D rendering was done in software and later OpenGL. Vulkan looks as if the API will be written in C too. Writing bindings for another language would be an absolute pain to develop and maintain. In short, C is still the go to language for such systems, so using C in a way future-proofs your product.
C89 is a withdrawn standard. There is no reason to write code in it for user space applications.
C99 and C11 were and are well portable. I have a C99, C11 and C++14 codebase, and all of the code is easily buildable for all major desktop platforms, including Windows (using mingw, previously with gcc, and now with clang).
We aim far wider than “all major desktop platforms”, but the exact C standard is not a big discussion point in our project. I suppose we’ll switch to C99 one day.
Are you aware that HP-UX continues to ship a K&R compiler for C in the base operating system, that is not ANSI-C compliant, let alone C99?
K&R-standard code continues to be the only allowed input in many environments. We aspire to ANSI-C in many cases, and we fail to reach it. I’m still finding bugs in mission-critical K&R C.
|
cc/2021-04/en_middle_0071.json.gz/line3085
|
__label__wiki
| 0.699168
| 0.699168
|
Content printed form Havas - The Download - https://dare.havas.com/behind-the-work/the-power-of-one/
Behind the Work
Patricia Murphy
Havas Milan and Coop’s latest campaign takes viewers on a journey through the eyes of a determined shopping cart.
"There are issues and battles we just can’t fight alone and it’s only by fostering collective awareness that you can aim at such goals"
Can responsible grocery shopping change the world? Havas Milan and Coop certainly think so. The Italian supermarket’s latest campaign showcases the power of individuals in the global movement for change. The “Shopping Can Change the World” message is portrayed through a powerful modern-day fairy tale, which follows a strong-willed Coop grocery cart as it breaks free and embarks on an epic journey to tackle some of the greatest challenges facing our generation. Giovanni Porro, Chief Creative Officer of Havas Milan, talks about the emotive campaign that champions Coop’s commitment to safeguarding the planet and the people and animals that inhabit it.
How did the concept of this campaign form and why was the shopping cart chosen as the main protagonist?
The idea that “Good Shopping Can Change the World” is what first shaped this campaign. Looking at this sentence on a white slide felt like something magnificent. It’s a strong, inspiring line, born from what Coop concretely does every day. In this campaign, we matched this idea with some contemporary issues that are becoming more and more urgent to our society. A whole generation is taking over the world to remind us of their desire for a different future, and grocery shopping is one of the ways we can have a positive impact on change.
The shopping cart idea came at the second stage of concept development. We were looking for a strong symbol that could represent both Coop’s commitment and the consumers’ common feeling. We needed a memorable protagonist that was able to make us passionate about its adventures.
The campaign took a subject as serious as climate change and told Coop’s story in a playful way—what was the thinking behind this decision?
What led us in this direction was Coop’s DNA. Coop is, in many ways, a brand ahead of its time. It started pursuing sustainability, labor rights, and food safety long before these issues became trending topics. With its actions, Coop has often anticipated behaviors that are now required by law. The risk, in these cases, is to sound like someone who’s bragging about their achievements and, as we know, generally, “Mr. Perfects” are not very well loved. So, we decided to narrate Coop’s big commitment in an entertaining way, to try to engage people through emotions.
"What we absolutely wanted was to give this cart a real soul and to make it more human"
How does the video highlight Coop’s brand mission and values?
The video shows some of the areas of Coop’s commitment. One is, for instance, reduction of plastic in packaging and the decision to avoid including microplastics in products. Another is the welfare of farm animals, along with labor rights, especially in agriculture. Also, Coop’s commitment to lowering the amount of pesticides and their alignment with the fight against deforestation. In our institutional video, we tried to touch on as many sides of Coop’s commitment as possible.
The Family’s Vincent Lobelle directed the story—how did his involvement elevate the campaign?
We chose Vincent for two reasons. The quality of his reel was impressive, of course, especially in terms of CGI mastery. But, even more than that, he has the ability to always convey emotion. What we absolutely wanted was to give this cart a real soul and to make it more human. The coin scene with the two little girls, for example, was Vincent’s idea: a cart interacting with two kids, acting just as if it were human. The small details that elevate the audience’s final feeling.
The video starts off small and builds to an epic finale. Tell us a little about the production process. Where did you film scenes for the ad and what was involved in digitally creating scenes such as the ones in the depths of the ocean and in the Antarctic?
We spent five days shooting and about 50 post-producing. We filmed the beach, countryside, and supermarket scenes in Tuscany. It required an interesting mix of techniques. When possible, we used a real cart moved by ropes, or by a remote-controlled motor, or propelled by a quad. In scenes such as that with the whale, or the train journey, we pasted the cart in CGI onto pre-existing material. The Antarctic scene is 100% digital.
The shopping cart shows how the power of one can inspire many; was this a key goal of the campaign?
There are issues and battles we just can’t fight alone. It’s only by fostering collective awareness that you can aim at such goals. We expressed this concept that a coalition of carts would act as one as they begin to follow their leader.
Climate change is extremely topical; why did Havas Milan think it was important for Coop to align itself with this movement?
Coop is a new client to Havas Milan. Of course, we knew climate change was important from the consumers’ perspective. But as we started to study Coop as consultants, something became immediately clear. It wasn’t us who suggested Coop joining the movement for the protection of our planet; it was rather in Coop’s story itself. The contemporary ideas that form its sustainable philosophy are completely in line with the current trending topics. The challenge was to find the courage to state something important. And then, of course, to find the right storytelling that struck the right notes. We hope we achieved that.
Senior Editor and Writer
Patricia Murphy joined Havas Group in October 2019 as a Senior Editor and Writer. She has a background in digital journalism and content creation.
A Song in the Key for Life
Havas London empowers the ocean to clean itself
The Worst Song in the World
Might be catchier than you think.
Advertising by Day, Author by Night
Havas North America’s Tim Maleeny on the release of his fifth novel and how he juggles his career in advertising with his passion for storytelling.
Havas Media’s Jamie Seltzer on the group’s Femmes Forward program and how it pushed her into a new, exciting role.
|
cc/2021-04/en_middle_0071.json.gz/line3087
|
__label__cc
| 0.624211
| 0.375789
|
Video: Beto Campaign Appears to Illegally Spend Funds on Supplies for Caravan Aliens — ‘Nobody needs to know’
Joe Newby November 3, 2018
On Thursday, Project Veritas posted a damning video in which the campaign of far-left Democrat Robert ‘Beto’ O’Rourke appears to be illegally spending funds on supplies for the illegal migrant caravans winding their way to the United States.
According to Project Veritas:
Featured in this report are campaign staffers who work on Congressman O’Rourke’s US Senate campaign discussing how they use campaign resources to help Honduran aliens and transport them to airports and bus stations. Said Dominic Chacon and AnaPaula Themann, who work on O’Rourke’s campaign:
Chacon: “The Hondurans, yeah… I’m going to go get some food right now, like just some stuff to drop off…”
Themann: “How did they get through?”
Chacon: “Well I think they accepted them as like asylum-seekers… So, I’m going to get some groceries and some blankets…”
Themann: “Don’t ever repeat this and stuff but like if we just say that we’re buying food for a campaign event, like the Halloween events…”
Chacon: “That’s not a horrible idea, but I didn’t hear anything. Umm, we can wait until tomorrow for that.”
Themann: “Well that’s exactly the food we need. And I will just mark it as, I do have dozens of block walkers.”
Using “pre-paid credit cards” … “some sort of violation”
A Project Veritas Action attorney reviewed the footage and assessed:
“The material Project Veritas Action Fund captured shows campaign workers covering up the true nature of spending of campaign funds and intentionally misreporting them. This violates the FEC’s rules against personal use and misreporting. It also violates Section 1001, making a false statement to the federal government. The FEC violations impose civil penalties, including fines of up to $10,000 or 200 percent of the funds involved. Violations of Section 1001 are criminal and include imprisonment of up to five years.”
“Nobody needs to know,” one staffer said. “Don’t ever repeat this,” another campaign staffer added.
O’Rourke is running for the U.S. Senate from Texas against Republican Ted Cruz.
Veritas says this is the eighth video in a series exposing illegal and unethical conduct by political campaigns.
Courtesy of Conservative Firing Line
Joe Newby
Why People Are Upset: It Took Congress 9 Months to Send $600 But Only 6 Days to Impeach Trump
Democrats are now moving quickly to reclassify conservative dissent as “domestic terrorism”
|
cc/2021-04/en_middle_0071.json.gz/line3090
|
__label__wiki
| 0.704069
| 0.704069
|
Wisconsin Republican Still Pushing Transgender Bathroom Bill
More hate and fear!
By Chris capper Li...
When North Carolina Republicans passed their hateful HB2 law, Attorney General Loretta Lynch pulled no punches in stating that it violated the Civil Rights Act.. Shortly thereafter, President Barack Obama made Republican heads explode when he issued a letter of guidance saying that public schools could not discriminate against transgender people.
On top of all that, the state has lost billions of dollars in tourism and new business who said that they want nothing to do with a state that would pass this type of law.
But all that did not slow down the hate and bigotry in Wisconsin. Republican State Representative Jesse Kremer has said that he is planning on re-introducing his own transgender bathroom bill:
Kremer introduced a similar bill during the last legislative session, but it died in committee.
He said the administration's letter doesn't change anything in his eyes. He also said he's not sure whether electing a Republican president would guarantee a rollback of the guidelines, noting that likely GOP nominee Donald Trump has previously said transgender people should use the bathroom in which they are most comfortable. In response to Obama's letter, Trump said states should decide the issue.
Kremer said he's most concerned not with bathrooms, but with locker rooms and changing facilities. He said he'll wait and see what happens in other cases throughout the country before determining how to move forward with his legislation
Kremer's bill has the backing of the right wing hate group Wisconsin Family Action, whose leader, Julaine Appling, worked hand in hand with Kremer in crafting the bill. This is noteworthy because Appling herself is a confirmed bachelorette who has been living together for years with another unmarried woman, but I'm sure that means nothing and really isn't our business (sips tea).
While it might be a little mind-boggling and unbelievable that Kremer would come out with this now, but it really isn't surprising. Kremer is up for reelection this year. And since he can't run on job creation, improving the economy, making education better or anything else that most people care about, all he has left is the old Republican stand by - hate and fear.
Bigotry, Jesse Kremer, Transgender bathroom bill, Wisconsin
WI Republican Lawmaker Renews War On Women
Kremer: Women should just reverse those abortions
WI Republican: 'I Would Be Tempted To Be A Pervert'
Bigotry because of perversion!
Wisconsin Lawmakers Battle Over Orlando
Racist does some whitesplainin'.
WI Republican Proposes Jim Crow Diet For The Poor
WI State Rep. Jesse Kremer proposes photo ID, separate stores for people on food stamps
Scott Walker And The Right-To-Bigotry Law
Walker shorter: Silly protesters, protections are for businesses, not people!
|
cc/2021-04/en_middle_0071.json.gz/line3091
|
__label__cc
| 0.552082
| 0.447918
|
Why isn't it simple to count the number of words in a regular language?
Given a DFA, A, let L(A) denote the number of words A accepts. I think it's easy to calculate L(A): Translate the encoding of A into a regular expression. If the Kleene star appears anywhere in the expression - the language is infinite. Else: Go through and count all the combinations of words that are possible to make using the expression (basically if there is a + operator on the expression, multiply the amount of legal words by the amount of strings connected by the +..)
Is this wrong? Thanks in advance
regular-languages automata regular-expressions
$\begingroup$ $\varepsilon^*$ isn't an infinite language. $\endgroup$ – David Richerby Mar 10 '17 at 17:43
$\begingroup$ cstheory.stackexchange.com/q/8200/5038 $\endgroup$ – D.W.♦ Mar 10 '17 at 19:42
Yep, this is wrong, because of ambiguity.
Consider the following language: $(a + aa) + a(a + \epsilon)$.
With your method, we see 4 words, $a, aa, aa, a$. But we have duplicates! There are multiple ways to make the same word within the given regular expression.
A better method is to use dynamic programming on an minimal DFA for your language, with no "dead" states. If the minimal DFA is cyclic, the language is infinte, so we can assume there's no cycles. Using a DFA is key, because the determinism means there's exactly one path through the DFA for each word.
What you do is build up a recurrence for the number of words that end at a given state:
1 words ends at the start state: $\epsilon$
For each state $q$, the number of words ending there is the sum of the number of words ending at each state with a transition into $q$.
The total number of words is then the sum of the number of words ending at each final state.
jmitejmite
$\begingroup$ It bears noting that these recurrences can always be solved by computer algebra, e.g. for the generating functions. So yea, regular language are actually easy to count. $\endgroup$ – Raphael♦ Mar 10 '17 at 19:54
Complementing jmite's answer, it is not too difficult to compute the number of words in a regular language, using the "transfer matrix" method. This is the same as jmite's dynamic programming, but the technique has further applications such as asymptotic enumeration.
Given a DFA, construct a $Q\times Q$ matrix $M$ (where $Q$ is the set of states) in which $M(i,j)$ is the number of letters that cause the DFA to move from state $j$ to state $i$. Let $1_{q_0}$ and $1_F$ be the indicators for the initial state and for the accepting states, respectively. Finally, let $n = |Q|$.
The number of words of length $m$ is $c_m := 1_F M^m 1_{q_0}$. Compute $c_m$ for $0 \leq m < 2n$. If $c_n + \cdots + c_{2n-1} > 0$ then the language accepted by the DFA is infinite. Otherwise, the number of words in the language is $c_0 + \cdots + c_{n-1}$.
(When computing powers of $M$, care must be taken regarding the magnitude of the entries, which is exponential in $m$. Since their size is only polynomial, the resulting algorithm runs in polynomial time.)
$\begingroup$ I love this approach. I've also found that computing the eigenvalues of $M$ actually correspond to the roots of the denominator in the generating function approach, and that, perhaps unsurprisingly, these eigenvalues are invariant to DFA minimization. However, I have absolutely no idea how to correctly interpret this. $\endgroup$ – Lee Mar 10 '17 at 19:01
$\begingroup$ This is not so surprising, given that the generating function is $P(z) = \sum_{n=0}^\infty 1_F M^n 1_{q_0} z^n$, which simplifies to $P(z) = 1_F (I-zM)^{-1} 1_{q_0}$. You can get an even more explicit result by redoing this calculation using the Jordan form of $M$, which features the eigenvalues. $\endgroup$ – Yuval Filmus Mar 10 '17 at 19:04
Actually, you can still derive counting formulas for unambiguous regular expressions with Kleene stars within.
Given the inductive definition of a regular expression as: $$ \begin{equation*} e \in \mathrm{Re} := x \in \Sigma \mid e_0 ~ e_1 \mid e_0 + e_1 \mid e^* \end{equation*} $$
Consider the following translation $[\![\cdot]\!] : \mathrm{Re} \to \mathbb{C}(z)$ that takes a regular expression and translates it into a complex-valued rational function:
$$ \begin{align*} [\![x \in \Sigma]\!] &= z \\ [\![e_0 ~ e_1]\!] &= [\![e_0]\!] \times [\![e_1]\!]\\ [\![e_0 + e_1]\!] &= [\![e_0]\!] + [\![e_1]\!]\\ [\![e^*]\!] &= \frac{1}{1 - [\![e]\!]} \end{align*} $$
We can show that this translation returns a rational expression by doing structural induction on $e$, and noting that all of the operations used on the right-hand side preserves rational-ness.
Suppose that the regular expression $e$ that we put in is unambiguous, then we would find that the rational function denoted by $[\![e]\!] \in \mathbb{C}(z)$ is actually the generating function for the family of words that are accepted by the language underlying $e$, ranked by their length.
For example, consider the language $(a^*b)^*$, which defines the language of runs of $a$ delimited by $b$. Now, this regular expression is unambiguous, so we can run our translation trick:
$$ \begin{align*} [\![(a^*b)^*]\!] &= \frac{1}{1 - [\![a^*b]\!]} \\ &= \frac{1}{1 - ([\![a^*]\!] \times [\![b]\!])} \\ &= \frac{1}{1 - \left(\frac{1}{1 - [[a]]} \times z\right)} \\ &= \frac{1}{1 - \frac{z}{1 - z}} \\ &= \frac{1}{2} + \frac{1}{2 - 4 z} \end{align*} $$
As it turns out, given the above generating function, its coefficient extraction will be $$ [z^n][\![(a^*b)^*]\!] = 2^{n - 1} + \frac{\delta\left(n\right)}{2} $$ where $$ \delta(n) = \begin{cases} 1 & \text{if } n = 0 \\ 0 & \text{otherwise} \end{cases} $$
In fact, since our translation $[\![\cdot]\!]$ generates rational functions, we can use a partial fraction decomposition to create an enumeration formula for any unambiguous regular expression.
Suppose you have a irreducible rational function $$ r(z) + \frac{p(z)}{q(z)} $$ where $r, p, q$ are polynomials, then you can decompose this into $$ r(z) + \frac{C_0}{z - q^*_0} + \dots + \frac{C_n}{z - q^*_n} $$ where $q^*_k$ are the roots of $q(z)$. There's a bit of technical corner-cases (like multiplicity of roots, etc), but it's relatively easy to do coefficient extraction on the expression above: $$ [z^n] \frac{C}{z - q^*} = C \times {q^*}^{-n} $$
In fact, the partial fraction decomposition generalize to multivariate rational functions, so you can actually construct counting formulas for queries such as "How many words are there where there are $n$ as and $m$ bs?"
Unfortunately, the extent to which this method will be useful ends when you have an ambiguous expression.
Not the answer you're looking for? Browse other questions tagged regular-languages automata regular-expressions or ask your own question.
Count the unique subsequences
Calculate the number of distinct permutations of length n in the closure of a language
What is the density of a regular language $L$ over an alphabet $\Sigma$ in $\Sigma^n$?
How to calculate the number of invalid strings given a constraint system on alphabet, word blacklist, and string length
Number of words in the regular language $(00)^*$
Possessive Kleene star operator
Why the language of unary primes isn't regular
Subset of a regular language, for each of whose words there exists an element with the same number of 1s in the other regular language
Equivalence of states between two “quasi-deterministic” strongly connected Büchi automata accepting the same $\omega$-language
Why is this language a regular language?
|
cc/2021-04/en_middle_0071.json.gz/line3093
|
__label__wiki
| 0.523723
| 0.523723
|
Early Algebraic Language and the Algorithm: Preparing an Art of Thinking for People and Machines
Giovanna Cifoletti
Professor at the School for Advanced Studies in Social Research (EHESS)
Please join us on Friday, November 22nd at 12:00 pm in 442 Stephens Hall for a presentation and luncheon with Giovanna Cifoletti. Al Kwarizmi, the name at the origin of the word algorithm, was a very productive Persian mathematician of the early ninth-century. He wrote two crucial books, one on arithmetic and one on algebra. The first became the basis of a genre of books (in Arabic, Hebrew and later Latin) called algorismus and teaching how to calculate the four operations with Indo-Arabic digits instead of the abacus. The second was the first book of algebra articulated into a discipline, with a systematic presentation of solution procedures expressed on numbers, and geometrical proofs. Arabic algebraic notation became stable with the works of the Berberian mathematician Al Qalasadi (1312-1486): algorismus and algebraic notation combined to a plan of connecting all mathematical sciences and arts of the time became the ambitious program of « solving all problems », as Viète would say in 1591. Algorithm was born, and started its process of development until the twenty-first century. Of this long development I shall choose a moment at the culminating period of the printing press in Venice, from Luca Pacioli (1594) to Niccolo’ Tartaglia (1557). These mathematicians have been particularly influential and also quite explicit in their mathematical projects of identifying algebra with an art based on a common language to express all sorts of problems and solutions in mathematics.
Please RSVP here by Wednesday Morning, November 20th to receive the reading and sign up for lunch.
*Please note the time and location of this event has been changed
|
cc/2021-04/en_middle_0071.json.gz/line3094
|
__label__wiki
| 0.504662
| 0.504662
|
Inmate #1: The Rise of Danny Trejo
Clare Lowe June 22, 2020 FeaturedFilmFilm Reviews
Danny Trejo has become something of a cult icon in the past decade. Appearances in films like Heat, Desperado and Con Air made him a recognisable face in the ‘man’s man film’ realm.
In this documentary we meet the man behind the face, learning of his tough childhood in Pacioma, LA, which led to heroin abuse at a young age and came hand in hand with violent crime and jail time. The main focus of the film appears at first to be a redemption story, and an impressive one at that. After an early life spent in and out of prison, Trejo finally gets out and changes his life around. He becomes a councillor and through that, and some fortunate meetings, a successful and highly prolific actor.
It’s distracting that a large amount of time is spent telling escalating tales of how tough Trejo was, with talking heads that very much teeter on the tightrope of glorifying his escapades. The problem with a redemption story is that it’s all too common for the struggles of the past to be glorified, with the recovery becoming secondary. This is what happens during Inmate #1. Although Trejo himself does the common PTSD reaction of laughing when retelling his experiences, you can tell the pain and the guilt that has built up within him and he comes across as a man grateful for his experiences as they give him perspective on how great his life has become. The documentary doesn’t go too far into what he actually did to end up in prison, glossing over it and putting the blame on an uncle that was a very dangerous influence on him.
Too many details are skipped in this documentary; how Trejo went clean is a one sentence story, and we don’t learn anything about how the pressure of masculinity in prison led him to get more and more violent. The filmmakers seem entirely interested in painting the picture of a ‘tough’ guy gone soft rather than making a statement, which seems like a wasted opportunity. Trejo, with his charity work, counselling experience and recovery, could be the perfect tale of the power of rehabilitation in a country with a failing prison system, but instead it feels a little bit like a ‘men and motors’ version of a hallmark channel daytime film.
Inmate #1: The Rise of Danny Trejo is available on digital platforms from 22 June 2020
Sparks Fly Between Will Smith & Margot Robbie In New ‘Focus’ Trailer
Natalie Xenos October 10, 2014
Grace Of Monaco Review
James McAllister June 7, 2014
The brilliance of Westworld Season 1
Jerome Cox-Strong December 10, 2016
Much Ado About Nothing – Berlin Film Festival Review
James McAllister February 22, 2016
Marvel’s Runaways Episode 4 Review: ‘Fifteen’
Matt Mallinson May 3, 2018
The Death of Stalin Review
|
cc/2021-04/en_middle_0071.json.gz/line3096
|
__label__wiki
| 0.815682
| 0.815682
|
Items Watching The Flight.
Watching The Flight.
Costume -- 1901s -- Men
Shelf locator: PC COSTU-190-Me
Men -- Clothing & dress -- 1900-1909
Shoes -- 1900-1909
Suits (Clothing) -- 1900-1909
Staffs (Sticks) -- 1900-1909
Bowler hats -- 1900-1909
Content: Written on border: "1908" Printed on border: "Arthur Schneider, New York City" Stamped on verso: "Library of Congress two copies received Aug. 22, 1908 copy B" Written in stamp: "67986"
Extent: 1 print : b ; 31 x 25 cm. (12 x 10 in.)
Universal Unique Identifier (UUID): 8eabe1c0-c547-012f-85a4-58d385a7bc34
The Miriam and Ira D. Wallach Division of Art, Prints and Photographs: Picture Collection, The New York Public Library. "Watching The Flight." The New York Public Library Digital Collections. https://digitalcollections.nypl.org/items/510d47e0-ee69-a3d9-e040-e00a18064a99
The Miriam and Ira D. Wallach Division of Art, Prints and Photographs: Picture Collection, The New York Public Library. "Watching The Flight." New York Public Library Digital Collections. Accessed January 18, 2021. https://digitalcollections.nypl.org/items/510d47e0-ee69-a3d9-e040-e00a18064a99
The Miriam and Ira D. Wallach Division of Art, Prints and Photographs: Picture Collection, The New York Public Library. Watching The Flight. Retrieved from https://digitalcollections.nypl.org/items/510d47e0-ee69-a3d9-e040-e00a18064a99
<ref name=NYPL>{{cite web | url=https://digitalcollections.nypl.org/items/510d47e0-ee69-a3d9-e040-e00a18064a99 | title= (still image) Watching The Flight.|author=Digital Collections, The New York Public Library |accessdate=January 18, 2021 |publisher=The New York Public Library, Astor, Lenox, and Tilden Foundations}}</ref>
|
cc/2021-04/en_middle_0071.json.gz/line3101
|
__label__wiki
| 0.533984
| 0.533984
|
12:00 AMNCIS
Motorcyclist Killed, Hit Multiple Times On US-23
Filed Under:accident, Fatal Accident, Hartland Township, hit and run, motorcycle, motorcycle accident, US 23, white lake township
(credit: ThinkStock)
WHITE LAKE TWP. (WWJ) – A White Lake Township man was killed after apparently losing control of his Honda motorcycle in Hartland Township.
It happened at around 10 p.m. Wednesday along southbound U-S-23 on Crouse Road, north of Hartland High School.
Police said Christopher Muncy, 53, was ejected when he lost control and landed in the left lane of the freeway, where he was hit by a car. Several other vehicles continued to strike Muncy as he lay in the road, officers said — but no one stopped and waited for police.
Based on parts found at the scene, police said the vehicle that initially struck Muncy was a grayish or light blue Mercury that was possibly an older model Grand Marquis. The vehicle has significant front end damage and is missing the silver Mercury grill, officers said.
A woman was seen exiting a car that had initially stopped at the scene, but was gone by the time EMS arrived.
Anyone with information about the vehicle described above is asked to contact Crime Stoppers at 1-800-SPEAK-UP or Deputy Brad Neff with the Livingston County Sheriff’s Department Traffic Safety Bureau at 517-540-7984.
|
cc/2021-04/en_middle_0071.json.gz/line3114
|
__label__cc
| 0.544571
| 0.455429
|
Covid 19 Spreading Rapidly Louisville City Stepping Safety Measures
During the city’s update on COVID-19 in Louisville today, Mayor Greg Fischer and Public Health and Wellness Director Dr. Sarah Moyer stated that with Louisville’s COVID-19 case counts significantly increasing, extreme action is needed by everyone to stop the spread.
Jefferson County has surpassed 2,000 weekly COVID positive cases in the past two consecutive weeks.
Voicing her concerns of the city nearing record highs of COVID spread, Dr. Moyer said, “I want to make this clear: everyone in our community is at risk for catching COVID-19 or spreading it to your friends, family or coworkers if you let your guard down.
“We must renew and strengthen our commitment to fight this virus together. I know so many of you are doing the right thing. You have been sacrificing to protect yourselves but also because you care about others. Please don’t give up the fight. Stay strong. We can do this. But it will take all of us.”
“COVID-19 is a threat to our community, and it’s a threat that each of us need to take more seriously than we have been,” said Mayor Fischer. “We are in the ‘red zone’ again this week. As we look ahead to the holidays and family gatherings, we have to factor COVID-19 into our plans, or we are potentially putting ourselves and our families in serious danger.”
Here are the key data metrics for the week of November 10:
There were 2,300 new cases over the previous week.
Louisville’s rolling two-week average positivity rate is at 6.8 percent.
Hospitalization data:
16% of patients currently hospitalized have COVID-19.
66 patients in ICU with COVID-19 as of November 10, an increase from 58 the week prior.
40 COVID-19 patients on ventilators as of November 10, compared to 34 last week.
COVID-19 cases are in every Louisville ZIP code, with nearly all at the red alert level.
Largest increase in cases remains in those ages of 15-34.
Given the high level of community spread, any interaction with members outside your household leaves you at greater risk of bringing an infection home. Once one person is infected in a household, they are likely to spread it to other members.
As the amount of COVID spread in the community continues on an upward trajectory, Dr. Moyer issued her recommendations on how residents must adapt to break the chain of transmission. They included reducing all contact with people who you do not live with including refraining from attending bars, events such as parties, weddings, funerals, sports practices and other gatherings.
“Simply put, in order to stop COVID-19 from spreading so rapidly, we need to severely limit where we go and who we are around,” she said. “With the record number of cases weekly, no indoor activity is safe from COVID.”
Updated Compliance Strategy
Due to the uncontrolled outbreak and increasing spread of COVID-19 cases across Jefferson County, Louisville Metro Public Health and Wellness is expanding compliance and enforcement activity across Louisville.
“We want our community to know we are taking it seriously. COVID is the primary concern that we have in our community that is affecting our public health right now,” said Nick Hart, Environmental Health Manager.
According to Hart, environmentalists will quadruple the amount of time spent during evening, late-night and weekend surveillance, focusing on peak operation hours. Hart noted these are crucial periods where large numbers of people often congregate in shared spaces.
Additionally, inspectors will be observing businesses that are serving the public on a regular basis. Businesses will not know who is in attendance conducting surveillance, but could get a follow-up email or phone call afterward if a violation is observed.
“We’re not trying to disrupt businesses, but we are trying to get a realistic idea of what it looks like during the times we see people out in our community,” he said.
Hart said Public Health and Wellness plans to publish a violation list on its website for the public to see who is not complying with Healthy at Work or face-covering guidelines.
COVID Care Kits aim to alleviate stress for those in self-isolation
The Department of Public Health and Wellness Center for Health Equity has been working to increase support for residents affected by the virus.
Rebecca Hollenbach, Executive Administrator at the Center for Health Equity, said asking people to partake in new behaviors like self-isolating for 10 days or more can prove difficult.
To improve that experience, care kits are being distributed to individuals in Jefferson County who have tested positive and in the city’s contact tracing system. Care packages include educational resources, medical resources and items for self-care.
“This is a gift of support from us to you to thank you for everything you’re doing to help keep yourself, your family and your community safe,” Hollenbach said.
First Responder Data
Currently, 116 members of LMPD, Louisville Fire, Metro EMS, Metro Corrections and the Sheriff’s Office are off-duty due to COVID-19:
54 are off with positive tests and in self-isolation
34 are off and quarantined due to exposure to someone who tested positive
28 are off with symptoms, pending test results
Positive test numbers for first responders/public safety since the incident began:
322 positive tests
269 have fully recovered and returned to duty
Metro Corrections inmate data:
Total Tested = 4040
Total Positive = 251
Total Recovered = 236
Total currently under medical isolation = 15
Total pending = 0
To view the entire COVID-19 weekly update with Public Health officials click here. The city’s COVID-19 data dashboard, a complete list of COVID-19 testing sites, information on symptoms, prevention and contact tracing can be found at www.louisville.gov/covid19. The LOU HEALTH COVID19 Helpline is also available: 502- 912-8598.
Test New Page_01132021163306 Edited
Test New Page_12222020103353
|
cc/2021-04/en_middle_0071.json.gz/line3116
|
__label__wiki
| 0.518442
| 0.518442
|
Hyper-Local Ad Network Chalkboard Helps Stores Increase Walk-In Traffic
Serkan Toto @serkantoto / 10 years
Mobile advertising continues to be a hot topic, with new startups cropping up everywhere lately. And now we have South East Asia- and US-based Chalkboard throwing its hat into the ring, a hyper-local mobile ad network for brick-and-mortar stores that want to increase their walk-in traffic.
Chalkboard’s goal is to boost the relevance of mobile ads, by bringing promotions to potential customers when they’re near the store. The way it works is extremely simple: business owners hoping to drive footfall traffic can let Chalkboard place targeted ads or real-time promotions in mobile apps (developers can integrate ads via a customizable API).
Setting up an account and entering a 160-character text for a promotion is enough to have it instantly appear in apps that are part of the Chalkboard ad network. The promotions then show up on the cell phone screen automatically when shoppers are within 1km or 1 mile of a store (when they are much more likely to actually walk in and make a purchase).
Users can click on the ads to view the promotion, access maps/directions or share the information with their friends on Twitter and Facebook. Here’s how an ad/promotion delivered via Chalkboard typically looks:
Customer heat map around a store:
Business owners can run an unlimited number of promotions (sent in via the dashboard, Twitter or SMS) to an unlimited number of users for a flat fee, which starts at $0.99 per day.
And the Chalkboard concept seems to work: the eponymous company says in 6 months, it has attracted 1,373 businesses in Singapore (via a combination of local retailers, shopping malls and credit card companies) and 1,170 businesses in Kuala Lumpur, Malaysia (where operations will start next month).
Chalkboard received an investment from Joi Ito’s Singapore-based Neoteny Labs fund and now plans to expand its operations to the US, right after SXSW 2011.
For the US market, Chalkboard says it already has a number of mobile app developers signed up to be part of the network. Most notably, the company has teamed up with Oecoway, maker of the popular Facebook app Friendly for the iPad (ads and promotions will be integrated in Friendly’s “Places” function soon).
See below for early screenshots:
Here’s the official Chalkboard company video:
|
cc/2021-04/en_middle_0071.json.gz/line3117
|
__label__cc
| 0.748051
| 0.251949
|
CIA: How to Destroy Companies
How corporate staff inadvertently destroy organizations from the inside using techniques from a declassified CIA sabotage field manual.
No Comments on CIA: How to Destroy Companies
During World War 2, the OSS (precursor to the CIA) created a manual to help its spies break down the efficiency and morale of enemy organizations.
The targets of these sabotage efforts were anything from strategic military planning departments to armaments manufacturers. The intent was to weaken the operational efficiency of organizations supporting the enemy’s war effort.
These sabotage techniques weren’t what you’d typically see in the movies – they didn’t require bombs or guns. Instead, the techniques used subtle behavioural ploys to slow decision making and progress. The techniques were as simple as asking irrelevant questions or seeking consensus where none was required. These techniques didn’t raise suspicion, because they simply spread bad business practices masquerading as productive work.
Subscribe to Dumbwealth
I’ve provided the list of techniques directly from the manual below. As you read through the list, what you’ll notice is that many of these sabotage techniques are things that happen every day in modern bureaucratic businesses.
Ever wonder why it’s so hard to get anything done at work?
Most people working in businesses today aren’t purposely trying to create inefficiencies. Yet, many people – including senior leadership – purposely behave in ways that align with the CIA’s suggestions for killing efficiency.
I believe this is because few people running businesses today pay attention to the actual science of running a business.
To get to their position, many leaders simply rose through the ranks after starting as functional experts with no real management training. While many of these people eventually get formal training, unfortunately business schools and corporate training programs do a poor job of actually teaching people how to run companies.
Consequently, many leaders go with their gut instead of their head. A combination of charisma, confidence and cunning make these leaders appear highly competent. The honest truth is in most bureaucracies it’s the blind who lead the blind. Few really know what they’re doing.
When you manage a business using your gut, you go with what feels right. Does it feel like work? Is it challenging? Does it involve a lot of people in high positions? We’re accustomed to equating these things with progress.
Corporate leaders and management inadvertently destroy their companies by adopting behaviours that feel like work, yet actually slow down their organizations.
Striving for consensus, doing everything by the book, creating committees, making speeches and haggling over minutia feel like the right things to do. However, you can spend 10 hours a day doing that stuff without actually moving the business forward.
Because many of these behaviours are ingrained in many corporate cultures, it takes intelligent, conscientious and honest leaders to cut activities that feel important to everyone yet produce nothing. Once indoctrinated into the corporate culture, these behavioural patterns are very difficult to change. This is why large companies can slowly drift right into an iceberg everyone sees coming from miles away.
For example, how can the big 5 Canadian banks – which essentially provide commoditized products and services – have varying degrees of success with some trading at persistent valuation discounts lasting years? It’s because the laggards have allowed corporate culture to fester into a gangrenous nightmare. This is not to say people hate working there, but that the culture supports (even enforces) inefficient and ineffective business practices.
If you want to build or lead an effective organization, I suggest reading the excerpt from the Simple Sabotage Field Manual below and doing the opposite.
I’ve pasted an image of the original text from the actual manual. If you find that difficult to read, I’ve also included the full copy below.
(Source: “Simple Sabotage Field Manual“)
(11) General Interference with Organizations and Production
(a) Organizations and Conferences (1) Insist on doing everything through “channels.” Never permit short-cuts to be taken in order to expedite decisions.
(2) Make “speeches.” Talk as frequently as possible and at great length. Illustrate your “points” by long anecdotes and accounts of personal experiences. Never hesitate to make a few appropriate “patriotic” comments.
(3) When possible, refer all matters to committees, for “further study and consideration.” Attempt to make the committees as large as possible — never less than five.
(4) Bring up irrelevant issues as frequently as possible.
(5) Haggle over precise wordings of communications, minutes, resolutions.
(6) Refer back to matters decided upon at the last meeting and attempt to re-open the question of the advisability of that decision.
(7) Advocate “caution.” Be “reasonable” and urge your fellow-conferees to be “reasonable” and avoid haste which might result in embarrassments or difficulties later on.
(8) Be worried about the propriety of any decision — raise the question of whether such action as is contemplated lies within the jurisdiction of the group or whether it might conflict with the policy of some higher echelon.
(b) Managers and Supervisors
(1) Demand written orders.
(2) “Misunderstand” orders. Ask endless questions or engage in long correspondence about such orders. Quibble over them when you can.
(3) Do everything possible to delay the delivery of orders. Even though parts of an order may be ready beforehand, don’t deliver it until it is completely ready.
(4) Don’t order new working materials until your current stocks have been virtually exhausted, so that the slightest delay in filling your order will mean a shutdown.
(5) Order high-quality materials which are hard to get. If you don’t get them argue about it. Warn that inferior materials will mean inferior work.
(6) In making work assignments, always sign out the unimportant jobs first. See that the important jobs are assigned to inefficient workers of poor machines.
(7) Insist on perfect work in relatively un important products; send back for refinishing those which have the least flaw. Approve other defective parts whose flaws are not visible to the naked eye.
(8) Make mistakes in routing so that parts and materials will be sent to the wrong place in the plant.
(9) When training new workers, give in complete or misleading instructions.
(10) To lower morale and with it, production, be pleasant to inefficient workers; give them undeserved promotions. Discriminate against efficient workers; complain unjustly about their work.
(11) Hold conferences when there is more critical work to be done.
(12) Multiply paper work in plausible ways. Start duplicate files.
(13) Multiply the procedures and clearances involved in issuing instructions, pay checks, and so on. See that three people have to approve everything where one would do.
(14) Apply all regulations to the last letter.
(c) Office Workers
(1) Make mistakes in quantities of material when you are copying orders. Confuse similar names. Use wrong addresses.
(2) Prolong correspondence with government bureaus.
(3) Misfile essential documents.
(4) In making carbon copies, make one too few, so that an extra copying job will have to be done.
(5) Tell important callers the boss is busy or talking on another telephone.
(6) Hold up mail until the next collection.
(7) Spread disturbing rumors that sound like inside dope.
(d) Employees
(1) Work slowly. Think out ways to in crease the number of movements necessary on your job: use a light hammer instead of a heavy one, try to make a small wrench do when a big one is necessary, use little force where considerable force is needed, and so on.
(2) Contrive as many interruptions to your work as you can: when changing the material on which you are working, as you would on a lathe or punch, take needless time to do it. If you are cutting, shaping or doing other measured work, measure dimensions twice as often as you need to. When you go to the lavatory, spend a longer time there than is necessary. Forget tools so that you will have to go back after them.
(3) Even if you understand the language, pretend not to understand instructions in a foreign tongue.
(4) Pretend that instructions are hard to understand, and ask to have them repeated more than once. Or pretend that you are particularly anxious to do your work, and pester the foreman with unnecessary questions.
(5) Do your work poorly and blame it on bad tools, machinery, or equipment. Complain that these things are preventing you from doing your job right.
(6) Never pass on your skill and experience to a new or less skillful worker.
(7) Snarl up administration in every possible way. Fill out forms illegibly so that they will have to be done over; make mistakes or omit requested information in forms.
(8) If possible, join or help organize a group for presenting employee problems to the management. See that the procedures adopted are as inconvenient as possible for the management, involving the presence of a large number of employees at each presentation, entailing more than one meeting for each grievance, bringing up problems which are largely imaginary, and so on.
Subscribe to DumbWealth to get the latest on income investing, corporate life and wealth creation:
US Companies That Actually Raised Dividends Last Month
8 Recent Dividend Raises by Canadian Companies
40 S&P 500 Companies Raised Dividends During the Covid-19 Crisis
Tags Productivity, Work
← 8 Recent Dividend Raises by Canadian Companies → Why Invest in Dividend Stocks
|
cc/2021-04/en_middle_0071.json.gz/line3119
|
__label__cc
| 0.650793
| 0.349207
|
Athens Heritage Lions Club
Athens, Georgia - United States
District 18-I
1st Thursday at Noon & 3rd Thursday at 6:00 P.M.
145 Barrington Drive, Athens, GA 30605
Lions have a dynamic history. Founded in 1917, we are best known for fighting blindness, but we also volunteer for many different kinds of community projects - including caring for the environment, feeding the hungry and aiding seniors and the disabled.
Lions give sight. By conducting vision screenings, equipping hospitals and clinics, distributing medicine and raising awareness of eye disease, Lions work toward their mission of providing vision for all. We have extended our commitment to sight conservation through countless local efforts and through our international SightFirst Program, which works to eradicate blindness.
Lions serve youth. Our community projects often support local children and schools through scholarships, recreation and mentoring. Internationally, we offer many programs, including the Peace Poster Contest, Youth Camps and Exchange and Lions Quest.
Our Leo Program provides the youth of the world with an opportunity for personal development through volunteering. There are approximately 144,000 Leos and 5,700 Leo clubs in more than 140 countries worldwide.
Lions award grants. Since 1968, the Lions Clubs International Foundation (LCIF) has awarded more than US$700 million in grants to support Lions humanitarian projects around the world. LCIF was also ranked the number one nongovernmental organization in a 2007 study by The Financial Times.
Lions help during disasters. Together, our Foundation and Lions are helping communities following natural disasters by providing for immediate needs such as food, water, clothing and medical supplies – and aiding in long-term reconstruction.
Lions are active. Our motto is "We Serve." Lions are part of a global service network, doing whatever is necessary to help our local communities.
For more about Lions Clubs, go to www.lionsclubs.org
©2021 This site is the property of Athens Heritage Lions Club - Athens - United States
|
cc/2021-04/en_middle_0071.json.gz/line3122
|
__label__cc
| 0.582841
| 0.417159
|
Foodservice System Management
Total Degrees
Awarded in 2017
declining 10.6%
Median In-State
Public Tuition
growing 0%
Median Out-of-State
growing 6.77%
Average Wage
declining 3.36%
People in Workforce
Average Employee Age
The locations with the highest concentration of Foodservice System Management degree recipients are Providence, RI, Charlotte, NC, and North Miami, FL. The locations with a relatively high number of Foodservice System Management degree recipients are North Miami, FL, Weldon, NC, and Providence, RI. The most common degree awarded to students studying Foodservice System Management is a bachelors degree.
Human SciencesFoods, Nutrition, & Related Services
Information about the types of higher education institutions that grant degrees in Foodservice System Management and the types of students that study this field. Johnson & Wales University-Providence awards the most degrees in Foodservice System Management in the US, but Johnson & Wales University-North Miami and Johnson & Wales University-Charlotte have the highest percentage of degrees awarded in Foodservice System Management.
Tuition costs for Foodservice System Management majors are, on average, $7,014 for in-state public colleges, and $27,590 for out of state private colleges.
The most common sector, by number of institutions, that offers Foodservice System Management programs are Public, 2-year institutions (39 total). The most common sector, by number of degrees awarded, is Private not-for-profit, 4-year or above (836 completions).
Institution with the Most Degrees Awarded in Foodservice System Management
Johnson & Wales University-Providence
Johnson & Wales University-North Miami
The most common sector, by number of degrees awarded in Foodservice System Management, is Private not-for-profit, 4-year or above (836 completions).
The following chart shows the share of universities that offer Foodservice System Management programs, by the total number of completions, colored and grouped by their sector.
Tuition Costs for Common Institutions
State TuitionOut Of State TuitionTotal Graduates
Median Out of State Private
Johnson & Wales University-Providence has the most Foodservice System Management degree recipients, with 396 degrees awarded in 2017.
The following bar chart shows the state tuition for the top 5 institutions with the most degrees awarded in Foodservice System Management.
Specialized Colleges
Highest Concentration Institution
Johnson & Wales University-Online
Out of all institutions that offer Foodservice System Management programs and have at least 5 graduates in those programs, Johnson & Wales University-North Miami and Johnson & Wales University-Charlotte have the highest percentage of degrees awarded in Foodservice System Management, with 24.9% and 24.4%, respectively.
Degrees Awarded by County
Counties with the Most Degrees Awarded in Foodservice System Management
Mecklenburg County, NC
This map shows the counties in the United States colored by the highest number of degrees awarded in Foodservice System Management by year.
Growth in Awarded Degrees
Counties with the Fastest Growing Number of Degrees Awarded
Suffolk County, MA
Kittitas County, WA
Lee County, NC
This map shows the counties in the United States colored by the highest growth in degrees awarded for Foodservice System Management.
Information on the businesses and industries that employ Human Sciences graduates and on wages and locations for those in the field.
The average salary for Human Sciences majors is $51,719 and the most common occupations are Elementary & middle school teachers, Preschool & kindergarten teachers, and Social workers, all other.
The industry that employs the most Human Sciences majors is Elementary & secondary schools, though the highest paying industry, by average wage, is Agencies, brokerages, and other insurance related activities.
Yearly Income for Common Jobs
The closest comparable data for the 6 Digit Course Foodservice System Management is from the 2 Digit Course Human Sciences.
Average Wage in Workforce
This chart shows the average annual salaries of the most common occupations for Human Sciences majors.
Highest Paying Locations
Highest Paying Pumas
Arden-Arcade, Carmichael & Fair Oaks (West) PUMA, CA
Sunset District (North) PUMA, CA
Milpitas & San Jose (Northeast) Cities PUMA, CA
This map shows the public use micro areas (PUMAs) in the United States colored by the average salary of Human Sciences majors.
Note that the census collects information tied to where people live, not where they work. It is possible that Human Sciences majors live and work in the same place, but it is also possible that they live and work in two different places.
The most common occupations Human Sciences majors, by number of employees, are Elementary & middle school teachers, Preschool & kindergarten teachers, and Social workers, all other.
Compared to other majors, there are an unusually high number of Human Sciences majors working as Dietitians & nutritionists, Marriage and family therapists, and Child, family, and school social workers.
The highest paid occupations by median income for Human Sciences majors are Physicians, Lawyers, & judges, magistrates, & other judicial workers, and Firstline supervisors of nonretail sales workers.
2018 Workforce
± 15,646
The number of Human Sciences graduates in the workforce has been growing at a rate of 7.25%, from 379,676 in 2017 to 407,221 in 2018.
The largest single share of Human Sciences graduates go on to work as Elementary & middle school teachers (13.6%). This chart shows the various jobs filled by those with a major in Human Sciences by share of the total number of graduates.
The most common industries that employ Human Sciences majors, by number of employees, are Elementary & secondary schools, Child day care services, and General medical and surgical hospitals, and specialty (except psychiatric and substance abuse) hospitals.
The highest paying industries of Human Sciences majors, by average wage, are Agencies, brokerages, and other insurance related activities, Machinery, equipment, & supplies merchant wholesalers , and Securities, commodities, funds, trusts & other financial investments.
Industries by Share
The industry which employs the most Human Sciences graduates by share is Elementary & secondary schools, followed by Child day care services. This visualization shows the industries that hire those who major in Human Sciences.
PUMAS with a relatively high number of Human Sciences majors
Carr 2-Carr 111 PUMA, PR
Carr 2 (Noroeste) PUMA, PR
This map shows the public use micro areas (PUMAs) in the United States where there are a relatively high population of Human Sciences majors.
Demographic information on those who earn a degree in Human Sciences in the US. The average age of a person in the workforce with a degree in Human Sciences is 42.2, and the most common degree type these workers hold is a Bachelors Degree. Female employees are more likely to hold Human Sciences degrees, and White students earn the majority (631) of the degrees.
Workforce Age
Average Age in 2018
± 0.524 Years
This chart shows distribution of ages for employees with a degree in Human Sciences. The most common ages of employees with this major are 25 and 26 years old, which represent 3.91% and 3.26% of the population, respectively.
Degrees Awarded
The most common degree types awarded to students graduating in Foodservice System Management are Bachelors Degree, < 1 Year Postsecondary Certificate, and Associates Degree.
Workforce Degrees
The most common degree types held by the working population in Human Sciences are Bachelors Degree, Masters Degree, and Professional degree.
Gender Imbalance for Common Institutions
Female (61.4%)
Most Common Gender with a Degree in this Field
This chart shows the granted degrees by gender at the 5 institutions that graduate the most students in Foodservice System Management.
Race & Ethnicity by Degrees Awarded
This chart shows the number of degrees awarded in Foodservice System Management for each race & ethnicity. White students earned the largest share of the degrees with this major.
Most Common Race/Ethnicity and Gender Combination
This chart illustrates the differences by gender for each race & ethnicity of Bachelors Degree recipients in Foodservice System Management. White Female students, who earn most of the degrees in this field, are the most common combination of race/ethnicity and gender.
People in WorkforcePeople in Workforce (RCA)
Most Common Countries of Origin
5,205 degree recipients
High Relative Number of Students
4.78 times more than expected
3.9 times more than expected
There are a relatively high number of people that were born in Kenya that hold Human Sciences degrees (4.78 times more than expected), and the most common country of origin by total numbers for non-US students earning a degree in this field is Mexico (5,205 degree recipients).
Data on the critical and distinctive skills necessary for those working in the Foodservice System Management field from the Bureau of Labor Statistics. Foodservice System Management majors need many skills, but most especially Speaking. The revealed comparative advantage (RCA) shows that Foodservice System Management majors need more than the average amount of Operation and Control, Quality Control Analysis, and Troubleshooting.
These two visualizations, one a radial chart and one a bar chart, show the same information, a rating of how necessary the following skills are for Foodservice System Management majors. Toggle between "value" and "RCA" to see the absolute rating of that skill (value) and the revealed comparative advantage (RCA), or how much greater or lesser that skill's rating is than the average. The longer the bar or the closer the line comes to the circumference of the circle, the more important that skill is. The importance of Operation and Control is very distinctive for majors, but the Speaking, Reading Comprehension, and Active Listening are the three most important skills for people in the field.
Radar Distribution
ValueRCA
CIP2
Foods, Nutrition, & Related Services
Facial Treatment Specialist
Fire Services Administration
Agronomy & Crop Science
|
cc/2021-04/en_middle_0071.json.gz/line3131
|
__label__wiki
| 0.979971
| 0.979971
|
Blue Flu: Atlanta police call out of work in wake of charges
The police department in the United States city of Atlanta reassured residents on Thursday that it can still protect the city even though officers are calling out in larger numbers than normal, a day after prosecutors charged a member of the force with murder for shooting a man in the back.
Prosecutors brought felony murder and other charges against the white officer who shot Rayshard Brooks, saying that Brooks was not a deadly threat and that the officer kicked the wounded Black man and offered no medical treatment for more than two minutes as he lay dying on the ground. Another officer is being charged with aggravated assault.
More: A timeline of the George Floyd and anti-police brutality protests Atlanta police chief resigns after Black man killed: Live updates Protests after Black man killed by police in Atlanta
Hours later, the Atlanta Police Department tweeted late on Wednesday that it had more officers calling out than normal but that it had "enough resources to maintain operations & remain able to respond to incidents."
"The Atlanta Police Department is able to respond effectively to 911 calls. Please don't hesitate to call if you have an emergency," the department tweeted Thursday.
Mayor Keisha Lance Bottoms, who has issued orders calling for reforms in policing, also insisted that the department would be able to operate effectively despite the callouts and said many of the department's partner agencies had been notified in case they needed to call in others.
Earlier suggestions that multiple officers from each zone had walked off the job were inaccurate. The department is experiencing a higher than usual number of call outs with the incoming shift. We have enough resources to maintain operations & remain able to respond to incidents.
— Atlanta Police Department (@Atlanta_Police) June 18, 2020
"If we have officers that don't want bad officers weeded out of the force then that's another conversation we need to have," Bottoms said on CNN.
The decision to prosecute the officers came less than five days after the killing rocked a city - and a nation - already roiled by the death of George Floyd after more than eight minutes under a police officer's knee in Minneapolis late last month.
Floyd's death set off nationwide protests that have urged an extensive rethink of policing and an examination of racism in the US.
Police in New York City may be trying to go on an official strike on July 4, US Independence Day, according to The New York Post newspaper. It said flyers and a text message circulating among officers is encouraging them to call in sick, or request an ambulance to take them home from work if they do show up.
Rayshard Brooks
Brooks's funeral is set for Tuesday at Atlanta's historic Ebenezer Baptist Church, which was Martin Luther King Jr's congregation, the Reverend Raphael Warnock announced. Tyler Perry, the actor and filmmaker, has offered financial help for the services, officials said in announcing the funeral.
Police were called to a Wendy's last week about complaints of a car blocking the drive-through lane. An officer found Brooks asleep behind the wheel, and a breath test showed he was intoxicated. Police body-camera video showed Brooks and officers having a long, relatively calm conversation before things rapidly turned violent when officers tried to handcuff him.
Officer Garrett Rolfe shot Brooks after the 27-year-old Black man grabbed a Taser and ran, firing it at the officer, Fulton County District Attorney Paul Howard said. But when the officer fired his gun, Brooks was too far ahead of him for the Taser to be a danger, and it had already been fired twice, so it was empty and no longer a threat, Howard said.
"I got him!" Howard quoted Rolfe as saying.
"Mr Brooks on the night of this incident was calm, he was cordial and really displayed a cooperative nature," Howard said.
A lawyer for two witnesses said Thursday that the shooting could have been avoided and that officers need to be held accountable.
"As the video shows, this could have been avoided by just letting him run away, giving him another day, but instead a family has lost a father, a loved one, a friend," lawyer Shean Williams said at a Thursday news conference. "This community has lost a man."
Williams's client Michael Perkins, who was a passenger in a car that arrived in the drive-through lane just minutes before the shooting, said that when he heard officers telling Brooks to stop resisting, he predicted that Brooks would end up getting shot.
"It's just what I felt like was going to happen because that's what's been happening lately," he said Thursday during a news conference at his lawyer's office in downtown Atlanta. "These cops have been killing people."
Prosecutors also announced charges of aggravated assault and violation of his oath against a second officer, Devin Brosnan, who the district attorney said stood on Brooks's shoulder as he struggled for his life.
Atlanta Police officer Devin Brosnan has been charged with aggravated assault and four oath violations in the shooting death of Rayshard Brooks [Brynn Anderson/AP Photo]
Rolfe's lawyers said he feared for his and others' safety and was justified in shooting Brooks. Rolfe opened fire after hearing a sound "like a gunshot and saw a flash in front of him", apparently from the Taser.
"Mr. Brooks violently attacked two officers and disarmed one of them. When Mr. Brooks turned and pointed an object at Officer Rolfe, any officer would have reasonably believed that he intended to disarm, disable or seriously injure him," the lawyers said in a statement.
The felony murder charge against Rolfe, 27, carries life in prison or the death penalty, but prosecutor Howard told CNN on Thursday that he would not seek it. Rolfe was also charged with 10 other offences punishable by decades behind bars.
The district attorney said Brosnan, 26, is cooperating with prosecutors and will testify as a state's witness. But one of his lawyers, Amanda Clark Palmer, denied he had agreed to be a prosecution witness that he was simple a witness and said Brosnan was not pleading guilty to anything.
Clark Palmer said the charges were baseless and that Brosnan stood on Brooks'shand, not his shoulder, for just seconds to make sure he did not have a weapon.
Brosnan turned himself in Thursday, his lawyer said. He did not speak to reporters as he later left. He said he would request $50,000 bond for Brosnan and no bail for Rolfe.
Rolfe also turned himself in on Thursday.
A new poll by The Associated Press-NORC Center for Public Affairs Research says more Americans today than five years ago believe police brutality is a very serious problem that too often goes undisciplined and unequally targets Black Americans.
In the Minneapolis case, Derek Chauvin, the officer who put his knee on Floyd's neck for several minutes, has been charged with murder. Three other officers have been charged with aiding and abetting. All four were fired.
|
cc/2021-04/en_middle_0071.json.gz/line3133
|
__label__wiki
| 0.520884
| 0.520884
|
hoakley August 13, 2018 Macs, Technology
Blowhole, RouteMap, and a Signpost Kit
Do you code, or are you interested in discovering what goes on in macOS? If yes to either, then you should find my new Signpost Kit of use.
Apple is pushing performance as its major theme for Mojave, and has been putting a lot of work into improving the performance of much of macOS. Although there are tools for measuring and monitoring performance, most impose their own significant performance overhead. It has been hard to measure the performance of your code without the instrument altering that performance.
Announced at WWDC 2018, and part of Mojave, is a new log system dubbed Signposts. Although primarily intended to help us assess the performance of our code, Signposts can be used for a great deal more. In Mojave in particular they are a relatively quiet feature in the cacophony that is the unified log, so they’re quick and simple to access, and an ideal way of recording information in the log.
Apple sees Signposts as being used by apps built in Xcode 10, using its Instruments feature to analyse them in quite specific ways. I beg to differ, and am in the process of developing more flexible tools which enable regular users to use Signposts from regular apps.
If you’re writing code in Swift or Objective-C, Xcode 10 provides quite good access to Signposts through the os_signpost() functions. I provide some example code for this in my Signpost test platform Whither.
If you’re scripting in AppleScript, shell scripts, or any other language or environment which doesn’t have direct access to os_signpost(), the only means of writing Signposts is my command tool Blowhole. There are some limitations, and because of a bug somewhere between Mojave ß6 and Xcode 10ß5, this doesn’t work as well as it used to or should, but it is easy to use.
I am now also releasing the second alpha version of my GUI app for harvesting and analysing Signposts, RouteMap. This doesn’t yet do any performance analysis, but does now display details of Signposts in usable ways.
But many of us will need to continue to run code in Sierra and High Sierra, for which there isn’t official support for Signposts. In fact, Apple has introduced some Signpost features into High Sierra’s log, although its interface remains private, and not accessible from third-party High Sierra code.
So, using Blowhole and RouteMap, and shown in Swift example code in Whither, I have come up with Pseudo-Signposts for Sierra and High Sierra: these are normal log entries whose eventMessage field starts with the keyword Signpost, then contains the following information separated by space characters:
type name ID content…
where type is the Signpost type (begin, end, or event), name is an arbitrary Signpost name which doesn’t contain any space characters, ID is an integer of your choice, and content is additional text content which will form the message associated with that Signpost (and can contain space characters).
These Pseudo-Signposts enable you to work with almost identical calls and features across Sierra, High Sierra, and Mojave, using the same tools (Blowhole and RouteMap).
Here’s the new version of RouteMap showing Pseudo-Signposts in Sierra:
Although High Sierra does support Signposts, they are not accessible to third-party code, but Pseudo-Signposts look essentially the same:
In Mojave, full Signpost features are readily accessible in Xcode 10ß, and are displayed in RouteMap thus:
The best way to experience all this is with a simple and short tutorial, which I have put together in the Signpost Kit. It comes complete with RouteMap, Blowhole, Whither and its Swift source code, and full documentation. Please take a look at it, and see how useful Signposts and Pseudo-Signposts could be to you.
This new version of Blowhole (6) is available from here: blowhole7 – version 7 now works around this
RouteMap 1.0a2 is available from here: routemap10a2
They are both bundled in the Signpost Kit 1, which is available from here: signpostkit (version 1.1 with updated Blowhole)
and, of course, in Downloads above.
Posted in Macs, Technology and tagged Consolation, High Sierra, log, macOS, Mojave, performance, RouteMap, scripting, Sierra, Signposts, Swift, Whither. Bookmark the permalink.
Susanna and the Elders 2: Masters and the modern
Plutarch’s Lives in Paint: 9b Coriolanus
|
cc/2021-04/en_middle_0071.json.gz/line3134
|
__label__wiki
| 0.87271
| 0.87271
|
Published Thursday, December 3, 2020 11:09AM MST Last Updated Thursday, December 3, 2020 4:19PM MST
EDMONTON -- Alberta set a new daily high on Thursday with 1,854 cases of COVID-19 after nearly 20,000 tests.
Of the 17,743 active coronavirus cases, 511 Albertans are in hospital and 97 of them in ICU.
Chief Medical Officer of Health Dr. Deena Hinshaw also reported 14 deaths, increasing the fatal count to 575.
14 new deaths reported today
*3 of them occurred yesterday
*9 in the Edmonton Zone (258 total)
*Age range: 2x in 60s, 1x in 70s, 9x in 80s, 2x in 90s
*9 connected with known outbreaks#COVID19AB #yeg #yyc pic.twitter.com/pGjqX8E1Yo
— Matthew Black (@ByMatthewBlack) December 3, 2020
“These numbers are very concerning,” Hinshaw said during her briefing.
RURAL ALBERTA
Combined, the Edmonton and Calgary health zones have more than 80 per cent of the province’s cases; however, Hinshaw says the disease is an increasing threat to smaller communities.
For example, the Municipal District of Acadia No. 34, with a population of 368, has four cases and an active case rate of 1,086.5. Smoky Lake County has 75 cases and a case rate of 890.7, and the Municipality of Jasper has 41 cases with a case rate of 730.1.
“COVID-19 is not a Calgary problem or an Edmonton problem,” Hinshaw said. “This is a provincial problem within the context of a global problem.
“It’s natural that some people living in those areas may feel safe from COVID due to their smaller populations and distance from larger urban centres.”
Hinshaw will give another update Friday afternoon.
Alberta’s chief medical officer of health Dr. Deena Hinshaw provided an update, from Edmonton on Wednesday, June 3, 2020, on COVID-19 and the ongoing work to protect public health. (photography by Chris Schwarz/Government of Alberta)
Some of Alberta's smallest communities are dealing with the highest rate of cases
|
cc/2021-04/en_middle_0071.json.gz/line3136
|
__label__cc
| 0.554193
| 0.445807
|
Friday, May 3rd
Saturday, May 4th
Sunday, May 5th
Chefs & Culinary Presenters
Sommeliers & Winemakers
Effervescence 2018
A three day celebration of Champagne and sparkling wine in Los Angeles
Join our exclusive notification list to receive updates on the Effervescence program and events.
Casey Lane
Casey Lane is chef and owner of The Tasting Kitchen in Venice, California, Casa Apicii in New York’s Greenwich Village and Viale dei Romani in West Hollywood.
After a childhood spent drawn to his Marseilles-born mother and grandfather’s cooking for family gatherings, Lane decided to attend culinary school in Portland based on his simple belief that “the best food in the world only ever comes from farmland.” After graduating and getting his professional start in banquet catering, Lane began cooking at Portland’s Clarklewis restaurant in 2003. At Clarklewis, Lane would spend the next five years under Chef Morgan Brownlow developing his skills and knowledge about true farm-to-table cooking. His experience with Chef Brownlow would serve as the guiding principles of his own culinary style in the years to come.
In 2009, Lane moved to Los Angeles and was given the opportunity to reboot a Scandinavian restaurant on Abbot Kinney Boulevard in Venice called AK. With little more than a handwritten menu and minor subsequent renovations, Lane’s cooking alone transformed the space into The Tasting Kitchen, which remains one of LA’s most popular neighborhood staples. Lane was awarded multiple “best of” accolades from GQ, Food & Wine, Los Angeles Magazine and more that year, which initiated a four-year-long run as a semi-finalist for the James Beard Foundation’s ‘Rising Star Chef of the Year’ award. “The Tasting Kitchen has prepared some of the most delicious food I’ve eaten all year,” wrote Jonathan Gold in a 2009 LA Weekly review.
We are thrilled to announce that our exclusive Krug Lovers Dinner will be prepared by Chef Casey Lane at his white-hot new restaurant in the Hotel La Peer in West Hollywood. Lane’s career trajectory culminates at Viale dei Romani, where his deft touch with both European technique and California’s local bounty are given full expression.
Krug Lovers Dinner
Charitable Collaborator
Copyright ©2021 Tasting The Stars, LLC
Join our exclusive notification list to receive news and exclusive updates on the Effervescence program and events.
I'm a*
Consumer / CollectorWinemaker / WinerySommelierDistributor / Importer
|
cc/2021-04/en_middle_0071.json.gz/line3138
|
__label__wiki
| 0.587388
| 0.587388
|
Education | Research | Health
Medicine Home
Allergy & Immunology Home
Hospitals & Affiliates
Division Administration
Fellowship Training Program
Grand Rounds, Lectures, and Conferences
Montefiore AERD and Drug Allergy Center
Rosenstreich Lab
Faculty: Elina Jerschow, MD
Home > Departments > Medicine > Divisions > Allergy and Immunology > Montefiore AERD and Drug Allergy Center
Division of Allergy & Immunology
Image: Penicillin is one of many commonly prescribed drugs to which patients can have adverse reactions.
The Montefiore Aspirin Exacerbated Respiratory Disease (AERD) and Drug Allergy Center offers full evaluation services to treat both AERD and drug reactions.
AERD
Aspirin-exacerbated respiratory disease (AERD) is a subset of asthma, associated with nasal polyposis and respiratory reactions to medications that inhibit cyclooxygenase 1 (COX-1). These commonly used, non-steroidal anti-inflammatory drugs (NSAID) include aspirin, ibuprofen, naproxen, etc. Desensitization and treatment using carefully controlled administration of aspirin have been shown to be an effective therapy for many AERD patients, and long-term aspirin therapy has been reported to improve asthma control and prevent nasal polyp recurrence. Our AERD care includes a comprehensive evaluation by a team of allergists and otorhinolaryngology (ENT) doctors at the Comprehensive Sinus and Allergy Clinics (LINK).
Drug Allergy
The AERD and Drug Allergy Center offers tests to correctly diagnose whether or not a patient has AERD or is hypersensitive to a particular drug. Skin prick and patch testing may be used to test for allergic sensitivity, and in vitro blood testing may be implemented in certain cases. The Center's allergy/immunology faculty experts from Albert Einstein College of Medicine may then recommend a medication challenge to confirm the lack of allergy to a particular medication. If the patient is allergic, drug desensitization procedures are designed to develop a state of tolerance in the immune system.
Chemotherapy and Biological Allergy Evaluations
Patients suffering from allergic or adverse reactions to chemotherapy and biological agents are offered help at the Montefiore Cancer Center, where medication testing and desensitizations are taking place.
AERD and Drug Allergy Center faculty specialists treat adult and pediatric patients who may be referred by their physicians. Montefiore accepts Medicaid and Medicare as well as private insurance.
Elina Jerschow, MD, MSc
Associate Professor, Department of Medicine (Allergy & Immunology)
Associate Professor, Department of Microbiology & Immunology
Merhunisa Karagic, MD
Comprehensive Sinus and Allergy Clinic at Montefiore
Chronic rhinosinusitis (CRS) is a chronic inflammatory disease of the sinonasal mucosa. CRS affects as many as 31 million Americans and is a common reason for outpatient referral to an otorhinolaryngologist. It has long been known that CRS has a strong association with other immune-mediated comorbidities including asthma, atopy, and allergy. Consequently, many of these patients will require referral to both an otolaryngologist and an allergist/immunologist.
Other conditions beyond allergic rhinoconjunctivitis may also benefit from a collaborative approach between otolaryngologists and allergists. A subset of patients with CRS with nasal polyposis may have underlying aspirin-exacerbated respiratory disease (AERD). Other patients with chronic nasal symptoms might have local allergic rhinitis (LAR).
Montefiore Comprehensive Sinus and Allergy Clinic (CSAC) offers an interdisciplinary care for evaluation and treatment of environmental allergies, sinusitis, nasal polyps, and asthma. The goals of the CSAC are to provide a more efficient access to Rhinology and Allergy/Immunology specialists, to enhance patient satisfaction, and to optimize the management of conditions requiring a comprehensive evaluation including AERD and LAR.
Comprehensive Sinus and Allergy Clinic at Montefiore is lead by a team of allergists (Denisa Ferastraoaru, MD, and Elina Jerschow, MD) and otorhinolaryngologists (Waleed Abuzeid, MBBS and Nadeem Akbar, MD).
Weekly schedule of topics and speakers.
Rosenstreich Laboratory
The Doctor’s
Tablet Blog
About Einstein
Dean's Page
Centers (Research)
Giving to Einstein
Graduate Medical Education (G.M.E.)
Graduate Program (Ph.D.)
Master of Science in Bioethics (M.B.E.)
Master of Science in Clinical Research Methods (M.S.)
Medical Program (M.D.)
MSTP Program (M.D. - Ph.D.)
Einstein Senate
Clinical Programs
E-M Partnership
Luminis Portal
Einstein in the News
Expert List for Media
Collaboration Zone
ALBERT EINSTEIN ®
© 2021 Albert Einstein College of Medicine | Jack and Pearl Resnick Campus | 1300 Morris Park Avenue Bronx, NY 10461
718.430.2000 | Privacy Policy | Terms of Use | Webmaster | Accessibility Statement
|
cc/2021-04/en_middle_0071.json.gz/line3139
|
__label__wiki
| 0.706866
| 0.706866
|
SC Speaker: Move Energy Policy Away From Massive Projects
Posted on March 08, 2020 By News Team
House Speaker Jay Lucas says he sees South Carolina’s opportunity to sell or reform state-owned utility Santee Cooper as a chance to reshape the future of energy in the state.
COLUMBIA, S.C. — House Speaker Jay Lucas sees South Carolina’s opportunity to sell or overhaul state-owned utility Santee Cooper as a chance to reshape the future of energy, at least where he lives.
Lucas is stressing that whoever ends up controlling the utility that directly or indirectly powers nearly half the state needs to move away from massive plants and into markets where energy can bought and sold as needed.
The Republican speaker from Hartsville has at least some authority over what happens to Santee Cooper, since it is owned by the state. But he could also influence potential private buyer NextEra Energy as the House considers reopening negotiations with the massive Florida utility.
“What the House wants to try and do is to move energy markets in this state,” Lucas told The Associated Press on Tuesday. “We think it’s time we leave the vertically integrated model Santee Cooper has operated under to a wholesale energy market at tremendous savings to the people of South Carolina.”
What that might mean is fewer massive power plans costing hundreds of millions of dollars and more reliance on buying power on the emerging wholesale markets, where utilities can get memberships for under $10,000 a year and work out deals with other power providers to buy electricity when needed or sell excess power without a long term contract.
Lucas wants utilities to look toward the future, where the ability to save solar and wind energy in batteries may radically alter the power industry the way natural gas generation has done this century.
But as Lucas and the House continue on a dual path of negotiating a possible Santee Cooper sale and reforming the state utility, the Senate is taking its own route.
A Senate Finance Committee vote Thursday appeared to close the door to a sale and put all the Senate’s efforts into reforming Santee Cooper, appointing a subcommittee to come up with robust reform ideas.
The two chambers will need to reach an agreement on their next steps before the General Assembly’s session ends this year or Santee Cooper will be free to do what it wishes. That prospect that alarms many lawmakers in the state after the utility ended up $4 billion in debt from its minority share in a pair of nuclear reactors that were shuttered during construction.
It also upsets the South Carolina electric cooperatives, who have a contract until 2058 to buy power from Santee Cooper for their 2 million customers, The Electric Cooperatives of South Carolina CEO Michael Couick told senators Thursday.
Couick told senators Santee Cooper ignored warnings from co-ops that the nuclear deal was too risky and signed an ill-fated 60-year contract to sell gypsum, a byproduct from burning coal, to a private company. The gypsum market has turned down and the utility now pays $10 million to keep up its end of the deal.
Couick is on board with Lucas’ thoughts. He asked senators to not just concentrate on what Santee Cooper did wrong, but how they can make things right.
“It’s not just about the failures of the past. It’s about the opportunities of the future,” Couick said.
And that future needs to be nimble and provide the kind of innovative leadership and freedom for Santee Cooper or whoever buys it that the co-ops don’t currently have because of the utility’s poor leadership and that long contract to buy power, Couick said.
“The future is going to be different in energy,” Couick said. It’s going to be about market forces. It’s not going to be about putting all your money into steel and concrete,”
Pot Entrepreneurs Flocking to the Bible Belt for Low Taxes
Burning calories: pig starts farm fire by excreting pedometer
|
cc/2021-04/en_middle_0071.json.gz/line3140
|
__label__wiki
| 0.75074
| 0.75074
|
For information on the process of downloading itself, see Resurrection (RDM).
"Downloaded"
An episode of the Re-imagined Series
Writer(s) Bradley Thompson
David Weddle
Director Jeff Woolnough
Special guest(s) Lucy Lawless as Number Three
Nielsen Rating 1.8
US airdate 2006-02-24
CAN airdate 2006-05-13
UK airdate 2006-05-02
DVD release 19 September 2006 US
28 August 2006 UK
Population 49,579 survivors ( 5)
Extended Info {{{extra}}}
The Captain's Hand Downloaded Lay Down Your Burdens, Part I
Podcast Transcript – View
Continuity Errors Present – View
iTunes: USA | Canada | UK
Cylon society is revealed when a Cylon's consciousness is downloaded into a new body following her death. The conquerors of occupied Caprica hail two "heroes of the Cylon," who both resist their new celebrity status.
1.6 On Galactica
4.2 Unanswered Questions
The episode begins with a flashback scene entitled, "Nine months ago - Caprica".
The scene recalls Baltar's house being destroyed in the Cylon attack as the mysterious blonde he dated for two years tries to shield him from the blast (TRS: "Miniseries").
The scene reforms to show the Cylon's consciousness is downloaded and reborn in a resurrection tank. Surrounding the tank are other humanoid Cylon models who act as midwives to this Number Six's "rebirth."
One face that the Six sees is very unexpected. Someone that appears to be Gaius Baltar is at the edge of the tank, but before Six can talk to him, this Baltar warns that he is not really there: He is someone only she can see and hear and tells her not to reveal his "presence".
Still in the Cylon version of birth trauma, Six attempts to relax as the other Cylons comfort her and answer her questions about Gaius Baltar's fate.
The scenes shifts to another flashback: "Ten weeks later". The scene shows a busy hallway on Galactica as Cally Henderson shoots and kills the traitorous Cylon agent, Sharon Valerii ("Resistance").
The scene follows Valerii's point of view as she also downloads, waking up totally disoriented in a resurrection tank.
A Number Three comes to comfort her. As Valerii sees a copy of herself, reminding her once more of her true nature as a Cylon, she screams.
On Caprica, present day, the Cylons are rebuilding the city of Delphi for their own use, including gardens. A Three sits down to talk with the recently downloaded Six.
Six continues to be "haunted" by the virtual Baltar, who gives scathing retorts on the Cylon's progress of inhabiting their city after their genocide of the human race.
The Three congratulates Six, who is considered a "Hero of the Cylon" for her work as the prime agent that was personally responsible for gaining the information that allowed the virtual destruction of the Colonial Fleet. The Three tells Six that her celebrity has given her a specific name: "Caprica".
Three asks Caprica-Six to visit another recently downloaded Hero of the Cylon that is having trouble adapting: A Number Eight that still refuses to think of herself as anything but her human alias, Sharon Valerii.
Three warns that if Valerii cannot be fixed, there is talk of "boxing" her.
Caprica-Six visits Valerii's apartment. Valerii refuses Caprica's courtesies, denying the Cylon God or his "love," noting that the only real love she had was with Galactica crew.
Valerii expresses intense guilt at betraying them. Caprica-Six starts to manipulate her by trying to empathize with her, saying that she loved a man too — Gaius Baltar. Startled, Valerii says that Baltar is not dead, but is the new Vice President of the Colonies.
Moving their conversation to a cafe on the ground floor of Valerii's apartment, Caprica-Six and Valerii wonder why Number Three never told Caprica-Six that Baltar was alive.
Caprica-Six (through conversation with her virtual Baltar) realizes that Number Three manipulated her by hoping that her interaction with another Cylon with strong (and, to the Cylon collective, undesired) emotional ties with humanity would cause her distress sufficient enough to justify having them both boxed.
Elsewhere, outside the building, Samuel Anders and two other members of the human resistance movement reconnoiter the apartment building as they plan to demolish the building with explosives.
While the team realizes that the Cylons will not permanently die, Anders believes, based on the insight of a benevolent Eight, that Cylons remember their horrifically painful memories of being killed, which may show them that nowhere on Caprica is safe and that leaving Caprica is their only option.
Number Three shows up at the cafe. Realizing Three's deception, Caprica-Six lies, telling Three that Valerii will move out of her apartment and start adapting back to Cylon life. Valerii follows Six's lead.
Visibly disappointed, but not showing it through her speech, Number Three offers to help her move out right now. After a moment's hesitation, the three Cylons leave the cafe for Valerii's apartment.
The resistance members arm the bomb in the underground garage, where many abandoned cars sit, gathering dust. Anders is preparing to leave when a patrolling Cylon Centurion arrives, blocking Anders' exit.
When the Centurion sees the bomb, Anders shoots it to distract long enough for the bomb's cigarette fuse to drop, creating a massive explosion that levels the entire building. Anders manages to take cover under a car.
Caprica-Six, Three, and Valerii survive the blast as the stairwell protected them on the higher floor. Caprica-Six is injured and buried under some rubble. When Three (who takes off her coat) insists that Caprica-Six is dead, Caprica-Six speaks in the negative and calls for help.
Six's knee is dislocated, and Three again suggests that it would be easier, if Six wanted, to just kill her so she'll be reborn. Realizing Three is trying to have her boxed, she declines the "offer."
The Cylons find someone else under some rubble, and Number Three clears it off to discover Anders. She takes his gun away and prepares to kill him, but Valerii protests. Caprica-Six agrees, but to avoid suspicion from Number Three, claims pragmatically that they shouldn't kill him so he can be interrogated.
Valerii notices that Anders is wearing Kara Thrace's dog tags. Number Three explains that she was on the planet a few weeks ago. Valerii realizes Anders is someone important to her former comrade.
Number Three cruelly toys with Anders, putting his gun on the ground and daring him to take it. When Valerii asks her to stop, Number Three retorts that Valerii is a broken machine that thinks she's human, but isn't.
Valerii states she has a conscience, but Three counters that Valerii is a murderer.
Caprica-Six realizes that murder and the genocide of the human race cannot be the path of their loving God.
Caprica-Six realizes why Number Three wanted her and Valerii boxed: they are celebrities in a culture based on uniformity. Three knew that their heroes had a different perspective on the war. Due to their celebrity status as Cylon heroes, they could actually cause a change the Cylons view about their conflict with the humans, upsetting the status quo which Number Three upholds.
Number Three says that Six and Valerii are a waste, corrupted by their experiences. Caprica-Six explains to Valerii that that is why Three wanted to get rid of them, because Six and Valerii understand that murder, vengeance, and genocide are sins in the eyes of God. Valerii realizes that their knowledge could convince other Cylons that the slaughter of mankind was a mistake.
The rubble of the building shifts as Cylons outside try to clear their way to any survivors inside.
Anders grabs his gun and tries to escape, shooting at Number Three before Valerii knocks the gun out of his hands.
The gun lands near Three. As she is about to shoot Anders, Caprica-Six hits her over the head with a large rock of stone, then bashes Three in the head again, killing her.
Caprica-Six tells Anders to leave, and gives him back Starbuck's dog tags. Valerii gives him back his gun as he leaves, alive but confused at the Cylons' benevolence.
Six realizes that with all of the Cylons dead in the cafe, it should be at least 36 hours before Number Three is resurrected and tells the others what happened.
Caprica-Six and Valerii believe that there is sufficient time to start a new beginning for the Cylons: A way to live in God's love, without hate or lies. Together, the two Heroes of the Cylon agree to a new plan as their rescuers arrive.
On Galactica
Caprica-Valerii has gone into labor; she passed out and her placenta had detached.
Dr. Cottle delivers the baby by surgery. However, the child is premature and is taken to an incubator.
As Caprica-Valerii predicted, it is a girl. Karl Agathon and Caprica-Valerii adore it together, naming her Hera.
Meanwhile, President Roslin, Baltar, Admiral Adama and Colonel Tigh debate what to do with the child. Baltar points out that it is half-human. Adama realizes the Cylons want it, and that the Cylons still hiding in the Fleet will try to make a move for it if they know about it.
President Roslin has decided, secretly and unilaterally, to hide Hera to protect her. She has Cottle convince Agathon and Caprica-Valerii that their baby has died using other remains. Caprica-Valerii becomes hysterical and nearly chokes Cottle before breaking down, sobbing.
Roslin has given Hera to a woman named Maya, who lost her baby in the Cylon attack. Maya believes that the child is a normal human child from a Pegasus officer.
Agathon, helped by Chief Tyrol, spreads the ashes of "Hera" out the hatch of a spaceborne Raptor.
The virtual Number Six is devastated that Baltar could not protect "their baby", although he says he did all he could.
Number Six says that God's will was that Hera should survive and "would lead the next generation of God's children." In a rage, she says that Baltar has committed a sin, and his entire race will suffer God's vengeance.
This episode was nominated for the Hugo Award for "Best Dramatic Presentation (short-form)" aired in 2006.
This episode reveals three Cylon model numbers: the D'Annas are Number Threes, the Dorals are Number Fives, and the Sharons are Number Eights.
Anders refers to humanoid Cylons as "skin jobs" in this episode, another reference to Blade Runner by the Re-Imagined Series (which Edward James Olmos also co-starred in). The Cylon Centurions are being referred to as "bullet heads".
When episode writer Bradley Thompson was asked by Battlestar Wiki how it was decided to incorporate this reference into the episode, he said:
"There was no real "decision" as such. We were writing "Downloaded". Barolay and Anders were on the roof and we needed a quick way to categorize. We remembered the term from Blade Runner and put it in. The drafts went through the usual pathways of approval and nobody shot it down. So now there are skin jobs along with metal jobs, clankers, and bulletheads (that last is credited to Gary Hutzel)."
Rick Worthy (Simon) and Callum Keith Rennie (Leoben Conoy) do not actually appear in this episode. In several brief shots, body doubles dressed as their characters are seen from behind or in the distance, but these actors did not return for the episode. Ron Moore noted in his podcast of the episode that body doubles were used because the production team felt it would just be a waste of Worthy and Rennie's time having them only appear in the background of shots and not have any dialog.
Much of the dialog in the episode recap is entirely new, and dubbed in to better summarize the segment.
Caprica-Six assumed residence on Caprica two years prior to the Cylon attack, which matches both the beginning of her relationship with Baltar (TRS: "Miniseries") and the date that Sharon Valerii was assigned to Galactica (TRS: "The Farm").
There are three cars in the underground garage. One clearly visible is a Citroën DS. When the Cylon enters the garage, the car on the right appears to be a Rover P6. The car on the left with a central headlamp appears to be a 1930s Tatra 87. According to the podcast, older European cars were used to make them somewhat more alien to American viewers, but this can have the opposite effect on European viewers.
The license plate on the front of the car crushed in Anders' bomb attack reads SEXYMOM, and has a "C-Bucs Rule" bumper sticker (for the Caprica Buccaneers, the core of Ander's resistance group).
Whenever Baltar's internal Number Six appears on Galactica during the series, Number Six's distinct soundtrack theme is played (plunking staccato notes on a xylophone, accompanied by violins). There is a subtle twist on this for this episode with Caprica-Six's internal Baltar: whenever Six's hallucinatory Baltar appears, the normal "Number Six theme" is played in reverse. The xylophone notes are played in reverse order, though the violin overlay is still played "forwards".
Different music plays during the two downloads at the beginning of the episode. A variation on the "Number Six theme" is heard during Caprica-Six's flashbacks, while Boomer's flashbacks are accompanied by a more militaristic tune.
The image that Sharon throws against the wall is from the episode "Water", done after Sharon lands the Raptor and asks Tyrol to take care of her ejection seat. While a picture from her time on Galactica could be in her apartment, it is an error that she has one from after the fall of the Colonies.
Interestingly, the Baltar in Caprica-Six's head seems to be rather sharper-tongued, more cynical, and more harshly moralistic than the actual Baltar. He spends most of the episode playing conscience to Caprica-Six.
In the Miniseries, Leoben claimed to Adama that Cylons are superior to primitive humans, who are only "one step above beating each other to death with clubs". Ironically, Caprica-Six savagely beats Number Three to death "primitively" with a rock.
Apparently the documentary broadcast from the Fleet in "Final Cut" was not made widely available, since if Caprica-Six had seen it, she would have already known about Baltar's survival.
However, Number Three states at one point that Kara Thrace's arrival on Caprica (as seen earlier in the season) occurred only "a couple of weeks ago". Unless this is an error (as clearly the birth of Hera has to have occurred months after Starbuck's return to the planet), it may suggest that the Caprica scenes in this episode occur months earlier than the Fleet scenes shown in parallel. If this is the case, the Final Cut documentary likely hasn't been made yet.
The others seem to have kept the news from Caprica-Six, out of concern for her attachment to Baltar. When she resurrects, she immediately asks if Baltar is alive and the Three & Eight exchange glances. Three asks if she would be troubled if Baltar were dead, and never answers Caprica-Six's question. Apparently, they believed that knowledge of Baltar's survival would impede Caprica-Six's reintegration into Cylon society.
There does not appear to be any pattern to the numbering scheme of the 12 Cylon models: Three (Biers), Five (Doral), Six (Shelley Godfrey/Gina), Eight (Valerii), e.g. not all females are an even number, males an odd number.
From Ron Moore's blog on July 27th, 2006: "Number Six was specifically a homage to "The Prisoner," but the rest were assigned their numbers randomly.
Cylon society on Caprica appears to consist of mostly mimicking human behavior; clothing, apartments, cafés, parks for relaxation, etc. In essence, the Cylons are merely trying to be what they have just exterminated: humans.
The Cylons did not expect their initial attack to be anywhere near as successful as it was. This would explain the apparently large number of Cylon military vessels showing up everywhere as the Cylons expected to fight a more protracted war against a larger surviving human military force.
While it is not explicitly known in this episode, Admiral Adama was kept in the dark about Roslin's decision to fake Hera's death. The only people who know the complete truth are the President, Tory and Doctor Cottle. The episode "The Eye of Jupiter" later confirms this point.
Tyrol accompanies Helo to his and Sharon's daughter's "funeral", but who exactly is he there in support of? Helo or Caprica-Valerii? The easy answer is "both", but it seems likely that his presence is more on Helo's behalf. Having been effectively marginalized in Caprica-Valerii's eyes (TRS: "Resurrection Ship, Part II"), and his later fears of being a Cylon, his feelings for her are on the downswing.
In a deleted scene (included on the Season 2.5 DVD), Gina dubs Hera "Number 13".
Future developments in the series contradict this deleted scene. The final five remaining Cylons do not have model numbers, so the next designation would be Number Nine, not Number Thirteen. This is because the writers did not come up with the idea of the Final Five until Season Three.
What will Number Three do when she is resurrected? (Answer)
What model numbers are "Simon" and "Leoben Conoy"? (Answer 1, Answer 2)
Given that Caprica-Six now has a virtual Gaius Baltar, what are these virtual beings? (Answer #1, #2)
Does death hold any meaning to the Cylons? (Future Partial Answer)
Given that Baltar's home was destroyed and Caprica-Six "died" in a nuclear explosion, how did Baltar survive?
Several Cylons are seen in conversation in the park and cafe scenes. What do they have to talk about?
Why do the other Cylons see Boomer as a "war hero" despite the fact that she wasn't conscious of carrying out her mission(s) and her attempt on Adama's life ultimately failed?
David Eick's video blog shows the crew preparation for filming the Cylon rebirthing scene for this episode.
According to RDM's podcast, there was an entire subplot in this episode in which Lucy Lawless's character "D'anna Biers" interviews President Roslin about rumors that the pregnant Cylon prisoner's baby had been born. Then "Galactica-Three" tries to kidnap the baby off of Galactica in collusion with Gina Inviere (Pegasus-Six). The subplot was cut for time (they wanted to spend more time focusing on events on Caprica), and also because they felt it made the episode very confusing; cutting between many different Cylon copies both on Caprica and Galactica.( These scenes were filmed then cut; they are provided as deleted scenes on the Season 2.5 DVD sets).
Caprica-Valerii has gone into premature labor with her Hybrid baby:
Cottle: I find it absolutely amazing you people went to all the trouble to appear human, and didn't upgrade the plumbing.
"Caprica-Six" and a Number Three-copy walk past a crowd of other Cylons of various models, and they all keep turning their heads to look at Caprica-Six:
Caprica-Six: I still can't get used to this.
Three: Well, you're a Hero of the Cylon now. You're our first celebrity!
Caprica-Six: Oh, I'm just another Six.
Three: You're too modest. I'm just another Three... and they're Fives (motions at a Doral-model)... and Eights (motions at a Sharon-model). But you, everyone calls you "Caprica-Six"... like you're the only Six on the planet!
President Roslin, Baltar, Admiral Adama and Col. Tigh discuss what to do with the Hybrid baby:
Roslin: If the baby does survive, the question is — what do we do with it?
Baltar: Do? What are you suggesting? That we throw it out of an airlock?
Roslin: I don't make suggestions, Mr. Baltar - if I want to toss a baby out of an airlock, I'd say so.
Number Three prepares to execute Samuel Anders:
Three: Humans don't respect life the way we do. (loads pistol)
Anders' gun is knocked out of his hands, and it miraculously lands near Number Three, who picks it up, stands over Anders and gets ready to execute him:
Number Three: God loves me. (Caprica-Six pops up behind Number Three and bashes her over the head with a big rock of debris)
Caprica-Six: See you again soon! (Caprica-Six bashes her head with the rock a second time, killing her current body, while her consciousness will soon download into another)
Sharon Valerii picks up a photograph of Galactica crew to make a point to Caprica-Six about love:
"This is love. These people love me. I love them. I didn't pretend to feel something so I could screw people over. I loved them. And then I betrayed them! I shot a man I love, frakked over another man, ruined his life, and why? Because I'm a lying machine! I'm a frakking Cylon!"
Caprica-Six's internal Baltar recites verse
Life is short, but the next one's not
Let your heart adrift, and your soul will get caught
Believe the lies, ignore the truth
Listen to me, I will show you the proof.
Speak from your heart: say the things you know to be true
Michael Hogan as Colonel Saul Tigh
Aaron Douglas as Chief Galen Tyrol
Tahmoh Penikett as Lt. Karl "Helo" Agathon
Michael Trucco as Samuel Anders
Donnelly Rhodes as Dr. Cottle
Matthew Bennett as Number Five
Rekha Sharma as Tory Foster
Kerry Norton as Paramedic Layne Ishay
Alisen Down as Jean Barolay
Erica Cerra as Maya
Diego Diablo Del Mar as Hillard
Battlestar Galactica (Re-Imagined) Season 2 (2005-2006) Episode List
< Previous Season Episode | Scattered | Valley of Darkness | Fragged | Resistance | The Farm | Home, Part I | Home, Part II | Final Cut | Flight of the Phoenix | Pegasus | Resurrection Ship, Part I | Resurrection Ship, Part II | Epiphanies | Black Market | Scar | Sacrifice | The Captain's Hand | Downloaded | Lay Down Your Burdens, Part I | Lay Down Your Burdens, Part II | Next Season Episode >
Retrieved from "https://en.battlestarwiki.org/index.php?title=Downloaded&oldid=234224"
Episode Guide (TRS)
Episodes written by Bradley Thompson
Episodes written by David Weddle
Episodes directed by Jeff Woolnough
|
cc/2021-04/en_middle_0071.json.gz/line3145
|
__label__cc
| 0.746956
| 0.253044
|
Guided tours Lyon City Card
Leisure Cruise
City Tram Croix-Rousse
Bus city tour
Unusual vehicules
Discovering the Renaissance district
Discovering the Silk district
The 24 columns Guided tours
The 24 columns
I want to book this tour
Guided tours Unusual
Tour proposed by Lyon tourisme et Congrès
Lyon's historical Palais de Justice reveals its secrets...
Following four years of renovation, discover this architectural jewel by Louis-Pierre Baltard, Lyon's historical Palais de Justice.
Entering via its imposing façade with its 24 columns, you will discover and understand this focal point housing the court of appeal and the assizes on the same site where justice has been dispensed since the tenth century.
An exceptional opportunity to wander through the building's main concourse, the court rooms used every day by magistrates and lawyers.
The very place where several of the most importtant trials in French history have been conducted.
Visit exclusively proposed by ONLYLYON Tourism and Conventions.
Please ensure you arrive 10 minutes before the tour commences.
Booking is necessary online or at
Cancellation free of charge 72 hours before schedule activity.
Limited access visit requiring names of all participants. Please bring ID.
Covid-19: in order to protect your health and that of residents, this tour is temporarily unavailable
Health and safety commitments
In order to ensure the safety of our visitors, all tours provided by ONLYLYON Tourism have been adapted with routes that enable physical distancing and compliance with applicable health regulations:
Group limited according to the standards in force
The guide and all participants aged 11 and above must wear a mask at all times
A distance of 1 metre must be maintained between participants
Our guides are equipped with a hygiene kit
Our guides alone make contact with objects (doors, light switches, etc.)
Out of respect for the inhabitants, we limit the passage in the traboules during the visit
Guided tour on foot
Metro D > Vieux-Lyon
At the foot of the Palais de Justice' steps, quai Romain-Roland, Lyon 5th
Adults €6.00
With Lyon City Card Free
This tour is available
More than 70 themes of guided tours, in 9 languages,
30 anthusiastic guides : an unprecedented offer indeed!
Academic | Associations | Businesses
Tourism Professionals | Group of people
All I need is a sturdy pair of shoes and a good hat, and I'm ready to take you on a "voyage through our city" I'll be delighted to take you on a discovery tour of our "landmark" sights as well as my own favourites.
In other words, I'd like to help you gain insight into the soul of our city! And on the way, I'll tell you all about the history and art of our UNESCO-listed capital.
During tours, people often ask me if I'm a student. I'm too old for that. I'm a historian without the qualifications. I'm an architect without the diploma. But I was born in Lyon, and I enjoy helping members of the public discover this city which is a lot more than just a row of lovely façades.
You have to get a feel for the substance of the past, the depth of roots, the art of construction, the relation with light, the appeal of good food, one's relationship with a site, and the diversity of the different areas.
What you see counts of course, but as far as I'm concerned, a tour is only successful when people have had a good time, when I've managed, throughout the tour, to take them behind the scenes, to give them a sense of how people lived in those days and how we live in the city today.
I'm often delighted to hear people say they want to come back and spend more time here.
I started out by working as a lecturing guide for a travel agency for 7 years. Then I decided to settle permanently and resumed my initial job as a guide in my hometown.
I have a passion for History, and the Middle Ages and the Renaissance in particular, and the history of art, and therefore particularly enjoy being in this city which boasts several centuries of history.
I love good food, and really blossom in this capital of gastronomy, where good food is part of local culture. So I quite naturally took an interest in the history of food and chefs.
So many passions I intend to share with you during your next visit.
Kind regards from Lyon!
"Look and listen to the stones of my city".
Teaching people to look, telling stories, making sense of things, that's mainly what motivates me in my job.
My own personal story has mainly unfolded in Lyon, which I have proudly seen blossom over the past decades.
Sharing with visitors from all over the world -I speak English and German- the beauty of my city is a great pleasure to me, and an honour. But what I also like is talking to the locals themselves, while helping them understand the specific characteristics of their area.
How lucky I am to have been able to study the history of art and archaeology in Lyon. It's magic! From the Roman theatres to the Musée des Confluences, past, present and future combine in beauty and harmony, just like the gold, silver and silk threads woven by the canuts.
Let's set out for a spot of "trabouling" with Rabelais' ghost, who will lead us from Hôtel-Dieu to the wealthy homes of the merchant bankers in Vieux-Lyon, stopping at inns, bouchons or star-rated restaurants on the way…
Let your eyes feast on the golden light that's worthy of Italy, and gilds the slopes of Croix-Rousse on summer evenings as you stroll along the embankment amid the seagulls and boats.
I love this city because life is so sweet here, and I love telling visitors all about it, as the enthusiastic urbanist in me sees the city as a living organism.
When seeking to share Lyon's heritage with people, I like to broach the question from the viewpoint of technical skills and know-how, and even economy, whether it's architecture and town planning, or vineyards and gastronomy.
This guided tour is included
with the Lyon City Card
The essential pass to have on hand! The Lyon City Card is the pass
you need for your next stay in Lyon.
MUSEUMS AND EXHIBITIONS | ATTRACTIONS | TRANSPORT
GUIDED TOURS | PUPPET SHOW | SHOPPING | WIFI
Our online salesGuarantees
Reservation guaranteed
No processing costs
Your bank card is debited when your reservation has been confirmed
Discover our visits
special for groups
Choose your visit
"a-la-carte" Know more
Call our Lyon City Experts
7/7 from 9:30 AM to 6:00 PM +33 (0)4 72 77 69 69
Office du Tourisme et des Congrès du Grand Lyon Place Bellecour - BP 2254
© 2021 Office du Tourisme et des Congrès du Grand Lyon.
Covid-19: Guided tours and activities are suspended until further notice. Flexible cancellation conditions available. Read more...
A Lyon City Expert is available!
|
cc/2021-04/en_middle_0071.json.gz/line3146
|
__label__cc
| 0.607085
| 0.392915
|
2014 Dirty Dozen
We encourage you to join us in publicly recognizing these twelve as responsible parties in the spread of pornography and exploitation. Help us call on them to change their ways.
Help Spread The Word:
Download the Dirty Dozen Flyer here
Eric Holder »
Mr. Holder refuses to enforce existing federal obscenity laws against hardcore adult pornography, despite the fact that these laws have been upheld by the U.S. Supreme Court and effectively enforced by previous attorneys general.
Take Action »
Verizon »
Verizon pushes porn into our homes now through multiple channels. Not only do they provide hardcore pay-per-view movies through Fios, but they are also in the distribution business through their smartphones and tablets and as an Internet Service Provider. Verizon can offer to filter and block this content, yet provides very few options for those who do not want this material.
The world’s most popular social networking site has become a top place to trade pornography, child pornography and for sexual exploitation. Facebook’s guidelines prohibit such behavior, but Facebook is doing little to enforce them.
Google »
Google’s empire thrives on porn. Porn is shoved at kids today through YouTube, GooglePlay, Google Images and Google Ads. We urge Google to continue to improve their efforts to protect children and al who wish to be porn-free.
Sex Week »
Many of our nation’s top schools are succumbing to student pressure to welcome so-called “sex week” celebrations to bring hardcore pornography, as well as pornographic displays for public consumption on campuses. Some schools even include lectures on sex by naked instructors and demonstrations encouraging students to engage in violent, torture sex. Yale University was the first to initiate Sex Week.
Hilton Hotels »
This hotel chain, like Hyatt, Starwood and many other top hotel chains, provides hardcore pornography movie choices; and its porn channels are often the first thing advertised when you turn on the TV.
Tumblr »
One can hardly go on this popular social media blogging site without being bombarded with porn. Users must only be 13 and the filters do not work.
American Lib. Assoc. »
For years, ALA has worked to encourage public libraries to keep their computers unfiltered and allow patrons, including children, access to pornography.
Playstation »
The PlayStation 4 is the most popular game console used today, with over 4.2 million sales in 2013. Children under 18 are their main users. PlayStation’s livestreaming abilities are filling thousands of homes with live porn and hundreds of pornographic and sexually violent games are in the PlayStation Store.
Cosmo Magazine »
This staple of the supermarket checkout line may be as pornographic as Playboy Magazine, but without the pictures. This publication has steadily declined from an inspirational women’s magazine into a full-on pornographic “how-to” sex guide, encouraging women to accept the pornified culture around them. What’s worse is that they specifically market their smut to teen girls.
Barnes & Noble »
This Fortune 500 company, operator of 689 retail bookstores and a very active website, is a major supplier of adult pornography and child erotica. They also regularly put pornography near the children’s sections in their stores and provide free, unfiltered porn publications on their Nook e-reader.
Fifty Shades of Grey »
This bestselling book and coming movie are normalizing rape and sexual torture of women. Oprah Winfrey Network, Broadway and other mainstream outlets have even promoted this abusive lifestyle.
View the 2013 List Here
VICTORIES from the 2014 Dirty Dozen List include:
Google removed porn and sexually explicit apps from app store, Google Play
Google no longer accepts ads with pornographic language or graphics and will not allow ads that link to sexually explicit websites.
Verizon recently stopped offering many pseudo-child pornography films through their cable service. They did so quietly, with no announcement – but many of the titles that we complained about (with the public’s help) are now completely gone.
The Department of Defense stopped the sale of pornography in the Army and Air Force exchanges and all branches removed explicit content from public and work spaces;
Comcast improved their parental settings for cable;
Facebook took steps to improve efforts to block child pornography on its site;
GooglePlay instituted policies that prohibit allowing pornographic apps in their app store (they still need to better enforce these though).
Why the Dirty Dozen List?
Common Sense, anecdotal evidence and scientific research all demonstrate that pornography is a harmful, mind-altering drug. Our nation is suffering a pandemic of harm from pornography. Consequences include:
Children and adults developing life-long addictions to pornography;
On average, American children are seeing hardcore pornography at age 11 and often acting out what they see in porn;
Four out of five 16-year-olds now regularly access pornography online and many are developing life-long social/sexual problems as a result;
Violence against women, rape and other sex crimes are directly tied to the consumption of pornography;
56% of divorces cite Internet pornography as a factor in the breakup;
There is increased demand for child pornography because many adult-porn users find they are no longer excited by adult images and move to child images;
Pornography is a major factor creating and driving demand for prostituted and trafficked women and children;
More and more young men are suffering from sexual dysfunction as a result from repeated and prolonged porn use.
In addition to the many proven harms of pornography, it is a violation of federal law to distribute obscene (hardcore adult pornography) material on the Internet, cable/satellite TV, hotel/motel TV, in retail shops, through the U.S. Mail, and by common carrier. Additionally, most states prohibit the distribution of obscene pornography. Despite pornography’s destructive force and the illegality of most pornography in the US, its availability is increasing.
|
cc/2021-04/en_middle_0071.json.gz/line3147
|
__label__cc
| 0.606428
| 0.393572
|
Cities, Culture, Politics and Life
Tag Archives: Crisis
Democracy in a Time of Crisis
The Chinese government’s draconian response to the coronavirus outbreak begs a question. Do authoritarian regimes have an advantage, relative to democracies, in responding to crises?
A brief refresher on democracy. A form of government “in which the supreme power is vested in the people and exercised by them directly or indirectly.” (Merriam-Webster Dictionary)
A brief refresher on the Coronavirus quarantine. Following the Coronavirus outbreak, the Chinese government imposed a quarantine that severely restricts travel into and out of an area with a population the size of California.
Chinese Police with Face Masks. Source: Wikimedia Commons.
In an interview with Scientific American, NYU bioethicist Arthur Caplan upheld the measure as necessary for containing the spread of the disease. In addition, he noted the legal hurdles that might prevent such a measure in the United States.
“But quarantining an entire large city—or multiple cities—is not an approach that would work in many other places. You’re not going to quarantine the city of New York, ever,” Caplan argues, noting that U.S. authorities could not even effectively enforce a quarantine imposed on one nurse who returned to the country after treating Ebola patients in Sierra Leone in 2014. “
The last sentence refers to the quarantine attempted on Kari Hickox. Upon her return to the states from West Africa, where she had treated Ebola patients, Hickox was quarantined for three days in New Jersey before being permitted to return to Maine. The Maine authorities tried to extend Hickox’ quarantine but Hickox took legal action and won.
(Hickox was neither infected with Ebola nor showed any symptoms).
There aren’t many other recent examples of an industrialized democracy dealing with a pandemic (though the US imposed a fair number of quarantines in the 19th-century: more on this later).
However, democratic systems have stumbled in confronting the multitude of crises currently facing humanity.
Take climate change. In the United States, older, more conservative constituencies support politicians who deny its very existence despite the numerous signs that it is indeed happening.
Even lefties in the US and Europe who claim to care about climate change are loath to take measures to restrict vehicle travel (e.g. ending parking minimums, raising gas taxes) that would actually make a dent in emissions.
Contentious Hearing on a Road Diet in Los Angeles. “Road Diets”, which reallocate road space from cars to transit and non-motorized travel, have faced fierce opposition on Los Angeles’ west side. Source: Argonaut
In a government where politicians are responsive to the people, prudent action can be hampered by imperfect information, groupthink (i.e. voting based on social identity rather than substantive issues), and lack of political knowledge. Differing levels of political participation not only take the “democratic” out of democracy (as practiced) but allow well-connected minorities to hamper actions that would benefit the populace at large.
And yet, China’s response to the Coronavirus shows that authoritarian systems, in all likelihood, do a worse job of handling crises.
In the first days of the outbreak, the Wuhan provincial government dragged its feet, going so far as to threaten a doctor who reported the first cases of the virus.
Such misinformation may reflect authoritarian governments’ prioritization of (the facade of) stability over public welfare. They can solidify legitimacy this way (and always have a golden escape parachute in case things get out of control).
In fact, the Chinese government is already sending people back to work, despite acknowledging that the virus is still an issue.
Furthermore, the quarantine may not actually have been the most effective measure. By concentrating persons (both healthy and sick) in a disease-ridden area, it could end up increasing the infection rate in these areas. Restrictions on the flow of goods into and out of quarantine areas create shortages in medicines those infected desperately need. Democratic oversight on this policy would have probably warranted consideration of these issues.
Point being, democracies have stronger incentives and improved feed-back mechanisms for protecting public well-being in times of crisis. How can democracies respond to voters without being beholden to voters’ imperfections, or to the narrow interests of a loud minority?
I wonder how improving the spread of knowledge from expert sources can better inform voters (something social media could aid, if willing to referee). Bringing more people into the democratic process dampens interest group politics, if the focus is on achieving outcomes rather than fighting battles.
Women’s March, January 2017.
This entry was posted in Coronavirus, Politics and tagged China, Coronavirus, Crisis, Democracy, United States on March 2, 2020 by Ryland L.
What Biden Needs to Do
The Danger of Normalizing Trump
Don’t Let the Experts off the Hook
Falling Back to Blog
Entre-pocalypse:The End of America’s Long Twentieth Century (1898-2020)
Homebar
Ryland L
Transport and geography enthusiast. Politico. Current affairs junkie. Poet. Foodie. These eclectic interests define my blogs. I look forward to receiving feedback and engaging in thoughtful and, at times, provocative discussion.
|
cc/2021-04/en_middle_0071.json.gz/line3150
|
__label__cc
| 0.735106
| 0.264894
|
Dignity in Social Care -
Home / Uncategorized / Dignity in Social Care
Dignity in Social Care
Dignity in Social Care This assignment will use academic resources from the United Kingdom (UK) to help you to understand further the modern concept of ‘dignity’ in social care, a theoretical perspective developed in Europe, which is gaining traction in the United States. The resources are predominantly from the UK because of the advanced stage of ‘Dignity in Social Care’ concepts, largely due to more widespread and integrated social care systems in the UK and Europe.
In the assignment, you will review the UK resources and then respond to the prompts for the body of your research paper, which will provide details for application of ‘Dignity in Social Care’ concepts in the US. While the concept is at an earlier stage in the US, there are resources in the Ashford Library which cover the US – be sure to seek these out using ProQuest to support your paper. To access the ProQuest database, click on the Journal Articles button on the library homepage. Select the ProQuest (Search All ProQuest Databases) link. To limit results to the U.S. try using United Sates as an additional search term, or you can use the location limiter on the left side of your search results page to filter your results to those pertaining to the U.S. [Be sure to present your paper according to the ‘Assignment requirements’ listed below.] Step 1 – Review the Resources:
UK-Based Articles Anderson, L. (2008, Oct 22). Aging more complicated for gays; many fear discrimination in health care, social isolation and no familyPreview the document. The Province Retrieved from https://search.proquest.com/docview/269506746?accountid=32521
Kinnear, D., Williams, V., & Victor, C. (2014). The meaning of dignified care: An exploration of health and social care professionals’ perspectives working with older peoplePreview the document. BMC Research Notes, 7 doi:https://dx.doi.org/10.1186/1756-0500-7-854
Saltus, R., & Folkes, E. (2013). Understanding dignity and care: An exploratory qualitative study on the views of older people of african and african-caribbean descentPreview the document. Quality in Ageing and Older Adults, 14(1), 36-46. doi:https://dx.doi.org/10.1108/14717791311311094
US-Based News/Opinion Dingell, D. (2015, Jul 12). Aging with dignity out of reach for many in AmericaPreview the document. Detroit Free Press. Retrieved from https://search.proquest.com/docview/1695502378?accountid=32521
UK-Based Multimedia for Dignity Factors [Only 4 listed here] Dignity in care: Choice and control (Links to an external site.) Dignity in care: Communication (Links to an external site.) Dignity in care: Privacy (Links to an external site.) Dignity in care: Social inclusion (Links to an external site.)
UK-Based Website [Includes Information and Resources on All Eight Dignity Factors] Social Care Institute for Excellence. (2016). Eight dignity factors (Links to an external site.). Retrieved from https://www.scie.org.uk/publications/guides/guide15/factors/index.asp Step 2 – Recommendations for US Implementation Assume that you work for an organization that runs a system of social care in your State. The system includes individual elder care homes as well as care managers supporting elder care in private homes. Your Director of Operations has asked you to prepare a research paper of what factors to consider when implementing the ‘Dignity in Social Care’ concepts. Be sure to:
Explain what “Dignity in Social Care” is.
Describe the eight Dignity Factors with at least one example. Describe how Dignity in Social Care concepts uniquely pertain to: Elders whom are LGBTQI Elders whom are Female Elders whom are Racially Diverse (for example: African American, Native American, etc.) Elders whom are Culturally Diverse (for example: Asians who are devout Hindu, Buddhist, Muslim, etc.) Assignment requirements: Must be 4 to 6 double-spaced pages in length (excluding title and reference pages), and formatted according to APA style (Links to an external site.). Must include a title page (Links to an external site.) with the following: Title of paper Student’s name Course name and number Instructor’s name Date submitted Must address the topic of the paper with critical thought. Must be presented in the traditional research paper format of: Title Page Introduction (Links to an external site.) with Thesis Statement (Links to an external site.)
Body of Paper (covering provided assignment prompts) Conclusion (Links to an external site.) Reference List Must use the textbook and at least two scholarly sources. The Scholarly, Peer-Reviewed, and Other Credible Sources table (Links to an external site.) offers additional guidance on appropriate source types. If you have questions about whether a specific source is appropriate for this assignment, please contact your instructor. Your instructor has the final say about the appropriateness of a specific source for a particular assignment. For help searching the library’s scholarly resources check out this Database Search Tips tutorial video (Links to an external site.).
Be sure to integrate your research (Links to an external site.) rather than simply inserting it. Must document all sources in APA style, as outlined in the Ashford Writing Center. Cite your sources in text and on a separate reference page. For more information please review the In-Text Citation Guide (Links to an external site.) and the APA References List. (Links to an external site.)
← principles of international strategy on Biosata Organics Pty Ltd Compare and contrast the Arizona APA and the federal APA →
|
cc/2021-04/en_middle_0071.json.gz/line3152
|
__label__cc
| 0.632907
| 0.367093
|
Amy Kuchenbecker: “ECCL Volunteer of the Year 2020”
Dec 14, 2020 | Council News, Education
“You never spend more money than you make! You never spend more money than you make!” This enthusiastic chant is performed often and quite loudly in every one of Amy Kuchenbecker’s Junior Achievement (JA) sessions at Three Oaks Middle School. Making 8th graders, a...
The ECCL Congratulates FGCU
Dec 2, 2020 | Education
FGCU named best public school in Florida for undergraduate entrepreneurship By Kyle McCurry Florida Gulf Coast University (FGCU) has been named the top public college or university in Florida for undergraduate entrepreneurship studies, according to The Princeton...
Junior Achievement in Southwest Florida: Why it’s Important!
Oct 28, 2020 | Education
Junior Achievement of Southwest Florida and The ECCL Hosted First-Ever Virtual Gala earlier this year at The Club at Grandezza. FORT MYERS, Fla. (October 28, 2020) – Junior Achievement of Southwest Florida and The Estero Council of Community Leaders (ECCL) hosted a...
More students equals more schools needed in South Lee County
Ever wonder why we need to build new schools in south Lee County? The linked infographic identifies K-12 students in the Estero Area and South Lee County. This information will be used in the Village of Estero Community database so new residents can determine...
“2-5-8-Graduate” Junior Achievement’s Programs A Resounding Success in Four Estero Area Schools
Jul 3, 2020 | Education
On March 27, 2018, the Village of Estero signed a Memorandum with Lee School District entitled, Estero Education Initiative (EEI). In the Fall of 2018, 161 Estero retirees and non-retired residents volunteered to participate in Junior Achievement’s...
Breaking Par at Grandezza Virtual Gala
Apr 20, 2020 | Education
Check out the awesome Virtual Gala held for Junior Achievement on April 24th! “Breaking Par at Grandezza” Was Held Friday, April 24th “Today is survival. Tomorrow will be a success, then a Celebration”. Unfortunately, COVID-19 forced us to postpone one of...
|
cc/2021-04/en_middle_0071.json.gz/line3154
|
__label__cc
| 0.605931
| 0.394069
|
Research Briefing. The Best and the Brightest EU students at UK universities and as highly skilled graduate workers in the UK
Download "Research Briefing. The Best and the Brightest EU students at UK universities and as highly skilled graduate workers in the UK"
Bridget Davidson
1 Research Briefing The Best and the Brightest EU students at UK universities and as highly skilled graduate workers in the UK Academic performance and labour market outcomes of EU domiciled students in higher education What is the impact of EU migration at the higher end of the skill spectrum, among graduates and postgraduates, especially in in sectors of particular instrumental importance, such as science, technology, engineering and maths? Dr Renee Luthra and Greta Morando Institute for Social and Economic Research, published 20 May 2016 The economic impact of EU migration is a central point of contention in the debate on the upcoming EU referendum. Yet while the majority of this debate focuses on how many EU migrants claim state benefits or whether migration drives down the wages of low skilled British workers, the positive contribution of EU migrants at the higher end of the skill spectrum receives much less attention. In 2014, the UK Commission for Employment and Skills concluded that the UK s key strength in terms of international competitiveness lies in the size of its pool of high skilled labour. 1 This key strength is strongly linked to immigration. In 2014, 23% of UK graduates were born abroad and a third of these were born in the EU 2. Particularly in finance and tech, UK employers rely on foreign graduates, 3 to fill shortages of graduates with skills in science, technology, engineering and maths (STEM) 4. While many of these graduates will have come to the UK after finishing their degrees, a sizeable proportion are likely to have arrived as students: 16% of the working age immigrant population in the UK originally arrived for study, and more than half of these have at least one UK degree 5.When we look at the future of the graduate workforce by examining those still in training, we see that foreign born representation in this population is likely to remain high: the most recent statistics from the Higher Education Statistics Agency (HESA) show that foreign students continue to comprise one in five of those studying in British higher education. And of the nearly half million foreign students studying in the UK in 2014/2015, 124,575 are from the EU. Understanding what Brexit would mean for EU domiciled 6 students in higher education, and the knock on effects on the graduate labour force, is a complicated question. We do not know how leaving the EU would affect fees and visa requirements for EU students wanting to study in the UK, nor how hard it would be, Labour Force Survey Defined as those whose normal residence prior to commencing their programme of study was in countries which are current European Union members.
2 post-brexit, for EU domiciled students that had been allowed to study in the UK to then stay on after graduation to work here. However, we can safely assume that the process of negotiating exit from the EU would create a period of significant uncertainty, complicate the procedures of recruitment for education and work, and could well make the UK a less desirable place to study during the period of transition. 7 The UK government makes significant investments in higher education with the goal of adequately supplying a strong demand for graduate workers. Understanding the position of EU domiciled students, and the contribution they place to providing a skilled UK workforce, is therefore a critical part of the Brexit immigration story. The goal of this research brief is to demonstrate the importance of EU domiciled students for the higher education sector and the graduate labour market, and to provide insights into the potential repercussions of a decline in EU student recruitment and graduate retention due to Brexit related complications. We use data from the HESA Destination of Leavers of Higher Education (DLHE) survey, and find that EU domiciled students comprise more than one in twelve of the students in postgraduate taught programs, nearly one in eight in postgraduate research, and around 1 in 20 of all undergraduates. Among those pursuing postgraduate research degrees (mostly PhDs), two thirds of EU students are concentrated in highly desired STEM fields: in 2011/2012 alone, 5,446 EU undergraduates and 6,941 postgraduates graduated with a STEM degree. Besides constituting a sizeable proportion of graduates in higher education, EU domiciled students go on to contribute to the UK economy: more than half remain in the UK six months following graduation. And those who stay perform well: EU domiciled students are more likely than UK students to continue on with further study and to obtain a job commensurate with their training. EU undergraduates, in particular, are very high performers, and are more likely to obtain a first, less likely to be unemployed, and earn higher salaries, on average, than their UK domiciled peers even when we consider those that graduated from the same universities, with the same marks, in the same year, and with the same degree subjects. In the pages that follow, we will provide more detail on our evidence base and the analysis used to estimate these results. In our conclusion, we also discuss what these findings mean in the wider context of the Brexit debate. The Evidence To examine the academic performance and early labour market outcomes of EU domiciled students, we use nearly a decade of data from the Higher Education Statistics Agency Destination of Leavers of Higher Education (DLHE) survey. The DLHE survey collects data on all graduates of UK higher education six months after graduation, and is the largest source of information on UK and EU domiciled graduates and their early labour market outcomes. In this study we restrict our analysis to respondents who graduated between 2003/4-2011/12 and were full-time students. We further focus on students in typical age ranges for the degree: those aged less than 24 at graduation for those studying for an undergraduate degree, between in taught postgraduate courses, and between for those in postgraduate research. In our analysis of degree qualification, job quality and wages, we exclude survey respondents who are working outside of the UK. The resulting sample contains 2 million higher education leavers, including over 20,000 leavers from the 7
3 new EU countries that joined in 2004 and 2007 (Bulgaria, Cyprus, Czech Republic, Estonia, Hungary, Latvia, Lithuania, Malta, Poland, Romania Slovakia and Slovenia) and 96,000 leavers from old EU countries of Austria, Belgium, Denmark, Finland, France, Germany, Greece, Ireland, Italy, Luxembourg, Netherlands, Portugal, Spain and Sweden. This data is unique in providing detailed information on the labour market outcomes of over 75% of recent graduates in the UK. However, as is common with self-reported survey information, there is substantial non-response or non-disclosure for salaries. Moreover, following HESA guidelines, we restrict our analysis of earnings to those in full-time paid employment. EU domicile undergraduates The UK attract very high performing EU undergraduates truly the brightest and the best. As can be seen in Figure 1, EU domiciled students are much more likely than British students to earn a first degree classification. Those who remain in the UK are 6 percentage points more likely to have a first class degree than British students within STEM fields, and 9 percentage points more likely to have a first within non- STEM fields. Figure 1. Their high performance translates into better outcomes and higher earnings. Six months after graduation, only 17% of British undergraduates are in further study, but 45% of EU domiciled undergraduates are pursuing a further degree. EU domiciled graduates are also less likely to be unemployed, and earn over 1,000 more per annum (in 2012 pounds) than their UK domiciled peers. Moreover, these differences are robust when we apply statistical controls to best compare like to like. In regression analyses controlling for age group, gender, disability, degree classification (for undergraduates), subject of study, year of graduation, and the higher education institution, the extremely positive performance of EU domiciled undergraduates remains. In Table 1 below, these findings are summarised. Even comparing EU and UK graduates within the same institutions, with the same subject of study and at the same level of performance, EU domiciled undergraduates are between 26 and 30 percentage points
4 more likely to continue to study, are less likely to be unemployed, and those who stay in the UK are more likely to be in a job commensurate with their training. With the caveat that the salary information is perhaps less robust than the other measures, we also see that the those Old EU domiciled undergraduate degree holders who are in full-time employment in the UK earn, on average, 9% more than their British peers. EU Domicile Postgraduates EU domiciled students comprise a much larger share of postgraduate higher education than at the undergraduate level: 8% and 13% of taught postgraduate and postgraduate research degrees respectively. Similar to undergraduates, EU domiciled postgraduates perform well, with outcomes that are similar to or better than British postgraduates, even after adjusting for university characteristics and subject of study. EU domiciled postgraduates are more likely than British postgraduates to continue in full-time education. Postgraduates in research programs who remain in the UK are also between 9 and 12 percentage points more likely to be in jobs where their training is required or is expected for their job, rather than being in a job where their training is not required, something that is often taken as a marker of over-qualification. However, they are slightly more likely to be unemployed, and earn about the same as their British equivalents. Table 1. Labour market outcomes for undergraduates 6 months after graduation, graduates remaining in the UK Among those working In Study Unemployed Job requires degree / degree expected Professional / Managerial Salary in 2012 Pounds Undergraduates New EU ,151 Old EU ,504 British ,712 N 1,547,197 1,547, , , ,603 Postgraduate Taught New EU ,539 Old EU ,813 British ,295 N 322, , , , ,284 Postgraduate Research New EU ,212 Old EU ,092 British ,853 N 39,985 39,985 21,733 25,059 14,131 Note: Predicted probabilities presented as average marginal effects, controlling for gender, age group, disable, degree classification (only for undergrads), subject studied, year of graduation dummies, and higher education institution. Probabilities of further study or unemployment include all leavers regardless of location, whereas job quality and salary is restricted to those working in the UK. Salary information is self-reported with a high degree of missing (~46%) Conclusion This research brief has shown that EU domiciled students are high performers in UK higher education, and that they go on to occupy a strong position in the UK labour market, at both the undergraduate and postgraduate levels. There is no evidence of exploitation or lower wages: on the contrary, EU undergraduates that stay in the UK have the very best outcomes, even controlling for university and degree of study, and EU postgraduates that stay in the UK are also employed in well-paid jobs commensurate with their training. EU students therefore increase the size of the UK s skilled labour force.
5 Moreover, there is evidence that this initial strong position in the labour market continues well after they settle in the UK 8. How might an exit from the EU impact this well-functioning university to skilled employee pipeline? There is, of course, considerable uncertainty over how a UK outside of the EU would treat EU domiciled young people wanting to study or work in the UK. However, it is likely that Brexit would reduce the flow of these high performing students in a variety of ways: a) EU funding for research from resulted in a net gain of 2.7 billion for the UK 9. By reducing the availability of EU funding for research, there would likely be fewer EU-funded paid postgraduate posts. b) In the short term, EU students may be less likely to begin study in the UK, to continue on with study in the UK after graduation, or to work in the UK following graduation given the uncertainty that would result from a vote to leave the EU. c) In the longer term, the impact of Brexit would depend on how future UK governments changed university fees, the availability of loans to study, and visa requirements for EU citizens to study and work in the UK. However, given many of the arguments made in favour of Brexit, it would seem surprising if a UK outside the EU would make it easier for young people from outside the UK to study and work here. Technical notes Description of the sample and main outcomes Our sample is composed of 1,909,728 graduates (1,547,197 from undergraduate courses, 322,546 from postgraduate taught courses, and 39,985 from postgraduate research courses) who graduated in the years 2003/ /12. These are EU domiciled and British students who enrolled in full-time courses. We implement ordinary least squares regression analysis on the following outcomes (all measured at six months after graduation): A) Activity status This information is available for all students who responded at the questionnaire. 1) Studying vs. working, unemployed, working and studying, in a voluntary/unpaid job, other. 2) Unemployed vs. working, studying, working and studying, in a voluntary/unpaid job, other. B) Type of job When looking at these outcomes we restrict our sample to those students who work (full-time or part-time) in the UK only. 1) Whether the degree was required or expected for the job In the questionnaire it is asked Would you have been able to get the job you will be doing on [date] without the qualification you recently obtained (the actual qualification, not the subject of study)? We consider that students are in a matched job if they reply that their qualification was expected or required for that job. This information is missing for 16.48% of students in our sample. 2) Whether in a managerial/professional occupation This variable is based on the SOC categories (Managers and senior officials, Professional occupations, and Associate professional and technical occupations vs. all other categories: Administrative and secretarial occupations, Skilled trades occupations, Personal service occupations, Sales and customer service occupations, Process, plant and machine operatives, and Elementary occupations). This information is missing for 0.11% of students in our sample
6 3) Salary This information is available for full-time employee graduates only. We excluded from the analysis the top and bottom 1% of the distribution within each degree type and we adjust the salary in terms of 2012 pounds. This information is missing for 46.54% of students in our sample. We condition on: gender, age group, disability, degree classification (available for undergraduate students only), subject studied, year of graduation, and university attended. We cluster the standard errors by university. We also replicate the analysis by using other techniques of estimation such as Probit and Multinomial logit for the activity status outcomes. Results are robust across the different specifications. Definition of groups British: graduates domiciled in the UK prior university enrolment. New-EU: graduates domiciled in A2 and A8 countries prior university enrolment. These include Bulgaria, Cyprus, Czech Republic, Estonia, Hungary, Latvia, Lithuania, Malta, Poland, Romania Slovakia and Slovenia. Old-EU: graduates domiciled in all other European Union countries prior university enrolment. These include Austria, Belgium, Denmark, Finland, France, Germany, Greece, Ireland, Italy, Luxembourg, Netherlands, Portugal, Spain and Sweden. Level of Study 10 First degree includes first degrees (including eligibility to register to practice with a health or social care or veterinary statutory regulatory body), first degrees with Qualified Teacher Status (QTS)/registration with a General Teaching Council (GTC), postgraduate bachelors degree at level H, enhanced first degrees (including those leading towards obtaining eligibility to register to practice with a health or social care or veterinary statutory regulatory body), first degrees obtained concurrently with a diploma and intercalated first degrees. Postgraduate (taught) includes doctorate, and masters degrees, postgraduate bachelors degrees at level M and postgraduate diplomas or certificates not studied primarily through research, including Postgraduate Certificate in Education (PGCE) at level M (unless shown separately), Masters in Teaching and Learning, level M Diploma in Teaching in the Lifelong Learning Sector, and professional qualifications. Postgraduate (research) includes doctorate (incorporating New Route PhD), masters degrees and postgraduate diplomas or certificates (not Postgraduate Certificate in Education (PGCE) at level M) studied primarily through research. STEM and non-stem subjects Subjects included in the STEM group: Medicine & dentistry; Subjects allied to medicine; Biological sciences; Veterinary science; Agriculture & related subjects; Physical sciences; Mathematical sciences; Computer science; Engineering & technology; Architecture, building & planning. Subjects included in the non-stem group: Social studies; Law; Business & administrative studies; Communication; Languages; Historical & philosophical studies; Creative arts & design; Education. Dr Renee Luthra and Greta Morando Institute for Social and Economic Research, published 20 May From HESA Definitional Support: 10 From HESA Definitional Support: content&view=article&id=2880&limit=&start=#level
Regional characteristics of foreignborn people living in the United Kingdom
Regional characteristics of foreignborn people living in the United Kingdom By Alice Reid and Caroline Miller, Office for National Statistics Abstract This article examines the characteristics of foreign-born
Overseas degree equivalency: methodology
This document was produced by UK NARIC for the National College for Teaching and Leadership (NCTL) 1. Introduction The current allocation of bursaries for postgraduate teacher training places in England
ERASMUS+ MASTER LOANS
ERASMUS+ MASTER LOANS Erasmus+ Master Loan: opening up access to more affordable lending for cross-border studies The Erasmus+ programme makes it possible for students who want to take a full Masters level
Ref. Ares(2015)660570-17/02/2015 ERASMUS+ MASTER LOANS Erasmus+ Master Loan: opening up access to more affordable lending for cross-border studies The Erasmus+ programme makes it possible for students
Labour Force Survey 2014 Almost 10 million part-time workers in the EU would have preferred to work more Two-thirds were women
75/2015-27 April 2015 Labour Force Survey 2014 Almost 10 million part-time workers in the EU would have preferred to work more Two-thirds were women Among the 44.1 million persons in the European Union
193/2014-15 December 2014. Hourly labour costs in the EU28 Member States, 2012 (in )
193/2014-15 December 2014 Labour Cost Survey 2012 in the EU28 Labour costs highest in the financial and insurance sector Three times higher than in the accommodation and food sector In 2012, average hourly
SURVEY ON THE TRAINING OF GENERAL CARE NURSES IN THE EUROPEAN UNION. The current minimum training requirements for general care nurses
SURVEY ON THE TRAINING OF GENERAL CARE NURSES IN THE EUROPEAN UNION This survey serves as a background document for the discussion of the Commission's legislative proposal to modernize the minimum requirements
ERASMUS+ MASTER LOANS Erasmus+ Master Loan: opening up access to more affordable lending for cross-border studies The Erasmus+ programme makes it possible for students who want to take a full Master's-level
Alcohol Consumption in Ireland 1986-2006 A Report for the Health Service Executive
Alcohol Consumption in Ireland 1986-2006 A Report for the Health Service Executive Prepared by Dr. Ann Hope This report should be referenced: Hope, A. (2007). Alcohol consumption in Ireland 1986-2006.
The Structure of the European Education Systems 2014/15:
The Structure of the European Education Systems 2014/15: Schematic Diagrams November 2014 Eurydice Facts and Figures Education and Training at is Eurydice The Eurydice Network provides information on and
Planned Healthcare in Europe for Lothian residents
Planned Healthcare in Europe for Lothian residents Introduction This leaflet explains what funding you may be entitled to if you normally live in Lothian (Edinburgh, West Lothian, Midlothian and East Lothian
IMMIGRATION TO AND EMIGRATION FROM GERMANY IN THE LAST FEW YEARS
IMMIGRATION TO AND EMIGRATION FROM GERMANY IN THE LAST FEW YEARS Bernd Geiss* Germany, Destination for Migrants Germany is in the middle of Europe and has common borders with nine countries. Therefore,
Size and Development of the Shadow Economy of 31 European and 5 other OECD Countries from 2003 to 2015: Different Developments
January 20, 2015 ShadEcEurope31_January2015.doc Size and Development of the Shadow Economy of 31 European and 5 other OECD Countries from 2003 to 2015: Different Developments by Friedrich Schneider *)
Guidance on Sponsorship
Guidance on Sponsorship (Recruiting and Employing Non-EEA Nationals under Tier 2 of the UK s Points Based System) Human Resources 1 Introduction 1.1 These guidance notes set out the requirements in place
The structure of the European education systems 2012/13: schematic diagrams
What is Eurydice The Eurydice Network provides information on and analyses of European education systems and policies. It consists of 38 national units based in all 34 countries participating in the EU's
Employee eligibility to work in the UK
Employee eligibility to work in the UK This document details legal requirements that apply to ALL new members of staff All employers in the UK are legally bound to comply with the Asylum and Immigration
SEPA. Changes in the Payment System Implementation of the European SEPA Regulations for Kuna and Euro Payments
SEPA Changes in the Payment System Implementation of the European SEPA Regulations for Kuna and Euro Payments SEPA The Single Euro Payments Area (SEPA) stands for a European Union (EU) payments integration
The structure of the European education systems. schematic diagrams. Eurydice Highlights. Education and Training
RETAIL FINANCIAL SERVICES
Special Eurobarometer 373 RETAIL FINANCIAL SERVICES REPORT Fieldwork: September 211 Publication: April 212 This survey has been requested by the European Commission, Directorate-General Internal Market
TPI: Traffic Psychology International on a common European curriculum for postgraduate education in traffic psychology
TPI: Traffic Psychology International on a common European curriculum for postgraduate education in traffic psychology Sucha, M.*, Sramkova, L.** DeVol, D.* * TPI - Traffic Psychology International **
Health care in Scotland for UK passport holders living abroad
Health care in Scotland for UK passport holders living abroad If you have a UK passport and you live abroad, this factsheet tells you how you can get health care from the NHS when you are in Scotland.
Attitudes towards vocational education and training
Special Eurobarometer 369 European Commission Attitudes towards vocational education and training REPORT Special Eurobarometer 369 / Wave TNS opinion & social Fieldwork: June Publication: September This
EUROPEAN AREA OF SKILLS AND QUALIFICATIONS
EUROPEAN AREA OF SKILLS AND QUALIFICATIONS REPORT Fieldwork: April - May 2014 Publication: June 2014 This survey has been requested by the European Commission, Directorate-General for Education and Culture
The education system and lifelong learning in Finland. October 2015 Petri Haltia
The education system and lifelong learning in Finland October 2015 Petri Haltia FINLAND Population: year 2012: 5,421,827 density: 16/km 2 Area: total 338,424 km 2 water 10 % GDP (nominal) 2011 estimate:
FAQS (Frequently Asked Questions) Index 1. General information on the project 3 What is the Erasmus Mundus Programme? 3 Which is my home institution? 3 Which is my host institution? 3 What is a Target
Special Eurobarometer 373 RETAIL FINANCIAL SERVICES REPORT Fieldwork: September 211 Publication: March 212 This survey has been requested by Directorate-General Internal Market and Services and co-ordinated
ERASMUS FOR YOUNG ENTREPRENEURS : A NEW EXCHANGE PROGRAMME
PRESS DOSSIER INDEX PRESS DOSSIER...1 INDEX...2 ERASMUS FOR YOUNG ENTREPRENEURS : A NEW EXCHANGE PROGRAMME...3 WHO CAN PARTICIPATE?...5 WHAT BENEFITS AND FOR WHOM?...6 HOW DOES IT WORK? STRUCTURE AND IMPLEMENTATION...7
INNOBAROMETER 2015 - THE INNOVATION TRENDS AT EU ENTERPRISES
Eurobarometer INNOBAROMETER 2015 - THE INNOVATION TRENDS AT EU ENTERPRISES REPORT Fieldwork: February 2015 Publication: September 2015 This survey has been requested by the European Commission, Directorate-General
Contract Work in Switzerland. A Brief Guide
Contract Work in Switzerland. A Brief Guide Introduction to Swissroll There are approximately 1,000,000 foreign employees in Switzerland, 25% of which commute from outside the country. Swissroll are registered
Small Scale Study ll. Managed Migration and the Labour Market the Health Sector
1 Small Scale Study ll Managed Migration and the Labour Market the Health Sector Swedish NCP 2 1. Executive summary...3 2. Introduction to the healthcare sector in Sweden...4 2.1 County councils' main
Computing our Future Computer programming and coding in schools in Europe. Anja Balanskat, Senior Manager European Schoolnet
Computing our Future Computer programming and coding in schools in Europe Anja Balanskat, Senior Manager European Schoolnet ABOUT THE SURVEY What do Ministries currently think about the topic? Curricula
COMMUNICATION FROM THE COMMISSION
EUROPEAN COMMISSION Brussels, 17.9.2014 C(2014) 6767 final COMMUNICATION FROM THE COMMISSION Updating of data used to calculate lump sum and penalty payments to be proposed by the Commission to the Court
In May and July 2014 UK Visas and Immigration (UKVI) introduced changes to the right to work checks employers are required to carry out.
Summary of changes - August 2014 In May and July 2014 UK Visas and Immigration (UKVI) introduced changes to the right to work checks employers are required to carry out. In light of the recent changes,
EUF STATISTICS. 31 December 2013
. ESTIMATES OF EU TURNOVER VOLUMES. Turnover volumes by product, allocation and notification (Estimates of EU s, Millions of ) Estimate of the EU % on Turnover Significance of the sample on total turnover
Family benefits Information about health insurance country. Udbetaling Danmark Kongens Vænge 8 3400 Hillerød. A. Personal data
Mail to Udbetaling Danmark Kongens Vænge 8 3400 Hillerød Family benefits Information about health insurance country A. Personal data Name Danish civil registration (CPR) number Address Telephone number
Application Form: Receptionist / PA to the Senior Leadership Team
Application Form: Receptionist / PA to the Senior Leadership Team This application form is written in BLACK ink. Please answer the questions in dark blue and return electronically to Lesley Starkes, Finance
Erasmus Mundus Master in Membrane Engineering EM 3 E Third Call for Applications
Erasmus Mundus Master in Membrane Engineering EM 3 E Third Call for Applications Master edition 2013-2015 Erasmus Mundus is a cooperation and mobility programme in the field of higher education, promoted
International Hints and Tips
International Hints and Tips Content Q: What is the cut off time for processing International payments? A: International payments must be submitted and fully approved within the cut off time indicated
for people coming to Scotland to work
for people coming to Scotland to work In Scotland, most health care is provided by the National Health Service (NHS). If you are coming from overseas to work in Scotland, and you live here legally, this
YOUNG PEOPLE AND DRUGS
Eurobarometer YOUNG PEOPLE AND DRUGS REPORT Fieldwork: June 2014 Publication: August 2014 This survey has been requested by the European Commission, Directorate-General for Justice and co-ordinated by
THE ROLE OF PUBLIC SUPPORT IN THE COMMERCIALISATION OF INNOVATIONS
Flash Eurobarometer THE ROLE OF PUBLIC SUPPORT IN THE COMMERCIALISATION OF INNOVATIONS REPORT Fieldwork: January February 2014 Publication: May 2014 This survey has been requested by the European Commission,
Education and training in Denmark Facts and Key Figures
Education and training in Denmark Facts and Key Figures Education and training in Denmark The Danish education and training system is composed of two parallel systems: the mainstream education and training
Students: undergraduate and graduate students who are currently enrolled in universities
DUO-Korea: 1. General Description CAUTION: If any application falls under the following 3 cases, the application is disqualified and will not be considered for selection. If such case is found after the
Special Eurobarometer 369 European Commission Attitudes towards vocational education and training SUMMARY Special Eurobarometer 369 / Wave EB75.4 TNS opinion & social Fieldwork: June 2011 Publication:
Cash machine withdrawal in the EU (+Norway and Iceland)
Cash machine withdrawal in the EU (+Norway and Iceland) Country Is it free of charge to go to a cash machine from a different bank than consumers own to withdraw money? If withdrawal is not free of charge,
Visa Information 2012
Visa Information This document is intended to provide you with information on obtaining the correct visa to enter Australia to attend the Global Eco Asia-Pacific Tourism Conference however it is a guideline
NEW PASSENGER CAR REGISTRATIONS BY ALTERNATIVE FUEL TYPE IN THE EUROPEAN UNION 1 Quarter 4 2015
NEW PASSENGER CAR REGISTRATIONS BY ALTERNATIVE FUEL TYPE IN THE Quarter 4 2015 Alternative fuel vehicle (AFV) registrations: +20.0% in 2015; +21.1% in Q4 In the fourth quarter of 2015, total alternative
EUROPE 2020 TARGET: EARLY LEAVERS FROM EDUCATION AND TRAINING
EUROPE 2020 TARGET: EARLY LEAVERS FROM EDUCATION AND TRAINING By 2020, the share of early leavers from education and training (aged 18-24) should be less than 10% Early school leaving 1 is an obstacle
168/2014-4 November 2014. At risk of poverty or social exclusion 2 rate in the EU28, 2008-2013 (% of total population)
168/2014-4 November 2014 At risk of poverty or social exclusion in the EU28 More than 120 million persons at risk of poverty or social exclusion in 2013 Almost 1 out of every 4 persons in the EU in this
Statewatch Briefing ID Cards in the EU: Current state of play
Statewatch Briefing ID Cards in the EU: Current state of play Introduction In March 2010, the Council Presidency sent out a questionnaire to EU Member States and countries that are members of the socalled
EUROPLAT EMPLOYABILITY SURVEY: CORE FINDINGS AND IMPLICATIONS
Stanislav Ježek 1, Jan Mareš 1 & Aleš Neusar 2 1 Masaryk University Brno, Czech Republic 2 Palacky University Olomouc, Czech Republic EUROPLAT EMPLOYABILITY SURVEY: CORE FINDINGS AND IMPLICATIONS Problem
INNOVATION IN THE PUBLIC SECTOR: ITS PERCEPTION IN AND IMPACT ON BUSINESS
Flash Eurobarometer INNOVATION IN THE PUBLIC SECTOR: ITS PERCEPTION IN AND IMPACT ON BUSINESS REPORT Fieldwork: February-March 22 Publication: June 22 This survey has been requested by the European Commission,
1. Perception of the Bancruptcy System... 2. 2. Perception of In-court Reorganisation... 4
Bankruptcy Systems and In-court Reorganisation of Firms, 2010 Content: 1. Perception of the Bancruptcy System... 2 2. Perception of In-court Reorganisation... 4 3. Perception of Creditor Committees, Fast
Monitoring the social impact of the crisis: public perceptions in the European Union (wave 6) REPORT
Eurobarometer Monitoring the social impact of the crisis: public perceptions in the European Union (wave 6) REPORT Fieldwork: December 2011 Publication: April 2012 This survey has been requested by Directorate-General
European Higher Education Fair - 2014
EU Public Diplomacy and Outreach in India and in the SAARC European Higher Education Fair - 2014 New Delhi - 30 November to 01 December Bengaluru - 03 December Kolkata - 05 December Students FAQs Answered
NERI Quarterly Economic Facts Summer 2012. 4 Distribution of Income and Wealth
4 Distribution of Income and Wealth 53 54 Indicator 4.1 Income per capita in the EU Indicator defined National income (GDP) in per capita (per head of population) terms expressed in Euro and adjusted for
4 Distribution of Income, Earnings and Wealth
4 Distribution of Income, Earnings and Wealth Indicator 4.1 Indicator 4.2a Indicator 4.2b Indicator 4.3a Indicator 4.3b Indicator 4.4 Indicator 4.5a Indicator 4.5b Indicator 4.6 Indicator 4.7 Income per
SMEs access to finance survey 2014
EUROPEAN COMMISSION MEMO Brussels, 12 November 2014 SMEs access to finance survey 2014 This memo outlines the results of a survey undertaken by the European Commission to provide policy makers with evidence
EUROPEAN YOUTH: PARTICIPATION IN DEMOCRATIC LIFE
Flash Eurobarometer EUROPEAN YOUTH: PARTICIPATION IN DEMOCRATIC LIFE REPORT Fieldwork: April 2013 Publication: May 2013 This survey has been requested by the European Commission, Directorate-General for
EUROPE 2020 TARGET: TERTIARY EDUCATION ATTAINMENT
EUROPE 2020 TARGET: TERTIARY EDUCATION ATTAINMENT Low tertiary or equivalent education attainment levels create skills bottlenecks in knowledgeintensive economic sectors and hamper productivity, innovation
How To Understand Factoring
EIF Project "Jeremie" General Report on Factoring 1 Market analysis on Factoring in EU 25+2 prepared by International Factors Group (IFG) for European Investment Fund (EIF) project JEREMIE Preliminary
INTERNATIONAL TRACKED POSTAGE SERVICE
INTERNATIONAL TRACKED POSTAGE SERVICE Index Expanding Internationally...03 The Post NL Service...04 How it works... 05 Post NL Rates...06 Transit times...07 Customer Service...08 Expanding Internationally
INTRODUCTION... 2. I. Participation in the 2014 European elections... 3
?? Directorate-General for Communication PUBLIC OPINION MONITORING UNIT 2014 EUROPEAN ELECTIONS DESK RESEARCH Brussels, April 2015 Profile of voters and abstainees in the European elections 2014 INTRODUCTION...
Electricity, Gas and Water: The European Market Report 2014
Brochure More information from http://www.researchandmarkets.com/reports/2876228/ Electricity, Gas and Water: The European Market Report 2014 Description: The combined European annual demand for electricity,
Energy prices in the EU Household electricity prices in the EU rose by 2.9% in 2014 Gas prices up by 2.0% in the EU
92/2015-27 May 2015 Energy prices in the EU Household electricity prices in the EU rose by 2.9% in 2014 Gas prices up by 2.0% in the EU In the European Union (EU), household electricity prices 1 rose by
EBA REPORT ON THE BENCHMARKING OF DIVERSITY PRACTICES. EBA-Op-2016-10 08 July 2016
EBA REPORT ON THE BENCHMARKING OF DIVERSITY PRACTICES EBA-Op-2016-10 08 July 2016 BENCHMARKING OF DIVERSITY PRACTICES AT THE EU LEVEL Benchmarking of diversity practices at the European Union level List
Statistical Data on Women Entrepreneurs in Europe
Statistical Data on Women Entrepreneurs in Europe September 2014 Enterprise and Industry EUROPEAN COMMISSION Directorate-General for Enterprise and Industry Directorate D SMEs and Entrepreneurship Unit
Challenges in Combating Pensioner Poverty Helsinki, 4-5 Dec 2006
Challenges in Combating Pensioner Poverty Helsinki, 4-5 Dec 2006 1st Afternoon Plenary session Design and reform of minimum income guarantee and general public earnings related pension schemes and their
13 th Economic Trends Survey of the Architects Council of Europe
13 th Economic Trends Survey 13 th Economic Trends Survey of the Architects Council of Europe 13 th Economic Trends Survey Breakdown of responses COUNTRY ANSWERS France 1464 Belgium 399 Spain 365 Italy
How To Calculate Tax Burden In European Union
The Tax Burden of Typical Workers in the EU 28 2015 James Rogers Cécile Philippe Institut Économique Molinari, Paris Bruxelles TABLE OF CONTENTS Abstract 2 Background 2 Main Results 3 On average, a respite
Pan-European opinion poll on occupational safety and health
PRESS KIT Pan-European opinion poll on occupational safety and health Results across 36 European countries Press kit Conducted by Ipsos MORI Social Research Institute at the request of the European Agency
International Higher Education in Facts and Figures. Autumn 2013
International Higher Education in Facts and Figures Autumn 2013 UK Higher Education International Unit International higher education in facts and figures covers the majority of the UK higher education
Equity Release Schemes in the European Union
Reifner Clerc-Renaud Perez-Carillo Tiffe Knobloch Equity Release Schemes in the European Union institut fur finanzdienstleistungen e.v. Contents PREFACE I EXECUTIVE SUMMARY V TABLES XXIX FIGURES XXX 1.
NECs. Q2. Are any of the employees of your NEC coordinating other European innitiatives (e.g. Youth Action, Euroguidance, LLP, EURES, etc.)?
NECs Survey Questionnaire for the National Europass Centres Q2. Are any of the employees of your NEC coordinating other European innitiatives (e.g. Youth Action, Euroguidance, LLP, EURES, etc.)? Frequency
The Guardianship Service
The Guardianship Service How can they help you? When you arrive in Belgium Are you under the age of 18 and have you arrived in Belgium without your father or mother? You are searching for support and accommodation
EUROPE 2020 TARGETS: RESEARCH AND DEVELOPMENT
EUROPE 2020 TARGETS: RESEARCH AND DEVELOPMENT Research, development and innovation are key policy components of the EU strategy for economic growth: Europe 2020. By fostering market take-up of new, innovative
187/2014-5 December 2014. EU28, euro area and United States GDP growth rates % change over the previous quarter
187/2014-5 December 2014 This News Release has been revised following an error in the data for Gross Fixed Capital Formation. This affects both the growth of GFCF and its contribution to GDP growth. All
University of Portsmouth Postgraduate Support Scheme 2015/16 Phase 2 - January 2016 start Masters courses only
University of Portsmouth Postgraduate Support Scheme 2015/16 Phase 2 - January 2016 start Masters courses only Terms and Conditions The Postgraduate Support Scheme (PSS) is a joint Government and University
99/2015-9 June 2015. EU28, euro area and United States GDP growth rates % change over the previous quarter
2005Q1 2005Q2 2005Q3 2005Q4 2006Q1 2006Q2 2006Q3 2006Q4 2007Q1 2007Q2 2007Q3 2007Q4 2008Q1 2008Q2 2008Q3 2008Q4 2009Q1 2009Q2 2009Q3 2009Q4 2010Q1 2010Q2 2010Q3 2010Q4 2011Q1 2011Q2 2011Q3 2011Q4 2012Q1
Conditions for entitlement to disability benefits, 2013
Austria Belgium Bulgaria Croatia Cyprus Reduction in capacity for work of 50%. Reduction of capacity for work of at least 66%. 50% reduction in working capacity/degree of disability. More than 50% reduction
ECCE Standing Committee Education & Training
ECCE Standing Committee Education & Training Impact of the Bologna Process on Civil engineering education in Europe Prof. Iacint Manoliu 45 th ECCE meeting Bucharest, 11 May 2007 SCD Civil Engineering
How To Find Out What Young People Do In The European Union
Flash Eurobarometer 319a The Gallup Organization Flash Eurobarometer European Commission Youth on the move Fieldwork: February 211 Publication: May 211 Flash Eurobarometer 319a YOUTH PARTICIPION This survey
Definition of Public Interest Entities (PIEs) in Europe
Definition of Public Interest Entities (PIEs) in Europe FEE Survey October 2014 This document has been prepared by FEE to the best of its knowledge and ability to ensure that it is accurate and complete.
Applying for Pension from Abroad. Did you know that you can apply for a pension even for work you did abroad in the 1960s?
Applying for Pension from Abroad Did you know that you can apply for a pension even for work you did abroad in the 1960s? The Finnish Centre for Pensions is at your service when you apply for a pension
CABINET OFFICE THE CIVIL SERVICE NATIONALITY RULES
ANNEX A CABINET OFFICE THE CIVIL SERVICE NATIONALITY RULES Introduction The Civil Service Nationality Rules concern eligibility for employment in the Civil Service on the grounds of nationality and must
in Scotland for holidaymakers from overseas
in Scotland for holidaymakers from overseas In Scotland, most health care is provided by the National Health Service (NHS). If you are coming to Scotland on holiday or to visit friends or relatives, you
PORTABILITY OF SOCIAL SECURITY AND HEALTH CARE BENEFITS IN ITALY
PORTABILITY OF SOCIAL SECURITY AND HEALTH CARE BENEFITS IN ITALY Johanna Avato Human Development Network Social Protection and Labor The World Bank Background study March 2008 The Italian Social Security
Country note China. More than 255 million people in OECD and G20 countries have now attained tertiary education (Table A1.3a).
Education at a Glance 2011 OECD Indicators DOI: http://dx.doi.org/10.1787/eag-2011-en OECD 2011 Under embargo until 13 September, at 11:00 Paris time Education at a Glance 2011 Country note China Questions
Minimum Wage Protection Current German and European Debates
Årskonferanse i Fafo Østforum Fire år etter EU-utvidelsen: Status og framtidsperspektiver Oslo, 3 June 2008 Minimum Wage Protection Current German and European Debates Thorsten Schulten Wirtschafts- und
Introduction. Fields marked with * are mandatory.
Questionnaires on introducing the European Professional Card for nurses, doctors, pharmacists, physiotherapists, engineers, mountain guides and estate agents(to competent authorities and other interested
How To Calculate Tertiary Type A Graduation Rate
Indicator How Many Students Finish Tertiary Education? Based on current patterns of graduation, it is estimated that an average of 46% of today s women and 31% of today s men in OECD countries will complete
Funding and network opportunities for cluster internationalization
BSR Innovation Express: Cluster- to- Cluster Conference Funding and network opportunities for cluster internationalization Jens Peter Vittrup Special Adviser Email: jpv@ai.dk Why international R&I cooperation?
41 T Korea, Rep. 52.3. 42 T Netherlands 51.4. 43 T Japan 51.1. 44 E Bulgaria 51.1. 45 T Argentina 50.8. 46 T Czech Republic 50.4. 47 T Greece 50.
Overall Results Climate Change Performance Index 2012 Table 1 Rank Country Score** Partial Score Tendency Trend Level Policy 1* Rank Country Score** Partial Score Tendency Trend Level Policy 21 - Egypt***
PORTABILITY OF SOCIAL SECURITY AND HEALTH CARE BENEFITS IN THE UNITED KINGDOM
PORTABILITY OF SOCIAL SECURITY AND HEALTH CARE BENEFITS IN THE UNITED KINGDOM Johanna Avato Human Development Network Social Protection and Labor The World Bank Background study March 2008 The UK Social
AGENDA ITEM IV: EU CITIZEN'S RIGHTS
SCREENING CHAPTER 23 Country Session: 4.1. THE RIGHT TO VOTE AND STAND FOR EP ELECTIONS Voting in diplomatic missions in Turkey is not prohibited by the Turkish legislation. Foreigners may cast their votes
WOMEN IN DECISION-MAKING POSITIONS
Special Eurobarometer 376 WOMEN IN DECISION-MAKING POSITIONS REPORT Fieldwork: September 2011 Publication: March 2012 This survey has been requested by Directorate-General Justice and co-ordinated by Directorate-
Car tax refund on export
Car tax customer bulletin 13 Car tax refund on export www.tulli.fi 1 January 2015 Replaces the bulletin from August 2014 Car tax refund on export This bulletin applies to getting refund on export if a
How To Teach In Latvian Higher Education
HIGHER EDUCATION IN LATVIA Gunta Takere Academic Programme Agency Key Facts About Latvia One of the Baltic States, member of European Union, on the east coast of the Baltic Sea Capital Riga 2,3 million
|
cc/2021-04/en_middle_0071.json.gz/line3159
|
__label__cc
| 0.559895
| 0.440105
|
Meet Sage Scott, the Everyday Wanderer
Privacy Policy for Everyday Wanderer
Museums and More
National Park System
Confessions of a Midlife Travel Blogger
Everyday Postcards
See the USA
Due to COVID-19, check local advisories and contact the places you plan to visit before you go to confirm they’re open. It’s also wise to book a hotel with free cancellation in case you need to change your plans at the last minute. And, I always do these things to avoid getting sick when I travel (even when we’re not dealing with a pandemic).
The fascinating history behind its most beloved traditions
Arizona Wildflowers
The best places to see beautiful blossoms this spring
The best places to see wild animals
Midwest Stereotypes
Debunked By People Who Live In "Flyover" States
Fun Facts About Huckleberries
Includes Recipes!
Bitten by the travel bug as a preschooler when her family moved abroad for the first time, Sage Scott understands the tremendous benefits of travel. But as a single mom with four kids, three cats, two dogs, and a mortgage, she also knows that not everyone is in a position to travel the world for a living.
Now settled in America’s Heartland, Sage Scott taps into her experiences growing up all over the United States and Europe. She writes her travel blog with a midlife traveler’s perspective from Kansas City — the Midwestern cowtown affectionately called the Paris of the Plains and the undisputed Barbeque Capital of the World.
If you’ve got wanderlust and a “real” life, Sage invites you to explore travel destinations, find travel inspiration, and more at Everyday Wanderer.
Browse Everyday Wanderer by Travel Theme
How to safely observe wildlife in national parks and the best sanctuaries and zoos around the world.
Enjoying the local food and wine is such a delicious part of travel!
From majestic mountains to sandy beaches, from tropical rainforests to frozen glaziers, the world is full of natural wonder.
Art, history, science and other museums plus libraries, memorials, historic sites, and other attractions not managed by the National Park Service.
National Parks, Monuments & Historic Sites
Including battlefields, historic sites, national monuments, and parks, the National Park System manages more than 400 sites across the United States.
Designed to encourage road tripping travelers to stop and explore, roadside attractions can vary from fascinating to freaky.
The best places to travel by season: winter, spring, summer, and fall.
Murals, outdoor sculptures, and other forms of street art showcase a city's history, culture, passion, and pride.
Wandering our beautiful world doesn’t have to be complicated or costly, especially when you leverage these travel planning resources.
Sage's Top Travel Tips
Do Compression Packing Cubes Really Work?
Easy Ways to Overcome Language Barriers When Traveling Abroad
How to Enjoy a Smoke-Free Vacation in Las Vegas
How to Pull Your Kids Out of School to Travel (without Making Enemies)
How to Take Your First Solo Trip (without Prematurely Aging Your Parents)
How to Travel on Your Employer's Dime (without Getting Fired)
Petiquette 101: Dog Etiquette Rules for Traveling with Your Dog
Phrases to Know in the Local Language When You Travel Abroad
Planning Family Travel with a Full-Time Job and School-Aged Children
Ready, Set, Snooze! How to Get a Good Night's Sleep While Traveling
Take Better Travel Photos with These Seven Tips
Tips to Help You Adjust to Higher Altitudes
Ultimate Road Trip Packing List (with Free Download)
What Every American Needs to Know Before Traveling to Europe
Why You Should Explore via an Interactive Scavenger Hunt
Browse All Travel Tips
Explore Everyday Travel Destinations by Continent
Morocco, South Africa, Tunisia, and Algeria are the most popular travel destinations in Africa.
At the top of many Asia travel bucket lists are Indonesia, Thailand, Vietnam, Cambodia, Japan, Nepal, China, and India.
Approximately 12 million Americans visit Europe each year with France, England, Italy, and Spain as top travel destinations.
Travel destinations in North America are dominated by Canada, Mexico, and the United States.
Oceania includes Australia and New Zealand as well as the island nations of Micronesia and Polynesia.
When it comes to popular travel destinations in South America, Brazil, Chile, Ecuador, and Peru are very popular.
Just Landed - Recently Published Articles
What to Know BEFORE You Visit the Oklahoma City Memorial
On a typical spring morning in 1995, a bomb exploded outside the Murrah Federal Building in Downtown Oklahoma City. Within minutes, a nine-story office building was reduced to rubble, and
23 Delicious Barbeque Quotes That Will Make Your Mouth Water
Emanating from the South, there are four major styles of barbeque in the United States. Whether you prefer pork or beef, like your barbeque “dry” or slathered in sauce, these
Get to Know Downtown San Antonio On This Self-Guided Walking Tour
Get a fantastic overview of the history, culture, and food of San Antonio with this 1.7-mile, self-guided free walking tour of Downtown San Antonio. Starting at The Alamo, it includes
Winter Road Trip Checklist: Essentials to Pack for a Winter Road Trip
No matter what your destination, a winter road trip often includes bad weather, frigid temperatures, and travel delays. Use this winter road trip checklist so you don’t forget anything important
30 Impressive Tulsa Murals That Tell T-Town’s Story
Like most urban murals, the art filling walls across Tulsa tells the city’s story without words. Scenes from the past, whimsical maps, and present-day social concerns spread across buildings and
The Best Huckleberry Drinks In Montana
No flavor personifies Big Sky Country quite like the sweetly tart taste of huckleberries. Locals add huckleberry drink syrup to their morning lattes, pour a shot of huckleberry vodka to
9 Stunning Must-See Yosemite Waterfalls at Yosemite National Park
While Yosemite National Park is forever linked to Half Dome, the massive granite monolith immortalized by landscape photographer Ansel Adams, it’s also home to many fabulous flowing waterfalls. Bridalveil and
6 Wonderful Things To Do In Jackson Hole In Winter (Besides Ski)
Home to some of the top ski resorts in the country, many travelers visit Jackson Hole to hit the slopes. But this Teton Mountain destination just south of Yellowstone National
Get the latest articles delivered to you!
Thank You! You have successfully joined our subscriber list.
To help offset the costs of running EverydayWanderer.com, you’ll find affiliate links lightly sprinkled throughout the site. If you choose to make a purchase via one of these links, there’s no additional cost to you, but I’ll earn a teeny tiny commission. You can read all of the legal blah blah blah (as my little niece says) on the full disclosure page.
Copyright 2021. Made with love in Kansas City by Sage Scott
|
cc/2021-04/en_middle_0071.json.gz/line3164
|
__label__cc
| 0.63111
| 0.36889
|
Exclusive: Top cybersecurity experts give advice for the Davos crowd
Michael B. Kelley
·Head of Audience Development
Cybersecurity should be top of mind for attendees of the World Economic Forum’s annual meeting in Davos, according to the Global Risks Report 2018.
“Cyberattacks are perceived as the global risk of highest concern to business leaders in advanced economies,” WEF reported ahead of this week’s annual meeting of global leaders in the Swiss resort town. “Cyber is also viewed by the wider risk community as the risk most likely to intensify in 2018, according to the risk perception survey that underpins the Global Risks Report.”
Addressing those concerns, experts at WEF spent a year compiling a playbook for cyber resilience that identifies 14 policy areas where there needs to be public-private cooperation. Davos will also see the launching of a Global Centre for Cybersecurity to facilitate that cooperation.
“This comes from trying to come up with a common language both about security policy and the values that underly it so that at least the discussion is transparent and can take place before an emergency situation,” Daniel Dobrygowski, Project Lead for Cyber Resilience at WEF, told Yahoo Finance. “If we’re all speaking the same language, then we’re apt to get more done.”
Staff talk in the Congress Hall ahead of the World Economic Forum (WEF) annual meeting in the Swiss Alps resort of Davos, Switzerland January 22, 2018 REUTERS/Denis Balibouse
‘We need a new model for a global security platform’
Yahoo Finance sent WEF’s cyber playbook to top cybersecurity experts and asked: What is the topic or topics that business and government leaders should be focusing on when it comes to cybersecurity and policy in 2018?
“We need a new model for a global security platform that combines governmental and private-entity resources to counter the challenges on the emerging threat horizon. Davos, where the world’s biggest stakeholders come together, may be just the place to start the discussion.” – William J. Bratton, Executive Chairman of Teneo Risk and former Police Commissioner of New York City
“Something I would like to see is governmental [groups] — whether that’s overarching bodies like the European Commission or whether that’s on a national level, having representatives from governments or civil services of various nations coming together — to engage more with the private sector.” – Rik Ferguson, Vice President of Security Research at Trend Micro
“Pinpointing blame for a cyberattack takes a blend of cutting-edge digital forensics, traditional intelligence, ever-better defensive technologies, and more robust public-private cooperation including threat intelligence sharing. Conflict managers in the public sector will be wise to have all available resources collaborate on attribution and response design – while deflecting public clamor for quick revenge.” – Steve Grobman, CTO of McAfee
“Traditional defense is simply not enough. Companies must do more than monitor and assess threats, they need to be proactive about collecting intelligence and context about bad actors. If they truly want to defend their networks, organizations must complement commercial threat intelligence sources with analysis about all potential vulnerabilities within their network — known and unknown. Only then can they get a fuller picture of actual risk.” – Leo Taddeo, Chief Information Security Officer for Cyxtera and former FBI Special Agent in Charge of the Special Operations/Cyber Division at the New York Office (Check out more detailed analysis from Taddeo.)
Cyber-attacks are the third most likely global risk for 2018, according to WEF. Photo: WEF
“Focus on making companies more secure through automated and integrated solutions: The way into my organization might be through my trusted relationship with your organization; your risk often becomes my risk. Neither of us can sufficiently manage the security problems of speed and scale without adopting the solutions of automation and integration.” – Philip Quade, CISO at Fortinet and former Special Assistant to the NSA Director for Cyber (Check out more detailed analysis from Quade.)
“Redefine a win in cyberspace. You will get breached, mitigating the impact of the breach before data is stolen is a win. In 2016 we saw on average a dwell time globally of 99 days before a breach is detected. That’s the time between when a hacker compromises a system and the organization either detects the breach or is notified by an external party of the breach. That dwell time needs to shrink to under 10 minutes if we want to be successful in almost always mitigating the impact of a breach. Think of it like a security system on your house, a burglar breaks in, the alarm sounds, they run out and no one is harmed and nothing is stolen. Everything worked as planned.” – Tony Cole, VP and Global Government Chief Technology Officer at FireEye
“Go on the offensive against your own systems. Be the adversary and perform aggressive red teaming that mimics their tradecraft. Patch quickly and ensure all patches are actually effective by thoroughly testing them.” –Mark Kuhr, CTO and Co-Founder of Synack
“One of the most pressing areas is how to best secure IoT devices. Malicious botnets incorporating IoT devices are extremely representative of today’s evolving threat landscape, and recent IoT threats have challenged our collective defenses. Unfortunately, this trend will continue to accelerate exponentially as more devices come online.” – Bill Wright, Director of Government Affairs at Symantec
Participants use their smart phones and laptops between sessions during the annual meeting of the World Economic Forum (WEF) in Davos, Switzerland January 22, 2016. REUTERS/Ruben Sprich
“The biggest topics right now from both a business and government perspective are definitely these: cryptocurrency ecosystems, election security, ‘DevSecOps’ (this may sound dull, but think: IoT, cars, airline computer systems, smart homes, smart cities, Intel chips, Juniper routers, Huawei, the Internet, basically everything digital under the sun), increased regulation, cyber warfare and attribution.” – Jason Glassberg, co-founder of Casaba Security (Check out more detailed analysis from Glassberg.)
“Nation State hacking and targeting of Critical Infrastructures — since this is an economic forum that may greatly impact any of our countries, should we examine the potential for rules, guidelines, rules of engagement, or even a moratorium on targeting member countries critical infrastructures?” – Jeff Bardin, CIO of Treadstone 71
Dobrygowski noted that while WEF doesn’t recommend policy, the organization’s mandate involves “expanding the universal tools available for people in leadership positions to make intelligent decisions around these sorts of challenges.”
He added: “We need to get everyone who has a stake in this conversation in the room to help decide what our expectations are around security and the internet.”
This post will be updated with links to more detailed insights from various experts as the week progresses.
Daniel Howley contributed to this report.
Follow Yahoo Finance on Facebook, Twitter, Instagram, and LinkedIn
Follow Michael B. Kelley on Twitter @MichaelBKelley
Coming to Davos: Power leaders, snow and Trump
‘Very high level of confidence’ Russia used Kaspersky software for devastating NSA leaks
Hillary Clinton: ‘We are totally unprepared’ for the rise of artificial intelligence
Legendary Facebook backer nails the existential issue facing social media
|
cc/2021-04/en_middle_0071.json.gz/line3172
|
__label__cc
| 0.661841
| 0.338159
|
10 Causes and Symptoms of Vitreous Hemorrhage
HomeAilmentsEyes
By Jimmy, Facty StaffUpdated: Dec 14, 2018
Vitreous gel is a substance inside the eyeball, made up mostly of water and a small amount of collagen and hyaluronic acid. A vitreous hemorrhage occurs when blood leaks into the normally clear vitreous gel. The cause could be a rupture of any blood vessels surrounding the eye. Sometimes, certain conditions cause the development of new, abnormal blood vessels that are very fragile. The vessels may grow right into the vitreous gel.
Cause: Diabetic Retinopathy
Diabetic retinopathy develops due to blood sugar issues. It can be irreversible if not caught early, but unfortunately, may start off with no symptoms and not be noticed until symptoms appear. Abnormal blood vessels may form, which are quite fragile and bleed easily. Larger vessels can also be affected. Anyone with diabetes should make regular visits to an eye specialist to ensure diabetic retinopathy is not developing -- the condition can cause blindness, but early treatment lowers the chances of this by 95 percent.
JackF / Getty Images
Cause: Head or Eye Trauma
Head trauma from car accidents, sports injuries, or any direct blow to the head can cause a vitreous hemorrhage. A direct blow to the eye by a punch or kick can cause blood vessels to bleed into the vitreous gel.
KatarzynaBialasiewicz / Getty Images
Cause: Posterior Vitreous Detachment
As we age, the vitreous gel tends to shrink. When this occurs, the gel pulls away from the retina at the back of the eye. The retina has small blood vessels in it. Bleeding may happen because the gel pulls on the retina, causing small tears or holes. A fluid forms in the pocket that develops between the gel and the retina.
RossHelen / Getty Images
Cause: Blocked Blood Vessels
Some eye conditions can cause blockage of the vessels which feed the retina, resulting in blood leaking into the vitreous gel. The vessels may be too narrow, or a small clot may have traveled into the eye from elsewhere in the body. Atherosclerosis, a common condition wherein fatty deposits are stuck to the lining of the arteries, may be a factor if small particles break loose and travel to the eye.
saginbay / Getty Images
Cause: Sickle Cell Anemia
Sickle cell anemia is an inherited condition that leads the blood cells to become sticky and crescent-shaped. Often, these cells become stuck in small vessels. The tiny vessels of the eye may be clogged up with these cells, and this can damage the retina, causing vision problems and bleeding. Sickle cell anemia can also lead to the new growth of vessels.
Cause: Retinal Tears and Detachment
A detached retina is a medical emergency. Blindness can result if the retina is completely detached, and this requires surgery. If there is a tear in the retina, the vitreous gel can leak behind it and accumulate. If the vitreous gel pulls away from the front of the retina, the retina can peel away from the blood vessels located behind it. Once detached, the retina cannot function and the individual experiences loss of vision. Partial detachment will also cause a gap in vision.
DawnPoland / Getty Images
Symptom: Floaters
Floaters are small dark spots in the field of vision. They can also appear as shadowy shapes, squiggly lines, and cobwebs. When the eyes move, the floaters go with them, but when you try to focus on them, they dart away. When your eyes rest, they drift and don't follow your line of vision when looking around. Floaters are a part of the aging process and for most people are just an annoyance. However, a sudden increase of floaters, along with flashes in the peripheral vision or loss of peripheral vision could indicate an issue like a vitreous hemorrhage.
Rawpixel / Getty Images
Symptom: Blurry or Reddish Vision
Blurry vision can be a result of bleeding into the vitreous gel. Reddish vision is caused by the blood leaking in and light shining through it. This symptom is painless but an indication that the bleeding may be increasing.
zoranm / Getty Images
Symptom: Flashes
Vitreous hemorrhages can cause flashes to occur in the peripheral vision because the vitreous gel is pulling away from the retina. This can lead to a retinal tear or detached retina, which are medical emergencies. The flashes are painless and may appear suddenly, and should be checked by a doctor.
dolgachov / Getty Images
Symptom: Blind Spots and Dark Streaks
Blind spots or scotomas are distortions in the field of vision. The affected individual may see dark streaks, as well. As the vitreous shrinks, it may create stringy shadows on the retina, which the eye interprets as lines. These are also considered floaters. These symptoms should send a person to an ophthalmologist or an optometrist, as they could be indicative of a vitreous hemorrhage.
kadmy / Getty Images
|
cc/2021-04/en_middle_0071.json.gz/line3175
|
__label__wiki
| 0.630982
| 0.630982
|
The Questers is an international study club, which was founded in 1944 by Jessie Elizabeth Bardens. Its major objectives are to stimulate an appreciation of antiques and other collections and to encourage the preservation and restoration of existing historical landmarks. Its motto, “It’s fun to search and a joy to find,” has been the by-word for shared adventures and friendships in over 900 chapters across the country and in Canada.
When a Quester from San Franciso, CA, moved to Arkansas in 1970, she gathered together some of her new friends and formed Quapaw Chapter #519 in the Little Rock area. By 1977 there were five more chapters: Fairfield Bay #800; Petit Jean #819; La Petit Roche #822; Clara B. Eno #830; and Arkopolis #867. Now, in 2013, there are fourteen chapters throughout the state.
On May 2, 1980, Arkansas’ chapters became an “Organized Quester State”, with the first state-wide meeting held in Little Rock. The National President brought the State Quester Charter to the meeting and installed the first State officers.
Over the years, chapters have been formed and dissolved, but Arkansas’ first chapter, Quapaw, is still meeting and actively supporting not only their local and state preservation and restoration projects, but the goals of The Questers International as they have for 43 years!
There are two active chapters in Fairfield Bay who meet in the homes of members once a month. For information about Davis Special, call Fran Schroeder at 884-5440 or Willa Wells at 884-3218 for meeting times and information of the Indian Rock chapter.
Davis Special Chapter #1193 – Fairfield Bay, AR
Davis Special Chapter was chartered on February 21, 1991 at the home of Norma Miller. The Charter members were Dorothy Ball, Billie Covelli, Elda Gerndt, Maxine Hall, LaVon Hedges, Ruth Long, Norma Miller, Jacola Newton, Ollie Shelton and Melvis Sutton.
Through the years their main Preservation & Restoration project has been to help with the upkeep of Davis Special School, but recently we also started make regular donations to the Log Cabin Museum in Fairfield Bay. The latest project for both Fairfield Bay Quester groups was for signage at the Indian Thong Tree at Woodland Mead Park in Fairfield Bay. Indian tribes in this area pioneered trails and secretly marked certain trees in the forest to point to areas that had water sources, caves that provided shelter and safety, and other points of interest to them.
Indian Rock Questers, Chapter #869 – Fairfield Bay, AR
Indian Rock was chartered on December 5, 1977. The charter members were Esther Claybourn, Dorothy Gallagher, Encel Henning, Martha Hokanson, Lola McKenzie, Annette Mangan, Beatrice Plume, and Georgia Schoenecker
Their current project is the Fairfield Bay Log Cabin…Two log cabins, built in the mid 1850’s with hand-hewn logs chinked with mud and straw, were saved from destruction when they were moved during the 1950’s, from what is now the middle of Greer’s Ferry Lake. As the US government prepared to build a dam site there, the cabins were disassembled and re-built using cement instead of chinking materials. The smaller of the two cabins was placed in Fairfield Bay, with a fireplace constructed from local stone and a mantle of rosewood, walnut and pine.
Antiques are part of human history, a tangible record of the things of everyday living. A fascinating hobby, the study of antiques gives the most pleasure to those who strive to learn all they can about where, when, why and how they were made. Through discovery and knowledge of antiques, we may bring the past to life and profit by experiences of previous generations.
|
cc/2021-04/en_middle_0071.json.gz/line3176
|
__label__wiki
| 0.637614
| 0.637614
|
Fantastic Facts
One of The Rock’s first acting roles was as an alien fighting Star Trek’s Seven of Nine
12 Comments / Dwayne Johnson, Jeri Ryan, Seven of Nine, Star Trek: Voyager
Jeri Ryan recalls fighting Dwayne ‘The Rock’ Johnson on Star Trek: Voyager
Dwayne Johnson’s appearance in Star Trek: Voyager was one of his earliest acting roles. He wasn’t yet the biggest star in the world but the Seven of Nine actress could definitely smell what was cooking…
Transport back in time to the year 2000. WWE was still called WWF, and fast becoming its biggest star was Dwayne Johnson, or as he was better known, The Rock. It was inevitable that his charm, charisma and acting chops would be tested in dramatic roles, and so The Rock beamed into the 15th episode of the sixth season of Star Trek: Voyager.
The plot saw ex-Borg crew member Seven of Nine kidnapped and forced to fight in an arena for entertainment. Her first opponent is a Pendari champion who looks good in silver spandex. Here’s what … Continue Reading (3 minute read)
In high school, with his imposing physique and creepy mustache, most Dwayne “the Rock” Johnson’s classmates thought he was an undercover cop.
Zoe Saldana is the only person to appear in 2 movies making $2 billion or more in the box office.
Patrick Stewart hated having pet fish in Picard's ready room on TNG, considering it an affront to a show that valued the dignity of different species
12 thoughts on “One of The Rock’s first acting roles was as an alien fighting Star Trek’s Seven of Nine”
Slimeball3000
I remember watching that as a kid. It was pretty badass.
StereoSodaTexas
The article states even though he was famous by then, the actress didn’t know who he was. She assumed it was just “some guy.” So, after it was over, she found an autographed photo of him left in her trailer with him dressed as a wrestler with the words “The Rock smells what you’re cooking.” and this really confused her, because she had never even heard of his nickname, or catchphrase.
That pic, taken completely out of context, must have made him seem like the weirdest guy ever.
“I had a really fun time working with you. Here’s a pic of me in spandex.”
alwayswait01
You assimilate what the rock is cooking?
HooplaCool
And his grandpa fought James Bond in ‘You Only Live Twice.’
mowens87
Do you smell what The Rock is replicating?
Infernalism
His best role was in Be Cool.
Skullmonkey42
Seven of Nine? More like 10/10, amirite?
GhostFish
Professional wrestling *is* acting. It’s a stunt show of impressive physical feats, but it is acting.
manwithavandotcom
~~Big Show was also on that episode.~~
Oops–Big Show was on Enterprise, not TNG. Great scene when he picks-up T’Pol like she’s a misbehaving toddler.
Anyway–Jeri Ryan needs her own action hero franchise. Seriously, did you see her on Picard?! She makes Sara Connor look like a wimp.
dgl6y7
Geez I’m old.
japekai
I’d let her win.
PFCDoofles
I can’t believe in 2021 I’m still reminding people that professional wrestling is a stage acting gig. Dwayne “the rock” johnson was on Voyager as a guest spot because he was such a popular wrestler.
Copyright © 2021 Fantastic Facts
Arabic Chinese (Simplified) Dutch French German Italian Japanese Portuguese Russian Spanish
|
cc/2021-04/en_middle_0071.json.gz/line3180
|
__label__cc
| 0.573071
| 0.426929
|
« Are You A Werewolf? Game Review
Castle Dice Game Review (prepublished version) »
ZombieZone Game Review
By Cyrus | October 24, 2012 - 10:02 am | September 27, 2013 Reviews
Approximately 30 minutes
Counting & Math
Risk vs. Reward
Worker Placement & Area Control
Welcome to the newest pop-culture television phenomenon: Undead Reality TV!
Gamer Geek rejected!
Parent Geek approved!
The Zombie Invasion caught everyone by surprise. Despite the movies, the t-shirt slogans, and books that detailed how the zombies would attack and how to defend yourself, the population of the world shifted from alive and bored to undead and stiff. Once the initial shock wore off and the human race organized itself to fight and contain the zombie outbreak, life more or less returned to normal. Oh, sure, there were some changes. For example, EVERYONE now carried a handgun, graveyards had watchtowers, and the most popular TV show in history pitted willing living participants against mindless undead in a battle royal. In fact, you just signed a contract to be part of the next season, alive or undead. Good luck!
ZombieZone, by game designer Jason Tagmire (of Pixel Linconln fame), is comprised of 1 game board that depicts the arena floor, 20 Zombie/Human tokens (double-sided), 20 Ammo discs (red), 4 Bomb discs (blue), 4 six-sided die (2 black, 2 red), and 1 Shotgun die.
Pre-Show Checklist
Note: you are required to place the Zombie and Human stickers on the tokens and number values on the Shotgun die prior to your first game. This will take you all of about 5 or so minutes.
To set up the game, first place the game board in the playing area between the two players.
Second, choose which player will be the Zombies and which will be the Humans. Divide the Zombie/Human tokens evenly between both players (10 per player). The game rules suggest taking one of the tokens and flipping it as you would a coin to determine which player either selects first or which faction the player will take.
The tokens: Today’s Human is tomorrow’s Zombie
Third, there is no set “starting side” for Humans or Zombies as the game board is not meant to be symmetrical. Players should feel free to rotate the board however they like. Regardless of what side is used, players will place their tokens (with their specific faction facing up) on the edge of the board. There will be a square space for each of the tokens. The suggested first-time game board set up is shown below.
Fourth, the Zombie player should take the 2 black six-sided die and the Human player should take the 2 red six-sided die, the Shotgun die, the 20 Ammo discs, and the 4 Bomb discs.
Fifth, the Human player now places 2 Ammo discs on each of their Human tokens and 4 Bomb discs on 4 Human tokens of the player’s choice.
That’s it! Time to start the show! Choose who will go first if not already determined and begin!
Lights! Camera! Shotguns!
The game is played in rounds with each player taking a single turn per round. Both players only have two phases on their turn. These are move and attack. How the factions does either is dependent on if they have a pulse or not.
Phase 1: Move
The Zombie player will roll the 2 black six-sided die. The HIGHEST number rolled determines the maximum number of Zombies that can move this round. The LOWEST number rolled determines the maximum number of spaces the Zombies can move. For example, if the Zombie player rolled a “6” and “2”, this would mean that a maximum of 6 Zombie tokens can be moved a maximum of 2 spaces each. If the die values rolled are equal, then an equal number of Zombies will move an equal number of spaces.
The Human player will roll the 2 red six-sided die and their movement is exactly the same as a Zombie, but because the Humans have a working brain, they get to make a choice based on their rolled values. Like the Zombie player, one rolled value will determine the maximum number of Human tokens that can move this round and the other will determine the maximum number of spaces each token can move. The Human player, however, gets to decide. The HIGHEST value could be the total number of tokens moved or the number of spaces, for example.
Movement for both factions is always done orthogonally and never diagonally. A player is never forced to move any of their tokens, but if they do move them, they have to move at minimum of 1 space.
When a player only has one token left in play, they get the added bonus of an “Adrenaline Rush” that allows them to combine the two dice together to determine the number of spaces the lone unit can move (they can attack automatically). This bonus remains in effect for as long as the player has only one token in the game to use.
Phase 2: Attack
Technically, a Zombie attack happens at the same time as movement. Zombies bite and infect the Humans when they approach them. When a Human token is bit, it is flipped over and is now a Zombie token. Any Human token that is adjacent (orthogonally speaking) to a zombie is automatically and immediately flipped over. This can also cause a chain reaction that causes more than 1 Human token to be infected and flipped. Yikes! Luckily, a Zombie can only attack once, which means that if more than 1 Human token is adjacent to a single Zombie token, the Zombie player can only choose one of the Human tokens to attack. But, if the Human player moves one of their Human tokens adjacent to a Zombie token, the Zombie attacks automatically! This is bad news, indeed, especially if that Human token was carrying ammo or a bomb. If they were, the Human player removes the discs and places them on an adjacent and unoccupied space, where each space can only hold one disc each. If the space is occupied, the next space is used, and so on until all the items are dropped. The Ammo and Bomb can be recovered by another Human token.
Humans are a bit smarter but not as lethal. Humans, being cautious creatures, can move to a position that is best suited for them and then attack versus just blindly moving ahead. While this gives the Human player a distinct tactical advantage, it does not come without some inherent risk. The further away the targeted Zombie token is from the attacking Human token, the harder it is to drop the Zombie. This is because the Humans ares sporting shotguns. Terribly lethal at short-range, but less so the further out the target is.
Only the Human tokens that are activated can fire their shotgun and only then if they have an Ammo disc. To fire at a Zombie target, the Human player declares what Human token is attacking (with at least 1 Ammo disc attached), what Zombie token they are attempting to hit, and then rolls the Shotgun die. The rolled result shows the number of spaces that are in range for this attack. Unlike movement and Zombie attacks, shotguns can attack in all directions at once, both orthogonally and diagonally. If the rolled die value is equal to or greater than the number of spaces the targeted Zombie token is away from the attacking Human token, the Zombie token is removed from the game along with one Ammo disc. If the value rolled is not, the shot misses, but the Ammo disc is still removed. A roll of “X” is always a miss.
The number on each zombie indicates the range
All the action takes place on the game board grid. Movement is tracked by moving across the grid on the squares. Occupying some of the square spaces are crates. Crates provide “high ground” for the Human player and give any Human token attacking from a crate a +1 to range, however, it costs 2 movement to climb on top of it. Moving from one crate to another and hopping down from a crate only costs 1 movement.
Humans can attack through crates and Zombies can attack Humans standing up on a crate, but cannot climb onto them. Sorry, Zombies, you have to shamble around those annoying wooden boxes. If a Human player moves a token on top of an Ammo crate, they can automatically refill their Ammo discs to no more than 2.
Ammo crate (left) and normal crate (right)
The game can end one of two ways.
The first player to eliminate all of their opponent’s tokens from the game wins. For the Zombie player, this means all the Human tokens have been turned to zombies, and for the Human player, all the Zombie tokens have been removed from the game.
The Human player has deposited 1 Bomb on each of the 4 Ammo crates, in which case, the Human player wins. A Bomb disc can be dropped on an Ammo crate by simply moving a Human token onto it that is also holding a Bomb.
House Rule
The game plays just fine “as is”, but we have added a house rule for our little geeks that takes away some of the difficulty without reducing the fun. The Human players have to scrounge for ammo and this can be a difficult game mechanism for your little geek to grasp. Resource management is one of those Geek Skills that even Gamer Geeks still struggle with from time to time. If your little geeks wants to play as the Humans, put all the Ammo and Bomb discs in a central pile (we used a cup) and then have the little geek remove one Ammo disc each time they fire their shotgun. Having just one ammo pile to pull from reduces the need for the little geeks to conserve ammo as all the Human tokens share the central pile. They are still limited by total ammo available, but can collect 2 Ammo discs, putting them back in the pile, when a Human token stops on or moves on top of an Ammo crate.
To learn more about ZombieZone and read the full rules, visit the game’s web site on The Game Crafter.
ZombieZone, just by reading the rules, appears to be a very simple 2-player game of area control. Each faction shares the same available actions, but how they go about those actions is different enough to warrant some speculation on game balance. My concern is that one faction will have a decisive and very obvious advantage over the other. Games, especially 2-player games, where one side is by default stronger, are not much fun to play. However, I do see a glimmer of game balance from just reading the rulebook. For example, zombie movement reduces the number of zombie attacks without reducing the attack’s effectiveness. Likewise, the human movement gives the player much more choice on where they want to go, but the need to move to reduce range puts the human player at risk of being eaten. These simple mechanisms already reveal that the game designer has put some thought into game balance. We’ll just have to play the game to see if it works.
The game doesn’t take long to teach, but special emphasis should be placed on the ammo limit and the bomb placement. We developed the noted house rule for our youngest players, but for everyone else, you just need to make sure that they understand that humans have a limited number of ammo and how they can get more. Not complicated, but essential to the Human player’s survival. After that, it’s pretty much just making sure everyone understands by what is meant by “adjacent”, “orthogonal”, and “diagonal”. One player was already confused when I showed them that a Human player could stand diagonally beside a Zombie token without fear of being bit. Again, all it took was a quick explanation and everything was set. But before we played our first game with our little geeks, I asked them their thoughts on the game so far.
“A very simple looking zombie game, but I love how the humans turn into zombies when they get bit!” ~ Liam (age 8)
“Daddy, can I be the Human player? I don’t want to be a Zombie. They are not nice monsters.” ~ Nyhus (age 5)
Looks like my little geeks are ready to go hunting! Let’s see if this game is an exciting match to the undeath!
The Child Geeks really liked this game and found both factions to be a lot of fun to play. One little Child Geek said this game was like a better version of Checkers. To which we would agree. Any game that replaced abstract colored discs with shotguns and massive groups of undead is automatically a “step up”. Where the game really shined for my little geeks were how similar, but different, the two factions were. This made each game into something unique for them and guaranteed that their opponent wouldn’t just “copy” what they were doing (a big issue for the little geeks when it comes to Checkers and Chess). When the dust settled and the game was completed, both little geeks left the table feeling happy regardless of who won or who was eaten.
Parent Geeks, honestly, were not thrilled about the theme or narrative of the game. This put them at something of a distance right from the start. Once they played the game with their family members, they changed their minds. The games are fast and can be very intense without ever feeling weighty or unforgiving. Parents almost always took the role of the humans and the Child Geeks jumped at the chance to play the zombies. The game played very well between players with different skill levels and always felt balanced. The choices the player’s made had real impact in the game and the only time there was any analysis paralysis was when a Zombie player rolled 2 “6’s”. Turns out moving 6 Zombies at a time can be a logistical mess.
Gamer Geeks were torn on this one. They liked the theme but not the game play. The roll-n-move aspect reduced much of the strategy and tactics, leaving the game as nothing more than an exercise in limited decision making. Oh, they enjoyed the game, but their overall dislike of any game that trumped their ability to make tactical moves and choices simply because the dice didn’t roll the right way left a bad taste in their mouth. At most, they suggested this was a game they’d be happy to play if nothing else was available. One Gamer Geek said he was going to look into replacing his copy of Candy Land with ZombieZone. I imagine his little geeks will have nightmares in the future…
My little geek smirks as he gets ready to roll for his faction – he was really good with the shotgun!
Gamer Geeks, this is a very casual game that does require the player to use strategy and tactics, but not much. A great deal of the decision making is first based on the roll of the dice. Which tokens are moved and where are up to the player, but their choices are limited to the dice values rolled. This makes the game feel a bit too much like a “roll-n-move” experience and can turn off the most elitist of Gamer Geeks quickly. Look past this game mechanism and you’ll see a fun and fast 2-player game that sets up quickly and breaks down easily. Perfect for game fillers or whenever you feel like a quick zombiefest. The game was not accepted by the Gamer Geeks because of the “roll-n-move” like game mechanism, but don’t let that stop you from playing it with family and friends.
Parent Geeks, this is an easy to teach and easy to learn game of light strategy and tactics that reduces the player’s options to a subset of simple actions. While that might sound exceedingly basic, the area in which each player can move and the different way each faction operates, makes the game feel bigger and more difficult than it really is. If you don’t mind a slightly grotesque image of a zombie, you won’t have any problem playing this game. Some of the Parent Geeks thought the game was perfect for easy plays and introduction to more complex strategy games where location of pieces was very important to achieving victory. Non-gamer also enjoyed it, but didn’t comment for or against the theme.
Child Geeks, there are a lot of zombie games on the market. A lot. It’s one of those themes that you can slap on a game and it starts to sell before you can even get it on the shelves. However, most zombie games tend to put the player in a position where they must use a lot of tactics and strategy to keep their playing piece in the game. This usually also requires the player to go up against some incredibly poor odds of survival. This is the game’s intention and can feel very overwhelming, to say nothing of the stress the game play can produce. ZombieZone might stress you out a bit, but the game is not meant to be “hardcore”. You can pick a side, play a game within 30 minutes or less, and never feel like the game is getting out of control. Both sides are fun to play and act differently enough to make switching sides a worthwhile experience. This is especially true when neither side has any advantage over the other. Fast and fun, this is a great introduction to the more complex zombie-themed games you will doubtlessly play in your future.
I all kinds of disagree with the Gamer Geeks on this one, regarding endorsement. I play a lot of roll-n-move games with my little geeks, and while this game does require the player to roll the dice to determine movement, the dice values do not dictate or finalize a player’s actions. There is still a lot of thought that needs to go into the placement of the tokens. Zombies are great for simply just pushing forward and are much more effective if grouped together. Humans, on the other hand, have a much higher survival rate if they separate (which is completely contradictory to horror movie law). Each faction has their strengths and flaws, but the game is exceedingly well-balanced with the one exception being the dice rolls themselves. Depending on a player’s “luck”, they can get excellent rolls again and again. Just as likely, a player could also have really poor luck which will make their faction exceedingly ineffective. This was not lost on the Gamer Geeks and was at the root of their lack of endorsement. Any game that trumps or boosts a player’s natural gaming ability on a dice roll starts to feel very unfair and out of balance. But when we consider that the majority of dice rolls will not be in the extreme and the player gets to decide how to use them (tokens moved and spaces moved), the sense of being tied to the outcome of a single dice roll starts to feel less automatic and more strategic. Perhaps you want to move more tokens this turn instead of moving less spaces? Or, vice versa? Both options are available to the player and they are never forced to move any at all, if they don’t like. That’s why I can’t and won’t agree with the Gamer Geeks on this one, but I’m outnumbered regarding the endorsement level. At the very least, this is a game that is great for quick fillers and a wonderful introduction for new players (be they little geeks or adults just getting into the hobby) to zombie games were movement and location can make the difference between surviving or being lunch.
If you are looking for a quick game of zombie survival that is easy to teach, well-balanced, and perfect for those times when you “just want a quick game”, do lock your sights on ZombieZone. While not the most complex of zombie survival games on the market, it is certainly no cakewalk and was found to be much fun to play.
This game was given to Father Geek as a review copy. Father Geek was not paid, bribed, wined, dined, or threatened in vain hopes of influencing this review. Such is the statuesque and legendary integrity of Father Geek.
Zombie Ninja Pirates Game Review
Blaster Waves Game Review
Smash Up Game Review
LightSpeed Game Review
Host Game Review
Zombie Tower 3D Game Review
Tagged Parent Geek Approved, Print and Play Games, Zombie Games. Bookmark the permalink.
7 Responses to ZombieZone Game Review
Pingback: Father Geek’s Top 5 Games Played in 2012 » Father Geek
Pingback: Castle Danger Game Review (10th Anniversary Edition) » Father Geek
|
cc/2021-04/en_middle_0071.json.gz/line3183
|
__label__cc
| 0.724545
| 0.275455
|
Bipolar disorder may be a difficult diagnosis to live with, and finding successful personalized treatments is challenging. Oftentimes, treatment targets shift, patients are non-adherent to medication regimens, and comorbidity rates are extremely high.[1] Unfortunately, bipolar disorder is also associated with high rates of suicide, usually with more lethal means than other mental disorders.[2] Contributing factors to such an association have been reported to be onset of disease at an early age, large number of depressive episodes, comorbid substance use disorders, and hostile and impulsive traits.1 According to Stephen Sobel, Clinical Instructor at the University of California, San Diego, it is usually easier to diagnose bipolar I disorder than it is to diagnose bipolar II, as bipolar I includes episodes of full-blown mania.1 Therefore, Sobel states that psychiatrists should recognize the primary mood state of mania may be irritability rather than euphoria and that symptoms may last fewer than four days, contrary to the DSM-IV diagnostic guidelines.[3]
Bipolar disorder is recognized as a biopsychosocial disorder, with mood-stabilizing medicines creating the backbone of all treatment plans.1 According to Sobel, there are three categories of mood-stabilizing medicines: lithium, antiepileptic agents, and second-generation antipsychotics.1 Oftentimes, a combination of medications is needed to successfully treat manic symptoms.1 For example, either lithium or an antiepileptic paired with an atypical antipsychotic. However, bipolar depression is more difficult to treat than bipolar mania, as it often proves treatment resistance.1 The FDA has approved the medicines Seroquel, Seroquel XR, and Symbyax for the treatment of bipolar depression.1 Patients with bipolar disorder require lifelong treatment, frequently with two or more medications, one to prevent the mania and the other to prevent the depression.1
According to Sobel, the best medicine combination is the one the patient will take regularly, for even effective medicines are not effective if they are not taken regularly.1 Therefore, a strong and trusting patient-physician relationship is needed for a successful decision-making process.1 As maintenance treatment is often necessary for patients, choosing medicines that are tolerable in the long-run are more likely to work out.1 Medicines may need to be adjusted or changed over time, as the illness changes and so does a patient’s lifestyle.1 Sobel states that the following are also factors needed to be taken into consideration when choosing a medicine for bipolar treatment: history of treatment response, family history of treatment response, adverse effects of a drug, drug interactions, pregnancy, and breast-feeding.1
Psychotherapy is the second important aspect of treatment for bipolar disorder.1 Effective psychotherapies include cognitive-behavioral therapy and social rhythm therapy.[4] Psychotherapy focuses on education, comorbidities, medication adherence, and interpersonal relationships.1 Therapy also challenges automatic, distorted and dysfunctional thoughts, helping the patient to change their thinking and to maintain certain social rhythms.1 Involvement of family members is also important.1
Overall, Sobel states that each appointment with a patient with bipolar disorder should focus on changes in their occupational, family, social, and medical health status.1 Therefore, medicine regimens can be evaluated and treatment can be made as effective as possible.1
[1] Sobel, S.V. (2012, August 2). Effective Personalized Strategies for Treating Bipolar Disorder. Psychiatric Times. Retrieved from http://www.psychiatrictimes.com/bipolar-disorder/content/article/10168/2094000.
[2] Raja M, Azzoni A. Suicide attempts: differences between unipolar and bipolar patients and among groups with different lethality risk. J Affect Disord. 2004;82:437-442.
[3] Akiskal HS, Benazzi F. Optimizing the detection of bipolar II disorder in outpatient private practice: toward a systematization of clinical diagnostic wisdom. J Clin Psychiatry. 2005;66:914-921.
[4] Frank E, Soreca I, Swartz HA, et al. The role of interpersonal and social rhythm therapy in improving occupational functioning in patients with bipolar 1 disorder. Am J Psychiatry. 2008;165:1559-1565.
|
cc/2021-04/en_middle_0071.json.gz/line3186
|
__label__cc
| 0.733859
| 0.266141
|
« Morphometric features of the river network from the Bârlad catchment
Invasive terrestrial plant species in the Romanian protected areas. Case study:… »
Volume XI | Issue 1
The Evaluation of Geomorphosites from the Ponoare Protected Area
Laura Comănescu1,*, Alexandru Nedelea1, Robert Dobre1
Abstract: In the present paper we present a new method of evaluating the geomorphosite. The method is presented by us/ our team and it was tested in the protected area Ponoare. In the first part of the article, we will apply, for the geomorphosites inventorized here, the other methods of evaluation known worldwide, and after that we will evaluate geomorphosites by following the new method proposed by us, a method which is adapted to geomorphological reality and to the reality of touristic exploitation of the analysed area. There were taken into account the methods developed up to now in the specialized literature, namely: the method of evaluating the touristic value of geomorphosites for the evaluation of the touristic value conceived by J. P. Pralong in 2005, the method developed in 2007 by E. Reynard et al.; the method developed at the University of Modena and Reggio Emilia by P. Coratza and C. Giusti in 2005; and the method proposed at the University of Cantabria by V. M. Bruschi and A. Cendrero in 2005; the method developed by the University from Valladolid by E. Serrano and J. J. Gonzales Trueba in 2005; the method proposed by the University of Minho in 2007 by P. Pereira, the Greek method developed by N. Zourous in 2005 and the Slavonian method proposed in 2012 by B. Erhatic. The results obtained show different quantitative values compared to previous methods, but comparing the rank obtained by each geomorphosite during the evaluation, the rank stays the same. The values are situated in a different deviation compared to other methods, having in view that for additional values firstly the cultural value is reduced in the analysed area.
Keywords: geomorphosite, carst, evaluation, method, Ponoare
Full article 10.5775/fg.2067-4635.2012.037.iDates: Received: 31-08-2011 Accepted: 01-09-2011 Printed: 01-06-2012 Online: 29-07-2012
1 University of Bucharest, Faculty of Geography, Department of Geomorphology, Pedology, Geomatics
* lauracomanescu@yahoo.com
Copyright: © 2012 Forum geografic. All rights reserved.Acknowledgements: The present contribution is part of the research project PNII/Idei (Inventorying, evaluating and mapping of the geomorphosites. Case studies: the Dobrogea Tableland and the South Carpathians) financed by NURC (National University Research Council), project manager Laura Comănescu.
|
cc/2021-04/en_middle_0071.json.gz/line3188
|
__label__wiki
| 0.721176
| 0.721176
|
MA: 617-231-7829
CA: 415-579-9481
Consumer Protection Actions
Data Breach & Medical Privacy
Employment & Wage Actions
Unfair Housing Practices
Unfair Debt Collection
Bad Faith Insurance Practices
John R. Yasi, Esq.
Data Breach Litigation
Employment/Wage
Unfair Collections
Unfair Housing
Unfair Insurance Practices
Attorney Yasi is a founding partner of the Salem, Massachusetts based law firms Forrest | LaMothe and Yasi & Yasi, PC.
As a partner of Forrest | LaMothe, Mr. Yasi practices in the areas of: Consumer Protection, False Advertising, Data Breach and Medical Privacy, Employment/Wage, Unfair Housing, Unfair Collections and Product Liability.
Attorney Yasi has been a member of the Massachusetts Bar association since 1990. Since that time, he has been a partner at Yasi & Yasi, P.C. practicing exclusively in the fields of civil litigation and class action litigation. Mr. Yasi has solely represented plaintiffs for over twenty years, focusing on civil litigation and class action litigation.
Mr. Yasi’s successful representation of Massachusetts insureds has led to major policy shifts in regard to how Massachusetts insurers pay out claims, judgments and arbitration awards.
Mr. Yasi is a 1990 graduate of Suffolk University Law School where he received his J.D. and a 1986 graduate of Arizona State University.
Mr. Yasi is admitted to the Massachusetts Bar.
Michael C. Forrest, Esq.
Matthew T. LaMothe, Esq.
Robert E. Mazow, Esq.
Kevin J. McCullough, Esq.
Paul F.X. Yasi, Esq.
Brian P. McNiff, Esq.
David J. Relethford, Esq.
Massachusetts Offices
2 Salem Green, Suite 2 Salem MA 01970
California Offices
3998 Chestnut Avenue, Concord, CA 94519
Please be advised that any information provided on this website is for informational purposes only and in no way serves as, or establishes an attorney-client relationship between you and Forrest, LaMothe, Mazow, McCullough, Yasi & Yasi, P.C.
Please be advised that submitting information for review through this form in no way serves as, or establishes an attorney-client relationship between you and Forrest, LaMothe, Mazow, McCullough, Yasi & Yasi, P.C.
Copyright © 2018 Forrest, LaMothe, Mazow, McCullough, Yasi & Yasi, P.C. Website by Compete Now.
|
cc/2021-04/en_middle_0071.json.gz/line3194
|
__label__wiki
| 0.559953
| 0.559953
|
Man Down’s big reveal is really a big mistake
North Texas represents with 7 nominations in 59th Grammy Awards
Texas Ballet Theater presents The Nutcracker at Bass Performance Hall, December 9-24. Photo by Marty Sohl
The Texas Rangers present Anxiously Awaiting Santa Tours at Globe Life Park in Arlington, Tuesdays through Saturdays through December 17. Photo by Kelly Gavin/Texas Rangers
Gift of Lights is on display at Texas Motor Speedway through December 30. Photo courtesy of Texas Motor Speedway
Aquarius screens six times between December 9 and 11 at the Modern Art Museum of Fort Worth. Photo courtesy of Vitagraph Films
The annual Cowtown Indie Bazaar is at Will Rogers Memorial Center on December 10. Photo courtesy of North Texas MADE
If you're interested in attending a new event this weekend in Fort Worth, you'd better be in the holiday mood. Almost all the events in this week's roundup are holiday-themed, including two ballet concerts, alternative uses for two sports venues, and various holiday shopping opportunities.
Below are the best options for your precious free time Thursday through Sunday. Don't like what you see? Lucky for you, we have a much longer list of the city's best events.
Texas Rangers present Anxiously Awaiting Santa Tours
Baseball season may be over, but you can still get your Texas Rangers fix with their Anxiously Awaiting Santa Tours, the annual holiday-themed ballpark tours. Fans can see behind the scenes as Globe Life Park decks the halls for Santa’s arrival, and kids have the opportunity to participate in a special story time and write a letter to Santa to mail from the Texas Rangers “North Pole” mailbox. Tours take place Tuesdays through Saturdays through December 17.
Texas Motor Speedway presents Gift of Lights
Texas Motor Speedway opens its gates to the public for the annual Gift of Lights, a 2-mile drive through the speedway that features over 200 lighted displays with more than two million LED lights. Back again is Santa’s Village, a 22,000-square-foot village located in the TMS infield, where visitors can get a photo with Santa Claus, refreshments, and ride a miniature train, in addition to other great family activities. The holiday event is open every day through December 30.
Magnolia at the Modern: Aquarius
In Aquarius, Sonia Braga plays a 65-year-old widow and retired music critic who vows to live in her apartment until she dies after a developer buys all of the units around her. The Portuguese film with English subtitles has six screenings through Sunday at the Modern Art Museum in Fort Worth.
Ballet Concerto presents A Holiday Special
Ballet Concerto's annual A Holiday Special features Winterwonderland set to familiar Christmas tunes and choreographed by Margo Dean; The Christmas Grump, choreographed by Margo Dean and restaged by Webster Dean; and A Hanukah Flamenco, which introduces the audience to the story of Hanukah. The program, taking place at Will Rogers Memorial Center, wraps up with a reenactment of the nativity set to “O Holy Night,” with choreography by Margo Dean.
Texas Ballet Theater presents The Nutcracker
A must-see holiday theater tradition, The Nutcracker is once again brought to life by Texas Ballet Theater. Playing at Bass Performance Hall through December 24, the ballet features a score by Tchaikovsky and enduring characters such as Clara, the Sugar Plum Fairy, and the Nutcracker Prince. And don't forget about the adults-only version on December 16, The Nutty Nutcracker, a send-up of pop culture featuring wild characters and racy action from start to finish.
WestBend Wonderland
Activities at WestBend Wonderland include hourly snowfalls, in-store specials, and live local music throughout the day. Guests are invited to dress up in their best “hipster Santa” outfit to participate in an Instagram competition. WestBend is also hosting a toy drive during the event, benefiting the Fort Worth Margarita Society. New, unwrapped toys can be dropped off at the Christmas tree near the Woodhouse Day Spa.
North Texas MADE presents Cowtown Indie Bazaar
The Cowtown Indie Bazaar is North Texas MADE's holiday show, featuring handcrafted goods from indie makers all across North Texas. Taking place at Will Rogers Memorial center, visitors can find handmade jewelry, home goods, children’s items, unique clothing, accessories, bath and body products, original artwork, eco-friendly items, and more. The first 40 attendees receive a complimentary swag bag filled with handmade items. The event includes photo ops with Santa, photo booth, and cash bar.
Fort Worth Youth Orchestra presents Holiday Concert 2016
Fort Worth Youth Orchestra's Annual Holiday Concert features all four orchestras joined by the FWISD Elementary Children’s Honor Choir, who are premiering a newly commissioned work, written by TCU’s Dr. Till M. Meyn. Enjoy an audience sing-along of holiday classics at TCU’s Ed Landreth Auditorium.
The Modern Art Museum of Fort Worth presents FOCUS: Leidy Churchman
Magnolia at the Modern: No Man's Land
Bass Performance Hall
Globe Life Park in Arlington
Modern Art Museum of Fort Worth
|
cc/2021-04/en_middle_0071.json.gz/line3195
|
__label__wiki
| 0.67295
| 0.67295
|
CoD: Modern Warfare Multiplayer Beta Dates; PS4 Early Access Revealed
By Hermain Irshad On Sep 10, 2019
It cannot be denied that the hype for Call of Duty: Modern Warfare is high and despite some criticisms that have been made against the annual title model promoted by Activision for the franchise, the contemporary war series has sufficient recognition to grant the benefit of the doubt. Although there are still weeks left for its debut, in a few days it will be possible to try the multiplayer component in an open Beta.
Activision and Infinity Ward recently revealed the dates on which the Call of Duty: Modern Warfare multiplayer Open Beta will take place, which will be available to PS4, Xbox One and PC players. In the case of the Sony console, it will be there where everything starts from September 12 under the following scheme:
September 12 and 13 it will only be accessible for those who pre-ordered the game.
From September 14 to 16, access will be open to all.
From 19 to 23 access will be open to all.
PlayStation Plus subscription required.
The preload will begin on September 12.
On the other hand, the Open Beta of Call of Duty: Modern Warfare on Xbox One and PC will take place from September 19 under the following scheme:
September 19 and 20 there will only be accessible for those who preorder the game on Xbox One or Battle.net.
From September 21 to 23, access will be open to all players.
An Xbox LIVE Gold subscription or Battle.net account is required to play.
The preload will begin before September 19.
READ The Last Guardian Release Date Confirmed for 2016 by Sony on PS4
Call of Duty: Modern Warfare will release on October 25 on PS4, Xbox One and PC. In other news, it was also confirmed that the game’s DLC will release first on PS4.
Get battle-tested in the free Open Beta.
Pre-order #ModernWarfare for early access starting September 12 on PS4. pic.twitter.com/xe08nWQlHr
— Call of Duty (@CallofDuty) September 9, 2019
Call of Duty: Modern WarfareCOD: Modern WarfareModern WarfareMultiplayer Betapc gamePS4video gameXbox One
Hermain Irshad592 posts
Hermain is a reporter for Game Transfers. After graduating from the University of Lahore, Hermain got an internship at a local newspaper and worked as a beat reporter and editor. Hermain has also worked as a columnist for the Thefrisky. Hermain covers Gaming and community events for Game Transfers.
Super Smash Bros. Ultimate Initial File Size Was 60 GB
The Last of Us Part II Media Event Planned, Here Are the Details
Triniti Stars Announces Earth Keeper: Avengers
Rumor: Konami to Reveal Metal Gear Solid 5 Daemon Edition at Gamescom 2019
News, Nintendo, PC, PlayStation, Xbox
Microsoft Poland Leaks Keyboard and Mouse Support for Xbox One
News, Xbox
Super Smash Bros. Ultimate is characterized by the huge amount of content it has, especially since it brings together characters,...
|
cc/2021-04/en_middle_0071.json.gz/line3201
|
__label__wiki
| 0.84204
| 0.84204
|
DA Who Failed to Indict Killer Cop Now GOP Front Runner for Congress
Hudson Hongo
Filed to: eric garner
daniel donovan
Earlier this month, Staten Island District Attorney Daniel Donovan made headlines for failing to secure an indictment for Daniel Pantaleo, the Staten Island NYPD officer who killed Eric Garner. This week, Donovan is in the papers again, this time as the Republican Party's "clear front runner" for the congressional seat opened up by outgoing representative/convicted felon Michael Grimm.
Killer Cop Who Choked Eric Garner Walks Free
Daniel Pantaleo, the Staten Island NYPD officer who killed Eric Garner with a chokehold in July,…
According to The New York Observer, sources within the Staten Island GOP say Donovan "has emerged as the strongest candidate" and will likely win the party's backing in the upcoming special election.
Donovan has yet to formally announce his candidacy, but on Tuesday he released a statement saying he was "very seriously considering the race."
From the Staten Island Advance:
[Staten Island Borough President Guy] Molinari said he doesn't think the grand jury decision in the Eric Garner case will hurt Donovan, even as some criticized the district attorney's handling of the case.
"He did what you're supposed to do: He brought the facts before a grand jury and the grand jury spoke," Molinari said. "That's a tough part of the business."
Among the lingering questions surrounding the Garner case: Donovan's unexplained decision to leave a reckless endangerment charge against Officer Pantaleo off the table.
Others were more direct in their assessment of how the case affected Donovan's reputation.
"He could have killed the guy himself and still would get re-elected," one Island Democrat told The Daily Beast. "Everybody just loves Danny. To them, the guy can do no wrong."
[Image via AP Images//h/t Wall Street Journal]
|
cc/2021-04/en_middle_0071.json.gz/line3202
|
__label__cc
| 0.73447
| 0.26553
|
Ben Fulford Updates
White Hats Report
Nazism & Zionism
New World Disorder
The Situation is So Intense, it Involves the Entire US Government | FBI Insider
Turkey Crisis
Global Settlements
The Interview The Global Elite Never Want You To Hear
BRICS / SCO / EAEU
Corporatocracy / Fascism
Nuclear/Kinetic Warfare
HAARP / Manmade Disasters
Drugs & Trafficking
Intelligence/Espionage
US Militia
The Empire Strikes Out as Khazarian mafia fake Zika virus, negative interest rate offensives fail
Clearly the Khazarian mafia is running scared and running out of ammunition. The fact that the Khazarian mob controlled Bank of Japan was forced last week to resort to negative interest rates proves their fake fiat money is now worth less than nothing. The Federal Reserve Board will soon be forced to do the same thing. The more you put money in their banks, the more that money vanishes. More about that later.
[soundcloud url=”https://api.soundcloud.com/tracks/244894835″ params=”color=ff5500&auto_play=false&hide_related=false&show_comments=true&show_user=true&show_reposts=false” width=”100%” height=”166″ iframe=”true” /]
The other thing that is clearly failing is their ability to create mass panic, fear and loathing, their traditional control tools. Their latest attempt, upgrading a relatively minor illness known as Zika virus into a baby head-shrinking pandemic is so totally fake, with nothing but computer graphics of small headed babies as evidence, that very few real doctors or hospitals are taking it seriously. Time to round up the criminal liars at the WHO.
The latest attempt to create disease panic may be related to efforts to force the Bill and Melinda Gates Foundation to cede control over their vaccination and other “medical” (eugenic) activities to meritocratic management.
http://www.independent.co.uk/news/world/politics/gates-foundation-accused-of-dangerously-skewing-aid-priorities-by-promoting-big-business-a6822036.html
Bill Gates is also now the point man for computer fraud to make sure a Khazarian mobster wins the upcoming US presidential “election.” This is being presented as Microsoft volunteering the use of its “app” to count votes in Iowa.
http://thehill.com/policy/technology/267586-microsoft-on-the-hot-seat-in-iowa
Of course, the Khazarian mob is not going to be allowed to steal yet another US election, US agency sources say.
Instead, the FBI probe into Hillary Clinton is being “expanded to intel agencies to purge her moles and embedded Bush/Israeli agents,” a Pentagon source says. A CIA source, meanwhile, put his neck on the line by predicting Hillary will be “indicted by February 28th.”
If the Pentagon and the agencies are serious about taking down Hillary, they should, as Russia’s Vladimir Putin so eloquently put it, “go after the dog’s owner.” Here is Hillary describing her master in her own words spoken on July 15, 2009 at the Rockefeller controlled Council on Foreign Relations Washington DC offices:
“I am delighted to be here in these new headquarters. I have been often to, I guess, the mother ship in New York City, but it’s good to have an outpost of the Council right here down the street from the State Department. We get a lot of advice from the Council, so this will mean I won’t have as far to go to be told what we should be doing and how we should think about the future.”
http://www.activistpost.com/2016/01/hillary-clinton-brags-about-getting-her-marching-orders-from-the-cfr.html
Many clear signals are already being sent to the Wall Street mobsters in New York. For one thing, their corporate media control grid is being hacked. According to Pentagon sources, “Rupert Murdoch’s Fox Network has been ordered to reboot the x-files program to reveal truth in plain sight about alien technology, free energy, anti-gravity, 911, NSA, depopulation etc.” Agency sources say “Bush cancelled the show in 2002 to prevent it from exposing 911.” Meanwhile, the CIA has declassified its UFO files.
Other corporate media outlets have also joined this sudden return to real reporting with such outlets as the New York Times and Time Life reporting 911 truth.
http://www.veteranstoday.com/2016/01/25/nytimes911/
The US, Russian and Chinese alliance against the Khazarian mafia is also proceeding well in their take down of the Khazarian mob regime currently enslaving the brainwashed people of Israel with fear and paranoia.
The Israeli power grid was hacked and taken down on January 25th, after which, on January 27th, US top general Joseph Dunford and Defense Secretary Ashton Carter visited the US cyber command “to encourage cyber troops to up the fight against ISIS and their sponsors.”
In a clear sign that sensible Israelis are reading the writing on the wall, Israeli Defense Minister Moshe Ya’alon tried to blame Turkey for being in charge of ISIS.
http://www.israelnationalnews.com/News/Flash.aspx/349951#.VqxUrVKjChk
The US has also now joined the EU in a demand for labelling and boycott of all goods produced in the illegally occupied West Bank.
US, Russian military cooperation against Israel has also meant that Iranian affiliated troops have now arrived at the Israeli border while the Israeli airforce remains grounded and unable to do anything about it. As the Mossad linked news site DEBKA puts it “leaders opt to avoid action on three menacing fronts.”
http://www.debka.com/article/25201/Israel%E2%80%99s-leaders-opt-to-avoid-action-on-three-menacing-fronts-
Russian and US military cooperation is now extended to sharing information about China as well as about enemies like ISIS, “the bad guys in Israel,” Turkey, drugs, Saudi Arabia and “cabal targets.”
For example, the Russian Insider news site said the following about US State Department criminal Victoria Nuland, the chief agitator and trouble-maker in the Ukraine: “she is a target.”
http://russia-insider.com/en/lavrovs-nuland-signal-slap-surkov/ri12398
The US and Cuban militaries are also now in full cooperation mode to cut off the flow of drug money to the Bush cabal and their ISIS mercenary proxies, Pentagon and Vatican officials agree. That is why Cuba was supplied with hellfire missiles to allow it to shoot down drug running planes, the Pentagon sources say.
There has also been agency and Pentagon cooperation aimed at preventing cabal provocateurs from starting a civil war inside the United States. This is the case with the dispute going on in Oregon where a large group of armed militia men seized a national wildlife refuge property. The dispute started with what appears to be a legitimate grievance over excessive persecution of two ranchers by Federal Agents.
http://www.theaustralian.com.au/news/world/oregon-occupation-one-dead-as-fbi-arrests-in-public-lands-dispute/news-story/c9a172347d2320ee81d3a923533cb7a7
However, this grievance is now headed for the courts where hopefully justice will prevail. In the meantime, evidence has emerged that Khazarian crisis actors have arrived on the scene in an attempt to provoke civil strife.
http://henrymakow.com/2016/01/crisis-actors-used-to-discredit.html
It is understandable for patriotic Americans to feel angry with the Federal Government. However, picking the wrong battle against the wrong enemy will only result in defeat. The enemy is not in Oregon, it is in Washington DC and New York, so, if you really feel like fighting for freedom, go there and attack the Khazarian mob bosses like the Bush/Clinton crime family and do not take it out on some poor working FBI stiff or local sheriff.
In any case, the real war will be won in the economic, financial and economic spheres and here things are going very badly for the Khazarians. For one thing last week, the heads of the African Union appear to have joined Iran, Russia, Western Europe and many others in moving away from Khazarian controlled debt instruments mislabelled “US dollars,” and agreed to go with gold backed Yuan instead.
http://news.xinhuanet.com/english/photo/2016-02/01/c_135062206.htm
The Khazarians continue to lose any real backing for their so-called dollars. For example, there are now 500 times more contracts to buy gold at the Chicago Mercantile Exchange than there is physical gold to back these contracts. Real, as opposed to paper, gold trading has now migrated to the Shanghai exchange.
Now the London Bullion Market Association appears to have lost control of the ability to set the price of silver when last week their price turned out to be 6% lower than the physical spot price.
http://www.zerohedge.com/news/2016-01-28/silver-market-disarray-after-benchmark-price-fix-manipulation
After the Japanese Imperial family failed to find gold to back the yen when they went to the Philippines last week, the Khazarian controlled Bank of Japan was forced to join the European Central Bank and issue negative interest rates. This means real Japanese money will be fleeing to cash and to real assets like gold and silver.
The Khazarian slave bankers are under the illusion that negative interest rates will boost the real economy by forcing businesses and people to invest and spend their money. However, with Japan and the EU suffering from shrinking populations and economies, stealing the people’s savings is not going to boost production.
The Khazarian slave regime in Japan is on its last legs anyway. Last week Akira Amari, the Japanese economy minister who oversaw TPP negotiations, was forced to resign over bribery charges. Others will follow.
In Malaysia too now, it turns out the Goldman Sachs and the Saudi Arabians were bribing Prime Minister Najib Razak.
https://www.rt.com/business/330665-goldman-leissner-malaysia-corruption/
You can be sure the trail of this bribery investigation will eventually lead to the truth about the Malaysian air flight 370 disappearance.
The Khazarians are now losing electronic control of the financial system as well, as banks worldwide are being forced to install CIPS, which will replace the current Khazarian SWIFT system. This will take some time, which may be why the Chinese delegate to the White Dragon, who is involved in bank computer systems, said 2018 will be the year when internationally traded US dollars will have a Chinese signature on them.
The Khazarian mobster hedge funds such as Soros, Carlyle, Nexus etc. have all said they are going to gang up and bet on a devaluation of the Chinese Yuan. However, what these people do not get is that the Chinese are busy shedding their dollar holdings on purpose because they know they will be replacing these dollars.
In any case, no matter how many dollars the Khazarians put in their bank computers, reality is a different thing. Even though a growing chorus of bankers is calling for a ban on cash, so that people will be forced to accept negative interest rates, they cannot ban reality. On this front, the global trade squeeze against people refusing to pay for shipping in Yuan is beginning to hurt. Pentagon sources say a shut down of New York ports by dockworkers “is a message to Wall Street and the Khazarian mafia.” Now South Korea has reported an 18.5% drop in trade in January.
Finally, the official Chinese Xinhua News Site has confirmed a recent report by this newsletter that the Chinese Communist Party was moving towards power sharing with other political parties.
http://news.xinhuanet.com/english/2016-01/30/c_135059965.htm
There can be no doubt about it, the good guys are winning.
http://benjaminfulford.net/2016/02/01/the-empire-strikes-out-as-khazarian-mafia-fake-zika-virus-negative-interest-rate-offensives-fail/
One of the significant sources of funds for the Nazionist Khazarian Mafia is the healthcare industry which registered a whopping $3.09 trillion in 2014, and is projected to soar to $3.57 trillion in 2017, in the US alone. We believe that this is just a conservative figure.
We can avoid using drugs, defeat any viral attack and scaremongering easily by knowing how to build our own comprehensive antiviral system. Find more about it here.
You can actually participate in crippling the Deep State organized criminal cabal, while enjoying healthcare freedom at the same time, by boycotting Big Pharma for good.
2 thoughts on “The Empire Strikes Out as Khazarian mafia fake Zika virus, negative interest rate offensives fail”
https://petitions.whitehouse.gov/petition/we-demand-conviction-usa-president-barack-obama-and-trial-international-criminal-court-hague
We demand conviction of a war criminal Barack Obama and trial in the International Criminal Court in Hague. He is guilty of crimes not only against the USA citizens, but against the whole world.
One of the most dreadful prisons in history – Guantanamo – continues to function. Libya was destroyed as a result of Obama’s aggression. In Syria, Obama’s agents train, fund and organize terrorist groups, deceitfully naming them “moderate opposition”, who, among other things, bear a relation to Al-Qaeda, implicated in crimes against the American people. Secret services collect the Americans’ personal data information on a 24 hour basis under the canopy battling terrorism, using electronic surveillance tools on political undesirables, effectively stomping on the Americans’ right for privacy.
Published Date: Feb 08, 2016
Issues: Civil Rights and Liberties, Foreign Policy, Human Rights
Terry Noyes says:
People need to remember, and keep in mind that when Pres. Reagan was nearing the end of his term, he had stated in front of the lame stream media, ‘Watch out for Obama’- We were well warned, yet most of you laughed- You’re not laughing now, are you?
“Never underestimate the power of a few committed people to change the world. Indeed, it is the only thing that ever has.”
~ Margaret Meade
COVID19: Crime Against Humanity
Covert Hybrid WW3
https://www.youtube.com/watch?v=IMSkLu31QdE&list=PL-vyCOc3Mo5dm1UV9Hvu_TeoNmnH2H5aX
The Israel Lobby
16,016,552 hits | Thank you for flying with us!
Benjamin de Rothschild Died of A Heart Attack
‘The Shape of Things to Come’ Has Arrived Today
Big Tech & the Democratic Party Are Leading America to a Fascist Future
A Stunning Success: China’s International Development Cooperation
Today’s demonstrators have no real goals beyond snapping that protest selfie
Russia & U.S. are Building Up Their Forces in Syria Ahead of Biden Inauguration
America’s Richest 1% Owned 5% in 1990, Own 36% Today
The Storming of The US Capitol is A Symptom of a Bigger Disease
Capitol Riot Spells the End for Trump with the Republicans
Archives Select Month January 2021 (14) December 2020 (24) November 2020 (34) October 2020 (25) September 2020 (32) August 2020 (26) July 2020 (22) June 2020 (23) May 2020 (15) April 2020 (12) March 2020 (11) February 2020 (22) January 2020 (42) December 2019 (13) November 2019 (17) October 2019 (17) September 2019 (11) August 2019 (15) July 2019 (19) June 2019 (25) May 2019 (31) April 2019 (24) March 2019 (34) February 2019 (24) January 2019 (14) December 2018 (26) November 2018 (24) October 2018 (22) September 2018 (22) August 2018 (21) July 2018 (21) June 2018 (12) May 2018 (9) April 2018 (24) March 2018 (19) February 2018 (16) January 2018 (9) December 2017 (14) November 2017 (8) October 2017 (26) September 2017 (39) August 2017 (48) July 2017 (29) June 2017 (54) May 2017 (46) April 2017 (38) March 2017 (48) February 2017 (38) January 2017 (55) December 2016 (47) November 2016 (27) October 2016 (29) September 2016 (31) August 2016 (19) July 2016 (29) June 2016 (34) May 2016 (34) April 2016 (32) March 2016 (32) February 2016 (36) January 2016 (36) December 2015 (63) November 2015 (50) October 2015 (41) September 2015 (49) August 2015 (38) July 2015 (69) June 2015 (74) May 2015 (100) April 2015 (74) March 2015 (101) February 2015 (74) January 2015 (89) December 2014 (65) November 2014 (95) October 2014 (76) September 2014 (70) August 2014 (76) July 2014 (40) June 2014 (22) May 2014 (31) April 2014 (24) March 2014 (37) February 2014 (17) January 2014 (19) December 2013 (11) November 2013 (10) October 2013 (17) September 2013 (23) August 2013 (9) July 2013 (16) June 2013 (18) May 2013 (11) April 2013 (20) March 2013 (9) February 2013 (13) January 2013 (21) December 2012 (11) November 2012 (7) October 2012 (14) September 2012 (5) August 2012 (19) July 2012 (22) June 2012 (18) May 2012 (12) April 2012 (23) March 2012 (20) February 2012 (8) January 2012 (6) December 2011 (16) November 2011 (2) October 2011 (7) September 2011 (4) August 2011 (2) July 2011 (4) June 2011 (10) May 2011 (8) April 2011 (12) March 2011 (7) February 2011 (2) January 2011 (1) December 2010 (4) December 2009 (1)
Dom on Big Tech & the Democratic Party Are Leading America to a Fascist Future
Kennedy on A Stunning Success: China’s International Development Cooperation
Rob on Khazarian Mafia Seeks to Surrender as Second American Revolution Underway
Ken on Bush Funeral Service Foreshadows A Series of Radical Events
Beyond the Smoke & Mirrors
Lost Land of Maharlika
Duterte Plays Hard Ball vs Local Oligarchs and US Deep State
3,500 Ton Philippine Gold Bars Unlawfully Shipped Out, But for Whose Benefit?
US State Department Blueprint to Oust Duterte Leaked by A US Embassy Insider
Mayor Duterte is Not Genocidal, The West is. Here’s the proof…
Philippine Decision 2016
Behold the Philippines Under U.S. Democracy for 113 Years!
What Was the U.S. Role in the Slaughter of 44 Filipino Special Ops Police?
Why CIA Created the Abu Sayyaf in the Philippines
Why U.S. Mercenaries are in the Philippines?
U.S. Attacked Philippines with HAARP
Unacknowledged American Atrocities in the Philippines
Has Obama Lost Control Of the Philippines?
US Pays Out ‘Peanuts’ for Eco-Crime Committed in Philippines
Why is China Reclaiming The Kalayaan Group of Islands?
Pivot Away from Containment
The Last Senseless War
Learn the Tricks of the Trade & Set Yourself Free
Governments are Corporations
Vatican: The Greatest Usurper
Bank for International Settlements (BIS) – The Vatican’s Central Bank
Proof All of Your Debt is Prepaid!
The UCC Connection to Our Slavery & How to Access Our Strawman Account
How the Cabal Maintains Their Power & How to Defeat Them
The Corporation: History & Revolution
Khazarian Mafia History
The Top of the Pyramid
The Khazarian Mafia 2.0
The Protocols of Zion is Derived from the Jewish Talmud, But never Semitic
Israel’s Secretive Nuclear Facility Leaking as Watchdog Finds Israel Has Nearly 100 Nukes
Deep State Nazionists Establishing A Parallel State for Ratline 2.0
Corporate Power and Expansive U.S. Military Policy | Prof. Gaffney
Covert War Between Russia and Khazarian Jewry
DEEP STATE 2.0
The Rothschilds are Jesuits
Powerful Bloodlines
Technocracy: An Artificial Intelligence Driven Dictatorship
Social Engineering for Global Slavery
The True Purpose of U.N. Agenda 21 “Sustainable Development”
Chemtrail Pilot Blows the Lid Off OPERATION INDIGO SKYFOLD
From State Sponsored Terror to State Sponsored “Freedom”
Top 10 Ways They’re Killing Us
The Foundation for The New World Economic Order
The Ultimate Geopolitical Game Changer Is Here
GeoPolitical and SocioEconomics Q1 Summary
Declassified: The Sino-Russian Masterplan To End U.S. Dominance In Middle East
Russia, China Offer Eurasian Emporium, the US – Sabre Rattling
Enjoy Healthcare Freedom Now!
Defeat the Cabal by Supporting this site
This is a self-funded site. But with your help, we can sustain the task of informing the world with reliable information and objective analyses, while your own family enjoys healthcare freedom that they deserve.
Find more about how we can help each other from our healthcare site.
Privacy & Cookies: A cookie is a small text file containing information that a website transfers to your computer’s hard disk for statistical record-keeping purposes and allows us to analyse our site traffic patterns. It does not contain chocolate chips, you cannot eat it and there is no special hidden jar. Your browser may also save common page elements to improve your overall experience on this site, e.g. faster page loading. By continuing to use this website, you agree to their use. Cookie Policy
In Memoriam: George H. Scherff Jr. aka George HW Bush Sr.
Hidden History of the Incredibly Evil Khazarian Mafia
George Bush Pedophile Sex Ring and Blackmail of Congress
"Covid19 Crisis" is A Crime Against Humanity | German Corona Investigative Committee
Bush Funeral Service Foreshadows A Series of Radical Events
EXPOSED: Child Escaping from Buckingham Palace Naked
Recent Posts: Virutron
13 Israelis suffer FACIAL PARALYSIS after taking Pfizer COVID19 jab
‘We see nothing alarming,’ says Norwegian drugs regulator, after 13 deaths linked to Pfizer vaccine jabs
Hazards of the COVID-19 Vaccine | Academia.edu
‘Very healthy’ Miami doctor dies 2 weeks after taking Pfizer’s Covid-19 jab, CDC launches probe
World Health Organization Redefines Herd Immunity to Accommodate Vaccine Manufacturers
Frontliners as High as 50% in California Hospitals Won’t Take COVID19 Vaccines
240 Israelis got infected with Covid19 Post Pfizer/BioNTech Vaccination
Moderna’s FDA Report Lists 13 Deaths in Vaccine Trials — 6 in Vaccine Group, 7 in Placebo
1000s Suffer Adverse Effects from COVID19 Vaccines; CDC Launches Probe, New Guidelines
‘Serious Allergic Reaction’, First Glitches Emerge in COVID-Vax Rollout
Categories Select Category Africa Agenda 2030 Alert Anonymous Artificial Intelligence ASEAN Asia Banking & Finance Big Tech Bioweapons / Germ Warfare Brave New World Brazil Coup BRICS / SCO / EAEU Carl Vinson Strike Group Cartoon Censorship Clinton Crimes Commerce Common Law Corporatocracy / Fascism CryptoCurrencies Deep State Disclosure Drugs & Trafficking Economy Energy Enlightenment Environment ET/UFO/Exopolitics EU False Flag Federal Reserve Financial Crisis Free Energy Fulford Genocide Geopolitics Global Reset Global Settlements Global Warming / Climate Change Great Reset HAARP / Manmade Disasters Intelligence/Espionage Iran on Target Iraq Crisis Korean Peninsula Latin America Libyan Crisis Mainstream Media Maritime Silk Road Middle East Military Industrial Complex Multipolar World Nazism & Zionism New World Disorder Nuclear/Kinetic Warfare One Belt One Road Pedophilia / Human Trafficking Philippine Affairs Press Freedom / Whistleblowing Propaganda / Misinformation Qatar Crisis Racism / Bigotry Regime Change Russia / Kremlin Satanism Social Engineering Solutions South China Sea Space Weaponization Sports Surveillance Syria Crisis Technocracy Terrorism Trade Agreements Trade Wars Turkey Crisis Ukrainian Crisis Uncategorized US Militia Vatican / Luciferianism Venezuelan Crisis Wahabbism War Crimes Western Hypocrisy White House White Supremacy WW3 Yemen Crisis
Archives Select Month January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 March 2020 February 2020 January 2020 December 2019 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 April 2019 March 2019 February 2019 January 2019 December 2018 November 2018 October 2018 September 2018 August 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 December 2017 November 2017 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 November 2016 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 November 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 September 2013 August 2013 July 2013 June 2013 May 2013 April 2013 March 2013 February 2013 January 2013 December 2012 November 2012 October 2012 September 2012 August 2012 July 2012 June 2012 May 2012 April 2012 March 2012 February 2012 January 2012 December 2011 November 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 April 2011 March 2011 February 2011 January 2011 December 2010 December 2009
© 2011-2021 Copyright Covert Geopolitics - an online publication of eClinik Learning. All rights reserved.
|
cc/2021-04/en_middle_0071.json.gz/line3206
|
__label__cc
| 0.673605
| 0.326395
|
View all by FrostWorksFrostWorks
Follow FrostWorksFollowFollowing FrostWorksFollowing
Quest Failed - Chapter Two
← Return to game
Viewing most recent comments 7 to 46 of 87 · Next page · Last page
Shadowolf619 days ago
hiya frosty, I'm so sorry, but I am unfortunately having to pull my funding from you guys. I'm SO sorry, it is not you guys, but I'm boycotting patreon at the moment, is there somewhere, anywhere else I can support you guys?
FrostWorks19 days ago
Heyo,
No worries--I completely understand and appreciate the heads up! You don't have to apologise!
At the moment I have no other way for people to potentially support me, beyond direct purchases of the games, as I always worry about stretching myself too thin across too many platforms.
I understand, I still feel bad though... But thank you for understanding.
p.s. has anyone ever told you that your setting, premise, and characters would make a fantastic rpg? I would love to make a pixel based one off cross over of this and monster girl dreams by threshold as a party builder dungeon crawler. I think that would be amazing!
Ahh, I've actually thought that a lot, and even experimented with a couple of things in RPG Maker with little pixel based versions of characters--but it's quite a daunting task and would take too much time away from the VNs, so I had to just leave them as fun little what-ifs, haha.
https://twitter.com/Frost_Works/status/1032706409081790464
Shadowolf619 days ago(+1)
Holy crap, that looks so good! But yeah, as you said, you got enough on your plat right now. But who knows in the years to come? Maybe you'll re-release these games re-imagined as classic rpg's later.
Dethrox45 days ago
Any updates about Quest Failed - Chapter Two ?? really enjoyed the first one :( and would love to dive in the secont part too :o
Hiya, still trucking along in development with tons of scenes completed! Definitely one of the more ambitious things I've tackled, haha. Thank you so much for your patience and support!
Feylirei136 days ago
I love your work FrostWorks! Looking forward to the game when it releases. You are awesome! Stay safe and keep well. Crazy times right now with the pandemic. ~hugs
Mike_90168 days ago (1 edit)
Hey, Frost.
You say that you give pre-access of certain things (like pictures, test..) for those who become patreon.
I want to help on your works. I'm waiting Chapter 2 since a year now (don't worry, take your time :p ) and so I want to encourage your works with a patreon. Plus, i'm really happy than you still continue the dev and not despair because of time or whatever !
But, please... if I become a patreon.. can you just send me nothing ? I just don't want to be spoil on anything ^^'
I jJust want to help you as more as i can and discover the surprise one day :) (I just hope that Jilly will always stay with Matt !)
FrostWorks168 days ago(+2)(-1)
Hiya there!
If you wish to support me without receiving the usual benefits as to avoid spoiling the full experience--that's totally fine and understandable! Though, since I send out rewards and posts to everyone on Patreon at once--admittedly it might be more difficult to just filter you out of those if you chose to pledge. To avoid spoilers, I would suggest to make sure your email settings on Patreon were set not to alert you on new posts--or to be wary of opening the posts if you did so.
JustForLewds169 days ago
Hey Frost, huge fan of this series. Question about version-- is this demo the most recent thing? Or is there something with more content if I become a Patron? So sorry if that's in an FAQ somewhere, I am totally new to this.
A total side note: is there any way to just go ahead and like, buy the game for $20 or whatever you're thinking it will cost, and then get updates along the way? I realize that's probably not a possibility since the current system of being a Patron probably nets you way more cash but I genuinely wanted to make sure I was thinking about that correctly and there wasn't some way to buy it in an "early access" kind of way.
FrostWorks169 days ago
Hiya there, thank you so much for your kind words!
The demo featured on itch.io is just a small offering of what the current alpha build on Patreon offers--though admittedly the alpha build is far rougher in presentation, and some scenes may not have voice acting just yet as I forge ahead with things and continue to finish up the h-scenes and story segments.
At present--there only way to get alpha builds is to be a monthly subscribe to the tier, yeah. Where you get the most recent build for the month you're on after processing, as an on-going thing, with it usually taking a couple of months for a new build to be uploaded due to the immense work that goes behind each one. Which I understand isn't an ideal thing for people that may just wish to pay a one-time thing for access. But I do it in this way as a way of ensuring that only those that are serious about supporting things and wanting to help test/improve the game as it moves along go to the tier--rather than those that perhaps are just looking to play Chapter Two early. As I feel that in its current state it doesn't represent what I want people to experience for their first, full playthrough and would rather that people play it in its finished state if possible. But if people really want to support me to such a degree, then I'm happy to let them test the builds as a means of thanking them. If that makes sense : P
Hopefully I haven't rambled too much, haha, but essentially, I don't want Chapter Two to be considered like other adult games where people play incremental builds that come out rapidly--and want it to be a fully-fledged commercial experience that people can play with all of the content ready to go. And that the alpha builds are just there as a bonus for supporters, rather than being the intended way to play it.
So if you want a fully polished experience right from the get-go, I would say to wait for the full release!
JustForLewds46 days ago
Dude I am so sorry that it took me 122 days to reply to this, I am the absolute worst. I completely forgot and just haven't been on in a long time. Thank you so much for taking the time to reply to me, I totally understand what you mean-- and you weren't rambling at all! I'm glad to know for sure that the subscription method is the best way to support you and others who are making this kind of content.
By the way, the writing, voice acting, artwork, and even pacing are just fantastic by the way. I've recently gotten in to wanting to craft experiences for people via video games and I know how much it can mean to get not just generic praise but also specific feedback. I sincerely wish the best for you and everyone else working on this.
All good, haha. I completely understand! Life has a tendency to do that sometimes.
Thanks again for your very kind words! A lot of love has definitely went into QF over the years--and even though I haven't been able to get everything exactly the way I wanted it, I'm still incredibly proud of what I've achieved so far! While 2020 was rough in general, hopefully it won't be tooOOOOOoooo much longer before everything comes together!
Deleted post185 days ago
Deleted 183 days ago
Heya! Apologies. At the current moment in time all I can do is refer you back to my previous reply regarding ETAs!
desolatesharidan210 days ago (1 edit)
I freaking love you Frostworks, your game is the best h-game i've ever played and it's leagues above most non h-games i've played. I just wanted to show some appreciation for all the hard you're putting into the game and tell you that i can't wait til it's done. I legit made an account just to write this. Much love man <3
FrostWorks210 days ago(+1)
Ahhh, thank you very much! I really appreciate your kind words and support~ It motivates me to do the best I can, and hopefully deliver an awesome experience for everyone who's been so supportive and patient with me. I very much hope that the complete version of Chapter Two will meet your expectations~!
GrizzliesfIRepOWer212 days ago
Any kind of guess into how much longer it will be until release?
Still difficult to say just yet. Apologies that I can't give a more concrete answer at this moment in time, but due to the non-linear way I've been approaching the writing and tackle various scenes out of order, it gets pretty difficult to tell how much is left--and how far along things are. But I'm pretty happy with how things are, at the very least!
kayeskay222 days ago(+1)
Hey! Really excited for the game! Do you have an estimation of how much it will cost yet?
Hello! Happy to hear it~
Not set price as of yet, but I'm thinking between $15 - $20 (probably on the higher side of the range) due to the sheer amount of content it has compared to Chapter One!
CommandoSchneider227 days ago
Heya! I look forward to the release of the sec. chapter! I really need to ask this now, netherless. Will there be mor foot play in the game? Maybe even with my fav. dragon girl? ^^
There’s definitely a couple of new foot related scenes to look forward to for sure!
One with more normal feet and then another of the...fluffier variety, : P
Hungrysan227 days ago
So Frostworks. I have been waiting for this game for years. I joined your patreon at the 25 dollar rank a long time ago hoping to play an updated demo and then that demo got cancelled. Is there anything new for this other than art? A release date? A demo with more content than it had when it was released over a year ago? Anything? I understand that you've been working hard and I know that the game will be great but I just need something to let me know this isn't going to get cancelled leaving all of my time and money wasted.
Hiya there! Apologies for any confusion or upset on anything regarding new content builds. While it's true I ultimately cancelled the public early access plans I had at the end of 2019--as I realised that putting the game out in its current state to the public was going to sour the first time experience and not give the impression I'd hope for--I've still been releasing new alpha builds for people on the $25 tier on a frequent basis. That part never changed. Just the plans to release it to the public on a wider scale until it was done.
I released a new alpha build as of April (0.10), for example, which contained a significant addition to the main scenario, along with new h-scenes and voiced scenes. And it features far more content than the current demo on itch.io.
I've spent thousands of dollars developing this second chapter--and hundreds of hours writing it--I'm certainly invested in finishing it. Abandoning it at this point would be unthinkable. While I understand I've been slower than I--or most people--would have liked, I'm still inching closer to the finish line every day.
I understand I took on a massive undertaking here, and aimed quite high in regards to scope, and truly apologise for how long Chapter Two is taking to be completed, not a day goes by where I don't fret about how long it's taken me. It frustrates me just as much as everyone else, if not moreso. I've learned many lessons here that I'll be taking to heart with Chapter Three as I plan it in a far more realistic way.
I can't give a solid release date yet, as I'd only end up disappointing people if it didn't come to be, and I can't offer additional free demos (as I feel the one linked here was more than generous with its content)--but all I can say is that this project is pretty much my life right now. And there's no chance of it ever being dropped. It might take a while to come out, yes--and I truly am sorry for the wait--but it'll be completed! I can only hope all of the content in it will make up for the lengthy development time and feel like several games at once, since it's certainly much larger than Chapter One.
Thank you for your support over the years and I hope Chapter Two will meet your expectations!
Larry239 days ago
You've done your job.
There's still more to come.
Until then, we'll wait.
Hopefully you won't have to wait too much longer!
Desert_fox78241 days ago
I must say i'm really looking forward to chapter 2! of course, take your time. Game creation can be very stressful, but keep up the great work! (love the character designs too, as cute as they are lewd!)
Ahh, thank you very much! I'll do my best to ensure that Chapter 2 meets your expectations!
And I completely agree. The artists did a fantastic job bringing all my characters to life! I'm really happy with how everything has turned out~
NvXenon243 days ago
So can someone tell me who this mysterious necromancer girl is,and how is she related to mc?She seems to know him,but he doesn't know her...
And part 3 is worth waiting for and when?
After Chapter Two is fully completed! This is just a demo--a small taste of what's to come for the full game!
Wow!So this is just the beginning?)
Yup yup! Barely scratching the surface of what Chapter Two will offer!
Solo Player252 days ago (1 edit)
I've done playing the chapter one days ago then,I was about to download the chapter yet I saw that it's not playable on android.That's kinda sad,If I can play it using android that would be awesome.
Heya there,
At the present moment in time no android port is planned, as I need to focus on finishing the main version first. But once I've got that out, I could potentially start looking at other ports!
Kendrick420292 days ago
can't wait for the release ! Take You're time FrostWorks take some breaks and dont pressure yourself, you got this!
Unflowlessspoon317 days ago
Is this available on android?
Not currently, unfortunately!
Though once Chapter 2 is fully completed, and if there was a demand for it--I could definitely explore mobile versions!
How much longer do you think until release?
Heyo, I have a large alpha update coming out soon for patrons that covers a significant part of the story, along with more h-events. So while the full game isn't quite out yet, a large chunk of it has been coming along nicely!
I apologise for the grueling wait--and understand that this has been quite an unreasonable development time for a visual novel of all things. I'll be forging on ahead in the coming months to try and get things out as soon as I can!
KOKe2351 days ago
Hello. I am having trouble playing when I try to play a game that comes out to me(Quest Failed - Chapter Two - Demo.exe error) _Sorry if my english is bad_
I'm sorry to hear you're having issues launching the demo! I'll do my best to help and try to solve the issue! To be sure--you've unzipped the contents of the folder and are launching the .exe from the unzipped folder, correct? And are running on WIndows?
Also, if possible, could you printscreen/take a picture of the exact error message you're getting? It will help me to find out the source of the issue much faster and get you playing the game as quick as I can!
FrostWorks351 days ago (2 edits)
I've seen a similar error message before--though not this exact one. And just to cross off any possibilities: are you running the exe within the original folder you extracted it in? Since the exe won't work if it's moved away from the main folders.
Edit: I was able to replicate the exact error and confirm that this issue comes up if you attempt to launch the exe without the other files alongside it!
When you extract the zip folder, avoid moving or deleting any of the files there and try launching the .exe from that spot.
If you wish to create a shortcut to put on your desktop, etc.--don't move the .exe itself. Instead, right click the exe and select 'create shortcut', and then you can move that one safely around!
GrizzliesfIRepOWer1 year ago
How soon do you think until full release? Another post said it would be early 2020, so how early? Like this month? 3 months? 5?
What's the sitch?
FrostWorks1 year ago(+1)
At the moment I'm trying to avoid cursing myself with any promises, since I already goofed up hard with the early access stuff that didn't come to be in the end. Not this month--but beyond that there's too many variables up in the air to discern when everything else will come together.
I understand that it's an incredibly vague answer, and I apologise, but I feel it's better if I try to avoid hyping up for anything until I'm absolutely sure there's a release in sight. Dx
I understand. I helped some friends make a video game a long time ago and although not a management position(I did translation, Japanese/french to English but not anymore tho) I understand the pressure completely. Sorry about asking so much, but i'm just eager to see this done.
PS: Will there be a steam release?
FrostWorks1 year ago
No worries--I'm just glad to see there's still interest in the game being completed, even after I've taken so long, haha. It really is encouraging!
Steam release is difficult to say. In a perfect world I've love to release it on there--but the adult game space seems incredibly shaky on there. and I wouldn't want to get in any trouble or find my game removed if it ended up breaking one of the rules that surround NSFW games there. Since some games release as they are and pass by fine, others release with a patch that can be applied, and others seem to get taken down with vague explanations as to why. It's a bit scary, really and I'd hate to waste time and resources getting everyone on Steam only for that to happen. Dx
GrizzliesfIRepOWer1 year ago(+1)
any kind of eta?
After a lot of thinking on the matter, I've ended up deciding not to move forward with the early access plans, as I think I was potentially rushing myself into an incredibly bad decision on that matter and feel it wouldn't have represented the experience in the way I had desired. I want everyone's first experience with Chapter Two to be something special, and not an early access, incomplete build with brick walls everywhere that limit progress and choice, and might sour peoples opinion on the game before they've even had a chance to experience the full thing. When I release it fully, I want it to be a big, special event to celebrate and to garner hype, rather than releasing something that might fall flat in the eyes of people hoping for the full adventure.
Unfortunately I understand that this is probably not the answer that people want to hear after I spent so long hyping up and promising the early access build as a thing to look forward to at the end of the year and that this decision may upset some, but I feel it's the best way to move forward with things to get out a game of the quality it deserves.
I was incredibly short-sighted with my early-access plans, and they definitely don't suit a visual novel of all games. I apologise for going back on this.
I'll be instead focusing my efforts on alpha builds as I build towards the full release of Chapter Two--of which I have no current ETA for at this time.
Feylirei1 year ago(+1)
Thank you for the update. You are working very hard, and we all can definitely acknowledge the amazing efforts you are putting into the game. Take all the time you need. You're awesome; and the game I know will be incredible when it gets released. No need to rush. The first game was a masterpiece, and I am sure the second will equally be a masterpiece! Keep up the amazing work!
Also, an early Merry Christmas and Happy New Year!
Ahh, thank you--I really appreciate your patience and understanding on the matter. I truly do want this to be the best experience possible right from the get-go, so want to avoid taking any shortcuts or rushing any sloppy products out. I understand that the wait has been long--and possibly painful--but I'm incredibly proud of what I have so far, and think the full game will really be worth it!
And a very Merry Christmas and Happy New Year to you as well!
Hungrysan1 year ago (1 edit)
Does this mean we won't be getting that big Christmas preview?
PyrrhicVictor1 year ago(+1)
Thanks for keeping us updated. Might there be any holiday specials in the upcoming release? I'm greedy I know, but I really enjoyed the previous ones.
Sadly there'll be no holiday specials as I haven't had the time or resources to work on them while busy with Chapter Two--but once things die down a little I might be able to manage something as a video like before, and then add it directly into the game via a patch!
I suppose the closest thing that could be included would be the Halloween one I did last year, though that's very small and very silly compared to the others, haha.
Hungrysan1 year ago
Hey where is that end of year demo I heard about? Is it free or do I need to pay for it?
The end of year release will be a little closer to the end of the year, if not a little over that estimate! And it'll be paid, as it's essentially an early release of the full game, rather than a demo!
Feylirei1 year ago
Out of curiousity, upon release of the early-access version (paid version); will the future updates/patches be part of that paid package? or will it be a seperate cost later on?
If you buy the early access release you'll be entitled to all of the future updates for free as the rest of the game is built upon and finished, since this is treated as a sort of soft launch of the whole game.
Oh, awesome! Definitely look forward to it! Thank you,
JustAnAveragePerson1 year ago
I know this might sound stupid and all but is there any chance of quest failed and quest failed 2 releasing on android .I am a big fan of your work and its just awesome there aren't many games with such good storyline and quality.
And please I don't want to offend you in anyway if my comment seamed offensive please ignore it and have a nice day.
Hiya there, no worries at all--it's a perfectly understandable question!
Right now my main focus is finishing Chapter Two and getting it released on Windows/Mac/Linux--but once I've had the chance to get that out and look at things, I can definitely consider looking at mobile ports! It's just that they might take a little extra work to make sure the UI compliments touchscreen controls and that everything has scaled nicely. Since I know the demand for a more portable version of QF is there, and I'd love to be able to release them if I could!
YourNemesis1 year ago
are there more games like this one where the queen is hot and sexy?
(games which have scene's with a queen)
While my knowledge of this particular thing is limited, the Kyonyuu Fantasy (Localised as Funbag Fantasy through Mangagamer) might be able to provide what you need, since while I haven't played the games personally--but plan to eventually--they seem to be fantasy focused and bound to have a Queen in them!
Additionally, you could search through the 'queen heroine' tag on VNDB and look for games that have English releases!
https://vndb.org/g1241
YourNemesis1 year ago (1 edit)
thx man (if you’re a girl, i’m sorry for saying man)
MiniPiP1 year ago
My last comment might have seemed unmature but I honestly cant wait anymore I just LOVE this game. PLEASE tell me its going to be released before 2020
At this point all I can currently do is refer to my previous responses on the matter!
Namely that something will more than likely release before the end of the year, even if it isn't the full game. So keep a look out!
MiniPiP1 year ago (1 edit)
Oh okay! btw if I sometimes type something REALLY stupid and a comment that makes no sense its just cause I cant wait anymore and im hyped ^^
I have a question. You said there would be a kind of beta releasing around the end of the year. Would this be exclusive to patrons or should I save my money for something else like buying the beta separately?
I haven't planned out the specifics just yet--but I do want to aim for a more wide-open public early access build on itch.io, just to get the game out there a bit more now that extensive work has been done on the current alphas over the years, since I feel like there's a lot of content still even if it's not complete yet.
Though this could all potentially change depending on what I feel is best! I'd say your best bet is to just keep an eye on twitter, etc. for when I start moving forward with it all and announcing solid plans.
Which Patron Tier gets test builds?
The alpha testing/$25 tier on patreon gets access to each new build as it comes out!
Do I get access to past builds as well?
Just the most recent build that might exist that month. Though each subsequent build expands on the content from the previous builds--so it's the most up to date version of the game. No older content is deleted or withheld, it all just gets wrapped into each new build!
DemonbreedDX1 year ago
I feel like I just watched a commercial
GrizzliesfIRepOWer1 year ago (1 edit) (+1)
Is there a loosely foreseeable release date? Please and thank you!
Something will more than likely be released to the public at the end of the year!
It won't be the full thing, and may be more of an early access deal--but will still have lots of content. I'm still mulling over whether this is a good way to go, or to just wait for the full thing a little bit further down the line. I'm not completely sure yet!
I think the fans will eat you alive if something doesn't happen soon. LOL. (Read comment below this)
Thank you for an update. The work you do is amazing! Definitely take the time needed to complete the game the way you invision it to be completed. No need to rush. Not saying that the excitement isn't here, it definitely is; however, a game is best enjoyed when completed when the artist/ designer is satisfied. Keep up the amazing work, you are awesome!
MiniPiP1 year ago (1 edit) (-2)
I honestly I cant wait please update its been 21 (YOU STUPID!) days ever since I posted my last comment UAHRUIASHFDOJFIOSJDF (PS: I MORE TO SEE MORE OF RUBY <3)
Do you really think they are going to answer you with an attitude like that? It'll come when it comes.
Deleted post1 year ago
FuturPlanet1 year ago(+2)
I think ur to young... Ur are not allowed to play this game :p
Omg its been a month since i posted my last comment please give updates I wanna play this so much :D
Hi hi!
No major updates on things to announce so far, sadly, but it's been a steady grind!
I advise you to keep an eye on my twitter for future updates--since the comments section is admittedly a little scattered here, and you'll be able to get up-to-date information on if I announce anything major relating to the game!
So how has things been for you? Haven't checked back in about a month now because of IRL problems. How close do you think this is to full release?
It's a slow, steady grind as I chip away at the giant script!
Still unsure of when things may be fully finished, but I'm getting there!
Shadowolf61 year ago
Hi, is there a way to contact you directly?
If you wish to contact me directly regarding any queries you might have about Quest Failed, you can do so at: unlimitedfrostworks@gmail.com
Seriously cant wait anymore
Is it possible to get an update?
(Btw I am pretty sure you read my previous comment and I was just joking obviously so sorry if I offended you)
FrostWorks1 year ago (1 edit)
Hi hi,
The enthusiasm is always appreciated, though unfortunately at this present moment in time I don't have anything new to share regarding the release. For the most up to date news on Quest Failed I recommend you keep an eye on my Twitter and Patreon feeds since when I have large updates to share on the status of things I'll be sure to update all my regular channels!
And apologies if by chance I ended up not replying to a previous comment, since I may have felt I had no significant news to share at that time. Dx
PhiaKnight1 year ago
Chapter Two was awesome! The freedom of movement and interactivity added a whole to level of enjoyment for me and I hope it's here to stay going forward or at least some elements of it. I'm enjoying the new characters a lot and I cain't wait to see more of them. Will there be any CG scenes with Cynthia or Anna in the future?
Hiya, thank you so much for your kind words! I'm really glad to hear you enjoyed the demo! I'm sure Chapter Three will follow the same template, though I might have to dial it back a tiny bit for the sake of faster releases in the future, haha. : P
And yupyup! The full game will have at least 2 CG each for most characters (some get more!) so you'll have a whole lot to look forward to!
IDK421 year ago
Maybe shooting for a summer release???
No solid plans are laid out for a complete release yet--but I'm forging ahead with the early builds and gradually adding more and more content--so never say never, though I want to avoid getting hopes up just in case things go a bit slower than intended.
Gregory Swan1 year ago (1 edit)
So... Let's start with that i'm a game pirate. Not because i'm greedy, but because i don't have much money (ask my 10 year old PC lol). You can judge me, but i don't really care. Anyways, this game is awesome. This game series is awesome. Everything is awesome. Artstyle? Awesome. H-scenes? Awesome. Characters? Awesome. Too much awesome. When i played Chapter 1, i was thinking "oh, another H-game, nothing special...". But then i was shocked. All of the characters are unique. They aren't just sex dolls, they have different personalities. So much work for a H-game. My stereotypes about H-games were shattered to pieces. 11/10. Eleven out of freakin' ten. This game series have so much potential. Frostworks, i wish you all good luck!
- Sincerely, Gregory the poor pirate.
P.S. I just realised that you also made "Room". That's why the artstyle looked familiar...
Heimrichyy1 year ago
Is this demo updated with 0.8 alpha demo?
Hiya! This demo is the same one it’s always been.
Newer Alpha builds are exclusive to patrons on the alpha testing tier!
Well that's a bummer. I thought it would be updated here :(
I know it must be irritating to hear this and I am sorry but, is there any foreseeable full release date?
PS: Have you played Neko-nin Exheart series or KARAKARA visual novels at all? If not then I highly recommend them. Waiting on #3 of each series along with Quest failed Chapter 2.
It's hard to say at this particular moment in time--I apologise! But I'll be sure to keep everyone up to date when I believe I'm nearing the finish line; the game just ended up a far bigger undertaking than I imagined, with all of the h-scenes and events present in the game. I really do believe it'll be worth it in the end though! Thanks so much for your support and patience <3
And I haven't played either of those games, though believe I got KARAKARA in a bundle once--so might give it a look when I have some free time!
Whenever you do get a chance to play. Let me know what you think. Just curious.
itch.io·View all by FrostWorks·Report·Embed
|
cc/2021-04/en_middle_0071.json.gz/line3209
|
__label__wiki
| 0.651588
| 0.651588
|
Home / Books / Pretend We Live Here by Genevieve Hudson
In her debut collection of stories, Pretend We Live Here, Genevieve Hudson explores the idea of home and what it means to find one: in the body, in the world, in other people. Her characters are seekers, whose actions are influenced by their slippery identities and by the strange landscapes that surround them.
Pretend We Live Here by Genevieve Hudson quantity
Categories: Books, Fiction, Short Stories Tags: Alabama, Amsterdam, debut, Fiction, Genevieve Hudson, paperback, Portland, Pretend, queer, Short Stories, The South
In “Boy Box,” a young woman yearns to test her luck with a wild punk girl crush. In “God Hospital,” a character journeys deep into the woods of Alabama in search of an infamous religious healer, hoping he can fix her teeth. In “Adorno,” someone in need of forgiveness crosses paths with a band of radical vegan activists and gets subsumed into their world. In “Dance!,” a recluse writes a breakthrough song for her pink dolphin, but the song’s success only drives her further away from society. Set in Amsterdam, the Pacific Northwest, and the Deep South, these stories hum with sexual tension, queerness, displacement, longing, humor, and dark nostalgia.
“A terrific collection of stories. There are echoes here of Flannery O’Connor, Barry Hannah, and Denis Johnson, but Genevieve Hudson is her own writer—impressively and gloriously so. Her eye for the clinching detail is unnerving and her sympathies are fascinatingly conflicted. I hope, and suspect, this book will be the start of a long and inspiring career.” —Tom Bissell, author of The Disaster Artist and Magic Hours
“Jagged, queer, and nervy, these stories beat with an urgent, potent pulse. They’re often funny, sometimes wrenching, and never predictable. A bold and bracing debut.” —Chelsey Johnson, author of Stray City
“In Pretend We Live Here, characters bleed and breathe with a caustic energy that dares the reader to keep pace as they are taken from the Deep South to Western Europe and back again. Genevieve Hudson is a new, coming-of-age voice that spotlights rural America, injecting it with a queer freshness that makes her writing impossible to forget.” —Jing-Jing Lee, author of How We Disappeared
“Poetic, twisted, wild, and tender, Genevieve Hudson writes with what some call a burning tongue. On every page, her agile, clashing lines throw off sparks of youth and queer desire. Check this out. Here is a writer at the beginning of something truly great.” —Jon Raymond, author of Freebird
“Full of blood and dust and stars and light, Hudson captures the beauty and horror of the everyday and makes it all seem like magic.” —Leah Dieterich, author of Vanishing Twins: A Marriage
Genevieve Hudson is also the author of A Little in Love with Everyone (Fiction Advocate, 2018), a book on Alison Bechdel’s Fun Home. Her writing has been published in Catapult, Hobart, Tin House online, Joyland, Vol.1 Brooklyn, Split Lip, The Collagist, No Tokens, Bitch, The Rumpus, and other places. Her work has been supported by the Fulbright Program and artist residencies at the Dickinson House, Caldera Arts, and the Vermont Studio Center. She received an MFA in Creative Writing from Portland State University, where she occasionally teaches Fiction Writing and Gender Studies courses. She recently sold her first novel to Norton.
Released on July 24th, 2018. This page is for purchasing the paperback edition. If you wish to own one of the limited edition hardcovers, which we have 99 copies of, go to this page. Thank you.
Cover design by Jess Vande Werken, Photo by Elena Kendall-Aranda
ALSO AVAILABLE AS AN EBOOK!
Also read: Genevieve’s story, “Too Much Is Never Enough,” on Joyland.
Reviewed at Portland Mercury
I Remember by Shane Allison
Partial List of People to Bleach by Gary Lutz (Hardcover)
|
cc/2021-04/en_middle_0071.json.gz/line3210
|
__label__wiki
| 0.57562
| 0.57562
|
Keyword: louisiana
City councilman in Louisiana arrested for election fraud
01/15/2021 7:09:11 PM PST · by Beave Meister · 12 replies
KTBS.com ^ | 1/7/2021
BATON ROUGE, La – Louisiana Attorney General Jeff Landry and Secretary of State Kyle Ardoin Thursday morning announced their offices have arrested an Amite City Councilman on eight counts of election fraud. Emanuel Zanders, III is accused of submitting voter registration applications that are known by the person to be materially false, fictitious, or fraudulent. At a news conference in Baton Rouge, both Attorney General Landry and Secretary Ardoin expressed the importance of election integrity through free and fair elections. They stressed that every legal voter gets one legal vote and no more: one man, one vote. “Anything other than...
Widow of Late Representative-elect Letlow Makes a Bold Decision
01/14/2021 8:29:03 AM PST · by rktman · 19 replies
townhall.com ^ | 1/14/2021 1115 hrs est | Cortney O'Brien
Louisiana Rep.-elect Luke Letlow was to be sworn in with his new colleagues on January 3, but he tragically died from COVID-19 complications last month, leaving behind his wife Julia and his two young children. He was only 41 years old and it was a stark reminder of how this virus can be deadly to more than just the elderly or those with underlying conditions. Now his wife, Julia Letlow, is hoping to fill his seat herself. “Everything in my life and in my marriage has prepared me for this moment," she said in a statement. "My motivation is the...
Joint Statement from Senators Cruz, Johnson, Lankford, Daines, Kennedy, Blackburn, Braun, Senators-Elect Lummis,, Marshall, Hagerty, Tuberville
01/02/2021 10:11:25 AM PST · by TigerClaws · 232 replies
Ted Cruz ^
WASHINGTON, D.C. - U.S. Senators Ted Cruz (R-Texas), Ron Johnson (R-Wis.), James Lankford (R-Okla.), Steve Daines (R-Mont.), John Kennedy (R-La.), Marsha Blackburn (R-Tenn.), and Mike Braun (R-Ind.), and Senators-Elect Cynthia Lummis (R-Wyo.), Roger Marshall (R-Kan.), Bill Hagerty (R-Tenn.), and Tommy Tuberville (R-Ala.) issued the following statement in advance of the Electoral College certification process on January 6, 2021: "America is a Republic whose leaders are chosen in democratic elections. Those elections, in turn, must comply with the Constitution and with federal and state law. "When the voters fairly decide an election, pursuant to the rule of law, the losing candidate...
Congressman-elect Luke Letlow dies from COVID-19
12/29/2020 7:26:06 PM PST · by Meatspace · 477 replies
WDSU ^ | 12/29/20
SHREVEPORT, La. — Congressman-elect Luke Letlow has died after contracting COVID-19 last week, according to his campaign manager Andrew Bautsch. Letlow, who just turned 41, was getting treatment in the intensive care unit in Shreveport, according to an announcement on his Twitter page last week.
LA: Armed robbery turns deadly after employee fires back at gunman
12/27/2020 5:00:21 AM PST · by marktwain · 29 replies
WWLTV.COM ^ | 23 December, 2020 | Jade Cunningham
New Orleans Police say a man walked into the store around 9:30 p.m. Hingel says soon after, shots flew. "The customer walked in, went over to the coolers, walked over and started coming behind the counter," he said. "Apparently the girl didn't get the money out fast enough and started shooting." However, another employee stepped in. "The cooler man pushed the girl on the ground and went behind the wall a bit and came out and told the man get on the floor," said Hingel. "And the guy started shooting at him again." The armed robber, who's name isn't yet...
‘Antiracism’ At LSU (Critical Race Theory class near being mandated)
12/22/2020 1:07:11 PM PST · by SeafoodGumbo · 27 replies
The American Conservative ^ | 12-21-20 | Rod Dreher
The racist “antiracist” madness has now come home to my alma mater, Louisiana State University. Before we go further, I should point out that this is the flagship public university in a very red state governed by a Republican legislature and a conservative Democratic governor. The LSU Faculty Senate has a proposal before it — one that a source within the university tells me is fully expected to pass.
Florida Is Open, New York Is Closed, And The Latter Has More COVID Deaths
12/16/2020 7:00:44 AM PST · by SeekAndFind · 17 replies
The Federalist ^ | 12/16/2020 | Christopher Bedford
Thus far in Florida, approximately 20,000 people have died of COVID-19. In Texas, the number stands around 24,000, and in New York, about 35,000.New York is the smallest of the three, with 19.54 million residents. Then comes Florida, with 21.67 million, before Texas, with 28.7 million residents.COVID numbers are difficult to trust. Cases are often counted more than once as patients go in and out of the hospital, and some deaths are attributed to COVID that are barely related, if at all.There’s a perverse incentive to write down “COVID” and get state and federal money, no doubt, but one thing...
Suspects sought for vandalism of church in Bayou Blue
12/12/2020 8:33:55 PM PST · by nickcarraway · 3 replies
WDSU ^ | 12/9
A reward is being offered for information leading to the arrests of those responsible in a church vandalism in Bayou Blue, according to Lafourche Parish Sheriff Craig Webre. Webre said on Monday deputies responded to a report of property damage at St. Louis Catholic Church on Bayou Blue Road. Advertisement A bathroom was found to have several areas spray-painted inside and outside. A brick wall behind the rectory and another building were also found to have been vandalized, according to Webre's report. Webre said deputies determined the vandalization occurred sometime between the evening of Dec. 5 to the morning of...
Breaking — Louisiana AND Alabama join Texas case before Supreme Court
12/08/2020 2:57:22 PM PST · by rxsid · 72 replies
https://www.citizenfreepress.com ^ | 12.08.2020 | Kane
Breaking — Louisiana AND Alabama join Texas case before Supreme CourtLouisiana Attorney General Jeff Landry issued the following statement regarding the ongoing controversies over the 2020 federal election and the new motion put forward by the State of Texas before the U.S. Supreme Court. “Millions of Louisiana citizens, and tens of millions of our fellow citizens in the country, have deep concerns regarding the conduct of the 2020 federal elections. Deeply rooted in these concerns is the fact that some states appear to have conducted their elections with a disregard to the U.S. Constitution. Furthermore, many Louisianans have become more...
[Louisiana] Attorney General Jeff Landry's Statement On 2020 Federal Elections And Recent Texas Motion Before The Supreme Court
12/08/2020 1:31:46 PM PST · by Ebenezer · 11 replies
Attorney General Jeff Landry ^ | December 8, 2020 | Attorney General Jeff Landry
BATON ROUGE, LA - Attorney General Jeff Landry issued the following statement regarding the ongoing controversies over the 2020 federal election and the new motion put forward by the State of Texas before the U.S. Supreme Court: “Millions of Louisiana citizens, and tens of millions of our fellow citizens in the country, have deep concerns regarding the conduct of the 2020 federal elections. Deeply rooted in these concerns is the fact that some states appear to have conducted their elections with a disregard to the U.S. Constitution. Furthermore, many Louisianans have become more frustrated as some in media and the...
Former Tangipahoa Parish Sheriff’s Office Employee and Local Woman Charged in a Bribery Scheme
11/29/2020 3:16:48 PM PST · by ransomnote · 2 replies
justice.gov ^ | November 24, 2020 | U.S. Attorney’s Office Eastern District of Louisiana
NEW ORLEANS, LOUISIANA – United States Attorney Peter G. Strasser announced that SONJA DYSON EVANS, 58, of Ponchatoula, Louisiana, and SHAWANDA DOVE, 51, of Amite, Louisiana were charged on November 23, 2020, in a bill of information with one count of violating 18 U.S.C. §§ 1952(a)(3) and 2, use of an interstate facility with intent to carry on unlawful activity.According to the bill of information, at the time of the offense, EVANS was employed by the Tangipahoa Parish Sheriff’s Office as a Criminal Records Division Supervisor. From January 2016 through January 2017, both EVANS and DOVE used cell phones to...
Baffling: Supreme Court rejects pastor’s case involving violations of the ban on large gatherings
11/28/2020 12:34:38 PM PST · by LibertyWoman · 64 replies
BPR ^ | 11/28/2020 | Vivek Saxena
Supreme Court Justice Samuel Alito has rejected a request from a Louisiana pastor who’d sought emergency relief from criminal charges he faces for the apparent crime of holding large church services in contravention of the state’s coronavirus rules. ... As the months passed, Spell wound up accruing three additional charges, making for a total of nine. Now fast-forward to last week, when he filed a motion with Justice Alito requesting an injunction against the charges he faces. ... For reasons that remain unclear, Alito outright rejected the request — meaning it won’t receive a full hearing in the Supreme Court...
Police seeking shooter after robber, retail employee killed on Sherwood Forest Boulevard
The Advocate ^ | 20 November, 2020 | Staff
A Baton Rouge Police identified the two people shot and killed on South Sherwood Forest Boulevard Friday afternoon — one a robber and the other a retail employee. The shooting was reported around noon Friday at the address of a business in the 2600 block of South Sherwood Forest Boulevard near where it crosses Interstate 12. Police said that Timothy McCoy, 28, robbed and shot Wise Communications employee, Mahmod Khalaf, 48, according to spokesperson Sgt. L'Jean McKneely Jr. McKneely said detectives believe a third person witnessed the incident and shot McCoy as he left the business. That person then ran...
‘BREATHTAKING ABUSE’: Republican Attorneys General file amicus brief urging SCOTUS to rule on Pennsylvania mail-in ballots
11/11/2020 7:05:05 AM PST · by Red Badger · 39 replies
https://thegreggjarrett.com ^ | by Jarrett Staff November 11, 2020
As the post-election legal battle forges on, 10 Republican Attorneys General from several states are urging the Supreme Court to get involved in the state of Pennsylvania. =========================================================================== As the post-election legal battle forges on, 10 Republican Attorneys General from several states are urging the Supreme Court to get involved in the state of Pennsylvania. Led by Missouri Attorney General Eric Schmitt, Attorneys General from Alabama, Arkansas, Florida, Kentucky, Louisiana, Mississippi, South Carolina, South Dakota and Texas filed an amicus brief with the Supreme Court concerning the mail-in ballot lawsuit filed in Pennsylvania. Ohio Attorney General Dave Yost filed a...
House GOP celebrates unexpected gains
11/04/2020 5:25:11 PM PST · by RandFan · 59 replies
The Hill ^ | 11/04/20 08:15 PM EST | BY JULIEGRACE BRUFKE
House Republicans may not have taken back control of the lower chamber, but GOP lawmakers say they see the party's sizable gains as a promising sign they can take back the House in 2022. Political handicappers, in the days leading up to Nov. 3, projected GOP losses of between five and 20 seats, and the ultimate results left some within the GOP stunned by the unexpected success and with how the party significantly broadened the conference’s diversity and increased the number of female members. “Now I've heard for months from the pollsters in the media about how Republicans were going...
Louisiana Amendment to ban abortion is winning
11/03/2020 7:10:38 PM PST · by topher · 17 replies
Secretary of State Voter Portal ^ | 3-Nov-2020 | Secretary of State Voter Portal
CA NO. 1 (ACT 447, 2019 - HB 425) -- Relating to Declaring There Is No Right to and No Funding of Abortion in the Louisiana Constitution Vote tallies 9:10 CST Click on "State Wide Tab" and find "Amendment #1" 1290 of 3934 precints reporting For the Amendment 525,418 Against the Amendment 287,490
Officer’s 2-Year-Old Son Murdered By Wanted Fugitive
10/23/2020 10:37:01 PM PDT · by robowombat · 32 replies
Police Tribune ^ | OCT 23, 2020 3:00 PM | Tom Gantert
Officer’s 2-Year-Old Son Murdered By Wanted Fugitive Tom Gantert Baton Rouge, LA – The two-year-old son of a New Roads police officer was gunned down inside his mother’s home by a wanted career criminal who was out on parole after having tried to kill 11 people. Baton Rouge Police Sergeant L’Jean McKneely Jr. said the murderous crime spree began at about 8 p.m. on Oct. 15 when 41-year-old Kendrick Myles kidnapped his nine-year-old nephew from a home on Bluebonnet Boulevard in East Baton Rouge, The Advocate reported. Sgt. McKneely said Myles dragged the child along as he embarked on a...
LA Legislature signs petition ending Gov emergency
10/23/2020 8:55:21 PM PDT · by Pikachu_Dad · 13 replies
Misc | Oct 23, 2020 | Self
Louisiana legislature just signed and turned in petition ending the Governors current emergency.
Louisiana Officer (Rapides Parish) In Critical Condition After Gunman Opens Fire On Him
10/22/2020 6:40:26 PM PDT · by robowombat · 6 replies
Police Tribune ^ | Oct 21, 2020 | Holly Matkin
Louisiana Officer In Critical Condition After Gunman Opens Fire On Him Holly Matkin Mangham, LA – A Mangham police officer is in critical condition after being shot in the abdomen during a traffic stop on Saturday. Franklin Parish Sheriff Kevin Cobb said the shooting occurred after Mangham Police Department (MPD) Officer Marshall Waters conducted a traffic stop on Louisiana Highway 425 near the Richland-Franklin parish line at approximately 1 p.m. on Oct. 17, KATC reported. As Officer Waters stepped out of his patrol vehicle, the driver of the vehicle he stopped opened fire, shooting him in the lower abdomen beneath...
Early voting in Louisiana nears 440k
10/21/2020 3:58:42 PM PDT · by 11th_VA · 28 replies
KLFY.com ^ | Oct 20, 2020 | KLFY Staff
(KLFY) More than 430-thousand Louisianans have marked their election day ballots by going to the polls for early voting. The Louisiana Secretary of State’s Office says that 430,682 ballots have been cast as of Wednesday, October 21 for the November 3 election. Registered voters have until Tuesday, October 27 at 7 p.m. to cast a ballot at your local registrar of voters office or at other designated locations in your parish. View the statewide early voting statistical report Here
|
cc/2021-04/en_middle_0071.json.gz/line3214
|
__label__wiki
| 0.908565
| 0.908565
|
MORRIS SPORTS 850.
Mini has never been a stranger to breaking rules.
So when the Morris Sports 850 - a rare model with a controversial history – hit the road, it made people pay attention.
The Sports 850 was built specifically to qualify for racing – and only sold for two years between 1961 and 1963.
Nobody really knows how many were built, as no records were kept.
The first time the car was put to the test was the 1961 Armstrong 500 at Philip Island, and was the first car in that race subject to allegations of cheating.
Neil Johannesen was the first person to race a Mini in the event and brought a Sports 850 with twin carburettors to the even.
Officials accused him of cheating – but Johannesen was able to provide a telegram straight from BMC, claiming the modification was legal.
The car was taken off the grid and the racing team had to replace them with a standard carburettor from a spectator’s Mini.
To add insult to injury, a rock later smashed the Sports 850’s windscreen. Johannsen then took a replacement off the spectator’s Mini and continued with the race.
But officials weren’t happy with that move either, and he was disqualified, then reinstated in last place.
The controversial debut made people pay attention to the Mini though, impressing spectators with its speed and performance and paving the way for Mini’s spectacular win at the Gallagher 500 five years later.
Five of the Sports 850s competed the following year – this time placing second and third in the 1962 Armstrong 500.
Peter Manton was one of the key people involved in producing the Sports 850, which was sold through two dealerships in Melbourne and Sydney.
The modification - with twin 1 1/4" SU carburettors, special manifolding, tuned exhaust and special Sports 850 badging – was a dealership only model, but earned tentative support from BMC, and ended up retaining a full factory warranty.
It’s not known how many originals still exist today.
Wez Fischer, who owns a Saxon Green Sports 850, says his car which is in original condition and is only one of a few known examples in Australia.
Wez bought his Sports 850 after buying his first car in 1976 and then a Mini Moke.
It’s now part of a small family including a jet red 1969 Mini Cooper S and a black 1974 Mini Moke.
Leave your details and we’ll keep you up to date with MINI 60 year celebrations.
First name* Please enter your first name
Last name* Please enter your last name
Email* Please enter a valid email
GALLAGHER 500 REUNION.
Australian Mini driver Bob and Finnish rally star Rauno, the champion of 1966 Gallagher 500 with a Morris Cooper S. Hear the legendary stories behind the win.
A LOVELY STORY BEHIND A 1969 MORRIS MINI MATIC CAR.
A 1969 Morris Mini Matic only run 8k miles but still in perfect condition. The Mini Matic owner said the story behind it was as significant as its pristine condition.
A LIFELONG LOVE FOR MINI.
Mini lovers have always been known to love creating adventures and a unique life. Meet Jocelyn Chey and hear how she enjoyed her Mini Cooper in the 60s.
|
cc/2021-04/en_middle_0071.json.gz/line3216
|
__label__cc
| 0.59846
| 0.40154
|
Home Home | News & Events | Non Immigrant Visas
By U.S. Consulate in Thessaloniki | 17 July, 2020 | Topics: News, Non Immigrant Visas
Temporary Suspension of Consular Operations
The Consular Section at U.S. Embassy Athens has suspended non-emergency visa operations in the interest of public health and safety during the COVID-19 pandemic. American Citizen Services will remain available for U.S. citizen emergency appointments. All visa appointments have been suspended until further notice. Immigrant visa appointments will be rescheduled at a later date. In the meantime, …
By U.S. Consulate in Thessaloniki | 18 March, 2020 | Topics: Immigrant Visas, News, Non Immigrant Visas, U.S. Citizen Services
|
cc/2021-04/en_middle_0071.json.gz/line3219
|
__label__wiki
| 0.816322
| 0.816322
|
Greek City Times
World Title Fight: George Kambosos Jr vs Teofimo Lopez Jr
Greek athlete Giorgos Kotsimpos enters Guinness Book of Records
George Michael’s ‘Last Christmas’ reaches number one 36 years after its release
Natalie Martin January 3, 2021
Greece and Israel agree on air force flight training centre in Kalamata
‘Natasa Theodoridou and Friends’ spread musical Christmas cheer
Antonia Komarkowski December 28, 2020
Today we remember the tens of thousands of Greeks killed by Stalin
Gct December 16, 2020
The charms of the Museum of Cycladic Art for 2021
Greek-Illyrian Helmet Found In Southern Dalmatia, Croatia
GCT B December 7, 2020
Greek guitar goddess Orianthi releases new album ‘O’
Natalie Martin December 5, 2020
A Cretan Baker’s Life: 86-year-old Giorgos Hatziparaskos
Antonia Komarkowski November 23, 2020
Head of ancient statue found just metres under the ground in Athens
GCT Team November 15, 2020
Lysicrates Foundation: James Martin statue unveiled in Sydney, Australia
Antonia Komarkowski November 9, 2020
Exploring beautiful Nafplio in Autumn
Gct November 8, 2020
Lycabettus Hill is a must see in Athens
SMS 13033 for movement during lockdown
Volkswagen group to electrify Astypalaia
Stelios Kerasidis becomes the youngest Greek student at famous music conservatory in Paris
Steve Tsoukalas’ enduring love for the iconic Sydney Opera House
World leading fashion store ‘Zara’ was nearly called ‘Zorba’
Greek American AJ Ginnis makes history at the FIS Alpine Ski World Cup
Greek-American alpine ski racer AJ Ginnis made history at the 2021 Alpine Skiing FIS World Cup in Flachau, Austria. He is the first skier representing Greece to register World Cup points. “Wow what a day for…
January 18, Feast Day of Agios Athanasios
On January 18 the Greek Orthodox Church celebrates the Feast Day of Agios Athanasios. Agios Athanasios was born in Alexandria in the year 296, and from his early childhood, he had an…
ARTS, FILM
Xronia Polla Betty White, who turns 99 today
American actress and comedian who is of ¼ Greek descent, Betty White was born on January 17, 1922, in Oak Park, Illinois. She is the only child of Christine Tess Cachikis and…
Archbishop Ieronymos clarifies his controversial statement about Islam
Responding to criticism due to his comments about Islam, Archbishop Ieronymos I clarified his statement through a spokesperson. “The Archbishop and our Church respect in practice all the known religions,” said the…
GCT P January 18, 2021
Vasilakopoulos: Do not link the death of the elderly with the COVID-19 vaccine
Professor of Pulmonology, Theodoros Vasilakopoulos, noted when speaking on OPEN TV that several elderly people will lose their lives if they are vaccinated. Vasilakopoulos’ comments were made as vaccinations for people over the…
Varoufakis: The Greek people do not trust the government
Former Greek Financial Minister and Secretary of the MeRA25 political party, Yanis Varoufakis, claimed in Parliament that Greek society does not trust the government as it could not fulfill its obligations in…
Voting in the next Greek elections? Now the diaspora can
Greek citizens living abroad have always had the right to vote in Greek elections according to the country’s constitution. Still, up until recently, they have only been able to exercise their right…
Gct January 17, 2021
‘Casa Odyssia’ in Corfu overlooks the Ionian Sea
In the northeastern part of Corfu, one finds an impressive house that overlooks the Ionian Sea. ‘Casa Odyssia’ is a leisure residence that aims to host its visitor, as a modern Odysseus. It…
Greek Lifestyle, FOOD
NOYNOY, a household name in Greece
NOYNOY is a household name in Greece, with generations of children growing up drinking this famous milk, which first hit Greek supermarket shelves in 1929. This concentrated milk is pure, whole cows…
Greek Culture, COMMUNITY, Greek NEWS, HISTORY
“Greece 2021″ committee releases official memorabilia
President of the ‘Greece 2021’ Committee, Gianna Angelopoulos-Daskalaki, announced the release of the official line of licenced commemorative and collectible products.
100-year-old man wearing traditional Cretan head piece receives COVID-19 vaccine
The process of vaccination of over 85 years is progressing smoothly in Crete, Creta Live reported. The vaccination coverage of the population over 85 years of age started smoothly in Crete, in…
Greece Travel, Greek Lifestyle, TRAVEL NEWS
Athens and Santorini named two of the ‘Most Instagrammable places in the world for 2021′
Athens and Santorini been named one of the “most instagrammable” places in the world. The list was drawn up by Big 7 Travel, after it analysed Instagram hashtags for destinations around the…
Greece Travel, Greek NEWS, TRAVEL NEWS
The New York Times picked Andros as one of its ’52 Places to Love in 2021′
Andros made The New York Times‘ list “52 Places to Love in 2021.” Usually titled “52 Places to Go” and compiled by recommendations from editors, reporters, and contributors at the New York…
Greek NEWS, SPORT
Olympic star Sofia Bekatorou reveals sex abuse after Sydney Olympics
GCT reported that Olympic sailing champion Sofia Bekatorou accused a sporting official of sexually assaulting her in 1998 during preparations for the Sydney Games.
January 17, Feast Day of Agios Antonios O Megas
On January 17 the Greek Orthodox Church celebrates the Feast Day of Agios Antonios O Megas, the Anchorite of Egypt and the Father of all Monks. Saint Anthony was born near Herakleopolis…
Turkey outdoes itself: Commits to military exercises in the Aegean until December with new NAVTEX’s
Ten days before the start of exploratory talks between Greece and Turkey, and hours after Turkish President Recep Tayyip Erdoğan indirectly invited Greek Prime Minister Kyriakos Mitsotakis for a meeting, Ankara issued…
COVID-19 vaccinations started today for people over 85: See the photos
The COVID-19 vaccination program for people over the age of 85 started today. Vaccinations for health workers who are on the front line of the battle is also underway. It is recalled…
Maria Sakkari under quarantine before Australian open
An Australian Open press release on Saturday night revealed that a passenger on the charter flight from Melbourne to Abu Dhabi returned positive in COVID-19 test, putting Greek tennis player Maria Sakkari…
Ice sculpture replica of Odeon of Herodes Atticus at China’s Harbin Ice Festival
Made out of ice, an impressive life-size replica of the ancient Odeon of Herodes Atticus theatre is on display at the 37th Harbin International Ice and Snow Sculpture Festival in China.
Two minors arrested over ‘cowardly attack’ on Metro stationmaster
Two minors have been arrested over the savage bashing of a 52-year-old stationmaster at Omonia Metro. The two perpetrators, brothers aged 15 and 17, were identified and taken into police custody on…
Athens and Santorini been named one of the “most instagrammable”…
Rizogalo- Rice Pudding Recipe
Rizogalo (ρυζόγαλο) is named after its two key ingredients: ‘rizi’…
“I feel very lucky”: Greek Australian Marie-Claire Stevens received the highest possible ATAR of 99.95
On December 18, 2020, more than 66,000 NSW students learned…
Home of Greek poet Nikos Gatsos, set to be declared a monument
The house in Asea, Arcadia, where prominent 20th century Greek…
On this day in 1873, Olympic legend Spyridon Louis was born
In 1896, Spyridon Louis made Greek sporting history. He won…
DJ Krazy Kon – Milestone 25th album in iconic ‘Greek’ Mix series
Turn up the volume! Australia’s leading Greek DJ and producer,…
Statue of Ancient Greek god Asclepius and bust of Zeus-Serapis found in Turkey
A statue of the Ancient Greek god of health Asclepius…
The best diet for 2021 is the Mediterranean
The Mediterranean diet — rich in healthy fats, fish, whole…
Unanswered questions about Turkey’s relationship with ISIS
Unanswered questions about Turkey’s relationship with ISIS In a recent…
Abdulrahman Taleb January 14, 2021
Putin’s participation in Greece’s 200-year independence anniversary from the Turks will boost relations
Greece on March 25 will celebrate the 200-year anniversary since…
Paul Antonopoulos January 14, 2021
“One of the greatest civilisations in the world has become…
It’s happening. The world title fight for George “Ferocious” Kambosos Jr.
American actress and comedian who is of ¼ Greek descent,…
Starlings Entertainment has announced that two high profile series projects…
On this day in 1859, Greek poet Kostis Palamas was born
Kostis Palamas (Κωστής Παλαμάς) was a Greek poet who wrote…
Madwalk celebrates 10 years with spectacular fashion and music (VIDEOS)
MadWalk 2020 by Serkova Crystal Pure – The Fashion Music…
NOYNOY is a household name in Greece, with generations of…
Why Fakes and Fasolada are considered Superfoods of the World
Legumes (also known as pulses) are a group of plant…
Patatokeftedes – Potato Fritters Recipe
A quick and easy recipe for the most delicious Patatokeftedes…
Antonia Komarkowski January 8, 2021
Greek-American alpine ski racer AJ Ginnis made history at the 2021…
An Australian Open press release on Saturday night revealed that…
Nick Giannopoulos announces his dad has passed away aged 88
Nick Giannopoulos has taken to Facebook to announce the death…
The beloved artist proved that apart from being a great…
Greece’s 2020 Box Office Hits
In 2020, the biggest box office hit in Greece was….…
Andros made The New York Times‘ list “52 Places to…
Greek PM Mitsotakis proposes joint EU vaccination certificate to ease travel
Greek Prime Minister Kyriakos Mitsotakis is calling for the creation of…
Athens International Airport passenger traffic drops 68.4% in 2020
Passenger numbers at Athens International Airport (AIA) dropped by 68.4%…
Have you ever wondered how the famous Spanish clothing company…
Greek brand SOPHIA now being sold at the Louvre and British Museums
The love for Greek cultural heritage and a desire to share it with the whole world led to the creation of Greek brand SOPHIA, now being sold worldwide including at the iconic Louvre and British Museums.
Paulina Karavasili October 17, 2020
Versace’s ‘Versacepolis’- characterised by boldness, character and attitude
Italian luxury fashion house Versace debuted ‘Versacepolis’ over the weekend, which was iconic in so many ways.
Antonia Komarkowski September 28, 2020
Kastellorizian Jewellery: A Dispersed Archive of a Past Culture
Inspired by the recognition that Kastellorizio’s once thriving culture was being lost and scattered, Nick Bogiatzis’ latest book ‘Kastellorizian Jewellery. A Dispersed Archive of a Past Culture’ provides an absorbing and informative insight into the island’s jewellery.
Natalie Martin September 9, 2020
Shop ‘Til You Drop in Athens
Whether you prefer to take a leisurely stroll and window shop, or head to a hub where you can find all your favourite brands and stores in the one spot, Athens has all of your shopping needs covered. Read our guide for shopping in Athens complete with shopping tips.
In the northeastern part of Corfu, one finds an impressive…
Butterfly-shaped houses ‘land’ in Vouliagmeni
“The Butterfly” is currently being built in Vouliagmeni, a seaside…
New Metropolitan Sea Airport of Elefsina: “One of the most ambitious and visionary projects taking place in Greece”
Embodying the philosophy of eco-emotional intelligence, the €25 million Metropolitan Sea Airport of Elefsina that has gained the attention and praise of the international architecture community is set to open its doors next year.
Paulina Karavasili November 28, 2020
When Steve (Skevos) Tsoukalas arrived in Sydney in 1964 at the young age of 19, he was filled with awe when he first saw the Opera House. Little did he know that his incredible connection with the Opera House would still be enduring over 50 years later.
House in Corinth inspired by the Pythagorean Theorem
A house so unique and beautiful is hard to square.
Among 600 olive trees, is this dream, minimalistic house inspired by the Pythagorean theorem and created by architect Tilemachos Andrianopoulos.
|
cc/2021-04/en_middle_0071.json.gz/line3230
|
__label__wiki
| 0.571744
| 0.571744
|
Greeks more proud of their identity than EU counterparts
by Gct
A recent survey found that Greeks are more proud of their history and identity compared to their European counterparts.
According to the data from the Ipsos survey, four in five Greek say they are proud of their Greek history and identity, a much higher percentage than in other European countries (similar surveys have been also carried out in Germany, Italy, France and the Netherlands).
However, this strong sense of national identity does not translate into anti-migrant feelings but, to the contrary, Greeks consider that compassion and solidarity form a part of their identity.
The Greek people are more positively disposed toward refugees than residents in many other EU countries, according to an Ipsos survey on how Greeks view their national identity and migration into Greece. At the same time, however, Greeks also express concern over the migration and its economic repercussions, anger at globalisation and lack of trust regarding the role of non-governmental organisations (NGOs).
The survey was conducted by Ipsos for the non-profit organisation “More in Common” via a series of telephone interviews, using a sample of 2,000 adults aged 18-64 years old, as well as discussion with population groups. It was concluded in October 2018.
Tags: EU, France, Germany, globalisation, Greek history, greek identity, Greek news, Greeks, Italy, migration, national identity, Netherlands, survey
On this day in 2009, Evgenios Spatharis passes away
Greek President along with all European Leaders celebrate Europe Day
Gct May 9, 2019
Cyprus- Foundation laying ceremony for CYCLOPS training facility
Holy Synod rejects government decision to close places of worship on Epiphany
Qantas plans to resume international flights in July 2021
Greek celebrities under fire for New Year party in ‘Covid free’ Dubai
GCT B January 4, 2021
Elias Giovanidis, an example of solidarity and kindness
Dr. Jane Goodall’s message of support to Animal Welfare Karpathos
The ceremonial groundbreaking event for the Cyprus Center for Land, Open-seas, and Port Security (CYCLOPS),…
The Holy Synod of the Greek Orthodox Church on Monday said it will open churches to the faithful during the Epiphany celebration on January 6.
Qantas is selling seats on international flights for July 2021! Australia’s largest airline has been…
Agia Sophia’s conversion into a mosque was the crown of 2020, says Erdoğan
Turkish President Recep Tayyip Erdoğan kicked off the New Year with a provocative reference to…
Turkish DM Akar: Greece cheats, lies and does everything to pressure us
Turkey’s so-called Defense Minister Hulusi Akar has claimed that Greece is “cheating with lies,” once…
|
cc/2021-04/en_middle_0071.json.gz/line3231
|
__label__wiki
| 0.766937
| 0.766937
|
Spokane Bar Sapphire Mine & Gold Fever Rock Shop – A Montana Mining Adventure
By Brian D’Ambrosio
There are barely a handful of places in the U.S. where you can mine for your own gemstones, and one of them is only 10 miles east of Helena.
This explains why people arrive at the Spokane Bar Sapphire Mine from eclectic corners of the world to rock hound and rummage around for sapphires, rubies, garnets and other precious and semi-precious stones.
Sapphire has been treasured for eons. Ancient Persians believed that the earth rested on a large sapphire and its reflection painted the sky. The gemstone’s mystique is no less valued today, and it is the primary prize that people pursue at the Helena Valley mine.
“We’ve had tours of Taiwanese and folks from every continent except Antarctica here searching for sapphires,” said Cass Thompson, owner of the Spokane Bar Sapphire Mine.
Thompson recalls an especially memorable Japanese businessman who would fly to Montana to visit the mine weekly for three straight months.
“He would spend the whole day here,” said Thompson. “He spoke almost no English. He’d fly to Helena, take a taxi, and just keep coming. I’ll never forget that.”
Those in the Helena-area don’t have to travel as far, but that doesn’t make the adventure any less fulfilling – or addicting.
Gravel is sold in three gallon bags that have been extracted (but not sifted or sorted through) from the Spokane Bar Mine or local El Dorado mine. One three gallon bag costs $50. Smaller quantities include a pint sample bag, which costs $10. Ten dollars’ worth of soil and earth is sufficient enough to keep one kid occupied for as long as two hours.
“Kids have a good eye for panning and rock hounding,” said Patrick Moore, who has worked at the Spokane Bar Sapphire Mine for more than 10 years. He grew up nearby and started exploring and examining rocks at an early age. “They probably have a better eye than adults. I couldn’t tell you why. Maybe they just like shiny, sparkly things.”
The Spokane gravel bar was named by geologists mapping the Missouri River in the early 1900s. Spokane shale was found in the neighboring Spokane Hills.
“Our family bought the land because they thought it would be a good place to go camping,” said Thompson. “It was about 100 dollars an acre back in the 1950’s. We didn’t know about the value or the minerals.”
It was Cass’s mother, Deb Thompson, who accidentally unearthed the mystery of the precious assets underground.
“She was swimming at age 7 and she dove into the water,” said Thompson. “She came up with a handful of sand and a blue rock which turned out to be a sapphire.”
The mine opened soon after and has stayed in the family as a family business ever since.
“When I was in the third grade, the school made me come and take a tour of my own house and land,” said Thompson. “They made me give the tour.”
Overlooking mountain range horizons and the dark blue waters of Hauser Lake, one of the mine and rock shop’s big bonuses is its scenic value. Samuel T. Hauser, one of Montana’s territorial governors, played a noteworthy role in Spokane Bar’s mining history. Governor Hauser and three partners inspected the gravel bar for gold. Heavy stones blocked the sluice box. Baffled, the miners mailed samples to England, where they were identified as sapphires and “worthless” objects.
“You can see leftovers of ditches that hint of a water system that carried water from a source ten miles away,” said Thompson. “A rough hydraulic system washed out dirt and gravel away from the hill into wooden sluice boxes.”
Current river levels straddle approximately 175 feet beneath the early deposits. Four gravel terraces with sapphire and gold deposits envelop Spokane Bar. Terraces jut on both sides of the river. Below Spokane Bar, the bars of El Dorado, American, Ming’s, Gruel’s and Ruby have also seen momentous gold placering activity. The El Dorado bar has also produced an imposing quantity of sapphires.
If your pan is perfect, you can locate sapphires in multiple colors. The natural sapphire crystal structure is hexagon with triangle “terminations,” which are often flat. The most commonly found color is greenish-blue. Sapphires arise in many different shades but the most valuable of sapphires is a rich intense blue. Ruby is red sapphire, another highly prized object.
“We’ve seen blue and green colored sapphires,” said Moore. “We’ve seen the whole rainbow, purple, pink, oranges and yellows. There was a kid who was eight-years-old who found a 30-pound garnet once and we’ve seen 20-pound sapphires leave here.”
“The 4 Cs of sapphire quality are color, clarity, carat weight, and cut,” said Thompson.
On this mid-March afternoon, some of our take includes garnets, mossy agate, hematite (heavy iron ore), quartz (dull, cloudy rock), garnet, serpentine, moonstone, and low-quality jade.
There are about 495 variations of color in a sapphire. The largest known sapphire from the Spokane Bar was 155 carats, found by a man from Idaho. Other finds, though rare, are diamond, topaz, citrine, and ruby. Garnets of several varieties can be found; the largest on record weighed 40 carats.
“This place is every kid’s dream,” said Thompson. “Think about it. You are a treasure hunter looking for the mother lode.”
Visitors can purchase bags in the rock shop or elect to dig in an open pit on an adjacent hill. If you purchase the bag from the shop, the mine provides you with tweezers, wooden tables for sorting, as well as screens and gloves.
If you opt to excavate independently you will need to bring a screwdriver, a bucket, a shovel, a whisk broom, gloves, tweezers, a garden trowel, a dust pan and a pick.
In the Gold Fever Rock Shop, examples of the Thompson family’s experience sit under glass. Gems of infinite shapes and colors sparkle on display. There’s even a vial of gold nuggets and other locally mined precious stones, including blood-red garnets and smoky topaz. Most of the folks who come to the mine, however, prefer to pick their own rather than purchase them. Sifting and inspecting is just as enjoyable at home.
“We have people who will come and buy a bag on Christmas day to take with them,” said Thompson. “We are always here. We work eight days a week here not seven.”
Directions: Take York Road out of Helena to Mile Marker #8. Turn right onto Hart Lane. After the road makes a ninety-degree turn, go left on Castles Road. Hours: The Spokane Bar Sapphire Mine is open 7 days a week, year-round, from 9 a.m. to 5 p.m. Click here for a map.
|
cc/2021-04/en_middle_0071.json.gz/line3241
|
__label__cc
| 0.71696
| 0.28304
|
Accessibility at Accredible
Our platform is designed with accessibility in mind so that anyone can use Digital Credentials.
Digital Credentials Accessible for Everyone
At Accredible we believe that everyone should have the ability to access digital credentials, whether as a recipient or as a potential stakeholder. We believe this is should be the case for people regardless of their abilities, and that is why are dedicated to making our platform accessible to all users. Technology should help to increase the access to skills and achievements, not hinder it.
To this end, Accredible has recently launched a number of updates to it's product to ensure that credentials are Section 508 & WCAG 2.1 compliant.
The product was tested by an IAAP-accredited tester, examining the product across multiple browsers and assistive technologies (including screen readers, screen magnification, and speech recognition tools). In addition, manual and automated code analysis was undertaken to identify any potential outstanding accessibility issues.
All accessibility features on Accredible have been applied to the recipient and third-party experiences.
Accredible's VPAT
For more information on the accessibility features Accredible has provided for listed content, platforms, players, and portals in order to address Section 508 and WCAG 2.1 (A and AA) accessibility requirements, here is our voluntary product accessibility template (VPAT):
Accredible WCAG 2.0 VPAT PDF
|
cc/2021-04/en_middle_0071.json.gz/line3243
|
__label__wiki
| 0.616515
| 0.616515
|
Ministry to offer additional COVID-19 relief in Hickory
Susie Tolbert, NET coordinator at Greater Hickory Cooperative Christian Ministry, pays a client's power bill. The ministry will now be able to offer additional utility and housing assistance to residents facing hardship as a result of the pandemic.
ROBERT C. REED, RECORD
A COVID-19 relief program available through Greater Hickory Cooperative Christian Ministry will be able to expand and meet other pressing needs following an amendment to the agreement approved by the Hickory City Council on Jan. 5.
Under the amended agreement, $216,800 in additional funding will be provided for the relief program.
The scope of the program is also broader now.
Previously, the program only covered payments for water and sewer bills. Now, in addition to those water and sewer expenses, it will also cover power, natural gas and rental and mortgage assistance.
Lily Moody, the assistant executive director of the ministry, said the changes to the program will help the ministry better meet the needs in the community.
She said the ministry was seeing a number of significant needs in the community that could not be addressed by the program as it was constituted at that time.
“We had neighbors who came in for rental and mortgage assistance that were literally about to become homeless,” Moody said.
The amended program is also less restrictive in some ways.
There are no caps on how much money individual households can get. Previously, there was a limit of $100 per household for up to three months.
The relief is limited to three straight months for the housing assistance and six straight months for any of the utility assistance.
Just as before, the program is restricted to city residents who can demonstrate their hardship is linked to the pandemic.
Moody said it will do a lot to help meet both those specific needs as well as others.
“That is going to really alleviate the stress and anxiety of our neighbors and we feel like we can then provide other services at GHCCM such as medical and pharmacy,” Moody said. “The Whole Life Center has an array of services that we can connect them to (such as) budget counseling.”
She added that the ministry’s mission is to help and that people in need should feel free to reach out to find out what resources are available. The ministry’s services are not just limited to the homeless, Moody said.
For more information on the relief program and other services, call 828-327-0979.
The city was able to expand the program after receiving an additional $274,200 in relief funding.
Hickory Communications Specialist Sarah Killian said additional funds not used for the program will be used for administrative functions and additional COVID relief that has not yet been determined.
The city first partnered with the ministry in July to use $156,000 in federal funding for a program to help residents pay water and sewer bills. Of that amount, $145,000 was available for direct relief.
Hickory has been able to recoup $11,200 from the program through Nov. 20, Killian said.
Outstanding water and sewer balances currently total $177,500. It is not clear how much of that can be recovered through the program since it only covers people who could not pay bills as a result of the pandemic.
Kevin Griffin is the City of Hickory reporter at the Hickory Daily Record.
Lily Moody
Hickory City Council
Hickory Daily Record city reporter Email: kgriffin@hickoryrecord.com
Follow Kevin Griffin
Govt. and Politics
Not your typical dollar store: New Hickory Dollar General to have different look
The Dollar General store currently under construction at the intersection of 10th Street Boulevard NW and 12th Avenue NW will not have the loo…
Watch Now: Two suspects wanted for murder after shooting at furniture business
Two Alexander County residents are wanted in connection with a shooting that left a woman dead at the furniture business TCS Designs on Wednes…
Unbearable pain: Stepdaughter of murder victim reflects on her life, calls for justice
As the search continues for two suspects charged in the murder of a TCS Designs employee, the stepdaughter of the victim is remembering the im…
Watch Now: Fire damages vacant building on 14th Street NE in Hickory
This story was updated at 9:33 a.m. on Jan. 13.
65 or older? Get in line for your vaccine
Catawba County residents over age 65 can now get the COVID-19 vaccine from Catawba County Public Health.
Teen shooter dies following confrontation at convenience store in Caldwell County
A teenager was shot and killed during a confrontation at a convenience store in Caldwell County last week.
Taylorsville man faces rape charges in Alexander County
A Taylorsville man faces statutory rape charges in Alexander County.
Felony death by vehicle charge lodged against Taylorsville man following fatal crash
A Taylorsville man faces several charges following a fatal single-vehicle wreck in Alexander County.
Maiden man dies in single-vehicle wreck
A Maiden man died following a single-vehicle wreck in Maiden on Monday.
|
cc/2021-04/en_middle_0071.json.gz/line3250
|
__label__wiki
| 0.775684
| 0.775684
|
Plays/Adaptations
Teaching and Criticism
Hamlet: Fall of the Sparrow
Red Bike
SuperTrue
American Medea
Harry and the Thief
The Metal Children
Rimers of Eldritch
As Long as Fear Can Turn to Wrath
Holly L. Derr
Famous, Fearless, and Feminist
Posted by Holly L. Derr under Ms. in the Biz | Tags: Amy Poehler, Beyoncé, Ellen Page, Evan Rachel Wood, Geena Davis, Jada Pinkett-Smith, Jennifer Lawrence, Natalie Portman |
Originally published by Ms. in the Biz
When Beyoncé’s latest album dropped, feminists went nuts. This is not the first time they’ve gone nuts over Beyoncé: When Ms. Magazine put her on its cover earlier this year, its readers erupted in outrage that a woman who “writhes around,” scantily clad “for the benefit of men” could be considered a feminist. Millions of other women came to her defense, arguing that feminism is about allowing women to be whoever they want to be. The editors of Ms. stood by their choice, but the disagreement hasn’t faded, and the new album has only added fuel to the fire. The combination of lyrics sampled from a Ted Talk given by Nigerian author Chimamanda Ngozi Adichie –
We teach girls to shrink themselves
To make themselves smaller
We say to girls
‘You can have ambition
But not too much
You should aim to be successful
But not too successful
Otherwise you will threaten the man.’
– and those contributed by Beyoncé’s husband referring to himself as Ike Turner, casting her as Tina, and referencing a well-known episode of domestic abuse between them, debate once again flared as to the validity of Beyoncé’s claim to feminism.
Such controversies may not do much to further the cause of feminism, but they sure do generate page views. Not surprisingly, therefore, in the last few years, Hollywood reporters have taken every opportunity to ask stars, “Do you consider yourself a feminist?” While women like Taylor Swift, Katy Perry, and even Susan Sarandon have eschewed the term, others have boldly taken up the mantle and declared their commitment to changing the status quo for women in Hollywood.
In an interview with the Guardian, Ellen Page spoke freely about her support for reproductive rights and LGBTQ rights and her appreciation for feminism:
I don’t know why people are so reluctant to say they’re feminists. Maybe some women just don’t care. But how could it be any more obvious that we still live in a patriarchal world when feminism is a bad word? Feminism always gets associated with being a radical movement – good. It should be. A lot of what the radical feminists [in the 1970s] were saying, I don’t disagree with it.
Regarding projects she is writing and directing, she shared, “Of course, if you just write a script in which the woman has control over her destiny and love isn’t the main thing in the film, that’s seen as super feminist. [But] it’s hard to get stuff made, especially if it’s about women. Everything’s about international bankability.”
Geena Davis has thrown the weight of her name, her resume, and her money behind the Geena Davis Institute on Gender in Media, a research-based organization working to “engage, educate, and influence the need for gender balance, reducing stereotyping and creating a wide variety of female portrayals for children’s entertainment.” The Institute found that the ratio of male to female roles in family films – three to one – has not changed since 1946. In a recent guest article in The Hollywood Reporter, she offered some great advice on solving the problem:
Step 1: Go through the projects you’re already working on and change a bunch of the characters’ first names to women’s names. With one stroke you’ve created some colorful unstereotypical female characters that might turn out to be even more interesting now that they’ve had a gender switch. What if the plumber or pilot or construction foreman is a woman? What if the taxi driver or the scheming politician is a woman? What if both police officers that arrive on the scene are women — and it’s not a big deal?
Step 2: When describing a crowd scene, write in the script, “A crowd gathers, which is half female.” That may seem weird, but I promise you, somehow or other on the set that day the crowd will turn out to be 17 percent female otherwise. Maybe first ADs think women don’t gather, I don’t know.
Jada Pinkett-Smith, who questioned the feminist policing of Beyoncé by asking “Whose body is this anyway?” on Facebook, also used the social network to defend her daughter, Willow, when she became subject to vitriolic criticism over a haircut: “This is a world where women, girls are constantly reminded that they don’t belong to themselves; that their bodies are not their own, nor their power or self determination. I made a promise to endow my little girl with the power to always know that her body, spirit and her mind are her domain.”
Pinkett-Smith further defined her brand of feminism with a Facebook post on how sexism harms men as well as women: “There is a deep sadness when I witness a man that can’t recognize the emptiness he feels when he objectifies himself as a bank and truly believes he can buy love with things and status. It is painful to witness the betrayal when a woman takes him up on that offer.” She has also become a spokesperson for the anti-human-trafficking movement through her organization “Don’t Sell Bodies.”
The list goes on and on. Jennifer Lawrence has used her press junket for The Hunger Games: Catching Fire to advocate against women calling each other fat and for more reasonable representations of women’s bodies on screen. Evan Rachel Wood loudly protested the MPAA excision of a cunnilingus scene from her film Charlie Countryman. Natalie Portman called representations of women who are vulnerable just as feminist as those of women kicking ass. Amy Poehler told a reporter her feminism is “just who I am, in the same way that I’m a woman, or I’m 5’2″ or whatever.”
The controversy over Beyonce’s feminism shows no sign of fading, but though the singer was “terrified” before the album’s release, she says now she feels liberated, and the dispute certainly hasn’t hurt album sales. If these women aren’t shying away from calling themselves feminist – and haven’t suffered any repercussions to their careers for it – why should anybody else?
So when reporters ask you, “Do you consider yourself a feminist?”, what will your answer be?
Biography Bitch Media Education Film/TV HowlRound Interview Ms. in the Biz Ms. Magazine News Plays Rehearsal Review Role/Reboot Teaching Theater The Atlantic Theory Women and Hollywood
@realDonaldTrump suck it, you orange chump washingtonpost.com/media/2020/10/… 3 months ago
RT @GuthrieTheater: Director @LavinaJadhwani recently published an important field guide titled “Dismantling Anti-Black Linguistic Racism i… 4 months ago
RT @HowlRound: Holly Derr (@hld6oddblend) interviews Lavina Jadhwani (@LavinaJadhwani) about the document she created, Dismantling Anti-Bla… 4 months ago
The University of Memphis Department of Theatre and Dance is looking to commission a play about the impact on immig… twitter.com/i/web/status/1… 7 months ago
Amazing Memphis'-based news or: Meet our journalists who cover justice by @MLK50Memphis mlk50.com/meet-our-team-… 7 months ago
A.R.T./MXAT Institute for Advanced Theater Training
big dance theatre
Brown University/Trinity Repertory Company Consortium
C. Denby Swanson
CalArts School of Theater
Columbia University School of the Arts Theater Arts
Ensemble Studio Theatre LA
Gregory S. Moss
PlayPenn New Play Development
SITI Company
Smith College Theatre Department
Timothy Braun
University of California at Riverside, Department of Theatre
University of North Carolina at Chapel Hill Department of Dramatic Arts
|
cc/2021-04/en_middle_0071.json.gz/line3254
|
__label__wiki
| 0.922779
| 0.922779
|
Mashery Acquisition Continues Intel’s Diversification
by Nick Kolakowski April 18, 2013 3 min read
APIDataDevelopersIntelMasheryNetworks
Mashery’s offerings include a consolidated dashboard for managing all APIs.
Intel is purchasing API technology firm Mashery, as first reported by ReadWrite and subsequently reported by other publications. If the deal goes through, it will give Intel a deeper presence in software and services, particularly those targeted at developers; Mashery’s API-related features include reporting and analytics, API resource “packaging,” and a consolidated dashboard for managing all APIs.
TechCrunch quoted Intel’s purchase-price for Mashery at more than $180 million, citing an unnamed source “familiar with [the] deliberations.” The publication also noted that ReadWrite had estimated the sale price in roughly the same range.
“Intel is one of the biggest software companies in the world, and we’re excited to be a part of it,” Mashery CEO Oren Michels told VentureBeat. “We’re coming in here to do interesting things.”
Mashery and Intel had flirted long before this particular marriage, at one point partnering on a joint API management solution, the Intel Expressway API Manager. That platform offered up a combination of developer tools, API analytics and security, and a community API portal. But Intel isn’t just buying Mashery for its technology; the latter comes with high-profile clients such as Aetna, Best Buy, and Coca-Cola.
Intel is intent on branching out beyond its traditional processor business into other areas. In February, for example, it announced its own Apache Hadoop distribution, one apparently built “from the silicon up” to efficiently access and crunch massive datasets. The company has also become more interested in providing security to clients, as evidenced by its acquisition of McAfee in 2010.
Intel’s first-quarter earnings, reported April 16, show a company that could profit from more diversification. Its PC client business reported a 6 percent year-over-year drop to $8.0 billion—unsurprising, given the recent weakness in the laptop-and-desktop market. Other Intel Architecture Group revenue, which comes from other hardware such as set-top boxes, also dropped a significant 9 percent. (Data centers represented a bright spot, climbing 7.5 percent year-over-year to $2.6 billion.)
Those dips aren’t necessarily Intel’s fault; the PC market has gone infamously soft in recent quarters, as tablets and mobile devices have moved to the center of many customers’ computing lives. But the numbers do illustrate Intel’s need to branch out from its areas of traditional strength, and reposition itself as a provider of additional services to companies and developers. The Mashery buy is another step in that process.
Image: Mashery
Tuesday's News: Promotion by Acquisition
Consumerization Continues to Baffle IT
Wireless Cell Site Acquisition Specialist
Facebook Provides Near-Real-Time PUE Data for Its Data Centers
Google Chrome Targeting Internet Explorer’s Business Users
Nick Kolakowski has written for The Washington Post, Slashdot, eWeek, McSweeney's, Thrillist, WebMD, Trader Monthly, and other venues. He's also the author of "A Brutal Bunch of Heartbroken Saps" and "Maxine Unleashes Doomsday," a pair of noir thrillers.
|
cc/2021-04/en_middle_0071.json.gz/line3275
|
__label__wiki
| 0.977701
| 0.977701
|
press print
WeWork selects Houston as one of its markets for a 3D printing pilot program
Natalie Harms
Jun 20, 2019, 9:17 am
Houston is one of only five WeWork Labs markets that can expect access to 3D printers as a part of a pilot program with two companies. Courtesy of WeWork
WeWork has teamed up with two leading 3D printing companies to bring their technology into five WeWork Labs markets — including Houston's downtown location. The other locations tapped for the pilot program are London, San Francisco, New York, and Seattle.
Massachusetts-based Formlabs' Form 2 printer has over 20 different material resins WeWork Labs members can use to prototype and print products using desktop stereolithography.
"Formlabs was founded eight years ago on the basis of empowering anyone to make anything," says Max Lobovsky, CEO and co-founder of Formlabs in a release. "Today, our customers have printed more than 40 million parts, they vary from early stage entrepreneurs changing the status quo and developing new applications to Fortune 500s experimenting with new business models or production methods."
The other company involved in the program is Seattle-based Glowforge, which created a 3D laser printer. Glowforge Plus uses subtractive laser technology to cut and sculpt projects from materials like wood, leather, acrylic, stone — and even stickers. The company, which was founded in 2014, has had over three million prints on its devices — everything from jewelry and clothing to machinery.
"We are thrilled to partner with WeWork Labs to provide their community of entrepreneurs and startups alike access to the tools that will help them create corporate giveaways, new product prototypes, and full production runs — everything to take their dreams from idea to creation," says Dan Shapiro, CEO of Glowforge, in the release.
The printers will be revealed at various launch events celebrating the National Week of Making, which begins June 21 and goes through June 27. Houston's launch event will be on June 28, but the specifics have not yet been finalized.
"We see WeWork Labs as a platform for creators, innovators and makers alike, and believe partnering with Glowforge and Formlabs will give our members even more of an opportunity to take their ideas, and bring them to life," says Katie Perkins, creative director at WeWork Labs, in the release. "We are incredibly excited to welcome two leading brands and their products into our community, giving creators access to the tools they need and inspiring new creators to be makers themselves."
Houston's WeWork Labs program launched in March in the WeWork Jones Building at 708 Main St. and includes a partnership with local digital startup resource, Alice. The WeWork Labs program started a little over a year ago and is already in over 30 markets worldwide.
"As the fourth largest city, Houston is in a unique position to launch high-impact startups," says Houston Labs Manager Carlos Estrada, in a previous release. "We see WeWork Labs in Houston as a tremendous platform for innovation, as our founder-focused approach to supporting early-stage startups will nurture and accelerate the work of entrepreneurs to scale their solutions to today's biggest challenges."
Courtesy of WeWork
Using 20 types of resin materials, Formlabs' Form 2 can create parts or prototypes.
formlabs glowforge max lobovsky katie perkins carlos estrada houston wework downtown houston 3d printing form 2 glowforge plus wework labs
The Bevy Way
Building Houston
Time to Connect
Now is the time to bring venture capital to Houston
Laura Furr Mericas
A new report finds that the Lone Star State is ideal for female entrepreneurs. Photo via Getty Images
merchant maverick women-led startups female entrepreneurs
|
cc/2021-04/en_middle_0071.json.gz/line3286
|
__label__wiki
| 0.588491
| 0.588491
|
Clement Lochio Lomornana
Clement Lochio Lomornana was a prominent journalist and a strong voice in the defence of media rights and freedom of speech in Africa. The journalist had been working for a radio and internet news service called Gurtong Media for approximately 6 years and has been very vocal about the civil war and subsequent peace talks to end the 20-month conflict in the country.
Clement Lochio Lomornana has been targeted on a number of occasions in the previous months as a result of his work. Following complaints about his government’s record of press freedom, President Salva Kiir told journalists, “If anybody among [journalists] does not know that this country has killed people, we will demonstrate it one day, one time. … Freedom of the press does not mean you work against the country.”
In the months prior to his disappearance, Clement Lochio Lomornana had been subjected to a number of serious acts of intimidation and attempted attacks. He reported being followed in Juba on several occasions and he received death threats. After sharing his concerns with family and friends, the human rights defender decided to leave the country for a period of time. He went into hiding in Uganda and Kenya but he returned to South Sudan in early August.
On 6 August 2015, in the middle of the night, security forces arbitrarily detained Clement together with two of his friends, brothers Amin and Nailo Venansio. The officers took the three men from their huts in the village of Chukudum, Budi County, in the south of the country, and brought them to a military barracks. According to local sources, the officers tortured them in order to force them to confess to crimes they hadn’t committed. Amin and Nailo Venansio were allowed to receive visits from their family, while Clement Lochio Lomornana was not. It appears that Clement was the primary target and that Amin and Nailo were simply in the wrong place at the wrong time.
On August 15, Clement Lochio Lomornana and Nailo Venansio were reportedly last seen being forced into a military vehicle. Authorities in South Sudan have officially denied that they arrested them. Since then unconfirmed reports claim that Clement’s headless body was found along the Chukundum-Torit Road by members of his local Didinga community.
Region:Africa
Country:South Sudan
Department/Province/State:Namorunyang
Previous Threats:Yes
Type of Work:Journalist/communicator
Organisation:Gurtong Media
Sector or Type of Rights the HRD Worked On:Civil and Political Rights
Sector Detail:Abuse of power/corruption, Documenting rights in conflict, Freedom of Expression
Front Line Defenders
https://www.frontlinedefenders.org/en/case/case-history-clement-lochio-lomornana
https://medium.com/@aborcupakuer/peace-efforts-earn-bishop-paride-taban-top-un-award-5b29e22d879c
South Sudan News Agency
https://southsudannewsagency.org/index.php/2015/08/29/whereabouts-of-journalist-and-human-rights-defender-unknown/
The Nation Mirror
http://www.thenationmirror.com/news/south-sudan-news/1333-haula-community-demand-release-of-detained-journalist
|
cc/2021-04/en_middle_0071.json.gz/line3288
|
__label__wiki
| 0.840636
| 0.840636
|
Balally 3.09
Balally
About Balally
Balally is one of the popular place listed under City in Dublin , Train Station in Dublin ,
Contact Details & Working Hours
Yes ⇒
Balally, Dublin, Ireland, is a residential area at the southern end of Dundrum, Dublin between Dundrum village and the Sandyford Industrial Estate in Sandyford.Balally Parish itself reaches from Ardglas to the M50 motorway. It has 2 primary schools (St. Olaf's National School and Queen of Angels) and 2 secondary schools (St. Tiernan's and Wesley College). Balally is part of the conurbation of Greater Dublin, in the county of Dún Laoghaire–Rathdown. The area contains a Luas tram station, located near the southern entrance to the new Dundrum Town Centre.It was originally farmland and is located at the foot of the Wicklow Mountains. It consists of: Balally Drive, Balally Hill, Balally Grove, Balally Close, Balally Park, Balally Avenue & Balally Road, and Sandyford Road. It has been re-connected to Sandyford Road at Balally Hill after access was closed off due to cars cutting through the estate to beat the traffic congestion.NameThe area is named after Olaf, the first King of Viking Dublin, who is reputed to have built a fort in the locality. The place name Baile Mhic Amhlaoibh, meaning "the town of the son of Olaf" was anglicised as Balally.
Map of Balally
Enter an address to get driving directions
Reviews of Balally
Loading comments-box...
OTHER PLACES NEAR BALALLY
St. Olafs National School
3.38 Balally Drive
Bill O'Reilly Sewing Machines
1.63 129 Wedgewood Estate, off Sandyford Road, Dublin
Sandyford Road
County Monaghan
1.44 Unit 3, Dundrum Town Centre, Sandyford Road
Valerie Lawrence MIRI ITEC Mar
1.55 9 Balally
EXPLORE NEARBY BALALLY
Report Incorrect Data / Abuse
|
cc/2021-04/en_middle_0071.json.gz/line3292
|
__label__wiki
| 0.614532
| 0.614532
|
contact@igerent.com
US DollarEURGBP
Place your trademark order
Trademark Registration in Estonia
Trademark Search in Estonia
Determine the probabilities your trademark has of being successfully registered in Estonia
The price is for wordmarks only. If the trademark includes a figurative element (logo), an additional fee of 30 USD per class will apply.
+$80/Additional Class
All fees included
Trademark Application in Estonia
Apply to have your trademark registered in Estonia
Once the trademark is accepted, a final fee for registration will be due.
$510 FIRST CLASS + N/A/Additional Class All fees included
+$160/Additional Class
Choose the services you want in the next step
or Contact Us if you're not sure how to proceed
Free Consulting More information
No hidden charges See pricing policy
Worldwide services See list of countries
Expert Agents Learn more about us
Excellent client ratings See verified ratings
Why and how to register a trademark in Estonia
In Estonia, trademark registration is mandatory to be granted rights over a trademark, as it is a "first to file" jurisdiction. Only in some exceptional cases can an unregistered trademark be protected. The trademark applications must be filed with the Estonian Patent Office (EPA).
Estonia is also a member of the European Union, therefore European Union Trademarks (EUTM) are protected in this jurisdiction. It is also a member state to the Madrid Protocol. Thus, the extension of an international registration of a trademark via the Madrid System is possible for this country. For further information regarding our services for trademark filing through the Madrid System click here.
It is not necessary for a trademark to be in use in Estonia in order for it to register. However, prior use may be useful as it can help overcome an objection raised on the grounds of lack of distinctiveness, by proving that the trademark has acquired distinctiveness.
If you register a combined trademark (which includes both word elements and figurative elements) in Estonia, the exclusive right to use the trademark is limited to a use of the trademark in the exact configuration or way in which it was filed and registered. If you wish to use the word element of your trademark separately from the logo (or vice versa), it is recommended you register for another trademark including only the word or figurative elements you wish to use and protect separately.
Nevertheless, if a third party eventually intends to register or use a trademark for similar goods or services that includes a primary or distinct part or portion of your trademark, you will have the right to oppose the application based on confusing similarity.
Trademark oppositions in Estonia can be filed during the period of two months that follows the date of publication of the trademark application in the official bulletin. The probabilities of success for an opposition will vary in each case depending on the circumstances.
Although a trademark does not have to be in use in order for it to register, it must not go unused for periods of five years or it will become vulnerable to cancellation actions based on lack of use of the trademark. The amount of use must be on a commercial scale.
Registered trademarks in Estonia have a validity of ten (10) years from the registration date and can be renewed indefinitely for further periods of ten (10) years. The trademark renewal can be requested as early as twelve (12) months before the expiration date. It can also be requested during the grace period of six (6) months after expiration, upon payment of a late renewal fee.
What do our clients say about our services
Clients who already trust us
Trademark Registration Order
International Industrial Designs
click here for more reviews
Copyright @2020 iGERENT SM (iGERENT LLC.) All Rights Reserved.
Disclaimer: iGERENT provides access to independent attorneys and independent professionals based locally in the countries in which you require services. iGERENT is not a law firm or a substitute for an attorney or law firm.
|
cc/2021-04/en_middle_0071.json.gz/line3293
|
__label__cc
| 0.690381
| 0.309619
|
The Story's Story
Links: The cost of construction, writing really long fiction, computerized farms, and more!
March 15, 2019 By Jake Seliger in Links Tags: Links Leave a comment
* Why American Costs Are So High.
* “What’s Left of the Center-Left?” Depressing. Also depressing, Clinton-era centrist Democrat Brad DeLong explains why the center-left is dead.
* Charlie Stross: Lessons learned: writing really long fiction.
* “What if All the World’s Economic Woes Are Part of the Same Problem?“, and that problem is demographic: an aging workforce is less innovative, takes fewer risks, and is more sclerotic overall.
* “Leaked Documents Show the U.S. Tracking Journalists Through a Secret Database.” How is this the country we’ve ended up living in?
* “Why Do People Love to Hate Steven Pinker? By proclaiming the gospel of human progress, the Harvard psychologist has made a lot of enemies.” I see a lot of straw-manning Pinker and almost no steel-manning of him.
* “Progressivism and the West;” we are our own worst enemies!
* “This is Roquette Science: How computerized arugula (aka roquette) farms take over the world.”
* But at least one random writer thinks Biden will win, which sounds like a good, electable outcome to me.
* An essay against Taleb’s Antifragile.
* “The Industrial Revolution of Shame.” Does this enhance rewards to shamelessness?
* On the new translation of The Odyssey.
* Attraction Inequality and the Dating Economy.
* “US to build six nuclear power plants in India.” Total comedy given the seeming inability of the US to build nuclear power plants in the US.
« The college bribery scandal vs. Lambda School
Links: Free speech, free persons, smart is not enough, biking is fun, and more! »
My latest novel: THE HOOK
You should read my latest novel, THE HOOK.
In Anything You Want, Derek Sivers says: "The coolest people I meet are the ones who find me through something I've written." Reach me at seligerj@gmail.com.
Links: Where fantasy ends, public domain day, bicycle booming, and more!
Santa Monica requiem: Reflections as 2020 drifted into 2021
Links: Many deep dives
Links The evils of the non-compete clause, how COVID-19 spread, the nature of the future, and more!
Links: The nature of expression, the best books of 2020, the social reality, and more!
About Last Night
Paul Graham’s Essays
Grant Writing Confidential
Seliger + Associates
|
cc/2021-04/en_middle_0071.json.gz/line3300
|
__label__cc
| 0.541901
| 0.458099
|
LDP lawmaker under fire for Obama remarks; refuses to resign
Feb. 19, 2016 06:55 am JST Feb. 19, 2016 | 06:58 am JST
By MARI YAMAGUCHI
some14some
Feb. 19, 2016 07:23 am JST
The U.S. Embassy declined to comment.
speaks a lot...lawyer-tarento-lawmaker Maruyama will resign shortly.
I don't think this gaff is quite resign material.
Make politicians resign for pork barrel politicking and never attempting to make or change laws for the better.
voiceofokinawa
If men of such mentality swarmed in Tokyo's political circles, the Okinawa’s base issue, the Futenma issue in particular, would never be solved. Washington's Japan hands and so-called "pro-Japan experts" (親日派）may be making the best use of them to sway Japan's public opinion through such people who willingly identify themselves with the U.S.
I saw an ultra-rightists' sound truck on a Naha street several days ago with the Rising Sun and the Stars and Stripes hoisted in its front as usual.
sillygirl
Just ignorance about history. Poor guy, educated in the states apparently. The 51st state crap is just that, crap. Resign- worthy? Nah, just cringe-worthy.
Not the best way to articulate your point, however, I don't understand how this is an issue demanding resignation from either posts.
True Okinawa
Don't quit. Get over it....
A low-level politician makes an ignorant gaff, and there are immediate demands for his resignation. The Finance Minister is found fiddling finances, and he's given a week to investigate himself. And his boss doesn't want him to resign.
I don't understand. The smaller you are, the harder you fall?
AsianGaijinYesWeExist
He should resign. But not for commenting on Obama's ancestry, rather for entertaining the idea of Japan becoming a U.S. state.
Kurobune
I wonder if this character has been talking to The Donald ?
jpn_guy
I think the DPJ lawmakers are well out of line here. It's a factual error certainly, and Maruyama should be better informed. But to suggest it is insulting, as Yosuke Kamiyama does, is more insulting than the initial remark. If we are to take this as an 'insult' rather than a 'factual error' the only possible interpretation is that it is a source of shame to be 'tainted' by slave blood.
I am descended from slaves certainly (and slave owners possibly). My grandmother's grandfather was a slave freed in the 1800s. I'm not ashamed of it, quite the contrary. I am quite happy to talk about it in conversation, if it comes up. The reason I don't do so more often is more to do with discomfort on the part of the listener rather than personal embarrassment.
Kamiyama seems to be unable to distinguish between personally calling a black man going about his business a 'slave' and referring to slave ancestry. The former is obviously an insult as it is clearly incorrect, the latter could be positive or negative, factual or incorrect depending on the context. As Maruyama's emphasis seems to be "look how far the US has come, look what they've achieved", surely here we have a positive context combined with a factual error.
Much as I would vote DPJ rather than LDP, in think in this case the DPJ show a disturbing lack of nuance. There are plenty of better ways to criticize the LDP than this and the talk of resignation is ridiculous.
Maybe Mr. Kamiyama would like to resign for suggesting it is embarrassing to have slave ancestors - his is a far more damaging statement.
Ricky Kaminski
Muchadoabout nothing. DPJ needs to lift their game. Smells of desperation.
karlrb
Per Wikipedia, Obama's grandmother, on his mothers' side, 'may' have descended from a black slave. His mother, on the other hand, appears to have been an agnostic or atheist who graduated from my high school in 1961 in Mercer Island Washington. She was obviously quite an exceptional lady. (By the way, I am not an Obama fan.)
browny1
jpn-guy - good points. I agree.
However in the cauldron of politics the DPJ would be negligent not to pursue the hounding of Maruyama, if only to show that it is a consistent characteristic of LDP to often show an ill conceived amateurish face. Whether Maruyama had any discriminatory intent is besides the matter.
As the "slips" pile up expect to hear more from DPJ as the elections near. But indeed, they have to make sure their hands are squeaky clean, as the Jiminto scouts are hunting for Democrat dirt right now.
“Today, America has a black person as president. A person who inherits black people’s blood. Frankly speaking, they were slaves,” he said Wednesday,
No, that's not what he said. They have added way too much to this translation that was not part of what he actually said in Japanese. What he said in Japanese was:
アメリカは黒人が大統領になっている。 - America has a black president.
これは奴隷ですよ。- This is a slave.
Nothing about inheriting blood, nothing about 'frankly speaking'.
This is just sloppy reporting - someone needs to do some fact checking.
turbotsat
Strangerland: No, that's not what he said. They have added way too much to this translation that was not part of what he actually said in Japanese. What he said in Japanese was: アメリカは黒人が大統領になっている。 - America has a black president. これは奴隷ですよ。- This is a slave. Nothing about inheriting blood, nothing about 'frankly speaking'.
The quote various sources are reporting has a sentence in between the two you posted: 黒人の血を引くね。
Which Google translates as: I pull the black blood.
And at least, "黒人" = "black person", "の" = (a particle used variously, as in "of", "'s", etc.), "血" = "blood".
Strangerland: ... someone needs to do some fact checking.
Mmmm, yes. Someone does.
samwatters
Clunky but no racist intent. The point he was trying to make was that America has progressed a great deal in regards to race-relations. No reasonably-minded should have a problem with this.
You're right, some research shows I was wrong. I stand corrected.
Amended translation:
今、米国は黒人が大統領になっている。- Now, America has a black president.
黒人の血を引くね。- He has the blood of black people.
Blundering, hapless and ignorant.................depressingly attributes, traits and character flaws all present and correct in a majority of our political elite regardless of Country or Culture. It's the inane grin in the press photo I find particularly disturbing,
ghoneim mohamed
Its obvious DP is hunting mistakes to LDP,but it wont work. Once he apologized quickly,denying any bad intention,that would be fair enough.Calling for his resignation is ridiculous.Claiming,his announcement may harm Japan-American relations is really funny.U,S embassy declined to comment,but it seems DP is more royal than a king!!
rainyday
Feb. 19, 2016 12:19 pm JST
An ignorant and stupid comment from an ignorant and stupid lawmaker to be sure, but I`m not sold on the argument that this is the sort of thing that merits a resignation.
BNlightened
Could we also then claim this?: Since the Japanese people originally descended from races in North-East Asia, and only much later emigrated to these "Japanese" islands, wouldn't this idiot lawmaker's "descendants" presently also be rejected as candidates for high office like Prime Minister in modern contemporary Japanese politics? I think they would.
The Japanese would surely refuse the "humiliation" of having an "outsider" Asian lead their glorious country...what with the "unpure" blood this guy's ancestors had running through their veins and all!
I think the analogy does work, (and yes I'm trying to be ludicrous here), though I'm sure this fool would be VERY outraged to hear he comes from an "immigrant family" from "mainland Asia!" And seeing the quite dismal state of history taught in this country, I'm sure he has a crackpot historical text handy that "proves" his pure race descended from some God or Goddess or other such palpable pap!
@Strangerland
How come 'Amerika' became 'Beikoku'? I know they mean the same thing, but now I wonder what he actually said.
Having now seen the original Japanese supplied by Strangerland, I would have to amend my above view to say that the way Maruyama has expressed himself is very inelegant, as it comes dangerously close to saying black person=slave. In the context of praising changes in US society, I still don't think that is what he meant, but the an apology for clumsy wording would be in order. That said, I still don't think that suggesting someone has slave ancestry is an insult though, as to suggest so stigmatizes those that do.
What he said was factually incorrect, and politically incorrect, but the point he was making was one of hope, so I see no need to resign, and an apology should be limited to having been incorrect in his premise.
Good| Bad
AsianGaijinYesWeExistFeb. 19, 2016 - 01:04PM JST
@Strangerland N How come 'Amerika' became 'Beikoku'? I know they mean the same thing, but now I wonder what he actually said.
'Amerika' became ikoku'? I know they mean the same thingn
, but now I wonder what he actually said.
knji ME
He will bow out or Japan will pay a price some how!
Isn't anybody in Japan disturbed that one of their elected representatives is making this gaffe in the context of arguing that there is no problem with Japan becoming the 51st state of the USA?
What's the point of resigning when he's just going to get a position as a minister of something else? Japanese politics is like a game of musical chairs with the same number of chairs as people: POINTLESS
1glenn
As someone who voted for Obama, twice, I do not see the remark as insulting, either to the President or to the United States.
However, as pointed out in the article, his father is from Kenya, so it is unlikely that Pres. Obama is descended from slaves, although he is very possibly related to descendants of slaves.
Anyway, I do not see what the bid deal is. Here in the States we had a bunch of Old White Men in the opposition party state, even before Sen. Obama was sworn in as President, that they would not work with him, so the statement that an African-American could not have been elected earlier in our history is hardly shocking news. Much more shocking is the amount of racism still left in the world, and in this country.
Welcome back, toshiko !
I wonder why the recent negative votes on my post that simply quoted Wikipedia information about Obama's mothers' mother who 'may' have descended from a slave. This was not a judgment call, I was just presenting information that appeared to be reasonably valid. The LDP members comments were not being judged by me. I thought that people might like to know what the facts really are - this of course assumes that Wikipedia and Ancestry.com are not biased themselves.
hachikou
First I thought,... Why on earth did he talk about african american and slave? What's wrong with him?? THen I read his ALL remark, which makes sense.
He was not talking about African american nor slave. He was talking about hypothetical story about making Japan as 51st state of US. He was talking about, if so, the possibility of even Japanese descendent can be a President of the United states, because even afrcian american, once its race was slave, became President of United States. It was not racial quote, it is all about how great America and its ability to accept and adapt new things. I feel sorry for him. I don't understand why media doesn't talk about the whole context? Geeez...
"The remarks were made as he questioned experts about a revision to Japan’s constitution, which has never been amended since it was drafted by the United States during its post-World War II occupation. He noted there would be no problem if Japan becomes America’s “51st state” and that would allow people from “the state of Japan” to become U.S. president. Then he mentioned Obama."
This is far more lunatic than his comments about US history and Obama, which I truly don't think were meant to be racist but were just poorly said. Seems pretty obvious the opposition is just out for blood for any reason they can be.
Manny Pereira
I think he meant it as a complement and I'll take it as one.
Don't worry Japan, we Americans are not particularly thinned skinned.
Michelle Harrison
“Back at the beginning of U.S. history, it would have been unthinkable that a black person, a slave, would become president. That’s how dynamic a transformation this country makes.” This is not incorrect, nor racist to say so. I don't know this man or his values. But I do not take offence to what he said. You just need to turn on TV to listen to Donald Trump talk if you want to hear what racism sounds like.
Soufa King Madd
Hyperbole, yes it was. Gaffe, yes it was. But I cannot even tell what he is trying to say. More like a Palin than a Trump.
Simon Foston
The DPJ are making themselves look shrill, silly and ineffectual as usual. It's one thing to call him out over making the remarks, but calling for him to resign is a waste of time. He doesn't really have to and he won't. Other LDP members have said far more stupid things and it didn't do them any harm.
Fadamor
Good analogy. Rather than a Trump quote, which is ALWAYS designed to insult, this was more of a Palin quote, which is just a "blonde moment" quote.
Not really seeing where this requires a resignation. If he apologizes without the qualifiers then we should just move on with our lives.
He made an assumption. Do not assume, for when you assume you make an ASS out of U and ME.
Chances are that he's probably cringing about it and might consider resignation just to get out of the spotlight, but I don't believe that he should be forced out. As long as he doesn't make a habit of it!
It was a mistake. He apologized. His point was intended to be positive, however. I think resigning is way over the top.
The U.S. Embassy declined to comment
Embassy stuffs know brain of Japanese politician]?
They don't need to - they can still have a comment.
But they didn't make one, so it's irrelevant.
therougou
The Finance Minister is found fiddling finances, and he's given a week to investigate himself.
Not really. It was his aides that were found fiddling finances, so it made sense to take a week and investigate in that case.
It was his aides that were found fiddling finances, so it made sense to take a week and investigate in that case.
It would have made sense for the police to investigate, not for the minister and his aides to be given time to concoct a story and arrange a fall guy. In fact it was not found that 'his aides were fiddling finances': Amari himself admitted to receiving huge amounts of money and other gifts, of which he claimed an aide had personally spent (a mere) 3 million. And a time limit need not be put on any investigation; it should take as long as it takes.
Britain invites G-7 leaders to Cornish resort for June summit
New S Korean ambassador eyes political solutions to issues with Japan
Japan's envoy to Britain appointed as Supreme Court justice
|
cc/2021-04/en_middle_0071.json.gz/line3305
|
__label__wiki
| 0.938616
| 0.938616
|
Asia cracks down on virus ‘fake news’
Date: April 10, 2020 Author: Katie Forster Category: Uncategorized
← Fake cures, risky rumours: virus misinformation hits home
Domestic workers among few in Hong Kong to miss TikTok →
AFP investigation published April 10, 2020
Hundreds of people have been arrested across Asia for posting purported false coronavirus information, according to an AFP investigation, deepening concerns that growing government efforts to combat “fake news” will target the wrong people and silence dissent.
From teenagers to a TV star, people have been wrongly detained under vaguely worded cybercrime laws or broad state-of-emergency powers ushered in since the outbreak began, rights groups say.
“Governments are using the ‘fake news’ label to dress up their rights-abusing efforts to censor views and statements that are at odds with whatever strategy they have taken to deal with the COVID-19 crisis,” said Phil Robertson, Asia deputy director for Human Rights Watch (HRW).
“It’s insane frankly. In many cases it’s people being dragged out of their homes to the lock-up, put in pre-trial detention, in crowded spaces where they’re more likely to get COVID.”
At least 266 people have been arrested for posting coronavirus-related information in 10 Asian countries, from Thailand to India and Mongolia, according to an AFP tally based on police reports.
They include a local politician in India who claimed on Facebook that the government was downplaying virus fatalities, and a Malaysian TV personality made to pay a fine of several thousand US dollars after he posted a YouTube video criticising a hospital’s handling of the pandemic.
Authorities say criminalisation is needed to curb the online flood of dangerous fake cures and conspiracy theories that the World Health Organization has called an “infodemic”.
But HRW and other campaigners point to cases where opposition figures or journalists have been targeted — as well as questioning the fairness of arresting ordinary people who may not even realise they are spreading misinformation.
A middle-aged woman in Sri Lanka spent three days in custody this week after posting a prank message on Facebook saying the president had tested positive for COVID-19, police said.
In Cambodia, a Facebook pundit who posted a quote from Prime Minister Hun Sen was charged with incitement to commit felony and is facing up to two years in jail, according to a court warrant seen by AFP.
Officials say Hun Sen was joking when he told motorbike taxi drivers to sell their vehicles if they cannot make money in the pandemic.
– ‘Rumour mongering’ –
Cambodian authorities have also detained four opposition politicians, according to HRW, while a local rights group and police sources said a 14-year-old girl was among more than a dozen people arrested. She was released soon after questioning with no charges.
The surge in arrests in Asia focused on coronoavirus misinformation has come after various countries toughened laws or introduced new ones on so-called fake news.
“Regulating misinformation by either introducing new legislation or by expanding the scope of existing laws has been the trend in Asia for the last few years,” said Masato Kajimoto, a journalism researcher at the University of Hong Kong.
The pandemic has accelerated this because a crackdown can be perceived as protecting public health, rather than infringing on freedom of speech, he said.
In Thailand, a state-of-emergency decree passed in late March criminalised sharing misinformation online about COVID-19 that could “instigate fear”.
This is on top of the Computer Crimes Act, which has a five-year maximum jail penalty and is often used to stifle dissent online.
The Philippines also recently adopted an emergency law giving it more powers to combat the pandemic, including arresting people who share false information about the disease.
Nearly 100 people in India have been arrested for spreading virus misinformation under existing penal laws and the disaster management act — with punishments including up to one year in prison.
“While India lacks any specific fake news law, there do exist provisions of laws that can be used for ‘rumour mongering’,” said Apar Gupta, director of the Delhi-based Internet Freedom Foundation.
“It is fair to state that these laws are broadly phrased and can result in arbitrary action, given India’s slow judicial system that also generally displays a prosecutorial bias,” he said.
Karuna Nandy, an Indian Supreme Court lawyer, told AFP that such arrests were particularly alarming in a lockdown, when courts are mostly shut.
– Hoax confusion –
In Singapore, an anti-government website was blocked earlier this year under the city-state’s controversial and sweeping new anti-misinformation law, passed in October.
Authorities accused the States Times Review of circulating falsehoods including about the coronavirus outbreak.
Police in neighbouring Indonesia have made more than 80 arrests under the country’s strict electronic information law since the outbreak began. The maximum penalty is five years in jail.
They include individuals accused of attacking the government and its response to the outbreak, and multiple people who shared claims that a Muslim woman had died suddenly from COVID-19 at Jakarta’s international airport.
Damar Juniarto, from digital rights group SAFEnet, said Indonesian law gives “no clear definition” of a hoax, which can be spread by accident.
“The source of the problem is that there is no information leadership from the government,” said Juniarto. Indonesia’s doctors association has warned that the crisis there is worse than officially reported.
HRW’s Robertson echoed this sentiment. “People should not be criminalised for saying what they think online. It’s up to the governments to provide effective information”.
|
cc/2021-04/en_middle_0071.json.gz/line3307
|
__label__wiki
| 0.656389
| 0.656389
|
Business News Archives for 2017-09
First Positive September since 2013
Posted: 2017-09-29 09:23:00 by Northwest Quadrant Wealth Management
Wall Street looks to post its first positive September since 2013. On the final trading day of the month and the quarter, the Dow, S&P 500, and Nasdaq look to post a third straight week of gains. The S&P 500 is at a record high. (CNBC)
The shuttered Hynix memory chip factory in Eugene sold at auction for $12.75 million. The buyer was not identified. Hynix spent $1.5 billion to build and the 1.2 million sq. ft. factory in 1998. It employed 1,400 people. (Oregonian)
Mortgage Bankers Association says mortgage application volume fell 0.5% last week and is now 21.5% lower than a year ago. Applications to refinance fell 4%for the week and are 36% lower than a year ago. The average 30-year fixed-rate mortgage stands at 4.11%.
Small caps and micro caps had big days Wednesday on the release of potential tax reform. The Russell 2000 Index gained 1.9% and closed at a new high for the fourth day in a row. In the process, it outperformed the S&P 500 by 1.5%, which was the largest one-day outperformance since November 2016. Micro caps did even better, as the Russell Microcap Index closed at its seventh all-time high over the past eight days and gained 2.2% for its largest one-day spike since November 2016.
With Northwest Quadrant Wealth Management, a Registered Investment Advisor I am Troy Reinhart.
The Least Volatile September Ever?
This month has been calm by historical standards, which is similar to what we've been seeing all year in 2017. The average daily intraday closing range on the S&P 500 (from high to low) has been less than 0.4%. Should this average hold over the next couple days, it would be the least volatile September on record; however, it is important to remember that October has historically been the most volatile month. (LPL Research)
Crude is in a bull market. It is official, earlier this week WTI crude oil moved into a bull market - up 20% from the summer lows. Increased optimism over global supply and demand has sparked much of the rally. This has helped energy stocks, which in turn has helped value stocks outperform growth so far in September. The International Energy Agency said global demand growth was very strong in Q2, up 2.4% year over year. (LPL Research)
The Commerce Department says new orders for capital goods increased 0.9%, more than expected, in August. Orders for machinery rose 0.3%. Overall orders for durable goods surged 1.7% as bookings for transportation equipment jumped 4.9%.
With Northwest Quadrant Wealth Management, a
Registered Investment Advisor I am Troy Reinhart.
Nike had it's Slowest Quarterly Sales Growth
The S&P CoreLogic Case-Shiller U.S. National Home Price reported a 5.9% annual gain through July. Seattle, Portland, and Las Vegas reported the highest year-over-year gains. Seattle led the way with a 13.5% year-over-year price increase, followed by Portland with a 7.6% increase, and Las Vegas with a 7.4% increase. The National Index posted a month-over-month gain of 0.7% in July.
The Conference Board Consumer Confidence Index, which had improved marginally in August, declined slightly in September. The Index now stands at 119.8, down from 120.4 in August. The Present Situation Index decreased from 148.4 to 146.1, while the Expectations Index rose marginally from 101.7 last month to 102.2.
Nike had its slowest quarterly sales growth in nearly seven years as competition intensified by Adidas. Beaverton, Oregon-based Nike also said it expects its second-quarter revenue to grow in the low single-digit percentage range. Nike's gross margins fell 1.8%, while inventory was up 6%. Revenue from North America, the company's largest revenue contributor, fell 3% percent - its first decline in more than 10 quarters. Total revenue rose marginally to $9.07 billion, while Nike said it earned 57 cents per share. (Reuters)
Welders at Precision Castparts
Stocks are higher this morning following yesterday's tech-driven drop. The Nasdaq is coming off its biggest one-day decline since August 17th, even as the small-cap Russell 2000 posted a record closing high. The Dow is riding a three-day losing streak, and a decline today would give it its first four-day decline since late June. (CNBC)
Highlighting this week's calendar, a more detailed tax framework will be released by the Big Six (key Republican tax policy players), and details are already trickling out. The path to an agreement was always going to be difficult, but we have seen nothing so far that suggests a deal cannot be reached. The biggest stumbling block remains getting a 2018 budget deal done, without which tax law changes become virtually impossible. (LPL Research)
Welders at Precision Castparts in the Portland have voted to join the International Association of Machinists and Aerospace Workers. The vote impacts about 100 employees. 54 voted to join the union, and 38 voted against. (OregonLive)
Nestle set an operating profit margin target of 18.5% by 2020 and also will speed up stock buybacks. The company has been under pressure from activist investor Third Point to improve its performance. (FT)
Striking a Blow for Consumer Choice
General Electric has sold its Industrial Solutions unit to Swiss power grid maker ABB for $2.6 billion. (AP)
Striking a blow for consumer choice, General Mills, the producer of the multi-colored cereal Trix, will be bringing back the original, artificially-colored version after customers complained. "Classic Trix," which is colored artificially, will sit on store shelves alongside the new, natural-flavor version. (CNBC)
Walmart is testing a service to deliver groceries straight to customers' refrigerators. It is partnering with August Home, a provider of smart locks and smart home accessories, to test the service. The delivery person would get access to the customer's house using a pre-authorized one-time passcode and would put away groceries. (Reuters)
According to a Bloomberg Shake Shack, Chipotle, and Wingstop will be added to Amazon.com's delivery service through its partnership with mobile ordering and pay platform Olo.
Check our blog at www.FinancialFocusRadio.com .
Walgreens Approved To Buy Rite Aid
Walgreens has approval to buy Rite Aid. They will buy 1,932 Rite Aid stores for $4.38 billion. With the addition of the Rite Aid stores, Walgreens will have about 10,000 locations in the U.S.. Integration will begin in October and be completed in the spring of 2018. The remaining 1,200 Rite Aid stores will go to another buyer. (OregonLive)
The National Association of Realtors said existing home sales fell 1.7% in August. That is the fourth decline in five months. To blame is a lack of available homes to buy. The median existing-home price in August was $253,500, up 5.6%. Total housing inventory in August declined 2.1% and is 6.5% lower than a year ago.
Supermarket chain Albertsons, is buying meal-kit delivery service Plated. Financial terms of the deal were not disclosed. Albertsons says Plated meal kits will be offered at its stores, online, and through other distribution options. (Reuters)
The index of leading economic indicators increased 0.4% in August, more-than-expected. The index projects the economy in 6 to 12 months. It tracks 10 components, including manufacturers' new orders, stock prices and average weekly initial claims for unemployment insurance. (CNBC)
The S&P 500 is down 2 and the NASDAQ is down 14. The MSCI international index is lower.
Oil is down 12 cents at $50.43 a barrel.
Gold is up $4 at $1298 a Troy ounce.
Amazon Will Open New Fulfillment Ctr
Amazon will open another fulfillment center in North Portland in 2018, creating 1,000 full-time jobs. That is in addition to the opening of fulfillment centers in Troutdale and Salem next year along with another 2,500 jobs. The Portland facility will be 918,400-square-feet. (OregonLive)
NORPAC Foods officially notified Oregon employment officials the company will close its Hermiston Foods plant in November and eliminate 199 jobs. The closure is tied to NORPAC's decision to sell its canning operations to Seneca Foods. (OBN)
Last week, the bull market that started in March 2009 moved ahead of the bull market from 1949 to 1956 to officially make it the second largest bull market gain since World War II. The current gain of 270% is second only to the 417% gain seen during the bull market of the 1990s. (LPL Research)
Communications chipmaker Qorvo, the combination in 2015 of Hillsboro-based TriQuint Semiconductor and North Carolina, RF Micro Devices, plans to eliminate an unspecified number of jobs. Qorvo's employs about 1,000 at a factory and administrative office in Hillsboro. Qorvo did not specify when the cuts will take place, or how large they will be. (Oregon Live)
The S&P 500 is down 2 and the NASDAQ is down 4. The MSCI international index is higher.
Gold is down $21 at $1296 a Troy ounce.
Gun Stocks Rose Tuesday
Toys 'R' Us, has filed for Chapter 11 bankruptcy protection. They have 1,600 stores and 64,000 employees. Stores and online sites remain open. The company has debt from a $6.6 billion buyout in 2005 by private equity firms. It's the second-largest retail bankruptcy, trailing the filing in 2002 by Kmart. (Reuters)
The Commerce Department says housing starts slipped 0.8% in August. Single-family home permits fell 1.5%, while permits for the construction of multi-family homes soared 19.6%.
The Labor Department says import prices rose 0.6% in August. In the last 12 months import prices have surged 2.1%. The report also showed export prices rose 0.6% in August. They have increased 2.3% year-on-year.
FedEx will raise shipping rates in January. FedEx Express, Ground and Home Delivery will go up about 5%. The One Rate shipping, which offers a simple flat price, will increase 3.5% (CNBC)
Gun stocks rose yesterday as President Trump prepares to ease rules for overseas sales of US guns. Strum Ruger stock was up 13% and American Outdoors was up 10%. (Yahoo Finance)
The S&P 500 is up 1 and the NASDAQ is flat. The MSCI international index is higher.
Oil is up 57 cents at $50.05 a barrel.
The S&P 500 Five New Highs
The Fed's policy making arm, the FOMC, will starts its sixth of eight meetings today. We do not expect a rate hike, but do expect to see the Fed announce the start of its balance sheet normalization program. Markets will be parsing the Fed statement, economic projections, and press conference comments for any sign of a shift in the Fed's inflation expectations and what that could mean for the future path of rate hikes. (LPL Research)
The Dow closed at a new high five consecutive days and was higher seven days in a row. Incredibly, the Dow had a 9-day new-high streak in July and August, and a 12-day new-high streak in February. The S&P 500, meanwhile, made new highs five of the past six days. (LPL Research)
The mining equipment market will grow next year boosting Caterpillar's business, according to UBS. Caterpillar stock is up 33% year to date.
The Wall Street Journal reports the damage from hurricanes Harvey and Irma stands to hinder US economic growth as August saw a 0.9% drop in industrial production and a 0.2% decline in spending at retailers. Americans’ perceptions of the economy which was highest before the storms since 2000 and are now 1.5% lower, according to the University of Michigan.
Gold is flat at $1311 a Troy ounce.
98 Days Until Christmas
98 days till Christmas and Macy's will increase by 20% the number of workers it hires during the holiday shopping season to fill online orders. They will hire 18,000 holiday workers to fulfill online orders, an increase of about 3,000 from last year. Total hiring for the holiday season will be 83,000 workers. Target said it will hire 43% more seasonal workers, or a total of 100,000, for the holiday season. Staffing firm Radial expects retailers, to hire 35% more workers this holiday season.
The Commerce Department says retail sales fell in August by 0.2%. The hurricanes put the brakes on shoppers as motor vehicle sales tumbled 1.6%. Consumer spending accounts for more than two-thirds of U.S. economic activity and has increased at a 3.3% rate through the second quarter. Sales at building material stores fell 0.5%, receipts at service stations increased 2.5%, sales at electronics and appliance stores fell 0.7% and receipts at clothing stores dropped 1.0%.
People are cutting the cord at a faster rate according to eMarketer. There will be 22.2 million cord cutters this year. That is up more than 33% over 2016. As a result, TV ad spend expectations for 2017 are expected to expand by only 0.5% to $71.65 billion.
The S&P 500 is up 4 and the NASDAQ is up 10. The MSCI international index is higher.
Oil is down 30cents at $49.59 a barrel.
Gold is down $9 at $1316 a Troy ounce.
Consumer Prices Rose
The Labor Department says consumer prices rose 0.4% in August. These gains are the largest in seven months and CPI is up 1.9% year-on-year. Gasoline prices surged 6.3%, the biggest gain since January. Food prices rose 0.1% and the cost of rental accommodation surged 0.4%. .
The Census Bureau says Oregon's median household income is $59,135. Oregon's poverty rate is 13.3%.
President Donald Trump has blocked the $1.3 billion sale of Lattice Semiconductor to Chinese investors over national security concerns. Founded in Oregon 34 years ago by veterans of Tektronix and Intel, Lattice makes a class of programmable computer chip used in consumer gadgets and industrial and networking equipment. (OregonLive)
Chinese economic data was weaker than expected. Retail sales were up 10.1% (year-over-year); while industrial production grew at 6%, both less than expectations and previous data. (LPL Research)
Join us this weekend for Financial Focus Radio, the truth in wealth building, when we will talk about if inflation is about to take off.
Record Closing Highs
It was record closing highs for the Dow, S&P 500, and Nasdaq yesterday as the session marked the first time all three have closed at record highs on the same day since July 26th.
The Census Bureau reports middle-class income hit a record level in 2016. Median household income was $59,039, surpassing the previous record of $58,655 set in 1999. The poverty rate fell to 12.7%. Lowest since 2007.
Major events such as hurricanes have both human and economic impacts. Reinsurers lost almost 2% in market cap last week and gained almost all that back this week. It appears that economic growth in the third quarter could see a hit of -0.5% to -1.0% to GDP, bringing growth down to ~2.0%, due to storm damage. The rebuilding process, though, will last for some time, boosting output by a similar magnitude in ensuing quarters. Material, energy, and home improvement retailers are among those poised to potentially benefit. (LPL Research)
It is not just the big boys that have security worries. Bright Wood, Jefferson County’s biggest employer, has notified its 915 workers of a security breach. Names, birthdates, addresses and Social Security numbers may have been compromised. (KTVZ)
52 Weeks in a Row...
...without a big weekly decline. The S&P 500 has now gone 52 straight weeks without closing lower by at least 2%. This is the longest such streak since 61 weeks in a row that ended in late 1995. The longest ever was 90 consecutive weeks ending in December 1958. (LPL Research)
Busy week of economic data ahead. Small business optimism, labor market turnover, inflation, industrial production, and retail sales. Overseas, a plethora of Chinese data is due out, including inflation, retail sales, industrial production, money supply, and new loan growth. (LPL Research)
The National Federation of Independent Business reported its small business optimism index for August rose 0.1% to 105.3, matching the year-to-date high posted in January. Some 28% of small business owners reported raising employees' pay in the past three months. Only 15% of small business owners are planning to raise wages in the next three months. Business owners said their single most important problem is taxes (20%), followed by quality of labor (19%). Government regulations and red tape (16%) and cost/availability of insurance (11%) were the third and fourth most-cited problems.
Market Leadership Continues to Shift
When I was a kid it was the go to place, but the Salishan Spa & Golf Resort on the Oregon Coast is up for auction. The minimum starting bid is $5.25 million. The resort underwent a $7 million remake over the past two years. The property is currently bank-owned. Built in 1965 Salishan sold in 1996 for $25.3 million and sold again in 2003 for $13 million. (PBJ)
Market leadership continues to shift as the healthcare sector hit new absolute and relative highs versus the S&P 500 Index. Biotechnology stocks are at their highest levels in over two years and small cap healthcare stocks are also working well for investors, which is one of the lone groups supporting small caps. (LPL Research)
Panasonic is eliminating 92 jobs as it closes its Salem solar energy operations. Layoffs will begin on November 4th. Panasonic bought the factory from Sanyo in 2012. Domestic solar producers have struggled to compete against less expensive Chinese imports. (Oregon Live)
The chairman of the House Ways and Means Committee, is floating the idea to provide relief for those suffering from the hurricanes by allowing affected residents to access their 401(k) retirement savings without paying a penalty, but pay taxes. Bad idea. (CNBC)
10 months without a 3% Correction
The Labor Department says worker productivity rose at a 1.5% annualized rate in the second quarter. Compared to the second quarter of 2016, productivity increased at a 1.3% rate. That is the strongest performance in two years.
Wage growth has remained sluggish even as the labor market nears full employment as unit labor costs fell at a 0.2% rate.
CNBC is reporting Toys R Us has hired a law firm to help restructure its roughly $400 million in debt due in 2018, a move that could include the marquee toy store filing for bankruptcy protection.
Yesterday officially marked 10 consecutive months without so much as a 3% correction for the S&P 500. Dating back to 1928, this is now the second longest streak ever without a 3% correction, bested only by 11 months in the mid-1990s. (LPL Research)
American Outdoor Brands, the former Smith and Wesson saw a sharp drop in quarterly earnings and sales, and lowered its fiscal 2018 guidance, as the firearms business slows. (CNBC)
Join us this weekend for Financial Focus Radio when we will give you the truth in wealth building.
Just 109 Days 'til Christmas
Portland-based helicopter operator Erickson has named Doug Kitani as their new CEO. Kitani is a West Point graduate who has worked in the defense contractor and aerospace industry for the past 14 years. For the past three years, he was CEO at IAP Worldwide Services. (Oregon Live)
Frozen concentrated orange juice futures are spiking higher as Hurricane Irma approaches Florida. In 2017 Florida was expected to produce more than half of the U.S. oranges and nearly half of the nation’s grapefruit. (CNBC)
Just 109 days till Christmas and Wal-Mart has started its holiday layaway plan. The program allows customers to put as little as $10 down to hold items with a minimum sales price of $50. (CNBC)
Nike has informed the State of Oregon it is terminating 490 workers. The reductions, all non-union workers, will take place by September 30th. Nike employs more than 70,000 workers world-wide and over 12,000 in Oregon. (PBJ)
Summer vacation is over...
...and traders are back at their desks. The S&P 500 closed higher by 0.6% in August to mark its fifth consecutive monthly gain. The Dow has also gained five months in a row, while the Nasdaq has been higher nine of the past 10 months. On a total return basis, including dividends, the S&P 500 gained for the tenth consecutive month. That is the longest streak since 10 in a row in 1995. (LPL Research)
Apple is getting closer to the $1 trillion valuation mark. Shares of the iPhone maker hit another all-time high last week. At about $163, they are just $30 a share away from making Apple the first U.S. company to cross the $1 trillion threshold in terms of market capitalization. (CNBC)
Costco saw a 6.1% increase in U.S. same-store sales, excluding gasoline, for August, topping the 3.7% percent consensus estimate. (Reuters)
A sign of the digital age. As the human attention span shortens, so do the efforts to capture it. For NFL games on FOX this season, the network will debut six-second commercials. They'll be used along with the more traditional 15-second and 30-second spots. (NBC Sports)
Flir Systems Says They're Reorganizing
The Department of Labor says the US economy added 156,000 new jobs in August, 165,000 in the private sector and government cut 9,000 jobs. The unemployment rate was up to 4.4%.
Reuters and Bloomberg report Oregon’s largest tech company, Lattice Semiconductor, is making a direct appeal to President Trump to salvage its sale to Chinese firm Canyon Bridge Capital Partners. The company, backed by the Chinese government, has made an offer for Lattice of $1.3 billion, or $8.30 a share.
Wilsonville based Flir Systems, says their new CEO is reorganizing. Flir COO Tom Surran will resign effective September 30th. Flir is a manufacturer of night-vision and thermal imaging cameras. Flir reported $1.66 billion in revenue last year, and profits of $167 million.
The Commerce Department said U.S. consumer spending rose 0.3% in July and inflation increased at a 1.4% annualized rate, its slowest pace since late 2015.
Personal income increased 0.4% last month. Wages and salaries advanced 0.5%.
Join us this weekend for Financial Focus Radio when we will talk about – is it better after 50?
2021-01 | 2020-12 | 2020-11 | 2020-10 | 2020-09 | 2020-08 | 2020-07 | 2020-06 | 2020-05 | 2020-04 | 2020-03 | 2020-02 | 2020-01 | 2019-12 | 2019-11 | 2019-10 | 2019-09 | 2019-08 | 2019-07 | 2019-06 | 2019-05 | 2019-04 | 2019-03 | 2019-02 | 2019-01 | 2018-12 | 2018-11 | 2018-10 | 2018-09 | 2018-08 | 2018-07 | 2018-06 | 2018-05 | 2018-04 | 2018-03 | 2018-02 | 2018-01 | 2017-12 | 2017-11 | 2017-10 | 2017-09 | 2017-08 | 2017-07 | 2017-06 | 2017-05 | 2017-04 | 2017-03 | 2017-02 | 2017-01 | 2016-12 | 2016-11 | 2016-10 | 2016-09 | 2016-08 | 2016-07 | 2016-06 | 2016-05 | 2016-04 | 2016-03 | 2016-02 | 2016-01 | 2015-12 | 2015-11 | 2015-10 | 2015-09 | 2015-08 | 2015-07 | 2015-06 | 2015-05 | 2015-04 | 2015-03 | 2015-02 | 2015-01 | 2014-12 | 2014-11 | 2014-10 | 2014-09 | 2014-08 | 2014-07 | 2014-06 | 2014-05 | 2014-04 | 2014-03 | 2014-02 | 2014-01 | 2013-12 | 2013-11 | 2013-10 | 2013-09 | 2013-05 | 2013-04
|
cc/2021-04/en_middle_0071.json.gz/line3308
|
__label__wiki
| 0.81071
| 0.81071
|
Row templates allow you to display custom content in grid rows. In this demo, a row template adds employee images and extra information to regular grid rows.
To configure a row template, use the rowTemplate option (rowRender in React). Define row markup in a <tbody> element with the dx-row class.
You should disable or implement certain DataGrid features to use row templates. Refer to the rowTemplate article for details.
<dx-data-grid id="gridContainer" [dataSource]="employees" [columnAutoWidth]="true" [showBorders]="true" rowTemplate="rowTemplateName"> <dxi-column caption="Photo" [width]="100" [allowFiltering]="false" [allowSorting]="false"></dxi-column> <dxi-column dataField="Prefix" [width]="70" caption="Title"></dxi-column> <dxi-column dataField="FirstName"></dxi-column> <dxi-column dataField="LastName"></dxi-column> <dxi-column dataField="Position"></dxi-column> <dxi-column dataField="BirthDate" dataType="date"></dxi-column> <dxi-column dataField="HireDate" dataType="date"></dxi-column> <tbody class="employee dx-row" [ngClass]="{'dx-row-alt': employee.rowIndex % 2}" *dxTemplate="let employee of 'rowTemplateName'" > <tr class="main-row"> <td rowspan="2"><img [src]="employee.data.Picture"/></td> <td>{{employee.data.Prefix}}</td> <td>{{employee.data.FirstName}}</td> <td>{{employee.data.LastName}}</td> <td>{{employee.data.Position}}</td> <td>{{employee.data.BirthDate | date: "M/d/yyyy"}}</td> <td>{{employee.data.HireDate | date: "M/d/yyyy"}}</td> </tr> <tr class="notes-row"> <td colspan="6"><div>{{employee.data.Notes}}</div></td> </tr> </tbody> </dx-data-grid>
import { NgModule, Component, enableProdMode } from '@angular/core'; import { BrowserModule } from '@angular/platform-browser'; import { platformBrowserDynamic } from '@angular/platform-browser-dynamic'; import { DxDataGridModule, DxTemplateModule } from 'devextreme-angular'; import { Service, Employee } from './app.service'; if(!/localhost/.test(document.location.host)) { enableProdMode(); } @Component({ selector: 'demo-app', templateUrl: 'app/app.component.html', styleUrls: ['app/app.component.css'], providers: [Service] }) export class AppComponent { employees: Employee[]; constructor(service: Service) { this.employees = service.getEmployees(); } } @NgModule({ imports: [ BrowserModule, DxDataGridModule, DxTemplateModule ], declarations: [AppComponent], bootstrap: [AppComponent] }) export class AppModule { } platformBrowserDynamic().bootstrapModule(AppModule);
::ng-deep #gridContainer { height: 450px; } ::ng-deep .dx-row img { height: 100px; } ::ng-deep #gridContainer tr.main-row td:not(:first-child) { height: 21px; } ::ng-deep #gridContainer tr.notes-row { white-space: normal; vertical-align: top; } ::ng-deep #gridContainer tr.notes-row td { height: 70px; color: #999; } ::ng-deep .dark #gridContainer tr.notes-row td { color: #777; } ::ng-deep #gridContainer tbody.employee:hover { background-color: #EBEBEB; } ::ng-deep .dark #gridContainer tbody.employee:hover { background-color: #484848; } ::ng-deep #gridContainer tbody.employee:hover tr.main-row td { color: #000; } ::ng-deep .dark #gridContainer tbody.employee:hover tr.main-row td { color: #CCC; } ::ng-deep #gridContainer tbody.employee:hover tr.notes-row td { color: #888; }
import { Injectable } from '@angular/core'; export class Employee { ID: number; FirstName: string; LastName: string; Prefix: string; Position: string; Picture: string; BirthDate: string; HireDate: string; Notes: string; Address: string; } let employees: Employee[] = [{ "ID": 1, "FirstName": "John", "LastName": "Heart", "Prefix": "Mr.", "Position": "CEO", "Picture": "../../../../images/employees/01.png", "BirthDate": "1964/03/16", "HireDate": "1995/01/15", "Notes": "John has been in the Audio/Video industry since 1990. He has led DevAv as its CEO since 2003. When not working hard as the CEO, John loves to golf and bowl. He once bowled a perfect game of 300.", "Address": "351 S Hill St." }, { "ID": 2, "FirstName": "Olivia", "LastName": "Peyton", "Prefix": "Mrs.", "Position": "Sales Assistant", "Picture": "../../../../images/employees/09.png", "BirthDate": "1981/06/03", "HireDate": "2012/05/14", "Notes": "Olivia loves to sell. She has been selling DevAV products since 2012. Olivia was homecoming queen in high school. She is expecting her first child in 6 months. Good Luck Olivia.", "Address": "807 W Paseo Del Mar" }, { "ID": 3, "FirstName": "Robert", "LastName": "Reagan", "Prefix": "Mr.", "Position": "CMO", "Picture": "../../../../images/employees/03.png", "BirthDate": "1974/09/07", "HireDate": "2002/11/08", "Notes": "Robert was recently voted the CMO of the year by CMO Magazine. He is a proud member of the DevAV Management Team. Robert is a championship BBQ chef, so when you get the chance ask him for his secret recipe.", "Address": "4 Westmoreland Pl." }, { "ID": 4, "FirstName": "Greta", "LastName": "Sims", "Prefix": "Ms.", "Position": "HR Manager", "Picture": "../../../../images/employees/04.png", "BirthDate": "1977/11/22", "HireDate": "1998/04/23", "Notes": "Greta has been DevAV's HR Manager since 2003. She joined DevAV from Sonee Corp. Greta is currently training for the NYC marathon. Her best marathon time is 4 hours. Go Greta.", "Address": "1700 S Grandview Dr." }, { "ID": 5, "FirstName": "Brett", "LastName": "Wade", "Prefix": "Mr.", "Position": "IT Manager", "Picture": "../../../../images/employees/05.png", "BirthDate": "1968/12/01", "HireDate": "2009/03/06", "Notes": "Brett came to DevAv from Microsoft and has led our IT department since 2012. When he is not working hard for DevAV, he coaches Little League (he was a high school pitcher).", "Address": "1120 Old Mill Rd." }, { "ID": 6, "FirstName": "Sandra", "LastName": "Johnson", "Prefix": "Mrs.", "Position": "Controller", "Picture": "../../../../images/employees/06.png", "BirthDate": "1974/11/15", "HireDate": "2005/05/11", "Notes": "Sandra is a CPA and has been our controller since 2008. She loves to interact with staff so if you've not met her, be certain to say hi. Sandra has 2 daughters both of whom are accomplished gymnasts.", "Address": "4600 N Virginia Rd." }, { "ID": 7, "FirstName": "Kevin", "LastName": "Carter", "Prefix": "Mr.", "Position": "Shipping Manager", "Picture": "../../../../images/employees/07.png", "BirthDate": "1978/01/09", "HireDate": "2009/08/11", "Notes": "Kevin is our hard-working shipping manager and has been helping that department work like clockwork for 18 months. When not in the office, he is usually on the basketball court playing pick-up games.", "Address": "424 N Main St." }, { "ID": 8, "FirstName": "Cynthia", "LastName": "Stanwick", "Prefix": "Ms.", "Position": "HR Assistant", "Picture": "../../../../images/employees/08.png", "BirthDate": "1985/06/05", "HireDate": "2008/03/24", "Notes": "Cindy joined us in 2008 and has been in the HR department for 2 years. She was recently awarded employee of the month. Way to go Cindy!", "Address": "2211 Bonita Dr." }, { "ID": 9, "FirstName": "Kent", "LastName": "Samuelson", "Prefix": "Dr.", "Position": "Ombudsman", "Picture": "../../../../images/employees/02.png", "BirthDate": "1972/09/11", "HireDate": "2009/04/22", "Notes": "As our ombudsman, Kent is on the front-lines solving customer problems and helping our partners address issues out in the field. He is a classically trained musician and is a member of the Chamber Orchestra.", "Address": "12100 Mora Dr" }]; @Injectable() export class Service { getEmployees() { return employees; } }
|
cc/2021-04/en_middle_0071.json.gz/line3310
|
__label__cc
| 0.512834
| 0.487166
|
JVI Classic Spotlights
About JVI
Vaccines and Antiviral Agents
T Cells Engineered with a Cytomegalovirus-Specific Chimeric Immunoreceptor
Florian Full, Manfred Lehner, Veronika Thonn, Gabriel Goetz, Brigitte Scholz, Kerstin B. Kaufmann, Michael Mach, Hinrich Abken, Wolfgang Holter, Armin Ensser
Florian Full
1Virologisches Institut
Manfred Lehner
2Abteilung Zelltherapie der Klinik für Kinder und Jugendliche, Universitätsklinikum Erlangen, Erlangen, Germany
Veronika Thonn
Gabriel Goetz
Brigitte Scholz
Kerstin B. Kaufmann
Michael Mach
Hinrich Abken
3Zentrum für Molekulare Medizin Köln und Tumorgenetik, Klinik I für Innere Medizin, Universitätsklinikum Köln, Cologne, Germany
Wolfgang Holter
Armin Ensser
For correspondence: armin.ensser@viro.med.uni-erlangen.de
DOI: 10.1128/JVI.02117-09
Cytomegalovirus (CMV) infection in patients receiving hematopoietic stem cell transplants (HSCT) is associated with morbidity and mortality. Adoptive T cell immunotherapy has been used to treat viral reactivation but is hardly feasible in high-risk constellations of CMV-positive HSCT patients and CMV-negative stem cell donors. We endowed human effector T cells with a chimeric immunoreceptor (cIR) directed against CMV glycoprotein B. These cIR-engineered primary T cells mediated antiviral effector functions such as cytokine production and cytolysis. This first description of cIR-redirected CMV-specific T cells opens up a new perspective for HLA-independent immunotherapy of CMV infection in high-risk patients.
Primary infection by human cytomegalovirus (CMV) and reactivation of latent virus are major problems after hematopoietic stem cell transplantation (HSCT), resulting in inflammation of a wide range of organs, systemic disease, and an increased rate of graft-versus-host disease (GvHD) (3, 5, 21). Antiviral chemotherapy with nucleoside analogs is used prophylactically and preemptively in the early phase after transplantation, but long-term treatment is often associated with toxicity, selection of resistant virus variants, and the inability to prevent all CMV-associated complications (4, 7, 28). Sustained control of latent CMV infection depends on the restoration of a functional antiviral immune response (15, 25).
Adoptive T cell transfer has been used successfully to bridge the critical phase of delayed or insufficient antiviral response in patients with immune suppression. In CMV and Epstein-Barr virus (EBV) infection, the adoptive transfer of ex vivo-expanded, donor-derived, virus-specific T cells reduced virus titers in the recipient to levels similar to those in immunocompetent, healthy, seropositive controls (10, 23, 29, 31). Ex vivo expansion of these cells can be carried out by different procedures (9). In naïve seronegative persons, however, virus-specific T cells occur at very low frequencies, generally insufficient for expansion.
As an alternative, T cells can be grafted with defined specificities using recombinant immunoreceptors (11). The receptor specificity is determined by extracellular single-chain fragments of the variable region (scFv) that recognize predefined antigens and can easily be altered by selecting an appropriate scFv (16). Recombinant immunoreceptors have been successfully developed against a number of tumor antigens (16) but against only a few viral proteins from HIV and hepatitis B virus (6, 20, 22) and not against CMV.
In human CMV infection, the analysis of the physiological cytotoxic T lymphocyte (CTL) response has been focused on a limited set of proteins, namely, the proteins pp65, IE1, and IE2; recent and more extensive studies have shown that glycoprotein B (gB) as well as other CMV glycoproteins is also able to evoke adaptive T cell responses (32, 34). Notably, the CMV gB is expressed at the cell surface during the early or delayed early phase of CMV replication, even in the presence of clinically used inhibitors of viral DNA replication (33).
We hypothesize that engineered T cells with specificity for CMV gB have the potential to control CMV infection by specific elimination of infected cells. The time course of gB expression at the surfaces of infected HFF cells was investigated by flow cytometry with gB-specific antibody 27-287 and an anti-mouse immunoglobulin (Ig) Cy5 secondary antibody. Whereas surface expression of CMV gB could be confirmed 48 h after infection (Fig. 1A), one single replication cycle of CMV in cell culture required about 4 days, as detected by quantitative PCR. Supernatants from CMV strain Ad169-infected HFF cells were harvested, debris was removed (720 × g, 10 min), and the virus was pelleted (18,600 × g, 2 h, 4°C). Pellets were subjected to proteinase K digestion (100 μg/ml, 50 min at 56°C and 10 min at 95°C) and analyzed by quantitative real-time PCR (CMV5′, AAGCGGCCTCTGATAACCAAG; CMV3′, GAGCAGACTCTCAGAGGATCGG; 6-carboxyfluorescein [FAM]/6-carboxytetramethylrhodamine [TAMRA]-labeled CMV probe, CATGCAGATCTCCTCAATGCGCGC). CMV gB is thus accessible on the surfaces of infected cells before the viral replication cycle is completed and virus release and spreading occurs.
T cells were redirected against an immunodominant gB epitope which is conserved between various CMV strains and clinical isolates (17). A functional single-chain antibody molecule (gB scFv) (Fig. 1B and C) was derived from the hybridoma cell line 27-287 by PCR with specific oligonucleotides (Vh27-287f, 5′-GCCACCATGGAATGCAGCTGGGTCTT-3′; Vh27-287rLINKER, 5′-ACCCGACCCGCCACCGCCCGATCCACCACCTCCTGAGGAGACGGTGACTGAGG-3′; Vl27-287fLINKER, 5′-TCGGGCGGTGGCGGGTCGGGTGGCGGCGGATCTGACATTGTGCTGACACAGTCTCCT-3′; and Vl_rBamHI, 5′-GGATCCCCATCAGCCCGTTTTATTTCC-3′) and cloned into pSTBlue-1. The scFv was excised with PmlI and BamHI and cloned into the pBullet #607 vector (14). The resulting chimeric immunoreceptor (cIR) consists of variable regions of the gB scFv molecule, an Ig hinge region, CD28 transmembrane and costimulatory domains, and signal-transducing elements of the CD3ζ chain (Fig. 1D). For lentiviral expression, the gB cIR was excised from the pBullet vector by HincII and EcoRV and cloned into the PmeI site of the pWPI vector. Lentiviral vector particles were generated by transfection of 293T cells with a three-plasmid HIV-derived lentiviral system using Lipofectamine 2000 (Invitrogen) with plasmids pWPI, psPAX2, and pMD2.G (D. Trono, Geneva, Switzerland) in a molar ratio of 4:3:1. Supernatants were concentrated by ultracentrifugation for 2 h at 4°C and 20,000 rpm in a Beckmann SW28 rotor and used for infection of lymphocytes (3 × 106 cells with 3 μg p24). This transduction of Jurkat and primary human T cells resulted in high cIR surface expression (Fig. 2). Engineered T cells were specifically activated by the gB cIR since lentivirally transduced T cells cocultured with CMV-infected HFF cells produced large amounts of gamma interferon (IFN-γ), whereas untransduced T cells showed only background amounts of cytokine production (data not shown).
As an alternative strategy, we expressed the anti-gB cIR by RNA transfer (1). Electroporation of GMP-grade cIR RNA has several advantages over lentiviral vectors with regard to its use in clinical trials (35). Persistence of transferred RNA and therefore of cIR expression is limited to a period of several days. It does not raise the issue of gene vector safety, nor does it require additional safety measures, such as the inclusion of a suicide gene. On the other hand, the shorter expression period following RNA transfer might necessitate repeated transfer of RNA-transfected effector T cells. The cIR constructs were excised from the pBullet vector and cloned into the vector pST1 (13). RNA ivT was obtained with the mMessage mMachine T7 Ultra mRNA in vitro transcription kit (Ambion) using a linear DNA template derived from the vector pST1. T7 RNA polymerase-mediated in vitro transcription yielded respective mRNAs with two RNA-stabilizing 3′ β-globin untranscribed regions (UTRs) and a 120-nucleotide (nt) poly(A) tail (Fig. 2A). Electroporation of 8 μg of mRNA (500 V, 5-ms square-wave pulse, 4-mm cuvette) resulted in high-level cIR expression in >97% of cells as detected with a goat anti-human Ig Cy5 antibody (Fig. 2B). cIR surface expression lasted for 7 days, although with decreasing expression densities over time (Fig. 2C).
Coincubation of gB-cIR-expressing T cells with infected HFF cells resulted in specific production of tumor necrosis factor (TNF) and IFN-γ in T cells of CMV-seronegative donors (Fig. 3A). Intracellular staining with an anti-human TNF antibody confirmed that only gB-cIR-expressing T cells, and not T cells with irrelevant cIR, responded to stimulation with CMV-infected HFF cells with production of TNF (Fig. 3B). Moreover, coincubation of gB-cIR-engineered T cells with infected HFF cells led to specific degranulation, as estimated by CD107a surface staining (Fig. 3C). gB-cIR-expressing T cells are able to kill gB-positive (gB+) target cells efficiently at a low effector-to-target (E/T) ratio of 2.5:1. Carcinoembryonic antigen (CEA)-cIR-carrying T cells showed no cytotoxicity toward gB+ cells (Fig. 3D), illustrating again the specificity of target recognition.
We assume that targeting gB by cIR-redirected T cells, engineered by lentiviral or RNA-mediated gene transfer, has the potential to prevent CMV replication and limit the spread of CMV in vivo. Murine CMV (MCMV) is the established and convenient model for acute and persistent herpesviral infection (27). However, preclinical animal studies of the MCMV model would be complicated by the fact that the MCMV gB homolog shares only poor sequence similarity to human CMV gB. This precludes cross-reactivity of reagents specific for human CMV gB. Moreover, the MCMV gB gene is a true late and lytic gene (26), thereby differing significantly from the human CMV gB gene. Although beyond the scope of this paper, it is conceivable that one could develop a model based on a recombinant MCMV expressing the human CMV gB. Such an approach would still be complicated by the fact that MCMV gB cannot be simply replaced by human CMV gB in functional terms and would further require appropriate transcriptional regulation of gB expression. Rhesus CMV (RhCMV), another model of acute and persistent cytomegalovirus infection, is more closely related to human CMV (30). RhCMV gB is similarly processed and shares higher homology to human CMV gB (24). RhCMV gB transcription and expression patterns are not known in detail, and further studies on this promising macaque model are required to determine its suitability in this setting. Nevertheless, the potential use of our cIR in an RhCMV infection model warrants further studies, as the antibody 27-287 has shown cross-reactivity with RhCMV gB (18).
The strategy of eliminating CMV-infected cells by cIR-redirected T cells has the advantage of HLA-independent recognition of gB. This is of particular relevance since CMV has evolved several efficient mechanisms to downregulate the major histocompatibility complex (MHC) (8) and to prevent peptide presentation (12). The anti-gB cIR, however, enables the cytotoxic T cell to recognize gB on the cell surface, independently of processed antigen presentation by the MHC. This principle is not used by naturally occurring adaptive T-cell immunity; CMV has thus not been under selective pressure to evolve a counterstrategy.
A further concern may be the blockade of the cIR by soluble antigen, e.g., viral particles containing gB. However, the load of human CMV particles in infected individuals is low, virus is mostly cell associated (2), and soluble forms of gB or shedding from the surfaces of cells or particles have not been reported despite extensive research. It was shown that cIR function of T cells redirected against tumor antigen is unimpaired by soluble protein present in serum (14, 36).
Taken together we show that CMV gB, which is expressed by infected cells early in the replication cycle, is an attractive target for redirected, engineered T cells endowed with a specific cIR. cIR-redirected target recognition would allow adoptive transfer with T cells from CMV-negative donors and, more remarkably, independently of HLA restriction. This approach has the potential to pave the way for a new therapeutic option in the treatment of one of the most dreaded complications after stem cell transplantation.
CMV gB expression on surfaces of infected cells and construction of chimeric immunoreceptors. (A, left) Time course of gB surface expression on CMV-infected HFF cells as determined by fluorescence-activated cell sorting (FACS) analysis using the 27-287 antibody and a secondary Cy5-labeled anti-mouse antibody compared to that for an isotype control. (Right) Release of viral particles from infected cells into the supernatant determined by quantitative real-time PCR at the indicated time points. Small amounts of human CMV (HCMV) genomes detected within the first 48 h postinfection are due to residual input virus. (B) Construction of an scFv. RNA was isolated from the hybridoma cell line 27-287, which produces an antibody against CMV gB. cDNA was generated, and the antibodies' variable regions were amplified by PCR, cloned, and sequenced. This was followed by fusion with specific primers in an overlap extension PCR. PCR products were cloned into the vector pBullet #607 (14), which already contained the cIR signaling domains, and sequenced. Vh, variable region of immunoglobulin heavy chain; Vl, variable region of immunoglobulin light chain. (C) Specific binding of 27-287-scFv-myc (gB-scFv-myc) protein to CMV gB was monitored by Western blotting. Protein lysates of uninfected and CMV-infected HFF cells were prepared in radioimmunoprecipitation assay (RIPA) buffer. Twenty micrograms of protein was used for SDS-PAGE, transferred to polyvinylidene difluoride (PVDF) membranes, blocked, and incubated (1 h) with the 27-287 hybridoma supernatant or the pCDNA4-27-287-scFv-MH-transfected 293T cell supernatant. gB-scFv-myc protein was detected with anti-myc antibody and anti-mouse horseradish peroxidase (HRP) antibody; 27-287 monoclonal antibody (MAb) was detected with anti-mouse HRP antibody by enhanced chemiluminescence and documented with a Fuji LAS-1000 system. (D) Schematic representation of a chimeric immunoreceptor. The extracellular gB scFv was fused to an Ig hinge region and intracellular signaling domains of the CD28 and CD3ζ cDNAs.
Expression of cIR in CD8+ T cells after RNA transfer. (A) Schematic diagram of the vector pST1 (kindly provided by U. Sahin) coding for the anti-gB cIR. T7 promoter-mediated in vitro transcription results in 5′-capped RNA with two copies of the 3′ β-globin UTR and a 120-nt poly(A) tail. (B) Expression of gB cIR and a carcinoembryonic-antigen-specific control receptor (CEA cIR) (14) on the surfaces of CD8+ T cells 1 day postelectroporation, detected with an anti-human Ig Cy5 antibody. Cells electroporated without RNA served as a control. (C) Time course of surface cIR expression after electroporation of in vitro-transcribed RNA into CD8+ T cells detected with an anti-human Ig Cy5 antibody. Cells electroporated with green fluorescent protein (GFP) RNA served as a control. (D) Surface expression of cIR on lentivirally transduced Jurkat T cells. Jurkat T cells transduced with the empty vector or with a vector expressing the gB cIR or the CEA cIR were centrifuged onto glass slides, fixed with 2% paraformaldehyde, and stained with an anti-human Ig Cy5 antibody. Cells were counterstained with DAPI (4′,6-diamidino-2-phenylindole; 1 μg/ml). The samples were analyzed with a Leica TCS SP5 microscope.
gB-specific T cells engineered by RNA transfer are functionally redirected. (A) RNA-electroporated T cells with gB and CEA cIR (1 × 105 T cells) were coincubated with, respectively, CMV-infected (HFF+) and uninfected (HFF−) HFF cells (5,000 HFF cells/well) in medium containing 5% (vol/vol) human serum of CMV-negative donors for 18 to 20 h. IFN-γ and TNF in supernatants were quantified by sandwich enzyme-linked immunosorbent assay (ELISA) (human IFN-γ and TNF OptEIA ELISA set; BD Biosciences). Data represent the means of results from triplicates plus standard deviations (SD). Three different T cell-HFF combinations are shown. First row, T cells derived from cord blood (50% CD8+ and 50% CD4+); second and third rows, magnetic-bead-purified CD8+ T cells (Miltenyi) from CMV-negative donors. (B) TNF is produced by gB-cIR-engineered T cells after coincubation with CMV-infected HFF cells, as determined by intracellular flow cytometry with a phycoerythrin (PE)-labeled anti-human TNF antibody (clone mab11). Staining was performed after incubation with 10 μg/ml Brefeldin A for 5 h at 37°C. (C) Specific degranulation of cIR-engineered T cells was determined by FACS analysis with a PE-labeled anti-CD107a antibody (clone H4A3). cIR-expressing T cells were coincubated with CMV-infected HFF cells at an E/T ratio of 5:1 for 6 h in the presence of 5 μM monensin and with 5% serum from CMV-negative individuals. T cells with gB cIR show degranulation compared to T cells with control CEA cIR and without cIR. (Left) Fraction of CD107a-positive cells (above cutoff value, which is set to 98% of measured events of the negative control). The mean values from three independent experiments are shown. (Right) Histogram data of a representative experiment. MFI, mean fluorescence intensity. (D) Antigen-specific lysis of CMV gB-expressing cells by cIR RNA-electroporated T cells. Europium-based cytotoxicity assay showing specific lysis after coincubation of gB cIR or control anti-CEA-cIR-engineered T cells with 293T cells with or without gB expression. Cytotoxicity assays were performed as described previously (19). Specific lysis was calculated by the formula percent lysis = (experimental counts − spontaneous release) × 100/(maximum release − spontaneous release). Data represent the means of results of triplicates plus SD.
We acknowledge Niels Schaft for helpful discussions; Barbara Alberter for helpful discussions and critical reading of the manuscript; Didier Trono, Geneva, Switzerland, for providing the plasmids of the lentiviral vector system; and Ugur Sahin, Mainz, Germany, for providing the pST1 plasmid.
This work was supported in part by the Wilhelm Sander Foundation (grants 2002.033.1, 2002.034.1, and 2009.002.1), the Interdisciplinary Center for Clinical Research (IZKF; Genesis, Diagnostics and Therapy of Inflammation Processes), the Universitätsbund Erlangen-Nürnberg, and the Deutsche Forschungsgemeinschaft (grants SFB 796 and EN423/2-1).
Received 6 October 2009.
Accepted 25 January 2010.
Birkholz, K., A. Hombach, C. Krug, S. Reuter, M. Kershaw, E. Kampgen, G. Schuler, H. Abken, N. Schaft, and J. Dorrie. 2009. Transfer of mRNA encoding recombinant immunoreceptors reprograms CD4+ and CD8+ T cells for use in the adoptive immunotherapy of cancer. Gene Ther.16:596-604.
Boeckh, M., and G. Boivin. 1998. Quantitation of cytomegalovirus: methodologic aspects and clinical applications. Clin. Microbiol. Rev.11:533-554.
Boeckh, M., W. Leisenring, S. R. Riddell, R. A. Bowden, M. L. Huang, D. Myerson, T. Stevens-Ayers, M. E. Flowers, T. Cunningham, and L. Corey. 2003. Late cytomegalovirus disease and mortality in recipients of allogeneic hematopoietic stem cell transplants: importance of viral load and T-cell immunity. Blood101:407-414.
Boeckh, M., and P. Ljungman. 2009. How we treat cytomegalovirus in hematopoietic cell transplant recipients. Blood113:5711-5719.
Boeckh, M., W. G. Nichols, G. Papanicolaou, R. Rubin, J. R. Wingard, and J. Zaia. 2003. Cytomegalovirus in hematopoietic stem cell transplant recipients: current status, known challenges, and future strategies. Biol. Blood Marrow Transplant.9:543-558.
Bohne, F., M. Chmielewski, G. Ebert, K. Wiegmann, T. Kurschner, A. Schulze, S. Urban, M. Kronke, H. Abken, and U. Protzer. 2008. T cells redirected against hepatitis B virus surface proteins eliminate infected hepatocytes. Gastroenterology134:239-247.
Boutolleau, D., C. Deback, C. Bressollette-Bodin, S. Varnous, N. Dhedin, B. Barrou, J. P. Vernant, I. Gandjbakhch, B. M. Imbert-Marcille, and H. Agut. 2009. Resistance pattern of cytomegalovirus (CMV) after oral valganciclovir therapy in transplant recipients at high-risk for CMV infection. Antiviral Res.81:174-179.
del Val, M., K. Munch, M. J. Reddehase, and U. H. Koszinowski. 1989. Presentation of CMV immediate-early antigen to cytolytic T lymphocytes is selectively prevented by viral genes expressed in the early phase. Cell58:305-315.
Einsele, H., and H. Hebart. 2004. CMV-specific immunotherapy. Hum. Immunol.65:558-564.
Einsele, H., E. Roosnek, N. Rufer, C. Sinzger, S. Riegler, J. Loffler, U. Grigoleit, A. Moris, H. G. Rammensee, L. Kanz, A. Kleihauer, F. Frank, G. Jahn, and H. Hebart. 2002. Infusion of cytomegalovirus (CMV)-specific T cells for the treatment of CMV infection not responding to antiviral chemotherapy. Blood99:3916-3922.
Eshhar, Z., T. Waks, G. Gross, and D. G. Schindler. 1993. Specific activation and targeting of cytotoxic lymphocytes through chimeric single chains consisting of antibody-binding domains and the gamma or zeta subunits of the immunoglobulin and T-cell receptors. Proc. Natl. Acad. Sci. U. S. A.90:720-724.
Hengel, H., and U. H. Koszinowski. 1997. Interference with antigen processing by viruses. Curr. Opin. Immunol.9:470-476.
Holtkamp, S., S. Kreiter, A. Selmi, P. Simon, M. Koslowski, C. Huber, O. Tureci, and U. Sahin. 2006. Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. Blood108:4009-4017.
Hombach, A., D. Koch, R. Sircar, C. Heuser, V. Diehl, W. Kruis, C. Pohl, and H. Abken. 1999. A chimeric receptor that selectively targets membrane-bound carcinoembryonic antigen (mCEA) in the presence of soluble CEA. Gene Ther.6:300-304.
Kapp, M., S. M. Tan, H. Einsele, and G. Grigoleit. 2007. Adoptive immunotherapy of HCMV infection. Cytotherapy9:699-711.
Kershaw, M. H., M. W. Teng, M. J. Smyth, and P. K. Darcy. 2005. Supernatural T cells: genetic modification of T cells for cancer therapy. Nat. Rev. Immunol.5:928-940.
Kniess, N., M. Mach, J. Fay, and W. J. Britt. 1991. Distribution of linear antigenic sites on glycoprotein gp55 of human cytomegalovirus. J. Virol.65:138-146.
Kropff, B., and M. Mach. 1997. Identification of the gene coding for rhesus cytomegalovirus glycoprotein B and immunological analysis of the protein. J. Gen. Virol.78:1999-2007.
Lehner, M., C. Grillhoesl, F. Full, B. Vogel, P. Weller, I. Muller-Fleckenstein, M. Schmidt, B. Fleckenstein, W. Holter, and A. Ensser. 2009. Transformation efficiency by herpes-virus saimiri is not a limiting factor in clonal CD8pos T cell outgrowth. Virology388:15-20.
Masiero, S., V. C. Del, R. Gavioli, G. Mattiuzzo, M. G. Cusi, L. Micheli, F. Gennari, A. Siccardi, W. A. Marasco, G. Palu, and C. Parolin. 2005. T-cell engineering by a chimeric T-cell receptor with antibody-type specificity for the HIV-1 gp120. Gene Ther.12:299-310.
Matthes-Martin, S., S. W. Aberle, C. Peters, W. Holter, T. Popow-Kraupp, U. Potschger, G. Fritsch, R. Ladenstein, A. Rosenmayer, K. Dieckmann, and H. Gadner. 1998. CMV-viraemia during allogenic bone marrow transplantation in paediatric patients: association with survival and graft-versus-host disease. Bone Marrow Transplant.21(Suppl. 2):S53-S56.
Patel, S. D., M. Moskalenko, T. Tian, D. Smith, R. McGuinness, L. Chen, G. A. Winslow, S. Kashmiri, J. Schlom, C. P. Stanners, M. H. Finer, and J. G. McArthur. 2000. T-cell killing of heterogenous tumor or viral targets with bispecific chimeric immune receptors. Cancer Gene Ther.7:1127-1134.
Peggs, K. S., S. Verfuerth, A. Pizzey, N. Khan, M. Guiver, P. A. Moss, and S. Mackinnon. 2003. Adoptive cellular therapy for early cytomegalovirus infection after allogeneic stem-cell transplantation with virus-specific T-cell lines. Lancet362:1375-1377.
Powers, C., and K. Fruh. 2008. Rhesus CMV: an emerging animal model for human CMV. Med. Microbiol. Immunol.197:109-115.
Quinnan, G. V., Jr., N. Kirmani, A. H. Rook, J. F. Manischewitz, L. Jackson, G. Moreschi, G. W. Santos, R. Saral, and W. H. Burns. 1982. Cytotoxic t cells in cytomegalovirus infection: HLA-restricted T-lymphocyte and non-T-lymphocyte cytotoxic responses correlate with recovery from cytomegalovirus infection in bone-marrow-transplant recipients. N. Engl. J. Med.307:7-13.
Rapp, M., M. Messerle, B. Buhler, M. Tannheimer, G. M. Keil, and U. H. Koszinowski. 1992. Identification of the murine cytomegalovirus glycoprotein B gene and its expression by recombinant vaccinia virus. J. Virol.66:4399-4406.
Reddehase, M. J., C. O. Simon, C. K. Seckert, N. Lemmermann, and N. K. Grzimek. 2008. Murine model of cytomegalovirus latency and reactivation. Curr. Top. Microbiol. Immunol.325:315-331.
Reusser, P., H. Einsele, J. Lee, L. Volin, M. Rovira, D. Engelhard, J. Finke, C. Cordonnier, H. Link, and P. Ljungman. 2002. Randomized multicenter trial of foscarnet versus ganciclovir for preemptive therapy of cytomegalovirus infection after allogeneic stem cell transplantation. Blood99:1159-1164.
Riddell, S. R., K. S. Watanabe, J. M. Goodrich, C. R. Li, M. E. Agha, and P. D. Greenberg. 1992. Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones. Science257:238-241.
Rivailler, P., A. Kaur, R. P. Johnson, and F. Wang. 2006. Genomic sequence of rhesus cytomegalovirus 180.92: insights into the coding potential of rhesus cytomegalovirus. J. Virol.80:4179-4182.
Rooney, C. M., C. A. Smith, C. Y. Ng, S. Loftin, C. Li, R. A. Krance, M. K. Brenner, and H. E. Heslop. 1995. Use of gene-modified virus-specific T lymphocytes to control Epstein-Barr-virus-related lymphoproliferation. Lancet345:9-13.
Scheinberg, P., J. J. Melenhorst, J. M. Brenchley, B. J. Hill, N. F. Hensel, P. K. Chattopadhyay, M. Roederer, L. J. Picker, D. A. Price, A. J. Barrett, and D. C. Douek. 2009. The transfer of adaptive immunity to cytomegalovirus (CMV) during hematopoietic stem cell transplantation is dependent on the specificity and phenotype of CMV-specific T cells in the donor. Blood114:5071-5080.
Smuda, C., E. Bogner, and K. Radsak. 1997. The human cytomegalovirus glycoprotein B gene (ORF UL55) is expressed early in the infectious cycle. J. Gen. Virol.78:1981-1992.
Sylwester, A. W., B. L. Mitchell, J. B. Edgar, C. Taormina, C. Pelte, F. Ruchti, P. R. Sleath, K. H. Grabstein, N. A. Hosken, F. Kern, J. A. Nelson, and L. J. Picker. 2005. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects. J. Exp. Med.202:673-685.
Van Tendeloo, V., P. Ponsaerts, and Z. N. Berneman. 2007. mRNA-based gene transfer as a tool for gene and cell therapy. Curr. Opin. Mol. Ther.9:423-431.
Zhang, T., A. Barber, and C. L. Sentman. 2006. Generation of antitumor responses by genetic modification of primary human T cells with a chimeric NKG2D receptor. Cancer Res.66:5927-5933.
Journal of Virology Mar 2010, 84 (8) 4083-4088; DOI: 10.1128/JVI.02117-09
Thank you for sharing this Journal of Virology article.
You are going to email the following T Cells Engineered with a Cytomegalovirus-Specific Chimeric Immunoreceptor
Message Subject (Your Name) has forwarded a page to you from Journal of Virology
Message Body (Your Name) thought you would be interested in this article in Journal of Virology.
Receptors, Immunologic
Follow #Jvirology
JVI in collaboration with
|
cc/2021-04/en_middle_0071.json.gz/line3312
|
__label__wiki
| 0.859735
| 0.859735
|
Kellee writes about classic & modern film, retro TV... and life's adventures, with a sassy Irish passion.
31 Days of Oscar
TCMFF
Kansas Silent Film Festival
Buster Keaton Celebration
Modern Film
Nostalgia for Killer Blobs
August 28, 2012 by kelleepratt 2 Comments
The following piece was originally published on The Cinementals site in early June 2012:
Recently, I attended a fun and nostalgic cinematic treat. I live in a college town in Kansas, where the opportunities for enjoying classic cinema in a public venue are not exactly frequent. Kansas Public Radio’s Retro Cocktail Hour hosted a duo of drive-in classics for “Killer Blob Night.” (KPR’s Retro Cocktail Hour is a weekly radio show devoted to the Space Age Pop revival genre. Picture a “Mad Men” happy hour soundtrack.) The Double Feature included the oozing, pulsating, flesh-eating Kinji Fukasaku’s THE GREEN SLIME (1968) and Mario Bava’s (uncredited) CALTIKI, THE IMMORTAL MONSTER (1959). The experience that followed was an audience verbally engaged akin to “Mystery Science 3000” with shout-out commentary, laughter and howls at every campy gaffe.
The Japanese-American co-production of the B movie cult favorite THE GREEN SLIME oozes with campy delight. As an asteroid hurdles towards earth, a crew must launch to save the day. A feisty love triangle develops between Gamma III station Commander Vince Elliott (portrayed by Richard Jaeckel, also known for THE DIRTY DOZEN), cocky and devoid of any emotion Commander Jack Rankin (portrayed by Robert Horton of TV series fame such as “Wagon Train” and “A Man Called Shenandoah”) and love interest Dr. Lisa Benson (portrayed by Italian beauty Luciana Paluzzi of THUNDERBALL and MUSCLE BEACH PARTY fame). The crew lands upon the speeding asteroid rock and drills in prep for explosion, a scene plot eerily similar and precursor to “Armageddon” (1998). In a hurried departure, a scientist on the team accidentally brings back some green slime on his space suit after completing a successful mission. Quickly things go haywire at the station as the green ooze evolves into one-eyed tentacled creatures whose energy feeds off and weapon for destruction is electricity. It turns out when the creatures are zapped by the crew’s weapons, not unlike some plot components from ALIEN, their green blood just makes them grow stronger! This cult gem was the first film covered in Mystery Science 3000’s never aired pilot. All this it’s-so-bad-it’s-good-goodness is made even better by it’s theme song. It was written by Charles Fox; well known music composer of 100+ film music scores, songs and TV theme songs from “Love, American Style” to Grammy winning “Killing Me Softly With His Song.”
The second entry of the double feature was the Italian production, CALTIKI, THE IMMORTAL MONSTER. It shows Riccardo Freda as director but he claimed later that Mario Bava did most the directing after just a few days into production. The B cast ensemble includes John Merivale, Didi Sullivan, Gerard Herter, and Daniela Rocca. The plot centers around a group of archeologists exploring Mayan ruins who discover ancient Caltiki via pulsating, rapidly growing and flesh-eating blob monsters. In discovering Mayan gold and many skeletons in a hidden cave lake, one of the first victims is driven by greed for more yet narrowly escapes and becomes partially mutated then later turns into a killer driven by madness. As the blobs continue to mutant and grow, armies attack with fire blowers. The plot thickens as a comet reappears after a 1300 year absence which showers radiation to make the ancient flesh-eating blob turn into one enormous pile of goo destined for world domination. For it’s time and budget, there are some impressive special effects including underwater shots, authentic looking Mayan ruin sets, gory half-melted flesh shots and a film noir feel.
One of the highlights of the evening was the appearance of a local celeb, Crematia Mortem (aka Roberta Solomon, vocal and TV talent) She was the host of a late night TV show “CREATURE FEATURE” which aired from 1981-1988 and featured the best of the worst in horror and monster flicks. You could say growing up watching campy creature and horror flicks had an impact on me. Because of this influence, last year I discovered a twitter community for cinematic fans of B-movies experience called the @DriveInMob and I continue to reach out to fellow cinementals through twitterverse and other social media formats. After all, what’s better than sharing your love for all the genres of classic cinema with other fans?
silverscreenings says:
Gasp! I can't believe I don't know ANY of these movies! Where on earth have I been? Thanks for bringing me up to speed – I mean it!
Irish Jayhawk says:
You're most welcome! I'm so glad you enjoyed it and I hope you can see these cult classic films someday soon. SO much fun!
Gorgeous Photos…
Film Fests
|
cc/2021-04/en_middle_0071.json.gz/line3314
|
__label__wiki
| 0.768718
| 0.768718
|
Google Pacman
Gunfight.io
Boas.io
Snake.io
Defly.io
Gulch.io
Combines.io
Google Pacman is a 30-year anniversary remake of the international cult classic that was created in Japan and became one of the most recognized arcade games in existence. It was later ported to every console and device imaginable, there are hundreds of versions, sequels and interpretations. The gameplay is simple enough to figure out without any instructions and the circle-shaped protagonist has become an icon that often represents the industry of video games as a whole.
This new Google Doodle Pacman version pays homage to the legacy of the classic by trying to recreate the charm of the original gameplay: control the circle-shaped character that, as far as facial features go, only has a mouth, eat white dots of energy scattered around the level and avoid ghosts that can kill you with a single touch. You can also collect a special bonus that will make you temporarily invulnerable and allow you to be the one killing the ghosts instead. Collect all the energy on the level to win!
If you love classic arcade entertainment Google Games Pacman is a great way to go back in time to try and re-live those precious memories or to imagine what it was like growing up during that time.
Google Pacman is one of the best Arcade Game you can play on Kevin Games.
This game works perfectly in modern browsers and requires no installation.
Google Pacman has been played by thousands of gamers who rated it 3.8 / 5 with 25 votes.
Did you enjoy this game? Then give other Arcade Games a try.
Enter the amount 4 + 12 =
Free Online Games © Kevin Games 2020
|
cc/2021-04/en_middle_0071.json.gz/line3316
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.