pred_label
stringclasses
2 values
pred_label_prob
float64
0.5
1
wiki_prob
float64
0.25
1
text
stringlengths
75
951k
source
stringlengths
39
45
__label__cc
0.640501
0.359499
You are here:Home/Resources/ Byzantine Seals/ Search the Catalogue/ Anthony I Kassymatas, patriarch of Constantinople (821–37) Anthony I Kassymatas, patriarch of Constantinople (821–37) Cruciform invocative monogram (type VIII); in each quarter, a cross. Wreath border. Inscription of five lines. Wreath border. ΝΤΩ ΝΙΩΕΠΙΣ ΚΟΠΩΚΩΝ ΣΤΑΝΤΙΝ ..ΛΕ Ἀντωνίῳ ἐπισκόπῳ Κωνσταντινου[πό]λε(ως). BZS.1958.106.5703 (formerly DO 58.106.5703) DO Seals 6, no. 111.1; Zacos–Veglery, no. 1417; Zacos, Seals 2: no. 3; Laurent, Corpus 5.1: no. 4; Oikonomides, Dated Lead Seals, no. 45. Κύριε βοήθει Ἀντωνίῳ ἐπισκόπῳ Κωνσταντινουπόλεως. Lord, help Anthony, bishop [patriarch] of Constantinople. Anthony’s given name was Constantine. Unlike his predecessor he was not the scion of an illustrious family. His father stemmed from a family of shoemakers. Constantine (Anthony) was born at Constantinople between 760 and 780; he rose through education to the position of nomikos or lawyer, a profession that he exercised during the first phase of his career in the Constantinopolitan quarter known as Sphorakiou. Subsequently he became a monk and then abbot of a monastery located in the Petrion quarter of Constantinople called μονὴ τῆς Θεοτόκου τῶν Μητροπολίτου (Janin, Églises, 197); by 814 he had been elevated to the episcopal throne of Syllaion (ἐπίσκοπος τοῦ Συλέου; see Letter of the Three Patriarchs, p. 116). In 821 Michael II, frustrating the wishes of the party of Theodore of Stoudios, who wanted to see Nikephoros I return to the patriarchal throne, placed Anthony on it instead. Before his death in 837 he seems to have convened an iconoclast synod (Letter of the Three Patriarchs, p. 66). He is anathematized, along with his predecessor Theodotos and his successor John, in the Synodikon of Orthodoxy: Θεοδότῳ, Ἀντωνίῳ καὶ Ἰωάννῃ, τοῖς ἀλληλοπροξένοις τῶν κακῶν καὶ ἑτεροδιαδόχοις τὴν δυσσέβειαν, ἀνάθεμα (Gouillard, “Synodikon,” 57, at lines 173–74). For an overview of Anthony’s career, see Prosopographie der mittelbyzantinischen Zeit 1: no. 550. Laurent illustrates this seal, but fails to mention it in the entry. Instead he cites a specimen in the Vienna Collection (no. 74) that seems to have slightly different lettering. Both this seal and that of Patriarch Theodotos (BZS.1947.2.3) employ a decorative motif consisting of a cruciform monogram with a cross in each quarter. It is not a common device and at this date is anachronistic. One can cite examples, such as Zacos–Veglery, nos. 1396 and 1399, but both specimens date from the eighth century. Catalogue of Byzantine Seals at Dumbarton Oaks and in the Fogg Museum of Art, Volume 6: Emperors, Patriarchs of Constantinople, Addenda Le Corpus des sceaux de l’empire byzantin, vol. 5, L’Église A Collection of Dated Byzantine Lead Seals La géographie ecclésiastique de l’empire byzantin, vol. 1, Le siège de Constantinople et le patriarcat oecuménique, pt. 3, Les églises et les monastères The Letter of the Three Patriarchs to Emperor Theophilos and Related Texts Le Synodikon de l’orthodoxie: Édition et commentaire Prosopographie der mittelbyzantinischen Zeit Byzantine Collection DO Seals 6
cc/2019-30/en_middle_0028.json.gz/line13100
__label__wiki
0.879257
0.879257
TOC: Newton overwhelms North for chance to play for 5th By Shelton Burch/Sports Editor Junior Alex Krogeimer and the Newton Railers set the tone early and often in Friday’s Tournament of Champions game against the Wichita North Redskins. Krogeimer had 15 in the first quarter, and the Railers outscored the Redskins 21-0 in the first quarter on the way to a 66-38 win. They’ll play Saturday at 1:30 p.m. in the the Tournament’s fifth-place game. Wichita North will play in the seventh-place one at Noon Saturday. Newton shot an incredible 75 percent from the field in the first quarter and were 3 of 5 from 3-point territory in the first quarter. “I thought really like the first minute and a half we were kind of sleepwalking, but after that (for) I think it was about the next three and a half, four minutes we really defended really well,” Newton head coach Andy Preston said. “Our defense kind of sets our culture and I thought defensively we did some nice things. We shared the ball. They emphasized taking away Ty (Berry), Alex stepped up, made some big shots, I thought Jamieson Jones really played aggressive for us and Damarius (Peterson) was himself again today. It was nice to get other guys involved outside of Ty today.” The Railers continued their strong shooting in the second, and ended up shooting 75 percent on 15 of 20 shooting from the field in the first half, ending the game with a shooting percentage of 61.9 percent. For Wichita North, Senior RJ Hunter had a team-high 4 points through the first half for the Redskins and a total of 8 in the game. Redskins senior Jeremiah Randall finished as the team-leader in Friday’s game, with 17 points. Krogeimer finished with a game-high 22. The Railers had lost in the late game Thursday night to Bishop Carroll, losing despite playing well enough to have probably beaten most other teams. “Last night it was disappointing,” Preston said. “It was a tough loss. I mean Carroll’s a really good team and we did a good job not letting Carroll beat us this afternoon in the game today. We bounced back really well. The kids were really disappointed last night but I thought today we showed up, we played with energy, we played with a lot of effort. We can’t win the Championship, but we can at least win the next two games.”
cc/2019-30/en_middle_0028.json.gz/line13101
__label__cc
0.5877
0.4123
Ethereum Foundation Declares $5 Million Grant to Parity Technologies by Girish Vidhani in Ethereum News and Updates Ethereum Foundation has declared a $5 million grant to Parity Technologies, a firm based out in the United Kingdom, as per the post published on the official ETH blog. As per the ETH team, the grant is provided for scalability, usability and security work. Moreover, the latest raised funds will be used to improve Casper, a proof-of-scale protocol upgrade, scaling, light clients, developer tools, QA, audits, and infrastructure improvements. The post also explains that funding will be provided in different portions. Out of which, the first part includes the development of parity network which is completed. The rest of the funding will be provided after the completion of the assembly standard eWasm Compatibility work, a light wallet for the mainnet and for the successful completion of the first two phases of the shading network. Parity is basically a blockchain infrastructure startup, co-founded by Jutta Steiner who is a former security chief at Ethereum Foundation. The firm is popular for developing Ethereum software client, Parity Ethereum, which claims to be the fastest and most advanced. Apart from this, it has also developed some tools like Substrate, a service which allows users to form customize blockchains for decentralized applications. This is not the first time, Ethereum is providing funding to the startups. Earlier, the firm said that its main purpose is to fund teams and individuals building common infrastructure over the network. Before two months, Ethereum's co-founder Vitalik Buterin granted $3 million to various blockchain startups and developers. In November 2017, one user of Ethereum's Parity multisignature wallet seemingly accidentally rendered $280 million in ETH inaccessible employing a vulnerability founded in some smart contracts. In April 2018, the time when funds were worth $360 million, week-long voting due to the above incident results in 55% of participants voting against it, hence the funds left where they were before. Before 2 months, Parity showed a live blockchain launch in just 15 minutes on a brand new MaC. The parity founder showed the demonstration in order to give insight about the speed of the entire process of platform launch. Girish is a blockchain engineer with experience in writing. He is enthusiastic and has a keen interest in developing his knowledge in blockchain and cryptocurrency. Girish follows cryptocurrency market trends and is fascinated by its dominance in the financial world. He does regular technical analysis of the market and reports on blockchain and cryptocurrency on our portal. Jutta Steiner Crypto Exchange Huobi Burns 14 Million Huobi Tokens between Revenue Gains Brendon Buthello Fear of missing out? Come on,those were the old days. P.S. We never spam! New to Cryptocurrency? Here’s the Cryptocurrency guide for you to get started! Introduction to Cryptocurrency How to Buy and Sell Cryptocurrency? Ultimate Cryptocurrency Mining Guide Uses of Cryptocurrencies Future of Cryptocurrencies Beginners Guide to Binance Cryptocurrency Exchange - From Opening & Securing the Account to Trading View Complete Guide Coinbase Wallet Now Supports Bitcoin Cash (BCH) Cryptocurrency Telegram Raises $850 Million For the TON Blockchain Development Amid I... Washington State County Catches Unauthorized Cryptocurrency Miners A Third of Shapeshift’s Workforce Laid Off: Crypto-Layoffs Continue
cc/2019-30/en_middle_0028.json.gz/line13104
__label__wiki
0.908185
0.908185
Out on Video THE STRONG MAN TRAMP, TRAMP, TRAMP One of Harry Langdon's movies calls his character "just a crumb off the spongecake of life," and it's hard to top that description. Also instructive is the overall title Kino gives this collection of the comedian's first three features - "Harry Langdon: The Forgotten Clown." Silent-comedy connoisseurs have usually ranked him below Charles Chaplin and Buster Keaton on the laugh meter, and even Harold Lloyd has claimed more attention from critics and fans. Still, he's never completely faded from memory, partly because legendary filmmaker Frank Capra directed two of his best-known pictures. The movies presented on this three-cassette series, all made in the mid-1920s, show every side of Langdon's decidedly odd talent. He usually plays a sort of child-man character that anticipates screen personalities like Pee-Wee Herman and Pinky Lee by decades. His comedy takes its cue from two basic situations: some kind of daunting physical challenge, like World War I combat or a coast-to-coast walkathon, and his desperate longing for a woman who barely knows he's alive. In the better Langdon movies, humor and pathos arise from the contrast between our hero's inadequacies and his dogged determination to overcome the huge hurdles in his path. His pictures lack the slapstick energy often found in Chaplin and Keaton classics, but his character is strangely fascinating even when the story seems uncertain where it wants to go. The best of this batch is "Tramp, Tramp, Tramp," where he woos Joan Crawford while competing in a cross-country walking race. "The Strong Man" starts on a battlefield and ends in a vaudeville theater, and "Long Pants" finds him dallying with a femme fatale while his girl-next-door fiance wonders if their wedding day will ever arrive. It's unlikely other Langdon features will surface on video, since after these three he directed himself in a series of barely remembered flops. That gives all the more value to Kino's handsomely produced series, which also includes a couple of the comedian's vintage Mack Sennett shorts. (Not rated; Kino Video) Chapter & Verse Charlie Chaplin's novella is published for the first time Charlie Chaplin: 10 quotes on his birthday Review My Autobiography, by Charlie Chaplin
cc/2019-30/en_middle_0028.json.gz/line13105
__label__cc
0.658745
0.341255
How to Breed Cane Corso By Louise Lawson The cane corso is a large, rugged mastiff-type dog bred in Italy. Used by farmers as a catch dog for cattle and sheep, as well as a drover and cart dog, the cane corso was nearly extinct by the 1970's. Careful breeding increased the number of dogs around the world, and it is now officially recognized by both the United Kennel Club and American Kennel Club. Further breeding efforts are necessary to improve the gene pool and re-establish healthy lines around the globe. Select a pair of dogs that complement each other and display traits that you want to pass on to future generations. The cane corso is a molosser-type dog, and both male and female should be between 23 and 27 inches tall at the shoulder, with a wide head, broad muzzle and deep, pronounced stop. The forelegs should be straight and well-muscled, and the hindquarters strong, with thick muscling over the thigh. Both male and female should be approximately the same size to prevent complications from overly-large puppies during whelping. Ask your veterinarian to perform complete pre-breeding physicals on both dogs. Cane corso are fairly hearty dogs, but still prone to genetic conditions such as hip dysplasia, so both dogs should have their hips examined prior to breeding. The vet will also test for communicable diseases including brucellosis, and rule out any illnesses prior to breeding. Monitor the female for signs of estrus. Larger breeds such as the cane corso come into season every 8 to 12 months, and will be receptive to breeding for a period of approximately 10 days. The female's vulva will swell and darken in color, and she will produce a discharge that turns from red to clear in color as her heat progresses. Allow the dogs time to explore each other, and stand quietly as they investigate. If the female is receptive, she will turn her hindquarters towards the male and allow him to mount her. Mating may be as brief as five minutes or as long as an hour, so don't attempt to move or otherwise disturb the dogs until they part on their own. Pair the dogs every other day until the female is no longer receptive. Note the first mating on a calendar, and count 63 days from the first mating. Dogs normally carry a litter for 9 weeks, although cane corsos often whelp around day 60 due to large puppies and a lack of room in the uterus. Prepare the whelping area 10 days before the female is due. Place the box in a quiet room, and line the bottom with towels or old blankets to absorb messes and make the box more comfortable. Introduce the female to the box and let her sleep there so she is familiar with her new surroundings before the puppies arrive. Observe the female for signs of whelping. Her pelvic area will swell and distend as the puppies move down towards the birth canal, and a small amount of pink-colored fluid will dampen the blankets when labor begins. She will pant and pace as she adjusts herself, and her abdomen will tighten with each contraction. As the first puppy emerges, the placenta will cover its nose. The female normally breaks the sac and licks the puppy clean, but if she is inexperienced, break the sac with your fingers and rub the puppy with a clean towel to stimulate breathing. The female will break the umbilical cord with her teeth, and the next puppy should be born within 15 minutes. Cane corso have wide pelvic bones and should have no trouble whelping, but if puppies take longer than 30 minutes to arrive, call your veterinarian. Attach the heat lamp to the whelping box once the mother is done giving birth, and gently move the puppies under the lamp. Cane corso puppies are larger than other breeds, but still prone to hypothermia, especially in colder climates. Tie a short length of different-colored ribbon around each puppy's neck to aid in tracking and identification of your new litter. How to Assist With a Puppy Birth Signs That My Dog Is Going to Give Birth Breeding Cycle of a Miniature Dachshund How to Breed a Cavalier King Charles Spaniel How to Breed Basset Hounds at Home Signs Your Dog Is Having Puppies Soon
cc/2019-30/en_middle_0028.json.gz/line13108
__label__cc
0.571056
0.428944
Safer Junctions - Kingsland Road and Balls Pond Road Added by Simon Munk 28 days ago tfl_consultation tfl_safer_junctions TfL says: We are proposing to make some changes to the junction between A10 Kingsland Road and Balls Pond Road, also known as Dalston Junction in Hackney. Our Safer Junctions programme is reducing road danger at some of the most hazardous junctions in London. These junctions have high collision rates for vulnerable road users, including people walking and cycling. This programme directly contributes to our Vision Zero target to stop people from dying and being seriously injured on London’s road network by 2041. The objectives of the programme are to: Reduce road danger and help eliminate Killed and Seriously Injured (KSI) collisions Help create streets where people feel safe to walk, cycle and use public transport Make hostile junctions more welcoming and less dominated by motor vehicles, demonstrating the Healthy Streets Approach Why we are proposing to change the junction? In the three years up to 31 October 2016, 16 collisions occurred which resulted in people being injured. Five of these collisions involved pedestrians (three on the southern arm, one on the western arm and one on the northern arm). Historic trends also highlight a significant risk for cyclists, although this was not captured as a trend within the 2016/17 study period. Changing the layout of this junction would: Reduce road danger by providing more space and priority to people walking or cycling Restrict some vehicle movements to reduce conflict with other road users Make journeys by foot to and from Dalston Junction easier with wider and more direct pedestrian crossings, encouraging more journeys by walking, cycling or public transport Create a more welcoming retail and leisure environment, encouraging people to spend more time in the area What are we proposing? The proposals are to upgrade the existing junction in a number of ways: Widening the footway to the north, east and western arms to improve the space for people walking Installing coloured surfacing on all pedestrian crossing points to make it easier and safer to cross A new cycle feeder lane into the Advanced Stop Line southbound on A10 Kingsland High Street Banning the left turn eastbound from A10 Kingsland High Street into Dalston Lane for all vehicles except cycles Raising the pedestrian crossing on Dalston Lane at the top of Dalston Square to slow speeds making it easier and safer for people to cross Closing Kingsland Passage to motor vehicles and installing of new seating for places to stop and rest A plan showing all the proposed changes is below. These changes are intended to make the junction safer for all users, while significantly improving the environment for people walking and cycling, improving access to Dalston Junction Overground station. Kingsland Road/Balls Pond Road proposals (PDF 704KB) Healthy Streets The changes proposed in this scheme are part of our commitment to deliver the Healthy Streets Approach. We are taking this approach to create a vibrant, successful city where the streets are welcoming to all and everyone can live active, healthy lives. The streets within this scheme and the proposed changes have been assessed by our designers against ten Healthy Streets Indicatorsusing our Healthy Streets Check for Designers tool. This tool assesses the layout of streets against thirty one measures which produce an overall Healthy Streets Check score out of 100. We use infographics to show the current score for the streets within this scheme and potential scores based on our proposed changes. The Healthy Streets results can be seen in the diagram below. Kingsland Road/Balls Pond Road Healthy Streets results (PDF 132KB) Equality Impact Assessment We are subject to the general public sector equality duty set out in section 149 of the Equality Act 2010, which requires us to have due regard to the need to eliminate discrimination, advance equality of opportunity and foster good relations by reference to people with protected characteristics. The protected characteristics are: age, gender reassignment, marriage and civil partnership, pregnancy and maternity, race, religion or belief, sex and sexual orientation. In considering changes to the design of our streets, we closely consider the needs of all users throughout the design process and complete a draft Equality Impact Assessment (EqIA). The draft EqIA can be found below. Kingsland Road/Balls Pond Road Equality Impact Assessment (PDF 162KB) Traffic impacts We have carried out analysis to understand the impact of the above proposals. We predict no significant impacts to general traffic or bus journey times on the A10, Dalston Lane or Balls Pond Road. No significant impact on journey times for general traffic or buses travelling along the A10. https://consultations.tfl.gov.uk/roads/kingsland-road/?cid=kingsland-road Simon Still posted 9 days ago
cc/2019-30/en_middle_0028.json.gz/line13111
__label__wiki
0.785321
0.785321
Nigel Farage Wins Money From Man Who Threw Milkshake At Him In Court Ruling (Photo by Matt Cardy/Getty Images) Phillip Nieto Contributor June 18, 2019 10:51 PM ET A British court ruled on Tuesday that the man who threw a milkshake at Brexit Party leader, Nigel Farage, will have to pay him compensation for his suit cleaning. Paul Crowther assaulted Farage on May 20th with a milkshake during a campaign tour for the Brexit Party in Newcastle, England. Crowther was immediately arrested by authorities and then fired from his job as a technical adviser for the telecoms company Sky. Crowther pleaded guilty on Tuesday to common assault and criminal damage. NEWCASTLE-UPON-TYNE, ENGLAND – MAY 20: Paul Crowther (R) is pulled away by security and held by police after throwing what was thought to be milkshake over Brexit Party leader Nigel Farage in Northumberland Street in Newcastle Upon Tyne during a whistle stop UK tour on May 20, 2019 in Newcastle Upon Tyne, England. (Photo by Ian Forsyth/Getty Images) After he pleaded guilty, Judge Bernard Begley ruled that the defendant would pay Farage £350($438) to cover damages to Farage’s suit and a lapel microphone. Crowther will also have to complete 150 hours of unpaid work. Begley told Crowther, “This was an act of crass stupidity.” “While members of the public have the democratic right to engage in peaceful protest, it is wholly appropriate to bring charges in any case where such protests cross the line into criminal behavior,” said Chris Atkinson of the crown prosecution service. “In an open democracy, people should be free to conduct legitimate political campaigns without fear of physical assault.” NEWCASTLE-UPON-TYNE, ENGLAND – MAY 20: Brexit Party leader Nigel Farage is escorted to a car after having what is thought to be milkshake thrown over him as he visits Northumberland Street in Newcastle Upon Tyne during a whistle stop UK tour on May 20, 2019 in Newcastle Upon Tyne, England. (Photo by Ian Forsyth/Getty Images) Farage condemned the attack on Twitter directly after it occurred: Sadly some remainers have become radicalised, to the extent that normal campaigning is becoming impossible. For a civilised democracy to work you need the losers consent, politicians not accepting the referendum result have led us to this. — Nigel Farage (@Nigel_Farage) May 20, 2019 Fortunately for Crowther, he may not have to pay the full £350 from his own pocket. A Gofundme page entitled, “Get Paul Crowther his milkshake money back” has already raised £1,705. The trend of assaulting conservative right-wing politicians with milkshakes has gained popularity in the United States since the incident. Just a few weeks ago Republican Florida Rep. Matt Gaetz had a milkshake thrown at him as he left a town hall in Pensacola, Florida. (RELATED: ‘Milkshaking’ Crosses The Pond, Matt Gaetz Gets Doused In Pensacola) Matt Gaetz got milkshaked in Pensacola pic.twitter.com/yqz3bPgjw5 — jordan (@JordanUhl) June 1, 2019 Many prominent left wing advocates, including Carlos Maza of Vox, have openly called for physically assaulting conservatives with milkshakes following Farage’s milkshake attack. Milkshake them all. Humiliate them at every turn. Make them dread public organizing. https://t.co/myrCSv07Dx pic.twitter.com/7dozYzJoAl — Carlos Maza (@gaywonk) May 21, 2019 Despite the physical violence Farage faced on the campaign trail, his Brexit Party had a surprising victory in the European Parliamentary elections. The Brexit Party won 32% of the vote and 28 MEPs earning itself the position as one of Britain’s foremost political parties. Follow Phillip On Twitter Tags : brexit european union nigel farage Phillip Nieto
cc/2019-30/en_middle_0028.json.gz/line13112
__label__cc
0.595947
0.404053
Technologies>Communications Bluetooth Systems Get Highly Integrated RF Front-End IC Staff | Aug 01, 2000 1 of Enlarge image Made using a SiGe process, the T7024 RF front-end IC was developed for use in the radio portion of Bluetooth systems. It integrates a low-noise (2.3 dB typ.) amplifier and a power amplifier that delivers +23 dBm at 3V and a gain of 25 dB. The device, together with the firm's T2901 RF transceiver chip, Atmel's AT76C55X Bluetooth controller (baseband), and flash memory is said to provide all the ICs needed to comply with the 20-dBm Bluetooth spec. The T7024 RF SiGe front-end chip consumes as little as 170 mA, with current consumption dropping to a mere 10 µA in the IC's standby mode. The device comes in a tiny, PSSO20 package and has a starting price of $2.10 each/10,000. A design kit is also available. Company: TEMIC SEMICONDUCTORS Bringing mmWave Signals to the Masses Wireless Makes the Electric Grid Smarter and More Reliable (.PDF Download) Wireless Makes the Electric Grid Smarter and More Reliable Wi-Fi 6 vs. 5G: Why Trying to Pick a Winner is Missing the Point
cc/2019-30/en_middle_0028.json.gz/line13116
__label__wiki
0.912701
0.912701
Volkswagen's i.D. is its electric ego Scandal-plagued German carmaker Volkswagen is sparing no effort to electrify at the Paris Motor Show. But its emissions tests scam is still making for a highly charged atmosphere, reports Janelle Dumalaon. "It's so futuristic, you can't even believe it would actually drive." Those are the words of one spectator at the Paris Motor Show, where Volkswagen has unveiled a fully electric, always-online vehicle, with a range of at least 400 kilometers (248 miles) on a single charge. It's called the Volkswagen i.D. - and it could be key to Volkswagen maintaining its identity as a modern carmaker who has managed to drive into the future despite being tailgated by scandal today. In the weeks leading to the Paris Motor Show, the carmaker had said it was set to unveil a concept car "as revolutionary as the Beetle was seven decades ago" - leaving many eager to see the vehicle but wondering whether it would be enough for Volkswagen to leave an uneasy year in the dust. A full 12 months after the news that Europe's biggest carmaker cheated on emissions tests for its diesel cars in the US, fresh allegations continue to tail Volkswagen, amid a tightening tangle of litigation. But at the Paris Motor Show, Volkswagen brand chief Herbert Diess was the picture of confidence. Fast development The i.D is something of a pet project of his. According to Diess, a small team within Volkswagen developed the car at the lightning speed of about eight months. And the cars are set to be road-ready as soon as 2020 - each at a 30,000-euro-price tag. That kind of accelerated timeline might be possible because of the changes Diess himself has pushed for in his year as Volkswagen CEO - like a more decentralized production process and more independence for Volkswagen's R&D teams. Indeed, Volkswagen's traditionally very top-down structure is often seen as one of the conditions that gave rise to the cheating, as teams within the carmaker struggled to carry out management's ambitious and inflexible plans. Fallout from the scandal has only widened since then, with renewed hits to Volkswagen's image as late as this week. On Monday, Audi, the Volkswagen group's most profitable brand, bid goodbye to development chief Stefan Knirsch, who left the company after it emerged that he knew about the installation of so-called "defeat devices" in Audi cars which allowed the models to show more favorable levels of emissions during testing than they actually had. Knirsch's departure could be an indication that the cheating was a more generally-known affair within the group. Citing insiders, German media have reported that a probe into Audi chief Rupert Stadler's own awareness of the cheating turned up with little. Still, who knew what and when will remain the key question posed by regulators, plaintiffs, consumers and shareholders in the tedious search for accountability. As such, Volkswagen has to find the balance between forging its future and dealing with the clouds of its past. But industry observers point out that Volkswagen had been working on electric vehicles for years. The Dieselgate scandal, while painful, has helped the carmaker to solidify its strategy,said Ian Fletcher, the principal automotive analyst for consultancy IHS Markit. "Fundamentally, Volkswagen is still a car company. It needs to move forward, it needs to show more products," said Fletcher. "The electric vehicles were always going to be part of its strategy, given emissions regulations, and consumer interest in the area." Demand for e-cars and hybrids stagnates Demand for alternative fuel vehicles in Europe remains stagnant. In the second quarter of 2016, new registrations only went up by 0.6 percent across the EU. That's about 148,000 new e-cars spread across 28 member states. (07.09.2016) Batteries are hitting physical limits The performance of today's lithium-ion batteries can't be improved much further. Grand hopes for the future of e-vehicles now depend on driving down battery prices and on prototype silicon-air super-batteries. (04.08.2016) E-car concepts set to steal the show in Paris Europe's first auto show of the season is kickstarting in Paris on Thursday. Most automakers are showcasing their e-cars at the event. DW takes a look at some of the models and concept cars. (28.09.2016) BMW to electrify its most popular models BMW is rethinking its electric car strategy. Amid lackluster sales of its all-electric i3 and hybrid i8, the automaker is reportedly planning to launch electric versions of its 3 Series, X4 and Mini Cooper. (12.09.2016) Author Janelle Dumalaon Related Subjects Volkswagen (VW) Keywords Volkswagen, VW, iD, Paris, motor show Permalink https://p.dw.com/p/2Qi2q Shanghai motor show: German automakers shrug off China slowdown 16.04.2019 Despite China's car sales falling for nine months, German automakers are betting on new electric models to boost market share. Further headwinds could emerge when Beijing's generous electric car subsidies end next year. Ex-VW boss Martin Winterkorn charged in Dieselgate scandal 15.04.2019 German prosecutors have charged former Volkswagen boss Martin Winterkorn in the diesel emissions scandal. The charges include one of major fraud. The news coincides with VW showcasing its wares at the Shanghai auto show. Paris Motor Show: Carmakers brace for uncertain future 03.10.2018 Auto industry executives gathering this week for the Paris Motor Show see plenty of reasons to worry: from global trade tensions to challenges posed by e-cars and stringent emissions targets. Janelle Dumalaon reports.
cc/2019-30/en_middle_0028.json.gz/line13119
__label__wiki
0.837929
0.837929
Graham McConnell Predestination Review Predestination's trailer is one of false hopes. Gunplay and explosions are ever present, interspersed with a time travel element made to look like Time Cop 2, only without the splits of JCVD. Time Cop 2 may be overselling it (or under selling depending upon how much you like dumb action movies), but the trailer was misleading. It's still, definitely intriguing, but it's a completely different, and a more than pleasantly surprising experience once you actually watch it. Plot - Predestination Review If is very difficult to explain the plot of Predestination without giving away vital information that would ruin the experience. That said, it's not just the twists that make the movie, but how they are intricately woven together to tell the story. There are two mysteries, one, who is the antagonist, and two; what the hell does a particular conversation (near the beginning of the film) have to do with the first mystery? The first few scenes sets up Ethan Hawke's character and create the conflict with some action, but after this initial setup the film's tone changes considerably. Hawke's character, is sent back in time, but it's not clear exactly why this particular date and location was targeted. A bomber is loose and he's looking for any information to help him catch the Fizzle Bomber before the "next" strike. What unfolds is absolutely brilliant, and has quite the proverbial "twist." Predestination jumps into and from several different time periods over the course of the film all while being connected by the storyteller's autobiography. What follows is the story of someone who's had a tough, but accomplished upbringing that leads to a series of "aided" events that literally transforms them. And that's really the journey, it's not the mystery of the bomber, it's how a particular character fits into it all. The Future Is Clean - Predestination Review Predestination is filmed very cleanly. There are very little grand exterior shots, no slow motion, but everything is sharp. There are a few clever shots thrown in, shots that help to create mystery by only showing specific angles of a scene which hide a character. There are shots that come in very tight on a character to illustrate helplessness and pain. The most effective piece of cinematography are the differences between time periods. The cinematography of Predestination makes the ability to discern between time periods simple by the filters of applied to each. Partly due to the set design, the clean look of the future is bright and white. The scenes in the past are appropriately colored to match the bland attire and interior decorations with olive drab among brown and yellow variations. It can be subtle and subliminal but effective. Partly due to the complicated story telling and plot, the music does nothing to standout. The musical themes are unmemorable, but not necessarily poor. The film's score certainly does nothing to harm the overall value of the film. An infrequent Explosion - Predestination Review Ethan Hawke gets top billing, and he's fine, but Sarah Snook is the standout performer in Predestination. Her role is so complicated (which cannot be explained without spoiling the film) that the transformation her character takes is benefited from her ability to project many different traits. Predestination isn't a film where there are a lot of performances to begin with, so if Snook's didn't stand out, it would absolutely dilute the film's quality. Hawke as an undercover agent does get a chance to apply multiple character traits as well. His take on a bartender in search of the Fizzle Bomber is natural and charming versus his take as a more traditional "cop." There are some emotional moments, and like previously stated, Hawke does well to convey them, but he is overshadowed by Snook. The Real Predestination - Predestination Review Predestination Review Reflection For fans of a thinking man's, mind bending science-fiction, this adaptation of a Robert A. Heinlen short story is a satisfying film. The trailer is misleading, and unfortunately that may have mismarketed the film as an action film, when what Predestination does is ask questions about destiny and fate, and whether or not those are variable outcomes or predetermined. Defy Expectations and See This Film Newer PostThe Signal Review Older PostRanking Michael Mann Films Best Submarine Movies Best Mission: Impossible Movie - Ranking the Series 13 Assassins Review Bone Tomahawk Review Colossal Review Best Cyberpunk Movies The Alien Movies Ranked: Best in the Series Guilty Pleasure Movies The Signal Review
cc/2019-30/en_middle_0028.json.gz/line13124
__label__wiki
0.555551
0.555551
Supernatural: The Raid "We'll walk away. Go back to the way things were, the way things are supposed to be. Hunters and vampires, cops and robbers, a fair fight." They did it again. They came up with a new idea. Why not go corporate? Yes, of course I feel massive resistance, but that is probably because I love Supernatural as it is. My Supernatural is about Dean and Sam hunting monsters, about the Winchesters and their tragic lives. If the British Men of Letters truly have a way to wipe out monsters everywhere in North America (I'm assuming that includes Canada), what exactly is wrong with that? What's wrong with the idea of Dean and Sam having a life, of Sam going back to law school, of Dean maybe starting his own garage and working on classic cars, of wives and kids and the whole nine? This completely explains why Mary joined up in the first place. We know that the hunter life is never what she wanted for her children. What mother would? Dean saw her joining up with the British Men of Letters as a personal betrayal, but she's been fighting for a future for her boys all this time. It makes perfect sense. I should have realized. Sam would be good at it, too. The entire BMoL temporary storage container bunker would have been wiped out if it weren't for Sam taking command. I almost liked Mick this time, too, for being so clever and quick about getting that bullet for the Colt into Sam's hands. It's obvious that, if the BMoL are depending on traitorous idiots like Pierce Moncrieff, they are in desperate need of the leadership and practical experience of hunters like Dean and Sam, and points for them, they're even aware of it. But... the very idea of our Winchesters joining a huge organization turns the primary focus of this series on its ear. What about the upper management, the "old men" in England, whom I can't help but see as the Supernatural version of the ineffective, idiotic Watchers' Council on Buffy? What about Lady Toni torturing Sam the way she did? Not to mention the fact that they deliberately employ psycho killers like Ketch? Despite the way Ketch was acting all buddy buddy with Dean and bringing him expensive scotch and we're all psycho killers together, Dean is not a psycho killer, and he'll never fit in with them. Much of this episode was exciting and a lot of fun. I enjoyed seeing Mary and Sam work together so well in such dire circumstances, and of course, they fought rings around Mick and his inexperienced team. Did I believe it when Sam was offering to make a deal with the Alpha Vamp? No, it didn't sound like something Sam would ever do. But the bit with the Colt and the slomo death of the Alpha vamp was very cool. With that as a possible exception, the best scene in the episode was the opener when Dean finally had enough and showed Mary the door. Amara gave Dean his mother back, but it has been far from the joyful gift it could have been. How painful has Mary's constant rejection been for Dean? Maybe less so than for Sam, our peacemaker, who never knew Mary at all when he was little, but I was relieved that Sam took Dean's side. I would expect him to do that. Will Dean be able to let go of his resentment and join the BMoL? It's an interesting situation. Dean does not play well with others, and he won't like anyone telling him what to do. He might not do it for Mary. Maybe he'll do it for Sam. But will it work out? I'm going to go out on a limb and say no. Bits: — The storage container temporary base seemed out of place for the BMoL. You'd expect them to pick up a gorgeous old estate off in the woods somewhere. — Farewell to Rick Worthy as the Alpha Vampire. He goes pretty far back to season six: "Live Free or Twihard," "Family Matters" and season seven's "There Will Be Blood." Honestly, I wish they'd found time to write a bigger plot arc around him. — Hunter and traitor Pierce Moncrieff, who once knew our guy Rufus, survived but was taken away in chains. What's going to happen to him? Not that he deserves tea and scones for betraying the human race, but seriously? — Aaron Douglas and Rick Worthy both played important characters on Battlestar Galactica, so this episode was a Battlestar reunion. — This week: the MoL bunker, the Morest Motel vampire nest in Wichita, Kansas, and the BMoL temporary headquarters, which was where? Was it in Kansas, too? Kansas is centrally located, and probably where the BMoL would set up. Sam: "A hunter got killed." Mary: "You think I don't know? I'm the one who burned his body. I'm the one who told his wife. I watch him die every night." Dean: "Good." Dean: "How about once, you just try and be a mom." Mary: "I am your mother. But I am not just a mom, and you are not a child." Dean: "I never was. So between us and them..." Mary: "It's not like that." Dean: "Yeah, Mary, it is. And you made your choice. So there's the door." Sam: "You know, I dig the whole low-budget Mission Impossible vibe, but I'm gonna head back." Alpha Vamp: "You've killed so many of my children. I've seen your work... in England. I didn't get involved because, well, it's England. But America, yes. America is my home. And it is time that you Get. Off. My. Lawn!" Good one, and food for thought. Three out of four Mission Impossible vibes, Billie Doux has been reviewing Supernatural for so long that Dean and Sam Winchester feel like old friends. Courageous, adventurous, gorgeous old friends. Supernatural season 12 Supernatural home Labels: :S12.E14, Billie Doux, Supernatural, Supernatural reviews, The Raid While I do completely understand Mary's reasoning, even if I think she's going about everything horribly and doesn't understand her sons at all, Sam really puzzles me. He's about to go to work for a group of hunters (they may use fancier titles but that's what they are at the end of the day) that wants to eradicate all supernatural creatures from the face of the Earth (they said America but you just know their endgame is the world), regardless of whether or not they've even done anything to deserve it. Where's the Sam Winchester who actually has compassion for people who are trapped in situations they have no control over? Sure, a lot of the creatures are evil but not all of them. Does't Sam remember when HE was the one being targeted as a creature by a group of hunters who figured out he had powers and set Lucifer free, the same group that subsequently tried to torture him and force-feed demon blood down his throat? Those guys were using Mick's logic to a tee, that if something is unnatural you should just kill it, regardless of any evidence of wrongdoing. If he really is forgetting all that just so he can have a normal life, I'm highly disappointed. Friday, March 3, 2017 at 6:02:00 PM PST I really hope they will reveal what the 5 immune entities are. Especially now that they introduced Amara making her the second obvious inclusion after God which leaves 3 open spaces and that means all creatures that come in 4s (Horsemen, Archangels) are no longer eligible which means tehy could technically finally kill Lucifer for good. Saturday, March 18, 2017 at 11:38:00 PM PDT Oh I'm so frustrated. It's not that I don't like the story arc, I do, but I'm very frustrated with the decisions Mary and now Sam are making. It's like the brits are invading America and "ok, I'm in". What? No! I actually rooted for the Alpha on this one, and I'm disppointed in Sam. He's the first one who learned about grey in this profession, the one who let Lenore go safely, just to say one. The Winchesters know not every monster is, actually, a monster, and they have learn how to make a difference and who to kill. They are not the extermination kind of people, there is justice in their actions, and none in the Bmol ones. So yes, I can see how Mary can be tempted -she has been raised in a black-white vision of hunting, and I can understand her motives- but come on, 12 years have passed, do you really think Sam can just go back to law school? I don't. I think Sam has found his call, his purpose in hunting, and if you take it from him -same as Dean- I don't think he can have just an apple pie life. Is not who they are, not anymore, and Mary is so focused in other stuff she has not taken time to understand her boys, to know them. So yes, I'm disappointed in Sam this time. Come on, what are you gonna do when they send you on Garth's pack? On Lenore nest? On Rowena, or Crowley? On Kate? Have Sam thought this trough? Dean is usual Dean, needing to punch something andndrink, just as he always do when he is upset. And yes, he is a killer, and he enjoys his work, but he's not a psycopath like Ketch, he has his values and a moral and thank God he hasn't the Mark of cain anymore. I liked the Dean bit with the vampire girl, he shows what's lacking in anyone else, compassion. And compassion is a very important and lovable quality in the brothers. I liked the ep, very much, even if I'm sorry to see the Alpha die ("see you next season" not anymore, pal), but I'm frustrated. Three out of four broken anti vampires device. And thank you, Billie, for the reviews. They are always very good and are my favourite thing to read after an episode, to win a bit of distance and understand what I really thought about them. Sunday, February 24, 2019 at 6:46:00 AM PST This was a good episode. But I do hope Sam retains his view that not all monsters are evil. I have a feeling he is going to maybe sabotage BMOL. As even though there end game appears to be getting rid of the supernatural threat but I feel that they have something more planned. In regards to pierce I feel ketch just took him out and killed him and I am surprised Sam and dean allowed that to happen. Thursday, March 28, 2019 at 3:27:00 AM PDT
cc/2019-30/en_middle_0028.json.gz/line13127
__label__cc
0.673492
0.326508
Dreamers Are Us Information about Deferred Action for Childhood Arrivals (DACA) for DREAMers. Update November 2014: At this time, there are no plans for a DREAM Act to legalize DREAMers. It also does not appear that there will be Comprehensive Immigration Reform either any time soon. Instead, eligible DREAMers of all ages can apply for Deferred Action for Childhood Arrivals (DACA). This is being done through an executive action for President Barack Obama of the United States. It does not provide any permanent legal status and you cannot travel freely outside the country, but you are able to work legally using your own valid Social Security number and you cannot be deported simply for being present illegally in the USA. Obsolete Information below for reference purposes For the so-called DREAMers, essentially undocumented aliens who arrived legally or illegally to the United States as children (minors), the process of legalizing to the RPI status is somewhat different than that for other immigrants. It seems that since many of the most desirable elements of the DREAM Act have now been incorporated into the Border Security, Economic Opportunity, and Immigration Modernization Act of 2013, there will not be a separate act of Congress as such. As such, the following topics answer all the questions related to legalization for DREAMers: RPI visa process for DREAMers RPI visas for DREAMers in removal RPI status advantages RPI visas as family RPI status for deported immigrants DREAM Act green card How will illegals become legal under Obama immigration plan? DREAMers green card and citizenship Obama Amnesty LPI visa details Documents needed for file application for RPI by non-DACA DREAMers Docs for RPI status application for DACA approved DREAMers What should a DREAMer do if I made a false claim to US citizenship From the latest proposals before Congress, it appears that there will not be a separate DREAM and/or ACHIEVE Act. At this time, all illegals will be processed under one Comprehensive Immigration Reform Bill, though, with different paths for legalization and citizenship depending on the conditions of entry. The current bill calls for a faster track to green card and citizenship for the DREAMers, which will be accomplished by their completing separate USCIS forms and providing evidence proving that they entered America as children. This is a place to get all latest news and articles related to whichever law Congress considers, whether the DREAM Act or ACHIEVE Act (being pushed by Senators Kay Baley Hutchinson, John Kyl, and Marco Rubio). Whenever the law is signed by the President Obama, I will also provide complete details on the forms and process to get approved for W-1 visas. Below are the links to the latest updates: What type of documents and fees will be needed for DREAM Act application Majority of Americans support DREAM Act ACHIEVE Act legislation in Congress What are W visa types Implications of ACHIEVE Act Should I wait for DREAM Act to pass Will ACHIEVE Act replace DREAM Act DACA program is currently operating under a lot of uncertainty. However, you are allowed to renew your EAD permit and work legally, though, you can no longer exploit the Obama loophole to use advanced parole and become a citizen. Keep your eyes here for latest developments and prepare to act at short notice. Information on this page is NOT legal advice. Only when you pay an immigration lawyer (and not a notary or notario), you have an attorney client relationship for legal counsel. Please hire a lawyer; immigration is too important a matter to do it yourself. What is the future of DACA in 2018? This blog does not provide legal advice and the content here is not a substitute for professional legal advice. Each case is unique and only specific legal advice from an attorney with whom you have an attorney-client relationship can answer all the questions. Content on this website is not created by legal professionals in the United States. In fact you would be doing enormous harm to your case if you were to use information available on the Internet to make decisions about your case. Please seek a lawyer and discuss all the facts of your case before making a decision. The attempt here is to only provide general information related to DACA and Comprehensive Immigration Reform as part of Amnesty to illegals. Also included is information for illegal and undocumented immigrants or DREAMers who came as children to America and dream of becoming American citizens. Help on how to apply for or renew a work permit document or EAD card under the Deferred Action for Childhood Arrivals Process (DACA) eventually to apply for DREAM Act. Undocumented aliens can, thus, get their renewal papers and Social Security number to live and work legally.
cc/2019-30/en_middle_0028.json.gz/line13132
__label__wiki
0.808972
0.808972
EghtesadOnline: The Persian Gulf Petrochemical Industries Company is looking closely at ways to add value to its output and is building petrochemical plants estimated to cost $8.5 billion, the managing director said Thursday. Speaking at the groundbreaking ceremony of a petrochemical project in the southwestern city of Andimeshk, Khuzestan Province, Jafar Rabiei said three major complexes would come on early next year, the Oil Ministry news website Shana reported. “Bid Boland Gas Refinery in Khuzestan, urea and ammonia units of Lordegan Petrochemical Complex in Chaharmahal and Bakhtiari Province, and two olefin plants at Ilam Petrochemical Complex, costing over $4 billion will be launched next year,” he said. “Completing unfinished projects is on the agenda of the PGPIC,” Rabiei added. Gachsaran Petrochemical Company in Kohgiluyeh and Boyer-Ahmad Province is another such venture expected to be commissioned by 2020, according to Financial Tribune. Previously, the petrochemical industry focused on the upstream sector, but the policy now is to develop downstream projects, the company boss noted and referred to ethylene and urea as products that have a bigger profit margin. Construction of the Andimeshk Petrochemical Complex is one example of the PGPIC shift on the downstream sector. “It will help create more value-added in the petrochemical industry as its products are more profitable than ethylene,” Rabiei said. The complex will be fed by ethylene produced at South Pars Gas Field and will annually produce 300,000 tons of ethylene oxide, glycol ether and ethanolamine to be used as feedstock for hygiene items, detergents, and additives in textile, cement, gas sweetening, refining and petrochemical industries. Over the past six years and thanks to the completion of several South Pars Gas Field phases, there has been an abundance of ethane and ethylene supply. Collecting APG Rabiei added that the PGPIC had finalized a deal with the National Iranian South Oil Company for collecting associated petroleum gas in oil-rich regions. “The petrochemical industry has joined the National Iranian Oil Company for collecting flare gases which are of high value.” Collecting APG from oilfields has been a priority of the Oil Ministry and according to plans almost 90% of the APG will be collected by 2022. In three years flaring should come to a permanent end and will be used as feedstock for the rapidly expanding petrochemical industry. Raising Output Also addressing the groundbreaking event, Oil Minister Bijan Namdar Zanganeh said the domestic petrochemical industry is growing rapidly and next year for the first time there will be feedstock surpluses for petrochemical projects. Currently, 30 million tons of petrochemicals worth $20 billion dollars is produced in Iran, which can cross 45 million tons within two years, provided ongoing projects come online. Zanganeh said there are plans to invest $6.5 billion in petroleum projects with help from domestic resources. He said a total of 100 million cubic meters of natural gas was added to production capacity in the current calendar year that ends on March 20. Approach Iran petrochemical plants petrochemical sector Value-Added Iran Petrochem Industry Profit Margins High Iran's Capital Market Outperforms Other Sectors Oil, Condensate Offer on IRENEX Before Yearend Iran's Trade Deficit With US Highest Over Past Decade UK Envoy Talks Trade in Tehran
cc/2019-30/en_middle_0028.json.gz/line13139
__label__cc
0.628453
0.371547
Majors and Degree Programs/ Transfer Opportunities/ /Amarillo College Amarillo College Transfer Partnership Program Options Eastern New Mexico has established 2 plus 2 programs (2+2) to allow students to continue their educations by transferring college credits to Eastern New Mexico University-Portales. This is a bachelor's degree program that ideally requires 2 years at Amarillo College and 2 years at Eastern New Mexico University-Portales, to complete. These are specific degree plans drawn up between ENMU Portales and Amarillo College for certain academic programs. There are a clear set of courses to take at each school in order to satisfy the overall program requirements and obtain your degree. In addition, some classes for the ENMU degree are taught at Amarillo College, which assists Amarillo College students in an efficient path to their bachelor's degree. Please note that if documentation is posted on these pages, it may not provide the most current information. Both Amarillo and Eastern New Mexico University-Portales are always working to upgrade programs, so the posted materials should be considered a guide only. Contact the specific department you are interested in for the most current information. ENMU's partnership with Amarillo College includes the following 2+2 programs. 2+2 Programs AA in Art to BFA in Art, Visual Arts Emphasis AS in Biology to BS in Biology (General Biology) AS in Biology to BS in Biology, Ecology, Evolution and Organismal Biology (EEOB) Emphasis AS in Biology to BS in Biology, Microbiology, Molecular Biology and Biotechnology (MMBB) Emphasis AS in Biology to BS in Biology, Pre-Medicine Emphasis AS in Business Administration to Bachelor of Business Administration (BBA) AS in Computer Information Systems to Bachelor of Business Administration, Information Systems Emphasis AS in Criminal Justice to BS in Criminal Justice AS in Engineering Computer Science to BS in Computer Science AA in English to BA in English AS in Mass Media to BS in Communication, Broadcast Production Emphasis AS in Mass Media to BS in Communication, Journalism Emphasis AS in Mass Media to BS in Communication, Public Relations Emphasis AS in Mathematics to BS in Mathematics AS in Psychology to BS in Psychology AA in Religion to BA or BS in Religion AS in Social Work to Bachelor of Social Work (BSW) AS in Theatre to BS in Theatre Coordinator, Transfer Center
cc/2019-30/en_middle_0028.json.gz/line13141
__label__wiki
0.713665
0.713665
2017, pp. 528, e-Book Translated by: Antony Shugaar Region: Italy Paper edition Paper edition Paper edition In Ostia, a depressed coastal settlement twenty miles from the powerful and corrupt city of Rome, a mighty local crime family, the Mafia, corrupt politicians, and new rabid criminal elements battle each other for a billion-dollar payoff. Suburra will be released as a Netflix original series in 2017. During the final days of Silvio Berlusconi's reign, a massive development proposal that will turn Ostia into a gambling paradise, a Las Vegas on the Mediterranean, is winding its way through the Italian legislature thanks to the sponsorship of politicians in the pay of crime syndicates with vested interests. In short, it's business as usual in the Italian capital. But a vicious gang of local thugs loyal to nobody but themselves is insisting on a bigger cut than agreed upon. They argue their case quite convincingly, but the Mafia and their political puppets aren't likely to back down without a fight. De Cataldo and Bonini have created a compelling, provocative portrait of contemporary Rome--a city prey to pitiless criminal factions and political opportunism. A fast-paced and atmospheric work of crime fiction, Suburra rivals the best novels by writers such as Denis Lehane, Richard Price, and George Pelecanos, and successful series like The Wire and The Night Of. Carlo Bonini Carlo Bonini was born in Rome in 1967. He is a staff writer at the Italian national daily, La Repubblica. Giancarlo De Cataldo Giancarlo De Cataldo is the author of the bestselling novel, Romanzo Criminale, an essayist, the author of numerous TV screenplays, and a judge on the circuit court of Rome. 14 Books to Read this August — Literary Hub “this contemporary noir will appeal to readers intrigued by gangland crime, big-city corruption, and how Italy actually ‘works.’’ — Library Journal (Starred Review) “Rome...in all its history, glory, and despair, is skillfully sewn into the fiber of the tale.” “unflinching look at real-life widespread corruption in Italy.” Whether you’re traveling to exotic locales this summer or in the mood for some deck-chair travel, you can find the perfect novel with which to while away the long summer days below. Jean-Claude Izzo The Father and the Foreigner Tiziana de Rogatis Elena Ferrante's Key Words A lighted path made of luminous key words that synthesize the multiform aspects of Ferrante’s writing and guide us through the labyrinth of her... Incidental Inventions “This is my last column, after a year that has scared and inspired me.” Marco Malvaldi The Measure of a Man Five hundred years after Leonardo’s death, Marco Malvaldi combines literature, science, history, and mystery to bring back to life one of the greatest... Helena Janeczek The Girl with the Leica The Girl with the Leica is a must-read for fans of historical fiction centered on extraordinary women’s lives. Andrea Marcolongo The Ingenious Language For word nerds, language loons, and grammar geeks, an impassioned and informative literary leap into the wonders of the Greek language. Piero Boitani A New Sublime Boitani’s presentation of the classics is as entertaining and unexpected as it is informative. He invites the reader to discover the timeless beauty... The Double Mother From the author of the “wonderfully ingenious” (Marilyn Stasio, New York Times Book Review) novel After The Crash comes a brilliant... Liam McIlvanney The Quaker It is 1969 and Glasgow is in the grip of the worst winter in decades. But it’s not the weather that has Glaswegians on edge: a serial killer is... Sharp, dark, and taut, The Night of Rome is fiction that sails dangerously close to the wind of current events. Book 3 in de Giovanni’s bestselling “Bastards of Pizzofalcone” series is set in contemporary Naples during season of cold winds, political... The second thrilling installment in the Harry McCoy series. “McCoy is so noir he makes most other Scottish cops seem light grey.”—... Little Criminals “A great story... relentless and brilliant.”—Roddy Doyle
cc/2019-30/en_middle_0028.json.gz/line13147
__label__wiki
0.684136
0.684136
Boeken > Alfabetisch overzicht > Helensburgh in old picture postcards volume 2 Helensburgh in old picture postcards volume 2 : Patricia M. Drayton : Strathclyde : United Kingdom Levertijd: 2-3 weken (onder voorbehoud). Het getoonde omslag kan afwijken. Fragmenten uit het boek 'Helensburgh in old picture postcards volume 2' << | < | 1 | 2 | 3 | 4 | 5 | 6 | 7 | > | >> HELE~SB(;RGH rRI~CES ST REET 29. This undivided back, dated 1903 shows Princes Street devoid of traffic but full of children at play. On the right can be seen the little umbrella shop owned by Miss E. Walker. This shop sold umbrellas, walking sticks, leather goods and a few small toys. It also offered an umbrella repair service. The shop was also well-known as aServants Registry. This was a forerunner of today's Job Centre. The difference being that here both ernployer and employee paid a fee on registering and another when suited, so it was a nice little side line for the business. A sm all green urnbreIla hung above the shop, it was a target for sm all boys throwing stones. When this business was bought in 1971 by Lilly's (called after Rhet Lilly of the famous handbag shop) they moved into other premises on West Clyde Street, taking the little urnbreIla sign with thern. It has been repaired, repainted and still hangs above the shop as it has done for 85 years. 30. This card dated 1910 just carried the message 'Ye Ken Whae Frae' and no signature. It shows Upper Sinclair Street just below the High Station. The house on the left is Northwood House, bought at one time for only J::SOO. Today it is a residential home for the elderly. Note the Post Office delivery barrow and the postman leaning on it. At this time the postmen had very heavy uniforms and their hats resembied those worn by the French Foreign Legion. Note all the ladies have their parasols up and the children on the opposite side of the street are wearing huge sun bonnets. 31. 'The Castie' on East Clyde Street. This quaint old building was demolished many years ago. It was christened 'The Castie' . The shop was listed in the Trades directory as a greengrocers, but it was a general store, selling everything from sweets to paraffin for lamps. The owner lived in the back shop, with just a curtain separating from the selling area. At one time there was a shop next door which sold antiques and secend-hand jewellery. One locallady teils the story of how, as a young girl in her first job, she fancied a bracelet in this window. She saved up to buy it and when she did so she found that the charm which she thought to be a threepenny piece was really a groat. This was an English silver coin worth fourpence. After 1662 this was only coined as Maundy Money. She still treasures her unusual charm bracelet. 32. This card in the Reliable series is dated 1909. It shows Helensburgh from the pier. The small boats probably belonged to the three main boat hiring families in the town: the Mundies, the MacGettricks and the Mackechnies. At one time seven fleets of boats plied their trade on the seafront at Helensburgh. The MacGettricks had three motor boats and the Mackechnie brothers a motor baat each. It cast 6d per hour to hire a boat or 2/6 for a whole day. Several people seem to be waiting at the pier, probably for a steamer. 33. This card is one of the Heraldic series. Most towns had cards with their town's coat of arms pictured on the front. This is the older version of the Burgh Arms, it has the shield divided vertically instead of horizontally. The engrailed saltire and the animal supporter is taken from the Colquhoun family arrns and the stars and human supporter come from the Sutherland arms, thus combining the crests of Sir James Colquhoun's family with th at of his wife, Lady Helen, who was a member of the Sutherland family. 34. This card, addressed to Mr. Rae in Calcutta, India, was posted in Helensburgh in 1915. It is a charrning study of West Clyde Streel. The horse and cart making its unhurried way along the street was probably a coal cart belonging to A. and R. Spy, coal merchants, whose premises were situated in Sinclair Street. This firm had several horses and they were stabied in the coal yard so that customers, when calling to pay their accounts, could, if so minded feed sugar lumps to the animals and chat with their handlers many of whom were real 'pawky' characters and all devoted to 'their' particular charge. The general favourite was 'Darkie' , a handsome Clydesdale and a real 'Black Beauty'. There was a great rapport between these horses and their handlers. Note how freely they are walking along side by side; the handler is not touching the animal, using no restraint, just controlling it with his voice and gestures. These coal horses knew which houses to stop at and would do so without being forced. They got tit-bits from some of the customers and they knew which houses these were given from, and would wait until they were forthcoming before moving on. The building they are seen passing is Flower Bank, a charming little property on West Clyde Street and William Street corner. It is listed Category C. 35. This handsome red sandstone building at 28 Colquhoun Street is today being used as a hairdressing salon, known as 'A Cut Above'. The owner lives in the flat above the shop. This building dates from 1859 when Mrs. Dixon (née Gay), her husband, and Mr. Heetor Gay (possibly her brother) bought 6 lots of land with a view to building houses. In 1879 1,007 square yards of ground on Colquhoun Street was eonveyed to Heetor Gay by the other two, with a house on it known as Gay Cottage. In 1908 Heetor Gay conveyed 368 square yards of ground together with Gay Cottage to the Helensburgh and Gareloch Liberal Assoeiation with a ground rent of H8 per year. The remainder of the ground was sold to the Christian Brethern who built the Bethesda Hall on it around 1930. The Liberal Association had their headquarters there until1948 when they sold the property to the Red Cross Society, who then used it as their headquarters unti11980. It was then sold to a Mr. Dayman and Mr. Darke, who then sold it to the present owners in 1983. This building in its lifetime has had many uses, and was at one time the site of a Shirt faetory, but this was a short lived venture and it soon closed down. The little building beside the salon is the new Bethesda Hall. Their eentre is built on the site of Gay Cottage. 36. This card dates from about 1901. The Glasgow, Dumbarton and Helensburgh Railway opened in 1857 with a station at George Streel. By 1863 it had been extended to East Princes Streel. Cabs from the two earriage hirers Waldie and Co. and Frew met all trains. Opposite the station at 16 East Prinees Street was the business premises of Macneur and Bryden. In 1875 Mr. Samuel Bryden went into partnership with Mr. Macneur, buying premises from Mr. William Battrum, printers. Mr. Maeneur died soon after forming the partnership and Mr. Bryden then carried on alone. He built it up into a popular stationers, booksellers, newsagents and librarians, and in later years an estate agents. In June 1880 Mr. Bryden launched a loeal paper, ealling it 'The Helensburgh and Gareloch Times'. This popular little paper was sent all over the world, taking loeal news 10 exiles abroad. The thundering of the press was a familiar sound on East Prinees Street until1973 when the paper was sold to Universal Newspapers who cJosed the printworks and took the printing to other eentres in Seotland. The last owner of the business, Mr. Walter S. Bryden, took over from his father in 1959 and continued in charge untiJ it cJosed, after serving the local eommunity for 104 years. 37. This sepia eard, produeed by Valentine, shows the bathing pool on a very busy day. Perhaps it was during the Glasgow Fair Fortnight. Glasgow is just 22 miles from Helensburgh and it was an inexpensive trip to eome down and spend a day at the seaside. The pool was the gift of Baillie Andrew Buehanan in 1929, a year befare he beeame Provost. Warm sea water filtered in a continuous flow. There was plenty of room for bathers and spectators and sun bathers had a special endosure. Galas and floodlit swimming were regular events throughout the season. Qualified staff were in attendance to teach the art of swimming, lessans were arranged with the pondmaster. The pool dosed some years ago and another indoor pool opened nearby. The Granary Restaurant ean be seen on the eard. This was a popular eating plaee for locals and visitors. Also in the picture is the Old Parish Chureh doek tower. 38. This card, in the Reliable series, is dated 1904. It was probably posted during the Glasgow Fair Fortnight. The message on the back says: 'Thanks for card. All the houses here are full of Glasgow holidaymakers. Lovely weather, Great holiday Love A.R.' It is addressed to Miss Muir in North Wales. On the front of the card is printed 'The Esplanade, Helensburgh from the West' then the sender has added 'which looks a deal more lively just now than it is represented Glasgow Fairies'. Two ofthe 'fairies' are seen walking eastward along the Esplanade. Between the gable end of the small, low building and the large, tall building can be seen two white gateposts. In 1812 this was the lodge of Lady Augusta Clavering's estate, and marked the end of the town boundary. Today there is an ice cream parlour and café on the site which is called Augusta Lodge.
cc/2019-30/en_middle_0028.json.gz/line13148
__label__cc
0.736484
0.263516
Dispensers for Safe Water Deworm the World Evidence Action Beta Our Approach and History Our Board and Advisors What Is Evidence Action Beta Working On? Evidence Action Beta: What Are We Working On? So what is our brand-new program Evidence Action Beta working on? As is true for many beta projects, we fully expect that some of these programs will not progress beyond the current stage as we learn more about them. We aim for one or two new programs at Evidence Action to be identified over the next year that meet our rigorous filters on the “path to scale.” YOUNG 1OVE: INNOVATIVE HIV EDUCATION In Botswana 21 percent of adults (aged 15-49) are living with HIV/AIDS. Similarly high rates of infection are seen throughout Southern Africa. Teenage girls that engage in sex with older men are more susceptible to infection, since 25-year-old men are more likely to already have HIV than 16 year olds. Programs aimed at addressing risky sexual behavior have the potential to protect against the spread of HIV and reduce rates of adolescent pregnancy. In a rigorous evaluation in Kenya, youth were given information on the increased risk of HIV/AIDS disaggregated by age and gender, resulting in a 28 percent reduction in adolescent pregnancy rates. Do these results hold up in Botswana and elsewhere in the region where infection rates are the highest? Evidence Action is exploring partnering with Young 1ove, a non-profit based in Botswana, to implement an advocacy program aimed at reducing the spread of HIV/AIDS among youth. The Young 1ove program targets youth through primary school visits to promote curriculum on HIV/AIDS risk disaggregated by age and gender, with emphasis on the increased risk of infection from cross-generational sex. The pilot’s implementation will be accompanied by a rigorous evaluation in conjunction with the Baylor International Pediatric AIDS Initiative in Botswana and J-PAL Africa. The evaluation will test information delivery methods for program effectiveness and cost efficiency to inform the potential for a nationwide scale-up. NO LEAN SEASON: SEASONAL INCOME SUPPORT Seasonal income insecurity is a problem in many regions of the world for the very poor during the period between planting food crops and harvest time. For example, northern Bangladesh is at risk of significant income insecurity during three months leading to the winter harvest that affects very poor people especially. Researchers working in this region identified a simple and effective solution that took advantage of the relative abundance of employment opportunities outside of the famine-prone north during this lean season.They provided households a travel subsidy for work-migration during the lean season, allowing them to send a member away to generate income that would otherwise not have been possible. This resulted in significant improvements in household welfare (including consumption and nutrition) during the lean season, an effect that held even in subsequent years. Based on this evidence, providing these travel subsidies is a promising way to avert seasonal insecurity. We are investigating several critical questions to pressure test the hypothesis that alternative strategies to food aid may be effective and cost effective means of providing seasonal income support in Bangladesh and elsewhere. In collaboration with Innovations for Poverty Action and the original research team, we will test alternative strategies to allocate people to different destinations, local price effects of worker inflow to migration destinations; impacts on household well-being (marital harmony, intra-household allocation, possible introduction of disease by migrant member); and welfare impacts of the program on non-participating households. This work will help us explore unintended consequences that could arise if the program were implemented at a large scale, and understand how to develop a business model for this program. COMMUNITY HEALTH PROMOTERS: SIMPLE NUTRITION MESSAGING We are exploring the potential to use Dispensers for Safe Water’s existing rural delivery system to deliver nutrition information to targeted groups at a low marginal cost in order to reduce the impact of undernutrition and malnutrition on child health. The nutrition messaging program is modeled on the MaiMwana infant feeding intervention from Malawi. A randomized controlled trial found that the MaiMwana program led to significant reductions in infant mortality as well as improvements in height-for-age among young children. The nutrition information provided in the program was simple and non-technical; it’s possible that our promoters could be effective as information providers. Evidence Action is collaborating with evaluators to explore whether the initial results found in the Malawi context can be sustained at a larger scale with less intensive quality control. We will do this by using dispenser promoters for nutrition message delivery. G-UNITED: VOLUNTEER MENTORING FOR REMEDIAL EDUCATION Evidence Action is working with the Government of Kenya on G-United, a pilot program for post-university volunteers that aims to increase social cohesion, improve student literacy outcomes, and provide unemployed college graduates with professional skills. Rigorous evaluations conducted in India, Ghana, and Kenya have shown that an additional lightly trained volunteer working with remedial students can be a low-cost method of improving literacy and raising standardized test scores. Working closely with the Government of Kenya, we are supporting the development of a program intended to achieve these educational outcomes, as well as other important goals, with university graduates. The initial pilot that we are supporting will focus on strategies for recruiting a quality cohort of volunteers, creating compelling incentives for volunteers to engage consistently with the most vulnerable children, and measuring learning and other outcomes. PROJECT SAWA: SAFE WATER FOR HOUSEHOLDS THAT DON’T USE DISPENSERS (Update, April 2016: Project Sawa is currently on hold as we streamline our Beta portfolio) Evidence Action has an interest in understanding how to effectively target water treatment products to low-income households at scale, in order to expand our reach and impact beyond the current/planned catchment area of the Dispensers for Safe Water program. This could include operation in other countries where potential partner organizations work, or new strategies in areas where Evidence Action operates but where certain districts are not good candidates for chlorine dispensers (for instance due to population sizes). In 2007-08, a team of researchers found that requiring rural households to exert the effort of traveling to a nearby clinic or shop to redeem coupons in exchange for free bottles of dilute chlorine did effectively target the product to those who would use it for drinking water treatment. To investigate this idea in more detail, we are developing a series of strategies for allocating and redeeming coupons at scale. This involves thinking through how to transfer funds to shopkeepers, detect cheating, and monitor usage of chlorine. We are also exploring how to transfer our model of carbon crediting from dispensers to this alternative model. As we are launching Evidence Action Beta, we understand that some of our criteria will be be met by these projects we are looking at. As with many beta products, not all make it to a mass market. Evidence Action Beta will be transparent about what we are finding and what projects at scale we will be embarking on beyond Dispensers for Safe Water and the Deworm the World Initiative. We are excited to take a hard look at what works in development — for millions of people. Deworm the world initiative Fundraising Policies and Donor Rights Sign up with your email address to receive updates from Evidence Action. Envelope Facebook Twitter Instagram Youtube
cc/2019-30/en_middle_0028.json.gz/line13149
__label__cc
0.569058
0.430942
Detected contaminantsPollution sourcesEPA data City of Durango EWG's drinking water quality report shows results of tests conducted by the water utility and provided to the Environmental Working Group by the Colorado Department of Public Health & Environment, as well as information from the U.S. EPA Enforcement and Compliance History database (ECHO). For the latest quarter assessed by the EPA (July 2018 - September 2018), tap water provided by this water utility was in compliance with federal health-based drinking water standards. What about lead? Want to filter these contaminants out? contaminants detected above health guidelines other detected contaminants Includes chemicals detected in 2015 for which annual utility averages exceeded an EWG-selected health guideline established by a federal or state public health authority; radiological contaminants detected between 2010 and 2015. Bromodichloromethane cancer✕ Bromodichloromethane, one of the total trihalomethanes (TTHMs), is formed when chlorine or other disinfectants are used to treat drinking water. Bromodichloromethane and other disinfection byproducts increase the risk of cancer and may cause problems during pregnancy. Click here to read more about disinfection byproducts. THIS UTILITY How your levels compare HEALTH GUIDELINE: 0.06 ppb The State and National averages were calculated using the averages of the contaminant measurements for each utility in 2015. Health risks of bromodichloromethane in excess of health guideline The health guideline of 0.06 ppb for bromodichloromethane was proposed in 2018 by the California Office of Environmental Health Hazard Assessment as a one-in-a-million lifetime risk of cancer. Values greater than one-in-a-million cancer risk level can result in increased cancer cases above one in a million people. Testing summary by quarter ABOVE HEALTH GUIDELINE Utility Average 2015: 5.08 ppb Health Guideline Exceeded 2015: Yes Legal Limit Exceeded 2015: No Exceeded 5.08 ppb Yes No MORE TESTING DATA FOR THIS CONTAMINANT harm to the kidney✕ Cadmium is a toxic metal found in food and drinking water. It has been linked to kidney toxicity, bone damage, cancer, and damage to developing fetuses. LEGAL LIMIT: 5 ppb 0.00840 ppb 0.0500 ppb Health risks of cadmium in excess of health guideline The health guideline of 0.04 ppb for cadmium was defined by the California Office of Environmental Health Hazard Assessment as a public health goal, the level of a drinking water contaminant that does not pose a significant health risk. This health guideline protects against harm to internal organs. ABOVE LEGAL LIMIT Utility Average 2015: 0.0500 ppb 0.0500 ppb Yes No Chloroform, one of the total trihalomethanes (TTHMs), is formed when chlorine or other disinfectants are used to treat drinking water. Chloroform and other disinfection byproducts increase the risk of cancer and may cause problems during pregnancy. 0.4 ppb 11.4 ppb Health risks of chloroform in excess of health guideline The health guideline of 0.4 ppb for chloroform was proposed in 2018 by the California Office of Environmental Health Hazard Assessment as a one-in-a-million lifetime risk of cancer. Values greater than one-in-a-million cancer risk level can result in increased cancer cases above one in a million people. Utility Average 2015: 33.4 ppb 33.4 ppb Yes No 0.401 ppb Health risks of dibromochloromethane in excess of health guideline Utility Average 2015: 0.401 ppb 0.401 ppb Yes No Dichloroacetic acid Dichloroacetic acid, one of the group of five haloacetic acids regulated by federal standards, is formed when chlorine or other disinfectants are used to treat drinking water. Haloacetic acids and other disinfection byproducts increase the risk of cancer and may cause problems during pregnancy. Click here to read more about disinfection byproducts. Health risks of dichloroacetic acid in excess of health guideline The health guideline of 0.7 ppb for dichloroacetic acid was defined by the Environmental Protection Agency as a one-in-a-million lifetime risk of cancer. Values greater than one-in-a-million cancer risk level can result in increased cancer cases above one in a million people. Radiological contaminants This utility detected Radium, combined (-226 & -228), Radium-226 & Uranium. Radiological contaminants leach into water from certain minerals and from mining. Drinking water contamination with radioactive substances increases the risk of cancer and may harm fetal development. Total trihalomethanes (TTHMs) Trihalomethanes are cancer-causing contaminants that form during water treatment with chlorine and other disinfectants. The total trihalomethanes group includes four chemicals: chloroform, bromodichloromethane, dibromochloromethane and bromoform. 80 ppb Health risks of trihalomethanes in excess of health guideline The health guideline of 0.8 ppb for trihalomethanes was defined by the California Office of Environmental Health Hazard Assessment as a draft public health goal, the level of drinking water contaminant that does not pose a significant health risk. This health guideline protects against cancer. Trichloroacetic acid Trichloroacetic acid, one of the group of five haloacetic acids regulated by federal standards, is formed when chlorine or other disinfectants are used to treat drinking water. Haloacetic acids and other disinfection byproducts increase the risk of cancer and may cause problems during pregnancy. Click here to read more about disinfection byproducts. Health risks of trichloroacetic acid in excess of health guideline The health guideline of 0.5 ppb for trichloroacetic acid was defined by the Environmental Protection Agency as a one-in-a-million lifetime risk of cancer. Values greater than one-in-a-million cancer risk level can result in increased cancer cases above one in a million people. Includes chemicals detected in 2015 for which annual utility averages were lower than an EWG-selected health guideline established by a federal or state public health authority; chemicals detected under the EPA's Unregulated Contaminant Monitoring Rule (UCMR 3) program in 2013 to 2015, for which annual utility averages were lower than an EWG-selected health guideline established by a federal or state public health authority. Antimony is a naturally occurring metal that enters tap water from plumbing fittings and also from industrial uses, such as production of metal alloys, batteries and plastics. Antimony causes organ damage and shortens lifespans in studies of laboratory animals. Health risks of antimony in excess of health guideline The health guideline of 1 ppb for antimony was defined by the California Office of Environmental Health Hazard Assessment as a public health goal, the level of a drinking water contaminant that does not pose a significant health risk. This health guideline protects against change to the stomach and intestines. Health Guideline Exceeded 2015: No 0.0750 ppb No No Barium Barium is a mineral present in rocks, soil and water. High concentrations of barium in drinking water increase the risk of cardiovascular disease and hypertension. 700 ppb 2,000 ppb Health risks of barium in excess of health guideline The health guideline of 700 ppb for barium was defined by the Environmental Protection Agency as a children's health-based limit for 10-day exposure, a non-enforceable federal health advisory. This health guideline protects against harm to internal organs. 41.0 ppb No No Chlorate Chlorate forms in drinking water as a byproduct of disinfection. Chlorate impairs thyroid function, making chlorate exposure most harmful during pregnancy and childhood. 114.9 ppb The State and National averages were calculated using the averages of the contaminant measurements for each utility in 2010-2015. Health risks of chlorate in excess of health guideline The health guideline of 210 ppb for chlorate was defined by the Environmental Protection Agency as a benchmark for testing under the Unregulated Contaminant Monitoring Rule program. This health guideline protects against hormone disruption. Utility Average 2010-2015: 22.7 ppb Health Guideline Exceeded 2010-2015: No Legal Limit Exceeded 2010-2015: No Chromium (hexavalent) Chromium (hexavalent) is a carcinogen that commonly contaminates American drinking water. Chromium (hexavalent) in drinking water may be due to industrial pollution or natural occurrences in mineral deposits and groundwater. Read more about chromium (hexavalent). Health risks of chromium (hexavalent) in excess of health guideline The health guideline of 0.02 ppb for chromium (hexavalent) was defined by the California Office of Environmental Health Hazard Assessment as a public health goal, the level of a drinking water contaminant that does not pose a significant health risk. This health guideline protects against cancer. Utility Average 2010-2015: 0.01000 ppb 0.01000 ppb No No Chromium (total) Chromium is a naturally occurring metal, but industrial uses can elevate its levels in water. One form, hexavalent chromium, causes cancer. Total chromium is not a good indicator of the amount of hexavalent chromium in drinking water. Utility Average 2010-2015: 1.74 ppb 1.74 ppb No No Fluoride occurs naturally in surface and groundwater and is also added to drinking water by many water systems. 4 ppm 0.437 ppm ppm = parts per million. Utility Average 2015: 0.692 ppm 0.692 ppm No No Haloacetic acids (HAA5) Haloacetic acids are formed when disinfectants such as chlorine are added to tap water. The group of five haloacetic acids regulated by federal standards includes monochloroacetic acid, dichloroacetic acid, trichloroacetic acid, monobromoacetic acid and dibromoacetic acid. Molybdenum is a metal that occurs naturally in soil, minerals and water. People who ingest large amounts can have increased levels of uric acid and gout-like symptoms. Health risks of molybdenum in excess of health guideline The health guideline of 40 ppb for molybdenum was defined by the Environmental Protection Agency as a lifetime health-based limit for effects other than cancer. This health guideline protects against an increased risk of gout. Utility Average 2010-2015: 0.126 ppb 0.126 ppb No No Nitrate, a fertilizer chemical, frequently contaminates drinking water due to agricultural and urban runoff, and discharges from municipal wastewater treatment plants and septic tanks. Excessive nitrate in water can cause oxygen deprivation in infants and increase the risk of cancer. Click here to read more about nitrate. 0.14 ppm 0.0450 ppm Health risks of nitrate in excess of health guideline The health guideline of 0.14 ppm for nitrate was defined in a peer-reviewed scientific study by EWG and corresponds to one-in-one-million annual cancer risk level. Utility Average 2015: 0.0450 ppm 0.0450 ppm No No Nitrate and nitrite Nitrate and nitrite enter water from fertilizer runoff, septic tanks and urban runoff. These contaminants can cause oxygen deprivation for infants and increase the risk of cancer. Nitrite is significantly more toxic than nitrate. Click here to read more about nitrate. Health risks of nitrate and nitrite in excess of health guideline The health guideline of 5 ppm for nitrate and nitrite was defined by EWG based on studies by scientists at the National Cancer Institute and other independent researchers. This health guideline protects against cancer and harm to fetal growth and development. Strontium is a metal that accumulates in the bones. Radioactive strontium-90 can cause bone cancer and leukemia, and any form of strontium at high doses can harm bone health. Health risks of strontium in excess of health guideline The health guideline of 1,500 ppb for strontium was defined by the Environmental Protection Agency as a benchmark for testing under the Unregulated Contaminant Monitoring Rule program. This health guideline protects against harm to bones. Utility Average 2010-2015: 422.6 ppb 422.6 ppb No No Thalium is a naturally occurring metal released into the environment from metal smelting and coal burning. Exposure to too much thalium can cause hair loss, liver damage, reduced sperm motility and nervous system impairment. Health risks of thallium in excess of health guideline The health guideline of 0.1 ppb for thallium was defined by the California Office of Environmental Health Hazard Assessment as a public health goal, the level of a drinking water contaminant that does not pose a significant health risk. This health guideline protects against harm to internal organs. Utility Average 2015: 0.00833 ppb Vanadium is a metal used in steels and other alloys. People are commonly exposed to vanadium in water and food. Excessive exposure can be toxic during pregnancy and childhood. Health risks of vanadium in excess of health guideline The health guideline of 21 ppb for vanadium was defined by the Environmental Protection Agency as a benchmark for testing under the Unregulated Contaminant Monitoring Rule program. This health guideline protects against change in blood chemistry. Utility Average 2010-2015: 0.0803 ppb Click on each pollution source to see from which source contaminants come. byproducts Runoff & sprawl occuring Radium, combined (-226 & -228) Radium-226 Specific water contaminants can come from more than one source. City of Durango compliance with legally mandated federal standards From October 2015 to September 2018, City of Durango complied with health-based drinking water standards. in violation of any federal drinking water standard from October 2015 to September 2018 Information in this section on City of Durango comes from the U.S. EPA Enforcement and Compliance History Online database. Click here for more information for this utility. Other contaminants tested Chemicals tested for but not detected from 2010 to 2015: 1,1,1,2-Tetrachloroethane, 1,1,1-Trichloroethane, 1,1,2,2-Tetrachloroethane, 1,1,2-Trichloroethane, 1,1-Dichloroethane, 1,1-Dichloroethylene, 1,1-Dichloropropene, 1,2,3-Trichlorobenzene, 1,2,3-Trichloropropane, 1,2,4-Trichlorobenzene, 1,2,4-Trimethylbenzene, 1,2-Dibromo-3-chloropropane (DBCP), 1,2-Dichloroethane, 1,2-Dichloropropane, 1,3,5-Trimethylbenzene, 1,3-Butadiene, 1,3-Dichloropropane, 1,3-Dichloropropene, 1,4-Dioxane, 2,2-Dichloropropane, 2,4,5-TP (Silvex), 2,4-D, 3-Hydroxycarbofuran, Alachlor (Lasso), Aldicarb, Aldicarb sulfone, Aldicarb sulfoxide, Aldrin, Arsenic, Atrazine, Benzene, Benzo[a]pyrene, Beryllium, Bromobenzene, Bromochloromethane, Bromoform, Bromomethane, Butachlor, Carbaryl, Carbofuran, Carbon tetrachloride, Chlordane, Chlorodifluoromethane, Chloroethane, Chloromethane, cis-1,2-Dichloroethylene, Cobalt, Dalapon, Di(2-ethylhexyl) adipate, Di(2-ethylhexyl) phthalate, Dibromoacetic acid, Dibromomethane, Dicamba, Dichlorodifluoromethane, Dichloromethane (methylene chloride), Dieldrin, Dinoseb, Diquat, Endothall, Endrin, Ethylbenzene, Ethylene dibromide, Heptachlor, Heptachlor epoxide, Hexachlorobenzene (HCB), Hexachlorobutadiene, Hexachlorocyclopentadiene, Isopropylbenzene, Lindane, m-Dichlorobenzene, Mercury (inorganic), Methomyl, Methoxychlor, Metolachlor, Metribuzin, Monobromoacetic acid, Monochloroacetic acid, Monochlorobenzene (chlorobenzene), n-Butylbenzene, n-Propylbenzene, Naphthalene, Nitrite, o-Chlorotoluene, o-Dichlorobenzene, Oxamyl (Vydate), p-Chlorotoluene, p-Dichlorobenzene, p-Isopropyltoluene, Pentachlorophenol, Perfluorobutane sulfonate (PFBS), Perfluoroheptanoic acid (PFHPA), Perfluorohexane sulfonate (PFHXS), Perfluorononanoic acid (PFNA), Perfluorooctane sulfonate (PFOS), Perfluorooctanoic acid (PFOA), Picloram, Polychlorinated biphenyls (PCBs), Propachlor, Radium-228, sec-Butylbenzene, Selenium, Simazine, Styrene, tert-Butylbenzene, Tetrachloroethylene (perchloroethylene), Toluene, Toxaphene, trans-1,2-Dichloroethylene, Trichloroethylene, Trichlorofluoromethane, Vinyl chloride, Xylenes (total) Serves: 23,069 Data available: 2010-2015 Source: Surface water EWG Drinking Water Standards Questions for Your Local Officials
cc/2019-30/en_middle_0028.json.gz/line13150
__label__wiki
0.923832
0.923832
Real or not? Pitchers clap back against early HR barrage 78dDavid Schoenfield David SchoenfieldESPN Senior Writer Senior writer of SweetSpot baseball blog Former deputy editor of Page 2 Been with ESPN.com since 1995 On Monday, I wrote about all the home runs in April. Well, the pitchers got a little revenge on Tuesday. For one night at least, the best games revolved around good starting pitching instead of dingers. Here's a roll call of some of those performances: Gerrit Cole, Houston Astros: 7 IP, 1 H, 0 R, 3 BB, 11 SO Cole took a no-hitter into the sixth inning before Max Kepler doubled to right field with one out. Cole entered the game with a 1-4 record and 4.71 ERA, but he had pitched better than those numbers indicate. He was tied with Max Scherzer for the major league lead in strikeouts, and batters were hitting .212 off him. He'd given up six home runs, but all were solo shots. He had one bad game in which the Rangers scored nine runs off him, including five in the first inning, and that helped ruin his ERA. CC 3K! The stories behind Sabathia's most significant strikeouts The biggest MLB winners and losers of April How Cole Hamels found the secret to pitching in 2019 Anyway, Cole handcuffed the Twins all game with his four-pitch arsenal. His swing-and-miss rate is almost 5 percent higher than it was in 2018 and ranks fourth among starters (behind those of Blake Snell, Luis Castillo and Scherzer) this season. He's an elite starter with elite stuff, and I expect he'll have a run of good games coming up that should get him back in the Cy Young discussion in the second half. As for the hard-hittin' Twins, they entered the game leading the majors in home runs per game while averaging 5.42 runs per game, but they scored one run the past two games against Cole and Justin Verlander (they won 1-0 on Monday). Granted, we're talking about two of the best pitchers in the league, but let's not hand the AL Central to the Twins just yet. Twins versus Orioles: 6-0, 7.5 runs per game, 3.83 home runs per game; Twins versus everyone else: 11-10, 4.57 runs per game, 1.29 home runs per game. I like what the Twins have done, but we'll have a better feel for them after the next two games against Houston and a six-game road trip to New York and Toronto. Gerrit Cole overpowered the Twins, sending Minnesota a message about its readiness to play with MLB's elite. Carlos Gonzalez/Star Tribune via AP Rick Porcello, Boston Red Sox: 8 IP, 2 H, 0 R, 2 BB, 8 SO After a horrid start (11.12 ERA in his first three outings), Porcello is looking back on track and has allowed five runs in 19⅔ innings in his past three starts. His Game Score of 84 ties the fourth-highest of his career, so this was not just his best start of 2019 but also one of the best of his career. Chris Paddack, San Diego Padres: 6 IP, 4 H, 2 R, 1 BB, 5 SO Love me some Chris Paddack. This kid is the real deal. The two runs he allowed came in the second inning on three singles -- exit velocities of 82.6, 90.0 and 80.2 mph. Even when he was hit, he wasn't hit hard. Premium ⛽️ from @PaddackChris#FriarFaithful pic.twitter.com/kq9GOpwIcF — San Diego Padres (@Padres) May 1, 2019 There were two other takeaways from this game, a 4-3 victory for the Padres over the Braves. First, Franmil Reyes hit two home runs and drove in three runs. He's hitting .232/.286/.561 and has eight home runs. He's a huge key to the Padres' success this year. When he connects, the ball goes a long way. His strikeout rate is not excessive (22 percent), but his chase rate is too high at the moment (36.4 percent). If he can show the plate discipline he had in the second half last season, he's capable of big-time numbers. Second, is Kirby Yates the best closer in the game? He has an argument. He has allowed one run in 16 innings, has a 25-5 strikeout-to-walk ratio and 14 saves, and was dominant last season (2.14 ERA, 63 innings, 90 K's), so you can't say it's a fluke. Closers aren't exactly lighting it up this year, and some of the longtime best in the game have dropped a notch (Kenley Jansen, Aroldis Chapman). Yates, by the way, was claimed off waivers from the Angels in April 2017. Yates got help in the ninth from this incredible throw by Francisco Mejia: Throw: perfect 🎯 Pitch: nasty 💨 Rally: erased 👊#FriarFaithful pic.twitter.com/jHn2SpenJU Spencer Turnbull, Detroit Tigers: 6 IP, 3 H, 1 R, 2 BB, 5 SO It's not easy to go into Philly and shut down the high-powered Phillies' offense, but Turnbull pitched a great game and lowered his ERA to 2.53. Is he legit? It's too early to say. He throws hard enough, with a 94 mph fastball. His minor league track record isn't overly impressive except for one aspect: He was stingy with home runs. That's what has happened so far, with just two in 32 innings. He has allowed a .293 wOBA, and his expected wOBA via Statcast data isn't much higher, so there hasn't been a lot of luck in his results. He has been good and maybe surpasses his back-end starter projection. Plus, he still has rookie status. By the way, Bryce Harper was booed at home in this game. "I'd do the same thing," he said afterward. Harper finishes his first month in a Phillies uniform at .240/.388/.490 with six home runs and 20 RBIs in 29 games, but he's hitting .188 in his past 17 games. Also, this happened in Tuesday's game: Bryce Harper showing why he had a -3.2 defensive WAR last season, per Baseball-Reference... Misplays a ball with a 99% catch probability per Statcast, and faceplants in the outfield. — Paul Casella (@paul_casella) May 1, 2019 Those were just a few of the highlights. I didn't even mention German Marquez, who took a perfect game into the sixth inning against the Brewers, only to lose it when Raimel Tapia had a very catchable fly ball bounce off his glove. Jesus Aguilar then did this against an 0-2 pitch in the seventh for a three-run home run, and the Brewers beat the Rockies 4-3: Here's another example of why #WeBelieveInJesús! #ThisIsMyCrew pic.twitter.com/SrEFTbqtFz — Milwaukee Brewers (@Brewers) May 1, 2019 Trevor Bauer also started and beat the Marlins, striking out 10 in seven innings. But he allowed four runs and four walks. I'm sure in his mind it was a dominant start. The aforementioned Castillo started for the Reds and had another strong effort, allowing two runs in 6⅔ innings. He came away with a no-decision. Speaking of that game ... Mets blow late lead, win in extras: The Mets led 3-1 entering the ninth inning, but with Edwin Diaz unavailable after pitching three days in a row, manager Mickey Callaway tried to eke out a second inning from Jeurys Familia. It didn't work. The Reds scored twice to tie it up, and Drew Gagnon escaped a bases-loaded jam with a strikeout of Eugenio Suarez. The Mets won in the bottom of the 10th when J.D. Davis doubled and Pete Alonso scored him with a sacrifice fly. Thoughts on that ninth inning: 2019 MLB Draft Coverage From the names to know to the teams positioned to grab a star, get ready for the 2019 MLB draft. Complete draft coverage • Diaz pitched Friday when the Mets were down 8-6 and Saturday to save a three-run lead. Callaway's usage of Diaz hasn't exactly been optimal, as he has used him twice with a four-run lead, once when down two runs and three times with a three-run lead. The game Friday was probably just to get him some work because he hadn't pitched in four days, but pitching that game meant he wasn't available to pitch this game. • Trying to get two innings from Familia was odd, considering he hasn't pitched well this season. Clearly, as evidenced by using Diaz with those four-run leads, Callaway has little faith in the rest of the bullpen. To be fair, the rest of the bullpen hasn't been great, and Seth Lugo, the best of the rest, pitched the previous two days and threw 39 pitches. Some of this ties into what all teams are facing these days: If your starters aren't going deep into games and your bullpen isn't deep and you have a string of close games, you're going to burn through your top relievers. Still, it doesn't seem that Callaway has a good feel yet on optimal usage for his pen. P.S.: Jeff McNeil had a four-hit game, his fifth since joining the Mets on July 24, the most four-hit games in that span. CC gets to 3,000 strikeouts: Congrats to CC Sabathia on his 3,000th career strikeout, which makes him just the third lefty (Randy Johnson, Steve Carlton) and 17th pitcher overall to achieve that milestone: Cementing a Career. #LegaCCy pic.twitter.com/BJE3G9qSfg — New York Yankees (@Yankees) May 1, 2019 Of the other 16 in this elite group, only Curt Schilling and Roger Clemens haven't been elected to the Hall of Fame. Sabathia was a fringe Hall of Fame candidate a few years ago, but he has bounced back from some injury issues and added enough bulk to his numbers that his case is much stronger now. He isn't quite a lock, but he has passed 3,000 strikeouts, is three wins short of 250, has a Cy Young Award and was big in the Yankees' 2009 title run. His first strikeout in the majors: April 8, 2001, against Mike Kinkade. The Indians beat the Orioles 4-3 that day (CC got a no-decision). In the lineup for the Orioles: Cal Ripken Jr., who made his debut 20 years earlier in 1981. One of the Orioles in the lineup was Rick Dempsey. In Dempsey's first game in 1969, he played with Harmon Killebrew, who debuted in 1954. In that game, Phil Cavarreta was in the opposing lineup. His debut came in 1934, and a teammate in that game was an old catcher named Bob O'Farrell, who debuted in 1915. O'Farrell played against Honus Wagner in his first game. Sabathia to Ripken to Dempsey to Killebrew to Cavarreta to O'Farrell to Wagner -- six degrees of CC, and we go all the way back to 1897. Vladdy Jr. with the D: Vladimir Guerrero Jr. showed off some range and arm (granted, Albert Pujols was running): The 🔥 corner #LetsGoBlueJays pic.twitter.com/AGpTQSY9rx — Toronto Blue Jays (@BlueJays) May 1, 2019 Pick it, big guy!
cc/2019-30/en_middle_0028.json.gz/line13164
__label__cc
0.656065
0.343935
New Port, La Bajadilla Location: Marbella, Málaga ESTUDIO SEGUÍ The main feature of this winning project of the Competition, was the fact of reinterpreting its objective by enhancing and qualifying it as a strategic “new centrality” both in its urban scale (Marbella) and territorial scale (Costa del Sol). The proposal of the new Puerto de la Bajadilla in Marbella was the result of a National Competition called by the Andalusian Public Port Authority (APPA) of the Junta de Andalucía for the concession of the “La Bajadilla” Port in Marbella. The main feature of this winning project of the Contest was to reinterpret its objective by enhancing it and qualifying it as a strategic “new centrality” both in its urban (Marbella) and territorial scale (Costa del Sol). After a complicated initial administrative process, the concession was recovered with the help of Marbella Town Hall and Junta de Andalucía, which meant an important public commitment to carry out this Project of the “New Port-New Port” of Marbella That so much illusion and expectations had provoked in the city. Both the formalization of its port design and the distribution of commercial uses were aimed at supporting this idea of a new urban and territorial “centrality” for the future development of the city in the East, as well as “Puerto Banus” The West in the last century XX. Its main vocation will be to become the reference of the high quality tourism that the current national and international demands require for the City of Marbella and its Costa del Sol. The winning technical project was projected by Estudio Seguí and the engineers “Berenguer Ingenieros” And “Axel Logis”.
cc/2019-30/en_middle_0028.json.gz/line13165
__label__wiki
0.733481
0.733481
EU tables ground-breaking ‘low-carbon benchmark’ for green finance By Beatriz Rios | EURACTIV.com "When it comes to climate change, we are running out of time," said Valdis Dombrovskis, Vice-President of the European Commission in charge of the Euro and Social Dialogue, and Jyrki Katainen, Vice-President of the EC in charge of Jobs, Growth, Investment and Competitiveness. [Georges Boulougouris/European Commission] Languages: Français | Slovak The European Commission presented on Thursday (24 May) a set of proposals aimed at boosting private investment in low-carbon technologies like renewable energies while increasing transparency in sustainable finance to avoid green-washing. Brussels wants to leverage the contribution of the private sector in order to decarbonise the European economy and meet the objectives of the Paris Agreement on climate change. “Meeting our climate commitments will require large scale investments. For Europe alone, we need an estimated €180 billion of additional investment every year until 2030,” said Valdis Dombrovskis, the European Commission Vice-president in charge of Financial Stability. “No public authority has this kind of money,” added Jyrki Katainen, Commissioner for Jobs, Growth, Investment and Competitiveness, saying private capital needs to be mobilised “in favour of our planet”. In order to do that, the EU executive came forward yesterday with a new EU-wide classification taxonomy that will assess, sector by sector, if an economic activity is environmentally sustainable. The taxonomy will provide investors, pension funds and private equity firms with “a common definition of what is green and what is not” in order to channel greater amounts of capital into sustainable businesses. “This is a ground-breaking step,” Dombrovskis stated during the presentation of the initiative, symbolically wearing a green tie. “For the first time, we will assess sector by sector which economic activities are good for the climate and the environment,” he said. How can we incentivise the #EU financial sector contribute to the fight against climate change? Today we propose to put our #SustainableFinanceEU strategy into law. Our press remarks with @jyrkikatainen: https://t.co/QYyYotAjnG #COP21 #OnePlanet pic.twitter.com/04ISX3pfJ9 — Valdis Dombrovskis (@VDombrovskis) May 24, 2018 A group of experts will draw up guidelines to assess the sustainability of economic activities, based on scientific evidence. The guidelines will then be turned into “a binding classification, with specific criteria for each economic sector and sub sector,” Dombrovskis explained. For example, in the building sector, a housing project could be qualified as green based on its energy efficiency, or based on the share of recycled building material, the Commission Vice-President said. EU finance advisors back ‘less risky’ energy efficiency loans A high level group of financial experts has advised European regulators to encourage more favourable treatment for energy saving loans and mortgages, in a move that could unlock billions in lending for green building renovation programmes across Europe. Transparency and benchmarks The new regulation also aims to ensure that institutional investors factor in the ecological footprint of their decisions. Pension funds and private equity firms will have to disclose how their investments pursue sustainability objectives, as to guarantee better transparency and discourage ‘green-washing’. The Commission also proposed the creation of two new categories of benchmarks; a “low-carbon benchmark”, which is a “decarbonised” version of standard indices, and a “positive-carbon impact benchmark”, allowing investment portfolios to be better aligned with the Paris Agreement objective of limiting global warming to below 2° C. How can we make the EU financial sector a powerful actor in fighting climate change? ✅ unified EU classification system ✅ investors' duties and disclosures ✅ low-carbon benchmarks ✅ better advice to clients on sustainabilityhttps://t.co/gagnqfEYLk #SustainableFinanceEU pic.twitter.com/Ydc5n4hcV8 — European Commission ?? (@EU_Commission) May 24, 2018 Only companies whose activity reduce carbon emissions by more than they produce will qualify for the positive-carbon impact benchmark, in line with the objectives of the Paris Agreement to keep global warming within 2°C. “When it comes to climate change we are running out of time”, Dombrovkis pointed out. “The Titanic could not turn to avoid the iceberg at the last minute, and we will soon be in a very similar situation,” he said, adding: “We will act now”. Green finance group calls on EU to stop funding fossil fuels A group of financial experts has set out their vision for hardwiring sustainability goals into the European Union’s financial system, calling on 28-country bloc to stop pouring public money into polluting fossil fuels and focus spending on clean energies instead. Civil society praise The EU executive’s plan to boost green economy has been warmly welcomed by civil society actors. “Today’s proposals by the Commission will strengthen the market for sustainable finance, despite some limitations”, stated Sébastien Godinot, an economist at WWF, the global conservation organisation. The ball, said Godinot, is now in the court of MEPs and member states “to support, strengthen and turn the planned laws into a tool for consumers to re-direct their money into sustainable assets and avoid those which harm the planet.” Independent climate change think tank E3G praised the initiative saying they will speed up the transition to a sustainable economy. “The proposals for a taxonomy and low-carbon benchmarks will help provide the necessary market infrastructure to help to re-orient capital flows towards a more sustainable economy,” said Sandrine Dixson-Declève, senior associate at E3G. Invest Europe, the European private equity and venture capital association, also embraced the “step-by-step approach to developing an EU taxonomy” and underlined that “European private equity has long been committed to developing and sharing industry best practice on responsible investment”. However the organisation remains vigilant as “the key challenge will be to determine appropriate criteria and metrics” to measure environmental performance. sustainable economy
cc/2019-30/en_middle_0028.json.gz/line13166
__label__cc
0.629578
0.370422
Fink & Fuchs PR to communicate for Fiducia & GAD IT AG 14. August 2015 | Fink & Fuchs Wiesbaden, August 14, 2015 – Fiducia & GAD IT has awarded its PR account to Fink & Fuchs PR. The company that was formed through the merger of Fiducia and GAD operates as an IT service provider to all 1,100 German Cooperative Banks, the central institutions of the cooperative FinanzGruppe and numerous private and specialized banks. As part of the new assignment of the account, Fink & Fuchs PR prevailed in an agency pitch and will be helping the company with its external company communications from now on. Fink & Fuchs PR’s more than 10 years of experience in the market for financial technology was the main reason to choose the firm. With turnover of around 1.26 billion euros a year and close to 5,600 employees, the Fiducia & GAD Group is one of the largest IT centers of excellence in Germany. The company provides the IT infrastructure, including the necessary network structures, to more than 164,000 banking workplaces at the connected cooperative credit institutions at its high-security data centers in Karlsruhe and Münster. Fiducia & GAD manages nearly one hundred million customer accounts with the IT solutions it provides. In addition, the IT service provider with approximately 38,000 self-service terminals in Germany also ensures comfortable cash availability throughout the country. With a fresh new brand image and great enthusiasm for technological innovation, the company intends to present itself as a strong partner to the cooperative FinanzGruppe in the future and actively shape the dynamic innovation cycles in the sector. “Communicating on IT topics – especially in the B2B sector – requires unique experience and skills. Here, Fink & Fuchs really impressed us with their ideas and strategic approaches. We are therefore certain that we now have the right communications professionals at our side,” said Wilhelm Schulte, Director of Communications, Marketing and the Corporate Office at Fiducia & GAD IT AG. “Our collaboration with GAD thus far and their enthusiasm for the developments in the market for financial technology have inspired us to accompany the newly formed brand Fiducia & GAD IT AG with professional communication. We are proud to continue to be active in this exciting environment,” explained Alexandra Groß, a Board member of Fink & Fuchs Public Relations. Brief profile of Fiducia & GAD IT AG Fiducia & GAD IT AG is the service provider on information technology to the cooperative FinanzGruppe. The company with its administrative headquarters in Karlsruhe and Münster and branch offices in Munich, Frankfurt and Berlin currently has close to 5,600 employees who together generate annual consolidated revenues of approximately 1.26 billion euros. The clientele of Fiducia & GAD includes all 1,100 local cooperative banks in Germany as well as numerous private banks and companies in other industries, including ADAC. The company serves more than 164,000 banking workplaces, manages nearly 100 million customer accounts and ensures comfortable cash availability nationwide with its own 38,000 self-service devices. Fiducia & GAD currently offers two banking procedures “agree” and “bank21” at its four high-security data centers that will gradually be replaced with the uniform future procedure “agree21” in the years to come. Visit the website: www.fiduciagad.de 14. August 2015 Fink & Fuchs < vorheriger Beitrag Fink & Fuchs to advise AccuMeda healthcare group Fink & Fuchs to open Berlin office < Back to the Listing Time limit is exhausted. Please reload CAPTCHA. − = Your contacts for press and marketing inquireries concerning Fink & Fuchs. Follow Fink & Fuchs You can follow this blog via RSS-Feed. communication management communications agency communications consultancy Consulting Corporate Communications Corporate PR Design Thinking Employer Branding Employer Communication European Communication Monitor Fake News GPRA Innovation Marketing Online-Communications Online PR PR-Agentur PR agency Product PR Public Relations Public Sector Social Media Social Media Delphi Social Media Governance Storytelling Studien Survey Trainee Trusted Content Understanding the future.
cc/2019-30/en_middle_0028.json.gz/line13170
__label__wiki
0.622554
0.622554
Notes on Captivity by John Zerzan, Paula Zerzan Fifth Estate # 284, July, 1977 “Few books today are forgivable. Black on the canvas, silence on the screen, an empty white sheet of paper, are perhaps feasible.” — R.D. Laing, The Politics of Experience I. Every Ideology Is —a philosophy, a school: private property —a substitute self-identity —a barrier to life: mediation —a projection of present concepts: defense against the future. II. Specifics of Ideology in Decline —the fate of situationism: mainly a return to orthodox leftism (e.g. economism, constant salivation over the impending crisis). —also, the events in Italy (e.g. refusal of revolutionaries to delegate any authority) as outstanding critique of councilism (and critique of all politics). —anti-authoritarianism trend? putrefaction of leninism. But prospect of a reconstitution of leftism via its reform and re-packaging? (e.g. Open Road: an ‘anti-authoritarian’ Rolling Stone, with its slick ‘unity’, carefully edited letters, etc.) III. Our Lives, Not Our Words —Emma Goldman: supported the Bolsheviks until state power was firmly won in 1921 (over, the bodies of the Kronstadt and Ukrainian revolutionaries); defended the state power in Spain (1936-7) and its policy of military efficiency (read: destruction of dissidents and collectives). —Raoul Vaneigem: bourgeois professional (teacher, journalist); refused to let May, 1968 interfere with his going to the Riviera on vacation. —Murray Bookchin: not only professor but college administrator; his latest commodity, The Spanish Anarchists, on sale for a mere $12.95. IV. Directness. Acting Out of Our Personal Sadness and Rage with This Existence —united opposition of left to spontaneity —totalitarian regimes (e.g. China, Cuba) crush freedom and autonomy, but are forced to simulate their existence (lavish publicity for official demonstrations billed as ‘spontaneous’ and for pro-government ‘volunteers’). —the persistent universality of looting, vandalism. V. Today All Ideologies Smell the Same —Oswald Spengler, peerless reactionary, ended his Decline of the West with: “A task that historic necessity has set will be accomplished, with the individual or against him.” How ‘dialectical!’ Compare with the central, determinist myth of the left. —antidote: the transformation of the world that begins when we decide to form all our own ideas; the power of negative thinking.
cc/2019-30/en_middle_0028.json.gz/line13172
__label__cc
0.640099
0.359901
Home > Movie Stars > Y > Takeuchi Yuko Takeuchi Yuko Takeuchi Yuko (b. April 1, 1980) is a Japanese actress originally from Saitama prefecture. She is popular for her cute looks and cheerful image. Making her big break with NHK's television series Asuka and JTGreen's commercial, she has gone on to star in many tv shows, movies, and commercials. Some tv programs she has been in are Mukodono(My Husband), Lunch No Jouou(The Queen of Lunch), Egao No Housoku, and Pride. In Mukodono she comically plays newly weds with popular band TOKIO 's lead singer, Nagase Tomoya, and in Luncho no Jouou she plays an active girl with a mysterious past. Egao No Housoku shows her experience meeting new people while supporting a manga writer, and in Pride she is a symbol of the good old days to the main character, played by Kimura Takuya. All of these shows portray her as playful and witty, and her smile never fails to melt the hearts of other characters. Movies she has starred in include Hoshi Ni Negaiwo and Yomigaeri. Both of these have thought-provoking plots and she acts well, pulling the audience into the story. Her excellent performance in Yomigaeri was recognized by the 27th Japanese Academy Awards. She has also won other various awards for her television and movie appearances. Takeuchi Yuko Facts Birthday April 1, 1980 (39) Sign Aries Birthplace Japan Article text released under CC-BY-SA. It uses material from the Wikipedia article "Takeuchi Yuko" (20-Aug-2004)
cc/2019-30/en_middle_0028.json.gz/line13173
__label__cc
0.677826
0.322174
FIA press conference schedule - Abu Dhabi This year's chief title rivals Lewis Hamilton and Sebastian Vettel will face the world's media in Abu Dhabi on Thursday - as will Red Bull's duo and McLaren's two-time world champion Fernando Alonso. On Friday meanwhile it is the turn of team bosses from the likes of Ferrari, Mercedes and Red Bull... Thursday, November 23, 1500 hours local time (1100 GMT) Part 1: Lewis Hamilton (Mercedes), Daniel Ricciardo (Red Bull), Sebastian Vettel (Ferrari) Part 2: Fernando Alonso (McLaren), Valtteri Bottas (Mercedes), Max Verstappen (Red Bull) Friday, November 24, 1900 hours local time (1500 GMT) Part 1: Maurizio Arrivabene (Ferrari), Christian Horner (Red Bull), Toto Wolff (Mercedes) Part 2: Cyril Abiteboul (Renault), Zak Brown (McLaren), Mario Isola (Pirelli) The qualifying and post-race conferences with the top three drivers will take place immediately after the respective sessions. As always, Formula1.com will bring you full transcripts. ‘High voltage’ power unit problem meant Albon couldn’t pit on safety grounds DT’s 10 Hot Takes – On Hamilton’s 'luck', Leclerc's toughness & more McLaren pace was 'quite poor' against midfield rivals, says Norris Strategy error cost me victory shot, says Bottas FIA post-race press conference - Great Britain
cc/2019-30/en_middle_0028.json.gz/line13178
__label__wiki
0.835654
0.835654
Now, robot masseuse to treat back and knee pain Named Emma, short for Expert Manipulative Massage Automation, the robot mimics the human palm and thumb to replicate therapeutic massages such as shiatsu and physiotherapy. PTI | Updated: Oct 10, 2017, 08:25PM IST Emma also has advanced sensors and diagnostic functions which can measure the exact stiffness of a particular muscle or tendon. SINGAPORE: A technology start-up in Singapore has designed a robot masseuse that specialises in back and knee massages. Emma started work on patients this week at the NovaHealth Traditional Chinese Medicine (TCM) clinic, working alongside its human colleagues - a physician and a massage therapist. Emma 3.0 - the first to go into public service is more compact than the first prototype unveiled last year. It uses advanced sensors to measure tendon and muscle stiffness, together with Artificial Intelligence (AI) and cloud-based computing to calculate the optimal massage and to track a patient's recovery over a course of treatments. Emma has been developed by AiTreat, a technology start-up incubated at Nanyang Technological University, Singapore (NTU Singapore). The technology aims to address workforce shortages and quality consistency challenges in the healthcare industry, said Albert Zhang, an alumnus of NTU Singapore who led the development of Emma. Using Emma in chronic pain management has the potential of creating low-cost treatment alternatives in countries where healthcare costs are high, and where ageing populations have a growing demand for such treatment. ParallelDots announces $2 million funding ParallelDots, Inc., an artificial intelligence company developing novel algorithms and high impact solutions for real world problems, announced it has raised additional funding of $1.4 Million, bringing its total funding to $2 Million. Zhang said that Emma was designed to deliver a clinically precise massage according to the prescription of a qualified traditional Chinese medicine physician or physiotherapist, without the fatigue faced by a human therapist. "By using Emma to do the labour intensive massages, we can now offer a longer therapy session for patients while reducing the cost of treatment," said Zhang. "The human therapist is then free to focus on other areas such as the neck and limb joints which Emma can't massage at the moment," said Zhang. Emma has a touch screen with a fully articulated robotic limb with six degrees of freedom. Mounted at the end of the limb are two soft massage tips made from silicon, which can be warmed for comfort. The data collected of each patient is then sent to a server in a cloud, where AI computes the exact pressure to be delivered during the massage procedure. The AI can also track and analyse the progress of the patient, generating a performance report that will allow a physician to measure a patient's recovery using precise empirical data. Coolpad Note 5 Lite (Space Grey, 3GB RAM + 16 GB) Unirock [Pack 1] Screen Protector,[9H Hardness] [Anti-Scratches] [Anti-Fingerprint] Tempered Glass Screen Protector for Coolpad Note 5 Lite (Space Grey, 3GB RAM + 16 GB) (Transparent) Coolpad Mega 2.5D (Space Grey) This article is no longer available 1Now, robot masseuse to treat back and knee pain 2This article is no longer available
cc/2019-30/en_middle_0028.json.gz/line13185
__label__wiki
0.795033
0.795033
US personnel chief resists calls to resign after more than 21 million had data stolen in hack Published July 10, 2015 Government And InstitutionsAssociated Press The head of the government&apos;s personnel office is rejecting bipartisan calls for her resignation following revelations that hackers stole the personal information of more than 21 million people on her watch. The director of the Office of Personnel Management, Katherine Archuleta, says she has no plans to step down and is committed to continuing her work. The White House says President Barack Obama remains confident in Archuleta&apos;s leadership. The escalating calls for Archuleta to be replaced came as the administration disclosed that the number of people affected by the federal breach is far higher than the 4.2 million previously reported. Hackers downloaded Social Security numbers, health histories or other highly sensitive data from OPM&apos;s databases. Numerous U.S. lawmakers who have been briefed on the investigation point the finger at China.
cc/2019-30/en_middle_0028.json.gz/line13187
__label__wiki
0.910891
0.910891
FS Arizona Plus Arizona State Sun Devils NCAA BK Arizona State Sun Devils NCAA FB Arizona Wildcats NCAA BK Arizona Wildcats NCAA FB Northern Arizona Lumberjacks NCAA BK Northern Arizona Lumberjacks NCAA FB FOX Sports Arizona – Phoenix Mercury Sun Devils No. 1 Arizona blows out rival ASU foxsports Jan 16, 2014 at 11:36p ET TUCSON, Ariz. — Arizona raced out to a big lead and did not back off, hitting the accelerator instead. No way were the Wildcats going to let their biggest rival get even a sniff of a comeback. Top-ranked Arizona raced out to a big early lead and extended it with a strong start to the second half, rolling past rival Arizona State in a 91-68 rout Thursday night. "We tried to start out the game really well and made some shots and some stops on defense, then did the same thing in the second half," said Arizona guard Nick Johnson, who led the Wildcats with 17 points. "We didn’t want to give them any false hope of trying to come back or anything." There wasn’t much chance the way the Wildcats were playing. Arizona (18-0, 5-0 Pac-12) dominated the Sun Devils almost from the opening tip, turning missed shots and turnovers into points at the other end while building a 21-point lead in the first half. The Wildcats didn’t let up, either, stretching the lead to extend the best start in school history. Arizona put seven players in double figures, shot 56 percent and had 21 assists on 34 field goals to beat the Sun Devils for the sixth time in seven games. Aaron Gordon had 16 points, and Kaleb Tarczewski added 12 points and eight rebounds for the Wildcats. T.J. McConnell finished with 10 points, six assists and three steals. "No doubt about it, we have a group of guys that plays with a lot of energy, a lot of effort and we are willing to share the ball," Arizona coach Sean Miller said. Arizona State (13-5, 2-3) played without second-leading scorer Jermaine Marshall and had trouble with Arizona’s size all night, shooting 34 percent. Jahii Carson had 20 points and five assists, but struggled early and had at least four shots blocked. ASU center Jordan Bachynski battled foul trouble in the first half and wasn’t much of a factor when he was in the game, finishing with three points while missing all three of his shots. Bo Barnes added 13 points for the Sun Devils, who had 18 turnovers and seven assists. "You look at the results they are posting night in and night out, it wasn’t a surprise, only a confirmation," Sun Devils coach Herb Sendek said of Arizona. "They are very well balanced and their size is a factor." Arizona has gotten off to the best start in school history behind its defense The Wildcats entered the game fourth nationally in scoring at 56 points per game, seventh in field goal percentage at 37 percent and 13th in 3-point shooting at 28 percent. Arizona State was already going to have a tough time against the long, athletic Wildcats and it certainly didn’t help that Marshall was out after injuring his groin in practice this week. Revved up by the boisterous crowd, Arizona was at its defensive best early, contesting every shot, pass and dribble. Arizona State missed 15 of its first 17 shots and Carson had nowhere to go against Arizona’s pressure — particularly McConnell — while missing his first five shots. After a jittery offensive start, the Wildcats started hitting from everywhere, racing out to a 21-point lead while making 14 of 28 shots. The Sun Devils started to shoot a little better late in the half, but had a hard time digging out of the hole, trailing 42-28 after shooting 6 of 26. Arizona kept rolling to start the second half, hitting five of its first eight shots to stretch the lead to 22. Gordon then scored on an alley-oop, Tarczewski threw down a dunk on a no-look pass from Gabe York and McConnell dropped in a 3-pointer, flashing three fingers to the fans across from the bench after putting the Wildcats up 59-38. "Those guys are ready to play every day," said Carson, who shot 7 of 19. "They have great leadership and are No. 1 in the country for a reason. They just have so many weapons." FOX Sports Arizona
cc/2019-30/en_middle_0028.json.gz/line13189
__label__wiki
0.883464
0.883464
All Articles: indefinite leave to remain Does ANY overstaying rule out settlement after 10 years’ long residence? Confusion after Court of Appeal ruling Migrants who have spent ten years in the UK with continuous and lawful leave can apply for indefinite leave to remain (ILR). Can leave be “continuous” if it involved short gaps between lawful periods of leave where an applicant has oversta ... 27th June 2019 By Nick Nason Major judgment finds Home Office policy of ejecting migrants over tax discrepancies “legally flawed” The Court of Appeal has handed down a blockbuster judgment on the highly controversial use of paragraph 322(5) of the Immigration Rules to refuse settlement to migrants over alleged tax discrepancies. It says that the Home Office’s stance in the ... 17 years and counting for an indefinite leave to remain decision I acted for the appellant in the extraordinary case of Guled v SSHD [2019] EWCA Civ 92, in which the Court of Appeal ruled on the legal status of a deportation order made in 2002. 2002: deportation order made Even by immigration standards, Mr G had a ... 1st March 2019 By Nicola Burgess Briefing: the rules on returning residents with indefinite leave to remain (ILR) Indefinite leave to remain in the UK is a type of immigration status that means a person can live and work in the UK for as long as they like, with no further need to apply for a visa extension. Occasionally, though, people with ILR are refused entry ... 1st November 2018 By Colin Yeo Refugee “safe return reviews” needlessly causing anxiety, statistics suggest About 18 months ago, the Home Office announced that refugees would no longer get indefinite leave to remain automatically after being in the UK for five years. Officials are now supposed to review whether the refugee still needs the protection of the ... 23rd October 2018 By Colin Yeo What happens if you mistakenly apply for British citizenship instead of indefinite leave to remain? What happens when an American graduate, about to become eligible for indefinite leave to remain having lived lawfully in the UK for almost a decade, incorrectly thinks that he is eligible to apply for British citizenship and applies for that instead? ... 17th August 2018 By John Vassiliou The meaning of “residence” for indefinite leave to remain applications In the case of R (Nesiama & Ors) v Secretary of State for the Home Department [2018] EWCA Civ 1369, the Court of Appeal found that “residence” in the UK means “physical presence”, such that continuous residence in an application for indefi ... Comment: waive immigration fees for soldiers from overseas The ill-treatment of Commonwealth soldiers may no longer make headlines, but scandalously high immigration fees are depriving many of those who have served this country of their right to settle in Britain, writes Vinita Templeton of Duncan Lewis. The ... 18th May 2018 By Vinita Templeton Do you need to worry about Brexit if you have indefinite leave to remain? An EU citizen with indefinite leave to remain in this country has taken the drastic step to leave the UK because of Brexit. You might have seen the story on Twitter, where it went viral. 24/ So my mum has taken the decision to return to the country of ... 11th April 2018 By Chris Desira Why doctors are being kicked out in the middle of an NHS crisis In the midst of an “NHS crisis”, with two in three hospitals said to have a shortage of doctors, immigration laws appear to be making the situation worse. Last week iNews reported that dozens of medics with offers to work in the NHS had their vi ... 24th January 2018 By Nath Gbikpi Big changes to continuous residence rule for ILR applicants Hidden within December’s statement of changes (HC309) to the Immigration Rules are new provisions that will affect how the Home Office assesses continuous residence for indefinite leave to remain (ILR) applications. Certain visa categories require a ... 8th January 2018 By Joanna Hunt High Court quashes refusal of settlement to highly skilled migrant family From the main Garden Court Chambers website regarding the case of Granovski & Ors v Secretary of State for the Home Department [2015] EWHC 1478 (Admin): The High Court today handed down judgment on a judicial review challenging the Secretary ... 9th June 2015 By Colin Yeo Making it harder for Turkish citizens to settle in the UK is for their own good, judge says PhD-level jobs to be exempt from work visa quota No implied limits on power to revoke indefinite leave to remain New settlement route for Turkish businesspeople expected later this year No more settlement for Turkish businesspeople under the Ankara Agreement
cc/2019-30/en_middle_0028.json.gz/line13193
__label__cc
0.688
0.312
As Built Avoiding Numbers When Building or Remodeling a Home "Mark your work in place whenever possible" is just one of several tips seasoned carpenter Scott McBride offers in this guide to measuring more efficiently and accurately on the job site. By Scott McBride Issue 284 -July 2019 Synopsis: For many builders, numbers are a necessary evil. If you want to avoid errors with measurements, Scott McBride describes a few tips and tricks for trimming a jack, determining stud length, and mitering door and window trim. He also recommends using a story pole to mark instead of measure, and employing a spring divider for stepping off repetitive increments. I once read that the artist Pablo Picasso had trouble with arithmetic because he was incapable of interpreting the numeral 7 as anything other than a human nose in profile. “Ah, a kindred spirit,” I thought. Yes, numbers are an indispensable part of the building trades, but for some of us they’re a necessary evil, with emphasis on the word “evil.” Whenever there’s a way to take the measure of a thing without resorting to those slippery little bugs called “numbers,” I’m the first to try it. If you happen to be a math wiz, I envy you, and you can skip this story. But if you’re numerically challenged like the rest of us, here are a few tricks that might help keep you straight. The simplest way to avoid measuring is to mark your work in place whenever possible. That may sound obvious, but I often see experienced journeymen pulling measurements that seem unnecessary. For instance, when framing walls flat on a deck, the jack studs need to be trimmed to compensate for vagaries in the header width (due to crooked lumber, misalignment, etc.). The simplest way to trim a jack is to butt its top against the header and strike a mark on the bottom end flush with the king stud. Reach for a nearby circular saw and buzz it, and you’re done. Striking a mark rather than measuring is also useful when the target is above eye level. Suppose you need to determine the stud length for a garage wall that steps down from the main subfloor, and you already have a regular 8-ft. wall standing adjacent to the garage. You could measure from the garage slab to the top of the regular wall and subtract 4 1/2 in. for the thickness of three plates. You’ll need a tall stepladder to get your eyeball high enough for an accurate measurement—and you’ll need to hope you got the math right. Or, you could stack three scraps of 2x on the slab, stand a 10-ft. 2×4 on top of the stack, and strike a mark flush with the top of the regular wall. A similar trick is useful for mitering door and window trim. First, chop all the legs in the room to rough length, using a stop on the saw so you don’t have to measure each one. Use the leftovers to make head casing. Tack all the head casing in place and miter all the legs. Set the chopsaw square and leave it there. Then mark each leg by standing it upside down—point to the floor for doors and point to the stool for windows. Tick a mark by feel at the top of the head casing and chop it square. You could also stand the leg right-side up and mark the long point of it’s miter, but a square cut is visually easier to zero in than an oblique cut. Believe me, when you’re an old wood butcher with bifocals sliding off the end of your nose, you’ll appreciate the difference. The best way I know to avoid errors and keep your tape in your pouch is to make a story pole. Think of a story pole as a ruler with only the marks you need for the job at hand. There are 4800 marks on a standard carpenter’s tape, and a good story pole gets rid of the ones you don’t need. I make story poles for siding, stairs, millwork—anything with repeatable increments. So, for instance, if I’m building a set of winder steps and I need to plot the elevation of the winders on the wall framing, I refer to a single story pole instead of multiplying the riser height at each location. Fortunately, being a woodworker, I have an inexhaustible supply of rip offcuts and leftover boards from which to make story poles. A light- colored fine-grained wood works best. One end of the pole usually represents a starting point of some kind, such as the subfloor or soffit. I cut this end square and write its meaning as clearly as possible. I cut the other end at an angle to quickly identify it as the non-reference end of the pole. Laying out a story pole starts with marking a few given dimensions, such as the width of a frieze. I do this carefully because a mistake on the pole will be reproduced wherever the pole is applied. Then, for stepping off repetitive increments such as risers or siding courses, I put away my tape and use a spring divider. A spring divider is a compass with a steel point on both legs instead of a pencil. Spring pressure on the legs affords very fine adjustments. It takes some practice to divide, say, 108 3/16 in. into 14 equal increments. If you fall short on the first try, there’s a tendency to open the legs too much and thus overshoot on the next try. Practice makes perfect. Sure, there are calculator functions that can generate a list of measurements and will round them off to whatever degree of accuracy you require. But transferring all those fractions to the pole risks error. The pin pricks left by a pair of dividers are idiotproof as long as you start and stop in the right place. The final step in preparing a story pole, or “rod” as the British call it, is to label it clearly. This is particularly important on a complex job such as a paneled library, where you might have height rods and width rods for each wall. Writing “north wall/height” with a bold marker will make it easier to pull the desired rod from the bundle when you need it. If I’m using a 2×4 as a story pole on a framing job, I flag it with blasts of spray paint; otherwise it’s liable to end up as fire blocking, or I’ll lose it among the hundreds of identical 2x4s lying around the site. Please don’t ask if this has happened to me before. Sticks can be useful for measuring even without marks. We once rebuilt a Victorian cornice with heavy corbels. Between the corbels were multiple short moldings requiring hundreds of inside measurements. By sliding two slender sticks alongside each other and pinching them between thumb and fingers, we were able to transfer the lengths needed to the trim stock. Sliding sticks also come in handy to extend one’s reach, such as when measuring the height of a tall ceiling. This is an awkward task with a tape alone, but you can make the job easier and more accurate by sliding a pair of sticks from floor to ceiling, clamping them, and then lowering the combined sticks to be measured. A spring divider lets me step off long story poles with no numbers whatsoever, but for dividing shorter distances there’s a hybrid trick that is part numerical and part graphic. The numerical part is easy and reliable because it bypasses fractions. Imagine that you need to find the center of a board that is 7 5/16 in. wide. Lay your framing square diagonally across the board so that the corner (0) touches one edge and the 8 touches the opposite edge. The center of the board will be at 4, and a line gauged through that point will be the centerline. The same trick works when dividing something into multiple parts. Suppose I have to apply lattice to a frame opening of 29 1/8 in. I’m using 1 1/2-in.- wide lattice strips and I want all the intervening spaces to be equal. Ideally, the width of the spaces would also be 1 1/2 in. to create a perfect on-center spacing of 3 in. (lattice + space). That doesn’t work out, though, because 29 1/8 divided by three gives me nine units with 2 1/8 in. left over. I want a space at both edges of the panel, so there will be nine strips and ten spaces. The aggregate width of all the strips is 13 1/2 in. (9 x 1 1/2), and the remaining aggregate width of all the spaces comes to 15 5/8 in. (29 1/8 – 13 1/2). The width of a single space will therefore be one-tenth of 15 5/8. I would rather avoid this numerical equation—there’s way too much room for error. So I gauge a line on a sheet of plywood 15 5/8 in. from the edge. I lay my square on the plywood with the corner (0) on the edge and the 20 on the line, and I tick a mark at 2 (one-tenth of 20 in.). The distance from the tick mark to the edge is the unit space, so I set my dividers to unit space plus lattice width to step off the layout on the frame. There’s no avoiding math in carpentry —it comes with the territory. But let’s face it: Building in today’s complex environment is a constant battle to maintain focus. Don’t clutter your head with unnecessary numbers that can turn around and bite you in the butt. From Fine Homebuilding #284 More As Built Confessions of an Energy Dinosaur Engineering Lessons A Trip to the Cedar Shed Preserving Colonial American Houses Take a look at several beautiful examples of restored 18th-century homes–and some well-executed reproductions–plus see what it takes to bring these historic homes back to their former glory. Tiny House Kits: An Online Buying Trend Breaking the Thermal Bridge With Tstuds House-Flipping How-Tos If you know your market and you can stomach the risk, there's still money to be made buying and selling homes. Tying in an Addition to an Existing Home Use these tips and tricks to match new floor heights to old and get everything square. How to Build a Curved Ipé Garden Benches Clamps and lots of screws put a bend in this dense and durable wood. Podcast 184: Insulating an All-Brick House, Working with Engineered Siding, and Carpentry as a Second Career Job-Site Protection
cc/2019-30/en_middle_0028.json.gz/line13196
__label__cc
0.576206
0.423794
We use cookies to help improve your experience of www.flooredgenius.com. A cookie is a small piece of data that our website stores on your computer, and accesses each time you visit, so we can understand how you use our site. Pass data to advertising networks This cookie policy is part of Floored Genius’s privacy policy, and covers the use of cookies between your device and our site. We also provide basic information on third-party services we may use, who may also use cookies as part of their service, though they are not covered by our policy. If you don’t wish to accept cookies from us, you should instruct your browser to refuse cookies from www.flooredgenius.com, with the understanding that we may be unable to provide you with some of your desired content and services. A cookie is a small piece of data that a website stores on your device when you visit, typically containing information about the website itself, a unique identifier that allows the site to recognise your web browser when you return, additional data that serves the purpose of the cookie, and the lifespan of the cookie itself. Cookies are used to enable certain features (eg. logging in), to track site usage (eg. analytics), to store your user settings (eg. timezone, notification preferences), and to personalise your content (eg. advertising, language). Cookies set by the website you are visiting are normally referred to as “first-party cookies”, and typically only track your activity on that particular site. Cookies set by other sites and companies (ie. third parties) are called “third-party cookies”, and can be used to track you on other websites that use the same third-party service. Types of cookies and how we use them Essential cookies are crucial to your experience of a website, enabling core features like user logins, account management, shopping carts and payment processing. We use essential cookies to enable certain functions on our website. Performance cookies are used in the tracking of how you use a website during your visit, without collecting personal information about you. In our respect this information is anonymous and aggregated with information tracked across all site users, to help us understand visitor usage patterns, identify and diagnose problems or errors their users may encounter, and make better strategic decisions in improving their audience’s overall website experience. These cookies may be set by the website you’re visiting (first-party) or by third-party services. We use performance cookies on our site. Functionality cookies are used in collecting information about your device and any settings you may configure on the website you’re visiting (like language and timezone settings). With this information, websites can provide you with customised, enhanced or optimised content and services. These cookies may be set by the website you’re visiting (first-party) or by third-party service. We use functionality cookies for selected features on our site. Targeting/advertising cookies are used in determining what promotional content is more relevant and appropriate to you and your interests. Websites may use them to deliver targeted advertising or to limit the number of times you see an advertisement. This helps companies improve the effectiveness of their campaigns and the quality of content presented to you. These cookies may be set by the website you’re visiting (first-party) or by third-party services. Targeting/advertising cookies set by third-parties may be used to track you on other websites that use the same third-party service. We do not use this type of cookie on our site. Third-party cookies on our site We may employ third-party companies and individuals on our websites—for example, analytics providers and content partners. We grant these third parties access to selected information to perform specific tasks on our behalf. They may also set third-party cookies in order to deliver the services they are providing. Third-party cookies can be used to track you on other websites that use the same third-party service. As we have no control over third-party cookies, they are not covered by Floored Genius’s cookie policy. Our third-party privacy promise We review the privacy policies of all our third-party providers before enlisting their services to ensure their practices align with ours. We will never knowingly include third-party services that compromise or violate the privacy of our users. How you can control or opt out of cookies If you do not wish to accept cookies from us, you can instruct your browser to refuse cookies from our website. Most browsers are configured to accept cookies by default, but you can update these settings to either refuse cookies altogether, or to notify you when a website is trying to set or update a cookie. If you browse websites from multiple devices, you may need to update your settings on each individual device. Although some cookies can be blocked with little impact on your experience of a website, blocking all cookies may mean you are unable to access certain features and content across the sites you visit.
cc/2019-30/en_middle_0028.json.gz/line13203
__label__wiki
0.561714
0.561714
The Challenge of Champions This film shows horse racing at Gulfstream in 1975. The wild animal race uses Bengal tigers. Viewers see jockey Eddie Arcaro. Produced by Tel-Air Interests; sponsored by Gulfstream Park. 14:00; color; sound; V-16 CA093; S. 828 Jai-Alai 4-May-79 In this film, jai-alai players talk about the equipment used to play their game. A promoter explains how bets are placed and winnings are distributed. The film has additional footage of jai-alai players in action. Produced by WFSU-TV. 11:35; color; silent and sound; V-191 BA297; S.1239 Four Thousand Winners This film has horse racing footage at the Gulfstream Racetrack in Hallandale, Florida. The winning jockey and horse owner are shown receiving a trophy. Produced by the Florida Development Commission. 1:12;b&w; silent, V-234 AA487, S. 828 Color Me Fun Three models representing the colors red, yellow, and blue demonstrate how to have fun in Miami Beach, the "one place where colors and people come together." Viewers see a variety of available foods, nightlife, water sports, and other recreation. There is shopping, where "there are all sorts of groo... 13:20; color; sound; BA144, s.828 Hialeah: An American Racing Tradition This film starts with a look at some horse breeding farms in Ocala where viewers see the big winner, Carry Back. The film also shows a horse auction and horses in training at the track. Two trainers, Jim Fitzsimons and H.A. Jones, offer testimonials on the importance of Hialeah. The film uses a pie ... Jai-Alai: The Fastest Game This film has an introduction by Pat McCann, Executive Director of the National Association of Jai-Alai Frontons. This film has lovely photography of the Basque region of Spain and France and tells how jai-alai is a way out of the traditional life. It tells about the origin of the sport, the making ... West of the Sun This film shows the commerce and community of the West Palm Beach area and asserts that, whether it's nature, recreation, fashion, or industry, West Palm Beach has something for everyone. A McLeod Film Production presented by the West Palm Beach Public Information Department and the City of West Pa... 14:20; color; sound; V-126 CA141; S. 828 Fifteen Years with 4-WTVJ Host Ralph Rennick shows footage and stories that Miami TV station WTVJ collected in its first 15 years on the air. Mitchell Wolfson, co-host, founded the station, as well as Wometco Enterprises. There are scenes of the 1951 Orange Bowl Parade, the 1951 Senate Crime Hearings in Dade County on gamb... 1964/29:25; B&W; sound; V-95 DA044; S. 828 Reflections of the Good Life This film shows the good life in Palm Beach, including all the fun in the sun activities, as well as a giant slide, lawn bowling, ice skating, hockey, roller derby, the pari-mutuels, baseball spring training and polo. Viewers see electronics industries, a research submarine, agriculture, cattle, hor... Florida Gulf Coast Holiday This film begins in Pensacola. Viewers see Fort Pickens, Blue Angels and the Naval Air Station. The film moves to Panama City, where viewers see people frolicking in the surf and teens with a guitar. In Tallahassee, the film shows Apalachee Parkway toward the Old Capitol, FSU and Killearn Gardens St... 14:30; color; sound; V-12 CA028; S.828 POMPANO BEACH RACEWAY 1:50; b&w; silent; V-124 AA217; S. 828 This film shows harness racing at Pompano Park. 8:00; color; sound, V-244 S. 1354 Film B This film is composed of 10 television public service announcements on organized crime, gambling, fencing, drug addiction and petty crime. Two spots feature a message from Gov. Reubin Askew. There are long and short versions on each subject. Produced by the Florida Organized Crime Control Board. WHOLESOME 1960S FLORIDA 29:30; b&w; silent and sound; V-194 EA032; S.1239 This film opens with footage of various dairy products in production at Bassett's Dairy (silent). Next, officials of the Florida Department of Agriculture inspect petroleum samples in a laboratory (silent). Another Department of Agriculture official makes a surprise inspection of a Publix grocery st... BROWARD: THE GOLDEN COUNTY This film shows a little of Port Everglades and then other features in Broward County such as the airport, Pioneer City ("old west" attraction), crowds on the beach and fishing. It also shows hospitals, churches, condos, Nova University, some industry, pari-mutuel wagering, sports and nightlife. It ... 13:00; color; sound; V-1 CA110; S. 828 This film shows the beach, hotels, condos, schools, churches and shopping. Viewers also see Miami Beach Auditorium (home of the Jackie Gleason Show), Convention Hall, the library, Bass Museum of Art, Miami Seaquarium, Parrot Jungle and Monkey Jungle, where a chimp wears a Beatle wig and strums a gui... GULFSTREAM DERBY 10:40; color; silent; not yet transferred to video S. 828 Mickey Rooney appears in one shot in this film. There are aerials of the racetrack. The opening ceremony includes a marching band and majorettes. A small boat sails on the lake inside the track and there is a water ski show. Viewers see a parade of pleasure horses and the lineup of race horses. The ... Search Videos again Search only videos viewable online Black & White Color Both Tip: The most accurate way to search is to identify phrases within your query. Example: "Kingsley Plantation" "Fort George Island"
cc/2019-30/en_middle_0028.json.gz/line13204
__label__wiki
0.727421
0.727421
Cocoa company turns loved ones' ashes into jewelry Business spotlight for April 8. Cocoa company turns loved ones' ashes into jewelry Business spotlight for April 8. Check out this story on floridatoday.com: http://on.flatoday.com/1Y8Dxfm Kristen Alligood, Brevard Published 1:00 a.m. ET April 8, 2012 | Updated 1:14 p.m. ET April 8, 2012 Marion Cheney and his wife Lynn, in their studio making Star Seed Gems, memory pendants - fused cremation ashes in dichronic glass.Under certain conditions, the ashes glow in the pendant, Photo by Malcolm Denemark(Photo: image Credit) Owners: Marion and Lynn Cheney Location: Cocoa Website: www.StarSeedGems.com Description: Custom pendants featuring cremation ashes fused within art glass stones, set in hand-sculpted, fine silver settings. The ashes are coated with a photoluminescent powder solution that allows them to glow. Pendants can be ordered online or purchased through Davis Seawinds Funeral Home in Melbourne. How did StarSeed Gems get started? StarSeed Gems began in 2008, two years after the Cheneys unexpectedly lost their son to an illness. “We wanted something that we could do with his ashes that would be artistic,” Lynn Cheney said. “He loved light. Sometimes as a part-time job, he worked for theaters and did lighting in theaters, so we really wanted light involved in what we did, and then it just moved on from there. We got online to see what we could do and we saw glass and bought a kiln and just kept at it until we saw something that we liked. It was for us, and then we thought we would offer it.” Professional background: Lynn Cheney taught students with disabilities at various Brevard Public Schools for 23 years. She has a master’s degree in education from Nova Southeastern. Marion Cheney taught psychology at Brevard Community College for more than 38 years. He has a doctorate degree in education from Nova Southeastern, and a master’s degree from the University of Georgia. A few questions with Lynn Cheney: Business philosophy? To offer a unique item that aids people in their healing process. “This is a real specialty; a product and a service,” Lynn Cheney said. “I think that love never dies, and these help people remember that.” Business goal? To expand and hire some employees and to work with more funeral homes. “I would like to be able to eventually pass the business down to some very artistic grandchildren that I have.” Biggest challenge? Getting the word out. “You can create a website, but it’s not that easy to get it seen. How do you market something like this? It’s a real specialty item that’s kind of wrought with emotion. It reaches out to people who are hurting and I really don’t want to commercialize it too much, I don’t want to exploit people’s pain.” Best business experience? “For both of us it’s been the contacts we’ve made, the clients we’ve had. “I think probably one of the most satisfying contracts that we’ve had was we made six identical Air Force emblems with stones in the middle of the star on the emblem. We had really nothing to go on besides the emblem. Most of our stuff is organic and the Air Force emblem is really geometric, so it was challenging. We were able to accomplish it and the client was so pleased that she had these to give to her family.” Business advice? Do what you love. “If you don’t like it, don’t do it. I think if you don’t love it, you try to avoid it rather than focusing hard on it and working hard at it.” Business mentor? Theo Baker from Davis Seawinds Funeral Home and Crematory. “He’s been a real cheerleader over our designs and product.” What’s next? Working with more funeral homes and offering bronze settings. Read or Share this story: http://on.flatoday.com/1Y8Dxfm Apollo 11 anniversary brings tourism to Space Coast Poliakoff: Condo board's rule-making authority questioned Titusville's appeal of code board Airbnb decision fails Business Spotlight: A Lifetime of Fitness Titusville couple running Airbnb face code appeal Smoking issue at condo pool? They can ban you
cc/2019-30/en_middle_0028.json.gz/line13205
__label__cc
0.595271
0.404729
Our State Georgia Trend Magazine Trendsetters: Chinese Southern Belle Food Fusion Mary Ann DeMuth, Multicultural Influences: From left, Margaret and Natalie Keng Credit: Chinese Southern Belle Smyrna native and entrepreneur Natalie Keng is the living, breathing epitome of fusion. Born, as she says, “closer to Canton, Ga., than Canton, China,” she is the daughter of Asian immigrants and grew up loving grits and fried chicken as much as egg rolls and Hunan catfish. Her multicultural influences – and experiences as a member of the only Asian family in her 1970s neighborhood – prompted her to launch her business, Chinese Southern Belle, a decade ago “to make the world a better place through food,” she says. Chinese Southern Belle is the umbrella company for a smorgasbord of products and services. Keng and her mother, Margaret, a former Cobb County Teacher of the Year, started the business by hosting dinners that featured family recipes. Those dinners have morphed into big events like their annual Chinese Lunar New Year tasting celebration at a local restaurant. While shopping for ingredients at Asian markets, Keng found herself advising random customers about soy sauces, spices and woks. That led her to begin a service helping people explore and shop in Asian and international grocery stores. In time, she also began giving tours of Buford Highway eateries and shops, taking advantage of the ethnic concentration found along the northeast Atlanta corridor. She and her mom segued into teaching cooking classes at venues around Atlanta, including Cook’s Warehouse and the Evening at Emory program. They’ve now taught more than 300 private and corporate group classes, introducing participants to foods influenced by the East, the West and the South, and “opening minds, one mouth at a time,” she says. The Chinese Southern Belle’s latest venture is locally sourced, all-natural family recipe cooking sauces such as Sweet Chili Peach, Soy Ginger Vidalia and Asian BBQ Teriyaki Pineapple that can be used to flavor meats, vegetables and what Keng calls the “one-minute stir-fry.” She and her mother oversee all aspects of production and, thanks to word of mouth from their many in-person demonstrations at farmers’ markets, the sauces are now available in Kroger stores, Whole Foods and on Amazon. Keng says even though she grew up working in her family’s restaurant, she swore she’d never go into food. She became an advocate of social justice issues while attending Vassar College and Harvard University’s Kennedy School of Government. Her education led her to campaign successfully and serve two terms on the town council in South Hadley, Mass. She also worked in diversity communications for financial services company MassMutual. But, craving grits and boiled peanuts, she came home to Georgia in 2008, and her entrepreneurial gene kicked in along with her dedication to inspiring positive multicultural relations through food. “It was part of my passion to be able to share about cooking, but also about our culture and history and stories of our family life and identity,” Keng says. “It [the business] became like a stir fry: it looks like there’s a lot of different things, but they all stand on their own.” This article appears in the May 2019 issue of Georgia Trend. Categories: Trendsetters, Up Front Tags: Chinese Southern Belle, Mary Ann DeMuth Trendsetters: Saving Smarts for Kids Trendsetters: Keeping a Craft Alive Trendsetters: Yorkville Hops & Produce Free DAILY eNews Sign up to get our free news roundup, Georgia Trend Daily, in your inbox Free digital edition Sign up to receive the free monthly digital edition of Georgia Trend in your inbox Browse The Digital Edition Greater Columbus GA Chamber Business After Hours @ Rivermill Event Center Enjoy hors d’oeuvres and beverages in a relaxed setting with other Chamber members once the work day ends. Hosted at a fellow member business starting at 5:30pm the Business After Hours is the perfect opportunity to meet, mingle and make new contacts. This is a member exclusive event. 21 & up PCOM South Georgia Ribbon Cutting @ PCOM South Georgia PCOM South Georgia’s leadership team is planning a ribbon-cutting ceremony which will take place on August 6, 2019 at 2 p.m. Georgia Governor Brian Kemp has confirmed that he will address attendees as the first four-year medical school in Southwest Georgia opens its doors. The ribbon-cutting ceremony will begin at 2 p.m. Refreshments and tours will follow the ceremony. A community open house will take place until 6 p.m Greater Hall Chamber Business After Hours @ Georgia Mountain Food Bank The faces of hunger may surprise you. Come learn more as Georgia Mountain Food Bank kicks off our fall activities at Business After Hours on August 8. Hosted at GMFB, and sponsored by Liberty Utilities, we will share our fall calendar including introducing the Quinlan Visual Arts Center’s newest exhibit, “Still Hungry in America,” opening August 16, which explores the faces of hunger over the past fifty years as captured by photographer Al Clayton and his daughter Jennie. Join us for food, music and fun and hear all we have going while networking with Chamber friends. gamountainfoodbank.org Georgia Trend’s 2019 40 Under 40 Celebration @ Ocean's Ballroom of the Georgia Aqarium Join us for our annual celebration of Georgia Trend’s 2019 40 Under 40 nominees. Tweets by GeorgiaTrend Employment Evolution Economic Development Around the State Local Address, Global Reach Hospital Mergers: The Wheres, the Whys and the Hows Carpet Maker To The World 100 Most Influential Georgians: Georgia's Power List Moving MARTA forward Atlanta’s MARTA is moving forward with transit expansions and transit oriented development (TOD), all designed to get more metro residents where they want to be. TODs – development on land around a transit station that MARTA owns and leases to a developer – are one of the newer tools in the MARTA toolbox. The idea […] Igniting innovation The nonprofit Jewish Federation of Greater Atlanta has awarded a total of $200,000 in PROPEL Innovation Grants to 10 organizations that are reimagining Jewish life in the city. The grants will help launch creative, scalable projects that can positively impact the community. PROPEL Grant recipients include: Hillel Georgia Tech, for developing innovative assistive devices for […] Accelerate Southside launches Invest Atlanta, the city’s economic development agency, and The Guild, a co-living organization helping entrepreneurs with business services that include asset and real estate ownership, are partnering in a new program for minority-owned businesses. Accelerate Southside will assist businesses south of Atlanta in growing and owning space as a wealth-building tool. The program will address […] Sustainable Georgia Roundup Political Notes Economic Development Features Sustainable Georgia At Issue Georgia View Neely Young Sports Leisure Georgia Fare Art of the Meal Sports Desk Georgian of the Year Respected Leader Best Places Influential Georgians © 2019 Georgia Trend Magazine. 5880 Live Oak Pkwy Suite 280 770-931-9410 (Main #)
cc/2019-30/en_middle_0028.json.gz/line13206
__label__wiki
0.621183
0.621183
General News of Thursday, 20 December 2018 Source: dailyguideafrica.com Sanitation Minister to sue Ahi over wicked lies Minister of Sanitation and Water Resources, Cecilia Abena Dapaah, is expected to sue the opposition National Democratic Congress (NDC) Member of Parliament (MP) for Bodi, Sampson Ahi for allegedly defaming her. Mr. Ahi, a former deputy minister of Works and Housing and current Ranking Member of the Works and Housing Committee of Parliament, alleged recently that the 2019 Budget estimates of allowances for the Sanitation Ministry were meant for the clothing and entertainment of Ms Dapaah. He also raised concerns about the estimated GH¢89,000 that the Sanitation Ministry was due to spend as personal emoluments on the recruitment of security personnel. But at a press conference held on Monday, December 16, 2018, she dismissed the claims, saying they were meant to discredit her. “The allegations are misplaced, a set of wicked lies, malicious, defamatory and propaganda meant to attack my hard won reputation and integrity.” According to her, “This has caused me and my family pain and embarrassment, as well as emotional distress.” Setting records straight Setting the records straight, the minister explained that “I, Cecilia Abena Dapaah, Minister for Sanitation and Water Resources, am not in any way and by any stretch of imagination benefitting or getting any budget allocation for clothes and entertainment as the MP for Bodi, Hon. Sampson Ahi alleges.” According to her, “For his information, Cecilia Abena Dapaah has never stayed in a government bungalow since joined public service 40 years ago.” She revealed that the expenditure items as listed in the budget of the ministry, were meant for public service officers within categories ‘A and B’ in the Public Service (Directors and above) and not for the minister.” Ms Dapaah mentioned that benefits such as fuel, vehicles, housing, domestic house help, entertainment go to all directors and chief directors of all ministries, departments and agencies. “I wish to draw the attention of Hon. Ahi to the fact that the allowances he was referring to were officially approved by the Fair Wages and Salaries Commission and communicated to all MDAs by the Ministry of Finance.” According to her, “Furthermore, these allowances are perks and as such are not to be negotiated, but determined from time to time by the employer, which is the government.” She also disclosed that the GH¢89,000 would be given to four environmental health workers of the Ministry. Ms Dapaah, on Monday, December 16, 2018, gave Mr. Ahi 48 hours to render an unqualified apology for defaming her. She also asked Ghanaweb and Herald Newspaper to apologize for publishing the defamatory statements of Mr. Ahi. I won’t apologize But Mr. Ahi has dared her to take him to court, saying he would not apologize. The Herald Newspaper defiantly published Mr. Ahi’s reaction to the minister on Wednesday, December 18. Sources told DAILY GUIDE that the Minister would take legal action against Mr. Ahi and the newspaper in the coming days. Sanitation: 2019 Miss Metro Ghana contestants to use beauty and intellect as weapon of ‘warfare’ 2 jailed, 8 fined GH? 3,840 for sanitation offences 2 jailed, 8 fined GHC 3,840 for sanitation offences Government to provide more litter bins to tackle sanitation - Sanitation Minister Support Assemblies to improve sanitation – Accra Mayor to media Read all related articles This article has 15 comment(s), give your comment Bawumia leads government trade, investment delegation to Canada
cc/2019-30/en_middle_0028.json.gz/line13210
__label__cc
0.747017
0.252983
Hello Kitty gears up to big B-Day celebrations Can you imagine that the ever-young feline character from Japan is getting 35 this November? While the main birthday celebrations will be held on November 1, the Day Hello Kitty was created in 1974, celebs as well as designers and the whole fashion world are already gearing up for big global celebrations. I like Hello Kitty, and I love my Hello Kitty tote, it’s just awesome, so I’m really looking forward to new Hello Kitty stuff coming in the next few months. First of all, Hello Kitty creator Sanrio Co. is going to launch a new British inspired tartan collection that will hit Japanese stores this month. The checkered-pink series will feature handbags, trinkets, a shawl and a Kitty version of a teddy bear. Also, get ready for Hello Kitty special birthday iPhone cases and business card holders designed by Kimora Lee Simmons, a one-of-a-kind Hello Kitty-inspired Swarovski necklace, and other collaborations with designers like Judith Leiber, Linda Farrow, and American Apparel among others, WWD.com reported. Besides, some celebs wearing Hello Kitty will take part in the photo exhibition held in New York and LA in October this year to mark the glam event. Are you excited? Hello Kitty was created in 1974 as an Asian counterpart to Mickey Mouse. Ever since 1980 it has been designed by Yuko Yamaguchi. Hello Kitty has become a massive global brand selling some 50,000 products in 70 nations, including dolls, clothes, accessories and homeware. Hello Kitty has some A-list fans as well. Check out some of then in the gallery below: Lady GaGa (Hello Kitty inspired hair bow) Mariah Carey (check out the bandaid) Taylor Momsem Britney Spears (Hello Kitty necklace in ‘Do Something’ video) HAPPY COMING BIRTHDAY, HELLO KITTY! Camilla Skovgaard F/W 2010-2011 shoe range Jessica Simpson & Co: Hollywood's new trend - no prenup! Britney Spears comic book Category: Celeb Fashion Trends, Glam Events Posted to: AnnaLynne McCord, Britney Spears, Cameron Diaz, Katy Perry, Kimora Lee Simmons, Lady GaGa, Mariah Carey, Paris Hilton, Taylor Momsem How to be rich & famous: The Hills Full-length trailer of ‘Beastly’
cc/2019-30/en_middle_0028.json.gz/line13213
__label__wiki
0.912298
0.912298
Sophia’s family: She was the centre of our universe Assistance dogs at Lockyer Valley Regional Council Winter rain for the Lockyer Valley Seatbelt offence, Laidley Learner driver killed in single vehicle rollover north of Jandowae Notre Dame Cathedral ravaged by fire in Paris Julian Assange arrested Liberal versus Labor: key policies Federal election 2019: Our pollies behaving badly Walrus scene - Our Planet How Queensland police use iPads to fight crime He is not us: Fraser Anning condemned in Senate Truck driver sacked over cyclist abuse Desperate search for William captured Jason Blackwood Senator Fraser Anning slaps prankster twice after egging Sophia Naismith's family's emotional tribute (7 News) by Elizabeth Henson, Andrew Hough, Josephine Lim The devastated parents of teenager Sophia Naismith - who was struck and killed by a sports car - have made an emotional tribute to their "cherished first-born", declaring her "the centre of our universe". The out-of-control high performance Lamborghini hit the popular Brighton Secondary School student, aged 15, on a footpath on Morphett Rd, Glengowrie on Saturday night. She died at the scene, while her best friend Jordyn Callea, also 15, was seriously injured. The car stopped outside the House of Tien Chinese restaurant just after 10pm. Sophia's parents, Pia Vogrin and Luke Naismith, of Seaview Downs, on Monday released an emotional tribute to the talented athlete, and gifted student, as did Jordyn, who is recovering in hospital. Sophia Naismith, 15, was killed when she was hit by an out-of-control Lamborghini on Morphett Rd at Glengowrie on Saturday. Picture: Supplied by family. Brighton students are receiving counselling to help them cope with what Sophia's school principal Toni Carellas described as "one of our saddest days". Her parents told how "everything has changed". "Nothing prepares you for times like this," they said, speaking on behalf of Sophia's two younger sisters, and their wider family. "Sophia was the centre of our universe. Our cherished first-born. Best friend to her sisters. Adored by her grandparents. Admired by her Aunts, Uncles and cousins. Good friend to many. Loved by all. Everything has changed. She was an accomplished state volleyballer, gymnast, soccer player and a popular and gifted student. Our lives will never be the same again." They added: "We want to thank our precious family and friends for their love and support in such a distressing time. "We also want to thank the paramedics and police who came to Sophia's aid. Our thoughts and prayers are with Sophia's friend Jordyn who was injured in the accident." Hours earlier, Sophia's parents were visibly distressed during a visit to the crash scene accompanied by friends, as they read the tributes to their daughter. Friends said the girls had been waiting for Sophia's father, a respected member of the state's film industry. Jordyn Callea, right, posted this photograph of her and her best friend Sophia Naismith, on Instagram on Monday. Relatives described the best friends, and classmates, as "inseparable". Jordyn, of Richmond, in Adelaide's inner south west, was last night in a stable condition in the Flinders Medical Centre. She posted her own tribute to her friend on social media, along with a picture of the pair together. "Every single piece of my heart goes out to this strong, beautiful girl," she wrote. "I will love you forever and always. Words cannot describe how much I want to change what has happened. "You will be forever loved in everyone's heart and never forgotten." She finished with "rest easy Soph, I love you". A woman leaves flowers at the scene where Sophia was killed. Picture: Tricia Watkinson The Lamborghini driver, Alexander Damian Campbell, 37, has been charged with causing Sophia's death, and Jordyn's injuries, by dangerous driving. He was bailed to appear in court next month. Police do not believe the sports car, which accelerates from 0-100km/h in 3.4 seconds, was involved in any street racing although officers are investigating whether his driving was a contributing factor. The white $330,000 Lamborghini Huracan, which also hit a sign post and a tree, came to a rest after it crashed into the restaurant. It has become a makeshift shrine as Sophia's family and scores of friends left flowers and heartfelt messages at its entrance. Video of the moments leading up to the crash emerged on Sunday that showed the sports car side-by-side with another vehicle. The smash capped a horror four hours on the state's roads, during which three people died and two drivers were charged. Many students at Brighton, where both girls were studying Year 10, chose to stay home on Monday, while some classmates turned her locker into another shrine. In a statement issued by the Education Department, Ms Carellas said the school was "in mourning". "This is one of our saddest days as a school community and it will take us a long time to come to terms with what has happened," she said. She described Sophia as "gifted". "Sophia was a popular and vibrant member of our school who brought a huge amount of positive energy to everything she did," she said. "She was a gifted athlete and brilliant academically. "Her contribution to school life across the board, but in particular to our volleyball program, will be missed enormously by her teammates, friends and teachers alike." The school has arranged counsellors for students and teachers and "at the appropriate time we will reach out to Sophia's family to discuss how we can best celebrate her life". "Our thoughts are also with Jordyn and her family and we hope for a speedy recovery," she said. Flowers left in tribute to Sophia Naismith outside the House Of Tien restaurant. Picture: Tricia Watkinson A growing amount of flowers and tributes are being left at the scene. Picture: Tricia Watkinson ALF star’s tragic death sophia naismith crash editors picks fatality lamborghini sophia naismith Mayor followed by eager student Community Year 11 student Lachlan Armstrong spent the day shadowing the LVRC Mayor YOUR GUIDE: what time the fire works are on and more News President expects a bumper show despite drought Federal treasurer meets with irrigators on water security News Canberra came to the Lockyer Valley today OPINION: Why you should enter the show Opinion You don't have to be a superstar to enter the show
cc/2019-30/en_middle_0028.json.gz/line13216
__label__cc
0.632836
0.367164
Home » Security » Uber dismissive about security flaw that lets hackers bypass its 2FA Uber dismissive about security flaw that lets hackers bypass its 2FA January 23rd, 2018 Waqas Security 0 comments by Waqas on January 23rd, 2018 TagsBug, Bug Bounty, Flaw, hacking, internet, Privacy, security, Technology, Two-Factor Authentication, Uber, Vulnerability Uber has no plans to fix a critical security flaw in its two-factor authentication (2FA) protocol reported by an IT security researcher. An Indian IT security researcher Karan Saini has discovered a critical security flaw in the two-factor authentication protocol used by the ride-hailing giant Uber to protect user accounts from hijacking and prevent their data from hackers. The flaw, on the other hand, allows attackers to bypass 2FA that could apparently lead them to perform a number of malicious acts including hacking a targeted account, change its username and password and book expensive rides etc. More: Uber users beware; Faketoken Android malware hits ride-sharing apps Simply put, 2FA is an extra layer of security that is known as “multi-factor authentication” that requires not only a password and username but also something that only that user has on them, i.e. a piece of information only they should know or have immediately to hand – such as a physical token or a code. Uber not serious about fixing the bug In Uber’s case, Siani reported his findings to Uber’s bug bounty program on HackerOne, who acknowledged that there is indeed a bug in its two-factor authentication but at the same time the company downplayed the severity of it and stated that his findings were informative but “this report contained useful information but did not warrant an immediate action or a fix.” Uber uses two-factor authentication in case of suspicious login activity and sends the second code to the user’s device in order to verify their identity. Uber has been testing the 2FA feature since 2015 however, Siani’s findings highlighted how a hacker can bypass 2FA security without even entering the correct code. According to a statement to ZDNet, Uber spokesperson Melanie Ensign said that the bug was not a bypass but could be caused by ongoing security testing the company is conducting on the app. “We’ve been testing different solutions since we received a lot of user complaints about requiring 2FA on [an Uber web address which we are redacting per our decision to not reveal specifics of the bug] when people are trying to report a lost or stolen phone and can’t receive a code on that device, Ensign told ZDNet. “We believe those tests are causing both the existence and inconsistency of this issue.” Not for the first time If you are a hacker or security researcher keen to report vulnerabilities to Uber you have to be sure about the severeness of it as you never know what is serious for the company and what not. However, this is not the first time that Uber has rejected someone’s findings regarding the presence of critical security flaws in its online infrastructure. In December 2017, a security researcher Gregory Perry reported his findings to Uber bug bounty program on HackerOne but in return, the company rejected his findings. In his blog post “How I Got Paid $0 From the Uber Security Bug Bounty” Perry described his experience with Uber and labeled its bug bounty program as “completely bogus.” Uber pays to cybercriminals but not to the good guys Last time when Uber was in news regarding its security was in November 2017 when Bloomberg reported that the ride-hailing giant suffered a massive security breach in October 2016 in which hackers stole private details of around 75 million Uber users. In return, the company paid $100,000 to hackers to hide the breach. In the breach, two hackers stole files containing names and license numbers of 600,000 drivers from the US and personal data such as names, email IDs and mobile phone numbers of 57 million Uber users from across the globe. If Uber keeps on treating the good guys like Saini and Perry in such a negative manner, it is quite possible that reluctant security researchers might simply stop reporting their findings to Uber which could be disastrous for the company. Remember, companies like Google and Microsoft have their own security teams yet they depend on independent security researchers and firms to report the existence of vulnerabilities and malware in the system and it has been quite successful for both. Image credit: DepositPhotos/Simpson33 Previous article Evrial Info-Stealing Trojan Modifies Addresses to Steal Cryptocurrency Next article Opera Mobile Browser for Android & iOS Blocks Cryptocurrency Mining
cc/2019-30/en_middle_0028.json.gz/line13220
__label__cc
0.715738
0.284262
FEES 7.1.1R 01/06/2010 1This chapter applies to every person listed in FEES 1.1.2R (5). The purpose of this chapter is to set out the requirements on the persons listed in FEES 7.1.1 R to pay annual CFEB levies in order to establish and fund the CFEB. Section 6A(1) of the Act (Enhancing public understanding of financial matters etc) (as it had effect before the passing of the Financial Services Act 2012) required4 the FSA to establish the CFEB in order to enhance: the understanding and knowledge of members of the public of financial matters (including the UK financial system); and the ability of members of the public to manage their own financial affairs. Paragraph 12(1) of Part 2 of Schedule 1A to the Act enables the FCA to make rules requiring certain2 authorised persons or payment service providers or electronic money issuers2 to pay to the FCA specified amounts or amounts calculated in a specified way in order to meet a proportion of: the expenses incurred by the FCA in establishing the CFEB, whenever these were incurred; and the expenses incurred, or expected to be incurred, by the CFEB in connection with the discharge of the functions described in FEES 7.1.3 G. FEES 7.1.5G 01/06/2010 FEES 7 sets out the rules referred to in FEES 7.1.4 G. The FCA must have regard to other anticipated sources of funding of the costs described in FEES 7.1.4 G when setting the CFEB levy. The amounts to be paid under the CFEB levy may include a component to cover the FCA's expenses in collecting the payments. The FCA must pay to the CFEB the amounts that it receives under the CFEB levy apart from amounts in respect of its collection costs (which it may keep). Paragraph 7(1) of Part 1 of Schedule 1A to the Act requires the CFEB to adopt an annual budget which has been approved by the FCA. FEES 7.1.10G 01/06/2010 RP This chapter sets out the method by which the CFEB levy will be calculated. Details of the actual levy payable will vary from year to year, depending on the CFEB's annual budget. These details are set out in FEES 7 Annex 1. New details will be prepared and consulted on for each financial year. 2A firm is not liable to pay a CFEB levy in relation to payment services or electronic money issuance if it is the Bank of England, a government department, a local authority, a municipal bank or the National Savings Bank.
cc/2019-30/en_middle_0028.json.gz/line13222
__label__cc
0.624497
0.375503
+ Text Only Site + Non-Flash Version + Contact Glenn This page is intended for college, high school, or middle school students. For younger students, a simpler explanation of the information on this page is available on the Kid's Page. As an aircraft moves through the air, the air molecules near the aircraft are disturbed and move around the aircraft. Exactly how the air re-acts to the aircraft depends upon the ratio of the speed of the aircraft to the speed of sound through the air. Because of the importance of this speed ratio, aerodynamicists have designated it with a special parameter called the Mach number in honor of Ernst Mach, a late 19th century physicist who studied gas dynamics. For aircraft speeds which are much greater than the speed of sound, the aircraft is said to be hypersonic. Typical speeds for hypersonic aircraft are greater than 3000 mph and Mach number M greater than five, M > 5. We are going to define a high hypersonic regime at M > 10 to account for re-entry aerodynamics. The chief characteristic of hypersonic aerodynamics is that the temperature of the flow is so great that the chemistry of the diatomic molecules of the air must be considered. At low hypersonic speeds, the molecular bonds vibrate, which changes the magnitude of the forces generated by the air on the aircraft. At high hypersonic speeds, the molecules break apart producing an electrically charged plasma around the aircraft. Large variations in air density and pressure occur because of shock waves, and expansions. The only manned aircraft to fly in the low hypersonic regime were the X-15 and the Space Shuttle during re-entry. The X-15 is shown on the figure. The X-15 used a rocket propulsion system to achieve sustained Mach 6 flight. Recently, an un-manned X-43A used a scramjet, or supersonic combustion ramjet, to make two hypersonic flights; one at Mach 7, the other at Mach 10. Because of the pressure losses associated with the terminal shock of the inlet, a ramjet has very limited performance beyond Mach 5. Because lift and drag depend on the square of the velocity, hypersonic aircraft do not require a large wing area. For Mach numbers greater than 5, the frictional heating of the airframe by the air becomes so high that very special nickel alloys are required for the structure. For some proposed hypersonic aircraft, the skin is actively cooled by circulating fuel through the skin to absorb the heat. Navigation .. Beginner's Guide Home Page + Inspector General Hotline + Equal Employment Opportunity Data Posted Pursuant to the No Fear Act + Budgets, Strategic Plans and Accountability Reports + Freedom of Information Act + The President's Management Agenda + NASA Privacy Statement, Disclaimer, and Accessibility Certification Editor: Nancy Hall NASA Official: Nancy Hall Last Updated: May 05 2015
cc/2019-30/en_middle_0028.json.gz/line13228
__label__cc
0.600365
0.399635
Chandragupta leads India in Civilization VI 2K Games has revealed that the second of the nine leaders in Civilization VI’s Rise and Fall DLC pack will be Chandragupta. Although not as well known as the previously announced Genghis Khan, Chandragupta Maurya built up a huge Indian empire in the third century BC. Renowned as a master strategist and diplomat, he rose to fame by toppling the corrupt Nanda dynasty in 322 BC, installing himself as ruler, and reclaiming land in the Indus Valley that had been conquered by Alexander the Great’s Macedonian empire. From 305 to 303, he waged war with the Seleucid empire, which he won; eventually Chandragupta’s empire stretched from modern-day Afghanistan to southern India. Later in life, he discovered the religion Jainism and renounced everything in favour of meditation. You can read more about Chandragupta – a historical figure with a surprisingly modern outlook – on the Civilization VI blog. Or peruse the video below. Chandraguptra will come with a leader ability entitled Arthashastra, which roughly translates as “The science of politics”. In Civilization VI: Rise and Fall, that ability will bring Movement and Combat Strength bonuses as you march into battle. Previous articleHas update removed NES Golf Easter egg from Switch? Next articleGran Turismo 6 online services to end on March 28 Civilization VI: Rise and Fall – new features explained Genghis Khan to feature in Civilization VI Firaxis want to keep doing expansion packs instead of micro-transactions First expansion for Civilization VI is announced Civilization VI: Q&A with Sarah Darney, Associate Producer Civilization VI: Q&A with Brian Busatti, Art Director
cc/2019-30/en_middle_0028.json.gz/line13232
__label__wiki
0.707142
0.707142
Eleven-year-old Riley knows a thing or two about wishes. Ever since his mom disappeared, all he's been doing is wishing: wishing for her return, wishing he'd stop wetting the bed and wishing his dad would love him again. Finally, with the police investigation stalled and worried his mother might soon be out of time, Riley is desperate for answers. So, he turns to the Whispers, mythical wood creatures who will grant your heart’s desires if you bring them tribute. It's a story his mother used to tell him every night. He never really believed they were real until one day he hears them call to him, telling him his mother is near. Riley is determined to find the Whispers and ask for the one thing he wants the most: his mother's return--no matter the cost--especially since he thinks a secret he’s been holding close is the reason she's gone. This is his chance to make things right. Along with his best friend, his loyal dog and a neighbor boy with secrets of his own, Riley ventures deep into the dark woods--where all sorts of dangers lurk--to find the Whispers and, he hopes, his mother. But what he finds will change everything for Riley forever. Greg Howard stuns in this heartrending, mesmerizing debut about love, magic and what it means to believe in the impossible. Praise for The Whispers: “This taut, moving tale delves beyond loss into issues of sexuality, conformity and self-acceptance…a masterful exploration into the power of storytelling but also its dangers, including self-denial and escapism.” —The New York Times Book Review “With sensitivity and skill, Howard handles themes of sexual identify, self-worth, loss and friendship.” —The Washington Post "Howard’s personal story helps create a fictional narrative both realistic and relevant, while also calling on the fantastical magic of the imagination…. A tale of family, friendship and loss, filled with magic and heart." —The Associated Press "A dreamy novel recalling Bridge to Terabithia." —Entertainment Weekly "A heartbreaking, beguiling debut… This poignant journey through the badlands of grief is crammed with tenderness, wit and warmth." —The Guardian ★ "This is a story of a boy coming to grips with heartbreak and trying to understand why he is the way he is, who must learn to discern what is real, and who discovers redemption." —School Library Connection, starred review "A beautiful, heart-expanding journey into the wilds of grief and back out again. This gorgeous book will give readers’ hearts a hug that’s filled with hope and possibility."—Donna Gephart, author of In Your Shoes and Lily and Dunkin "A moving, thoughtful examination of trauma, grief, and the power of imagination." —Teen Librarian Toolbox "A beautiful, heartfelt book about love and loss and friendship. It feels real and true and resonant. Bravo, Greg Howard!" —Dan Gemeinhart, author of The Remarkable Journey of Coyote Sunrise "The Whispers needs to be on every reading list of kids who loved Bridge to Terabithia and Counting by 7s." —B&N Kids Blog "A realistic tale of coming to terms and coming-of-age, of friendship and loss, with a touch of magic and humor."—Kirkus "We’re predicting this emotional story will be an award winner." —Parents Magazine "A touching story of grief and healing." —Booklist "This touching, often wry novel offers a memorable psychological puzzle and explores grief and acceptance." —Publishers Weekly "[Riley’s] a thoroughly sympathetic [narrator], and it’s easy to root for his eventual understanding of the truth—and of his own blamelessness." —Horn Book Magazine "…an inspired and sensitive portrait of childhood traumatic grief." —Bulletin of the Center for Children’s Books "Riley’s voice is so wise and funny and compelling that readers—especially but not exclusively young ones—will gladly follow him on the kind of harrowing, hilarious journey that shows us we can survive the heartbreak and the beauty the world has in store for us." —Sam J. Miller, author of The Art of Starving and Blackfish City "A thrill ride to the soul. Gorgeously written, full of depth and wit." —James Brandon, author of Ziggy, Stardust and Me Order THE WHISPERS here: Amazon | Barnes & Noble | IndieBound | BAM | Powell’s
cc/2019-30/en_middle_0028.json.gz/line13233
__label__cc
0.72591
0.27409
GroupOne Revenue Cycle Blog Insights to guide your practice. Meaningful Use Changes: #1 Patient Interaction by Kaitlyn Houseman on May 9, 2011 Patients Will Be More Involved in Their Care With more information in their hands because of meaningful use, and more data available to physicians at the time of a visit, patients are going to be more involved in health care decisions, experts said at HIMSS. One way meaningful use rules address this is by granting patients access to medical records, including diagnostic results, problem lists and medication lists. Many practices and hospitals already provide this access through patient portals, many of which combine data with patient education tools. Some of these organizations offered a glimpse of what other practices can expect when the physician-patient relationship is changed by technology. On average, elderly, chronically ill patients see 14 physicians. Michael Solomon, PhD, is practice lead of eCare Management at the Coral Springs, Fla.-based health information technology consulting firm Point-of-Care Partners. He and researchers from the Carolinas Healthcare System conducted a 12-week controlled randomized study of 220 patients using the portal offered to patients of Carolinas Physician Network, a large medical group operated by CHS. They analyzed the effectiveness of the portal to engage patients and affect patient outcomes. "If we expect the patient to play a critical role in a patient-centered approach to care, then we need to measure the effect of care intervention on a patient's level of engagement -- that is, how activated they are in their own health care," Solomon said. The group found that the more patients used the portal, the more engaged they were in their health care. For Miramont Family Medicine, a family medicine practice in Fort Collins, Colo., adopting an EMR meant that patient visits were more meaningful because of the information available and collected at the time of visit. John Bender, MD, a family physician at Miramont, said "value-added time" -- time patients actually spend with doctors as opposed to sitting in waiting rooms -- improved from 64% to 67% after implementation. "Now that doesn't sound large," he said, "But a 3 [percentage point] improvement across all 10,000 patients we were seeing at the time -- that's huge." Dr. Bender said this was especially significant, given that the average appointment time increased from 41 to 51 minutes after going electronic. Doctors are documenting several metrics they weren't documenting before, and patients "are getting a lot more time per visit with the physician." Topics: Patient Portal, Incentive Programs
cc/2019-30/en_middle_0028.json.gz/line13236
__label__cc
0.604179
0.395821
GTR Ventures Forgotten your password? Password No account yet? Create one now By signing up, you agree to GTR Privacy Policy and Terms of Use. HSBC creates new senior trade finance role for Europe On the Move / 01-05-19 / by Sanne Wass EU-Vietnam FTA: Two down, eight to go in Asean Absa Bank secures syndicated facility to boost US dollar lending Inwha Huh leaves HSBC to join IBM Demica to offer direct access to its receivables finance platform HSBC’s Jasmine22 startup relaunched as Serai HSBC has appointed George Francis as Europe head of business management in the bank’s global trade and receivables finance (GTRF) business. In this newly-created position, Francis will play a leading role in shaping and executing GTRF EU27 region-wide strategies, client-centricity and connectivity across the group, according to an HSBC spokesperson. He will report to Andrew Betts, regional head of GTRF Europe and global head of commodities at HSBC. Francis moves to London from Dubai, where he was HSBC’s regional head of business management, trade and receivables finance for Mena and Turkey. Before joining the bank in 2014, he was a manager in the group strategy department of Emirates NBD. He has previously held consultancy and analyst roles at PwC and First National Bank Lebanon. Tags: Andrew Betts, George Francis, HSBC JP Morgan hires new treasury services head in Thailand Supply chain finance industry gets guidance on receivables discounting Canopius continues Asia Pacific expansion with Singapore hire Digitising African commodity trading: “You can just be digitising existing inefficiencies” GTR Asia 2019 GTR Training Masterclass Singapore 2019 GTR Training Masterclass Geneva 2019 [see more] GTR Best Deals 2019 View recent issue's contents Get listed in GTR Directory now! Become a part of the most comprehensive contact listing of service providers in the global trade, commodity and export finance markets. What is Trade Finance? © Exporta Publishing & Events Ltd 2019 Our privacy commitments This Privacy Policy outlines the information we may collect about you in relation to your use of our websites, events, related publications and services (“personal data”) and how we may use that personal data. It also outlines the methods by which we and our service providers may (subject to necessary consents) monitor your online behaviour to deliver customised advertisements, marketing materials and other tailored services. This Privacy Policy also tells you how you can verify the accuracy of your personal data and how you can request that we delete or update it. This Privacy Policy applies to all websites operated by Exporta Publishing & Events Ltd (as indicated on the relevant website). This privacy statement does not cover the activities of third parties, and you should consult those third-party sites’ privacy policies for information on how your data is used by them. Any questions regarding this Policy and our privacy practices should be sent by e-mail to privacy@gtreview.com or by writing to Data Protection Officer at, Exporta Publishing & Events Ltd, 4 Hillgate Place, London, SW12 9ER, United Kingdom. Alternatively, you can telephone our London headquarters at +44 (0) 20 8673 9666. Established in 2002 and with offices in London and Singapore, Exporta Publishing & Events Ltd is the world’s leading trade and trade finance media company, offering information, news, events and services for companies and individuals involved in global trade. Our principal business activities are: Business-to-Business financial publishing. We provide a range of products and services focused on international commodities, export, supply chain and trade finance markets including magazines, newsletters, electronic information and data Organisers of seminars, conferences, training courses and exhibitions for the finance industry Exporta Publishing & Events Ltd is a company registered in the United Kingdom with company number 4407327 | VAT Registration: 799 1585 59 This Data Protection Policy explains when and why we collect personal information about people who visit our website, how we use it, the conditions under which we may disclose it to others and how we keep it secure. Why do we collect information from you? Our primary goal in collecting personal data from you is to give you an enjoyable customised experience whilst allowing us to provide services and features that will meet your needs. We collect certain personal data from you, which you give to us when using our Site and/or registering or subscribing for our products and services. However, we also give you the option to access our Sites’ home pages without subscribing or registering or disclosing your personal data. We also collect certain personal data from other group companies to whom you have given information through their websites (including, by way of example, Exporta Publishing & Events Ltd and subsidiaries, in accordance with the purposes listed below). Should we discover that any such personal data has been delivered to any of the Sites, we will remove that information as soon as possible. Why this policy exists This Data Protection Policy ensures Exporta Publishing & Events Ltd: Complies with data protection law and follow good practice Protects the rights of staff, customers and partners Is open about how it stores and processes individuals’ data pretexts itself from the risk of a data breach We may change this Policy from time to time so please check this page occasionally to ensure that you’re happy with any changes. By using our website, you’re agreeing to be bound by this Policy. Data protection law The Data Protection Act 1998 described how organisations – including Exporta Publishing & Events Ltd – must collect, handle and store personal information. These rules apply regardless of whether data is stored electronically, on paper or on other materials. To comply with the law, personal information collected must be stored safely, not disclosed unlawfully and used fairly. The Data Protection Act is underpinned by eight important principles. These say that personal data must: Be processed fairly and lawfully Be obtained only for specific, lawful purposes Be adequate, relevant and not excessive Be accurate and kept up to date Not be held for any longer than necessary Processed in accordance with the rights of data subjects Be protected in appropriate ways Not be transferred outside the European Economic Area (EEA), unless that country of territory also ensures an adequate level of protection How do we collect information from you? We obtain information about you when you use our website, for example, when you contact us about products and services, when you register for an event, register to receive eNewsletters, subscribe or register for a trial to our GTR magazine/website. Types of Personal Data Held and its Use 1. Customer Services and Administration On some Sites, Exporta Publishing & Events Ltd collects personal data such as your name, job title, department, company, e-mail, phone, work and/or home address, in order to register you for access to certain content, subscriptions and events. In addition, we may also store information including IP address and page analytics, including information regarding what pages are accessed, by whom and when. This information is used to administer and deliver to you the products and/or services you have requested, to operate our Sites efficiently and improve our service to you, and to retain records of our business transactions and communications. By using the Sites and submitting personal information through the registration process you are agreeing that we may collect, hold, process and use your information (including personal information) for the purpose of providing you with the Site services and developing our business, which shall include (without limitation) the purposes described in the below paragraphs. 2. Monitoring use of our Sites Where, as part of our Site services, we enable you to post information or materials on our Site, we may access and monitor any information which you upload or input, including in any password-protected sections. Subject to any necessary consents, we also monitor and/or record the different Sites you visit and actions taken on those Sites, e.g. content viewed or searched for. If you are a registered user (e.g. a subscriber or taking a trial), when you log on, this places a cookie on your machine. This enables your access to content and services that are not publicly available. Once you are logged on, the actions you take – for example, viewing an article – will be recorded (subject to any necessary consents). We may use technology or a service provider to do this for us. This information may be used for one or more of the following purposes: to fulfil our obligations to you; to improve the efficiency, quality and design of our Sites and services; to see which articles, features and services are most read and used to track compliance with our terms and conditions of use, e.g. to ensure that you are acting within the scope of your user licence; for marketing purposes (subject to your rights to opt-in and opt-out of receiving certain marketing communications) – see paragraph 3 below; for advertising purposes, although the information used for these purposes does not identify you personally. Please see paragraph 5 below for more details; to protect or comply with our legal rights and obligations; and to enable our journalists to contact and interact with you online in connection with any content you may post to our Sites. Please see paragraph 5 below for more information on cookies and similar technologies and a link to a page where you can turn them on or off. Some of your personal data collected under paragraphs 1 and 2 above may be used by us to contact you by e-mail, telephone and/or post for sending information or promotional material on our products and/or services and/or those of our other group companies.
We give you the opportunity to opt-out of receiving marketing communications. Further detail can be found on the applicable Site and in the footer of each marketing communication sent by us, our group companies or service providers. See also “Consents and opt-outs” section below.
We will not share your information with third parties for marketing purposes. We may analyse your personal information to create a profile of your interests and preferences so that we can contact you with information relevant to you. 5. Cookies and similar technologies All our Sites use cookies and similar technical tools to collect information about your access to the Site and the services we provide. When you enter some sites, your computer will be issued with a cookie. Cookies are text files that identify your computer to servers. Cookies in themselves do not identify the individual user, just the computer used. Many sites do this whenever a user visits their site in order to track traffic flows, recording those areas of the site that have been visited by the computer in question, and for how long. Users have the opportunity to set their computers to accept all cookies, to notify them when a cookie is issued, or not to receive cookies at any time. Selecting not to receive means that certain personalised services Exporta Publishing & Events Ltd offers cannot then be provided to that user. Why do we use cookies? Log In – Where we provide log in mechanisms for site users a cookie is created at login and for the duration of the session. Each cookie contains a unique reference number only (no personal information) which is used to confirm you are authorised. Analytics – To allow us to keep track of traffic to our website we use cookies. The cookies simply tell us if you have previously visited our website so we can get more accurate figures for New vs Returning visitors. Find and control your cookies All of the major browser providers offer advice on setting up and using the privacy and security functions for their products. If you require technical advice or support for a specific browser/version please contact the provider or visit their website for further details: www.microsoft.com / www.mozilla.com / www.apple.com / www.opera.com / www.aol.com / www.netscape.com / www.flock.com / www.google.com We may use cookies to: remember that you have used the Site before; this means we can identify the number of unique visitors we receive to different parts of the Site. This allows us to make sure we have enough capacity for the number of users that we get and make sure that the Site runs fast enough remember your login session so you can move from one page to another within the Site; store your preferences or your user name and password so that you do not need to input these details every time you visit the Site; customise elements of the layout and/or content of the pages of Site for you; record activity on our Sites so that we understand how you use our Sites enabling us to better tailor our content, services and marketing to your needs; collect statistical information about how you use the Site so that we can improve the Site; and gather information about the pages on the Site that you visit, and other information about other websites that you visit, so as to place you in a “market segment”. This information is only collected by reference to the IP address that you are using, but does include information about the county and city you are in, together with the name of your internet service provider. Most web browsers automatically accept cookies but, if you prefer, you can change your browser to prevent that, or to notify you each time a cookie is set. You can also learn more about cookies in general by visiting www.allaboutcookies.org which includes additional useful information on cookies and how to block cookies using different types of browser. Please note however, that by blocking, deleting or turning off cookies used on the Site you may not be able to take full advantage of the Site. 6. E-mail tracking E-mail tracking is a method for monitoring the e-mail delivery to those subscribers who have opted-in to receive marketing e-mails from GTR, including GTR Africa, GTR Asia, GTR Americas, GTR Europe, GTR Mena, GTR eNews, Third party e-mails and GTR Ventures. Why do we track e-mails? So that we can better understand our users’ needs, we track responses, subscription behaviour and engagement to our e-mails – for example, to see which links are the most popular in newsletters. They enable us to understand the consumers journey through metrics including open rate, click-through rate, bounces and unsubscribes. Any other purposes for which Exporta Publishing & Events Ltd wishes to use your personal data will be notified to you and your personal data will not be used for any such purpose without obtaining your prior consent. How do you track GTR eNewsletters? To do this, we use pixel GIFs, also known as “pixel tags” – these are small image files that are placed within the body of our e-mail messages. When that image is downloaded from our web servers, the e-mail is recorded as being opened. By using some form of digitally time-stamped record to reveal the exact time and date that an e-mail was received or opened, as well the IP address of the recipient. 7. Consents and opt-outs You can give your consent to opt-out of all or any particular uses of your data as indicated above by: Indicating at the point on the relevant Site where personal data is collected Informing us by e-mail, post or phone Updating your preferences on the applicable Site or eNewsletter (unsubscribe and preference options are available in the footer of each eNewsletter) To turn cookies and similar technologies on and off, see the information in paragraph 5 above. Any questions regarding consents and opt-outs should be sent by e-mail to privacy@gtreview.com or by writing to Data Protection Officer at, Exporta Publishing & Events Ltd, 4 Hillgate Place, London, SW12 9ER, United Kingdom. Alternatively, you can telephone our London headquarters at +44 (0) 20 8673 9666. Information collected at one Site may be shared between Exporta Publishing & Events Ltd and other group companies for the purposes listed above. We may transfer, sell or assign any of the information described in this policy to third parties as a result of a sale, merger, consolidation, change of control, transfer of assets or reorganisation of our business. 9. Public forums, message boards and blogs Some of our Sites may have a message board, blogs or other facilities for user generated content available and users can participate in these facilities. Any information that is disclosed in these areas becomes public information and you should always be careful when deciding to disclose your personal information. 10. Data outside the EEA Services on the Internet are accessible globally so collection and transmission of personal data is not always limited to one country. Exporta Publishing & Events Ltd may transfer your personal data, for the above-listed purposes to other third parties, which may be located outside the European Economic Area and/or with a different level of personal data protection. However, when conducting transfers, we take all necessary steps to ensure that your data is treated reasonably, securely and in accordance with this Privacy Statement. Who has access to your information? Confidentiality and Security of Your Personal Data We are committed to keeping the data you provide us secure and will take reasonable precautions to protect your personal data from loss, misuse or alteration. However, the transmission of information via the internet is not completely secure. Although we will do our best to protect your personal data, we cannot guarantee the security of your data transmitted to our Site; any transmission is at your own risk. Once we have received your information, we will use strict procedures and security features described above to try to prevent unauthorised access. We have implemented information security policies, rules and technical measures to protect the personal data that we have under our control from: unauthorised access improper use or disclosure unauthorised modification unlawful destruction or accidental loss All our employees, contractors and data processors (i.e. those who process your personal data on our behalf, for the purposes listed above), who have access to, and are associated with the processing of your personal data, are obliged to keep the information confidential and not use it for any other purpose than to carry out the services they are performing for us. Everyone who works for or with Exporta Publishing & Events Ltd has some responsibility for ensuring data is collected, stored and handled appropriately. Each team handling personal data must ensure that it is handled and processed in line with this policy and data protection principles. However, the following people have key areas of responsibility. The board of directors is ultimately responsible for ensuring that Exporta Publishing & Events Ltd meets its legal obligations. Name of Data Controller The Data Controller is Exporta Publishing & Events Ltd. Exporta Publishing & Events Ltd is subject to the UK Data Protection Act 1998 and is registered in the UK with the Information Commissioner`s Office. How to access, update and erase your personal information If you wish to know whether we are keeping personal data about you, or if you have an enquiry about our privacy policy or your personal data held by us, in relation to any of the Sites, you can contact the Data Protection Officer via: By writing to this address: Data Protection Officer, Exporta Publishing & Events Ltd, 4 Hillgate Place, London, SW12 9ER, UK E-mail: privacy@gtreview.com Upon request, we will provide you with a readable copy of the personal data which we keep about you. We may require proof of your identity and may charge a small fee (not exceeding the statutory maximum fee that can be charged) to cover administration and postage. Exporta Publishing & Events Ltd allows you to challenge the data that we hold about you and, where appropriate in accordance with applicable laws, you may have your personal information: rectified or amended Disclosing data for other reasons In certain circumstances, the Data Protection Act allows personal data to be disclosed to law enforcement agencies without the consent of the data subject. Under these circumstances, Exporta Publishing & Events Ltd, will disclose requested data. However, the Data Controller will ensure the request is legitimate, seeking assistance from the board and from the company’s legal advisors where necessary. We will occasionally update this Privacy Statement to reflect new legislation or industry practice, group company changes and customer feedback. We encourage you to review this Privacy Statement periodically to be informed of how we are protecting your personal data. Providing information Exporta Publishing & Events Ltd aims to ensure that individuals are aware that their data is being processed, and that they understand. How the data is being used How to exercise their rights To this end, the company has a privacy statement, setting out how data relating to individuals is used by the company. This is available on request and available on the company’s website. Review of this policy We keep this Policy under regular review. This Privacy Statement was last updated in April 2018.
cc/2019-30/en_middle_0028.json.gz/line13238
__label__wiki
0.525758
0.525758
CHANNELS MORE SEARCH SUBSCRIBE Beyond HumanBig PictureCatalystsConnected WorldExchangeMarketing MixNew MoneyNew SchoolPeople SciencePulse We work with many partners from around the world and look forward to exploring how we can work together. Nicki Dexter SVP People and Communications, Schibsted Marketplaces Nicki Dexter is EVP of people and communications at Schibsted Media Group, one of the world’s leading online classified ads businesses, active in 22 countries and reaching more than 200 million people worldwide. Dexter has extensive knowledge and expertise in defining the people agenda, talent acquisition and development, employee relations, performance management and large scale HR programme management. Having worked at Schibsted under a number of HR-related titles, Dexter is a change and transformation specialist with experience of integrating technologies to suit her talent. Filter author posts Stories Audio Events Videos How Schibsted Media Group is using GDPR as a springboard to customer trust and 91 “It's a chance to create to some good conversations with customers as well as increase the trust and transparency with regards to their data.” How Schibsted Media Group manages it’s acquired businesses’ data under GDPR If GDPR is forcing firms to review data policies, how should companies like Schibsted Media Group, which owns several different brands, react? GDPR, the employee and the psychological contract at the heart of HR For Nicki Dexter, the relationship between employer and employee could be improved thanks to GDPR, as long as businesses take the time to promote their transparency. What every HR leader should know by now about GDPR Transparency and trust: the HR function is set for a huge shake-up because of the latest European regulation - and that's a good thing, according to Nicki Dexter. HR’s data opportunity: How GDPR will maximize people’s potentials GDPR presents a golden opportunity for HR to maximize its data literacy. Don't believe us? Just ask Nicki Dexter. Live GDPR Broadcast: Nicki Dexter, SVP, People & Communications, Schibsted ‘There’s Something About Data’ GDPR series highlights Receive our monthly email digest © 2019 | By continuing to browse this site you agree to our Terms of Use
cc/2019-30/en_middle_0028.json.gz/line13245
__label__cc
0.503673
0.496327
Drumbeg House, Naomi Wakan, Gabriola You are here: BC Travel -> BC Destinations -> Vancouver Island and Gulf Islands -> Southern Gulf Islands -> Gabriola Island Drumbeg House, Naomi Wakan T: 250 247-0014 write email [Literary Arts, Author/Writer, Creative Writing, Poetry] Naomi Beth Wakan is a writer who has compiled/written over thirty books including Images of Japan (Pacific-Edge Publishing) and Haiku: one breath poetry (Heian International). The latter book was a choice of the Canadian Children's Book Centre and was also selected by the American Library Association for its 2001 catalogue of Popular Paperbacks for Young Adults. Her most recent book of poetry, Segues, was published by Wolsak and Wynn in the Spring of 2005. Her book to encourage the older writer, Late Bloomer - on writing later in life was published by Wolsak and Wynn, Toronto, Fall, 2006. Her most recent book from Wolsak and Wynn is Compositions: notes on the written word, Spring 2008. Her writing workshops, Late Bloomers, are to inspire and empower the older writer. Her book of essays, Book Ends will be out from Wolsak and Wynn, Spring 2010. Naomi is a member of Haiku Canada and contributes frequently to their newsletters. She is also a member of The League of Canadian Poets and Tanka Canada. Her poetry and essays have been printed in numerous magazines including Geist, Room of One's Own, Moonset and Resurgence. She lives on Gabriola Island, B.C. with her husband, the sculptor, Elias Wakan. "Gabriola Year" is Naomi's homage to the little island where she lives. The book describes day-to-day life and community events on the island of Gabriola in the Georgia Strait. "Late Bloomer - on writing late in life" is Naomi Beth Wakan's popular book to encourage the reader who says they will write one day, but haven't yet. Bobbie Jo Sheriff, the editor of "Senior Living Magazine" describes it as "sinsightful, inspirational and honest." "Segues" is Naomi Beth Wakan's first major book of poetry. Richard Harrison says of it "I loved this poetry. This is someone who's seen life, knows it pulls no punches, and who can still laugh like a child running down a hillside. I can hear her voice. I can hear her." To see all of Naomi Beth Wakan's books in print go to www.naomiwakan.com To contact her: naomi@naomiwakan.com Contact Drumbeg House, Naomi Wakan 3085 Mander Rd, Gabriola, V0R 1X7, British Columbia write email www.naomiwakan.com
cc/2019-30/en_middle_0028.json.gz/line13247
__label__wiki
0.746128
0.746128
Do Aborted Babies Go To Heaven? Young Man's Elvis Audition Wows The Judges credit: youtube.com One of my favorite things in the world is finding out that extraordinary talent is inside of ordinary people. And lucky for me that is the premise behind the show the Voice. Judges sit with their backs to contestants who are given about 2 minutes to show the judges what God gave them. If the judges like what they hear they turn their chair around and get to work with the person auditioning. When Benedikt Köstler got a chance to audition for the Voice he jumped at the opportunity. Benedikt has an incredible voice and chances don't come around like this often. So he picked the song he thought showcased his voice the very best. There's nothing like hearing a classic Elvis Presley song. And when you hear young Benedikt sing 'Always On My Mind' you will be in awe. His voice has such an old school feel that this audition will take you way back! There is no wonder he seriously impressed the judges when he started to audition with this classic. From the very first note, you can see the look of surprise on their faces. It was only a matter of time before the judges started pressing their buttons and turning around. And it is no surprise that they all turned around for a chance to work with Benedikt. I definitely didn't see that huge voice coming out of this young man but he absolutely gave that performance his all. What a great audition. I don't know what I loved more, his voice, or the look on his family's face when that first chair turned. What an incredible talent and he certainly has the support to help him achieve his dreams. I can't wait to see what he comes up with next! What song would you sing if you had one chance to change your life? Source: The Voice of Germany - Offiziell When Chip and Joanna Gaines showed up to help 81-year-old Doris Davis rebuild, it was the kind of surprise every Fixer Upper fan dreams of. But the sweet lady certainly deserves it after Hurricane Harvey destroyed her home. And it's just one more reason to love Chip and Jo! Credit: Mireya Acierto, FilmMagic When Hurricane Harvey hit Houston in late August, Doris' home took in two feet of water. The elderly woman remained in her home for three days as the water rose, paralyzed by fear. “I don’t know if I was so frightened, from all this going on, I really could not move,” she recalled. Doris' grandchildren were worried sick, but couldn't get to her themselves. They turned to social media for help. Thankfully, they learned a kind neighbor rescued their grandmother and took her to the hospital for care. Chip And Joanna Gaines Showed Up To Help Like so many, the flooding ravaged Doris' home. But tears welled up in her eyes as she watched roughly 60 ExxonMobil volunteers arrive to help rebuild her home. And along with the crowd of Good Samaritans, Chip and Joanna Gaines showed up to help! RELATED: Chip And Joanna Reveal The Real Reason They're Leaving 'Fixer Upper' The sweet lady was blown away by the flood of support, and the surprise visit from two of reality television's biggest stars. If the first :30 of my #khou11 report don't bring a smile to your face, I don't know what will! Catch the full story tonight at 10!!!! pic.twitter.com/AXKIPV3MUq — Melissa Correa (@MCorreaKHOU) October 29, 2017 The down-to-earth celebs shared a hug with the 81-year-old, then went to work with the rest of the volunteers to fix Doris' home. And the woman who relies on a wheelchair and sometimes a cane to get around can't thank everyone who's helping enough. She says she'd never be able to any of this on her own. Of course, lovebirds Chip and Joanna couldn't be happier to be a part of the project. "For us, finally getting to be here -- feet, hands on the ground -- it's a huge honor. We're excited to get after it," Joanna said. RELATED: 4 Things We Can Learn About Marriage From Chip And Joanna Gaines Chip mirrored his wife's excitement, encouraging everyone to get involved in relief efforts. "We really want to embolden everybody to get in and do their part," he said. The repairs will be completed In about four weeks. Then Doris and her three dogs will be able to move back in. WATCH: Chip And Joanna Gaines Showed Up To Help Hurricane Victim h/t: GodUdpates YOU MAY ALSO LIKE: Woman Tries To Give Mattress To Man Living in Truck, But He Won’t Keep It Credit: Facebook #flash mob #wedding #surprise More content from Jillian Hauntingly Beautiful Footage From Outer Space Grumpy Old Man On A Mission To Save Christmas Gets A Big Surprise Exclusive Interview: The Holy Spirit Left Reba McEntire In Tears While Recording New Gospel Album 5 Signs Your Child Is Entitled (And It's Time To Do Something About It)
cc/2019-30/en_middle_0028.json.gz/line13248
__label__wiki
0.821978
0.821978
The Replacer & Dr. DisRespect Join Forces In New ‘Call of Duty: Black Ops 4’ Trailer By: Riley Jones (@moviemanjones) The Replacer is back! In celebration of Call of Duty: Black Ops 4’s latest DLC and in-game updates arriving today, Activision and Treyarch dropped a hilarious new trailer for Call of Duty: Black Ops 4 Operation Grand Heist, featuring the return of ‘The Replacer’ (Peter Stormare) and well-known Twitch streamer, Dr. DisRespect. Check out the all-new trailer below: Want the latest Movie Trailers delivered straight to your inbox? Sign up for our Exclusive Goliath Movie Trailer Email! This now marks the fourth time Stormare has portrayed the character in a Black Ops related ads, the first coming back in 2013 for the release of Call of Duty: Black Ops II. What are your thoughts on the return of The Replacer? Are you planning to download today’s Black Ops 4’s latest DLC? Let us know in the comments below. 10 Reasons Why 'Tony Hawk's Pro Skater 3' Is Still The Best Game In The Series What Microsoft Actually Got Right With The Xbox One The 10 Best Maps in 'Call of Duty' History Call of Duty is one of the most popular and successful video game franchises in history. The 10 Greatest Halo Weapons of All Time While it may have been dethroned long ago by the Call of Duty series as the most popular first person shooter franchise, the Halo... 10 Video Game Series That Need To Just Go Away Having too much of a good thing is a very real issue in the gaming industry. The 9 Biggest Gaming Controversies of 2015 2015 could very well go down as one of the best years for gaming, period. 10 Things We Want From 'Destiny 2' Even though it was released in 2014, Destiny was still one of the most popular and obsessively-played games of 2015 thanks in... 10 Guilty Pleasure Video Games People Don't Want To Admit They Play Every gamer has several titles in their library that, for various reasons, they are embarrassed to share with others. The 10 Most Overrated Video Games Of All Time We've written before about some of our favorite video games, the kind you always fall back on when you're looking for something... 14 Celebrities You Probably Didn't Know Were Huge Gamers Video games have been going through a bit of an identity crisis for the past decade or so. 10 Reasons Why The PlayStation Vita Failed Drinkbox Studios recently released Severed, by most accounts a great game that very well could end up being the last of its kind... Destiny 2: 11 Problems That Hold The Game Back Destiny 2, which is out now on PS4 and Xbox One, is a great game that I've already lost too many hours of my life to and will only... Ranking The 'Halo' Games From Worst To Best Originally conceived as a third-person real-time strategy game for Mac computers, Bungie's Halo franchise has gone on to become... 2017 Video Games That Will Probably Be Delayed To 2018 Every year a number of video games experience delays and 2017 is sure to be no different in that regard. 2016 Game Awards The Biggest Moments From The 2016 Game Awards The video game industry has its version of the Academy Awards last night with Geoff Keighley's annual Game Awards ceremony, which... The 10 Hottest Toys For Christmas This Year Halloween 2015 is officially in the books, which means it’s time for everyone to turn their attention to Christmas! Nintendo Switch: Everything We Know So Far About Nintendo's New Console After a year and a half of rumors and speculation, Nintendo has finally let the cat out of the bag and revealed the NX, which is... Destiny: Rise of Iron - 10 Things You Need To Know The final expansion for Destiny, Bungie's seemingly deathproof shooter/RPG/quasi-MMO hybrid, is almost here. 12 Games That Could Challenge 'PUBG' and 'Fortnite' With Their Own Battle Royale Modes Top 10 Guns In 'Call Of Duty' History 10 Ways 'Infinite Warfare' Can Revive a Stale Franchise The 12 Best-Selling Video Game Franchises Of All Time The 20 Most Controversial Video Games Ever Made
cc/2019-30/en_middle_0028.json.gz/line13251
__label__cc
0.749739
0.250261
Southeast Asia’s food capitals By GQ Staff 1 August 2012 Foodies, this one's for you: a list of must-visit food destinations in Southeast Asia You might have been there but have you done that? Our list of must-visit cities for foodies will give you a whole new reason to start planning your next trip to Southeast Asia Arguably Asia’s food capital, the city-state’s blend of Chinese, Malay and Indian populations have produced a street food culture that’s one of the yummiest in the world and is also backed by Singapore’s obsession with hygiene. Singapore’s hawker centres are more food courts than roadside stalls and are also chock-full of culinary treasures. Dig into Singapore’s unofficial national dish, Chilli Crab, either at UDMC Seafood Centre along the East Coast or at Mattar Road Seafood Barbecue on the Old Airport Road. Other must-try dishes include Kaya toast, Hainanese Chicken rice, South Indian-style Roti Prata and the Katong Laska. And if fine dining is your scene, it doesn’t get better than the seven-course meal at Iggy’s at the Hilton, where exotic ingredients combine with creative recipes and an impressive wine list curated by one of Singapore’s most respected sommeliers. The Thai tradition of small and frequent meals through the day has fuelled a street food culture that Bangkok can truly be proud of. There&rsquo;s the ubiquitous Cha Yen &ndash; a strong black tea that incorporates star anise and crushed tamarind seeds served with ice and sweet condensed milk &ndash; a perfect on-the-go drink served in a plastic bag. You can sniff out Moo Ping (grilled pork skewers marinated with fish sauce and cilantro) at almost every market. And if you want some peace and quiet, head to Issaya, which is set in a tropical garden and brings together a tantalising blend of traditional Thai and progressive cooking with a dynamic &lsquo;fresh from the market&rsquo; menu. For fine dining options head to [Gaggan, ](http://www.gqindia.com/content/dining-out-gaggan-bangkok)Bangkok&#39;s take on Indian molecular gastronomy or Patara in Soi Thanglorm, which dishes out delicious Thai food in a chic, contemporary setting. Hanoi The street-side eateries might look dodgy and you may need to keep those indigestion pills handy but when you're in Hanoi, you must check out the the city’s one-dish restaurants. Head to Pho 112 for a bowl of Pho – Vietnam’s famous rice noodle soup that is a local breakfast favourite – or visit Bun Bo Nam Bo for your fill of Bun Bo (rice noodles with crisp fried garlic, bean sprouts, peanuts, basil, and beef). If you don’t have the stomach for street food but still want to explore Vietnam’s culinary traditions, Quan An Ngon is a great option. Styled like the old Hanoi quarter and with a bustling atmosphere full of food stalls, it’s almost like being on the street. Hong Kong You don’t have to go to China to savour food from the country’s diverse culinary regions. While Cantonese food dominates the food scene in Hong Kong, there’s a tempting selection of Pekingese, Shanghainese and Sichuan cuisine. Your gastronomical fortitude might well be put to the ultimate test with local favourites like Snake soup, eel heads and pig’s brain but there’s more to Hong Kong than the bizarre. You will be spoilt for choice with over 100 dim sum varieties in local hangouts like the Choi Lung restaurant or the upscale Fook Lam Moon. High tea at hotels like the Intercontinental and Peninsula keep one of Hong Kong's strong British traditions alive and make for the perfect late-afternoon pit stop. Kuala Lumpur Worth visiting for its culinary diversions alone, KL benefits from the strong presence of Chinese and Tamil populations that have added their own dimension to the city’s food scene along with traditional Malay cuisine. If you don’t have time to hunt for the city’s culinary gems hidden in Chinatown and Bukit Bintang, head to the food court at the KLCC mall within the Petronas Towers or walk to the nearby Top Hat. Set in a 1930s bungalow with bright walls, the restaurant’s set meals give you a quick peek into Nyonya, Melaka (Malacca), Portuguese, and traditional Malay cuisines. Spinning away in Singapore The world's best chefs: Ian Kittichai The best holidays in the world AsiaATMOSPHEREBAGBANGKOKHANOI Elon Musk lost over ₹34,000 crore in Tesla’s disastrous start to a year By Abhishek Nair 5 June 2019 Is Apple about to release a foldable phone? By Vrutika Shah 31 May 2019
cc/2019-30/en_middle_0028.json.gz/line13255
__label__cc
0.578043
0.421957
Rome Journal: Arrivederci, Roma! If you read the lyrics to "Arrivederci, Roma" the hit Mario Lanza song that became the sound track for The Seven Hills of Rome (l957), you find it contains a scam. The crux is that if you throw a penny in the Trevi fountain you are going to "bind fate" so you will come back. But in the next stanza we learn that the minute the English girl throws her penny in the fountain a kid comes along and grabs it. Popular films were so lighthearted about the kind of poverty and despair more graphically portrayed say in a movie like Bicycle Thieves (1948). There a father Antonio (Laberto Maggiorani) and his son Bruno (Enzo Staiola) journey throughout the city in an exhaustive search to find a stolen item. De Sica's masterpiece recalls Gogol's famous short story The Overcoat where the poor civil servant Akaky Akakievitch is similarly deprived of something that symbolizes his dispossession. Here in a popular song, the notion of the turn around of fortune has far less gravitas but, is in some senses, equally invidious since the magic and enchantment of Rome and of believing that wishes will come true are removed all in one fell swoop--by a street urchin, of the kind that young Bruno threatens to become in the Bicycle Thieves' culminating scene where the father's loss becomes compounded by a desperate crime. "While the English girl departs/a little kid comes by/goes into the fountain, picks a/penny, goes away!/Goodbye Rome!" The words are actually quite sad when you think about it since the meaning relates the fact that the enraptured tourist may never be able to recapture the promise of an immortal beauty, symbolized by Rome.
cc/2019-30/en_middle_0028.json.gz/line13256
__label__wiki
0.879867
0.879867
The iPad Parent Trap By Kathleen Man Gyllenhaal, Contributor Kathleen is a screenwriter and filmmaker whose recent document... Last month, I wrote a blog about how addictive the iPad was for my 2-year-old son. I received a wide range of comments from Why Netflix Is Actually Good For Your Relationship, According To Science By Health.com, Contributor By Anthea Levi It’s no relationship secret that having friends in common can improve a couple’s bond. But what if your social Likeable People By Dr. Samineh I. Shaheem, Contributor A Learning & Talent Development Specialist, assistant professo... Your likability is what sets you apart and leaves a positive impression on others. In reality, it could be the main force Jupiterimages via Getty Images Pregnant? Stressed? Science Says Talk to Your Baby I was a first time mother-to-be, nearing 40. I’d already had two miscarriages and I wasn’t getting any younger and I could The Importance Of Paternal Bonding By Gabrielle Pfeiffer, Contributor Mom first, freelance entrepreneur second with a dependency on ... Dads start out with a disadvantage from the moment that their children are conceived. Sure, they are their children just as much as the mom's, but it doesn't always seem like that Dads Need Alone Time With Baby Too I think that dads start out with a disadvantage from the moment that their children are conceived. Sure, they are their children just as much as the mom's, but it doesn't always seem like that. Why I'm Scared To Have A Second Child By Lauren Plotkin, Contributor Wife. Mom. Target Addict. The love I have for my baby is the greatest love I’ve ever known. 5 Musts for Epic Team Building By Doug A. Sandler, Contributor It's not what you do or even how you do your team building, but it is the sheer fact that you are doing it that creates an impact. Team building does just that, it builds your team. My Struggle With Football: My Fun Connection With My Son By Krishna Pendyala, Contributor Author, Speaker & Systems Entrepreneur devoted to building a m... We have once again begun to watch football together, but with much greater empathy for the players. He no longer cheers for big hits and he is actually concerned for the affected players' well-being. He looks the very next day to see if the perpetrator got fined and shares it with me. SWNS Father And Son Dress In Drag, Rob Convenience Store By Samantha Guff Granny's got a gun. GPS FOR THE SOUL In Our Quest for Connection, Have We Become Anything But Connected? By Jamie Scanlon, Contributor Freelance Writer | Blogger | Copywriter | Guider of the soul |... We are living in times where we are more accessible than ever before. So in an age where we have access to our friends, families, strangers, celebrities and so on at the touch of a button on a device that fits into the palm of our hand, how are there lonely people? THE WORLD POST City by the Sea -- A Runway for these Souls By Mariam Khan, Contributor Without fearing the unknown, kids from around the seafaring metropolis have learnt to celebrate the essence of life. A Week in the City of Light and Love By Brian Chesky, Contributor Co-founder and CEO at Airbnb Reflecting on this week, two things come to mind -- light and love. Crisis has an unfortunate way of bonding people together, and our bond was forged not just through shared experience but a deep care and love for one another. In the face of this tragedy, I saw the very best. How To Resist The Urge To Bolt (From a Former Serial Bolter) By Gabriella Taylor, Contributor Professional Life Coach, Relationship Expert and Minister I've bolted from everything from hot yoga to high school (I think I lasted about four weeks in the 9th grade), to being held against my own will in a creepy old drunk mans car when I was a girl (actually, the police helped that one. Why the Best Mental Health Day Is a Vacation By Hippo Reads, Contributor Real World Issues, Academic Insights It's easy to spot the deep tan that marks someone recently returned from vacation. But the most important and long-lasting effect of travel may be one of the least visible. Books like Eat, Pray, Love and Wild have become international bestsellers by describing it: that sense of renewal, satisfaction, and well-being that can come from "getting away from it all." Does Your Kid Behave Much Better When You're NOT Around? By Juliet Linley, Contributor Why oh why, when we leave our kid with friends, grandparents or other relatives, do they often tell us what deep down we'd rather not hear? I mean, sure on the one hand we're relieved to hear that those who were doing us the favour of watching our kids, didn't end up having to deal with a gigantic tantrum. Bond Better by Altering How You Speak, Move and Appear By Kare Anderson, Contributor TED speaker (over 1.9 million views) on becoming an Opportunit... Ready to turn more in-person situations into opportunities to bond with unexpected allies and others? Make some simple changes in how you dress, move, speak or optimize the settings in which you meet. The Powerful Allure of Sports By Ken Reed, Contributor Ken Reed is sports policy director for League of Fans and auth... When sport is driven by the soul instead of the ego, it can be good, very good. Besides forging lifelong bonds between family members and friends, there are many other reasons -- egoless reasons -- why we're drawn to sports. Consider just a few: What These 5 Mealtime Traditions From Around The World Can Teach Us About Bonding By Kate Moriarty Think back to the last meal you enjoyed: the conversation, the time spent at the table, the memories made. Now ask yourself: What if you did it all differently? Keeping That Sizzle Long After First Sight By Rosie Noesi, Contributor Television and radio personality We all have different ways we need to be loved. A note on your lover's car before they go to work can go a long way. In the book "The 5 Love Languages," the author tell us about how to show your partner love by speaking their love language. There are five: quality time, words of affirmation, gifts, touch, and acts of service. This Is What Happened at a Grownup Sleepover By Rumni Saha, Contributor A citizen of the world in love with life. For some time I had been wicked stressed, taking on way more than I could handle but I did it -- well disguised on the outside but a veritable mess on the inside. So finally when I was able to convince myself that I was no superwoman in spite of what I liked to believe, and that it was nothing to be ashamed of, I felt a sense of relief. However, it was now time to make up for lost time and "unhad" fun. When Moms Bond By Lisa Sadikman, Contributor Writer, tween whisperer, toddler wrangler. We look at each other and laugh and that's all it takes for the floodgates to open. She has three kids; I have three kids. We both worked in offices before having children and now stay at home. We're both killing time with our toddlers, wondering how we'll fill the next three hours. Our Favorite Stars Of 'The Sopranos' Stars of the iconic series "The Sopranos" Dominic Chianese, Steven Van Zandt, Steve Schirripa and Michael Imperioli visited HuffPost Live to talk about being part of the show that reinvented a genre and to reminisce about the late James Gandolfini. Why Love Isn't Such A Mystery After All By Alena Hall “I think it’s absolutely disastrous for us to keep defining love as a big mystery,” Johnson says. “We need to know about
cc/2019-30/en_middle_0028.json.gz/line13257
__label__wiki
0.996307
0.996307
Mike Russell: Brexit talks should include Scottish Government By Paul Hutcheon Politics and Investigations Editor, Herald on Sunday Mike Russell Theresa May is facing calls to open up talks about leaving the European Union to ministers from Holyrood and Cardiff in a bid to help break the Brexit impasse. Scottish Constitutional Relations Secretary Mike Russell made the plea shortly after the Prime Minister was granted more time by Europe to reach agreement over Britain's future relationship with the EU. The Prime Minister now has until October 31 to find a way forward, and Russell stressed she must "use this extra time wisely". He said "all parties and all devolved governments" should be invited to the negotiating table. He urged May to "drop her red lines", which have seen her insist the UK's departure from the EU will also see it leave both the single market and the customs union. The Scottish Government has repeatedly made the case for Britain to remain part of these arrangements, arguing this will help mitigate the economic impact of Brexit. Russell said: "Taking us out of a market around eight times bigger than the UK will cost jobs, make people poorer and undermine the democratic decision of the people of Scotland to remain in the European Union. "The Scottish Government set out compromise plans that would keep both Scotland and the UK in the single market but these were dismissed out of hand by the UK Government." Meanwhile, the boss of a biscuit firm in Forres, Moray, has warned Brexit would make its plans to expand into Japan more difficult, as well as increase its costs. Maclean's Highland Bakery produces traditional shortbread, biscuits and oatcakes, but managing director Lewis Maclean said while the Brexit extension was a "reprieve", he has a "really terrible feeling" about the way forward. A UK Government spokeswoman said: "There are already regular discussions at all levels between the UK and Scottish Government ahead of UK's exit from the European Union to discuss the next steps in delivering Brexit in a smooth and orderly way." Gordon Brown: Boris Johnson could be last Prime Minister of the UK Trump's migrant detention centres are concentration camps, says Scots MEP End of United Kingdom is now 'more likely than not,' says Nick Clegg May warns coarsening of political debate pushing country to 'much darker place' Calls for cross-party action to tackle Scotland’s drugs deaths ’emergency’ Boris Johnson considers suspending parliament to force no-deal Brexit May puts pressure on Corbyn at PMQs over anti-Semitism row raging in Labour Party
cc/2019-30/en_middle_0028.json.gz/line13266
__label__wiki
0.925993
0.925993
Sarasota advisory boards dogged by costly Sunshine Law missteps By JESSIE VAN BERKEL Nov 1, 2012 at 2:05 PM The city has had to pay about $100,000 in legal fees this year over open meeting violations Advice has come at a high cost for Sarasota this year. An artist, historian, store owner and dozens of others volunteer on the city's 21 advisory boards and help commissioners make decisions that impact thousands. They are the “lifeblood” of Sarasota, City Manager Tom Barwin said. But in a city with a fierce legal watchdog and a state with stringent open records laws, they are also a liability. Government-in-the-Sunshine Law and public record missteps have cost Sarasota about $100,000 in legal fees since this spring and local attorney Andrea Mogensen's firm has garnered the majority of the money. The firm doggedly monitors local government for missteps and last week filed a suit claiming Sarasota's advisory boards have a widespread problem: Members conducting public business through private email accounts, text messages and social media. Michael Barfield, a paralegal with Mogensen's firm, watched from the back of City Hall chambers as about 60 advisory board members trickled in for an open records refresher course, intended to prevent further breaches of the law. Before starting on the review, City Auditor and Clerk Pam Nadalini wryly suggested that if city officials could not answer a public records question, perhaps Barfield could. “He's an expert,” she said to laughter. Mogensen's firm is unique, said Jon Kaney, general counsel for the First Amendment Foundation. No other attorney in Florida is so active in open government lawsuits. The best way to prevent costly violations, Kaney said, is to give advisory board members copies of the law and drill requirements into them: Do not talk to other board members outside of meetings. Do not email about city business from a private account. Sarasota volunteers have gone through the rules time and again, including 90 members who showed up for refresher sessions in the last couple of weeks. People just have not got the message, Barfield said. “We believe the violations are so pervasive that a court needs to take action, step in and hold the city's feet to the fire, if you will, on its obligations under the public records act,” he said. Advisory boards recommend how to spend taxpayer money, and Sunshine and public records laws are intended to keep that conversation accessible. Florida's laws on open government are some of the most far-reaching in the country. Under the state Constitution, virtually everything is public. In 1974, the Florida Supreme Court determined advisory committees are subject to the same Sunshine Law requirements as elected officials. If a commissioner or public board member knowingly violates the open records law, it is a misdemeanor offense, punishable by up to 60 days in jail and a $500 fine. Mogensen's firm solidified its reputation as an enforcer — her opponents sometimes argue “abuser” would be a better term — of the law in 2009 after representing the nonprofit Citizens for Sunshine Inc. in an open records case against Venice City Council. The parties settled and Mogensen received $750,000 in legal fees. During the past two years, the firm has sued Sarasota for Sunshine Law violations that include a public art steering committee holding meetings without notifying the public and members of a civil service board discussing the actions of a police officer outside of a public meeting. Sarasota has paid the firm nearly $100,000 for the cases. Barfield has an ongoing public records lawsuit against the Downtown Improvement District advisory board, claiming two members deleted emails that they are required to keep and used personal email accounts for public matters. Both men had to turn over their computers so a forensic computer expert could examine them — an awful experience that “breaks our heart,” Nadalini said during the recent refresher presentation to advisory board members. City Manager Barwin said he wishes the watchdogs were solution-oriented rather than adversarial, and worries the lawsuits might discourage advisory board members from participating. “We now have a situation where it's become a business for some, they get legal fees,” he said. If the elected officials and their appointees follow the law they will not have problems, Kaney said. The more costly cases are usually due to hard-headed ignorance and an unwillingness to comply with requests, he said. “I've hear public officials complain about the expense, but if they do it right the first time they do not have the expense. That does not bring a tear to my eye,” Kaney said. “It's the cost of government.” Two months into his job, Barwin said the Sunshine Law has been his greatest challenge, and one he did not anticipate. He is constantly confronted with a new interpretation of the law that includes more people, like members of subcommittees, Barwin said. “Florida's like a giant government nudist colony,” he said. “We don't have anything to hide, but it's boring and not that attractive.” Barfield disagrees, saying most of the city's sensitive issues are discussed on private email accounts, outside of the public sphere. Text messages and social media have added another complicated layer of records. In the past five years, debates over how the law applies to electronic media have been hashed out in court, said Kraig Conn, legislative counsel for the Florida League of Cities. While local municipalities are generally good at educating advisers about the Sunshine Law when they start the job, legal nuances can complicate things, Conn said. Advisory board members in Sarasota are not accidentally slipping up on public record obligations, they are deliberately disobeying the law, Barfield said. “It's quite easy for a board member to follow the law,” he said. “Don't communicate about public business on your private email. Period.” Barfield expanded his lawsuit against the Downtown Improvement District last week to say the city's boards have made a practice of using private electronic accounts — email, Facebook and texts — to evade the law. Barfield would not disclose the basis for his claim that board members were texting one another about public business. He said advisers have written posts about city business on private, invitation-only Facebook pages. The Florida Attorney General has stated texts are subject to the same public records rules as emails, and material posted on a city Facebook page can be public records. “The medium is not important, it's the message,” Kaney said. Barfield's complaint also alleges widespread email violations. Public email records show city staff sending messages to board members' private accounts, he said. Historic Preservation Board member Sherry Svekis used to get notifications from the city on her private email account, telling her the agenda for an coming meeting was released and she should check her city email for details. Now she does not even get those, she said. Svekis, a historical archaeologist, said she applied to the board to offer her specialized expertise and a fresh perspective. After city commissioners selected her to serve as an adviser, city staff went over public records and Sunshine Law requirements and gave her packets of information. Svekis said it has always been clear that she should not talk with other board members about city business outside of meetings and should use only her city email for public business. The preservation board meets once a month and rarely uses email, she said. “I can't imagine anyone on the boards trying to do business outside of the public eye,” Svekis said. “We're serving because we care about the community.”
cc/2019-30/en_middle_0028.json.gz/line13267
__label__cc
0.698023
0.301977
Top firm CEO criticised on Twitter for having 'no idea what he is doing' Tough words for this top firm CEO. Bloomberg News reports that DoubleLine Capital CEO Jeffrey Gundlach had tough words for the head of Paris-based Societe Generale, Frederic Oudea, after its shares fell to a five-year low on Thursday. Fresh 5 year low share price for tanking SocGen as Oudea continues to have no idea what he is doing except running the bank into the ground. — Jeffrey Gundlach (@TruthGundlach) February 7, 2019 .The French bank said earlier in the day that it’s shrinking its markets business and cutting an additional 500 million euros of costs to combat a market rout that sent trading revenue tumbling. Gundlach is an American investor and businessperson. He is the founder of DoubleLine Capital LP, an investment firm. According to Forbes, his net worth is estimated to be in excess of around $2bn. Gundlach Says SocGen CEO Has ‘No Idea What He Is Doing’ Ex-Goldman Analyst Seeks Record U.K. Discrimination Payout And the Best Place to Work in the global financial markets 2018 is... More articles from City Desk
cc/2019-30/en_middle_0028.json.gz/line13271
__label__wiki
0.798116
0.798116
Bill English (IWK Picture) Tuesday, October 24, 2017 Sandeep Singh National Party has chosen to stick with their “rock,” the outgoing Prime Minister Bill English as the Leader of the Party in the new parliament. The Deputy Leader position also remained unchanged with the caucus sticking with Paula Bennett. Bill English was given the nickname of “rock” by many young Turks in the Party prior to election based on his performance as the country’s Finance Minister in successful sailing the country through the global financial crisis. The Party was hopeful of sailing through 2017 election and getting a historic fourth successive term by sticking rock solid behind their leader Bill English, which was only doomed on last Thursday, October 19, when Winston Peters chose to side with their nemesis Labour Party in forming the next government. Mr English has though delivered a rock-star performance on the election night by returning the Party with a record 46 per cent votes and the status of the single largest party in the new parliament. Mr English continues to surprise many, including some commentators who were predicting his exodus and replacement by new generational leaders such as Nikki Kaye, by choosing not to give up and hoping to “rise again.” Mr English had delivered one of the powerful one-liner statements in one of the live Leader’s debate before elections when he roared “I rose up again,” (after the drubbing of 2002 as the then National leader). It seems that Mr English is living one more day (read this term of parliament) to rise again on another day (read 2020 election). Although this is obviously a hope as of now, it does demonstrate resoluteness of the “old guard” in the Party, and the nation, if one is willing to accept that analogy, bit generously, about the values of discipline, and relentlessness in pursuing goals that one cherishes. – a good lesson for the newer generations, millennial, in particular. Mr English told the media that the meeting of National MPs today was "sober and positive". Stand for the Auckland you love Get our weekly news, events and special deals Indian Weekender
cc/2019-30/en_middle_0028.json.gz/line13275
__label__wiki
0.748189
0.748189
Posted: Friday, 05 October 2018 07:18 Blog: Prohibition in Bihar doing well- almost Oct 05: The politicians of Bihar say with a straight face that the Prohibition enacted in the State on April 5, 2016 has been operating very successfully but in fact, strange cases of missing alcohol where police is suspected to be involved are coming to the fore, with the first case involving a possible smuggling big racket by or with the connivance of police and in other cases instances of missing seized alcohol where the blame is conveniently placed on rodents in the cells consuming big amounts of misplaced liquor When Bihar went dry on April 5, 2016 I was invited by a national TV Hindi Chanel in their studios to express my opinion about prohibition. Although I am a strong anti-alcohol (my motto is that wine is not alcohol-it has some) lobbyist but promoting wine as a food product substitute, I have always been anti-prohibition for the simple reason that it never works in real life- be it Gujarat, Maharashtra, Haryana and now Bihar. Those who drink wine are addicts who need their daily fix and the government needs to bring swacchta (cleanliness) in their minds and propagate ill-effects of alcohol and provide cure in the hospitals rather than simply try for them to kick the habit. One has seen it in the cigarette industry!! The addicts need their daily fix and would do anything to get it, at any cost. Cops caught smuggling liquor Visualize for a moment a movie scene shot in one of the Indian states where prohibition has been in full swing, ostensibly working very well. A subs-inspector (SI) and his assistant sub-inspector (ASI) drive into a police station in an empty pick-up truck. After some time it leaves the premises unobtrusively. But wait, there is an informant in the plot who has passed on the information based on which the truck is intercepted after a bit of a chase-a la Bollywood. The cops are forced to stop and the pickup truck is found to be full of smuggles liquor picked up from the police station. A scene from a Bollywood movie? Perhaps inspired but it’s not a reel life case but a real life story that happened between the night of 30 September and 1 October, a day before Mahatma Gandhi’s birthday on October 2. Mahatma was one of the architects of Indian Constitution and a strong promoter of prohibition. In fact, he was one of the handful who gave the reins of States to decide the sales and excise policy that points to prohibition. But in this case, how did the smuggled liquor get into the police station? Was it stored under security from a seizure or is the police station a den of smuggling activities? Before you let your imagination run wild, the two policemen have been arrested in the first of its kind incident since prohibition became effective on April 5, 2016 in Bihar. The rules became so strict that a senior bureaucrat was once reported to have been arrested to be prosecuted for 7 years jail when a bottle of importe scotch was found from his house. Many people have been crying foul and calling it a political vendetta through the archaic prohibition laws while the watchdogs make marry. In this first reported case of its kind since enforcement of prohibition in Bihar, Gopalganj’s Baikunthpur police station SHO, Laxmi Narayan Mahto and his sub-ordinate Sudhir Kumar were arrested from the police station premises on Wednesday for allegedly smuggling liquor from the police station premises, according to a report by TNN. A probe team interrogated the two officers in which the received information about liquor smuggling from police station premises prima facie turned out to be true, according to the SP. The police later also caught the driver of the pick-up van in which the smuggled liquor was loaded for smuggling and off-loaded at a place called Mashrakh where he hailed from. It was not known yet whether the liquor smuggled from police station premises was seized item or unreported or whether a smuggling racket was operating from the station premises. Oh Rats! The liquor is missing Rats are often used in experiments with various commodities including wine and alcohol to measure cause and effects. But in Bihar, it appears they are used to feed the confiscated alcohol lest it is consumed by humans. According to a report in TOI on Thursday, 200 beer cans confiscated by police were found to be empty on Monday with neat holes on the top. The police quickly blamed the rats for drinking it all up. The SDM says, ‘it looks like the doing of rates. They were 6-7 cartons of beer and all cans were empty.” The DM also concurs. ‘ The beer cans were gnawed into by rats.’ An enquiry has been instituted. This is not the first time rates have been blamed either. In May 2017, says the Report, several lakhs (1 lakh= 100,000) liters of alcohol that went missing in Patna, Bihar were supposedly swigged by rats. A few cops had then reportedly told SSP that drunken rodents had gulped the booze seized. Ordinary denizens are not so gullible to believe these stories. VS Dubey, who retired as chief secretary of undivided Bihar says, ‘Officials are either drinking or selling it and then blaming it on the rats.’ This seems credible because stories like these have been doing the rounds in Gujarat where the state has been dry for over 50 years. Many people have confirmed to delWine privately that cops can deliver you any bottle of wine, whiskey or beer to your hotel room in Gujarat if you pay the delivery charges. More such stories are likely to come out of Bihar as the prohibition continues. Any authentic story published by media after checking out will be reported in delWine- we are anti- alcohol (pro-wine) but sensible enough not to support complete prohibition-fully aware of the ill-effects-bodily, financially and socially. It is interesting to end the Article by mentioning that there has been practically no sale of wine in Bihar before the Prohibition. In the meanwhile, smuggling is unabated in Bihar. For one last year’s report, read TOI: “Prohibition gave birth to a liquor smuggling syndicate which has become monstrous in the state with a supply chain extending even up to Haryana and its roots spreading up to West Bengal, Jharkhand and Uttar Pradesh,” said a senior IPS officer. “Liquor smuggling is increasing with each passing day. Whatever amount of liquor is being seized is just a small part of the smuggled liquor consignments,” he added. Please also read: 2 Bihar cops arrested for smuggling liquor from police station Rats' drinking seized booze in dry Bihar Liquor smuggling unabated in Bihar
cc/2019-30/en_middle_0028.json.gz/line13276
__label__cc
0.595196
0.404804
Optio 47 We are excited to release the very limited edition "Tertia Optio" 47 raglan shirt. On 26 July 1947 President Truman signed the National Security Act into law, thus creating the Central Intelligence Agency. With its history firmly planted in the covert action and paramilitary work carried out by officers of the Office of Strategic Services, the CIA's Special Activities Division uses "Tertia Optio" as its motto to detail the President's third option when military force isn't appropriate and diplomacy is lacking. Subtly covert, the Optio 47 raglan is perfect for those cool spring mornings or late nights by the campfire. Its screened on a great tri-blend raglan of 50% polyester/25% combed ring-spun cotton/25% rayon jersey in vintage black sleeves and heather grey body. **These are being sold as a very limited edition, and only run once. Get them while you can! The pre-sale runs from 10 May 2017 until 24 May 2017. They are expected to ship the last week of May. ** © 2019, Inglorious Amateurs Store Powered by Shopify
cc/2019-30/en_middle_0028.json.gz/line13279
__label__cc
0.608187
0.391813
Personal Injury Claims in Ireland Irish Claims News Injuries Board AdviceCompensation for Crash with Garda Compensation for Crash with Garda Having to claim compensation for crash with Garda may seem like a daunting prospect, but provided that you have been the victim of negligence you may be entitled to make a claim. After suffering an injury from Garda crash you may find it difficult to make a claim, or you may even decide that pursuing compensation is not worth the time and effort. However a claim after a crash with Garda car may be worth pursuing not only to help contend with the costs of your medical care, but also to ensure that you can provide for yourself and your family. Needless to say, while pursuing Garda crash compensation can be done on your own, you are strongly advised to seek the professional advice of a personal injury solicitor before pursuing compensation. This is not only to ensure that your Garda car crash claim is professionally represented, but this will also greatly increase the likelihood that you will receive a fair amount of compensation for your injury. For this reason, a solicitor should be consulted at the earliest opportunity following your Garda car crash accident. Medical Attention after a Garda Car Crash Accident Before you seek compensation for crash with Garda, it is important that you first pursue medical attention to have your injuries treated by a medical professional. This should be done for the sake of your health because – despite the Garda crash compensation you may be entitled to receive for your injuries – this will never truly compensate for a long-term injury which could have been easily avoided with medical attention. It is also important to note that medical attention should be sought from a professional and you should not rely upon first aid following your injury from Garda crash. Medical attention is also important for the strength of your Garda car crash claim as if you neglect to receive immediate medical treatment for your injuries, it may be considered that your injuries deteriorated as a result. In this scenario, while you may still be entitled to make a claim after a crash with Garda car, your compensation may be reduced to reflect your own carelessness, which could make it difficult to fully recover from your Garda car crash accident. Liability for your Injury from Garda Crash When seeking compensation for crash with Garda, the identity of the party who was liable for your accident has to be established. On one hand, a claim after a crash with Garda car can be made against the Gardai if the careless actions of one of their members caused your injury. Even if Gardai can break the speed limit in certain circumstances, it is still important for them to take great care to avoid the possibility of a Garda car crash accident occurring. Garda crash compensation could be made against the local council if the crash was at least partially caused by the poor condition of the road on which you were driving. However it is also possible that you are partially liable for your own injury from Garda crash if contributory negligence was a factor – for instance, if you neglected to heed a red light or were travelling too fast. A Garda car crash claim may not be impossible in this situation – however the amount of compensation you can claim may be reduced to reflect your carelessness. Assessing your Garda Car Crash Claim To help determine liability for your compensation for crash with Garda, you are advised to consult a personal injury solicitor at the earliest opportunity. Your solicitor can assess your claim after a crash with Garda car and advise you on its strength, inform you on whether it is worth pursuing and assist in gathering evidence in support of your claim. This evidence can include CCTV footage of your Garda car crash accident, your medical records and verification from any eyewitnesses to your accident. It should also be noted that your Garda crash compensation will have a time limit of two years in which to initiate a claim, as per the statute of limitations. While this may seem like plentiful time, it should be noted that a Garda car crash claim may take a while to prepare and initiate. For this reason, you should not delay seeking legal advice following your injury from Garda crash in order to prevent your claim becoming time-barred. Claim after a Crash with Garda Car for a Child If a child has been injured as a result of the negligence of a Garda, it may be possible to claim compensation for crash with Garda on their behalf. It should be noted that children are legally unable to initiate a claim after a crash with Garda car until they have reached the age of eighteen, nor can they instruct a solicitor to do so on their behalf. For this reason a parent or guardian can initiate a claim for an injury from Garda crash on their behalf as a “next friend”. This litigation friend must not have a conflict of interest in the child’s Garda car crash accident (for instance, they must not be partially liable for the accident) and must be willing to accept financial liability for an unsuccessful claim. It should also be remembered that any application to the Injuries Board for a Garda car crash claim has to be made through the post, and online applications will be rejected. When a settlement of Garda crash compensation has been agreed upon, this sum will be paid into court funds where it will remain until the child has reached the age of eighteen. Garda Crash Compensation: Summary Seeking Garda crash compensation is achievable, although your likelihood of success will be greatly assisted with the assistance of a personal injury solicitor. By doing so, not only will you be aware of the amount of Garda crash compensation to which you may be entitled but you can also ensure that your claim will be greatly assisted with strong evidence. A solicitor can also help assign liability for your Garda car crash accident and advise you on whether contributory negligence is a factor in your injury. The success of your claim after a crash with Garda car will depend on its strength, and to ensure that you have the strongest claim possible, you are advised to contact a solicitor at the earliest opportunity following your injury from Garda crash. This will help ensure that you receive fair compensation for crash with Garda. Personal Injuries Claim How much is my claim worth? Compensation examples Tweets by @AdviceInjury Most Read Expert Articles Privacy Policy, Data Protection, and Cookies Compliance
cc/2019-30/en_middle_0028.json.gz/line13280
__label__wiki
0.979712
0.979712
Home » Privacy Shield Statement Privacy Shield Statement Last revised on 10 May 2019 IDDI Inc. has subscribed to the EU-US Privacy Shield Framework and the Swiss-U.S. Privacy Shield Framework. IDDI Inc. adheres to the Privacy Shield Principles including the Supplemental Principles, for personal data received from entities in the European Economic Area, the United Kingdom and Switzerland. This IDDI Privacy Shield Statement together with the IDDI Public Privacy Statement, the IDDI Privacy Statement for Candidates and the IDDI Privacy Statement for Employees describe the privacy practices that we implement for personal data received from the EEA, the United Kingdom or Switzerland in reliance on the Privacy Shield. If there is any conflict between the terms in this Privacy Shield Statement and the Privacy Shield Principles as concerns the personal data received under the Privacy Shield, the Privacy Shield Principles shall govern to the extent of the conflict. To learn more about the Privacy Shield program visit www.privacyshield.gov, and to view our certification, please visit https://www.privacyshield.gov/list. 1. Notice and choice IDDI’s Public Privacy Statement describes how we use personal data in the context of our normal business activities when acting as a data controller; this statement is available on our website. IDDI Privacy Statement for Candidates describes how we treat personal data received from job applicants; this statement is also available on our website. IDDI Privacy Statement for Employees describes how we process personal data in the context of an employment relationship, this statement is communicated to all our employees and available on request. Each statement explains how data subjects can exercise their rights, including the right to access their data, and how to express their choices. IDDI also processes personal data on behalf of its customers (data controllers) in the context of its clinical research services related to patient randomization, drug supply management, electronic data capture, data management, biostatistical analysis, IDMC and medical writing. In the context of these activities where IDDI acts as a processor, the notice and choice duties are with the responsible data controllers. 2. Accountability for onward transfers IDDI has responsibility for the processing of personal data it receives under the Privacy Shield and subsequently transfers to a third party acting as an agent on its behalf. IDDI shall remain liable under the Privacy Shield Principles if its agent processes such personal data in a manner inconsistent with the Privacy Shield Principles, unless IDDI proves that it is not responsible. When acting as a processor IDDI will obtain the approval of the data controller prior to any onward transfer to third parties. IDDI will employ reasonable and appropriate technical, administrative and physical safeguards to protect personal data in its possession from loss, misuse, unauthorized access, disclosure, alteration and destruction, taking into account the risks involved in the processing and the nature of the personal data IDDI is processing. 4. Data integrity and purpose limitation We only collect personal data that is relevant to our activities and services. We process personal data as notified through one of our Privacy Statements or otherwise agreed with our customers. We take reasonable steps to ensure that the personal data received under the Privacy Shield is accurate, complete, and current. 5. Access rights Our different Privacy Statements explain how you may access or submit requests to review, correct, update or delete personal data. You may also ask us to exercise your access rights by sending a written request to dataprivacy@iddi.com We may limit or deny access to personal data where providing such access is unreasonably burdensome, expensive under the circumstances, or as otherwise permitted by the Privacy Shield Principles. Where IDDI processes data on behalf of its customers, such access requests must be addressed to the responsible data controllers. IDDI will support its customers in responding to such requests. 6. Recourse, Enforcement and Liability If you have any questions or concerns, please write to us at the address listed below. We will investigate and attempt to resolve complaints and disputes regarding use and disclosure of personal data in accordance with the Privacy Shield Principles in a timely manner. You may also introduce a complaint with the relevant EU Data Protection Authority (“DPA”) or the Swiss Federal Data Protection and Information Commissioner (“FDPIC”). IDDI has committed to cooperate with the relevant national DPA’s and to comply with the decisions of the DPA panel and the FDPIC. The services of EU DPAs are provided at no cost to you. Please note that if your complaint is not resolved through any of the above channels a binding arbitration option may be available before a Privacy Shield Panel. For additional information please see: https://www.privacyshield.gov/article?id=How-to-Submit-a-Complaint The Federal Trade Commission has jurisdiction over IDDI’s compliance with the Privacy Shield. 7. How to contact us You can contact us by mail on dataprivacy@iddi.com, or write to the following address: IDDI Inc. Attention: Ms. Linda Danielson 8. Changes to this Privacy Shield Statement This Privacy Shield Statement may be changed from time to time, consistent with the requirements of the Privacy Shield and in accordance with the IDDI Public Privacy Statement. You can determine when this Privacy Shield Statement was last revised by referring to the “Last Revised” date at the top of this document.
cc/2019-30/en_middle_0028.json.gz/line13282
__label__wiki
0.802729
0.802729
Mercedes-Benz recalls thousands of cars in Canada by Lyle Adriano 14 May 2018 Mercedes-Benz recalls thousands of cars in Canada | Insurance Business German automaker Mercedes-Benz has announced a recall of its Smart model cars in Canada due to a fire risk. The company is recalling the Smart model years 2008 and 2009 due to a fire risk caused by defective engine insulation. The decision comes as the US National Highway Traffic Safety Administration (NHTSA) begins investigating a series of unexplained car fires involving the Smart model cars. NHTSA documents revealed that a rear insulation mat in the engine compartment of 2008 and 2009 model year cars “may deform, deteriorate and loosen over time, allowing the mat to contact hot exhaust system components.” Transport Canada has posted notice of the recall online, saying that 7,028 cars are affected. Mercedes-Benz Canada told CBC News that it would notify all affected customers via email, asking them to contact an official service partner to have the mat replaced. It is currently unclear if Mercedes-Benz will compensate those whose insurance will not cover their loss. Automobile Protection Association director George Iny suggested that for those motorists, the best recourse would be a lawsuit against Mercedes-Benz – though it could be difficult for them to prove that the cause of the fire was the defect in question. Alternatively, Iny told CBC News that the automaker could be sued by insurance companies who have paid for claims related to the vehicle fires. Ford announces another recall, pulls out 350,000 trucks and SUVs Ford issues new recall for Ranger pickup trucks in Canada and the US ClaimsPro Lorri Frederick steps down as president of ClaimsPro After a distinguished career of over 30 years in the property and casualty industry, Lorri Frederick has decided to step down from her role as president of ClaimsPro ClaimsPro expands in Southern Alberta with addition of Lloyd Stiles Rossier ClaimsPro welcomes niche adjusting firm Lloyd Stiles Rossier (LSR), Special Risk Loss Adjusting in Calgary, AB to its ranks Can-sure Underwriting Cansure Underwriting announce the appointment of Denise Yeng as Vice President, Sales and Marketing She joins an experienced executive leadership team at Cansure known for continuous innovation and deep expertise in their respective fields Redefining peace-of-mind Insurance Business America
cc/2019-30/en_middle_0028.json.gz/line13287
__label__cc
0.524151
0.475849
InnovationAppleShareSubscribe People Are Rightfully Flipping Out About AirPods' Terrible Battery Warranty It's bad for your wallet and the environment. Filed Under Batteries & Environment For all the criticism over planned obsolescence, Apple’s warrantee policy for the much-loved AirPods sure seems designed to make you buy a new pair within two years. That’s because while the lithium ion battery within them should provide up to five hours of charge, heavy use reduces your charge capacity. Run through your battery, and it’ll likely cost you $138 to replace both year-old batteries, which is nearly the cost of a new pair. The stingy policy was first picked up on Reddit. Indeed, users save a paltry $21 if they choose to take their AirPods in for repair more than a year after they’ve been purchased. This doesn’t include a new charging case, which would cost an additional $69 to fix. The warranty doesn’t make economic sense and incentivizes users to throw away their current pair. This is bad for consumers’ wallets and is at odds with Apple’s commitment to environmental friendliness, which the company touted loudly at its latest hardware announcement. Apple has long been accused of planned obsolescence — or selling products that quickly need to be replaced — and AirPods battery life is more evidence. One redditor, recounted that their pair barely lasts an hour 20 months after purchasing. Apple’s warranty explicitly states it will only offer reduced fees for defective units, not accidental damage or daily wear. “The Apple Limited Warranty covers a defective battery, but it doesn’t cover wear from normal use,” reads the AirPods support page. “If your battery has a manufacturing defect and it’s covered by our warranty or consumer law, we’ll service it at no additional cost. If your battery service isn’t covered, we can replace your battery for a fee.” AirPods: How Can I Fix Broken AirPods? If you notice your AirPods acting up in less than a year, take them into the Apple Store because there’s a chance you could get a battery replacement for $49 per bud. If you accidentally step on them or just use them so much they begin to fade, the fee will be bumped to $69. Apple also does not offer the AppleCare+ service for the AirPods, which extends the warranty of devices like the iPhone and Apple Watch to two years and two instances of accidental damage. AirPods: How AirPods’ Warranty Stacks Up the iPhone’s AppleCare+ aside, it costs $549 and $599 to repair an out-of-warranty iPhone XS and XS Max respectively, roughly half of the price of each phone. That’s a huge improvement over the AirPods policy, which puts the user on the hook for almost 90 percent of the costs. To be fair, the company never provided repair services or AppleCare+ for its $29, wired EarPods. But it also seems fair to point out that the AirPods cost about five times as much. AirPods: How AirPods’ Warranty Is Bad For the Environment The disincentive to repair your AirPods also seems at odds with Apple’s recent touting of its environmental efforts. At the recent iPhone launch, Lisa Jackson, Apple’s VP of environment policy, pledged to begin using more recycled materials for its devices and releasing products that last longer. The AirPods warranty is a clear contradiction to that. AirPods are labeled as electronics waste because of the tiny lithium-ion batteries inside of them. There is a major issue with consumers not responsibly recycling e-waste, which need to be tossed in specialized bins or facilities. In 2016, 44.5 million metric tons of electronics were thrown away, enough to build nine Great Pyramids. NPD Group estimated that 900,000 AirPods were sold as of September 2017, roughly a year after their release. Apple has clearly pushed consumers to buy the wireless earbuds by eliminating the headphone jack from its smartphones. The company likely won’t backtrack from this marketing strategy, so if AirPods don’t become cheaper to repair or easier to recycle, there are going to be a lot of white earbuds in those nine pyramids of e-waste in the future. Media via Apple, Unsplash / Ben Kolde FaceApp: Privacy Concerns, Features for the Viral Ap... Apple Card: Apple's Titanium Credit Card Is Imminent... Apple Car: 3 Futuristic Automotive Technologies Appl... iOS 13: New iMessage Feature May Give Users Cause to... This iPad Is Nearly 40% Off for Amazon Prime Day
cc/2019-30/en_middle_0028.json.gz/line13292
__label__cc
0.517709
0.482291
Corporate Finance & Accounting Business Corporate Finance & Accounting Classified Board Reviewed by James Chen What is a Classified Board A classified board is a structure for a board of directors in which some directors serve for different term lengths, depending on their particular classification. Under a classified system, directors serve terms usually lasting between one and eight years, with longer terms often awarded to more senior board positions (i.e., the chairman of the corporate governance committee). Classified boards are often referred to as "staggered boards," although staggered boards and classified boards have somewhat different structures. Staggered boards need not be classified, but classified boards are inherently staggered. BREAKING DOWN Classified Board The classified board structure features continuity of direction and preservation of skill but has come under harsh criticism from shareholder advocacy groups for a number of reasons. Opponents to the classified structure argue that the system breeds board member complacency and forces directors to develop close relations with management. Classified Boards as an Anti-Takeover Measure When an outside group gains control or takes over a company, they may have to wait a number of years before being in a position to take over control of the board of directors when a classified board structure is in place. With only part of the board up for election each year, it helps to insulate a company from a hostile takeover by delaying the amount of time before members of the board can be replaced, and a majority achieved for the acquiring company. Pros and Cons of Classified Boards A classified board may be in a better position to successfully prevent proxy contests from a group of stockholders or activist investors who could be pressuring the board on a set of actions. Another possible benefit of having a classified board structure is that the staggered approach promotes stability of the board and fosters a long-term strategic vision for corporate initiatives. With a number of board members being assured of returning on a given year – since only part of the board is up for election – this structure also establishes a level of continuity in management. On the flip side, having a set of directors locked in for a period of time can be a negative for shareholders and employees if the board makes poor decisions or is slow to react to a change in the business landscape. Failure to make good decisions or pivot strategies in enough time can sometimes lead to a significant drop in operating results, or in a worst case scenario, bankrupt the business. There is also the moral hazard of a board of directors being less accountable to the company's shareholders in a structure where their control is more protected. Understanding Proxy Fights A proxy fight occurs when a group of shareholders join forces and gather enough shareholder proxies to win a corporate vote. Sometimes referred to as a "proxy battle,” this action is mainly used in corporate takeovers. How Chairmen Are Different from CEOs A chairman is an executive elected by a company's board of directors who presides over board meetings and works to build consensus in board decisions. How Greenmail Works Greenmail is the practice of buying enough shares to threaten a hostile takeover so that the target company will repurchase its shares at a premium. Stagger System A stagger system acts as a defense against a hostile takeover because only part of the board of directors are put up for re-election in any one year. Staggered Board A staggered board consists of directors grouped into classes serving different terms in length, mainly meant to thwart a hostile bid. Control refers to having sufficient amount of voting shares of a company to make all corporate decisions. What Is a Staggered Board? How can a company resist a hostile takeover? How Do Modern Corporations Deal With Agency Problems? Keeping Control of Your Business After the IPO How To Become A Corporate Board Member Corporate Takeover Defense: A Shareholder's Perspective
cc/2019-30/en_middle_0028.json.gz/line13294
__label__cc
0.663866
0.336134
Press Releases Policy publications - Tech & entrepreneurship TfL and Uber must find a way through licence stand-off Responding to Transport for London’s decision to cancel Uber’s London licence today, Dan Lewis, Senior Infrastructure Adviser at the Institute of Directors, said: “Large numbers of Londoners will be dismayed by Transport for London’s decision today to block Uber’s licence. Ride-hailing apps have brought enormous positive disruption to transport in the capital, and the taxi market has become much more competitive as result. “User safety is clearly very important and it is the role of the regulator to ensure any company operating private-hire licences meets appropriate security standards. In the short space of time now available for an appeal, we urge Uber to clarify how it will meet the standards outlined by the regulator. We also urge TfL to pay heed to London’s hard-fought and positive reputation as a hotbed for disruptive innovation and tech-driven competition. Regulatory hurdles should not be an insurmountable barrier to allowing consumers to use products if they find them useful. “With 40,000 jobs now at stake across London, there could also a big human cost to this decision. TfL and Uber must come together to find a way through this because the bottom line is that competition driven by consumer choice is the cornerstone of the UK’s future economic success.” Tags Start ups Technology
cc/2019-30/en_middle_0028.json.gz/line13295
__label__wiki
0.590903
0.590903
Home Medway News Article Fire investigators at scene of fatal bungalow blaze in Strood By Ed McConnell emcconnell@thekmgroup.co.uk Published: 20:17, 24 March 2019 | Updated: 20:41, 24 March 2019 Fire investigators are this evening combing the scene of a fatal blaze after a pensioner was found dead. Witnesses reported emergency crews have taped off a bungalow in Orchid Close, Strood, and that the inside of the property appears to have been badly burnt. Police cars and ambulances were also seen in the area near Bligh Way shops. Orchid Close, Strood Kent Police spokesman Natalie Hardy said: "We were called at 4.20pmto a fire at a residential property in Orchid Close, Rochester. "Officers attended and provided assistance to crews from Kent Fire and Rescue Service and South East Coast Ambulance Service. "A man in his 70s was pronounced dead at the scene. His next of kin have been informed and a report is being prepared for the coroner. "Inquiries into the cause of the fire are ongoing. It is currently being treated as unexplained." Police said they attended Sovereign Court, however witnesses said the bungalow was actually opposite the block. Kent Fire and Rescue Service said it was called just after 4pm by a home monitoring system to reports of a fire in sheltered accommodation. A spokesman added: "Upon arrival, the property was found to be full of smoke. Fire crews quickly deployed a search team wearing breathing apparatus as further information suggested that the occupant was still inside the property. "Firefighters worked swiftly to clear smoke and fumes from the property using a positive pressure ventilation fan. "One male casualty was discovered by the rescue team, but sadly was found to be deceased by paramedics. "Inquiries into the circumstances of the incident are in progress with KFRS fire investigators and Kent Police. There are no reports of any other injuries." Witnesses said the victim was disabled and had carers visit him on a daily basis.
cc/2019-30/en_middle_0028.json.gz/line13302
__label__wiki
0.824051
0.824051
Kevin Barron MP for Rother Valley Hellaby You are here: Home / Rother Valley / Find your area / Hellaby Hellaby lies in the north of the Rother Valley constituency. In the west of the ward are those parts of Wickersley and Bramley to the south of Bawtry Road. In the east of the ward is west Maltby and in the centre is Hellaby. The ward contains parts of the Wickersley, Bramley and Maltby parishes. Rotherham Borough Councillors Local Parish and Town Councils Councillor Richard Fleming Maltby Town Council Councillor John Turner Bramley Parish Council Councillor Lauren Astbury Wickersley Parish Council Hellaby Parish Council Bramley appears in the Domesday Book, its name deriving from 'Bramleia' meaning a 'forest glade overgrown with broom'. Junction 1 of the M18 is situated in Bramley. Hellaby is the location of Hellaby Hall Hotel which is set in a 17th Century mansion built by the Fretwell family. It is also home to a large industrial estate. Wickersley Wickersley is mentioned in the Domesday Book and takes its name from 'Wicresleia' meaning 'Vikar's forest-clearing'. Vikar is a Norse name, which indicates that the village was founded during the Viking occupation of the area. Wickersley was once held by Richard FitzTurgis (who adopted the name 'de Wickersley), founder of Roche Abbey. Little remains of Wickersley's medieval church apart from the tower, the lower part of which dates from the 15th Century. The upper part of the tower dates from the 18th Century and the top from the 1950s. In the 18th Century, Wickersley stone was found to make excellent, fine-grained grindstones for which there was a great demand from Sheffield cutlers. Land to the south of the village was purchased by the Cutlers' Company and a number of quarries were opened up, however the demand for grindstones from the cutlery industry started to decline at the beginning of the 20th Century and by 1939 there was only one quarry still producing grindstones for the export market. Increased population in the area led to the development of the Tanyard shopping centre in 1966. Find your area Anston and Woodsetts Holderness Rother Vale Sitwell Kevin Barron MP for Rother Valley © Copyright 2019 Kevin Barron MP. All Rights Reserved. This website is paid for by Kevin Barron. website by Hudson Berkley Reinhart Ltd
cc/2019-30/en_middle_0028.json.gz/line13303
__label__wiki
0.883153
0.883153
Navy SEAL Eddie Gallagher acquitted of murder - witness with immunity claims he killed ISIS captive Special Operations Chief Eddie GallagherFacebook The trial of Navy SEAL chief Eddie Gallagher has reached its verdict. Gallagher was cleared of charges of murder and attempted murder and was found guilty of posing for photos with the dead body of a teenage ISIS captive. Special Operations Chief Edward "Eddie" Gallagher, 40, was acquitted of murder charges yesterday in a Naval courtroom in San Diego. He was found guilty on one charge - posing for photos with the body of the dead captive - but will not serve time because the sentence, four months, is less than the time he spent in pre-trial detention. Read More: Decorated Navy SEAL on trial for killing Islamic State prisoner In a turn of events that stunned prosecutors, a witness for the prosecution who initially testified that he had seen Gallagher stab the teenage captive in their custody changed his testimony to say that he himself had killed the boy by blocking air to a tracheal tube in his neck. U.S. Navy SEAL Eddie Gallagher has been found not guilty of war crimes in the murder of an ISIS prisoner. @CBSDavidMartin explains the key arguments that may have swayed the jury in the case. https://t.co/N5oZfxvFs3 pic.twitter.com/3MZjjh4z5n — CBS News (@CBSNews) July 2, 2019 The witness, Navy SEAL medic Corey Scott, had been granted immunity from prosecution in exchange for his testimony. He may now face perjury charges. Chief Gallagher, a decorated SEAL platoon leader who completed eight tours of duty, was accused last spring by his own subordinates of a number of crimes while deployed to Mosul, Iraq in 2017. They included stabbing to death an injured teenage ISIS captive, distributing photos of himself with the corpse via text message, shooting at unarmed civilians including an elderly man and a schoolgirl, and intimidating members of the SEAL team into not reporting him. Gallagher's subordinates first reported their concerns to the platoon commander, Lt. Jacob Portier, shortly after the alleged crimes took place in 2017. However, Lt. Portier did not act on the SEAL team's report for nearly one year, resulting in a lacj of physical evidence. Thus, the trial hinged on witness testimony and on Gallagher's text messages and photos. Read More: WATCH - Irish American Navy SEAL describes the unusual way bin Laden was identified They included so-called "victory photos" he took with the boy's corpse, which he sent to comrades in the US with messages like "Good story behind this. Got him with my hunting knife" and "I've got a cool story for you when I get back. I've got my knife skills on." Throughout the two weeks of the trial, members of Gallagher's platoon testified that they had seen the chief stab the captive multiple times and attempt to conceal the evidence. However, when Scott was cross-examined by the defense, the Special Operator said that he himself had killed the boy. CNN reports that he described it as a "mercy killing" because he was worried the Iraquis would harm him. Navy Seal Eddie Gallagher says he wants to thank @realDonaldTrump for intervening in his case. A jury just found Chief Gallagher not guilty of murder #ABCNews #EddieGallagher pic.twitter.com/THKXd13ltz — Will Carr (@WillCarr) July 3, 2019 Outside the courtroom yesterday, Gallagher told reporters "I'm happy and I'm thankful. I thank God, my legal team and my wife." According to the Daily Mail, his wife, Andrea, who ran a vigorous social media campaign proclaiming Gallagher's innocence and unfair treatment, said: "I was feeling like we're finally vindicated after being terrorized by the government that my husband fought for for 20 years. "I think that this vindication, I hope, will be a lesson learned to everybody, that we need to uphold innocent until proven guilty [and] due process." Navy SEAL Eddie Gallagher is found not guilty of murdering an ISIS terrorist by a military jury. | @ToddPiro pic.twitter.com/XunaVnsFiR — Fox & Friends First (@FoxFriendsFirst) July 3, 2019 They drove away in a white Mustang convertible, joking that they had an evening of "tattoos and alcohol" ahead. Chief Gallagher's family claimed that he was wrongfully persecuted by "millennial" subordinates who resented his leadership. They maintained his innocence throughout the trial and worked closely with news outlets like the Navy Times in addition to some Republicans in Congress, who lobbied on behalf of Gallagher. Read More: Shannon Kent, Navy hero, killed in Syria by suicide bombing President Trump, who had intervened to release Gallagher from his pre-trial detention, congratulated him and his family via Twitter: Congratulations to Navy Seal Eddie Gallagher, his wonderful wife Andrea, and his entire family. You have been through much together. Glad I could help! — Donald J. Trump (@realDonaldTrump) July 3, 2019
cc/2019-30/en_middle_0028.json.gz/line13307
__label__wiki
0.841105
0.841105
Funds Tracker Businessperson Awards EY Entrepreneur of the Year Limerick unveils €500m development programme Largest commercial development plan outside Dublin could yield more than 5,000 jobs Mon, Sep 19, 2016, 11:53 Updated: Mon, Sep 19, 2016, 15:33 Kathryn Hayes Businessman Denis Brosnan is to chair Limerick Twenty Thirty Strategic Development DAC. Photograph: Brenda Fitzsimons A €500 million investment programme to make Limerick the best placed English-speaking city in the European Union to capitalise on post-Brexit inward investment opportunities has been unveiled in Limerick. Limerick Twenty Thirty Strategic Development DAC (Designated Activity Company) will be tasked with delivering transformational investment infrastructure across four strategic sites in Limerick City, with the capacity to create more than 5,000 jobs over the next five years. It is the biggest single Irish commercial property development programme undertaken outside Dublin. The company – created by the merged Limerick City and County Council and with businessman Denis Brosnan as chairman – will prioritise the redevelopment of 1.4 million sq ft of prime real estate across the four sites into state-of-the-art office, retail, residential, education and enterprise space. “This is about capitalising on Limerick’s opportunity to become the best placed Limerick city in Europe to capitalise on post-Brexit inward investment opportunities,” said Limerick City and County Council chief executive Conn Murray. “Other cities have capacity constraints. We are now redeveloping over 1.4m sq foot of property for office, retail, residential, education and enterprise space and as we have seen over the past three years we are already proving our track record in terms of attracting investment this will enable us to do more,” he added. Key location “Brexit will happen in the next few years so we will be tempting those businesses; Limerick is the place to be, not Dublin. It’s a crime-free city. Everybody had a view of Limerick that it was deep in crime, which it was. Today you can walk the streets of Limerick any time of the day or night, it’s a crime-free city,” he said. “Obviously, post-Brexit will help all the Irish economy. We want to be the city in the west of Ireland which will attract those businesses. So far they all go to Dublin but Dublin – if it’s not already – will get choked with traffic and Dublin doesn’t have adequate accommodation or office space at this stage and we think we are fitting into a niche and a time where we will be ahead of that,” he added. Mr Brosnan was appointed in 2009 to spearhead the Mid West Task Force Jobs following the closure of Dell’s manufacturing plant in Limerick and the loss of 2,000 jobs. Among his early recommendations was the merging of Limerick City and County Council to one unified local authority. He also advised that a number of key strategic sites be acquired by the local authority so it could determine the future development of the city centre. “The key site will be Opera Site with 500,000sq ft of office and retail space. We will be tempting businesses who might be leaving London,” he said. Mr Brosnan described the prediction of 5,000 jobs as a “very pessimistic figure” and believes the actual potential for job creation in the four strategic sites will be far greater. Four sites The four sites also include the 340,000sq ft Troy Studios Film Hub in Castletroy where an €8 million fit-out is nearing completion ahead of the commencement of production. The 112,000sq ft Gardens International Office on Henry Street, will be ready for occupation in spring 2018. The 8-acre Cleeves site, which Mr Brosnan helped negotiate from previous owners Kerry Group, is expected to be devoted to tourism activities. “What’s important is to try to get developers back into Limerick, developers are scarce on the ground in Ireland. They are scarce on the ground in every city but they are totally absent in Limerick,” said Mr Brosnan. “What we want is obviously where we will be the catalyst. The Limerick 2030 company will develop where there is a vacuum where nobody else is doing it. We would like to see lots of private developers moving into Limerick also,” he added. Launching Limerick 2030, junior minister Patrick O’Donovan said the plan sees the local authority taking a “very brave step and the right step for the city and county and a move in becoming a big city on the west coast of Europe”. Mr O’Donovan said the Government would look at supporting the infrastructural and transportation needs and upgrades in line with these developments. Mayor of Limerick Kieran O’Hanlon said the aim of the redevelopment project is to grow Limerick to a city of 200,000 people working and living in the metropolitan district and to transform the city centre into a vibrant economic hub for the region. Conn Murray Denis Brosnan Patrick O Donovan Limerick Twenty Thirty Strategic Development DAC The regeneration of Limerick Michael Flatley backs €40m Limerick city development US developer to cash in on Liffey Valley stake Dublin’s dominance of State ‘near unique’ in western world €50,000 threshold for higher rate tax will cost €2.3bn How to manage interpersonal conflict in the workplace Demand for London office buildings falls as staff are packed in Cheap eats: The early bird captures the best deal Eir’s baffling broadband plan offer raises suspicions of sabotage The best school for your child? New Irish research has news for parents Moon landing was almost comically low-tech – by today’s standards 05:30 Most Read in Business 2 London house prices fall at sharpest rate since 2009 3 Ryanair may close bases and says it has a surplus of 300 pilots 4 Bank of Ireland offers lower rates for ‘green’ customers 5 US restaurant platform to add 120 staff in Dublin 6 Instagram ‘likes’ to disappear from public view 7 Big investors pour €615m into Dublin private rented sector in second quarter 8 Paradise Papers: Leaked records reveal offshore companies’ role in forest destruction 9 Netflix subscriber numbers disappoint as prices rise 10 Nanotech breakthrough may lead to an ‘Internet of Brains’
cc/2019-30/en_middle_0028.json.gz/line13308
__label__cc
0.519586
0.480414
Tag Archives: Retail Michael Hill admits it owes its staff $25 million It has been revealed Australian jewellery chain Michael Hill owes its workers upwards of A$25 million (C$22.8 million), after an internal review determined its local stores did not fully comply with Australian wage rules. Pandora cuts 1200 jobs after disappointing first quarter Pandora is laying off 1200 workers from a manufacturing facility in Thailand after experiencing a drop in sales in the first quarter, Reuters reports. Spence aims to expand brand with new CEO Vancouver-based retailer Spence Diamonds has promoted its chief marketing officer, Veeral Rathod, to the position of CEO. A brief history of jewellery marketing The information super-highway has completely and irrevocably changed the way merchants, including jewellers, interact with their marketplace. GIA retail program highlights coloured stones Participants in the Gemological Institute of America’s (GIA’s) Retailer Support Program now have access to an enhanced collection of materials to sell and promote coloured stones. Silver sales on the rise, survey says Retailers in the U.S. enjoyed strong silver jewellery sales last year and this trend is expected to continue in 2019. Boosting your bottom line with sterling silver Silver is sometimes looked at as secondary to gold. However, offering silver pieces (including gold-plated items) can make jewellery more accessible, increase turnover, and help retailers reach a wider customer base. Pearls: The evolution of a classic Pearls are just about the only gems that are ready to use as soon as they are collected, which is why they are considered older than other gemstones Birks Group launches WeChat program Canadian jewellery brand Birks Group has introduced a new future-focused purchasing method. Jewellery retail sales continue increasing Jewellery retail sales are continuing to moderately climb, according to recent data released from Statistics Canada. Get the click: How to make your brand stand out on social media Social media channels have become a primary avenue for promotion. For the retail landscape, this means brands now possess the capability to market themselves directly to their target consumers. An oasis of gemstones in the desert: Inside Tucson 2019 The Tucson gem shows have yet again struck our hearts and wallets. Each February, the city comes alive with tourists and professionals alike, converging to gape at the fossils, crystals, jewellery, and oddities that line the streets in need of homes. Québécois designers recognized with JCK Jewelers’ Choice Awards Two Québécois companies are among the winners of the 12th annual JCK Jewelers’ Choice Awards, recognizing exceptional jewellery design. All that glitters: Tips for appraising gold jewellery pieces When Sonja Sanders graduated as a gemmologist, she assumed her years working as a goldsmith would give her a competitive edge in the world of appraisals. She soon learned this was not necessarily the case, as appraising encompasses a multitude of design and manufacturing knowledge. Wedding rings and a theory of evolution Most who work in the jewellery industry are familiar with the story of the first documented diamond ring used to signify engagement, presented by Archduke Maximilian of Austria upon his betrothal to Mary of Burgundy in 1477. The ring as a symbol of love and commitment, however, traces its... Record-setting diamond watch highlights Canadian artistry A Coronet watch featuring artwork by Canadian designer Reena Ahluwalia has received the Guinness World Record for most diamonds set on a watch. READ EXCLUSIVE E-BOOKS These collections offered exclusively through Jewellery Business are the ultimate resource for those passionate jewellery professionals who face various challenges every day. + See all Issues
cc/2019-30/en_middle_0028.json.gz/line13313
__label__wiki
0.604411
0.604411
Cutting Edge: Clustered AU-Rich Elements Are the Target of IL-10-Mediated mRNA Destabilization in Mouse Macrophages Raj Kishore, Julie M. Tebo, Mikhail Kolosov and Thomas A. Hamilton J Immunol March 1, 1999, 162 (5) 2457-2461; Raj Kishore Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44122 Julie M. Tebo Mikhail Kolosov Thomas A. Hamilton In the present study we show that IL-10-mediated inhibition of inflammatory gene expression can be mediated by an AU-rich element (ARE) cluster present in the 3′ untranslated region (3′UTR) of sensitive genes. A series of chloramphenicol acetyl transferase (CAT) reporter gene constructs were prepared in which different fragments from the IL-10-sensitive KC mRNA 3′UTR were placed downstream of the coding region of the reporter gene CAT. CAT mRNA containing the KC 3′UTR was markedly destabilized as compared with the control CAT mRNA, and the decay rate was further increased in cells stimulated with IL-10. The KC 3′UTR contains an ARE cluster and three isolated ARE motifs. The ARE cluster spanning nucleotides 378–399 appeared to be both necessary and sufficient to mediate sensitivity to IL-10 because a 116-nucleotide fragment that contains the cluster conferred sensitivity, while mutation of the sequence between positions 378 and 399 eliminated sensitivity. The destabilizing effect of IL-10 was relatively selective, as the stability of chimeric CAT mRNAs was not modulated in cells treated with IFN-γ or IL-4. The inflammatory response is a key component of host defense that is tightly regulated in vivo 1, 2 . Mononuclear phagocytes participate in the host immune response, at least in part, through production of cytokines and chemokines that is initiated in response to an array of extracellular stimuli 1, 2, 3 . Because the inflammatory process may generate significant tissue injury, it is necessarily subject to negative control through the action of anti-inflammatory cytokines like IL-4 and IL-10 3, 4 . IL-10, initially identified as a Th2 product that inhibited Th1 cell proliferation, has pleiotropic activities 5 . Although IL-10 can serve as a stimulatory factor for B cells and mast cells, it is known to inhibit the production of multiple cytokines, including IL-1β, TNF-α, IFN-γ, IL-4, IL-5, IL-6, IL-8, macrophage inflammatory protein (MIP)3-1α, MIP-1β, and KC in macrophages and other inflammatory cell types 6, 7, 8, 9, 10, 11 . The importance of IL-10 in regulating inflammatory responses in vivo is indicated by the phenotype of the IL-10 knockout mouse, which develops chronic enterocolitis as well as other inflammation-related abnormalities 12, 13 . Mechanisms of IL-10-suppressive action, though incompletely characterized, appear to be diverse and depend upon the gene of interest, the nature of the stimulus, and the cell type. Various studies have demonstrated that IL-10 can reduce the level of gene transcription, decrease the stability of specific mRNAs, and reduce their translation 11, 14, 15, 16 . There is abundant evidence indicating that AU-rich elements (AREs) found in the 3′ untranslated region (3′UTR) of short-lived mRNAs are important in determining mRNA stability and translation 17, 18 . In previous work using primary mouse macrophages, we have observed that IL-10 suppressed TNF-α, IL-1α, IL-1β, and KC gene expression through selective destabilization of mRNA (Ref. 11 and H. S. Kim, J.M.T., and T.A.H., unpublished observations). A common feature of all of these mRNAs is their short half-life and the presence of multiple ARE sequences. In this study, we have asked whether nucleotide sequences contained in the 3′UTR of an IL-10-sensitive gene (KC) are able to confer IL-10 sensitivity to an otherwise stable reporter mRNA. Utilizing chimeric constructs containing various regions of the KC 3′UTR linked to the chloramphenicol acetyltransferase (CAT) gene, we have systematically defined the ARE motif in the 3′UTR as both necessary and sufficient for IL-10-mediated destabilization of reporter mRNA. Mouse rIFN-γ, DMEM, Dulbecco’s PBS, antibiotics, glutamine, guanidine isothiocyanate, and cesium chloride were obtained from Life Technologies (Gaithersburg, MD). FBS was purchased from BioWhittaker (Walkersville, MD). Transfast transfection reagent and plasmid pCATcontrol and CAT template DNA were purchased from Promega (Madison, WI). Maxiscript in vitro transcription kit and ribonuclease protection assay kit (RPA II) were obtained from Ambion (Austin, TX). Mouse rIL-10 and rIL-4 were purchased from Genzyme (Cambridge, MA). Dupont/New England Nuclear (Boston, MA) was the source of α-[32P]-UTP. Polyacrylamide gel electrophoresis and protein assay reagents were purchased from Bio-Rad Laboratories (Richmond, CA). Actinomycin-D was purchased from Sigma (St. Louis, MO). TLC plates (silica gel 60) were obtained from Merck (Darmstadt, Germany). The RAW264.7 mouse macrophage-like cell line was maintained as described previously 19 . Preparation of reporter plasmids The following chimeric constructs were used in this study: pCAT3′UTR 289–889(289–889), pCAT-AREmu 289–889(289–889), and pCAT-ARE 341–457(341–457). Numbers in parentheses denote nucleotide position as defined from the KC cDNA sequence in the GenBank database. The fragments of the KC 3′UTR were prepared using PCR. The pCAT-AREmu was generated by substituting nucleotides between positions 382 and 394 (wild-type ARE cluster sequence, 378-ATTTATTTATGTATTTATTTA-398; mutant sequence (underlined), ATTTCGATCGAGATATCTTTA). PCR products were subcloned into pCAT3-control vector (Promega) at the XbaI site immediately downstream of the CAT-coding region. Orientation and sequence of cloned fragments were determined by sequencing in the Molecular Biotechnology Core Facility of the Lerner Research Institute. Reporter plasmids and a β-galactosidase expression plasmid were transiently cotransfected into RAW264.7 cells using Transfast transfection reagent following the manufacturer’s instructions. Stable transfectants were established using a similar transfection protocol using cotransfection with a plasmid (pBABEpuromycin)-encoding puromycin resistance and were selected in 8 μg/ml of puromycin. CAT activity was measured as previously described 19 . Ribonuclease protection assay (RPA) Template DNA (1 μg) for CAT and β-actin (Ambion) were subjected to in vitro transcription to generate α-[32P]-UTP-radiolabeled single-stranded RNA hybridization probe, using Maxiscript kit. Total cellular RNA (20 μg) from transfected cells treated with or without stimulus for indicated times were hybridized with labeled probe (5 × 104 cpm) following the manufacturer’s instructions. Protected fragments were electrophoresed on a 5% denaturing polyacrylamide gel containing 8 M urea in 1× TBE buffer (90 mM Tris, 64.6 mM boric acid, and 2.5 mM EDTA (pH 8.3)). Gels were exposed to x-ray film and quantified by phosphorescence analysis as described previously 19 . The role of the KC 3′UTR in determining sensitivity to IL-10 was examined using a chimeric reporter plasmid construct in which the 3′UTR of the KC gene (nucleotides (nt) 289–889) was inserted just downstream from the CAT-coding sequence (pCAT-3′UTR). RAW264.7 cells were transiently transfected with either unmodified pCATcontrol or pCAT-3′UTR, stimulated or not with IL-10, and treated with actinomycin D to prevent further transcription. Levels of CAT mRNA were measured immediately and following 30, 60, or 120 min of further incubation (Fig. 1⇓). CAT mRNA transcribed from pCATcontrol was highly stable over the 2-h period of the experiment (t1/2 ∼8 h) while the half-life of CAT mRNA containing the KC 3′UTR was reduced to ∼75 min. IL-10 treatment did not alter the stability of control CAT mRNA but further destabilized mRNA containing the KC 3′UTR (t1/2 < 30 min). Enzyme activity in cells transfected with pCAT3′UTR was reduced by 90% in cells treated with IL-10 for 12 h (Fig. 2⇓). The KC 3′UTR confers mRNA instability and sensitivity to IL-10 on CAT mRNA. RAW264.7 cells tranfected with pCATcontrol or pCAT3′UTR were treated with actinomycin D and stimulated or not with IL-10 (10 ng/ml). Cultures were harvested either immediately or following 30, 60, and 120 min of further incubation. Total cellular RNA was prepared, and levels of CAT and β-actin mRNA were assayed by RPA. Levels of CAT mRNA were quantified by phosphorimage analysis and were normalized to those of β-actin levels in the same experiment. Similar results were obtained in at least three independent experiments. CAT enzyme activity in cells transfected with pCAT3′UTR is reduced by treatment with IL-10. RAW264.7 cells transfected either with pCATcontrol or pCAT3′UTR were treated or not with IL-10 (10 ng/ml) for 12 h. Cytoplasmic extracts were prepared and assayed for CAT enzyme activity as described in Materials and Methods. Similar results were obtained in at least three separate experiments. These results indicate that the 3′UTR of the KC gene contains nucleotide sequence that can confer constitutive instability and IL-10 sensitivity to an otherwise stable mRNA. Experiments using two plasmid constructs that encoded nt 289–504 and nt 405–889 of the KC 3′UTR, respectively, revealed that sensitivity to IL-10 was retained only in the 289–504 fragment (data not shown). On the basis of these observations, we hypothesized that the cluster of AREs spanning nt 378–398 might be responsible for regulating mRNA stability and IL-10 sensitivity. To test this possibility, two plasmid constructs were analyzed. The first, termed pCAT-ARE, contained a 116-nt fragment (nt 341–457) that includes the ARE cluster, while the second, termed pCAT-AREmu, contained the full KC 3′UTR in which the ARE cluster was mutated by nucleotide substitution at positions 382–394. Enzyme and RPA assays for CAT mRNA decay were conducted on cells transfected with each of these two plasmids either with or without IL-10 treatment. Cells transfected with pCAT-AREmu had high levels of CAT activity that was not altered by IL-10 (data not shown). Furthermore, CAT mRNA decay patterns were very similar to those seen in cells transfected with pCATcontrol (Fig. 3⇓). In contrast, CAT activity and mRNA decay curves (Fig. 3⇓) in pCAT-ARE-transfected cells were virtually the same as seen when cells were transfected with pCAT3′UTR. Since pCAT-AREmu differs from pCAT3′UTR only at positions 382–394, it is clear that both constitutive and IL-10-mediated mRNA destabilization are dependent upon the four clustered AUUUA motifs. These results suggest that the three additional AREs (located between nt 405 and 889) in the KC 3′UTR are not necessary for destabilization or IL-10 sensitivity. Four clustered ARE motifs in KC 3′UTR are necessary and sufficient to confer sensitivity to IL-10-mediated mRNA destabilization to CAT mRNA. RAW264.7 cells were transfected with pCAT-ARE and pCAT-AREmu and treated with actinomycin D and with or without IL-10 as described in Fig. 1⇑. RPA assays were conducted on total RNA and were quantified by phosphor image analysis. Similar results were obtained in two separate experiments. The results presented in Figs. 1–3⇑⇑⇑ were obtained under conditions of transient transfection. To eliminate possible artifacts that might be related to the high levels of expression for transfected sequences, we prepared permanently transfected cultures using each of the plasmid constructs described above. The behavior of each CAT mRNA was essentially identical to that described above and, thus, fully confirmed the studies using transient transfections (data not shown). To determine whether the ability of IL-10 to destabilize mRNA was stimulus-specific, CAT mRNA decay was monitored in cells treated with IL-10, IL-4, or IFN-γ. RAW264.7 cells stably transfected with pCAT-ARE were treated with IL-10, IL-4, or IFN-γ in the presence of actinomycin D for 30, 60, or 120 min. CAT mRNA containing the ARE cluster decayed with a half-life of ∼60–70 min, similar to that seen in Fig. 3⇑ (Fig. 4⇓). In cells treated with either IL-4 or IFN-γ, the half-life was unaltered while IL-10 treatment resulted in rapid destabilization and a half-life of <30 min. Thus, the effects of IL-10 on mRNA stability are relatively specific. The mRNA-destabilizing activity of IL-10 is selective. Cultures of puromycin-resistant RAW264.7 cells expressing CAT from pCAT-ARE were untreated or treated with IL-10 (10 ng/ml), IL-4 (10 ng/ml), or IFN-γ (25 ng/ml) in the presence of actinomycin D for 30, 60, or 120 min, and levels of CAT mRNA were measured by RPA and quantified as described in Fig. 1⇑. Similar results were obtained in two separate experiments. In prior work, we have demonstrated that IL-10 can selectively regulate the stability of the mouse KC mRNA in primary mouse macrophages 11 . To identify mRNA sequences that determine the sensitivity to IL-10-mediated destabilization, we have prepared plasmids encoding CAT-expression cassettes that contain sequences corresponding to different regions of the 3′UTR of the mouse KC gene. The stability of transfected plasmid-encoded CAT sequences have been examined in untreated and IL-10-treated RAW264.7 macrophages. On the basis of mutational analysis, we propose that a cluster of four overlapping AUUUA motifs within the 3′UTR of the KC gene is both necessary and sufficient to confer sensitivity to IL-10-induced mRNA destabilization. This conclusion is supported by two lines of evidence: 1) CAT mRNAs that contain either the complete 3′UTR or the ARE cluster (nt 341–457) confer both mRNA instability and IL-10 sensitivity, and 2) mRNA containing the full 3′UTR in which the ARE cluster has been mutated is stable and insensitive to IL-10. The hypothesis that IL-10-mediated mRNA destabilization depends upon the presence of specific ARE sequence motifs in the 3′UTR of target mRNAs is consistent with the spectrum of genes that have been reported to exhibit enhanced decay in response to IL-10. Thus, mRNAs encoding TNF-α, IL-1α, IL-1β, granulocyte-macrophage colony-stimulating factor, and the chemokine genes KC, MIP-1α, MIP-1β, and IL-8 have all been reported to be destabilized in IL-10-treated cells 6, 9, 11, 14, 20, 21, 22 . A common feature of all of these mRNAs is the presence of multiple clusters of AU-rich sequences in their 3′UTR. In concert with the data presented above, these collective findings suggest the possibility that such ARE clusters may be a common target for the action of IL-10. Support for this is provided by the observation that TNF-α expression in transgenic mice whose TNF-α gene contains a mutant ARE cluster have lost sensitivity to regulation by IL-10 in vivo 23 . The effect of IL-10 appears to be relatively specific. Treatment of macrophages with IFN-γ or IL-4 did not alter the stability of CAT mRNA containing the IL-10-sensitive ARE sequence. ARE motifs vary considerably in size and spacing. The features of an ARE required for specific functional effects also vary, and the presence of an ARE motif does not necessarily predict alterations in mRNA stability. The pentameric sequence AUUUA was initially identified as the basic core of the ARE motif 17, 18 . Previous studies by Zubiaga et al. 24 and Lagnado et al. 25 , however, have shown that a single or isolated pentamer is not sufficient for mRNA destabilization. These investigators identified the minimal sequence motif required for destabilization of mRNA to be a nonameric sequence: UUAUUUA(U/A)(U/A). While multiple copies of this nonameric sequence were used in artificial plasmid constructs, a recent study has reported that the presence of a single nonameric motif in the 3′UTR of the gene encoding urokinase plasminogen activator receptor is sufficient to destabilize a reporter gene and confer sensitivity to integrin-mediated signaling 26 . According to our results, a single nonameric ARE (position 579–588) in the mouse KC 3′UTR is neither necessary nor sufficient to cause destabilization or confer sensitivity to IL-10 (data not shown). Similarly, IL-3 mRNA is destabilized by a series of isolated (nonoverlapping) pentameric AUUUA motifs 27 . Though the KC 3′UTR contains three isolated AUUUAs (one of which is part of the nonameric motif mentioned above), these do not appear to alter reporter mRNA decay either in untreated or IL-10-treated cells. To understand the mechanism of ARE-mediated mRNA decay, a considerable effort has been invested to identify proteins that interact with ARE motifs; indeed, multiple ARE-binding proteins have now been cloned 28, 29 . While there are several reports linking ARE-binding proteins to stimulus-dependent change in the stability of ARE-containing mRNAs, little is known of the mechanisms involved 30, 31, 32 . Preliminary experiments have identified a protein that binds to the ARE cluster in IL-10-dependent fashion R.K. and T.A.H., unpublished observations). In this regard, the data presented above indicate that the ARE cluster motif in the KC 3′UTR determines both basal and IL-10-mediated KC mRNA stability. Whether both basal and IL-10-enhanced mRNA decay involve the action of the same ARE-binding proteins cannot be discerned from the available data. The IL-10-induced signaling pathways through which the destabilizing effects are mediated are only poorly defined. Binding of IL-10 with the receptor chain results in phosphorylation and activation of the Janus family protein tyrosine kinases, TYK2 and Jak1, followed by activation of STAT1α and STAT3 33, 34 . While the participation of STAT3 appears to be required for the suppressive action of IL-10 (removal of STAT3 docking sites on the intracellular domain of the IL-10 receptor abrogate suppression), activation of STAT3 alone does not block IL-10 inhibitory function 35 . In a separate report, IL-10 suppressed protein tyrosine phosphorylation in LPS-treated macrophages 36 . Determining which, if any, of these signaling events are linked with control of mRNA stability will, however, require additional experiments. ↵1 This work was supported by U.S. Public Health Service Grant CA39621. ↵2 Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Department of Immunology Cleveland Clinic Foundation NN10, 9500 Euclid Avenue, Cleveland, OH 44122. E-mail address: hamiltt{at}cesmtp.ccf.org ↵3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; nt, nucleotide; 3′UTR, 3′untranslated region; ARE, AU-rich element; CAT, chloramphenicol acetyltransferase; RPA, RNase protection assay Accepted December 30, 1998. Adams, D. O., T. A. Hamilton. 1992. Macrophages as destructive cells in host defense. J. I. Gallin, and I. M. Goldstein, and R. Snyderman, eds. Inflammation: Basic Principles and Clinical Correlates 637 Raven Press, New York. Nathan, C. F., Z. A. Cohn. 1995. Cellular components of inflammation: monocytes and macrophages. W. Kelly, and E. Harris, and S. Ruddy, and R. Hedge, eds. Textbook of Rheumatology 144 W. B. Saunders, New York. Ohmori, Y., T. A. Hamilton. 1994. Regulation of macrophage gene expression by T cell derived lymphokines. Pharmacol. Ther. 63: 235 Street, N. E., T. R. Mosmann. 1991. Functional diversity of T lymphocytes due to secretion of different cytokine patterns. FASEB J. 5: 171 Moore, K. W., A. O’Garra, R. De Waal Malefyt, P. Vieira, T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11: 165 Bogdan, C., Y. Vodovotz, C. Nathan. 1991. Macrophage deactivation by interleukin 10. J. Exp. Med. 174: 1549 Oswald, I. P., T. A. Wynn, A. Sher, S. L. James. 1992. Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor α required as a costimulatory factor for interferon γ-induced activation. Proc. Natl. Acad. Sci. USA 89: 8676 Wang, P., P. Wu, J. C. Anthes, M. I. Siegel, R. W. Egan, M. M. Billah. 1994. Interleukin-10 inhibits interleukin-8 production in human neutrophils. Blood 83: 2678 Kasama, T., R. M. Strieter, N. W. Lukacs, M. D. Burdick, S. L. Kunkel. 1994. Regulation of neutrophil-derived chemokine expression by IL-10. J. Immunol. 152: 3559 Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, A. O’Garra. 1991. Il-10 inhibits cytokine production by activated macrophages. J. Immunol. 147: 3815 Kim, H. S., D. Armstrong, T. A. Hamilton, J. M. Tebo. 1998. IL-10 suppresses LPS-induced KC mRNA expression via a translation-dependent decrease in mRNA stability. J. Leukocyte Biol. 64: 33 Berg, D. J., M. W. Leach, R. Kühn, K. Rajewsky, W. Müller, N. J. Davidson, D. Rennick. 1995. Interleukin 10 but not interleukin 4 is a natural suppressant of cutaneous inflammatory responses. J. Exp. Med. 182: 99 Rennick, D. M., M. M. Fort, N. J. Davidson. 1997. Studies with IL-10-/- mice: An overview. J. Leukocyte Biol. 61: 389 Bogdan, C., J. Paik, Y. Vodovotz, C. Nathan. 1992. Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-β and interleukin-10. J. Biol. Chem. 267: 23301 Wang, P., P. Wu, M. I. Siegel, R. W. Egan, M. M. Billah. 1994. IL-10 inhibits transcription of cytokine genes in human peripheral blood mononuclear cells. J. Immunol. 153: 811 Aste-Amezaga, M., X. Ma, A. Sartori, G. Trinchieri. 1998. Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10. J. Immunol. 160: 5936 Shaw, G., R. Kamen. 1986. A conserved AU sequence from the 3′ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46: 659 Ross, J.. 1995. mRNA stability in mammalian cells. Microbiol. Rev. 3: 423 Ohmori, Y., T. A. Hamilton. 1995. The interferon-stimulated response element and a κB site mediate synergistic induction of murine IP-10 gene transcription by IFN-γ and TNFα. J. Immunol. 154: 5235 De Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, J. E. De Vries. 1991. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J. Exp. Med. 174: 1209 Levitz, S. M., A. Tabuni, S. H. Nong, D. T. Golenbock. 1996. Effects of interleukin-10 on human peripheral blood mononuclear cell responses to Cryptococcus neoformans, Candida albicans, and lipopolysaccharide. Infect. Immun. 64: 945 Brown, C. Y., C. A. Lagnado, M. A. Vadas, G. J. Goodall. 1996. Differential regulation of the stability of cytokine mRNAs in lipopolysaccharide-activated blood monocytes in response to interleukin-10. J. Biol. Chem. 271: 20108 Kontoyiannis, D., M. Pasparakis, and G. Kollias. 1996. Generation and initial characterization of mice lacking TNF AU rich control elements. J. Leukocyte Biol. Supplement: (Abstract). Zubiaga, A. M., J. G. Belasco, M. E. Greenberg. 1995. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell Biol. 15: 2219 Lagnado, C. A., C. Y. Brown, G. J. Goodall. 1994. AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A). Mol. Cell Biol. 14: 7984 Wang, G. J., M. Collinge, F. Blasi, R. Pardi, J. R. Bender. 1998. Posttranscriptional regulation of urokinase plasminogen activator receptor messenger RNA levels by leukocyte integrin engagement. Proc. Natl. Acad. Sci. USA 95: 6296 Stoecklin, G., S. Hahn, C. Moroni. 1994. Functional hierarchy of AUUUA motifs in mediating rapid interleukin-3 mRNA decay. J. Biol. Chem. 269: 28591 Bohjanen, P. R., B. Petryniak, C. H. June, C. B. Thompson, T. Lindsten. 1992. AU RNA-binding factors differ in their binding specificities and affinities. J. Biol. Chem. 267: 6302 Zhang, W., B. J. Wagner, K. Ehrenman, A. W. Schaefer, C. T. De Maria, D. Crater, K. De Haven, L. Long, G. Brewer. 1993. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol. Cell Biol. 13: 7652 Bohjanen, P. R., B. Petryniak, C. H. June, C. B. Thompson, T. Lindsten. 1991. An inducible cytoplasmic factor (AU-B) binds selectively to AUUUA multimers in the 3′ untranslated region of lymphokine mRNA. Mol. Cell Biol. 11: 3288 Pande, A., K. D. Tremmel, C. T. DeMaria, B. C. Blaxall, W. A. Minobe, J. A. Sherman, J. D. Bisognano, M. R. Bristow, G. Brewer, J. D. Port. 1996. Regulation of the mRNA-binding protein AUF1 by activation of the β-adrenergic receptor signal transduction pathway. J. Biol. Chem. 271: 8493 Sirenko, O. I., A. K. Lofquist, C. T. De Maria, J. S. Morris, G. Brewer, J. S. Haskill. 1997. Adhesion-dependent regulation of an A+U-rich element-binding activity associated with AUF1. Mol. Cell Biol. 17: 3898 Finbloom, D. S., K. D. Winestock. 1995. IL-10 induces the tyrosine phosphorylation of Tyk2 and Jak1 and the differential assembly of STAT1α and STAT3 complexes in human T cells and monocytes. J. Immunol. 155: 1079 Weber-Nordt, R. M., J. K. Riley, A. C. Greenlund, K. W. Moore, J. E. Darnell, B. D. Schreiber. 1996. Stat-3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J. Biol. Chem. 271: 27954 O’Farrell, A. M., Y. Lui, K. W. Moore, A. L. F. Mui. 1998. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for STAT3-dependent and independent pathways. EMBO J. 17: 1006 Geng, Y., E. Gulbins, A. Altmon, M. Lotz. 1994. Monocyte deactivation by interleukin 10 via inhibition of tyrosine kinase activity and the Ras signaling pathway. Proc. Natl. Acad. Sci. USA 91: 8602 You are going to email the following Cutting Edge: Clustered AU-Rich Elements Are the Target of IL-10-Mediated mRNA Destabilization in Mouse Macrophages Raj Kishore, Julie M. Tebo, Mikhail Kolosov, Thomas A. Hamilton The Journal of Immunology March 1, 1999, 162 (5) 2457-2461; Cutting Edge: Bacillus Calmette–Guérin–Induced T Cells Shape Mycobacterium tuberculosis Infection before Reducing the Bacterial Burden Cutting Edge: Tcf1 Instructs T Follicular Helper Cell Differentiation by Repressing Blimp1 in Response to Acute Viral Infection Cutting Edge: Protein Arginine Deiminase 2 and 4 Regulate NLRP3 Inflammasome–Dependent IL-1β Maturation and ASC Speck Formation in Macrophages Show more CUTTING EDGE
cc/2019-30/en_middle_0028.json.gz/line13315
__label__wiki
0.947117
0.947117
Home / Current Affairs / Sadiqabad train collision death toll rises to 21 and 100+ injured 7 days ago Current Affairs Leave a comment 109 Views Authorities said a passenger train, Akbar Express, collapsed on a freight train at the Walter railway station of Sadiqabad when at least 21 people were killed and 100+ injured. Rahim Yar Khan Deputy Commissioner (DC) Jamil Ahmed Jamil told that all the passengers were trapped on a train, which was taken under Quetta, it was removed from the destruction and continued clearance operations. Earlier, Jamil said that heavy machinery is being used to overcome the passengers who were trapped in the train, adding that they were being provided with food and water. Police spokesman said police, rescue officials and other relevant agencies are engaged in rescue operations. Authorities said that the Pakistan Army was also participating in rescue efforts. The ambulance started reaching the area of ​​the area from different areas of the district to convey the injuries of Rahim Yar Khan to DHP Sadiqabad and Sheikh Zaid Hospital. The spokesperson said that soon after obtaining information about the accident, Sadiqabad AP Dr. Hafeez ur Rehman Bugti and a police action reached the spot. Rahim Yar Khan, DP Omar Farooq, said, “It is based on the initial reports when the signal is converted to the track, the passenger train went to the loop line, which caused traffic due to the accident. Prime Minister Imran Khan presented his condolences to the families of the victims. In a joint publication on Twitter, Prime Minister prayed for the fast recovery of the injured. He has written that for the sake of dealing with the infrastructure of the railway, the Minister of Railways has asked that he has ignored the railway infrastructure and has ensured safety standards. Railway Minister Sheikh Rashid Ahmed also expressed concern for the loss of precious lives due to the accident. Rasheed said that the incident occurred due to human negligence. He said that in this incident, he ordered the superior inquiry. Sadiqabad train collision death toll rises to 21 and 84 injured Previous FIA airport staff involved in stealing passengers data Next Healthcare Department Jobs For Junior Clerk, Computer Operator (43 Vacancies) FIA airport staff involved in stealing passengers data Islamabad: Director of the agency’s cybercrime told Wednesday the Parliamentary Committee that apart from travel …
cc/2019-30/en_middle_0028.json.gz/line13316
__label__cc
0.550982
0.449018
Talk to us 0115 941 5566 johnhooper@johnhooper.com Financial Settlement Collaborative Family Law Civil Partnerships Solicitors International Family Law Issues Cohabitation Law Family Law News Civil Partnerships for... The courts have taken the first step towards legalising Civil Partnerships for heterosexual couples. Rebecca Steinfeld and Charles Keidan’s widely publicised appeal for heterosexual Civil Partnership has been upheld by the Supreme Court by... The legal rights of cohabitees continue to be much less than what they should be. There is no doubt that some protection is available but not nearly enough. The situation becomes more complicated if... The Cost of Divorce Not surprisingly, this is one of the first questions that a client asks a lawyer. “How much is all this going to cost?” The general response is “it depends”. If a case is resolved... Supreme Court to decide what... A petitioner who was refused a decree of divorce because the court did not consider that her husband’s conduct amounted to unreasonable behaviour, has been granted permission to appeal to the Supreme Court. Mrs... The Cohabitation Rights Bill The Cohabitation Rights Bill is a result of The Law Commission’s report and proposals in 2007. The first reading of the Bill took place on 5 July 2017. This is a formality to start... Grace Evans – Our First... I undertook the Family Law module at the University of Nottingham during the final year of my studies. I thoroughly enjoyed the module which included learning about marriage, domestic violence, divorce and financial settlements... When Needs Does Not Mean When a court is asked to decide a matrimonial financial dispute between spouses or between a couple in a Civil Partnership, Section 25 of the Matrimonial Causes Act 1973 and Part 5 of Schedule... You’re Not So Special! On 11th April 2017, Daily Mail Online reported that ex Manchester United footballer, Ryan Giggs, was seeking to argue in The High Court in London that he had made a “special contribution” to the... Prenuptial Agreements –... With wedding season fast approaching, people who have recently got engaged may want to consider prenuptial agreements. Particularly those marrying once they have already built up a large asset portfolio. Prenuptial agreements are often... It Never Rains but it Pours After something of a drought of developments in Family Law, the early part of 2017 saw a flood of various events, cases and announcements. First of all we had the case of Briers. This... John Hooper Wins National... A headteacher who abandoned her career to be looked after by her millionaire husband may not claim compensation for lost earnings, a court has ruled. Katriona MacFarlane had claimed Dr James MacFarlane, represented by... 2016 News Roundup Family Law case update and legal news from 2016. The Family Court continues to struggle. The cases of Gohil and Sharland were considered by the Supreme Court – which came to the conclusion that fraud,... Authorised & Regulated by the Solicitors' Regulation Authority @ 2019 John Hooper & co | Web Design Fifteen johnhooperlaw @johnhooperlaw John Hooper & Co @johnhooperlaw @NottsLawSociety @NottsLawSociety you are welcome. Gay man wins parental rights over surrogate child after split https://t.co/lNdImLkt80 Follow @johnhooperlaw Children’s Issues – Family Law Financial Settlement Agreement NG1 5BQ E: johnhooper@johnhooper.com
cc/2019-30/en_middle_0028.json.gz/line13317
__label__wiki
0.703651
0.703651
About Our Legal Practice Pro Bono/Civic Engagement James P. Mayes, Esquire Advocate@james-p-mayes-esquire.com DUNS Number: 868017034 New Online Presentation Now you can learn more about our services and fields of practice online. Pro Bono/ Civic Engagement Attorney James Mayes is deeply committed to public service. Each year he provides a minimum of fifty hours of pro bono service in his areas of practice and for general issues. The following list provides examples of his service to the community. Facilitator, Constitutional Day programs (2005, 2006, 2007, 2009, 2010 and 2011) Committee Member, National Law program (2005, 2006, 2007 and 2008) Committee Member, HBCU White House Initiative (2006) Coordinator, Campaign Watch 2008 and Campaign Watch 2012, Webcast debates on Presidential Election (2008) Coordinator, The Inaugural of Barak Obama: A National Forum in conjunction with the Washington Historical Society (January 21, 2009) Presenter, Rules Workshop, Model United Nations, North Carolina Consortium for International and Intercultural Education (2009) Discussion Leader, Ethics and Professionalism program, ElonLawSchool(04/10/2007) Advisor, Judge Elreta A. Ralston Criminal Justice Society (2005, 2006, 2007, 2008, 2009) Advisor, Eta Upsilon chapter, Alpha Phi Sigma National Criminal Justice Honor Society (2007, 2008, 2009) Coach, We the People team,NorthwestGuilfordHigh School, state and national competition (2006, 2007, 2008, 2009, 2010, 2011, 2012) Committee Member, Weed and Seed Project,Greensboro,NC(2008) Rotarian, member, past club president, past club secretary, Paul Harris Fellow, sustaining member (2003 to present) Volunteer, North Carolina Kids Voting East Market Street Development Corporation,Greensboro,North Carolina (2006 to 2009) National Association of Neighborhoods,Washington,D.C. (1995 to present) Princeton Alumni Schools Committee (past Triad chair 2001 - 2005; 2011, 2012) Planning Committee Member, Charlotte Hawkins Brown, State Historic Site (2008) Founding Board Member,CommunityHabilitationCenter ofBaltimore (1992 – 1994) Member, Prison Reform Committee, State ofMaryland (1992 – 1993) © James P. Mayes, Esquire
cc/2019-30/en_middle_0028.json.gz/line13321
__label__wiki
0.532957
0.532957
News / Features / HYST? Christian Weaver, Facebook Have You Seen This? Young basketball player helps teammate score By Xoel Cardenas, KSL.com | Posted - Mar 20th, 2019 @ 3:00pm THE HARDWOOD — It’s March and that means spring, trees getting green and warmer, longer days. Oh yeah, and the madness that is the NCAA Tournament. People around the country will be filling out their brackets and watching games at work beginning Thursday. We at KSL.com also have our own bracket challenge going on, as we’re asking Utahns to select which high school is the best in the state. Hoops fever is in the air, and we have a feel-good video that shows one little boy’s passion for basketball and his teammate’s effort to make his goal of scoring a reality. In this clip, a boy named Austin, wearing the No. 0, is playing a game of five-on-five. He and his blue team teammates are trying to make a basket. The kid wearing the No. 50 grabs the rebound and, instead of putting the shot back up, he looks for Austin to try and help get him a bucket. Assisted by No. 50, Austin’s first shot is short. Another teammate grabs the ball and shoots, but his shot is off the rim. The rebound is taken by another blue team player. The boy wearing No. 50 asks for the ball, a la, Shaquille O’Neal in his prime. From there, No. 50 knows it’s time to get Austin his basket. Austin gets ready, No. 50 gets ready, and they put up the shot. It’s in! The crowd goes wild as Austin gets his bucket. His teammates clap in celebration. Austin is ecstatic, running down the court, looking at the crowd as happy as could be. The blue team’s coach comes onto the court to give Austin a high five. Austin is so thrilled, he starts giving double finger guns to the crowd while gameplay continues on. “We're so blessed to have so many people support him,” Christina Weaver, who filmed the moment, said in a Facebook post. “A huge thanks to his team for always helping him and even bigger thanks to Coach Mike for everything he's done for Austin.” Teamwork, passion, hard work and dedication: these are some of the pillars of sports, and they perfectly describe what Austin, his teammates (in particular, No. 50) and his coach did on this night, to say the least. He may be the smallest one on the court, but from his celebration, you can tell Austin’s love for basketball is the biggest among his peers. March Madness is here. Let’s go! Xoel Cardenas
cc/2019-30/en_middle_0028.json.gz/line13326
__label__wiki
0.721458
0.721458
Home British & World English grant Definition of grant in English: 1usually with two objects Agree to give or allow (something requested) to. ‘they were granted a meeting’ ‘her request was granted’ ‘When asked for permission to reproduce a work she granted the request and refused payment.’ ‘Accordingly, whether to grant a relocation request is not a decision courts make lightly.’ ‘Near the end of the first semester, I requested and was granted permission to open a school store.’ ‘A spokesman says he must appear, that there's been no request or permission granted excusing his presence.’ ‘The Act seems to apply where the bank has agreed to grant the customer an overdraft but has not finalized details of the arrangement.’ ‘The judge granted his request to testify behind a screen.’ ‘If you grant the request, put the arrangements in writing.’ ‘It granted the officers' request for a warrant, but didn't specifically say that they could search occupants of the house other than the drug dealer.’ ‘Naturally, I did not read between the lines of her letter, and did not detect the threatening undertone of what would happen if her request was not granted.’ ‘The memo does not indicate the nature of the search, whether Justice ever asked the court and - if so - whether the court granted the request.’ ‘A month ago I would have gladly granted your request.’ ‘I do hope the lady's request is granted, but we on this estate seem to be banging our heads against a brick wall as no-one is listening to us, or if they are, they are just ignoring us.’ ‘He eventually ruled he couldn't grant the request for an injunction because he would then be deciding the question of rights without hearing full evidence and argument.’ ‘A circus could be part of this year's Stromness Shopping Week, after councillors agreed to grant permission to allow a visiting circus to set up on OIC land.’ ‘‘Bulgaria has already granted Germany's request,’ he said, adding no further requests are expected.’ ‘Now Defra has announced that the Government will keep the rural exceptions policy, allowing local councils to grant planning permission for affordable homes.’ ‘Her request was granted, although the hospital doesn't usually acquiesce to such appeals.’ ‘His request was granted - but then overturned when legal chiefs in London intervened, ruling it was not a legitimate excuse.’ ‘He's finally come to the conclusion that he's granting her last request.’ ‘The grateful czar told the soldier that he would reward him by granting any request he made.’ allow, accord, permit, afford, concede, vouchsafe 1.1Give (a right, power, property, etc.) formally or legally to. ‘they will grant you asylum’ ‘However, Article 10 does not in itself grant a right of asylum or a right for an alien to stay in a given country.’ ‘Can powers granted by an enabling Act only be enlarged or modified by express words of authorisation?’ ‘The court ruled that international law does not grant the right of individuals to seek war damages from a state.’ ‘What cannot be ignored is why property rights are granted - what social functions they serve.’ ‘It has been a sovereign entity and has enjoyed this situation for years under the rights granted by international law.’ ‘Thus in some countries, we have been able to craft the license to give the author the power to grant both copyrights and moral rights.’ ‘Similarly, we would say, a common law lease grants a right of exclusive possession because that is what a common law lease does.’ ‘Thus, Massachusetts will now take the lead among states as the only one to grant the right of civil marriage to same-sex couples.’ ‘However, the preferred option is to grant a power of attorney.’ ‘Even though they might appear to be enquiring into the validity or scope of an intellectual property right granted by a foreign sovereign.’ ‘A patent grants the exclusive rights to sell a drug for 17 years.’ ‘So why, then, do we grant intellectual property rights?’ ‘Now under Victorian law, there is a specific power granted by parliament to enable police to engage in criminal activity for drug investigations.’ ‘A by-law is a kind of municipal statute - it is municipal legislation within the powers granted by the provincial Legislature.’ ‘I have already mentioned the power to grant bail.’ ‘Property owners must also grant right of access to Revenue officials to an approved building to monitor compliance with the reasonable access requirements.’ ‘The usual understanding of Reed is that it applies to require the State that grants immigration rights to unmarried partners of its own nationals to grant such rights to migrant workers too.’ ‘I conclude that, notwithstanding the use of the word private to describe the Order route, unrestricted public rights of way including vehicular rights were undoubtedly granted.’ ‘If the Secretary of State decides to grant a right of retention he shall issue to the grantee a retention document.’ ‘Rather than grant rights of asylum, the report A New Vision for Refugees proposes a range of ‘protected areas’ near or in the refugees' country of origin, where they can be held.’ bestow on, confer on, give, impart to, present with 2usually with two objects Agree or admit to (someone) that (something) is true. ‘he hasn't made much progress, I'll grant you that’ ‘I did have time to think ‘oh no’ (very useful, I grant you) and turn to follow her progress.’ ‘Especially since it's true (only an added benefit these days, I grant you.)’ ‘It's true, I'll grant you, that we are the party of the family - in an entirely inclusive, compassionate sort of way, naturally - and mean to stay that way.’ admit, accept, concede, yield, cede, allow, appreciate, recognize, acknowledge, confess 1A sum of money given by a government or other organization for a particular purpose. ‘a research grant’ ‘The money is used for small grants to deserving organizations and individuals.’ ‘The 18 per cent grant set aside in the budget will be used appropriately for this purpose.’ ‘The money will enable Essex Police to use the main grant for its intended purpose - crime prevention.’ ‘If a grant is awarded the money will go towards research and a feasibility study for the larger project of copying and moving the stones.’ ‘The association records any research grants or contracts money that council members have received in a financial year.’ ‘The World Bank, founded in 1944, lends money and makes grants to developing countries around the world.’ ‘The council now has to raise £6.7m, with the remaining money coming from smaller grants and sponsorship.’ ‘The first part of the initiative sought to make it easier for religious organizations to get government grants to provide social services.’ ‘AMERICAN FORESTS is raising money to provide tree-planting grants to organizations in the Chicago area.’ ‘The appointee will be responsible for raking in as much money as possible from grants, bids, special policing services and sponsorship.’ ‘Students who place in the top 20 percent of their class are sought after by schools and often eligible for free money - scholarships and grants.’ ‘Twenty-one arts projects in the Yorkshire and Humber region got the go-ahead with the announcement of a new round of grants from Lottery money yesterday.’ ‘She argued that students from lower income families would get grants and bursaries and, in effect, money from well-off students would be directed to help them.’ ‘A two-tier system is already in place in terms of the allocation of existing research grants and that will only be exacerbated if and when greater resources become available.’ ‘If the pools are closed, will the council promise to redirect the money saved to grants to help clubs and support other well-organised projects that promote sports participation?’ ‘All farmers, landowners and parish councils in the National Park can apply for grants from the money which has come through Yorkshire and Humber Regional Development Agency.’ ‘He said: ‘They have raised half of their money with grants and if we do half as well as them we'll be fine.’’ ‘Ever since the withdrawal of the government's local authority social housing grant, the district council has been looking at ways of financing development of affordable housing in the district.’ ‘Local government is hardly local at all, in that most of its functions involve hitting targets set by central government, while most of its money comes in grants from the centre, rather than locally raised council tax.’ ‘If all they are going to do is cream off money from research grants in Europe, we would not want to see that happen.’ endowment, subvention, award, donation, bursary, contribution, allowance, subsidy, handout, allocation, allotment, gift, present 1.1formal mass noun The action of granting something. ‘we had to recommend the grant or refusal of broadcasting licences’ ‘This would, therefore, keep issues such as grant of visas and immigration policies very much alive in the days to come.’ ‘In their dissenting note both the members had stated that the committee did not have the power to go into the question of grant or refusal of minority statues to anyone.’ ‘By the late Sixties, corruption spread to more areas of administration, particularly large projects and grant of permits, licences and quotas.’ ‘Accordingly he argued that the Council should have sought judicial review of the grant of listed building consent in 1993.’ ‘A similar inference can be drawn from the lack of any sustained increase in the grant of legal aid certificates in respect of clinical negligence and the value of bills paid in this area.’ ‘It held that the merits of the case did not justify the grant of legal aid.’ allocation, allotment, issuing, issuance, awarding, grant, granting, administration, earmarking, designation, setting aside, budgeting 1.2Law A legal conveyance or formal conferment. ‘a grant of probate’ ‘The most sought-after expression of patronage was a grant of land, conferring both wealth and status.’ ‘The estate as of the death, whatever it was, if any, passes to the executor from the will not on the grant of probate, of course.’ ‘But it is to the discretion of the bank/building society that hold the assets whether or not they require to see the legal document called a grant of Probate or Letters of administration.’ ‘Mr Chitolie seeks revocation of a grant of probate to his brothers of his sister's will.’ ‘She continued to draw income support after her mother's death and after the grant of probate to her mother's will of which she was an executrix as well as a beneficiary.’ take for granted 1Fail to properly appreciate (someone or something), especially as a result of overfamiliarity. ‘the comforts that people take for granted’ ‘The right to own land and other property is taken for granted in many countries.’ ‘Everything ran smoothly for the next two months, but I guess I took things for granted.’ ‘I know I took you for granted, expecting you always to be around when that's not possible.’ ‘The problem with being an All-Star is that good performances are taken for granted and people expect more.’ ‘Their wives have become spoiled, take their efforts for granted and have unrealistic expectations.’ ‘The average citizen fails to appreciate civil liberties precisely because in this country they can be taken for granted.’ ‘I have found that people in developing countries do not take their medical care for granted and really appreciate the care that we give to their children.’ ‘You don't take things for granted, you accept what you have, and you're aware, well, you are only human in the end, no matter if you're rich or you're poor, everyone's the same.’ ‘In reality, he's showing all the signs of taking our success for granted and assuming it will go on forever…’ ‘We believe teachers have been taken for granted for too long.’ 2take something for grantedAssume that something is true without questioning it. ‘George had taken it for granted that they'd get married’ ‘To take these issues for granted, to simply accept knowledge structures as they are presented to you, is to avoid critical thinking.’ ‘If it is taken for granted that material comfort is all that our elderly parents hope for, where then can we draw the line of demarcation between our attitudes toward pet animals and our parents, who begot, gave birth to and raised us?’ ‘They take the void for granted and don't expect the day when it will fill up with romance, or children, or whatever.’ ‘The conclusions of the Qur'an are not taken for granted but verified through observation of the world.’ ‘Bean's profound understanding of the work can be taken for granted; his fiery brilliance is evident at the start of the finale.’ Middle English from Old French granter ‘consent to support’, variant of creanter ‘to guarantee’, based on Latin credere ‘entrust’. /ɡrɑːnt/ Types of Dance Which of the following is a type of dance? panatella chicken trot pacarana ceroll ceroc
cc/2019-30/en_middle_0028.json.gz/line13338
__label__wiki
0.838167
0.838167
Linux Foundation Energy member TenneT “open sources” their open source strategy By jefro | Announcement, Blog This post was written by Loek Bakker, Corporate Information Management Office Head at TenneT TenneT is the first European cross-border electricity transmission system operator (TSO), with activities in the Netherlands and in Germany, providing uninterrupted electricity to over 41 million people. The security of our supply is among the best in Europe, with 99.99% grid availability. With the energy transition, TenneT is contributing to a future in which wind and solar energy are the most important primary sources to produce electricity. As an LF Energy member, we recognize that open source is the commodity foundation upon which the entire IT industry rests. A recent Synopsis study indicated that 100% of the proprietary software our vendors are using in the energy and utility space have open source inside [1]. Yet, as an industry, we do not manage our software as a community, and we have relative ignorance about what exists within our “black boxes”. The open source model refers to the software development practice that encourages transparent governance and open collaboration to create software for which the original source code (design, code, ingredients) is made freely available and may be redistributed and modified. For TenneT, like many other utilities, open source is essential to our strategic success. TenneT chose to adopt the open source model in 2017 by developing the TenneT Data Platform (TDP). We now want to accelerate the development and adoption of open source for the following reasons: TenneT wants to drive the energy transition. Open source is the dominant software model for open innovation efforts in the new digital economy. TenneT increasingly uses open source for mission-critical workloads, and this will increase in the future. Open source software is used within mission-critical workloads by over 90% of IT operations across industries. It is the global standard. TenneT has a public task and is focused on lowering cost for society. Open source provides opportunities for faster innovation, and lowering overall development and maintenance costs for software. These reasons closely relate to the renewed strategic goals for TenneT as a TSO, meaning that our open source strategy fully supports TenneT’s strategic direction. Since we truly believe that open source is one of the great leverage points to accelerate technological paradigm changes which are necessary for the energy transition, we have decided to publish our open source strategy under a Creative Commons license, making it available for everyone to see, share, and use. This will not only improve the quality of our own strategy document, but it can also support other parties in moving forward with open source and creating solutions for the energy transition. And what better way to do this than through the LF Energy initiative, to underline our commitment to LF Energy as a neutral place for collaboration and cooperation. Click to read TenneT’s full strategy [PDF]. Europe’s Two Largest TSOs Discuss the Call to Open Source and Joining Linux Foundation Energy Join a webinar with Loek Bakker from TenneT and Lucian Balea from RTE August 8th at 8:00am PT, 16:00 GMT, 17:00 CET [1] 2019 OPEN SOURCE SECURITY AND RISK ANALYSIS: Synopsys Cybersecurity Research Center https://www.synopsys.com/blogs/software-security/open-source-trends-ossra/ LF Energy Ecosystem Gains Momentum for Open Source Innovation With New Members and Projects By LF Energy | Announcement, Latest Energy Industry Comes Together To Collaborate On the Grid of the Future and Secure Distributed Power Systems INNOGRID, BRUSSELS, May 15, 2019 – LF Energy, a Linux Foundation initiative developing and sustaining open source technology innovation in the energy and electricity sectors, is rapidly growing its community with additional founding Premier member, Faraday Grid, joining RTE. New General members include IBM, OSISoft, and Recurve; while Elering AS, Energinet, Energy Foundation, École Polytechnique Fédérale de Lausanne, Fraunhofer IEE, FIWARE Foundation, Iowa State University, Monash University, National Renewable Energy Laboratory (NREL), North Carolina State University FREEDM Center, Project Haystack, Stanford University, TenneT, The Energy Coalition, University of Kassel, and Washington State University join European Network of Transmission System Operators (ENTSO-E) and Vanderbilt University as new Associate members. In addition, three new projects, Energy Market Methods Consortium (EM2), OpenEEmeter, and Open Energy Data Initiative are now hosted by LF Energy. OpenEEmeter is an open-source engine focused on quantifying changes in energy consumption and providing standards for enabling behind-the-meter flexibility in building as a grid resource. The project is contributed by Recurve, formerly Open Energy Efficiency. The Energy Market Methods Consortium (EM2) is designing standards to quantify energy flexibility at both the meter and the grid, and for ensuring customer privacy when using smart meter data. This is also contributed by Recurve, formerly Open Energy Efficiency. The Open Energy Data Initiative, which focuses on building open data connections to high-value federal datasets to better enable analysis and computation, contributed by the U.S. Department of Energy’s National Renewable Energy Laboratory (NREL). LF Energy is a growing community supported by the world’s leading utilities, system operators, system integrators, technology vendors, academic institutions, and end-user organizations to accelerate the global energy industry transition to achieve efficient, sustainable, and distributed power systems. “LF Energy is working with global energy providers to build and run scalable applications in modern, dynamic environments to transform centralized grids into distributed systems by leveraging open source and open standards,” said Shuli Goodman, Executive Director of LF Energy. “It’s incredibly exciting to see momentum and support for LF Energy grow so quickly. A robust ecosystem of projects, developers and members joining and contributing to LF Energy will be instrumental in achieving a secure, flexible, and sustainable grid.” Several LF Energy founding members, including Elering, Energinet, ENTSO-E, Faraday Grid, TenneT and RTE, came together in Brussels at InnoGrid2020+ May 13-14 to exhibit and introduce new projects that expand the initiative beyond operators and the control room. Goodman also presented closing remarks on day one, and Faraday Grid participated in the “Time to Market” panel on May 14. Background on New LF Energy Projects LF Energy provides open frameworks and reference architectures that bring complementary projects to one central home to create collaborative solutions that are compatible and support the entire power systems ecosystem from generation and aggregation to transmission, distribution, and demand response and flexibility services. Energy Market Methods Consortium (EM2): Energy Market Methods Consortium is developing standardized methods, linked to open source code, to enable demand flexibility as a resource, supporting energy programs and distributed energy resources (DER) ​markets. EM2 includes three working groups: CalTRACK to standardize measurements of meter-based changes in consumption; GRID to provide methods for relative impacts to load shape for claimable savings and forecasting net grid impacts; and SEAT, which leverages differential privacy to enable a range of data-driven policy and market-based use cases using AMI data. This project was contributed by a diverse group of stakeholders that includes utilities, regulators, evaluators, software companies, and load shape aggregators, through a multi-year process that was led by Recurve, formerly Open Energy Efficiency. OpenEEmeter: The OpenEEmeter project is an open source engine that quantifies monthly, daily, and hourly changes in energy consumption, from behind-the-meter building interventions, to define consistent transactional units for distributed energy resources, ensure transparency, and provide a quantifiable standard for an ecosystem that enables markets for behind-the-meter flexibility as a resource. OpenEEmeter implements the methods created by the CalTRACK working group in EM2. This project was contributed by Recurve, formerly Open Energy Efficiency. Open Energy Data Initiative (OEDI): The mission of OEDI is to improve and automate access to high-value energy (and related) datasets to make data actionable and discoverable by researchers and industry to accelerate analysis and advance innovation. OEDI will provide governance oversight of technical contributions, curate multiple datasets and data lakes, and develop and support machine learning and artificial intelligence based on datasets. The initial contribution comes from the U.S. Department of Energy’s National Renewable Energy Laboratory (NREL). Existing LF Energy projects include OperatorFabric, PowSyBl, and RIAPS. OperatorFabric is a modular, extensible, industrial-strength and field-tested platform for use in electricity, water, and other utility operations. It features Let’s Coordinate, a multi-system technical and organizational module based on OperatorFabric, that streamlines organizational and technical communications between operators in power systems. PowSyBl provides the code building blocks for the simulations and analyses of power systems, for horizons from real-time operation to investment planning) RIAPS: The Resilient Information Architecture Platform for Smart Grid (RIAPS) provides core infrastructure and services for building effective, secure and powerful distributed Smart Grid applications, such as monitoring and control, data collection and analytics, energy management, microgrid control, and protection applications. Because of the breadth of the energy sector, LF Energy will also add more projects in the future from across the entire electricity and power systems lifecycle to enable and facilitate the acceleration of the energy transition. With members across 10 countries, LF Energy anticipates new initiatives to include a digital substation project that will disaggregate and virtualize the substation bus utilizing open source and commodity x86 hardware to drive costs down and capacity for data consumption. A second predictive maintenance project will utilize IoT and drone technology to build AI and machine learning algorithms using sensors, geospatial images, and harmonic listening. Additionally, Powernet and Visdom, two Stanford open source projects, are already engaging with LF Energy. Supporting Quotes from Founding LF Energy Members “With accelerating change in the energy sector, keeping costs under control is a real challenge,” said Georg Rute, Digitalisation Manager at Elering. “We welcome the initiative to open source our basic IT infrastructure, thus helping reduce costs for all grid operators and bring down barriers in integrating our energy systems.” “Decarbonization and digitalization of the energy system calls for radical changes to our IT ecosystem,” said Henrik Lang Petersen, CIO at Energinet. “Increased collaboration across borders and sectors is needed. For these reasons, Energinet has joined LF Energy in an ambition to foster new partnerships and further advance the socio-economic value of our IT investments.” “It is no surprise that LF Energy has been developing so fast,” said Nicolas Richet, Chief Information Officer and Secretary of the Digital committee at ENTSO-E. “It allows for the collaborative development of building blocks that will support the cutting-edge innovations needed for customers worldwide to enjoy a reliable and sustainable power supply. ENTSO-E Members are already applying this collaborative approach in their shared IT developments. This is why ENTSO-E is supporting LF Energy and looks forward to stakeholders across the power system to join.” “To realise reliable, affordable, and decarbonised energy systems and drive continued prosperity, we must look beyond the historical technology approaches,” said Matthew Williams, Faraday Grid Founder, Director and CTO. “We need speed of innovation, which requires that we adopt new processes and practices, with open collaboration at the heart of this. Faraday Grid is proud to be a founding member of LF Energy to enable prosperous and sustainable energy systems globally.” “LF Energy brings the collaborative benefits of open source software and data to the energy industry. We are thrilled to be a founding member and are committed to building a healthy and extensive global ecosystem,” said Neil Gerber, Director, IBM’s Energy, Environment & Utilities Industry. “This will dramatically improve system interoperability and enable advanced technologies like Artificial Intelligence. This is necessary to address the world’s need to rapidly evolve the electrical grid infrastructure, while enhancing transparency and innovation.” “Monash University is developing a digital platform, Smart Energy City, to provide crucial infrastructure supporting our $135 million commitment to reach net zero emissions by 2030,” said Ken Sloan, Monash Deputy Vice-Chancellor and Vice-President Enterprise. “The platform will enable research and deployment to create a transactive energy market as a living laboratory for academics, students and industry. The LF Energy partnership vastly accelerates our access and connectivity to global technology leaders and developers.” “NREL aims to build a network of data users and contributors for our platform, while at the same time making open energy data more useful, usable, and accessible for researchers and analysts,” said Debbie Brodt-Giles, Data, Analytics, Tools, and Applications (DATA) Group Manager at NREL. “By its very nature, power spans many boundaries – political, enterprise, economic, social and cultural. As we face rising concerns around global warming and grid disturbances from more frequent severe weather events, we need to leverage technology – from renewable energy to advanced grid control – not to thrive, but just to survive. OSIsoft is thrilled to support LF Energy as a vehicle to drive collaboration and cooperative software and systems that are desperately needed to meet these challenges,” said Richard Beeson, CTO of OSIsoft. “OSIsoft is fortunate to serve 75% of the world’s top energy companies. Our technology helps them manage their operations data for better situational awareness and renewable integration. We are committed to working with the broader ecosystem in helping our collective customers, their stakeholders and the communities and people they serve in adapting and continuing on this journey.” “We finally found our people,” said Matt Golden, CEO of Recurve (formerly OpenEE), who recently contributed their open source project, the OpenEEmeter, and the CalTRACK method process to LF Energy. “LF Energy is the perfect home for this important consensus building effort. Clearly LFE understands open source and how to help make projects succeed. However, what sets LFE apart is their vision for how open source can drive innovation and the software ecosystem needed to achieve a distributed clean energy grid.” “In the smart grid, all players take part,” said Loek Bakker, Head of Information Management Office, TenneT. “TenneT believes that this open market demands open software, which is why we have joined the LF Energy initiative.” LF Energy provides the leadership, infrastructure, training, legal support, and community outreach needed to nurture an open source ecosystem to pave the way for alternative paths to energy efficiency and savings, the integration of renewables, and electric mobility, powered by open source. Energy sector engineers and developers across hybrid clouds, containers, and microservices, are encouraged to learn more and to join the LF Energy community in deploying, testing, and improving open source software to rapidly digitize the grid. About the Linux Foundation Founded in 2000, the Linux Foundation is supported by more than 1,000 members and is the world’s leading home for collaboration on open source software, open standards, open data, and open hardware. Linux Foundation’s projects are critical to the world’s infrastructure, including Linux, Kubernetes, Node.js and more. The Linux Foundation’s methodology focuses on leveraging best practices and addressing the needs of contributors, users, and solution providers to create sustainable models for open collaboration. For more information, please visit us at linuxfoundation.org. The Linux Foundation has registered trademarks and uses trademarks. For a list of trademarks of the Linux Foundation, please visit our trademark usage page at https://www.linuxfoundaton.org/trademark-usage. Linux is a registered trademark of Linus Torvalds. The Linux Foundation Launches LF ENERGY, New Open Source Coalition By LF Energy | Announcement LF ENERGY Launches with Europe’s Biggest Transmission System Provider, RTE; Initiative Fuels Energy Transition and Momentum for Open Source Innovation SAN FRANCISCO, July 12, 2018 – Just as open source software has transformed automobiles, telecommunications, financial services, and healthcare, The Linux Foundation today announces the formation of LF Energy with support from RTE, Europe’s biggest transmission power systems provider, and other organizations, to speed technological innovation and transform the energy mix across the world. LF Energy also welcomes four new projects to be hosted at The Linux Foundation as part of the initiative, which will advance everything from smart assistants for system operators to smart grid controls software. LF Energy is an umbrella organization that will support and sustain multi-vendor collaboration and open source progress in the energy and electricity sectors to accelerate information and communication technologies (ICT) critical to balanced energy use and economic value. “Our complex, multifaceted global energy market is evolving quickly, and it demands that we not only keep pace, but act more rapidly than ever before,” said Shuli Goodman, LF Energy Executive Director. “A collaborative open source approach to development of these technologies across companies, countries, and end users, will provide the innovation needed to meet our respective goals in renewable energy, power electronics, electric mobility, and rapid digitalization for the energy sector overall.” LF Energy members aim to inform and expedite the energy transition, including the move to electric mobility and connected sensors and devices—all while modernizing and protecting the grid. “We are thrilled to launch LF Energy and honored to work with RTE, European Network of Transmission System Operators, Vanderbilt University and The Electric Power Research Institute to harness open source technologies and advance the energy transition. We invite developers and organizations around the world to join us in advancing this exciting new endeavor,” said Jim Zemlin, Executive Director of The Linux Foundation. “With the technical and operational guidance of the Linux Foundation, LF Energy will create a sustainable ecosystem to quickly and efficiently deliver robust, secure and innovative solutions. Our goal with LF Energy is to deliver value as quickly as possible to help our stakeholders advance their business goals, strengthen local and global economies, and improve renewable energy and grid modernization.” LF Energy will focus on curating reusable components, open APIs and interfaces through project communities that the energy ecosystem can adopt into platforms and solutions. Building the plumbing upon a common infrastructure enables energy companies and solution providers to differentiate at higher value layers and services, while reducing cost and integration complexity at non-differentiating layers. As a result, power system providers will be empowered to achieve time to market, scale and efficiency much faster than ever before. Key Facts, Background and Supporting Partners RTE is a French transmission system operator and Europe’s biggest transmission system provider. “RTE is thrilled to be a founding member of LF Energy because we believe it is essential for creating forward-thinking grid solutions,” said Olivier Grabette, Executive Vice President and Member of the Executive board. “Shared open development is fundamental to enabling smart power for the benefit the global economy and the energy landscape of the future. RTE is proud to contribute three significant projects to the LF Energy ecosystem, and we look forward to working closely with The Linux Foundation and the open source community to make our systems smarter and more secure.” Vanderbilt University is a private research university in Nashville that conducts research in the area of cyber-physical systems through its Institute for Software-Integrated Systems. “Vanderbilt’s Institute for Software-Integrated Systems has a long track record in building various open source software tools and this is an exciting cross-sector collaboration,” said Gabor Karsai, Associate Director of the Institute. “This initiative will allow us to share our research results with the open source community and facilitate technology transition to industry.” ENTSO-E, the European Network of Transmission System Operators, represents 43 electricity transmission system operators (TSOs) from 36 countries across Europe. “ENTSO-E sees the potential for community and collaborative action that the LF Energy initiative offers to pool skills and knowledge in new strategic digital areas,” said Laurent Schmitt, Secretary General, ENTSO-E. “ENTSO-E recognizes the benefits of open source and shared development to develop agility in future digital developments, which is key for ENTSO-E and our TSO community. We have established a first liaison with LF Energy as a strategic option for meeting ENTSO-E’s and the European TSOs’ commitment to a cost effective and secure energy transition. We are pleased to be part of this global announcement.” The Electric Power Research Institute (EPRI) conducts research, development, and demonstration projects for the benefit of the public in the United States and internationally. Its membership has grown to represent approximately 90% of the electric utility revenue generated in the United States and extends to participation in more than 35 countries. “The Electric Power Research Institute believes a collaborative, innovative, and objective approach is necessary to tackle many of the opportunities ahead for maintaining a safe, reliable, affordable, environmentally responsible, and integrated electric power system,” said EPRI Vice President of Integrated Grid Mark McGranaghan. “This effort will continue to foster that spirit of collaboration, bringing multi-national perspectives to the table to inform globally-impactful work toward our respective and complimentary missions.” RTE contributed three projects to The Linux Foundation to form LF Energy, and Vanderbilt University will transition its Resilient Information Architecture Platform for Smart Grid (RIAPS) applications technology. These projects will help seed an open source ecosystem for TSOs, distribution system operators, aggregators, utilities, vendors, and other energy sector stakeholders. More about new LF Energy projects: OperatorFabric: is a smart assistant for system operators for use in electricity, water, and other utility operations. The industrial strength, extensible and flexible grid operations platform provides strategic management of information with a modular approach to applications, easy-to-add new functionality, and open APIs. Let’s Coordinate: an extensible solution of OperatorFabric, enables organizational power system coordination, visibility, communication, and workflow between distributed users across national and regional boundaries. The PowSyBl Framework: of reusable modular components is a high-performance computing platform that enables grid modeling (e.g., CGMES) and simulation in a highly distributed energy resource environment from system expansion studies to planning and operation. RIAPS: The Resilient Information Architecture Platform for Smart Grid (RIAPS) provides core services for building effective, secure and powerful distributed applications. Created at the Institute for Software-Integrated Systems at Vanderbilt University, with support from North Carolina State University, Washington State University, and funding from the U.S. Department of Energy’s Advanced Research Projects Agency for Energy (ARPA-E), RIAPS enables smart grid control software to run reliably, just as smartphone apps run on platforms like Android and Apple iOS that have become industry standards. Hardware, software, UI, services, and applications suppliers will work together on these independent technical projects as part of LF Energy to accelerate the energy transition. To learn more about LF Energy or join the effort, go to https://www.lfenergy.org/. The Linux Foundation is the organization of choice for the world’s top developers and companies to build ecosystems that accelerate open technology development and industry adoption. Together with the worldwide open source community, it is solving the hardest technology problems by creating the largest shared technology investment in history. Founded in 2000, The Linux Foundation today provides tools, training and events to scale any open source project, which together deliver an economic impact not achievable by any one company. More information can be found at www.linuxfoundation.org. The Linux Foundation has registered trademarks and uses trademarks. For a list of trademarks of The Linux Foundation, please see our trademark usage page: https://www.linuxfoundation.org/trademark-usage. Linux is a registered trademark of Linus Torvalds.
cc/2019-30/en_middle_0028.json.gz/line13339
__label__wiki
0.994209
0.994209
Stephen Moutray calls for probe into erection of Irish tricolour at Stormont PACEMAKER BELFAST 03/06/2015'An Irish Tricolour has appeared briefly over Parliament Buildings in Belfast, before being removed amid calls for an investigation.'The flag was erected on Wednesday and appeared over Stormont for about 10 minutes.'DUP North Down MLA Peter Weir has written to Assembly Speaker Mitchell McLaughlin and Chief Executive Trevor Reaney to ask why it happened.''''Whatever the motivation behind this there must be a full explanation from the Assembly as to who had access to the flag poles and who was responsible for this action,' he said. Published: 16:51 Updated: 17:00 Wednesday 03 June 2015 An investigation is underway after an Irish tricolour was flown from Stormont on Wednesday. Upper Bann MLA Stephen Moutray said: “I’m appalled to learn that someone was able to raise two Irish tricolours on Parliament Buildings this morning. “Serious questions will be asked of the authorities as to who had access to the roof and if an outside contracting company was involved what sanctions will be taken. I hope the culprit enjoyed his 5 minutes because it’s the only time that flag will fly in that position. “I have this afternoon written to the Dirctor General of NI Assembly requesting a full investigation into this morning’s incident at Parliament Buildings and that appropiate sanctions be imposed on those found to have been involved.” DUP North Down MLA Whip Peter Weir says he has written to the Northern Ireland Assembly Speaker Mitchell McLaughlin and Chief Executive Trevor Reaney demanding an explanation. “Whatever the motivation behind this there must be a full explanation from the Assembly as to who had access to the flag poles and who was responsible for this action. “If it was carried out by someone working for an outside contractor then this surely would represent a breach of contract which should result in sanction. It would also place an onus on the company to take disciplinary action against those responsible. “I have inquired too whether the Union Flags, flying to mark Coronation Day, were interfered with yesterday (Tuesday). “I have been assured by the Assembly that these were rogue actions and are being fully investigated.” Some years ago a number of republicans draped a tricolour over the statue of Edward Carson at Stormont. Traffic starting to move after crash near NI railway station Ambulance at scene after man hurt in NI crash
cc/2019-30/en_middle_0028.json.gz/line13350
__label__wiki
0.691534
0.691534
The Loop Hits Apple's Newsstand product By Jeff Gamet May 9th, 2013 10:10 AM EDT Apple-and-sundry news site The Loop is expanding beyond your Web browser into a digital magazine available through Apple's Newsstand for the iPhone and iPad. The Loop Magazine expands on what's available through the website with longer form articles and will include content that's unique just to the magazine. Jim Dalrymple, the man behind The Loop and life support system for The Beard, said The Loop Magazine will publish twice a month and cost US$1.99 a month. You can check it out for free for seven days, so head on over to Newsstand and download a copy. Check It Out: The Loop Hits Apple's Newsstand Jeff Gamet
cc/2019-30/en_middle_0028.json.gz/line13352
__label__wiki
0.919005
0.919005
Apple Adds New Apple Watch ‘Guided Tours’ to Website Chris Hauk - Apr 3, 2015 Apple has added a new “Guided Tours” section to its Apple Watch website. The new area includes a number of Apple Watch walkthrough videos. “Welcome to Apple Watch,” takes viewers through all the features of the Watch, while a video entitled “Messages” demonstrates how to receive and send messages using the device. Other videos include “Faces,” which shows how to customize the device’s watchfaces, and “Digital Touch,” which demonstrates how to communicate with loved ones via sketches, a single tap, or even your heartbeat. Marked as “Coming Soon,” are videos for “Phone Calls,” “Siri,” “Maps,” “Music,” “Apple Pay,” “Activity,” and “Workout,” which should be added in the coming days. The videos are at this point only available on the Apple Watch site, but if Apple follows it’s usual MO, they’ll upload them to YouTube eventually. Next Up Samsung Patent Review Request Could Actually Help Apple Topics AppleApple Watchguided toursVideos
cc/2019-30/en_middle_0028.json.gz/line13353
__label__cc
0.712444
0.287556
Building with Blogs Name a topic with a community of interest around it. Now go to Google and look it up. There's a good chance one or more of the top results will include somebody's weblog (aka blog). Let's take three examples: 802.11b: the top listing out of 687,000 results is WiFi news, a weblog by a pair of journalists, Glenn Fleishman and Adam Engst. The IEEE working group's site is in the #2 position. The WiFi Alliance's portal is #3. Segway: the top listing out of 81,500 results is the Segway company's site, followed by the Berkeley Segway Portal and then followed by Segway News—a weblog by Paul Nakada. Weblog: out of 2,620,000 results, the top listing is Aaron Swartz's Google Weblog, followed by the Guardian Limited's weblog. Following them is the blog of a certain Linux Journal editor who also happens to be writing what you're reading right now. Blogs succeed largely because they are extremely native to the Web as Tim Berners-Lee conceived it in the first place. Here's how weblog software pioneer Dave Winer explains it: The first weblog was the first web site, info.cern.ch, the site built by Tim Berners-Lee at CERN. From this page TBL pointed to all the new sites as they came on-line. Luckily, the content of this site has been archived at the World Wide Web Consortium. (Thanks to Karl Dubost for the link.) Linking to sources and crediting them (as Dave does in that last line) has always been a native ethical and journalistic practice on the Web. While big-time broadcasters, publishers and VC-funded wannabes continue to see the Net as nothing more than a plumbing system for distributing “content” to “consumers”, blogging software developers have quietly added enormous value to the linking and crediting functionality of the Web. Dave and other independent developers have created standards like XML-RPC, SOAP and RSS, plus open APIs that together turn the Web into a writing and publishing medium like nothing we've ever seen before. Blogging is not about “architecting”, “building”, “designing” or “authoring” anything, because blogs aren't “sites” in the usual sense. Blogs are journals. With blogs you write directly on the Web. Most posts are short, though they don't have to be. All are topical and current, or they disappear from the aggregation sites and services and eventually from the “blogrolls” of listed favorite links on other blogs. Each blog is like a fireplace, and each post is like a log heaved on top to keep the fire burning. Every post has its own “permalink”, so others can point directly to it. As long as a blog puts out heat and light, others who care about the author's subject are drawn to it. So are Google and other search engines, which sift constantly through the ashes. At their best, blogs are link magnets as well as sources of links, which is why Google likes them so much. Google equates inbound links with authority and ranks the results accordingly. More links from more highly linked-to pages result in higher page ranks. That's why so many blogs rise to the top of so many subject searches. The whole system—which includes blogs, aggregators, web services and Google itself—feeds, builds and grows on itself. It also attracts and feeds on the RSS streams offered up by discussion and news sites ranging from Slashdot and Linux Journal to the New York Times. RSS is one among a growing number of free and open technologies created and/or improved by weblog developers. As weblogs account for more and more of the traffic in knowledge about a given subject, they become powerful instruments for hacking common wisdom. In many categories, they are moving ahead of mainstream journals and portals and building useful community services where over-funded dot-com efforts failed spectacularly. One example from that last category is John Hiler's Cityblogs, which appeared in December 2002. Hiler explains: Local sites are caught between a rock and a hard place: either they hire expensive full-time writers to create content they can't afford or they fire their writers and turn to automated content: weather reports, local news and movie listings. It's a Gordian knot—hire expensive writers or you have no content—that blogs are uniquely positioned to cut in two. Now that I've set up the site, I can cover these three categories in an hour or two a day. As Glenn “Instapundit” Reynolds put it at a recent conference on weblogs, “blogging is cheap”. So blogging is becoming an option in all kinds of places, which means there's a good chance that you, as a Linux Journal reader, fall into one or both of two groups: Users who want to set up a blog and start writing on the Web. System administrators and others with scripting and programming skills, who are either looking to set up a blogging system or to manage or change a system that's already in place. To get a handle on both, let's go back to Google. For better or worse, Google is a commercial company whose services have become de facto web infrastructure. This is especially true for blogs, which make liberal use not only of Google's search engine but also of its APIs, which allow automated queries from programs. Google's APIs are part of a growing raft of sites and services, mostly hacked together by enterprising independent developers. Technorati (see Sidebar), for example, pays attention to fresh links between blogs (leapfrogging referrer logs) and organizes the information into “watchlists” and other useful listings. If you want Technorati to tell you who's currently linking to your blog, you can ask for this information on the site or pay $5 per year for a watchlist sent out each day by e-mail. The Technorati Story: How a New Web-Services Product Review Grew Out of a Research Assignment Technorati is the creation of this article's coauthor, David Sifry, who is a cofounder of Linuxcare and Sputnik. It's a good example of a LAMP program—one based on the de facto platform of Linux, Apache, MySQL and Python, PHP or Perl. Another LAMP creation is Phillip Pearson's Blogging Ecosystem, which keeps two Top 300 lists: one for the most-linked-to blogs and one for the blogs that do the most linking. Both Technorati and the Blogging Ecosystem are made possible in large part by RSS, the XML dialect whose acronym means really simple syndication. Thanks to RSS, every story you read on the Linux Journal web site is syndicated automatically to anyone who wants to read and point to it or aggregate it with other sources. The Blogger API is another enabling infrastructure hack. It's used not only by Blogger (the most popular weblog system, in terms of sign-ups) but by Radio Userland and Movable Type, the other two leading weblog systems. This API is what made it possible for one of your authors to hack methods for posting to various breeds of blogs through e-mail and Jabber. There are many other hacks just as there are many other blogging systems. SourceForge alone lists dozens of weblog systems in various states of completion. In the LAMP vein, Geeklog and CafeLog are PHP-based and use MySQL, as does Drupal. In fact, PHP-Nuke, PostNuke, Drupal and Slashcode all are flexible enough to serve as weblog systems. So is Rusty Foster's Scoop, which is written in Perl, as is Movable Type. Roller is written in Java for J2EE environments; in fact, there is a whole community of Java bloggers. The list goes on, and it's a long one. So let's break the list down a bit into four family trees. Built-for-Blogging Systems Packages designed from the ground up specifically for blogging include Radio Userland, Blogger, Movable Type, Greymatter, Roller and CafeLog. Most include advanced features like the Blogger API, MetaWeblog API, RSS feeds and subscriptions and XML-RPC pings to aggregator sites such as www.weblogs.com. Without RSS feeds and XML-RPC pings, blogs don't get included in blog-based web services like DayPop, Blogdex and Technorati. You hear a lot about the theory of web services, but in the blog world they're easy to put into practice. Also falling into this category is LiveJournal, an open-source project with a large following that puts a high emphasis on community ties and participation. It's designed as a centralized system open to many clients on different platforms, all of which are also open source. While LiveJournal does RSS feeds, it doesn't make XML-RPC pings to aggregator sites. It also lacks some of the formatting characteristics one associates with blogs, such as blogrolls in the margins, all of which makes it less blog-like than the others in this family. Discussion Sites After the wild success of discussion sites like Slashdot and Kuro5hin, a number of software packages emerged with Slashdot-like functionality. Slash is Slashdot's own code base, Scoop is Kuro5hin's, and mod_virgule is the trust system on which Advogato is based. These first-generation packages allow you to set up story posting, site membership, comment moderation, topics or categories (with icons), polls, post archives and so on. These cover the main requirements of blogging tools, although many lack more-advanced functions, such as RSS feeds and XML-RPC pings to aggregators. Given the essentially personal nature of blogging, even on blogs with more than one author, features like karma and moderation are essentially unimportant. The growing popularity of PHP invited the second generation of discussion-oriented sites. PHP-Nuke launched the generation; but when it went unmaintained, a number of programmers forked the code base and created PostNuke, Geeklog and PostTEP, among others. This generation also allows easy theming and better plugin management, so you can easily write code that might go, say, in a sidebox on the site to perform a specific task. PHP-Nuke is maintained again, by the way. This family also includes hybrids like PHP-Slash, which is Jay Bloodworth's port of Slash code from Perl and mod_perl to PHP. Some blogging tools come out of the traditional web site content management space, including support for multiple authors and permissions and work-flow enforcement. This is the Vignette StoryServer tradition, which includes Zope, which is more than just a CMS, Nucleus and Drupal. Content management sites provide for a more formalized model-view-controller approach, with clear separations between content, markup and work flow. These tools often are ideal for creating dynamic web sites with a lot of authors and editors, but they tend to lack some of the advanced features found in blogging tools, such as RSS feeds and XML-RPC pings. They also lack Blogger and MetaWeblog APIs for posting and editing content from other non-web browser-based applications. Wikis are another way to create dynamic web sites. They allow anyone to edit and mark up a page easily, while still maintaining version control. Some blogging tools are based on Wiki code or on Wiki ideas. These include SnipSnap, TWiki, Tiki, WikiWiki, MoinMoin and ZWiki. They offer some content management but focus mostly on ease of editing and posting and speed of updates, neglecting such blogging functions as dated entries and RSS feeds. Other families worth noting are the Java-based blogging tools, such as Roller and WebForum; and Python- and Ruby-based tools, such as Pyblosxom and tDiary, which is hot in Japan. We list all these families because your particular needs may not be restricted to blogging. But if blogs are what you want to do, or what you want to support, you need to pay close attention to what works best for blogging purposes. Simply put, your blogging system doesn't qualify for the label if it can't answer yes to the following questions: Can a user dynamically post to a site? Are posts easy to create, review and edit again after they're posted? Can an administrator limit who posts to the front page? Can a user edit in a browser (at a minimum) or another tool of his or her choice? Does its page format allow blogrolls and other sections outside the daily posting area? Does it produce RSS feeds? Does every post have a permanent URL (or permalink)? Do current posts have unique URLs? Can search engines crawl the archives? Are the archives stable and safe from rot? The big three—Blogger, Movable Type and Radio Userland—qualify on all those grounds, because they were built from the ground up as pure blogging systems. This is also why most of the blogs listed in the Blogging Ecosystem's Top 300 lists are produced by big three tools. We've been experimenting at Linux Journal with various weblog systems, hosted on a server kindly provided by Penguin Computing. Most of our efforts have been focused on Movable Type, which is the only one of the big three that hosts on Linux and the one that appears to have the most momentum in the Linux development community. The source code is available to end users but not under an open-source license. Movable Type offers two licenses of its own: a free (as in beer) one for noncommercial use and a $150 US one for commercial use. While this disqualifies Movable Type as an option for writers and publishers, including Linux Journal, who prefer to use free software, many blogging organizations that support the Open Source and Free Software movements, such as the Electronic Frontier Foundation and Creative Commons, are using Movable Type. So what are your choices here? If you want to put up a bare-bones blog and don't mind if it doesn't say yes to all the questions listed above, LiveJournal is a handy and popular choice. You'll be left outside the Blogging Ecosystem (as roughly defined by Phil Pearson's aggregation site by that name), but you'll be using mostly GPLed open-source software and be involved with a lively community. If you want your blog to thrive in the Ecosystem and don't care too much about what's happening on the back end (just as you might not care what's behind a Hotmail-type web e-mail system), you might consider Blogger or Radio Userland. Both allow you to blog from any server to which you can FTP data and serve HTTP. For example, to do a Blogger blog, go to www.blogger.com, set up an account, make it point to your FTP server with your user name, password and web server HTML directory. In Debian the default is /var/www. On Red Hat, it's /home/httpd/html. This is a simple, easy-to-set-up blog system and a popular choice—even for a hacker who doesn't want to be bothered setting up everything from scratch. If you want a full-featured Linux-based blogging system for yourself or your organization, and you don't have a problem with its licensing scheme, Movable Type is your best choice. Installing it is almost easy enough for novices. It's also extremely flexible, capable and easy to maintain. If platform and licensing issues keep you away from the big three, you need to look among the discussion site and content management systems. If you're already using a PHP-based system such as PHP-Nuke, you might consider adapting your current system or going to another one in the same general family, such as Geeklog or Drupal. None are as easy to install as Movable Type, but none are hard to maintain once you master their methods. Command-line tools for blog editing and posting exist on Linux as well. One example is Philip Myelin's Bzero. Philip also is the author of the Python Community Server and phpStorageSystem, both of which are clones of the Userland Radio Community Server. Running one of these applications on your web server allows you to host Radio-based blogs on your Linux box. If none of the alternatives suits your fancy, you might consider creating or improving an open-source built-for-blogging system. Greymatter, which is written in Perl and GPLed, had some good momentum going until 2001, when Noah Grey decided he had better things to do. You could pick up where he left off, or you could build a new blog system from scratch. Countless options are available. URLDIR can generate a variety of feature comparison tables that cover all the systems listed here and then some. If you're at the tire-kicking stage, it's a good place to start. But don't make a decision before looking at the blogs produced by these different systems. Follow David Ogilvy's classic advice to companies looking for an advertising agency: “Look for work you envy, and find out who does it.” Blosxom: Think of It as cat(1) with Stylesheets Doc Searls is senior editor of Linux Journal. David Sifry is cofounder of Linuxcare and Sputnik, where he is also CTO.
cc/2019-30/en_middle_0028.json.gz/line13358
__label__wiki
0.632729
0.632729
Kate Middleton Wore A Baby Blue Dress For A Wimbledon Date With Prince William Sheer, Plunging, Short…. Let’s talk About The Rise Of The 'Naked Wedding Dress' What the rise of the barely-there wedding dress means for feminism - by Clare Press And the bride wore… a see-through body stocking with strategically placed crystals. That’s not as unlikely as it sounds, given the current celebsession with so-called naked dressing. Barely (ho ho) a week passes without a Kardashian, a Hadid or a Logie-winner flashing skin at some traditionally dressed-up occasion. This very weekend, Australian model Nicole Trunfio took the trend to the races, wearing slip-less Toni Maticevski to Derby Day. Please take a moment to remember the scandal when British model Jean Shrimpton arrived at the 1965 Melbourne Cup with exposed knees? All power to Trunfio, I say. If I had a body like hers, I’d have no qualms. Nicole Trunfio attends Derby Day. Photo: Getty It all started with Rihanna at the 2014 CFDA Awards with her boobs and bum exposed by what amounted to a pair of pink sparkly tights in tank dress form. (Actually, it all started with Marilyn Monroe in Some Like It Hot, but since the film pre-dates the modern feminist conversation, let’s pretend we don’t know that). So. Ri-Ri. What was she saying with that outfit? Was it a PR stunt? Was it tacky? Or was it, as the Independent suggested, “a fearless, powerful and fantastically seductive feminist statement” from a strong, ballsy female boss who has every right to be proud of her body? Is (near) nudity always a political statement or only when the scantily clad one claims it as such? Beyonce didn’t need words to justify the sheer gold sheath she wore to the 2015 Met Gala. Ditto J-Lo almost naked in Versace. But at this year’s event, after Madonna wore a revealing Givenchy dress, she voiced her motives on Instagram: “My dress was a political statement as well as a fashion statement. The fact that people actually believe a woman is not allowed to express her sexuality and be adventurous past a certain age is proof that we still live in an ageist and sexist society.” But would you choose a similar look for your wedding day? On the downside, it might make your dad feel awkward if he’s escorting you down the aisle. And it’s not exactly church friendly. Australian TV presenter Ksenija Lukich pulled it off recently with an elegantly revealing option by Steven Khalil, who counsels: “The secret to keeping sheer chic is to use it as highlight rather than a completely sheer gown. It’s very beautiful when used in subtler elements.” ksenijalukich View Profile likes - View Post on Instagram They say the first week of marriage is the most difficult  Sheer may not be the traditional choice. But what does that even mean in 2016? It was Queen Victoria who popularised the chaste white wedding gown. Since she and Albert wed in 1840, the demure white gown has come to symbolise the virgin bride, but, today? Seriously? Come on. The average Australian woman loses her virginity at 17. The median age of Aussie brides is 29. Of the couples who married in Australia in 2014, 79 per cent cohabitated before they said “I do”. I for one would am not happy for my fashion choices to be taken as some antiquated signifier of my sexual activity status. That’s my business, thank you. It’s my 10th year wedding anniversary on Friday. I got married in a field wearing a crown of glass flowers and a high-necked, long-sleeved opaque white vintage frock. Was my aim to send a coded message to my friends and family that I was a pure unsullied virgin about to offer myself before god to my betrothed? Um, no. I was 30-years-old, and living with my finance. We were married in a secular ceremony and I walked down the aisle to Jane Birkin and Serge Gainsbourg’s Je t’aime. I chose my dress because I loved it – and I’m a high-necked, long-sleeved sort of a person in general life. I didn’t want to dress up like someone I wasn’t – not Beyonce in not much, or a Disney princess in a meringue. isabelifontana View Profile ☀️ But had I been, say, Brazilian Victoria’s Secret model Isabeli Fontana, would I have said “I do” in a transparent mesh swim coverup if I’d felt like it? Damn straight I would. Because I am a modern woman, and we wear what we want.
cc/2019-30/en_middle_0028.json.gz/line13363
__label__wiki
0.804416
0.804416
Del Taco now has a vegetarian burrito — what consumers need to know about meatless fast food’s cost and calorie count By Jeanette Settembre Published: Jun 29, 2019 10:18 am ET Meatless menu items are also available at Burger King, McDonald’s, White Castle and Little Caesars Tex-Mex chain Del Taco is rolling out meatless burritos after selling two million Beyond Tacos. Meatless fast food may not necessarily be healthier, but it sells. California-based Tex-Mex chain Del Taco sold two million of its meatless tacos made with a plant-based substitute from Beyond Meat BYND-1.71% two months after the launch. It was so well-received, the chain has decided to roll out meatless burritos. The West Coast eatery is the latest fast food restaurant to jump on the alternative meat bandwagon, joining the likes of Burger King, Little Caesars and White Castle as consumers continue to crave alternative protein. Del Taco’s new Beyond Meat menu items will include the Beyond 8 Layer Burrito ($4.49) and the Epic Beyond Cali Burrito ($6.49). Both will include Beyond Meat crumbles, tomatoes, guacamole, sour cream, and the Beyond 8 Layer will also come with beans, red sauce, lettuce and sour cream. The Epic Beyond Cali Burrito will be loaded with Del Tacos fries and pico de gallo salsa. The chain will also dish out free Beyond burritos with any purchase starting Thursday. Beef-stuffed burritos cost around $4.49. Del Taco currently sells the Beyond Taco for $2.49, $1 more than its beefy counterpart. But nutritionists say it has a very similar nutritional value compared to a regular taco. Both are 300 calories and contain nearly the same amount of fat and saturated fat. The Beyond Taco, however, contains 100 more milligrams of salt. The alternative meat market is booming, with plant-based fake meats that look, taste and bleed just like the real thing taking over grocery stores and fast food restaurants. Part of the appeal for diners is that eating less red meat can cut the risk of heart disease and other health risks. But nutritionists and registered dietitians say ordering a meatless burger at a chain — especially one where you can get fries with it — might not be that much better for you. “Are they healthier as far as sodium, calories and fat content? Definitely not,” Sharon Zarabi, a registered dietitian and bariatric program director at Lenox Hill Hospital, told MarketWatch. MarketWatch compared the nutritional value of meatless menu items to their meaty counterparts at Burger King QSR+1% McDonald’s MCD0% White Castle and Del Taco TACO-1.9% The nutritional profiles are strikingly similar, and though fast food is seen as a cheap option for eaters on the go, the meatless versions of the fast food menu items were more expensive in all cases. At Burger King, the meatless Impossible Whopper, available at select locations, is 630 calories, compared to the regular Whopper which is 660. (The Impossible burger is made with soy protein, potato protein, coconut oil, sunflower oil and heme, a molecule that makes it look and bleed like real meat). Both have around the same amount of fat (34 grams of fat, and 11 grams of saturated fat for the Impossible Whopper; and 40 grams of fat, and 12 grams of saturated fat for the Whopper). The meatless version has a whopping 1,240 milligrams of sodium verses 980 for the meaty one. “It’s almost the same amount of calories as the regular burger. The fat is slightly lower, but the saturated fat is still pretty high,” notes Zarabi of the saturated fat, which is almost the same exact amount in each. Consumers can expect to pay at least $1 more for the Impossible Whopper ($5.19), with prices varying by location. In the Bay Area, the meatless Whopper is selling for $6.19 before tax, compared to $4.19 for the original version, according to FastFoodMenuPrices.com. (Burger King did not respond to a request for comment.) ‘Our goal is to make food that is at least as nutritious as the animal-derived versions.’ — Rachel Konrad, spokeswoman for Impossible Foods Impossible Foods doesn’t seem to be trying to make a product that’s necessarily healthier. In fact, a spokeswoman said the company’s focus is on matching the nutritional value of meat. “Our goal is to make food that is at least as nutritious as the animal-derived versions,” Rachel Konrad, a spokeswoman for Impossible Foods, told MarketWatch in an email. Zarabi urges consumers to look at the weight in grams for each menu option. At White Castle, the Impossible Slider is 90 grams in weight, compared to the Original Slider, which is 55 grams. If you don’t look at the nutrition facts, it could easily seem like the Impossible Slider is worse for you, but they’re actually almost on par with each other. The Impossible Slider is 210 calories with 11 grams of fat, and 4 grams of saturated fat, compared to the Original Slider’s 140 calories with 7 grams of fat and 2.5 grams of saturated fat. The Impossible Slider costs $1.27 more. White Castle did not respond to a request for comment. “It’s a larger size, that’s why the calories are going to be more, that’s why the sodium is going to be more. It means that they’re almost similar in profile,” Zarabi explained. Is America ready for the McDonald’s McVegan? Other fast food eateries have experimented with plant-based proteins on a limited basis. McDonald’s launched a McVegan sandwich, a vegetable-based vegan burger made with soybeans, in 2017, but only in Finland and Sweden. This spring, it added a burger called the Big Vegan TS — made with a patty by Nestle NSRGY+1.32% — to menus in Germany. Nestle has said it wants to start selling a meatless burger at U.S. retailers this fall and it’s looking to expand its restaurant partnerships beyond McDonald’s, Reuters reported. A rep for McDonald’s did not immediately return a request for comment. Chick-fil-A has been studying vegan meat substitutes, according to Business Insider, and a spokeswoman for the Georgia-based chicken sandwich chain hinted to MarketWatch that the company could be coming out with a meatless variety in the future, but would not give any further details. “The culinary team at Chick-fil-A is always exploring new trends and possible menu offerings for our customers, and we are still in the early phases of the development process. We currently offer several vegan options for our guests,” Leigh Jackson, a spokeswoman for Chick-fil-A told MarketWatch in an email. (The chain’s hash browns and waffle fries are vegan, among other items.) Wendy’s WEN-0.52% tested a black bean vegetarian burger (which customers could turn into a vegan burger by ordering it without cheese) in 2016, but discontinued the item. Wendy’s did not respond to a request for comment. See also: Beyond Meat has hit the ‘short-squeeze trifecta’ as borrow fees keep soaring Beware of the ‘health halo’ Dr. Lisa Young, a registered dietitian and author of “Finally Full, Finally Slim,” says meat alternatives become even more unhealthy when you factor in the bread, condiments and French fries that typically round out a fast food meal. “They often come with white bread, cheese and who knows the oil that they’re grilling in it,” Young said. Another concern: the so-called “health halo” effect. Research has shown that when people eat food they perceive to be healthy, they tend to over-indulge later. Many people perceive meatless foods as being better for them, so they could be inclined to consume more calories later in the day after they eat a meatless meal. “People get tricked by the ‘health halo’ effect,” Young said. “If they contain similar calories, a similar amount of saturated fat and sodium, not only are you not better off, but you might actually be worse off. If you have one of these meatless burgers, you might think, ‘I can have pizza for dinner.’” Fast-food restaurants seem to be in a frantic game of catch-up adding meat substitutes to their menues. The market for plant-based of lab-made meat substitutes could swell to $140 billion in the next 10 years, Barclays said recently. The May IPO for Beyond Meat BYND-1.71% –– the maker of the Beyond Burger and the meat inside Del Taco’s Beyond Taco –– made history, with shares surging from $46 to $65.75 for a 163% gain. Shares of Burger King parent company Restaurant Brands have been up 33% year-to-date. That’s compared to an 11% gain for the Dow Jones Industrial Average DJIA-0.42% and a 15% increase S&P 500 Index SPX-0.65% This story was updated on June 20, 2019. See original version of this story Copyright ©2019 MarketWatch, Inc.
cc/2019-30/en_middle_0028.json.gz/line13364
__label__wiki
0.693808
0.693808
Pacific Union rebrands three Los Angeles home sales brokerages under its banner This home on Latigo Bay View Drive in Malibu is listed for $5.75 million with Pacific Union International. (Pacific Union International) By Roger VincentStaff Writer Pacific Union International, the eighth-largest real estate brokerage in the country, is expanding into the Los Angeles market. As part of the change, the brokerage’s name will immediately replace those of John Aaroe Group, Partners Trust and Gibson International on listing signs in front of hundreds of homes for sale in the county. Pacific Union bought the three independent luxury brokerages over the last two years. The company also announced that Nick Segal, the former chief executive of Partners Trust, will become president of Pacific Union L.A., the Southern California branch of San Francisco-based Pacific Union International. He now oversees more than 900 real estate agents in 20 offices on the Westside, San Gabriel Valley and San Fernando Valley under the Pacific Union banner. Pacific Union L.A. has about 625 active listings of homes, condominiums and commercial properties for sale, Segal said, and plans to post new listings on its website before they hit the Multiple Listing Service. “These are going to be vetted properties,” he said. The supply of homes for sale in Los Angeles County is tight, he said, but “the market is steady.” The company’s economist, Selma Hepp, predicts that the local median home price of $585,000 will rise 6% in 2018, 5% in 2019 and 2% in 2020. “We’ve got more runway left in this market,” Segal said. “There is no precipitous crash [coming] that I can see.” roger.vincent@latimes.com Twitter: @rogervincent Roger Vincent Roger Vincent covers commercial real estate for the Business section of the Los Angeles Times. Myths and risks in FaceApp, which gives you a peek at your older self People raise fears on Twitter and other social media sites that on iPhones, FaceApp would be able to see and upload all your photos. That’s not actually true Disney calls Abigail Disney’s remarks about workers’ pay ‘gross and unfair’ A feud between Walt Disney Co. and the granddaughter of co-founder Roy Disney is getting more heated Nuclear industry has been pushing for less oversight, and it’s working Several rollbacks sought by the industry are already approved or pending approval by the Nuclear Regulatory Commission, largely with little input from the general public. EBay stock rises as company considers sale of StubHub EBay Inc. bowed to pressure from activist investors, saying it is reviewing the role and value of its StubHub and Classifieds businesses “to determine the best path forward to maximize shareholder value.” Netflix has its biggest subscriber stumble since the DVD-by-mail era Netflix delivered a shock by reporting a drop in U.S. subscribers and much slower growth overseas, a sign it’s losing momentum just as a competitors prepare to pounce. Stocks fall; railroads pull down industrial sector U.S. stocks extended their losses into a second day Wednesday as railroad operator CSX had its biggest drop in 11 years, pulling other industrial companies down with it. Tom Barrack’s Colony Capital explores sale of warehouse business Tom Barrack’s Colony Capital Inc. is exploring the sale of Colony Industrial, its unit that owns warehouses, according to people with knowledge of the matter. Trump expressed concerns about Pentagon cloud-computing contract President Donald Trump recently demanded more information about how the Pentagon crafted a massive cloud-computing contract it’s poised to award to Amazon.com Inc. or Microsoft Corp., in order to decide whether he should intervene. Filmmaker Walter Hill seeks a scene change on Malibu’s Broad Beach Prolific action filmmaker Walter Hill is seeking $8.995 million for his modern Malibu beach house of 14 years.
cc/2019-30/en_middle_0028.json.gz/line13370
__label__cc
0.544982
0.455018
Top Bachelor of Laws Programs in Legal Practice in Birmingham United Kingdom Most Bachelor of Laws (LLB) degree programs last three or four years. Some schools have programs designed to fit students’ interests in a specific sector of law such as European law before they start practicing in the field. Birmingham is home to six universities, largest further education college in UK, three business schools and three religious education colleges. It’s no wonder it’s the second most populous British city, other than London. Top Bachelor of Laws Program in Legal Practice in Birmingham in United Kingdom 1 Results in Legal Practice, Birmingham Filter LLB (Hons) Law The University of Law Undergraduate Programmes Campus Full-time 3 years September 2019 United Kingdom Guildford London Chester Manchester Bristol Birmingham Leeds Nottingham + 7 more Combining academic rigour with practical legal skills, in a business-like environment, our LLB provides you with the essential groundwork whether you’re committed to being a lawyer or want to explore other career options.
cc/2019-30/en_middle_0028.json.gz/line13371
__label__wiki
0.656965
0.656965
How synthetic biology could wipe out humanity -- and how we can stop it | Rob Reid The world-changing promise of synthetic biology and gene editing has a dark side. In this far-seeing talk, author and entrepreneur Rob Reid reviews the risks of a world where more and more people have access to the tools and tech needed to create a doomsday bug that could wipe out humanity -- and suggests that it's time to take this danger seriously. Get TED Talks recommended just for you! Learn more at The TED Talks channel features the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and more. You're welcome to link to or embed these videos, forward them to others and share these ideas with people you know. For more information on using TED for commercial purposes (e.g. employee learning, in a film or online course), please submit a Media Request here: Follow TED on Twitter: Like TED on Facebook: How to build your confidence -- and spark it in others | Brittany Packnett Confidence is the necessary spark before everything that follows, says educator and activist Brittany Packnett. In an inspiring talk, she shares three ways to crack the code of confidence -- and her dream for a world where revolutionary confidence helps turn our most ambitious dreams into reality. Why we get mad -- and why it's healthy | Ryan Martin Anger researcher Ryan Martin draws from a career studying what makes people mad to explain some of the cognitive processes behind anger -- and why a healthy dose of it can actually be useful. Your anger exists in you ... because it offered your ancestors, both human and nonhuman, an evolutionary advantage, he says. [It's] a powerful and healthy force in your life. "Everything happens for a reason" -- and other lies I've loved | Kate Bowler In life's toughest moments, how do you go on living? Kate Bowler has been exploring this question ever since she was diagnosed with stage IV cancer at age 35. In a profound, heartbreaking and unexpectedly funny talk, she offers some answers -- challenging the idea that everything happens for a reason and sharing hard-won wisdom about how to make sense of the world after your life is suddenly, completely changed. I believe that in the darkness, even there, there will be beauty and there will be love, she says. Sleep is your superpower | Matt Walker Sleep is your life-support system and Mother Nature's best effort yet at immortality, says sleep scientist Matt Walker. In this deep dive into the science of slumber, Walker shares the wonderfully good things that happen when you get sleep -- and the alarmingly bad things that happen when you don't, for both your brain and body. Learn more about sleep's impact on your learning, memory, immune system and even your genetic code -- as well as some helpful tips for getting some shut-eye. The lies our culture tells us about what matters --- and a better way to live | David Brooks Our society is in the midst of a social crisis, says op-ed columnist and author David Brooks: we're trapped in a valley of isolation and fragmentation. How do we find our way out? Based on his travels across the United States -- and his meetings with a range of exceptional people known as weavers -- Brooks lays out his vision for a cultural revolution that empowers us all to lead lives of greater meaning, purpose and joy. The healing power of reading | Michelle Kuo Reading and writing can be acts of courage that bring us closer to others and ourselves. Author Michelle Kuo shares how teaching reading skills to her students in the Mississippi Delta revealed the bridging power of the written word -- as well as the limitations of its power. The difference between healthy and unhealthy love | Katie Hood In a talk about understanding and practicing the art of healthy relationships, Katie Hood reveals the five signs you might be in an unhealthy relationship -- with a romantic partner, a friend, a family member -- and shares the things you can do every day to love with respect, kindness and joy. While love is an instinct and an emotion, the ability to love better is a skill we can all build and improve on over time, she says. 3 steps to turn everyday get-togethers into transformative gatherings | Priya Parker Why do some gatherings take off and others don't? Author Priya Parker shares three easy steps to turn your parties, dinners, meetings and holidays into meaningful, transformative gatherings. Inside the mind of a master procrastinator | Tim Urban Tim Urban knows that procrastination doesn't make sense, but he's never been able to shake his habit of waiting until the last minute to get things done. In this hilarious and insightful talk, Urban takes us on a journey through YouTube binges, Wikipedia rabbit holes and bouts of staring out the window -- and encourages us to think harder about what we're really procrastinating on, before we run out of time. For more from Tim Urban, visit Wait But Why: The TED Talks channel features the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and more. My son was a Columbine shooter. This is my story | Sue Klebold Sue Klebold is the mother of Dylan Klebold, one of the two shooters who committed the Columbine High School massacre, murdering 12 students and a teacher. She's spent years excavating every detail of her family life, trying to understand what she could have done to prevent her son's violence. In this difficult, jarring talk, Klebold explores the intersection between mental health and violence, advocating for parents and professionals to continue to examine the link between suicidal and homicidal thinking. Note: Comments are disabled for this video because YouTube's comment moderation tools are not up to the task of maintaining a quality discourse here. You are welcome and invited to comment on the talk at TED.com Find closed captions and translated subtitles in many languages at Follow TED news on Twitter: How to spot a liar | Pamela Meyer On any given day we're lied to from 10 to 200 times, and the clues to detect those lie can be subtle and counter-intuitive. Pamela Meyer, author of Liespotting, shows the manners and hotspots used by those trained to recognize deception -- and she argues honesty is a value worth preserving. Check out more TED Talks: Your brain hallucinates your conscious reality | Anil Seth Right now, billions of neurons in your brain are working together to generate a conscious experience -- and not just any conscious experience, your experience of the world around you and of yourself within it. How does this happen? According to neuroscientist Anil Seth, we're all hallucinating all the time; when we agree about our hallucinations, we call it reality. Join Seth for a delightfully disorienting talk that may leave you questioning the very nature of your existence. The most detailed map of galaxies, black holes and stars ever made | Juna Kollmeier Humans have been studying the stars for thousands of years, but astrophysicist Juna Kollmeier is on a special mission: creating the most detailed 3-D maps of the universe ever made. Journey across the cosmos as she shares her team's work on the Sloan Digital Sky Survey, imaging millions of stars, black holes and galaxies in unprecedented detail. If we maintain our pace, she says, we can map every large galaxy in the observable universe by 2060. We've gone from arranging clamshells to general relativity in a few thousand years, she says. If we hang on 40 more, we can map all the galaxies. The power of introverts | Susan Cain In a culture where being social and outgoing are prized above all else, it can be difficult, even shameful, to be an introvert. But, as Susan Cain argues in this passionate talk, introverts bring extraordinary talents and abilities to the world, and should be encouraged and celebrated. 10 things you didn't know about orgasm | Mary Roach Bonk author Mary Roach delves into obscure scientific research, some of it centuries old, to make 10 surprising claims about sexual climax, ranging from the bizarre to the hilarious. (This talk is aimed at adults. Viewer discretion advised.) ADHD As A Difference In Cognition, Not A Disorder: Stephen Tonti at TEDxCMU Stephen is a Senior Directing major at Carnegie Mellon. He is also the current President of Carnegie Mellon's Film Club. He recently completed his Thesis Project within the School of Drama: a production of Mac Wellman's A Murder of Crows. He is currently working on creating a collective of Film Enthusiasts across Carnegie's Campus as well as other colleges and universities around Pittsburgh. You can find out more about Stephen and his talk on his website: or follow his blog Caffeine, Nicotine, and ADHD: a guide to maintaining sanity. In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations) 5 challenges we could solve by designing new proteins | David Baker Proteins are remarkable molecular machines: they digest your food, fire your neurons, power your immune system and so much more. What if we could design new ones, with functions never before seen in nature? In this remarkable glimpse of the future, David Baker shares how his team at the Institute for Protein Design is creating entirely new proteins from scratch -- and shows how they could help us tackle five massive challenges facing humanity. (This ambitious plan is a part of the Audacious Project, TED's initiative to inspire and fund global change.) The greatest TED Talk ever sold - Morgan Spurlock Sign up for our newsletter and never miss an episode: With humor and persistence, filmmaker Morgan Spurlock dives into the hidden but influential world of brand marketing on his quest to make a completely sponsored film about sponsorship. (And yes, onstage naming rights for this talk were sponsored too. By whom and for how much? He'll tell you.) Talk by Morgan Spurlock. The power of vulnerability | Brené Brown Brené Brown studies human connection -- our ability to empathize, belong, love. In a poignant, funny talk at TEDxHouston, she shares a deep insight from her research, one that sent her on a personal quest to know herself as well as to understand humanity. A talk to share. Process Engineer - A day in the life 4K Ultra HD Video of Wild Animals - 1 HR 4K Wildlife Scenery with Floating Music Sounds of the Pacific Ocean | 4K Beach Relax Video with Nature Sounds - 8 Hours Video The Tallest Trees on Earth - 4K Nature Documentary Film | Redwood National and State Parks Os Planetas De Star Wars Podem Existir? - Space Today TV Ep.538 Running Rhino Surprise Passing Through The Sleeping Lions Along The Way APN PARA MOVISTAR SIN REDES PERU 2019 | JEYLINI The First Domino Fell... & We're Ready! Gojoy AMA Livestream | Wir schreiben die DevAthlon-Seite | YellowPhoenix18 DDX for Devs 3 - Libraries How to fit your Pioneer™ 2-Point Harness Call for Tenders | Odoo Purchase My Passport Go!
cc/2019-30/en_middle_0028.json.gz/line13377
__label__cc
0.602626
0.397374
Your Trigger Moment – The Mike Koenigs Show 004 with Pat Flynn, Alex Mandossian Our first guest is Pat Flynn, CEO of Smart Passive Income, an entrepreneur who’s been running a podcast for 6 years, earning over six figures a month, who just came out with a new book that sold 14,000 copies in a WEEK. When you subscribe to the podcast, you'll get the extended interview explaining how Pat did it! To grab your copy of Pat's new book “Will it Fly?” visit http://www.MrBz.com/Fly Our next guest is Alex Mandossian – a guy I met 14 years ago at my first marketing conference who is one of the smartest marketers in the business. You can get his new book, “Alexisms” free at http://www.MrBz.com/Alex We also have Mike’s Gadget Giveaway, Health Amplifiers with JJ Virgin, Productivity Amplifiers, Blind Dumb and Deaf Taste Tests and MUCH MORE! This EPISODE is about YOUR TRIGGER MOMENT. That’s a defining moment when you were about to give up but something happened that turned everything around for you. If you have had that moment, the question you ask is how do you create that again? On this #LIVE streaming webcast, well show you the latest tech trends and new opportunities as well as some tools that will change the way you automate your business. Are you a curious, motivated, ADHD entrepreneur who wants an extra edge? Do you want to get smarter, richer and more famous? Are you constantly reinventing yourself – seeking new ways to amplify your productivity, body, health, investing, business and marketing skills? Every week, Mike Koenigs, 10-time #1 bestselling author, serial entrepreneur, cancer survivor, angel investor and philanthropist, interviews disruptive, innovative entrepreneurs, celebrities, thought-leaders and authors who share their secrets to getting smarter, richer and famous – so you can too. Mike’s co-host, Ed Rush, former F-18 Marine Fighter Pilot, business coach and 3x #1 bestselling author rounds out the show with his humor and business advice. Unexpected NERDGASMS! Mike tests and gives away the latest gadgets, apps and tools you can use to make more money, become competition and recession-proof. Mike has bootstrapped and sold his companies twice to publicly-traded companies, earned over $44mm online, served over 45,000 customers in 61 countries, produced an award-winning feature film, documentary and produced 12 consecutive multi-million dollar launches. He can help you start, launch, grow and exit from a business and have fun! Past studio guests include Academy Award-Winning Actor Richard Dreyfuss, The Wolf of Wall Street, Jordan Belfort, Celebrity Nutrition Expert and NY Times #1 Bestselling Author JJ Virgin, Dave Asprey, Chairman of Bulletproof Coffee, John Assaraf from the movie The Secret, Chalene Johnson, Host of EOFire/Entrepreneur On Fire John Lee Dumas, Success Magazine publisher Darren Hardy, Tim Ferriss and more! For questions or comments call +1 (858) 412-7692. Do You Want to Connect with a High-Value Audience? Are You a Potential Advertiser or Sponsor? Do You Have an Audience and Want to Expand Your Reach as a Guest on the Show? The Mike Koenigs Show is produced LIVE from MiXiV Studio Network every Thursday night at 6:00 pm PST and released every Friday at 6:00 pm PST on Apple’s iTunes podcast channel. Subscribe to the Mike Koenigs Show LIVE! Register for the Show: http://www.MrBz.com/show Or use your mobile phone and text “MKShow” to 58885 (US and Canada Only) OR if you want to get the show delivered right to your phone, tablet, desktop or laptop computer, subscribe to the VIDEO podcast or to the AUDIO Podcast Follow Us on Social: http://www.MrBz.com/social
cc/2019-30/en_middle_0028.json.gz/line13380
__label__wiki
0.846169
0.846169
Atlantic joy sours from community gaffe Atlantic Gold’s deal with Australian gold producer St Barbara could be under threat before the ink is dry following a disastrous public meeting to talk about tailings. Atlantic Gold's Moose River operation in Nova Scotia, Canada The May 23 meeting was convened by Atlantic to share with local communities its plans for tailings storage at its proposed Cochrane Hill mine in Nova Scotia, Canada, and to provide an opportunity for locals to ask questions of a panel of experts. With so many people wanting to participate the company agreed to hold an evening meeting in addition to the original matinee. However, a routine public outreach activity descended into notoriety after heavy-handed security and a Royal Canadian Mounted Police officer wrestled local John Perkins to the ground during the second event after forcibly rejecting him on the grounds that he participated in the first session. Witnesses claim he and a handful of others that participated in the first meeting—including Halifax Examiner journalist Joan Baxter who documented it all—received permission to attend the second meeting if there was space, which there was. As a result, the St Mary's River Association (SMRA) says Atlantic has lost its social licence to operate and called on environment minister Gordon Wilson to delay approval of the transfer of all mining rights from Atlantic to St Barbara. "What transpired [at the public presentation] was nothing short of a total insult to the community. The video and the stories of the event have been seen around the world, leaving people frustrated with and even less confident in Atlantic Gold and St Barbara," it said in a statement. SMRA opposes the project and aims to engage community members to make informed choices, foster productive relationships between St Mary's District Council, the local community, First Nations, Atlantic Mining and federal regulators, to empower community members to actively engage with the company and to engage the community about the benefit of protecting the environment. St Barbara made a C$2.90 per share, $722 million offer for Atlantic a week before the meeting. Atlantic operates the 100,000 ounce per year Moose River openpit mine in Nova Scotia that is one of the lowest cost operations in the world with all-in-sustaining-costs of less than US$555/oz. It has planned expansions involving three other pits in the area targeted to take output well past 200,000oz/y. Moose river Cochrane hill Atlantic gold St barbara Atlantic still ticking all St Barbara's boxes Community incident won't threaten deal, Vassie says Belanger: Three questions to ask about TSFs St Barbara makes its trans-Atlantic move Atlantic Gold lifts MRC reserves, mine life Atlantic Gold increases Moose River gold resources
cc/2019-30/en_middle_0028.json.gz/line13382
__label__wiki
0.944378
0.944378
By MintPress News Desk Democratic National Committee Chair Donna Brazile speaks during the second day of the Democratic National Convention in Philadelphia , Tuesday, July 26, 2016. MINNEAPOLIS — In an interview on Sunday, the interim chair of the Democratic National Committee criticized Julian Assange, the WikiLeaks founder who she called a “criminal,” and the media for what she perceived to be positive treatment of the government transparency website’s work. Donna Brazile took over as interim DNC chair in July after Debbie Wasserman Schultz resigned in the wake of WikiLeaks’ “DNC Leak,” an archive of almost 20,000 emails and over 8,000 files that also forced out other key party leaders. Appearing on ABC News’ “This Week”, Brazile praised Americans for supporting the victims of the Louisiana flood then criticized Republican presidential candidate Donald Trump for his failure to distance himself from the racist statements and attitudes of some of his supporters, including the so-called “alt-right” movement. “Hillary Clinton is talking to all Americans,” Brazile said, contrasting the Democratic nominee with the GOP’s choice for president. “She’s talking about jobs, she’s talking about how to make this country stronger in terms of our national security. She’s talking about opportunity for our young people.” But the discussion grew tense when anchor Martha Raddatz asked Brazile about an Aug. 27 ABC News investigation into emails recently released from Clinton’s private server by the conservative NGO Citizens United. The emails appear to show Huma Abedin, Clinton’s top aide, who was a Clinton Foundation official at the time, requesting special favors for donors at a State Department luncheon. Brazile dismissed the importance of the report before steering the discussion back to the DNC email leak: “This notion that, somehow or another, someone who is a supporter … saying I want access, I want to come into a room and I want to meet people, we often criminalize behavior that is normal.” In the past, Brazile had expressed contrition over the content of the emails revealed in the leak. In a July 25 statement, she wrote that they “do not reflect the values of the DNC or our steadfast commitment to neutrality during the nominating process.” But in her interview on Sunday, Brazile took a much harsher tone toward the leaks and their anonymous leaker, repeating claims that Russia released the documents in order to undermine the upcoming election. “We know from the company we hired … that there was Russian involvement in this to destabilize not just our institution, the Democratic Party, but our democracy itself,” she said. But as MintPress News’ founder Mnar Muhawesh noted in a July 25 analysis, these claims are based on circumstantial evidence provided by security experts with dubious ties to the national security state. Assange has also denied links between the leak and Russia, and NSA whistleblower Edward Snowden suggested earlier this month that the accusations may even have inspired the release of another leak containing NSA surveillance tools. Brazile told Raddatz that “the DNC and other institutions are victims of a cybercrime led by thugs,” adding that steps had been taken internally to prevent future leaks. “[W]e have taken appropriate steps to ensure that we have the safest possible system,” she said. “We’re working with federal officials.” She then lashed out at Assange and the media for taking WikiLeaks’ work seriously, suggesting instead that it should be considered a criminal enterprise. Brazile said: “[T]he notion that we’re going let some person, you know, put out personal sensitive information across the world, jeopardizing people’s privacy, and we’re interviewing him as if he’s going to have a smoking gun for October. The smoking gun is that we’re interviewing somebody who is involved in a cybercrime and not calling him a criminal.” But Brazile herself, and her neutrality, have been called into question by emails contained in leaked DNC emails which reveal her harsh criticism of the Bernie Sanders campaign, as WikiLeaks itself pointed out via Twitter on July 24. New interim US #DNC Chair Donna Brazile also implicated #DNCLeak https://t.co/WGXESuD6N5 #FeelTheBern #DNCinPHL pic.twitter.com/qFTvvdXgb2 — WikiLeaks (@wikileaks) July 24, 2016 In one email, which WikiLeaks links to in its tweet, Brazile forwarded a press request from Washington Post reporter Abby Phillip for a comment about a conflict between the Sanders campaign and the DNC. “I have no intentions of touching this,” Brazile wrote. “Why? Because I will cuss out the Sanders camp!” Watch the full interview with Donna Brazile from ABC News’ “This Week” (Full transcript): https://youtu.be/RrtE2ok6OpI DNC Leaks Donna Brazile
cc/2019-30/en_middle_0028.json.gz/line13383
__label__wiki
0.990037
0.990037
EXCLUSIVE: IT COULD BE URANUS RICHARD Branson is planning a third bid to run the lottery - with a trip in space as a dream prize. Stephen Moyes The billionaire Virgin chief hopes to win the next lotto licence in 2009 after failing in 1994 and 2002. He has already announced plans for a Virgin Galactic service in which passengers would pay #115,000 to fly 70 miles above Earth, experiencing weightlessness for six minutes. Now he hopes to include Galactic as one of his lottery prizes. Speaking exclusively to the Mirror, Sir Richard said: "If we win the licence, flights to space will be thrown in. We&apos;re two and a half years away from getting a licence for Virgin Galactic. But 40,000 people have already asked to fly. My dream is a Virgin hotel in space!" The tycoon was beaten by Camelot when the first lottery licence was granted in 1994. He spent #20million trying to win the second licence in 2002. But Camelot won the day again. He now believes that a new licensing system will help him triumph when the lottery next comes up for auction in 2009. The tender process is so complicated it begins next year. He said: "I don&apos;t give up on anything, so the chances are more likely than not that I&apos;ll have another go." Sir Richard revealed his plans as he flew to New York to celebrate the 21st anniversary of his airline at a fashionable New York club where old friend Pamela Anderson, 37, was among the guests. Attacking Camelot for what he said was a #6billion shortfall in donations to good causes, he said: "When Camelot bid to run the lottery they said #15billion would be handed over. "Then, after getting the licence, they said it would be #9billion. Now, they judge themselves against #9billion, not the #15billion they promised. That&apos;s not a good job." Sir Richard, 55 next month, also revealed that he is ploughing $1million of his money into a ground-breaking project to fight malaria in Africa. Speaking the weekend before Live 8 concerts highlight Third World poverty, he said: "I believe malaria can be stamped out in Africa. "We want to see every mother and child provided with their own mosquito net which would both provide protection and kill any mosquito which landed on it. "We also want to provide special paint to keep mosquitoes away. I&apos;m encouraging others to donate $1million and lobbying govern ment to back the project." Telling of his pride at his airline&apos;s anniversary, he said: "She&apos;s a beautiful lady. I&apos;ll be involved until I drop."
cc/2019-30/en_middle_0028.json.gz/line13384
__label__wiki
0.808613
0.808613
San Jose taxi drivers end strike, look forward… San Jose taxi drivers end strike, look forward to deregulation Passengers stranded by a taxi strike in San Jose, Calif., wait for shuttles at Mineta San Jose International Airport Monday morning, Nov. 9, 2015. Cab drivers struck in a protest over proposed new rules for ride-sharing drivers. (Karl Mondon/Bay Area News Group) Carol Halter, of Santa Clara, left, calls her son for a ride after San Jose taxi cabs staged a strike Monday morning, Nov. 8, 2015, at Mineta San Jose International Airport in San Jose, Calif. (Karl Mondon/Bay Area News Group) Stranded by a taxi strike Monday morning, Nov. 9, 2015, at Mineta San Jose International Airport, William West monitors Uber's 3.9X surge pricing while deciding how to get to downtown San Jose, Calif. West, here from Denver, Co. on business, finally opted to catch an Uber ride when the surge pricing fell to 2X. (Karl Mondon/Bay Area News Group) By Ramona Giwargis and Mark Gomez | mgomez@bayareanewsgroup.com | Bay Area News Group PUBLISHED: November 11, 2015 at 12:40 am | UPDATED: August 12, 2016 at 1:31 am SAN JOSE — Deflated from the City Council’s unanimous decision to scale back the rules for Uber and Lyft drivers at the airport, hundreds of taxi drivers ended a two-day strike Wednesday but remained hopeful about the city’s bid next week to ease taxi regulations. “The strike didn’t accomplish anything,” said Kirpal Bajwa, secretary of the Taxi Workers Alliance of Silicon Valley. “There is nothing left for us to protest now. The city has overwhelmingly voted in their favor. What’s left for us?” The council cut the red tape Tuesday for ride-booking at the airport after a tougher regulatory scheme adopted as a pilot in June failed to attract any participants. Not a single Uber or Lyft driver applied to pick up passengers at the Mineta San Jose International Airport because of the city rules, which required drivers to submit fingerprints, meet vehicle age and condition requirements and obtain business licenses. City leaders backtracked on the fingerprints and vehicle restrictions. Instead of mandatory fingerprints for all drivers, only 1 percent will be subject to monthly audits, including random curbside audits. The vehicle restrictions, which barred ride-booking drivers in cars more than 10 years old or with 400,000 miles, were also eliminated — as long as drivers pass vehicle inspections. Taxi leaders argued that auditing only 1 percent of Uber and Lyft drivers will compromise passenger safety. Uber spokeswoman Laura Zapata estimated the Bay Area, including the company’s home in San Francisco, is home to 20,000 Uber drivers. Cabdrivers said they pay higher trip fees and face tougher regulations. They pressed the council to “even the playing field” between the taxi industry and its high-tech competition. “They need to either raise their fees or reduce ours to make it fair,” Bajwa said. The council on Tuesday will consider deregulating taxis in an effort to close the gap. Some ideas include lowering fees for taxi fares booked through mobile apps, using a simpler vehicle inspection process and issuing temporary permits to cabbies while they wait for background check results. And if the auditing model approved Tuesday is successful for ride-share drivers at the airport, city officials could offer it to taxi drivers. The disparity between rules for taxi companies, usually set by cities and counties, and ride-booking companies, regulated by the California Public Utilities Commission, isn’t unique to San Jose. A federal lawsuit filed Tuesday against Uber and the CPUC on behalf of a Southern California cab company alleges a violation of the unfair competition law because of Uber’s “unfair pricing” and business model. The lawsuit seeks unspecified damages and an injunction to stop ride-booking operations in Orange County. “The pricing, lack of licensing and insurance makes it so that we cannot fairly compete,” said Maryann Cazzell, a Santa Ana attorney representing A White and Yellow Cab, Inc. “They come in with these de-facto taxi cabs and take all the business,” she continued. “We’re saying we have a right to get that money back that was stolen from our taxi drivers.” Though San Jose gave up on fingerprinting Uber and Lyft drivers at its airport, the council will appeal to the CPUC, the agency that regulates ride-booking, to require fingerprints for drivers statewide. Follow Ramona Giwargis at Twitter.com/ramonagiwargis or contact her at 408-920-5705. Mark Gomez Mark Gomez has worked for the Mercury News since 1992, including the past ten years as a reporter on the breaking news/public safety team. He is a South Bay native and graduate of San Jose State University. Follow Mark Gomez @markmgomez More in Transportation CHP tweets about carpool violation on Highway 4 involving a mannequin, and what makes it worse is that the driver is a Los Angeles Angels fan. Mr. Roadshow’s Q&A chat, live at noon Gary Richards, Mr. Roadshow, takes questions on Bay Area roads and traffic during a live online chat most Wednesdays. Man accused of killing Nia Wilson at BART station found competent to stand trial John Lee Cowell, the man accused of fatally stabbing Nia Wilson in July 2018 was found competent to stand trial on Wednesday. Fix complete for falling concrete on Richmond-San Rafael Bridge The work to repair crumbling concrete and aging expansion joints on the upper deck of the Richmond-San Rafael Bridge was completed Tuesday, officials said.
cc/2019-30/en_middle_0028.json.gz/line13389
__label__wiki
0.698386
0.698386
Sunnyvale girl, 7, exhibits dragon mural Aria Luna Parra Rasine, 7, stands next to her mural titled ‘Dragon Storm,’ which was on display at the Cubberley Community Center in Palo Alto. Her work was part of the ‘Guided Colors’ exhibit, a K-8 art exhibition through the Cubberley Artist Studio Program. (Courtesy photo) By Victoria Kezra | PUBLISHED: December 22, 2017 at 10:00 am | UPDATED: February 8, 2018 at 3:42 pm Drawing is a favorite pastime of young children, but they typically don’t draw a wall-size dragon battle. Seven-year-old Sunnyvale artist Aria Luna displayed her art at the “Guided Colors” exhibit at the Cubberley Community Center in Palo Alto. Her mural of a ferocious dragon battle spanned an entire wall and featured more than a dozen fantastical dragons of different shapes, colors and sizes embroiled in a melee. Her piece is called “Dragon Storm.” “Guided Colors” ran through last Friday and featured works by 13 young artists around the Bay Area who have taken classes with artist and teacher Pantea Karimi. Mediums included paper and canvas, mixed media, sculpture and murals. The students’ art was also placed on postcards for sale at the museum. Proceeds are headed to communities affected by the fires in Sonoma and Napa counties. Birgitte Rasine, mother to Aria Luna, said she felt it was appropriate that the money go to help victims of the fire, given her daughter’s “fiery” imagery. “We thought, ‘What a beautiful metaphor.’ Where fire usually destroys, it can protect and rejuvenate,” she said. For her part, Aria Luna was very particular about the placement, color and even name spellings of all of her creations. Her mural took about 10 hours to complete. She said that at first her mother insisted that she work on ocean creatures instead, but held her ground and created dragons using charcoal and pastels, with some mixed-medial elements such as coins and ribbons incorporated into the artwork. “I love them,” she said, adding that the fantasy novel series “Wings of Fire” is a favorite of hers. “The water dragon is my favorite. The mother dragon is (named) Celosous. Fire dragon is Solar.” Each piece is accompanied by a few words from the artist, and Aria Luna’s highlights her love of art as well as her desire to share her visions. “I have a big imagination, and I want to share it with the world.” Victoria Kezra More in Community News Exclusive Palo Alto school redevelopment plan would cause significant traffic issues, report says The school has been violating its enrollment cap for nearly two decades. Kniss, Newton victorious at Antioch Speedway Fraser wins his fifth 20-lap B Modified Main Event Youth results Alameda Junior Golf Club Tournament at Corica Park GC, North Course, July 10 Boys (first-third place results) 16-18: 63 – Adrian Davis; 67 – Brice Chin; 80 – Joseph Donovan 14-15: 64 – Amaan Kanji; 75 – Cooper Gunning; 86 – Zachary Williams 12-13: 78 – Francisconeil Albelda Jr.; 84 – Colin Pero; 102 – Jared Chin Girls 14-16: 65 – Kaylen Tu; 72 –... What’s Happening sports briefs for July 19 To submit an item to the What’s Happening calendar, email ccnsports@bayareanewsgroup.com to request a form. Put “What’s Happening” in the subject line. Nonprofit organizations only. You might be asked to submit a copy of your 1099 or 501(c) 3 to verify nonprofit status. Entries are edited for content and are published as space is available. Adult sports Albany Recreation: Registration open...
cc/2019-30/en_middle_0028.json.gz/line13390
__label__wiki
0.753512
0.753512
Thieves target Bay Area satanic group’s… NewsNews Based on facts, either observed and verified directly by the reporter, or reported and verified from knowledgeable sources. Admiration or antagonism? Thieves target Bay Area satanic group’s Christmas in the Park tree Organization says it had to redecorate tree after many of its ornaments went missing By Jason Green | jason.green@bayareanewsgroup.com | Bay Area News Group PUBLISHED: November 28, 2018 at 12:08 am | UPDATED: November 28, 2018 at 4:53 pm SAN JOSE — For a second year in a row, a satanic group’s tree at Christmas in the Park has been pilfered of decorations. Satanic Bay Area says its tree at Christmas in the Park in San Jose was stripped of nearly 140 handmade ornaments. The group is asking “admirers” not to take any more of its decorations. (Courtesy of Daniel Walker) Daniel Walker of Satanic Bay Area said the group’s roughly 7-foot-tall tree had to be redecorated after many of its 140 satanic-themed, mostly handmade ornaments were pilfered over the weekend. “We’re fairly certain that people are taking them out of admiration rather than antagonism,” Walker said. “But we’re running out so fast that we’re issuing this plea for light-fingered admirers to stop,” he continued. “If you really want a satanic ornament, email us and we might just send you one.” The tree, which went up Nov. 23, is one of hundreds that constitute Christmas in the Park. Now in its 39th year, the event is held at Plaza de Cesar Chavez in downtown San Jose. Any organization can apply to decorate a tree. There are no restrictions beyond a vague prohibition on the use of offensive language. Last year, someone allegedly plucked a black goat head mask from the top of a tree decorated by the San Jose chapter of The Satanic Temple, which is separate from Satanic Bay Area. The pentagram topping Satanic Bay Area’s tree has been left alone, according to Walker. Walker said Satanic Bay Area was founded in 2015 as a grassroots atheistic group to create community and left-wing political action for Satanists in the South Bay and beyond. “It’s our hope that the proliferation of satanic-themed holiday displays in cities across America helps people realize that Satanist groups are part of their local communities too, and that many different kinds of people find joy in the holiday season,” Walker said. “But it seems some people’s idea of holiday cheer is to pull a reverse Santa and make off with the goods in the middle of the night.” There have been other thefts at the event. In fact, thieves also have targeted Christian symbols. San Jose: Children’s gym placed on lockdown because of police activity Noose found hanging from bush at Stanford University Shooting south of downtown San Jose wounds one Car crashes into San Jose home, driver flees San Jose: Suspects sought in robbery at SJSU “The baby Jesus from our nativity scene gets stolen on a pretty regular basis,” said the event’s executive director, Jason Minsky, in an interview last year after the goat head mask vanished. Walker said fellow Satanists in Sacramento have volunteered to make additional ornaments. “If this keeps up, we might have to put some kind of curse on the new ones — or maybe just stick something gross on the backside,” he said. “We haven’t decided yet.” PM Report South Bay Crime Jason Green Jason Green is a breaking news reporter for the Bay Area News Group. He works week nights and spends most of his time covering crime and public safety. A graduate of UC Santa Barbara and the University of Southern California, he cut his teeth at the Inland Valley Daily Bulletin and the Palo Alto Daily News, and has been with the Bay Area News Group since its inception. Follow Jason Green @JGreenMercNews More in Crime & Courts The president has pledged to "fight all the subpoenas" issued by Congress and says he won't work on legislative priorities, such as infrastructure, until Congress halts investigations of his administration.
cc/2019-30/en_middle_0028.json.gz/line13391
__label__cc
0.565428
0.434572
LEK: The discovery of THE THAI WIFE #6 by Meridith Mckinnon When I first discovered Lek, this is how I think of her; a discovery, I knew she would be complex. No-one can leave what they know easily for another life in a completely different culture, and not have complexities. Lek ‘s move into Australian life was extreme and although in the comfort of our white Anglo homes, we like to think we are embracing of different cultures when we are in fact often bad at it. Lek moved to Australia in the early 80’s. It was a time of complacency in Australian multiculturalism, especially in the deep western district of Victoria where affluence of industry set precedence for superiority of white Anglo’s. I think when Lek married David to move to Australia ​... ​he genuinely had good intentions in the respect to thinking he could override conservatism and small town racism. To a degree he did by surrounding himself with friends who were culturally aware and enjoyed Lek’s company. But outside of this circle of friends it is obvious that there was racial prejudice within the town even in daily things that Lek would do, like walking down the street and talking to her boys in Thai. Maybe this is why she rode her bike so often so it didn’t give people a chance to taunt her. Small town racism does not only take the form of audible or visual tacks. More subtle approaches are often used that Lek would have experienced and most likely is the reason why she never worked. Finding employment would have been extremely difficult for her and in a sense David always knew this but chose to support her at home, thinking this was what she wanted. So why was Lek not happy? Why wasn’t it enough for her? And this is where Lek changes our perception of the Thai wife. It is not enough for Lek to spend her life in the comforts of Warrnambool and certainly not enough when she has begun to lead a double life apart from David and her boys. And although she fights this decision eventually she cannot resist and she makes the decision that changes everything. Also when I wrote about Lek’s experiences with racism, I explored the kind of racism that David felt when living in Kamphaengphet. How could it be the same? I drew on my own experiences and believe the two are not the same. However, the experiences of David, I believe, could still be felt as racist. Although greatly more subtle, and nowhere as near as aggressive, David’s feelings of isolation, loneliness and of being on show, were his feelings of cultural difference and potential subtle racism. In today’s broad interpretation of racism I attempt to compare his incidents with Leks. Lek’s encounters appear more aggressive and unacceptable but both feel the isolation and loneliness of being the only foreigner in another place. Also the fact of David being male would have altered his experiences to Lek’s. The story moves quickly on and yet I wanted this subject to be an important part of both the characters background. Both have experienced the down sides of living in another culture yet this is not a contributing factor to either thinking it is not possible. Cultural difference in embedded within cultures and the way David tries to intervene and by even talking to police shows that cultures within cultures differ in opinions of racial abuse and tolerance. The complexity of Lek’s character in relation to racism pales to insignificance as the story moves to the plight of stateless people who she exposes in her fight against human trafficking. Meridith McKinnon, Author Copyright © 2018 Meridith Mckinnon | all rights reserved.
cc/2019-30/en_middle_0028.json.gz/line13392
__label__cc
0.730955
0.269045
Mersey Morris Men Dancing Excellence since 1928 80 Years of Morris in Liverpool Squires Roll of Honour Unsung Hero Award – ‘The Nev’ The Rappering of Mersey Morris Men Longsword Mumming Morris Links Morris Mutters Musings of a new Dancer Dancing Wisdom Squiring About Morris Talk Why I Dance Posted on September 3, 2015 by It tends to be at the larger, public displays over the summer that incredulous members of the public, often stumbling across the spectacle by chance and uninvited, look searchingly into one’s eyes and ask, ‘Why do you do it?’. A fair question and one perhaps each of us has considered. Certainly there cannot be many born to the art or who harboured a childhood ambition to be a Morris dancer. Indeed, unlike other “callings” or vocations, those that fix on it as their destiny must be few and far between. However, perhaps there is something brewing in those early, formative years that create a character that may have certain predispositions. From the very start perhaps those predispositions are the product of a desire to express oneself, perhaps to make good other shortcomings or deficits. Might this form of expression make good, or get away from feelings of isolation or being undervalued? Over time, through experience and practice it may be that projecting a certain persona might yield advantage or benefits. Playing the clown in the school playground to avoid the zealous attention of the bully; a sense of levity to compensate for the disappointments that life might throw in one’s way. Via such means there comes a growing clarity around one’s place in world, what one hopes to achieve, certain aims, objectives and ambitions. So it is that it might just be possible to consider this and devise some universal answer as to why we dance. There are four great motives for dancing which exist in different degrees in every dancer. They are: Sheer egoism. Desire to seem clever, to be talked about. Certainly there is a degree of complexity to dancing the Morris which is not as easily grasped as may appear from the outside. Thus, as with any skill or practice, a side of Morris dancers can set themselves aside from the “norm” as elite. It is self-centred, requires concentration on the self, and getting it right can make you feel good. It is physical and mental exercise, and being able to sustain a performance hints at a sense of machismo. Could it be possible that spectators look on in awe at the stamina, endurance and control? The hope that they do feeds the ego and pushes you on. The most flamboyant and demanding dances become all the more so in the face of a jeering crowd. The clash of the sticks all the more aggressive, egged on by an audience baying for blood. Serious dancers, I should say, are on the whole more vain and self-centred than others who exercise, though less concerned with social acceptability. Aesthetic enthusiasm. Desire to share an experience which one feels is valuable and ought not to be missed. There are many forms of art that surround us in our modern world, why not embrace expression through dancing the Morris as an aesthetic form? It is all too easy to go about one’s day-to-day life without encountering the romanticism of the Morris but why should people be so denied? It can be an art of measured performance and expression that can lift the eyes and spirts of an otherwise sullen onlooker. There is colour and spectacle to it, not to mention the enticing, catchy, repetitious tunes. Yet, ultimately no end good comes of it: there is no tangible output or product. Those that participate do not become richer via its practice; for the most part we do not become more integrated into society. The spectators are but passers-by: these are fleeting encounters unlikely to build into anything more meaningful but, nevertheless, there is beauty and so value to it. Above the level of the most moribund of dances, no form of dance is quite free from aesthetic considerations. Historical impulse. A desire to display the state of things, to seek out origins and store them up for the use of posterity. It is a truism that the most fatal trap that any unassuming member of the public can fall into is to ask any one of our number what it is all about and where it comes from. In large part it is our history and heritage that spurs us on. It is for this reason that we dedicate ourselves to ensuring that our hankies are rotating in the right direction, or reaching their peak at the appropriate time. It is absolutely traditional in its forms and committed to replicating the past. Morris dancers are all historians and historical artefacts. We take pride in the past and dedicate a good deal of time to preserving it. This also serves to validate us and give us standing, however illusory that may be. It is why when that unsuspecting member of the public poses such an unassuming question that they may yet take root on the spot to upwards of half an hour. Partly perhaps it is an excuse to justify what we do for fear that it would otherwise verge on the ridiculous: because it happened in the past, because it is on-going and has persisted in the face of adversity makes it right and worthwhile. We act out our roles as protectors and custodians of the past. Yet this also blends with sheer egoism as we are empowered to say what that history is and to shape its future. Not only do we borrow from the past but we project ourselves into the future. Who controls the past controls the future: who controls the present controls the past. Since we are committed, we have faith and belief; we believe that this is worthy history that should live on: we dance to give it life. Political purpose – using the word ‘political’ in the widest possible sense. Desire to alter other people’s idea of the kind of society that they should strive after. Imagine the scene whereby Joe Average rouses himself of a morning determined to indulge in the ultimately futile “leisure” pursuit of shopping. Taking himself along to the regimented consumption pantheon, he slips into well-known, well-understood grooves of conduct and practice. All is known, there are expectations which prove reassuring. However, what if that easy passage is disrupted by the unexpected and unknown? What if progress is impeded by Young Collins? A challenge is presented that nudges routine out of its grooves and upsets the “normal”. In effect, dancing the Morris in busy public places speaks to the postmodern: securities are challenged, regular patterns disrupted as “normality” gives way to the carnivalesque and chaotic. I see this as a “public service” and accounts, in part, for why I dance. There is every danger that we live within a cossetted and confined world, only encountering the known and expected, rather than challenging ourselves to live a life less ordinary. Morris dancing forces itself onto the public stage and asks of those passing to take a different perspective, whether they want to or not. We cause a rupture and encourage change. The opinion that art should have nothing to do with politics is itself a political attitude. Without doubt, the preponderance of one or the other of these motives will shift and change according to situation and circumstance. On some occasion it may be that just one of these motives drives one on or is satisfied. At other times perhaps all may come together in joyous harmony but they all play some part at some time, in some way. The commitment in all ways to the practice of Morris dancing is not something taken lightly or purely for the sake of it. Were that the case it would very soon cease to exist. But it has purpose and drive, it seeks to achieve certain objectives, to satisfy these motives. Dancing the Morris can be a horrible, exhausting struggle, like a long bout of some painful illness. One would never undertake such a thing if one were not driven on by some demon whom one can neither resist nor understand. For all one knows that demon is simply the same instinct that makes a baby squall for attention. Dr D. J. Clampin FRHistS (with profound apologies to George Orwell). This entry was posted in Dancing Wisdom by . Bookmark the permalink. all-day West Midlands Ring Meeting; gues... West Midlands Ring Meeting; gues... 8:00 pm The Harp, Little Neston The Harp, Little Neston 8:00 pm Egremont ferry, The Magazine, Ne... Egremont ferry, The Magazine, Ne... Bordering on Poetry Border and Molly in Chester MMM’s Visit to Brittany Farewell Nev Mersey Morris Ceilidh – April 16th 2016 New Members wanted!!! Your local morris team needs you... We are always looking for new members to join our team, either as dancers or musicians. Come along one Monday, you might just like it!!! Mersey Morris Men enter here!!!!
cc/2019-30/en_middle_0028.json.gz/line13393
__label__cc
0.595196
0.404804
NAIMISH, Victor Murray 10 Condolences April 5, 1926 – Regina, Saskatchewan September 1, 2018 – Calgary, Alberta Victor passed away peacefully exactly one month after his wife, Sharon on Saturday, September 1, 2018 at the age of 92 years. Victor led a full and productive life. He was the seventh of ten children, born to Romanian immigrants. He grew up on the East side of Regina, SK, a veritable united nations. He made friends with people who originated from all over the world and this likely contributed to his sense of justice. He excelled at school and pursued a career in law, via entering the military to pay for his schooling. He had twelve years of service in the military and later embarked on his own private law practice. He was a graduate of the University of Saskatchewan, Law Class 1948. His first job was with the Standard Oil Company of Ohio (SOHIO). He practiced in the area of Oil & Gas Law at a time when a business deal was completed with a handshake. Victor had an incredible strength of character, work ethic and discipline. His joke telling and storytelling are legend amongst his family and friends. A true leader, he volunteered in the community as a soccer coach for many years. His daughters, Mary and Ann feel such gratitude for having a father with such strong ideals and leadership. He was a pillar of society, contributing professionally and personally to so many people. He will be dearly missed by his daughters, Mary Naimish of San Diego, Ann Naimish (Ron Garneau) of Calgary; his grandchildren, David Ambagtsheer and Michael Ambagtsheer of San Diego and Scott Garneau and Alana Garneau of Calgary as well as numerous friends and extended family. He is also survived by his sister, Evelyn McCann of Michigan. A celebration of both Victor and Sharon’s well-lived lives will be held at a later date. Condolences may be forwarded through www.mcinnisandholloway.com. In living memory of Victor Murray a tree will be planted at Fish Creek Provincial Park by McINNIS & HOLLOWAY FUNERAL HOMES, Park Memorial, 5008 Elbow Drive S.W., Calgary, AB, T2S 2L5, Telephone: 403-243-8200. Offer Condolence for the family of NAIMISH, Victor Murray Susan Marrinan We are so sorry for your loss of Victor and Sharon- wonderful examples of lives well lived. Susan and Michael Marrinan Patty & Scott Williams and boys Mary and Ann, We will always remember how wonderful and kind both Sharon and Victor were to our whole family. They made us feel like we were all part of your family. You are in our hearts and prayers. We love you. Marilyn Glerum I am sorry to hear Victor passed away one month after Sharon. I feel in my heart that he is now in a happier place with Sharon and that I had the pleasure of his company over the years. Loved Vic’s jokes. I would ask him for his latest joke only to get that look from Sharon (how many times have I heard this?). Lately, I had him putting one ice cube in his wine which brought some humour. May your memories give you strength and peace. Phillip Ambagtsheer My sincerest condolences to all in the family. Carmen Gallant I am so sorry for your loss. Mr Naimish was my first client when I started my business in 1988 and it was a pleasure to work with him for for 30 years. He was a true gentleman. Gary Litschke It was with shock and surprise that Vic’s passing was seen in the Calgary Herald. The reaction shouldn’t have been either, considering how long we have known each other. Vic looked after my corporate legal affairs for many years prior to his retirement. The lunches, before and after that were always most enjoyable. I regret there weren’t more of them. I will miss Vic’s presence here, but look forward to a reunion. There is a lot of reminiscing / visiting / discussion left to do. Please also accept my condolences for the passing of Sharon, which I wasn’t aware of until now. Best Regards to all. Ian Richard (Rich) Mayers Mary, Ann (and Family); I was sorry to learn of the passing of both of your parents. I unfortunately did not know your Mum, Sharon; but through a mutual friend, Grey Austin, I spent some very pleasant times in Vic’s company (often over a hearty, jovial lunch with the two of them). Your Dad was a true gentleman; gracious, exceptionally good humored and so very generous with both his personal and professional advice. Please accept my condolences; and may your fond memories bring all of you comfort, strength and lasting peace. Honourable Nick Taylor Alberta has lost a great gentleman and scholar with whom I was privileged to work a few times, My condolences to the family. Janis Kaminsky My sincere condolences to Ann, Mary and families in memory of my very good friends Sharon and Vic. Sharon and I were at university together and had kept in touch, more so in recent years. I shall miss her phone calls in catching up on her news and sharing mine. Also seeing her on her occasional visits to Winnipeg. Ann, Ron and family, my condolences for your loss of Mr. Naimish. I echo all of the comments which have already been made here. It was always interesting, insightful, just and quite often entertaining to have a conversation with Mr. Naimish. Bob Ross
cc/2019-30/en_middle_0028.json.gz/line13395
__label__wiki
0.544652
0.544652
Toyota Forklift launches AICHI Vertical Mast Lifts Toyota Material Handling, USA, Inc. 5559 Inwood Dr http://www.toyotaforklift.com Toyota Material Handling USA has launched its new AICHI Vertical Mast Lift aerial work platforms to the market. The AICHI Vertical Mast Lifts feature multi-stage post style masts providing high lift heights in a compact unit that fits through a standard doorway. They offer platform heights of 12 and 16 feet with a standard platform extension that provides an additional 15 inches for hard to reach locations. The vertical mast lifts are just 30 inches wide and 4 feet, 6 inches long, allowing for navigation in space-restricted and narrow areas where a scissor lift would be too big. The new AICHI product comes with a zero-degree turn radius for enhanced maneuverability and standard non-marking tires. It also features a dual motor AC direct drive system that offers precise travel and industry-leading run time. This system eliminates the leaks and maintenance that can be found in the hydraulic drive systems used in other brands. AICHI Vertical Mast Lifts share this system and other parts with the AICHI scissor lift models for convenience of service and maintenance. When it comes to features, the vertical mast lifts also offer an intuitive control handle, anti-rollback functionality, and a tilt alarm, which alerts operators to unsafe working conditions and limits platform movement until proper operation is restored. The lifts come standard with onboard diagnostics and an LCD display/hour meter, eliminating the need for special tools to diagnose any codes. “We set out to build new work platforms for the construction trades primarily, but these lifts offer a lot more,” said Toyota Material Handling Senior Vice President Tony Miller. “This is an ideal solution for any workspace in which a ladder over 10 feet is needed.” In addition to applications in the construction industry, the new lifts are ideal for plant and building maintenance, piping, painting and many other applications. Toyota is taking orders now, with inventory on hand. Toyota launches AICHI scissor lifts in North America Toyota Material Handling, U.S.A., Inc. (TMHU) recently launched a new line of high-quality scissor lifts… Toyota launches forklift electronic diagnostic system Toyota Industrial Equipment recently launched the Toyota Electronic Diagnostic (T.E.D.) expert system for dealer technicians. T.E.D. was… Toyota launches three new products Toyota Industrial Equipment introduced several new products to its customers and dealers this month including a…
cc/2019-30/en_middle_0028.json.gz/line13396
__label__wiki
0.618629
0.618629
International (English) International (English) About MaxonRegister / Login / ePortfolio New in Release 20 Node-Based Materials CAD Data Import Volume Modeling Polygon Modeling Parametric Modeling Materials / Shaders 3D Painting General Workflow Take System Short-Term Licenses Workflow Integration Real-Time Graphics « Workflow Integration Render Engines Advertising / Design Movies / VFX Educational Solutions Resellers & International Distributors About Maxon Creating the Semi Permanent 2018 Titles Joyce N. Ho and Nidia Dias offer a behind-the-scenes look at a global collaboration. By Meleah Maynard For 16 years, Semi Permanent has been bringing together artists from all over the globe for a three-day design conference devoted to sharing experiences and ideas. The event’s title sequence is a key part of the action. Hong Kong-born, New York-based designer Joyce N. Ho directed the 2018 titles, the theme being “creative tension as inspiration.” The first female director in the conference’s history, Ho assembled a team of 11 collaborators who worked remotely from around the globe, including designer and art director and Nidia Dias, who used Maxon’s Cinema 4D, Red Shift, After Effects and X-Particles for Act III. We asked Ho and Dias to break down the widely praised, otherworldly titles, which were made in partnership with Dropbox, including explaining how the titles were inspired by the work of Ernst Haeckel, a German professor and biologist known for discovering and naming thousands of new species while also helping to visually promote Charles Darwin’s theories of evolution. Joyce, how did you get the job of creating the 2018 titles? J.N.H.: I actually reached out to the founder of Semi Permanent, Murray Bell. Since going freelance and moving to New York from Australia, where I grew up, I’ve made it a personal goal to try to direct something every year. Last year, I did titles for Likeminds, and Semi Permanent has always been a part of my design life. Every year they do such amazing title sequences by a lot of designers I really look up to, so I thought, ‘Wouldn’t it be cool if I could direct the titles?’ So I sent Murray an email last year, explaining who I am and that I’d love to do the titles. I didn’t expect to hear anything back but he got back to me a few weeks later to say that Framestore was doing them for 2017 and he would like me to do them next year. I was just over the moon. Talk a bit about your background, and how you became a motion designer. J.N.H.: I was born in Hong Kong and my family moved to Brisbane, Australia, when I was 4. I’ve always loved watching TV, and I think that’s how I got introduced to animation, just watching a bunch of cartoons and also drawing and making things. After high school, I went to the Queensland University of Technology and majored in animation. Once I discovered motion design, though, I realized that was for me. Nidia, how about you? N.D.: I’m a designer and art director. I grew up in Portugal but I’m living in Toronto right now. I’ve always liked to draw but I went to engineering school for one year before realizing it was completely not what I wanted. So I studied graphic design for three years and then discovered motion design. I moved to Canada in 2017 to work at Tendril. Joyce, what kind of direction did you get from Murray Bell? J.N.H.: The titles needed to speak to the idea of creative tension, and Murray explained what that theme meant to him. After the initial call, I broke down his explanation, always thinking about how to tell the story while allowing enough room for other people’s ideas. We only had three months, so it was a big puzzle to solve. Murray also wanted the 2018 titles to be a little bit different. Semi Permanent had a bigger partnership with Dropbox, so they asked me to organize a grand collaboration between artists who work in 3D, design, motion graphics and music. I would be the director and we would use Dropbox to work together remotely. I had free reign to choose my team, which is such a rarity and a wonderful opportunity to work with designers I really admired. I knew I wanted to center the direction around nature and science because they’re such a huge inspiration to me. While doing research the old-fashioned way at the New York Public Library, I found Artforms in Nature by Ernst Haeckel. He did beautiful illustrations of micro-organisms and algae and creatures from the sea. I was so inspired, and I knew right away that those would be my key references. I wrote a treatment with three acts: Pushing and Pulling, Friction and Release. I thought about how I wanted to visualize each section and then broke down each act into style frames. I gave those style frames and a base music track I was working with to the collaborators I reached out to. Lucky for me, about 90 percent of the people I asked to participate said yes. They had the latitude to interpret what I gave them, and I was super open to them bringing in their own sense of style, as long as it kept with the color palette and what my idea of what the shot needed to be. Describe what happens in the titles? J.N.H.: It’s a microscopic world inspired by Haeckel. You follow the organisms from birth to death and the three acts are really stages of creative tension. The beginning is all about the time when creative concepts are forming. We shot in 4K, so we were able to zoom in and follow the sphere, which was half a Styrofoam ball. I composited a digital sphere later. Act II represents aspects of a project that can cause conflicts, like deadlines and budgets. There’s friction in the process at this point, and I showed that using the principle of cell division. This act represents multiple aspects of a project that may be causing conflict; whether it be the timeline or the budget or the actual project itself, it's where things are evolving and sometimes not working out the way you want it to — that little bit of friction in the creative process. And yes, I felt like I was living out all these stages through the creation of the titles in real life! Nidia created the first half of Act III, which represents the micro-organism, or idea, in its most complex form. At this point, I wanted the organism to have tentacles, which turned out to be challenging. She definitely had one of the toughest 3D shots. Nidia, explain what you created to visualize “Release” for Act III. N.D.: Joyce knew what she wanted from the start, which was great, and the music was done so it was easy to put things to the beat. My job was to make something that looked like a living organism. Joyce gave me a bunch of Ernst Haeckel references, and I combined a lot of what I saw into one fake 3D organism, which I wanted to look a bit like a jellyfish. I started by doing an animatic and motion tests to get the movement right before I modeled something. I used MoGraph, the bevel deformer, and a few other deformers to make the organism look like it was alive, but my main challenge was getting the motion right. (Watch Dias’ breakdown video below.) J.N.H.: The difficult thing with the tentacles was that they looked great from the side, but when we placed the camera above them, they didn’t have the depth we wanted. I animated them in 2D using a rigged Newton joint [a 2D physics simulator], and then Nidia comped those into the 3D shot in Cinema 4D. N.D.: I also collaborated with Joyce on the tunnel shot where everything feels like it is being pulled into a vortex. I used X-Particles for a few variations of the tunnel, which was emitting little circles from my previous shot. I layered my C4D file in After Effects so that Joyce could use to make the tunnel look so painterly. I had a great time working on this project. Joyce’s art direction was beautiful, and I loved the color palette and that everybody was able to bring in their own style. How do you see your career evolving? J.N.H.: Currently, as a freelancer, I do a wide range of stuff. I specialize in art direction for motion, and I really like to direct my own projects. Title design is something I’m very interested in and what to keep doing. I enjoyed the puzzle aspect of this project so much. Completing such a mammoth project and being able to work with so many designers whom I’ve really admired from afar was so amazing. It was a rare opportunity and very much a dream project that means a lot to me personally and as a designer. Direction and Production: Joyce N. Ho Music & Sound Design: Ambrose Yu Type Design & Animation: Worship Audio Design & Animation: William Arnold. Nidia Dias, Joyce N. Ho, Somei Sun, Joel Watkins Cinematography: Davy Evans Edit: Alex Gee Storyboard: Mercy Lomelin Additional Animation: Hayato Yamane Special Thanks: Murray Bell, Patrick Clair, Jonathan Kim, Dropbox Meleah Maynard is a writer and editor in Minneapolis, Minnesota. Dealers & International Distributors This website uses cookies to ensure you get the best experience on our website Learn more Okay /en/header-meta-navigation/about-maxon/legal/privacy-policy/
cc/2019-30/en_middle_0028.json.gz/line13397
__label__cc
0.681513
0.318487
Hon Michelle Roberts BA DipEd MLA Minister for Police; Road Safety Kimberley to benefit from $329,045 in crime grants McGowan Government supporting local crime prevention initiatives Initiatives aim to break the cycle of juvenile offending and anti-social behaviour Police Minister Michelle Roberts has announced 13 community groups in the Kimberley will share in $348,901 to fund grass roots crime prevention initiatives. The Minister made the announcement as part of her trip to the Kimberley, where she met with local police, road safety and community groups. The funding has been sourced through the Community Safety and Crime Prevention Fund. Broome Youth Creative Projects: $25,000 For a program to engage with and encourage Aboriginal people to express their creativity, learn new skills and transform urban spaces through street art, sculpture and creative workshops. Broome Youth and Community Hub Inc. $25,000 To implement a Monday Sports Night program to engage at risk youth in socially positive and healthy activities and provide a platform for delivery of a range of workshops. Mowanjum healthy Holiday Program, Derby: $25,000 To implement a school holiday program including carpentry workshops, swimming activities, back to country trips, sports and games. Bayulu Warden Program: $25,000 To re-establish a Warden program in the Bayulu Community. Wardens will maintain a presence at the Community gate, search vehicles for alcohol, attend family disturbances and carry out patrols of the community. Garl Garl Walbu Aboriginal Corporation: $25,000 For an 8-week intensive educational and diversionary program for youth currently at risk, or in contact with police. Participants who successfully complete the program, attend school, and not offended or reoffend will be rewarded with a three-day camp on the Dampier Peninsula. Bidyadanga Community Patrol: $25,000 To employ two part-time community members as Community Patrol Team Leaders. The aim of the community patrols is to address the ongoing problem of children and young people roaming the streets until the early hours of the morning. Garnduwa Amboorny Wirnan Aboriginal Corporation: $25,000 To host a Friday Night Youth Hub - aimed at steering youth away from anti-social activities in Fitzroy Crossing. Healthy meals and transport will be provided to ensure youth are off the streets at the conclusion of activities and transported home safely. Kununurra Waringarri Aboriginal Corporation: $24,775 For a series of back to country trips targeted at youth in Kununurra. The overarching aim is to promote reconnection to country and culture. Elders will attend all trips to reinforce the value of traditional culture and empower youth by reinstating positive behaviours. Save the Children Kununurra Our Mob Matters: $25,000 To deliver school holiday activities for young people identified at risk of offending, to ensure they are engaged in positive activities rather than falling into patterns of offending due to boredom. Kimberley NightFields $25,000 The WA Football Commission will implement the NightFields program targeted to regional centres in the Kimberley to deliver sports based activities and engage participants in positive behaviours and provide direct connections to youth service providers. Yakanarra Aboriginal Corporation: $24,285 To deliver daily after school activities for young people aged 7 to 17 years in order to provide a supervised space to socialise. Weekly activities include smoothie making classes, painting and other art and craft activities, movie screenings and board games. Three Aboriginal artists from Waringarri Aboriginal Arts Centre will be employed to deliver ten mentoring sessions with local young people and work with them to design a moveable mural with an anti-graffiti message. The mural will be displayed at graffiti hotspots throughout Kununurra. Shire of Wyndham East Kimberley: $19,600 To purchase new reporting technology to commence local graffiti data collection and analysis. Graffiti data collected will include a GPS location for each tag, leading to improved mapping and graphic representation to allow more accurate identification of graffiti hotspots for reporting. Comments attributed to Police and Road Safety Minister Michelle Roberts: "We know there is an issue in the Kimberley relating to youth involvement in crime and anti-social behaviour. "These programs are aimed at encouraging 'at risk' young people to be involved in self-development programs. "Through grass roots initiatives like these, we can divert young people away from crime and provide positive activities and role models. "I want to congratulate these community groups and organisations for taking a lead role in preventing crime and anti-social behaviour in their communities." Minister's office: 6552 6900
cc/2019-30/en_middle_0028.json.gz/line13405
__label__cc
0.737753
0.262247
Thursday 18 , July Min:17º Max:34º Know Montserrat ORGANIZE YOUR VISIT IDEAS FOR YOUR VISIT Visit the Sanctuary Montserrat surrounding GROUPS AND ORGANISATIONS Montserrat Friends News Newsletter Agenda History Spirituality Nature Culture To find out more How to get here Where to sleep Where to eat Where to buy Useful information Visit the Sanctuary Guided tours Nature Montserrat surrounding Celebrations Enterprises Travel Agents Montserrat Friends Tourism Offices Escolania (Boys' Choir) The image of Our Lady of Montserrat, popularly known as La Moreneta (the Dark One), due to the dark colour of Her skin, is a truly beautiful 12th century Romanesque polychrome carving. Pope Leo XIII proclaimed Our Lady of Montserrat Patron Saint of Catalonia in 1881. In 1947, the image was enthroned in a silver altarpiece, paid for by popular subscription and installed in the upper section of the basilica apse. Artistically, the image imitates a popular model, that of Our Lady in Majesty, with a wholly frontal attitude and Baby Jesus on Her lap in the centre. Both Mother and Child are wearing crowns. The figure of Our Lady stretches out Her right hand, which holds the globe, symbolising the cosmos. Our Lady nearly rests Her left hand on the Child’s shoulder, indicating that this omnipotent king is Her Son. With His right hand, the Child gives a blessing, whilst His left hand holds a pinecone, symbol of fertility and everlasting life. Basilica: From 7.30 am to 8.00 pm Throne of Our Lady: From 8.00 am to 10.30 am and from 12.00 pm to 6.15 pm From 15 July to 30 September: also from 7.15 pm to 8.00 pm Pastoral Coordination Centre: From 9.30 am to 1.00 pm and from 4.00 pm to 6.00 pm Website of the Abbey
cc/2019-30/en_middle_0028.json.gz/line13408
__label__wiki
0.908717
0.908717
Home / Magazine / Featured articles / Healing Power Records Hits Toronto With a Sonic Balm Healing Power Records Hits Toronto With a Sonic Balm By Jonathan Bunce Issue 118 The last place you’d expect to hear a comprehensive showcase of a modern experimental music community is on a dance mix. But with Heart of Toronto, a 2013 CD and download compilation, the Toronto-based label Healing Power has done just that. A compelling snapshot of North America’s fourth-largest city’s dizzyingly interconnected underground music scenes, Heart of Toronto cross-fades smoothly from tribal protest music by Mas Aya to moody synth-pop from Fan Fiction and Seance Centre, from Ethiopian-inspired free-jazz by Nifty and Brodie West to pummelling techno by Guy Dallas and squelchy electro by Piège (a.k.a composer Nick Storring). The result is simultaneously deep-listening music and something you could safely throw on at a party. It took Healing Power cofounder Wolfgang Nessel two years to realize his long-standing dream of a Toronto underground dance mix—a testament to his shared slow-burning passion with partner Victoria Cheong for local music, or more specifically, music made by their friends. “Friends” is how Nessel sums up Healing Power’s artistic mandate, when asked to define it. “New music, new sounds, new ideas,” he goes on to explain. “We like things to feel new and exciting,” Cheong concurs. “People that push themselves as artists within music or sound is what we’re interested in. We find an underlying comfort in this idea of the healing power of music and art—for artists and for everyone that listens, and for the community around them.” The sincerity that drove them to christen their label Healing Power may have unwittingly attracted the attention of New Age musicians—ironic given their penchant for unsettling noise alongside more meditative drone music—but their sincere desire to help out their friends has driven them since their first release, a twelve-inch LP for Residents-inspired synth-funk performance-art prankster Man Made Hill (a.k.a. Randy Gagne), co-released with Bennifer Editions in 2010. Observing a lot of creative musicians in their social circles who had yet to release a record, the pair saw a void to be filled. “It’s just a lot of friends who haven’t put things out—like Hoover Party,” says Nessel. “I just bug Jonathan [Adjemian] every year to see if he has a new record.” Having released two cassettes’ worth of synth-based instrumental abstraction (Some Liquidity for These Troubled Times, Vol. 1, HPR 08, and Vol. 2, HPR 15), Hoover Party is now one of the label’s core stable of artists—though their relationship remains informal, as it does with the rest of their roster. Other artists Healing Power has recently released demonstrate a deeply interconnected family tree: esteemed improv–noise–global-rhythm duo Not the Wind, Not the Flag (Garments of Light, HPR 21); solo releases by that band’s members Colin Fisher (Original Face, HPR 20) and Brandon Valdivia, a.k.a. Mas Aya (Kairos, HPR 19); Valdivia’s percussion-and-vocal duo with Alexandra MacKenzie, Pachamama (s/t, HPR 16); and MacKenzie’s solo project, Petra Glynt (Of This Land, HPR 14). “Since it started, Not the Wind, Not the Flag has been my favourite band in the city,” says Nessel. “They just work so well together, they always ‘go off’—always into space. Anything Brandon touches is golden. He’s always pushing himself, finding new rhythms, new ways to express himself.” Cheong concurs: “With Mas Aya, Brandon is writing songs, which is very different for him, to be that raw and vulnerable, because as a percussionist he’s such a master.” As for Petra Glynt, MacKenzie’s loose overtures to pop, in terms of vocal delivery and song structure, combined with her unique DIY fashion-sensibility and acclaimed visual-art practice have led some pundits to label her a “next big thing” contender—but she seems too focused on making art to go the route of mass appeal. Of This Land’s intricate cassette packaging would also raise eyebrows around music-industry marketing tables. Likewise, the label founders and much of their roster live their lives as “total artists,” often working unrelated jobs to make ends meet. Nessel is a DJ who also works at the Tranzac, a long-running venue for experimental music in Toronto, while Cheong is a video artist, who also works as an editor. “However it takes shape, Healing Power is people living and working as artists,” says Cheong. “And that is a really rewarding and interesting and beautiful and amazing and uncertain life. But you’re living with that risk and gaining those rewards.” Ever fans and supporters of their local community, Healing Power kicks off 2014 by releasing a ten-inch vinyl record by another one of their friends, alto sax man Brodie West, and his warped calypso jazz sextet, Eucalyptus. Of West, Cheong says: “He’s endlessly curious and wandering and searching, and that comes out in his music.” When they’re not helping out the rest of the scene, Cheong and Nessel make their own music as HVYWTR, a project that began as “loops and drones” but is now “psychedelic techno.” “As mixed up as the label is, that’s how mixed up HVYWTR is,” says Cheong. “Whatever sounds we are imagining from what we’re hearing all the time, that gets filtered through and ends up influencing us.” So is Healing Power all about living in the moment? “I think it has to be. Yeah,” says Cheong. “I think that’s a good thing to aspire to.” Image: Artwork for Heart of Toronto compilation from Healing Power Records. Image by: Victoria Cheong and Sandy Plotnikoff. Jonathan Bunce (a.k.a. Jonny Dovercourt) has been participating in the independent music community in Toronto – as a musician, writer, editor, presenter, organizer and advocate – since the early 1990s. He has been a member of more than a dozen bands and helped co-found Wavelength, a multi-genre music series. He is currently collaborating in the space-improv-punk guitar duo, Hybrid Moments. Jonny has also served as Artistic Director of The Music Gallery, a long-running Toronto concert space, and as Operations & Development Manager at the Images Festival. He has also co-edited two volumes of Coach House Books’ acclaimed uTOpia anthology. Sam Shalabi and the Evolution of a Global Aesthetic The Aural Perspectives of Brodie West What's Inside Musicworks 131 - Fall 2018
cc/2019-30/en_middle_0028.json.gz/line13417
__label__wiki
0.75575
0.75575
Home Sports B-UMS wins state archery tournament, now headed to nationals WVPremium B-UMS wins state archery tournament, now headed to nationals Monica Zalaznik The state champion Buckhannon-Upshur Middle School archery team. BUCKHANNON – A local archery team are now state champions, but they’ve already set their sights on a bigger target — nationals. The Buckhannon-Upshur Middle School’s archery team took first place in the state archery tournament in Huntington on March 30, amassing a total score of 3,281. The win kept their undefeated season season alive, as they are now headed to the national tournament in Louisville, Kentucky May 9-11. Head coach Russ Warner said he wasn’t surprised the B-UMS team won the state tournament. “They’re not cocky kids,” Warner said. “They’re just very good, they’re very comfortable on the line, they don’t get nervous and they’ve just kept improving.” The top four teams at the state tournament are invited to the national tournament, but Warner said he would not take his team if they hadn’t placed first. “I only take my teams to the national if they get first place,” Warner said. “The national tournament is extremely competitive, and to do well in the nationals you have to be extremely accurate.” Warner said last year, when his elementary division team qualified for their first national tournament, he saw first-hand just how competitive it was. “We had our first team in the elementary division ever [last year],” Warner said. “They broke the state record in the elementary division — they shot a 3,004. We went on to nationals and shot a 3,091 and we still only got 26th, which was great because there were 240 some teams there, but it just shows how competitive it is.” Some members of the program also took home top 10 standings in the state. Elijah Bryant from Buckhannon-Upshur Middle School placed fourth in the state for the boys division with a score of 282. Three Buckhannon-Upshur Middle School girls made the top 10 in the girls division, with Leah Bennett placing sixth in the state with a score of 281, Alyssa Lewis finishing seventh with a score of 280 and Kendall Defibaugh coming in 10th with a score of 276. Two elementary archers also placed in the top 10 at the state tournament. Reese Curry from Buckhannon Academy placed second in the girls division with a score of 278 and Carly McHenry from Washington District placed fourth with a score of 265. Reese Curry from Buckhannon Academy and Carly McHenry from Washington District Elijah Bryant Leah Bennett, Alyssa Lewis, Kendall Defibaugh Approximately 550 students from 64 schools participated in the competition, according to a press release from the WVDNR. Ripley High School won the high school team division, while Bridge/Clendenin Elementary took the top honors in the younger bracket. The Upshur County Homeschool Archery Association also picked up some top spots. Jeremy Mcdonald was second in the elementary boys division, with middle schoolers Clay Tenney and Abilene Supers each finishing third in that division’s boys and girls categories, respectively. Rylee Hitt was fifth among high school boys. Previous articleStonewall Resort hosting community-focused culinary, dance events in April Next articleB-U junior to study abroad as an exchange student in Germany Horticulturist Rob Barbor resigning from post as city’s floral guru ‘Code Red’ at Ellamore VFD: Professional wrestling stunt ‘gone wrong’ sends Pennsylvania fighter to West Penn Burn Center B-UHS English teacher throws her hat into the 2020 House of Delegates ring as education issues dominate legislature
cc/2019-30/en_middle_0028.json.gz/line13419