hexsha
stringlengths
40
40
size
int64
7
1.05M
ext
stringclasses
13 values
lang
stringclasses
1 value
max_stars_repo_path
stringlengths
4
269
max_stars_repo_name
stringlengths
5
108
max_stars_repo_head_hexsha
stringlengths
40
40
max_stars_repo_licenses
listlengths
1
9
max_stars_count
int64
1
191k
max_stars_repo_stars_event_min_datetime
stringlengths
24
24
max_stars_repo_stars_event_max_datetime
stringlengths
24
24
max_issues_repo_path
stringlengths
4
269
max_issues_repo_name
stringlengths
5
116
max_issues_repo_head_hexsha
stringlengths
40
40
max_issues_repo_licenses
listlengths
1
9
max_issues_count
int64
1
67k
max_issues_repo_issues_event_min_datetime
stringlengths
24
24
max_issues_repo_issues_event_max_datetime
stringlengths
24
24
max_forks_repo_path
stringlengths
4
269
max_forks_repo_name
stringlengths
5
116
max_forks_repo_head_hexsha
stringlengths
40
40
max_forks_repo_licenses
listlengths
1
9
max_forks_count
int64
1
105k
max_forks_repo_forks_event_min_datetime
stringlengths
24
24
max_forks_repo_forks_event_max_datetime
stringlengths
24
24
content
stringlengths
7
1.05M
avg_line_length
float64
1.21
330k
max_line_length
int64
6
990k
alphanum_fraction
float64
0.01
0.99
author_id
stringlengths
2
40
4adcff3d14f6a5d04685ea81eee3d833bd4ec8aa
599
cpp
C++
1-100/3.longest-substring-without-repeating-characters.cpp
chadwick2143/Leetcode-Problems
a07ad0165c86305a77acbf480bcba279316256af
[ "MIT" ]
null
null
null
1-100/3.longest-substring-without-repeating-characters.cpp
chadwick2143/Leetcode-Problems
a07ad0165c86305a77acbf480bcba279316256af
[ "MIT" ]
null
null
null
1-100/3.longest-substring-without-repeating-characters.cpp
chadwick2143/Leetcode-Problems
a07ad0165c86305a77acbf480bcba279316256af
[ "MIT" ]
1
2021-07-27T07:03:05.000Z
2021-07-27T07:03:05.000Z
class Solution { public: int lengthOfLongestSubstring(const string& s) { unordered_map<char, int> mapChrIdx; int nMaxLen = 0; int nChrBeg = -1; int nChrIdx = 0; for (const char& c : s) { if (mapChrIdx.count(c) == 1 && mapChrIdx[c] > nChrBeg) { nChrBeg = mapChrIdx[c]; } else if (nChrIdx - nChrBeg > nMaxLen) { nMaxLen = nChrIdx - nChrBeg; } mapChrIdx[c] = nChrIdx; ++nChrIdx; } return nMaxLen; } };
24.958333
66
0.452421
chadwick2143
4ade02896e96ef223439dad2736603a6a9964655
4,069
cpp
C++
i2c/02-Uebung/src/main.cpp
mc-b/IoTKitV3
87d7a66a1730f71bc69110a214b1b2a18f22edcb
[ "Apache-2.0" ]
2
2019-01-24T19:53:40.000Z
2020-01-08T07:41:35.000Z
i2c/02-Uebung/src/main.cpp
mc-b/IoTKitV3
87d7a66a1730f71bc69110a214b1b2a18f22edcb
[ "Apache-2.0" ]
null
null
null
i2c/02-Uebung/src/main.cpp
mc-b/IoTKitV3
87d7a66a1730f71bc69110a214b1b2a18f22edcb
[ "Apache-2.0" ]
5
2019-01-12T04:48:11.000Z
2020-12-16T09:36:43.000Z
/** * 6D Lagsensor und Schrittmotor bringt mit dem 6 Lagesensor den ersten oder zweiten Schrittmotor vor- oder rückwärts zum laufen. */ #include "mbed.h" #include "OLEDDisplay.h" #include "LSM6DSLSensor.h" // UI OLEDDisplay oled( MBED_CONF_IOTKIT_OLED_RST, MBED_CONF_IOTKIT_OLED_SDA, MBED_CONF_IOTKIT_OLED_SCL ); static DevI2C devI2c( MBED_CONF_IOTKIT_I2C_SDA, MBED_CONF_IOTKIT_I2C_SCL ); static LSM6DSLSensor acc(&devI2c,LSM6DSL_ACC_GYRO_I2C_ADDRESS_LOW); // low address // Stepper 1 DigitalOut s1( MBED_CONF_IOTKIT_STEPPER1_1 ); DigitalOut s2( MBED_CONF_IOTKIT_STEPPER1_2 ); DigitalOut s3( MBED_CONF_IOTKIT_STEPPER1_3 ); DigitalOut s4( MBED_CONF_IOTKIT_STEPPER1_4 ); // Stepper 2 DigitalOut s5( MBED_CONF_IOTKIT_STEPPER2_1 ); DigitalOut s6( MBED_CONF_IOTKIT_STEPPER2_2 ); DigitalOut s7( MBED_CONF_IOTKIT_STEPPER2_3 ); DigitalOut s8( MBED_CONF_IOTKIT_STEPPER2_4 ); static float s = 0.005f; int main() { uint8_t id; uint8_t xl = 0; uint8_t xh = 0; uint8_t yl = 0; uint8_t yh = 0; uint8_t zl = 0; uint8_t zh = 0; char report[256]; oled.clear(); oled.printf( "6D Servo Pos\n" ); /* Init all sensors with default params */ acc.init(NULL); acc.enable_g(); acc.enable_x(); acc.enable_6d_orientation(); acc.read_id(&id); printf("LSM6DSL accelerometer & gyroscope = 0x%X\r\n", id); while (true) { oled.clear(); acc.get_6d_orientation_xl(&xl); acc.get_6d_orientation_xh(&xh); acc.get_6d_orientation_yl(&yl); acc.get_6d_orientation_yh(&yh); acc.get_6d_orientation_zl(&zl); acc.get_6d_orientation_zh(&zh); printf( "\nxl %d, xh %d, yl %d, yh %d, zl %d, zh %d\n", xl, xh, yl, yh, zl, zh ); if ( xh ) { sprintf( report, " _____________\n" \ " * |_____________|\n" ); for ( int i = 0; i < 20/4; i++ ) { s1 = 1; s2 = 0; s3 = 0; s4 = 0; wait( s ); s1 = 0; s2 = 1; wait( s ); s2 = 0; s3 = 1; wait( s ); s3 = 0; s4 = 1; wait( s ); } } else if ( xl ) { sprintf( report, " _____________\n" \ "|_____________| *\n" ); for ( int i = 0; i < 20/4; i++ ) { s4 = 1; s3 = 0; s2 = 0; s1 = 0; wait( s ); s4 = 0; s3 = 1; wait( s ); s3 = 0; s2 = 1; wait( s ); s2 = 0; s1 = 1; wait( s ); } } else if ( yh) { sprintf( report, " _____________\n" \ "|______v______|\n" ); for ( int i = 0; i < 20/4; i++ ) { s5 = 1; s6 = 0; s7 = 0; s8 = 0; wait( s ); s5 = 0; s6 = 1; wait( s ); s6 = 0; s7 = 1; wait( s ); s7 = 0; s8 = 1; wait( s ); } } else if ( yl ) { sprintf( report, " _____________\n" \ "|______^______|\n" ); for ( int i = 0; i < 20/4; i++ ) { s8 = 1; s7 = 0; s6 = 0; s5 = 0; wait( s ); s8 = 0; s7 = 1; wait( s ); s7 = 0; s6 = 1; wait( s ); s6 = 0; s5 = 1; wait( s ); } } else if ( zh ) { sprintf( report, " ______*______ \n" \ "|_____________|\n" ); } else if ( zl ) { sprintf( report, " ____________\n" \ "|____________|\n" \ " * \n" ); } else { sprintf( report, "None of the 6D orientation axes is set in LSM6DSL - accelerometer.\r\n" ); } oled.printf( report ); printf( report ); wait( 0.2f ); } }
26.94702
129
0.454657
mc-b
4adecf3561bc0798c3d9fca682a5604b1cc337ce
850
cpp
C++
client/UI/angelscript/RegistryUtils.cpp
vblanco20-1/NovusCore-Client
662596465a1851cb87240290f34544f4edf76aa0
[ "MIT" ]
null
null
null
client/UI/angelscript/RegistryUtils.cpp
vblanco20-1/NovusCore-Client
662596465a1851cb87240290f34544f4edf76aa0
[ "MIT" ]
null
null
null
client/UI/angelscript/RegistryUtils.cpp
vblanco20-1/NovusCore-Client
662596465a1851cb87240290f34544f4edf76aa0
[ "MIT" ]
null
null
null
#include "RegistryUtils.h" #include <entity/registry.hpp> #include <angelscript.h> #include "../../Scripting/ScriptEngine.h" #include "../../Utils/ServiceLocator.h" #include "../ECS/Components/Singletons/UILockSingleton.h" namespace UIUtils::Registry { void RegisterNamespace() { i32 r = ScriptEngine::SetNamespace("UI"); assert(r >= 0); { r = ScriptEngine::RegisterScriptFunction("LockToken@ GetLock(uint8 state)", asFUNCTION(GetLock)); assert(r >= 0); } r = ScriptEngine::ResetNamespace(); } UIScripting::LockToken* GetLock(UIScripting::LockState state) { entt::registry* registry = ServiceLocator::GetUIRegistry(); auto lockSingleton = &registry->ctx<UISingleton::UILockSingleton>(); return new UIScripting::LockToken(lockSingleton->mutex, state); } }
31.481481
125
0.667059
vblanco20-1
4ae0ef4b84a3c1ed20f28b9fdf2a405a58f0a250
594
cpp
C++
tests/core/test_fcvt.cpp
albertobarri/idk
a250884f79e2a484251fc750bb915ecbc962be58
[ "MIT" ]
9,724
2015-01-01T02:06:30.000Z
2019-01-17T15:13:51.000Z
tests/core/test_fcvt.cpp
albertobarri/idk
a250884f79e2a484251fc750bb915ecbc962be58
[ "MIT" ]
7,584
2019-01-17T22:58:27.000Z
2022-03-31T23:10:22.000Z
tests/core/test_fcvt.cpp
albertobarri/idk
a250884f79e2a484251fc750bb915ecbc962be58
[ "MIT" ]
1,519
2015-01-01T18:11:12.000Z
2019-01-17T14:16:02.000Z
/* * Copyright 2016 The Emscripten Authors. All rights reserved. * Emscripten is available under two separate licenses, the MIT license and the * University of Illinois/NCSA Open Source License. Both these licenses can be * found in the LICENSE file. */ /* This example borrowed from MSDN documentation */ #include <stdlib.h> #include <stdio.h> int main() { int decimal, sign; char *buffer; double source = 3.1415926535; buffer = fcvt(source, 7, &decimal, &sign); printf("source: %2.10f buffer: '%s' decimal: %d sign: %d\n", source, buffer, decimal, sign); }
28.285714
79
0.685185
albertobarri
4ae17bffcf832c2d3d387c99b83e349b73b95b58
1,749
hpp
C++
CSGOSimple/features/visuals.hpp
dodo343434/aurawareSelfLeak
ca05649ce42fb4ceed7dea52e04f73d0627feb65
[ "MIT" ]
null
null
null
CSGOSimple/features/visuals.hpp
dodo343434/aurawareSelfLeak
ca05649ce42fb4ceed7dea52e04f73d0627feb65
[ "MIT" ]
null
null
null
CSGOSimple/features/visuals.hpp
dodo343434/aurawareSelfLeak
ca05649ce42fb4ceed7dea52e04f73d0627feb65
[ "MIT" ]
null
null
null
#pragma once class C_BasePlayer; class C_BaseEntity; class C_BaseCombatWeapon; class C_PlantedC4; class Color; class ClientClass; class CUserCmd; extern unsigned long esp_font; extern unsigned long hit_font; namespace Visuals { namespace Player { bool Begin(C_BasePlayer* pl); void RenderBox(); void RenderName(); void RenderHealth(); void RenderArmour(); void RenderWeapon(); void RenderSnapline(); //void BoneESP(C_BasePlayer * entity); void HeadEsp(C_BasePlayer * entity); void KevESP(C_BasePlayer * entity); void EyePos(C_BasePlayer * ent); } namespace Misc {; void Radar(); void RenderC4Info(C_PlantedC4 * ent); void Flash(C_BasePlayer * entity); void GrenESP(C_BaseCombatWeapon * m_nade); void EyePos(C_BasePlayer * ent); void Skel(C_BasePlayer * ent); void SniperX(C_BasePlayer * entity); void RenderWeapon(C_BaseCombatWeapon* ent) ; void RenderNet(C_BasePlayer * Player); void RenderDefuseKit(C_BasePlayer * ent); //void RenderDefuseKit(C_BaseEntity* ent); void RenderPlantedC4(C_BaseEntity* ent); void NightMode(); void KnifeLeft(); void RecoilCrosshair(); void SkyChanger(); void ColorModulateSkybox(); void ThirdPerson(); void Noscope(); void SetLocalPlayerReady(); //void DamageInd; //void Recoilx(C_BaseEntity * loc, C_BasePlayer * ply); } /* if (g_Options.ColorSkybox) { Visuals::Misc::ColorModulateSkybox(); }/**/ bool CreateFonts(); void DestroyFonts(); bool IsVisibleScan(C_BasePlayer * player); void DrawString(unsigned long font, int x, int y, Color color, unsigned long alignment, const char * msg, ...); void Hitbox(int index); }
16.817308
112
0.683248
dodo343434
4ae34591bddc4e70017cd072707c581c181e94a3
567
cpp
C++
fboss/qsfp_service/oss/QsfpServer.cpp
fakeNetflix/facebook-repo-fboss
b4b64540c779022bcbeff72376549d0addf3f7e7
[ "BSD-3-Clause" ]
7
2016-09-22T22:53:09.000Z
2016-10-05T13:19:16.000Z
fboss/qsfp_service/oss/QsfpServer.cpp
fakeNetflix/facebook-repo-fboss
b4b64540c779022bcbeff72376549d0addf3f7e7
[ "BSD-3-Clause" ]
2
2018-10-06T18:29:44.000Z
2018-10-07T16:46:04.000Z
fboss/qsfp_service/oss/QsfpServer.cpp
fakeNetflix/facebook-repo-fboss
b4b64540c779022bcbeff72376549d0addf3f7e7
[ "BSD-3-Clause" ]
1
2018-02-28T06:57:20.000Z
2018-02-28T06:57:20.000Z
#include "fboss/qsfp_service/QsfpServiceHandler.h" #include <thrift/lib/cpp2/server/ThriftServer.h> #include <folly/init/Init.h> using namespace facebook; using namespace facebook::fboss; int qsfpServiceInit(int * argc, char *** argv ) { folly::init(argc, argv, true); return 0; } int doServerLoop(std::shared_ptr<apache::thrift::ThriftServer> thriftServer, std::shared_ptr<QsfpServiceHandler> /* unused */) { thriftServer->setup(); folly::EventBase * evb = thriftServer->getEventBaseManager()->getEventBase(); evb->loopForever(); return 0; }
27
79
0.726631
fakeNetflix
4ae471ce2322fd2eb3a37e23556ac93916f5ae13
1,270
hpp
C++
src/oath/base32.hpp
animeslave/bbauth
d10861c8a4a72ee8186fb11de739556c03cbfc4d
[ "Apache-2.0" ]
1
2021-05-20T03:50:21.000Z
2021-05-20T03:50:21.000Z
src/oath/base32.hpp
animeslave/bbry-gauth
d10861c8a4a72ee8186fb11de739556c03cbfc4d
[ "Apache-2.0" ]
3
2021-05-20T03:52:23.000Z
2021-05-20T16:20:29.000Z
src/oath/base32.hpp
BerryTrucks/bbry-gauth
1d6850a0a7756077f55b8253b18611bc3df5045d
[ "Apache-2.0" ]
1
2021-05-20T03:51:14.000Z
2021-05-20T03:51:14.000Z
////////////////////////////////////////////////////////////////////// // Base32.h ////////////////////////////////////////////////////////////////////// #ifndef BASE32_HPP_ #define BASE32_HPP_ #include <stdint.h> /* Base32 encoding / decoding. Encode32 outputs at out bytes with values from 0 to 32 that can be mapped to 32 signs. Decode32 input is the output of Encode32. The out parameters should be unsigned char[] of length GetDecode32Length(inLen) and GetEncode32Length(inLen) respectively. To map the output of Encode32 to an alphabet of 32 characters use Map32. To unmap back the output of Map32 to an array understood by Decode32 use Unmap32. Both Map32 and Unmap32 do inplace modification of the inout32 array. The alpha32 array must be exactly 32 chars long. */ struct Base32 { static bool Decode32(unsigned char* in, int inLen, unsigned char* out); static bool Encode32(unsigned char* in, int inLen, unsigned char* out); static int GetDecode32Length(int bytes); static int GetEncode32Length(int bytes); static bool Map32(unsigned char* inout32, int inout32Len, unsigned char* alpha32); static bool Unmap32(unsigned char* inout32, int inout32Len, unsigned char* alpha32); }; #endif /* BASE32_HPP_ */
37.352941
91
0.662992
animeslave
4ae75478444782d7145cccc450b7a9468e5d548d
5,670
cc
C++
math/bspline_basis.cc
RobotLocomotion/drake-python3.7
ae397a4c6985262d23e9675b9bf3927c08d027f5
[ "BSD-3-Clause" ]
2
2021-02-25T02:01:02.000Z
2021-03-17T04:52:04.000Z
math/bspline_basis.cc
RobotLocomotion/drake-python3.7
ae397a4c6985262d23e9675b9bf3927c08d027f5
[ "BSD-3-Clause" ]
null
null
null
math/bspline_basis.cc
RobotLocomotion/drake-python3.7
ae397a4c6985262d23e9675b9bf3927c08d027f5
[ "BSD-3-Clause" ]
1
2021-06-13T12:05:39.000Z
2021-06-13T12:05:39.000Z
#include "drake/math/bspline_basis.h" #include <algorithm> #include <functional> #include <set> #include <utility> #include <fmt/format.h> #include "drake/common/default_scalars.h" namespace drake { namespace math { namespace { template <typename T> std::vector<T> MakeKnotVector(int order, int num_basis_functions, KnotVectorType type, const T& initial_parameter_value, const T& final_parameter_value) { if (num_basis_functions < order) { throw std::invalid_argument(fmt::format( "The number of basis functions ({}) should be greater than or " "equal to the order ({}).", num_basis_functions, order)); } DRAKE_DEMAND(initial_parameter_value <= final_parameter_value); const int num_knots{num_basis_functions + order}; std::vector<T> knots(num_knots); const T knot_interval = (final_parameter_value - initial_parameter_value) / (num_basis_functions - order + 1.0); for (int i = 0; i < num_knots; ++i) { if (i < order && type == KnotVectorType::kClampedUniform) { knots.at(i) = initial_parameter_value; } else if (i >= num_basis_functions && type == KnotVectorType::kClampedUniform) { knots.at(i) = final_parameter_value; } else { knots.at(i) = initial_parameter_value + knot_interval * (i - (order - 1)); } } return knots; } // This custom comparator is needed to explicitly convert Formula to bool when // T == Expression. template <typename T> bool less_than_with_cast(const T& val, const T& other) { return static_cast<bool>(val < other); } } // namespace template <typename T> BsplineBasis<T>::BsplineBasis(int order, std::vector<T> knots) : order_(order), knots_(std::move(knots)) { if (static_cast<int>(knots_.size()) < 2 * order) { throw std::invalid_argument( fmt::format("The number of knots ({}) should be greater than or " "equal to twice the order ({}).", knots_.size(), 2 * order)); } DRAKE_ASSERT(CheckInvariants()); } template <typename T> BsplineBasis<T>::BsplineBasis(int order, int num_basis_functions, KnotVectorType type, const T& initial_parameter_value, const T& final_parameter_value) : BsplineBasis<T>(order, MakeKnotVector<T>(order, num_basis_functions, type, initial_parameter_value, final_parameter_value)) {} template <typename T> std::vector<int> BsplineBasis<T>::ComputeActiveBasisFunctionIndices( const std::array<T, 2>& parameter_interval) const { DRAKE_ASSERT(parameter_interval[0] <= parameter_interval[1]); DRAKE_ASSERT(parameter_interval[0] >= initial_parameter_value()); DRAKE_ASSERT(parameter_interval[1] <= final_parameter_value()); const int first_active_index = FindContainingInterval(parameter_interval[0]) - order() + 1; const int final_active_index = FindContainingInterval(parameter_interval[1]); std::vector<int> active_control_point_indices{}; active_control_point_indices.reserve(final_active_index - first_active_index); for (int i = first_active_index; i <= final_active_index; ++i) { active_control_point_indices.push_back(i); } return active_control_point_indices; } template <typename T> std::vector<int> BsplineBasis<T>::ComputeActiveBasisFunctionIndices( const T& parameter_value) const { return ComputeActiveBasisFunctionIndices( {{parameter_value, parameter_value}}); } template <typename T> T BsplineBasis<T>::EvaluateBasisFunctionI(int index, const T& parameter_value) const { std::vector<T> delta(num_basis_functions(), 0.0); delta[index] = 1.0; return EvaluateCurve(delta, parameter_value); } template <typename T> int BsplineBasis<T>::FindContainingInterval(const T& parameter_value) const { DRAKE_ASSERT(parameter_value >= initial_parameter_value()); DRAKE_ASSERT(parameter_value <= final_parameter_value()); const std::vector<T>& t = knots(); const T& t_bar = parameter_value; return std::distance( t.begin(), std::prev(t_bar < final_parameter_value() ? std::upper_bound(t.begin(), t.end(), t_bar, less_than_with_cast<T>) : std::lower_bound(t.begin(), t.end(), t_bar, less_than_with_cast<T>))); } template <typename T> boolean<T> BsplineBasis<T>::operator==(const BsplineBasis<T>& other) const { if (this->order() == other.order() && this->num_basis_functions() == other.num_basis_functions()) { boolean<T> result{true}; const int num_knots{num_basis_functions() + order()}; for (int i = 0; i < num_knots; ++i) { result = result && (this->knots()[i] == other.knots()[i]); if (std::equal_to<boolean<T>>{}(result, boolean<T>{false})) { break; } } return result; } else { return boolean<T>{false}; } } template <typename T> boolean<T> BsplineBasis<T>::operator!=(const BsplineBasis<T>& other) const { return !this->operator==(other); } template<typename T> bool BsplineBasis<T>::CheckInvariants() const { return std::is_sorted(knots_.begin(), knots_.end(), less_than_with_cast<T>) && static_cast<int>(knots_.size()) >= 2 * order_; } } // namespace math } // namespace drake DRAKE_DEFINE_CLASS_TEMPLATE_INSTANTIATIONS_ON_DEFAULT_SCALARS( class ::drake::math::BsplineBasis)
36.580645
80
0.643563
RobotLocomotion
4ae7be5391a247fdb49f2c6a31f7ca2d7f6c61e0
1,130
cpp
C++
src/ROSUnit_UpdateReference.cpp
CaptCrunch333/positioning_system
62da7f2773dae9a66f3e89d6134453fba526bb11
[ "BSD-3-Clause" ]
null
null
null
src/ROSUnit_UpdateReference.cpp
CaptCrunch333/positioning_system
62da7f2773dae9a66f3e89d6134453fba526bb11
[ "BSD-3-Clause" ]
null
null
null
src/ROSUnit_UpdateReference.cpp
CaptCrunch333/positioning_system
62da7f2773dae9a66f3e89d6134453fba526bb11
[ "BSD-3-Clause" ]
null
null
null
#include "ROSUnit_UpdateReference.hpp" //TODO rename the topics and class ROSUnit_UpdateReference* ROSUnit_UpdateReference::_instance_ptr = NULL; UpdatePoseMessage ROSUnit_UpdateReference::_pose_ref_msg; ROSUnit_UpdateReference::ROSUnit_UpdateReference(ros::NodeHandle& t_main_handler) : ROSUnit(t_main_handler) { _srv_setpoint = t_main_handler.advertiseService("update_pose_reference", callbackSetpoint); _instance_ptr = this; } ROSUnit_UpdateReference::~ROSUnit_UpdateReference() { } void ROSUnit_UpdateReference::receive_msg_data(DataMessage* t_msg){ } bool ROSUnit_UpdateReference::callbackSetpoint( positioning_system::Update_Pose_Reference::Request &req, positioning_system::Update_Pose_Reference::Response &res){ //TODO change to receive only one reference at a time float x, y, z, yaw; x = req.setpoint_pose.x; y = req.setpoint_pose.y; z = req.setpoint_pose.z; yaw = req.setpoint_pose.yaw; _pose_ref_msg.setPoseMessage(x, y, z, yaw); _instance_ptr->emit_message((DataMessage*) &_pose_ref_msg); return true; }
30.540541
109
0.738938
CaptCrunch333
4ae8970872e04db2464dc837d48998bde06abfbb
2,675
hpp
C++
include/board.hpp
oschonrock/chess
51da68c767879ef44a7fcdba85ae9a212ceb7b8b
[ "BSD-3-Clause" ]
null
null
null
include/board.hpp
oschonrock/chess
51da68c767879ef44a7fcdba85ae9a212ceb7b8b
[ "BSD-3-Clause" ]
null
null
null
include/board.hpp
oschonrock/chess
51da68c767879ef44a7fcdba85ae9a212ceb7b8b
[ "BSD-3-Clause" ]
null
null
null
/** * File: board.h * * Content on and manipulation of a chess board implemented as 10x12 squares, * with default out_of_border values. * * "magic" numbers will be used, they aren't magic if you know this structure. * Source way too messy with a lot of variable names and variable calculations instead of plain * numbers. * * Author: Ken Rouwas * Date 2017-09-14 * * Refactored and expanded upon by Oliver Schönrock - 2021 */ #pragma once #include <array> #include <cstdlib> #include <exception> #include <iostream> #include <sys/types.h> #include <vector> namespace chess { constexpr size_t board_size = 10 * 12; enum class color { white, black, none }; inline color flip_turn(color turn) { return (turn == color::white) ? color::black : color::white; } enum class piece : int { king, // a king without castle potential king_castle, // a king with castle potential queen, pawn, // a pawn without en passant potential pawn_en_passant, // a pawn with en passant potential rook, rook_castle, knight, bishop, none, out_of_board // Illegal position }; struct square { square() = default; square(piece p, color c) : piece_color_(c), piece_(p) {} color piece_color_ = color::none; piece piece_ = piece::out_of_board; }; struct board_change { board_change() : where_(move_done) {} // default is terminator, at end of move sequence board_change(ssize_t where, square old_square) : where_(where), old_square_(old_square) {} [[nodiscard]] bool is_terminator() const { return where_ == move_done; } size_t where_; square old_square_; constexpr static size_t move_done = board_size; }; class board { public: void init(); void set(const size_t where, square s) { if (where >= board_size) throw std::out_of_range("board::set : out of range error"); squares_[where] = s; } [[nodiscard]] square get(const size_t where) const { if (where >= board_size) throw std::out_of_range("board::get : out of range error"); return squares_[where]; } void undo_move() { if (bh_.empty()) return; if (bh_.back().is_terminator()) bh_.pop_back(); while (!bh_.empty() && !bh_.back().is_terminator()) { set(bh_.back().where_, bh_.back().old_square_); bh_.pop_back(); } } void do_change(size_t where, square new_square) { bh_.emplace_back(where, get(where)); set(where, new_square); } void terminate_change() { bh_.emplace_back(); // default constructor gives the terminator } private: std::array<square, board_size> squares_; std::vector<board_change> bh_; }; std::string where_to_str(size_t where); } // namespace chess
24.768519
99
0.680374
oschonrock
4ae9fec185526c0e5e8c44151a4df18cf7536d35
1,070
cpp
C++
icpc/2019-3-3/G-std.cpp
Riteme/test
b511d6616a25f4ae8c3861e2029789b8ee4dcb8d
[ "BSD-Source-Code" ]
3
2018-08-30T09:43:20.000Z
2019-12-03T04:53:43.000Z
icpc/2019-3-3/G-std.cpp
Riteme/test
b511d6616a25f4ae8c3861e2029789b8ee4dcb8d
[ "BSD-Source-Code" ]
null
null
null
icpc/2019-3-3/G-std.cpp
Riteme/test
b511d6616a25f4ae8c3861e2029789b8ee4dcb8d
[ "BSD-Source-Code" ]
null
null
null
#include <cstdio> //FILE *fin = fopen("a.in", "r"), *fout = fopen("a.out", "w"); #define fin stdin #define fout stdout #define CAT 300003 #define LIM 500009 double v[LIM], add[LIM]; int h; inline void baga(int a, int b, int x, int y) { if (b == y) { add[b - h + CAT] += x - a; add[b + 1 + CAT] -= x - a; return ; } if (b < y) b ^= y ^= b ^= y; double u = (x - a) / (double) (b - y); v[y - h + CAT] += u; v[b - h + CAT] -= u; v[y + CAT] -= u; v[b + CAT] += u; } int main() { int n; fscanf(fin, "%d%d", &n, &h); int a = 0, b = 0; for (int i = 1; i <= n; i++) { int x, y; fscanf(fin, "%d%d", &x, &y); baga(a, b, x, y); a = x; b = y; } double ans = 0, acum = 0, panta = 0, sc = 0; for (int i = 0; i < LIM; i++) { acum += panta; panta += v[i]; sc += add[i]; if (acum + sc > ans) ans = acum + sc; } fprintf(fout, "%.12f\n", ans); fclose(fin); fclose(fout); return 0; }
18.448276
62
0.400935
Riteme
4aea705d3a4dea8425e86e05654cc2411639b518
1,498
cc
C++
src/ops/tile.cc
funboarder13920/CTranslate2
6b14d9a948c5d30c08cba8c9d20c49e73de97523
[ "MIT" ]
null
null
null
src/ops/tile.cc
funboarder13920/CTranslate2
6b14d9a948c5d30c08cba8c9d20c49e73de97523
[ "MIT" ]
1
2020-12-24T01:00:33.000Z
2020-12-24T01:02:02.000Z
src/ops/tile.cc
funboarder13920/CTranslate2
6b14d9a948c5d30c08cba8c9d20c49e73de97523
[ "MIT" ]
1
2020-12-23T11:21:59.000Z
2020-12-23T11:21:59.000Z
#include "ctranslate2/ops/tile.h" #include "device_dispatch.h" #include "type_dispatch.h" namespace ctranslate2 { namespace ops { Tile::Tile(const dim_t axis, const dim_t num_tiles) : _axis(axis) , _num_tiles(num_tiles) { } void Tile::operator()(const StorageView& input, StorageView& output) const { PROFILE("Tile"); const dim_t axis = _axis < 0 ? input.rank() + _axis : _axis; if (axis >= input.rank()) throw std::out_of_range("Can't tile axis " + std::to_string(axis) + " for input with rank " + std::to_string(input.rank())); { Shape output_shape(input.shape()); output_shape[axis] *= _num_tiles; output.resize(std::move(output_shape)); } dim_t inner_size = 1; dim_t outer_size = 1; for (dim_t i = 0; i < axis; ++i) outer_size *= input.dim(i); for (dim_t i = axis; i < input.rank(); ++i) inner_size *= input.dim(i); DEVICE_DISPATCH(input.device(), TYPE_DISPATCH(input.dtype(), (compute<D, T>(input, outer_size, inner_size, output)))); } void Tile::operator()(StorageView& input) const { StorageView input_clone(std::move(input)); operator()(input_clone, input); } } }
29.96
90
0.506008
funboarder13920
4aec6db1a21eba59439ff4d6601bd1d220c4e804
6,375
cc
C++
lite/kernels/cuda/nearest_interp_compute_test.cc
tensor-tang/Paddle-Lite
d60b8d611bdf7c377dbe239954c60f25f70c9a75
[ "Apache-2.0" ]
null
null
null
lite/kernels/cuda/nearest_interp_compute_test.cc
tensor-tang/Paddle-Lite
d60b8d611bdf7c377dbe239954c60f25f70c9a75
[ "Apache-2.0" ]
null
null
null
lite/kernels/cuda/nearest_interp_compute_test.cc
tensor-tang/Paddle-Lite
d60b8d611bdf7c377dbe239954c60f25f70c9a75
[ "Apache-2.0" ]
null
null
null
// Copyright (c) 2019 PaddlePaddle Authors. All Rights Reserved. // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. #include "lite/kernels/cuda/nearest_interp_compute.h" #include <gtest/gtest.h> #include <memory> #include <utility> #include "lite/fluid/eigen.h" namespace paddle { namespace lite { namespace kernels { namespace cuda { template <typename T, size_t D, int MajorType = Eigen::RowMajor, typename IndexType = Eigen::DenseIndex> using EigenTensor = lite::fluid::EigenTensor<T, D, MajorType, IndexType>; using Tensor = lite::Tensor; static void NearestNeighborInterpolate(const Tensor& input, Tensor* output, const float ratio_h, const float ratio_w, const int n, const int c, const int out_h, const int out_w, const bool align_corners) { auto input_t = EigenTensor<float, 4>::From(input); auto output_t = EigenTensor<float, 4>::From(*output); for (int k = 0; k < out_h; k++) { // loop for images int in_k = (align_corners) ? static_cast<int>(ratio_h * k + 0.5) : static_cast<int>(ratio_h * k); for (int l = 0; l < out_w; l++) { int in_l = (align_corners) ? static_cast<int>(ratio_w * l + 0.5) : static_cast<int>(ratio_w * l); for (int i = 0; i < n; i++) { // loop for batches for (int j = 0; j < c; j++) { // loop for channels output_t(i, j, k, l) = input_t(i, j, in_k, in_l); } } } } } static void NearestInterpRef(operators::InterpolateParam param, Tensor* input, const size_t scale, const size_t n, const size_t c, const size_t in_h, const size_t in_w, Tensor* output_size, Tensor* output, size_t out_h, size_t out_w) { if (scale > 0) { out_h = static_cast<int>(in_h * scale); out_w = static_cast<int>(in_w * scale); } bool align_corners = param.align_corners; if (output_size != nullptr) { auto out_size_data = output_size->mutable_data<float>(); out_h = static_cast<int>(out_size_data[0]); out_w = static_cast<int>(out_size_data[1]); } float* input_data = input->mutable_data<float>(); LOG(INFO) << *(input_data + 2); float* output_data = output->mutable_data<float>(); LOG(INFO) << *(output_data + 2); if (in_h == out_h && in_w == out_w) { std::memcpy(output_data, input_data, sizeof(float) * n * c * in_h * in_w); LOG(INFO) << *(output_data + 2); return; } float ratio_h = 0.f; float ratio_w = 0.f; if (out_h > 1) { ratio_h = (align_corners) ? static_cast<float>(in_h - 1) / (out_h - 1) : static_cast<float>(in_h) / out_h; } if (out_w > 1) { ratio_w = (align_corners) ? static_cast<float>(in_w - 1) / (out_w - 1) : static_cast<float>(in_w) / out_w; } NearestNeighborInterpolate( *input, output, ratio_h, ratio_w, n, c, out_h, out_w, align_corners); } TEST(nearest_interp, normal) { NearestInterpCompute nearest_interp_kernel; std::unique_ptr<KernelContext> ctx(new KernelContext); auto& context = ctx->As<CUDAContext>(); operators::InterpolateParam param; Tensor x, osz, out; Tensor x_cpu, osz_cpu, out_cpu; Tensor x_ref, osz_ref, out_ref; int n = 1, c = 3, in_h = 4, in_w = 4; int in_chw = c * in_h * in_w; int out_h = 4, out_w = 4; float scale = 2.0; param.out_h = out_h; param.out_w = out_w; param.scale = scale; param.align_corners = false; x.Resize({n, c, in_h, in_w}); osz.Resize({2}); out.Resize({n, c, out_h, out_w}); x_cpu.Resize({n, c, in_h, in_w}); osz_cpu.Resize({2}); out_cpu.Resize({n, c, out_h, out_w}); x_ref.Resize({n, c, in_h, in_w}); osz_ref.Resize({2}); out_ref.Resize({n, c, out_h, out_w}); auto* x_data = x.mutable_data<float>(TARGET(kCUDA)); auto* osz_data = osz.mutable_data<float>(TARGET(kCUDA)); auto* out_data = out.mutable_data<float>(TARGET(kCUDA)); float* x_cpu_data = x_cpu.mutable_data<float>(); float* osz_cpu_data = osz_cpu.mutable_data<float>(); float* out_cpu_data = out_cpu.mutable_data<float>(); float* x_ref_data = x_ref.mutable_data<float>(); float* osz_ref_data = osz_ref.mutable_data<float>(); float* out_ref_data = out_ref.mutable_data<float>(); for (int i = 0; i < x_cpu.numel(); ++i) { x_cpu_data[i] = i + 5.0; x_ref_data[i] = i + 5.0; } osz_cpu_data[0] = out_h; osz_cpu_data[1] = out_w; osz_ref_data[0] = out_h; osz_ref_data[1] = out_w; x.Assign<float, lite::DDim, TARGET(kCUDA)>(x_cpu_data, x_cpu.dims()); osz.Assign<float, lite::DDim, TARGET(kCUDA)>(osz_cpu_data, osz_cpu.dims()); param.X = &x; param.OutSize = &osz; param.Out = &out; nearest_interp_kernel.SetParam(param); cudaStream_t stream; cudaStreamCreate(&stream); context.SetExecStream(stream); nearest_interp_kernel.SetContext(std::move(ctx)); nearest_interp_kernel.Launch(); cudaDeviceSynchronize(); CopySync<TARGET(kCUDA)>( out_cpu_data, out_data, sizeof(float) * out.numel(), IoDirection::DtoH); NearestInterpRef( param, &x_ref, scale, n, c, in_h, in_w, &osz_ref, &out_ref, out_h, out_w); for (int i = 0; i < out.numel(); i++) { EXPECT_NEAR(out_cpu_data[i], out_ref_data[i], 1e-5); } } } // namespace cuda } // namespace kernels } // namespace lite } // namespace paddle
34.090909
80
0.591529
tensor-tang
4aece99356a22bba0e4530067873fc7e15b0d15f
605
hpp
C++
top-k_OAFP_pos/src/varlist.hpp
ShowHey57/top-k_AOFP_pos
afbd69ca41a73dc5f0fcd86cad643a01df16e0a9
[ "MIT" ]
null
null
null
top-k_OAFP_pos/src/varlist.hpp
ShowHey57/top-k_AOFP_pos
afbd69ca41a73dc5f0fcd86cad643a01df16e0a9
[ "MIT" ]
null
null
null
top-k_OAFP_pos/src/varlist.hpp
ShowHey57/top-k_AOFP_pos
afbd69ca41a73dc5f0fcd86cad643a01df16e0a9
[ "MIT" ]
null
null
null
#ifndef VAR_LIST_HPP_ #define VAR_LIST_HPP_ #include <cstdint> #include <cstdlib> #include <iostream> #include <vector> #include "constant_numbers.hpp" #include "common_functions.hpp" #include "vardata.hpp" class VarList{ private: std::vector<VarData*> varlist_; //pointer of VarData's vector public: VarList(): varlist_(0){}; ~VarList(){}; void Init(); void Set(VarData* kVdata); void Push(VarData* kVdata); uint64_t Pop(); bool IsEmpty(); void Free(); VarData* VpPop(); uint64_t Size(); uint64_t GetVar(); uint64_t GetFreq(); }; #endif // VAR_LIST_HPP_
18.333333
63
0.67438
ShowHey57
4aefe700dc764e8752c22c91169835f102615662
38,368
cpp
C++
TEST_APPS/device/socket_app/cmd_socket.cpp
c1728p9/mbed
784fa91294fb4849ab761fe558af7c3cfa2a9174
[ "Apache-2.0" ]
null
null
null
TEST_APPS/device/socket_app/cmd_socket.cpp
c1728p9/mbed
784fa91294fb4849ab761fe558af7c3cfa2a9174
[ "Apache-2.0" ]
5
2018-08-15T12:02:20.000Z
2018-09-03T11:28:18.000Z
TEST_APPS/device/socket_app/cmd_socket.cpp
c1728p9/mbed
784fa91294fb4849ab761fe558af7c3cfa2a9174
[ "Apache-2.0" ]
null
null
null
/* * Copyright (c) 2018 ARM Limited. All rights reserved. * SPDX-License-Identifier: Apache-2.0 * Licensed under the Apache License, Version 2.0 (the License); you may * not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an AS IS BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ #include "mbed.h" #include "NetworkStack.h" #include "UDPSocket.h" #include "TCPSocket.h" #include "TCPServer.h" #include "NetworkInterface.h" #include "SocketAddress.h" #include "Queue.h" #include <vector> #include <cctype> #include <cassert> #include <cstring> #ifndef __STDC_FORMAT_MACROS #define __STDC_FORMAT_MACROS #endif #include <inttypes.h> #include "mbed-client-cli/ns_cmdline.h" #include "mbed-trace/mbed_trace.h" #include "strconv.h" #define TRACE_GROUP "Asck" #include "cmd_ifconfig.h" #include "cmd_socket.h" #define SIGNAL_SIGIO 0x1 #define PACKET_SIZE_ARRAY_LEN 5 #define MAN_SOCKET "\r\nSOCKET API\r\n"\ "\r\n"\ "socket <operation> [options]\r\n\r\n"\ " new <type>\r\n" \ " type: UDPSocket|TCPSocket|TCPServer\r\n"\ " return socket id\r\n"\ " <id> delete\r\n"\ " remote the space allocated for Socket\r\n"\ " <id> open\r\n"\ " <id> close\r\n"\ " <id> bind [port] <port> [addr <addr>]\r\n"\ " <id> set_blocking <bool>\r\n"\ " <id> set_timeout <ms>\r\n"\ " <id> register_sigio_cb\r\n"\ " <id> set_RFC_864_pattern_check <true|false>\r\n"\ "\r\nFor UDPSocket\r\n"\ " <id> sendto <addr> <port> (\"msg\" | --data_len <len>)\r\n"\ " \"msg\" Send packet with defined string content\r\n"\ " --data_len Send packet with random content with size <len>\r\n"\ " <id> recvfrom <len>\r\n"\ " <id> start_udp_receiver_thread --max_data_len <len> [--packets <N>]\r\n"\ " --max_data_len Size of input buffer to fill up\r\n"\ " --packets Receive N number of packets, default 1\r\n"\ "\r\nFor TCPSocket\r\n"\ " <id> connect <host> <port>\r\n"\ " <id> send (\"msg\" | --data_len <len>)\r\n"\ " <id> recv <len>\r\n"\ " <id> start_tcp_receiver_thread --data_len <len> [--max_recv_len <L>] [--repeat <N>]\r\n"\ " --data_len Size of input buffer to fill up\r\n"\ " --max_recv_len Read maximum of L bytes in at a time. Default full buffer <len>\r\n"\ " --repeat Repeat buffer filling N times, default 1\r\n"\ " <id> join_tcp_receiver_thread\r\n"\ " <id> start_bg_traffic_thread\r\n"\ " <id> join_bg_traffic_thread\r\n"\ " <id> setsockopt_keepalive <seconds[0-7200]>\r\n"\ " <id> getsockopt_keepalive\r\n"\ "\r\nFor TCPServer\r\n"\ " <id> listen [backlog]\r\n"\ " <id> accept <new_id>\r\n"\ " accept new connection into <new_id> socket. Requires <new_id> to be pre-allocated.\r\n"\ "\r\nOther options\r\n"\ " print-mode [--string|--hex|--disabled] [--col-width <width>]" class SInfo; static Queue<SInfo, 10> event_queue; static int id_count = 0; class SInfo { public: enum SocketType { TCP_CLIENT, TCP_SERVER, UDP }; SInfo(TCPSocket *sock): _id(id_count++), _sock(sock), _type(SInfo::TCP_CLIENT), _blocking(true), _dataLen(0), _maxRecvLen(0), _repeatBufferFill(1), _receivedTotal(0), _receiverThread(NULL), _receiveBuffer(NULL), _senderThreadId(NULL), _receiverThreadId(NULL), _packetSizes(NULL), _check_pattern(false) { assert(sock); } SInfo(TCPServer *sock): _id(id_count++), _sock(sock), _type(SInfo::TCP_SERVER), _blocking(true), _dataLen(0), _maxRecvLen(0), _repeatBufferFill(1), _receivedTotal(0), _receiverThread(NULL), _receiveBuffer(NULL), _senderThreadId(NULL), _receiverThreadId(NULL), _packetSizes(NULL), _check_pattern(false) { assert(sock); } SInfo(UDPSocket *sock): _id(id_count++), _sock(sock), _type(SInfo::UDP), _blocking(true), _dataLen(0), _maxRecvLen(0), _repeatBufferFill(1), _receivedTotal(0), _receiverThread(NULL), _receiveBuffer(NULL), _senderThreadId(NULL), _receiverThreadId(NULL), _packetSizes(NULL), _check_pattern(false) { assert(sock); } ~SInfo() { this->_sock->sigio(Callback<void()>()); if (this->_receiverThread) { this->_receiverThread->terminate(); delete this->_receiverThread; } if (this->_receiveBuffer) { delete this->_receiveBuffer; } delete this->_sock; } int id() const { return this->_id; } Socket &socket() { return *(this->_sock); } Socket &socket() const { return *(this->_sock); } TCPSocket *tcp_socket() { return this->_type == SInfo::TCP_CLIENT ? static_cast<TCPSocket *>(this->_sock) : NULL; } TCPServer *tcp_server() { return this->_type == SInfo::TCP_SERVER ? static_cast<TCPServer *>(this->_sock) : NULL; } UDPSocket *udp_socket() { return this->_type == SInfo::UDP ? static_cast<UDPSocket *>(this->_sock) : NULL; } SInfo::SocketType type() const { return this->_type; } void setDataCount(int dataCount) { this->_dataLen = dataCount; } int getDataCount() { return this->_dataLen; } void setReceiverThread(Thread *receiverThread) { this->_receiverThread = receiverThread; } Thread *getReceiverThread() { return this->_receiverThread; } void setReceiveBuffer(uint8_t *receiveBuffer) { this->_receiveBuffer = receiveBuffer; } uint8_t *getReceiveBuffer() { return this->_receiveBuffer; } void setMaxRecvLen(int recvLen) { this->_maxRecvLen = recvLen; } int getMaxRecvLen() { return this->_maxRecvLen; } void setRepeatBufferFill(int n) { this->_repeatBufferFill = n; } int getRepeatBufferFill() { return this->_repeatBufferFill; } void setRecvTotal(int n) { this->_receivedTotal = n; } int getRecvTotal() { return this->_receivedTotal; } void setSenderThreadId(osThreadId threadID) { this->_senderThreadId = threadID; } void setReceiverThreadId(osThreadId threadID) { this->_receiverThreadId = threadID; } osThreadId getSenderThreadId() { return this->_senderThreadId; } osThreadId getReceiverThreadId() { return this->_receiverThreadId; } void setPacketSizeArray(int *ptr) { this->_packetSizes = ptr; } int *getPacketSizeArray() { return this->_packetSizes; } void setUnavailable() { this->_available = false; } void setAvailable() { this->_available = true; } bool available() { return this->_available; } void set_pattern_check(bool enabled) { _check_pattern = enabled; }; bool check_pattern(void *buffer, size_t len); const char *type_str() const { const char *str; switch (this->_type) { case SInfo::TCP_CLIENT: str = "TCPSocket"; break; case SInfo::TCP_SERVER: str = "TCPServer"; break; case SInfo::UDP: str = "UDPSocket"; break; default: assert(0); break; } return str; } bool blocking() const { return this->_blocking; } void set_blocking(bool blocking) { socket().set_blocking(blocking); this->_blocking = blocking; } bool can_connect() { return (this->type() == SInfo::TCP_CLIENT); } bool can_bind() { return (this->type() == SInfo::UDP || this->type() == SInfo::TCP_SERVER); } bool can_send() { return (this->type() == SInfo::TCP_CLIENT); } bool can_recv() { return (this->type() == SInfo::TCP_CLIENT); } bool can_sendto() { return (this->type() == SInfo::UDP); } bool can_recvfrom() { return (this->type() == SInfo::UDP); } bool can_listen() { return (this->type() == SInfo::TCP_SERVER); } bool can_accept() { return (this->type() == SInfo::TCP_SERVER); } private: const int _id; Socket *_sock; const SInfo::SocketType _type; bool _blocking; int _dataLen; int _maxRecvLen; int _repeatBufferFill; int _receivedTotal; Thread *_receiverThread; uint8_t *_receiveBuffer; osThreadId _senderThreadId; osThreadId _receiverThreadId; int *_packetSizes; bool _available; bool _check_pattern; SInfo(); }; static std::vector<SInfo *> m_sockets; static enum { PRINT_DISABLED, PRINT_STRING, PRINT_HEX } printing_mode = PRINT_STRING; static int printing_col_width = 20; static int cmd_socket(int argc, char *argv[]); static void print_data(const uint8_t *buf, int len); static void print_data_as_string(const uint8_t *buf, int len, int col_width); static void print_data_as_hex(const uint8_t *buf, int len, int col_width); /** Generate RFC 864 example pattern. * * Pattern is 72 chraracter lines of the ASCII printing characters ending with "\r\n". * There are 95 printing characters in the ASCII character set. * Example: `nc echo.mbedcloudtesting.com 19 | dd bs=1 count=222` * !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefg * !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh * "#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghi * * NOTE: Pattern starts with space, not ! * * \param offset Start pattern from offset * \param len Length of pattern to generate. */ static void generate_RFC_864_pattern(size_t offset, uint8_t *buf, size_t len) { while (len--) { if (offset % 74 == 72) { *buf++ = '\r'; } else if (offset % 74 == 73) { *buf++ = '\n'; } else { *buf++ = ' ' + (offset % 74 + offset / 74) % 95 ; } offset++; } } bool SInfo::check_pattern(void *buffer, size_t len) { if (!_check_pattern) { return true; } void *buf = malloc(len); if (!buf) { return false; } size_t offset = _receivedTotal; generate_RFC_864_pattern(offset, (uint8_t *)buf, len); bool match = memcmp(buf, buffer, len) == 0; if (!match) { cmd_printf("Pattern check failed\r\nWAS:%.*s\r\nREF:%.*s\r\n", len, (char *)buffer, len, (char *)buf); } free(buf); return match; } static void sigio_handler(SInfo *info) { if (info->getReceiverThreadId()) { osSignalSet(info->getReceiverThreadId(), SIGNAL_SIGIO); } if (info->getSenderThreadId()) { osSignalSet(info->getSenderThreadId(), SIGNAL_SIGIO); } } void cmd_socket_init(void) { cmd_add("socket", cmd_socket, "socket", MAN_SOCKET); } int handle_nsapi_error(const char *function, nsapi_error_t ret) { if (ret != NSAPI_ERROR_OK) { cmd_printf("%s returned: %d -> %s\r\n", function, ret, networkstack_error_to_str(ret)); return CMDLINE_RETCODE_FAIL; } return CMDLINE_RETCODE_SUCCESS; } int handle_nsapi_size_or_error(const char *function, nsapi_size_or_error_t ret) { if (ret < 0) { return handle_nsapi_error(function, ret); } else { cmd_printf("%s returned: %d\r\n", function, ret); } return CMDLINE_RETCODE_SUCCESS; } static SInfo *get_sinfo(int id) { for (std::vector<SInfo *>::iterator it = m_sockets.begin(); it != m_sockets.end(); it++) { if ((*it)->id() == id) { return *it; } } return NULL; } static int del_sinfo(SInfo *info) { for (std::vector<SInfo *>::iterator it = m_sockets.begin(); it != m_sockets.end(); it++) { if ((*it) == info) { delete info; m_sockets.erase(it); return CMDLINE_RETCODE_SUCCESS; } } return CMDLINE_RETCODE_FAIL; } static int cmd_socket_new(int argc, char *argv[]) { const char *s; SInfo *info; if (cmd_parameter_last(argc, argv)) { s = cmd_parameter_last(argc, argv); if (strcmp(s, "UDPSocket") == 0) { tr_debug("Creating a new UDPSocket"); info = new SInfo(new UDPSocket); } else if (strcmp(s, "TCPSocket") == 0) { tr_debug("Creating a new TCPSocket"); info = new SInfo(new TCPSocket); } else if (strcmp(s, "TCPServer") == 0) { tr_debug("Creating a new TCPServer"); info = new SInfo(new TCPServer); } else { cmd_printf("unsupported protocol: %s\r\n", s); return CMDLINE_RETCODE_INVALID_PARAMETERS; } } else { cmd_printf("Must specify socket type\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } // Note, this cannot fail. We either succeed or "new" woud call exit(1) in failure. // We did not ask no_throw version of it. cmd_printf("new socket. sid: %d\r\n", info->id()); m_sockets.push_back(info); return CMDLINE_RETCODE_SUCCESS; } static void udp_receiver_thread(SInfo *info) { SocketAddress addr; int i = 0, received = 0; int n = info->getRepeatBufferFill(); int *packetSizes = info->getPacketSizeArray(); nsapi_size_or_error_t ret = 0; info->setReceiverThreadId(Thread::gettid()); while (i < n) { ret = static_cast<UDPSocket &>(info->socket()).recvfrom(&addr, info->getReceiveBuffer() + received, info->getDataCount() - received); if (ret > 0) { if (!info->check_pattern(info->getReceiveBuffer() + received, ret)) { return; } received += ret; packetSizes[i % PACKET_SIZE_ARRAY_LEN] = ret; i++; info->setRecvTotal(info->getRecvTotal() + ret); } else if (ret == NSAPI_ERROR_WOULD_BLOCK) { Thread::signal_wait(SIGNAL_SIGIO); } else { handle_nsapi_size_or_error("Thread: UDPSocket::recvfrom()", ret); return; } } } static nsapi_size_or_error_t start_udp_receiver_thread(SInfo *info, int argc, char *argv[]) { int32_t max_size; int32_t n = 1; if (!cmd_parameter_int(argc, argv, "--max_data_len", &max_size)) { cmd_printf("Need data max data size\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (cmd_parameter_index(argc, argv, "--packets") > 0) { if (!cmd_parameter_int(argc, argv, "--packets", &n)) { cmd_printf("Need number of packets\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } } uint8_t *dataIn = (uint8_t *)malloc(max_size + 1); if (!dataIn) { cmd_printf("malloc() failed\r\n"); return CMDLINE_RETCODE_FAIL; } int *packetSizes = new (nothrow) int[PACKET_SIZE_ARRAY_LEN]; if (!packetSizes) { cmd_printf("Allocation failed\r\n"); return CMDLINE_RETCODE_FAIL; } for (int i = 0; i < PACKET_SIZE_ARRAY_LEN; i++) { packetSizes[i] = 0; } memset(dataIn, 0x00, max_size + 1); info->setReceiveBuffer(dataIn); info->setDataCount(max_size); info->setRepeatBufferFill(n); info->setPacketSizeArray(packetSizes); info->setReceiverThread(new Thread()); info->getReceiverThread()->start(callback(udp_receiver_thread, info)); return CMDLINE_RETCODE_SUCCESS; } static nsapi_size_or_error_t udp_sendto_command_handler(SInfo *info, int argc, char *argv[]) { char *host; int32_t port; if (!cmd_parameter_val(argc, argv, "sendto", &host)) { cmd_printf("Need host name\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (!cmd_parameter_int(argc, argv, host, &port)) { cmd_printf("Need port number\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } // Replace NULL-strings with NULL host = strcmp(host, "NULL") ? host : NULL; int32_t len; void *data; if (cmd_parameter_int(argc, argv, "--data_len", &len)) { data = malloc(len); if (!data) { cmd_printf("Failed to allocate memory\r\n"); return CMDLINE_RETCODE_FAIL; } } else { // Replace NULL-strings with NULL if (strcmp(argv[5], "NULL") == 0) { data = NULL; len = 0; } else { data = argv[5]; len = strlen(argv[5]); } } nsapi_size_or_error_t ret = static_cast<UDPSocket &>(info->socket()).sendto(host, port, data, len); if (ret > 0) { cmd_printf("sent: %d bytes\r\n", ret); } if (data != argv[5]) { free(data); } return handle_nsapi_size_or_error("UDPSocket::sendto()", ret); } static nsapi_size_or_error_t udp_recvfrom_command_handler(SInfo *info, int argc, char *argv[]) { SocketAddress addr; int32_t len; if (!cmd_parameter_int(argc, argv, "recvfrom", &len)) { cmd_printf("Need len\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } void *data = malloc(len); if (!data) { cmd_printf("malloc() failed\r\n"); return CMDLINE_RETCODE_FAIL; } nsapi_size_or_error_t ret = static_cast<UDPSocket &>(info->socket()).recvfrom(&addr, data, len); if (ret > 0) { cmd_printf("UDPSocket::recvfrom, addr=%s port=%d\r\n", addr.get_ip_address(), addr.get_port()); cmd_printf("received: %d bytes\r\n", ret); print_data((const uint8_t *)data, len); if (!info->check_pattern(data, len)) { ret = -1; } info->setRecvTotal(info->getRecvTotal() + ret); } free(data); return handle_nsapi_size_or_error("UDPSocket::recvfrom()", ret); } static void tcp_receiver_thread(SInfo *info) { int i, received; int n = info->getRepeatBufferFill(); int recv_len = info->getMaxRecvLen(); int bufferSize = info->getDataCount(); nsapi_size_or_error_t ret = 0; info->setReceiverThreadId(Thread::gettid()); for (i = 0; i < n; i++) { received = 0; while (received < bufferSize) { ret = static_cast<TCPSocket &>(info->socket()).recv(info->getReceiveBuffer() + received, recv_len - received); if (ret > 0) { if (!info->check_pattern(info->getReceiveBuffer() + received, ret)) { return; } received += ret; info->setRecvTotal(info->getRecvTotal() + ret); } else if (ret == NSAPI_ERROR_WOULD_BLOCK) { Thread::signal_wait(SIGNAL_SIGIO); } else { handle_nsapi_size_or_error("Thread: TCPSocket::recv()", ret); return; } } } } static nsapi_size_or_error_t start_tcp_receiver_thread(SInfo *info, int argc, char *argv[]) { int32_t len; int32_t recv_len; int32_t n = 1; if (!cmd_parameter_int(argc, argv, "--data_len", &len)) { cmd_printf("Need data len\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } recv_len = len; if (cmd_parameter_index(argc, argv, "--max_recv_len") > 0) { if (!cmd_parameter_int(argc, argv, "--max_recv_len", &recv_len)) { cmd_printf("Need max recv len\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } } if (cmd_parameter_index(argc, argv, "--repeat") > 0) { if (!cmd_parameter_int(argc, argv, "--repeat", &n)) { cmd_printf("Need repeat number\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } } uint8_t *dataIn = (uint8_t *)malloc(len + 1); if (!dataIn) { cmd_printf("malloc() failed\r\n"); return CMDLINE_RETCODE_FAIL; } info->setReceiveBuffer(dataIn); info->setDataCount(len); info->setMaxRecvLen(recv_len); info->setRepeatBufferFill(n); info->setReceiverThread(new Thread()); info->getReceiverThread()->start(callback(tcp_receiver_thread, info)); return CMDLINE_RETCODE_SUCCESS; } static nsapi_size_or_error_t tcp_send_command_handler(SInfo *info, int argc, char *argv[]) { int32_t len; void *data; nsapi_size_or_error_t ret = 0; info->setSenderThreadId(Thread::gettid()); if (cmd_parameter_int(argc, argv, "--data_len", &len)) { data = malloc(len); if (!data) { cmd_printf("Failed to allocate memory\r\n"); return CMDLINE_RETCODE_FAIL; } } else { data = argv[3]; len = strlen(argv[3]); } ret = static_cast<TCPSocket &>(info->socket()).send(data, len); if (ret > 0) { cmd_printf("sent: %d bytes\r\n", ret); } if (data != argv[3]) { free(data); } return handle_nsapi_size_or_error("TCPSocket::send()", ret); } static nsapi_size_or_error_t tcp_recv_command_handler(SInfo *info, int argc, char *argv[]) { int32_t len; if (!cmd_parameter_int(argc, argv, "recv", &len)) { cmd_printf("Need length\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } void *data = malloc(len); if (!data) { cmd_printf("malloc() failed\r\n"); return CMDLINE_RETCODE_FAIL; } nsapi_size_or_error_t ret = static_cast<TCPSocket &>(info->socket()).recv(data, len); if (ret > 0) { cmd_printf("received: %d bytes\r\n", ret); print_data((const uint8_t *)data, ret); if (!info->check_pattern(data, ret)) { ret = -1; } info->setRecvTotal(info->getRecvTotal() + ret); } free(data); return handle_nsapi_size_or_error("TCPSocket::recv()", ret); } static nsapi_size_or_error_t recv_all(char *const rbuffer, const int expt_len, SInfo *const info) { int rtotal, rbytes; char *rhead; rtotal = 0; rhead = rbuffer; while (rtotal < expt_len) { rbytes = info->tcp_socket()->recv(rhead, expt_len); if (rbytes <= 0) { // Connection closed abruptly rbuffer[rtotal] = '\0'; return rbytes; } rtotal += rbytes; rhead = rbuffer + rtotal; } rbuffer[rtotal] = '\0'; info->setRecvTotal(info->getRecvTotal() + rtotal); return rtotal; } static void bg_traffic_thread(SInfo *info) { static const int data_len = 10; char sbuffer[data_len + 1] = "dummydata_"; char rbuffer[data_len + 1]; int scount, rtotal = 0; info->setSenderThreadId(Thread::gettid()); for (;;) { if (!info->available()) { (void)handle_nsapi_size_or_error(__func__, rtotal); break; } sbuffer[data_len - 1] = 'A' + (rand() % 26); scount = info->tcp_socket()->send(sbuffer, data_len); rtotal = recv_all(rbuffer, data_len, info); if (scount != rtotal || (strcmp(sbuffer, rbuffer) != 0)) { info->setUnavailable(); tr_err("Background received data does not match to sent data"); tr_err("Background sent: \"%s\"", sbuffer); tr_err("Background received: \"%s\"", rbuffer); } wait_ms(10); } } static nsapi_size_or_error_t start_bg_traffic_thread(SInfo *info, int argc, char *argv[]) { info->setReceiverThread(new Thread()); info->setAvailable(); info->getReceiverThread()->start(callback(bg_traffic_thread, info)); return CMDLINE_RETCODE_SUCCESS; } static void thread_clean_up(SInfo *info) { if (info->getReceiverThread()) { delete info->getReceiverThread(); info->setReceiverThread(NULL); } if (info->getReceiveBuffer()) { delete info->getReceiveBuffer(); info->setReceiveBuffer(NULL); } if (info->getPacketSizeArray()) { delete[] info->getPacketSizeArray(); info->setPacketSizeArray(NULL); } } static int cmd_socket(int argc, char *argv[]) { if (cmd_parameter_index(argc, argv, "new") == 1) { return cmd_socket_new(argc, argv); } else if (cmd_parameter_index(argc, argv, "print-mode") > 0) { if (cmd_parameter_index(argc, argv, "--string") > 0) { printing_mode = PRINT_STRING; } else if (cmd_parameter_index(argc, argv, "--hex") > 0) { printing_mode = PRINT_HEX; } else if (cmd_parameter_index(argc, argv, "--disabled") > 0) { printing_mode = PRINT_DISABLED; } int32_t parsed_col_width = 0; if (cmd_parameter_int(argc, argv, "--col-width", &parsed_col_width)) { if (parsed_col_width <= 0) { cmd_printf("Printing column width must be > 0"); return CMDLINE_RETCODE_FAIL; } if (printing_mode == PRINT_HEX && parsed_col_width > 42) { cmd_printf("Maximum column width for hex data is 42 bytes"); return CMDLINE_RETCODE_FAIL; } printing_col_width = (int)parsed_col_width; } // Allow print-mode to be used as a parameter to other commands if (cmd_parameter_index(argc, argv, "print-mode") == 1) { return CMDLINE_RETCODE_SUCCESS; } } // Rest of the commands require Socket SInfo *info = get_sinfo(strtol(argv[1], NULL, 10)); if (!info) { cmd_printf("Invalid socket id %s\r\n", argv[1]); return CMDLINE_RETCODE_FAIL; } bool enable_pattern_check; if (cmd_parameter_bool(argc, argv, "set_RFC_864_pattern_check", &enable_pattern_check)) { info->set_pattern_check(enable_pattern_check); return CMDLINE_RETCODE_SUCCESS; } // Helper macro for checking the which command was given #define COMMAND_IS(cmd) (cmd_parameter_index(argc, argv, cmd) == 2) /* * Generic Socket commands: * delete, open, close, bind, set_blocking, set_timeout */ if (COMMAND_IS("delete")) { return del_sinfo(info); } else if (COMMAND_IS("open")) { NetworkInterface *interface; interface = get_interface(); // get default interface if (!interface) { cmd_printf("Invalid interface\r\n"); return CMDLINE_RETCODE_FAIL; } switch (info->type()) { case SInfo::TCP_CLIENT: return handle_nsapi_error("Socket::open()", info->tcp_socket()->open(interface)); case SInfo::UDP: return handle_nsapi_error("Socket::open()", info->udp_socket()->open(interface)); case SInfo::TCP_SERVER: return handle_nsapi_error("Socket::open()", info->tcp_server()->open(interface)); } } else if (COMMAND_IS("close")) { return handle_nsapi_error("Socket::close()", info->socket().close()); } else if (COMMAND_IS("bind")) { int32_t port = 0; char *addr; if (!cmd_parameter_int(argc, argv, "port", &port) && !cmd_parameter_int(argc, argv, "bind", &port) && port <= 0 && port > 65535) { printf("Missing or invalid port number\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (cmd_parameter_val(argc, argv, "addr", &addr)) { // Replace NULL-strings with NULL addr = strcmp(addr, "NULL") ? addr : NULL; cmd_printf("Socket::bind(%s, %" PRId32 ")\r\n", addr, port); SocketAddress tmp(addr, port); return handle_nsapi_error("Socket::bind(addr, port)", info->socket().bind(tmp)); } else { cmd_printf("Socket::bind(%" PRId32 ")\r\n", port); SocketAddress tmp(NULL, port); return handle_nsapi_error("Socket::bind(port)", info->socket().bind(tmp)); } } else if (COMMAND_IS("set_blocking")) { bool val; if (!cmd_parameter_bool(argc, argv, "set_blocking", &val)) { cmd_printf("Need boolean value"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } info->set_blocking(val); return CMDLINE_RETCODE_SUCCESS; } else if (COMMAND_IS("set_timeout")) { int32_t ms; if (!cmd_parameter_int(argc, argv, "set_timeout", &ms)) { cmd_printf("Need timeout value"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (ms == -1) { info->set_blocking(true); } else { info->set_blocking(false); } info->socket().set_timeout(ms); return CMDLINE_RETCODE_SUCCESS; } else if (COMMAND_IS("register_sigio_cb")) { info->socket().sigio(callback(sigio_handler, info)); return CMDLINE_RETCODE_SUCCESS; } /* * Commands related to UDPSocket: * sendto, recvfrom */ if ((COMMAND_IS("sendto") || COMMAND_IS("recvfrom") || COMMAND_IS("start_udp_receiver_thread") || COMMAND_IS("last_data_received")) && info->type() != SInfo::UDP) { cmd_printf("Not UDPSocket\r\n"); return CMDLINE_RETCODE_FAIL; } if (COMMAND_IS("sendto")) { return udp_sendto_command_handler(info, argc, argv); } else if (COMMAND_IS("recvfrom")) { return udp_recvfrom_command_handler(info, argc, argv); } else if (COMMAND_IS("start_udp_receiver_thread")) { return start_udp_receiver_thread(info, argc, argv); } else if (COMMAND_IS("last_data_received")) { print_data((const uint8_t *)info->getReceiveBuffer(), info->getDataCount()); if (info->getPacketSizeArray()) { int *packetSizes = info->getPacketSizeArray(); cmd_printf("packet_sizes: "); for (int i = 0; i < PACKET_SIZE_ARRAY_LEN; i++) { cmd_printf("%d ", packetSizes[i]); } cmd_printf("\r\n"); } if (info->getReceiverThread()) { info->getReceiverThread()->terminate(); } thread_clean_up(info); return handle_nsapi_error("UDPSocket::last_data_received()", NSAPI_ERROR_OK); } /* * Commands related to TCPSocket * connect, send, recv */ if ((COMMAND_IS("connect") || COMMAND_IS("recv") || COMMAND_IS("start_tcp_receiver_thread") || COMMAND_IS("join_tcp_receiver_thread") || COMMAND_IS("start_bg_traffic_thread") || COMMAND_IS("join_bg_traffic_thread") || COMMAND_IS("setsockopt_keepalive") || COMMAND_IS("getsockopt_keepalive")) && info->type() != SInfo::TCP_CLIENT) { cmd_printf("Not TCPSocket\r\n"); return CMDLINE_RETCODE_FAIL; } if (COMMAND_IS("connect")) { char *host; int32_t port; if (!cmd_parameter_val(argc, argv, "connect", &host)) { cmd_printf("Need host name\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (!cmd_parameter_int(argc, argv, host, &port)) { cmd_printf("Need port number\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } if (strcmp(host, "NULL") == 0) { host = NULL; } cmd_printf("Host name: %s port: %" PRId32 "\r\n", host, port); return handle_nsapi_error("TCPSocket::connect()", static_cast<TCPSocket &>(info->socket()).connect(host, port)); } else if (COMMAND_IS("send")) { return tcp_send_command_handler(info, argc, argv); } else if (COMMAND_IS("recv")) { return tcp_recv_command_handler(info, argc, argv); } else if (COMMAND_IS("start_tcp_receiver_thread")) { return start_tcp_receiver_thread(info, argc, argv); } else if (COMMAND_IS("join_tcp_receiver_thread")) { info->getReceiverThread()->join(); print_data((const uint8_t *)info->getReceiveBuffer(), info->getDataCount()); cmd_printf("received: %d bytes\r\n", info->getRecvTotal()); thread_clean_up(info); return CMDLINE_RETCODE_SUCCESS; } else if (COMMAND_IS("start_bg_traffic_thread")) { return start_bg_traffic_thread(info, argc, argv); } else if (COMMAND_IS("join_bg_traffic_thread")) { int bg_thread_success = CMDLINE_RETCODE_SUCCESS; if (!info->available()) { // Tells that background thread stumbled to an issue and stopped prematurely bg_thread_success = CMDLINE_RETCODE_FAIL; } info->setUnavailable(); info->getReceiverThread()->join(); thread_clean_up(info); return bg_thread_success; } else if (COMMAND_IS("setsockopt_keepalive")) { int32_t seconds; nsapi_error_t ret; if (!cmd_parameter_int(argc, argv, "setsockopt_keepalive", &seconds)) { cmd_printf("Need keep-alive value(0-7200seconds)"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } ret = info->socket().setsockopt(NSAPI_SOCKET, NSAPI_KEEPALIVE, &seconds, sizeof(seconds)); return handle_nsapi_error("TCPSocket::setsockopt()", ret); } else if (COMMAND_IS("getsockopt_keepalive")) { int32_t optval; unsigned optlen = sizeof(optval); nsapi_error_t ret; ret = info->socket().getsockopt(NSAPI_SOCKET, NSAPI_KEEPALIVE, &optval, &optlen); if (optlen != sizeof(int)) { return CMDLINE_RETCODE_FAIL; } if (ret < 0) { return handle_nsapi_error("TCPSocket::getsockopt()", ret); } return handle_nsapi_size_or_error("TCPSocket::getsockopt()", optval); } /* * Commands for TCPServer * listen, accept */ if ((COMMAND_IS("listen") || COMMAND_IS("accept")) && info->type() != SInfo::TCP_SERVER) { cmd_printf("Not TCPServer\r\n"); return CMDLINE_RETCODE_FAIL; } if (COMMAND_IS("listen")) { int32_t backlog; if (cmd_parameter_int(argc, argv, "listen", &backlog)) { return handle_nsapi_error("TCPServer::listen()", static_cast<TCPServer &>(info->socket()).listen(backlog)); } else { return handle_nsapi_error("TCPServer::listen()", static_cast<TCPServer &>(info->socket()).listen()); } } else if (COMMAND_IS("accept")) { SocketAddress addr; int32_t id; if (!cmd_parameter_int(argc, argv, "accept", &id)) { cmd_printf("Need new socket id\r\n"); return CMDLINE_RETCODE_INVALID_PARAMETERS; } SInfo *new_info = get_sinfo(id); if (!new_info) { cmd_printf("Invalid socket id\r\n"); return CMDLINE_RETCODE_FAIL; } TCPSocket *new_sock = static_cast<TCPSocket *>(&new_info->socket()); nsapi_error_t ret = static_cast<TCPServer &>(info->socket()).accept(new_sock, &addr); if (ret == NSAPI_ERROR_OK) { cmd_printf("TCPServer::accept() new socket sid: %d connection from %s port %d\r\n", new_info->id(), addr.get_ip_address(), addr.get_port()); } return handle_nsapi_error("TCPServer::accept()", ret); } return CMDLINE_RETCODE_INVALID_PARAMETERS; } void print_data(const uint8_t *buf, int len) { switch (printing_mode) { case PRINT_STRING: print_data_as_string(buf, len, printing_col_width); break; case PRINT_HEX: print_data_as_hex(buf, len, printing_col_width); break; case PRINT_DISABLED: break; default: assert(0); } } void print_data_as_string(const uint8_t *buf, int len, int col_width) { int printable_bytes; for (printable_bytes = 0; printable_bytes < len; printable_bytes++) { if (!isprint(buf[printable_bytes])) { break; } } cmd_mutex_lock(); cmd_printf("string data, printing %d bytes:\r\n", len); for (int i = 0; i < printable_bytes; i += col_width) { if (printable_bytes - i > col_width) { cmd_printf("%04d: %.*s\r\n", i, col_width, buf + i); } else { cmd_printf("%04d: %.*s\r\n", i, printable_bytes - i, buf + i); } } cmd_printf("Printed %d bytes\r\n", printable_bytes); if (len != printable_bytes) { cmd_printf("Error! Couldn't print all data. " "Unprintable character: 0x%02x found at index: %d\r\n", buf[printable_bytes], printable_bytes); } cmd_mutex_unlock(); } void print_data_as_hex(const uint8_t *buf, int len, int col_width) { cmd_mutex_lock(); cmd_printf("hex data, printing %d bytes:\r\n", len); for (int i = 0; i < len; i += col_width) { if (len - i > col_width) { cmd_printf("%04d: %s:\r\n", i, print_array(buf + i, col_width)); } else { cmd_printf("%04d: %s\r\n", i, print_array(buf + i, len - i)); } } cmd_printf("Printed %d bytes\r\n", len); cmd_mutex_unlock(); }
31.761589
141
0.578294
c1728p9
4af01049cafe3b9f54048a835cd8666a05a6d00c
17,215
cpp
C++
src/LexBase.cpp
eXtremal-ik7/config4cpp
087ee5457c6db2f0ca5d1b12c9b60c44b1fd130d
[ "MIT" ]
null
null
null
src/LexBase.cpp
eXtremal-ik7/config4cpp
087ee5457c6db2f0ca5d1b12c9b60c44b1fd130d
[ "MIT" ]
null
null
null
src/LexBase.cpp
eXtremal-ik7/config4cpp
087ee5457c6db2f0ca5d1b12c9b60c44b1fd130d
[ "MIT" ]
null
null
null
//----------------------------------------------------------------------- // Copyright 2011 Ciaran McHale. // // Permission is hereby granted, free of charge, to any person obtaining // a copy of this software and associated documentation files (the // "Software"), to deal in the Software without restriction, including // without limitation the rights to use, copy, modify, merge, publish, // distribute, sublicense, and/or sell copies of the Software, and to // permit persons to whom the Software is furnished to do so, subject to // the following conditions. // // The above copyright notice and this permission notice shall be // included in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, // EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF // MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND // NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS // BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN // ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN // CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE // SOFTWARE. //---------------------------------------------------------------------- //-------- // #include's //-------- #include "LexBase.h" #include "UidIdentifierDummyProcessor.h" #include <assert.h> #include <stdlib.h> #include <errno.h> #include <string.h> #include <ctype.h> #include <wchar.h> #include <stdio.h> namespace CONFIG4CPP_NAMESPACE { extern "C" int CONFIG4CPP_C_PREFIX(keywordInfoCmp)(const void * ptr1, const void * ptr2) { const LexBase::KeywordInfo * sas1; const LexBase::KeywordInfo * sas2; sas1 = (const LexBase::KeywordInfo *)ptr1; sas2 = (const LexBase::KeywordInfo *)ptr2; return strcmp(sas1->m_spelling, sas2->m_spelling); } void LexBase::searchForKeyword( const char * spelling, bool & found, short & symbol) { LexBase::KeywordInfo searchItem; LexBase::KeywordInfo * result = 0; searchItem.m_spelling = spelling; if (m_keywordInfoArraySize == 0) { found = false; return; } result = (LexBase::KeywordInfo *) bsearch(&searchItem, m_keywordInfoArray, m_keywordInfoArraySize, sizeof(searchItem),CONFIG4CPP_C_PREFIX(keywordInfoCmp)); if (result == 0) { found = false; } else { found = true; symbol = result->m_symbol; } } extern "C" int CONFIG4CPP_C_PREFIX(funcInfoCmp_c)(const void * ptr1, const void * ptr2) { const LexBase::FuncInfo * sas1; const LexBase::FuncInfo * sas2; sas1 = (const LexBase::FuncInfo *)ptr1; sas2 = (const LexBase::FuncInfo *)ptr2; return strcmp(sas1->m_spelling, sas2->m_spelling); } void LexBase::searchForFunction( const char * spelling, bool & found, short & funcType, short & symbol) { FuncInfo searchItem; FuncInfo * result = 0; if (m_funcInfoArraySize == 0) { found = false; return; } searchItem.m_spelling = spelling; result = (FuncInfo *)bsearch(&searchItem, m_funcInfoArray, m_funcInfoArraySize, sizeof(searchItem), CONFIG4CPP_C_PREFIX(funcInfoCmp_c)); if (result == 0) { found = false; } else { found = true; funcType = result->m_funcType; symbol = result->m_symbol; } } //---------------------------------------------------------------------- // Function: Constructor // // Description: //---------------------------------------------------------------------- LexBase::LexBase( Configuration::SourceType sourceType, const char * source, UidIdentifierProcessor * uidIdentifierProcessor) { StringBuffer msg; //-------- // Initialize state for the multi-byte functions in the C library. //-------- memset(&m_mbtowcState, 0, sizeof(mbstate_t)); m_keywordInfoArray = 0; m_keywordInfoArraySize = 0; m_funcInfoArray = 0; m_funcInfoArraySize = 0; m_uidIdentifierProcessor = uidIdentifierProcessor; m_amOwnerOfUidIdentifierProcessor = false; m_sourceType = sourceType; m_source = source; m_lineNum = 1; m_ptr = 0; m_atEOF = false; switch (sourceType) { case Configuration::INPUT_FILE: if (!m_file.open(source)) { msg << "cannot open " << source << ": " << strerror(errno); throw ConfigurationException(msg.c_str()); } break; case Configuration::INPUT_STRING: m_ptr = m_source; break; case Configuration::INPUT_EXEC: if (!execCmd(source, m_execOutput)) { msg << "cannot parse 'exec#" << source << "': " << m_execOutput.c_str(); throw ConfigurationException(msg.c_str()); } m_ptr = m_execOutput.c_str(); break; default: assert(0); // Bug! break; } nextChar(); // initialize m_ch } //---------------------------------------------------------------------- // Function: Constructor // // Description: //---------------------------------------------------------------------- LexBase::LexBase(const char * str) { StringBuffer msg; //-------- // Initialize state for the multi-byte functions in the C library. //-------- memset(&m_mbtowcState, 0, sizeof(mbstate_t)); m_keywordInfoArray = 0; m_keywordInfoArraySize = 0; m_funcInfoArray = 0; m_funcInfoArraySize = 0; m_uidIdentifierProcessor = new UidIdentifierDummyProcessor(); m_amOwnerOfUidIdentifierProcessor = true; m_sourceType = Configuration::INPUT_STRING; m_source = str; m_lineNum = 1; m_ptr = m_source; m_atEOF = false; nextChar(); // initialize m_ch } //---------------------------------------------------------------------- // Function: Destructor // // Description: //---------------------------------------------------------------------- LexBase::~LexBase() { if (m_amOwnerOfUidIdentifierProcessor) { delete m_uidIdentifierProcessor; } } //---------------------------------------------------------------------- // Function: nextByte() // // Description: Read the next byte from the input source //---------------------------------------------------------------------- char LexBase::nextByte() { int ch; if (m_sourceType == Configuration::INPUT_FILE) { do { ch = m_file.getChar(); } while (ch == '\r'); } else { do { ch = *m_ptr; if (ch == '\0') { ch = EOF; } else { m_ptr ++; } } while (ch == '\r'); } m_atEOF = (ch == EOF); if (m_atEOF) { ch = 0; } return (char)ch; } //---------------------------------------------------------------------- // Function: nextChar() // // Description: Read the next char from the input file //---------------------------------------------------------------------- void LexBase::nextChar() { char ch; int status; wchar_t wChar; m_ch.reset(); status = -1; while (status == -1) { ch = nextByte(); if (m_atEOF && !m_ch.isEmpty()) { StringBuffer msg; msg << "Invalid multi-byte character on line " << m_lineNum; throw ConfigurationException(msg.c_str()); } if (m_atEOF) { //-------- // At EOF. Our work is done. //-------- break; } if (!m_ch.add(ch)) { StringBuffer msg; msg << "Invalid multi-byte character on line " << m_lineNum; throw ConfigurationException(msg.c_str()); } status = mbrtowc(&wChar, m_ch.c_str(), m_ch.length(), &m_mbtowcState); if (status == -1 && m_ch.isFull()) { StringBuffer msg; msg << "Invalid multi-byte character on line " << m_lineNum; throw ConfigurationException(msg.c_str()); } m_ch.setWChar(wChar); } if (m_ch == '\n') { m_lineNum ++; } } //---------------------------------------------------------------------- // Function: nextToken() // // Description: Analyse the next token from the input file //---------------------------------------------------------------------- void LexBase::nextToken(LexToken &token) { StringBuffer spelling; bool found; short funcType; short symbol; //-------- // Skip leading white space //-------- while (m_ch.isSpace()) { nextChar(); } //-------- // Check for EOF. //-------- if (m_atEOF) { if (m_sourceType == Configuration::INPUT_STRING) { token.reset(LEX_EOF_SYM, m_lineNum, "<end of string>"); } else { token.reset(LEX_EOF_SYM, m_lineNum, "<end of file>"); } return; } //-------- // Note the line number at the start of the token //-------- const int lineNum = m_lineNum; //-------- // Miscellaneous kinds of tokens. //-------- switch (m_ch.c_str()[0]) { case '?': nextChar(); if (m_ch == '=') { nextChar(); token.reset(LEX_QUESTION_EQUALS_SYM, lineNum, "?="); } else { token.reset(LEX_UNKNOWN_SYM, lineNum, spelling.c_str()); } return; case '!': nextChar(); if (m_ch == '=') { nextChar(); token.reset(LEX_NOT_EQUALS_SYM, lineNum, "!="); } else { token.reset(LEX_NOT_SYM, lineNum, "!"); } return; case '@': spelling.append(m_ch.c_str()); nextChar(); while (!m_atEOF && isKeywordChar(m_ch)) { spelling.append(m_ch.c_str()); nextChar(); } searchForKeyword(spelling.c_str(), found, symbol); if (found) { token.reset(symbol, lineNum, spelling.c_str()); } else { token.reset(LEX_UNKNOWN_SYM, lineNum, spelling.c_str()); } return; case '+': nextChar(); token.reset(LEX_PLUS_SYM, lineNum, "+"); return; case '&': nextChar(); if (m_ch == '&') { nextChar(); token.reset(LEX_AND_SYM, lineNum, "&&"); } else { spelling << '&' << m_ch.c_str(); token.reset(LEX_UNKNOWN_SYM, lineNum, spelling.c_str()); } return; case '|': nextChar(); if (m_ch == '|') { nextChar(); token.reset(LEX_OR_SYM, lineNum, "||"); } else { spelling << '|' << m_ch.c_str(); token.reset(LEX_UNKNOWN_SYM, lineNum, spelling.c_str()); } return; case '=': nextChar(); if (m_ch == '=') { nextChar(); token.reset(LEX_EQUALS_EQUALS_SYM, lineNum, "=="); } else { token.reset(LEX_EQUALS_SYM, lineNum, "="); } return; case ';': nextChar(); token.reset(LEX_SEMICOLON_SYM, lineNum, ";"); return; case '[': nextChar(); token.reset(LEX_OPEN_BRACKET_SYM, lineNum, "["); return; case ']': nextChar(); token.reset(LEX_CLOSE_BRACKET_SYM, lineNum, "]"); return; case '{': nextChar(); token.reset(LEX_OPEN_BRACE_SYM, lineNum, "{"); return; case '}': nextChar(); token.reset(LEX_CLOSE_BRACE_SYM, lineNum, "}"); return; case '(': nextChar(); token.reset(LEX_OPEN_PAREN_SYM, lineNum, "("); return; case ')': nextChar(); token.reset(LEX_CLOSE_PAREN_SYM, lineNum, ")"); return; case ',': nextChar(); token.reset(LEX_COMMA_SYM, lineNum, ","); return; case '"': consumeString(token); return;; case '<': nextChar(); if (m_ch != '%') { token.reset(LEX_UNKNOWN_SYM, lineNum, "<"); return; } nextChar(); // skip over '%' consumeBlockString(token); return; case '#': //-------- // A comment. Consume it and immediately following // comments (without resorting to recursion). //-------- while (m_ch == '#') { //-------- // Skip to the end of line //-------- while (!m_atEOF && m_ch != '\n') { nextChar(); } if (m_ch == '\n') { nextChar(); } //-------- // Skip leading white space on the next line //-------- while (m_ch.isSpace()) { nextChar(); } //-------- // Potentially loop around again to consume // more comment lines that follow immediately. //-------- } //-------- // Now use (a guaranteed single level of) recursion // to obtain the next (non-comment) token. //-------- nextToken(token); return; } //-------- // Is it a function or identifier? //-------- if (isIdentifierChar(m_ch)) { //-------- // Consume all the identifier characters // but not an immediately following "(", if any //-------- spelling.append(m_ch.c_str()); nextChar(); while (!m_atEOF && isIdentifierChar(m_ch)) { spelling.append(m_ch.c_str()); nextChar(); } //-------- // If "(" follows immediately then it is (supposed to be) // a function. //-------- if (m_ch == '(') { spelling.append(m_ch.c_str()); nextChar(); searchForFunction(spelling.c_str(), found, funcType, symbol); if (found) { token.reset(symbol, lineNum, spelling.c_str(), funcType); } else { token.reset(LEX_UNKNOWN_FUNC_SYM, lineNum, spelling.c_str()); } return; } //-------- // It's not a function so it looks like an identifier. // Better check it's a legal identifier. //-------- if (strcmp(spelling.c_str(), ".") == 0) { token.reset(LEX_SOLE_DOT_IDENT_SYM, lineNum, spelling.c_str()); } else if (strstr(spelling.c_str(), "..") != 0) { token.reset(LEX_TWO_DOTS_IDENT_SYM, lineNum, spelling.c_str()); } else { try { m_uidIdentifierProcessor->expand(spelling); token.resetWithOwnership(LEX_IDENT_SYM, lineNum, spelling); } catch (const ConfigurationException &) { token.resetWithOwnership(LEX_ILLEGAL_IDENT_SYM, lineNum, spelling); } } return; } //-------- // None of the above //-------- spelling << m_ch.c_str(); nextChar(); token.reset(LEX_UNKNOWN_SYM, lineNum, spelling.c_str()); } //---------------------------------------------------------------------- // Function: consumeBlockString() // // Description: Consume a string from the input file and return the // relevant token. //---------------------------------------------------------------------- void LexBase::consumeBlockString(LexToken &token) { StringBuffer spelling; MBChar prevCh; int lineNum; //-------- // Note the line number at the start of the string //-------- lineNum = m_lineNum; //-------- // Consume chars until we get to "%>" //-------- prevCh = ' '; while (!(prevCh == '%' && m_ch == '>')) { if (m_atEOF) { token.reset(LEX_BLOCK_STRING_WITH_EOF_SYM, lineNum, spelling.c_str()); return; } spelling << m_ch.c_str(); prevCh = m_ch; nextChar(); } //-------- // Spelling contains the string followed by '%'. // Remove that unwanted terminating character. //-------- spelling.deleteLastChar(); nextChar(); // consumer the '>' //-------- // At the end of the string. //-------- token.resetWithOwnership(LEX_STRING_SYM, lineNum, spelling); return; } //---------------------------------------------------------------------- // Function: consumeString() // // Description: Consume a string from the input file and return the // relevant token. //---------------------------------------------------------------------- void LexBase::consumeString(LexToken &token) { StringBuffer spelling; StringBuffer msg; assert(m_ch == '"'); //-------- // Note the line number at the start of the string //-------- const int lineNum = m_lineNum; //-------- // Consume chars until we get to the end of the sting //-------- nextChar(); while (m_ch != '"') { if (m_atEOF || m_ch.c_str()[0] == '\n') { token.reset(LEX_STRING_WITH_EOL_SYM, lineNum, spelling.c_str()); return; } switch (m_ch.c_str()[0]) { case '%': //-------- // Escape char in string //-------- nextChar(); if (m_atEOF || m_ch.c_str()[0] == '\n') { token.reset(LEX_STRING_WITH_EOL_SYM, lineNum, spelling.c_str()); return; } switch (m_ch.c_str()[0]) { case 't': spelling << '\t'; break; case 'n': spelling << '\n'; break; case '%': spelling << '%'; break; case '"': spelling << '"'; break; default: msg << "Invalid escape sequence (%" << m_ch.c_str()[0] << ") in string on line " << m_lineNum; throw ConfigurationException(msg.c_str()); } break; default: //-------- // Typical char in string //-------- spelling << m_ch.c_str(); break; } nextChar(); } nextChar(); // consume the terminating double-quote char //-------- // At the end of the string. //-------- token.resetWithOwnership(LEX_STRING_SYM, lineNum, spelling); return; } //---------------------------------------------------------------------- // Function: isKeywordChar() // // Description: Determine if the parameter is a char that can appear // in a keyword (after the initial "@"). //---------------------------------------------------------------------- bool LexBase::isKeywordChar(const MBChar & mbCh) { wchar_t wCh; wCh = mbCh.getWChar(); if ('A' <= wCh && wCh <= 'Z') { return true; } if ('a' <= wCh && wCh <= 'z') { return true; } return false; } //---------------------------------------------------------------------- // Function: isIdentifierChar() // // Description: Determine if the parameter is a char that can appear // in an identifier. //---------------------------------------------------------------------- bool LexBase::isIdentifierChar(const MBChar & mbCh) { wchar_t wCh; bool result; wCh = mbCh.getWChar(); result = (::iswalpha(wCh) != 0) // letter || (::iswdigit(wCh) != 0) // digit || mbCh == '-' // dash || mbCh == '_' // underscore || mbCh == '.' // dot || mbCh == ':' // For C++ nested names, e.g., Foo::Bar || mbCh == '$' // For mangled names of Java nested classes || mbCh == '?' // For Ruby identifiers, e.g., found? || mbCh == '/' // For URLs, e.g., http://foo.com/bar/ || mbCh == '\\' // For Windows directory names ; return result; } }; // namespace CONFIG4CPP_NAMESPACE
23.326558
73
0.5605
eXtremal-ik7
4af02a5b0bec8809fda94987e4977de395d29240
2,658
cpp
C++
src/walker.cpp
markosej11/turtlebot3_walker
5a7e25367588f969383631da62c078abe08b472a
[ "MIT" ]
null
null
null
src/walker.cpp
markosej11/turtlebot3_walker
5a7e25367588f969383631da62c078abe08b472a
[ "MIT" ]
null
null
null
src/walker.cpp
markosej11/turtlebot3_walker
5a7e25367588f969383631da62c078abe08b472a
[ "MIT" ]
null
null
null
/** * @Copyright 2021 Markose Jacob * @file walker.cpp * @author Markose Jacob * @date 11/28/2021 * * @brief Walker class * * @section LICENSE * * MIT License * Copyright (c) 2021 Markose Jacob * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in all * copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE * SOFTWARE. * * @section DESCRIPTION * * Class implementation * */ #include <ros/ros.h> #include <std_msgs/String.h> #include <sensor_msgs/LaserScan.h> #include "geometry_msgs/Twist.h" #include "walker.hpp" void hw13::Walker::laserCallback(const sensor_msgs::LaserScan::ConstPtr& data) { distance = data->ranges[180]; ROS_INFO_STREAM("Distance: " << distance); } hw13::Walker::Walker(ros::NodeHandle node) { // ROS subscriber to LaserScan ros::Subscriber laserSubscriber = node.subscribe("/scan", 1000, &Walker::laserCallback, this); // ROS publisher to velocity topic ros::Publisher velocityPublisher = node.advertise<geometry_msgs::Twist>("/cmd_vel", 1); // Looprate of 4 Hz ros::Rate rate(4); while (ros::ok()) { // Define twist msg geometry_msgs::Twist twist; // Initialize to all zeros twist.linear.x = 0.0; twist.linear.y = 0.0; twist.linear.z = 0.0; twist.angular.x = 0.0; twist.angular.y = 0.0; twist.angular.z = 0.0; if (distance > 0.45) { ROS_INFO_STREAM("Moving forward ..."); twist.linear.x = -0.12; } else { ROS_INFO_STREAM("Rotating ..."); twist.angular.z = 1.4; } velocityPublisher.publish(twist); ros::spinOnce(); rate.sleep(); } }
31.642857
81
0.665538
markosej11
4af0736226210688b87e52b7ec2f4f760e052ede
307
hpp
C++
include/LTRE/core/ray.hpp
yumcyaWiz/LTRE
dd65125bb133c345a10a3cf3d4c2a330b38ee82b
[ "MIT" ]
3
2021-08-15T08:59:21.000Z
2021-11-27T08:23:37.000Z
include/LTRE/core/ray.hpp
yumcyaWiz/LTRE
dd65125bb133c345a10a3cf3d4c2a330b38ee82b
[ "MIT" ]
null
null
null
include/LTRE/core/ray.hpp
yumcyaWiz/LTRE
dd65125bb133c345a10a3cf3d4c2a330b38ee82b
[ "MIT" ]
1
2021-12-09T15:43:57.000Z
2021-12-09T15:43:57.000Z
#ifndef _LTRE_RAY_H #define _LTRE_RAY_H #include "LTRE/math/vec3.hpp" namespace LTRE { struct Ray { Vec3 origin; Vec3 direction; mutable float tmin; mutable float tmax; Ray(); Ray(const Vec3& origin, const Vec3& direction); Vec3 operator()(float t) const; }; } // namespace LTRE #endif
13.954545
49
0.693811
yumcyaWiz
4af1152a152a0bd3c3841095701527b33c6fff47
607,038
cpp
C++
hphp/parser/hphp.7.tab.cpp
webhacking/hhvm
24b6fd8acfaa00a2bbb6086942d084eb28bcc9d7
[ "PHP-3.01", "Zend-2.0" ]
null
null
null
hphp/parser/hphp.7.tab.cpp
webhacking/hhvm
24b6fd8acfaa00a2bbb6086942d084eb28bcc9d7
[ "PHP-3.01", "Zend-2.0" ]
null
null
null
hphp/parser/hphp.7.tab.cpp
webhacking/hhvm
24b6fd8acfaa00a2bbb6086942d084eb28bcc9d7
[ "PHP-3.01", "Zend-2.0" ]
null
null
null
// @generated /* A Bison parser, made by GNU Bison 2.4.1. */ /* Skeleton implementation for Bison's Yacc-like parsers in C Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ /* As a special exception, you may create a larger work that contains part or all of the Bison parser skeleton and distribute that work under terms of your choice, so long as that work isn't itself a parser generator using the skeleton or a modified version thereof as a parser skeleton. Alternatively, if you modify or redistribute the parser skeleton itself, you may (at your option) remove this special exception, which will cause the skeleton and the resulting Bison output files to be licensed under the GNU General Public License without this special exception. This special exception was added by the Free Software Foundation in version 2.2 of Bison. */ /* C LALR(1) parser skeleton written by Richard Stallman, by simplifying the original so-called "semantic" parser. */ /* All symbols defined below should begin with yy or YY, to avoid infringing on user name space. This should be done even for local variables, as they might otherwise be expanded by user macros. There are some unavoidable exceptions within include files to define necessary library symbols; they are noted "INFRINGES ON USER NAME SPACE" below. */ /* Identify Bison output. */ #define YYBISON 1 /* Bison version. */ #define YYBISON_VERSION "2.4.1" /* Skeleton name. */ #define YYSKELETON_NAME "yacc.c" /* Pure parsers. */ #define YYPURE 1 /* Push parsers. */ #define YYPUSH 0 /* Pull parsers. */ #define YYPULL 1 /* Using locations. */ #define YYLSP_NEEDED 1 /* Substitute the variable and function names. */ #define yyparse Compiler7parse #define yylex Compiler7lex #define yyerror Compiler7error #define yylval Compiler7lval #define yychar Compiler7char #define yydebug Compiler7debug #define yynerrs Compiler7nerrs #define yylloc Compiler7lloc /* Copy the first part of user declarations. */ /* Line 189 of yacc.c */ #line 1 "hphp.y" // macros for bison #define YYSTYPE HPHP::HPHP_PARSER_NS::Token #define YYSTYPE_IS_TRIVIAL false #define YYLTYPE HPHP::Location #define YYLTYPE_IS_TRIVIAL true #define YYERROR_VERBOSE #define YYINITDEPTH 500 #define YYLEX_PARAM _p #include "hphp/compiler/parser/parser.h" #include <folly/Conv.h> #include "hphp/util/text-util.h" #include "hphp/util/logger.h" #define line0 r.line0 #define char0 r.char0 #define line1 r.line1 #define char1 r.char1 #ifdef yyerror #undef yyerror #endif #define yyerror(loc,p,msg) p->parseFatal(loc,msg) #ifdef YYLLOC_DEFAULT # undef YYLLOC_DEFAULT #endif #define YYRHSLOC(Rhs, K) ((Rhs)[K]) #define YYLLOC_DEFAULT(Current, Rhs, N) \ do \ if (N) { \ (Current).first(YYRHSLOC (Rhs, 1)); \ (Current).last (YYRHSLOC (Rhs, N)); \ } else { \ (Current).line0 = (Current).line1 = YYRHSLOC (Rhs, 0).line1;\ (Current).char0 = (Current).char1 = YYRHSLOC (Rhs, 0).char1;\ } \ while (0); \ _p->setRuleLocation(&Current); #define YYCOPY(To, From, Count) \ do { \ YYSIZE_T yyi; \ for (yyi = 0; yyi < (Count); yyi++) { \ (To)[yyi] = (From)[yyi]; \ } \ if (From != From ## a) { \ YYSTACK_FREE (From); \ } \ } \ while (0) #define YYCOPY_RESET(To, From, Count) \ do \ { \ YYSIZE_T yyi; \ for (yyi = 0; yyi < (Count); yyi++) { \ (To)[yyi] = (From)[yyi]; \ (From)[yyi].reset(); \ } \ if (From != From ## a) { \ YYSTACK_FREE (From); \ } \ } \ while (0) #define YYTOKEN_RESET(From, Count) \ do \ { \ YYSIZE_T yyi; \ for (yyi = 0; yyi < (Count); yyi++) { \ (From)[yyi].reset(); \ } \ if (From != From ## a) { \ YYSTACK_FREE (From); \ } \ } \ while (0) # define YYSTACK_RELOCATE_RESET(Stack_alloc, Stack) \ do \ { \ YYSIZE_T yynewbytes; \ YYCOPY_RESET (&yyptr->Stack_alloc, Stack, yysize); \ Stack = &yyptr->Stack_alloc; \ yynewbytes = yystacksize * sizeof (*Stack) + YYSTACK_GAP_MAXIMUM; \ yyptr += yynewbytes / sizeof (*yyptr); \ } \ while (0) #define YYSTACK_CLEANUP \ YYTOKEN_RESET (yyvs, yystacksize); \ if (yyvs != yyvsa) { \ YYSTACK_FREE (yyvs); \ } \ if (yyls != yylsa) { \ YYSTACK_FREE (yyls); \ } \ // macros for rules #define BEXP(...) _p->onBinaryOpExp(__VA_ARGS__); #define UEXP(...) _p->onUnaryOpExp(__VA_ARGS__); using namespace HPHP::HPHP_PARSER_NS; typedef HPHP::ClosureType ClosureType; /////////////////////////////////////////////////////////////////////////////// // helpers static void scalar_num(Parser *_p, Token &out, const char *num) { Token t; t.setText(num); _p->onScalar(out, T_LNUMBER, t); } static void scalar_num(Parser *_p, Token &out, int num) { Token t; t.setText(folly::to<std::string>(num)); _p->onScalar(out, T_LNUMBER, t); } static void scalar_null(Parser *_p, Token &out) { Token tnull; tnull.setText("null"); _p->onConstantValue(out, tnull); } static void scalar_file(Parser *_p, Token &out) { Token file; file.setText("__FILE__"); _p->onScalar(out, T_FILE, file); } static void scalar_line(Parser *_p, Token &out) { Token line; line.setText("__LINE__"); _p->onScalar(out, T_LINE, line); } /////////////////////////////////////////////////////////////////////////////// static void constant_ae(Parser *_p, Token &out, Token &value) { const std::string& valueStr = value.text(); if (valueStr.size() < 3 || valueStr.size() > 5 || (strcasecmp("true", valueStr.c_str()) != 0 && strcasecmp("false", valueStr.c_str()) != 0 && strcasecmp("null", valueStr.c_str()) != 0 && strcasecmp("inf", valueStr.c_str()) != 0 && strcasecmp("nan", valueStr.c_str()) != 0)) { HPHP_PARSER_ERROR("User-defined constants are not allowed in user " "attribute expressions", _p); } _p->onConstantValue(out, value); } /////////////////////////////////////////////////////////////////////////////// /** * XHP functions: They are defined here, so different parsers don't have to * handle XHP rules at all. */ static void xhp_tag(Parser *_p, Token &out, Token &label, Token &body) { if (!body.text().empty() && body.text() != label.text()) { HPHP_PARSER_ERROR("XHP: mismatched tag: '%s' not the same as '%s'", _p, body.text().c_str(), label.text().c_str()); } label.xhpLabel(); Token name; _p->onName(name, label, Parser::StringName); _p->onNewObject(out, name, body); } static void xhp_attribute(Parser *_p, Token &out, Token &type, Token &label, Token &def, Token &req) { /** * The bool, int, float, and string typenames are not given any special * treatment by the parser and are treated the same as regular class names * (which initially gets marked as type code 5). However, XHP wants to use * different type codes for bool, int, float, and string, so we need to fix * up the type code here to make XHP happy. */ if (type.num() == 5) { auto* str = type.text().c_str(); if (_p->scanner().isHHSyntaxEnabled()) { switch (type.text().size()) { case 6: if (!strcasecmp(str, "HH\\int")) { type.reset(); type.setNum(3); } break; case 7: if (!strcasecmp(str, "HH\\bool")) { type.reset(); type.setNum(2); } break; case 8: if (!strcasecmp(str, "HH\\float")) { type.reset(); type.setNum(8); } else if (!strcasecmp(str, "HH\\mixed")) { type.reset(); type.setNum(6); } break; case 9: if (!strcasecmp(str, "HH\\string")) { type.reset(); type.setNum(1); } break; default: break; } } else { switch (type.text().size()) { case 3: if (!strcasecmp(str, "int")) { type.reset(); type.setNum(3); } break; case 4: if (!strcasecmp(str, "bool")) { type.reset(); type.setNum(2); } else if (!strcasecmp(str, "real")) { type.reset(); type.setNum(8); } break; case 5: if (!strcasecmp(str, "float")) { type.reset(); type.setNum(8); } else if (!strcasecmp(str, "mixed")) { type.reset(); type.setNum(6); } break; case 6: if (!strcasecmp(str, "string")) { type.reset(); type.setNum(1); } else if (!strcasecmp(str, "double")) { type.reset(); type.setNum(8); } break; case 7: if (!strcasecmp(str, "integer")) { type.reset(); type.setNum(3); } else if (!strcasecmp(str, "boolean")) { type.reset(); type.setNum(2); } break; default: break; } } } Token num; scalar_num(_p, num, type.num()); Token arr1; _p->onArrayPair(arr1, 0, 0, num, 0); Token arr2; switch (type.num()) { case 5: /* class */ { Token cls; _p->onScalar(cls, T_CONSTANT_ENCAPSED_STRING, type); _p->onArrayPair(arr2, &arr1, 0, cls, 0); break; } case 7: /* enum */ { Token arr; _p->onArray(arr, type); _p->onArrayPair(arr2, &arr1, 0, arr, 0); break; } default: { Token tnull; scalar_null(_p, tnull); _p->onArrayPair(arr2, &arr1, 0, tnull, 0); break; } } Token arr3; _p->onArrayPair(arr3, &arr2, 0, def, 0); Token arr4; _p->onArrayPair(arr4, &arr3, 0, req, 0); _p->onArray(out, arr4); out.setText(label); } static void xhp_attribute_list(Parser *_p, Token &out, Token *list, Token &decl) { if (decl.num() == 0) { decl.xhpLabel(); if (list) { out = *list; out.setText(list->text() + ":" + decl.text()); // avoiding vector<string> } else { out.setText(decl); } } else { Token name; _p->onScalar(name, T_CONSTANT_ENCAPSED_STRING, decl); _p->onArrayPair(out, list, &name, decl, 0); if (list) { out.setText(list->text()); } else { out.setText(""); } } } static void xhp_attribute_stmt(Parser *_p, Token &out, Token &attributes) { Token modifiers; Token fname; fname.setText("__xhpAttributeDeclaration"); { Token m; Token m1; m1.setNum(T_PROTECTED); _p->onMemberModifier(m, NULL, m1); Token m2; m2.setNum(T_STATIC); _p->onMemberModifier(modifiers, &m, m2); } _p->pushFuncLocation(); _p->onMethodStart(fname, modifiers); std::vector<std::string> classes; HPHP::split(':', attributes.text().c_str(), classes, true); Token arrAttributes; _p->onArray(arrAttributes, attributes); Token dummy; Token stmts0; { _p->onStatementListStart(stmts0); } Token stmts1; { // static $_ = -1; Token one; scalar_num(_p, one, "1"); Token mone; UEXP(mone, one, '-', 1); Token var; var.set(T_VARIABLE, "_"); Token decl; _p->onStaticVariable(decl, 0, var, &mone); Token sdecl; _p->onStatic(sdecl, decl); _p->addStatement(stmts1, stmts0, sdecl); } Token stmts2; { // if ($_ === -1) { // $_ = array_merge(parent::__xhpAttributeDeclaration(), // attributes); // } Token parent; parent.set(T_STRING, "parent"); Token cls; _p->onName(cls, parent, Parser::StringName); Token fname; fname.setText("__xhpAttributeDeclaration"); Token param1; _p->onCall(param1, 0, fname, dummy, &cls); Token params1; _p->onCallParam(params1, NULL, param1, false, false); for (unsigned int i = 0; i < classes.size(); i++) { Token parent; parent.set(T_STRING, classes[i]); Token cls; _p->onName(cls, parent, Parser::StringName); Token fname; fname.setText("__xhpAttributeDeclaration"); Token param; _p->onCall(param, 0, fname, dummy, &cls); Token params; _p->onCallParam(params, &params1, param, false, false); params1 = params; } Token params2; _p->onCallParam(params2, &params1, arrAttributes, false, false); Token name; name.set(T_STRING, "array_merge"); Token call; _p->onCall(call, 0, name, params2, NULL); Token tvar; tvar.set(T_VARIABLE, "_"); Token var; _p->onSimpleVariable(var, tvar); Token assign; _p->onAssign(assign, var, call, 0); Token exp; _p->onExpStatement(exp, assign); Token block; _p->onBlock(block, exp); Token tvar2; tvar2.set(T_VARIABLE, "_"); Token var2; _p->onSimpleVariable(var2, tvar2); Token one; scalar_num(_p, one, "1"); Token mone; UEXP(mone, one, '-', 1); Token cond; BEXP(cond, var2, mone, T_IS_IDENTICAL); Token dummy1, dummy2; Token sif; _p->onIf(sif, cond, block, dummy1, dummy2); _p->addStatement(stmts2, stmts1, sif); } Token stmts3; { // return $_; Token tvar; tvar.set(T_VARIABLE, "_"); Token var; _p->onSimpleVariable(var, tvar); Token ret; _p->onReturn(ret, &var); _p->addStatement(stmts3, stmts2, ret); } Token stmt; { _p->finishStatement(stmt, stmts3); stmt = 1; } { Token params, ret, ref; ref = 1; _p->onMethod(out, modifiers, ret, ref, fname, params, stmt, nullptr, false); } } static void xhp_collect_attributes(Parser *_p, Token &out, Token &stmts) { Token *attr = _p->xhpGetAttributes(); if (attr) { Token stmt; xhp_attribute_stmt(_p, stmt, *attr); _p->onClassStatement(out, stmts, stmt); } else { out = stmts; } } static void xhp_category_stmt(Parser *_p, Token &out, Token &categories) { Token fname; fname.setText("__xhpCategoryDeclaration"); Token m1; m1.setNum(T_PROTECTED); Token modifiers; _p->onMemberModifier(modifiers, 0, m1); _p->pushFuncLocation(); _p->onMethodStart(fname, modifiers); Token stmts0; { _p->onStatementListStart(stmts0); } Token stmts1; { // static $_ = categories; Token arr; _p->onArray(arr, categories); Token var; var.set(T_VARIABLE, "_"); Token decl; _p->onStaticVariable(decl, 0, var, &arr); Token sdecl; _p->onStatic(sdecl, decl); _p->addStatement(stmts1, stmts0, sdecl); } Token stmts2; { // return $_; Token tvar; tvar.set(T_VARIABLE, "_"); Token var; _p->onSimpleVariable(var, tvar); Token ret; _p->onReturn(ret, &var); _p->addStatement(stmts2, stmts1, ret); } Token stmt; { _p->finishStatement(stmt, stmts2); stmt = 1; } { Token params, ret, ref; ref = 1; _p->onMethod(out, modifiers, ret, ref, fname, params, stmt, nullptr, false); } } static void xhp_children_decl_tag(Parser *_p, Token &arr, Token &tag) { Token num; scalar_num(_p, num, tag.num()); Token arr1; _p->onArrayPair(arr1, &arr, 0, num, 0); Token name; if (tag.num() == 3 || tag.num() == 4) { _p->onScalar(name, T_CONSTANT_ENCAPSED_STRING, tag); } else if (tag.num() >= 0) { scalar_null(_p, name); } else { HPHP_PARSER_ERROR("XHP: unknown children declaration", _p); } Token arr2; _p->onArrayPair(arr2, &arr1, 0, name, 0); arr = arr2; } static void xhp_children_decl(Parser *_p, Token &out, Token &op1, int op, Token *op2) { Token num; scalar_num(_p, num, op); Token arr; _p->onArrayPair(arr, 0, 0, num, 0); if (op2) { Token arr1; _p->onArrayPair(arr1, &arr, 0, op1, 0); Token arr2; _p->onArrayPair(arr2, &arr1, 0, *op2, 0); _p->onArray(out, arr2); } else { xhp_children_decl_tag(_p, arr, op1); _p->onArray(out, arr); } } static void xhp_children_paren(Parser *_p, Token &out, Token exp, int op) { Token num; scalar_num(_p, num, op); Token arr1; _p->onArrayPair(arr1, 0, 0, num, 0); Token num5; scalar_num(_p, num5, 5); Token arr2; _p->onArrayPair(arr2, &arr1, 0, num5, 0); Token arr3; _p->onArrayPair(arr3, &arr2, 0, exp, 0); _p->onArray(out, arr3); } static void xhp_children_stmt(Parser *_p, Token &out, Token &children) { Token fname; fname.setText("__xhpChildrenDeclaration"); Token m1; m1.setNum(T_PROTECTED); Token modifiers; _p->onMemberModifier(modifiers, 0, m1); _p->pushFuncLocation(); _p->onMethodStart(fname, modifiers); Token stmts0; { _p->onStatementListStart(stmts0); } Token stmts1; { // static $_ = children; Token arr; if (children.num() == 2) { arr = children; } else if (children.num() >= 0) { scalar_num(_p, arr, children.num()); } else { HPHP_PARSER_ERROR("XHP: XHP unknown children declaration", _p); } Token var; var.set(T_VARIABLE, "_"); Token decl; _p->onStaticVariable(decl, 0, var, &arr); Token sdecl; _p->onStatic(sdecl, decl); _p->addStatement(stmts1, stmts0, sdecl); } Token stmts2; { // return $_; Token tvar; tvar.set(T_VARIABLE, "_"); Token var; _p->onSimpleVariable(var, tvar); Token ret; _p->onReturn(ret, &var); _p->addStatement(stmts2, stmts1, ret); } Token stmt; { _p->finishStatement(stmt, stmts2); stmt = 1; } { Token params, ret, ref; ref = 1; _p->onMethod(out, modifiers, ret, ref, fname, params, stmt, nullptr, false); } } static void only_in_hh_syntax(Parser *_p) { if (!_p->scanner().isHHSyntaxEnabled()) { HPHP_PARSER_ERROR( "Syntax only allowed in Hack files (<?hh) or with -v " "Eval.EnableHipHopSyntax=true", _p); } } static void validate_hh_variadic_variant(Parser* _p, Token& userAttrs, Token& typehint, Token* mod) { if (!userAttrs.text().empty() || !typehint.text().empty() || (mod && !mod->text().empty())) { HPHP_PARSER_ERROR("Variadic '...' should be followed by a '$variable'", _p); } only_in_hh_syntax(_p); } // Shapes may not have leading integers in key names, considered as a // parse time error. This is because at runtime they are currently // hphp arrays, which will treat leading integer keys as numbers. static void validate_shape_keyname(Token& tok, Parser* _p) { if (tok.text().empty()) { HPHP_PARSER_ERROR("Shape key names may not be empty", _p); } if (isdigit(tok.text()[0])) { HPHP_PARSER_ERROR("Shape key names may not start with integers", _p); } } /////////////////////////////////////////////////////////////////////////////// static int yylex(YYSTYPE *token, HPHP::Location *loc, Parser *_p) { return _p->scan(token, loc); } /* Line 189 of yacc.c */ #line 651 "hphp.7.tab.cpp" /* Enabling traces. */ #ifndef YYDEBUG # define YYDEBUG 0 #endif /* Enabling verbose error messages. */ #ifdef YYERROR_VERBOSE # undef YYERROR_VERBOSE # define YYERROR_VERBOSE 1 #else # define YYERROR_VERBOSE 0 #endif /* Enabling the token table. */ #ifndef YYTOKEN_TABLE # define YYTOKEN_TABLE 0 #endif /* Tokens. */ #ifndef YYTOKENTYPE # define YYTOKENTYPE /* Put the tokens into the symbol table, so that GDB and other debuggers know about them. */ enum yytokentype { T_REQUIRE_ONCE = 258, T_REQUIRE = 259, T_EVAL = 260, T_INCLUDE_ONCE = 261, T_INCLUDE = 262, T_LAMBDA_ARROW = 263, T_LOGICAL_OR = 264, T_LOGICAL_XOR = 265, T_LOGICAL_AND = 266, T_PRINT = 267, T_POW_EQUAL = 268, T_SR_EQUAL = 269, T_SL_EQUAL = 270, T_XOR_EQUAL = 271, T_OR_EQUAL = 272, T_AND_EQUAL = 273, T_MOD_EQUAL = 274, T_CONCAT_EQUAL = 275, T_DIV_EQUAL = 276, T_MUL_EQUAL = 277, T_MINUS_EQUAL = 278, T_PLUS_EQUAL = 279, T_YIELD = 280, T_AWAIT = 281, T_BOOLEAN_OR = 282, T_BOOLEAN_AND = 283, T_IS_NOT_IDENTICAL = 284, T_IS_IDENTICAL = 285, T_IS_NOT_EQUAL = 286, T_IS_EQUAL = 287, T_SPACESHIP = 288, T_IS_GREATER_OR_EQUAL = 289, T_IS_SMALLER_OR_EQUAL = 290, T_SR = 291, T_SL = 292, T_INSTANCEOF = 293, T_UNSET_CAST = 294, T_BOOL_CAST = 295, T_OBJECT_CAST = 296, T_ARRAY_CAST = 297, T_STRING_CAST = 298, T_DOUBLE_CAST = 299, T_INT_CAST = 300, T_DEC = 301, T_INC = 302, T_POW = 303, T_CLONE = 304, T_NEW = 305, T_EXIT = 306, T_IF = 307, T_ELSEIF = 308, T_ELSE = 309, T_ENDIF = 310, T_LNUMBER = 311, T_DNUMBER = 312, T_ONUMBER = 313, T_STRING = 314, T_STRING_VARNAME = 315, T_VARIABLE = 316, T_NUM_STRING = 317, T_INLINE_HTML = 318, T_HASHBANG = 319, T_CHARACTER = 320, T_BAD_CHARACTER = 321, T_ENCAPSED_AND_WHITESPACE = 322, T_CONSTANT_ENCAPSED_STRING = 323, T_ECHO = 324, T_DO = 325, T_WHILE = 326, T_ENDWHILE = 327, T_FOR = 328, T_ENDFOR = 329, T_FOREACH = 330, T_ENDFOREACH = 331, T_DECLARE = 332, T_ENDDECLARE = 333, T_AS = 334, T_SUPER = 335, T_SWITCH = 336, T_ENDSWITCH = 337, T_CASE = 338, T_DEFAULT = 339, T_BREAK = 340, T_GOTO = 341, T_CONTINUE = 342, T_FUNCTION = 343, T_CONST = 344, T_RETURN = 345, T_TRY = 346, T_CATCH = 347, T_THROW = 348, T_USE = 349, T_GLOBAL = 350, T_PUBLIC = 351, T_PROTECTED = 352, T_PRIVATE = 353, T_FINAL = 354, T_ABSTRACT = 355, T_STATIC = 356, T_VAR = 357, T_UNSET = 358, T_ISSET = 359, T_EMPTY = 360, T_HALT_COMPILER = 361, T_CLASS = 362, T_INTERFACE = 363, T_EXTENDS = 364, T_IMPLEMENTS = 365, T_OBJECT_OPERATOR = 366, T_NULLSAFE_OBJECT_OPERATOR = 367, T_DOUBLE_ARROW = 368, T_LIST = 369, T_ARRAY = 370, T_CALLABLE = 371, T_CLASS_C = 372, T_METHOD_C = 373, T_FUNC_C = 374, T_LINE = 375, T_FILE = 376, T_COMMENT = 377, T_DOC_COMMENT = 378, T_OPEN_TAG = 379, T_OPEN_TAG_WITH_ECHO = 380, T_CLOSE_TAG = 381, T_WHITESPACE = 382, T_START_HEREDOC = 383, T_END_HEREDOC = 384, T_DOLLAR_OPEN_CURLY_BRACES = 385, T_CURLY_OPEN = 386, T_DOUBLE_COLON = 387, T_NAMESPACE = 388, T_NS_C = 389, T_DIR = 390, T_NS_SEPARATOR = 391, T_XHP_LABEL = 392, T_XHP_TEXT = 393, T_XHP_ATTRIBUTE = 394, T_XHP_CATEGORY = 395, T_XHP_CATEGORY_LABEL = 396, T_XHP_CHILDREN = 397, T_ENUM = 398, T_XHP_REQUIRED = 399, T_TRAIT = 400, T_ELLIPSIS = 401, T_INSTEADOF = 402, T_TRAIT_C = 403, T_HH_ERROR = 404, T_FINALLY = 405, T_XHP_TAG_LT = 406, T_XHP_TAG_GT = 407, T_TYPELIST_LT = 408, T_TYPELIST_GT = 409, T_UNRESOLVED_LT = 410, T_COLLECTION = 411, T_SHAPE = 412, T_TYPE = 413, T_UNRESOLVED_TYPE = 414, T_NEWTYPE = 415, T_UNRESOLVED_NEWTYPE = 416, T_COMPILER_HALT_OFFSET = 417, T_ASYNC = 418, T_FROM = 419, T_WHERE = 420, T_JOIN = 421, T_IN = 422, T_ON = 423, T_EQUALS = 424, T_INTO = 425, T_LET = 426, T_ORDERBY = 427, T_ASCENDING = 428, T_DESCENDING = 429, T_SELECT = 430, T_GROUP = 431, T_BY = 432, T_LAMBDA_OP = 433, T_LAMBDA_CP = 434, T_UNRESOLVED_OP = 435 }; #endif #if ! defined YYSTYPE && ! defined YYSTYPE_IS_DECLARED typedef int YYSTYPE; # define YYSTYPE_IS_TRIVIAL 1 # define yystype YYSTYPE /* obsolescent; will be withdrawn */ # define YYSTYPE_IS_DECLARED 1 #endif #if ! defined YYLTYPE && ! defined YYLTYPE_IS_DECLARED typedef struct YYLTYPE { int line0; int char0; int line1; int char1; } YYLTYPE; # define yyltype YYLTYPE /* obsolescent; will be withdrawn */ # define YYLTYPE_IS_DECLARED 1 # define YYLTYPE_IS_TRIVIAL 1 #endif /* Copy the second part of user declarations. */ /* Line 264 of yacc.c */ #line 886 "hphp.7.tab.cpp" #ifdef short # undef short #endif #ifdef YYTYPE_UINT8 typedef YYTYPE_UINT8 yytype_uint8; #else typedef unsigned char yytype_uint8; #endif #ifdef YYTYPE_INT8 typedef YYTYPE_INT8 yytype_int8; #elif (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) typedef signed char yytype_int8; #else typedef short int yytype_int8; #endif #ifdef YYTYPE_UINT16 typedef YYTYPE_UINT16 yytype_uint16; #else typedef unsigned short int yytype_uint16; #endif #ifdef YYTYPE_INT16 typedef YYTYPE_INT16 yytype_int16; #else typedef short int yytype_int16; #endif #ifndef YYSIZE_T # ifdef __SIZE_TYPE__ # define YYSIZE_T __SIZE_TYPE__ # elif defined size_t # define YYSIZE_T size_t # elif ! defined YYSIZE_T && (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) # include <stddef.h> /* INFRINGES ON USER NAME SPACE */ # define YYSIZE_T size_t # else # define YYSIZE_T unsigned int # endif #endif #define YYSIZE_MAXIMUM ((YYSIZE_T) -1) #ifndef YY_ # if YYENABLE_NLS # if ENABLE_NLS # include <libintl.h> /* INFRINGES ON USER NAME SPACE */ # define YY_(msgid) dgettext ("bison-runtime", msgid) # endif # endif # ifndef YY_ # define YY_(msgid) msgid # endif #endif /* Suppress unused-variable warnings by "using" E. */ #if ! defined lint || defined __GNUC__ # define YYUSE(e) ((void) (e)) #else # define YYUSE(e) /* empty */ #endif /* Identity function, used to suppress warnings about constant conditions. */ #ifndef lint # define YYID(n) (n) #else #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static int YYID (int yyi) #else static int YYID (yyi) int yyi; #endif { return yyi; } #endif #if ! defined yyoverflow || YYERROR_VERBOSE /* The parser invokes alloca or malloc; define the necessary symbols. */ # ifdef YYSTACK_USE_ALLOCA # if YYSTACK_USE_ALLOCA # ifdef __GNUC__ # define YYSTACK_ALLOC __builtin_alloca # elif defined __BUILTIN_VA_ARG_INCR # include <alloca.h> /* INFRINGES ON USER NAME SPACE */ # elif defined _AIX # define YYSTACK_ALLOC __alloca # elif defined _MSC_VER # include <malloc.h> /* INFRINGES ON USER NAME SPACE */ # define alloca _alloca # else # define YYSTACK_ALLOC alloca # if ! defined _ALLOCA_H && ! defined _STDLIB_H && (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) # include <stdlib.h> /* INFRINGES ON USER NAME SPACE */ # ifndef _STDLIB_H # define _STDLIB_H 1 # endif # endif # endif # endif # endif # ifdef YYSTACK_ALLOC /* Pacify GCC's `empty if-body' warning. */ # define YYSTACK_FREE(Ptr) do { /* empty */; } while (YYID (0)) # ifndef YYSTACK_ALLOC_MAXIMUM /* The OS might guarantee only one guard page at the bottom of the stack, and a page size can be as small as 4096 bytes. So we cannot safely invoke alloca (N) if N exceeds 4096. Use a slightly smaller number to allow for a few compiler-allocated temporary stack slots. */ # define YYSTACK_ALLOC_MAXIMUM 4032 /* reasonable circa 2006 */ # endif # else # define YYSTACK_ALLOC YYMALLOC # define YYSTACK_FREE YYFREE # ifndef YYSTACK_ALLOC_MAXIMUM # define YYSTACK_ALLOC_MAXIMUM YYSIZE_MAXIMUM # endif # if (defined __cplusplus && ! defined _STDLIB_H \ && ! ((defined YYMALLOC || defined malloc) \ && (defined YYFREE || defined free))) # include <stdlib.h> /* INFRINGES ON USER NAME SPACE */ # ifndef _STDLIB_H # define _STDLIB_H 1 # endif # endif # ifndef YYMALLOC # define YYMALLOC malloc # if ! defined malloc && ! defined _STDLIB_H && (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) void *malloc (YYSIZE_T); /* INFRINGES ON USER NAME SPACE */ # endif # endif # ifndef YYFREE # define YYFREE free # if ! defined free && ! defined _STDLIB_H && (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) void free (void *); /* INFRINGES ON USER NAME SPACE */ # endif # endif # endif #endif /* ! defined yyoverflow || YYERROR_VERBOSE */ #if (! defined yyoverflow \ && (! defined __cplusplus \ || (defined YYLTYPE_IS_TRIVIAL && YYLTYPE_IS_TRIVIAL \ && defined YYSTYPE_IS_TRIVIAL && YYSTYPE_IS_TRIVIAL))) /* A type that is properly aligned for any stack member. */ struct yyalloc { yytype_int16 yyss_alloc; YYSTYPE yyvs_alloc; YYLTYPE yyls_alloc; }; /* The size of the maximum gap between one aligned stack and the next. */ # define YYSTACK_GAP_MAXIMUM (sizeof (struct yyalloc) - 1) /* The size of an array large to enough to hold all stacks, each with N elements. */ # define YYSTACK_BYTES(N) \ ((N) * (sizeof (yytype_int16) + sizeof (YYSTYPE) + sizeof (YYLTYPE)) \ + 2 * YYSTACK_GAP_MAXIMUM) /* Copy COUNT objects from FROM to TO. The source and destination do not overlap. */ # ifndef YYCOPY # if defined __GNUC__ && 1 < __GNUC__ # define YYCOPY(To, From, Count) \ __builtin_memcpy (To, From, (Count) * sizeof (*(From))) # else # define YYCOPY(To, From, Count) \ do \ { \ YYSIZE_T yyi; \ for (yyi = 0; yyi < (Count); yyi++) \ (To)[yyi] = (From)[yyi]; \ } \ while (YYID (0)) # endif # endif /* Relocate STACK from its old location to the new one. The local variables YYSIZE and YYSTACKSIZE give the old and new number of elements in the stack, and YYPTR gives the new location of the stack. Advance YYPTR to a properly aligned location for the next stack. */ # define YYSTACK_RELOCATE(Stack_alloc, Stack) \ do \ { \ YYSIZE_T yynewbytes; \ YYCOPY (&yyptr->Stack_alloc, Stack, yysize); \ Stack = &yyptr->Stack_alloc; \ yynewbytes = yystacksize * sizeof (*Stack) + YYSTACK_GAP_MAXIMUM; \ yyptr += yynewbytes / sizeof (*yyptr); \ } \ while (YYID (0)) #endif /* YYFINAL -- State number of the termination state. */ #define YYFINAL 3 /* YYLAST -- Last index in YYTABLE. */ #define YYLAST 19079 /* YYNTOKENS -- Number of terminals. */ #define YYNTOKENS 210 /* YYNNTS -- Number of nonterminals. */ #define YYNNTS 283 /* YYNRULES -- Number of rules. */ #define YYNRULES 1028 /* YYNRULES -- Number of states. */ #define YYNSTATES 1863 /* YYTRANSLATE(YYLEX) -- Bison symbol number corresponding to YYLEX. */ #define YYUNDEFTOK 2 #define YYMAXUTOK 435 #define YYTRANSLATE(YYX) \ ((unsigned int) (YYX) <= YYMAXUTOK ? yytranslate[YYX] : YYUNDEFTOK) /* YYTRANSLATE[YYLEX] -- Bison symbol number corresponding to YYLEX. */ static const yytype_uint8 yytranslate[] = { 0, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 53, 208, 2, 205, 52, 35, 209, 200, 201, 50, 47, 9, 48, 49, 51, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 30, 202, 40, 14, 41, 29, 56, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 67, 2, 207, 34, 2, 206, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 203, 33, 204, 55, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 31, 32, 36, 37, 38, 39, 42, 43, 44, 45, 46, 54, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 }; #if YYDEBUG /* YYPRHS[YYN] -- Index of the first RHS symbol of rule number YYN in YYRHS. */ static const yytype_uint16 yyprhs[] = { 0, 0, 3, 4, 7, 10, 11, 13, 15, 17, 19, 21, 23, 28, 32, 33, 40, 41, 47, 51, 56, 61, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 236, 238, 242, 244, 248, 250, 252, 255, 259, 264, 266, 269, 273, 278, 280, 283, 287, 292, 294, 298, 300, 304, 307, 309, 312, 315, 321, 326, 329, 330, 332, 334, 336, 338, 342, 348, 357, 358, 363, 364, 371, 372, 383, 384, 389, 392, 396, 399, 403, 406, 410, 414, 418, 422, 426, 430, 436, 438, 440, 442, 443, 453, 454, 465, 471, 472, 486, 487, 493, 497, 501, 504, 507, 510, 513, 516, 519, 523, 526, 529, 533, 536, 537, 542, 552, 553, 554, 559, 562, 563, 565, 566, 568, 569, 579, 580, 591, 592, 604, 605, 615, 616, 627, 628, 637, 638, 648, 649, 657, 658, 667, 668, 676, 677, 686, 688, 690, 692, 694, 696, 699, 703, 707, 710, 713, 714, 717, 718, 721, 722, 724, 728, 730, 734, 737, 738, 740, 743, 748, 750, 755, 757, 762, 764, 769, 771, 776, 780, 786, 790, 795, 800, 806, 812, 817, 818, 820, 822, 827, 828, 834, 835, 838, 839, 843, 844, 852, 861, 868, 871, 877, 884, 889, 890, 895, 901, 909, 916, 923, 931, 941, 950, 957, 965, 971, 974, 979, 985, 989, 990, 994, 999, 1006, 1012, 1018, 1025, 1034, 1042, 1045, 1046, 1048, 1051, 1054, 1058, 1063, 1068, 1072, 1074, 1076, 1079, 1084, 1088, 1094, 1096, 1100, 1103, 1104, 1107, 1111, 1114, 1115, 1116, 1121, 1122, 1128, 1131, 1134, 1137, 1138, 1149, 1150, 1162, 1166, 1170, 1174, 1179, 1184, 1188, 1194, 1197, 1200, 1201, 1208, 1214, 1219, 1223, 1225, 1227, 1231, 1236, 1238, 1241, 1243, 1245, 1250, 1257, 1259, 1261, 1266, 1268, 1270, 1274, 1277, 1280, 1281, 1284, 1285, 1287, 1291, 1293, 1295, 1297, 1299, 1303, 1308, 1313, 1318, 1320, 1322, 1325, 1328, 1331, 1335, 1339, 1341, 1343, 1345, 1347, 1351, 1353, 1357, 1359, 1361, 1363, 1364, 1366, 1369, 1371, 1373, 1375, 1377, 1379, 1381, 1383, 1385, 1386, 1388, 1390, 1392, 1396, 1402, 1404, 1408, 1414, 1419, 1423, 1427, 1431, 1436, 1440, 1444, 1448, 1451, 1453, 1455, 1459, 1463, 1465, 1467, 1468, 1470, 1473, 1478, 1482, 1486, 1493, 1496, 1500, 1507, 1509, 1511, 1513, 1515, 1517, 1524, 1528, 1533, 1540, 1544, 1548, 1552, 1556, 1560, 1564, 1568, 1572, 1576, 1580, 1584, 1588, 1591, 1594, 1597, 1600, 1604, 1608, 1612, 1616, 1620, 1624, 1628, 1632, 1636, 1640, 1644, 1648, 1652, 1656, 1660, 1664, 1668, 1671, 1674, 1677, 1680, 1684, 1688, 1692, 1696, 1700, 1704, 1708, 1712, 1716, 1720, 1724, 1730, 1735, 1737, 1740, 1743, 1746, 1749, 1752, 1755, 1758, 1761, 1764, 1766, 1768, 1770, 1774, 1777, 1779, 1785, 1786, 1787, 1799, 1800, 1813, 1814, 1818, 1819, 1824, 1825, 1832, 1833, 1841, 1842, 1848, 1851, 1854, 1859, 1861, 1863, 1869, 1873, 1879, 1883, 1886, 1887, 1890, 1891, 1896, 1901, 1905, 1910, 1915, 1920, 1925, 1927, 1929, 1931, 1933, 1937, 1940, 1944, 1949, 1952, 1956, 1958, 1961, 1963, 1966, 1968, 1970, 1972, 1974, 1976, 1978, 1983, 1988, 1991, 2000, 2011, 2014, 2016, 2020, 2022, 2025, 2027, 2029, 2031, 2033, 2036, 2041, 2045, 2049, 2054, 2056, 2059, 2064, 2067, 2074, 2075, 2077, 2082, 2083, 2086, 2087, 2089, 2091, 2095, 2097, 2101, 2103, 2105, 2109, 2113, 2115, 2117, 2119, 2121, 2123, 2125, 2127, 2129, 2131, 2133, 2135, 2137, 2139, 2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155, 2157, 2159, 2161, 2163, 2165, 2167, 2169, 2171, 2173, 2175, 2177, 2179, 2181, 2183, 2185, 2187, 2189, 2191, 2193, 2195, 2197, 2199, 2201, 2203, 2205, 2207, 2209, 2211, 2213, 2215, 2217, 2219, 2221, 2223, 2225, 2227, 2229, 2231, 2233, 2235, 2237, 2239, 2241, 2243, 2245, 2247, 2249, 2251, 2253, 2255, 2257, 2259, 2261, 2263, 2265, 2267, 2269, 2271, 2273, 2278, 2280, 2282, 2284, 2286, 2288, 2290, 2294, 2296, 2300, 2302, 2304, 2308, 2310, 2312, 2314, 2317, 2319, 2320, 2321, 2323, 2325, 2329, 2330, 2332, 2334, 2336, 2338, 2340, 2342, 2344, 2346, 2348, 2350, 2352, 2354, 2356, 2360, 2363, 2365, 2367, 2372, 2376, 2381, 2383, 2385, 2389, 2393, 2397, 2401, 2405, 2409, 2413, 2417, 2421, 2425, 2429, 2433, 2437, 2441, 2445, 2449, 2453, 2457, 2460, 2463, 2466, 2469, 2473, 2477, 2481, 2485, 2489, 2493, 2497, 2501, 2505, 2511, 2516, 2520, 2524, 2528, 2530, 2532, 2534, 2536, 2540, 2544, 2548, 2551, 2552, 2554, 2555, 2557, 2558, 2564, 2568, 2572, 2574, 2576, 2578, 2580, 2584, 2587, 2589, 2591, 2593, 2595, 2597, 2601, 2603, 2605, 2607, 2610, 2613, 2618, 2622, 2627, 2630, 2631, 2637, 2641, 2645, 2647, 2651, 2653, 2656, 2657, 2663, 2667, 2670, 2671, 2675, 2676, 2681, 2684, 2685, 2689, 2693, 2695, 2696, 2698, 2700, 2702, 2704, 2708, 2710, 2712, 2714, 2718, 2720, 2722, 2726, 2730, 2733, 2738, 2741, 2746, 2752, 2758, 2764, 2770, 2772, 2774, 2776, 2778, 2780, 2782, 2786, 2790, 2795, 2800, 2804, 2806, 2808, 2810, 2812, 2816, 2818, 2823, 2827, 2831, 2833, 2835, 2837, 2839, 2841, 2845, 2849, 2854, 2859, 2863, 2865, 2867, 2875, 2885, 2893, 2900, 2909, 2911, 2916, 2921, 2923, 2925, 2930, 2933, 2935, 2936, 2938, 2940, 2942, 2946, 2950, 2954, 2955, 2957, 2959, 2963, 2967, 2970, 2974, 2981, 2982, 2984, 2989, 2992, 2993, 2999, 3003, 3007, 3009, 3016, 3021, 3026, 3029, 3032, 3033, 3039, 3043, 3047, 3049, 3052, 3053, 3059, 3063, 3067, 3069, 3072, 3075, 3077, 3080, 3082, 3087, 3091, 3095, 3102, 3106, 3108, 3110, 3112, 3117, 3122, 3127, 3132, 3137, 3142, 3145, 3148, 3153, 3156, 3159, 3161, 3165, 3169, 3173, 3174, 3177, 3183, 3190, 3197, 3205, 3207, 3210, 3212, 3215, 3217, 3222, 3224, 3229, 3233, 3234, 3236, 3240, 3243, 3247, 3249, 3251, 3252, 3253, 3256, 3259, 3262, 3267, 3270, 3276, 3280, 3282, 3284, 3285, 3289, 3294, 3300, 3304, 3306, 3309, 3310, 3315, 3317, 3321, 3324, 3327, 3330, 3332, 3334, 3336, 3338, 3342, 3347, 3354, 3356, 3365, 3372, 3374 }; /* YYRHS -- A `-1'-separated list of the rules' RHS. */ static const yytype_int16 yyrhs[] = { 211, 0, -1, -1, 212, 213, -1, 213, 214, -1, -1, 234, -1, 251, -1, 258, -1, 255, -1, 263, -1, 472, -1, 125, 200, 201, 202, -1, 152, 226, 202, -1, -1, 152, 226, 203, 215, 213, 204, -1, -1, 152, 203, 216, 213, 204, -1, 113, 220, 202, -1, 113, 107, 221, 202, -1, 113, 108, 222, 202, -1, 231, 202, -1, 78, -1, 99, -1, 158, -1, 159, -1, 161, -1, 163, -1, 162, -1, 184, -1, 185, -1, 187, -1, 186, -1, 188, -1, 189, -1, 190, -1, 191, -1, 192, -1, 193, -1, 194, -1, 195, -1, 196, -1, 217, -1, 135, -1, 164, -1, 128, -1, 129, -1, 120, -1, 119, -1, 118, -1, 117, -1, 116, -1, 115, -1, 108, -1, 97, -1, 93, -1, 95, -1, 74, -1, 91, -1, 12, -1, 114, -1, 105, -1, 54, -1, 166, -1, 127, -1, 152, -1, 69, -1, 10, -1, 11, -1, 110, -1, 113, -1, 121, -1, 70, -1, 133, -1, 68, -1, 7, -1, 6, -1, 112, -1, 134, -1, 13, -1, 88, -1, 4, -1, 3, -1, 109, -1, 73, -1, 72, -1, 103, -1, 104, -1, 106, -1, 100, -1, 27, -1, 107, -1, 71, -1, 101, -1, 169, -1, 92, -1, 94, -1, 96, -1, 102, -1, 89, -1, 90, -1, 98, -1, 111, -1, 122, -1, 218, -1, 126, -1, 220, 9, 223, -1, 223, -1, 224, 9, 224, -1, 224, -1, 225, 9, 225, -1, 225, -1, 226, -1, 155, 226, -1, 226, 98, 217, -1, 155, 226, 98, 217, -1, 226, -1, 155, 226, -1, 226, 98, 217, -1, 155, 226, 98, 217, -1, 226, -1, 155, 226, -1, 226, 98, 217, -1, 155, 226, 98, 217, -1, 217, -1, 226, 155, 217, -1, 226, -1, 152, 155, 226, -1, 155, 226, -1, 227, -1, 227, 477, -1, 227, 477, -1, 231, 9, 473, 14, 412, -1, 108, 473, 14, 412, -1, 232, 233, -1, -1, 234, -1, 251, -1, 258, -1, 263, -1, 203, 232, 204, -1, 71, 339, 234, 285, 287, -1, 71, 339, 30, 232, 286, 288, 74, 202, -1, -1, 90, 339, 235, 279, -1, -1, 89, 236, 234, 90, 339, 202, -1, -1, 92, 200, 341, 202, 341, 202, 341, 201, 237, 277, -1, -1, 100, 339, 238, 282, -1, 104, 202, -1, 104, 348, 202, -1, 106, 202, -1, 106, 348, 202, -1, 109, 202, -1, 109, 348, 202, -1, 27, 104, 202, -1, 114, 295, 202, -1, 120, 297, 202, -1, 88, 340, 202, -1, 144, 340, 202, -1, 122, 200, 469, 201, 202, -1, 202, -1, 82, -1, 83, -1, -1, 94, 200, 348, 98, 276, 275, 201, 239, 278, -1, -1, 94, 200, 348, 28, 98, 276, 275, 201, 240, 278, -1, 96, 200, 281, 201, 280, -1, -1, 110, 243, 111, 200, 403, 80, 201, 203, 232, 204, 245, 241, 248, -1, -1, 110, 243, 169, 242, 246, -1, 112, 348, 202, -1, 105, 217, 202, -1, 348, 202, -1, 342, 202, -1, 343, 202, -1, 344, 202, -1, 345, 202, -1, 346, 202, -1, 109, 345, 202, -1, 347, 202, -1, 373, 202, -1, 109, 372, 202, -1, 217, 30, -1, -1, 203, 244, 232, 204, -1, 245, 111, 200, 403, 80, 201, 203, 232, 204, -1, -1, -1, 203, 247, 232, 204, -1, 169, 246, -1, -1, 35, -1, -1, 107, -1, -1, 250, 249, 476, 252, 200, 291, 201, 481, 325, -1, -1, 329, 250, 249, 476, 253, 200, 291, 201, 481, 325, -1, -1, 433, 328, 250, 249, 476, 254, 200, 291, 201, 481, 325, -1, -1, 162, 217, 256, 30, 491, 471, 203, 298, 204, -1, -1, 433, 162, 217, 257, 30, 491, 471, 203, 298, 204, -1, -1, 269, 266, 259, 270, 271, 203, 301, 204, -1, -1, 433, 269, 266, 260, 270, 271, 203, 301, 204, -1, -1, 127, 267, 261, 272, 203, 301, 204, -1, -1, 433, 127, 267, 262, 272, 203, 301, 204, -1, -1, 164, 268, 264, 271, 203, 301, 204, -1, -1, 433, 164, 268, 265, 271, 203, 301, 204, -1, 476, -1, 156, -1, 476, -1, 476, -1, 126, -1, 119, 126, -1, 119, 118, 126, -1, 118, 119, 126, -1, 118, 126, -1, 128, 403, -1, -1, 129, 273, -1, -1, 128, 273, -1, -1, 403, -1, 273, 9, 403, -1, 403, -1, 274, 9, 403, -1, 132, 276, -1, -1, 445, -1, 35, 445, -1, 133, 200, 458, 201, -1, 234, -1, 30, 232, 93, 202, -1, 234, -1, 30, 232, 95, 202, -1, 234, -1, 30, 232, 91, 202, -1, 234, -1, 30, 232, 97, 202, -1, 217, 14, 412, -1, 281, 9, 217, 14, 412, -1, 203, 283, 204, -1, 203, 202, 283, 204, -1, 30, 283, 101, 202, -1, 30, 202, 283, 101, 202, -1, 283, 102, 348, 284, 232, -1, 283, 103, 284, 232, -1, -1, 30, -1, 202, -1, 285, 72, 339, 234, -1, -1, 286, 72, 339, 30, 232, -1, -1, 73, 234, -1, -1, 73, 30, 232, -1, -1, 290, 9, 434, 331, 492, 165, 80, -1, 290, 9, 434, 331, 492, 35, 165, 80, -1, 290, 9, 434, 331, 492, 165, -1, 290, 417, -1, 434, 331, 492, 165, 80, -1, 434, 331, 492, 35, 165, 80, -1, 434, 331, 492, 165, -1, -1, 434, 331, 492, 80, -1, 434, 331, 492, 35, 80, -1, 434, 331, 492, 35, 80, 14, 348, -1, 434, 331, 492, 80, 14, 348, -1, 290, 9, 434, 331, 492, 80, -1, 290, 9, 434, 331, 492, 35, 80, -1, 290, 9, 434, 331, 492, 35, 80, 14, 348, -1, 290, 9, 434, 331, 492, 80, 14, 348, -1, 292, 9, 434, 492, 165, 80, -1, 292, 9, 434, 492, 35, 165, 80, -1, 292, 9, 434, 492, 165, -1, 292, 417, -1, 434, 492, 165, 80, -1, 434, 492, 35, 165, 80, -1, 434, 492, 165, -1, -1, 434, 492, 80, -1, 434, 492, 35, 80, -1, 434, 492, 35, 80, 14, 348, -1, 434, 492, 80, 14, 348, -1, 292, 9, 434, 492, 80, -1, 292, 9, 434, 492, 35, 80, -1, 292, 9, 434, 492, 35, 80, 14, 348, -1, 292, 9, 434, 492, 80, 14, 348, -1, 294, 417, -1, -1, 348, -1, 35, 445, -1, 165, 348, -1, 294, 9, 348, -1, 294, 9, 165, 348, -1, 294, 9, 35, 445, -1, 295, 9, 296, -1, 296, -1, 80, -1, 205, 445, -1, 205, 203, 348, 204, -1, 297, 9, 80, -1, 297, 9, 80, 14, 412, -1, 80, -1, 80, 14, 412, -1, 298, 299, -1, -1, 300, 202, -1, 474, 14, 412, -1, 301, 302, -1, -1, -1, 327, 303, 333, 202, -1, -1, 329, 491, 304, 333, 202, -1, 334, 202, -1, 335, 202, -1, 336, 202, -1, -1, 328, 250, 249, 475, 200, 305, 289, 201, 481, 326, -1, -1, 433, 328, 250, 249, 476, 200, 306, 289, 201, 481, 326, -1, 158, 311, 202, -1, 159, 319, 202, -1, 161, 321, 202, -1, 4, 128, 403, 202, -1, 4, 129, 403, 202, -1, 113, 274, 202, -1, 113, 274, 203, 307, 204, -1, 307, 308, -1, 307, 309, -1, -1, 230, 151, 217, 166, 274, 202, -1, 310, 98, 328, 217, 202, -1, 310, 98, 329, 202, -1, 230, 151, 217, -1, 217, -1, 312, -1, 311, 9, 312, -1, 313, 400, 317, 318, -1, 156, -1, 29, 314, -1, 314, -1, 134, -1, 134, 172, 491, 173, -1, 134, 172, 491, 9, 491, 173, -1, 403, -1, 121, -1, 162, 203, 316, 204, -1, 135, -1, 411, -1, 315, 9, 411, -1, 315, 416, -1, 14, 412, -1, -1, 56, 163, -1, -1, 320, -1, 319, 9, 320, -1, 160, -1, 322, -1, 217, -1, 124, -1, 200, 323, 201, -1, 200, 323, 201, 50, -1, 200, 323, 201, 29, -1, 200, 323, 201, 47, -1, 322, -1, 324, -1, 324, 50, -1, 324, 29, -1, 324, 47, -1, 323, 9, 323, -1, 323, 33, 323, -1, 217, -1, 156, -1, 160, -1, 202, -1, 203, 232, 204, -1, 202, -1, 203, 232, 204, -1, 329, -1, 121, -1, 329, -1, -1, 330, -1, 329, 330, -1, 115, -1, 116, -1, 117, -1, 120, -1, 119, -1, 118, -1, 182, -1, 332, -1, -1, 115, -1, 116, -1, 117, -1, 333, 9, 80, -1, 333, 9, 80, 14, 412, -1, 80, -1, 80, 14, 412, -1, 334, 9, 474, 14, 412, -1, 108, 474, 14, 412, -1, 335, 9, 474, -1, 119, 108, 474, -1, 119, 337, 471, -1, 337, 471, 14, 491, -1, 108, 177, 476, -1, 200, 338, 201, -1, 69, 407, 410, -1, 68, 348, -1, 392, -1, 368, -1, 200, 348, 201, -1, 340, 9, 348, -1, 348, -1, 340, -1, -1, 27, -1, 27, 348, -1, 27, 348, 132, 348, -1, 200, 342, 201, -1, 445, 14, 342, -1, 133, 200, 458, 201, 14, 342, -1, 28, 348, -1, 445, 14, 345, -1, 133, 200, 458, 201, 14, 345, -1, 349, -1, 445, -1, 338, -1, 449, -1, 448, -1, 133, 200, 458, 201, 14, 348, -1, 445, 14, 348, -1, 445, 14, 35, 445, -1, 445, 14, 35, 69, 407, 410, -1, 445, 26, 348, -1, 445, 25, 348, -1, 445, 24, 348, -1, 445, 23, 348, -1, 445, 22, 348, -1, 445, 21, 348, -1, 445, 20, 348, -1, 445, 19, 348, -1, 445, 18, 348, -1, 445, 17, 348, -1, 445, 16, 348, -1, 445, 15, 348, -1, 445, 65, -1, 65, 445, -1, 445, 64, -1, 64, 445, -1, 348, 31, 348, -1, 348, 32, 348, -1, 348, 10, 348, -1, 348, 12, 348, -1, 348, 11, 348, -1, 348, 33, 348, -1, 348, 35, 348, -1, 348, 34, 348, -1, 348, 49, 348, -1, 348, 47, 348, -1, 348, 48, 348, -1, 348, 50, 348, -1, 348, 51, 348, -1, 348, 66, 348, -1, 348, 52, 348, -1, 348, 46, 348, -1, 348, 45, 348, -1, 47, 348, -1, 48, 348, -1, 53, 348, -1, 55, 348, -1, 348, 37, 348, -1, 348, 36, 348, -1, 348, 39, 348, -1, 348, 38, 348, -1, 348, 40, 348, -1, 348, 44, 348, -1, 348, 41, 348, -1, 348, 43, 348, -1, 348, 42, 348, -1, 348, 54, 407, -1, 200, 349, 201, -1, 348, 29, 348, 30, 348, -1, 348, 29, 30, 348, -1, 468, -1, 63, 348, -1, 62, 348, -1, 61, 348, -1, 60, 348, -1, 59, 348, -1, 58, 348, -1, 57, 348, -1, 70, 408, -1, 56, 348, -1, 414, -1, 367, -1, 366, -1, 206, 409, 206, -1, 13, 348, -1, 370, -1, 113, 200, 391, 417, 201, -1, -1, -1, 250, 249, 200, 352, 291, 201, 481, 350, 203, 232, 204, -1, -1, 329, 250, 249, 200, 353, 291, 201, 481, 350, 203, 232, 204, -1, -1, 80, 355, 360, -1, -1, 182, 80, 356, 360, -1, -1, 197, 357, 291, 198, 481, 360, -1, -1, 182, 197, 358, 291, 198, 481, 360, -1, -1, 182, 203, 359, 232, 204, -1, 8, 348, -1, 8, 345, -1, 8, 203, 232, 204, -1, 87, -1, 470, -1, 362, 9, 361, 132, 348, -1, 361, 132, 348, -1, 363, 9, 361, 132, 412, -1, 361, 132, 412, -1, 362, 416, -1, -1, 363, 416, -1, -1, 176, 200, 364, 201, -1, 134, 200, 459, 201, -1, 67, 459, 207, -1, 403, 203, 461, 204, -1, 403, 203, 463, 204, -1, 370, 67, 455, 207, -1, 371, 67, 455, 207, -1, 367, -1, 470, -1, 448, -1, 87, -1, 200, 349, 201, -1, 374, 375, -1, 445, 14, 372, -1, 183, 80, 186, 348, -1, 376, 387, -1, 376, 387, 390, -1, 387, -1, 387, 390, -1, 377, -1, 376, 377, -1, 378, -1, 379, -1, 380, -1, 381, -1, 382, -1, 383, -1, 183, 80, 186, 348, -1, 190, 80, 14, 348, -1, 184, 348, -1, 185, 80, 186, 348, 187, 348, 188, 348, -1, 185, 80, 186, 348, 187, 348, 188, 348, 189, 80, -1, 191, 384, -1, 385, -1, 384, 9, 385, -1, 348, -1, 348, 386, -1, 192, -1, 193, -1, 388, -1, 389, -1, 194, 348, -1, 195, 348, 196, 348, -1, 189, 80, 375, -1, 391, 9, 80, -1, 391, 9, 35, 80, -1, 80, -1, 35, 80, -1, 170, 156, 393, 171, -1, 395, 51, -1, 395, 171, 396, 170, 51, 394, -1, -1, 156, -1, 395, 397, 14, 398, -1, -1, 396, 399, -1, -1, 156, -1, 157, -1, 203, 348, 204, -1, 157, -1, 203, 348, 204, -1, 392, -1, 401, -1, 400, 30, 401, -1, 400, 48, 401, -1, 217, -1, 70, -1, 107, -1, 108, -1, 109, -1, 27, -1, 28, -1, 110, -1, 111, -1, 169, -1, 112, -1, 71, -1, 72, -1, 74, -1, 73, -1, 90, -1, 91, -1, 89, -1, 92, -1, 93, -1, 94, -1, 95, -1, 96, -1, 97, -1, 54, -1, 98, -1, 100, -1, 101, -1, 102, -1, 103, -1, 104, -1, 106, -1, 105, -1, 88, -1, 13, -1, 126, -1, 127, -1, 128, -1, 129, -1, 69, -1, 68, -1, 121, -1, 5, -1, 7, -1, 6, -1, 4, -1, 3, -1, 152, -1, 113, -1, 114, -1, 123, -1, 124, -1, 125, -1, 120, -1, 119, -1, 118, -1, 117, -1, 116, -1, 115, -1, 182, -1, 122, -1, 133, -1, 134, -1, 10, -1, 12, -1, 11, -1, 136, -1, 138, -1, 137, -1, 139, -1, 140, -1, 154, -1, 153, -1, 181, -1, 164, -1, 167, -1, 166, -1, 177, -1, 179, -1, 176, -1, 229, 200, 293, 201, -1, 230, -1, 156, -1, 403, -1, 411, -1, 120, -1, 453, -1, 200, 349, 201, -1, 404, -1, 405, 151, 454, -1, 404, -1, 451, -1, 406, 151, 454, -1, 403, -1, 120, -1, 456, -1, 200, 201, -1, 339, -1, -1, -1, 86, -1, 465, -1, 200, 293, 201, -1, -1, 75, -1, 76, -1, 77, -1, 87, -1, 139, -1, 140, -1, 154, -1, 136, -1, 167, -1, 137, -1, 138, -1, 153, -1, 181, -1, 147, 86, 148, -1, 147, 148, -1, 411, -1, 228, -1, 134, 200, 415, 201, -1, 67, 415, 207, -1, 176, 200, 365, 201, -1, 413, -1, 369, -1, 200, 412, 201, -1, 412, 31, 412, -1, 412, 32, 412, -1, 412, 10, 412, -1, 412, 12, 412, -1, 412, 11, 412, -1, 412, 33, 412, -1, 412, 35, 412, -1, 412, 34, 412, -1, 412, 49, 412, -1, 412, 47, 412, -1, 412, 48, 412, -1, 412, 50, 412, -1, 412, 51, 412, -1, 412, 52, 412, -1, 412, 46, 412, -1, 412, 45, 412, -1, 412, 66, 412, -1, 53, 412, -1, 55, 412, -1, 47, 412, -1, 48, 412, -1, 412, 37, 412, -1, 412, 36, 412, -1, 412, 39, 412, -1, 412, 38, 412, -1, 412, 40, 412, -1, 412, 44, 412, -1, 412, 41, 412, -1, 412, 43, 412, -1, 412, 42, 412, -1, 412, 29, 412, 30, 412, -1, 412, 29, 30, 412, -1, 230, 151, 218, -1, 156, 151, 218, -1, 230, 151, 126, -1, 228, -1, 79, -1, 470, -1, 411, -1, 208, 465, 208, -1, 209, 465, 209, -1, 147, 465, 148, -1, 418, 416, -1, -1, 9, -1, -1, 9, -1, -1, 418, 9, 412, 132, 412, -1, 418, 9, 412, -1, 412, 132, 412, -1, 412, -1, 75, -1, 76, -1, 77, -1, 147, 86, 148, -1, 147, 148, -1, 75, -1, 76, -1, 77, -1, 217, -1, 87, -1, 87, 49, 421, -1, 419, -1, 421, -1, 217, -1, 47, 420, -1, 48, 420, -1, 134, 200, 423, 201, -1, 67, 423, 207, -1, 176, 200, 426, 201, -1, 424, 416, -1, -1, 424, 9, 422, 132, 422, -1, 424, 9, 422, -1, 422, 132, 422, -1, 422, -1, 425, 9, 422, -1, 422, -1, 427, 416, -1, -1, 427, 9, 361, 132, 422, -1, 361, 132, 422, -1, 425, 416, -1, -1, 200, 428, 201, -1, -1, 430, 9, 217, 429, -1, 217, 429, -1, -1, 432, 430, 416, -1, 46, 431, 45, -1, 433, -1, -1, 130, -1, 131, -1, 217, -1, 156, -1, 203, 348, 204, -1, 436, -1, 454, -1, 217, -1, 203, 348, 204, -1, 438, -1, 454, -1, 67, 455, 207, -1, 203, 348, 204, -1, 446, 440, -1, 200, 338, 201, 440, -1, 457, 440, -1, 200, 338, 201, 440, -1, 200, 338, 201, 435, 437, -1, 200, 349, 201, 435, 437, -1, 200, 338, 201, 435, 436, -1, 200, 349, 201, 435, 436, -1, 452, -1, 402, -1, 450, -1, 451, -1, 441, -1, 443, -1, 445, 435, 437, -1, 406, 151, 454, -1, 447, 200, 293, 201, -1, 448, 200, 293, 201, -1, 200, 445, 201, -1, 402, -1, 450, -1, 451, -1, 441, -1, 445, 435, 437, -1, 444, -1, 447, 200, 293, 201, -1, 200, 445, 201, -1, 406, 151, 454, -1, 452, -1, 441, -1, 402, -1, 367, -1, 411, -1, 200, 445, 201, -1, 200, 349, 201, -1, 448, 200, 293, 201, -1, 447, 200, 293, 201, -1, 200, 449, 201, -1, 351, -1, 354, -1, 445, 435, 439, 477, 200, 293, 201, -1, 200, 338, 201, 435, 439, 477, 200, 293, 201, -1, 406, 151, 219, 477, 200, 293, 201, -1, 406, 151, 454, 200, 293, 201, -1, 406, 151, 203, 348, 204, 200, 293, 201, -1, 453, -1, 453, 67, 455, 207, -1, 453, 203, 348, 204, -1, 454, -1, 80, -1, 205, 203, 348, 204, -1, 205, 454, -1, 348, -1, -1, 452, -1, 442, -1, 443, -1, 456, 435, 437, -1, 405, 151, 452, -1, 200, 445, 201, -1, -1, 442, -1, 444, -1, 456, 435, 436, -1, 200, 445, 201, -1, 458, 9, -1, 458, 9, 445, -1, 458, 9, 133, 200, 458, 201, -1, -1, 445, -1, 133, 200, 458, 201, -1, 460, 416, -1, -1, 460, 9, 348, 132, 348, -1, 460, 9, 348, -1, 348, 132, 348, -1, 348, -1, 460, 9, 348, 132, 35, 445, -1, 460, 9, 35, 445, -1, 348, 132, 35, 445, -1, 35, 445, -1, 462, 416, -1, -1, 462, 9, 348, 132, 348, -1, 462, 9, 348, -1, 348, 132, 348, -1, 348, -1, 464, 416, -1, -1, 464, 9, 412, 132, 412, -1, 464, 9, 412, -1, 412, 132, 412, -1, 412, -1, 465, 466, -1, 465, 86, -1, 466, -1, 86, 466, -1, 80, -1, 80, 67, 467, 207, -1, 80, 435, 217, -1, 149, 348, 204, -1, 149, 79, 67, 348, 207, 204, -1, 150, 445, 204, -1, 217, -1, 81, -1, 80, -1, 123, 200, 340, 201, -1, 124, 200, 445, 201, -1, 124, 200, 349, 201, -1, 124, 200, 449, 201, -1, 124, 200, 448, 201, -1, 124, 200, 338, 201, -1, 7, 348, -1, 6, 348, -1, 5, 200, 348, 201, -1, 4, 348, -1, 3, 348, -1, 445, -1, 469, 9, 445, -1, 406, 151, 218, -1, 406, 151, 126, -1, -1, 98, 491, -1, 177, 476, 14, 491, 202, -1, 433, 177, 476, 14, 491, 202, -1, 179, 476, 471, 14, 491, 202, -1, 433, 179, 476, 471, 14, 491, 202, -1, 219, -1, 491, 219, -1, 218, -1, 491, 218, -1, 219, -1, 219, 172, 483, 173, -1, 217, -1, 217, 172, 483, 173, -1, 172, 479, 173, -1, -1, 491, -1, 478, 9, 491, -1, 478, 416, -1, 478, 9, 165, -1, 479, -1, 165, -1, -1, -1, 30, 491, -1, 98, 491, -1, 99, 491, -1, 483, 9, 484, 217, -1, 484, 217, -1, 483, 9, 484, 217, 482, -1, 484, 217, 482, -1, 47, -1, 48, -1, -1, 87, 132, 491, -1, 29, 87, 132, 491, -1, 230, 151, 217, 132, 491, -1, 486, 9, 485, -1, 485, -1, 486, 416, -1, -1, 176, 200, 487, 201, -1, 230, -1, 217, 151, 490, -1, 217, 477, -1, 29, 491, -1, 56, 491, -1, 230, -1, 134, -1, 135, -1, 488, -1, 489, 151, 490, -1, 134, 172, 491, 173, -1, 134, 172, 491, 9, 491, 173, -1, 156, -1, 200, 107, 200, 480, 201, 30, 491, 201, -1, 200, 491, 9, 478, 416, 201, -1, 491, -1, -1 }; /* YYRLINE[YYN] -- source line where rule number YYN was defined. */ static const yytype_uint16 yyrline[] = { 0, 740, 740, 740, 749, 751, 754, 755, 756, 757, 758, 759, 760, 763, 765, 765, 767, 767, 769, 770, 772, 774, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 866, 870, 871, 875, 877, 881, 883, 887, 889, 893, 894, 895, 896, 901, 902, 903, 904, 909, 910, 911, 912, 917, 918, 922, 923, 925, 928, 934, 941, 948, 952, 958, 960, 963, 964, 965, 966, 969, 970, 974, 979, 979, 985, 985, 992, 991, 997, 997, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1020, 1018, 1027, 1025, 1032, 1040, 1034, 1044, 1042, 1046, 1047, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1069, 1069, 1074, 1080, 1084, 1084, 1092, 1093, 1097, 1098, 1102, 1108, 1106, 1121, 1118, 1134, 1131, 1148, 1147, 1156, 1154, 1166, 1165, 1184, 1182, 1201, 1200, 1209, 1207, 1219, 1218, 1230, 1228, 1241, 1242, 1246, 1249, 1252, 1253, 1254, 1257, 1258, 1261, 1263, 1266, 1267, 1270, 1271, 1274, 1275, 1279, 1280, 1285, 1286, 1289, 1290, 1291, 1295, 1296, 1300, 1301, 1305, 1306, 1310, 1311, 1316, 1317, 1322, 1323, 1324, 1325, 1328, 1331, 1333, 1336, 1337, 1341, 1343, 1346, 1349, 1352, 1353, 1356, 1357, 1361, 1367, 1373, 1380, 1382, 1387, 1392, 1398, 1402, 1406, 1410, 1415, 1420, 1425, 1430, 1436, 1445, 1450, 1455, 1461, 1463, 1467, 1471, 1476, 1480, 1483, 1486, 1490, 1494, 1498, 1502, 1507, 1515, 1517, 1520, 1521, 1522, 1523, 1525, 1527, 1532, 1533, 1536, 1537, 1538, 1542, 1543, 1545, 1546, 1550, 1552, 1555, 1559, 1565, 1567, 1570, 1570, 1574, 1573, 1577, 1579, 1582, 1585, 1583, 1599, 1595, 1609, 1611, 1613, 1615, 1617, 1619, 1621, 1625, 1626, 1627, 1630, 1636, 1640, 1646, 1649, 1654, 1656, 1661, 1666, 1670, 1671, 1675, 1676, 1678, 1680, 1686, 1687, 1689, 1693, 1694, 1699, 1703, 1704, 1708, 1709, 1713, 1715, 1721, 1726, 1727, 1729, 1733, 1734, 1735, 1736, 1740, 1741, 1742, 1743, 1744, 1745, 1747, 1752, 1755, 1756, 1760, 1761, 1765, 1766, 1769, 1770, 1773, 1774, 1777, 1778, 1782, 1783, 1784, 1785, 1786, 1787, 1788, 1792, 1793, 1796, 1797, 1798, 1801, 1803, 1805, 1806, 1809, 1811, 1815, 1817, 1821, 1825, 1829, 1834, 1835, 1837, 1838, 1839, 1842, 1846, 1847, 1851, 1852, 1856, 1857, 1858, 1859, 1863, 1867, 1872, 1876, 1880, 1885, 1886, 1887, 1888, 1889, 1893, 1895, 1896, 1897, 1900, 1901, 1902, 1903, 1904, 1905, 1906, 1907, 1908, 1909, 1910, 1911, 1912, 1913, 1914, 1915, 1916, 1917, 1918, 1919, 1920, 1921, 1922, 1923, 1924, 1925, 1926, 1927, 1928, 1929, 1930, 1931, 1932, 1933, 1934, 1935, 1936, 1937, 1938, 1939, 1940, 1941, 1942, 1944, 1945, 1947, 1948, 1950, 1951, 1952, 1953, 1954, 1955, 1956, 1957, 1958, 1959, 1960, 1961, 1962, 1963, 1964, 1965, 1966, 1967, 1968, 1972, 1976, 1981, 1980, 1995, 1993, 2010, 2010, 2026, 2025, 2043, 2043, 2059, 2058, 2077, 2076, 2097, 2098, 2099, 2104, 2106, 2110, 2114, 2120, 2124, 2130, 2132, 2136, 2138, 2142, 2146, 2147, 2151, 2158, 2165, 2167, 2172, 2173, 2174, 2175, 2177, 2181, 2185, 2189, 2193, 2195, 2197, 2199, 2204, 2205, 2210, 2211, 2212, 2213, 2214, 2215, 2219, 2223, 2227, 2231, 2236, 2241, 2245, 2246, 2250, 2251, 2255, 2256, 2260, 2261, 2265, 2269, 2273, 2277, 2278, 2279, 2280, 2284, 2290, 2299, 2312, 2313, 2316, 2319, 2322, 2323, 2326, 2330, 2333, 2336, 2343, 2344, 2348, 2349, 2351, 2355, 2356, 2357, 2358, 2359, 2360, 2361, 2362, 2363, 2364, 2365, 2366, 2367, 2368, 2369, 2370, 2371, 2372, 2373, 2374, 2375, 2376, 2377, 2378, 2379, 2380, 2381, 2382, 2383, 2384, 2385, 2386, 2387, 2388, 2389, 2390, 2391, 2392, 2393, 2394, 2395, 2396, 2397, 2398, 2399, 2400, 2401, 2402, 2403, 2404, 2405, 2406, 2407, 2408, 2409, 2410, 2411, 2412, 2413, 2414, 2415, 2416, 2417, 2418, 2419, 2420, 2421, 2422, 2423, 2424, 2425, 2426, 2427, 2428, 2429, 2430, 2431, 2432, 2433, 2434, 2438, 2443, 2444, 2448, 2449, 2450, 2451, 2453, 2457, 2458, 2469, 2470, 2472, 2484, 2485, 2486, 2490, 2491, 2492, 2496, 2497, 2498, 2501, 2503, 2507, 2508, 2509, 2510, 2512, 2513, 2514, 2515, 2516, 2517, 2518, 2519, 2520, 2521, 2524, 2529, 2530, 2531, 2533, 2534, 2536, 2537, 2538, 2539, 2541, 2543, 2545, 2547, 2549, 2550, 2551, 2552, 2553, 2554, 2555, 2556, 2557, 2558, 2559, 2560, 2561, 2562, 2563, 2564, 2565, 2567, 2569, 2571, 2573, 2574, 2577, 2578, 2582, 2586, 2588, 2592, 2595, 2598, 2604, 2605, 2606, 2607, 2608, 2609, 2610, 2615, 2617, 2621, 2622, 2625, 2626, 2630, 2633, 2635, 2637, 2641, 2642, 2643, 2644, 2647, 2651, 2652, 2653, 2654, 2658, 2660, 2667, 2668, 2669, 2670, 2671, 2672, 2674, 2675, 2680, 2682, 2685, 2688, 2690, 2692, 2695, 2697, 2701, 2703, 2706, 2709, 2715, 2717, 2720, 2721, 2726, 2729, 2733, 2733, 2738, 2741, 2742, 2746, 2747, 2751, 2752, 2753, 2757, 2762, 2767, 2768, 2772, 2777, 2782, 2783, 2787, 2788, 2793, 2795, 2800, 2811, 2825, 2837, 2852, 2853, 2854, 2855, 2856, 2857, 2858, 2868, 2877, 2879, 2881, 2885, 2886, 2887, 2888, 2889, 2905, 2906, 2908, 2910, 2917, 2918, 2919, 2920, 2921, 2922, 2923, 2924, 2926, 2931, 2935, 2936, 2940, 2943, 2950, 2954, 2963, 2970, 2978, 2980, 2981, 2985, 2986, 2988, 2993, 2994, 3005, 3006, 3007, 3008, 3019, 3022, 3025, 3026, 3027, 3028, 3039, 3043, 3044, 3045, 3047, 3048, 3049, 3053, 3055, 3058, 3060, 3061, 3062, 3063, 3066, 3068, 3069, 3073, 3075, 3078, 3080, 3081, 3082, 3086, 3088, 3091, 3094, 3096, 3098, 3102, 3103, 3105, 3106, 3112, 3113, 3115, 3125, 3127, 3129, 3132, 3133, 3134, 3138, 3139, 3140, 3141, 3142, 3143, 3144, 3145, 3146, 3147, 3148, 3152, 3153, 3157, 3159, 3167, 3169, 3173, 3177, 3182, 3186, 3194, 3195, 3199, 3200, 3206, 3207, 3216, 3217, 3225, 3228, 3232, 3235, 3240, 3245, 3247, 3248, 3249, 3253, 3254, 3258, 3259, 3262, 3265, 3267, 3271, 3277, 3278, 3279, 3283, 3287, 3297, 3305, 3307, 3311, 3313, 3318, 3324, 3327, 3332, 3340, 3343, 3346, 3347, 3350, 3353, 3354, 3359, 3362, 3366, 3370, 3376, 3386, 3387 }; #endif #if YYDEBUG || YYERROR_VERBOSE || YYTOKEN_TABLE /* YYTNAME[SYMBOL-NUM] -- String name of the symbol SYMBOL-NUM. First, the terminals, then, starting at YYNTOKENS, nonterminals. */ static const char *const yytname[] = { "$end", "error", "$undefined", "T_REQUIRE_ONCE", "T_REQUIRE", "T_EVAL", "T_INCLUDE_ONCE", "T_INCLUDE", "T_LAMBDA_ARROW", "','", "T_LOGICAL_OR", "T_LOGICAL_XOR", "T_LOGICAL_AND", "T_PRINT", "'='", "T_POW_EQUAL", "T_SR_EQUAL", "T_SL_EQUAL", "T_XOR_EQUAL", "T_OR_EQUAL", "T_AND_EQUAL", "T_MOD_EQUAL", "T_CONCAT_EQUAL", "T_DIV_EQUAL", "T_MUL_EQUAL", "T_MINUS_EQUAL", "T_PLUS_EQUAL", "T_YIELD", "T_AWAIT", "'?'", "':'", "T_BOOLEAN_OR", "T_BOOLEAN_AND", "'|'", "'^'", "'&'", "T_IS_NOT_IDENTICAL", "T_IS_IDENTICAL", "T_IS_NOT_EQUAL", "T_IS_EQUAL", "'<'", "'>'", "T_SPACESHIP", "T_IS_GREATER_OR_EQUAL", "T_IS_SMALLER_OR_EQUAL", "T_SR", "T_SL", "'+'", "'-'", "'.'", "'*'", "'/'", "'%'", "'!'", "T_INSTANCEOF", "'~'", "'@'", "T_UNSET_CAST", "T_BOOL_CAST", "T_OBJECT_CAST", "T_ARRAY_CAST", "T_STRING_CAST", "T_DOUBLE_CAST", "T_INT_CAST", "T_DEC", "T_INC", "T_POW", "'['", "T_CLONE", "T_NEW", "T_EXIT", "T_IF", "T_ELSEIF", "T_ELSE", "T_ENDIF", "T_LNUMBER", "T_DNUMBER", "T_ONUMBER", "T_STRING", "T_STRING_VARNAME", "T_VARIABLE", "T_NUM_STRING", "T_INLINE_HTML", "T_HASHBANG", "T_CHARACTER", "T_BAD_CHARACTER", "T_ENCAPSED_AND_WHITESPACE", "T_CONSTANT_ENCAPSED_STRING", "T_ECHO", "T_DO", "T_WHILE", "T_ENDWHILE", "T_FOR", "T_ENDFOR", "T_FOREACH", "T_ENDFOREACH", "T_DECLARE", "T_ENDDECLARE", "T_AS", "T_SUPER", "T_SWITCH", "T_ENDSWITCH", "T_CASE", "T_DEFAULT", "T_BREAK", "T_GOTO", "T_CONTINUE", "T_FUNCTION", "T_CONST", "T_RETURN", "T_TRY", "T_CATCH", "T_THROW", "T_USE", "T_GLOBAL", "T_PUBLIC", "T_PROTECTED", "T_PRIVATE", "T_FINAL", "T_ABSTRACT", "T_STATIC", "T_VAR", "T_UNSET", "T_ISSET", "T_EMPTY", "T_HALT_COMPILER", "T_CLASS", "T_INTERFACE", "T_EXTENDS", "T_IMPLEMENTS", "T_OBJECT_OPERATOR", "T_NULLSAFE_OBJECT_OPERATOR", "T_DOUBLE_ARROW", "T_LIST", "T_ARRAY", "T_CALLABLE", "T_CLASS_C", "T_METHOD_C", "T_FUNC_C", "T_LINE", "T_FILE", "T_COMMENT", "T_DOC_COMMENT", "T_OPEN_TAG", "T_OPEN_TAG_WITH_ECHO", "T_CLOSE_TAG", "T_WHITESPACE", "T_START_HEREDOC", "T_END_HEREDOC", "T_DOLLAR_OPEN_CURLY_BRACES", "T_CURLY_OPEN", "T_DOUBLE_COLON", "T_NAMESPACE", "T_NS_C", "T_DIR", "T_NS_SEPARATOR", "T_XHP_LABEL", "T_XHP_TEXT", "T_XHP_ATTRIBUTE", "T_XHP_CATEGORY", "T_XHP_CATEGORY_LABEL", "T_XHP_CHILDREN", "T_ENUM", "T_XHP_REQUIRED", "T_TRAIT", "\"...\"", "T_INSTEADOF", "T_TRAIT_C", "T_HH_ERROR", "T_FINALLY", "T_XHP_TAG_LT", "T_XHP_TAG_GT", "T_TYPELIST_LT", "T_TYPELIST_GT", "T_UNRESOLVED_LT", "T_COLLECTION", "T_SHAPE", "T_TYPE", "T_UNRESOLVED_TYPE", "T_NEWTYPE", "T_UNRESOLVED_NEWTYPE", "T_COMPILER_HALT_OFFSET", "T_ASYNC", "T_FROM", "T_WHERE", "T_JOIN", "T_IN", "T_ON", "T_EQUALS", "T_INTO", "T_LET", "T_ORDERBY", "T_ASCENDING", "T_DESCENDING", "T_SELECT", "T_GROUP", "T_BY", "T_LAMBDA_OP", "T_LAMBDA_CP", "T_UNRESOLVED_OP", "'('", "')'", "';'", "'{'", "'}'", "'$'", "'`'", "']'", "'\"'", "'\\''", "$accept", "start", "$@1", "top_statement_list", "top_statement", "$@2", "$@3", "ident_no_semireserved", "ident_for_class_const", "ident", "use_declarations", "use_fn_declarations", "use_const_declarations", "use_declaration", "use_fn_declaration", "use_const_declaration", "namespace_name", "namespace_string_base", "namespace_string", "namespace_string_typeargs", "class_namespace_string_typeargs", "constant_declaration", "inner_statement_list", "inner_statement", "statement", "$@4", "$@5", "$@6", "$@7", "$@8", "$@9", "$@10", "$@11", "try_statement_list", "$@12", "additional_catches", "finally_statement_list", "$@13", "optional_finally", "is_reference", "function_loc", "function_declaration_statement", "$@14", "$@15", "$@16", "enum_declaration_statement", "$@17", "$@18", "class_declaration_statement", "$@19", "$@20", "$@21", "$@22", "trait_declaration_statement", "$@23", "$@24", "class_decl_name", "interface_decl_name", "trait_decl_name", "class_entry_type", "extends_from", "implements_list", "interface_extends_list", "interface_list", "trait_list", "foreach_optional_arg", "foreach_variable", "for_statement", "foreach_statement", "while_statement", "declare_statement", "declare_list", "switch_case_list", "case_list", "case_separator", "elseif_list", "new_elseif_list", "else_single", "new_else_single", "method_parameter_list", "non_empty_method_parameter_list", "parameter_list", "non_empty_parameter_list", "function_call_parameter_list", "non_empty_fcall_parameter_list", "global_var_list", "global_var", "static_var_list", "enum_statement_list", "enum_statement", "enum_constant_declaration", "class_statement_list", "class_statement", "$@25", "$@26", "$@27", "$@28", "trait_rules", "trait_precedence_rule", "trait_alias_rule", "trait_alias_rule_method", "xhp_attribute_stmt", "xhp_attribute_decl", "xhp_nullable_attribute_decl_type", "xhp_attribute_decl_type", "non_empty_xhp_attribute_enum", "xhp_attribute_enum", "xhp_attribute_default", "xhp_attribute_is_required", "xhp_category_stmt", "xhp_category_decl", "xhp_children_stmt", "xhp_children_paren_expr", "xhp_children_decl_expr", "xhp_children_decl_tag", "function_body", "method_body", "variable_modifiers", "method_modifiers", "non_empty_member_modifiers", "member_modifier", "parameter_modifiers", "parameter_modifier", "class_variable_declaration", "class_constant_declaration", "class_abstract_constant_declaration", "class_type_constant_declaration", "class_type_constant", "expr_with_parens", "parenthesis_expr", "expr_list", "for_expr", "yield_expr", "yield_assign_expr", "yield_list_assign_expr", "await_expr", "await_assign_expr", "await_list_assign_expr", "expr", "expr_no_variable", "lambda_use_vars", "closure_expression", "$@29", "$@30", "lambda_expression", "$@31", "$@32", "$@33", "$@34", "$@35", "lambda_body", "shape_keyname", "non_empty_shape_pair_list", "non_empty_static_shape_pair_list", "shape_pair_list", "static_shape_pair_list", "shape_literal", "array_literal", "collection_literal", "static_collection_literal", "dim_expr", "dim_expr_base", "query_expr", "query_assign_expr", "query_head", "query_body", "query_body_clauses", "query_body_clause", "from_clause", "let_clause", "where_clause", "join_clause", "join_into_clause", "orderby_clause", "orderings", "ordering", "ordering_direction", "select_or_group_clause", "select_clause", "group_clause", "query_continuation", "lexical_var_list", "xhp_tag", "xhp_tag_body", "xhp_opt_end_label", "xhp_attributes", "xhp_children", "xhp_attribute_name", "xhp_attribute_value", "xhp_child", "xhp_label_ws", "xhp_bareword", "simple_function_call", "fully_qualified_class_name", "static_class_name_base", "static_class_name_no_calls", "static_class_name", "class_name_reference", "exit_expr", "backticks_expr", "ctor_arguments", "common_scalar", "static_expr", "static_class_constant", "scalar", "static_array_pair_list", "possible_comma", "hh_possible_comma", "non_empty_static_array_pair_list", "common_scalar_ae", "static_numeric_scalar_ae", "static_string_expr_ae", "static_scalar_ae", "static_array_pair_list_ae", "non_empty_static_array_pair_list_ae", "non_empty_static_scalar_list_ae", "static_shape_pair_list_ae", "non_empty_static_shape_pair_list_ae", "static_scalar_list_ae", "attribute_static_scalar_list", "non_empty_user_attribute_list", "user_attribute_list", "$@36", "non_empty_user_attributes", "optional_user_attributes", "object_operator", "object_property_name_no_variables", "object_property_name", "object_method_name_no_variables", "object_method_name", "array_access", "dimmable_variable_access", "dimmable_variable_no_calls_access", "object_property_access_on_expr", "object_property_access_on_expr_no_variables", "variable", "dimmable_variable", "callable_variable", "lambda_or_closure_with_parens", "lambda_or_closure", "object_method_call", "class_method_call", "variable_no_objects", "reference_variable", "compound_variable", "dim_offset", "variable_no_calls", "dimmable_variable_no_calls", "assignment_list", "array_pair_list", "non_empty_array_pair_list", "collection_init", "non_empty_collection_init", "static_collection_init", "non_empty_static_collection_init", "encaps_list", "encaps_var", "encaps_var_offset", "internal_functions", "variable_list", "class_constant", "hh_opt_constraint", "hh_type_alias_statement", "hh_name_with_type", "hh_constname_with_type", "hh_name_with_typevar", "hh_name_no_semireserved_with_typevar", "hh_typeargs_opt", "hh_non_empty_type_list", "hh_type_list", "hh_func_type_list", "hh_opt_return_type", "hh_constraint", "hh_typevar_list", "hh_typevar_variance", "hh_shape_member_type", "hh_non_empty_shape_member_list", "hh_shape_member_list", "hh_shape_type", "hh_access_type_start", "hh_access_type", "hh_type", "hh_type_opt", 0 }; #endif # ifdef YYPRINT /* YYTOKNUM[YYLEX-NUM] -- Internal token number corresponding to token YYLEX-NUM. */ static const yytype_uint16 yytoknum[] = { 0, 256, 257, 258, 259, 260, 261, 262, 263, 44, 264, 265, 266, 267, 61, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 63, 58, 282, 283, 124, 94, 38, 284, 285, 286, 287, 60, 62, 288, 289, 290, 291, 292, 43, 45, 46, 42, 47, 37, 33, 293, 126, 64, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 91, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 40, 41, 59, 123, 125, 36, 96, 93, 34, 39 }; # endif /* YYR1[YYN] -- Symbol number of symbol that rule YYN derives. */ static const yytype_uint16 yyr1[] = { 0, 210, 212, 211, 213, 213, 214, 214, 214, 214, 214, 214, 214, 214, 215, 214, 216, 214, 214, 214, 214, 214, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 217, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 218, 219, 219, 220, 220, 221, 221, 222, 222, 223, 223, 223, 223, 224, 224, 224, 224, 225, 225, 225, 225, 226, 226, 227, 227, 227, 228, 229, 230, 231, 231, 232, 232, 233, 233, 233, 233, 234, 234, 234, 235, 234, 236, 234, 237, 234, 238, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 239, 234, 240, 234, 234, 241, 234, 242, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 234, 244, 243, 245, 245, 247, 246, 248, 248, 249, 249, 250, 252, 251, 253, 251, 254, 251, 256, 255, 257, 255, 259, 258, 260, 258, 261, 258, 262, 258, 264, 263, 265, 263, 266, 266, 267, 268, 269, 269, 269, 269, 269, 270, 270, 271, 271, 272, 272, 273, 273, 274, 274, 275, 275, 276, 276, 276, 277, 277, 278, 278, 279, 279, 280, 280, 281, 281, 282, 282, 282, 282, 283, 283, 283, 284, 284, 285, 285, 286, 286, 287, 287, 288, 288, 289, 289, 289, 289, 289, 289, 289, 289, 290, 290, 290, 290, 290, 290, 290, 290, 291, 291, 291, 291, 291, 291, 291, 291, 292, 292, 292, 292, 292, 292, 292, 292, 293, 293, 294, 294, 294, 294, 294, 294, 295, 295, 296, 296, 296, 297, 297, 297, 297, 298, 298, 299, 300, 301, 301, 303, 302, 304, 302, 302, 302, 302, 305, 302, 306, 302, 302, 302, 302, 302, 302, 302, 302, 307, 307, 307, 308, 309, 309, 310, 310, 311, 311, 312, 312, 313, 313, 314, 314, 314, 314, 314, 314, 314, 315, 315, 316, 317, 317, 318, 318, 319, 319, 320, 321, 321, 321, 322, 322, 322, 322, 323, 323, 323, 323, 323, 323, 323, 324, 324, 324, 325, 325, 326, 326, 327, 327, 328, 328, 329, 329, 330, 330, 330, 330, 330, 330, 330, 331, 331, 332, 332, 332, 333, 333, 333, 333, 334, 334, 335, 335, 336, 336, 337, 338, 338, 338, 338, 338, 339, 340, 340, 341, 341, 342, 342, 342, 342, 343, 344, 345, 346, 347, 348, 348, 348, 348, 348, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 349, 350, 350, 352, 351, 353, 351, 355, 354, 356, 354, 357, 354, 358, 354, 359, 354, 360, 360, 360, 361, 361, 362, 362, 363, 363, 364, 364, 365, 365, 366, 367, 367, 368, 369, 370, 370, 371, 371, 371, 371, 371, 372, 373, 374, 375, 375, 375, 375, 376, 376, 377, 377, 377, 377, 377, 377, 378, 379, 380, 381, 382, 383, 384, 384, 385, 385, 386, 386, 387, 387, 388, 389, 390, 391, 391, 391, 391, 392, 393, 393, 394, 394, 395, 395, 396, 396, 397, 398, 398, 399, 399, 399, 400, 400, 400, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 401, 402, 403, 403, 404, 404, 404, 404, 404, 405, 405, 406, 406, 406, 407, 407, 407, 408, 408, 408, 409, 409, 409, 410, 410, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 411, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 413, 413, 413, 414, 414, 414, 414, 414, 414, 414, 415, 415, 416, 416, 417, 417, 418, 418, 418, 418, 419, 419, 419, 419, 419, 420, 420, 420, 420, 421, 421, 422, 422, 422, 422, 422, 422, 422, 422, 423, 423, 424, 424, 424, 424, 425, 425, 426, 426, 427, 427, 428, 428, 429, 429, 430, 430, 432, 431, 433, 434, 434, 435, 435, 436, 436, 436, 437, 437, 438, 438, 439, 439, 440, 440, 441, 441, 442, 442, 443, 443, 444, 444, 445, 445, 445, 445, 445, 445, 445, 445, 445, 445, 445, 446, 446, 446, 446, 446, 446, 446, 446, 446, 447, 447, 447, 447, 447, 447, 447, 447, 447, 448, 449, 449, 450, 450, 451, 451, 451, 452, 453, 453, 453, 454, 454, 454, 455, 455, 456, 456, 456, 456, 456, 456, 457, 457, 457, 457, 457, 458, 458, 458, 458, 458, 458, 459, 459, 460, 460, 460, 460, 460, 460, 460, 460, 461, 461, 462, 462, 462, 462, 463, 463, 464, 464, 464, 464, 465, 465, 465, 465, 466, 466, 466, 466, 466, 466, 467, 467, 467, 468, 468, 468, 468, 468, 468, 468, 468, 468, 468, 468, 469, 469, 470, 470, 471, 471, 472, 472, 472, 472, 473, 473, 474, 474, 475, 475, 476, 476, 477, 477, 478, 478, 479, 480, 480, 480, 480, 481, 481, 482, 482, 483, 483, 483, 483, 484, 484, 484, 485, 485, 485, 486, 486, 487, 487, 488, 489, 490, 490, 491, 491, 491, 491, 491, 491, 491, 491, 491, 491, 491, 491, 492, 492 }; /* YYR2[YYN] -- Number of symbols composing right hand side of rule YYN. */ static const yytype_uint8 yyr2[] = { 0, 2, 0, 2, 2, 0, 1, 1, 1, 1, 1, 1, 4, 3, 0, 6, 0, 5, 3, 4, 4, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 3, 1, 3, 1, 3, 1, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 3, 1, 3, 2, 1, 2, 2, 5, 4, 2, 0, 1, 1, 1, 1, 3, 5, 8, 0, 4, 0, 6, 0, 10, 0, 4, 2, 3, 2, 3, 2, 3, 3, 3, 3, 3, 3, 5, 1, 1, 1, 0, 9, 0, 10, 5, 0, 13, 0, 5, 3, 3, 2, 2, 2, 2, 2, 2, 3, 2, 2, 3, 2, 0, 4, 9, 0, 0, 4, 2, 0, 1, 0, 1, 0, 9, 0, 10, 0, 11, 0, 9, 0, 10, 0, 8, 0, 9, 0, 7, 0, 8, 0, 7, 0, 8, 1, 1, 1, 1, 1, 2, 3, 3, 2, 2, 0, 2, 0, 2, 0, 1, 3, 1, 3, 2, 0, 1, 2, 4, 1, 4, 1, 4, 1, 4, 1, 4, 3, 5, 3, 4, 4, 5, 5, 4, 0, 1, 1, 4, 0, 5, 0, 2, 0, 3, 0, 7, 8, 6, 2, 5, 6, 4, 0, 4, 5, 7, 6, 6, 7, 9, 8, 6, 7, 5, 2, 4, 5, 3, 0, 3, 4, 6, 5, 5, 6, 8, 7, 2, 0, 1, 2, 2, 3, 4, 4, 3, 1, 1, 2, 4, 3, 5, 1, 3, 2, 0, 2, 3, 2, 0, 0, 4, 0, 5, 2, 2, 2, 0, 10, 0, 11, 3, 3, 3, 4, 4, 3, 5, 2, 2, 0, 6, 5, 4, 3, 1, 1, 3, 4, 1, 2, 1, 1, 4, 6, 1, 1, 4, 1, 1, 3, 2, 2, 0, 2, 0, 1, 3, 1, 1, 1, 1, 3, 4, 4, 4, 1, 1, 2, 2, 2, 3, 3, 1, 1, 1, 1, 3, 1, 3, 1, 1, 1, 0, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 3, 5, 1, 3, 5, 4, 3, 3, 3, 4, 3, 3, 3, 2, 1, 1, 3, 3, 1, 1, 0, 1, 2, 4, 3, 3, 6, 2, 3, 6, 1, 1, 1, 1, 1, 6, 3, 4, 6, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 5, 4, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 3, 2, 1, 5, 0, 0, 11, 0, 12, 0, 3, 0, 4, 0, 6, 0, 7, 0, 5, 2, 2, 4, 1, 1, 5, 3, 5, 3, 2, 0, 2, 0, 4, 4, 3, 4, 4, 4, 4, 1, 1, 1, 1, 3, 2, 3, 4, 2, 3, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 4, 4, 2, 8, 10, 2, 1, 3, 1, 2, 1, 1, 1, 1, 2, 4, 3, 3, 4, 1, 2, 4, 2, 6, 0, 1, 4, 0, 2, 0, 1, 1, 3, 1, 3, 1, 1, 3, 3, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 4, 1, 1, 1, 1, 1, 1, 3, 1, 3, 1, 1, 3, 1, 1, 1, 2, 1, 0, 0, 1, 1, 3, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 3, 2, 1, 1, 4, 3, 4, 1, 1, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3, 3, 5, 4, 3, 3, 3, 1, 1, 1, 1, 3, 3, 3, 2, 0, 1, 0, 1, 0, 5, 3, 3, 1, 1, 1, 1, 3, 2, 1, 1, 1, 1, 1, 3, 1, 1, 1, 2, 2, 4, 3, 4, 2, 0, 5, 3, 3, 1, 3, 1, 2, 0, 5, 3, 2, 0, 3, 0, 4, 2, 0, 3, 3, 1, 0, 1, 1, 1, 1, 3, 1, 1, 1, 3, 1, 1, 3, 3, 2, 4, 2, 4, 5, 5, 5, 5, 1, 1, 1, 1, 1, 1, 3, 3, 4, 4, 3, 1, 1, 1, 1, 3, 1, 4, 3, 3, 1, 1, 1, 1, 1, 3, 3, 4, 4, 3, 1, 1, 7, 9, 7, 6, 8, 1, 4, 4, 1, 1, 4, 2, 1, 0, 1, 1, 1, 3, 3, 3, 0, 1, 1, 3, 3, 2, 3, 6, 0, 1, 4, 2, 0, 5, 3, 3, 1, 6, 4, 4, 2, 2, 0, 5, 3, 3, 1, 2, 0, 5, 3, 3, 1, 2, 2, 1, 2, 1, 4, 3, 3, 6, 3, 1, 1, 1, 4, 4, 4, 4, 4, 4, 2, 2, 4, 2, 2, 1, 3, 3, 3, 0, 2, 5, 6, 6, 7, 1, 2, 1, 2, 1, 4, 1, 4, 3, 0, 1, 3, 2, 3, 1, 1, 0, 0, 2, 2, 2, 4, 2, 5, 3, 1, 1, 0, 3, 4, 5, 3, 1, 2, 0, 4, 1, 3, 2, 2, 2, 1, 1, 1, 1, 3, 4, 6, 1, 8, 6, 1, 0 }; /* YYDEFACT[STATE-NAME] -- Default rule to reduce with in state STATE-NUM when YYTABLE doesn't specify something else to do. Zero means the default is an error. */ static const yytype_uint16 yydefact[] = { 2, 0, 5, 1, 3, 0, 0, 0, 0, 0, 0, 436, 0, 831, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 921, 0, 909, 713, 0, 719, 720, 721, 22, 778, 898, 164, 165, 722, 0, 145, 0, 0, 0, 0, 23, 0, 0, 0, 0, 198, 0, 0, 0, 0, 0, 0, 403, 404, 405, 408, 407, 406, 0, 0, 0, 0, 225, 0, 0, 0, 726, 728, 729, 723, 724, 0, 0, 0, 730, 725, 0, 697, 24, 25, 26, 28, 27, 0, 727, 0, 0, 0, 0, 731, 409, 29, 30, 32, 31, 33, 34, 35, 36, 37, 38, 39, 40, 41, 530, 0, 163, 135, 0, 714, 0, 0, 4, 124, 126, 129, 777, 0, 696, 0, 6, 197, 7, 9, 8, 10, 0, 0, 401, 447, 0, 0, 0, 0, 0, 0, 0, 445, 887, 888, 516, 515, 430, 519, 0, 0, 429, 858, 698, 705, 0, 780, 514, 400, 861, 862, 873, 446, 0, 0, 449, 448, 859, 860, 857, 894, 897, 504, 779, 11, 408, 407, 406, 0, 0, 28, 0, 124, 197, 0, 965, 446, 964, 0, 962, 961, 518, 0, 437, 442, 0, 0, 487, 488, 489, 490, 513, 511, 510, 509, 508, 507, 506, 505, 898, 722, 700, 0, 0, 985, 880, 698, 0, 699, 469, 0, 467, 0, 925, 0, 787, 428, 709, 0, 985, 708, 703, 0, 718, 699, 904, 905, 911, 903, 710, 0, 0, 712, 512, 0, 0, 0, 0, 433, 0, 143, 435, 0, 0, 149, 151, 0, 0, 153, 0, 82, 81, 76, 75, 67, 68, 59, 79, 90, 0, 62, 0, 74, 66, 72, 92, 85, 84, 57, 80, 99, 100, 58, 95, 55, 96, 56, 97, 54, 101, 89, 93, 98, 86, 87, 61, 88, 91, 53, 83, 69, 102, 77, 70, 60, 52, 51, 50, 49, 48, 47, 71, 103, 105, 64, 45, 46, 73, 1018, 1019, 65, 1024, 44, 63, 94, 0, 0, 124, 104, 976, 1017, 0, 1020, 0, 0, 0, 155, 0, 0, 0, 0, 188, 0, 0, 0, 0, 0, 0, 107, 112, 314, 0, 0, 313, 0, 229, 0, 226, 319, 0, 0, 0, 0, 0, 982, 213, 223, 917, 921, 0, 946, 0, 733, 0, 0, 0, 944, 0, 16, 0, 128, 205, 217, 224, 603, 546, 0, 970, 528, 532, 534, 835, 436, 447, 0, 0, 445, 446, 448, 0, 0, 900, 715, 0, 716, 0, 0, 0, 187, 0, 0, 131, 305, 0, 21, 196, 0, 222, 209, 221, 406, 409, 197, 402, 178, 179, 180, 181, 182, 184, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 909, 0, 177, 902, 902, 185, 931, 0, 0, 0, 0, 0, 0, 0, 0, 399, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 468, 466, 836, 837, 0, 902, 0, 849, 305, 305, 902, 0, 917, 0, 197, 0, 0, 157, 0, 833, 828, 787, 0, 447, 445, 0, 929, 0, 551, 786, 920, 447, 445, 446, 131, 0, 305, 427, 0, 851, 711, 0, 135, 265, 0, 527, 0, 160, 0, 0, 434, 0, 0, 0, 0, 0, 152, 176, 154, 1018, 1019, 1015, 1016, 0, 1010, 0, 0, 0, 0, 78, 43, 65, 42, 977, 0, 183, 156, 186, 0, 0, 0, 0, 0, 0, 0, 561, 0, 568, 570, 571, 572, 573, 574, 575, 566, 588, 589, 135, 0, 173, 175, 0, 0, 109, 116, 0, 0, 111, 120, 113, 0, 18, 0, 0, 315, 0, 158, 228, 227, 0, 0, 159, 966, 0, 0, 447, 445, 446, 449, 448, 0, 1003, 235, 0, 918, 0, 0, 161, 0, 0, 732, 945, 778, 0, 0, 943, 783, 942, 127, 5, 13, 14, 0, 233, 0, 0, 539, 0, 0, 787, 0, 0, 706, 701, 540, 0, 0, 0, 0, 835, 135, 0, 789, 834, 1028, 426, 439, 501, 867, 886, 140, 134, 136, 137, 138, 139, 400, 0, 517, 781, 782, 125, 787, 0, 986, 0, 0, 0, 789, 306, 0, 522, 199, 231, 0, 472, 474, 473, 0, 0, 470, 471, 475, 477, 476, 492, 491, 494, 493, 495, 497, 499, 498, 496, 486, 485, 479, 480, 478, 481, 482, 484, 500, 483, 901, 0, 0, 935, 0, 787, 969, 0, 968, 985, 864, 215, 207, 219, 0, 970, 211, 197, 0, 440, 443, 451, 562, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 839, 0, 838, 841, 863, 845, 985, 842, 0, 0, 0, 0, 0, 0, 0, 0, 963, 438, 826, 830, 786, 832, 0, 702, 0, 924, 0, 923, 0, 702, 908, 907, 894, 897, 0, 0, 838, 841, 906, 842, 431, 267, 269, 135, 537, 536, 432, 0, 135, 249, 144, 435, 0, 0, 0, 0, 0, 261, 261, 150, 0, 0, 0, 0, 1008, 787, 0, 992, 0, 0, 0, 0, 0, 785, 0, 697, 0, 0, 129, 735, 696, 740, 0, 734, 133, 739, 985, 1021, 0, 0, 578, 0, 0, 584, 581, 582, 590, 0, 569, 564, 0, 567, 0, 0, 0, 117, 19, 0, 0, 121, 20, 0, 0, 0, 106, 114, 0, 312, 320, 317, 0, 0, 955, 960, 957, 956, 959, 958, 12, 1001, 1002, 0, 0, 0, 0, 917, 914, 0, 550, 954, 953, 952, 0, 948, 0, 949, 951, 0, 5, 0, 0, 0, 597, 598, 606, 605, 0, 445, 0, 786, 545, 549, 0, 0, 971, 0, 529, 0, 0, 993, 835, 291, 1027, 0, 0, 850, 0, 899, 786, 988, 984, 307, 308, 695, 788, 304, 0, 835, 0, 0, 233, 524, 201, 503, 0, 554, 555, 0, 552, 786, 930, 0, 0, 305, 235, 0, 233, 0, 0, 231, 0, 909, 452, 0, 0, 847, 848, 865, 866, 895, 896, 0, 0, 0, 814, 794, 795, 796, 803, 0, 0, 0, 807, 805, 806, 820, 787, 0, 828, 928, 927, 0, 0, 852, 717, 0, 271, 0, 0, 141, 0, 0, 0, 0, 0, 0, 0, 241, 242, 253, 0, 135, 251, 170, 261, 0, 261, 0, 0, 1022, 0, 0, 0, 786, 1009, 1011, 991, 787, 990, 0, 787, 761, 762, 759, 760, 793, 0, 787, 785, 0, 548, 0, 0, 937, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1014, 563, 0, 0, 0, 586, 587, 585, 0, 0, 565, 0, 189, 0, 192, 174, 0, 108, 118, 0, 110, 122, 115, 316, 0, 967, 162, 1003, 983, 998, 234, 236, 326, 0, 0, 915, 0, 947, 0, 17, 0, 970, 232, 326, 0, 0, 702, 542, 0, 707, 972, 0, 993, 535, 0, 0, 1028, 0, 296, 294, 841, 853, 985, 841, 854, 987, 0, 0, 309, 132, 0, 835, 230, 0, 835, 0, 502, 934, 933, 0, 305, 0, 0, 0, 0, 0, 0, 233, 203, 718, 840, 305, 0, 799, 800, 801, 802, 808, 809, 818, 0, 787, 0, 814, 0, 798, 822, 786, 825, 827, 829, 0, 922, 840, 0, 0, 0, 0, 268, 538, 146, 0, 435, 241, 243, 917, 0, 0, 0, 0, 0, 0, 0, 0, 0, 255, 0, 0, 1004, 0, 1007, 786, 0, 0, 0, 737, 786, 784, 0, 775, 0, 787, 0, 741, 776, 774, 941, 0, 787, 744, 746, 745, 0, 0, 742, 743, 747, 749, 748, 764, 763, 766, 765, 767, 769, 771, 770, 768, 757, 756, 751, 752, 750, 753, 754, 755, 758, 1013, 576, 0, 577, 583, 591, 592, 0, 135, 119, 123, 318, 0, 0, 0, 1000, 0, 400, 919, 917, 441, 444, 450, 0, 15, 0, 400, 609, 0, 0, 611, 604, 607, 0, 602, 0, 974, 0, 994, 531, 0, 297, 0, 0, 292, 0, 311, 310, 993, 0, 326, 0, 835, 0, 305, 0, 892, 326, 970, 326, 973, 0, 0, 0, 453, 0, 0, 811, 786, 813, 804, 0, 797, 0, 0, 787, 819, 926, 0, 135, 0, 264, 250, 0, 0, 0, 240, 166, 254, 0, 0, 257, 0, 262, 263, 135, 256, 1023, 1005, 0, 989, 0, 1026, 792, 791, 736, 0, 786, 547, 738, 0, 553, 786, 936, 773, 0, 0, 0, 0, 997, 995, 996, 237, 0, 0, 0, 407, 398, 0, 0, 0, 214, 325, 327, 0, 397, 0, 0, 0, 970, 400, 0, 950, 322, 218, 600, 0, 0, 541, 533, 0, 300, 290, 0, 293, 299, 305, 521, 993, 400, 993, 0, 932, 0, 891, 400, 0, 400, 975, 326, 835, 889, 817, 816, 810, 0, 812, 786, 821, 135, 270, 142, 147, 168, 244, 0, 252, 258, 135, 260, 1006, 0, 0, 544, 0, 940, 939, 772, 0, 135, 193, 999, 0, 0, 0, 978, 0, 0, 0, 238, 0, 970, 0, 363, 359, 365, 697, 28, 0, 353, 0, 358, 362, 375, 0, 373, 378, 0, 377, 0, 376, 0, 197, 329, 0, 331, 0, 332, 333, 0, 0, 916, 0, 601, 599, 610, 608, 301, 0, 0, 288, 298, 0, 0, 0, 0, 210, 521, 993, 893, 216, 322, 220, 400, 0, 0, 824, 0, 266, 0, 0, 135, 247, 167, 259, 1025, 790, 0, 0, 0, 0, 0, 0, 425, 0, 979, 0, 343, 347, 422, 423, 357, 0, 0, 0, 338, 661, 660, 657, 659, 658, 678, 680, 679, 649, 620, 621, 639, 655, 654, 616, 626, 627, 629, 628, 648, 632, 630, 631, 633, 634, 635, 636, 637, 638, 640, 641, 642, 643, 644, 645, 647, 646, 617, 618, 619, 622, 623, 625, 663, 664, 673, 672, 671, 670, 669, 668, 656, 675, 665, 666, 667, 650, 651, 652, 653, 676, 677, 681, 683, 682, 684, 685, 662, 687, 686, 689, 691, 690, 624, 694, 692, 693, 688, 674, 615, 370, 612, 0, 339, 391, 392, 390, 383, 0, 384, 340, 417, 0, 0, 0, 0, 421, 0, 197, 206, 321, 0, 0, 0, 289, 303, 890, 0, 135, 393, 135, 200, 0, 0, 0, 212, 993, 815, 0, 135, 245, 148, 169, 0, 543, 938, 579, 191, 341, 342, 420, 239, 0, 0, 787, 0, 366, 354, 0, 0, 0, 372, 374, 0, 0, 379, 386, 387, 385, 0, 0, 328, 980, 0, 0, 0, 424, 0, 323, 0, 302, 0, 595, 789, 0, 0, 135, 202, 208, 0, 823, 0, 0, 0, 171, 344, 124, 0, 345, 346, 0, 0, 360, 786, 368, 364, 369, 613, 614, 0, 355, 388, 389, 381, 382, 380, 418, 415, 1003, 334, 330, 419, 0, 324, 596, 788, 0, 523, 394, 0, 204, 0, 248, 580, 0, 195, 0, 400, 0, 367, 371, 0, 0, 835, 336, 0, 593, 520, 525, 246, 0, 0, 172, 351, 0, 399, 361, 416, 981, 0, 789, 411, 835, 594, 0, 194, 0, 0, 350, 993, 835, 275, 412, 413, 414, 1028, 410, 0, 0, 0, 349, 0, 411, 0, 993, 0, 348, 395, 135, 335, 1028, 0, 280, 278, 0, 135, 0, 0, 281, 0, 0, 276, 337, 0, 396, 0, 284, 274, 0, 277, 283, 190, 285, 0, 0, 272, 282, 0, 273, 287, 286 }; /* YYDEFGOTO[NTERM-NUM]. */ static const yytype_int16 yydefgoto[] = { -1, 1, 2, 4, 120, 905, 637, 185, 1471, 731, 350, 590, 594, 351, 591, 595, 122, 123, 124, 125, 126, 127, 402, 669, 670, 537, 252, 1535, 543, 1451, 1536, 1777, 861, 345, 585, 1736, 1094, 1274, 1794, 419, 186, 671, 945, 1154, 1329, 131, 640, 962, 672, 691, 966, 620, 961, 673, 641, 963, 421, 368, 385, 134, 947, 908, 891, 1109, 1474, 1206, 1014, 1683, 1539, 807, 1020, 542, 816, 1022, 1361, 799, 1003, 1006, 1195, 1801, 1802, 659, 660, 685, 686, 355, 356, 362, 1508, 1662, 1663, 1283, 1398, 1497, 1656, 1785, 1804, 1694, 1740, 1741, 1742, 1484, 1485, 1486, 1487, 1696, 1697, 1703, 1752, 1490, 1491, 1495, 1649, 1650, 1651, 1673, 1831, 1399, 1400, 187, 136, 1817, 1818, 1654, 1402, 1403, 1404, 1405, 137, 245, 538, 539, 138, 139, 140, 141, 142, 143, 144, 145, 1520, 146, 944, 1153, 147, 249, 656, 394, 657, 658, 533, 646, 647, 1230, 648, 1231, 148, 149, 150, 838, 151, 152, 342, 153, 343, 573, 574, 575, 576, 577, 578, 579, 580, 581, 851, 852, 1086, 582, 583, 584, 858, 1725, 154, 642, 1510, 643, 1123, 913, 1300, 1297, 1642, 1643, 155, 156, 157, 235, 158, 236, 246, 406, 525, 159, 1042, 842, 160, 1043, 936, 928, 1044, 990, 1176, 991, 1178, 1179, 1180, 993, 1340, 1341, 994, 776, 509, 198, 199, 674, 662, 492, 1139, 1140, 762, 763, 932, 162, 238, 163, 164, 189, 166, 167, 168, 169, 170, 171, 172, 173, 174, 723, 242, 243, 623, 227, 228, 726, 727, 1236, 1237, 378, 379, 899, 175, 611, 176, 655, 177, 334, 1664, 1715, 369, 414, 680, 681, 1036, 1134, 1281, 888, 889, 821, 822, 823, 335, 336, 844, 1473, 930 }; /* YYPACT[STATE-NUM] -- Index in YYTABLE of the portion describing STATE-NUM. */ #define YYPACT_NINF -1528 static const yytype_int16 yypact[] = { -1528, 223, -1528, -1528, 5678, 13751, 13751, -38, 13751, 13751, 13751, 11474, 13751, -1528, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 17565, 17565, 11681, 13751, 17691, -12, 38, -1528, -1528, -1528, -1528, -1528, 244, -1528, -1528, 348, 13751, -1528, 38, 222, 267, 306, -1528, 38, 11888, 14698, 12095, -1528, 14841, 10439, 52, 13751, 17756, 167, -1528, -1528, -1528, 44, 40, 67, 322, 357, 361, 388, -1528, 14698, 395, 398, -1528, -1528, -1528, -1528, -1528, 13751, 461, 17630, -1528, -1528, 14698, -1528, -1528, -1528, -1528, 14698, -1528, 14698, -1528, 134, 404, 14698, 14698, -1528, 179, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 12302, -1528, -1528, 174, 472, 547, 547, -1528, 387, 344, 484, -1528, 413, -1528, 73, -1528, 612, -1528, -1528, -1528, -1528, 18505, 626, -1528, -1528, 429, 459, 464, 476, 478, 483, 4806, -1528, -1528, -1528, -1528, 71, -1528, 583, 621, 488, -1528, 84, 492, -1528, 512, -16, -1528, 2385, 140, -1528, -1528, 1794, 60, 506, 138, -1528, 76, 77, 526, 142, -1528, -1528, 670, -1528, -1528, -1528, 589, 552, 592, -1528, 13751, -1528, 612, 626, 18819, 3516, 18819, 13751, 18819, 18819, 15035, 558, 18004, 15035, 709, 14698, 696, 696, 343, 696, 696, 696, 696, 696, 696, 696, 696, 696, -1528, -1528, -1528, 85, 13751, 608, -1528, -1528, 631, 572, 277, 588, 277, 17565, 18049, 595, 787, -1528, 589, 13751, 608, 661, -1528, 673, 625, -1528, 129, -1528, -1528, -1528, 277, 60, 12509, -1528, -1528, 13751, 9197, 813, 86, 18819, 10232, -1528, 13751, 13751, 14698, -1528, -1528, 5071, 624, -1528, 5128, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 16332, -1528, 16332, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 89, 90, 592, -1528, -1528, -1528, -1528, 627, 4373, 92, -1528, -1528, 677, 819, -1528, 687, 15623, 761, -1528, 640, 5173, 641, 600, -1528, 25, 16077, 18522, 18587, 14698, 93, -1528, 266, -1528, 17040, 100, -1528, 721, -1528, 722, -1528, 835, 104, 17565, 13751, 13751, 652, 692, -1528, -1528, 17171, 11681, 105, 471, 489, -1528, 13958, 17565, 505, -1528, 14698, -1528, 473, 344, -1528, -1528, -1528, -1528, 17817, 851, 768, -1528, -1528, -1528, 72, 13751, 669, 672, 18819, 674, 2038, 676, 5885, 13751, -1528, 443, 665, 565, 443, 440, 87, -1528, 14698, 16332, 678, 10646, 14841, -1528, -1528, 2988, -1528, -1528, -1528, -1528, -1528, 612, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 13751, 13751, 13751, 12716, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 17691, 13751, -1528, 13751, 13751, -1528, 13751, 14165, 14698, 14698, 14698, 14698, 14698, 18505, 767, 699, 4862, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, 13751, -1528, -1528, -1528, -1528, 16405, 13751, 13751, -1528, 10646, 10646, 13751, 13751, 17171, 680, 612, 12923, 16122, -1528, 13751, -1528, 682, 874, 736, 684, 686, 14308, 277, 13130, -1528, 13337, -1528, 690, 691, 3094, -1528, 187, 10646, -1528, 16845, -1528, -1528, 16167, -1528, -1528, 10853, -1528, 13751, -1528, 803, 9404, 885, 693, 18774, 883, 98, 53, -1528, -1528, -1528, 726, -1528, -1528, -1528, 16332, 3904, 700, 890, 16780, 14698, -1528, -1528, -1528, -1528, -1528, 717, -1528, -1528, -1528, 824, 13751, 826, 827, 13751, 13751, 13751, -1528, 600, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 720, -1528, -1528, -1528, 711, -1528, -1528, 14698, 710, 904, 314, 14698, 712, 906, 418, 442, 18604, -1528, 14698, 13751, 277, 167, -1528, -1528, -1528, 16780, 837, -1528, 277, 103, 114, 718, 719, 3952, 168, 723, 731, 379, 794, 725, 277, 121, 738, -1528, 17614, 14698, -1528, -1528, 870, 2736, 378, -1528, -1528, -1528, 344, -1528, -1528, -1528, 913, 815, 774, 217, 796, 13751, 816, 941, 752, 818, -1528, 141, -1528, 16332, 16332, 940, 813, 72, -1528, 773, 966, -1528, 16332, 29, -1528, 83, 152, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 741, 2881, -1528, -1528, -1528, -1528, 967, 806, -1528, 17565, 13751, 779, 972, 18819, 969, -1528, -1528, 856, 14503, 12080, 3819, 15035, 13751, 13943, 18978, 17107, 4182, 10625, 4138, 11659, 11659, 11659, 11659, 916, 916, 916, 916, 916, 1073, 1073, 668, 668, 668, 343, 343, 343, -1528, 696, 18819, 778, 781, 18106, 790, 989, 213, 13751, 214, 608, 24, -1528, -1528, -1528, 986, 768, -1528, 612, 17303, -1528, -1528, 15035, -1528, 15035, 15035, 15035, 15035, 15035, 15035, 15035, 15035, 15035, 15035, 15035, 15035, -1528, 13751, 330, -1528, 143, -1528, 608, 353, 798, 2944, 809, 820, 800, 3207, 122, 817, -1528, 18819, 16910, -1528, 14698, -1528, 29, 22, 17565, 18819, 17565, 18151, 29, 277, 145, -1528, 141, 869, 823, 13751, -1528, 153, -1528, -1528, -1528, 8990, 551, -1528, -1528, 18819, 18819, 38, -1528, -1528, -1528, 13751, 927, 16612, 16780, 14698, 9611, 829, 830, -1528, 75, 939, 897, 887, -1528, 1025, 838, 16211, 16332, 16780, 16780, 16780, 16780, 16780, 836, 894, 846, 16780, 13, -1528, 896, -1528, 847, -1528, 18907, -1528, 17, -1528, 13751, 863, 18819, 867, 1040, 11459, 1046, -1528, 18819, 16212, -1528, 720, 978, -1528, 6092, 18464, 858, 448, -1528, 18522, 14698, 479, -1528, 18587, 14698, 14698, -1528, -1528, 3567, -1528, 18907, 1045, 17565, 862, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 80, 14698, 18464, 864, 17171, 17434, 1051, -1528, -1528, -1528, -1528, 861, -1528, 13751, -1528, -1528, 5264, -1528, 16332, 18464, 872, -1528, -1528, -1528, -1528, 1065, 880, 13751, 17817, -1528, -1528, 14165, 882, -1528, 16332, -1528, 891, 6299, 1060, 130, -1528, -1528, 182, 16405, -1528, 16845, -1528, 16332, -1528, -1528, 277, 18819, -1528, 11060, -1528, 16780, 119, 892, 18464, 815, -1528, -1528, 18689, 13751, -1528, -1528, 13751, -1528, 13751, -1528, 3673, 893, 10646, 794, 1061, 815, 16332, 1081, 856, 14698, 17691, 277, 4003, 898, -1528, -1528, 158, 899, -1528, -1528, 1086, 16832, 16832, 16910, -1528, -1528, -1528, 1053, 905, 97, 907, -1528, -1528, -1528, -1528, 1099, 908, 682, 277, 277, 13544, 16845, -1528, -1528, 4283, 610, 38, 10232, -1528, 6506, 909, 6713, 910, 16612, 17565, 914, 983, 277, 18907, 1105, -1528, -1528, -1528, -1528, 54, -1528, 291, 16332, -1528, 994, 16332, 14698, 3904, -1528, -1528, -1528, 1120, -1528, 929, 967, 707, 707, 1068, 1068, 18253, 924, 1126, 16780, 15909, 17817, 2420, 15766, 16780, 16780, 16780, 16780, 16482, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 16780, 14698, -1528, 18819, 13751, 13751, 13751, -1528, -1528, -1528, 13751, 13751, -1528, 600, -1528, 1056, -1528, -1528, 14698, -1528, -1528, 14698, -1528, -1528, -1528, -1528, 16780, 277, -1528, 379, -1528, 651, 1131, -1528, -1528, 123, 937, 277, 11267, -1528, 2341, -1528, 5471, 768, 1131, -1528, 221, -11, -1528, 18819, 1010, 945, -1528, 948, 1060, -1528, 16332, 813, 16332, 65, 1133, 1071, 162, -1528, 608, 164, -1528, -1528, 17565, 13751, 18819, 18907, 956, 119, -1528, 955, 119, 959, 18689, 18819, 18208, 960, 10646, 961, 958, 16332, 964, 962, 16332, 815, -1528, 625, 408, 10646, 13751, -1528, -1528, -1528, -1528, -1528, -1528, 1031, 963, 1159, 1084, 16910, 1028, -1528, 17817, 16910, -1528, -1528, -1528, 17565, 18819, -1528, 38, 1143, 1108, 10232, -1528, -1528, -1528, 982, 13751, 983, 277, 17171, 16612, 985, 16780, 6920, 299, 987, 13751, 55, 293, -1528, 1017, 16332, -1528, 1059, -1528, 16257, 1162, 996, 16780, -1528, 16780, -1528, 997, -1528, 1067, 1192, 1001, -1528, -1528, -1528, 18310, 999, 1195, 14162, 15620, 15230, 16780, 18864, 19013, 17370, 4738, 11039, 12901, 13108, 13108, 13108, 13108, 1569, 1569, 1569, 1569, 1569, 1022, 1022, 707, 707, 707, 1068, 1068, 1068, 1068, -1528, 18819, 13736, 18819, -1528, 18819, -1528, 1004, -1528, -1528, -1528, 18907, 14698, 16332, 16332, -1528, 18464, 82, -1528, 17171, -1528, -1528, 15035, 1003, -1528, 1006, 499, -1528, 88, 13751, -1528, -1528, -1528, 13751, -1528, 13751, -1528, 813, -1528, -1528, 186, 1196, 1132, 13751, -1528, 1011, 277, 18819, 1060, 1012, -1528, 1013, 119, 13751, 10646, 1018, -1528, -1528, 768, -1528, -1528, 1021, 1023, 1020, -1528, 1024, 16910, -1528, 16910, -1528, -1528, 1027, -1528, 1092, 1029, 1222, -1528, 277, 1202, -1528, 1032, -1528, -1528, 1039, 1054, 124, -1528, -1528, 18907, 1050, 1052, -1528, 3393, -1528, -1528, -1528, -1528, -1528, -1528, 16332, -1528, 16332, -1528, 18907, 18355, -1528, 16780, 17817, -1528, -1528, 16780, -1528, 16780, -1528, 18943, 16780, 13751, 1057, 7127, 651, -1528, -1528, -1528, 570, 15036, 18464, 1134, -1528, 16710, 1097, 18403, -1528, -1528, -1528, 767, 2148, 106, 107, 1062, 768, 699, 125, -1528, -1528, -1528, 1103, 4334, 4657, 18819, -1528, 254, 1247, 1182, 13751, -1528, 18819, 10646, 1150, 1060, 648, 1060, 1064, 18819, 1066, -1528, 1128, 1063, 1337, -1528, -1528, 119, -1528, -1528, 1137, -1528, 16910, -1528, 17817, -1528, -1528, 8990, -1528, -1528, -1528, -1528, 9818, -1528, -1528, -1528, 8990, -1528, 1069, 16780, 18907, 1139, 18907, 18412, 18943, 12494, -1528, -1528, -1528, 18464, 18464, 14698, -1528, 1260, 15909, 79, -1528, 15036, 768, 18450, -1528, 1104, -1528, 108, 1072, 110, -1528, 15429, -1528, -1528, -1528, 112, -1528, -1528, 18330, -1528, 1075, -1528, 1198, 612, -1528, 15231, -1528, 15231, -1528, -1528, 1265, 767, -1528, 14451, -1528, -1528, -1528, -1528, 1266, 1201, 13751, -1528, 18819, 1082, 1088, 1079, 568, -1528, 1150, 1060, -1528, -1528, -1528, -1528, 1586, 1083, 16910, -1528, 1160, 8990, 10025, 9818, -1528, -1528, -1528, 8990, -1528, 18907, 16780, 16780, 13751, 7334, 1089, 1091, -1528, 16780, -1528, 18464, -1528, -1528, -1528, -1528, -1528, 16332, 1041, 16710, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 675, -1528, 1097, -1528, -1528, -1528, -1528, -1528, 96, 596, -1528, 1283, 115, 15623, 1198, 1284, -1528, 16332, 612, -1528, -1528, 1098, 1285, 13751, -1528, 18819, -1528, 126, -1528, -1528, -1528, -1528, 1100, 568, 14646, -1528, 1060, -1528, 16910, -1528, -1528, -1528, -1528, 7541, 18907, 18907, 11873, -1528, -1528, -1528, 18907, -1528, 15300, 101, 1292, 1101, -1528, -1528, 16780, 15429, 15429, 1246, -1528, 18330, 18330, 663, -1528, -1528, -1528, 16780, 1226, -1528, 1136, 1109, 116, 16780, -1528, 14698, -1528, 16780, 18819, 1231, -1528, 1303, 7748, 7955, -1528, -1528, -1528, 568, -1528, 8162, 1111, 1236, 1206, -1528, 1220, 1169, -1528, -1528, 1225, 16332, -1528, 1041, -1528, -1528, 18907, -1528, -1528, 1161, -1528, 1289, -1528, -1528, -1528, -1528, 18907, 1312, 379, -1528, -1528, 18907, 1127, 18907, -1528, 381, 1130, -1528, -1528, 8369, -1528, 1135, -1528, -1528, 1140, 1164, 14698, 699, 1155, -1528, -1528, 16780, 128, 132, -1528, 1256, -1528, -1528, -1528, -1528, 18464, 858, -1528, 1173, 14698, 553, -1528, 18907, -1528, 1141, 1334, 614, 132, -1528, 1264, -1528, 18464, 1145, -1528, 1060, 136, -1528, -1528, -1528, -1528, 16332, -1528, 1147, 1149, 117, -1528, 573, 614, 300, 1060, 1151, -1528, -1528, -1528, -1528, 16332, 294, 1338, 1273, 573, -1528, 8576, 301, 1342, 1278, 13751, -1528, -1528, 8783, -1528, 331, 1345, 1281, 13751, -1528, 18819, -1528, 1349, 1286, 13751, -1528, 18819, 13751, -1528, 18819, 18819 }; /* YYPGOTO[NTERM-NUM]. */ static const yytype_int16 yypgoto[] = { -1528, -1528, -1528, -578, -1528, -1528, -1528, 460, 2, -32, -1528, -1528, -1528, 769, 501, 500, 188, 1663, 1593, -1528, 2739, -1528, -443, -1528, 37, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -422, -1528, -1528, -160, 176, 30, -1528, -1528, -1528, -1528, -1528, -1528, 34, -1528, -1528, -1528, -1528, 36, -1528, -1528, 900, 915, 911, -115, 407, -866, 414, 467, -427, 190, -932, -1528, -148, -1528, -1528, -1528, -1528, -745, 18, -1528, -1528, -1528, -1528, -414, -1528, -590, -1528, -432, -1528, -1528, 786, -1528, -132, -1528, -1528, -1065, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -164, -1528, -81, -1528, -1528, -1528, -1528, -1528, -246, -1528, 3, -927, -1528, -1527, -436, -1528, -153, 137, -133, -423, -1528, -254, -1528, -1528, -1528, 14, -44, 0, 11, -715, -92, -1528, -1528, -19, -1528, -1528, -5, -62, -120, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -601, -856, -1528, -1528, -1528, -1528, -1528, 1224, -1528, -1528, -1528, -1528, 930, -1528, -1528, 317, -1528, 834, -1528, -1528, -1528, -1528, -1528, -1528, -1528, 324, -1528, 839, -1528, -1528, 556, -1528, 292, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -1528, -909, -1528, 2452, 41, -1528, 323, -396, -1528, -1528, 248, 3530, 3584, -1528, -1528, 377, -193, -659, -1528, -1528, 444, 242, -702, 243, -1528, -1528, -1528, -1528, -1528, 431, -1528, -1528, -1528, 68, -896, -180, -426, -415, -1528, 497, -123, -1528, -1528, 45, 46, 638, -1528, -1528, 992, -35, -1528, -340, 31, -346, 58, 211, -1528, -1528, -472, 1076, -1528, -1528, -1528, -1528, -1528, 425, 427, -1528, -1528, -1528, -330, -657, -1528, 1014, -1077, -1528, -66, -199, -26, 607, -1528, -1037, 47, -327, 328, 405, -1528, -1528, -1528, -1528, 359, 756, -1096 }; /* YYTABLE[YYPACT[STATE-NUM]]. What to do in state STATE-NUM. If positive, shift that token. If negative, reduce the rule which number is the opposite. If zero, do what YYDEFACT says. If YYTABLE_NINF, syntax error. */ #define YYTABLE_NINF -1013 static const yytype_int16 yytable[] = { 188, 190, 426, 192, 193, 194, 196, 197, 473, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 397, 332, 226, 229, 386, 501, 942, 771, 389, 390, 1135, 248, 522, 130, 518, 340, 251, 132, 1306, 133, 128, 651, 495, 253, 259, 472, 262, 650, 257, 341, 399, 346, 250, 426, 923, 331, 1292, 652, 904, 1127, 241, 526, 720, 767, 768, 760, 924, 422, 396, 1024, 234, 161, 992, 251, 239, 240, 761, 401, 1202, 965, 1152, 416, 814, 1025, 1359, 1389, 798, 1552, 1106, 372, -876, 791, 1010, 1303, 534, 493, 1163, -78, -43, 794, -42, 598, -78, -43, 1705, -42, 812, 398, 603, 1743, 795, 877, 608, 534, 1500, 1502, -356, 13, 1560, 527, 1644, 399, 534, 1712, 1712, 1552, 493, 13, 1706, 893, 893, 893, 893, 893, -699, 586, 1106, -556, 1411, 396, 135, 859, -869, -870, 1307, 1298, 361, 1729, 401, -560, -868, 490, 491, 512, 1210, 1211, 1212, 359, 490, 491, 1723, 191, 357, -985, 13, 360, 373, 1078, 520, 358, 510, 511, 633, 404, -707, 13, 789, 13, 398, 129, 401, 13, 1183, -881, 413, 504, 519, 244, 413, 1390, 1229, 1299, 627, 587, 1391, -910, 60, 61, 62, 178, 1392, 423, 1393, 1772, -558, 1724, -871, 498, 498, -872, 398, -913, 490, 491, 925, -985, 1136, -700, -875, -912, 1416, -883, 3, 960, -874, 398, -876, -706, -855, 1308, -856, 494, 375, -702, -558, 376, 377, 247, 529, 1394, 1395, 529, 1396, 387, 1184, 352, 353, 1026, 251, 540, 1425, -526, 1107, 212, 344, 815, 1360, 1431, 391, 1433, 551, 1137, 494, 424, 692, 1417, 212, 910, 382, -295, -880, 383, 1352, 1744, 417, 1209, 1423, 1213, -869, -870, 1553, 1554, -883, -879, 531, 1397, -868, 535, 536, 387, -78, -43, -701, -42, 599, 678, 1707, 474, 813, 1328, 1800, 604, 614, 878, 561, 609, 625, 1501, 1503, -356, 425, 1561, 1472, 1645, 879, 778, 1713, 1762, 1828, -295, 613, 894, 978, 1284, 1450, 1507, 1119, -788, 1339, 617, -788, -910, -279, 1513, 1833, 1847, -788, 497, 331, -878, 426, 772, -871, 499, 499, -872, 1138, -913, 220, 220, 1418, -882, 690, 1149, -875, -912, 1007, -885, 251, 398, -874, 1009, 502, 600, -855, 226, -856, 497, 883, 1529, 631, 354, 911, 1840, 612, 392, 403, 1293, 116, 1834, 1848, 393, 741, 332, -105, -104, 1521, 912, 1523, 196, 1294, 116, 1211, 1212, 1211, 1212, 459, 675, 1555, 1356, 1211, 1212, 386, 736, 737, 422, 490, 491, 460, 687, 1854, 865, -105, -104, -559, 1787, 411, 331, 1514, 1112, 412, 254, 1657, 1295, 1658, 886, 887, 693, 694, 695, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 917, 721, 742, 722, 722, 1841, 725, 1788, 661, 1291, 121, 1835, 1849, 255, 730, 412, 743, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 931, 1342, 933, 1349, 1675, 722, 766, 241, 687, 687, 722, 770, 1214, 1855, 1362, 743, 412, 234, 774, -843, 1389, 239, 240, 256, 1142, 490, 491, 782, 260, 784, 801, 330, 331, 869, 1460, 1143, 687, 373, 473, 363, 373, 732, -846, 633, 802, 1160, 803, -843, 367, 959, 1305, 957, 592, 596, 597, 626, 135, 870, 373, 407, 409, 410, 13, 1095, 374, 220, 384, 764, 367, 373, -846, 788, 367, 367, 364, 405, 472, 1315, 365, 847, 1317, 971, 850, 853, 854, 636, 373, 651, 732, 1168, 412, 806, 1208, 650, 1098, 129, 967, -844, 790, 903, 914, 796, 373, 652, 1533, 366, 376, 377, 633, 376, 377, 367, 370, 873, 412, 371, 931, 933, 490, 491, 412, 388, 999, 933, 1390, -844, 375, 376, 377, 1391, 415, 60, 61, 62, 178, 1392, 423, 1393, 376, 377, 1004, 1005, 1708, 949, 373, 412, 1031, 1438, 427, 1439, 408, 412, -985, 522, 628, 376, 377, 398, 1731, 165, 1709, 1079, 373, 1710, 418, 677, 739, 462, 633, 1389, 634, 376, 377, 413, 1394, 1395, 508, 1396, 428, 1000, 466, 222, 224, 429, 1432, 60, 61, 62, 178, 179, 423, 724, 638, 639, 220, 430, 939, 431, 424, 1193, 1194, -985, 432, 220, -985, 463, 1700, 464, 950, 1755, 220, 13, 465, 376, 377, 1468, 1469, 220, 651, 1415, 1410, 765, 1701, 496, 650, 121, 769, 1756, 649, 121, 1757, 376, 377, 541, 652, 456, 457, 458, 1825, 459, 1702, 958, 661, -877, 1321, 1427, 1814, 1815, 1816, 1351, 53, 460, 424, 1839, -557, 1331, 1532, -700, 60, 61, 62, 178, 179, 423, 380, 1505, 1279, 1280, 400, 500, 970, 507, 1810, 1390, 1074, 1075, 1076, 505, 1391, 460, 60, 61, 62, 178, 1392, 423, 1393, 1671, 1672, -881, 1077, 1823, 1829, 1830, 862, 1753, 1754, 413, 866, 513, 566, 567, 568, 352, 1002, 497, 1836, 569, 570, 1749, 1750, 571, 572, 517, 560, 1034, 1037, 1187, 629, 516, 251, 1008, 635, 1394, 1395, 424, 1396, 337, 474, -698, 1407, 60, 61, 62, 178, 179, 423, 1556, 532, 400, 220, 523, 524, 545, 552, -1012, 1679, 424, 1384, 629, 555, 635, 629, 635, 635, 556, 651, 1080, 562, 563, 565, 1222, 650, 1530, 605, 606, 607, 1019, 1226, 1522, 618, 400, 652, 60, 61, 62, 63, 64, 423, 121, 514, 619, 653, 654, 70, 467, 521, 663, 676, 679, 664, 53, 665, 330, 667, -130, 367, 689, 424, 775, 777, 628, 779, 165, 780, 1429, 1803, 165, 785, 786, 804, 534, 808, 1117, 811, 551, 825, 824, 1167, 1446, 845, 846, 469, 848, 849, 1803, 857, 1126, 860, 863, 864, 867, 868, 1824, 876, 1455, 880, 881, 730, 890, 424, 884, 892, 560, 367, 734, 367, 367, 367, 367, 885, 130, 135, 1147, 901, 132, 895, 133, 128, 1311, 906, 907, 909, 1155, -722, 915, 1156, 916, 1157, 759, 918, 922, 687, -1013, -1013, -1013, -1013, -1013, 451, 452, 453, 454, 455, 456, 457, 458, 919, 459, 926, 161, 560, 129, 927, 935, 1128, 1732, 937, 940, 941, 460, 943, 946, 952, 793, 1335, 953, 764, 1518, 796, 602, 1191, 955, 661, 135, 121, 956, 241, 964, 610, 1534, 615, 1196, 972, 220, 976, 622, 234, 974, 1540, 661, 239, 240, 632, 843, 948, 223, 223, -704, 975, 1546, 1286, 1001, 1011, 1027, 651, 549, 1028, 550, 1021, 1023, 650, 1030, 129, 1045, 1374, 1029, 1032, 165, 135, 1197, 652, 1379, 1046, 1047, 1049, 1228, 1081, 1050, 1234, 592, 1082, 1083, 1087, 596, 796, 1090, 1103, 872, 1093, 135, 220, 1105, 1115, 1768, 1111, 1116, 1071, 1072, 1073, 1074, 1075, 1076, 1122, 1267, 1268, 1269, 1124, 129, 1125, 850, 1271, 1129, 554, 898, 900, 1077, 1131, 1133, 1162, 1150, 1159, 1685, 1165, 1287, 651, 1170, -884, 1171, 129, 1181, 650, 220, 1182, 220, 1185, 1186, 1188, 1288, 1199, 1201, 652, 1204, 1205, 33, 34, 35, 1207, 453, 454, 455, 456, 457, 458, 1216, 459, 213, 1220, 1221, 1224, 1389, 220, 1077, 1225, 1273, 1285, 622, 460, 1282, 1313, 1301, 1813, 135, 960, 135, 1309, 1444, 130, 1302, 1310, 367, 132, 687, 133, 128, 1314, 1316, 1318, 1320, 1323, 1322, 1332, 1326, 687, 1288, 1325, 1334, 682, 1333, 985, 337, 1345, 13, 165, 1338, 74, 75, 76, 77, 78, 1346, 129, 1348, 129, 1353, 161, 215, 1357, 1363, 1365, 1367, 1344, 82, 83, 251, 1368, 1371, 1372, 220, 1373, 1375, 1377, 1378, 1383, 1358, 1408, 92, 1409, 1419, 1422, 1420, 1424, 1426, 220, 220, 223, 661, 1430, 1436, 661, 97, 1434, 1441, 1437, 1435, 1726, 1440, 1727, 1442, 1443, 1445, 1347, 1447, 989, 1390, 995, 1733, 649, 1448, 1391, 1476, 60, 61, 62, 178, 1392, 423, 1393, 218, 218, 1452, 1506, 1453, 1449, 135, 1489, 121, 1509, 1465, 1515, 1516, 1519, 1504, 1524, 1527, 1525, 426, 1531, 1541, 1543, 1017, 121, 1550, 1559, 1558, 1652, 1653, 1659, 1665, 1666, 1670, 1668, 1678, 1771, 1394, 1395, 1669, 1396, 1412, 1690, 1680, 1691, 1413, 129, 1414, 1711, 1717, 1721, 1720, 1745, 1751, 1728, 1421, 1747, 1759, 817, 1760, 1761, 424, 1766, 1767, 1774, 1428, 687, 1775, 1776, -352, 121, 1778, 938, 1706, 1779, 1782, 1097, 1783, 1786, 1798, 1100, 1101, 1789, 1526, 1793, 220, 220, 1805, 1791, 1655, 1808, 1792, 1389, 1811, 1812, 1820, 135, 223, 1822, 1826, 1108, 1827, 1406, 1842, 1843, 1837, 223, 1850, 616, 1851, 1856, 1406, 1857, 223, 1859, 121, 1096, 1860, 871, 1099, 223, 649, 1807, 738, 1166, 1121, 1161, 1454, 1464, 969, 560, 735, 1821, 733, 13, 129, 121, 661, 1838, 1684, 874, 1819, 759, 1350, 793, 1845, 1676, 1699, 1557, 1704, 1496, 1844, 1832, 1716, 1674, 1549, 744, 1477, 1272, 855, 920, 921, 1270, 1089, 856, 1517, 1296, 1330, 687, 929, 996, 1401, 997, 1227, 1336, 1177, 1337, 1189, 367, 1141, 1401, 688, 1035, 1467, 1784, 1278, 1219, 165, 1266, 0, 1175, 1175, 989, 0, 0, 0, 1390, 0, 624, 1015, 218, 1391, 165, 60, 61, 62, 178, 1392, 423, 1393, 793, 0, 0, 0, 0, 0, 121, 0, 121, 220, 121, 0, 0, 0, 0, 0, 1551, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1538, 1218, 0, 0, 223, 1406, 0, 1394, 1395, 165, 1396, 1406, 1719, 1406, 0, 1746, 661, 0, 560, 0, 649, 560, 1667, 0, 0, 220, 0, 1104, 0, 0, 0, 424, 0, 135, 0, 0, 0, 0, 0, 220, 220, 0, 622, 1114, 0, 0, 0, 0, 0, 0, 843, 0, 1688, 1528, 165, 474, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1275, 0, 0, 1276, 0, 129, 0, 1401, 165, 0, 0, 0, 0, 1401, 0, 1401, 0, 1682, 1538, 0, 0, 1498, 0, 218, 121, 682, 682, 0, 135, 0, 0, 0, 218, 0, 0, 1389, 0, 135, 0, 218, 0, 0, 1406, 0, 0, 0, 218, 0, 0, 0, 0, 0, 0, 220, -1013, -1013, -1013, -1013, -1013, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 129, 1714, 0, 0, 1796, 0, 0, 0, 0, 129, 13, 0, 0, 1077, 0, 0, 0, 0, 0, 0, 989, 165, 0, 165, 989, 165, 0, 1015, 1203, 0, 0, 1764, 0, 0, 121, 331, 0, 0, 1722, 0, 1120, 0, 426, 0, 1401, 0, 121, 0, 0, 135, 0, 0, 0, 223, 0, 135, 1130, 0, 0, 0, 1660, 135, 0, 0, 0, 0, 0, 217, 217, 1144, 0, 232, 1390, 0, 649, 0, 0, 1391, 0, 60, 61, 62, 178, 1392, 423, 1393, 0, 0, 129, 0, 0, 0, 0, 0, 129, 232, 0, 0, 1164, 0, 129, 0, 218, 0, 0, 0, 0, 0, 0, 0, 223, 0, 0, 0, 0, 0, 1385, 0, 0, 0, 0, 0, 1394, 1395, 0, 1396, 0, 0, 0, 0, 0, 0, 0, 0, 0, 165, 0, 0, 0, 0, 0, 0, 0, 0, 649, 0, 424, 0, 0, 0, 0, 223, 0, 223, 0, 0, 0, 0, 0, 1215, 0, 1312, 1217, 0, 0, 0, 0, 0, 1677, 0, 989, 0, 989, 0, 0, 0, 0, 0, 0, 0, 223, 0, 0, 0, 0, 0, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 0, 135, 0, 0, 0, 0, 0, 1343, 0, 0, 0, 0, 0, 165, 0, 0, 1852, 0, 0, 0, 0, 622, 1015, 121, 1858, 165, 0, 0, 0, 330, 1861, 0, 661, 1862, 0, 1494, 0, 488, 489, 0, 129, 0, 135, 135, 0, 0, 0, 0, 223, 135, 0, 661, 0, 0, 0, 0, 0, 0, 0, 661, 0, 0, 0, 223, 223, 0, 0, 217, 1304, 0, 929, 0, 0, 0, 0, 0, 0, 0, 0, 0, 989, 129, 129, 0, 0, 121, 218, 135, 129, 0, 121, 0, 0, 0, 121, 1797, 0, 1324, 0, 0, 1327, 0, 622, 490, 491, 0, 0, 0, 0, 367, 0, 0, 560, 0, 232, 330, 232, 0, 0, 0, 0, 0, 0, 0, 0, 1641, 129, 0, 0, 0, 0, 0, 1648, 0, 0, 0, 0, 0, 0, 330, 0, 330, 0, 218, 0, 0, 0, 330, 0, 0, 0, 1364, 0, 0, 135, 1144, 0, 0, 0, 0, 0, 135, 0, 0, 0, 0, 0, 0, 0, 0, 989, 232, 0, 121, 121, 121, 0, 0, 0, 121, 0, 0, 223, 223, 218, 121, 218, 0, 0, 0, 0, 0, 0, 129, 0, 0, 217, 0, 0, 0, 129, 165, 0, 0, 0, 217, 0, 0, 0, 0, 0, 0, 217, 218, 1386, 1387, 0, 0, 0, 217, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 503, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 232, 0, 0, 0, 0, 165, 0, 0, 0, 0, 165, 0, 0, 0, 165, 0, 0, 0, 0, 0, 0, 0, 218, 488, 489, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 560, 218, 218, 0, 0, 0, 1456, 232, 1457, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 330, 223, 0, 0, 989, 0, 0, 0, 0, 121, 0, 0, 836, 0, 0, 0, 0, 0, 1738, 0, 0, 1499, 0, 0, 0, 1641, 1641, 217, 0, 1648, 1648, 0, 490, 491, 0, 0, 165, 165, 165, 0, 0, 272, 165, 367, 0, 0, 223, 0, 165, 0, 121, 121, 0, 0, 0, 0, 0, 121, 0, 0, 223, 223, 0, 0, 836, 0, 0, 0, 274, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 232, 0, 0, 835, 0, 0, 0, 0, 0, 0, 0, 36, 0, 0, 0, 0, 121, 0, 0, 0, 218, 218, 0, 1795, 666, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, -399, 1809, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 423, 0, 835, 0, 0, 0, 0, 0, 0, 223, 0, 0, 0, 0, 547, 548, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 121, 0, 182, 0, 0, 84, 324, 121, 86, 87, 0, 88, 183, 90, 0, 0, 1695, 0, 232, 232, 0, 0, 0, 0, 0, 165, 328, 232, 0, 0, 0, 0, 424, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 217, 0, 329, 0, 0, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 165, 165, 0, 0, 0, 218, 436, 165, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 217, 836, 0, 0, 460, 0, 165, 0, 0, 0, 0, 218, 1718, 0, 0, 0, 836, 836, 836, 836, 836, 0, 0, 0, 836, 218, 218, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 217, 0, 217, 0, 0, 1054, 0, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 217, 835, 0, 165, 0, 219, 219, 0, 0, 233, 165, 0, 0, 1077, 232, 232, 835, 835, 835, 835, 835, 0, 0, 0, 835, 0, 1780, 60, 61, 62, 63, 64, 423, 0, 0, 0, 218, 0, 70, 467, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 836, 0, 0, 0, 217, 0, 0, 0, 0, 0, 0, 468, 1289, 469, 0, 0, 0, 232, 0, 217, 217, 0, 0, 0, 0, 0, 470, 0, 471, 0, 0, 424, 0, 232, 232, 0, 0, 929, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 232, 0, 0, 929, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 0, 835, 0, 0, 232, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1232, 0, 0, 0, 0, 0, 232, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 836, 0, 0, 0, 0, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 836, 0, 0, 0, 217, 217, 0, 219, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 232, 0, 232, 0, 0, 836, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 835, 0, 232, 0, 0, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 835, 0, 0, 0, 0, 0, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 835, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 333, 0, 0, 232, 0, 232, 0, 836, 0, 460, 0, 0, 0, 219, 0, 217, 0, 0, 0, 0, 0, 0, 219, 836, 0, 836, 0, 0, 0, 219, 0, 0, 232, 0, 0, 232, 219, 0, 0, 0, 0, 836, 0, 0, 0, 0, 0, 219, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 217, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 217, 217, 0, 835, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 232, 0, 0, 835, 0, 835, 0, 0, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 835, 0, 0, 0, 0, 0, 436, 233, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 902, 0, 232, 232, 0, 232, 0, 460, 217, 0, 0, 0, 219, 0, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 836, 0, 0, 0, 836, 0, 836, 0, 436, 836, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 0, 839, 0, 0, 460, 333, 0, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 232, 0, 0, 0, 0, 835, 232, 0, 0, 835, 0, 835, 0, 0, 835, 0, 0, 0, 0, 0, 0, 836, 0, 232, 232, 0, 0, 232, 0, 839, 0, 0, 0, 0, 232, 0, 36, 0, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 934, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 503, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 835, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 232, 0, 0, 219, 836, 836, 0, 232, 0, 232, 0, 836, 0, 0, 86, 87, 973, 88, 183, 90, 333, 0, 0, 333, 0, 0, 488, 489, 0, 0, 0, 232, 0, 232, 0, 0, 0, 0, 0, 232, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 689, 0, 0, 0, 219, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 835, 835, 0, 0, 0, 0, 0, 835, 0, 232, 0, 433, 434, 435, 0, 232, 0, 232, 490, 491, 0, 0, 0, 0, 0, 0, 0, 219, 0, 219, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 219, 839, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 839, 839, 839, 839, 839, 0, 0, 0, 839, 0, 0, 0, 333, 820, 0, 836, 837, 787, 0, 0, 0, 0, 0, 0, 0, 0, 836, 0, 0, 0, 0, 0, 836, 0, 1092, 0, 836, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 219, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 1110, 0, 219, 219, 837, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 1110, 0, 0, 0, 835, 0, 0, 0, 0, 219, 0, 0, 0, 0, 0, 835, 0, 836, 0, 0, 0, 835, 0, 0, 0, 835, 0, 0, 0, 0, 0, 0, 0, 333, 333, 0, 839, 0, 0, 1151, 0, 0, 333, 0, 433, 434, 435, 232, 0, 0, 0, 0, 977, 0, 0, 0, 0, 0, 0, 0, 0, 233, 0, 436, 1359, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 835, 459, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 460, 0, 0, 0, 219, 219, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 232, 0, 839, 0, 219, 0, 0, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 839, 503, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 0, 0, 0, 0, 0, 0, 0, 837, 0, 0, 0, 0, 839, 221, 221, 0, 0, 237, 0, 0, 333, 333, 837, 837, 837, 837, 837, 0, 0, 0, 837, 0, 0, 0, 433, 434, 435, 488, 489, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1360, 436, 219, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 219, 0, 0, 0, 0, 219, 0, 0, 333, 490, 491, 0, 0, 0, 0, 0, 0, 0, 0, 219, 219, 0, 839, 0, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 333, 839, 0, 839, 0, 0, 0, 0, 837, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 839, 0, 0, 0, 0, 0, 0, 0, 0, 436, 333, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 1388, 0, 0, 219, 0, 460, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 221, 0, 0, 0, 0, 0, 0, 0, 0, 333, 0, 0, 333, 0, 820, 0, 1102, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 837, 0, 0, 0, 0, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 837, 0, 0, 0, 0, 0, 0, 0, 839, 219, 0, 0, 839, 0, 839, 435, 0, 839, 0, 0, 0, 0, 0, 0, 0, 0, 837, 1475, 0, 0, 1488, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 333, 459, 333, 0, 0, 1158, 0, 0, 0, 0, 0, 0, 221, 460, 0, 0, 0, 0, 0, 0, 0, 221, 0, 219, 0, 0, 0, 0, 221, 333, 0, 0, 333, 0, 0, 221, 0, 0, 839, 0, 0, 0, 0, 0, 0, 0, 237, 0, 1547, 1548, 0, 0, 0, 0, 0, 0, 0, 0, 1488, 0, 0, 818, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 837, 0, 0, 0, 0, 0, 0, 0, 0, 333, 0, 0, 0, 333, 0, 0, 837, 0, 837, 0, 503, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 0, 837, 0, 36, 0, 0, 0, 0, 0, 0, 237, 0, 819, 0, 0, 0, 839, 839, 0, 0, 0, 0, 0, 839, 48, 1693, 0, 0, 0, 0, 0, 0, 0, 1488, 433, 434, 435, 488, 489, 333, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 221, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 182, 459, 0, 84, 0, 0, 86, 87, 0, 88, 183, 90, 0, 460, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 490, 491, 0, 840, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 333, 0, 333, 0, 0, 0, 0, 837, 0, 0, 0, 837, 0, 837, 0, 0, 837, 0, 0, 0, 0, 0, 0, 0, 0, 333, 0, 0, 0, 0, 0, 0, 0, 840, 0, 841, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 839, 882, 0, 0, 0, 0, 0, 0, 0, 0, 0, 839, 0, 0, 0, 0, 0, 839, 0, 0, 0, 839, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 875, 459, 0, 0, 0, 0, 837, 0, 0, 0, 0, 0, 0, 460, 0, 0, 1169, 0, 0, 0, 0, 0, 221, 0, 333, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 839, 459, 0, 0, 333, 0, 333, 0, 0, 1806, 0, 0, 333, 460, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1475, 0, 0, 0, 0, 0, 0, 0, 0, 0, 221, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 837, 837, 0, 0, 0, 0, 0, 837, 0, 0, 0, 433, 434, 435, 0, 333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 221, 436, 221, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 221, 840, 0, 0, 433, 434, 435, 0, 0, 460, 0, 0, 0, 0, 0, 0, 840, 840, 840, 840, 840, 0, 0, 436, 840, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 1016, 0, 0, 333, 0, 460, 0, 272, 0, 0, 0, 0, 221, 0, 0, 1038, 1039, 1040, 1041, 0, 333, 0, 0, 1048, 0, 0, 0, 221, 221, 0, 0, 0, 0, 0, 274, 0, 0, 0, 1739, 0, 0, 0, 0, 0, 837, 0, 0, 0, 0, 0, 0, 237, 0, 0, 0, 837, 36, 0, 0, 0, 0, 837, 0, 0, 0, 837, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 840, 0, 0, 0, 0, 0, 0, 553, 0, 333, 0, 0, 0, 0, 1192, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 237, 0, 0, 0, 0, 0, 0, 0, 0, 547, 548, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 837, 0, 0, 182, 0, 1148, 84, 324, 0, 86, 87, 0, 88, 183, 90, 0, 1511, 0, 0, 221, 221, 0, 0, 0, 0, 0, 0, 328, 0, 0, 0, 0, 0, 0, 333, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 333, 0, 329, 0, 840, 0, 237, 0, 0, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 840, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 840, 1235, 1238, 1239, 1240, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 0, 0, 0, 0, 0, 433, 434, 435, 0, 0, 0, 0, 0, 221, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 1277, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 237, 0, 0, 0, 0, 221, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 221, 221, 0, 840, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 840, 0, 840, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 840, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1354, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 1369, 0, 1370, 0, 0, 0, 0, 0, 221, 433, 434, 435, 0, 0, 0, 0, 0, 0, 1380, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 1512, 0, 0, 0, 5, 6, 7, 8, 9, 0, 0, 460, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 395, 12, 0, 0, 0, 0, 0, 0, 740, 0, 0, 0, 0, 840, 237, 0, 0, 840, 0, 840, 14, 15, 840, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 1459, 0, 0, 0, 1461, 48, 1462, 0, 0, 1463, 0, 0, 0, 53, 0, 0, 0, 237, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 840, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 461, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 1542, 97, 98, 338, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 0, 0, 0, 116, 117, 0, 118, 119, 0, 840, 840, 0, 0, 0, 0, 0, 840, 433, 434, 435, 0, 0, 0, 0, 0, 1698, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 1686, 1687, 0, 0, 0, 0, 0, 1692, 0, 0, 460, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 840, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 840, 0, 0, 0, 0, 0, 840, 0, 0, 0, 840, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 5, 6, 7, 8, 9, 0, 544, 0, 1781, 0, 10, 0, 0, 0, 0, 0, 0, 1748, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 1758, 0, 0, 0, 0, 0, 1763, 0, 0, 0, 1765, 0, 0, 0, 0, 13, 14, 15, 840, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 546, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 1799, 50, 51, 52, 53, 54, 55, 56, 564, 57, 58, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 69, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 81, 82, 83, 84, 85, 0, 86, 87, 0, 88, 89, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 95, 0, 96, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1118, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 54, 55, 56, 0, 57, 58, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 69, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 81, 82, 83, 84, 85, 0, 86, 87, 0, 88, 89, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 95, 0, 96, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1290, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 54, 55, 56, 0, 57, 58, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 69, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 81, 82, 83, 84, 85, 0, 86, 87, 0, 88, 89, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 95, 0, 96, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 668, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1091, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1132, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1198, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 1200, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 1355, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1466, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1689, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 1734, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1769, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1770, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 1773, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1790, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1846, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 1853, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 13, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 63, 64, 65, 0, 66, 67, 68, 0, 70, 71, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 91, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 530, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 805, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 1018, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 1537, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 1681, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 11, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 32, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 39, 40, 0, 0, 0, 41, 42, 43, 44, 0, 45, 0, 46, 0, 47, 0, 0, 48, 49, 0, 0, 0, 50, 51, 52, 53, 0, 55, 56, 0, 57, 0, 59, 60, 61, 62, 178, 179, 65, 0, 66, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 72, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 79, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 114, 115, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 338, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 339, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 683, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 684, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 800, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 1145, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 1146, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 395, 12, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 433, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 195, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 1084, 1085, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, -1013, -1013, -1013, -1013, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 225, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 433, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 1735, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 258, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 261, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 395, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 113, 0, 433, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 1545, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 528, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 696, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 740, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, -1013, -1013, -1013, -1013, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 781, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 783, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1190, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 0, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 433, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 37, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 1382, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 433, 434, 435, 116, 117, 0, 118, 119, 5, 6, 7, 8, 9, 0, 0, 0, 0, 0, 10, 436, 951, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 14, 15, 0, 0, 460, 0, 16, 0, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 0, 28, 29, 30, 31, 0, 0, 0, 0, 33, 34, 35, 36, 630, 38, 0, 0, 0, 0, 0, 0, 41, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 53, 0, 0, 0, 0, 0, 0, 0, 60, 61, 62, 178, 179, 180, 0, 0, 67, 68, 0, 0, 0, 0, 0, 0, 0, 0, 181, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 80, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 93, 0, 0, 0, 0, 0, 94, 0, 0, 0, 0, 97, 98, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 0, 0, 184, 0, 0, 0, 0, 116, 117, 0, 118, 119, 263, 264, 0, 265, 266, 1052, 1053, 267, 268, 269, 270, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1054, 271, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 273, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 212, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 728, 317, 318, 319, 0, 0, 0, 320, 557, 558, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 263, 264, 0, 265, 266, 0, 559, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 271, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 0, 0, 0, 0, 729, 0, 116, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 212, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 316, 317, 318, 319, 0, 0, 0, 320, 557, 558, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 263, 264, 0, 265, 266, 0, 559, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 271, 0, 272, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 274, 0, 0, 0, 729, 0, 116, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 0, 317, 318, 319, 36, 0, 0, 320, 321, 322, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 323, 0, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 0, 0, 0, 0, 0, 0, 328, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 263, 264, 329, 265, 266, 0, 1661, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 271, 0, 272, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 274, 948, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 0, 317, 318, 319, 36, 0, 0, 320, 321, 322, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 323, 0, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 0, 0, 0, 0, 0, 0, 328, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 263, 264, 329, 265, 266, 0, 1730, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 271, 0, 272, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 274, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 316, 317, 318, 319, 0, 0, 0, 320, 321, 322, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 323, 0, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 0, 0, 0, 0, 0, 0, 328, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 263, 264, 329, 265, 266, 0, 0, 267, 268, 269, 270, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 271, 436, 272, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 273, 0, 274, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 0, 317, 318, 319, 0, 0, 0, 320, 321, 322, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 323, 0, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 0, 0, 0, 0, 0, 0, 328, 1470, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 263, 264, 329, 265, 266, 0, 0, 267, 268, 269, 270, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 271, 1054, 272, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 273, 0, 274, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 0, 317, 318, 319, 0, 0, 0, 320, 321, 322, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 36, 0, 0, 0, 0, 323, 0, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 48, 327, 0, 0, 0, 0, 0, 0, 328, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 329, 1562, 1563, 1564, 1565, 1566, 0, 0, 1567, 1568, 1569, 1570, 0, 0, 0, 0, 0, 0, 0, 0, 0, 182, 0, 0, 84, 1571, 1572, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1573, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 1574, 1575, 1576, 1577, 1578, 1579, 1580, 1737, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1581, 1582, 1583, 1584, 1585, 1586, 1587, 1588, 1589, 1590, 1591, 48, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1599, 1600, 1601, 1602, 1603, 1604, 1605, 1606, 1607, 1608, 1609, 1610, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1621, 0, 0, 0, 1622, 1623, 0, 1624, 1625, 1626, 1627, 1628, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1629, 1630, 1631, 0, 0, 0, 86, 87, 0, 88, 183, 90, 1632, 0, 1633, 1634, 0, 1635, 0, 0, 0, 0, 0, 0, 1636, 1637, 0, 1638, 0, 1639, 1640, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 263, 264, 0, 265, 266, 0, 1053, 267, 268, 269, 270, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1054, 271, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 273, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 316, 317, 318, 319, 0, 0, 0, 320, 557, 558, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 263, 264, 0, 265, 266, 0, 559, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 271, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 1233, 317, 318, 319, 0, 0, 0, 320, 557, 558, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 263, 264, 0, 265, 266, 0, 559, 267, 268, 269, 270, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 271, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 273, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 275, 276, 277, 278, 279, 280, 281, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 48, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 0, 0, 0, 0, 317, 318, 319, 0, 0, 0, 320, 557, 558, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 559, 0, 0, 0, 0, 0, 86, 87, 0, 88, 183, 90, 325, 0, 326, 0, 0, 327, 0, 0, 0, 0, 0, 0, 0, 0, 433, 434, 435, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 272, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 274, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 588, 0, 0, 0, 0, 0, 0, 272, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 274, 0, 0, 0, 0, 0, 0, 0, 0, 0, 773, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 547, 548, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 272, 0, 182, 0, 0, 84, 324, 797, 86, 87, 0, 88, 183, 90, 0, 1033, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 328, 274, 0, 0, 547, 548, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 1088, 182, 36, 329, 84, 324, 0, 86, 87, 0, 88, 183, 90, 0, 1366, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 328, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 329, 0, 0, 0, 0, 0, 0, 0, 0, 547, 548, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 36, 182, 212, 0, 84, 324, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 328, 0, 0, 0, 1241, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 826, 827, 0, 329, 0, 0, 828, 0, 829, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 830, 0, 0, 0, 0, 0, 0, 0, 33, 34, 35, 36, 757, 0, 86, 87, 0, 88, 183, 90, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 0, 0, 0, 758, 0, 116, 0, 0, 0, 0, 0, 831, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 832, 0, 86, 87, 0, 88, 183, 90, 0, 1012, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 833, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 28, 0, 0, 834, 0, 0, 0, 0, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 214, 0, 0, 0, 0, 0, 0, 1478, 0, 0, 0, 0, 0, 1013, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 36, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 48, 0, 0, 216, 0, 0, 0, 0, 116, 0, 0, 0, 0, 0, 0, 0, 0, 0, 826, 827, 0, 0, 1479, 0, 828, 0, 829, 0, 0, 0, 0, 0, 0, 0, 0, 1480, 1481, 0, 830, 0, 0, 0, 0, 0, 0, 0, 33, 34, 35, 36, 0, 0, 0, 182, 0, 0, 84, 1482, 213, 86, 87, 0, 88, 1483, 90, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 1172, 1173, 1174, 36, 0, 0, 0, 831, 0, 74, 75, 76, 77, 78, 0, 0, 36, 0, 212, 0, 215, 0, 0, 0, 48, 182, 82, 83, 84, 832, 0, 86, 87, 0, 88, 183, 90, 48, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 833, 979, 980, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 981, 0, 0, 834, 0, 0, 0, 0, 982, 983, 984, 36, 0, 86, 87, 0, 88, 183, 90, 0, 985, 0, 0, 0, 757, 0, 86, 87, 0, 88, 183, 90, 48, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 986, 0, 0, 0, 792, 0, 116, 0, 0, 0, 0, 0, 0, 987, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 988, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 28, 0, 0, 0, 0, 0, 0, 0, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 214, 459, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 28, 0, 216, 0, 0, 601, 0, 116, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 214, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 621, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 28, 216, 968, 0, 0, 0, 116, 0, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 214, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 28, 0, 216, 0, 0, 0, 0, 116, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 214, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1113, 73, 0, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 28, 0, 216, 0, 0, 0, 0, 116, 33, 34, 35, 36, 0, 212, 0, 0, 0, 0, 0, 0, 213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 214, 0, 0, 0, 0, 0, 0, 36, 0, 896, 897, 0, 0, 0, 73, 0, 74, 75, 76, 77, 78, 0, 0, 36, 0, 0, 0, 215, 48, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 48, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 216, 33, 34, 35, 36, 116, 212, 86, 87, 0, 88, 183, 90, 213, 0, 0, 0, 0, 0, 0, 380, 0, 0, 86, 87, 48, 88, 183, 90, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 230, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 74, 75, 76, 77, 78, 0, 381, 36, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 48, 0, 0, 92, 0, 0, 0, 0, 347, 348, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 0, 0, 231, 33, 34, 35, 36, 116, 212, 0, 0, 0, 0, 0, 0, 644, 0, 0, 0, 0, 0, 0, 349, 0, 0, 86, 87, 48, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 214, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 74, 75, 76, 77, 78, 0, 0, 0, 0, 0, 0, 215, 0, 0, 0, 0, 182, 82, 83, 84, 85, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 92, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 97, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 433, 434, 435, 645, 0, 0, 0, 0, 116, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 506, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 515, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 436, 954, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 1054, 998, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1054, 1319, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 0, 0, 0, 0, 0, 1054, 1223, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 36, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 1051, 1052, 1053, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1054, 1376, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 36, 0, 0, 0, 0, 1646, 1458, 86, 87, 1647, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 1492, 36, 0, 1493, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 36, 0, 1544, 0, 0, 0, 0, 48, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 86, 87, 48, 88, 183, 90, 0, 0, 0, 0, 1479, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 36, 1480, 1481, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 36, 0, 182, 1493, 48, 84, 85, 0, 86, 87, 0, 88, 1483, 90, 0, 0, 182, 0, 0, 84, 85, 48, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 420, 0, 86, 87, 36, 88, 183, 90, 0, 0, 0, 0, 0, 0, 0, 0, 589, 0, 0, 86, 87, 36, 88, 183, 90, 48, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 48, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 593, 459, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 0, 460, 0, 0, 0, 349, 0, 0, 86, 87, 0, 88, 183, 90, 0, 0, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 433, 434, 435, 0, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 0, 809, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 433, 434, 435, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 436, 0, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 810, 459, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 460, 0, 0, 0, 0, 0, 0, 0, 1054, 1381, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1051, 1052, 1053, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 0, 0, 0, 0, 0, 1054, 0, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 0, 459, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 460, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1077 }; static const yytype_int16 yycheck[] = { 5, 6, 135, 8, 9, 10, 11, 12, 161, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 113, 54, 28, 29, 91, 186, 686, 500, 95, 96, 927, 32, 232, 4, 228, 55, 42, 4, 1135, 4, 4, 388, 166, 44, 50, 161, 52, 388, 49, 55, 113, 57, 42, 187, 656, 54, 1122, 388, 637, 916, 30, 242, 459, 496, 497, 492, 657, 134, 113, 815, 30, 4, 775, 79, 30, 30, 492, 113, 1011, 737, 947, 9, 30, 9, 30, 4, 530, 9, 9, 79, 67, 524, 808, 1131, 9, 67, 963, 9, 9, 526, 9, 9, 14, 14, 9, 14, 9, 113, 9, 9, 526, 9, 9, 9, 9, 9, 9, 46, 9, 243, 9, 184, 9, 9, 9, 9, 67, 46, 33, 9, 9, 9, 9, 9, 151, 111, 9, 67, 51, 184, 4, 585, 67, 67, 80, 157, 80, 1675, 184, 67, 67, 130, 131, 216, 101, 102, 103, 118, 130, 131, 35, 200, 119, 151, 46, 126, 80, 151, 231, 126, 86, 216, 86, 116, 151, 46, 523, 46, 184, 4, 216, 46, 86, 200, 172, 191, 231, 200, 172, 108, 1047, 203, 373, 169, 113, 67, 115, 116, 117, 118, 119, 120, 121, 1731, 67, 80, 67, 67, 67, 67, 216, 67, 130, 131, 658, 203, 35, 151, 67, 67, 35, 200, 0, 200, 67, 231, 203, 151, 67, 165, 67, 203, 148, 151, 67, 149, 150, 200, 244, 158, 159, 247, 161, 156, 148, 58, 80, 173, 254, 255, 1316, 8, 173, 80, 203, 203, 202, 1323, 80, 1325, 172, 80, 203, 182, 425, 80, 80, 51, 81, 198, 200, 84, 1205, 173, 202, 1021, 1314, 1023, 203, 203, 202, 203, 200, 200, 248, 204, 203, 202, 252, 156, 202, 202, 151, 202, 202, 209, 201, 161, 201, 1166, 173, 202, 365, 201, 337, 202, 202, 202, 202, 202, 135, 202, 1390, 202, 201, 509, 202, 202, 202, 201, 365, 201, 201, 201, 201, 201, 905, 198, 1185, 365, 201, 203, 201, 80, 35, 35, 201, 200, 337, 200, 474, 502, 203, 203, 203, 203, 165, 203, 26, 27, 165, 200, 419, 944, 203, 203, 800, 200, 364, 365, 203, 805, 187, 98, 203, 371, 203, 200, 201, 1435, 376, 205, 156, 80, 364, 197, 203, 157, 205, 80, 80, 203, 475, 416, 172, 172, 1424, 171, 1426, 395, 170, 205, 102, 103, 102, 103, 54, 403, 1476, 101, 102, 103, 469, 470, 471, 472, 130, 131, 66, 415, 80, 98, 200, 200, 67, 35, 30, 416, 165, 892, 155, 200, 1500, 203, 1502, 47, 48, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 647, 460, 475, 462, 463, 165, 465, 80, 394, 1120, 4, 165, 165, 200, 466, 155, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 663, 1186, 665, 1201, 1524, 493, 494, 459, 496, 497, 498, 499, 204, 165, 204, 503, 155, 459, 506, 172, 4, 459, 459, 200, 933, 130, 131, 515, 51, 517, 532, 54, 513, 98, 1373, 933, 524, 80, 674, 200, 80, 466, 172, 86, 532, 960, 534, 200, 71, 731, 1134, 727, 347, 348, 349, 67, 402, 98, 80, 117, 118, 119, 46, 98, 86, 225, 89, 492, 91, 80, 200, 523, 95, 96, 200, 86, 674, 1150, 200, 567, 1153, 763, 570, 571, 572, 380, 80, 916, 513, 968, 155, 537, 1018, 916, 98, 402, 739, 172, 523, 204, 645, 526, 80, 916, 1443, 200, 149, 150, 86, 149, 150, 134, 200, 601, 155, 200, 779, 780, 130, 131, 155, 200, 785, 786, 108, 200, 148, 149, 150, 113, 200, 115, 116, 117, 118, 119, 120, 121, 149, 150, 72, 73, 29, 692, 80, 155, 822, 1332, 202, 1334, 86, 155, 151, 835, 148, 149, 150, 645, 1678, 4, 47, 843, 80, 50, 35, 208, 473, 67, 86, 4, 148, 149, 150, 172, 158, 159, 199, 161, 202, 785, 151, 26, 27, 202, 1324, 115, 116, 117, 118, 119, 120, 463, 202, 203, 354, 202, 684, 202, 182, 72, 73, 200, 202, 363, 203, 67, 14, 202, 696, 29, 370, 46, 203, 149, 150, 128, 129, 377, 1047, 1303, 204, 493, 30, 200, 1047, 248, 498, 47, 388, 252, 50, 149, 150, 256, 1047, 50, 51, 52, 1817, 54, 48, 729, 657, 200, 1159, 1318, 115, 116, 117, 1204, 107, 66, 182, 1832, 67, 1170, 1441, 151, 115, 116, 117, 118, 119, 120, 155, 1405, 98, 99, 113, 200, 758, 45, 202, 108, 50, 51, 52, 202, 113, 66, 115, 116, 117, 118, 119, 120, 121, 202, 203, 200, 66, 1811, 202, 203, 589, 1705, 1706, 172, 593, 151, 183, 184, 185, 598, 792, 200, 1826, 190, 191, 1701, 1702, 194, 195, 9, 337, 824, 825, 993, 374, 207, 808, 804, 378, 158, 159, 182, 161, 54, 674, 151, 1285, 115, 116, 117, 118, 119, 120, 1477, 8, 184, 500, 151, 200, 202, 200, 151, 1531, 182, 1274, 405, 14, 407, 408, 409, 410, 151, 1185, 845, 80, 202, 202, 1037, 1185, 1436, 126, 126, 14, 813, 1044, 204, 201, 216, 1185, 115, 116, 117, 118, 119, 120, 402, 225, 172, 14, 98, 126, 127, 231, 201, 206, 412, 201, 107, 201, 416, 201, 200, 419, 200, 182, 200, 9, 148, 201, 248, 201, 1320, 1785, 252, 201, 201, 90, 9, 202, 901, 14, 172, 9, 200, 967, 1345, 186, 80, 164, 80, 80, 1804, 189, 915, 200, 202, 9, 202, 9, 1812, 80, 1361, 201, 201, 919, 128, 182, 201, 200, 466, 467, 468, 469, 470, 471, 472, 202, 904, 798, 941, 67, 904, 201, 904, 904, 1141, 30, 129, 171, 951, 151, 132, 954, 9, 956, 492, 201, 14, 960, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 151, 54, 198, 904, 513, 798, 9, 9, 919, 1680, 173, 201, 9, 66, 14, 128, 207, 526, 1180, 207, 931, 1422, 933, 354, 998, 204, 927, 859, 537, 9, 968, 14, 363, 1445, 365, 1004, 207, 683, 207, 370, 968, 201, 1454, 944, 968, 968, 377, 556, 200, 26, 27, 151, 201, 1465, 1115, 201, 98, 87, 1373, 272, 132, 274, 202, 202, 1373, 9, 859, 200, 1230, 151, 201, 402, 904, 1005, 1373, 1237, 151, 200, 151, 1046, 186, 203, 1049, 864, 186, 14, 9, 868, 999, 80, 14, 600, 203, 925, 740, 202, 14, 1725, 203, 207, 47, 48, 49, 50, 51, 52, 203, 1081, 1082, 1083, 14, 904, 201, 1087, 1088, 202, 329, 626, 627, 66, 198, 30, 30, 200, 200, 1537, 14, 1115, 1443, 200, 200, 14, 925, 49, 1443, 781, 200, 783, 200, 9, 201, 1115, 202, 202, 1443, 200, 132, 75, 76, 77, 14, 47, 48, 49, 50, 51, 52, 132, 54, 87, 9, 201, 207, 4, 810, 66, 9, 80, 200, 500, 66, 9, 1146, 132, 1802, 1007, 200, 1009, 14, 1341, 1119, 202, 80, 692, 1119, 1159, 1119, 1119, 201, 203, 200, 200, 203, 201, 132, 202, 1170, 1171, 203, 9, 413, 207, 87, 416, 30, 46, 537, 148, 136, 137, 138, 139, 140, 74, 1007, 202, 1009, 201, 1119, 147, 202, 173, 132, 30, 1193, 153, 154, 1201, 201, 201, 132, 877, 9, 201, 204, 9, 201, 1211, 204, 167, 203, 14, 200, 80, 201, 201, 892, 893, 225, 1150, 201, 200, 1153, 181, 202, 132, 201, 203, 1670, 201, 1672, 201, 9, 30, 1196, 202, 775, 108, 777, 1681, 916, 201, 113, 108, 115, 116, 117, 118, 119, 120, 121, 26, 27, 202, 1406, 202, 201, 1119, 160, 798, 156, 203, 14, 80, 113, 202, 201, 203, 201, 1401, 132, 201, 132, 812, 813, 14, 203, 172, 202, 80, 14, 14, 80, 203, 201, 201, 1728, 158, 159, 200, 161, 1295, 202, 132, 202, 1299, 1119, 1301, 14, 14, 14, 202, 9, 56, 203, 1309, 204, 80, 551, 172, 200, 182, 80, 9, 202, 1319, 1320, 80, 111, 98, 859, 151, 683, 33, 98, 163, 865, 14, 200, 173, 869, 870, 201, 204, 169, 1011, 1012, 80, 202, 1498, 166, 200, 4, 201, 9, 80, 1208, 354, 202, 201, 889, 201, 1283, 14, 80, 203, 363, 14, 365, 80, 14, 1292, 80, 370, 14, 904, 864, 80, 598, 868, 377, 1047, 1793, 472, 966, 907, 961, 1358, 1382, 740, 919, 469, 1808, 467, 46, 1208, 925, 1318, 1830, 1536, 603, 1804, 931, 1202, 933, 1837, 1527, 1560, 1478, 1644, 1396, 1836, 1824, 1656, 1523, 1470, 475, 1392, 1090, 574, 653, 654, 1087, 856, 574, 1419, 1123, 1168, 1422, 662, 781, 1283, 783, 1045, 1181, 980, 1182, 995, 967, 931, 1292, 416, 824, 1385, 1760, 1106, 1030, 798, 1078, -1, 979, 980, 981, -1, -1, -1, 108, -1, 371, 810, 225, 113, 813, 115, 116, 117, 118, 119, 120, 121, 999, -1, -1, -1, -1, -1, 1005, -1, 1007, 1145, 1009, -1, -1, -1, -1, -1, 1473, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1451, 1029, -1, -1, 500, 1425, -1, 158, 159, 859, 161, 1431, 1660, 1433, -1, 1696, 1436, -1, 1046, -1, 1185, 1049, 1515, -1, -1, 1190, -1, 877, -1, -1, -1, 182, -1, 1384, -1, -1, -1, -1, -1, 1204, 1205, -1, 892, 893, -1, -1, -1, -1, -1, -1, 1078, -1, 1545, 204, 904, 1406, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1095, -1, -1, 1098, -1, 1384, -1, 1425, 925, -1, -1, -1, -1, 1431, -1, 1433, -1, 1535, 1536, -1, -1, 1400, -1, 354, 1119, 824, 825, -1, 1446, -1, -1, -1, 363, -1, -1, 4, -1, 1455, -1, 370, -1, -1, 1529, -1, -1, -1, 377, -1, -1, -1, -1, -1, -1, 1285, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 1446, 1655, -1, -1, 1779, -1, -1, -1, -1, 1455, 46, -1, -1, 66, -1, -1, -1, -1, -1, -1, 1182, 1005, -1, 1007, 1186, 1009, -1, 1011, 1012, -1, -1, 1719, -1, -1, 1196, 1655, -1, -1, 1665, -1, 906, -1, 1797, -1, 1529, -1, 1208, -1, -1, 1534, -1, -1, -1, 683, -1, 1540, 922, -1, -1, -1, 1506, 1546, -1, -1, -1, -1, -1, 26, 27, 935, -1, 30, 108, -1, 1373, -1, -1, 113, -1, 115, 116, 117, 118, 119, 120, 121, -1, -1, 1534, -1, -1, -1, -1, -1, 1540, 54, -1, -1, 964, -1, 1546, -1, 500, -1, -1, -1, -1, -1, -1, -1, 740, -1, -1, -1, -1, -1, 1278, -1, -1, -1, -1, -1, 158, 159, -1, 161, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1119, -1, -1, -1, -1, -1, -1, -1, -1, 1443, -1, 182, -1, -1, -1, -1, 781, -1, 783, -1, -1, -1, -1, -1, 1025, -1, 1145, 1028, -1, -1, -1, -1, -1, 204, -1, 1332, -1, 1334, -1, -1, -1, -1, -1, -1, -1, 810, -1, -1, -1, -1, -1, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, -1, 1685, -1, -1, -1, -1, -1, 1190, -1, -1, -1, -1, -1, 1196, -1, -1, 1842, -1, -1, -1, -1, 1204, 1205, 1384, 1850, 1208, -1, -1, -1, 1390, 1856, -1, 1785, 1859, -1, 1396, -1, 64, 65, -1, 1685, -1, 1726, 1727, -1, -1, -1, -1, 877, 1733, -1, 1804, -1, -1, -1, -1, -1, -1, -1, 1812, -1, -1, -1, 892, 893, -1, -1, 225, 1133, -1, 1135, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1441, 1726, 1727, -1, -1, 1446, 683, 1771, 1733, -1, 1451, -1, -1, -1, 1455, 1779, -1, 1162, -1, -1, 1165, -1, 1285, 130, 131, -1, -1, -1, -1, 1470, -1, -1, 1473, -1, 272, 1476, 274, -1, -1, -1, -1, -1, -1, -1, -1, 1486, 1771, -1, -1, -1, -1, -1, 1493, -1, -1, -1, -1, -1, -1, 1500, -1, 1502, -1, 740, -1, -1, -1, 1508, -1, -1, -1, 1216, -1, -1, 1838, 1220, -1, -1, -1, -1, -1, 1845, -1, -1, -1, -1, -1, -1, -1, -1, 1531, 329, -1, 1534, 1535, 1536, -1, -1, -1, 1540, -1, -1, 1011, 1012, 781, 1546, 783, -1, -1, -1, -1, -1, -1, 1838, -1, -1, 354, -1, -1, -1, 1845, 1384, -1, -1, -1, 363, -1, -1, -1, -1, -1, -1, 370, 810, 1279, 1280, -1, -1, -1, 377, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 388, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 413, -1, -1, 416, -1, -1, -1, -1, 1446, -1, -1, -1, -1, 1451, -1, -1, -1, 1455, -1, -1, -1, -1, -1, -1, -1, 877, 64, 65, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1655, 892, 893, -1, -1, -1, 1365, 459, 1367, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1676, 1145, -1, -1, 1680, -1, -1, -1, -1, 1685, -1, -1, 555, -1, -1, -1, -1, -1, 1694, -1, -1, 1401, -1, -1, -1, 1701, 1702, 500, -1, 1705, 1706, -1, 130, 131, -1, -1, 1534, 1535, 1536, -1, -1, 29, 1540, 1719, -1, -1, 1190, -1, 1546, -1, 1726, 1727, -1, -1, -1, -1, -1, 1733, -1, -1, 1204, 1205, -1, -1, 607, -1, -1, -1, 56, -1, -1, -1, -1, -1, -1, -1, -1, -1, 551, 552, -1, -1, 555, -1, -1, -1, -1, -1, -1, -1, 78, -1, -1, -1, -1, 1771, -1, -1, -1, 1011, 1012, -1, 1778, 201, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, 1796, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, 607, -1, -1, -1, -1, -1, -1, 1285, -1, -1, -1, -1, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1838, -1, 152, -1, -1, 155, 156, 1845, 158, 159, -1, 161, 162, 163, -1, -1, 1558, -1, 653, 654, -1, -1, -1, -1, -1, 1685, 176, 662, -1, -1, -1, -1, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 683, -1, 200, -1, -1, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1726, 1727, -1, -1, -1, 1145, 29, 1733, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 740, 811, -1, -1, 66, -1, 1771, -1, -1, -1, -1, 1190, 1659, -1, -1, -1, 826, 827, 828, 829, 830, -1, -1, -1, 834, 1204, 1205, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 781, -1, 783, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 810, 811, -1, 1838, -1, 26, 27, -1, -1, 30, 1845, -1, -1, 66, 824, 825, 826, 827, 828, 829, 830, -1, -1, -1, 834, -1, 1743, 115, 116, 117, 118, 119, 120, -1, -1, -1, 1285, -1, 126, 127, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 860, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 943, -1, -1, -1, 877, -1, -1, -1, -1, -1, -1, 162, 207, 164, -1, -1, -1, 890, -1, 892, 893, -1, -1, -1, -1, -1, 177, -1, 179, -1, -1, 182, -1, 906, 907, -1, -1, 1817, -1, -1, -1, -1, -1, 916, -1, -1, -1, -1, -1, 922, -1, -1, 1832, -1, -1, -1, -1, -1, -1, -1, -1, -1, 935, -1, -1, -1, -1, -1, -1, -1, 943, -1, -1, 946, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 201, -1, -1, -1, -1, -1, 964, -1, -1, -1, 968, -1, -1, -1, -1, -1, -1, 1045, -1, -1, -1, -1, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, -1, -1, -1, 1011, 1012, -1, 225, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1025, -1, -1, 1028, -1, 1030, -1, -1, 1103, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1045, -1, 1047, -1, -1, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, -1, -1, -1, -1, -1, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 1103, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, 54, -1, -1, 1133, -1, 1135, -1, 1207, -1, 66, -1, -1, -1, 354, -1, 1145, -1, -1, -1, -1, -1, -1, 363, 1223, -1, 1225, -1, -1, -1, 370, -1, -1, 1162, -1, -1, 1165, 377, -1, -1, -1, -1, 1241, -1, -1, -1, -1, -1, 388, -1, -1, -1, -1, -1, -1, -1, 1185, -1, -1, -1, -1, 1190, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1204, 1205, -1, 1207, -1, -1, -1, -1, -1, -1, -1, -1, 1216, -1, -1, -1, 1220, -1, -1, 1223, -1, 1225, -1, -1, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1241, -1, -1, -1, -1, -1, 29, 459, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, 204, -1, 1279, 1280, -1, 1282, -1, 66, 1285, -1, -1, -1, 500, -1, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 1372, -1, -1, -1, 1376, -1, 1378, -1, 29, 1381, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, 555, -1, -1, 66, 272, -1, 274, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1365, -1, 1367, -1, -1, -1, -1, 1372, 1373, -1, -1, 1376, -1, 1378, -1, -1, 1381, -1, -1, -1, -1, -1, -1, 1458, -1, 1390, 1391, -1, -1, 1394, -1, 607, -1, -1, -1, -1, 1401, -1, 78, -1, 329, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 204, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1443, -1, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 1458, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1468, 1469, -1, -1, 683, 1543, 1544, -1, 1476, -1, 1478, -1, 1550, -1, -1, 158, 159, 204, 161, 162, 163, 413, -1, -1, 416, -1, -1, 64, 65, -1, -1, -1, 1500, -1, 1502, -1, -1, -1, -1, -1, 1508, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 200, -1, -1, -1, 740, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1543, 1544, -1, -1, -1, -1, -1, 1550, -1, 1552, -1, 10, 11, 12, -1, 1558, -1, 1560, 130, 131, -1, -1, -1, -1, -1, -1, -1, 781, -1, 783, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 810, 811, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, 826, 827, 828, 829, 830, -1, -1, -1, 834, -1, -1, -1, 551, 552, -1, 1700, 555, 201, -1, -1, -1, -1, -1, -1, -1, -1, 1711, -1, -1, -1, -1, -1, 1717, -1, 860, -1, 1721, -1, -1, -1, -1, -1, -1, -1, 1659, -1, -1, -1, -1, -1, -1, 877, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1676, -1, -1, 890, -1, 892, 893, 607, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1694, -1, 907, -1, -1, -1, 1700, -1, -1, -1, -1, 916, -1, -1, -1, -1, -1, 1711, -1, 1783, -1, -1, -1, 1717, -1, -1, -1, 1721, -1, -1, -1, -1, -1, -1, -1, 653, 654, -1, 943, -1, -1, 946, -1, -1, 662, -1, 10, 11, 12, 1743, -1, -1, -1, -1, 204, -1, -1, -1, -1, -1, -1, -1, -1, 968, -1, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 1783, 54, -1, -1, -1, -1, -1, -1, -1, 1792, -1, -1, -1, 66, -1, -1, -1, 1011, 1012, -1, -1, -1, -1, -1, -1, 1808, -1, -1, -1, -1, -1, -1, -1, -1, 1817, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1832, -1, 1045, -1, 1047, -1, -1, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, -1, -1, -1, -1, -1, -1, -1, 811, -1, -1, -1, -1, 1103, 26, 27, -1, -1, 30, -1, -1, 824, 825, 826, 827, 828, 829, 830, -1, -1, -1, 834, -1, -1, -1, 10, 11, 12, 64, 65, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 202, 29, 1145, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, 1185, -1, -1, -1, -1, 1190, -1, -1, 906, 130, 131, -1, -1, -1, -1, -1, -1, -1, -1, 1204, 1205, -1, 1207, -1, 922, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 935, 1223, -1, 1225, -1, -1, -1, -1, 943, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, 1241, -1, -1, -1, -1, -1, -1, -1, -1, 29, 964, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, 1282, -1, -1, 1285, -1, 66, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 225, -1, -1, -1, -1, -1, -1, -1, -1, 1025, -1, -1, 1028, -1, 1030, -1, 204, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1045, -1, -1, -1, -1, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, -1, -1, -1, -1, -1, -1, -1, 1372, 1373, -1, -1, 1376, -1, 1378, 12, -1, 1381, -1, -1, -1, -1, -1, -1, -1, -1, 1103, 1391, -1, -1, 1394, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 1133, 54, 1135, -1, -1, 204, -1, -1, -1, -1, -1, -1, 354, 66, -1, -1, -1, -1, -1, -1, -1, 363, -1, 1443, -1, -1, -1, -1, 370, 1162, -1, -1, 1165, -1, -1, 377, -1, -1, 1458, -1, -1, -1, -1, -1, -1, -1, 388, -1, 1468, 1469, -1, -1, -1, -1, -1, -1, -1, -1, 1478, -1, -1, 29, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1207, -1, -1, -1, -1, -1, -1, -1, -1, 1216, -1, -1, -1, 1220, -1, -1, 1223, -1, 1225, -1, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, -1, 1241, -1, 78, -1, -1, -1, -1, -1, -1, 459, -1, 87, -1, -1, -1, 1543, 1544, -1, -1, -1, -1, -1, 1550, 99, 1552, -1, -1, -1, -1, -1, -1, -1, 1560, 10, 11, 12, 64, 65, 1279, 1280, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 500, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 152, 54, -1, 155, -1, -1, 158, 159, -1, 161, 162, 163, -1, 66, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 130, 131, -1, 555, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 1365, -1, 1367, -1, -1, -1, -1, 1372, -1, -1, -1, 1376, -1, 1378, -1, -1, 1381, -1, -1, -1, -1, -1, -1, -1, -1, 1390, -1, -1, -1, -1, -1, -1, -1, 607, -1, 555, 1401, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1700, 201, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1711, -1, -1, -1, -1, -1, 1717, -1, -1, -1, 1721, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 607, 54, -1, -1, -1, -1, 1458, -1, -1, -1, -1, -1, -1, 66, -1, -1, 204, -1, -1, -1, -1, -1, 683, -1, 1476, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 1783, 54, -1, -1, 1500, -1, 1502, -1, -1, 1792, -1, -1, 1508, 66, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1808, -1, -1, -1, -1, -1, -1, -1, -1, -1, 740, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1543, 1544, -1, -1, -1, -1, -1, 1550, -1, -1, -1, 10, 11, 12, -1, 1558, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 781, 29, 783, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, 810, 811, -1, -1, 10, 11, 12, -1, -1, 66, -1, -1, -1, -1, -1, -1, 826, 827, 828, 829, 830, -1, -1, 29, 834, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, 811, -1, -1, 1659, -1, 66, -1, 29, -1, -1, -1, -1, 877, -1, -1, 826, 827, 828, 829, -1, 1676, -1, -1, 834, -1, -1, -1, 892, 893, -1, -1, -1, -1, -1, 56, -1, -1, -1, 1694, -1, -1, -1, -1, -1, 1700, -1, -1, -1, -1, -1, -1, 916, -1, -1, -1, 1711, 78, -1, -1, -1, -1, 1717, -1, -1, -1, 1721, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, 943, -1, -1, -1, -1, -1, -1, 107, -1, 1743, -1, -1, -1, -1, 204, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 968, -1, -1, -1, -1, -1, -1, -1, -1, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1783, -1, -1, 152, -1, 943, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, 204, -1, -1, 1011, 1012, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, 1817, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 1832, -1, 200, -1, 1045, -1, 1047, -1, -1, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1103, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, -1, -1, -1, -1, -1, 10, 11, 12, -1, -1, -1, -1, -1, 1145, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 1103, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, 1185, -1, -1, -1, -1, 1190, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1204, 1205, -1, 1207, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1223, -1, 1225, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 1241, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 1207, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 1223, -1, 1225, -1, -1, -1, -1, -1, 1285, 10, 11, 12, -1, -1, -1, -1, -1, -1, 1241, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 204, -1, -1, -1, 3, 4, 5, 6, 7, -1, -1, 66, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, 35, -1, -1, -1, -1, 1372, 1373, -1, -1, 1376, -1, 1378, 47, 48, 1381, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, 1372, -1, -1, -1, 1376, 99, 1378, -1, -1, 1381, -1, -1, -1, 107, -1, -1, -1, 1443, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, 1458, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, 202, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, 1458, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, -1, 1543, 1544, -1, -1, -1, -1, -1, 1550, 10, 11, 12, -1, -1, -1, -1, -1, 1559, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, 1543, 1544, -1, -1, -1, -1, -1, 1550, -1, -1, 66, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, 1700, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, 1711, -1, -1, -1, -1, -1, 1717, -1, -1, -1, 1721, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 3, 4, 5, 6, 7, -1, 202, -1, 1745, -1, 13, -1, -1, -1, -1, -1, -1, 1700, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, 1711, -1, -1, -1, -1, -1, 1717, -1, -1, -1, 1721, -1, -1, -1, -1, 46, 47, 48, 1783, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 202, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, 1783, 104, 105, 106, 107, 108, 109, 110, 202, 112, 113, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, 125, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, 177, -1, 179, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, 108, 109, 110, -1, 112, 113, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, 125, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, 177, -1, 179, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, 108, 109, 110, -1, 112, 113, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, 125, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, 177, -1, 179, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, 91, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, 97, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, 95, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, 93, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, 204, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 46, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, 126, 127, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, 71, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, 82, 83, -1, -1, -1, 87, 88, 89, 90, -1, 92, -1, 94, -1, 96, -1, -1, 99, 100, -1, -1, -1, 104, 105, 106, 107, -1, 109, 110, -1, 112, -1, 114, 115, 116, 117, 118, 119, 120, -1, 122, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, 144, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, 165, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, 203, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, 165, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 28, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 10, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, 104, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, 192, 193, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 10, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, 189, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 202, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 10, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, 188, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, 201, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 30, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 35, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, -1, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 10, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, 187, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, 10, 11, 12, 205, 206, -1, 208, 209, 3, 4, 5, 6, 7, -1, -1, -1, -1, -1, 13, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 66, -1, 53, -1, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, -1, 67, 68, 69, 70, -1, -1, -1, -1, 75, 76, 77, 78, 79, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 107, -1, -1, -1, -1, -1, -1, -1, 115, 116, 117, 118, 119, 120, -1, -1, 123, 124, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, 170, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, -1, -1, 200, -1, -1, -1, -1, 205, 206, -1, 208, 209, 3, 4, -1, 6, 7, 11, 12, 10, 11, 12, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 27, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, 80, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, 126, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 3, 4, -1, 6, 7, -1, 152, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, 27, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, -1, -1, -1, -1, 203, -1, 205, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, 80, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, 126, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 3, 4, -1, 6, 7, -1, 152, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, 27, -1, 29, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, 56, -1, -1, -1, 203, -1, 205, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, -1, 127, 128, 129, 78, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, 152, -1, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 3, 4, 200, 6, 7, -1, 204, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, 27, -1, 29, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, 56, 200, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, -1, 127, 128, 129, 78, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, 152, -1, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 3, 4, 200, 6, 7, -1, 204, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, 27, -1, 29, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, 56, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, 126, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 152, -1, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 3, 4, 200, 6, 7, -1, -1, 10, 11, 12, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 29, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 54, -1, 56, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, -1, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 152, -1, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, -1, -1, -1, -1, -1, -1, 176, 177, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 3, 4, 200, 6, 7, -1, -1, 10, 11, 12, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 27, 29, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, 54, -1, 56, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, -1, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 78, -1, -1, -1, -1, 152, -1, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, 99, 169, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 200, 3, 4, 5, 6, 7, -1, -1, 10, 11, 12, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, 152, -1, -1, 155, 27, 28, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 54, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 68, 69, 70, 71, 72, 73, 74, 204, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 152, 153, 154, -1, -1, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, 167, -1, 169, -1, -1, -1, -1, -1, -1, 176, 177, -1, 179, -1, 181, 182, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 3, 4, -1, 6, 7, -1, 12, 10, 11, 12, 13, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 27, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, 126, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 3, 4, -1, 6, 7, -1, 152, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, 27, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, 126, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 3, 4, -1, 6, 7, -1, 152, 10, 11, 12, 13, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, 27, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 68, 69, 70, 71, 72, 73, 74, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, -1, -1, -1, -1, 127, 128, 129, -1, -1, -1, 133, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 152, -1, -1, -1, -1, -1, 158, 159, -1, 161, 162, 163, 164, -1, 166, -1, -1, 169, -1, -1, -1, -1, -1, -1, -1, -1, 10, 11, 12, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, 29, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 56, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 202, -1, -1, -1, -1, -1, -1, 29, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, 56, -1, -1, -1, -1, -1, -1, -1, -1, -1, 201, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, 29, -1, 152, -1, -1, 155, 156, 201, 158, 159, -1, 161, 162, 163, -1, 165, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 176, 56, -1, -1, 134, 135, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 196, 152, 78, 200, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, 165, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 200, -1, -1, -1, -1, -1, -1, -1, -1, 134, 135, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 78, 152, 80, -1, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, 176, -1, -1, -1, 30, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 47, 48, -1, 200, -1, -1, 53, -1, 55, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 67, -1, -1, -1, -1, -1, -1, -1, 75, 76, 77, 78, 156, -1, 158, 159, -1, 161, 162, 163, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, -1, -1, -1, 203, -1, 205, -1, -1, -1, -1, -1, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, 35, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 67, -1, -1, 200, -1, -1, -1, -1, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 120, -1, -1, -1, -1, -1, -1, 29, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, 78, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 99, -1, -1, 200, -1, -1, -1, -1, 205, -1, -1, -1, -1, -1, -1, -1, -1, -1, 47, 48, -1, -1, 121, -1, 53, -1, 55, -1, -1, -1, -1, -1, -1, -1, -1, 134, 135, -1, 67, -1, -1, -1, -1, -1, -1, -1, 75, 76, 77, 78, -1, -1, -1, 152, -1, -1, 155, 156, 87, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 75, 76, 77, 78, -1, -1, -1, 134, -1, 136, 137, 138, 139, 140, -1, -1, 78, -1, 80, -1, 147, -1, -1, -1, 99, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 99, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, 176, 47, 48, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 67, -1, -1, 200, -1, -1, -1, -1, 75, 76, 77, 78, -1, 158, 159, -1, 161, 162, 163, -1, 87, -1, -1, -1, 156, -1, 158, 159, -1, 161, 162, 163, 99, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, 134, -1, -1, -1, 203, -1, 205, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 176, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 67, -1, -1, -1, -1, -1, -1, -1, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 120, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 67, -1, 200, -1, -1, 203, -1, 205, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 120, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, 67, 200, 69, -1, -1, -1, 205, -1, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 120, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 67, -1, 200, -1, -1, -1, -1, 205, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 120, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 133, 134, -1, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 67, -1, 200, -1, -1, -1, -1, 205, 75, 76, 77, 78, -1, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 120, -1, -1, -1, -1, -1, -1, 78, -1, 80, 81, -1, -1, -1, 134, -1, 136, 137, 138, 139, 140, -1, -1, 78, -1, -1, -1, 147, 99, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 99, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 200, 75, 76, 77, 78, 205, 80, 158, 159, -1, 161, 162, 163, 87, -1, -1, -1, -1, -1, -1, 155, -1, -1, 158, 159, 99, 161, 162, 163, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 120, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 136, 137, 138, 139, 140, -1, 203, 78, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, 99, -1, -1, 167, -1, -1, -1, -1, 107, 108, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, -1, -1, 200, 75, 76, 77, 78, 205, 80, -1, -1, -1, -1, -1, -1, 87, -1, -1, -1, -1, -1, -1, 155, -1, -1, 158, 159, 99, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 120, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 136, 137, 138, 139, 140, -1, -1, -1, -1, -1, -1, 147, -1, -1, -1, -1, 152, 153, 154, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 167, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 181, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 10, 11, 12, 200, -1, -1, -1, -1, 205, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 78, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 10, 11, 12, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 29, 132, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, 78, -1, -1, -1, -1, 156, 132, 158, 159, 160, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 124, 78, -1, 200, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 78, -1, 132, -1, -1, -1, -1, 99, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 158, 159, 99, 161, 162, 163, -1, -1, -1, -1, 121, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 78, 134, 135, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 78, -1, 152, 200, 99, 155, 156, -1, 158, 159, -1, 161, 162, 163, -1, -1, 152, -1, -1, 155, 156, 99, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 156, -1, 158, 159, 78, 161, 162, 163, -1, -1, -1, -1, -1, -1, -1, -1, 155, -1, -1, 158, 159, 78, 161, 162, 163, 99, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 99, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 155, 54, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, -1, 66, -1, -1, -1, 155, -1, -1, 158, 159, -1, 161, 162, 163, -1, -1, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 10, 11, 12, -1, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, -1, 28, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 98, 54, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, -1, -1, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 10, 11, 12, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, -1, -1, -1, -1, -1, 29, -1, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, 54, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, 66 }; /* YYSTOS[STATE-NUM] -- The (internal number of the) accessing symbol of state STATE-NUM. */ static const yytype_uint16 yystos[] = { 0, 211, 212, 0, 213, 3, 4, 5, 6, 7, 13, 27, 28, 46, 47, 48, 53, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 75, 76, 77, 78, 79, 80, 82, 83, 87, 88, 89, 90, 92, 94, 96, 99, 100, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 122, 123, 124, 125, 126, 127, 133, 134, 136, 137, 138, 139, 140, 144, 147, 152, 153, 154, 155, 156, 158, 159, 161, 162, 163, 164, 167, 170, 176, 177, 179, 181, 182, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 200, 202, 203, 205, 206, 208, 209, 214, 217, 226, 227, 228, 229, 230, 231, 234, 250, 251, 255, 258, 263, 269, 329, 330, 338, 342, 343, 344, 345, 346, 347, 348, 349, 351, 354, 366, 367, 368, 370, 371, 373, 392, 402, 403, 404, 406, 411, 414, 433, 441, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 468, 470, 472, 118, 119, 120, 133, 152, 162, 200, 217, 250, 329, 348, 445, 348, 200, 348, 348, 348, 104, 348, 348, 431, 432, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 80, 87, 120, 147, 200, 227, 367, 403, 406, 411, 445, 448, 445, 35, 348, 459, 460, 348, 120, 200, 227, 403, 404, 405, 407, 411, 442, 443, 444, 452, 456, 457, 200, 339, 408, 200, 339, 355, 340, 348, 236, 339, 200, 200, 200, 339, 202, 348, 217, 202, 348, 3, 4, 6, 7, 10, 11, 12, 13, 27, 29, 54, 56, 68, 69, 70, 71, 72, 73, 74, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 126, 127, 128, 129, 133, 134, 135, 152, 156, 164, 166, 169, 176, 200, 217, 218, 219, 230, 473, 488, 489, 491, 183, 202, 345, 348, 372, 374, 203, 243, 348, 107, 108, 155, 220, 223, 226, 80, 205, 295, 296, 119, 126, 118, 126, 80, 297, 200, 200, 200, 200, 217, 267, 476, 200, 200, 340, 80, 86, 148, 149, 150, 465, 466, 155, 203, 226, 226, 217, 268, 476, 156, 200, 476, 476, 80, 197, 203, 357, 27, 338, 342, 348, 349, 445, 449, 232, 203, 454, 86, 409, 465, 86, 465, 465, 30, 155, 172, 477, 200, 9, 202, 35, 249, 156, 266, 476, 120, 182, 250, 330, 202, 202, 202, 202, 202, 202, 10, 11, 12, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 54, 66, 202, 67, 67, 202, 203, 151, 127, 162, 164, 177, 179, 269, 328, 329, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 64, 65, 130, 131, 435, 67, 203, 440, 200, 200, 67, 203, 200, 249, 250, 14, 348, 202, 132, 45, 217, 430, 86, 338, 349, 151, 445, 132, 207, 9, 416, 338, 349, 445, 477, 151, 200, 410, 435, 440, 201, 348, 30, 234, 8, 360, 9, 202, 234, 235, 340, 341, 348, 217, 281, 238, 202, 202, 202, 134, 135, 491, 491, 172, 200, 107, 491, 14, 151, 134, 135, 152, 217, 219, 80, 202, 202, 202, 183, 184, 185, 190, 191, 194, 195, 375, 376, 377, 378, 379, 380, 381, 382, 383, 387, 388, 389, 244, 111, 169, 202, 155, 221, 224, 226, 155, 222, 225, 226, 226, 9, 202, 98, 203, 445, 9, 202, 126, 126, 14, 9, 202, 445, 469, 340, 338, 349, 445, 448, 449, 201, 172, 261, 133, 445, 458, 459, 202, 67, 435, 148, 466, 79, 348, 445, 86, 148, 466, 226, 216, 202, 203, 256, 264, 393, 395, 87, 200, 361, 362, 364, 406, 451, 453, 470, 14, 98, 471, 356, 358, 359, 291, 292, 433, 434, 201, 201, 201, 201, 201, 204, 233, 234, 251, 258, 263, 433, 348, 206, 208, 209, 217, 478, 479, 491, 35, 165, 293, 294, 348, 473, 200, 476, 259, 249, 348, 348, 348, 30, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 407, 348, 348, 455, 455, 348, 461, 462, 126, 203, 218, 219, 454, 267, 217, 268, 476, 476, 266, 250, 35, 342, 345, 348, 372, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 348, 156, 203, 217, 436, 437, 438, 439, 454, 455, 348, 293, 293, 455, 348, 458, 249, 201, 348, 200, 429, 9, 416, 201, 201, 35, 348, 35, 348, 201, 201, 201, 452, 453, 454, 293, 203, 217, 436, 437, 454, 201, 232, 285, 203, 345, 348, 348, 90, 30, 234, 279, 202, 28, 98, 14, 9, 201, 30, 203, 282, 491, 29, 87, 230, 485, 486, 487, 200, 9, 47, 48, 53, 55, 67, 134, 156, 176, 200, 227, 228, 230, 369, 403, 411, 412, 413, 217, 490, 186, 80, 348, 80, 80, 348, 384, 385, 348, 348, 377, 387, 189, 390, 232, 200, 242, 226, 202, 9, 98, 226, 202, 9, 98, 98, 223, 217, 348, 296, 412, 80, 9, 201, 201, 201, 201, 201, 201, 201, 202, 47, 48, 483, 484, 128, 272, 200, 9, 201, 201, 80, 81, 217, 467, 217, 67, 204, 204, 213, 215, 30, 129, 271, 171, 51, 156, 171, 397, 349, 132, 9, 416, 201, 151, 491, 491, 14, 360, 291, 232, 198, 9, 417, 491, 492, 435, 440, 435, 204, 9, 416, 173, 445, 348, 201, 9, 417, 14, 352, 252, 128, 270, 200, 476, 348, 30, 207, 207, 132, 204, 9, 416, 348, 477, 200, 262, 257, 265, 14, 471, 260, 249, 69, 445, 348, 477, 207, 204, 201, 201, 207, 204, 201, 47, 48, 67, 75, 76, 77, 87, 134, 147, 176, 217, 419, 421, 422, 425, 428, 217, 445, 445, 132, 435, 440, 201, 348, 286, 72, 73, 287, 232, 339, 232, 341, 98, 35, 133, 276, 445, 412, 217, 30, 234, 280, 202, 283, 202, 283, 9, 173, 87, 132, 151, 9, 416, 201, 165, 478, 479, 480, 478, 412, 412, 412, 412, 412, 415, 418, 200, 151, 200, 412, 151, 203, 10, 11, 12, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 66, 151, 477, 348, 186, 186, 14, 192, 193, 386, 9, 196, 390, 80, 204, 403, 203, 246, 98, 224, 217, 98, 225, 217, 217, 204, 14, 445, 202, 9, 173, 217, 273, 403, 203, 458, 133, 445, 14, 207, 348, 204, 213, 491, 273, 203, 396, 14, 201, 348, 361, 454, 202, 491, 198, 204, 30, 481, 434, 35, 80, 165, 436, 437, 439, 436, 437, 491, 35, 165, 348, 412, 291, 200, 403, 271, 353, 253, 348, 348, 348, 204, 200, 293, 272, 30, 271, 491, 14, 270, 476, 407, 204, 200, 14, 75, 76, 77, 217, 420, 420, 422, 423, 424, 49, 200, 86, 148, 200, 9, 416, 201, 429, 35, 348, 204, 72, 73, 288, 339, 234, 204, 202, 91, 202, 276, 445, 200, 132, 275, 14, 232, 283, 101, 102, 103, 283, 204, 491, 132, 491, 217, 485, 9, 201, 416, 132, 207, 9, 416, 415, 218, 361, 363, 365, 201, 126, 218, 412, 463, 464, 412, 412, 412, 30, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 412, 490, 348, 348, 348, 385, 348, 375, 80, 247, 217, 217, 412, 484, 98, 99, 482, 9, 301, 201, 200, 342, 345, 348, 207, 204, 471, 301, 157, 170, 203, 392, 399, 157, 203, 398, 132, 202, 481, 491, 360, 492, 80, 165, 14, 80, 477, 445, 348, 201, 291, 203, 291, 200, 132, 200, 293, 201, 203, 491, 203, 202, 491, 271, 254, 410, 293, 132, 207, 9, 416, 421, 423, 148, 361, 426, 427, 422, 445, 339, 30, 74, 234, 202, 341, 275, 458, 276, 201, 412, 97, 101, 202, 348, 30, 202, 284, 204, 173, 491, 132, 165, 30, 201, 412, 412, 201, 132, 9, 416, 201, 132, 204, 9, 416, 412, 30, 187, 201, 232, 217, 491, 491, 403, 4, 108, 113, 119, 121, 158, 159, 161, 204, 302, 327, 328, 329, 334, 335, 336, 337, 433, 458, 204, 203, 204, 51, 348, 348, 348, 360, 35, 80, 165, 14, 80, 348, 200, 481, 201, 301, 201, 291, 348, 293, 201, 301, 471, 301, 202, 203, 200, 201, 422, 422, 201, 132, 201, 9, 416, 30, 232, 202, 201, 201, 201, 239, 202, 202, 284, 232, 491, 491, 132, 412, 361, 412, 412, 412, 348, 203, 204, 482, 128, 129, 177, 218, 474, 491, 274, 403, 108, 337, 29, 121, 134, 135, 156, 162, 311, 312, 313, 314, 403, 160, 319, 320, 124, 200, 217, 321, 322, 303, 250, 491, 9, 202, 9, 202, 202, 471, 328, 201, 298, 156, 394, 204, 204, 80, 165, 14, 80, 348, 293, 113, 350, 481, 204, 481, 201, 201, 204, 203, 204, 301, 291, 132, 422, 361, 232, 237, 240, 30, 234, 278, 232, 201, 412, 132, 132, 188, 232, 403, 403, 476, 14, 218, 9, 202, 203, 474, 471, 314, 172, 203, 9, 202, 3, 4, 5, 6, 7, 10, 11, 12, 13, 27, 28, 54, 68, 69, 70, 71, 72, 73, 74, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 133, 134, 136, 137, 138, 139, 140, 152, 153, 154, 164, 166, 167, 169, 176, 177, 179, 181, 182, 217, 400, 401, 9, 202, 156, 160, 217, 322, 323, 324, 202, 80, 333, 249, 304, 474, 474, 14, 250, 204, 299, 300, 474, 14, 80, 348, 201, 200, 203, 202, 203, 325, 350, 481, 298, 204, 201, 422, 132, 30, 234, 277, 278, 232, 412, 412, 348, 204, 202, 202, 412, 403, 307, 491, 315, 316, 411, 312, 14, 30, 48, 317, 320, 9, 33, 201, 29, 47, 50, 14, 9, 202, 219, 475, 333, 14, 491, 249, 202, 14, 348, 35, 80, 391, 232, 232, 203, 325, 204, 481, 422, 232, 95, 189, 245, 204, 217, 230, 308, 309, 310, 9, 173, 9, 416, 204, 412, 401, 401, 56, 318, 323, 323, 29, 47, 50, 412, 80, 172, 200, 202, 412, 476, 412, 80, 9, 417, 204, 204, 232, 325, 93, 202, 80, 111, 241, 151, 98, 491, 411, 163, 14, 483, 305, 200, 35, 80, 201, 204, 202, 200, 169, 248, 217, 328, 329, 173, 412, 173, 289, 290, 434, 306, 80, 403, 246, 166, 217, 202, 201, 9, 417, 115, 116, 117, 331, 332, 289, 80, 274, 202, 481, 434, 492, 201, 201, 202, 202, 203, 326, 331, 35, 80, 165, 481, 203, 232, 492, 80, 165, 14, 80, 326, 232, 204, 35, 80, 165, 14, 80, 348, 204, 80, 165, 14, 80, 348, 14, 80, 348, 348 }; #define yyerrok (yyerrstatus = 0) #define yyclearin (yychar = YYEMPTY) #define YYEMPTY (-2) #define YYEOF 0 #define YYACCEPT goto yyacceptlab #define YYABORT goto yyabortlab #define YYERROR goto yyerrorlab /* Like YYERROR except do call yyerror. This remains here temporarily to ease the transition to the new meaning of YYERROR, for GCC. Once GCC version 2 has supplanted version 1, this can go. */ #define YYFAIL goto yyerrlab #define YYRECOVERING() (!!yyerrstatus) #define YYBACKUP(Token, Value) \ do \ if (yychar == YYEMPTY && yylen == 1) \ { \ yychar = (Token); \ yylval = (Value); \ yytoken = YYTRANSLATE (yychar); \ YYPOPSTACK (1); \ goto yybackup; \ } \ else \ { \ yyerror (&yylloc, _p, YY_("syntax error: cannot back up")); \ YYERROR; \ } \ while (YYID (0)) #define YYTERROR 1 #define YYERRCODE 256 /* YYLLOC_DEFAULT -- Set CURRENT to span from RHS[1] to RHS[N]. If N is 0, then set CURRENT to the empty location which ends the previous symbol: RHS[0] (always defined). */ #define YYRHSLOC(Rhs, K) ((Rhs)[K]) #ifndef YYLLOC_DEFAULT # define YYLLOC_DEFAULT(Current, Rhs, N) \ do \ if (YYID (N)) \ { \ (Current).line0 = YYRHSLOC (Rhs, 1).line0; \ (Current).char0 = YYRHSLOC (Rhs, 1).char0; \ (Current).line1 = YYRHSLOC (Rhs, N).line1; \ (Current).char1 = YYRHSLOC (Rhs, N).char1; \ } \ else \ { \ (Current).line0 = (Current).line1 = \ YYRHSLOC (Rhs, 0).line1; \ (Current).char0 = (Current).char1 = \ YYRHSLOC (Rhs, 0).char1; \ } \ while (YYID (0)) #endif /* YY_LOCATION_PRINT -- Print the location on the stream. This macro was not mandated originally: define only if we know we won't break user code: when these are the locations we know. */ #ifndef YY_LOCATION_PRINT # if YYLTYPE_IS_TRIVIAL # define YY_LOCATION_PRINT(File, Loc) \ fprintf (File, "%d.%d-%d.%d", \ (Loc).line0, (Loc).char0, \ (Loc).line1, (Loc).char1) # else # define YY_LOCATION_PRINT(File, Loc) ((void) 0) # endif #endif /* YYLEX -- calling `yylex' with the right arguments. */ #ifdef YYLEX_PARAM # define YYLEX yylex (&yylval, &yylloc, YYLEX_PARAM) #else # define YYLEX yylex (&yylval, &yylloc, _p) #endif /* Enable debugging if requested. */ #if YYDEBUG # ifndef YYFPRINTF # include <stdio.h> /* INFRINGES ON USER NAME SPACE */ # define YYFPRINTF fprintf # endif # define YYDPRINTF(Args) \ do { \ if (yydebug) \ YYFPRINTF Args; \ } while (YYID (0)) # define YY_SYMBOL_PRINT(Title, Type, Value, Location) \ do { \ if (yydebug) \ { \ YYFPRINTF (stderr, "%s ", Title); \ yy_symbol_print (stderr, \ Type, Value, Location, _p); \ YYFPRINTF (stderr, "\n"); \ } \ } while (YYID (0)) /*--------------------------------. | Print this symbol on YYOUTPUT. | `--------------------------------*/ /*ARGSUSED*/ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static void yy_symbol_value_print (FILE *yyoutput, int yytype, YYSTYPE const * const yyvaluep, YYLTYPE const * const yylocationp, HPHP::HPHP_PARSER_NS::Parser *_p) #else static void yy_symbol_value_print (yyoutput, yytype, yyvaluep, yylocationp, _p) FILE *yyoutput; int yytype; YYSTYPE const * const yyvaluep; YYLTYPE const * const yylocationp; HPHP::HPHP_PARSER_NS::Parser *_p; #endif { if (!yyvaluep) return; YYUSE (yylocationp); YYUSE (_p); # ifdef YYPRINT if (yytype < YYNTOKENS) YYPRINT (yyoutput, yytoknum[yytype], *yyvaluep); # else YYUSE (yyoutput); # endif switch (yytype) { default: break; } } /*--------------------------------. | Print this symbol on YYOUTPUT. | `--------------------------------*/ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static void yy_symbol_print (FILE *yyoutput, int yytype, YYSTYPE const * const yyvaluep, YYLTYPE const * const yylocationp, HPHP::HPHP_PARSER_NS::Parser *_p) #else static void yy_symbol_print (yyoutput, yytype, yyvaluep, yylocationp, _p) FILE *yyoutput; int yytype; YYSTYPE const * const yyvaluep; YYLTYPE const * const yylocationp; HPHP::HPHP_PARSER_NS::Parser *_p; #endif { if (yytype < YYNTOKENS) YYFPRINTF (yyoutput, "token %s (", yytname[yytype]); else YYFPRINTF (yyoutput, "nterm %s (", yytname[yytype]); YY_LOCATION_PRINT (yyoutput, *yylocationp); YYFPRINTF (yyoutput, ": "); yy_symbol_value_print (yyoutput, yytype, yyvaluep, yylocationp, _p); YYFPRINTF (yyoutput, ")"); } /*------------------------------------------------------------------. | yy_stack_print -- Print the state stack from its BOTTOM up to its | | TOP (included). | `------------------------------------------------------------------*/ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static void yy_stack_print (yytype_int16 *yybottom, yytype_int16 *yytop) #else static void yy_stack_print (yybottom, yytop) yytype_int16 *yybottom; yytype_int16 *yytop; #endif { YYFPRINTF (stderr, "Stack now"); for (; yybottom <= yytop; yybottom++) { int yybot = *yybottom; YYFPRINTF (stderr, " %d", yybot); } YYFPRINTF (stderr, "\n"); } # define YY_STACK_PRINT(Bottom, Top) \ do { \ if (yydebug) \ yy_stack_print ((Bottom), (Top)); \ } while (YYID (0)) /*------------------------------------------------. | Report that the YYRULE is going to be reduced. | `------------------------------------------------*/ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static void yy_reduce_print (YYSTYPE *yyvsp, YYLTYPE *yylsp, int yyrule, HPHP::HPHP_PARSER_NS::Parser *_p) #else static void yy_reduce_print (yyvsp, yylsp, yyrule, _p) YYSTYPE *yyvsp; YYLTYPE *yylsp; int yyrule; HPHP::HPHP_PARSER_NS::Parser *_p; #endif { int yynrhs = yyr2[yyrule]; int yyi; unsigned long int yylno = yyrline[yyrule]; YYFPRINTF (stderr, "Reducing stack by rule %d (line %lu):\n", yyrule - 1, yylno); /* The symbols being reduced. */ for (yyi = 0; yyi < yynrhs; yyi++) { YYFPRINTF (stderr, " $%d = ", yyi + 1); yy_symbol_print (stderr, yyrhs[yyprhs[yyrule] + yyi], &(yyvsp[(yyi + 1) - (yynrhs)]) , &(yylsp[(yyi + 1) - (yynrhs)]) , _p); YYFPRINTF (stderr, "\n"); } } # define YY_REDUCE_PRINT(Rule) \ do { \ if (yydebug) \ yy_reduce_print (yyvsp, yylsp, Rule, _p); \ } while (YYID (0)) /* Nonzero means print parse trace. It is left uninitialized so that multiple parsers can coexist. */ int yydebug; #else /* !YYDEBUG */ # define YYDPRINTF(Args) # define YY_SYMBOL_PRINT(Title, Type, Value, Location) # define YY_STACK_PRINT(Bottom, Top) # define YY_REDUCE_PRINT(Rule) #endif /* !YYDEBUG */ /* YYINITDEPTH -- initial size of the parser's stacks. */ #ifndef YYINITDEPTH # define YYINITDEPTH 200 #endif /* YYMAXDEPTH -- maximum size the stacks can grow to (effective only if the built-in stack extension method is used). Do not make this value too large; the results are undefined if YYSTACK_ALLOC_MAXIMUM < YYSTACK_BYTES (YYMAXDEPTH) evaluated with infinite-precision integer arithmetic. */ #ifndef YYMAXDEPTH # define YYMAXDEPTH 10000 #endif #if YYERROR_VERBOSE # ifndef yystrlen # if defined __GLIBC__ && defined _STRING_H # define yystrlen strlen # else /* Return the length of YYSTR. */ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static YYSIZE_T yystrlen (const char *yystr) #else static YYSIZE_T yystrlen (yystr) const char *yystr; #endif { YYSIZE_T yylen; for (yylen = 0; yystr[yylen]; yylen++) continue; return yylen; } # endif # endif # ifndef yystpcpy # if defined __GLIBC__ && defined _STRING_H && defined _GNU_SOURCE # define yystpcpy stpcpy # else /* Copy YYSRC to YYDEST, returning the address of the terminating '\0' in YYDEST. */ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static char * yystpcpy (char *yydest, const char *yysrc) #else static char * yystpcpy (yydest, yysrc) char *yydest; const char *yysrc; #endif { char *yyd = yydest; const char *yys = yysrc; while ((*yyd++ = *yys++) != '\0') continue; return yyd - 1; } # endif # endif # ifndef yytnamerr /* Copy to YYRES the contents of YYSTR after stripping away unnecessary quotes and backslashes, so that it's suitable for yyerror. The heuristic is that double-quoting is unnecessary unless the string contains an apostrophe, a comma, or backslash (other than backslash-backslash). YYSTR is taken from yytname. If YYRES is null, do not copy; instead, return the length of what the result would have been. */ static YYSIZE_T yytnamerr (char *yyres, const char *yystr) { if (*yystr == '"') { YYSIZE_T yyn = 0; char const *yyp = yystr; for (;;) switch (*++yyp) { case '\'': case ',': goto do_not_strip_quotes; case '\\': if (*++yyp != '\\') goto do_not_strip_quotes; /* Fall through. */ default: if (yyres) yyres[yyn] = *yyp; yyn++; break; case '"': if (yyres) yyres[yyn] = '\0'; return yyn; } do_not_strip_quotes: ; } if (! yyres) return yystrlen (yystr); return yystpcpy (yyres, yystr) - yyres; } # endif /* Copy into YYRESULT an error message about the unexpected token YYCHAR while in state YYSTATE. Return the number of bytes copied, including the terminating null byte. If YYRESULT is null, do not copy anything; just return the number of bytes that would be copied. As a special case, return 0 if an ordinary "syntax error" message will do. Return YYSIZE_MAXIMUM if overflow occurs during size calculation. */ static YYSIZE_T yysyntax_error (char *yyresult, int yystate, int yychar) { int yyn = yypact[yystate]; if (! (YYPACT_NINF < yyn && yyn <= YYLAST)) return 0; else { int yytype = YYTRANSLATE (yychar); YYSIZE_T yysize0 = yytnamerr (0, yytname[yytype]); YYSIZE_T yysize = yysize0; YYSIZE_T yysize1; int yysize_overflow = 0; enum { YYERROR_VERBOSE_ARGS_MAXIMUM = 5 }; char const *yyarg[YYERROR_VERBOSE_ARGS_MAXIMUM]; int yyx; # if 0 /* This is so xgettext sees the translatable formats that are constructed on the fly. */ YY_("syntax error, unexpected %s"); YY_("syntax error, unexpected %s, expecting %s"); YY_("syntax error, unexpected %s, expecting %s or %s"); YY_("syntax error, unexpected %s, expecting %s or %s or %s"); YY_("syntax error, unexpected %s, expecting %s or %s or %s or %s"); # endif char *yyfmt; char const *yyf; static char const yyunexpected[] = "syntax error, unexpected %s"; static char const yyexpecting[] = ", expecting %s"; static char const yyor[] = " or %s"; char yyformat[sizeof yyunexpected + sizeof yyexpecting - 1 + ((YYERROR_VERBOSE_ARGS_MAXIMUM - 2) * (sizeof yyor - 1))]; char const *yyprefix = yyexpecting; /* Start YYX at -YYN if negative to avoid negative indexes in YYCHECK. */ int yyxbegin = yyn < 0 ? -yyn : 0; /* Stay within bounds of both yycheck and yytname. */ int yychecklim = YYLAST - yyn + 1; int yyxend = yychecklim < YYNTOKENS ? yychecklim : YYNTOKENS; int yycount = 1; yyarg[0] = yytname[yytype]; yyfmt = yystpcpy (yyformat, yyunexpected); for (yyx = yyxbegin; yyx < yyxend; ++yyx) if (yycheck[yyx + yyn] == yyx && yyx != YYTERROR) { if (yycount == YYERROR_VERBOSE_ARGS_MAXIMUM) { yycount = 1; yysize = yysize0; yyformat[sizeof yyunexpected - 1] = '\0'; break; } yyarg[yycount++] = yytname[yyx]; yysize1 = yysize + yytnamerr (0, yytname[yyx]); yysize_overflow |= (yysize1 < yysize); yysize = yysize1; yyfmt = yystpcpy (yyfmt, yyprefix); yyprefix = yyor; } yyf = YY_(yyformat); yysize1 = yysize + yystrlen (yyf); yysize_overflow |= (yysize1 < yysize); yysize = yysize1; if (yysize_overflow) return YYSIZE_MAXIMUM; if (yyresult) { /* Avoid sprintf, as that infringes on the user's name space. Don't have undefined behavior even if the translation produced a string with the wrong number of "%s"s. */ char *yyp = yyresult; int yyi = 0; while ((*yyp = *yyf) != '\0') { if (*yyp == '%' && yyf[1] == 's' && yyi < yycount) { yyp += yytnamerr (yyp, yyarg[yyi++]); yyf += 2; } else { yyp++; yyf++; } } } return yysize; } } #endif /* YYERROR_VERBOSE */ /*-----------------------------------------------. | Release the memory associated to this symbol. | `-----------------------------------------------*/ /*ARGSUSED*/ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) static void yydestruct (const char *yymsg, int yytype, YYSTYPE *yyvaluep, YYLTYPE *yylocationp, HPHP::HPHP_PARSER_NS::Parser *_p) #else static void yydestruct (yymsg, yytype, yyvaluep, yylocationp, _p) const char *yymsg; int yytype; YYSTYPE *yyvaluep; YYLTYPE *yylocationp; HPHP::HPHP_PARSER_NS::Parser *_p; #endif { YYUSE (yyvaluep); YYUSE (yylocationp); YYUSE (_p); if (!yymsg) yymsg = "Deleting"; YY_SYMBOL_PRINT (yymsg, yytype, yyvaluep, yylocationp); switch (yytype) { default: break; } } /* Prevent warnings from -Wmissing-prototypes. */ #ifdef YYPARSE_PARAM #if defined __STDC__ || defined __cplusplus int yyparse (void *YYPARSE_PARAM); #else int yyparse (); #endif #else /* ! YYPARSE_PARAM */ #if defined __STDC__ || defined __cplusplus int yyparse (HPHP::HPHP_PARSER_NS::Parser *_p); #else int yyparse (); #endif #endif /* ! YYPARSE_PARAM */ /*-------------------------. | yyparse or yypush_parse. | `-------------------------*/ #ifdef YYPARSE_PARAM #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) int yyparse (void *YYPARSE_PARAM) #else int yyparse (YYPARSE_PARAM) void *YYPARSE_PARAM; #endif #else /* ! YYPARSE_PARAM */ #if (defined __STDC__ || defined __C99__FUNC__ \ || defined __cplusplus || defined _MSC_VER) int yyparse (HPHP::HPHP_PARSER_NS::Parser *_p) #else int yyparse (_p) HPHP::HPHP_PARSER_NS::Parser *_p; #endif #endif { /* The lookahead symbol. */ int yychar; /* The semantic value of the lookahead symbol. */ YYSTYPE yylval; /* Location data for the lookahead symbol. */ YYLTYPE yylloc; /* Number of syntax errors so far. */ int yynerrs; int yystate; /* Number of tokens to shift before error messages enabled. */ int yyerrstatus; /* The stacks and their tools: `yyss': related to states. `yyvs': related to semantic values. `yyls': related to locations. Refer to the stacks thru separate pointers, to allow yyoverflow to reallocate them elsewhere. */ /* The state stack. */ yytype_int16 yyssa[YYINITDEPTH]; yytype_int16 *yyss; yytype_int16 *yyssp; /* The semantic value stack. */ YYSTYPE yyvsa[YYINITDEPTH]; YYSTYPE *yyvs; YYSTYPE *yyvsp; /* The location stack. */ YYLTYPE yylsa[YYINITDEPTH]; YYLTYPE *yyls; YYLTYPE *yylsp; /* The locations where the error started and ended. */ YYLTYPE yyerror_range[2]; YYSIZE_T yystacksize; int yyn; int yyresult; /* Lookahead token as an internal (translated) token number. */ int yytoken; /* The variables used to return semantic value and location from the action routines. */ YYSTYPE yyval; YYLTYPE yyloc; #if YYERROR_VERBOSE /* Buffer for error messages, and its allocated size. */ char yymsgbuf[128]; char *yymsg = yymsgbuf; YYSIZE_T yymsg_alloc = sizeof yymsgbuf; #endif #define YYPOPSTACK(N) (yyvsp -= (N), yyssp -= (N), yylsp -= (N)) /* The number of symbols on the RHS of the reduced rule. Keep to zero when no symbol should be popped. */ int yylen = 0; yytoken = 0; yyss = yyssa; yyvs = yyvsa; yyls = yylsa; yystacksize = YYINITDEPTH; YYDPRINTF ((stderr, "Starting parse\n")); yystate = 0; yyerrstatus = 0; yynerrs = 0; yychar = YYEMPTY; /* Cause a token to be read. */ /* Initialize stack pointers. Waste one element of value and location stack so that they stay on the same level as the state stack. The wasted elements are never initialized. */ yyssp = yyss; yyvsp = yyvs; yylsp = yyls; #if YYLTYPE_IS_TRIVIAL /* Initialize the default location before parsing starts. */ yylloc.line0 = yylloc.line1 = 1; yylloc.char0 = yylloc.char1 = 1; #endif goto yysetstate; /*------------------------------------------------------------. | yynewstate -- Push a new state, which is found in yystate. | `------------------------------------------------------------*/ yynewstate: /* In all cases, when you get here, the value and location stacks have just been pushed. So pushing a state here evens the stacks. */ yyssp++; yysetstate: *yyssp = yystate; if (yyss + yystacksize - 1 <= yyssp) { /* Get the current used size of the three stacks, in elements. */ YYSIZE_T yysize = yyssp - yyss + 1; #ifdef yyoverflow { /* Give user a chance to reallocate the stack. Use copies of these so that the &'s don't force the real ones into memory. */ YYSTYPE *yyvs1 = yyvs; yytype_int16 *yyss1 = yyss; YYLTYPE *yyls1 = yyls; /* Each stack pointer address is followed by the size of the data in use in that stack, in bytes. This used to be a conditional around just the two extra args, but that might be undefined if yyoverflow is a macro. */ yyoverflow (YY_("memory exhausted"), &yyss1, yysize * sizeof (*yyssp), &yyvs1, yysize * sizeof (*yyvsp), &yyls1, yysize * sizeof (*yylsp), &yystacksize); yyls = yyls1; yyss = yyss1; yyvs = yyvs1; } #else /* no yyoverflow */ # ifndef YYSTACK_RELOCATE goto yyexhaustedlab; # else /* Extend the stack our own way. */ if (YYMAXDEPTH <= yystacksize) goto yyexhaustedlab; yystacksize *= 2; if (YYMAXDEPTH < yystacksize) yystacksize = YYMAXDEPTH; { yytype_int16 *yyss1 = yyss; struct yyalloc *yyptr = (struct yyalloc *) YYSTACK_ALLOC (YYSTACK_BYTES (yystacksize)); memset(yyptr, 0, YYSTACK_BYTES (yystacksize)); if (! yyptr) goto yyexhaustedlab; YYSTACK_RELOCATE (yyss_alloc, yyss); YYSTACK_RELOCATE_RESET (yyvs_alloc, yyvs); YYSTACK_RELOCATE (yyls_alloc, yyls); # undef YYSTACK_RELOCATE if (yyss1 != yyssa) YYSTACK_FREE (yyss1); } # endif #endif /* no yyoverflow */ yyssp = yyss + yysize - 1; yyvsp = yyvs + yysize - 1; yylsp = yyls + yysize - 1; YYDPRINTF ((stderr, "Stack size increased to %lu\n", (unsigned long int) yystacksize)); if (yyss + yystacksize - 1 <= yyssp) YYABORT; } YYDPRINTF ((stderr, "Entering state %d\n", yystate)); if (yystate == YYFINAL) YYACCEPT; goto yybackup; /*-----------. | yybackup. | `-----------*/ yybackup: /* Do appropriate processing given the current state. Read a lookahead token if we need one and don't already have one. */ /* First try to decide what to do without reference to lookahead token. */ yyn = yypact[yystate]; if (yyn == YYPACT_NINF) goto yydefault; /* Not known => get a lookahead token if don't already have one. */ /* YYCHAR is either YYEMPTY or YYEOF or a valid lookahead symbol. */ if (yychar == YYEMPTY) { YYDPRINTF ((stderr, "Reading a token: ")); yychar = YYLEX; } if (yychar <= YYEOF) { yychar = yytoken = YYEOF; YYDPRINTF ((stderr, "Now at end of input.\n")); } else { yytoken = YYTRANSLATE (yychar); YY_SYMBOL_PRINT ("Next token is", yytoken, &yylval, &yylloc); } /* If the proper action on seeing token YYTOKEN is to reduce or to detect an error, take that action. */ yyn += yytoken; if (yyn < 0 || YYLAST < yyn || yycheck[yyn] != yytoken) goto yydefault; yyn = yytable[yyn]; if (yyn <= 0) { if (yyn == 0 || yyn == YYTABLE_NINF) goto yyerrlab; yyn = -yyn; goto yyreduce; } /* Count tokens shifted since error; after three, turn off error status. */ if (yyerrstatus) yyerrstatus--; /* Shift the lookahead token. */ YY_SYMBOL_PRINT ("Shifting", yytoken, &yylval, &yylloc); /* Discard the shifted token. */ yychar = YYEMPTY; yystate = yyn; *++yyvsp = yylval; *++yylsp = yylloc; goto yynewstate; /*-----------------------------------------------------------. | yydefault -- do the default action for the current state. | `-----------------------------------------------------------*/ yydefault: yyn = yydefact[yystate]; if (yyn == 0) goto yyerrlab; goto yyreduce; /*-----------------------------. | yyreduce -- Do a reduction. | `-----------------------------*/ yyreduce: /* yyn is the number of a rule to reduce with. */ yylen = yyr2[yyn]; /* If YYLEN is nonzero, implement the default value of the action: `$$ = $1'. Otherwise, the following line sets YYVAL to garbage. This behavior is undocumented and Bison users should not rely upon it. Assigning to YYVAL unconditionally makes the parser a bit smaller, and it avoids a GCC warning that YYVAL may be used uninitialized. */ yyval = yyvsp[1-yylen]; /* Default location. */ YYLLOC_DEFAULT (yyloc, (yylsp - yylen), yylen); YY_REDUCE_PRINT (yyn); switch (yyn) { case 2: /* Line 1455 of yacc.c */ #line 740 "hphp.y" { _p->onNewLabelScope(true); _p->initParseTree();;} break; case 3: /* Line 1455 of yacc.c */ #line 743 "hphp.y" { _p->popLabelInfo(); _p->finiParseTree(); _p->onCompleteLabelScope(true);;} break; case 4: /* Line 1455 of yacc.c */ #line 750 "hphp.y" { _p->addTopStatement((yyvsp[(2) - (2)]));;} break; case 5: /* Line 1455 of yacc.c */ #line 751 "hphp.y" { ;} break; case 6: /* Line 1455 of yacc.c */ #line 754 "hphp.y" { _p->nns((yyvsp[(1) - (1)]).num(), (yyvsp[(1) - (1)]).text()); (yyval) = (yyvsp[(1) - (1)]);;} break; case 7: /* Line 1455 of yacc.c */ #line 755 "hphp.y" { _p->nns(); (yyval) = (yyvsp[(1) - (1)]);;} break; case 8: /* Line 1455 of yacc.c */ #line 756 "hphp.y" { _p->nns(); (yyval) = (yyvsp[(1) - (1)]);;} break; case 9: /* Line 1455 of yacc.c */ #line 757 "hphp.y" { _p->nns(); (yyval) = (yyvsp[(1) - (1)]);;} break; case 10: /* Line 1455 of yacc.c */ #line 758 "hphp.y" { _p->nns(); (yyval) = (yyvsp[(1) - (1)]);;} break; case 11: /* Line 1455 of yacc.c */ #line 759 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 12: /* Line 1455 of yacc.c */ #line 760 "hphp.y" { _p->onHaltCompiler(); _p->finiParseTree(); YYACCEPT;;} break; case 13: /* Line 1455 of yacc.c */ #line 763 "hphp.y" { _p->onNamespaceStart((yyvsp[(2) - (3)]).text(), true); (yyval).reset();;} break; case 14: /* Line 1455 of yacc.c */ #line 765 "hphp.y" { _p->onNamespaceStart((yyvsp[(2) - (3)]).text());;} break; case 15: /* Line 1455 of yacc.c */ #line 766 "hphp.y" { _p->onNamespaceEnd(); (yyval) = (yyvsp[(5) - (6)]);;} break; case 16: /* Line 1455 of yacc.c */ #line 767 "hphp.y" { _p->onNamespaceStart("");;} break; case 17: /* Line 1455 of yacc.c */ #line 768 "hphp.y" { _p->onNamespaceEnd(); (yyval) = (yyvsp[(4) - (5)]);;} break; case 18: /* Line 1455 of yacc.c */ #line 769 "hphp.y" { _p->nns(); (yyval).reset();;} break; case 19: /* Line 1455 of yacc.c */ #line 771 "hphp.y" { _p->nns(); (yyval).reset();;} break; case 20: /* Line 1455 of yacc.c */ #line 773 "hphp.y" { _p->nns(); (yyval).reset();;} break; case 21: /* Line 1455 of yacc.c */ #line 774 "hphp.y" { _p->nns(); _p->finishStatement((yyval), (yyvsp[(1) - (2)])); (yyval) = 1;;} break; case 22: /* Line 1455 of yacc.c */ #line 779 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 23: /* Line 1455 of yacc.c */ #line 780 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 24: /* Line 1455 of yacc.c */ #line 781 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 25: /* Line 1455 of yacc.c */ #line 782 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 26: /* Line 1455 of yacc.c */ #line 783 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 27: /* Line 1455 of yacc.c */ #line 784 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 28: /* Line 1455 of yacc.c */ #line 785 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 29: /* Line 1455 of yacc.c */ #line 786 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 30: /* Line 1455 of yacc.c */ #line 787 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 31: /* Line 1455 of yacc.c */ #line 788 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 32: /* Line 1455 of yacc.c */ #line 789 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 33: /* Line 1455 of yacc.c */ #line 790 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 34: /* Line 1455 of yacc.c */ #line 791 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 35: /* Line 1455 of yacc.c */ #line 792 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 36: /* Line 1455 of yacc.c */ #line 793 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 37: /* Line 1455 of yacc.c */ #line 794 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 38: /* Line 1455 of yacc.c */ #line 795 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 39: /* Line 1455 of yacc.c */ #line 796 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 40: /* Line 1455 of yacc.c */ #line 797 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 41: /* Line 1455 of yacc.c */ #line 798 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 106: /* Line 1455 of yacc.c */ #line 876 "hphp.y" { ;} break; case 107: /* Line 1455 of yacc.c */ #line 877 "hphp.y" { ;} break; case 108: /* Line 1455 of yacc.c */ #line 882 "hphp.y" { ;} break; case 109: /* Line 1455 of yacc.c */ #line 883 "hphp.y" { ;} break; case 110: /* Line 1455 of yacc.c */ #line 888 "hphp.y" { ;} break; case 111: /* Line 1455 of yacc.c */ #line 889 "hphp.y" { ;} break; case 112: /* Line 1455 of yacc.c */ #line 893 "hphp.y" { _p->onUse((yyvsp[(1) - (1)]).text(),"");;} break; case 113: /* Line 1455 of yacc.c */ #line 894 "hphp.y" { _p->onUse((yyvsp[(2) - (2)]).text(),"");;} break; case 114: /* Line 1455 of yacc.c */ #line 895 "hphp.y" { _p->onUse((yyvsp[(1) - (3)]).text(),(yyvsp[(3) - (3)]).text());;} break; case 115: /* Line 1455 of yacc.c */ #line 897 "hphp.y" { _p->onUse((yyvsp[(2) - (4)]).text(),(yyvsp[(4) - (4)]).text());;} break; case 116: /* Line 1455 of yacc.c */ #line 901 "hphp.y" { _p->onUseFunction((yyvsp[(1) - (1)]).text(),"");;} break; case 117: /* Line 1455 of yacc.c */ #line 902 "hphp.y" { _p->onUseFunction((yyvsp[(2) - (2)]).text(),"");;} break; case 118: /* Line 1455 of yacc.c */ #line 903 "hphp.y" { _p->onUseFunction((yyvsp[(1) - (3)]).text(),(yyvsp[(3) - (3)]).text());;} break; case 119: /* Line 1455 of yacc.c */ #line 905 "hphp.y" { _p->onUseFunction((yyvsp[(2) - (4)]).text(),(yyvsp[(4) - (4)]).text());;} break; case 120: /* Line 1455 of yacc.c */ #line 909 "hphp.y" { _p->onUseConst((yyvsp[(1) - (1)]).text(),"");;} break; case 121: /* Line 1455 of yacc.c */ #line 910 "hphp.y" { _p->onUseConst((yyvsp[(2) - (2)]).text(),"");;} break; case 122: /* Line 1455 of yacc.c */ #line 911 "hphp.y" { _p->onUseConst((yyvsp[(1) - (3)]).text(),(yyvsp[(3) - (3)]).text());;} break; case 123: /* Line 1455 of yacc.c */ #line 913 "hphp.y" { _p->onUseConst((yyvsp[(2) - (4)]).text(),(yyvsp[(4) - (4)]).text());;} break; case 124: /* Line 1455 of yacc.c */ #line 917 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 125: /* Line 1455 of yacc.c */ #line 919 "hphp.y" { (yyval) = (yyvsp[(1) - (3)]) + (yyvsp[(2) - (3)]) + (yyvsp[(3) - (3)]); (yyval) = (yyvsp[(1) - (3)]).num() | 2;;} break; case 126: /* Line 1455 of yacc.c */ #line 922 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = (yyval).num() | 1;;} break; case 127: /* Line 1455 of yacc.c */ #line 924 "hphp.y" { (yyval).set((yyvsp[(3) - (3)]).num() | 2, _p->nsDecl((yyvsp[(3) - (3)]).text()));;} break; case 128: /* Line 1455 of yacc.c */ #line 925 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]); (yyval) = (yyval).num() | 2;;} break; case 129: /* Line 1455 of yacc.c */ #line 928 "hphp.y" { if ((yyvsp[(1) - (1)]).num() & 1) { (yyvsp[(1) - (1)]).setText(_p->resolve((yyvsp[(1) - (1)]).text(),0)); } (yyval) = (yyvsp[(1) - (1)]);;} break; case 130: /* Line 1455 of yacc.c */ #line 935 "hphp.y" { if ((yyvsp[(1) - (2)]).num() & 1) { (yyvsp[(1) - (2)]).setText(_p->resolve((yyvsp[(1) - (2)]).text(),0)); } (yyval) = (yyvsp[(1) - (2)]);;} break; case 131: /* Line 1455 of yacc.c */ #line 942 "hphp.y" { if ((yyvsp[(1) - (2)]).num() & 1) { (yyvsp[(1) - (2)]).setText(_p->resolve((yyvsp[(1) - (2)]).text(),1)); } _p->onTypeAnnotation((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 132: /* Line 1455 of yacc.c */ #line 950 "hphp.y" { (yyvsp[(3) - (5)]).setText(_p->nsDecl((yyvsp[(3) - (5)]).text())); _p->onConst((yyval),(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 133: /* Line 1455 of yacc.c */ #line 953 "hphp.y" { (yyvsp[(2) - (4)]).setText(_p->nsDecl((yyvsp[(2) - (4)]).text())); _p->onConst((yyval),(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)]));;} break; case 134: /* Line 1455 of yacc.c */ #line 959 "hphp.y" { _p->addStatement((yyval),(yyvsp[(1) - (2)]),(yyvsp[(2) - (2)]));;} break; case 135: /* Line 1455 of yacc.c */ #line 960 "hphp.y" { _p->onStatementListStart((yyval));;} break; case 136: /* Line 1455 of yacc.c */ #line 963 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 137: /* Line 1455 of yacc.c */ #line 964 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 138: /* Line 1455 of yacc.c */ #line 965 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 139: /* Line 1455 of yacc.c */ #line 966 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 140: /* Line 1455 of yacc.c */ #line 969 "hphp.y" { _p->onBlock((yyval), (yyvsp[(2) - (3)]));;} break; case 141: /* Line 1455 of yacc.c */ #line 973 "hphp.y" { _p->onIf((yyval),(yyvsp[(2) - (5)]),(yyvsp[(3) - (5)]),(yyvsp[(4) - (5)]),(yyvsp[(5) - (5)]));;} break; case 142: /* Line 1455 of yacc.c */ #line 978 "hphp.y" { _p->onIf((yyval),(yyvsp[(2) - (8)]),(yyvsp[(4) - (8)]),(yyvsp[(5) - (8)]),(yyvsp[(6) - (8)]));;} break; case 143: /* Line 1455 of yacc.c */ #line 979 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 144: /* Line 1455 of yacc.c */ #line 981 "hphp.y" { _p->popLabelScope(); _p->onWhile((yyval),(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)])); _p->onCompleteLabelScope(false);;} break; case 145: /* Line 1455 of yacc.c */ #line 985 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 146: /* Line 1455 of yacc.c */ #line 988 "hphp.y" { _p->popLabelScope(); _p->onDo((yyval),(yyvsp[(3) - (6)]),(yyvsp[(5) - (6)])); _p->onCompleteLabelScope(false);;} break; case 147: /* Line 1455 of yacc.c */ #line 992 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 148: /* Line 1455 of yacc.c */ #line 994 "hphp.y" { _p->popLabelScope(); _p->onFor((yyval),(yyvsp[(3) - (10)]),(yyvsp[(5) - (10)]),(yyvsp[(7) - (10)]),(yyvsp[(10) - (10)])); _p->onCompleteLabelScope(false);;} break; case 149: /* Line 1455 of yacc.c */ #line 997 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 150: /* Line 1455 of yacc.c */ #line 999 "hphp.y" { _p->popLabelScope(); _p->onSwitch((yyval),(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)])); _p->onCompleteLabelScope(false);;} break; case 151: /* Line 1455 of yacc.c */ #line 1002 "hphp.y" { _p->onBreakContinue((yyval), true, NULL);;} break; case 152: /* Line 1455 of yacc.c */ #line 1003 "hphp.y" { _p->onBreakContinue((yyval), true, &(yyvsp[(2) - (3)]));;} break; case 153: /* Line 1455 of yacc.c */ #line 1004 "hphp.y" { _p->onBreakContinue((yyval), false, NULL);;} break; case 154: /* Line 1455 of yacc.c */ #line 1005 "hphp.y" { _p->onBreakContinue((yyval), false, &(yyvsp[(2) - (3)]));;} break; case 155: /* Line 1455 of yacc.c */ #line 1006 "hphp.y" { _p->onReturn((yyval), NULL);;} break; case 156: /* Line 1455 of yacc.c */ #line 1007 "hphp.y" { _p->onReturn((yyval), &(yyvsp[(2) - (3)]));;} break; case 157: /* Line 1455 of yacc.c */ #line 1008 "hphp.y" { _p->onYieldBreak((yyval));;} break; case 158: /* Line 1455 of yacc.c */ #line 1009 "hphp.y" { _p->onGlobal((yyval), (yyvsp[(2) - (3)]));;} break; case 159: /* Line 1455 of yacc.c */ #line 1010 "hphp.y" { _p->onStatic((yyval), (yyvsp[(2) - (3)]));;} break; case 160: /* Line 1455 of yacc.c */ #line 1011 "hphp.y" { _p->onEcho((yyval), (yyvsp[(2) - (3)]), 0);;} break; case 161: /* Line 1455 of yacc.c */ #line 1012 "hphp.y" { _p->onEcho((yyval), (yyvsp[(2) - (3)]), 0);;} break; case 162: /* Line 1455 of yacc.c */ #line 1013 "hphp.y" { _p->onUnset((yyval), (yyvsp[(3) - (5)]));;} break; case 163: /* Line 1455 of yacc.c */ #line 1014 "hphp.y" { (yyval).reset(); (yyval) = ';';;} break; case 164: /* Line 1455 of yacc.c */ #line 1015 "hphp.y" { _p->onEcho((yyval), (yyvsp[(1) - (1)]), 1);;} break; case 165: /* Line 1455 of yacc.c */ #line 1016 "hphp.y" { _p->onHashBang((yyval), (yyvsp[(1) - (1)])); (yyval) = T_HASHBANG;;} break; case 166: /* Line 1455 of yacc.c */ #line 1020 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 167: /* Line 1455 of yacc.c */ #line 1022 "hphp.y" { _p->popLabelScope(); _p->onForEach((yyval),(yyvsp[(3) - (9)]),(yyvsp[(5) - (9)]),(yyvsp[(6) - (9)]),(yyvsp[(9) - (9)]), false); _p->onCompleteLabelScope(false);;} break; case 168: /* Line 1455 of yacc.c */ #line 1027 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 169: /* Line 1455 of yacc.c */ #line 1029 "hphp.y" { _p->popLabelScope(); _p->onForEach((yyval),(yyvsp[(3) - (10)]),(yyvsp[(6) - (10)]),(yyvsp[(7) - (10)]),(yyvsp[(10) - (10)]), true); _p->onCompleteLabelScope(false);;} break; case 170: /* Line 1455 of yacc.c */ #line 1033 "hphp.y" { _p->onBlock((yyval), (yyvsp[(5) - (5)])); (yyval) = T_DECLARE;;} break; case 171: /* Line 1455 of yacc.c */ #line 1040 "hphp.y" { _p->onCompleteLabelScope(false);;} break; case 172: /* Line 1455 of yacc.c */ #line 1041 "hphp.y" { _p->onTry((yyval),(yyvsp[(2) - (13)]),(yyvsp[(5) - (13)]),(yyvsp[(6) - (13)]),(yyvsp[(9) - (13)]),(yyvsp[(11) - (13)]),(yyvsp[(13) - (13)]));;} break; case 173: /* Line 1455 of yacc.c */ #line 1044 "hphp.y" { _p->onCompleteLabelScope(false);;} break; case 174: /* Line 1455 of yacc.c */ #line 1045 "hphp.y" { _p->onTry((yyval), (yyvsp[(2) - (5)]), (yyvsp[(5) - (5)]));;} break; case 175: /* Line 1455 of yacc.c */ #line 1046 "hphp.y" { _p->onThrow((yyval), (yyvsp[(2) - (3)]));;} break; case 176: /* Line 1455 of yacc.c */ #line 1047 "hphp.y" { _p->onGoto((yyval), (yyvsp[(2) - (3)]), true); _p->addGoto((yyvsp[(2) - (3)]).text(), _p->getRange(), &(yyval));;} break; case 177: /* Line 1455 of yacc.c */ #line 1051 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 178: /* Line 1455 of yacc.c */ #line 1052 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 179: /* Line 1455 of yacc.c */ #line 1053 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 180: /* Line 1455 of yacc.c */ #line 1054 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 181: /* Line 1455 of yacc.c */ #line 1055 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 182: /* Line 1455 of yacc.c */ #line 1056 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 183: /* Line 1455 of yacc.c */ #line 1057 "hphp.y" { _p->onReturn((yyval), &(yyvsp[(2) - (3)])); ;} break; case 184: /* Line 1455 of yacc.c */ #line 1058 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 185: /* Line 1455 of yacc.c */ #line 1059 "hphp.y" { _p->onExpStatement((yyval), (yyvsp[(1) - (2)]));;} break; case 186: /* Line 1455 of yacc.c */ #line 1060 "hphp.y" { _p->onReturn((yyval), &(yyvsp[(2) - (3)])); ;} break; case 187: /* Line 1455 of yacc.c */ #line 1061 "hphp.y" { _p->onLabel((yyval), (yyvsp[(1) - (2)])); _p->addLabel((yyvsp[(1) - (2)]).text(), _p->getRange(), &(yyval)); _p->onScopeLabel((yyval), (yyvsp[(1) - (2)]));;} break; case 188: /* Line 1455 of yacc.c */ #line 1069 "hphp.y" { _p->onNewLabelScope(false);;} break; case 189: /* Line 1455 of yacc.c */ #line 1070 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]);;} break; case 190: /* Line 1455 of yacc.c */ #line 1079 "hphp.y" { _p->onCatch((yyval), (yyvsp[(1) - (9)]), (yyvsp[(4) - (9)]), (yyvsp[(5) - (9)]), (yyvsp[(8) - (9)]));;} break; case 191: /* Line 1455 of yacc.c */ #line 1080 "hphp.y" { (yyval).reset();;} break; case 192: /* Line 1455 of yacc.c */ #line 1084 "hphp.y" { _p->onNewLabelScope(false); _p->pushLabelScope();;} break; case 193: /* Line 1455 of yacc.c */ #line 1086 "hphp.y" { _p->popLabelScope(); _p->onFinally((yyval), (yyvsp[(3) - (4)])); _p->onCompleteLabelScope(false);;} break; case 194: /* Line 1455 of yacc.c */ #line 1092 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 195: /* Line 1455 of yacc.c */ #line 1093 "hphp.y" { (yyval).reset();;} break; case 196: /* Line 1455 of yacc.c */ #line 1097 "hphp.y" { (yyval) = 1;;} break; case 197: /* Line 1455 of yacc.c */ #line 1098 "hphp.y" { (yyval).reset();;} break; case 198: /* Line 1455 of yacc.c */ #line 1102 "hphp.y" { _p->pushFuncLocation(); ;} break; case 199: /* Line 1455 of yacc.c */ #line 1108 "hphp.y" { (yyvsp[(3) - (3)]).setText(_p->nsDecl((yyvsp[(3) - (3)]).text())); _p->onNewLabelScope(true); _p->onFunctionStart((yyvsp[(3) - (3)])); _p->pushLabelInfo();;} break; case 200: /* Line 1455 of yacc.c */ #line 1114 "hphp.y" { _p->onFunction((yyval),nullptr,(yyvsp[(8) - (9)]),(yyvsp[(2) - (9)]),(yyvsp[(3) - (9)]),(yyvsp[(6) - (9)]),(yyvsp[(9) - (9)]),nullptr); _p->popLabelInfo(); _p->popTypeScope(); _p->onCompleteLabelScope(true);;} break; case 201: /* Line 1455 of yacc.c */ #line 1121 "hphp.y" { (yyvsp[(4) - (4)]).setText(_p->nsDecl((yyvsp[(4) - (4)]).text())); _p->onNewLabelScope(true); _p->onFunctionStart((yyvsp[(4) - (4)])); _p->pushLabelInfo();;} break; case 202: /* Line 1455 of yacc.c */ #line 1127 "hphp.y" { _p->onFunction((yyval),&(yyvsp[(1) - (10)]),(yyvsp[(9) - (10)]),(yyvsp[(3) - (10)]),(yyvsp[(4) - (10)]),(yyvsp[(7) - (10)]),(yyvsp[(10) - (10)]),nullptr); _p->popLabelInfo(); _p->popTypeScope(); _p->onCompleteLabelScope(true);;} break; case 203: /* Line 1455 of yacc.c */ #line 1134 "hphp.y" { (yyvsp[(5) - (5)]).setText(_p->nsDecl((yyvsp[(5) - (5)]).text())); _p->onNewLabelScope(true); _p->onFunctionStart((yyvsp[(5) - (5)])); _p->pushLabelInfo();;} break; case 204: /* Line 1455 of yacc.c */ #line 1140 "hphp.y" { _p->onFunction((yyval),&(yyvsp[(2) - (11)]),(yyvsp[(10) - (11)]),(yyvsp[(4) - (11)]),(yyvsp[(5) - (11)]),(yyvsp[(8) - (11)]),(yyvsp[(11) - (11)]),&(yyvsp[(1) - (11)])); _p->popLabelInfo(); _p->popTypeScope(); _p->onCompleteLabelScope(true);;} break; case 205: /* Line 1455 of yacc.c */ #line 1148 "hphp.y" { (yyvsp[(2) - (2)]).setText(_p->nsClassDecl((yyvsp[(2) - (2)]).text())); _p->onClassStart(T_ENUM,(yyvsp[(2) - (2)]));;} break; case 206: /* Line 1455 of yacc.c */ #line 1152 "hphp.y" { _p->onEnum((yyval),(yyvsp[(2) - (9)]),(yyvsp[(5) - (9)]),(yyvsp[(8) - (9)]),0); ;} break; case 207: /* Line 1455 of yacc.c */ #line 1156 "hphp.y" { (yyvsp[(3) - (3)]).setText(_p->nsClassDecl((yyvsp[(3) - (3)]).text())); _p->onClassStart(T_ENUM,(yyvsp[(3) - (3)]));;} break; case 208: /* Line 1455 of yacc.c */ #line 1160 "hphp.y" { _p->onEnum((yyval),(yyvsp[(3) - (10)]),(yyvsp[(6) - (10)]),(yyvsp[(9) - (10)]),&(yyvsp[(1) - (10)])); ;} break; case 209: /* Line 1455 of yacc.c */ #line 1166 "hphp.y" { (yyvsp[(2) - (2)]).setText(_p->nsClassDecl((yyvsp[(2) - (2)]).text())); _p->onClassStart((yyvsp[(1) - (2)]).num(),(yyvsp[(2) - (2)]));;} break; case 210: /* Line 1455 of yacc.c */ #line 1169 "hphp.y" { Token stmts; if (_p->peekClass()) { xhp_collect_attributes(_p,stmts,(yyvsp[(7) - (8)])); } else { stmts = (yyvsp[(7) - (8)]); } _p->onClass((yyval),(yyvsp[(1) - (8)]).num(),(yyvsp[(2) - (8)]),(yyvsp[(4) - (8)]),(yyvsp[(5) - (8)]), stmts,0,nullptr); if (_p->peekClass()) { _p->xhpResetAttributes(); } _p->popClass(); _p->popTypeScope();;} break; case 211: /* Line 1455 of yacc.c */ #line 1184 "hphp.y" { (yyvsp[(3) - (3)]).setText(_p->nsClassDecl((yyvsp[(3) - (3)]).text())); _p->onClassStart((yyvsp[(2) - (3)]).num(),(yyvsp[(3) - (3)]));;} break; case 212: /* Line 1455 of yacc.c */ #line 1187 "hphp.y" { Token stmts; if (_p->peekClass()) { xhp_collect_attributes(_p,stmts,(yyvsp[(8) - (9)])); } else { stmts = (yyvsp[(8) - (9)]); } _p->onClass((yyval),(yyvsp[(2) - (9)]).num(),(yyvsp[(3) - (9)]),(yyvsp[(5) - (9)]),(yyvsp[(6) - (9)]), stmts,&(yyvsp[(1) - (9)]),nullptr); if (_p->peekClass()) { _p->xhpResetAttributes(); } _p->popClass(); _p->popTypeScope();;} break; case 213: /* Line 1455 of yacc.c */ #line 1201 "hphp.y" { (yyvsp[(2) - (2)]).setText(_p->nsClassDecl((yyvsp[(2) - (2)]).text())); _p->onClassStart(T_INTERFACE,(yyvsp[(2) - (2)]));;} break; case 214: /* Line 1455 of yacc.c */ #line 1204 "hphp.y" { _p->onInterface((yyval),(yyvsp[(2) - (7)]),(yyvsp[(4) - (7)]),(yyvsp[(6) - (7)]),0); _p->popClass(); _p->popTypeScope();;} break; case 215: /* Line 1455 of yacc.c */ #line 1209 "hphp.y" { (yyvsp[(3) - (3)]).setText(_p->nsClassDecl((yyvsp[(3) - (3)]).text())); _p->onClassStart(T_INTERFACE,(yyvsp[(3) - (3)]));;} break; case 216: /* Line 1455 of yacc.c */ #line 1212 "hphp.y" { _p->onInterface((yyval),(yyvsp[(3) - (8)]),(yyvsp[(5) - (8)]),(yyvsp[(7) - (8)]),&(yyvsp[(1) - (8)])); _p->popClass(); _p->popTypeScope();;} break; case 217: /* Line 1455 of yacc.c */ #line 1219 "hphp.y" { (yyvsp[(2) - (2)]).setText(_p->nsClassDecl((yyvsp[(2) - (2)]).text())); _p->onClassStart(T_TRAIT, (yyvsp[(2) - (2)]));;} break; case 218: /* Line 1455 of yacc.c */ #line 1222 "hphp.y" { Token t_ext; t_ext.reset(); _p->onClass((yyval),T_TRAIT,(yyvsp[(2) - (7)]),t_ext,(yyvsp[(4) - (7)]), (yyvsp[(6) - (7)]), 0, nullptr); _p->popClass(); _p->popTypeScope();;} break; case 219: /* Line 1455 of yacc.c */ #line 1230 "hphp.y" { (yyvsp[(3) - (3)]).setText(_p->nsClassDecl((yyvsp[(3) - (3)]).text())); _p->onClassStart(T_TRAIT, (yyvsp[(3) - (3)]));;} break; case 220: /* Line 1455 of yacc.c */ #line 1233 "hphp.y" { Token t_ext; t_ext.reset(); _p->onClass((yyval),T_TRAIT,(yyvsp[(3) - (8)]),t_ext,(yyvsp[(5) - (8)]), (yyvsp[(7) - (8)]), &(yyvsp[(1) - (8)]), nullptr); _p->popClass(); _p->popTypeScope();;} break; case 221: /* Line 1455 of yacc.c */ #line 1241 "hphp.y" { _p->pushClass(false); (yyval) = (yyvsp[(1) - (1)]);;} break; case 222: /* Line 1455 of yacc.c */ #line 1242 "hphp.y" { (yyvsp[(1) - (1)]).xhpLabel(); _p->pushTypeScope(); _p->pushClass(true); (yyval) = (yyvsp[(1) - (1)]);;} break; case 223: /* Line 1455 of yacc.c */ #line 1246 "hphp.y" { _p->pushClass(false); (yyval) = (yyvsp[(1) - (1)]);;} break; case 224: /* Line 1455 of yacc.c */ #line 1249 "hphp.y" { _p->pushClass(false); (yyval) = (yyvsp[(1) - (1)]);;} break; case 225: /* Line 1455 of yacc.c */ #line 1252 "hphp.y" { (yyval) = T_CLASS;;} break; case 226: /* Line 1455 of yacc.c */ #line 1253 "hphp.y" { (yyval) = T_ABSTRACT; ;} break; case 227: /* Line 1455 of yacc.c */ #line 1254 "hphp.y" { only_in_hh_syntax(_p); /* hacky, but transforming to a single token is quite convenient */ (yyval) = T_STATIC; ;} break; case 228: /* Line 1455 of yacc.c */ #line 1257 "hphp.y" { only_in_hh_syntax(_p); (yyval) = T_STATIC; ;} break; case 229: /* Line 1455 of yacc.c */ #line 1258 "hphp.y" { (yyval) = T_FINAL;;} break; case 230: /* Line 1455 of yacc.c */ #line 1262 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 231: /* Line 1455 of yacc.c */ #line 1263 "hphp.y" { (yyval).reset();;} break; case 232: /* Line 1455 of yacc.c */ #line 1266 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 233: /* Line 1455 of yacc.c */ #line 1267 "hphp.y" { (yyval).reset();;} break; case 234: /* Line 1455 of yacc.c */ #line 1270 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 235: /* Line 1455 of yacc.c */ #line 1271 "hphp.y" { (yyval).reset();;} break; case 236: /* Line 1455 of yacc.c */ #line 1274 "hphp.y" { _p->onInterfaceName((yyval), NULL, (yyvsp[(1) - (1)]));;} break; case 237: /* Line 1455 of yacc.c */ #line 1276 "hphp.y" { _p->onInterfaceName((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]));;} break; case 238: /* Line 1455 of yacc.c */ #line 1279 "hphp.y" { _p->onTraitName((yyval), NULL, (yyvsp[(1) - (1)]));;} break; case 239: /* Line 1455 of yacc.c */ #line 1281 "hphp.y" { _p->onTraitName((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]));;} break; case 240: /* Line 1455 of yacc.c */ #line 1285 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 241: /* Line 1455 of yacc.c */ #line 1286 "hphp.y" { (yyval).reset();;} break; case 242: /* Line 1455 of yacc.c */ #line 1289 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = 0;;} break; case 243: /* Line 1455 of yacc.c */ #line 1290 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]); (yyval) = 1;;} break; case 244: /* Line 1455 of yacc.c */ #line 1291 "hphp.y" { _p->onListAssignment((yyval), (yyvsp[(3) - (4)]), NULL);;} break; case 245: /* Line 1455 of yacc.c */ #line 1295 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 246: /* Line 1455 of yacc.c */ #line 1297 "hphp.y" { (yyval) = (yyvsp[(2) - (4)]);;} break; case 247: /* Line 1455 of yacc.c */ #line 1300 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 248: /* Line 1455 of yacc.c */ #line 1302 "hphp.y" { (yyval) = (yyvsp[(2) - (4)]);;} break; case 249: /* Line 1455 of yacc.c */ #line 1305 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 250: /* Line 1455 of yacc.c */ #line 1307 "hphp.y" { (yyval) = (yyvsp[(2) - (4)]);;} break; case 251: /* Line 1455 of yacc.c */ #line 1310 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 252: /* Line 1455 of yacc.c */ #line 1312 "hphp.y" { (yyval) = (yyvsp[(2) - (4)]);;} break; case 255: /* Line 1455 of yacc.c */ #line 1322 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 256: /* Line 1455 of yacc.c */ #line 1323 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]);;} break; case 257: /* Line 1455 of yacc.c */ #line 1324 "hphp.y" { (yyval) = (yyvsp[(2) - (4)]);;} break; case 258: /* Line 1455 of yacc.c */ #line 1325 "hphp.y" { (yyval) = (yyvsp[(3) - (5)]);;} break; case 259: /* Line 1455 of yacc.c */ #line 1330 "hphp.y" { _p->onCase((yyval),(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 260: /* Line 1455 of yacc.c */ #line 1332 "hphp.y" { _p->onCase((yyval),(yyvsp[(1) - (4)]),NULL,(yyvsp[(4) - (4)]));;} break; case 261: /* Line 1455 of yacc.c */ #line 1333 "hphp.y" { (yyval).reset();;} break; case 262: /* Line 1455 of yacc.c */ #line 1336 "hphp.y" { (yyval).reset();;} break; case 263: /* Line 1455 of yacc.c */ #line 1337 "hphp.y" { (yyval).reset();;} break; case 264: /* Line 1455 of yacc.c */ #line 1342 "hphp.y" { _p->onElseIf((yyval),(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),(yyvsp[(4) - (4)]));;} break; case 265: /* Line 1455 of yacc.c */ #line 1343 "hphp.y" { (yyval).reset();;} break; case 266: /* Line 1455 of yacc.c */ #line 1348 "hphp.y" { _p->onElseIf((yyval),(yyvsp[(1) - (5)]),(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 267: /* Line 1455 of yacc.c */ #line 1349 "hphp.y" { (yyval).reset();;} break; case 268: /* Line 1455 of yacc.c */ #line 1352 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 269: /* Line 1455 of yacc.c */ #line 1353 "hphp.y" { (yyval).reset();;} break; case 270: /* Line 1455 of yacc.c */ #line 1356 "hphp.y" { (yyval) = (yyvsp[(3) - (3)]);;} break; case 271: /* Line 1455 of yacc.c */ #line 1357 "hphp.y" { (yyval).reset();;} break; case 272: /* Line 1455 of yacc.c */ #line 1365 "hphp.y" { _p->onVariadicParam((yyval),&(yyvsp[(1) - (7)]),(yyvsp[(5) - (7)]),(yyvsp[(7) - (7)]),false, &(yyvsp[(3) - (7)]),&(yyvsp[(4) - (7)])); ;} break; case 273: /* Line 1455 of yacc.c */ #line 1371 "hphp.y" { _p->onVariadicParam((yyval),&(yyvsp[(1) - (8)]),(yyvsp[(5) - (8)]),(yyvsp[(8) - (8)]),true, &(yyvsp[(3) - (8)]),&(yyvsp[(4) - (8)])); ;} break; case 274: /* Line 1455 of yacc.c */ #line 1377 "hphp.y" { validate_hh_variadic_variant( _p, (yyvsp[(3) - (6)]), (yyvsp[(5) - (6)]), &(yyvsp[(4) - (6)])); (yyval) = (yyvsp[(1) - (6)]); ;} break; case 275: /* Line 1455 of yacc.c */ #line 1381 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 276: /* Line 1455 of yacc.c */ #line 1385 "hphp.y" { _p->onVariadicParam((yyval),NULL,(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),false, &(yyvsp[(1) - (5)]),&(yyvsp[(2) - (5)])); ;} break; case 277: /* Line 1455 of yacc.c */ #line 1390 "hphp.y" { _p->onVariadicParam((yyval),NULL,(yyvsp[(3) - (6)]),(yyvsp[(6) - (6)]),true, &(yyvsp[(1) - (6)]),&(yyvsp[(2) - (6)])); ;} break; case 278: /* Line 1455 of yacc.c */ #line 1395 "hphp.y" { validate_hh_variadic_variant( _p, (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]), &(yyvsp[(2) - (4)])); (yyval).reset(); ;} break; case 279: /* Line 1455 of yacc.c */ #line 1398 "hphp.y" { (yyval).reset(); ;} break; case 280: /* Line 1455 of yacc.c */ #line 1404 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(3) - (4)]),(yyvsp[(4) - (4)]),0, NULL,&(yyvsp[(1) - (4)]),&(yyvsp[(2) - (4)]));;} break; case 281: /* Line 1455 of yacc.c */ #line 1408 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),1, NULL,&(yyvsp[(1) - (5)]),&(yyvsp[(2) - (5)]));;} break; case 282: /* Line 1455 of yacc.c */ #line 1413 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(3) - (7)]),(yyvsp[(5) - (7)]),1, &(yyvsp[(7) - (7)]),&(yyvsp[(1) - (7)]),&(yyvsp[(2) - (7)]));;} break; case 283: /* Line 1455 of yacc.c */ #line 1418 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(3) - (6)]),(yyvsp[(4) - (6)]),0, &(yyvsp[(6) - (6)]),&(yyvsp[(1) - (6)]),&(yyvsp[(2) - (6)]));;} break; case 284: /* Line 1455 of yacc.c */ #line 1423 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (6)]),(yyvsp[(5) - (6)]),(yyvsp[(6) - (6)]),0, NULL,&(yyvsp[(3) - (6)]),&(yyvsp[(4) - (6)]));;} break; case 285: /* Line 1455 of yacc.c */ #line 1428 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (7)]),(yyvsp[(5) - (7)]),(yyvsp[(7) - (7)]),1, NULL,&(yyvsp[(3) - (7)]),&(yyvsp[(4) - (7)]));;} break; case 286: /* Line 1455 of yacc.c */ #line 1434 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (9)]),(yyvsp[(5) - (9)]),(yyvsp[(7) - (9)]),1, &(yyvsp[(9) - (9)]),&(yyvsp[(3) - (9)]),&(yyvsp[(4) - (9)]));;} break; case 287: /* Line 1455 of yacc.c */ #line 1440 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (8)]),(yyvsp[(5) - (8)]),(yyvsp[(6) - (8)]),0, &(yyvsp[(8) - (8)]),&(yyvsp[(3) - (8)]),&(yyvsp[(4) - (8)]));;} break; case 288: /* Line 1455 of yacc.c */ #line 1448 "hphp.y" { _p->onVariadicParam((yyval),&(yyvsp[(1) - (6)]),(yyvsp[(4) - (6)]),(yyvsp[(6) - (6)]), false,&(yyvsp[(3) - (6)]),NULL); ;} break; case 289: /* Line 1455 of yacc.c */ #line 1453 "hphp.y" { _p->onVariadicParam((yyval),&(yyvsp[(1) - (7)]),(yyvsp[(4) - (7)]),(yyvsp[(7) - (7)]), true,&(yyvsp[(3) - (7)]),NULL); ;} break; case 290: /* Line 1455 of yacc.c */ #line 1458 "hphp.y" { validate_hh_variadic_variant( _p, (yyvsp[(3) - (5)]), (yyvsp[(4) - (5)]), NULL); (yyval) = (yyvsp[(1) - (5)]); ;} break; case 291: /* Line 1455 of yacc.c */ #line 1462 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 292: /* Line 1455 of yacc.c */ #line 1465 "hphp.y" { _p->onVariadicParam((yyval),NULL,(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)]), false,&(yyvsp[(1) - (4)]),NULL); ;} break; case 293: /* Line 1455 of yacc.c */ #line 1469 "hphp.y" { _p->onVariadicParam((yyval),NULL,(yyvsp[(2) - (5)]),(yyvsp[(5) - (5)]), true,&(yyvsp[(1) - (5)]),NULL); ;} break; case 294: /* Line 1455 of yacc.c */ #line 1473 "hphp.y" { validate_hh_variadic_variant( _p, (yyvsp[(1) - (3)]), (yyvsp[(2) - (3)]), NULL); (yyval).reset(); ;} break; case 295: /* Line 1455 of yacc.c */ #line 1476 "hphp.y" { (yyval).reset();;} break; case 296: /* Line 1455 of yacc.c */ #line 1481 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(2) - (3)]),(yyvsp[(3) - (3)]),false, NULL,&(yyvsp[(1) - (3)]),NULL); ;} break; case 297: /* Line 1455 of yacc.c */ #line 1484 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)]),true, NULL,&(yyvsp[(1) - (4)]),NULL); ;} break; case 298: /* Line 1455 of yacc.c */ #line 1488 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(2) - (6)]),(yyvsp[(4) - (6)]),true, &(yyvsp[(6) - (6)]),&(yyvsp[(1) - (6)]),NULL); ;} break; case 299: /* Line 1455 of yacc.c */ #line 1492 "hphp.y" { _p->onParam((yyval),NULL,(yyvsp[(2) - (5)]),(yyvsp[(3) - (5)]),false, &(yyvsp[(5) - (5)]),&(yyvsp[(1) - (5)]),NULL); ;} break; case 300: /* Line 1455 of yacc.c */ #line 1496 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (5)]),(yyvsp[(4) - (5)]),(yyvsp[(5) - (5)]),false, NULL,&(yyvsp[(3) - (5)]),NULL); ;} break; case 301: /* Line 1455 of yacc.c */ #line 1500 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (6)]),(yyvsp[(4) - (6)]),(yyvsp[(6) - (6)]),true, NULL,&(yyvsp[(3) - (6)]),NULL); ;} break; case 302: /* Line 1455 of yacc.c */ #line 1505 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (8)]),(yyvsp[(4) - (8)]),(yyvsp[(6) - (8)]),true, &(yyvsp[(8) - (8)]),&(yyvsp[(3) - (8)]),NULL); ;} break; case 303: /* Line 1455 of yacc.c */ #line 1510 "hphp.y" { _p->onParam((yyval),&(yyvsp[(1) - (7)]),(yyvsp[(4) - (7)]),(yyvsp[(5) - (7)]),false, &(yyvsp[(7) - (7)]),&(yyvsp[(3) - (7)]),NULL); ;} break; case 304: /* Line 1455 of yacc.c */ #line 1516 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 305: /* Line 1455 of yacc.c */ #line 1517 "hphp.y" { (yyval).reset();;} break; case 306: /* Line 1455 of yacc.c */ #line 1520 "hphp.y" { _p->onCallParam((yyval),NULL,(yyvsp[(1) - (1)]),false,false);;} break; case 307: /* Line 1455 of yacc.c */ #line 1521 "hphp.y" { _p->onCallParam((yyval),NULL,(yyvsp[(2) - (2)]),true,false);;} break; case 308: /* Line 1455 of yacc.c */ #line 1522 "hphp.y" { _p->onCallParam((yyval),NULL,(yyvsp[(2) - (2)]),false,true);;} break; case 309: /* Line 1455 of yacc.c */ #line 1524 "hphp.y" { _p->onCallParam((yyval),&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),false, false);;} break; case 310: /* Line 1455 of yacc.c */ #line 1526 "hphp.y" { _p->onCallParam((yyval),&(yyvsp[(1) - (4)]),(yyvsp[(4) - (4)]),false,true);;} break; case 311: /* Line 1455 of yacc.c */ #line 1528 "hphp.y" { _p->onCallParam((yyval),&(yyvsp[(1) - (4)]),(yyvsp[(4) - (4)]),true, false);;} break; case 312: /* Line 1455 of yacc.c */ #line 1532 "hphp.y" { _p->onGlobalVar((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]));;} break; case 313: /* Line 1455 of yacc.c */ #line 1533 "hphp.y" { _p->onGlobalVar((yyval), NULL, (yyvsp[(1) - (1)]));;} break; case 314: /* Line 1455 of yacc.c */ #line 1536 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 315: /* Line 1455 of yacc.c */ #line 1537 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]); (yyval) = 1;;} break; case 316: /* Line 1455 of yacc.c */ #line 1538 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]); (yyval) = 1;;} break; case 317: /* Line 1455 of yacc.c */ #line 1542 "hphp.y" { _p->onStaticVariable((yyval),&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 318: /* Line 1455 of yacc.c */ #line 1544 "hphp.y" { _p->onStaticVariable((yyval),&(yyvsp[(1) - (5)]),(yyvsp[(3) - (5)]),&(yyvsp[(5) - (5)]));;} break; case 319: /* Line 1455 of yacc.c */ #line 1545 "hphp.y" { _p->onStaticVariable((yyval),0,(yyvsp[(1) - (1)]),0);;} break; case 320: /* Line 1455 of yacc.c */ #line 1546 "hphp.y" { _p->onStaticVariable((yyval),0,(yyvsp[(1) - (3)]),&(yyvsp[(3) - (3)]));;} break; case 321: /* Line 1455 of yacc.c */ #line 1551 "hphp.y" { _p->onClassStatement((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 322: /* Line 1455 of yacc.c */ #line 1552 "hphp.y" { (yyval).reset();;} break; case 323: /* Line 1455 of yacc.c */ #line 1555 "hphp.y" { _p->onClassVariableStart ((yyval),NULL,(yyvsp[(1) - (2)]),NULL);;} break; case 324: /* Line 1455 of yacc.c */ #line 1560 "hphp.y" { _p->onClassConstant((yyval),0,(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 325: /* Line 1455 of yacc.c */ #line 1566 "hphp.y" { _p->onClassStatement((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 326: /* Line 1455 of yacc.c */ #line 1567 "hphp.y" { (yyval).reset();;} break; case 327: /* Line 1455 of yacc.c */ #line 1570 "hphp.y" { _p->onClassVariableModifer((yyvsp[(1) - (1)]));;} break; case 328: /* Line 1455 of yacc.c */ #line 1571 "hphp.y" { _p->onClassVariableStart ((yyval),&(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 329: /* Line 1455 of yacc.c */ #line 1574 "hphp.y" { _p->onClassVariableModifer((yyvsp[(1) - (2)]));;} break; case 330: /* Line 1455 of yacc.c */ #line 1575 "hphp.y" { _p->onClassVariableStart ((yyval),&(yyvsp[(1) - (5)]),(yyvsp[(4) - (5)]),&(yyvsp[(2) - (5)]));;} break; case 331: /* Line 1455 of yacc.c */ #line 1577 "hphp.y" { _p->onClassVariableStart ((yyval),NULL,(yyvsp[(1) - (2)]),NULL);;} break; case 332: /* Line 1455 of yacc.c */ #line 1580 "hphp.y" { _p->onClassVariableStart ((yyval),NULL,(yyvsp[(1) - (2)]),NULL, true);;} break; case 333: /* Line 1455 of yacc.c */ #line 1582 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]); ;} break; case 334: /* Line 1455 of yacc.c */ #line 1585 "hphp.y" { _p->onNewLabelScope(true); _p->onMethodStart((yyvsp[(4) - (5)]), (yyvsp[(1) - (5)])); _p->pushLabelInfo();;} break; case 335: /* Line 1455 of yacc.c */ #line 1591 "hphp.y" { _p->onMethod((yyval),(yyvsp[(1) - (10)]),(yyvsp[(9) - (10)]),(yyvsp[(3) - (10)]),(yyvsp[(4) - (10)]),(yyvsp[(7) - (10)]),(yyvsp[(10) - (10)]),nullptr); _p->popLabelInfo(); _p->popTypeScope(); _p->onCompleteLabelScope(true);;} break; case 336: /* Line 1455 of yacc.c */ #line 1599 "hphp.y" { _p->onNewLabelScope(true); _p->onMethodStart((yyvsp[(5) - (6)]), (yyvsp[(2) - (6)])); _p->pushLabelInfo();;} break; case 337: /* Line 1455 of yacc.c */ #line 1605 "hphp.y" { _p->onMethod((yyval),(yyvsp[(2) - (11)]),(yyvsp[(10) - (11)]),(yyvsp[(4) - (11)]),(yyvsp[(5) - (11)]),(yyvsp[(8) - (11)]),(yyvsp[(11) - (11)]),&(yyvsp[(1) - (11)])); _p->popLabelInfo(); _p->popTypeScope(); _p->onCompleteLabelScope(true);;} break; case 338: /* Line 1455 of yacc.c */ #line 1610 "hphp.y" { _p->xhpSetAttributes((yyvsp[(2) - (3)]));;} break; case 339: /* Line 1455 of yacc.c */ #line 1612 "hphp.y" { xhp_category_stmt(_p,(yyval),(yyvsp[(2) - (3)]));;} break; case 340: /* Line 1455 of yacc.c */ #line 1614 "hphp.y" { xhp_children_stmt(_p,(yyval),(yyvsp[(2) - (3)]));;} break; case 341: /* Line 1455 of yacc.c */ #line 1616 "hphp.y" { _p->onClassRequire((yyval), (yyvsp[(3) - (4)]), true); ;} break; case 342: /* Line 1455 of yacc.c */ #line 1618 "hphp.y" { _p->onClassRequire((yyval), (yyvsp[(3) - (4)]), false); ;} break; case 343: /* Line 1455 of yacc.c */ #line 1619 "hphp.y" { Token t; t.reset(); _p->onTraitUse((yyval),(yyvsp[(2) - (3)]),t); ;} break; case 344: /* Line 1455 of yacc.c */ #line 1622 "hphp.y" { _p->onTraitUse((yyval),(yyvsp[(2) - (5)]),(yyvsp[(4) - (5)])); ;} break; case 345: /* Line 1455 of yacc.c */ #line 1625 "hphp.y" { _p->onTraitRule((yyval),(yyvsp[(1) - (2)]),(yyvsp[(2) - (2)])); ;} break; case 346: /* Line 1455 of yacc.c */ #line 1626 "hphp.y" { _p->onTraitRule((yyval),(yyvsp[(1) - (2)]),(yyvsp[(2) - (2)])); ;} break; case 347: /* Line 1455 of yacc.c */ #line 1627 "hphp.y" { (yyval).reset(); ;} break; case 348: /* Line 1455 of yacc.c */ #line 1633 "hphp.y" { _p->onTraitPrecRule((yyval),(yyvsp[(1) - (6)]),(yyvsp[(3) - (6)]),(yyvsp[(5) - (6)]));;} break; case 349: /* Line 1455 of yacc.c */ #line 1638 "hphp.y" { _p->onTraitAliasRuleModify((yyval),(yyvsp[(1) - (5)]),(yyvsp[(3) - (5)]), (yyvsp[(4) - (5)]));;} break; case 350: /* Line 1455 of yacc.c */ #line 1641 "hphp.y" { Token t; t.reset(); _p->onTraitAliasRuleModify((yyval),(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]), t);;} break; case 351: /* Line 1455 of yacc.c */ #line 1648 "hphp.y" { _p->onTraitAliasRuleStart((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 352: /* Line 1455 of yacc.c */ #line 1649 "hphp.y" { Token t; t.reset(); _p->onTraitAliasRuleStart((yyval),t,(yyvsp[(1) - (1)]));;} break; case 353: /* Line 1455 of yacc.c */ #line 1654 "hphp.y" { xhp_attribute_list(_p,(yyval), _p->xhpGetAttributes(),(yyvsp[(1) - (1)]));;} break; case 354: /* Line 1455 of yacc.c */ #line 1657 "hphp.y" { xhp_attribute_list(_p,(yyval), &(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 355: /* Line 1455 of yacc.c */ #line 1664 "hphp.y" { xhp_attribute(_p,(yyval),(yyvsp[(1) - (4)]),(yyvsp[(2) - (4)]),(yyvsp[(3) - (4)]),(yyvsp[(4) - (4)])); (yyval) = 1;;} break; case 356: /* Line 1455 of yacc.c */ #line 1666 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = 0;;} break; case 357: /* Line 1455 of yacc.c */ #line 1670 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 359: /* Line 1455 of yacc.c */ #line 1675 "hphp.y" { (yyval) = 4;;} break; case 360: /* Line 1455 of yacc.c */ #line 1677 "hphp.y" { (yyval) = 4;;} break; case 361: /* Line 1455 of yacc.c */ #line 1679 "hphp.y" { (yyval) = 4;;} break; case 362: /* Line 1455 of yacc.c */ #line 1680 "hphp.y" { /* This case handles all types other than "array", "var" and "enum". For now we just use type code 5; later xhp_attribute() will fix up the type code as appropriate. */ (yyval) = 5; (yyval).setText((yyvsp[(1) - (1)]));;} break; case 363: /* Line 1455 of yacc.c */ #line 1686 "hphp.y" { (yyval) = 6;;} break; case 364: /* Line 1455 of yacc.c */ #line 1688 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]); (yyval) = 7;;} break; case 365: /* Line 1455 of yacc.c */ #line 1689 "hphp.y" { (yyval) = 9; ;} break; case 366: /* Line 1455 of yacc.c */ #line 1693 "hphp.y" { _p->onArrayPair((yyval), 0,0,(yyvsp[(1) - (1)]),0);;} break; case 367: /* Line 1455 of yacc.c */ #line 1695 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]),0,(yyvsp[(3) - (3)]),0);;} break; case 368: /* Line 1455 of yacc.c */ #line 1700 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 369: /* Line 1455 of yacc.c */ #line 1703 "hphp.y" { (yyval) = (yyvsp[(2) - (2)]);;} break; case 370: /* Line 1455 of yacc.c */ #line 1704 "hphp.y" { scalar_null(_p, (yyval));;} break; case 371: /* Line 1455 of yacc.c */ #line 1708 "hphp.y" { scalar_num(_p, (yyval), "1");;} break; case 372: /* Line 1455 of yacc.c */ #line 1709 "hphp.y" { scalar_num(_p, (yyval), "0");;} break; case 373: /* Line 1455 of yacc.c */ #line 1713 "hphp.y" { Token t; scalar_num(_p, t, "1"); _p->onArrayPair((yyval),0,&(yyvsp[(1) - (1)]),t,0);;} break; case 374: /* Line 1455 of yacc.c */ #line 1716 "hphp.y" { Token t; scalar_num(_p, t, "1"); _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]),&(yyvsp[(3) - (3)]),t,0);;} break; case 375: /* Line 1455 of yacc.c */ #line 1721 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)]));;} break; case 376: /* Line 1455 of yacc.c */ #line 1726 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = 2;;} break; case 377: /* Line 1455 of yacc.c */ #line 1727 "hphp.y" { (yyval) = -1; if ((yyvsp[(1) - (1)]).same("any")) (yyval) = 1;;} break; case 378: /* Line 1455 of yacc.c */ #line 1729 "hphp.y" { (yyval) = 0;;} break; case 379: /* Line 1455 of yacc.c */ #line 1733 "hphp.y" { xhp_children_paren(_p, (yyval), (yyvsp[(2) - (3)]), 0);;} break; case 380: /* Line 1455 of yacc.c */ #line 1734 "hphp.y" { xhp_children_paren(_p, (yyval), (yyvsp[(2) - (4)]), 1);;} break; case 381: /* Line 1455 of yacc.c */ #line 1735 "hphp.y" { xhp_children_paren(_p, (yyval), (yyvsp[(2) - (4)]), 2);;} break; case 382: /* Line 1455 of yacc.c */ #line 1736 "hphp.y" { xhp_children_paren(_p, (yyval), (yyvsp[(2) - (4)]), 3);;} break; case 383: /* Line 1455 of yacc.c */ #line 1740 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 384: /* Line 1455 of yacc.c */ #line 1741 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (1)]),0, 0);;} break; case 385: /* Line 1455 of yacc.c */ #line 1742 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (2)]),1, 0);;} break; case 386: /* Line 1455 of yacc.c */ #line 1743 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (2)]),2, 0);;} break; case 387: /* Line 1455 of yacc.c */ #line 1744 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (2)]),3, 0);;} break; case 388: /* Line 1455 of yacc.c */ #line 1746 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (3)]),4,&(yyvsp[(3) - (3)]));;} break; case 389: /* Line 1455 of yacc.c */ #line 1748 "hphp.y" { xhp_children_decl(_p,(yyval),(yyvsp[(1) - (3)]),5,&(yyvsp[(3) - (3)]));;} break; case 390: /* Line 1455 of yacc.c */ #line 1752 "hphp.y" { (yyval) = -1; if ((yyvsp[(1) - (1)]).same("any")) (yyval) = 1; else if ((yyvsp[(1) - (1)]).same("pcdata")) (yyval) = 2;;} break; case 391: /* Line 1455 of yacc.c */ #line 1755 "hphp.y" { (yyvsp[(1) - (1)]).xhpLabel(); (yyval) = (yyvsp[(1) - (1)]); (yyval) = 3;;} break; case 392: /* Line 1455 of yacc.c */ #line 1756 "hphp.y" { (yyvsp[(1) - (1)]).xhpLabel(0); (yyval) = (yyvsp[(1) - (1)]); (yyval) = 4;;} break; case 393: /* Line 1455 of yacc.c */ #line 1760 "hphp.y" { (yyval).reset();;} break; case 394: /* Line 1455 of yacc.c */ #line 1761 "hphp.y" { _p->finishStatement((yyval), (yyvsp[(2) - (3)])); (yyval) = 1;;} break; case 395: /* Line 1455 of yacc.c */ #line 1765 "hphp.y" { (yyval).reset();;} break; case 396: /* Line 1455 of yacc.c */ #line 1766 "hphp.y" { _p->finishStatement((yyval), (yyvsp[(2) - (3)])); (yyval) = 1;;} break; case 397: /* Line 1455 of yacc.c */ #line 1769 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 398: /* Line 1455 of yacc.c */ #line 1770 "hphp.y" { (yyval).reset();;} break; case 399: /* Line 1455 of yacc.c */ #line 1773 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 400: /* Line 1455 of yacc.c */ #line 1774 "hphp.y" { (yyval).reset();;} break; case 401: /* Line 1455 of yacc.c */ #line 1777 "hphp.y" { _p->onMemberModifier((yyval),NULL,(yyvsp[(1) - (1)]));;} break; case 402: /* Line 1455 of yacc.c */ #line 1779 "hphp.y" { _p->onMemberModifier((yyval),&(yyvsp[(1) - (2)]),(yyvsp[(2) - (2)]));;} break; case 403: /* Line 1455 of yacc.c */ #line 1782 "hphp.y" { (yyval) = T_PUBLIC;;} break; case 404: /* Line 1455 of yacc.c */ #line 1783 "hphp.y" { (yyval) = T_PROTECTED;;} break; case 405: /* Line 1455 of yacc.c */ #line 1784 "hphp.y" { (yyval) = T_PRIVATE;;} break; case 406: /* Line 1455 of yacc.c */ #line 1785 "hphp.y" { (yyval) = T_STATIC;;} break; case 407: /* Line 1455 of yacc.c */ #line 1786 "hphp.y" { (yyval) = T_ABSTRACT;;} break; case 408: /* Line 1455 of yacc.c */ #line 1787 "hphp.y" { (yyval) = T_FINAL;;} break; case 409: /* Line 1455 of yacc.c */ #line 1788 "hphp.y" { (yyval) = T_ASYNC;;} break; case 410: /* Line 1455 of yacc.c */ #line 1792 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 411: /* Line 1455 of yacc.c */ #line 1793 "hphp.y" { (yyval).reset();;} break; case 412: /* Line 1455 of yacc.c */ #line 1796 "hphp.y" { (yyval) = T_PUBLIC;;} break; case 413: /* Line 1455 of yacc.c */ #line 1797 "hphp.y" { (yyval) = T_PROTECTED;;} break; case 414: /* Line 1455 of yacc.c */ #line 1798 "hphp.y" { (yyval) = T_PRIVATE;;} break; case 415: /* Line 1455 of yacc.c */ #line 1802 "hphp.y" { _p->onClassVariable((yyval),&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 416: /* Line 1455 of yacc.c */ #line 1804 "hphp.y" { _p->onClassVariable((yyval),&(yyvsp[(1) - (5)]),(yyvsp[(3) - (5)]),&(yyvsp[(5) - (5)]));;} break; case 417: /* Line 1455 of yacc.c */ #line 1805 "hphp.y" { _p->onClassVariable((yyval),0,(yyvsp[(1) - (1)]),0);;} break; case 418: /* Line 1455 of yacc.c */ #line 1806 "hphp.y" { _p->onClassVariable((yyval),0,(yyvsp[(1) - (3)]),&(yyvsp[(3) - (3)]));;} break; case 419: /* Line 1455 of yacc.c */ #line 1810 "hphp.y" { _p->onClassConstant((yyval),&(yyvsp[(1) - (5)]),(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 420: /* Line 1455 of yacc.c */ #line 1812 "hphp.y" { _p->onClassConstant((yyval),0,(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)]));;} break; case 421: /* Line 1455 of yacc.c */ #line 1816 "hphp.y" { _p->onClassAbstractConstant((yyval),&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 422: /* Line 1455 of yacc.c */ #line 1818 "hphp.y" { _p->onClassAbstractConstant((yyval),NULL,(yyvsp[(3) - (3)]));;} break; case 423: /* Line 1455 of yacc.c */ #line 1822 "hphp.y" { Token t; _p->onClassTypeConstant((yyval), (yyvsp[(2) - (3)]), t); _p->popTypeScope(); ;} break; case 424: /* Line 1455 of yacc.c */ #line 1826 "hphp.y" { _p->onClassTypeConstant((yyval), (yyvsp[(1) - (4)]), (yyvsp[(4) - (4)])); _p->popTypeScope(); ;} break; case 425: /* Line 1455 of yacc.c */ #line 1830 "hphp.y" { (yyval) = (yyvsp[(3) - (3)]); ;} break; case 426: /* Line 1455 of yacc.c */ #line 1834 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 427: /* Line 1455 of yacc.c */ #line 1836 "hphp.y" { _p->onNewObject((yyval), (yyvsp[(2) - (3)]), (yyvsp[(3) - (3)]));;} break; case 428: /* Line 1455 of yacc.c */ #line 1837 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_CLONE,1);;} break; case 429: /* Line 1455 of yacc.c */ #line 1838 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 430: /* Line 1455 of yacc.c */ #line 1839 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 431: /* Line 1455 of yacc.c */ #line 1842 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 432: /* Line 1455 of yacc.c */ #line 1846 "hphp.y" { _p->onExprListElem((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]));;} break; case 433: /* Line 1455 of yacc.c */ #line 1847 "hphp.y" { _p->onExprListElem((yyval), NULL, (yyvsp[(1) - (1)]));;} break; case 434: /* Line 1455 of yacc.c */ #line 1851 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 435: /* Line 1455 of yacc.c */ #line 1852 "hphp.y" { (yyval).reset();;} break; case 436: /* Line 1455 of yacc.c */ #line 1856 "hphp.y" { _p->onYield((yyval), NULL);;} break; case 437: /* Line 1455 of yacc.c */ #line 1857 "hphp.y" { _p->onYield((yyval), &(yyvsp[(2) - (2)]));;} break; case 438: /* Line 1455 of yacc.c */ #line 1858 "hphp.y" { _p->onYieldPair((yyval), &(yyvsp[(2) - (4)]), &(yyvsp[(4) - (4)]));;} break; case 439: /* Line 1455 of yacc.c */ #line 1859 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]); ;} break; case 440: /* Line 1455 of yacc.c */ #line 1863 "hphp.y" { _p->onAssign((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0, true);;} break; case 441: /* Line 1455 of yacc.c */ #line 1868 "hphp.y" { _p->onListAssignment((yyval), (yyvsp[(3) - (6)]), &(yyvsp[(6) - (6)]), true);;} break; case 442: /* Line 1455 of yacc.c */ #line 1872 "hphp.y" { _p->onAwait((yyval), (yyvsp[(2) - (2)])); ;} break; case 443: /* Line 1455 of yacc.c */ #line 1876 "hphp.y" { _p->onAssign((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0, true);;} break; case 444: /* Line 1455 of yacc.c */ #line 1881 "hphp.y" { _p->onListAssignment((yyval), (yyvsp[(3) - (6)]), &(yyvsp[(6) - (6)]), true);;} break; case 445: /* Line 1455 of yacc.c */ #line 1885 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 446: /* Line 1455 of yacc.c */ #line 1886 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 447: /* Line 1455 of yacc.c */ #line 1887 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 448: /* Line 1455 of yacc.c */ #line 1888 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 449: /* Line 1455 of yacc.c */ #line 1889 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 450: /* Line 1455 of yacc.c */ #line 1894 "hphp.y" { _p->onListAssignment((yyval), (yyvsp[(3) - (6)]), &(yyvsp[(6) - (6)]));;} break; case 451: /* Line 1455 of yacc.c */ #line 1895 "hphp.y" { _p->onAssign((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0);;} break; case 452: /* Line 1455 of yacc.c */ #line 1896 "hphp.y" { _p->onAssign((yyval), (yyvsp[(1) - (4)]), (yyvsp[(4) - (4)]), 1);;} break; case 453: /* Line 1455 of yacc.c */ #line 1899 "hphp.y" { _p->onAssignNew((yyval),(yyvsp[(1) - (6)]),(yyvsp[(5) - (6)]),(yyvsp[(6) - (6)]));;} break; case 454: /* Line 1455 of yacc.c */ #line 1900 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_PLUS_EQUAL);;} break; case 455: /* Line 1455 of yacc.c */ #line 1901 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_MINUS_EQUAL);;} break; case 456: /* Line 1455 of yacc.c */ #line 1902 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_MUL_EQUAL);;} break; case 457: /* Line 1455 of yacc.c */ #line 1903 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_DIV_EQUAL);;} break; case 458: /* Line 1455 of yacc.c */ #line 1904 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_CONCAT_EQUAL);;} break; case 459: /* Line 1455 of yacc.c */ #line 1905 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_MOD_EQUAL);;} break; case 460: /* Line 1455 of yacc.c */ #line 1906 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_AND_EQUAL);;} break; case 461: /* Line 1455 of yacc.c */ #line 1907 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_OR_EQUAL);;} break; case 462: /* Line 1455 of yacc.c */ #line 1908 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_XOR_EQUAL);;} break; case 463: /* Line 1455 of yacc.c */ #line 1909 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SL_EQUAL);;} break; case 464: /* Line 1455 of yacc.c */ #line 1910 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SR_EQUAL);;} break; case 465: /* Line 1455 of yacc.c */ #line 1911 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_POW_EQUAL);;} break; case 466: /* Line 1455 of yacc.c */ #line 1912 "hphp.y" { UEXP((yyval),(yyvsp[(1) - (2)]),T_INC,0);;} break; case 467: /* Line 1455 of yacc.c */ #line 1913 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_INC,1);;} break; case 468: /* Line 1455 of yacc.c */ #line 1914 "hphp.y" { UEXP((yyval),(yyvsp[(1) - (2)]),T_DEC,0);;} break; case 469: /* Line 1455 of yacc.c */ #line 1915 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_DEC,1);;} break; case 470: /* Line 1455 of yacc.c */ #line 1916 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_BOOLEAN_OR);;} break; case 471: /* Line 1455 of yacc.c */ #line 1917 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_BOOLEAN_AND);;} break; case 472: /* Line 1455 of yacc.c */ #line 1918 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_OR);;} break; case 473: /* Line 1455 of yacc.c */ #line 1919 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_AND);;} break; case 474: /* Line 1455 of yacc.c */ #line 1920 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_XOR);;} break; case 475: /* Line 1455 of yacc.c */ #line 1921 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'|');;} break; case 476: /* Line 1455 of yacc.c */ #line 1922 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'&');;} break; case 477: /* Line 1455 of yacc.c */ #line 1923 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'^');;} break; case 478: /* Line 1455 of yacc.c */ #line 1924 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'.');;} break; case 479: /* Line 1455 of yacc.c */ #line 1925 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'+');;} break; case 480: /* Line 1455 of yacc.c */ #line 1926 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'-');;} break; case 481: /* Line 1455 of yacc.c */ #line 1927 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'*');;} break; case 482: /* Line 1455 of yacc.c */ #line 1928 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'/');;} break; case 483: /* Line 1455 of yacc.c */ #line 1929 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_POW);;} break; case 484: /* Line 1455 of yacc.c */ #line 1930 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'%');;} break; case 485: /* Line 1455 of yacc.c */ #line 1931 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SL);;} break; case 486: /* Line 1455 of yacc.c */ #line 1932 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SR);;} break; case 487: /* Line 1455 of yacc.c */ #line 1933 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'+',1);;} break; case 488: /* Line 1455 of yacc.c */ #line 1934 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'-',1);;} break; case 489: /* Line 1455 of yacc.c */ #line 1935 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'!',1);;} break; case 490: /* Line 1455 of yacc.c */ #line 1936 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'~',1);;} break; case 491: /* Line 1455 of yacc.c */ #line 1937 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_IDENTICAL);;} break; case 492: /* Line 1455 of yacc.c */ #line 1938 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_NOT_IDENTICAL);;} break; case 493: /* Line 1455 of yacc.c */ #line 1939 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_EQUAL);;} break; case 494: /* Line 1455 of yacc.c */ #line 1940 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_NOT_EQUAL);;} break; case 495: /* Line 1455 of yacc.c */ #line 1941 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'<');;} break; case 496: /* Line 1455 of yacc.c */ #line 1942 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]), T_IS_SMALLER_OR_EQUAL);;} break; case 497: /* Line 1455 of yacc.c */ #line 1944 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'>');;} break; case 498: /* Line 1455 of yacc.c */ #line 1945 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]), T_IS_GREATER_OR_EQUAL);;} break; case 499: /* Line 1455 of yacc.c */ #line 1947 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SPACESHIP);;} break; case 500: /* Line 1455 of yacc.c */ #line 1949 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_INSTANCEOF);;} break; case 501: /* Line 1455 of yacc.c */ #line 1950 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 502: /* Line 1455 of yacc.c */ #line 1951 "hphp.y" { _p->onQOp((yyval), (yyvsp[(1) - (5)]), &(yyvsp[(3) - (5)]), (yyvsp[(5) - (5)]));;} break; case 503: /* Line 1455 of yacc.c */ #line 1952 "hphp.y" { _p->onQOp((yyval), (yyvsp[(1) - (4)]), 0, (yyvsp[(4) - (4)]));;} break; case 504: /* Line 1455 of yacc.c */ #line 1953 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 505: /* Line 1455 of yacc.c */ #line 1954 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_INT_CAST,1);;} break; case 506: /* Line 1455 of yacc.c */ #line 1955 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_DOUBLE_CAST,1);;} break; case 507: /* Line 1455 of yacc.c */ #line 1956 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_STRING_CAST,1);;} break; case 508: /* Line 1455 of yacc.c */ #line 1957 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_ARRAY_CAST,1);;} break; case 509: /* Line 1455 of yacc.c */ #line 1958 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_OBJECT_CAST,1);;} break; case 510: /* Line 1455 of yacc.c */ #line 1959 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_BOOL_CAST,1);;} break; case 511: /* Line 1455 of yacc.c */ #line 1960 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_UNSET_CAST,1);;} break; case 512: /* Line 1455 of yacc.c */ #line 1961 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_EXIT,1);;} break; case 513: /* Line 1455 of yacc.c */ #line 1962 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'@',1);;} break; case 514: /* Line 1455 of yacc.c */ #line 1963 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 515: /* Line 1455 of yacc.c */ #line 1964 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 516: /* Line 1455 of yacc.c */ #line 1965 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 517: /* Line 1455 of yacc.c */ #line 1966 "hphp.y" { _p->onEncapsList((yyval),'`',(yyvsp[(2) - (3)]));;} break; case 518: /* Line 1455 of yacc.c */ #line 1967 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_PRINT,1);;} break; case 519: /* Line 1455 of yacc.c */ #line 1968 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 520: /* Line 1455 of yacc.c */ #line 1975 "hphp.y" { (yyval) = (yyvsp[(3) - (5)]);;} break; case 521: /* Line 1455 of yacc.c */ #line 1976 "hphp.y" { (yyval).reset();;} break; case 522: /* Line 1455 of yacc.c */ #line 1981 "hphp.y" { Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo(); ;} break; case 523: /* Line 1455 of yacc.c */ #line 1987 "hphp.y" { _p->finishStatement((yyvsp[(10) - (11)]), (yyvsp[(10) - (11)])); (yyvsp[(10) - (11)]) = 1; (yyval) = _p->onClosure(ClosureType::Long, nullptr, (yyvsp[(2) - (11)]),(yyvsp[(5) - (11)]),(yyvsp[(8) - (11)]),(yyvsp[(10) - (11)]),(yyvsp[(7) - (11)])); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 524: /* Line 1455 of yacc.c */ #line 1995 "hphp.y" { Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo(); ;} break; case 525: /* Line 1455 of yacc.c */ #line 2001 "hphp.y" { _p->finishStatement((yyvsp[(11) - (12)]), (yyvsp[(11) - (12)])); (yyvsp[(11) - (12)]) = 1; (yyval) = _p->onClosure(ClosureType::Long, &(yyvsp[(1) - (12)]), (yyvsp[(3) - (12)]),(yyvsp[(6) - (12)]),(yyvsp[(9) - (12)]),(yyvsp[(11) - (12)]),(yyvsp[(8) - (12)])); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 526: /* Line 1455 of yacc.c */ #line 2010 "hphp.y" { _p->pushFuncLocation(); Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo(); Token u; _p->onParam((yyvsp[(1) - (1)]),NULL,u,(yyvsp[(1) - (1)]),0, NULL,NULL,NULL);;} break; case 527: /* Line 1455 of yacc.c */ #line 2018 "hphp.y" { Token v; Token w; Token x; _p->finishStatement((yyvsp[(3) - (3)]), (yyvsp[(3) - (3)])); (yyvsp[(3) - (3)]) = 1; (yyval) = _p->onClosure(ClosureType::Short, nullptr, v,(yyvsp[(1) - (3)]),w,(yyvsp[(3) - (3)]),x); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 528: /* Line 1455 of yacc.c */ #line 2026 "hphp.y" { _p->pushFuncLocation(); Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo(); Token u; _p->onParam((yyvsp[(2) - (2)]),NULL,u,(yyvsp[(2) - (2)]),0, NULL,NULL,NULL);;} break; case 529: /* Line 1455 of yacc.c */ #line 2034 "hphp.y" { Token v; Token w; Token x; (yyvsp[(1) - (4)]) = T_ASYNC; _p->onMemberModifier((yyvsp[(1) - (4)]), nullptr, (yyvsp[(1) - (4)])); _p->finishStatement((yyvsp[(4) - (4)]), (yyvsp[(4) - (4)])); (yyvsp[(4) - (4)]) = 1; (yyval) = _p->onClosure(ClosureType::Short, &(yyvsp[(1) - (4)]), v,(yyvsp[(2) - (4)]),w,(yyvsp[(4) - (4)]),x); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 530: /* Line 1455 of yacc.c */ #line 2043 "hphp.y" { _p->pushFuncLocation(); Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo();;} break; case 531: /* Line 1455 of yacc.c */ #line 2051 "hphp.y" { Token u; Token v; _p->finishStatement((yyvsp[(6) - (6)]), (yyvsp[(6) - (6)])); (yyvsp[(6) - (6)]) = 1; (yyval) = _p->onClosure(ClosureType::Short, nullptr, u,(yyvsp[(3) - (6)]),v,(yyvsp[(6) - (6)]),(yyvsp[(5) - (6)])); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 532: /* Line 1455 of yacc.c */ #line 2059 "hphp.y" { _p->pushFuncLocation(); Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo();;} break; case 533: /* Line 1455 of yacc.c */ #line 2067 "hphp.y" { Token u; Token v; (yyvsp[(1) - (7)]) = T_ASYNC; _p->onMemberModifier((yyvsp[(1) - (7)]), nullptr, (yyvsp[(1) - (7)])); _p->finishStatement((yyvsp[(7) - (7)]), (yyvsp[(7) - (7)])); (yyvsp[(7) - (7)]) = 1; (yyval) = _p->onClosure(ClosureType::Short, &(yyvsp[(1) - (7)]), u,(yyvsp[(4) - (7)]),v,(yyvsp[(7) - (7)]),(yyvsp[(6) - (7)])); _p->popLabelInfo(); _p->onCompleteLabelScope(true);;} break; case 534: /* Line 1455 of yacc.c */ #line 2077 "hphp.y" { _p->pushFuncLocation(); Token t; _p->onNewLabelScope(true); _p->onClosureStart(t); _p->pushLabelInfo();;} break; case 535: /* Line 1455 of yacc.c */ #line 2083 "hphp.y" { Token u; Token v; Token w; Token x; Token y; (yyvsp[(1) - (5)]) = T_ASYNC; _p->onMemberModifier((yyvsp[(1) - (5)]), nullptr, (yyvsp[(1) - (5)])); _p->finishStatement((yyvsp[(4) - (5)]), (yyvsp[(4) - (5)])); (yyvsp[(4) - (5)]) = 1; (yyval) = _p->onClosure(ClosureType::Short, &(yyvsp[(1) - (5)]), u,v,w,(yyvsp[(4) - (5)]),x); _p->popLabelInfo(); _p->onCompleteLabelScope(true); _p->onCall((yyval),1,(yyval),y,NULL);;} break; case 536: /* Line 1455 of yacc.c */ #line 2097 "hphp.y" { (yyval) = _p->onExprForLambda((yyvsp[(2) - (2)]));;} break; case 537: /* Line 1455 of yacc.c */ #line 2098 "hphp.y" { (yyval) = _p->onExprForLambda((yyvsp[(2) - (2)]));;} break; case 538: /* Line 1455 of yacc.c */ #line 2100 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]); ;} break; case 539: /* Line 1455 of yacc.c */ #line 2104 "hphp.y" { validate_shape_keyname((yyvsp[(1) - (1)]), _p); _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)])); ;} break; case 540: /* Line 1455 of yacc.c */ #line 2106 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 541: /* Line 1455 of yacc.c */ #line 2113 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0); ;} break; case 542: /* Line 1455 of yacc.c */ #line 2116 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0); ;} break; case 543: /* Line 1455 of yacc.c */ #line 2123 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0); ;} break; case 544: /* Line 1455 of yacc.c */ #line 2126 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0); ;} break; case 545: /* Line 1455 of yacc.c */ #line 2131 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]); ;} break; case 546: /* Line 1455 of yacc.c */ #line 2132 "hphp.y" { (yyval).reset(); ;} break; case 547: /* Line 1455 of yacc.c */ #line 2137 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]); ;} break; case 548: /* Line 1455 of yacc.c */ #line 2138 "hphp.y" { (yyval).reset(); ;} break; case 549: /* Line 1455 of yacc.c */ #line 2142 "hphp.y" { _p->onArray((yyval), (yyvsp[(3) - (4)]), T_ARRAY);;} break; case 550: /* Line 1455 of yacc.c */ #line 2146 "hphp.y" { _p->onArray((yyval),(yyvsp[(3) - (4)]),T_ARRAY);;} break; case 551: /* Line 1455 of yacc.c */ #line 2147 "hphp.y" { _p->onArray((yyval),(yyvsp[(2) - (3)]),T_ARRAY);;} break; case 552: /* Line 1455 of yacc.c */ #line 2152 "hphp.y" { Token t; _p->onName(t,(yyvsp[(1) - (4)]),Parser::StringName); BEXP((yyval),t,(yyvsp[(3) - (4)]),T_COLLECTION);;} break; case 553: /* Line 1455 of yacc.c */ #line 2159 "hphp.y" { Token t; _p->onName(t,(yyvsp[(1) - (4)]),Parser::StringName); BEXP((yyval),t,(yyvsp[(3) - (4)]),T_COLLECTION);;} break; case 554: /* Line 1455 of yacc.c */ #line 2166 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]));;} break; case 555: /* Line 1455 of yacc.c */ #line 2168 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]));;} break; case 556: /* Line 1455 of yacc.c */ #line 2172 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 557: /* Line 1455 of yacc.c */ #line 2173 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 558: /* Line 1455 of yacc.c */ #line 2174 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 559: /* Line 1455 of yacc.c */ #line 2175 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)])); ;} break; case 560: /* Line 1455 of yacc.c */ #line 2177 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 561: /* Line 1455 of yacc.c */ #line 2181 "hphp.y" { _p->onQuery((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)])); ;} break; case 562: /* Line 1455 of yacc.c */ #line 2185 "hphp.y" { _p->onAssign((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0, true);;} break; case 563: /* Line 1455 of yacc.c */ #line 2189 "hphp.y" { _p->onFromClause((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)])); ;} break; case 564: /* Line 1455 of yacc.c */ #line 2194 "hphp.y" { _p->onQueryBody((yyval), &(yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]), NULL); ;} break; case 565: /* Line 1455 of yacc.c */ #line 2196 "hphp.y" { _p->onQueryBody((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(2) - (3)]), &(yyvsp[(3) - (3)])); ;} break; case 566: /* Line 1455 of yacc.c */ #line 2198 "hphp.y" { _p->onQueryBody((yyval), NULL, (yyvsp[(1) - (1)]), NULL); ;} break; case 567: /* Line 1455 of yacc.c */ #line 2200 "hphp.y" { _p->onQueryBody((yyval), NULL, (yyvsp[(1) - (2)]), &(yyvsp[(2) - (2)])); ;} break; case 568: /* Line 1455 of yacc.c */ #line 2204 "hphp.y" { _p->onQueryBodyClause((yyval), NULL, (yyvsp[(1) - (1)])); ;} break; case 569: /* Line 1455 of yacc.c */ #line 2206 "hphp.y" { _p->onQueryBodyClause((yyval), &(yyvsp[(1) - (2)]), (yyvsp[(2) - (2)])); ;} break; case 570: /* Line 1455 of yacc.c */ #line 2210 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 571: /* Line 1455 of yacc.c */ #line 2211 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 572: /* Line 1455 of yacc.c */ #line 2212 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 573: /* Line 1455 of yacc.c */ #line 2213 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 574: /* Line 1455 of yacc.c */ #line 2214 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 575: /* Line 1455 of yacc.c */ #line 2215 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 576: /* Line 1455 of yacc.c */ #line 2219 "hphp.y" { _p->onFromClause((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)])); ;} break; case 577: /* Line 1455 of yacc.c */ #line 2223 "hphp.y" { _p->onLetClause((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)])); ;} break; case 578: /* Line 1455 of yacc.c */ #line 2227 "hphp.y" { _p->onWhereClause((yyval), (yyvsp[(2) - (2)])); ;} break; case 579: /* Line 1455 of yacc.c */ #line 2232 "hphp.y" { _p->onJoinClause((yyval), (yyvsp[(2) - (8)]), (yyvsp[(4) - (8)]), (yyvsp[(6) - (8)]), (yyvsp[(8) - (8)])); ;} break; case 580: /* Line 1455 of yacc.c */ #line 2237 "hphp.y" { _p->onJoinIntoClause((yyval), (yyvsp[(2) - (10)]), (yyvsp[(4) - (10)]), (yyvsp[(6) - (10)]), (yyvsp[(8) - (10)]), (yyvsp[(10) - (10)])); ;} break; case 581: /* Line 1455 of yacc.c */ #line 2241 "hphp.y" { _p->onOrderbyClause((yyval), (yyvsp[(2) - (2)])); ;} break; case 582: /* Line 1455 of yacc.c */ #line 2245 "hphp.y" { _p->onOrdering((yyval), NULL, (yyvsp[(1) - (1)])); ;} break; case 583: /* Line 1455 of yacc.c */ #line 2246 "hphp.y" { _p->onOrdering((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)])); ;} break; case 584: /* Line 1455 of yacc.c */ #line 2250 "hphp.y" { _p->onOrderingExpr((yyval), (yyvsp[(1) - (1)]), NULL); ;} break; case 585: /* Line 1455 of yacc.c */ #line 2251 "hphp.y" { _p->onOrderingExpr((yyval), (yyvsp[(1) - (2)]), &(yyvsp[(2) - (2)])); ;} break; case 586: /* Line 1455 of yacc.c */ #line 2255 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 587: /* Line 1455 of yacc.c */ #line 2256 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 588: /* Line 1455 of yacc.c */ #line 2260 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 589: /* Line 1455 of yacc.c */ #line 2261 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 590: /* Line 1455 of yacc.c */ #line 2265 "hphp.y" { _p->onSelectClause((yyval), (yyvsp[(2) - (2)])); ;} break; case 591: /* Line 1455 of yacc.c */ #line 2269 "hphp.y" { _p->onGroupClause((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)])); ;} break; case 592: /* Line 1455 of yacc.c */ #line 2273 "hphp.y" { _p->onIntoClause((yyval), (yyvsp[(2) - (3)]), (yyvsp[(3) - (3)])); ;} break; case 593: /* Line 1455 of yacc.c */ #line 2277 "hphp.y" { _p->onClosureParam((yyval),&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 594: /* Line 1455 of yacc.c */ #line 2278 "hphp.y" { _p->onClosureParam((yyval),&(yyvsp[(1) - (4)]),(yyvsp[(4) - (4)]),1);;} break; case 595: /* Line 1455 of yacc.c */ #line 2279 "hphp.y" { _p->onClosureParam((yyval), 0,(yyvsp[(1) - (1)]),0);;} break; case 596: /* Line 1455 of yacc.c */ #line 2280 "hphp.y" { _p->onClosureParam((yyval), 0,(yyvsp[(2) - (2)]),1);;} break; case 597: /* Line 1455 of yacc.c */ #line 2287 "hphp.y" { xhp_tag(_p,(yyval),(yyvsp[(2) - (4)]),(yyvsp[(3) - (4)]));;} break; case 598: /* Line 1455 of yacc.c */ #line 2290 "hphp.y" { Token t1; _p->onArray(t1,(yyvsp[(1) - (2)])); Token t2; _p->onArray(t2,(yyvsp[(2) - (2)])); Token file; scalar_file(_p, file); Token line; scalar_line(_p, line); _p->onCallParam((yyvsp[(1) - (2)]),NULL,t1,0,0); _p->onCallParam((yyval), &(yyvsp[(1) - (2)]),t2,0,0); _p->onCallParam((yyvsp[(1) - (2)]), &(yyvsp[(1) - (2)]),file,0,0); _p->onCallParam((yyvsp[(1) - (2)]), &(yyvsp[(1) - (2)]),line,0,0); (yyval).setText("");;} break; case 599: /* Line 1455 of yacc.c */ #line 2301 "hphp.y" { Token file; scalar_file(_p, file); Token line; scalar_line(_p, line); _p->onArray((yyvsp[(4) - (6)]),(yyvsp[(1) - (6)])); _p->onArray((yyvsp[(5) - (6)]),(yyvsp[(3) - (6)])); _p->onCallParam((yyvsp[(2) - (6)]),NULL,(yyvsp[(4) - (6)]),0,0); _p->onCallParam((yyval), &(yyvsp[(2) - (6)]),(yyvsp[(5) - (6)]),0,0); _p->onCallParam((yyvsp[(2) - (6)]), &(yyvsp[(2) - (6)]),file,0,0); _p->onCallParam((yyvsp[(2) - (6)]), &(yyvsp[(2) - (6)]),line,0,0); (yyval).setText((yyvsp[(6) - (6)]).text());;} break; case 600: /* Line 1455 of yacc.c */ #line 2312 "hphp.y" { (yyval).reset(); (yyval).setText("");;} break; case 601: /* Line 1455 of yacc.c */ #line 2313 "hphp.y" { (yyval).reset(); (yyval).setText((yyvsp[(1) - (1)]));;} break; case 602: /* Line 1455 of yacc.c */ #line 2318 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (4)]),&(yyvsp[(2) - (4)]),(yyvsp[(4) - (4)]),0);;} break; case 603: /* Line 1455 of yacc.c */ #line 2319 "hphp.y" { (yyval).reset();;} break; case 604: /* Line 1455 of yacc.c */ #line 2322 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (2)]),0,(yyvsp[(2) - (2)]),0);;} break; case 605: /* Line 1455 of yacc.c */ #line 2323 "hphp.y" { (yyval).reset();;} break; case 606: /* Line 1455 of yacc.c */ #line 2326 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)]));;} break; case 607: /* Line 1455 of yacc.c */ #line 2330 "hphp.y" { (yyvsp[(1) - (1)]).xhpDecode(); _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)]));;} break; case 608: /* Line 1455 of yacc.c */ #line 2333 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 609: /* Line 1455 of yacc.c */ #line 2336 "hphp.y" { (yyval).reset(); if ((yyvsp[(1) - (1)]).htmlTrim()) { (yyvsp[(1) - (1)]).xhpDecode(); _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)])); } ;} break; case 610: /* Line 1455 of yacc.c */ #line 2343 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]); ;} break; case 611: /* Line 1455 of yacc.c */ #line 2344 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 612: /* Line 1455 of yacc.c */ #line 2348 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 613: /* Line 1455 of yacc.c */ #line 2350 "hphp.y" { (yyval) = (yyvsp[(1) - (3)]) + ":" + (yyvsp[(3) - (3)]);;} break; case 614: /* Line 1455 of yacc.c */ #line 2352 "hphp.y" { (yyval) = (yyvsp[(1) - (3)]) + "-" + (yyvsp[(3) - (3)]);;} break; case 615: /* Line 1455 of yacc.c */ #line 2355 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 616: /* Line 1455 of yacc.c */ #line 2356 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 617: /* Line 1455 of yacc.c */ #line 2357 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 618: /* Line 1455 of yacc.c */ #line 2358 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 619: /* Line 1455 of yacc.c */ #line 2359 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 620: /* Line 1455 of yacc.c */ #line 2360 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 621: /* Line 1455 of yacc.c */ #line 2361 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 622: /* Line 1455 of yacc.c */ #line 2362 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 623: /* Line 1455 of yacc.c */ #line 2363 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 624: /* Line 1455 of yacc.c */ #line 2364 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 625: /* Line 1455 of yacc.c */ #line 2365 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 626: /* Line 1455 of yacc.c */ #line 2366 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 627: /* Line 1455 of yacc.c */ #line 2367 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 628: /* Line 1455 of yacc.c */ #line 2368 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 629: /* Line 1455 of yacc.c */ #line 2369 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 630: /* Line 1455 of yacc.c */ #line 2370 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 631: /* Line 1455 of yacc.c */ #line 2371 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 632: /* Line 1455 of yacc.c */ #line 2372 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 633: /* Line 1455 of yacc.c */ #line 2373 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 634: /* Line 1455 of yacc.c */ #line 2374 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 635: /* Line 1455 of yacc.c */ #line 2375 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 636: /* Line 1455 of yacc.c */ #line 2376 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 637: /* Line 1455 of yacc.c */ #line 2377 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 638: /* Line 1455 of yacc.c */ #line 2378 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 639: /* Line 1455 of yacc.c */ #line 2379 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 640: /* Line 1455 of yacc.c */ #line 2380 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 641: /* Line 1455 of yacc.c */ #line 2381 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 642: /* Line 1455 of yacc.c */ #line 2382 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 643: /* Line 1455 of yacc.c */ #line 2383 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 644: /* Line 1455 of yacc.c */ #line 2384 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 645: /* Line 1455 of yacc.c */ #line 2385 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 646: /* Line 1455 of yacc.c */ #line 2386 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 647: /* Line 1455 of yacc.c */ #line 2387 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 648: /* Line 1455 of yacc.c */ #line 2388 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 649: /* Line 1455 of yacc.c */ #line 2389 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 650: /* Line 1455 of yacc.c */ #line 2390 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 651: /* Line 1455 of yacc.c */ #line 2391 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 652: /* Line 1455 of yacc.c */ #line 2392 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 653: /* Line 1455 of yacc.c */ #line 2393 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 654: /* Line 1455 of yacc.c */ #line 2394 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 655: /* Line 1455 of yacc.c */ #line 2395 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 656: /* Line 1455 of yacc.c */ #line 2396 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 657: /* Line 1455 of yacc.c */ #line 2397 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 658: /* Line 1455 of yacc.c */ #line 2398 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 659: /* Line 1455 of yacc.c */ #line 2399 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 660: /* Line 1455 of yacc.c */ #line 2400 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 661: /* Line 1455 of yacc.c */ #line 2401 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 662: /* Line 1455 of yacc.c */ #line 2402 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 663: /* Line 1455 of yacc.c */ #line 2403 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 664: /* Line 1455 of yacc.c */ #line 2404 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 665: /* Line 1455 of yacc.c */ #line 2405 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 666: /* Line 1455 of yacc.c */ #line 2406 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 667: /* Line 1455 of yacc.c */ #line 2407 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 668: /* Line 1455 of yacc.c */ #line 2408 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 669: /* Line 1455 of yacc.c */ #line 2409 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 670: /* Line 1455 of yacc.c */ #line 2410 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 671: /* Line 1455 of yacc.c */ #line 2411 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 672: /* Line 1455 of yacc.c */ #line 2412 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 673: /* Line 1455 of yacc.c */ #line 2413 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 674: /* Line 1455 of yacc.c */ #line 2414 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 675: /* Line 1455 of yacc.c */ #line 2415 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 676: /* Line 1455 of yacc.c */ #line 2416 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 677: /* Line 1455 of yacc.c */ #line 2417 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 678: /* Line 1455 of yacc.c */ #line 2418 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 679: /* Line 1455 of yacc.c */ #line 2419 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 680: /* Line 1455 of yacc.c */ #line 2420 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 681: /* Line 1455 of yacc.c */ #line 2421 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 682: /* Line 1455 of yacc.c */ #line 2422 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 683: /* Line 1455 of yacc.c */ #line 2423 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 684: /* Line 1455 of yacc.c */ #line 2424 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 685: /* Line 1455 of yacc.c */ #line 2425 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 686: /* Line 1455 of yacc.c */ #line 2426 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 687: /* Line 1455 of yacc.c */ #line 2427 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 688: /* Line 1455 of yacc.c */ #line 2428 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 689: /* Line 1455 of yacc.c */ #line 2429 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 690: /* Line 1455 of yacc.c */ #line 2430 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 691: /* Line 1455 of yacc.c */ #line 2431 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 692: /* Line 1455 of yacc.c */ #line 2432 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 693: /* Line 1455 of yacc.c */ #line 2433 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 694: /* Line 1455 of yacc.c */ #line 2434 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 695: /* Line 1455 of yacc.c */ #line 2439 "hphp.y" { _p->onCall((yyval),0,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 696: /* Line 1455 of yacc.c */ #line 2443 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 697: /* Line 1455 of yacc.c */ #line 2444 "hphp.y" { (yyvsp[(1) - (1)]).xhpLabel(); (yyval) = (yyvsp[(1) - (1)]);;} break; case 698: /* Line 1455 of yacc.c */ #line 2448 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::StringName);;} break; case 699: /* Line 1455 of yacc.c */ #line 2449 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::StringName);;} break; case 700: /* Line 1455 of yacc.c */ #line 2450 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::StaticName);;} break; case 701: /* Line 1455 of yacc.c */ #line 2451 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]), Parser::StaticClassExprName);;} break; case 702: /* Line 1455 of yacc.c */ #line 2453 "hphp.y" { _p->onName((yyval),(yyvsp[(2) - (3)]), Parser::StaticClassExprName);;} break; case 703: /* Line 1455 of yacc.c */ #line 2457 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 704: /* Line 1455 of yacc.c */ #line 2466 "hphp.y" { _p->onStaticMember((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 705: /* Line 1455 of yacc.c */ #line 2469 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 706: /* Line 1455 of yacc.c */ #line 2470 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]), Parser::StaticClassExprName);;} break; case 707: /* Line 1455 of yacc.c */ #line 2480 "hphp.y" { _p->onStaticMember((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 708: /* Line 1455 of yacc.c */ #line 2484 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::StringName);;} break; case 709: /* Line 1455 of yacc.c */ #line 2485 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::StaticName);;} break; case 710: /* Line 1455 of yacc.c */ #line 2486 "hphp.y" { _p->onName((yyval),(yyvsp[(1) - (1)]),Parser::ExprName);;} break; case 711: /* Line 1455 of yacc.c */ #line 2490 "hphp.y" { (yyval).reset();;} break; case 712: /* Line 1455 of yacc.c */ #line 2491 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 713: /* Line 1455 of yacc.c */ #line 2492 "hphp.y" { (yyval).reset();;} break; case 714: /* Line 1455 of yacc.c */ #line 2496 "hphp.y" { (yyval).reset();;} break; case 715: /* Line 1455 of yacc.c */ #line 2497 "hphp.y" { _p->addEncap((yyval), NULL, (yyvsp[(1) - (1)]), 0);;} break; case 716: /* Line 1455 of yacc.c */ #line 2498 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 717: /* Line 1455 of yacc.c */ #line 2502 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 718: /* Line 1455 of yacc.c */ #line 2503 "hphp.y" { (yyval).reset();;} break; case 719: /* Line 1455 of yacc.c */ #line 2507 "hphp.y" { _p->onScalar((yyval), T_LNUMBER, (yyvsp[(1) - (1)]));;} break; case 720: /* Line 1455 of yacc.c */ #line 2508 "hphp.y" { _p->onScalar((yyval), T_DNUMBER, (yyvsp[(1) - (1)]));;} break; case 721: /* Line 1455 of yacc.c */ #line 2509 "hphp.y" { _p->onScalar((yyval), T_ONUMBER, (yyvsp[(1) - (1)]));;} break; case 722: /* Line 1455 of yacc.c */ #line 2510 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (1)]));;} break; case 723: /* Line 1455 of yacc.c */ #line 2512 "hphp.y" { _p->onScalar((yyval), T_LINE, (yyvsp[(1) - (1)]));;} break; case 724: /* Line 1455 of yacc.c */ #line 2513 "hphp.y" { _p->onScalar((yyval), T_FILE, (yyvsp[(1) - (1)]));;} break; case 725: /* Line 1455 of yacc.c */ #line 2514 "hphp.y" { _p->onScalar((yyval), T_DIR, (yyvsp[(1) - (1)]));;} break; case 726: /* Line 1455 of yacc.c */ #line 2515 "hphp.y" { _p->onScalar((yyval), T_CLASS_C, (yyvsp[(1) - (1)]));;} break; case 727: /* Line 1455 of yacc.c */ #line 2516 "hphp.y" { _p->onScalar((yyval), T_TRAIT_C, (yyvsp[(1) - (1)]));;} break; case 728: /* Line 1455 of yacc.c */ #line 2517 "hphp.y" { _p->onScalar((yyval), T_METHOD_C, (yyvsp[(1) - (1)]));;} break; case 729: /* Line 1455 of yacc.c */ #line 2518 "hphp.y" { _p->onScalar((yyval), T_FUNC_C, (yyvsp[(1) - (1)]));;} break; case 730: /* Line 1455 of yacc.c */ #line 2519 "hphp.y" { _p->onScalar((yyval), T_NS_C, (yyvsp[(1) - (1)]));;} break; case 731: /* Line 1455 of yacc.c */ #line 2520 "hphp.y" { _p->onScalar((yyval), T_COMPILER_HALT_OFFSET, (yyvsp[(1) - (1)]));;} break; case 732: /* Line 1455 of yacc.c */ #line 2523 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(2) - (3)]));;} break; case 733: /* Line 1455 of yacc.c */ #line 2525 "hphp.y" { (yyval).setText(""); _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyval));;} break; case 734: /* Line 1455 of yacc.c */ #line 2529 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 735: /* Line 1455 of yacc.c */ #line 2530 "hphp.y" { _p->onConstantValue((yyval), (yyvsp[(1) - (1)]));;} break; case 736: /* Line 1455 of yacc.c */ #line 2532 "hphp.y" { _p->onArray((yyval),(yyvsp[(3) - (4)]),T_ARRAY); ;} break; case 737: /* Line 1455 of yacc.c */ #line 2533 "hphp.y" { _p->onArray((yyval),(yyvsp[(2) - (3)]),T_ARRAY); ;} break; case 738: /* Line 1455 of yacc.c */ #line 2535 "hphp.y" { _p->onArray((yyval),(yyvsp[(3) - (4)]),T_ARRAY); ;} break; case 739: /* Line 1455 of yacc.c */ #line 2536 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 740: /* Line 1455 of yacc.c */ #line 2537 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 741: /* Line 1455 of yacc.c */ #line 2538 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 742: /* Line 1455 of yacc.c */ #line 2540 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_BOOLEAN_OR);;} break; case 743: /* Line 1455 of yacc.c */ #line 2542 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_BOOLEAN_AND);;} break; case 744: /* Line 1455 of yacc.c */ #line 2544 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_OR);;} break; case 745: /* Line 1455 of yacc.c */ #line 2546 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_AND);;} break; case 746: /* Line 1455 of yacc.c */ #line 2548 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_LOGICAL_XOR);;} break; case 747: /* Line 1455 of yacc.c */ #line 2549 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'|');;} break; case 748: /* Line 1455 of yacc.c */ #line 2550 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'&');;} break; case 749: /* Line 1455 of yacc.c */ #line 2551 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'^');;} break; case 750: /* Line 1455 of yacc.c */ #line 2552 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'.');;} break; case 751: /* Line 1455 of yacc.c */ #line 2553 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'+');;} break; case 752: /* Line 1455 of yacc.c */ #line 2554 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'-');;} break; case 753: /* Line 1455 of yacc.c */ #line 2555 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'*');;} break; case 754: /* Line 1455 of yacc.c */ #line 2556 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'/');;} break; case 755: /* Line 1455 of yacc.c */ #line 2557 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'%');;} break; case 756: /* Line 1455 of yacc.c */ #line 2558 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SL);;} break; case 757: /* Line 1455 of yacc.c */ #line 2559 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SR);;} break; case 758: /* Line 1455 of yacc.c */ #line 2560 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_POW);;} break; case 759: /* Line 1455 of yacc.c */ #line 2561 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'!',1);;} break; case 760: /* Line 1455 of yacc.c */ #line 2562 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'~',1);;} break; case 761: /* Line 1455 of yacc.c */ #line 2563 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'+',1);;} break; case 762: /* Line 1455 of yacc.c */ #line 2564 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'-',1);;} break; case 763: /* Line 1455 of yacc.c */ #line 2566 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_IDENTICAL);;} break; case 764: /* Line 1455 of yacc.c */ #line 2568 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_NOT_IDENTICAL);;} break; case 765: /* Line 1455 of yacc.c */ #line 2570 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_EQUAL);;} break; case 766: /* Line 1455 of yacc.c */ #line 2572 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_IS_NOT_EQUAL);;} break; case 767: /* Line 1455 of yacc.c */ #line 2573 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'<');;} break; case 768: /* Line 1455 of yacc.c */ #line 2575 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]), T_IS_SMALLER_OR_EQUAL);;} break; case 769: /* Line 1455 of yacc.c */ #line 2577 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),'>');;} break; case 770: /* Line 1455 of yacc.c */ #line 2580 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]), T_IS_GREATER_OR_EQUAL);;} break; case 771: /* Line 1455 of yacc.c */ #line 2584 "hphp.y" { BEXP((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),T_SPACESHIP);;} break; case 772: /* Line 1455 of yacc.c */ #line 2587 "hphp.y" { _p->onQOp((yyval), (yyvsp[(1) - (5)]), &(yyvsp[(3) - (5)]), (yyvsp[(5) - (5)]));;} break; case 773: /* Line 1455 of yacc.c */ #line 2588 "hphp.y" { _p->onQOp((yyval), (yyvsp[(1) - (4)]), 0, (yyvsp[(4) - (4)]));;} break; case 774: /* Line 1455 of yacc.c */ #line 2594 "hphp.y" { _p->onClassConst((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 1);;} break; case 775: /* Line 1455 of yacc.c */ #line 2596 "hphp.y" { (yyvsp[(1) - (3)]).xhpLabel(); _p->onClassConst((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 1);;} break; case 776: /* Line 1455 of yacc.c */ #line 2600 "hphp.y" { _p->onClassClass((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 1);;} break; case 777: /* Line 1455 of yacc.c */ #line 2604 "hphp.y" { _p->onConstantValue((yyval), (yyvsp[(1) - (1)]));;} break; case 778: /* Line 1455 of yacc.c */ #line 2605 "hphp.y" { _p->onConstantValue((yyval), (yyvsp[(1) - (1)]));;} break; case 779: /* Line 1455 of yacc.c */ #line 2606 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 780: /* Line 1455 of yacc.c */ #line 2607 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 781: /* Line 1455 of yacc.c */ #line 2608 "hphp.y" { _p->onEncapsList((yyval),'"',(yyvsp[(2) - (3)]));;} break; case 782: /* Line 1455 of yacc.c */ #line 2609 "hphp.y" { _p->onEncapsList((yyval),'\'',(yyvsp[(2) - (3)]));;} break; case 783: /* Line 1455 of yacc.c */ #line 2611 "hphp.y" { _p->onEncapsList((yyval),T_START_HEREDOC, (yyvsp[(2) - (3)]));;} break; case 784: /* Line 1455 of yacc.c */ #line 2616 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 785: /* Line 1455 of yacc.c */ #line 2617 "hphp.y" { (yyval).reset();;} break; case 786: /* Line 1455 of yacc.c */ #line 2621 "hphp.y" { (yyval).reset();;} break; case 787: /* Line 1455 of yacc.c */ #line 2622 "hphp.y" { (yyval).reset();;} break; case 788: /* Line 1455 of yacc.c */ #line 2625 "hphp.y" { only_in_hh_syntax(_p); (yyval).reset();;} break; case 789: /* Line 1455 of yacc.c */ #line 2626 "hphp.y" { (yyval).reset();;} break; case 790: /* Line 1455 of yacc.c */ #line 2632 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0);;} break; case 791: /* Line 1455 of yacc.c */ #line 2634 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]),0);;} break; case 792: /* Line 1455 of yacc.c */ #line 2636 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 793: /* Line 1455 of yacc.c */ #line 2637 "hphp.y" { _p->onArrayPair((yyval), 0, 0,(yyvsp[(1) - (1)]),0);;} break; case 794: /* Line 1455 of yacc.c */ #line 2641 "hphp.y" { _p->onScalar((yyval), T_LNUMBER, (yyvsp[(1) - (1)]));;} break; case 795: /* Line 1455 of yacc.c */ #line 2642 "hphp.y" { _p->onScalar((yyval), T_DNUMBER, (yyvsp[(1) - (1)]));;} break; case 796: /* Line 1455 of yacc.c */ #line 2643 "hphp.y" { _p->onScalar((yyval), T_ONUMBER, (yyvsp[(1) - (1)]));;} break; case 797: /* Line 1455 of yacc.c */ #line 2646 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(2) - (3)]));;} break; case 798: /* Line 1455 of yacc.c */ #line 2648 "hphp.y" { (yyval).setText(""); _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyval));;} break; case 799: /* Line 1455 of yacc.c */ #line 2651 "hphp.y" { _p->onScalar((yyval),T_LNUMBER,(yyvsp[(1) - (1)]));;} break; case 800: /* Line 1455 of yacc.c */ #line 2652 "hphp.y" { _p->onScalar((yyval),T_DNUMBER,(yyvsp[(1) - (1)]));;} break; case 801: /* Line 1455 of yacc.c */ #line 2653 "hphp.y" { _p->onScalar((yyval),T_ONUMBER,(yyvsp[(1) - (1)]));;} break; case 802: /* Line 1455 of yacc.c */ #line 2654 "hphp.y" { constant_ae(_p,(yyval),(yyvsp[(1) - (1)]));;} break; case 803: /* Line 1455 of yacc.c */ #line 2658 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING,(yyvsp[(1) - (1)]));;} break; case 804: /* Line 1455 of yacc.c */ #line 2661 "hphp.y" { _p->onScalar((yyval), T_CONSTANT_ENCAPSED_STRING, (yyvsp[(1) - (3)]) + (yyvsp[(3) - (3)]));;} break; case 806: /* Line 1455 of yacc.c */ #line 2668 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 807: /* Line 1455 of yacc.c */ #line 2669 "hphp.y" { constant_ae(_p,(yyval),(yyvsp[(1) - (1)]));;} break; case 808: /* Line 1455 of yacc.c */ #line 2670 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'+',1);;} break; case 809: /* Line 1455 of yacc.c */ #line 2671 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),'-',1);;} break; case 810: /* Line 1455 of yacc.c */ #line 2673 "hphp.y" { _p->onArray((yyval),(yyvsp[(3) - (4)]),T_ARRAY);;} break; case 811: /* Line 1455 of yacc.c */ #line 2674 "hphp.y" { _p->onArray((yyval),(yyvsp[(2) - (3)]),T_ARRAY);;} break; case 812: /* Line 1455 of yacc.c */ #line 2676 "hphp.y" { _p->onArray((yyval),(yyvsp[(3) - (4)]),T_ARRAY); ;} break; case 813: /* Line 1455 of yacc.c */ #line 2681 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 814: /* Line 1455 of yacc.c */ #line 2682 "hphp.y" { (yyval).reset();;} break; case 815: /* Line 1455 of yacc.c */ #line 2687 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0);;} break; case 816: /* Line 1455 of yacc.c */ #line 2689 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]),0);;} break; case 817: /* Line 1455 of yacc.c */ #line 2691 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 818: /* Line 1455 of yacc.c */ #line 2692 "hphp.y" { _p->onArrayPair((yyval), 0, 0,(yyvsp[(1) - (1)]),0);;} break; case 819: /* Line 1455 of yacc.c */ #line 2696 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]),0);;} break; case 820: /* Line 1455 of yacc.c */ #line 2697 "hphp.y" { _p->onArrayPair((yyval), 0, 0,(yyvsp[(1) - (1)]),0);;} break; case 821: /* Line 1455 of yacc.c */ #line 2702 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]); ;} break; case 822: /* Line 1455 of yacc.c */ #line 2703 "hphp.y" { (yyval).reset(); ;} break; case 823: /* Line 1455 of yacc.c */ #line 2708 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0); ;} break; case 824: /* Line 1455 of yacc.c */ #line 2711 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0); ;} break; case 825: /* Line 1455 of yacc.c */ #line 2716 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 826: /* Line 1455 of yacc.c */ #line 2717 "hphp.y" { (yyval).reset();;} break; case 827: /* Line 1455 of yacc.c */ #line 2720 "hphp.y" { _p->onArray((yyval),(yyvsp[(2) - (3)]),T_ARRAY);;} break; case 828: /* Line 1455 of yacc.c */ #line 2721 "hphp.y" { Token t; t.reset(); _p->onArray((yyval),t,T_ARRAY);;} break; case 829: /* Line 1455 of yacc.c */ #line 2728 "hphp.y" { _p->onUserAttribute((yyval),&(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),(yyvsp[(4) - (4)]));;} break; case 830: /* Line 1455 of yacc.c */ #line 2730 "hphp.y" { _p->onUserAttribute((yyval), 0,(yyvsp[(1) - (2)]),(yyvsp[(2) - (2)]));;} break; case 831: /* Line 1455 of yacc.c */ #line 2733 "hphp.y" { only_in_hh_syntax(_p);;} break; case 832: /* Line 1455 of yacc.c */ #line 2735 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 833: /* Line 1455 of yacc.c */ #line 2738 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 834: /* Line 1455 of yacc.c */ #line 2741 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 835: /* Line 1455 of yacc.c */ #line 2742 "hphp.y" { (yyval).reset();;} break; case 836: /* Line 1455 of yacc.c */ #line 2746 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = 0;;} break; case 837: /* Line 1455 of yacc.c */ #line 2747 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = 1;;} break; case 838: /* Line 1455 of yacc.c */ #line 2751 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = HPHP::ObjPropNormal;;} break; case 839: /* Line 1455 of yacc.c */ #line 2752 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = HPHP::ObjPropXhpAttr;;} break; case 840: /* Line 1455 of yacc.c */ #line 2753 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]); (yyval) = HPHP::ObjPropNormal;;} break; case 841: /* Line 1455 of yacc.c */ #line 2757 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 842: /* Line 1455 of yacc.c */ #line 2762 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = HPHP::ObjPropNormal;;} break; case 843: /* Line 1455 of yacc.c */ #line 2767 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 844: /* Line 1455 of yacc.c */ #line 2768 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 845: /* Line 1455 of yacc.c */ #line 2772 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 846: /* Line 1455 of yacc.c */ #line 2777 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 847: /* Line 1455 of yacc.c */ #line 2782 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 848: /* Line 1455 of yacc.c */ #line 2783 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 849: /* Line 1455 of yacc.c */ #line 2787 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 850: /* Line 1455 of yacc.c */ #line 2789 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)]));;} break; case 851: /* Line 1455 of yacc.c */ #line 2794 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 852: /* Line 1455 of yacc.c */ #line 2796 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)]));;} break; case 853: /* Line 1455 of yacc.c */ #line 2802 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(2) - (5)]), !(yyvsp[(4) - (5)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(5) - (5)]) ); ;} break; case 854: /* Line 1455 of yacc.c */ #line 2813 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(2) - (5)]), !(yyvsp[(4) - (5)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(5) - (5)]) ); ;} break; case 855: /* Line 1455 of yacc.c */ #line 2828 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(2) - (5)]), !(yyvsp[(4) - (5)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(5) - (5)]) ); ;} break; case 856: /* Line 1455 of yacc.c */ #line 2840 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(2) - (5)]), !(yyvsp[(4) - (5)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(5) - (5)]) ); ;} break; case 857: /* Line 1455 of yacc.c */ #line 2852 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 858: /* Line 1455 of yacc.c */ #line 2853 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 859: /* Line 1455 of yacc.c */ #line 2854 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 860: /* Line 1455 of yacc.c */ #line 2855 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 861: /* Line 1455 of yacc.c */ #line 2856 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 862: /* Line 1455 of yacc.c */ #line 2857 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 863: /* Line 1455 of yacc.c */ #line 2859 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(1) - (3)]), !(yyvsp[(2) - (3)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(3) - (3)]) ); ;} break; case 864: /* Line 1455 of yacc.c */ #line 2876 "hphp.y" { _p->onStaticMember((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 865: /* Line 1455 of yacc.c */ #line 2878 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 866: /* Line 1455 of yacc.c */ #line 2880 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 867: /* Line 1455 of yacc.c */ #line 2881 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 868: /* Line 1455 of yacc.c */ #line 2885 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 869: /* Line 1455 of yacc.c */ #line 2886 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 870: /* Line 1455 of yacc.c */ #line 2887 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 871: /* Line 1455 of yacc.c */ #line 2888 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 872: /* Line 1455 of yacc.c */ #line 2896 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(1) - (3)]), !(yyvsp[(2) - (3)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(3) - (3)]) ); ;} break; case 873: /* Line 1455 of yacc.c */ #line 2905 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 874: /* Line 1455 of yacc.c */ #line 2907 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 875: /* Line 1455 of yacc.c */ #line 2908 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 876: /* Line 1455 of yacc.c */ #line 2912 "hphp.y" { _p->onStaticMember((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 877: /* Line 1455 of yacc.c */ #line 2917 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 878: /* Line 1455 of yacc.c */ #line 2918 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 879: /* Line 1455 of yacc.c */ #line 2919 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 880: /* Line 1455 of yacc.c */ #line 2920 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 881: /* Line 1455 of yacc.c */ #line 2921 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 882: /* Line 1455 of yacc.c */ #line 2922 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 883: /* Line 1455 of yacc.c */ #line 2923 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 884: /* Line 1455 of yacc.c */ #line 2925 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 885: /* Line 1455 of yacc.c */ #line 2927 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(1) - (4)]),(yyvsp[(3) - (4)]),NULL);;} break; case 886: /* Line 1455 of yacc.c */ #line 2931 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 887: /* Line 1455 of yacc.c */ #line 2935 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 888: /* Line 1455 of yacc.c */ #line 2936 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 889: /* Line 1455 of yacc.c */ #line 2942 "hphp.y" { _p->onObjectMethodCall((yyval),(yyvsp[(1) - (7)]),(yyvsp[(2) - (7)]).num(),(yyvsp[(3) - (7)]),(yyvsp[(6) - (7)]));;} break; case 890: /* Line 1455 of yacc.c */ #line 2946 "hphp.y" { _p->onObjectMethodCall((yyval),(yyvsp[(2) - (9)]),(yyvsp[(4) - (9)]).num(),(yyvsp[(5) - (9)]),(yyvsp[(8) - (9)]));;} break; case 891: /* Line 1455 of yacc.c */ #line 2953 "hphp.y" { _p->onCall((yyval),0,(yyvsp[(3) - (7)]),(yyvsp[(6) - (7)]),&(yyvsp[(1) - (7)]));;} break; case 892: /* Line 1455 of yacc.c */ #line 2962 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(3) - (6)]),(yyvsp[(5) - (6)]),&(yyvsp[(1) - (6)]));;} break; case 893: /* Line 1455 of yacc.c */ #line 2966 "hphp.y" { _p->onCall((yyval),1,(yyvsp[(4) - (8)]),(yyvsp[(7) - (8)]),&(yyvsp[(1) - (8)]));;} break; case 894: /* Line 1455 of yacc.c */ #line 2970 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 895: /* Line 1455 of yacc.c */ #line 2979 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]));;} break; case 896: /* Line 1455 of yacc.c */ #line 2980 "hphp.y" { _p->onRefDim((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]));;} break; case 897: /* Line 1455 of yacc.c */ #line 2981 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 898: /* Line 1455 of yacc.c */ #line 2985 "hphp.y" { _p->onSimpleVariable((yyval), (yyvsp[(1) - (1)]));;} break; case 899: /* Line 1455 of yacc.c */ #line 2986 "hphp.y" { _p->onDynamicVariable((yyval), (yyvsp[(3) - (4)]), 0);;} break; case 900: /* Line 1455 of yacc.c */ #line 2988 "hphp.y" { (yyvsp[(1) - (2)]) = 1; _p->onIndirectRef((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]));;} break; case 901: /* Line 1455 of yacc.c */ #line 2993 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 902: /* Line 1455 of yacc.c */ #line 2994 "hphp.y" { (yyval).reset();;} break; case 903: /* Line 1455 of yacc.c */ #line 3005 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 904: /* Line 1455 of yacc.c */ #line 3006 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 905: /* Line 1455 of yacc.c */ #line 3007 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 906: /* Line 1455 of yacc.c */ #line 3010 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(1) - (3)]), !(yyvsp[(2) - (3)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(3) - (3)]) ); ;} break; case 907: /* Line 1455 of yacc.c */ #line 3021 "hphp.y" { _p->onStaticMember((yyval),(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 908: /* Line 1455 of yacc.c */ #line 3022 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 910: /* Line 1455 of yacc.c */ #line 3026 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 911: /* Line 1455 of yacc.c */ #line 3027 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]);;} break; case 912: /* Line 1455 of yacc.c */ #line 3030 "hphp.y" { _p->onObjectProperty( (yyval), (yyvsp[(1) - (3)]), !(yyvsp[(2) - (3)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(3) - (3)]) ); ;} break; case 913: /* Line 1455 of yacc.c */ #line 3039 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 914: /* Line 1455 of yacc.c */ #line 3043 "hphp.y" { _p->onAListVar((yyval),&(yyvsp[(1) - (2)]),NULL);;} break; case 915: /* Line 1455 of yacc.c */ #line 3044 "hphp.y" { _p->onAListVar((yyval),&(yyvsp[(1) - (3)]),&(yyvsp[(3) - (3)]));;} break; case 916: /* Line 1455 of yacc.c */ #line 3046 "hphp.y" { _p->onAListSub((yyval),&(yyvsp[(1) - (6)]),(yyvsp[(5) - (6)]));;} break; case 917: /* Line 1455 of yacc.c */ #line 3047 "hphp.y" { _p->onAListVar((yyval),NULL,NULL);;} break; case 918: /* Line 1455 of yacc.c */ #line 3048 "hphp.y" { _p->onAListVar((yyval),NULL,&(yyvsp[(1) - (1)]));;} break; case 919: /* Line 1455 of yacc.c */ #line 3049 "hphp.y" { _p->onAListSub((yyval),NULL,(yyvsp[(3) - (4)]));;} break; case 920: /* Line 1455 of yacc.c */ #line 3054 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 921: /* Line 1455 of yacc.c */ #line 3055 "hphp.y" { (yyval).reset();;} break; case 922: /* Line 1455 of yacc.c */ #line 3059 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]),0);;} break; case 923: /* Line 1455 of yacc.c */ #line 3060 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]),0);;} break; case 924: /* Line 1455 of yacc.c */ #line 3061 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]),0);;} break; case 925: /* Line 1455 of yacc.c */ #line 3062 "hphp.y" { _p->onArrayPair((yyval), 0, 0,(yyvsp[(1) - (1)]),0);;} break; case 926: /* Line 1455 of yacc.c */ #line 3065 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (6)]),&(yyvsp[(3) - (6)]),(yyvsp[(6) - (6)]),1);;} break; case 927: /* Line 1455 of yacc.c */ #line 3067 "hphp.y" { _p->onArrayPair((yyval),&(yyvsp[(1) - (4)]), 0,(yyvsp[(4) - (4)]),1);;} break; case 928: /* Line 1455 of yacc.c */ #line 3068 "hphp.y" { _p->onArrayPair((yyval), 0,&(yyvsp[(1) - (4)]),(yyvsp[(4) - (4)]),1);;} break; case 929: /* Line 1455 of yacc.c */ #line 3069 "hphp.y" { _p->onArrayPair((yyval), 0, 0,(yyvsp[(2) - (2)]),1);;} break; case 930: /* Line 1455 of yacc.c */ #line 3074 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 931: /* Line 1455 of yacc.c */ #line 3075 "hphp.y" { _p->onEmptyCollection((yyval));;} break; case 932: /* Line 1455 of yacc.c */ #line 3079 "hphp.y" { _p->onCollectionPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 933: /* Line 1455 of yacc.c */ #line 3080 "hphp.y" { _p->onCollectionPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]));;} break; case 934: /* Line 1455 of yacc.c */ #line 3081 "hphp.y" { _p->onCollectionPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 935: /* Line 1455 of yacc.c */ #line 3082 "hphp.y" { _p->onCollectionPair((yyval), 0, 0,(yyvsp[(1) - (1)]));;} break; case 936: /* Line 1455 of yacc.c */ #line 3087 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]);;} break; case 937: /* Line 1455 of yacc.c */ #line 3088 "hphp.y" { _p->onEmptyCollection((yyval));;} break; case 938: /* Line 1455 of yacc.c */ #line 3093 "hphp.y" { _p->onCollectionPair((yyval),&(yyvsp[(1) - (5)]),&(yyvsp[(3) - (5)]),(yyvsp[(5) - (5)]));;} break; case 939: /* Line 1455 of yacc.c */ #line 3095 "hphp.y" { _p->onCollectionPair((yyval),&(yyvsp[(1) - (3)]), 0,(yyvsp[(3) - (3)]));;} break; case 940: /* Line 1455 of yacc.c */ #line 3097 "hphp.y" { _p->onCollectionPair((yyval), 0,&(yyvsp[(1) - (3)]),(yyvsp[(3) - (3)]));;} break; case 941: /* Line 1455 of yacc.c */ #line 3098 "hphp.y" { _p->onCollectionPair((yyval), 0, 0,(yyvsp[(1) - (1)]));;} break; case 942: /* Line 1455 of yacc.c */ #line 3102 "hphp.y" { _p->addEncap((yyval), &(yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]), -1);;} break; case 943: /* Line 1455 of yacc.c */ #line 3104 "hphp.y" { _p->addEncap((yyval), &(yyvsp[(1) - (2)]), (yyvsp[(2) - (2)]), 0);;} break; case 944: /* Line 1455 of yacc.c */ #line 3105 "hphp.y" { _p->addEncap((yyval), NULL, (yyvsp[(1) - (1)]), -1);;} break; case 945: /* Line 1455 of yacc.c */ #line 3107 "hphp.y" { _p->addEncap((yyval), NULL, (yyvsp[(1) - (2)]), 0); _p->addEncap((yyval), &(yyval), (yyvsp[(2) - (2)]), -1); ;} break; case 946: /* Line 1455 of yacc.c */ #line 3112 "hphp.y" { _p->onSimpleVariable((yyval), (yyvsp[(1) - (1)]));;} break; case 947: /* Line 1455 of yacc.c */ #line 3114 "hphp.y" { _p->encapRefDim((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)]));;} break; case 948: /* Line 1455 of yacc.c */ #line 3116 "hphp.y" { _p->encapObjProp( (yyval), (yyvsp[(1) - (3)]), !(yyvsp[(2) - (3)]).num() ? HPHP::PropAccessType::Normal : HPHP::PropAccessType::NullSafe, (yyvsp[(3) - (3)]) ); ;} break; case 949: /* Line 1455 of yacc.c */ #line 3126 "hphp.y" { _p->onDynamicVariable((yyval), (yyvsp[(2) - (3)]), 1);;} break; case 950: /* Line 1455 of yacc.c */ #line 3128 "hphp.y" { _p->encapArray((yyval), (yyvsp[(2) - (6)]), (yyvsp[(4) - (6)]));;} break; case 951: /* Line 1455 of yacc.c */ #line 3129 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]);;} break; case 952: /* Line 1455 of yacc.c */ #line 3132 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = T_STRING;;} break; case 953: /* Line 1455 of yacc.c */ #line 3133 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = T_NUM_STRING;;} break; case 954: /* Line 1455 of yacc.c */ #line 3134 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); (yyval) = T_VARIABLE;;} break; case 955: /* Line 1455 of yacc.c */ #line 3138 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),T_ISSET,1);;} break; case 956: /* Line 1455 of yacc.c */ #line 3139 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),T_EMPTY,1);;} break; case 957: /* Line 1455 of yacc.c */ #line 3140 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),'!',1);;} break; case 958: /* Line 1455 of yacc.c */ #line 3141 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),'!',1);;} break; case 959: /* Line 1455 of yacc.c */ #line 3142 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),'!',1);;} break; case 960: /* Line 1455 of yacc.c */ #line 3143 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),'!',1);;} break; case 961: /* Line 1455 of yacc.c */ #line 3144 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_INCLUDE,1);;} break; case 962: /* Line 1455 of yacc.c */ #line 3145 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_INCLUDE_ONCE,1);;} break; case 963: /* Line 1455 of yacc.c */ #line 3146 "hphp.y" { UEXP((yyval),(yyvsp[(3) - (4)]),T_EVAL,1);;} break; case 964: /* Line 1455 of yacc.c */ #line 3147 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_REQUIRE,1);;} break; case 965: /* Line 1455 of yacc.c */ #line 3148 "hphp.y" { UEXP((yyval),(yyvsp[(2) - (2)]),T_REQUIRE_ONCE,1);;} break; case 966: /* Line 1455 of yacc.c */ #line 3152 "hphp.y" { _p->onExprListElem((yyval), NULL, (yyvsp[(1) - (1)]));;} break; case 967: /* Line 1455 of yacc.c */ #line 3153 "hphp.y" { _p->onExprListElem((yyval), &(yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]));;} break; case 968: /* Line 1455 of yacc.c */ #line 3158 "hphp.y" { _p->onClassConst((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0);;} break; case 969: /* Line 1455 of yacc.c */ #line 3160 "hphp.y" { _p->onClassClass((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)]), 0);;} break; case 972: /* Line 1455 of yacc.c */ #line 3174 "hphp.y" { (yyvsp[(2) - (5)]).setText(_p->nsClassDecl((yyvsp[(2) - (5)]).text())); _p->onTypedef((yyval), (yyvsp[(2) - (5)]), (yyvsp[(4) - (5)])); _p->popTypeScope(); ;} break; case 973: /* Line 1455 of yacc.c */ #line 3179 "hphp.y" { (yyvsp[(3) - (6)]).setText(_p->nsClassDecl((yyvsp[(3) - (6)]).text())); _p->onTypedef((yyval), (yyvsp[(3) - (6)]), (yyvsp[(5) - (6)])); _p->popTypeScope(); ;} break; case 974: /* Line 1455 of yacc.c */ #line 3183 "hphp.y" { (yyvsp[(2) - (6)]).setText(_p->nsClassDecl((yyvsp[(2) - (6)]).text())); _p->onTypedef((yyval), (yyvsp[(2) - (6)]), (yyvsp[(5) - (6)])); _p->popTypeScope(); ;} break; case 975: /* Line 1455 of yacc.c */ #line 3188 "hphp.y" { (yyvsp[(3) - (7)]).setText(_p->nsClassDecl((yyvsp[(3) - (7)]).text())); _p->onTypedef((yyval), (yyvsp[(3) - (7)]), (yyvsp[(6) - (7)])); _p->popTypeScope(); ;} break; case 976: /* Line 1455 of yacc.c */ #line 3194 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 977: /* Line 1455 of yacc.c */ #line 3195 "hphp.y" { only_in_hh_syntax(_p); (yyval) = (yyvsp[(2) - (2)]); ;} break; case 978: /* Line 1455 of yacc.c */ #line 3199 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 979: /* Line 1455 of yacc.c */ #line 3200 "hphp.y" { only_in_hh_syntax(_p); (yyval) = (yyvsp[(2) - (2)]); ;} break; case 980: /* Line 1455 of yacc.c */ #line 3206 "hphp.y" { _p->pushTypeScope(); (yyval) = (yyvsp[(1) - (1)]); ;} break; case 981: /* Line 1455 of yacc.c */ #line 3210 "hphp.y" { _p->pushTypeScope(); (yyval) = (yyvsp[(1) - (4)]); ;} break; case 982: /* Line 1455 of yacc.c */ #line 3216 "hphp.y" { _p->pushTypeScope(); (yyval) = (yyvsp[(1) - (1)]); ;} break; case 983: /* Line 1455 of yacc.c */ #line 3220 "hphp.y" { Token t; _p->setTypeVars(t, (yyvsp[(1) - (4)])); _p->pushTypeScope(); (yyval) = t; ;} break; case 984: /* Line 1455 of yacc.c */ #line 3227 "hphp.y" { (yyval) = (yyvsp[(2) - (3)]); ;} break; case 985: /* Line 1455 of yacc.c */ #line 3228 "hphp.y" { (yyval).reset(); ;} break; case 986: /* Line 1455 of yacc.c */ #line 3232 "hphp.y" { Token t; t.reset(); _p->onTypeList((yyvsp[(1) - (1)]), t); (yyval) = (yyvsp[(1) - (1)]); ;} break; case 987: /* Line 1455 of yacc.c */ #line 3235 "hphp.y" { _p->onTypeList((yyvsp[(1) - (3)]), (yyvsp[(3) - (3)])); (yyval) = (yyvsp[(1) - (3)]); ;} break; case 988: /* Line 1455 of yacc.c */ #line 3241 "hphp.y" { (yyval) = (yyvsp[(1) - (2)]); ;} break; case 989: /* Line 1455 of yacc.c */ #line 3246 "hphp.y" { (yyval) = (yyvsp[(1) - (3)]); ;} break; case 990: /* Line 1455 of yacc.c */ #line 3247 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 991: /* Line 1455 of yacc.c */ #line 3248 "hphp.y" { (yyval).reset(); ;} break; case 992: /* Line 1455 of yacc.c */ #line 3249 "hphp.y" { (yyval).reset(); ;} break; case 993: /* Line 1455 of yacc.c */ #line 3253 "hphp.y" { (yyval).reset(); ;} break; case 994: /* Line 1455 of yacc.c */ #line 3254 "hphp.y" { only_in_hh_syntax(_p); (yyval) = (yyvsp[(2) - (2)]); ;} break; case 997: /* Line 1455 of yacc.c */ #line 3264 "hphp.y" { _p->addTypeVar((yyvsp[(4) - (4)]).text()); ;} break; case 998: /* Line 1455 of yacc.c */ #line 3266 "hphp.y" { _p->addTypeVar((yyvsp[(2) - (2)]).text()); ;} break; case 999: /* Line 1455 of yacc.c */ #line 3270 "hphp.y" { _p->addTypeVar((yyvsp[(4) - (5)]).text()); ;} break; case 1000: /* Line 1455 of yacc.c */ #line 3273 "hphp.y" { _p->addTypeVar((yyvsp[(2) - (3)]).text()); ;} break; case 1001: /* Line 1455 of yacc.c */ #line 3277 "hphp.y" {;} break; case 1002: /* Line 1455 of yacc.c */ #line 3278 "hphp.y" {;} break; case 1003: /* Line 1455 of yacc.c */ #line 3279 "hphp.y" {;} break; case 1004: /* Line 1455 of yacc.c */ #line 3285 "hphp.y" { validate_shape_keyname((yyvsp[(1) - (3)]), _p); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)])); ;} break; case 1005: /* Line 1455 of yacc.c */ #line 3290 "hphp.y" { /* should not reach here as * optional shape fields are not * supported in strict mode */ validate_shape_keyname((yyvsp[(2) - (4)]), _p); _p->onTypeAnnotation((yyval), (yyvsp[(2) - (4)]), (yyvsp[(4) - (4)])); ;} break; case 1006: /* Line 1455 of yacc.c */ #line 3301 "hphp.y" { _p->onClsCnsShapeField((yyval), (yyvsp[(1) - (5)]), (yyvsp[(3) - (5)]), (yyvsp[(5) - (5)])); ;} break; case 1007: /* Line 1455 of yacc.c */ #line 3306 "hphp.y" { _p->onTypeList((yyval), (yyvsp[(3) - (3)])); ;} break; case 1008: /* Line 1455 of yacc.c */ #line 3307 "hphp.y" { ;} break; case 1009: /* Line 1455 of yacc.c */ #line 3312 "hphp.y" { _p->onShape((yyval), (yyvsp[(1) - (2)])); ;} break; case 1010: /* Line 1455 of yacc.c */ #line 3313 "hphp.y" { Token t; t.reset(); _p->onShape((yyval), t); ;} break; case 1011: /* Line 1455 of yacc.c */ #line 3319 "hphp.y" { (yyval) = (yyvsp[(3) - (4)]); (yyval).setText("array"); ;} break; case 1012: /* Line 1455 of yacc.c */ #line 3324 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 1013: /* Line 1455 of yacc.c */ #line 3329 "hphp.y" { Token t; t.reset(); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (3)]), t); _p->onTypeList((yyval), (yyvsp[(3) - (3)])); ;} break; case 1014: /* Line 1455 of yacc.c */ #line 3333 "hphp.y" { _p->onTypeAnnotation((yyval), (yyvsp[(1) - (2)]), (yyvsp[(2) - (2)])); ;} break; case 1015: /* Line 1455 of yacc.c */ #line 3340 "hphp.y" { only_in_hh_syntax(_p); _p->onTypeSpecialization((yyvsp[(2) - (2)]), '?'); (yyval) = (yyvsp[(2) - (2)]); ;} break; case 1016: /* Line 1455 of yacc.c */ #line 3343 "hphp.y" { only_in_hh_syntax(_p); _p->onTypeSpecialization((yyvsp[(2) - (2)]), '@'); (yyval) = (yyvsp[(2) - (2)]); ;} break; case 1017: /* Line 1455 of yacc.c */ #line 3346 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 1018: /* Line 1455 of yacc.c */ #line 3347 "hphp.y" { Token t; t.reset(); (yyvsp[(1) - (1)]).setText("array"); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (1)]), t); ;} break; case 1019: /* Line 1455 of yacc.c */ #line 3350 "hphp.y" { Token t; t.reset(); (yyvsp[(1) - (1)]).setText("callable"); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (1)]), t); ;} break; case 1020: /* Line 1455 of yacc.c */ #line 3353 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 1021: /* Line 1455 of yacc.c */ #line 3356 "hphp.y" { only_in_hh_syntax(_p); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (3)]), (yyvsp[(3) - (3)])); _p->onTypeSpecialization((yyval), 'a'); ;} break; case 1022: /* Line 1455 of yacc.c */ #line 3360 "hphp.y" { (yyvsp[(1) - (4)]).setText("array"); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (4)]), (yyvsp[(3) - (4)])); ;} break; case 1023: /* Line 1455 of yacc.c */ #line 3363 "hphp.y" { _p->onTypeList((yyvsp[(3) - (6)]), (yyvsp[(5) - (6)])); (yyvsp[(1) - (6)]).setText("array"); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (6)]), (yyvsp[(3) - (6)])); ;} break; case 1024: /* Line 1455 of yacc.c */ #line 3366 "hphp.y" { (yyvsp[(1) - (1)]).xhpLabel(); Token t; t.reset(); _p->onTypeAnnotation((yyval), (yyvsp[(1) - (1)]), t); _p->onTypeSpecialization((yyval), 'x'); ;} break; case 1025: /* Line 1455 of yacc.c */ #line 3372 "hphp.y" { only_in_hh_syntax(_p); _p->onTypeList((yyvsp[(7) - (8)]), (yyvsp[(4) - (8)])); _p->onTypeAnnotation((yyval), (yyvsp[(2) - (8)]), (yyvsp[(7) - (8)])); _p->onTypeSpecialization((yyval), 'f'); ;} break; case 1026: /* Line 1455 of yacc.c */ #line 3378 "hphp.y" { only_in_hh_syntax(_p); _p->onTypeList((yyvsp[(2) - (6)]), (yyvsp[(4) - (6)])); Token t; t.reset(); t.setText("array"); _p->onTypeAnnotation((yyval), t, (yyvsp[(2) - (6)])); _p->onTypeSpecialization((yyval), 't'); ;} break; case 1027: /* Line 1455 of yacc.c */ #line 3386 "hphp.y" { (yyval) = (yyvsp[(1) - (1)]); ;} break; case 1028: /* Line 1455 of yacc.c */ #line 3387 "hphp.y" { (yyval).reset(); ;} break; /* Line 1455 of yacc.c */ #line 14553 "hphp.7.tab.cpp" default: break; } YY_SYMBOL_PRINT ("-> $$ =", yyr1[yyn], &yyval, &yyloc); YYPOPSTACK (yylen); yylen = 0; YY_STACK_PRINT (yyss, yyssp); *++yyvsp = yyval; *++yylsp = yyloc; /* Now `shift' the result of the reduction. Determine what state that goes to, based on the state we popped back to and the rule number reduced by. */ yyn = yyr1[yyn]; yystate = yypgoto[yyn - YYNTOKENS] + *yyssp; if (0 <= yystate && yystate <= YYLAST && yycheck[yystate] == *yyssp) yystate = yytable[yystate]; else yystate = yydefgoto[yyn - YYNTOKENS]; goto yynewstate; /*------------------------------------. | yyerrlab -- here on detecting error | `------------------------------------*/ yyerrlab: /* If not already recovering from an error, report this error. */ if (!yyerrstatus) { ++yynerrs; #if ! YYERROR_VERBOSE yyerror (&yylloc, _p, YY_("syntax error")); #else { YYSIZE_T yysize = yysyntax_error (0, yystate, yychar); if (yymsg_alloc < yysize && yymsg_alloc < YYSTACK_ALLOC_MAXIMUM) { YYSIZE_T yyalloc = 2 * yysize; if (! (yysize <= yyalloc && yyalloc <= YYSTACK_ALLOC_MAXIMUM)) yyalloc = YYSTACK_ALLOC_MAXIMUM; if (yymsg != yymsgbuf) YYSTACK_FREE (yymsg); yymsg = (char *) YYSTACK_ALLOC (yyalloc); if (yymsg) yymsg_alloc = yyalloc; else { yymsg = yymsgbuf; yymsg_alloc = sizeof yymsgbuf; } } if (0 < yysize && yysize <= yymsg_alloc) { (void) yysyntax_error (yymsg, yystate, yychar); yyerror (&yylloc, _p, yymsg); } else { yyerror (&yylloc, _p, YY_("syntax error")); if (yysize != 0) goto yyexhaustedlab; } } #endif } yyerror_range[0] = yylloc; if (yyerrstatus == 3) { /* If just tried and failed to reuse lookahead token after an error, discard it. */ if (yychar <= YYEOF) { /* Return failure if at end of input. */ if (yychar == YYEOF) YYABORT; } else { yydestruct ("Error: discarding", yytoken, &yylval, &yylloc, _p); yychar = YYEMPTY; } } /* Else will try to reuse lookahead token after shifting the error token. */ goto yyerrlab1; /*---------------------------------------------------. | yyerrorlab -- error raised explicitly by YYERROR. | `---------------------------------------------------*/ yyerrorlab: /* Pacify compilers like GCC when the user code never invokes YYERROR and the label yyerrorlab therefore never appears in user code. */ if (/*CONSTCOND*/ 0) goto yyerrorlab; yyerror_range[0] = yylsp[1-yylen]; /* Do not reclaim the symbols of the rule which action triggered this YYERROR. */ YYPOPSTACK (yylen); yylen = 0; YY_STACK_PRINT (yyss, yyssp); yystate = *yyssp; goto yyerrlab1; /*-------------------------------------------------------------. | yyerrlab1 -- common code for both syntax error and YYERROR. | `-------------------------------------------------------------*/ yyerrlab1: yyerrstatus = 3; /* Each real token shifted decrements this. */ for (;;) { yyn = yypact[yystate]; if (yyn != YYPACT_NINF) { yyn += YYTERROR; if (0 <= yyn && yyn <= YYLAST && yycheck[yyn] == YYTERROR) { yyn = yytable[yyn]; if (0 < yyn) break; } } /* Pop the current state because it cannot handle the error token. */ if (yyssp == yyss) YYABORT; yyerror_range[0] = *yylsp; yydestruct ("Error: popping", yystos[yystate], yyvsp, yylsp, _p); YYPOPSTACK (1); yystate = *yyssp; YY_STACK_PRINT (yyss, yyssp); } *++yyvsp = yylval; yyerror_range[1] = yylloc; /* Using YYLLOC is tempting, but would change the location of the lookahead. YYLOC is available though. */ YYLLOC_DEFAULT (yyloc, (yyerror_range - 1), 2); *++yylsp = yyloc; /* Shift the error token. */ YY_SYMBOL_PRINT ("Shifting", yystos[yyn], yyvsp, yylsp); yystate = yyn; goto yynewstate; /*-------------------------------------. | yyacceptlab -- YYACCEPT comes here. | `-------------------------------------*/ yyacceptlab: yyresult = 0; goto yyreturn; /*-----------------------------------. | yyabortlab -- YYABORT comes here. | `-----------------------------------*/ yyabortlab: yyresult = 1; goto yyreturn; #if !defined(yyoverflow) || YYERROR_VERBOSE /*-------------------------------------------------. | yyexhaustedlab -- memory exhaustion comes here. | `-------------------------------------------------*/ yyexhaustedlab: yyerror (&yylloc, _p, YY_("memory exhausted")); yyresult = 2; /* Fall through. */ #endif yyreturn: if (yychar != YYEMPTY) yydestruct ("Cleanup: discarding lookahead", yytoken, &yylval, &yylloc, _p); /* Do not reclaim the symbols of the rule which action triggered this YYABORT or YYACCEPT. */ YYPOPSTACK (yylen); YY_STACK_PRINT (yyss, yyssp); while (yyssp != yyss) { yydestruct ("Cleanup: popping", yystos[*yyssp], yyvsp, yylsp, _p); YYPOPSTACK (1); } #ifndef yyoverflow if (yyss != yyssa) YYSTACK_FREE (yyss); YYSTACK_CLEANUP; #endif #if YYERROR_VERBOSE if (yymsg != yymsgbuf) YYSTACK_FREE (yymsg); #endif /* Make sure YYID is used. */ return YYID (yyresult); } /* Line 1675 of yacc.c */ #line 3390 "hphp.y" /* !PHP5_ONLY*/ /* REMOVED */ /* !END */ /* !PHP7_ONLY*/ bool Parser::parseImpl7() { /* !END */ return yyparse(this) == 0; }
41.057694
174
0.368974
webhacking
4af172af9e5d5986b19770cac0dd96d4533ad3bb
5,421
cc
C++
tutorials/examples/simple_sender_main.cc
isabella232/aistreams
209f4385425405676a581a749bb915e257dbc1c1
[ "Apache-2.0" ]
6
2020-09-22T18:07:15.000Z
2021-10-21T01:34:04.000Z
tutorials/examples/simple_sender_main.cc
isabella232/aistreams
209f4385425405676a581a749bb915e257dbc1c1
[ "Apache-2.0" ]
2
2020-11-10T13:17:39.000Z
2022-03-30T11:22:14.000Z
tutorials/examples/simple_sender_main.cc
isabella232/aistreams
209f4385425405676a581a749bb915e257dbc1c1
[ "Apache-2.0" ]
3
2020-09-26T08:40:35.000Z
2021-10-21T01:33:56.000Z
// Copyright 2020 Google LLC // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. // This example shows how you can programmatically send an arbitrary Packets // stream. It assumes that you already have a stream created in the server; if // you don't know how to do this, please refer to the README.md (e.g. using // aisctl). #include <memory> #include <string> #include "absl/flags/flag.h" #include "absl/flags/parse.h" #include "absl/strings/str_format.h" #include "absl/time/time.h" #include "aistreams/cc/aistreams.h" #include "aistreams/port/logging.h" #include "aistreams/port/status.h" #include "aistreams/port/statusor.h" #include "examples/hello.pb.h" ABSL_FLAG(std::string, target_address, "", "Address (ip:port) to the data ingress."); ABSL_FLAG(std::string, ssl_root_cert_path, "", "Path to the data ingress' ssl certificate."); ABSL_FLAG(bool, authenticate_with_google, true, "Set to true if you are sending to a stream on the Google managed " "service; false otherwise."); ABSL_FLAG(std::string, stream_name, "", "Name of the stream to ingest videos into."); ABSL_FLAG(int, greeting_iterations, 10, "Number of greeting iterations to send."); ABSL_FLAG(std::string, greeting_message, "Hello!", "The greeting message to send."); ABSL_FLAG(int, milliseconds_between_greetings, 1000, "Number of milliseconds to wait before sending the next greeting."); namespace aistreams { Status RunSender() { // Options to configure the sender. // // See aistreams/base/wrappers/sender.h for more details. SenderOptions sender_options; // Configure the connection to the data ingress. // // These have the usual conventions (see simple_ingester_main.cc for more // details.) ConnectionOptions connection_options; connection_options.target_address = absl::GetFlag(FLAGS_target_address); connection_options.ssl_options.ssl_root_cert_path = absl::GetFlag(FLAGS_ssl_root_cert_path); connection_options.authenticate_with_google = absl::GetFlag(FLAGS_authenticate_with_google); sender_options.connection_options = connection_options; // Specify the stream to send into. sender_options.stream_name = absl::GetFlag(FLAGS_stream_name); // Create a sender. // // See aistreams/base/wrappers/senders.h for more info. std::unique_ptr<PacketSender> sender; auto status = MakePacketSender(sender_options, &sender); if (!status.ok()) { LOG(ERROR) << status; return UnknownError("Failed to create a packet sender"); } // Send data packets. In this case, we keep sending the Greeting // message, just populated differently. // // Obviously, this is perhaps not all that useful in real life. But the // pattern here is what's important. Actually, you can send any protobuf // message whatsoever. int greeting_iterations = absl::GetFlag(FLAGS_greeting_iterations); std::string greeting_message = absl::GetFlag(FLAGS_greeting_message); int milliseconds_between_greetings = absl::GetFlag(FLAGS_milliseconds_between_greetings); for (int i = 0; i < greeting_iterations; ++i) { // Populate the greeting message. examples::Greeting greeting; greeting.set_iterations(i + 1); greeting.set_greeting(greeting_message); // Create a protobuf typed Packet. Notice that you do not need to do // anything special for the Packet to be typed correctly. Just give it your // data (move it in for efficiency if it is huge; overkill for this case). // // See aistreams/base/make_packet.h for more info. auto packet_statusor = MakePacket(std::move(greeting)); if (!packet_statusor.ok()) { LOG(ERROR) << packet_statusor.status(); return UnknownError("Couldn't make a packet. Call Google NOW!!"); } auto packet = std::move(packet_statusor).ValueOrDie(); // Send the Packet. auto status = sender->Send(packet); LOG(INFO) << "Sent " << i+1 << "'th packet."; if (!status.ok()) { LOG(ERROR) << status; return UnknownError("Failed to send a packet."); } // Not needed, but easier on the eyes for testing. absl::SleepFor(absl::Milliseconds(milliseconds_between_greetings)); } // Send an EOS packet to indicate you're done. // // See aistreams/base/util/packet_utils.h for more info. auto eos_packet_statusor = MakeEosPacket("Successfully sent all messages"); status = sender->Send(std::move(eos_packet_statusor).ValueOrDie()); if (!status.ok()) { LOG(ERROR) << status; LOG(ERROR) << "Failed to mark the end of the stream with EOS"; } LOG(INFO) << "Done!"; return OkStatus(); } } // namespace aistreams int main(int argc, char** argv) { google::InitGoogleLogging(argv[0]); absl::ParseCommandLine(argc, argv); auto status = aistreams::RunSender(); if (!status.ok()) { LOG(ERROR) << status; return EXIT_FAILURE; } return 0; }
35.900662
79
0.708725
isabella232
4af31509a5c6a6bdeba357e3ca82e07c42757ce9
6,467
cpp
C++
test/misc/ut_prng.cpp
PascalLG/zinc-cpp
560d51a6b7ccd60e4dcf3b0fd132a9bb56f72911
[ "MIT" ]
1
2021-04-07T11:03:57.000Z
2021-04-07T11:03:57.000Z
test/misc/ut_prng.cpp
PascalLG/zinc-cpp
560d51a6b7ccd60e4dcf3b0fd132a9bb56f72911
[ "MIT" ]
null
null
null
test/misc/ut_prng.cpp
PascalLG/zinc-cpp
560d51a6b7ccd60e4dcf3b0fd132a9bb56f72911
[ "MIT" ]
null
null
null
//======================================================================== // Zinc - Unit Testing // Copyright (c) 2020, Pascal Levy // // Permission is hereby granted, free of charge, to any person obtaining a copy // of this software and associated documentation files (the "Software"), to deal // in the Software without restriction, including without limitation the rights // to use, copy, modify, merge, publish, distribute, sublicense, and/or sell // copies of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included in // all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, // OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN // THE SOFTWARE. //======================================================================== #include <array> #include <iostream> #include "gtest/gtest.h" #include "misc/prng.h" //-------------------------------------------------------------- // Test the PRNG, sequence 1. //-------------------------------------------------------------- TEST(PRNG, Sequence1) { prng & g = prng::instance(); g.seed(1234u); static std::array<uint32_t, 128> expected = { 0x31076B2F, 0x7F66E2D3, 0x9F428526, 0xD15DDC35, 0x700EECCC, 0x9CB35D74, 0xC90D4298, 0xC577D7F9, 0xC7AC7E8F, 0xDC54DAB1, 0x45C8A117, 0x269024E9, 0x46C65C9A, 0x32D2201E, 0xCD477EAB, 0xD0AE849E, 0xF5489EEC, 0x28A81F7C, 0xE03D1F1A, 0x1DBB3576, 0x5B99E9BA, 0x034DE878, 0x80413770, 0x7CA11DDC, 0xAEF76D45, 0x54BD6D50, 0xB673A3C9, 0xCD79C97F, 0x5EC8C0F6, 0x192709FE, 0x8FAA8DAF, 0x0E559632, 0x80CA0EF0, 0x715256FB, 0x0386544C, 0x05AB3925, 0xC5D7F722, 0x4A6D2FA6, 0xE1F4C5FA, 0x3F13B4C3, 0x5D692AE7, 0xBD005C8B, 0x9D8A9A80, 0xE3A452E9, 0x134C2F4B, 0xFCB52950, 0x5E6B4003, 0x1E10C502, 0xEEE24513, 0x64CEEB8C, 0xA6C0B7C1, 0x73E619CB, 0x65AF1173, 0x89C40E6B, 0xC9EA37FA, 0xCA6635D1, 0x511C2C0E, 0x77410CF3, 0x916EE9C7, 0x6F71EF3C, 0xDE7F21EA, 0x91C95A6B, 0x6FA90FAE, 0xF8215B9C, 0xCD598C51, 0x0A61E357, 0x24CDE70D, 0x8C519074, 0xB44A7260, 0x766B6B8C, 0xB45F70C5, 0x60607BFD, 0x3802C271, 0x53F20BDF, 0xECC41FE5, 0xD0436E9F, 0x713022F9, 0xA58473FC, 0xE8C8EE59, 0x0C242454, 0x0F4FA82D, 0xFEB58A10, 0x2F2D7029, 0xB071BF48, 0x0C1F79B8, 0xEDF6B8EC, 0xACC4FF46, 0xEB09AFB8, 0x98395456, 0xF9AD5FAC, 0x888703DA, 0x65A1EBD3, 0x0B17492F, 0x433B76B1, 0x8FBA1412, 0x6E1E6655, 0x546526AE, 0xC3B849E2, 0x80C26F25, 0x9987F56D, 0x1CA51B26, 0x14B8F087, 0x9B710BE4, 0xB45D06C3, 0x90E1BF85, 0x29FCC6EE, 0x01BB4A2F, 0x08480BF6, 0x9E10A8F4, 0x5401A976, 0xE980E2AF, 0x794EE38F, 0xCA5FCA22, 0x116E000A, 0xFDF90D1C, 0x61F95404, 0xF5740852, 0x1E599067, 0xCABE2959, 0xE575C937, 0x490634EB, 0xC3A9B94E, 0x9FFA8A97, 0x601A89B2, 0x7A645AF9, 0x069BC23E, 0x3217C4B7, 0xE8126954, }; for (uint32_t x: expected) { ASSERT_EQ(x, g.next()); } } //-------------------------------------------------------------- // Test the PRNG, sequence 2. //-------------------------------------------------------------- TEST(PRNG, Sequence2) { prng & g = prng::instance(); g.seed(56789u); static std::array<uint32_t, 128> expected = { 0xCBE05A0F, 0x88D5FA24, 0xBD3CEEE0, 0x16AFF7CB, 0x09419667, 0x6BA97454, 0xF07A396B, 0xC8B70A55, 0x2D9643CC, 0x1C01261C, 0x483E97BD, 0x272ADCFA, 0xF676A561, 0x63E0BE1B, 0x0C4598E4, 0x7C584BBA, 0xA20A800A, 0xC243F2DB, 0x3836DD02, 0x99F0A0D7, 0x4C8E1008, 0xD6B8278E, 0xFC1E66F4, 0x68CD5167, 0xEA9E70E8, 0x72F91E20, 0x2214373B, 0x7F2D8A81, 0x2A7BFBA4, 0x2F961159, 0xDC93A084, 0x97FC9BB6, 0x04A7D38A, 0x173916E8, 0x6B40178F, 0x44DC490E, 0x81159EAF, 0x362DFD98, 0xDED0C0CB, 0xB1A9E1B2, 0x980BAB9E, 0xC25FA1FB, 0x0822B4EA, 0x8E52796D, 0x738AA9FE, 0x4E196FCA, 0x8997070B, 0x56475A4D, 0xEFE31CF5, 0x5E3DB07A, 0x0BF57F75, 0xD053476F, 0xFF3C7999, 0xDEFC2901, 0x1288EE6A, 0xD1E1B4DD, 0xE27AC7B1, 0x40BA5E7B, 0x350DAE8D, 0xC51CAEE2, 0xAC731672, 0x915E2EE0, 0x3050E290, 0x67CE7651, 0x4BF73555, 0xE48936D7, 0x6DAAE689, 0x9CB3A791, 0xF40392FA, 0xC1D37FA5, 0x13284090, 0xC4C60596, 0xE350A597, 0x9D88F323, 0xF5CD1EAE, 0x8394EC48, 0x38B91D03, 0x9B392E6A, 0xED6A8574, 0x8C52DF1F, 0x74B4B259, 0x3C9C5039, 0xABA15618, 0xD9B25606, 0x67BBECF3, 0x26A3EAD3, 0xDD85BF52, 0xA7B8F4A1, 0xD8BE0F54, 0x0FA86A68, 0xB1AA53F4, 0xD21D48D1, 0x44C8430F, 0xB6BCF3F9, 0x9D768E3E, 0xE217A1B6, 0x410E2423, 0x39206DE5, 0x9ED633CF, 0xF958EBDC, 0x5805A06C, 0x0F561750, 0x6DCF8E7A, 0xA02B35E1, 0x28514AF0, 0x09F0EE99, 0x8C0B2EA7, 0x9F699731, 0xF5129E42, 0x5332DE50, 0xFB1D3754, 0x357C7681, 0x809FDD2E, 0x08FFE150, 0x1AADD862, 0x3A330E24, 0xAE99E729, 0xB270BBD6, 0xC674C01D, 0xAFF9C413, 0x03A2C548, 0x59CFF8D6, 0xCE8BC1FF, 0x02DB4C2D, 0xEF884378, 0x866C96E6, 0x19ACC02A, 0xDD1D34D7, }; for (uint32_t x: expected) { ASSERT_EQ(x, g.next()); } } //-------------------------------------------------------------- // Test the statistical distribution. //-------------------------------------------------------------- TEST(PRNG, Statistics) { prng & g = prng::instance(); g.seed(); const int N = 1000000; std::array<unsigned int, 256> histo = { 0 }; for (size_t i = 0; i < N / 4; i++) { uint32_t v = g.next(); histo[v & 255]++; histo[(v >> 8) & 255]++; histo[(v >> 16) & 255]++; histo[(v >> 24) & 255]++; } double t = 0.0, s = 0.0; for (size_t i = 0; i < 256; i++) { double x = static_cast<double>(histo[i]); s += i * x; t += x * x; } double average = s / N; EXPECT_GE(average, 127.25); EXPECT_LE(average, 128.75); double khi = (256.0 * t / N) - N; EXPECT_GE(khi, 256.0 - 2.0 * sqrt(256.0)); // may fail sometimes... EXPECT_LE(khi, 256.0 + 2.0 * sqrt(256.0)); } //========================================================================
49.746154
111
0.640173
PascalLG
4afa96f08d7729d972cae38c04048b5527503392
17,631
cpp
C++
cpp/tests/column/column_view_shallow_test.cpp
karthikeyann/cudf
a00466fe30ce6618e8f790ea1337875558867512
[ "Apache-2.0" ]
3
2020-09-25T21:45:41.000Z
2020-09-28T01:51:57.000Z
cpp/tests/column/column_view_shallow_test.cpp
karthikeyann/cudf
a00466fe30ce6618e8f790ea1337875558867512
[ "Apache-2.0" ]
1
2020-09-26T01:22:44.000Z
2020-09-26T02:25:41.000Z
cpp/tests/column/column_view_shallow_test.cpp
karthikeyann/cudf
a00466fe30ce6618e8f790ea1337875558867512
[ "Apache-2.0" ]
null
null
null
/* * Copyright (c) 2021, NVIDIA CORPORATION. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ #include <cudf/column/column_view.hpp> #include <cudf/null_mask.hpp> #include <cudf/types.hpp> #include <cudf/utilities/traits.hpp> #include <cudf_test/base_fixture.hpp> #include <cudf_test/column_utilities.hpp> #include <cudf_test/column_wrapper.hpp> #include <cudf_test/cudf_gtest.hpp> #include <cudf_test/type_lists.hpp> #include <thrust/iterator/counting_iterator.h> #include <memory> #include <type_traits> // fixed_width, dict, string, list, struct template <typename T, std::enable_if_t<cudf::is_fixed_width<T>()>* = nullptr> std::unique_ptr<cudf::column> example_column() { auto begin = thrust::make_counting_iterator(1); auto end = thrust::make_counting_iterator(16); return cudf::test::fixed_width_column_wrapper<T>(begin, end).release(); } template <typename T, std::enable_if_t<cudf::is_dictionary<T>()>* = nullptr> std::unique_ptr<cudf::column> example_column() { return cudf::test::dictionary_column_wrapper<std::string>( {"fff", "aaa", "ddd", "bbb", "ccc", "ccc", "ccc", "", ""}, {1, 1, 1, 1, 1, 1, 1, 1, 0}) .release(); } template <typename T, std::enable_if_t<std::is_same_v<T, std::string> or std::is_same_v<T, cudf::string_view>>* = nullptr> std::unique_ptr<cudf::column> example_column() { return cudf::test::strings_column_wrapper( {"fff", "aaa", "ddd", "bbb", "ccc", "ccc", "ccc", "", ""}) .release(); } template <typename T, std::enable_if_t<std::is_same_v<T, cudf::list_view>>* = nullptr> std::unique_ptr<cudf::column> example_column() { return cudf::test::lists_column_wrapper<int>({{1, 2, 3}, {4, 5}, {}, {6, 7, 8}}).release(); } template <typename T, std::enable_if_t<std::is_same_v<T, cudf::struct_view>>* = nullptr> std::unique_ptr<cudf::column> example_column() { auto begin = thrust::make_counting_iterator(1); auto end = thrust::make_counting_iterator(16); auto member_0 = cudf::test::fixed_width_column_wrapper<int32_t>(begin, end); auto member_1 = cudf::test::fixed_width_column_wrapper<int32_t>(begin + 10, end + 10); return cudf::test::structs_column_wrapper({member_0, member_1}).release(); } template <typename T> struct ColumnViewShallowTests : public cudf::test::BaseFixture { }; using AllTypes = cudf::test::Concat<cudf::test::AllTypes, cudf::test::CompoundTypes>; TYPED_TEST_SUITE(ColumnViewShallowTests, AllTypes); // Test for fixed_width, dict, string, list, struct // column_view, column_view = same hash. // column_view, make a copy = same hash. // new column_view from column = same hash // column_view, copy column = diff hash // column_view, diff column = diff hash. // // column_view old, update data + new column_view = same hash. // column_view old, add null_mask + new column_view = diff hash. // column_view old, update nulls + new column_view = same hash. // column_view old, set_null_count + new column_view = same hash. // // column_view, sliced[0, size) = same hash (for split too) // column_view, sliced[n:) = diff hash (for split too) // column_view, bit_cast = diff hash // // mutable_column_view, column_view = same hash // mutable_column_view, modified mutable_column_view = same hash // // update the children column data = same hash // update the children column_views = diff hash TYPED_TEST(ColumnViewShallowTests, shallow_hash_basic) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // same = same hash { EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view)); } // copy column_view = same hash { auto col_view_copy = col_view; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_copy)); } // new column_view from column = same hash { auto col_view_new = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_new)); } // copy column = diff hash { auto col_new = std::make_unique<cudf::column>(*col); auto col_view_copy = col_new->view(); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_view_copy)); } // column_view, diff column = diff hash. { auto col_diff = example_column<TypeParam>(); auto col_view_diff = cudf::column_view{*col_diff}; EXPECT_NE(shallow_hash(col_view), shallow_hash(col_view_diff)); } } TYPED_TEST(ColumnViewShallowTests, shallow_hash_update_data) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // update data + new column_view = same hash. { // update data by modifying some bits: fixed_width, string, dict, list, struct if constexpr (cudf::is_fixed_width<TypeParam>()) { // Update data auto data = reinterpret_cast<cudf::bitmask_type*>(col->mutable_view().head()); cudf::set_null_mask(data, 2, 64, true); } else { // Update child(0).data auto data = reinterpret_cast<cudf::bitmask_type*>(col->child(0).mutable_view().head()); cudf::set_null_mask(data, 2, 64, true); } auto col_view_new = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_new)); } // add null_mask + new column_view = diff hash. { col->set_null_mask(cudf::create_null_mask(col->size(), cudf::mask_state::ALL_VALID)); auto col_view_new = cudf::column_view{*col}; EXPECT_NE(shallow_hash(col_view), shallow_hash(col_view_new)); col_view_new.null_count(); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_view_new)); auto col_view_new2 = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view_new), shallow_hash(col_view_new2)); } col_view = cudf::column_view{*col}; // updating after adding null_mask // update nulls + new column_view = same hash. { cudf::set_null_mask(col->mutable_view().null_mask(), 2, 4, false); auto col_view_new = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_new)); } // set_null_count + new column_view = same hash. set_null_count(UNKNOWN_NULL_COUNT) { col->set_null_count(cudf::UNKNOWN_NULL_COUNT); auto col_view_new = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_new)); col->set_null_count(col->size()); auto col_view_new2 = cudf::column_view{*col}; EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_view_new2)); } } TYPED_TEST(ColumnViewShallowTests, shallow_hash_slice) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // column_view, sliced[0, size) = same hash (for split too) { auto col_sliced = cudf::slice(col_view, {0, col_view.size()}); EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_sliced[0])); auto col_split = cudf::split(col_view, {0}); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_split[0])); EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_split[1])); } // column_view, sliced[n:] = diff hash (for split too) { auto col_sliced = cudf::slice(col_view, {1, col_view.size()}); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_sliced[0])); auto col_split = cudf::split(col_view, {1}); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_split[0])); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_split[1])); } // column_view, col copy sliced[0, 0) = same hash (empty column) { auto col_new = std::make_unique<cudf::column>(*col); auto col_new_view = col_new->view(); auto col_sliced = cudf::slice(col_view, {0, 0, 1, 1, col_view.size(), col_view.size()}); auto col_new_sliced = cudf::slice(col_new_view, {0, 0, 1, 1, col_view.size(), col_view.size()}); EXPECT_EQ(shallow_hash(col_sliced[0]), shallow_hash(col_sliced[1])); EXPECT_EQ(shallow_hash(col_sliced[1]), shallow_hash(col_sliced[2])); EXPECT_EQ(shallow_hash(col_sliced[0]), shallow_hash(col_new_sliced[0])); EXPECT_EQ(shallow_hash(col_sliced[1]), shallow_hash(col_new_sliced[1])); EXPECT_EQ(shallow_hash(col_sliced[2]), shallow_hash(col_new_sliced[2])); } // column_view, bit_cast = diff hash { if constexpr (std::is_integral_v<TypeParam> and not std::is_same_v<TypeParam, bool>) { using newType = std::conditional_t<std::is_signed_v<TypeParam>, std::make_unsigned_t<TypeParam>, std::make_signed_t<TypeParam>>; auto new_type = cudf::data_type(cudf::type_to_id<newType>()); auto col_bitcast = cudf::bit_cast(col_view, new_type); EXPECT_NE(shallow_hash(col_view), shallow_hash(col_bitcast)); } } } TYPED_TEST(ColumnViewShallowTests, shallow_hash_mutable) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // mutable_column_view, column_view = same hash { auto col_mutable = cudf::mutable_column_view{*col}; EXPECT_EQ(shallow_hash(col_mutable), shallow_hash(col_view)); } // mutable_column_view, modified mutable_column_view = same hash // update the children column data = same hash { auto col_mutable = cudf::mutable_column_view{*col}; if constexpr (cudf::is_fixed_width<TypeParam>()) { // Update data auto data = reinterpret_cast<cudf::bitmask_type*>(col->mutable_view().head()); cudf::set_null_mask(data, 1, 32, false); } else { // Update child(0).data auto data = reinterpret_cast<cudf::bitmask_type*>(col->child(0).mutable_view().head()); cudf::set_null_mask(data, 1, 32, false); } EXPECT_EQ(shallow_hash(col_view), shallow_hash(col_mutable)); auto col_mutable_new = cudf::mutable_column_view{*col}; EXPECT_EQ(shallow_hash(col_mutable), shallow_hash(col_mutable_new)); } // update the children column_views = diff hash { if constexpr (cudf::is_nested<TypeParam>()) { col->child(0).set_null_mask( cudf::create_null_mask(col->child(0).size(), cudf::mask_state::ALL_NULL)); auto col_child_updated = cudf::mutable_column_view{*col}; EXPECT_NE(shallow_hash(col_view), shallow_hash(col_child_updated)); } } } TYPED_TEST(ColumnViewShallowTests, is_shallow_equivalent_basic) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // same = same hash { EXPECT_TRUE(is_shallow_equivalent(col_view, col_view)); } // copy column_view = same hash { auto col_view_copy = col_view; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_copy)); } // new column_view from column = same hash { auto col_view_new = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_new)); } // copy column = diff hash { auto col_new = std::make_unique<cudf::column>(*col); auto col_view_copy = col_new->view(); EXPECT_FALSE(is_shallow_equivalent(col_view, col_view_copy)); } // column_view, diff column = diff hash. { auto col_diff = example_column<TypeParam>(); auto col_view_diff = cudf::column_view{*col_diff}; EXPECT_FALSE(is_shallow_equivalent(col_view, col_view_diff)); } } TYPED_TEST(ColumnViewShallowTests, is_shallow_equivalent_update_data) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // update data + new column_view = same hash. { // update data by modifying some bits: fixed_width, string, dict, list, struct if constexpr (cudf::is_fixed_width<TypeParam>()) { // Update data auto data = reinterpret_cast<cudf::bitmask_type*>(col->mutable_view().head()); cudf::set_null_mask(data, 2, 64, true); } else { // Update child(0).data auto data = reinterpret_cast<cudf::bitmask_type*>(col->child(0).mutable_view().head()); cudf::set_null_mask(data, 2, 64, true); } auto col_view_new = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_new)); } // add null_mask + new column_view = diff hash. { col->set_null_mask(cudf::create_null_mask(col->size(), cudf::mask_state::ALL_VALID)); auto col_view_new = cudf::column_view{*col}; EXPECT_FALSE(is_shallow_equivalent(col_view, col_view_new)); col_view_new.null_count(); EXPECT_FALSE(is_shallow_equivalent(col_view, col_view_new)); auto col_view_new2 = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view_new, col_view_new2)); } col_view = cudf::column_view{*col}; // updating after adding null_mask // update nulls + new column_view = same hash. { cudf::set_null_mask(col->mutable_view().null_mask(), 2, 4, false); auto col_view_new = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_new)); } // set_null_count + new column_view = same hash. set_null_count(UNKNOWN_NULL_COUNT) { col->set_null_count(cudf::UNKNOWN_NULL_COUNT); auto col_view_new = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_new)); col->set_null_count(col->size()); auto col_view_new2 = cudf::column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_view, col_view_new2)); } } TYPED_TEST(ColumnViewShallowTests, is_shallow_equivalent_slice) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // column_view, sliced[0, size) = same hash (for split too) { auto col_sliced = cudf::slice(col_view, {0, col_view.size()}); EXPECT_TRUE(is_shallow_equivalent(col_view, col_sliced[0])); auto col_split = cudf::split(col_view, {0}); EXPECT_FALSE(is_shallow_equivalent(col_view, col_split[0])); EXPECT_TRUE(is_shallow_equivalent(col_view, col_split[1])); } // column_view, sliced[n:] = diff hash (for split too) { auto col_sliced = cudf::slice(col_view, {1, col_view.size()}); EXPECT_FALSE(is_shallow_equivalent(col_view, col_sliced[0])); auto col_split = cudf::split(col_view, {1}); EXPECT_FALSE(is_shallow_equivalent(col_view, col_split[0])); EXPECT_FALSE(is_shallow_equivalent(col_view, col_split[1])); } // column_view, col copy sliced[0, 0) = same hash (empty column) { auto col_new = std::make_unique<cudf::column>(*col); auto col_new_view = col_new->view(); auto col_sliced = cudf::slice(col_view, {0, 0, 1, 1, col_view.size(), col_view.size()}); auto col_new_sliced = cudf::slice(col_new_view, {0, 0, 1, 1, col_view.size(), col_view.size()}); EXPECT_TRUE(is_shallow_equivalent(col_sliced[0], col_sliced[1])); EXPECT_TRUE(is_shallow_equivalent(col_sliced[1], col_sliced[2])); EXPECT_TRUE(is_shallow_equivalent(col_sliced[0], col_new_sliced[0])); EXPECT_TRUE(is_shallow_equivalent(col_sliced[1], col_new_sliced[1])); EXPECT_TRUE(is_shallow_equivalent(col_sliced[2], col_new_sliced[2])); } // column_view, bit_cast = diff hash { if constexpr (std::is_integral_v<TypeParam> and not std::is_same_v<TypeParam, bool>) { using newType = std::conditional_t<std::is_signed_v<TypeParam>, std::make_unsigned_t<TypeParam>, std::make_signed_t<TypeParam>>; auto new_type = cudf::data_type(cudf::type_to_id<newType>()); auto col_bitcast = cudf::bit_cast(col_view, new_type); EXPECT_FALSE(is_shallow_equivalent(col_view, col_bitcast)); } } } TYPED_TEST(ColumnViewShallowTests, is_shallow_equivalent_mutable) { using namespace cudf::detail; auto col = example_column<TypeParam>(); auto col_view = cudf::column_view{*col}; // mutable_column_view, column_view = same hash { auto col_mutable = cudf::mutable_column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_mutable, col_view)); } // mutable_column_view, modified mutable_column_view = same hash // update the children column data = same hash { auto col_mutable = cudf::mutable_column_view{*col}; if constexpr (cudf::is_fixed_width<TypeParam>()) { // Update data auto data = reinterpret_cast<cudf::bitmask_type*>(col->mutable_view().head()); cudf::set_null_mask(data, 1, 32, false); } else { // Update child(0).data auto data = reinterpret_cast<cudf::bitmask_type*>(col->child(0).mutable_view().head()); cudf::set_null_mask(data, 1, 32, false); } EXPECT_TRUE(is_shallow_equivalent(col_view, col_mutable)); auto col_mutable_new = cudf::mutable_column_view{*col}; EXPECT_TRUE(is_shallow_equivalent(col_mutable, col_mutable_new)); } // update the children column_views = diff hash { if constexpr (cudf::is_nested<TypeParam>()) { col->child(0).set_null_mask( cudf::create_null_mask(col->child(0).size(), cudf::mask_state::ALL_NULL)); auto col_child_updated = cudf::mutable_column_view{*col}; EXPECT_FALSE(is_shallow_equivalent(col_view, col_child_updated)); } } }
39.799097
100
0.695309
karthikeyann
4afad4c3e234e48b4e7f8cb7510b1a2467f4f2e0
26,453
cpp
C++
unit_tests/lim_malloc_test.cpp
IntelLabs/cc-simulator
d3baf1a9f7f3153a47db11592295f09834c42116
[ "MIT" ]
null
null
null
unit_tests/lim_malloc_test.cpp
IntelLabs/cc-simulator
d3baf1a9f7f3153a47db11592295f09834c42116
[ "MIT" ]
null
null
null
unit_tests/lim_malloc_test.cpp
IntelLabs/cc-simulator
d3baf1a9f7f3153a47db11592295f09834c42116
[ "MIT" ]
null
null
null
#include <gtest/gtest.h> #include <string.h> #include <math.h> #include <cstdlib> //for std::getenv typedef uint64_t logical_address_t; #ifndef TRACE_ONLY int trace_only; #define TRACE_ONLY #endif #include "lim_ptr_encoding.h" // Helper function to init ref data buffer with random data #ifndef PAGE_SIZE #define PAGE_SIZE SIM_PAGE_SIZE #endif #define SRAND_SEED 0 /* static void init_reference_data_random(uint8_t * buffer, int num) { srand(SRAND_SEED); for (int i = 0; i<num; i++) { buffer[i] = (uint8_t) rand(); } } */ #ifndef MAGIC #define MAGIC(n) do { \ int simics_magic_instr_dummy; \ __asm__ __volatile__ ("cpuid" \ : "=a" (simics_magic_instr_dummy) \ : "a" (0x4711 | ((unsigned)(n) << 16)) \ : "ecx", "edx", "ebx"); \ } while (0) #endif static void init_reference_data_sequential(uint8_t * buffer, int num) { uint8_t sequence=0x0; for (int i = 0; i<num; i++) { buffer[i] = sequence++; } } template <typename _type> static inline _type min (_type a, _type b) { return (a < b) ? a : b; } /* static void* align_ptr_on_next_page(void* ptr) { return (void*) (((uint64_t)ptr & 0xFFFFFFFFFFFFF000) + 0x1000); } */ static void* align_ptr_on_next_4p_bndry(void* ptr) { return (void*) (((uint64_t)ptr & (0xFFFFFFFFFFFFFFFF<<(PAGE_OFFSET+2))) + PAGE_SIZE*4); } static const size_t UNALIGNED_BUFFER_SIZE = 8*PAGE_SIZE; static uint8_t STATIC_BUFFER_8P_unaligned[UNALIGNED_BUFFER_SIZE]; static uint8_t* STATIC_BUFFER_4P_aligned = (uint8_t*) align_ptr_on_next_4p_bndry(STATIC_BUFFER_8P_unaligned); uint8_t ref_data[4*PAGE_SIZE]; const int MAX_ALLOCS = 100; void* pointer_array[MAX_ALLOCS]; class RWTest : public ::testing::Test { protected: const static int max_size = 4*PAGE_SIZE; void* encode(void* ptr, size_t data_size, lim_tag_t tag) { size_t total_alloc_size = get_min_metadata_size(data_size) + data_size; size_t meta_size = total_alloc_size - data_size; memset(ptr, 0x0, total_alloc_size); uint8_t encoded_size = calculate_encoded_size((uint64_t) ptr, total_alloc_size); // printf("Encoding pointer p=%p, alloc_size=%ld: encoded_size=%x\n", ptr, alloc_size, encoded_size); if (!trace_only) set_metadata(ptr, data_size, meta_size, tag); return (void*) lim_encode_pointer( (uint64_t) ptr, encoded_size, tag); } template <typename T> void write_ref_data(void* dest, size_t num_elements) { assert(num_elements*sizeof(T) <= max_size); T* ref_data_T = (T*) ref_data; T* dest_T = (T*) dest; for (size_t i = 0; i < num_elements; i++) { dest_T[i] = ref_data_T[i]; } } template <typename T> bool read_data_using_enc_ptr(void* ptr_enc, size_t num_elements) { T* ref_data_T = (T*) ref_data; T* ptr_enc_T = (T*) ptr_enc; for (size_t i = 0; i < num_elements; i++) { if (ptr_enc_T[i] != ref_data_T[i]) { return false; } } return true; } void print_addr_around_ptr(uint8_t* ptr) { int left_offset=4; int right_offset=16; for (int i = -left_offset; i<right_offset; i++ ) { printf("%02x ", (uint8_t) ((uint64_t)ptr+i)); } printf("\n"); printf(" ^\n"); } void print_memory_around_ptr(uint8_t* ptr) { int left_offset=4; int right_offset=16; for (int i = -left_offset; i<right_offset; i++ ) { printf("%02x ", *(ptr+i)); } printf("\n"); } ::testing::AssertionResult check_written_memory(void* ptr_enc, size_t size) { uint8_t* ptr = (uint8_t*) lim_decode_pointer((uint64_t) ptr_enc); uint8_t encoded_size = get_encoded_size((uint64_t) ptr_enc); void* ptr_metadata = (void*) get_metadata_address((uint64_t) ptr, encoded_size); size_t left_bytes; if ((uint64_t)ptr_metadata > (uint64_t) ptr) { left_bytes = min(size, (uint64_t)ptr_metadata - (uint64_t) ptr); } else { left_bytes = 0; } size_t right_bytes = size - left_bytes; assert (size>=left_bytes); assert (size>=right_bytes); bool match_left = ( memcmp(ptr, ref_data, left_bytes)==0) ? true: false; if (!match_left) { for (size_t i = 0; i<left_bytes; i++) { if (ptr[i] != ref_data[i]) { printf("ref_data: "); print_memory_around_ptr(&ref_data[i]); printf("actual : "); print_memory_around_ptr(&ptr[i]); printf("addr : "); print_addr_around_ptr(&ptr[i]); printf("Left mismatch at address %p\n", &ptr[i]); printf("ptr[%ld]=0x%02x != 0x%02x (ref_data)\n", i, ptr[i], ref_data[i]); return ::testing::AssertionFailure(); // << "left mismatch: ptr[" << i << "]=" << ptr[i] << " != ref_data=" << ref_data[i]; } } } size_t meta_size = get_metadata_size(encoded_size); bool match_right = ( memcmp(ptr+left_bytes+meta_size, ref_data+left_bytes, right_bytes)==0) ? true: false; if (!match_right) { for (size_t i = left_bytes; i<size+meta_size; i++) { if (ptr[i+meta_size] != ref_data[i]) { printf("ref_data: "); print_memory_around_ptr(&ref_data[i]); printf("actual : "); print_memory_around_ptr(&ptr[i]); printf("addr : "); print_addr_around_ptr(&ptr[i]); printf("Right mismatch at address %p\n", &ptr[i]); printf("ptr[%ld+meta_size]=0x%02x != 0x%02x (ref_data)\n", i, ptr[i+meta_size], ref_data[i]); return ::testing::AssertionFailure(); // << "right mismatch: ptr[" << i << "+LIM_METADATA_SIZE]=" << ptr[i+LIM_METADATA_SIZE] << " != ref_data=" << ref_data[i]; } } } if (match_left && match_right){ return ::testing::AssertionSuccess(); } else { return ::testing::AssertionFailure(); } } void clear_buffer() { memset(STATIC_BUFFER_8P_unaligned, 0xff, UNALIGNED_BUFFER_SIZE); } void SetUp() override { //printf("ptr (aligned)=%p\n", ptr); init_reference_data_sequential(ref_data, max_size); clear_buffer(); } void TearDown() override { } }; /* TEST(MallocT, SingleAlloc) { uint32_t exp_val = 0xFFFFFFFF; uint32_t * p = (uint32_t*) malloc(sizeof(uint32_t)); *p = exp_val; ASSERT_EQ(exp_val, *p); } */ TEST(PointerEncoding, StructSize) { encoded_pointer_t ep; lim_meta_1B_t meta_1B; lim_meta_2B_t meta_2B; lim_meta_8B_t meta_8B; lim_meta_16B_t meta_16B; ASSERT_EQ(sizeof(ep), 8); ASSERT_EQ(sizeof(meta_1B), 1); ASSERT_EQ(sizeof(meta_2B), 2); ASSERT_EQ(sizeof(meta_8B), 8); ASSERT_EQ(sizeof(meta_16B), 16); } TEST_F(RWTest, SingleWriteReadBeforeMetadata) { typedef uint32_t data_t; size_t total_size = 64; size_t size = total_size - LIM_METADATA_SIZE_32_64B; int offset = total_size/2 -sizeof(data_t) - LIM_METADATA_OFFSET_FROM_MIDDLE_32_64B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); // size_t size=64-LIM_METADATA_SIZE; // typedef uint32_t data_t; // data_t* ptr = (data_t*) STATIC_BUFFER_4P_aligned; // data_t* ptr_enc = (data_t*) encode(ptr, size); // data_t exp_data = 0xabcd1234; // int index = 0; // ptr_enc[index] = exp_data; // // test if data was written correctly, skipping metadata // ASSERT_EQ(ptr[index], exp_data); // ASSERT_EQ(ptr_enc[index], exp_data); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta) { typedef uint32_t data_t; size_t total_size = 64; size_t size = total_size - LIM_METADATA_SIZE_32_64B; int offset = total_size/2; //+ LIM_METADATA_SIZE_32_64B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadOverMetadata) { typedef uint32_t data_t; size_t total_size = 64; size_t size = total_size - LIM_METADATA_SIZE_32_64B; int offset = total_size/2 - sizeof(data_t)/2-LIM_METADATA_OFFSET_FROM_MIDDLE_32_64B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadBeforeMetadataCrossPage) { typedef uint32_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = PAGE_SIZE-sizeof(data_t)/2; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag);; size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta_SingleCloseToPageBndry) { typedef uint32_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 3*PAGE_SIZE-sizeof(data_t)-LIM_METADATA_SIZE_512B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag);; size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta_SingleToNextPage) { typedef uint32_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 3*PAGE_SIZE-sizeof(data_t); data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag);; size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta_SingleToCross) { typedef uint32_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 3*PAGE_SIZE-sizeof(data_t)/2-LIM_METADATA_SIZE_512B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag);; size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); // uint8_t* tmp = (uint8_t*) ((uint64_t) ptr_base + offset); // printf("Data at %p: ", tmp); // for (int i = 0; i<16; i++) { // printf("%02x ", tmp[i]); // } // printf("\n"); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta_CrossToCross) { typedef uint64_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 3*PAGE_SIZE-sizeof(data_t)/4-LIM_METADATA_SIZE_512B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); // uint8_t* tmp = (uint8_t*) ((uint64_t) ptr_base + offset); // printf("Data at %p: ", tmp); // for (int i = 0; i<16; i++) { // printf("%02x ", tmp[i]); // } // printf("\n"); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadAfterMeta_CrossToSingle) { typedef uint64_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 3*PAGE_SIZE-sizeof(data_t)/2; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); // uint8_t* tmp = (uint8_t*) ((uint64_t) ptr_base + offset); // printf("Data at %p: ", tmp); // for (int i = 0; i<16; i++) { // printf("%02x ", tmp[i]); // } // printf("\n"); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, SingleWriteReadOverMetadata_CrossPage) { typedef uint64_t data_t; size_t total_size = 4*PAGE_SIZE; size_t size=total_size-LIM_METADATA_SIZE_512B; int offset = 2*PAGE_SIZE-sizeof(data_t)/2-LIM_METADATA_OFFSET_FROM_MIDDLE_512B; data_t* ptr_base = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_base_enc = (data_t*) encode(ptr_base, size, tag); size_t encoded_size_in_bytes = get_slot_size_in_bytes(get_encoded_size((uint64_t)ptr_base_enc)); ASSERT_EQ(encoded_size_in_bytes, total_size); data_t* ptr_enc = (data_t*) ((uint64_t) ptr_base_enc + offset); int num_elements = 1; write_ref_data<data_t>(ptr_enc, num_elements); // uint8_t* tmp = (uint8_t*) ((uint64_t) ptr_base + offset); // printf("Data at %p: ", tmp); // for (int i = 0; i<16; i++) { // printf("%02x ", tmp[i]); // } // printf("\n"); ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } TEST_F(RWTest, 1BWriteRead_4Page) { int limit = 4*PAGE_SIZE; for (int size = 8; size+LIM_METADATA_SIZE_512B <= limit; size = size+8) { typedef uint8_t data_t; data_t* ptr = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_enc = (data_t*) encode(ptr, size, tag); size_t num_elements = size / sizeof(data_t); write_ref_data<data_t>(ptr_enc, num_elements); // test if data was written correctly, skipping metadata ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } } TEST_F(RWTest, 2BWriteRead_4Page) { int limit = 4*PAGE_SIZE; for (int size = 8; size+LIM_METADATA_SIZE_512B <= limit; size = size+8) { typedef uint16_t data_t; for ( uint64_t offset = 0; offset < sizeof(data_t); offset++) { data_t* ptr = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_enc = (data_t*) encode(ptr, size, tag);; ptr_enc = (data_t*) ((uint64_t)ptr_enc + offset); size_t num_elements = (size-offset) / sizeof(data_t); //printf("size=%d ptr=%p ptr_enc=%p num_elements=%ld\n", size, ptr, ptr_enc, num_elements); write_ref_data<data_t>(ptr_enc, num_elements); // test if data was written correctly, skipping metadata ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } } } TEST_F(RWTest, 4BWriteRead_4Page) { int limit = 4*PAGE_SIZE; for (int size = 8; size+LIM_METADATA_SIZE_512B <= limit; size = size+8) { typedef uint32_t data_t; for ( uint64_t offset = 0; offset < sizeof(data_t); offset++) { data_t* ptr = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_enc = (data_t*) encode(ptr, size, tag);; ptr_enc = (data_t*) ((uint64_t)ptr_enc + offset); size_t num_elements = (size-offset) / sizeof(data_t); //printf("size=%d ptr=%p ptr_enc=%p num_elements=%ld\n", size, ptr, ptr_enc, num_elements); write_ref_data<data_t>(ptr_enc, num_elements); // test if data was written correctly, skipping metadata ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } } } TEST_F(RWTest, 8BWriteRead_4Page) { int limit = 4*PAGE_SIZE; for (int size = 8; size+LIM_METADATA_SIZE_512B <= limit; size = size+8) { typedef uint64_t data_t; for ( uint64_t offset = 0; offset < sizeof(data_t); offset++) { data_t* ptr = (data_t*) STATIC_BUFFER_4P_aligned; lim_tag_t tag = 0xF; data_t* ptr_enc = (data_t*) encode(ptr, size, tag); ptr_enc = (data_t*) ((uint64_t)ptr_enc + offset); size_t num_elements = (size-offset) / sizeof(data_t); //printf("size=%d ptr=%p ptr_enc=%p num_elements=%ld\n", size, ptr, ptr_enc, num_elements); write_ref_data<data_t>(ptr_enc, num_elements); // test if data was written correctly, skipping metadata ASSERT_TRUE(check_written_memory(ptr_enc, num_elements*sizeof(data_t))); ASSERT_TRUE(read_data_using_enc_ptr<data_t>(ptr_enc, num_elements)); clear_buffer(); } } } TEST(Malloc, ManySmallAllocsThenFree) { srand(0); size_t max_alloc_size = SIM_CACHELINE_SIZE; for (int i = 0; i < MAX_ALLOCS; i++) { size_t size = (size_t) rand() % max_alloc_size; pointer_array[i] = malloc(size); bool pointer_is_null = (pointer_array[i] == NULL) ? true : false; ASSERT_FALSE(pointer_is_null); } for (int i = 0; i < MAX_ALLOCS; i++) { free(pointer_array[i]); } } TEST(Malloc, AllocThen_8B_to_64B_Reads) { int max_size = 1000; srand(0); uint8_t exp_val8[max_size]; uint8_t * p8 = (uint8_t*) malloc(max_size); //for (int offset = 0; offset < 64; offset+) for (int i = 0; i < max_size ; i++) { exp_val8[i] = (uint8_t) rand() ; p8[i] = exp_val8[i]; } for (int i8=0; i8 < max_size; i8++) { ASSERT_EQ(exp_val8[i8], p8[i8]); } uint16_t* exp_val16 = (uint16_t*) exp_val8; uint16_t* p16 = (uint16_t*) p8; for (int i16=0; i16 < max_size/2; i16++) { ASSERT_EQ(exp_val16[i16], p16[i16]); } uint32_t* exp_val32 = (uint32_t*) exp_val8; uint32_t* p32 = (uint32_t*) p8; for (int i32=0; i32 < max_size/4; i32++) { ASSERT_EQ(exp_val32[i32], p32[i32]); } uint64_t* exp_val64 = (uint64_t*) exp_val8; uint64_t* p64 = (uint64_t*) p8; for (int i64=0; i64 < max_size/8; i64++) { ASSERT_EQ(exp_val64[i64], p64[i64]); } free(p8); } TEST(Malloc, AllocThen_8B_to_64B_ReadsWithOffset) { int max_size = 10000; srand(0); uint8_t exp_val8[max_size]; uint8_t * p8 = (uint8_t*) calloc(1, max_size); for (int i = 0; i < max_size ; i++) { exp_val8[i] = (uint8_t) i;//rand() ; p8[i] = exp_val8[i]; } for (int offset = 1; offset < 64; offset++) { uint16_t* exp_val16 = (uint16_t*) (exp_val8+offset); uint16_t* p16 = (uint16_t*) (p8+offset); for (int i16=0; i16 < (max_size-offset)/2; i16++) { ASSERT_EQ(exp_val16[i16], p16[i16]); } uint32_t* exp_val32 = (uint32_t*) (exp_val8+offset); uint32_t* p32 = (uint32_t*) (p8+offset); for (int i32=0; i32 < (max_size-offset)/4; i32++) { ASSERT_EQ(exp_val32[i32], p32[i32]); } uint64_t* exp_val64 = (uint64_t*) (exp_val8+offset); uint64_t* p64 = (uint64_t*) (p8+offset); for (int i64=0; i64 < (max_size-offset)/8; i64++) { ASSERT_EQ(exp_val64[i64], p64[i64]); } } free(p8); } TEST(Malloc, CheckOldData_LargeAlloc) { srand(123456); size_t max_size = 10000; uint8_t ref_data[max_size]; for (unsigned int iteration = 0; iteration<max_size; iteration++ ) { size_t size = (size_t) iteration; //printf("************ iteration=%d ************\n", iteration); for (unsigned int i = 0; i < min<size_t>(size,max_size); i++) { ref_data[i] = (uint8_t) rand(); } uint8_t* p =(uint8_t*) malloc(size); for (unsigned int offset = 0; offset < min<size_t>(size,max_size); offset++) { p[offset] = ref_data[offset]; } //printf("GTEST: size = %d bytes, new_size = %d bytes\n", (int) size, (int) new_size); if (p == NULL) { printf ("GTEST: p_new is NULL\n"); printf ("GTEST: size =%d\n", (int) size); ASSERT_TRUE(0); } for (unsigned int offset = 0; offset < size; offset++) { int match = (ref_data[offset] == p[offset]) ? 1 : 0 ; if (!match) { printf("iteration=%d\n", iteration); printf ("Mismatch on realloc:\n"); printf ("size =%d\n", (int) size); printf ("offset =%d\n", (int) offset); printf ("ref_data =0x%02x\n", ref_data[offset]); printf ("p =0x%02x\n", p[offset]); } ASSERT_TRUE (match); } free((void*) p); } } TEST(Calloc, SingleAlloc) { uint32_t exp_val = 0x0; uint32_t * p = (uint32_t*) calloc(sizeof(uint32_t), 1); ASSERT_EQ(exp_val, *p); free (p); } TEST(Calloc, AllocRanging1Bto128M) { int max_size = 1<20; int max_num = 128; for (int size = 1; size <=max_size*max_num; size = size * max_num) { for (int num = 1; num <= max_num; num++) { // printf("CALLOC: num=%d, size=%d, total=%d\n", num, size, num*size); uint8_t* p = (uint8_t*) calloc (num, size); //check for zero for (int ind = 0; ind < num*size; ind++) { ASSERT_EQ(0x0, p[ind]); } free(p); } } } TEST(Realloc, SmallToLarge) { //pointer_key_t crypto_key; //init_crypto_key_struct(&crypto_key); size_t small_size = 8; size_t large_size = 1<<30; //init reference data size_t ref_size = small_size; uint8_t ref_data[ref_size]; for (size_t i = 0; i < ref_size; i++) { ref_data[i] = (uint8_t) rand(); } uint8_t* p = (uint8_t*) malloc (small_size); // init p with reference data for (size_t i=0; i < ref_size; i++) { p[i] = ref_data[i]; } uint8_t* p_new = (uint8_t*) realloc(p, large_size); // check whether old data survived for (size_t i=0; i < ref_size; i++) { ASSERT_EQ(ref_data[i], p_new[i]) << " i=" << i << std::endl; } free(p_new); } TEST(Realloc, LargeToSmall) { //pointer_key_t crypto_key; //init_crypto_key_struct(&crypto_key); int small_size = 8; int large_size = 1<<30; //init reference data int ref_size = small_size; uint8_t ref_data[ref_size]; for (int i = 0; i < ref_size; i++) { ref_data[i] = (uint8_t) rand(); } uint8_t* p = (uint8_t*) malloc (large_size); //ASSERT_TRUE(is_canonical((uint64_t) p)); // init p with reference data for (int i = 0; i < ref_size; i++) { p[i] = ref_data[i]; } uint8_t* p_new = (uint8_t*) realloc(p, small_size); //ASSERT_FALSE(is_canonical((uint64_t) p_new)); // check whether old data survived for (int i = 0; i < ref_size; i++) { ASSERT_EQ(ref_data[i], p_new[i]); } free(p_new); } TEST(Realloc, CheckOldData_LargeAlloc) { //pointer_key_t crypto_key; //init_crypto_key_struct(&crypto_key); srand(1234); size_t max_size = 10000; uint8_t ref_data[max_size]; for (unsigned int i = 0; i<max_size; i++ ) { size_t size = 1+ (((size_t)rand())% max_size); //printf("Count=%ld size=%ld\n", ++count, size); for (unsigned int i = 0; i < size; i++) { ref_data[i] = (uint8_t) rand(); } uint8_t* p =(uint8_t*) malloc(size); for (unsigned int offset = 0; offset < size; offset++) { p[offset] = ref_data[offset]; } int new_size = 1+ (((int)rand())%max_size); //printf ("GTEST: new_size=%d\n", (int) new_size); //printf("************ iteration i=%d ************\n", i); //printf("GTEST: size = %d bytes, new_size = %d bytes\n", (int) size, (int) new_size); uint8_t* p_new =(uint8_t*) realloc((void*)p, new_size); if (p_new == NULL) { printf ("GTEST: p_new is NULL\n"); printf ("GTEST: size =%d\n", (int) size); printf ("GTEST: new_size=%d\n", (int) new_size); ASSERT_TRUE(0); } for (unsigned int offset = 0; offset < min<size_t>(size,new_size); offset++) { int match = (ref_data[offset] == p_new[offset]) ? 1 : 0 ; if (!match) { printf("i=%d\n", i); printf ("Mismatch on realloc:\n"); printf ("size =%d\n", (int) size); printf ("new_size=%d\n", (int) new_size); printf ("offset =%d\n", (int) offset); printf ("ref_data =0x%02x\n", ref_data[offset]); printf ("p_new =0x%02x\n", p_new[offset]); } ASSERT_TRUE (match); } //printf("freeing p_new=%p\n", p_new); free((void*) p_new); } } int main (int argc, char **argv) { trace_only = (getenv("TRACE_ONLY")!= NULL); testing::InitGoogleTest(&argc, argv); return RUN_ALL_TESTS(); }
36.38652
166
0.67826
IntelLabs
4afd9707cacc4094c122440407dc12cf6711e195
11,682
cpp
C++
diploidizeSNPlog.cpp
YourePrettyGood/VariantCallingSimulations
3b21879450779ca78c936b961700ceab803daecb
[ "MIT" ]
1
2021-02-15T15:36:55.000Z
2021-02-15T15:36:55.000Z
diploidizeSNPlog.cpp
YourePrettyGood/VariantCallingSimulations
3b21879450779ca78c936b961700ceab803daecb
[ "MIT" ]
null
null
null
diploidizeSNPlog.cpp
YourePrettyGood/VariantCallingSimulations
3b21879450779ca78c936b961700ceab803daecb
[ "MIT" ]
null
null
null
/********************************************************************************** * diploidizeSNPlog.cpp * * Written by Patrick Reilly * * Version 1.0 written 2017/01/23 * * Description: * * * * Syntax: diploidizeSNPlog [haploid 1 merged SNP log] [haploid 2 merged SNP log] * **********************************************************************************/ #include <iostream> #include <fstream> #include <string> #include <getopt.h> #include <cctype> #include <vector> #include <map> #include <sstream> #include <array> //Define constants for getopt: #define no_argument 0 #define required_argument 1 #define optional_argument 2 //Version: #define VERSION "1.0" //Usage/help: #define USAGE "diploidizeSNPlog\nUsage:\n diploidizeSNPlog -i [FASTA .fai] -a [haploid 1 merged SNP log] -b [haploid 2 merged SNP log]\n" using namespace std; vector<string> splitString(string line_to_split, char delimiter) { vector<string> line_vector; string element; istringstream line_to_split_stream(line_to_split); while (getline(line_to_split_stream, element, delimiter)) { line_vector.push_back(element); } return line_vector; } long baseToLong(string &base) { switch(base[0]) { case 'A': case 'a': return 0; case 'C': case 'c': return 1; case 'G': case 'g': return 2; case 'T': case 't': return 3; default: return 4; } } long degenerateBases(long a, long b) { if (a == b) { //Homozygous return a; } else if (a > 3 || b > 3) { //Either is an N return 4; } else if ((a == 0 && b == 1) || (a == 1 && b == 0)) { //Het A/C return 5; //M } else if ((a == 0 && b == 2) || (a == 2 && b == 0)) { //Het A/G return 6; //R } else if ((a == 0 && b == 3) || (a == 3 && b == 0)) { //Het A/T return 7; //W } else if ((a == 1 && b == 2) || (a == 2 && b == 1)) { //Het C/G return 8; //S } else if ((a == 1 && b == 3) || (a == 3 && b == 1)) { //Het C/T return 9; //Y } else if ((a == 2 && b == 3) || (a == 3 && b == 2)) { //Het G/T return 10; //K } else { return 4; } } int main(int argc, char **argv) { //Numbers to bases map: char int2bases[] = {'A', 'C', 'G', 'T', 'N', 'M', 'R', 'W', 'S', 'Y', 'K'}; //Log file paths: string branch1snplog_path, branch2snplog_path, fai_path; //Option for debugging: bool debug = 0; //Variables for getopt_long: int optchar; int structindex = 0; extern int optind; //Create the struct used for getopt: const struct option longoptions[] { {"input_fai", required_argument, 0, 'i'}, {"hap1_snp_log", required_argument, 0, 'a'}, {"hap2_snp_log", required_argument, 0, 'b'}, {"debug", no_argument, 0, 'd'}, {"version", no_argument, 0, 'v'}, {"help", no_argument, 0, 'h'} }; //Read in the options: while ((optchar = getopt_long(argc, argv, "i:a:b:dvh", longoptions, &structindex)) > -1) { switch(optchar) { case 'i': cerr << "Using FASTA .fai index: " << optarg << endl; fai_path = optarg; break; case 'a': cerr << "Using haploid 1 merged SNP log: " << optarg << endl; branch1snplog_path = optarg; break; case 'b': cerr << "Using haploid 2 merged SNP log: " << optarg << endl; branch2snplog_path = optarg; break; case 'd': cerr << "Debugging mode enabled." << endl; debug = 1; break; case 'v': cerr << "diploidizeSNPlog version " << VERSION << endl; return 0; break; case 'h': cerr << USAGE; return 0; break; default: cerr << "Unknown option " << (unsigned char)optchar << " supplied." << endl; cerr << USAGE; return 1; break; } } //Ignore positional arguments if (optind < argc) { cerr << "Ignoring extra positional arguments starting at " << argv[optind++] << endl; } //Check that log paths are set: if (branch1snplog_path.empty() || branch2snplog_path.empty() || fai_path.empty()) { cerr << "Missing one of the input logs. Quitting." << endl; return 2; } //Open the FASTA .fai index: ifstream fasta_fai; fasta_fai.open(fai_path); if (!fasta_fai) { cerr << "Error opening FASTA .fai index file " << fai_path << ". Quitting." << endl; return 3; } //Read in the scaffold order from the .fai file: vector<string> scaffolds; string failine; while (getline(fasta_fai, failine)) { vector<string> line_vector; line_vector = splitString(failine, '\t'); scaffolds.push_back(line_vector[0]); } fasta_fai.close(); //Open the haploid 1 merged SNP log: ifstream branch1_snp_log; branch1_snp_log.open(branch1snplog_path); if (!branch1_snp_log) { cerr << "Error opening haploid 1 merged SNP log " << branch1snplog_path << ". Quitting." << endl; return 5; } //Open the haploid 2 merged SNP log: ifstream branch2_snp_log; branch2_snp_log.open(branch2snplog_path); if (!branch2_snp_log) { cerr << "Error opening haploid 2 merged SNP log " << branch2snplog_path << ". Quitting." << endl; branch1_snp_log.close(); return 6; } //Read branch 1 log into map (keyed by scaffold) of vectors of 3-element arrays (pos, oldallele, newallele): cerr << "Reading haploid 1 merged SNP log " << branch1snplog_path << endl; map<string, vector<array<long, 3>>> branch1_log; string b1line; while (getline(branch1_snp_log, b1line)) { vector<string> line_vector; line_vector = splitString(b1line, '\t'); long oldallele = baseToLong(line_vector[2]); long newallele = baseToLong(line_vector[3]); if (debug && (oldallele > 3 || newallele > 3)) { cerr << "Found non-ACGT base in branch 1 SNP log at " << line_vector[0] << " position " << line_vector[1] << endl; } array<long, 3> log_record; log_record[0] = stoul(line_vector[1]); log_record[1] = oldallele; log_record[2] = newallele; branch1_log[line_vector[0]].push_back(log_record); } branch1_snp_log.close(); cerr << "Done reading haploid 1 merged SNP log" << endl; //Read branch 2 log into map (keyed by scaffold) of vectors of 3-element arrays (pos, oldallele, newallele): cerr << "Reading haploid 2 merged SNP log " << branch2snplog_path << endl; map<string, vector<array<long, 3>>> branch2_log; string b2line; while (getline(branch2_snp_log, b2line)) { vector<string> line_vector; line_vector = splitString(b2line, '\t'); long oldallele = baseToLong(line_vector[2]); long newallele = baseToLong(line_vector[3]); if (debug && (oldallele > 3 || newallele > 3)) { cerr << "Found non-ACGT base in branch 1 SNP log at " << line_vector[0] << " position " << line_vector[1] << endl; } array<long, 3> log_record; log_record[0] = stoul(line_vector[1]); log_record[1] = oldallele; log_record[2] = newallele; branch2_log[line_vector[0]].push_back(log_record); } branch2_snp_log.close(); cerr << "Done reading haploid 2 merged SNP log" << endl; //Now iterate over scaffolds, outputting diploidized SNPs at any sites where either haploid deviates from ref: cerr << "Diploidizing SNP logs" << endl; for (auto scaffold_iterator = scaffolds.begin(); scaffold_iterator != scaffolds.end(); ++scaffold_iterator) { if (branch1_log.count(*scaffold_iterator) == 0) { if (branch2_log.count(*scaffold_iterator) > 0) { //Scaffold is only represented in one of the two haploids //Output haploid 2/ref degenerate base: for (auto b2_iterator = branch2_log[*scaffold_iterator].begin(); b2_iterator != branch2_log[*scaffold_iterator].end(); ++b2_iterator) { cout << *scaffold_iterator << '\t' << (*b2_iterator)[0] << '\t' << int2bases[(*b2_iterator)[1]] << '\t' << int2bases[degenerateBases((*b2_iterator)[2], (*b2_iterator)[1])] << endl; } } } else if (branch2_log.count(*scaffold_iterator) == 0) { //Scaffold must be represented in haploid 1 //Output haploid 1/ref degenerate base for (auto b1_iterator = branch1_log[*scaffold_iterator].begin(); b1_iterator != branch1_log[*scaffold_iterator].end(); ++b1_iterator) { cout << *scaffold_iterator << '\t' << (*b1_iterator)[0] << '\t' << int2bases[(*b1_iterator)[1]] << '\t' << int2bases[degenerateBases((*b1_iterator)[2], (*b1_iterator)[1])] << endl; } } else { //Scaffold is represented in both haploids, so diploidize the scaffold auto b1_iterator = branch1_log[*scaffold_iterator].begin(); auto b2_iterator = branch2_log[*scaffold_iterator].begin(); while (b1_iterator != branch1_log[*scaffold_iterator].end() && b2_iterator != branch2_log[*scaffold_iterator].end()) { if ((*b1_iterator)[0] < (*b2_iterator)[0]) { //Output haploid 1/ref degenerate base: cout << *scaffold_iterator << '\t' << (*b1_iterator)[0] << '\t' << int2bases[(*b1_iterator)[1]] << '\t' << int2bases[degenerateBases((*b1_iterator)[2], (*b1_iterator)[1])] << endl; ++b1_iterator; } else if ((*b1_iterator)[0] > (*b2_iterator)[0]) { //Output haploid 2/ref degenerate base: cout << *scaffold_iterator << '\t' << (*b2_iterator)[0] << '\t' << int2bases[(*b2_iterator)[1]] << '\t' << int2bases[degenerateBases((*b2_iterator)[2], (*b2_iterator)[1])] << endl; ++b2_iterator; } else { //Check that ref alleles match: if ((*b1_iterator)[1] != (*b2_iterator)[1]) { cerr << "Old alleles for site " << (*b1_iterator)[0] << " on scaffold " << *scaffold_iterator << " do not match between haploids." << endl; cerr << "Haploid 1 says " << int2bases[(*b1_iterator)[1]] << " while haploid 2 says " << int2bases[(*b2_iterator)[1]] << endl; } //Diploidize the SNP: cout << *scaffold_iterator << '\t' << (*b1_iterator)[0] << '\t' << int2bases[(*b1_iterator)[1]] << '\t' << int2bases[degenerateBases((*b1_iterator)[2], (*b2_iterator)[2])] << endl; ++b1_iterator; ++b2_iterator; } } //Output the remainder of the scaffold from whichever branch still hasn't reached its end: while (b1_iterator != branch1_log[*scaffold_iterator].end()) { cout << *scaffold_iterator << '\t' << (*b1_iterator)[0] << '\t' << int2bases[(*b1_iterator)[1]] << '\t' << int2bases[degenerateBases((*b1_iterator)[2], (*b1_iterator)[1])] << endl; ++b1_iterator; } while (b2_iterator != branch2_log[*scaffold_iterator].end()) { cout << *scaffold_iterator << '\t' << (*b2_iterator)[0] << '\t' << int2bases[(*b2_iterator)[1]] << '\t' << int2bases[degenerateBases((*b2_iterator)[2], (*b2_iterator)[1])] << endl; ++b2_iterator; } } } cerr << "Done diploidizing SNP logs" << endl; return 0; }
40.846154
195
0.555128
YourePrettyGood
4afe40388e78839d3c18eb7ba8bfa532b4ed6d53
1,209
cpp
C++
ARDUINO_CODE/Bluetooth.cpp
Allabakshu-shaik/Mercedes-POC
b338c471870830ba4b4fb26e4dc1097e0882a8e2
[ "MIT" ]
46
2020-01-08T16:38:46.000Z
2022-03-30T21:08:07.000Z
ARDUINO_CODE/Bluetooth.cpp
Allabakshu-shaik/Mercedes-POC
b338c471870830ba4b4fb26e4dc1097e0882a8e2
[ "MIT" ]
2
2020-03-28T08:26:29.000Z
2020-08-06T10:52:57.000Z
ARDUINO_CODE/Bluetooth.cpp
Allabakshu-shaik/Mercedes-POC
b338c471870830ba4b4fb26e4dc1097e0882a8e2
[ "MIT" ]
9
2020-03-13T20:53:02.000Z
2021-08-31T08:50:20.000Z
#include "Bluetooth.h" bool BLUETOOTH::isConnected = false; #ifdef ARDUINO_MEGA BLUETOOTH::BLUETOOTH() { Serial1.begin(9600); Serial1.clearWriteError(); } char* BLUETOOTH::read_message() { memset(buffer, 0x00, sizeof(buffer)); if (Serial1.available()) { uint8_t len = Serial1.read(); Serial1.readBytes(buffer, len); this->isConnected = true; DPRINTLN(BT_REC_STR+String(buffer)); } return buffer; } void BLUETOOTH::write_message(const char* msg, uint8_t len = 0) { for(uint8_t i = 0; i < len; i++) { Serial1.write(msg[i]); } } #else BLUETOOTH::BLUETOOTH(uint8_t rx, uint8_t tx) { bt = new SoftwareSerial(tx, rx); bt->begin(9600); bt->clearWriteError(); } char* BLUETOOTH::read_message() { memset(buffer, 0x00, sizeof(buffer)); if (bt->available()) { this->isConnected = true; uint8_t len = bt->read(); bt->readBytes(buffer, len); DPRINTLN(BT_REC_STR+String(buffer)); } return buffer; } void BLUETOOTH::write_message(const char* msg, uint8_t len = 0) { for(uint8_t i = 0; i < len; i++) { bt->write(msg[i]); } bt->write('\r'); bt->flush(); } #endif
22.388889
65
0.603805
Allabakshu-shaik
ab00784b9802f57a9c460c2c8dca85543846a516
16,515
cpp
C++
src/ReportWindow.cpp
fantoro/CapitalBe
0d5f7056a61e71693b1ef85b5024c9ce0894ab2f
[ "MIT" ]
2
2017-05-17T07:18:05.000Z
2018-02-28T13:51:47.000Z
src/ReportWindow.cpp
fantoro/CapitalBe
0d5f7056a61e71693b1ef85b5024c9ce0894ab2f
[ "MIT" ]
26
2016-12-20T12:28:52.000Z
2022-03-30T06:00:03.000Z
src/ReportWindow.cpp
fantoro/CapitalBe
0d5f7056a61e71693b1ef85b5024c9ce0894ab2f
[ "MIT" ]
13
2015-01-28T15:26:06.000Z
2020-10-26T06:03:42.000Z
#include "ReportWindow.h" #include <GridLayoutBuilder.h> #include <LayoutBuilder.h> #include <View.h> #include <StringView.h> #include <Bitmap.h> #include <TranslationUtils.h> #include "ReportGrid.h" #include "DateBox.h" #include "StickyDrawButton.h" #include "Layout.h" #include "TimeSupport.h" #include "ObjectList.h" #include "Database.h" #include "ColumnTypes.h" #include "HelpButton.h" #include "Preferences.h" #include "MsgDefs.h" int compare_stringitem(const void *item1, const void *item2); enum { M_REPORT_CASH_FLOW='csfl', M_REPORT_NET_WORTH, M_REPORT_TRANSACTIONS, M_REPORT_BUDGET, M_START_DATE_CHANGED, M_END_DATE_CHANGED, M_CATEGORIES_CHANGED, M_SUBTOTAL_NONE, M_SUBTOTAL_MONTH, M_SUBTOTAL_QUARTER, M_SUBTOTAL_YEAR, M_TOGGLE_ACCOUNT, M_TOGGLE_GRAPH }; ReportWindow::ReportWindow(BRect frame) : BWindow(frame,TRANSLATE("Reports"), B_DOCUMENT_WINDOW, B_ASYNCHRONOUS_CONTROLS | B_AUTO_UPDATE_SIZE_LIMITS), fSubtotalMode(SUBTOTAL_NONE), fReportMode(REPORT_CASH_FLOW), fStartDate(GetCurrentYear()), fEndDate(GetCurrentDate()), fTitleFont(be_bold_font), fHeaderFont(be_plain_font) { BString temp; fHeaderFont.SetFace(B_ITALIC_FACE); BView *view = new BView("back", B_WILL_DRAW); BLayoutBuilder::Group<>(this, B_VERTICAL, 0.0f) .SetInsets(0) .Add(view) .End(); view->SetViewColor(240,240,240); BGroupLayout *reportsLayout = new BGroupLayout(B_VERTICAL, 0); BGroupLayout *accountsLayout = new BGroupLayout(B_VERTICAL, 0); BGroupLayout *subtotalLayout = new BGroupLayout(B_VERTICAL, 0); BGroupLayout *categoriesLayout = new BGroupLayout(B_VERTICAL, 0); BGroupLayout *layout_ = new BGroupLayout(B_VERTICAL, 1.0f); BLayoutBuilder::Group<>(view, B_HORIZONTAL) .SetInsets(10) .AddGroup(B_VERTICAL, 1.0f) .Add(reportsLayout, 1) .Add(accountsLayout, 5) .Add(subtotalLayout, 1) .Add(categoriesLayout, 5) .End() .Add(layout_) .End(); BMenu *reportmenu = new BMenu(TRANSLATE("Reports")); reportmenu->SetLabelFromMarked(true); // TODO: Re-enable the Budget report // reportmenu->AddItem(new BMenuItem(TRANSLATE("Budget"), new BMessage(M_REPORT_BUDGET))); temp << TRANSLATE("Income") << " / " << TRANSLATE("Spending"); reportmenu->AddItem(new BMenuItem(temp.String(), new BMessage(M_REPORT_CASH_FLOW))); reportmenu->AddItem(new BMenuItem(TRANSLATE("Total Worth"), new BMessage(M_REPORT_NET_WORTH))); reportmenu->AddItem(new BMenuItem(TRANSLATE("Transactions"), new BMessage(M_REPORT_TRANSACTIONS))); reportmenu->SetRadioMode(true); reportmenu->ItemAt(0L)->SetMarked(true); fReportMode = REPORT_BUDGET; BRect r(10,10,reportmenu->StringWidth(temp.String())+45,60); temp = TRANSLATE("Reports"); temp += ": "; BStringView *sv = new BStringView("reportsv",temp.String()); reportsLayout->AddView(sv); fReportField = new BMenuField("reportfield","",reportmenu); reportsLayout->AddView(fReportField); temp = TRANSLATE("Accounts"); temp += ": "; sv = new BStringView("accountsv",temp.String()); accountsLayout->AddView(sv); fAccountList = new BListView("reportaccountlist",B_MULTIPLE_SELECTION_LIST); BScrollView *scrollview = new BScrollView("accountscroller",fAccountList,0, false,true); accountsLayout->AddView(scrollview); // This is disabled because otherwise the report is rendered once for each // account added when the report window is shown initially // fAccountList->SetSelectionMessage(new BMessage(M_TOGGLE_ACCOUNT)); temp = TRANSLATE("Subtotal"); temp += ":"; sv = new BStringView("subtotalsv",temp.String()); subtotalLayout->AddView(sv); BMenu *subtotalmenu = new BMenu(TRANSLATE("Subtotal")); subtotalmenu->AddItem(new BMenuItem(TRANSLATE("None"),new BMessage(M_SUBTOTAL_NONE))); subtotalmenu->AddItem(new BMenuItem(TRANSLATE("Month"),new BMessage(M_SUBTOTAL_MONTH))); subtotalmenu->AddItem(new BMenuItem(TRANSLATE("Quarter"),new BMessage(M_SUBTOTAL_QUARTER))); subtotalmenu->AddItem(new BMenuItem(TRANSLATE("Year"),new BMessage(M_SUBTOTAL_YEAR))); subtotalmenu->SetLabelFromMarked(true); subtotalmenu->SetRadioMode(true); subtotalmenu->ItemAt(0)->SetMarked(true); fSubtotalField = new BMenuField("subtotalfield","",subtotalmenu); subtotalLayout->AddView(fSubtotalField); prefsLock.Lock(); BString reporthelp = gAppPath; prefsLock.Unlock(); reporthelp << "helpfiles/" << gCurrentLanguage->Name() << "/Report Window Help"; HelpButton *help = new HelpButton("reporthelp", reporthelp.String()); temp = TRANSLATE("Categories"); temp += ": "; sv = new BStringView("catsv",temp.String()); categoriesLayout->AddView(sv); fCategoryList = new BListView("reportcattlist",B_MULTIPLE_SELECTION_LIST, B_WILL_DRAW | B_FULL_UPDATE_ON_RESIZE | B_NAVIGABLE); fCategoryScroller = new BScrollView("catscroller",fCategoryList,0,false,true); categoriesLayout->AddView(fCategoryScroller); fCategoryList->SetSelectionMessage(new BMessage(M_CATEGORIES_CHANGED)); fCategoryList->SetInvocationMessage(new BMessage(M_CATEGORIES_CHANGED)); BString datestring; gDefaultLocale.DateToString(GetCurrentYear(),datestring); temp = TRANSLATE("Starting Date"); temp += ": "; fStartDateBox = new DateBox("startdate",temp.String(),datestring.String(), new BMessage(M_START_DATE_CHANGED)); fStartDateBox->SetDate(GetCurrentYear()); // fStartDateBox->SetEscapeCancel(true); layout_->AddView(fStartDateBox); fStartDateBox->GetFilter()->SetMessenger(new BMessenger(this)); gDefaultLocale.DateToString(GetCurrentDate(),datestring); temp = TRANSLATE("Ending Date"); temp += ": "; fEndDateBox = new DateBox("enddate",temp.String(),datestring.String(), new BMessage(M_END_DATE_CHANGED)); fEndDateBox->SetDate(GetCurrentDate()); layout_->AddView(fEndDateBox); fEndDateBox->GetFilter()->SetMessenger(new BMessenger(this)); BBitmap *up, *down; BRect brect(0,0,16,16); up = BTranslationUtils::GetBitmap('PNG ',"BarGraphUp.png"); if(!up) up = new BBitmap(brect,B_RGB32); down = BTranslationUtils::GetBitmap('PNG ',"BarGraphDown.png"); if(!down) down = new BBitmap(brect,B_RGB32); brect.OffsetTo(Bounds().right - 10 - brect.Width(),10 + ((fEndDateBox->Frame().Height() - 16)/2) ); fGraphButton = new StickyDrawButton(brect,"graphbutton",up,down, new BMessage(M_TOGGLE_GRAPH), B_FOLLOW_TOP | B_FOLLOW_RIGHT,B_WILL_DRAW); // view->AddChild(fGraphButton); // TODO: This needs to be unhidden when graph support is finally added fGraphButton->Hide(); fGridView = new BColumnListView("gridview",B_WILL_DRAW, B_FANCY_BORDER); layout_->AddView(fGridView); layout_->AddItem(BGridLayoutBuilder(0.0f, 0.0f) .Add(BSpaceLayoutItem::CreateGlue(), 0, 0) .Add(help, 1, 0) ); // Configuring to make it look good and not like a grid fGridView->SetColumnFlags(B_ALLOW_COLUMN_RESIZE); fGridView->SetSortingEnabled(false); fGridView->SetEditMode(false); rgb_color white = { 255,255,255,255 }; fGridView->SetColor(B_COLOR_BACKGROUND,white); fGridView->SetColor(B_COLOR_ROW_DIVIDER,fGridView->Color(B_COLOR_BACKGROUND)); fGridView->SetColor(B_COLOR_SELECTION,fGridView->Color(B_COLOR_BACKGROUND)); fGridView->SetColor(B_COLOR_NON_FOCUS_SELECTION,fGridView->Color(B_COLOR_BACKGROUND)); fGridView->SetColor(B_COLOR_SEPARATOR_BORDER,fGridView->Color(B_COLOR_BACKGROUND)); fGridView->SetColor(B_COLOR_SEPARATOR_LINE,fGridView->Color(B_COLOR_BACKGROUND)); fGraphView = new BView(r,"As Graph",B_FOLLOW_ALL,B_WILL_DRAW); // view->AddChild(fGraphView); fGraphView->Hide(); gDatabase.AddObserver(this); for(int32 i=0; i<gDatabase.CountAccounts(); i++) { Account *acc = gDatabase.AccountAt(i); if(!acc) continue; AddAccount(acc); } fAccountList->SortItems(compare_stringitem); fCategoryList->SortItems(compare_stringitem); for(int32 i=0; i<fAccountList->CountItems(); i++) { BStringItem *item = (BStringItem*)fAccountList->ItemAt(i); if(!item) continue; Account *itemaccount = gDatabase.AccountByName(item->Text()); if(itemaccount && (!itemaccount->IsClosed())) fAccountList->Select(i,true); } // fAccountList->Select(0,fAccountList->CountItems()-1,true); fCategoryList->Select(0,fCategoryList->CountItems()-1,true); // Set up the scrollbars CalcCategoryString(); fReportField->MakeFocus(true); fAccountList->SetSelectionMessage(new BMessage(M_TOGGLE_ACCOUNT)); } void ReportWindow::HandleNotify(const uint64 &value, const BMessage *msg) { Lock(); if(value & WATCH_ACCOUNT) { Account *acc; if(msg->FindPointer("item",(void**)&acc)!=B_OK) { Unlock(); return; } if(value & WATCH_CREATE) { AddAccount(acc); } else if(value & WATCH_DELETE) { } else if(value & WATCH_RENAME) { } else if(value & WATCH_CHANGE) { } } else if(value & WATCH_TRANSACTION) { } RenderReport(); Unlock(); } void ReportWindow::MessageReceived(BMessage *msg) { switch(msg->what) { case M_PREVIOUS_FIELD: { if(fStartDateBox->ChildAt(0)->IsFocus()) fCategoryList->MakeFocus(); else if(fEndDateBox->ChildAt(0)->IsFocus()) fStartDateBox->MakeFocus(); break; } case M_NEXT_FIELD: { if(fStartDateBox->ChildAt(0)->IsFocus()) fEndDateBox->MakeFocus(); else if(fEndDateBox->ChildAt(0)->IsFocus()) fGridView->MakeFocus(); break; } case M_REPORT_CASH_FLOW: { fReportMode = REPORT_CASH_FLOW; RenderReport(); break; } case M_REPORT_NET_WORTH: { fReportMode = REPORT_NET_WORTH; RenderReport(); break; } case M_REPORT_TRANSACTIONS: { fReportMode = REPORT_TRANSACTIONS; RenderReport(); break; } case M_REPORT_BUDGET: { fReportMode = REPORT_BUDGET; RenderReport(); break; } case M_SUBTOTAL_NONE: { fSubtotalMode = SUBTOTAL_NONE; RenderReport(); break; } case M_SUBTOTAL_MONTH: { fSubtotalMode = SUBTOTAL_MONTH; RenderReport(); break; } case M_SUBTOTAL_QUARTER: { fSubtotalMode = SUBTOTAL_QUARTER; RenderReport(); break; } case M_SUBTOTAL_YEAR: { fSubtotalMode = SUBTOTAL_YEAR; RenderReport(); break; } case M_START_DATE_CHANGED: { time_t temp; if(gDefaultLocale.StringToDate(fStartDateBox->Text(),temp)==B_OK) { fStartDate = temp; if(fStartDate > fEndDate) fStartDate = fEndDate; RenderReport(); } else { ShowAlert(TRANSLATE("Capital Be didn't understand the date you entered."), TRANSLATE( "Capital Be understands lots of different ways of entering dates. " "Apparently, this wasn't one of them. You'll need to change how you " "entered this date. Sorry.")); fStartDateBox->MakeFocus(true); break; } BString formatted; gDefaultLocale.DateToString(fStartDate,formatted); fStartDateBox->SetText(formatted.String()); break; } case M_END_DATE_CHANGED: { time_t temp; if(gDefaultLocale.StringToDate(fEndDateBox->Text(),temp)==B_OK) { fEndDate = temp; if(fStartDate > fEndDate) fStartDate = fEndDate; RenderReport(); } else { ShowAlert(TRANSLATE("Capital Be didn't understand the date you entered."), TRANSLATE( "Capital Be understands lots of different ways of entering dates. " "Apparently, this wasn't one of them. You'll need to change how you " "entered this date. Sorry.")); fEndDateBox->MakeFocus(true); break; } BString formatted; gDefaultLocale.DateToString(fEndDate,formatted); fEndDateBox->SetText(formatted.String()); break; } case M_CATEGORIES_CHANGED: { CalcCategoryString(); RenderReport(); break; } case M_TOGGLE_ACCOUNT: { RenderReport(); break; } case M_TOGGLE_GRAPH: { if(fGridView->IsHidden()) { fGridView->Show(); fGraphView->Hide(); } else { fGridView->Hide(); fGraphView->Show(); } break; } default: BWindow::MessageReceived(msg); } } void ReportWindow::FrameResized(float w, float h) { BScrollBar *bar = fCategoryScroller->ScrollBar(B_VERTICAL); if(fCategoryList->CountItems()) { float itemheight = fCategoryList->ItemAt(0)->Height(); float itemrange = (fCategoryList->CountItems()+1) * itemheight; if(itemrange < fCategoryScroller->Frame().Height()) bar->SetRange(0,0); else bar->SetRange(0,itemrange - fCategoryScroller->Frame().Height()); float big, small; bar->GetSteps(&small, &big); big = (int32)(fCategoryScroller->Frame().Height() * .9); bar->SetSteps(small,big); } else bar->SetRange(0,0); FixGridScrollbar(); } void ReportWindow::AddAccount(Account *acc) { if(!acc) return; acc->AddObserver(this); AccountItem *accountitem = new AccountItem(acc); fAccountList->AddItem(accountitem); BString command = "select category from account_"; command << acc->GetID() << ";"; CppSQLite3Query query = gDatabase.DBQuery(command.String(),"ReportWindow::AddAccount"); while(!query.eof()) { BString catstr = DeescapeIllegalCharacters(query.getStringField(0)); if(catstr.CountChars()<1) { query.nextRow(); continue; } // Make sure that the category is not already in the list. BStringItem *existing = NULL; for(int32 k=0; k<fCategoryList->CountItems(); k++) { BStringItem *item = (BStringItem*)fCategoryList->ItemAt(k); if(!item) continue; if(catstr.ICompare(item->Text())==0) { existing = item; break; } } if(existing) { query.nextRow(); continue; } fCategoryList->AddItem(new BStringItem(catstr.String())); query.nextRow(); } } void ReportWindow::FixGridScrollbar(void) { BScrollBar *bar = fGridView->ScrollBar(B_VERTICAL); if (!bar) return; BRow *row = fGridView->RowAt(0); if(!row) return; float itemrange = (fGridView->CountRows()+3) * row->Height();; if(itemrange < fGridView->Frame().Height() - B_H_SCROLL_BAR_HEIGHT) bar->SetRange(0,0); else bar->SetRange(0,itemrange - fGridView->Frame().Height()); float big, small; bar->GetSteps(&small, &big); big = (int32)(fGridView->Frame().Height() * .9); bar->SetSteps(small,big); } /* void ReportWindow::CalcAccountString(void) { // Compile list of selected accounts fAccountString = ""; for(int32 i=0; i<gDatabase.CountAccounts(); i++) { AccountItem *accitem = (AccountItem*)fAccountList->ItemAt(i); if(accitem && accitem->IsSelected()) { if(fAccountString.CountChars()>0) fAccountString << ",account_" << accitem->account->GetID(); else fAccountString << "account_" << accitem->account->GetID(); } } } */ void ReportWindow::CalcCategoryString(void) { // Compile list of selected categories fCategoryString = ""; for(int32 i=0; i<fCategoryList->CountItems(); i++) { BStringItem *catitem = (BStringItem*)fCategoryList->ItemAt(i); if(catitem && catitem->IsSelected()) { if(fCategoryString.CountChars()>0) fCategoryString << ",'" << EscapeIllegalCharacters(catitem->Text()) << "'"; else fCategoryString << "'" << EscapeIllegalCharacters(catitem->Text()) << "'"; } } } void ReportWindow::RenderReport(void) { fGridView->Clear(); BColumn *column = fGridView->ColumnAt(0); while(column) { fGridView->RemoveColumn(column); delete column; column = fGridView->ColumnAt(0); } if(fAccountList->CountItems()<1 || fAccountList->CurrentSelection()<0) return; switch(fReportMode) { case REPORT_CASH_FLOW: { ComputeCashFlow(); break; } case REPORT_NET_WORTH: { ComputeNetWorth(); break; } case REPORT_TRANSACTIONS: { ComputeTransactions(); break; } case REPORT_BUDGET: { ComputeBudget(); break; } default: break; } FixGridScrollbar(); } bool ReportWindow::QuitRequested(void) { // We need to remove this window's observer object from each account's notifier, or else // we will crash the app after closing the window and selecting an account for (int32 i = 0; i < gDatabase.CountAccounts(); i++) { Account *acc = gDatabase.AccountAt(i); if(!acc) continue; acc->RemoveObserver(this); } gDatabase.RemoveObserver(this); return true; } int compare_stringitem(const void *item1, const void *item2) { BListItem *listitem1 = *((BListItem**)item1); BListItem *listitem2 = *((BListItem**)item2); BStringItem *stritem1=(BStringItem *)listitem1; BStringItem *stritem2=(BStringItem *)listitem2; int len1 = (stritem1 && stritem1->Text()) ? strlen(stritem1->Text()) : 0; int len2 = (stritem2&& stritem2->Text()) ? strlen(stritem2->Text()) : 0; if(len1 < 1) { return (len2 < 1) ? 0 : 1; } else if(len2 < 1) { return (len1 < 1) ? 0 : -1; } return strcmp(stritem1->Text(),stritem2->Text()); }
25.252294
111
0.706146
fantoro
ab02beb9d486873696b0937874ecc7c4d546deb7
2,124
cpp
C++
src/ArucoHandler.cpp
bobribbon/team_scheire_OK
e40c52a681e31bd3a0209f11e4de2268cc2d55e1
[ "MIT" ]
null
null
null
src/ArucoHandler.cpp
bobribbon/team_scheire_OK
e40c52a681e31bd3a0209f11e4de2268cc2d55e1
[ "MIT" ]
null
null
null
src/ArucoHandler.cpp
bobribbon/team_scheire_OK
e40c52a681e31bd3a0209f11e4de2268cc2d55e1
[ "MIT" ]
null
null
null
/* * Interactieve OK * Jeroen Lassche (j.lassche@bravis.nl) * * Fork van het project: * Immersief, interactief operatiekwartier * door Team Scheire, Imec en Jan Everaert * https://github.com/imec-int/team_scheire_OK */ #include "ArucoHandler.hpp" #include "ofxOpenCv.h" #include "ofxCv.h" #include "ofxAruco.h" /* * Teken oppervlaktes op de gevonden markers. */ void ArucoHandler::draw(MarkerHandler *markerHandler, SurfaceHandler *surfaceHandler, int mode) { vector<aruco::Marker> markers; framebuffer.begin(); ofClear(0, 0, 0, 0); // teken camera if (mode & MODE_SHOW_CAMERA) { camera.draw(0, 0, ofGetWidth(), ofGetHeight()); } markers = aruco.getMarkers(); for (int i = 0; i < markerHandler->visibleMarkersId.size(); i++) { Marker marker = markerHandler->get(markerHandler->visibleMarkersId.at(i)); aruco.begin(i); // teken sufaces if (marker.id != MARKER_UNKNOWN) { if (mode & MODE_EDIT && markerHandler->selectedMarkerId == marker.id) { surfaceHandler->draw(marker, true); } else { surfaceHandler->draw(marker); } } // teken marker if (mode & MODE_SHOW_MARKERS) { markerHandler->draw(marker); } aruco.end(); } framebuffer.end(); framebuffer.draw(0, 0); return; } /* * Verkrijg zichtbare markers id's. * Geeft een vector van ints terug met de gevonden id's. */ vector<int> ArucoHandler::getVisibleMarkersIds(void) { vector<aruco::Marker> arucoMarkers; vector<int> ids; arucoMarkers = aruco.getMarkers(); for (int i = 0; i < arucoMarkers.size(); i++) { ids.push_back(arucoMarkers.at(i).id); } return ids; } /* * Stel ofxAruco in. */ void ArucoHandler::setup(string dataPath) { camera.setDeviceID(0); camera.initGrabber(WIDTH, HEIGHT); aruco.setup(dataPath + "intrinsics.int", camera.getWidth(), camera.getHeight()); framebuffer.allocate(WIDTH, HEIGHT); return; } /* * Update camera. */ void ArucoHandler::update(int mode) { if (mode & MODE_TRACK) { camera.update(); if (camera.isFrameNew()) { camera.getPixelsRef().mirror(true, false); aruco.detectBoards(camera.getPixels()); } } return; }
17.848739
95
0.679379
bobribbon
ab073e642a41c91e273bab92f031deae626bb8b4
11,387
cpp
C++
src/plugins/ExampleSensor/ExampleSensor.cpp
SchademanK/Ookala
9a5112e1d3067d589c150fb9c787ae36801a67dc
[ "MIT" ]
null
null
null
src/plugins/ExampleSensor/ExampleSensor.cpp
SchademanK/Ookala
9a5112e1d3067d589c150fb9c787ae36801a67dc
[ "MIT" ]
null
null
null
src/plugins/ExampleSensor/ExampleSensor.cpp
SchademanK/Ookala
9a5112e1d3067d589c150fb9c787ae36801a67dc
[ "MIT" ]
null
null
null
// -------------------------------------------------------------------------- // $Id: ExampleSensor.cpp 135 2008-12-19 00:49:58Z omcf $ // -------------------------------------------------------------------------- // Copyright (c) 2008 Hewlett-Packard Development Company, L.P. // // Permission is hereby granted, free of charge, to any person obtaining // a copy of this software and associated documentation files (the "Software"), // to deal in the Software without restriction, including without limitation // the rights to use, copy, modify, merge, publish, distribute, sublicense, // and/or sell copies of the Software, and to permit persons to whom the // Software is furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included // in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS // OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL // THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR // OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, // ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR // OTHER DEALINGS IN THE SOFTWARE. // -------------------------------------------------------------------------- #include <stdio.h> #include <stdlib.h> #include <string.h> #ifdef __linux__ #include <unistd.h> #include <usb.h> #elif WIN32 #include <windows.h> #endif #include <algorithm> #include <iostream> #include "Sensor.h" #include "PluginChain.h" //ExampleSensor - headers ---------------------------------------------------- #include "ExampleSensor.h" // ---------------------------------- BEGIN_PLUGIN_REGISTER(1) PLUGIN_REGISTER(0, Ookala::ExampleSensor) END_PLUGIN_REGISTER // ---------------------------------- // ================================== // // ExampleSensor // // ---------------------------------- Ookala::ExampleSensor::ExampleSensor(): Sensor() { setName("ExampleSensor"); mDeviceOpen = false; mNextSensorKey = 1; mReadScreenRefresh = false; } // ---------------------------------- // Ookala::ExampleSensor::ExampleSensor(const ExampleSensor &src): Sensor(src) { mDeviceOpen = src.mDeviceOpen; mNextSensorKey = src.mNextSensorKey; mDeviceKey = src.mDeviceKey; mReadScreenRefresh = src.mReadScreenRefresh; } // ---------------------------------- // // virtual Ookala::ExampleSensor::~ExampleSensor() { // If we're left with an open device, close it. if (mDeviceOpen) { // XXX: Close the device handle. std::cout << " disposing of open sensor\n"; mDeviceOpen = false; } } // ---------------------------- // Ookala::ExampleSensor & Ookala::ExampleSensor::operator=(const ExampleSensor &src) { if (this != &src) { Sensor::operator=(src); mNextSensorKey = src.mNextSensorKey; mDeviceOpen = src.mDeviceOpen; mDeviceKey = src.mDeviceKey; mReadScreenRefresh = src.mReadScreenRefresh; } return *this; } // ---------------------------------- // // virtual std::vector<uint32_t> Ookala::ExampleSensor::sensors() { std::vector<uint32_t> devices; setErrorString(""); if (mDeviceOpen) { devices.push_back(mDeviceKey); } return devices; } // ---------------------------------- // // virtual bool Ookala::ExampleSensor::measureYxy(Yxy &value, PluginChain *chain /* = NULL */, uint32_t sensorId /* = 0 */) { DictOptions opts; setErrorString(""); if (!getDictOptions(opts, chain)) { return false; } // Update the calibration, in case someone changed // it out from under us. // XXX: Choose the calibration matrix, based on what's selected // in opts.calibration std::cout << " measureXY: selecting calibration matrix...\n"; // XXX: Choose the display type (e.g. LCD, CRT, etc) base // on the value in opts.displayType std::cout << " measureXY: setup LCD or CRT...\n"; // XXX: Choose the integration time based on the value in // opts.integrationTime std::cout << " measureXY: integration time applied...\n"; // XXX: Finally, read a measurement in cd/m&2 into the value // parameter. std::cout << " measureXY: reading measurement Yxy (candela)...\n"; // XXX: Return measured value value.Y = (double) 1.0; // Simulate (dummy) values value.x = (double) 0.312779; value.y = (double) 0.329183; std::cout << " measureXY: read (dummy) values Yxy (1.0, 0.31, 0.32) ...\n"; if (chain) { chain->setUiYxy("Ui::measured_Yxy", value); } return true; } // ---------------------------------- // // virtual std::vector<uint32_t> Ookala::ExampleSensor::actionNeeded( PluginChain *chain /* = NULL */, uint32_t sensorId /* = 0 */) { std::vector<uint32_t> actions; DictOptions opts; setErrorString(""); if (getDictOptions(opts, chain)) { // XXX: See if we need to do anything based on our options. // For example, if opts.displayType indicates CRT, // we might want to do: // actions.push_back(SENSOR_ACTION_MEASURE_REFRESH). // or for LCD: // actions.push_back(SENSOR_ACTION_DARK_READING). // YMMV. } if (!mDeviceOpen) { actions.push_back(SENSOR_ACTION_DETECT); } return actions; } // ---------------------------------- // // virtual bool Ookala::ExampleSensor::actionTaken(uint32_t actionKey, PluginChain *chain /* = NULL */, uint32_t sensorId /* = 0 */) { setErrorString(""); switch (actionKey) { // Here we need to probe for attached devices. case SENSOR_ACTION_DETECT: if (mDeviceOpen) { // XXX: Close the device if it's already open std::cout << " actionTaken: open sensor closed...\n"; mDeviceOpen = false; } // XXX: Open the device std::cout << " actionTaken: detect and open sensor device...\n"; // XXX: And check that it's what we're expecting std::cout << " actionTaken: confirm state...\n"; // Simulate open (dummy) sensor succeeded mDeviceOpen = true; break; case SENSOR_ACTION_DARK_READING: // XXX: Establish a dark reading point std::cout << " actionTaken: conduct Dark Reading...\n"; break; case SENSOR_ACTION_MEASURE_REFRESH: // XXX: Measure the refresh rate of monitor (CRT) std::cout << " actionTaken: conduct Refresh Reading (CRT)...\n"; // Simulate refresh (dummy) action succeeded mReadScreenRefresh = true; break; default: return false; break; } return true; } // ---------------------------------- // // Given a chain, lookup it's dict and pull out things that // we care about: // // ExampleSensor::displayType [STRING] {lcd, crt} // ExampleSensor::integrationTime [INT] Number of seconds to measure // ExampleSensor::calibrationIdx [INT] Override the calibration // matrix choice based on // displayType. // Can be 0-3. // // protected bool Ookala::ExampleSensor::getDictOptions(DictOptions &opts, PluginChain *chain) { Dict *chainDict = NULL; DictItem *item = NULL; StringDictItem *stringItem = NULL; IntDictItem *intItem = NULL; DoubleDictItem *doubleItem = NULL; std::string displayType; // XXX: Set default values based on the appropriate types opts.displayType = 0; // XXX: opts.integrationTime = 1; opts.calibration = 0; // XXX: std::cout << " DictOptions: setup base defaults...\n"; if (!chain) { std::cout << " DictOptions: no chain detected...\n"; return false; } chainDict = chain->getDict(); // Pull out the display type, and set a default calibration to match item = chainDict->get("ExampleSensor::displayType"); if (item) { stringItem = dynamic_cast<StringDictItem *>(item); if (stringItem) { displayType = stringItem->get(); std::transform(displayType.begin(), displayType.end(), displayType.begin(), #ifdef _WIN32 tolower); #else (int(*)(int))std::tolower); #endif if (displayType == "lcd") { // XXX: Set opts.displayType to LCD and opts.calibration // to something that makes sense. opts.displayType = 0; // XXX: opts.calibration = 0; // XXX: std::cout << " DictOptions: setup LCD parameters...\n"; } else if (displayType == "crt") { // XXX: Set opts.displayType to CRT and opts.calibration // to something that makes sense. opts.displayType = 0; // XXX: opts.calibration = 0; // XXX: std::cout << " DictOptions: setup CRT parameters...\n"; } else { setErrorString( std::string("Unknown display type: ") + displayType + std::string(".")); std::cout << " DictOptions: detected Unknown DisplayType...\n"; return false; } } } // Pull out an integration time, in seconds item = chainDict->get("ExampleSensor::integrationTime"); if (item) { doubleItem = dynamic_cast<DoubleDictItem *>(item); if (doubleItem) { opts.integrationTime = doubleItem->get(); std::cout << " DictOptions: IntegrationTime set" << opts.integrationTime << "\n";; } } // Finally, get a calibration setting item = chainDict->get("ExampleSensor::calibrationIdx"); if (item) { intItem = dynamic_cast<IntDictItem *>(item); if (intItem) { // XXX: Check range if ((intItem->get() < 0) || (intItem->get() > 3)) { setErrorString( "Invalid calibration setting for ExampleSensor::calibration."); return false; } // XXX: Translate the integer that we get from intItem->get() // to the appropriate value in opts.calibration. // This may just need to be a cast. opts.calibration = intItem->get(); std::cout << " DictOptions: Calibration Index set" << opts.calibration << "\n";; } } return true; }
27.977887
80
0.530517
SchademanK
ab08e3b9474e22d9d69ffee51a4f1ba6252a60de
3,781
cpp
C++
engine/camera.cpp
meifuku/AFGEngine
21e356eaf293dcaa0eea5823914bbc5c8ae7a85a
[ "MS-PL" ]
8
2021-03-04T23:41:02.000Z
2022-01-06T01:07:01.000Z
engine/camera.cpp
meifuku/AFGEngine
21e356eaf293dcaa0eea5823914bbc5c8ae7a85a
[ "MS-PL" ]
null
null
null
engine/camera.cpp
meifuku/AFGEngine
21e356eaf293dcaa0eea5823914bbc5c8ae7a85a
[ "MS-PL" ]
2
2021-09-14T09:48:51.000Z
2021-12-10T08:54:57.000Z
#include "camera.h" #include "window.h" #include <glad/glad.h> #include <glm/ext/matrix_transform.hpp> #include <glm/vec3.hpp> #include <cmath> #include <algorithm> #include <iostream> #include <fixed_point.h> FixedPoint interpolate(FixedPoint x, FixedPoint min, FixedPoint max, FixedPoint length) { x = x/length; return (max-min)*x*x*x * (FixedPoint(3) - FixedPoint(2) * x) + min; } const FixedPoint stageWidth(300); const FixedPoint stageHeight(225); Camera::Camera(float _maxScale) : scale(1.f), widthBoundary(internalWidth), heightBoundary(internalHeight), limitRatioX(FixedPoint(6)/FixedPoint(7)), limitRatioY(FixedPoint(2)/FixedPoint(3)) { if(_maxScale*(internalWidth/2.f)>(float)stageWidth) maxScale = (stageWidth*2.f)/(float)internalWidth; else maxScale = _maxScale; //No support for tall stages. } Camera& Camera::operator=(const Camera& c) { center = c.center; centerTarget = c.centerTarget; scale = c.scale; scaleTimer = c.scaleTimer; shakeTime = c.shakeTime; return *this; } Camera::Camera() : Camera(1.1f) { } void Camera::SetShakeTime(int time) { if(time > shakeTime) shakeTime = time; } glm::mat4 Camera::Calculate(Point2d<FixedPoint> p1, Point2d<FixedPoint> p2) { Point2d<FixedPoint> dif = p2 - p1; const FixedPoint distToScroll(100,0); //Zooms out when the distance between points is larger than the screen's h-ratio. FixedPoint targetScale = 1.f; FixedPoint scaleX, scaleY; if(dif.x.abs() > FixedPoint(widthBoundary*limitRatioX)) { scaleX = dif.x.abs()/(widthBoundary*limitRatioX); } if(dif.y.abs() > FixedPoint(heightBoundary*limitRatioY)) { scaleY = FixedPoint(0.75)+dif.y.abs()/(FixedPoint(4)*heightBoundary*limitRatioY); } auto biggerScale = std::max(scaleX, scaleY); if(biggerScale > targetScale) targetScale = biggerScale; if(targetScale > maxScale) targetScale = maxScale; if(targetScale < scale) { if(scaleTimer <= 0) { scale = interpolate(FixedPoint(scaleTimer+512),targetScale,scale,512); } --scaleTimer; } else { scale = targetScale; scaleTimer = 20; } dif.x.value >>= 1; dif.y.value >>= 1; auto rightmost = std::max(p1.x, p2.x); auto leftmost = std::min(p1.x, p2.x); if(rightmost > distToScroll + centerTarget.x) { centerTarget.x = rightmost-distToScroll; if(leftmost < -distToScroll + centerTarget.x) centerTarget.x.value = p1.x.value + (dif.x.value); } else if(leftmost < -distToScroll + centerTarget.x) centerTarget.x = leftmost+distToScroll; centerTarget.y = p1.y + dif.y; centerTarget.y -= 64; if(centerTarget.y < 0) centerTarget.y = 0; center.x += (centerTarget.x - center.x)*0.35; center.y += (centerTarget.y - center.y)*0.25; if(GetWallPos(camera::leftWall) <= -stageWidth) center.x = -stageWidth + widthBoundary*scale/FixedPoint(2); else if(GetWallPos(camera::rightWall) >= stageWidth) center.x = stageWidth - widthBoundary*scale/FixedPoint(2); centerYShake = center.y; if(shakeTime > 0) { centerYShake += 3*abs((shakeTime % 4) - 1); --shakeTime; } if(centerYShake > 450-(internalHeight)*(float)scale) { centerYShake = 450-(internalHeight)*(float)scale; centerYShake -= abs((shakeTime % 4) - 1); //Shake backwards } glm::mat4 view(1); view = glm::translate(view, glm::vec3(internalWidth/2.f, 0.f, 0.f)); view = glm::scale(view, glm::vec3(1.f/(float)scale, 1.f/(float)scale, 1.f)); view = glm::translate(view, glm::vec3(-center.x, -centerYShake, 0.f)); return view; } FixedPoint Camera::GetWallPos(int which) { switch(which) { case camera::leftWall: return center.x - widthBoundary*scale/FixedPoint(2); case camera::rightWall: return center.x + widthBoundary*scale/FixedPoint(2); } return 0; } centerScale Camera::GetCameraCenterScale() { return {center.x, centerYShake, scale}; }
23.93038
89
0.699815
meifuku
ab09711bbd4ba9463609fd235e39c4f3f4968994
3,126
cpp
C++
Source/OverlordProject/Materials/SkinnedDiffuseMaterial.cpp
TomvanWaas/OvercookedImitation
895b98ff23b026bafc24267c8707d68870a2ac58
[ "MIT" ]
null
null
null
Source/OverlordProject/Materials/SkinnedDiffuseMaterial.cpp
TomvanWaas/OvercookedImitation
895b98ff23b026bafc24267c8707d68870a2ac58
[ "MIT" ]
null
null
null
Source/OverlordProject/Materials/SkinnedDiffuseMaterial.cpp
TomvanWaas/OvercookedImitation
895b98ff23b026bafc24267c8707d68870a2ac58
[ "MIT" ]
null
null
null
#include "stdafx.h" #include "SkinnedDiffuseMaterial.h" #include "ContentManager.h" #include "TextureData.h" #include "ModelComponent.h" #include "ModelAnimator.h" ID3DX11EffectShaderResourceVariable* SkinnedDiffuseMaterial::m_pDiffuseSRVvariable = nullptr; ID3DX11EffectMatrixVariable* SkinnedDiffuseMaterial::m_pBoneTransforms = nullptr; ID3DX11EffectVectorVariable* SkinnedDiffuseMaterial::m_pColorVariable = nullptr; ID3DX11EffectScalarVariable* SkinnedDiffuseMaterial::m_pUseTextureVariable = nullptr; SkinnedDiffuseMaterial::SkinnedDiffuseMaterial() : Material(L"./Resources/Effects/PosNormTex3D_Skinned.fx"), m_pDiffuseTexture(nullptr) , m_Color({1,1,1,1}) , m_UseDiffuseTexture(false) {} void SkinnedDiffuseMaterial::SetDiffuseTexture(const std::wstring& assetFile) { m_pDiffuseTexture = ContentManager::Load<TextureData>(assetFile); m_UseDiffuseTexture = true; } void SkinnedDiffuseMaterial::LoadEffectVariables() { if (!m_pDiffuseSRVvariable) { m_pDiffuseSRVvariable = GetEffect()->GetVariableByName("gDiffuseMap")->AsShaderResource(); if (!m_pDiffuseSRVvariable->IsValid()) { Logger::LogWarning(L"SkinnedDiffuseMaterial::LoadEffectVariables() > \'gDiffuseMap\' variable not found!"); m_pDiffuseSRVvariable = nullptr; } } if (!m_pColorVariable) { m_pColorVariable = GetEffect()->GetVariableByName("gColor")->AsVector(); if (!m_pColorVariable->IsValid()) { Logger::LogWarning(L"SkinnedDiffuseMaterial::LoadEffectVariables() > \'gColor\' variable not found!"); m_pColorVariable = nullptr; } } if (!m_pUseTextureVariable) { m_pUseTextureVariable = GetEffect()->GetVariableByName("gUseDiffuseMap")->AsScalar(); if (!m_pUseTextureVariable->IsValid()) { Logger::LogWarning(L"SkinnedDiffuseMaterial::LoadEffectVariables() > \'gUseDiffuseMap\' variable not found!"); m_pUseTextureVariable = nullptr; } } //Create a link to the gBones variable if (!m_pBoneTransforms) { m_pBoneTransforms = GetEffect()->GetVariableByName("gBones")->AsMatrix(); if (!m_pBoneTransforms->IsValid()) { Logger::LogWarning(L"SkinnedDiffuseMaterial::LoadEffectVariables() > \'gBones\' variable not found!"); m_pBoneTransforms = nullptr; } } } void SkinnedDiffuseMaterial::UpdateEffectVariables(const GameContext& gameContext, ModelComponent* pModelComponent) { UNREFERENCED_PARAMETER(gameContext); UNREFERENCED_PARAMETER(pModelComponent); if (m_pDiffuseTexture && m_pDiffuseSRVvariable) { m_pDiffuseSRVvariable->SetResource(m_pDiffuseTexture->GetShaderResourceView()); } //Set the matrix array (BoneTransforms of the ModelAnimator)} if (m_pBoneTransforms != nullptr && pModelComponent != nullptr && pModelComponent->HasAnimator()) { auto ts = pModelComponent->GetAnimator()->GetBoneTransforms(); m_pBoneTransforms->SetMatrixArray((const float*)ts.data(), NULL, ts.size()); } if (m_pColorVariable) { m_pColorVariable->SetFloatVector((float*)&m_Color); } if (m_pUseTextureVariable) { m_pUseTextureVariable->SetBool(m_UseDiffuseTexture); } }
31.897959
116
0.746321
TomvanWaas
ab0eccd9c949ddbf0bce9ecf7a0959643641effa
258
hpp
C++
libng/core/src/libng_core/libcxx/map.hpp
gapry/libng
8fbf927e5bb73f105bddbb618430d3e1bf2cf877
[ "MIT" ]
null
null
null
libng/core/src/libng_core/libcxx/map.hpp
gapry/libng
8fbf927e5bb73f105bddbb618430d3e1bf2cf877
[ "MIT" ]
null
null
null
libng/core/src/libng_core/libcxx/map.hpp
gapry/libng
8fbf927e5bb73f105bddbb618430d3e1bf2cf877
[ "MIT" ]
null
null
null
#pragma once #include <third_party/eastl/eastl.hpp> namespace libng::libcxx { template<class KEY, class VALUE> class map { public: }; } // namespace libng::libcxx namespace libng { template<class KEY, class VALUE> using Map = eastl::map<KEY, VALUE>; }
13.578947
38
0.717054
gapry
ab13376ac74d3cd9d78cc77bcd24bd260f5334f1
7,316
cc
C++
RecoEgamma/EgammaMCTools/plugins/PFClusterMatchedToPhotonsSelector.cc
pasmuss/cmssw
566f40c323beef46134485a45ea53349f59ae534
[ "Apache-2.0" ]
null
null
null
RecoEgamma/EgammaMCTools/plugins/PFClusterMatchedToPhotonsSelector.cc
pasmuss/cmssw
566f40c323beef46134485a45ea53349f59ae534
[ "Apache-2.0" ]
null
null
null
RecoEgamma/EgammaMCTools/plugins/PFClusterMatchedToPhotonsSelector.cc
pasmuss/cmssw
566f40c323beef46134485a45ea53349f59ae534
[ "Apache-2.0" ]
null
null
null
// -*- C++ -*- // // Package: CommonTools/RecoAlgos // Class: PFClusterMatchedToPhotonsSelector // /**\class PFClusterMatchedToPhotonsSelector PFClusterMatchedToPhotonsSelector.cc CommonTools/RecoAlgos/plugins/PFClusterMatchedToPhotonsSelector.cc Description: Matches ECAL PF clusters to photons that do not convert Implementation: */ // // Original Author: RCLSA // Created: Wed, 22 Mar 2017 18:01:40 GMT // // // system include files #include <memory> #include <iostream> // user include files #include "FWCore/Framework/interface/Frameworkfwd.h" #include "FWCore/Framework/interface/stream/EDProducer.h" #include "FWCore/Framework/interface/Event.h" #include "FWCore/Framework/interface/MakerMacros.h" #include "FWCore/ParameterSet/interface/ParameterSet.h" #include "DataFormats/Common/interface/ValueMap.h" #include "DataFormats/Common/interface/Ref.h" #include "DataFormats/Math/interface/deltaR.h" #include "DataFormats/ParticleFlowReco/interface/PFCluster.h" #include "DataFormats/ParticleFlowReco/interface/PFClusterFwd.h" #include "DataFormats/HepMCCandidate/interface/GenParticle.h" #include "DataFormats/HepMCCandidate/interface/GenParticleFwd.h" #include "SimDataFormats/TrackingAnalysis/interface/TrackingParticle.h" #include "SimDataFormats/TrackingAnalysis/interface/TrackingParticleFwd.h" typedef reco::PFCluster::EEtoPSAssociation::value_type EEPSPair; bool sortByKey(const EEPSPair& a, const EEPSPair& b) { return a.first < b.first; } class PFClusterMatchedToPhotonsSelector : public edm::stream::EDProducer<> { public: PFClusterMatchedToPhotonsSelector(const edm::ParameterSet&); static void fillDescriptions(edm::ConfigurationDescriptions&); private: virtual void produce(edm::Event&, const edm::EventSetup&); edm::EDGetTokenT<reco::GenParticleCollection> genParticleToken_; // genParticles edm::EDGetTokenT<reco::PFClusterCollection> particleFlowClusterECALToken_; edm::EDGetTokenT<reco::PFCluster::EEtoPSAssociation> associationToken_; edm::EDGetTokenT<TrackingParticleCollection> trackingParticleToken_; double matchMaxDR2_; double matchMaxDEDR2_; double volumeZ_EB_; double volumeRadius_EB_; double volumeZ_EE_; }; PFClusterMatchedToPhotonsSelector::PFClusterMatchedToPhotonsSelector(const edm::ParameterSet& iConfig) { //now do what ever initialization is needed particleFlowClusterECALToken_ = consumes<reco::PFClusterCollection>(iConfig.getParameter<edm::InputTag>("pfClustersTag")); associationToken_ = consumes<reco::PFCluster::EEtoPSAssociation>(iConfig.getParameter<edm::InputTag>("pfClustersTag")); trackingParticleToken_ = consumes<TrackingParticleCollection>(iConfig.getParameter<edm::InputTag>("trackingParticleTag")); genParticleToken_ = consumes<reco::GenParticleCollection>(iConfig.getParameter<edm::InputTag>("genParticleTag")); matchMaxDR2_ = iConfig.getParameter<double>("maxDR2"); matchMaxDEDR2_ = iConfig.getParameter<double>("maxDEDR2"); volumeZ_EB_ = iConfig.getParameter<double>("volumeZ_EB"); volumeRadius_EB_ = iConfig.getParameter<double>("volumeRadius_EB"); volumeZ_EE_ = iConfig.getParameter<double>("volumeZ_EE"); produces<reco::PFClusterCollection>(); produces<reco::PFCluster::EEtoPSAssociation>(); produces<edm::ValueMap<reco::GenParticleRef> >(); } void PFClusterMatchedToPhotonsSelector::fillDescriptions(edm::ConfigurationDescriptions& descriptions) { edm::ParameterSetDescription desc; desc.add<edm::InputTag>("pfClustersTag", edm::InputTag("particleFlowClusterECAL")); desc.add<edm::InputTag>("trackingParticleTag", edm::InputTag("mix", "MergedTrackTruth")); desc.add<edm::InputTag>("genParticleTag", edm::InputTag("genParticles")); desc.add<double>("maxDR2", 0.1*0.1); desc.add<double>("maxDEDR2", 0.5*0.5); desc.add<double>("volumeZ_EB", 304.5); desc.add<double>("volumeRadius_EB", 123.8); desc.add<double>("volumeZ_EE", 317.0); descriptions.add("pfClusterMatchedToPhotonsSelector", desc); } void PFClusterMatchedToPhotonsSelector::produce(edm::Event& iEvent, const edm::EventSetup& iSetup) { edm::Handle<reco::PFClusterCollection> particleFlowClusterECALHandle_; edm::Handle<reco::PFCluster::EEtoPSAssociation> associationHandle_; edm::Handle<TrackingParticleCollection> trackingParticleHandle_; edm::Handle<reco::GenParticleCollection> genParticleHandle_; iEvent.getByToken(particleFlowClusterECALToken_, particleFlowClusterECALHandle_); iEvent.getByToken(trackingParticleToken_, trackingParticleHandle_); iEvent.getByToken(genParticleToken_, genParticleHandle_); iEvent.getByToken(associationToken_, associationHandle_); std::unique_ptr<reco::PFClusterCollection> out = std::make_unique<reco::PFClusterCollection>(); std::unique_ptr<reco::PFCluster::EEtoPSAssociation> association_out = std::make_unique<reco::PFCluster::EEtoPSAssociation>(); std::unique_ptr<edm::ValueMap<reco::GenParticleRef> > genmatching_out = std::make_unique<edm::ValueMap<reco::GenParticleRef> >(); std::vector<reco::GenParticleRef> genmatching; size_t iN(0); for (size_t iP = 0; iP < particleFlowClusterECALHandle_->size(); iP++) { auto&& pfCluster = particleFlowClusterECALHandle_->at(iP); bool isMatched = false; reco::GenParticleRef::key_type matchedKey; // Preselect PFclusters if (pfCluster.energy() <= 0) { continue; } for (auto&& trackingParticle : *trackingParticleHandle_) { if (trackingParticle.pdgId() != 22) continue; if (trackingParticle.status() != 1) continue; matchedKey = trackingParticle.genParticles().at(0).key(); float dR2 = reco::deltaR2(trackingParticle, pfCluster.position()); if (dR2 > matchMaxDR2_) continue; float dE = 1. - trackingParticle.genParticles().at(0)->energy()/pfCluster.energy(); if ((dR2 + dE*dE) > matchMaxDEDR2_) continue; bool isConversion = false; for (auto&& vertRef : trackingParticle.decayVertices()) { if (vertRef->position().rho() > volumeRadius_EB_ && std::abs(vertRef->position().z()) < volumeZ_EB_) continue; if (std::abs(vertRef->position().z()) > volumeZ_EE_) continue; for(auto&& tpRef: vertRef->daughterTracks()) { if(std::abs(tpRef->pdgId()) == 11) isConversion = true; break; } if (isConversion) break; } if (isConversion) continue; isMatched = true; break; } if (isMatched) { out->push_back(pfCluster); for (size_t i=0; i<associationHandle_.product()->size(); i++) { if (associationHandle_.product()->at(i).first == iP) { association_out->push_back(std::make_pair(iN, associationHandle_.product()->at(i).second)); } } genmatching.push_back(edm::Ref<reco::GenParticleCollection>(genParticleHandle_,matchedKey)); } } std::sort(association_out->begin(),association_out->end(),sortByKey); edm::OrphanHandle<reco::PFClusterCollection> pfClusterHandle= iEvent.put(std::move(out)); iEvent.put(std::move(association_out)); edm::ValueMap<reco::GenParticleRef>::Filler mapFiller(*genmatching_out); mapFiller.insert(pfClusterHandle, genmatching.begin(), genmatching.end()); mapFiller.fill(); iEvent.put(std::move(genmatching_out)); } //define this as a plug-in DEFINE_FWK_MODULE(PFClusterMatchedToPhotonsSelector);
41.333333
147
0.749863
pasmuss
ab1b72ea5cb1f048215b92306412d751355eb80d
1,368
cpp
C++
fboss/agent/hw/bcm/BcmEcmpUtils.cpp
midopooler/fboss
c8d08dd4255e97e5977f53712e7c91a7d045a0cb
[ "BSD-3-Clause" ]
1
2020-03-20T22:47:21.000Z
2020-03-20T22:47:21.000Z
fboss/agent/hw/bcm/BcmEcmpUtils.cpp
phshaikh/fboss
05e6ed1e9d62bf7db45a770886b1761e046c1722
[ "BSD-3-Clause" ]
null
null
null
fboss/agent/hw/bcm/BcmEcmpUtils.cpp
phshaikh/fboss
05e6ed1e9d62bf7db45a770886b1761e046c1722
[ "BSD-3-Clause" ]
null
null
null
/* * Copyright (c) 2004-present, Facebook, Inc. * All rights reserved. * * This source code is licensed under the BSD-style license found in the * LICENSE file in the root directory of this source tree. An additional grant * of patent rights can be found in the PATENTS file in the same directory. * */ #include "fboss/agent/hw/bcm/BcmEcmpUtils.h" #include "fboss/agent/hw/bcm/BcmRoute.h" #include "fboss/agent/hw/bcm/BcmSwitch.h" #include <folly/IPAddress.h> namespace facebook::fboss::utility { std::multiset<bcm_if_t> getEcmpGroupInHw(int unit, bcm_if_t ecmp, int sizeInSw) { std::multiset<bcm_if_t> ecmpGroup; bcm_l3_egress_ecmp_t existing; bcm_l3_egress_ecmp_t_init(&existing); existing.ecmp_intf = ecmp; bcm_if_t pathsInHw[sizeInSw]; int pathsInHwCount; bcm_l3_egress_ecmp_get(unit, &existing, sizeInSw, pathsInHw, &pathsInHwCount); for (size_t i = 0; i < pathsInHwCount; ++i) { ecmpGroup.insert(pathsInHw[i]); } return ecmpGroup; } int getEcmpSizeInHw(int unit, bcm_if_t ecmp, int sizeInSw) { return getEcmpGroupInHw(unit, ecmp, sizeInSw).size(); } bcm_if_t getEgressIdForRoute( const BcmSwitch* hw, const folly::IPAddress& ip, uint8_t mask, bcm_vrf_t vrf) { auto bcmRoute = hw->routeTable()->getBcmRoute(vrf, ip, mask); return bcmRoute->getEgressId(); } } // namespace facebook::fboss::utility
28.5
80
0.730263
midopooler
ab1c39c3d5de4d3afd619d5508b34ddcc950b773
952
cpp
C++
item.cpp
RichardVN/train-escape-game
a177276b2993288f85e8b1079c1ca2dc8babbd91
[ "MIT" ]
null
null
null
item.cpp
RichardVN/train-escape-game
a177276b2993288f85e8b1079c1ca2dc8babbd91
[ "MIT" ]
null
null
null
item.cpp
RichardVN/train-escape-game
a177276b2993288f85e8b1079c1ca2dc8babbd91
[ "MIT" ]
null
null
null
/***************************************************************** ** Program name: item.cpp ** Author: Richard Nguyen ** Date: 12/10/19 ** Description: Contains member function definitions for the class item. ******************************************************************/ #include "item.hpp" // ********************** // Default constructor * // ********************** item::item() { } // ********************** // Setter Functions * // ********************** void item::setQuantity(int quantity) { this -> quantity = quantity; } void item::setName(string name) { this -> name = name; } void item::setDescription(string description) { this -> description = description; } // ********************** // Getter functions * // ********************** string item::getName() { return this -> name; } string item::getDescription() { return this -> description; } int item::getQuantity() { return this -> quantity; }
17
67
0.462185
RichardVN
ab1cb62e1a59da716cc933d10f92e439dd2db2b4
17,422
cc
C++
arcane/src/arcane/impl/ParallelExchanger.cc
cedricga91/framework
143eeccb5bf375df4a3f11b888681f84f60380c6
[ "Apache-2.0" ]
16
2021-09-20T12:37:01.000Z
2022-03-18T09:19:14.000Z
arcane/src/arcane/impl/ParallelExchanger.cc
cedricga91/framework
143eeccb5bf375df4a3f11b888681f84f60380c6
[ "Apache-2.0" ]
66
2021-09-17T13:49:39.000Z
2022-03-30T16:24:07.000Z
arcane/src/arcane/impl/ParallelExchanger.cc
cedricga91/framework
143eeccb5bf375df4a3f11b888681f84f60380c6
[ "Apache-2.0" ]
11
2021-09-27T16:48:55.000Z
2022-03-23T19:06:56.000Z
// -*- tab-width: 2; indent-tabs-mode: nil; coding: utf-8-with-signature -*- //----------------------------------------------------------------------------- // Copyright 2000-2022 CEA (www.cea.fr) IFPEN (www.ifpenergiesnouvelles.com) // See the top-level COPYRIGHT file for details. // SPDX-License-Identifier: Apache-2.0 //----------------------------------------------------------------------------- /*---------------------------------------------------------------------------*/ /* ParallelExchanger.cc (C) 2000-2022 */ /* */ /* Echange d'informations entre processeurs. */ /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ #include "arcane/impl/ParallelExchanger.h" #include "arcane/utils/NotSupportedException.h" #include "arcane/utils/FatalErrorException.h" #include "arcane/utils/PlatformUtils.h" #include "arcane/MathUtils.h" #include "arcane/IParallelMng.h" #include "arcane/SerializeBuffer.h" #include "arcane/SerializeMessage.h" #include "arcane/Timer.h" #include "arcane/ISerializeMessageList.h" #include <algorithm> /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ namespace Arcane { /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ ParallelExchanger:: ParallelExchanger(IParallelMng* pm) : ParallelExchanger(makeRef(pm)) { } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ ParallelExchanger:: ParallelExchanger(Ref<IParallelMng> pm) : TraceAccessor(pm->traceMng()) , m_parallel_mng(pm) , m_timer(pm->timerMng(),"ParallelExchangerTimer",Timer::TimerReal) { String use_collective_str = platform::getEnvironmentVariable("ARCANE_PARALLEL_EXCHANGER_USE_COLLECTIVE"); if (use_collective_str=="1" || use_collective_str=="TRUE") m_exchange_mode = EM_Collective; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ ParallelExchanger:: ~ParallelExchanger() { for( auto* buf : m_comms_buf ) delete buf; m_comms_buf.clear(); delete m_own_send_message; delete m_own_recv_message; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ IParallelMng* ParallelExchanger:: parallelMng() const { return m_parallel_mng.get(); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ bool ParallelExchanger:: initializeCommunicationsMessages() { Int32 nb_send_rank = m_send_ranks.size(); UniqueArray<Int32> gather_input_send_ranks(nb_send_rank+1); gather_input_send_ranks[0] = nb_send_rank; std::copy(std::begin(m_send_ranks),std::end(m_send_ranks), std::begin(gather_input_send_ranks)+1); IntegerUniqueArray gather_output_send_ranks; Integer nb_rank = m_parallel_mng->commSize(); m_parallel_mng->allGatherVariable(gather_input_send_ranks, gather_output_send_ranks); m_recv_ranks.clear(); Integer total_comm_rank = 0; Int32 my_rank = m_parallel_mng->commRank(); { Integer gather_index = 0; for( Integer i=0; i<nb_rank; ++i ){ Integer nb_comm = gather_output_send_ranks[gather_index]; total_comm_rank += nb_comm; ++gather_index; for( Integer z=0; z<nb_comm; ++z ){ Integer current_rank = gather_output_send_ranks[gather_index+z]; if (current_rank==my_rank) m_recv_ranks.add(i); } gather_index += nb_comm; } } if (total_comm_rank==0) return true; _initializeCommunicationsMessages(); return false; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: initializeCommunicationsMessages(Int32ConstArrayView recv_ranks) { m_recv_ranks.resize(recv_ranks.size()); m_recv_ranks.copy(recv_ranks); _initializeCommunicationsMessages(); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: _initializeCommunicationsMessages() { if (m_verbosity_level>=1){ info() << "ParallelExchanger " << m_name << " : nb_send=" << m_send_ranks.size() << " nb_recv=" << m_recv_ranks.size(); if (m_verbosity_level>=2){ info() << "ParallelExchanger " << m_name << " : send=" << m_send_ranks; info() << "ParallelExchanger " << m_name << " : recv=" << m_recv_ranks; } } Int32 my_rank = m_parallel_mng->commRank(); for( Int32 msg_rank : m_send_ranks ){ auto* comm = new SerializeMessage(my_rank,msg_rank,ISerializeMessage::MT_Send); // Il ne sert à rien de s'envoyer des messages. // (En plus ca fait planter certaines versions de MPI...) if (my_rank==msg_rank) m_own_send_message = comm; else m_comms_buf.add(comm); m_send_serialize_infos.add(comm); } } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: processExchange() { ParallelExchangerOptions options; options.setExchangeMode(static_cast<ParallelExchangerOptions::eExchangeMode>(m_exchange_mode)); processExchange(options); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: processExchange(const ParallelExchangerOptions& options) { if (m_verbosity_level>=1) info() << "ParallelExchanger " << m_name << ": ProcessExchange (begin)" << " date=" << platform::getCurrentDateTime(); { Timer::Sentry sentry(&m_timer); _processExchange(options); } if (m_verbosity_level>=1) info() << "ParallelExchanger " << m_name << ": ProcessExchange (end)" << " total_time=" << m_timer.lastActivationTime(); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: _processExchange(const ParallelExchangerOptions& options) { if (m_verbosity_level>=1){ Int64 total_size = 0; for( SerializeMessage* comm : m_send_serialize_infos ){ Int64 message_size = comm->trueSerializer()->totalSize(); total_size += message_size; if (m_verbosity_level>=2) info() << "Send rank=" << comm->destination() << " size=" << message_size; } info() << "ParallelExchanger " << m_name << ": ProcessExchange" << " total_size=" << total_size << " nb_message=" << m_comms_buf.size(); } bool use_all_to_all = false; if (options.exchangeMode()) use_all_to_all = true; // TODO: traiter le cas EM_Auto // Génère les infos pour chaque processeur de qui on va recevoir // des entités Int32 my_rank = m_parallel_mng->commRank(); for( Int32 msg_rank : m_recv_ranks ){ auto* comm = new SerializeMessage(my_rank,msg_rank,ISerializeMessage::MT_Recv); // Il ne sert à rien de s'envoyer des messages. // (En plus ca fait planter certaines versions de MPI...) if (my_rank==msg_rank) m_own_recv_message = comm; else m_comms_buf.add(comm); m_recv_serialize_infos.add(comm); } if (use_all_to_all) _processExchangeCollective(); else{ Int32 max_pending = options.maxPendingMessage(); if (max_pending>0) _processExchangeWithControl(max_pending); else m_parallel_mng->processMessages(m_comms_buf); if (m_own_send_message && m_own_recv_message){ m_own_recv_message->serializer()->copy(m_own_send_message->serializer()); } } // Récupère les infos de chaque receveur for( SerializeMessage* comm : m_recv_serialize_infos ) comm->serializer()->setMode(ISerializer::ModeGet); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: _processExchangeCollective() { info() << "Using collective exchange in ParallelExchanger"; IParallelMng* pm = m_parallel_mng.get(); Int32 nb_rank = pm->commSize(); Int32UniqueArray send_counts(nb_rank,0); Int32UniqueArray send_indexes(nb_rank,0); Int32UniqueArray recv_counts(nb_rank,0); Int32UniqueArray recv_indexes(nb_rank,0); // D'abord, détermine pour chaque proc le nombre d'octets à envoyer for( SerializeMessage* comm : m_send_serialize_infos ){ auto* sbuf = comm->trueSerializer(); Span<Byte> val_buf = sbuf->globalBuffer(); Int32 rank = comm->destRank(); send_counts[rank] = arcaneCheckArraySize(val_buf.size()); } // Fait un AllToAll pour connaitre combien de valeurs je dois recevoir des autres. { Timer::SimplePrinter sp(traceMng(),"ParallelExchanger: sending sizes with AllToAll"); pm->allToAll(send_counts,recv_counts,1); } // Détermine le nombre total d'infos à envoyer et recevoir // TODO: En cas débordement, il faudrait le faire en plusieurs morceaux // ou alors revenir aux échanges point à point. Int32 total_send = 0; Int32 total_recv = 0; Int64 int64_total_send = 0; Int64 int64_total_recv = 0; for( Integer i=0; i<nb_rank; ++i ){ send_indexes[i] = total_send; recv_indexes[i] = total_recv; total_send += send_counts[i]; total_recv += recv_counts[i]; int64_total_send += send_counts[i]; int64_total_recv += recv_counts[i]; } // Vérifie qu'on ne déborde pas. if (int64_total_send!=total_send) ARCANE_FATAL("Message to send is too big size={0} max=2^31",int64_total_send); if (int64_total_recv!=total_recv) ARCANE_FATAL("Message to receive is too big size={0} max=2^31",int64_total_recv); ByteUniqueArray send_buf(total_send); ByteUniqueArray recv_buf(total_recv); bool is_verbose = (m_verbosity_level>=1); if (m_verbosity_level>=2){ for( Integer i=0; i<nb_rank; ++i ){ if (send_counts[i]!=0 || recv_counts[i]!=0) info() << "INFOS: rank=" << i << " send_count=" << send_counts[i] << " send_idx=" << send_indexes[i] << " recv_count=" << recv_counts[i] << " recv_idx=" << recv_indexes[i]; } } // Copie dans send_buf les infos des sérialisers. for( SerializeMessage* comm : m_send_serialize_infos ){ auto* sbuf = comm->trueSerializer(); Span<Byte> val_buf = sbuf->globalBuffer(); Int32 rank = comm->destRank(); if (is_verbose) info() << "SEND rank=" << rank << " size=" << send_counts[rank] << " idx=" << send_indexes[rank] << " buf_size=" << val_buf.size(); ByteArrayView dest_buf(send_counts[rank],&send_buf[send_indexes[rank]]); dest_buf.copy(val_buf); } if (is_verbose) info() << "AllToAllVariable total_send=" << total_send << " total_recv=" << total_recv; { Timer::SimplePrinter sp(traceMng(),"ParallelExchanger: sending values with AllToAll"); pm->allToAllVariable(send_buf,send_counts,send_indexes,recv_buf,recv_counts,recv_indexes); } // Recopie les données reçues dans le message correspondant. for( SerializeMessage* comm : m_recv_serialize_infos ){ auto* sbuf = comm->trueSerializer(); Int32 rank = comm->destRank(); if (is_verbose) info() << "RECV rank=" << rank << " size=" << recv_counts[rank] << " idx=" << recv_indexes[rank]; ByteArrayView orig_buf(recv_counts[rank],&recv_buf[recv_indexes[rank]]); sbuf->preallocate(orig_buf.size()); sbuf->globalBuffer().copy(orig_buf); sbuf->setFromSizes(); } } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ ISerializeMessage* ParallelExchanger:: messageToSend(Integer i) { return m_send_serialize_infos[i]; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ ISerializeMessage* ParallelExchanger:: messageToReceive(Integer i) { return m_recv_serialize_infos[i]; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: setVerbosityLevel(Int32 v) { if (v<0) v = 0; m_verbosity_level = v; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ void ParallelExchanger:: setName(const String& name) { m_name = name; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ namespace { class SortFunctor { public: /*! * \brief Operateur de tri des messages. * * Le tri se fait comme suit: * - d'abord prend 1 rang sur nb_phase pour éviter que tous les messages * aillent sur les mêmes noeuds (car on suppose que les rangs consécutifs sont * sur les mêmes noeuds) * - ensuite tri sur le rang de destination * - enfin poste les réceptions avant les envois. */ bool operator()(const ISerializeMessage* a,const ISerializeMessage* b) { const int nb_phase = 4; int phase1 = a->destination().value() % nb_phase; int phase2 = b->destination().value() % nb_phase; if (phase1 != phase2) return phase1<phase2; if (a->destination() != b->destination()) return a->destination() < b->destination(); if (a->isSend() != b->isSend()) return (a->isSend() ? false : true); return a->source() < b->source(); } }; } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ /*! * \brief Echange avec contrôle du nombre maximum de messages en vol. */ void ParallelExchanger:: _processExchangeWithControl(Int32 max_pending_message) { // L'ensemble des messages sont dans 'm_comms_buf'. // On les recopie dans 'sorted_messages' pour qu'ils soient triés. auto message_list {m_parallel_mng->createSerializeMessageListRef()}; UniqueArray<ISerializeMessage*> sorted_messages(m_comms_buf); std::sort(sorted_messages.begin(),sorted_messages.end(),SortFunctor{}); Integer position = 0; // Il faut au moins ajouter un minimum de messages pour ne pas avoir de blocage. // A priori le minimum est 2 pour qu'il y est au moins un receive et un send // mais il est préférable de mettre plus pour ne pas trop dégrader les performances. max_pending_message = math::max(4,max_pending_message); Integer nb_message = sorted_messages.size(); Integer nb_to_add = max_pending_message; Int32 verbosity_level = m_verbosity_level; if (verbosity_level>=1) info() << "ParallelExchanger " << m_name << " : process exchange WITH CONTROL" << " nb_message=" << nb_message << " max_pending=" << max_pending_message; while(position<nb_message){ for( Integer i=0; i<nb_to_add; ++i ){ if (position>=nb_message) break; ISerializeMessage* message = sorted_messages[position]; if (verbosity_level>=2) info() << "Add Message p=" << position << " is_send?=" << message->isSend() << " source=" << message->source() << " dest=" << message->destination(); message_list->addMessage(message); ++position; } // S'il ne reste plus de messages, alors on fait un WaitAll pour attendre* // que les messages restants soient tous terminés. if (position>=nb_message){ message_list->waitMessages(Parallel::WaitAll); break; } // Le nombre de messages terminés indique combien de message il faudra // ajouter à la liste pour la prochaine itération. Integer nb_done = message_list->waitMessages(Parallel::WaitSome); if (verbosity_level>=2) info() << "Wait nb_done=" << nb_done; if (nb_done==(-1)) nb_done = max_pending_message; nb_to_add = nb_done; } } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ Ref<IParallelExchanger> createParallelExchangerImpl(Ref<IParallelMng> pm) { return makeRef<IParallelExchanger>(new ParallelExchanger(pm)); } /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/ } // End namespace Arcane /*---------------------------------------------------------------------------*/ /*---------------------------------------------------------------------------*/
34.844
118
0.534554
cedricga91
ab1d2e9a4f19fedea425a860ab6718ea3ca83e87
3,301
cc
C++
pcraster/pcraster-4.2.0/pcraster-4.2.0/source/pcraster_old_calc/calc_timervalue.cc
quanpands/wflow
b454a55e4a63556eaac3fbabd97f8a0b80901e5a
[ "MIT" ]
null
null
null
pcraster/pcraster-4.2.0/pcraster-4.2.0/source/pcraster_old_calc/calc_timervalue.cc
quanpands/wflow
b454a55e4a63556eaac3fbabd97f8a0b80901e5a
[ "MIT" ]
null
null
null
pcraster/pcraster-4.2.0/pcraster-4.2.0/source/pcraster_old_calc/calc_timervalue.cc
quanpands/wflow
b454a55e4a63556eaac3fbabd97f8a0b80901e5a
[ "MIT" ]
null
null
null
#ifndef INCLUDED_STDDEFX #include "stddefx.h" #define INCLUDED_STDDEFX #endif #ifndef INCLUDED_CALC_TIMERVALUE #include "calc_timervalue.h" #define INCLUDED_CALC_TIMERVALUE #endif // Library headers. // PCRaster library headers. // Module headers. #ifndef INCLUDED_CALC_FIELDNRPARAMETER #include "calc_fieldnrparameter.h" #define INCLUDED_CALC_FIELDNRPARAMETER #endif #ifndef INCLUDED_CALC_ISCRIPT #include "calc_iscript.h" #define INCLUDED_CALC_ISCRIPT #endif /*! \file This file contains the implementation of the TimerValue class. */ //------------------------------------------------------------------------------ // DEFINITION OF STATIC TIMERVALUE MEMBERS //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // DEFINITION OF TIMERVALUE MEMBERS //------------------------------------------------------------------------------ calc::TimerValue::TimerValue() { } calc::TimerValue::~TimerValue() { } calc::TimerValue::TimerValue(const TimerValue& t): Symbol(t), d_vs(t.d_vs), d_value(t.d_value) { } calc::TimerValue::TimerValue( const Symbol& c): Symbol(c) { if (isNumber()) d_value = toNumber(); else { // may be a numeric binding // that is already set as a FieldNrParameter const FieldNrParameter *nrP = dynamic_cast<const FieldNrParameter *>( c.scriptConst().findSymbol(&c,VS_FIELD, false)); if (!nrP || nrP->isArray()) { // maybe a string binding const Symbol *s=scriptConst().findBinding(c.name()); if (s) // is a string binding, test48 posError(qName()+" does not have a numeric value"); // not known generate: undefined symbol test48a c.scriptConst().findSymbol(&c,VS_FIELD, true); } d_value=nrP->initialValue(); } d_vs=vsOfNumber(d_value); } size_t calc::TimerValue::value() const { return static_cast<size_t>(d_value); } size_t calc::TimerValue::check(const std::string& name) const { if ( (!isIn(VS_N,d_vs)) || d_value < 0) // pcrcalc/test7a posError(qName()+" is not a whole positive number (in "+name+" definition)"); return value(); } //------------------------------------------------------------------------------ // DEFINITION OF FREE OPERATORS //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // DEFINITION OF FREE FUNCTIONS //------------------------------------------------------------------------------ //! check if section is consistent defined void calc::checkTimerSection( const TimerValue& start, const TimerValue& end, const TimerValue& slice) { size_t timerStart = start.check("start time"); size_t timerEnd = end.check("end time"); size_t timerSlice = slice.check("time step"); if (timerStart != 1) /* pcrcalc/test6 */ end.posError("current limitation: start time must be 1 (not "+start.name()+")"); if (timerSlice != 1) /* pcrcalc/test7 */ slice.posError("current limitation: time step must be 1 (not "+slice.name()+")"); if (timerStart > timerEnd) /* pcrcalc/test8 */ start.posError("Start time ("+start.name()+") is greater than end time ("+end.name()+")"); }
25.392308
93
0.551954
quanpands
ab1d46e1e554441470b0df611f84f6d6ccc9d2b0
4,548
cpp
C++
src/core/states/euclidean.cpp
jcarpent/crocoddyl
155999999f1fbd0c5760875584c540e2bc13645b
[ "BSD-3-Clause" ]
1
2019-12-21T12:11:15.000Z
2019-12-21T12:11:15.000Z
src/core/states/euclidean.cpp
boyali/crocoddyl
155999999f1fbd0c5760875584c540e2bc13645b
[ "BSD-3-Clause" ]
null
null
null
src/core/states/euclidean.cpp
boyali/crocoddyl
155999999f1fbd0c5760875584c540e2bc13645b
[ "BSD-3-Clause" ]
null
null
null
/////////////////////////////////////////////////////////////////////////////// // BSD 3-Clause License // // Copyright (C) 2018-2019, LAAS-CNRS // Copyright note valid unless otherwise stated in individual files. // All rights reserved. /////////////////////////////////////////////////////////////////////////////// #include "crocoddyl/core/states/euclidean.hpp" namespace crocoddyl { StateVector::StateVector(const std::size_t& nx) : StateAbstract(nx, nx) {} StateVector::~StateVector() {} Eigen::VectorXd StateVector::zero() const { return Eigen::VectorXd::Zero(nx_); } Eigen::VectorXd StateVector::rand() const { return Eigen::VectorXd::Random(nx_); } void StateVector::diff(const Eigen::Ref<const Eigen::VectorXd>& x0, const Eigen::Ref<const Eigen::VectorXd>& x1, Eigen::Ref<Eigen::VectorXd> dxout) const { if (static_cast<std::size_t>(x0.size()) != nx_) { throw std::invalid_argument("x0 has wrong dimension (it should be " + std::to_string(nx_) + ")"); } if (static_cast<std::size_t>(x1.size()) != nx_) { throw std::invalid_argument("x1 has wrong dimension (it should be " + std::to_string(nx_) + ")"); } if (static_cast<std::size_t>(dxout.size()) != ndx_) { throw std::invalid_argument("dxout has wrong dimension (it should be " + std::to_string(ndx_) + ")"); } dxout = x1 - x0; } void StateVector::integrate(const Eigen::Ref<const Eigen::VectorXd>& x, const Eigen::Ref<const Eigen::VectorXd>& dx, Eigen::Ref<Eigen::VectorXd> xout) const { if (static_cast<std::size_t>(x.size()) != nx_) { throw std::invalid_argument("x has wrong dimension (it should be " + std::to_string(nx_) + ")"); } if (static_cast<std::size_t>(dx.size()) != ndx_) { throw std::invalid_argument("dx has wrong dimension (it should be " + std::to_string(ndx_) + ")"); } if (static_cast<std::size_t>(xout.size()) != nx_) { throw std::invalid_argument("xout has wrong dimension (it should be " + std::to_string(nx_) + ")"); } xout = x + dx; } void StateVector::Jdiff(const Eigen::Ref<const Eigen::VectorXd>&, const Eigen::Ref<const Eigen::VectorXd>&, Eigen::Ref<Eigen::MatrixXd> Jfirst, Eigen::Ref<Eigen::MatrixXd> Jsecond, Jcomponent firstsecond) const { assert(is_a_Jcomponent(firstsecond) && ("firstsecond must be one of the Jcomponent {both, first, second}")); if (firstsecond == first || firstsecond == both) { if (static_cast<std::size_t>(Jfirst.rows()) != ndx_ || static_cast<std::size_t>(Jfirst.cols()) != ndx_) { throw std::invalid_argument("Jfirst has wrong dimension (it should be " + std::to_string(ndx_) + "," + std::to_string(ndx_) + ")"); } Jfirst.setZero(); Jfirst.diagonal() = Eigen::VectorXd::Constant(ndx_, -1.); } if (firstsecond == second || firstsecond == both) { if (static_cast<std::size_t>(Jsecond.rows()) != ndx_ || static_cast<std::size_t>(Jsecond.cols()) != ndx_) { throw std::invalid_argument("Jsecond has wrong dimension (it should be " + std::to_string(ndx_) + "," + std::to_string(ndx_) + ")"); } Jsecond.setZero(); Jsecond.diagonal() = Eigen::VectorXd::Constant(ndx_, 1.); } } void StateVector::Jintegrate(const Eigen::Ref<const Eigen::VectorXd>&, const Eigen::Ref<const Eigen::VectorXd>&, Eigen::Ref<Eigen::MatrixXd> Jfirst, Eigen::Ref<Eigen::MatrixXd> Jsecond, Jcomponent firstsecond) const { assert(is_a_Jcomponent(firstsecond) && ("firstsecond must be one of the Jcomponent {both, first, second}")); if (firstsecond == first || firstsecond == both) { if (static_cast<std::size_t>(Jfirst.rows()) != ndx_ || static_cast<std::size_t>(Jfirst.cols()) != ndx_) { throw std::invalid_argument("Jfirst has wrong dimension (it should be " + std::to_string(ndx_) + "," + std::to_string(ndx_) + ")"); } Jfirst.setZero(); Jfirst.diagonal() = Eigen::VectorXd::Constant(ndx_, 1.); } if (firstsecond == second || firstsecond == both) { if (static_cast<std::size_t>(Jsecond.rows()) != ndx_ || static_cast<std::size_t>(Jsecond.cols()) != ndx_) { throw std::invalid_argument("Jsecond has wrong dimension (it should be " + std::to_string(ndx_) + "," + std::to_string(ndx_) + ")"); } Jsecond.setZero(); Jsecond.diagonal() = Eigen::VectorXd::Constant(ndx_, 1.); } } } // namespace crocoddyl
48.382979
116
0.600484
jcarpent
ab1d6e29f2ebf95f883847c77c2eb8515c8a5c10
3,108
cpp
C++
test/zisa/unit_test/reconstruction/weno_ao.cpp
1uc/ZisaFVM
75fcedb3bece66499e011228a39d8a364b50fd74
[ "MIT" ]
null
null
null
test/zisa/unit_test/reconstruction/weno_ao.cpp
1uc/ZisaFVM
75fcedb3bece66499e011228a39d8a364b50fd74
[ "MIT" ]
null
null
null
test/zisa/unit_test/reconstruction/weno_ao.cpp
1uc/ZisaFVM
75fcedb3bece66499e011228a39d8a364b50fd74
[ "MIT" ]
1
2021-08-24T11:52:51.000Z
2021-08-24T11:52:51.000Z
// SPDX-License-Identifier: MIT // Copyright (c) 2021 ETH Zurich, Luc Grosheintz-Laval #include <numeric> #include <zisa/grid/grid.hpp> #include <zisa/reconstruction/weno_ao.hpp> #include <zisa/testing/testing_framework.hpp> #include <zisa/unit_test/grid/test_grid_factory.hpp> #include <zisa/unit_test/reconstruction/hybrid_weno.hpp> TEST_CASE("WENO_AO API", "[weno_ao][math]") { SECTION("compatibility with std::vector") { SECTION("push_back") { auto grid = zisa::load_grid(zisa::TestGridFactory::small()); auto params = zisa::HybridWENOParams({{{1}, {"c"}, {2.0}}, {1.0}, 1e-10, 4.0}); auto rc = std::vector<zisa::WENO_AO>(); for (auto i : cell_indices(*grid)) { rc.emplace_back(grid, i, params); } REQUIRE(rc.size() == grid->n_cells); for (decltype(rc.size()) i = 0; i < rc.size(); ++i) { const auto &approx = rc[i]; auto exact = zisa::WENO_AO(grid, i, params); REQUIRE(approx == exact); } } } } TEST_CASE("WENO_AO; reconstruct smooth", "[weno_ao][math]") { auto grid_names = std::vector<std::string>{ zisa::TestGridFactory::unit_square_with_halo(1), zisa::TestGridFactory::unit_square_with_halo(2)}; double eps = 1e-10; double s = 4.0; using interval_t = std::tuple<double, double>; auto cases = std::vector<std::tuple<interval_t, bool, zisa::HybridWENOParams>>{ {{0.8, 1.15}, true, {{{1}, {"c"}, {2.0}}, {1.0}, eps, s}}, {{0.8, 1.15}, true, {{{1}, {"b"}, {2.0}}, {1.0}, eps, s}}, {{1.8, 2.2}, false, {{{2}, {"c"}, {2.0}}, {1.0}, eps, s}}, {{1.8, 2.2}, false, {{{2}, {"b"}, {2.0}}, {1.0}, eps, s}}, {{2.8, 3.25}, false, {{{3}, {"c"}, {2.0}}, {1.0}, eps, s}}, {{2.8, 3.25}, false, {{{3}, {"b"}, {2.0}}, {1.0}, eps, s}}, {{3.8, 4.4}, false, {{{4}, {"c"}, {2.0}}, {1.0}, eps, s}}}; cases.push_back({{2.9, 3.3}, true, {{{3, 2, 2, 2}, {"c", "b", "b", "b"}, {3.0, 1.5, 1.5, 1.5}}, {100.0, 1.0, 1.0, 1.0}, eps, s}}); // The reason for the second order convergence is the linear weights. They // allow too much pollution from the second order stencils. cases.push_back({{2.0, 3.8}, false, /* empirically is not non-oscillatory */ {{{4, 2, 2, 2}, {"c", "b", "b", "b"}, {2.0, 1.5, 1.5, 1.5}}, {10.0, 1.0, 1.0, 1.0}, eps, s}}); // Which can be remedied by increasing the central weight. cases.push_back({{3.8, 4.4}, true, {{{4, 2, 2, 2}, {"c", "b", "b", "b"}, {2.0, 1.5, 1.5, 1.5}}, {1000.0, 1.0, 1.0, 1.0}, eps, s}}); for (auto &[expected_rate, is_stable, params] : cases) { zisa::test_hybrid_weno_convergence<zisa::WENO_AO>( grid_names, expected_rate, params, 2); if (is_stable) { zisa::test_hybrid_weno_stability<zisa::WENO_AO>(grid_names, params, 2); } } }
34.533333
79
0.500644
1uc
ab1dbcdc8430028648634d96f6a0fd6f0c3af550
3,470
cc
C++
tests/test_schema.cc
mithro/hgdb
8a028b9ee8751a2cc77cd1c889e96059747b2f18
[ "BSD-2-Clause" ]
34
2021-01-19T21:14:06.000Z
2022-03-31T18:42:58.000Z
tests/test_schema.cc
mithro/hgdb
8a028b9ee8751a2cc77cd1c889e96059747b2f18
[ "BSD-2-Clause" ]
33
2021-01-12T18:50:16.000Z
2022-03-23T04:49:20.000Z
tests/test_schema.cc
mithro/hgdb
8a028b9ee8751a2cc77cd1c889e96059747b2f18
[ "BSD-2-Clause" ]
2
2021-03-28T06:58:46.000Z
2022-03-31T02:55:53.000Z
#include <random> #include "test_util.hh" class SchemaTest : public DBTestHelper {}; TEST_F(SchemaTest, init_db) { // NOLINT ASSERT_NE(db, nullptr); } TEST_F(SchemaTest, store_instance) { // NOLINT EXPECT_EQ(db->count<hgdb::Instance>(), 0); constexpr uint32_t id = 42; hgdb::store_instance(*db, id, "top.mod"); auto result = db->get_pointer<hgdb::Instance>(id); EXPECT_TRUE(result); EXPECT_EQ(result->id, id); } TEST_F(SchemaTest, store_breakpoint) { // NOLINT EXPECT_EQ(db->count<hgdb::BreakPoint>(), 0); constexpr uint32_t instance_id = 42; constexpr uint32_t breakpoint_id = 1729; hgdb::store_instance(*db, instance_id, "top.mod"); hgdb::store_breakpoint(*db, breakpoint_id, instance_id, __FILE__, __LINE__); auto result = db->get_pointer<hgdb::BreakPoint>(breakpoint_id); EXPECT_TRUE(result); EXPECT_EQ(result->id, breakpoint_id); EXPECT_EQ(result->filename, __FILE__); } TEST_F(SchemaTest, store_scope) { // NOLINT EXPECT_EQ(db->count<hgdb::Scope>(), 0); constexpr uint32_t scope_id = 42; hgdb::store_scope(*db, scope_id, 1u, 2u, 3u, 4u); auto result = db->get_pointer<hgdb::Scope>(scope_id); EXPECT_TRUE(result); EXPECT_EQ(result->breakpoints, "1 2 3 4"); } TEST_F(SchemaTest, store_variable) { // NOLINT EXPECT_EQ(db->count<hgdb::Variable>(), 0); constexpr uint32_t id1 = 42, id2 = 432; constexpr auto value1 = "top.mod.test"; hgdb::store_variable(*db, id1, value1); hgdb::store_variable(*db, id2, "value", false); EXPECT_EQ(db->count<hgdb::Variable>(), 2); auto result = db->get_pointer<hgdb::Variable>(id1); EXPECT_TRUE(result); EXPECT_EQ(result->value, value1); result = db->get_pointer<hgdb::Variable>(id2); EXPECT_TRUE(result); EXPECT_FALSE(result->is_rtl); } void add_breakpoint_var(hgdb::DebugDatabase &db) { constexpr uint32_t breakpoint_id = 42, variable_id = 432, instance_id = 163; constexpr auto instance_name = "top.mod"; constexpr auto value1 = "top.mod.test"; hgdb::store_instance(db, instance_id, instance_name); hgdb::store_variable(db, variable_id, value1); hgdb::store_breakpoint(db, breakpoint_id, instance_id, __FILE__, __LINE__); } TEST_F(SchemaTest, store_context_variable) { // NOLINT using namespace sqlite_orm; EXPECT_EQ(db->count<hgdb::ContextVariable>(), 0); constexpr uint32_t breakpoint_id = 42, variable_id = 432; constexpr auto name = "a"; add_breakpoint_var(*db); hgdb::store_context_variable(*db, name, breakpoint_id, variable_id); auto results = db->get_all<hgdb::ContextVariable>( where(c(&hgdb::ContextVariable::breakpoint_id) == breakpoint_id)); EXPECT_EQ(results.size(), 1); auto &result = results[0]; EXPECT_EQ(result.name, name); EXPECT_EQ(*result.variable_id, variable_id); } TEST_F(SchemaTest, store_generator_variable) { // NOLINT using namespace sqlite_orm; EXPECT_EQ(db->count<hgdb::ContextVariable>(), 0); constexpr uint32_t variable_id = 432, instance_id = 163; constexpr auto name = "a"; add_breakpoint_var(*db); hgdb::store_generator_variable(*db, name, instance_id, variable_id); auto results = db->get_all<hgdb::GeneratorVariable>( where(c(&hgdb::GeneratorVariable::instance_id) == instance_id)); EXPECT_EQ(results.size(), 1); auto &result = results[0]; EXPECT_EQ(result.name, name); EXPECT_EQ(*result.variable_id, variable_id); }
37.311828
80
0.693084
mithro
ab1eadd0371c04f108dbb19000c1643ee01cd840
1,361
cpp
C++
Source/10.0.18362.0/ucrt/misc/terminate.cpp
825126369/UCRT
8853304fdc2a5c216658d08b6dbbe716aa2a7b1f
[ "MIT" ]
2
2021-01-27T10:19:30.000Z
2021-02-09T06:24:30.000Z
Source/10.0.18362.0/ucrt/misc/terminate.cpp
825126369/UCRT
8853304fdc2a5c216658d08b6dbbe716aa2a7b1f
[ "MIT" ]
null
null
null
Source/10.0.18362.0/ucrt/misc/terminate.cpp
825126369/UCRT
8853304fdc2a5c216658d08b6dbbe716aa2a7b1f
[ "MIT" ]
1
2021-01-27T10:19:36.000Z
2021-01-27T10:19:36.000Z
// // terminate.cpp // // Copyright (c) Microsoft Corporation. All rights reserved. // // The terminate handler // #include <corecrt_internal.h> #include <corecrt_terminate.h> static terminate_handler __cdecl get_terminate_or_default( __acrt_ptd const* const ptd ) throw() { return ptd->_terminate ? ptd->_terminate : &abort; } extern "C" terminate_handler __cdecl _get_terminate() { return get_terminate_or_default(__acrt_getptd()); } extern "C" terminate_handler __cdecl set_terminate( terminate_handler const new_handler ) { __acrt_ptd* const ptd = __acrt_getptd(); terminate_handler const old_handler = get_terminate_or_default(ptd); ptd->_terminate = new_handler; return old_handler; } extern "C" void __cdecl terminate() { terminate_handler const handler = __acrt_getptd()->_terminate; if (handler) { // Note: We cannot allow any exceptions to propagate from a user- // registered terminate handler, so if any structured exception escapes // the user handler we abort. __try { handler(); } __except(EXCEPTION_EXECUTE_HANDLER) { ; // Deliberately do nothing } } // If the terminate handler returned, faulted, or otherwise failed to end // execution, we will do it: abort(); }
22.683333
79
0.667891
825126369
ab21d08280b6968b4027ceb8afaa35b34d30d51d
1,596
cpp
C++
QtBiVis/ccell.cpp
Archi0/QtBicVis
c6cd7f456fcf0ac9d2222ef60a2b5621089cb065
[ "MIT" ]
1
2019-10-05T15:17:06.000Z
2019-10-05T15:17:06.000Z
QtBiVis/ccell.cpp
Archi0/QtBicVis
c6cd7f456fcf0ac9d2222ef60a2b5621089cb065
[ "MIT" ]
1
2016-10-18T21:17:22.000Z
2016-10-18T21:17:22.000Z
QtBiVis/ccell.cpp
Archi0/QtBiVis
c6cd7f456fcf0ac9d2222ef60a2b5621089cb065
[ "MIT" ]
null
null
null
#include "ccell.h" CCell::CCell() { sValue = ""; sNumbers = ""; bState =false; // m_pRect = new QRectF(0,0,8,8); // setFlags(ItemIsSelectable); } QString CCell::getSValue() const { return sValue; } void CCell::setSValue(const QString &value) { sValue = value; } void CCell::setState(bool s) { bState = s; } void CCell::select() { QPixmap* pix; if(!bState) { pix = new QPixmap(10,10); pix->fill(Qt::red); bState = true; this->setPixmap(*pix); } } void CCell::unselect() { QPixmap* pix; if(bState) { pix = new QPixmap(10,10); pix->fill(m_color); bState = false; this->setPixmap(*pix); } } void CCell::mousePressEvent(QGraphicsSceneMouseEvent *e) { emit selected(this); } QString CCell::getSNumbers() const { return sNumbers; } bool CCell::getState() const { return bState; } void CCell::setSNumbers(const QString &value) { sNumbers = value; } int CCell::getNIndex() const { return nIndex; } void CCell::setNIndex(int value) { nIndex = value; } QColor CCell::getColor() const { return m_color; } void CCell::setColor(const QColor &color) { m_color = color; } /* void CCell::paint(QPainter *painter, const QStyleOptionGraphicsItem *option, QWidget *widget) { QPen pen(cLineColor); if (option->state & QStyle::State_Selected) { pen.setStyle(Qt::DotLine); pen.setWidth(2); emit selected(); } painter->setPen(pen); painter->setBrush(cBgColor); painter->drawRect(*m_pRect); }*/
14.642202
93
0.602757
Archi0
ab290af75e037f7e8bfcca446138bd1ebb5a585d
854
hpp
C++
Runtime/Character/CEffectComponent.hpp
jackoalan/urde
413483a996805a870f002324ee46cfc123f4df06
[ "MIT" ]
null
null
null
Runtime/Character/CEffectComponent.hpp
jackoalan/urde
413483a996805a870f002324ee46cfc123f4df06
[ "MIT" ]
null
null
null
Runtime/Character/CEffectComponent.hpp
jackoalan/urde
413483a996805a870f002324ee46cfc123f4df06
[ "MIT" ]
null
null
null
#pragma once #include <string> #include "Runtime/IOStreams.hpp" #include "Runtime/RetroTypes.hpp" #include "Runtime/Character/CParticleData.hpp" namespace urde { class CEffectComponent { std::string x0_name; SObjectTag x10_tag; std::string x18_boneName; float x28_scale; CParticleData::EParentedMode x2c_parentedMode; u32 x30_flags; static SObjectTag GetSObjectTagFromStream(CInputStream& in); public: CEffectComponent(CInputStream& in); std::string_view GetComponentName() const { return x0_name; } const SObjectTag& GetParticleTag() const { return x10_tag; } std::string_view GetSegmentName() const { return x18_boneName; } float GetScale() const { return x28_scale; } CParticleData::EParentedMode GetParentedMode() const { return x2c_parentedMode; } u32 GetFlags() const { return x30_flags; } }; } // namespace urde
26.6875
83
0.762295
jackoalan
ab2acb73f388b3a99446178945fbb00771677019
12,697
cpp
C++
enduser/netmeeting/t120/mst120/datapkt.cpp
npocmaka/Windows-Server-2003
5c6fe3db626b63a384230a1aa6b92ac416b0765f
[ "Unlicense" ]
17
2020-11-13T13:42:52.000Z
2021-09-16T09:13:13.000Z
enduser/netmeeting/t120/mst120/datapkt.cpp
sancho1952007/Windows-Server-2003
5c6fe3db626b63a384230a1aa6b92ac416b0765f
[ "Unlicense" ]
2
2020-10-19T08:02:06.000Z
2020-10-19T08:23:18.000Z
enduser/netmeeting/t120/mst120/datapkt.cpp
sancho1952007/Windows-Server-2003
5c6fe3db626b63a384230a1aa6b92ac416b0765f
[ "Unlicense" ]
14
2020-11-14T09:43:20.000Z
2021-08-28T08:59:57.000Z
#include "precomp.h" DEBUG_FILEZONE(ZONE_T120_MCSNC); /* * datapkt.cpp * * Copyright (c) 1997 by Microsoft Corporation, Redmond, WA * * Abstract: * This is the implementation file for the MCS data packet class. The data packet * class is responsible for encoding and decoding the PDUs, as well as * maintaining the necessary pointers to the encoded and decoded data. * However, they differ from normal packets, in that there is only one copy of the * user data in the encoded and decoded buffers. Only the encoded buffer has the user data, * while the decoded one maintains a pointer to the data. * Instances of this class will be created both by User and Connection * objects as PDUs flow through MCS. * * Private Instance Variables: * ulDataOffset * Maintains the offset of the starting byte of the user data * from the start of the encoded buffer. * * Caveats: * None. * * Author: * Christos Tsollis */ #include "omcscode.h" /* * This is a global variable that has a pointer to the one MCS coder that * is instantiated by the MCS Controller. Most objects know in advance * whether they need to use the MCS or the GCC coder, so, they do not need * this pointer in their constructors. */ extern CMCSCoder *g_MCSCoder; /* * The following array contains a template for the X.224 data header. * The 5 of the 7 bytes that it initializes are actually sent to the * wire. Bytes 3 and 4 will be set to contain the size of the PDU. * The array is only used when we encode a data PDU. */ extern UChar g_X224Header[]; /* * These are globals that correspond to the static variables declared as part * of this class. */ PVoid * DataPacket::Object_Array; long DataPacket::Object_Count; /* * operator new * * Public * * Functional Description: * This is the "new" operator for the DataPacket class. * */ PVoid DataPacket::operator new (size_t) { PVoid pNewObject; TRACE_OUT(("DataPacket::DataPacket: %d pre-allocated data packet objects are left.", Object_Count)); if (Object_Count > 0) { pNewObject = Object_Array[--Object_Count]; } else { // Allocate an object from the heap DBG_SAVE_FILE_LINE pNewObject = (PVoid) new BYTE[sizeof(DataPacket)]; if (pNewObject != NULL) ((PDataPacket) pNewObject)->fPreAlloc = FALSE; } return (pNewObject); } /* * operator delete * * Public * * Functional Description: * This is the "delete" operator for the Packet class. * */ Void DataPacket::operator delete (PVoid object) { if (((PDataPacket) object)->fPreAlloc) { Object_Array[Object_Count++] = object; } else delete [] ((BYTE *) object); } /* * The AllocateMemoryPool static function pre-allocates DataPacket * objects for use by MCS. */ Void DataPacket::AllocateMemoryPool (long maximum_objects) { ULong memory_size; PUChar object_ptr; long object_count; PVoid *pStack; /* * Calculate the amount of memory needed to hold the specified number of * entries. This memory block will contains two different types of * information: * * 1. A stack of available objects (each entry is a PVoid). The "new" * operator pops the top entry off the stack. The "delete" operator * pushes one back on. * 2. The objects themselves, sequentially in memory. * * That is why this calculation adds the size of a PVoid to the size of * an instance of the class, and multiplies by the specified number. This * allows enough room for both sections. */ memory_size = ((sizeof (PVoid) + sizeof (DataPacket)) * maximum_objects); /* * Allocate the memory required. */ DBG_SAVE_FILE_LINE Object_Array = (PVoid *) new BYTE[memory_size]; if (Object_Array != NULL) { Object_Count = maximum_objects; /* * Set a pointer to the first object, which immediately follows the * stack of available objects. */ object_ptr = (PUChar) Object_Array + (sizeof (PVoid) * maximum_objects); /* * This loop initializes the stack of available objects to contain all * objects, in sequential order. */ for (pStack = Object_Array, object_count = 0; object_count < maximum_objects; object_count++) { *pStack++ = (PVoid) object_ptr; ((PDataPacket) object_ptr)->fPreAlloc = TRUE; // this object is pre-allocated object_ptr += sizeof (DataPacket); } } else { /* * The memory allocation failed. Set the static variable indicating * that there are no objects left. This way, ALL attempted allocations * will fail. */ Object_Count = 0; } } /* * The FreeMemoryPool static function frees the pre-allocates DataPacket * objects. It also deletes the critical section * that controls access to these objects and the memory-tracking * mechanisms in T.120 */ Void DataPacket::FreeMemoryPool () { if (Object_Array != NULL) delete [] ((BYTE *) Object_Array); }; /* * DataPacket () * * Public * * Functional Description: * This constructor is used to create an outgoing data packet. * The packet is created by the user object, when the request * for a send data or uniform send data comes through the user * portal. */ //outgoing data packets. DataPacket::DataPacket (ASN1choice_t choice, PUChar data_ptr, ULong data_length, UINT channel_id, Priority priority, Segmentation segmentation, UINT initiator_id, SendDataFlags flags, PMemory memory, PPacketError packet_error) : SimplePacket(TRUE), m_fIncoming (FALSE), m_Memory (memory), m_EncodedDataBroken (FALSE), m_nMessageType(0) { *packet_error = PACKET_NO_ERROR; // Fill in the decoded domain PDU fields. m_DecodedPDU.choice = choice; m_DecodedPDU.u.send_data_request.initiator = (UserID) initiator_id; m_DecodedPDU.u.send_data_request.channel_id = (ChannelID) channel_id; m_DecodedPDU.u.send_data_request.data_priority = (PDUPriority) priority; m_DecodedPDU.u.send_data_request.segmentation = (PDUSegmentation) segmentation; m_DecodedPDU.u.send_data_request.user_data.length = data_length; m_DecodedPDU.u.send_data_request.user_data.value = (ASN1octet_t *) data_ptr; /* * Now, encode the data PDU. Note that no error/allocation should * occur during the Encode operation. */ if (flags == APP_ALLOCATION) { ASSERT (m_Memory == NULL); // We will need to memcpy the data m_EncodedPDU = NULL; } else { // No need for data memcpy! ASSERT (m_Memory != NULL); /* * We need to set the m_EncodedPDU ptr. If this is the 1st packet * of the data request, the space is already allocated. Otherwise, * we need to allocate it. */ if (segmentation & SEGMENTATION_BEGIN) { m_EncodedPDU = data_ptr - MAXIMUM_PROTOCOL_OVERHEAD; } else { DBG_SAVE_FILE_LINE m_EncodedPDU = Allocate (MAXIMUM_PROTOCOL_OVERHEAD); if (NULL != m_EncodedPDU) { m_EncodedDataBroken = TRUE; } else { WARNING_OUT (("DataPacket::DataPacket: Failed to allocate MCS encoded headers.")); *packet_error = PACKET_MALLOC_FAILURE; } } /* * We lock the big buffer that contains the data included in this packet. */ LockMemory (m_Memory); } if (*packet_error == PACKET_NO_ERROR) { if (g_MCSCoder->Encode ((LPVOID) &m_DecodedPDU, DOMAIN_MCS_PDU, PACKED_ENCODING_RULES, &m_EncodedPDU, &Encoded_Data_Length)) { if (m_Memory == NULL) { m_Memory = GetMemoryObjectFromEncData(m_EncodedPDU); } } else { WARNING_OUT (("DataPacket::DataPacket: Encode failed. Possibly, allocation error.")); *packet_error = PACKET_MALLOC_FAILURE; } } } /* * Packet () * * Public * * Functional Description: * This version of the constructor is used to create a DataPacket object * for incomming PDUs when the packet is to be created from an encoded * data stream containing the PDU data to be decoded. * * Input parameters: * pTransportData: This structure contains the following fields: * user_data: Pointer to space containing the real user data + 7 initial * bytes for X.224 headers. * user_data_length: Length of the user data including the 7-byte X.224 * header. * buffer: The beginning of the buffer containing the user_data ptr. These * 2 ptrs can be different because of security. This is the buffer * to be freed after we no longer need the data. * buffer_length: size of "buffer" space. It's only used for accounting * purposes. RECV_PRIORITY space is limited. * fPacketDirectionUp: Direction of the data pkt in MCS domain. */ // incoming packets DataPacket::DataPacket(PTransportData pTransportData, BOOL fPacketDirectionUp) : SimplePacket(fPacketDirectionUp), m_fIncoming (TRUE), m_Memory (pTransportData->memory), m_EncodedDataBroken (FALSE), m_nMessageType(0) { m_EncodedPDU = (LPBYTE) pTransportData->user_data; Encoded_Data_Length = (UINT) pTransportData->user_data_length; // take care of the X.224 header memcpy (m_EncodedPDU, g_X224Header, PROTOCOL_OVERHEAD_X224); AddRFCSize (m_EncodedPDU, Encoded_Data_Length); // Now, we can decode the PDU g_MCSCoder->Decode (m_EncodedPDU + PROTOCOL_OVERHEAD_X224, Encoded_Data_Length - PROTOCOL_OVERHEAD_X224, DOMAIN_MCS_PDU, PACKED_ENCODING_RULES, (LPVOID *) &m_DecodedPDU, NULL); TRACE_OUT (("DataPacket::DataPacket: incoming data PDU packet was created successfully. Encoded size: %d", Encoded_Data_Length - PROTOCOL_OVERHEAD_X224)); } /* * ~DataPacket () * * Public * * Functional Description: * Destructor for the DataPacket class. The destructor ensures that all * resources that have been allocated are freed. */ DataPacket::~DataPacket(void) { if (m_EncodedPDU != NULL) { UnlockMemory (m_Memory); if (m_EncodedDataBroken) { // Free the MCS and X.224 header buffer. Free (m_EncodedPDU); } } } /* * Equivalent () * * Public * * Functional Description: * This function returns TRUE if the 2 packets belong to the same * original SendData request (normal or uniform), and FALSE, otherwise. */ BOOL DataPacket::Equivalent (PDataPacket packet) { ASSERT (m_DecodedPDU.u.send_data_request.segmentation == SEGMENTATION_END); ASSERT ((packet->m_DecodedPDU.u.send_data_request.segmentation & SEGMENTATION_END) == 0); return ((m_DecodedPDU.u.send_data_request.initiator == packet->m_DecodedPDU.u.send_data_request.initiator) && (m_DecodedPDU.u.send_data_request.channel_id == packet->m_DecodedPDU.u.send_data_request.channel_id) && (m_DecodedPDU.u.send_data_request.data_priority == packet->m_DecodedPDU.u.send_data_request.data_priority) && (m_DecodedPDU.choice == packet->m_DecodedPDU.choice)); } /* * IsDataPacket () * * Public * * Functional Description: * This function returns whether this is a data packet (it is). */ BOOL DataPacket::IsDataPacket(void) { return (TRUE); } /* * SetDirection () * * Public * * Functional Description: * If the DataPacket object is oriented differently than desired * by the caller of this method, then the packet coder is called to * reverse the direction of the PDU. */ Void DataPacket::SetDirection (DBBoolean packet_direction_up) { /* * If the packet's encoded data is oriented differently from the desired * direction, call the packet coder's ReverseDirection method and * reverse the packet's direction indicator. */ if (packet_direction_up != Packet_Direction_Up) { /* * Reverse the direction of the PDU. */ g_MCSCoder->ReverseDirection (m_EncodedPDU); /* * The packet coder has reversed the direction of the PDU. Set * the Packet_Direction_Up flag to indicate the new state. */ Packet_Direction_Up = packet_direction_up; } } /* * GetDecodedData () * * Public * * Functional Description: * The GetDecodedData method returns a pointer to the decoded data * buffer. If the packet does not have decoded data the Decode method is * called. */ PVoid DataPacket::GetDecodedData () { return ((PVoid) &m_DecodedPDU); } /* * GetPDUType () * * Public * * Functional Description: * The GetPDUType method returns the PDU type for the data packet. * For such a packet, the value is always */ int DataPacket::GetPDUType () { return (DOMAIN_MCS_PDU); }
29.25576
112
0.684256
npocmaka
ab2eb0045b69e1139d620b90e58fa6fb3e80a166
431
cpp
C++
05-loops/5.22-drawing-a-right-triangle/trang-solution.cpp
trangnart/cis22a
498a7b37d12a13efa7749849dc95d9892d1786be
[ "MIT" ]
2
2020-09-04T22:06:06.000Z
2020-09-09T04:00:25.000Z
05-loops/5.22-drawing-a-right-triangle/trang-solution.cpp
trangnart/cis22a
498a7b37d12a13efa7749849dc95d9892d1786be
[ "MIT" ]
14
2020-08-24T01:44:36.000Z
2021-01-01T08:44:17.000Z
05-loops/5.22-drawing-a-right-triangle/trang-solution.cpp
trangnart/cis22a
498a7b37d12a13efa7749849dc95d9892d1786be
[ "MIT" ]
1
2020-09-04T22:13:13.000Z
2020-09-04T22:13:13.000Z
#include <iostream> using namespace std; int main() { char triangleChar; int triangleHeight; cout << "Enter a character:" << endl; cin >> triangleChar; cout << "Enter triangle height:" << endl; cin >> triangleHeight; cout << endl; for (int i = 0; i <= triangleHeight; ++i) { for (int j = 0; j < i; ++j) { cout << triangleChar << " "; } cout << endl; } return 0; }
18.73913
46
0.529002
trangnart
ab359129fa28e12be09092929798de061e208b6a
5,365
cpp
C++
VirtualBox-5.0.0/src/VBox/Runtime/r3/win/RTSystemShutdown-win.cpp
egraba/vbox_openbsd
6cb82f2eed1fa697d088cecc91722b55b19713c2
[ "MIT" ]
1
2015-04-30T14:18:45.000Z
2015-04-30T14:18:45.000Z
VirtualBox-5.0.0/src/VBox/Runtime/r3/win/RTSystemShutdown-win.cpp
egraba/vbox_openbsd
6cb82f2eed1fa697d088cecc91722b55b19713c2
[ "MIT" ]
null
null
null
VirtualBox-5.0.0/src/VBox/Runtime/r3/win/RTSystemShutdown-win.cpp
egraba/vbox_openbsd
6cb82f2eed1fa697d088cecc91722b55b19713c2
[ "MIT" ]
null
null
null
/* $Id: RTSystemShutdown-win.cpp $ */ /** @file * IPRT - RTSystemShutdown, Windows. */ /* * Copyright (C) 2012-2015 Oracle Corporation * * This file is part of VirtualBox Open Source Edition (OSE), as * available from http://www.virtualbox.org. This file is free software; * you can redistribute it and/or modify it under the terms of the GNU * General Public License (GPL) as published by the Free Software * Foundation, in version 2 as it comes in the "COPYING" file of the * VirtualBox OSE distribution. VirtualBox OSE is distributed in the * hope that it will be useful, but WITHOUT ANY WARRANTY of any kind. * * The contents of this file may alternatively be used under the terms * of the Common Development and Distribution License Version 1.0 * (CDDL) only, as it comes in the "COPYING.CDDL" file of the * VirtualBox OSE distribution, in which case the provisions of the * CDDL are applicable instead of those of the GPL. * * You may elect to license modified versions of this file under the * terms and conditions of either the GPL or the CDDL or both. */ /******************************************************************************* * Header Files * *******************************************************************************/ #include <iprt/system.h> #include "internal/iprt.h" #include <iprt/assert.h> #include <iprt/err.h> #include <iprt/string.h> #include <Windows.h> RTDECL(int) RTSystemShutdown(RTMSINTERVAL cMsDelay, uint32_t fFlags, const char *pszLogMsg) { AssertPtrReturn(pszLogMsg, VERR_INVALID_POINTER); AssertReturn(!(fFlags & ~RTSYSTEM_SHUTDOWN_VALID_MASK), VERR_INVALID_PARAMETER); PRTUTF16 pwszLogMsg; int rc = RTStrToUtf16(pszLogMsg, &pwszLogMsg); if (RT_FAILURE(rc)) return rc; DWORD cSecsTimeout = (cMsDelay + 499) / 1000; BOOL fRebootAfterShutdown = (fFlags & RTSYSTEM_SHUTDOWN_ACTION_MASK) == RTSYSTEM_SHUTDOWN_REBOOT ? TRUE : FALSE; BOOL fForceAppsClosed = fFlags & RTSYSTEM_SHUTDOWN_FORCE ? TRUE : FALSE; /* * Do the */ if (InitiateSystemShutdownW(NULL /*pwszMachineName = NULL = localhost*/, pwszLogMsg, cSecsTimeout, fForceAppsClosed, fRebootAfterShutdown)) rc = (fFlags & RTSYSTEM_SHUTDOWN_ACTION_MASK) == RTSYSTEM_SHUTDOWN_HALT ? VINF_SYS_MAY_POWER_OFF : VINF_SUCCESS; else { /* If we failed because of missing privileges, try get the right to shut down the system and call the api again. */ DWORD dwErr = GetLastError(); rc = RTErrConvertFromWin32(dwErr); if (dwErr == ERROR_ACCESS_DENIED) { HANDLE hToken = NULL; if (OpenThreadToken(GetCurrentThread(), TOKEN_ADJUST_PRIVILEGES, TRUE /*OpenAsSelf*/, &hToken)) dwErr = NO_ERROR; else { dwErr = GetLastError(); if (dwErr == ERROR_NO_TOKEN) { if (OpenProcessToken(GetCurrentProcess(), TOKEN_ADJUST_PRIVILEGES, &hToken)) dwErr = NO_ERROR; else dwErr = GetLastError(); } } if (dwErr == NO_ERROR) { union { TOKEN_PRIVILEGES TokenPriv; char ab[sizeof(TOKEN_PRIVILEGES) + sizeof(LUID_AND_ATTRIBUTES)]; } u; u.TokenPriv.PrivilegeCount = 1; u.TokenPriv.Privileges[0].Attributes = SE_PRIVILEGE_ENABLED; if (LookupPrivilegeValue(NULL /*localhost*/, SE_SHUTDOWN_NAME, &u.TokenPriv.Privileges[0].Luid)) { if (AdjustTokenPrivileges(hToken, FALSE /*DisableAllPrivileges*/, &u.TokenPriv, RT_OFFSETOF(TOKEN_PRIVILEGES, Privileges[1]), NULL, NULL) ) { if (InitiateSystemShutdownW(NULL /*pwszMachineName = NULL = localhost*/, pwszLogMsg, cSecsTimeout, fForceAppsClosed, fRebootAfterShutdown)) rc = (fFlags & RTSYSTEM_SHUTDOWN_ACTION_MASK) == RTSYSTEM_SHUTDOWN_HALT ? VINF_SYS_MAY_POWER_OFF : VINF_SUCCESS; else { dwErr = GetLastError(); rc = RTErrConvertFromWin32(dwErr); } } CloseHandle(hToken); } } } } RTUtf16Free(pwszLogMsg); return rc; } RT_EXPORT_SYMBOL(RTSystemShutdown);
40.338346
140
0.50028
egraba
ab36e203ba8f0c1f4d3d7c49b01eb995429c3ff2
2,170
cpp
C++
oneflow/api/python/ofblob/ofblob.cpp
mosout/oneflow
afbb221d900f1a340568ae2462b2022f8fcc4b3d
[ "Apache-2.0" ]
1
2022-01-19T07:50:28.000Z
2022-01-19T07:50:28.000Z
oneflow/api/python/ofblob/ofblob.cpp
mosout/oneflow
afbb221d900f1a340568ae2462b2022f8fcc4b3d
[ "Apache-2.0" ]
null
null
null
oneflow/api/python/ofblob/ofblob.cpp
mosout/oneflow
afbb221d900f1a340568ae2462b2022f8fcc4b3d
[ "Apache-2.0" ]
null
null
null
/* Copyright 2020 The OneFlow Authors. All rights reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. */ #include <pybind11/pybind11.h> #include "oneflow/api/python/of_api_registry.h" #include "oneflow/core/common/preprocessor.h" #include "oneflow/core/common/data_type_seq.h" #include "oneflow/api/python/ofblob/ofblob.h" #include "oneflow/api/python/ofblob/ofblob.e.h" namespace py = pybind11; ONEFLOW_API_PYBIND11_MODULE("", m) { m.def("Ofblob_GetDataType", &Ofblob_GetDataType); m.def("OfBlob_NumAxes", &OfBlob_NumAxes); m.def("OfBlob_IsDynamic", &OfBlob_IsDynamic); m.def("OfBlob_CopyShapeTo", &OfBlob_CopyShapeTo); m.def("OfBlob_CopyStaticShapeTo", &OfBlob_CopyStaticShapeTo); m.def("OfBlob_CopyShapeFrom", &OfBlob_CopyShapeFrom); m.def("Dtype_GetOfBlobCopyToBufferFuncName", &Dtype_GetOfBlobCopyToBufferFuncName); m.def("Dtype_GetOfBlobCopyFromBufferFuncName", &Dtype_GetOfBlobCopyFromBufferFuncName); #define EXPORT_COPY_DATA_API(T, type_proto) \ m.def("OfBlob_CopyToBuffer_" OF_PP_STRINGIZE(T), \ [](uint64_t of_blob_ptr, py::array_t<T> array) { \ oneflow::NumPyArrayPtr array_ptr(array.ptr()); \ OfBlob_CopyToBuffer_##T(of_blob_ptr, array_ptr); \ }); \ m.def("OfBlob_CopyFromBuffer_" OF_PP_STRINGIZE(T), \ [](uint64_t of_blob_ptr, py::array_t<T> array) { \ oneflow::NumPyArrayPtr array_ptr(array.ptr()); \ OfBlob_CopyFromBuffer_##T(of_blob_ptr, array_ptr); \ }); OF_PP_FOR_EACH_TUPLE(EXPORT_COPY_DATA_API, POD_DATA_TYPE_SEQ BOOL_DATA_TYPE_SEQ); #undef EXPORT_COPY_DATA_API }
41.730769
89
0.719816
mosout
ab38868c828b0217c1d806815d0435e14806bb58
2,339
cpp
C++
modules/video/perf/perf_ecc.cpp
thisisgopalmandal/opencv
4e2ef8c8f57644ccb8e762a37f70a61007c6be1c
[ "BSD-3-Clause" ]
56,632
2016-07-04T16:36:08.000Z
2022-03-31T18:38:14.000Z
modules/video/perf/perf_ecc.cpp
thisisgopalmandal/opencv
4e2ef8c8f57644ccb8e762a37f70a61007c6be1c
[ "BSD-3-Clause" ]
13,593
2016-07-04T13:59:03.000Z
2022-03-31T21:04:51.000Z
modules/video/perf/perf_ecc.cpp
thisisgopalmandal/opencv
4e2ef8c8f57644ccb8e762a37f70a61007c6be1c
[ "BSD-3-Clause" ]
54,986
2016-07-04T14:24:38.000Z
2022-03-31T22:51:18.000Z
#include "perf_precomp.hpp" namespace opencv_test { using namespace perf; CV_ENUM(MotionType, MOTION_TRANSLATION, MOTION_EUCLIDEAN, MOTION_AFFINE, MOTION_HOMOGRAPHY) typedef tuple<MotionType> MotionType_t; typedef perf::TestBaseWithParam<MotionType_t> TransformationType; PERF_TEST_P(TransformationType, findTransformECC, /*testing::ValuesIn(MotionType::all())*/ testing::Values((int) MOTION_TRANSLATION, (int) MOTION_EUCLIDEAN, (int) MOTION_AFFINE, (int) MOTION_HOMOGRAPHY) ) { Mat img = imread(getDataPath("cv/shared/fruits_ecc.png"),0); Mat templateImage; int transform_type = get<0>(GetParam()); Mat warpMat; Mat warpGround; double angle; switch (transform_type) { case MOTION_TRANSLATION: warpGround = (Mat_<float>(2,3) << 1.f, 0.f, 7.234f, 0.f, 1.f, 11.839f); warpAffine(img, templateImage, warpGround, Size(200,200), INTER_LINEAR + WARP_INVERSE_MAP); break; case MOTION_EUCLIDEAN: angle = CV_PI/30; warpGround = (Mat_<float>(2,3) << (float)cos(angle), (float)-sin(angle), 12.123f, (float)sin(angle), (float)cos(angle), 14.789f); warpAffine(img, templateImage, warpGround, Size(200,200), INTER_LINEAR + WARP_INVERSE_MAP); break; case MOTION_AFFINE: warpGround = (Mat_<float>(2,3) << 0.98f, 0.03f, 15.523f, -0.02f, 0.95f, 10.456f); warpAffine(img, templateImage, warpGround, Size(200,200), INTER_LINEAR + WARP_INVERSE_MAP); break; case MOTION_HOMOGRAPHY: warpGround = (Mat_<float>(3,3) << 0.98f, 0.03f, 15.523f, -0.02f, 0.95f, 10.456f, 0.0002f, 0.0003f, 1.f); warpPerspective(img, templateImage, warpGround, Size(200,200), INTER_LINEAR + WARP_INVERSE_MAP); break; } TEST_CYCLE() { if (transform_type<3) warpMat = Mat::eye(2,3, CV_32F); else warpMat = Mat::eye(3,3, CV_32F); findTransformECC(templateImage, img, warpMat, transform_type, TermCriteria(TermCriteria::COUNT+TermCriteria::EPS, 5, -1)); } SANITY_CHECK(warpMat, 3e-3); } } // namespace
32.486111
93
0.595126
thisisgopalmandal
ab3bb6b00c3541cad8a469b3d29d17898e40ae9f
800
cpp
C++
project/OFEC_sc2/instance/algorithm/realworld/DVRP/LKH/Penalty_TSPTW.cpp
BaiChunhui-9803/bch_sc2_OFEC
d50211b27df5a51a953a2475b6c292d00cbfeff6
[ "MIT" ]
null
null
null
project/OFEC_sc2/instance/algorithm/realworld/DVRP/LKH/Penalty_TSPTW.cpp
BaiChunhui-9803/bch_sc2_OFEC
d50211b27df5a51a953a2475b6c292d00cbfeff6
[ "MIT" ]
null
null
null
project/OFEC_sc2/instance/algorithm/realworld/DVRP/LKH/Penalty_TSPTW.cpp
BaiChunhui-9803/bch_sc2_OFEC
d50211b27df5a51a953a2475b6c292d00cbfeff6
[ "MIT" ]
null
null
null
#include "./INCLUDE/LKH.h" #include "./INCLUDE/Segment.h" namespace LKH { GainType LKHAlg::Penalty_TSPTW() { Node *N = Depot, *NextN; GainType Sum = 0, P = 0; int Forward = SUCC(N)->Id != N->Id + DimensionSaved; do { if (N->Id <= DimensionSaved) { if (Sum < N->Earliest) Sum = N->Earliest; else if (Sum > N->Latest && (P += Sum - N->Latest) > CurrentPenalty) return CurrentPenalty + 1; NextN = Forward ? SUCC(N) : PREDD(N); } NextN = Forward ? SUCC(N) : PREDD(N); Sum += ((this->*C)(N, NextN) - N->Pi - NextN->Pi) / Precision; } while ((N = NextN) != Depot); if (Sum > Depot->Latest && ((P += Sum - Depot->Latest) > CurrentPenalty || (P == CurrentPenalty && CurrentGain <= 0))) return CurrentPenalty + (CurrentGain > 0); return P; } }
28.571429
65
0.57125
BaiChunhui-9803
ab3f6a9aa9c131e7936a28e0735e9bd970780118
7,538
cpp
C++
dynamic/wrappers/cell_based/AbstractCellBasedSimulation3_3.cppwg.cpp
jmsgrogan/PyChaste
48a9863d2c941c71e47ecb72e917b477ba5c1413
[ "FTL" ]
6
2017-02-04T16:10:53.000Z
2021-07-01T08:03:16.000Z
dynamic/wrappers/cell_based/AbstractCellBasedSimulation3_3.cppwg.cpp
jmsgrogan/PyChaste
48a9863d2c941c71e47ecb72e917b477ba5c1413
[ "FTL" ]
6
2017-06-22T08:50:41.000Z
2019-12-15T20:17:29.000Z
dynamic/wrappers/cell_based/AbstractCellBasedSimulation3_3.cppwg.cpp
jmsgrogan/PyChaste
48a9863d2c941c71e47ecb72e917b477ba5c1413
[ "FTL" ]
3
2017-05-15T21:33:58.000Z
2019-10-27T21:43:07.000Z
#include <pybind11/pybind11.h> #include <pybind11/stl.h> #include <set> #include <vector> #include <string> #include <map> #include "SmartPointers.hpp" #include "UblasIncludes.hpp" #include "AbstractCellBasedSimulation.hpp" #include "AbstractCellBasedSimulation3_3.cppwg.hpp" namespace py = pybind11; typedef AbstractCellBasedSimulation<3,3 > AbstractCellBasedSimulation3_3; PYBIND11_DECLARE_HOLDER_TYPE(T, boost::shared_ptr<T>); typedef unsigned int unsignedint; class AbstractCellBasedSimulation3_3_Overloads : public AbstractCellBasedSimulation3_3{ public: using AbstractCellBasedSimulation3_3::AbstractCellBasedSimulation; void OutputSimulationParameters(::out_stream & rParamsFile) override { PYBIND11_OVERLOAD_PURE( void, AbstractCellBasedSimulation3_3, OutputSimulationParameters, rParamsFile); } void WriteVisualizerSetupFile() override { PYBIND11_OVERLOAD( void, AbstractCellBasedSimulation3_3, WriteVisualizerSetupFile, ); } unsigned int DoCellBirth() override { PYBIND11_OVERLOAD( unsignedint, AbstractCellBasedSimulation3_3, DoCellBirth, ); } void SetupSolve() override { PYBIND11_OVERLOAD( void, AbstractCellBasedSimulation3_3, SetupSolve, ); } bool StoppingEventHasOccurred() override { PYBIND11_OVERLOAD( bool, AbstractCellBasedSimulation3_3, StoppingEventHasOccurred, ); } void UpdateCellPopulation() override { PYBIND11_OVERLOAD( void, AbstractCellBasedSimulation3_3, UpdateCellPopulation, ); } void UpdateCellLocationsAndTopology() override { PYBIND11_OVERLOAD_PURE( void, AbstractCellBasedSimulation3_3, UpdateCellLocationsAndTopology, ); } void OutputAdditionalSimulationSetup(::out_stream & rParamsFile) override { PYBIND11_OVERLOAD_PURE( void, AbstractCellBasedSimulation3_3, OutputAdditionalSimulationSetup, rParamsFile); } }; void register_AbstractCellBasedSimulation3_3_class(py::module &m){ py::class_<AbstractCellBasedSimulation3_3 , AbstractCellBasedSimulation3_3_Overloads , boost::shared_ptr<AbstractCellBasedSimulation3_3 > >(m, "AbstractCellBasedSimulation3_3") .def(py::init<::AbstractCellPopulation<3, 3> &, bool, bool >(), py::arg("rCellPopulation"), py::arg("deleteCellPopulationInDestructor") = false, py::arg("initialiseCells") = true) .def( "GetNodeLocation", (::std::vector<double, std::allocator<double> >(AbstractCellBasedSimulation3_3::*)(unsigned int const &)) &AbstractCellBasedSimulation3_3::GetNodeLocation, " " , py::arg("rNodeIndex") ) .def( "GetDt", (double(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetDt, " " ) .def( "GetNumBirths", (unsigned int(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetNumBirths, " " ) .def( "GetNumDeaths", (unsigned int(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetNumDeaths, " " ) .def( "GetOutputDirectory", (::std::string(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetOutputDirectory, " " ) .def( "SetDt", (void(AbstractCellBasedSimulation3_3::*)(double)) &AbstractCellBasedSimulation3_3::SetDt, " " , py::arg("dt") ) .def( "SetEndTime", (void(AbstractCellBasedSimulation3_3::*)(double)) &AbstractCellBasedSimulation3_3::SetEndTime, " " , py::arg("endTime") ) .def( "SetOutputDirectory", (void(AbstractCellBasedSimulation3_3::*)(::std::string)) &AbstractCellBasedSimulation3_3::SetOutputDirectory, " " , py::arg("outputDirectory") ) .def( "SetSamplingTimestepMultiple", (void(AbstractCellBasedSimulation3_3::*)(unsigned int)) &AbstractCellBasedSimulation3_3::SetSamplingTimestepMultiple, " " , py::arg("samplingTimestepMultiple") ) .def( "SetNoBirth", (void(AbstractCellBasedSimulation3_3::*)(bool)) &AbstractCellBasedSimulation3_3::SetNoBirth, " " , py::arg("noBirth") ) .def( "SetUpdateCellPopulationRule", (void(AbstractCellBasedSimulation3_3::*)(bool)) &AbstractCellBasedSimulation3_3::SetUpdateCellPopulationRule, " " , py::arg("updateCellPopulation") ) .def( "GetUpdateCellPopulationRule", (bool(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetUpdateCellPopulationRule, " " ) .def( "AddCellKiller", (void(AbstractCellBasedSimulation3_3::*)(::boost::shared_ptr<AbstractCellKiller<3> >)) &AbstractCellBasedSimulation3_3::AddCellKiller, " " , py::arg("pCellKiller") ) .def( "RemoveAllCellKillers", (void(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::RemoveAllCellKillers, " " ) .def( "AddSimulationModifier", (void(AbstractCellBasedSimulation3_3::*)(::boost::shared_ptr<AbstractCellBasedSimulationModifier<3, 3> >)) &AbstractCellBasedSimulation3_3::AddSimulationModifier, " " , py::arg("pSimulationModifier") ) .def( "Solve", (void(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::Solve, " " ) .def( "rGetCellPopulation", (::AbstractCellPopulation<3, 3> &(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::rGetCellPopulation, " " , py::return_value_policy::reference_internal) .def( "rGetCellPopulation", (::AbstractCellPopulation<3, 3> const &(AbstractCellBasedSimulation3_3::*)() const ) &AbstractCellBasedSimulation3_3::rGetCellPopulation, " " , py::return_value_policy::reference_internal) .def( "GetOutputDivisionLocations", (bool(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetOutputDivisionLocations, " " ) .def( "SetOutputDivisionLocations", (void(AbstractCellBasedSimulation3_3::*)(bool)) &AbstractCellBasedSimulation3_3::SetOutputDivisionLocations, " " , py::arg("outputDivisionLocations") ) .def( "GetOutputCellVelocities", (bool(AbstractCellBasedSimulation3_3::*)()) &AbstractCellBasedSimulation3_3::GetOutputCellVelocities, " " ) .def( "SetOutputCellVelocities", (void(AbstractCellBasedSimulation3_3::*)(bool)) &AbstractCellBasedSimulation3_3::SetOutputCellVelocities, " " , py::arg("outputCellVelocities") ) .def( "OutputSimulationParameters", (void(AbstractCellBasedSimulation3_3::*)(::out_stream &)) &AbstractCellBasedSimulation3_3::OutputSimulationParameters, " " , py::arg("rParamsFile") ) ; }
42.829545
187
0.62762
jmsgrogan
ab3fb3eee8890f5201f17ecd0f5f0f6a7e1a5513
6,328
cpp
C++
source/RAIIGen/Generator/OpenGLESGenerator.cpp
Unarmed1000/RAIIGen
2516ab5949c1fb54ca1b6e51e5e99e15ecfebbfb
[ "BSD-3-Clause" ]
8
2016-11-02T14:08:51.000Z
2021-03-25T02:00:00.000Z
source/RAIIGen/Generator/OpenGLESGenerator.cpp
Unarmed1000/RAIIGen
2516ab5949c1fb54ca1b6e51e5e99e15ecfebbfb
[ "BSD-3-Clause" ]
4
2016-08-23T12:37:17.000Z
2016-09-30T01:58:20.000Z
source/RAIIGen/Generator/OpenGLESGenerator.cpp
Unarmed1000/RAIIGen
2516ab5949c1fb54ca1b6e51e5e99e15ecfebbfb
[ "BSD-3-Clause" ]
null
null
null
//*************************************************************************************************************************************************** //* BSD 3-Clause License //* //* Copyright (c) 2016, Rene Thrane //* All rights reserved. //* //* Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: //* //* 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. //* 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the //* documentation and/or other materials provided with the distribution. //* 3. Neither the name of the copyright holder nor the names of its contributors may be used to endorse or promote products derived from this //* software without specific prior written permission. //* //* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, //* THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR //* CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, //* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF //* LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, //* EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. //*************************************************************************************************************************************************** #include <RAIIGen/Generator/OpenGLESGenerator.hpp> #include <RAIIGen/Generator/FunctionNamePair.hpp> #include <RAIIGen/Generator/MatchedFunctionPair.hpp> #include <RAIIGen/CaseUtil.hpp> #include <RAIIGen/Capture.hpp> #include <FslBase/Exceptions.hpp> #include <FslBase/IO/File.hpp> #include <FslBase/String/StringUtil.hpp> #include <algorithm> #include <array> #include <iostream> #include <string> #include <unordered_map> #include <unordered_set> using namespace Fsl; namespace MB { namespace { const auto CREATE_FUNCTION = "glGen"; const auto DESTROY_FUNCTION = "glDelete"; const auto TYPE_NAME_PREFIX = "GL"; const auto FUNCTION_NAME_PREFIX = "gl"; // gl_enum, not good const auto ERRORCODE_TYPE_NAME = ""; const auto DEFAULT_VALUE = "VK_NULL_HANDLE"; const std::vector<FunctionNamePair> g_functionPairs{ FunctionNamePair(CREATE_FUNCTION, DESTROY_FUNCTION), }; // Manual matches for methods that don't follow 'standard' patterns const std::vector<FunctionNamePair> g_manualFunctionMatches{ // Pipelines are destroyed with vkDestroyPipeline // FunctionNamePair("vkCreateGraphicsPipelines", "vkDestroyPipeline"), }; const std::vector<RAIIClassCustomization> g_arrayRAIIClassCustomization{}; const std::vector<ClassFunctionAbsorb> g_classFunctionAbsorbtion{}; const std::unordered_map<std::string, RAIIClassMethodOverrides> g_classMethodOverride = {}; const std::vector<std::string> g_forceNullParameter{ //"VkAllocationCallbacks" }; const std::vector<FunctionGuard> g_functionGuards{}; const std::vector<BlackListEntry> g_functionNameBlacklist{}; const std::vector<BlackListEntry> g_enumNameBlacklist{}; const std::vector<BlackListEntry> g_enumMemberBlacklist{}; const std::vector<FunctionParameterNameOverride> g_functionParameterNameOverride{}; const std::vector<FunctionParameterTypeOverride> g_functionParameterTypeOverride{}; const std::unordered_map<std::string, std::string> g_typeDefaultValues = { //{ "VkBuffer", DEFAULT_VALUE }, //{ "VkBufferView", DEFAULT_VALUE }, //{ "VkCommandBuffer", DEFAULT_VALUE }, //{ "VkCommandPool", DEFAULT_VALUE }, //{ "VkDebugReportCallbackEXT", DEFAULT_VALUE }, //{ "VkDescriptorPool", DEFAULT_VALUE }, //{ "VkDescriptorSet", DEFAULT_VALUE }, //{ "VkDescriptorSetLayout", DEFAULT_VALUE }, //{ "VkDevice", DEFAULT_VALUE }, //{ "VkDeviceMemory", DEFAULT_VALUE }, //{ "VkEvent", DEFAULT_VALUE }, //{ "VkFence", DEFAULT_VALUE }, //{ "VkFramebuffer", DEFAULT_VALUE }, //{ "VkImage", DEFAULT_VALUE }, //{ "VkImageView", DEFAULT_VALUE }, //{ "VkInstance", DEFAULT_VALUE }, //{ "VkPipeline", DEFAULT_VALUE }, //{ "VkPipelineCache", DEFAULT_VALUE }, //{ "VkPipelineLayout", DEFAULT_VALUE }, //{ "VkQueryPool", DEFAULT_VALUE }, //{ "VkRenderPass", DEFAULT_VALUE }, //{ "VkSampler", DEFAULT_VALUE }, //{ "VkSemaphore", DEFAULT_VALUE }, //{ "VkShaderModule", DEFAULT_VALUE }, //{ "VkSurfaceKHR", DEFAULT_VALUE }, //{ "VkSwapchainKHR", DEFAULT_VALUE }, }; const std::vector<TypeNameAliasEntry> g_typeNameAliases = {}; } OpenGLESGenerator::OpenGLESGenerator(const Capture& capture, const BasicConfig& basicConfig, const Fsl::IO::Path& templateRoot, const Fsl::IO::Path& dstPath) : SimpleGenerator(capture, SimpleGeneratorConfig(basicConfig, g_functionPairs, g_manualFunctionMatches, g_arrayRAIIClassCustomization, g_classFunctionAbsorbtion, g_classMethodOverride, g_typeDefaultValues, g_forceNullParameter, g_functionGuards, g_functionNameBlacklist, g_enumNameBlacklist, g_enumMemberBlacklist, g_typeNameAliases, TYPE_NAME_PREFIX, FUNCTION_NAME_PREFIX, ERRORCODE_TYPE_NAME, false, false), templateRoot, dstPath) { } CaptureConfig OpenGLESGenerator::GetCaptureConfig() { std::deque<std::string> filters; filters.push_back(CREATE_FUNCTION); filters.push_back(DESTROY_FUNCTION); return CaptureConfig(TYPE_NAME_PREFIX, filters, g_functionParameterNameOverride, g_functionParameterTypeOverride, true); } }
41.090909
149
0.670512
Unarmed1000
ab419da48ab85657325a99a491edb80dcb19550b
6,672
cpp
C++
config/VMConfig.cpp
ispras/qemu-gui
08650ac6b7fe040f40416e6d3fcb9082611da8c7
[ "Apache-2.0" ]
12
2018-10-30T02:28:40.000Z
2021-12-22T13:40:14.000Z
config/VMConfig.cpp
ispras/qemu-gui
08650ac6b7fe040f40416e6d3fcb9082611da8c7
[ "Apache-2.0" ]
8
2018-06-26T11:20:03.000Z
2019-11-13T14:41:09.000Z
config/VMConfig.cpp
ispras/qemu-gui
08650ac6b7fe040f40416e6d3fcb9082611da8c7
[ "Apache-2.0" ]
4
2018-03-22T09:36:08.000Z
2021-08-24T10:44:11.000Z
#include "VMConfig.h" #include "DeviceStorage.h" #include "DeviceSystem.h" #include "DeviceUsb.h" #include "common/FileHelpers.h" const QString const_xml_name = "vm.xml"; const QString xml_parameters = "VMParameters"; const QString xml_field_name = "Name"; const QString xml_field_dir = "Directory_path"; const QString xml_field_img = "Image_path"; const QString xml_platform = "Platform"; const QString xml_cmdLine = "AdditionCommandLine"; const QString xml_kernel = "Kernel"; const QString xml_initrd = "InitialRamDisk"; VMConfig::VMConfig(const QString &path_vm) : system("System") { list_of_vm_file = NULL; system.setRemovable(false); path = path_vm; QString xml_name; if (path_vm.section('/', -1) != const_xml_name) { dir_path = path; path = path + "/" + const_xml_name; } else { dir_path = path; dir_path.chop(const_xml_name.size()); } readVMConfig(); } VMConfig::~VMConfig() { } void VMConfig::createVMFolder(const QString &path) const { QDir vm_dir(path); if (!vm_dir.exists()) { QDir().mkdir(path); } } void VMConfig::readVMConfig() { QFile file(path); if (file.open(QIODevice::ReadOnly)) { QXmlStreamReader xmlReader(&file); xmlReader.readNextStartElement(); Q_ASSERT(xmlReader.name() == xml_parameters); while (xmlReader.readNextStartElement()) { if (xmlReader.name() == xml_field_name) { name_vm = xmlReader.readElementText(); } else if (xmlReader.name() == xml_platform) { platform = xmlReader.readElementText(); } else if (xmlReader.name() == xml_cmdLine) { addCmdLine = xmlReader.readElementText(); } else if (xmlReader.name() == xml_kernel) { kernel = xmlReader.readElementText(); } else if (xmlReader.name() == xml_initrd) { initrd = xmlReader.readElementText(); } else /* Device */ { system.read(xmlReader); } } } else { /* Default config */ } } bool VMConfig::save_vm_config(const QString &path) const { createVMFolder(path); QString xml_name; xml_name = path + "/" + const_xml_name; QFile file(xml_name); if (file.open(QIODevice::WriteOnly)) { QXmlStreamWriter xmlWriter(&file); xmlWriter.setAutoFormatting(true); xmlWriter.writeStartDocument(); xmlWriter.writeStartElement(xml_parameters); xmlWriter.writeStartElement(xml_field_name); xmlWriter.writeCharacters(name_vm); xmlWriter.writeEndElement(); xmlWriter.writeStartElement(xml_platform); xmlWriter.writeCharacters(platform); xmlWriter.writeEndElement(); xmlWriter.writeStartElement(xml_cmdLine); xmlWriter.writeCharacters(addCmdLine); xmlWriter.writeEndElement(); xmlWriter.writeStartElement(xml_kernel); xmlWriter.writeCharacters(kernel); xmlWriter.writeEndElement(); xmlWriter.writeStartElement(xml_initrd); xmlWriter.writeCharacters(initrd); xmlWriter.writeEndElement(); system.save(xmlWriter); xmlWriter.writeEndElement(); xmlWriter.writeEndDocument(); file.close(); return true; } return false; } void VMConfig::save_vm_config() const { save_vm_config(dir_path); } void VMConfig::set_name(const QString &name_vm_) { name_vm = name_vm_; } void VMConfig::setCmdLine(const QString &cmdLine) { addCmdLine = cmdLine; } void VMConfig::addDefaultBus(const QString &image) { Device *pci = new DevicePciController(&system); pci->setRemovable(false); Device *ide = new DeviceIdeController(pci); ide->setRemovable(false); if (!image.isEmpty()) { new DeviceIdeHd(image, ide->getDevices().at(0)); } } void VMConfig::addDeviceMemory(const QString &size) { (new DeviceMemory(size, &system))->setRemovable(false); } void VMConfig::addDeviceMachine(const QString &name) { (new DeviceMachine(name, &system))->setRemovable(false); } void VMConfig::addDeviceCpu(const QString &name) { (new DeviceCpu(name, &system))->setRemovable(false); } void VMConfig::setKernel(const QString &name) { kernel = name; } void VMConfig::setInitrd(const QString &name) { initrd = name; } void VMConfig::addUsbDevice() { qDebug() << "---usb" << (new DeviceUsb(&system))->getDeviceTypeName(); //save_vm_config(); } QString VMConfig::get_vm_info() { QString info = "Name: " + name_vm + "\n" + "Directory: " + dir_path + "\n" + "Platform: " + platform + "\n"; QString kernelInfo = (!kernel.isEmpty()) ? "Kernel: " + kernel + "\n" : ""; QString initrdInfo = (!initrd.isEmpty()) ? "Initial ram disk: " + initrd + "\n" : ""; info += (kernelInfo + initrdInfo); info += system.getCommonDeviceInfo(); return info; } void VMConfig::setPlatform(const QString &platformVM) { platform = platformVM; } QString VMConfig::getPlatform() { return platform; } QString VMConfig::getMachine() { foreach(Device *dev, system.getDevices()) { if (dev->getDeviceTypeName() == "DeviceMachine") { DeviceMachine *machine = dynamic_cast<DeviceMachine *>(dev); return machine->getName(); } } return ""; } QString VMConfig::get_name() { return name_vm; } QString VMConfig::getKernel() { return kernel; } QString VMConfig::getInitrd() { return initrd; } QString VMConfig::getCmdLine() { return addCmdLine; } QString VMConfig::get_dir_path() { return dir_path; } QString VMConfig::getCommandLine(CommandLineParameters &cmdParams) { return QString(" -net none") + (kernel.isEmpty() ? "" : " -kernel " + kernel) + (initrd.isEmpty() ? "" : " -initrd " + initrd) + system.getCommandLine(cmdParams) + " " + addCmdLine; } QString VMConfig::getPathRRDir() { return get_dir_path() + "/RecordReplay"; } RecordReplayParams VMConfig::getRRParams(const QString &exec) { RecordReplayParams params; params.setCurrentDir(getPathRRDir() + "/" + exec); params.readXml(); return params; } void VMConfig::remove_directory_vm() { FileHelpers::deleteDirectory(dir_path); } QStringList VMConfig::getReplayList() { QDir rrDir(getPathRRDir()); QStringList dirs = rrDir.entryList(QDir::Dirs | QDir::AllDirs | QDir::Filter::NoDotAndDotDot); return dirs; }
22.849315
98
0.627998
ispras
ab41f97a3c93b5a3104c6e622cd441a024888c7a
524
hxx
C++
lang/Language.hxx
JeneLitsch/lang-get
9c11f12112b59539a954c804ba121c2dd513684e
[ "MIT" ]
null
null
null
lang/Language.hxx
JeneLitsch/lang-get
9c11f12112b59539a954c804ba121c2dd513684e
[ "MIT" ]
null
null
null
lang/Language.hxx
JeneLitsch/lang-get
9c11f12112b59539a954c804ba121c2dd513684e
[ "MIT" ]
null
null
null
#pragma once #include <unordered_map> #include <string> #include <string_view> #include <memory> namespace lang { class Language { public: const std::string find(const std::string & key) const; void insert(const std::string & key, const std::string & text); private: std::unordered_map<std::string, std::string> table; }; void set(std::shared_ptr<Language> language); const std::string get(const char * key); const std::string get(const std::string & key); const std::string get(const std::string_view key); }
27.578947
65
0.715649
JeneLitsch
ab4293a0f786f79d3cbf809561fbb99ba9b51d64
1,071
hpp
C++
sprout/iterator/remove_if_iterator.hpp
osyo-manga/Sprout
8885b115f739ef255530f772067475d3bc0dcef7
[ "BSL-1.0" ]
1
2020-02-04T05:16:01.000Z
2020-02-04T05:16:01.000Z
sprout/iterator/remove_if_iterator.hpp
osyo-manga/Sprout
8885b115f739ef255530f772067475d3bc0dcef7
[ "BSL-1.0" ]
null
null
null
sprout/iterator/remove_if_iterator.hpp
osyo-manga/Sprout
8885b115f739ef255530f772067475d3bc0dcef7
[ "BSL-1.0" ]
null
null
null
#ifndef SPROUT_ITERATOR_REMOVE_IF_ITERATOR_HPP #define SPROUT_ITERATOR_REMOVE_IF_ITERATOR_HPP #include <sprout/config.hpp> #include <sprout/iterator/filter_iterator.hpp> namespace sprout { // // remove_if_filter // template<typename Predicate> class remove_if_filter { public: typedef bool result_type; private: Predicate pred_; public: explicit SPROUT_CONSTEXPR remove_if_filter(Predicate pred) : pred_(pred) {} template<typename U> SPROUT_CONSTEXPR bool operator()(U const& value) const { return !pred_(value); } }; // // make_remove_if_iterator // template<typename Predicate, typename Iterator> inline SPROUT_CONSTEXPR sprout::filter_iterator<sprout::remove_if_filter<Predicate>, Iterator> make_remove_if_iterator(Predicate pred, Iterator it, Iterator last = Iterator()) { return sprout::filter_iterator<sprout::remove_if_filter<Predicate>, Iterator>( sprout::remove_if_filter<Predicate>(pred), it, last ); } } // namespace sprout #endif // SPROUT_ITERATOR_REMOVE_IF_ITERATOR_HPP
26.775
96
0.744164
osyo-manga
ab4599ab8b388d059839cdc3a3325f419bea4103
4,489
cc
C++
src/trace_processor/stats_table.cc
nicomazz/perfetto
fb875c61cf00ded88a3f46cb562ab943129cb7af
[ "Apache-2.0" ]
2
2020-03-09T04:39:32.000Z
2020-03-09T09:12:02.000Z
src/trace_processor/stats_table.cc
nicomazz/perfetto
fb875c61cf00ded88a3f46cb562ab943129cb7af
[ "Apache-2.0" ]
6
2021-03-01T21:03:47.000Z
2022-02-26T01:51:15.000Z
src/trace_processor/stats_table.cc
nicomazz/perfetto
fb875c61cf00ded88a3f46cb562ab943129cb7af
[ "Apache-2.0" ]
null
null
null
/* * Copyright (C) 2018 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ #include "src/trace_processor/stats_table.h" #include "src/trace_processor/sqlite/sqlite_utils.h" namespace perfetto { namespace trace_processor { StatsTable::StatsTable(sqlite3*, const TraceStorage* storage) : storage_(storage) {} void StatsTable::RegisterTable(sqlite3* db, const TraceStorage* storage) { SqliteTable::Register<StatsTable>(db, storage, "stats"); } util::Status StatsTable::Init(int, const char* const*, Schema* schema) { *schema = Schema( { SqliteTable::Column(Column::kName, "name", SqlValue::Type::kString), // Calling a column "index" causes sqlite to silently fail, hence idx. SqliteTable::Column(Column::kIndex, "idx", SqlValue::Type::kLong), SqliteTable::Column(Column::kSeverity, "severity", SqlValue::Type::kString), SqliteTable::Column(Column::kSource, "source", SqlValue::Type::kString), SqliteTable::Column(Column::kValue, "value", SqlValue::Type::kLong), }, {Column::kName}); return util::OkStatus(); } std::unique_ptr<SqliteTable::Cursor> StatsTable::CreateCursor() { return std::unique_ptr<SqliteTable::Cursor>(new Cursor(this)); } int StatsTable::BestIndex(const QueryConstraints&, BestIndexInfo*) { return SQLITE_OK; } StatsTable::Cursor::Cursor(StatsTable* table) : SqliteTable::Cursor(table), table_(table), storage_(table->storage_) {} int StatsTable::Cursor::Filter(const QueryConstraints&, sqlite3_value**, FilterHistory) { *this = Cursor(table_); return SQLITE_OK; } int StatsTable::Cursor::Column(sqlite3_context* ctx, int N) { const auto kSqliteStatic = sqlite_utils::kSqliteStatic; switch (N) { case Column::kName: sqlite3_result_text(ctx, stats::kNames[key_], -1, kSqliteStatic); break; case Column::kIndex: if (stats::kTypes[key_] == stats::kIndexed) { sqlite3_result_int(ctx, index_->first); } else { sqlite3_result_null(ctx); } break; case Column::kSeverity: switch (stats::kSeverities[key_]) { case stats::kInfo: sqlite3_result_text(ctx, "info", -1, kSqliteStatic); break; case stats::kDataLoss: sqlite3_result_text(ctx, "data_loss", -1, kSqliteStatic); break; case stats::kError: sqlite3_result_text(ctx, "error", -1, kSqliteStatic); break; } break; case Column::kSource: switch (stats::kSources[key_]) { case stats::kTrace: sqlite3_result_text(ctx, "trace", -1, kSqliteStatic); break; case stats::kAnalysis: sqlite3_result_text(ctx, "analysis", -1, kSqliteStatic); break; } break; case Column::kValue: if (stats::kTypes[key_] == stats::kIndexed) { sqlite3_result_int64(ctx, index_->second); } else { sqlite3_result_int64(ctx, storage_->stats()[key_].value); } break; default: PERFETTO_FATAL("Unknown column %d", N); break; } return SQLITE_OK; } int StatsTable::Cursor::Next() { static_assert(stats::kTypes[0] == stats::kSingle, "the first stats entry cannot be indexed"); const auto* cur_entry = &storage_->stats()[key_]; if (stats::kTypes[key_] == stats::kIndexed) { if (++index_ != cur_entry->indexed_values.end()) { return SQLITE_OK; } } while (++key_ < stats::kNumKeys) { cur_entry = &storage_->stats()[key_]; index_ = cur_entry->indexed_values.begin(); if (stats::kTypes[key_] == stats::kSingle || !cur_entry->indexed_values.empty()) { break; } } return SQLITE_OK; } int StatsTable::Cursor::Eof() { return key_ >= stats::kNumKeys; } } // namespace trace_processor } // namespace perfetto
31.836879
80
0.637336
nicomazz
ab47e69e238c6d2842e8382809e21b77de625432
11,274
cpp
C++
codec/decoder/plus/src/welsCodecTrace.cpp
TechSmith/openh264
5d616714c4cdd30287e2c6a8aa485c2fc6c68b84
[ "BSD-2-Clause" ]
null
null
null
codec/decoder/plus/src/welsCodecTrace.cpp
TechSmith/openh264
5d616714c4cdd30287e2c6a8aa485c2fc6c68b84
[ "BSD-2-Clause" ]
null
null
null
codec/decoder/plus/src/welsCodecTrace.cpp
TechSmith/openh264
5d616714c4cdd30287e2c6a8aa485c2fc6c68b84
[ "BSD-2-Clause" ]
null
null
null
/*! * \copy * Copyright (c) 2013, Cisco Systems * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions * are met: * * * Redistributions of source code must retain the above copyright * notice, this list of conditions and the following disclaimer. * * * Redistributions in binary form must reproduce the above copyright * notice, this list of conditions and the following disclaimer in * the documentation and/or other materials provided with the * distribution. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS * "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT * LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS * FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE * COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, * INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, * BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; * LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER * CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN * ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE * POSSIBILITY OF SUCH DAMAGE. * */ #ifdef _WIN32 #include <windows.h> #include <tchar.h> #endif #include <stdio.h> #include <stdarg.h> #include <string.h> #include "crt_util_safe_x.h" // Safe CRT routines like utils for cross platforms #include "utils.h" #include "welsCodecTrace.h" #include "utils.h" #include "logging.h" #if defined LINUX || defined SOLARIS || defined UNIX || defined MACOS //LINUX/SOLARIS/UNIX #include <dlfcn.h> #endif #if defined(MACOS) #include <carbon/carbon.h> #include <CoreFoundation/CFBundle.h> #endif//MACOS //using namespace WelsDec; namespace WelsDec { #ifdef MACOS static CFBundleRef LoadLibrary (const char* lpszbundle) { // 1.get bundle path char cBundlePath[PATH_MAX]; memset (cBundlePath, 0, PATH_MAX); Dl_info dlInfo; static int sDummy; dladdr ((void_t*)&sDummy, &dlInfo); strlcpy (cBundlePath, dlInfo.dli_fname, PATH_MAX); char* pPath = NULL; for (int i = 4; i > 0; i--) { pPath = strrchr (cBundlePath, '/'); //confirmed_safe_unsafe_usage if (pPath) { *pPath = 0; } else { break; } } if (pPath) { strlcat (cBundlePath, "/", PATH_MAX); } else { return NULL; } strlcat (cBundlePath, lpszbundle, PATH_MAX); FSRef bundlePath; OSStatus iStatus = FSPathMakeRef ((unsigned char*)cBundlePath, &bundlePath, NULL); if (noErr != iStatus) return NULL; CFURLRef bundleURL = CFURLCreateFromFSRef (kCFAllocatorSystemDefault, &bundlePath); if (NULL == bundleURL) return NULL; // 2.get bundle ref CFBundleRef bundleRef = CFBundleCreate (kCFAllocatorSystemDefault, bundleURL); CFRelease (bundleURL); // Boolean bReturn = FALSE; if (NULL != bundleRef) { // bReturn = CFBundleLoadExecutable(bundleRef); } return bundleRef; } static Boolean FreeLibrary (CFBundleRef bundle) { if (NULL != bundle) { // CFBundleUnloadExecutable(bundle); CFRelease (bundle); } return TRUE; } static void_t* GetProcessAddress (CFBundleRef bundle, const char* lpszprocname) { if (NULL == bundle) return NULL; CFStringRef cfprocname = CFStringCreateWithCString (NULL, lpszprocname, CFStringGetSystemEncoding()); void_t* processAddress = CFBundleGetFunctionPointerForName (bundle, cfprocname); CFRelease (cfprocname); return processAddress; } #endif int32_t CWelsTraceBase::SetTraceLevel (int iLevel) { m_iLevel = iLevel; return 0; } int32_t CWelsTraceBase::Trace (const int kLevel, const str_t* kpFormat, va_list pVl) { if (kLevel & m_iLevel) { str_t chWStrFormat[MAX_LOG_SIZE] = {0}; str_t chBuf[MAX_LOG_SIZE] = {0}; str_t chResult[MAX_LOG_SIZE] = {0}; const int32_t kLen = WelsStrnlen ((const str_t*)"[DECODER]: ", MAX_LOG_SIZE); WelsStrncpy (chWStrFormat, MAX_LOG_SIZE, (const str_t*)kpFormat, WelsStrnlen ((const str_t*)kpFormat, MAX_LOG_SIZE)); WelsStrncpy (chBuf, MAX_LOG_SIZE, (const str_t*)"[DECODER]: ", kLen); WelsVsprintf ((chBuf + kLen), MAX_LOG_SIZE - kLen, (const str_t*)kpFormat, pVl); WelsStrncpy (chResult, MAX_LOG_SIZE, (const str_t*)chBuf, WelsStrnlen ((const str_t*)chBuf, MAX_LOG_SIZE)); WriteString (kLevel, chResult); } return 0; } CWelsTraceFile::CWelsTraceFile (const str_t* pFileName) { m_pTraceFile = WelsFopen (pFileName, (const str_t*)"wt"); } CWelsTraceFile::~CWelsTraceFile() { if (m_pTraceFile) { WelsFclose (m_pTraceFile); m_pTraceFile = NULL; } } int32_t CWelsTraceFile::WriteString (int32_t iLevel, const str_t* pStr) { int iRC = 0; const static str_t chEnter[16] = "\n"; if (m_pTraceFile) { iRC += WelsFwrite (pStr, 1, WelsStrnlen (pStr, MAX_LOG_SIZE), m_pTraceFile); iRC += WelsFwrite (chEnter, 1, WelsStrnlen (chEnter, 16), m_pTraceFile); WelsFflush (m_pTraceFile); } return iRC; } #ifdef _WIN32 int32_t CWelsTraceWinDgb::WriteString (int32_t iLevel, const str_t* pStr) { OutputDebugStringA (pStr); return WelsStrnlen (pStr, MAX_LOG_SIZE); //strnlen(pStr, MAX_LOG_SIZE); } #endif CWelsCodecTrace::CWelsCodecTrace() { m_hTraceHandle = NULL; m_fpDebugTrace = NULL; m_fpInfoTrace = NULL; m_fpWarnTrace = NULL; m_fpErrorTrace = NULL; LoadWelsTraceModule(); } CWelsCodecTrace::~CWelsCodecTrace() { UnloadWelsTraceModule(); } int32_t CWelsCodecTrace::LoadWelsTraceModule() { #ifdef NO_DYNAMIC_VP m_fpDebugTrace = welsStderrTrace<WELS_LOG_DEBUG>; m_fpInfoTrace = welsStderrTrace<WELS_LOG_INFO>; m_fpWarnTrace = welsStderrTrace<WELS_LOG_WARNING>; m_fpErrorTrace = welsStderrTrace<WELS_LOG_ERROR>; #else #if defined _WIN32 HMODULE hHandle = ::LoadLibrary ("welstrace.dll"); // HMODULE handle = ::LoadLibrary("contrace.dll"); // for c7 trace if (NULL == hHandle) return -1; CHAR chPath[ _MAX_PATH] = {0}; GetModuleFileName ((HMODULE)hHandle, chPath, _MAX_PATH); m_hTraceHandle = ::LoadLibrary (chPath); OutputDebugStringA (chPath); if (m_hTraceHandle) { m_fpDebugTrace = (CM_WELS_TRACE)::GetProcAddress ((HMODULE)m_hTraceHandle, "WELSDEBUGA"); m_fpInfoTrace = (CM_WELS_TRACE)::GetProcAddress ((HMODULE)m_hTraceHandle, "WELSINFOA"); m_fpWarnTrace = (CM_WELS_TRACE)::GetProcAddress ((HMODULE)m_hTraceHandle, "WELSWARNA"); m_fpErrorTrace = (CM_WELS_TRACE)::GetProcAddress ((HMODULE)m_hTraceHandle, "WELSERRORA"); } // coverity scan uninitial if (hHandle != NULL) { ::FreeLibrary (hHandle); hHandle = NULL; } #elif defined MACOS m_hTraceHandle = LoadLibrary ("welstrace.bundle"); if (m_hTraceHandle) { m_fpDebugTrace = (CM_WELS_TRACE)GetProcessAddress ((CFBundleRef)m_hTraceHandle, "WELSDEBUG2"); m_fpInfoTrace = (CM_WELS_TRACE)GetProcessAddress ((CFBundleRef)m_hTraceHandle, "WELSINFO2"); m_fpWarnTrace = (CM_WELS_TRACE)GetProcessAddress ((CFBundleRef)m_hTraceHandle, "WELSWARN2"); m_fpErrorTrace = (CM_WELS_TRACE)GetProcessAddress ((CFBundleRef)m_hTraceHandle, "WELSERROR2"); } #elif defined LINUX || defined SOLARIS || defined UNIX //#else // CCmString cmPath; str_t chPath[255] = {0}; Dl_info sDlInfo; static int iMmTPAddress; dladdr (&iMmTPAddress, &sDlInfo); if (NULL == sDlInfo.dli_fname) return -1; WelsStrncpy (chPath, 255, (const str_t*)sDlInfo.dli_fname, WelsStrnlen ((const str_t*)sDlInfo.dli_fname, 255)); str_t* p = strrchr (chPath, '/'); //confirmed_safe_unsafe_usage if (NULL == p) return -1; const int iLenTraceName = WelsStrnlen ((const str_t*)"/libwelstrace.so", 15); const int iCurPos = p - chPath; if (iCurPos + iLenTraceName < 255) WelsStrncpy (p, 254 - iCurPos, (const str_t*)"/libwelstrace.so", iLenTraceName); else return -1; m_hTraceHandle = dlopen (chPath, RTLD_LAZY); if (m_hTraceHandle == NULL) { WelsFileHandle* fp = WelsFopen ((const str_t*)"/tmp/trace.txt", (const str_t*)"a"); if (fp) { fprintf (fp, "welsCodecTrace::welsCodecTrace ===> dlopen %s fail, %s\n", chPath, dlerror()); WelsFclose (fp); } return -1; } if (m_hTraceHandle) { m_fpDebugTrace = (CM_WELS_TRACE)dlsym (m_hTraceHandle, "WELSDEBUG2"); m_fpInfoTrace = (CM_WELS_TRACE)dlsym (m_hTraceHandle, "WELSINFO2"); m_fpWarnTrace = (CM_WELS_TRACE)dlsym (m_hTraceHandle, "WELSWARN2"); m_fpErrorTrace = (CM_WELS_TRACE)dlsym (m_hTraceHandle, "WELSERROR2"); if (m_fpDebugTrace == NULL) { WelsFileHandle* fp = WelsFopen ((const str_t*)"/tmp/trace.txt", (const str_t*)"a"); if (fp) { printf ("welsCodecTrace::welsCodecTrace ===> dlsym failed (WELSDEBUG2) , dlerror = %s\n", dlerror()); WelsFclose (fp); } return -1; } } #endif #endif // NO_DYNAMIC_VP return 0; } int32_t CWelsCodecTrace::UnloadWelsTraceModule() { #ifndef NO_DYNAMIC_VP #if defined _WIN32 if (m_hTraceHandle) { ::FreeLibrary ((HMODULE)m_hTraceHandle); } #elif defined MACOS if (m_hTraceHandle) { FreeLibrary ((CFBundleRef)m_hTraceHandle); } #elif defined LINUX || defined SOLARIS || defined UNIX if (m_hTraceHandle) { ::dlclose (m_hTraceHandle); } #endif #endif m_hTraceHandle = NULL; m_fpDebugTrace = NULL; m_fpInfoTrace = NULL; m_fpWarnTrace = NULL; m_fpErrorTrace = NULL; return 0; } int32_t CWelsCodecTrace::WriteString (int32_t iLevel, const str_t* pStr) { #ifndef NO_DYNAMIC_VP if (m_hTraceHandle) #endif { #ifdef _WIN32 switch (iLevel) { case WELS_LOG_ERROR: if (m_fpErrorTrace) m_fpErrorTrace ("%s", pStr); break; case WELS_LOG_WARNING: if (m_fpWarnTrace) m_fpWarnTrace ("%s", pStr); break; case WELS_LOG_INFO: if (m_fpInfoTrace) m_fpInfoTrace ("%s", pStr); break; case WELS_LOG_DEBUG: if (m_fpDebugTrace) m_fpDebugTrace ("%s", pStr); break; default: if (m_fpDebugTrace) m_fpInfoTrace ("%s", pStr); break; } #else switch (iLevel) { case WELS_LOG_ERROR: if (m_fpErrorTrace) m_fpErrorTrace ("CODEC", "%s", pStr); break; case WELS_LOG_WARNING: if (m_fpWarnTrace) m_fpWarnTrace ("CODEC", "%s", pStr); break; case WELS_LOG_INFO: if (m_fpInfoTrace) m_fpInfoTrace ("CODEC", "%s", pStr); break; case WELS_LOG_DEBUG: if (m_fpInfoTrace) m_fpInfoTrace ("CODEC", "%s", pStr); break; default: if (m_fpInfoTrace) m_fpInfoTrace ("CODEC", "%s", pStr); break; } #endif } return 0; } IWelsTrace* CreateWelsTrace (EWelsTraceType eType, void_t* pParam) { IWelsTrace* pTrace = NULL; switch (eType) { case Wels_Trace_Type: pTrace = new CWelsCodecTrace(); break; case Wels_Trace_Type_File: pTrace = new CWelsTraceFile(); break; #ifdef _WIN32 case Wels_Trace_Type_WinDgb: pTrace = new CWelsTraceWinDgb(); break; #endif default: break; } return pTrace; } } // namespace WelsDec
28.185
121
0.686269
TechSmith
ab4a881d65a6e50bcc24d2037844e8ed2b0c91e3
786
cpp
C++
10815 Andy's First Dictionary.cpp
zihadboss/UVA-Solutions
020fdcb09da79dc0a0411b04026ce3617c09cd27
[ "Apache-2.0" ]
86
2016-01-20T11:36:50.000Z
2022-03-06T19:43:14.000Z
10815 Andy's First Dictionary.cpp
Mehedishihab/UVA-Solutions
474fe3d9d9ba574b97fd40ca5abb22ada95654a1
[ "Apache-2.0" ]
null
null
null
10815 Andy's First Dictionary.cpp
Mehedishihab/UVA-Solutions
474fe3d9d9ba574b97fd40ca5abb22ada95654a1
[ "Apache-2.0" ]
113
2015-12-04T06:40:57.000Z
2022-02-11T02:14:28.000Z
#include <iostream> #include <set> #include <string> using namespace std; inline bool IsLowerCharacter(char c) { return c >= 'a' && c <= 'z'; } int main() { string in; set<string> words; while (cin >> in) { int size = in.size(); string current = ""; for (int i = 0; i < size; ++i) { char c = tolower(in[i]); if (IsLowerCharacter(c)) current += c; else if (current != "") { words.insert(current); current = ""; } } if (current != "") words.insert(current); } for (set<string>::iterator iter = words.begin(); iter != words.end(); ++iter) cout << *iter << '\n'; }
20.153846
81
0.433842
zihadboss
ab4aaf354a8f8389da4851be87a14f0654cdc4b0
1,561
cpp
C++
demos/tutorial/journaled_string_tree/journaled_string_tree_base.cpp
JensUweUlrich/seqan
fa609a123d3dc5d8166c12f6849281813438dd39
[ "BSD-3-Clause" ]
409
2015-01-12T22:02:01.000Z
2022-03-29T06:17:05.000Z
demos/tutorial/journaled_string_tree/journaled_string_tree_base.cpp
JensUweUlrich/seqan
fa609a123d3dc5d8166c12f6849281813438dd39
[ "BSD-3-Clause" ]
1,269
2015-01-02T22:42:25.000Z
2022-03-08T13:31:46.000Z
demos/tutorial/journaled_string_tree/journaled_string_tree_base.cpp
JensUweUlrich/seqan
fa609a123d3dc5d8166c12f6849281813438dd39
[ "BSD-3-Clause" ]
193
2015-01-14T16:21:27.000Z
2022-03-19T22:47:02.000Z
//![include] #include <iostream> #include <seqan/stream.h> #include <seqan/journaled_string_tree.h> //![include] //![match_printer] template <typename TTraverser> struct MatchPrinter { TTraverser & trav; MatchPrinter(TTraverser & _trav) : trav(_trav) {} void operator()() { auto pos = position(trav); for (auto p : pos) { std::cout << "Seq: " << p.i1 << " Pos: " << p.i2 << std::endl; } } }; //![match_printer] //![typedef] using namespace seqan; int main() { typedef JournaledStringTree<DnaString> TJst; typedef Pattern<DnaString, Horspool> TPattern; typedef Traverser<TJst>::Type TTraverser; //![typedef] //![init] DnaString seq = "AGATCGAGCGAGCTAGCGACTCAG"; TJst jst(seq, 10); insert(jst, 1, 3, std::vector<unsigned>{1, 3, 5, 6, 7}, DeltaTypeDel()); insert(jst, 8, "CGTA", std::vector<unsigned>{1, 2}, DeltaTypeIns()); insert(jst, 10, 'C', std::vector<unsigned>{4, 9}, DeltaTypeSnp()); insert(jst, 15, 2, std::vector<unsigned>{0, 4, 7}, DeltaTypeDel()); insert(jst, 20, 'A', std::vector<unsigned>{0, 9}, DeltaTypeSnp()); insert(jst, 20, Pair<unsigned, DnaString>(1, "CTC"), std::vector<unsigned>{1, 2, 3, 7}, DeltaTypeSV()); //![init] //![prepare_search] DnaString ndl = "AGCGT"; TTraverser trav(jst, length(ndl)); TPattern pat(ndl); JstExtension<TPattern> ext(pat); //![prepare_search] //![search] MatchPrinter<TTraverser> delegate(trav); find(trav, ext, delegate); return 0; } //![search]
24.015385
107
0.607944
JensUweUlrich
ab4bf87dfe24be850b0134f28f82323b4ae73334
1,338
cpp
C++
xc_PZ.cpp
f-fathurrahman/ffr-pspw-dft-c
5e673e33385eb467d99fcd992b350614c2709740
[ "MIT" ]
1
2018-05-17T09:01:12.000Z
2018-05-17T09:01:12.000Z
xc_PZ.cpp
f-fathurrahman/ffr-pspw-dft-c
5e673e33385eb467d99fcd992b350614c2709740
[ "MIT" ]
null
null
null
xc_PZ.cpp
f-fathurrahman/ffr-pspw-dft-c
5e673e33385eb467d99fcd992b350614c2709740
[ "MIT" ]
null
null
null
// eFeFeR, December 2011 #include <stdio.h> #include <stdlib.h> #include <math.h> void xc_PZ(double *rho, double *vxc, double &Exc, int NNR) { const double A = -0.1423; const double B = 1.0529; const double C = 0.3334; const double a = 0.0311; const double b = -0.0480; const double c = 0.0020; const double d = -0.0116; const double SMALL=1.e-13; double ax, r, ux, uc, ex, ec, rs, rrs, bpr, rsl; int i; Exc = 0.0; ax = -(3.0/4.0)*pow(3.0/2.0/M_PI,2.0/3.0); for(i=0; i<NNR; i++) { r = rho[i]; // if(r < -0.1) { // Is this safe? printf("***WARNING: Negative electron density: %18.10f\n", r); //abort(); } // else if(r <= SMALL) { ux = 0.0; uc = 0.0; ec = 0.0; ex = 0.0; } // else { rs = pow( 3.0/(4.0*M_PI*r), 1.0/3.0); rrs = sqrt(rs); // Exchange ex = ax/rs; ux = 4.0/3.0*ex; // Correlation for rs >= 1 if(rs >= 1.0) { bpr = 1.0 + B*rrs + C*rs; ec = A/bpr; uc = (1.0 + 7.0/6.0*B*rrs + 4.0/3.0*C*rs)*ec/bpr; } // Correlation for rs < 1 else { rsl = log(rs); ec = a*rsl + b + c*rs*rsl + d*rs; uc = (2.0*d - c)/3.0*rs + b-a/3.0 + a*rsl + 2.0*c/3.0*rs*rsl; } } vxc[i] = ux + uc; Exc = Exc + r*(ex + ec); } }
20.584615
69
0.457399
f-fathurrahman
ab4d5e5d8c20136f62f2dbe5e8b5ae3f0ea720b4
1,454
hpp
C++
src/LuminoEngine/src/Shader/ShaderManager.hpp
infinnie/Lumino
921caabdbcb91528a2aac290e31d650628bc3bed
[ "MIT" ]
null
null
null
src/LuminoEngine/src/Shader/ShaderManager.hpp
infinnie/Lumino
921caabdbcb91528a2aac290e31d650628bc3bed
[ "MIT" ]
null
null
null
src/LuminoEngine/src/Shader/ShaderManager.hpp
infinnie/Lumino
921caabdbcb91528a2aac290e31d650628bc3bed
[ "MIT" ]
null
null
null
 #pragma once #ifdef _WIN32 #include <d3dcompiler.h> #endif #include <LuminoEngine/Shader/Common.hpp> #include "../Base/RefObjectCache.hpp" namespace ln { namespace detail { class GraphicsManager; #ifdef _WIN32 typedef HRESULT(WINAPI* PFN_D3DCompile2)( LPCVOID pSrcData, SIZE_T SrcDataSize, LPCSTR pSourceName, const D3D_SHADER_MACRO* pDefines, ID3DInclude* pInclude, LPCSTR pEntrypoint, LPCSTR pTarget, UINT Flags1, UINT Flags2, UINT SecondaryDataFlags, LPCVOID pSecondaryData, SIZE_T SecondaryDataSize, ID3DBlob** ppCode, ID3DBlob** ppErrorMsgs ); #endif class ShaderManager : public RefObject { public: struct Settings { GraphicsManager* graphicsManager = nullptr; }; ShaderManager(); virtual ~ShaderManager(); void init(const Settings& settings); void dispose(); Ref<Shader> loadShader(const StringRef& filePath); GraphicsManager* graphicsManager() const { return m_graphicsManager; } const std::vector<std::pair<std::string, std::string>>& builtinShaderList() const { return m_builtinShaderList; } #ifdef _WIN32 PFN_D3DCompile2 D3DCompile2 = nullptr; #endif private: GraphicsManager* m_graphicsManager; std::vector<std::pair<std::string, std::string>> m_builtinShaderList; ObjectCache<String, Shader> m_shaderCache; #ifdef _WIN32 HMODULE m_hD3DCompilerDLL; #endif }; } // namespace detail } // namespace ln
22.030303
117
0.715956
infinnie
ab4efab1a51e772777b1e2597ea0c65927005d59
354
cpp
C++
src/terrain_features/TerrainFeature.cpp
nathanial/Craft
63ac73aa2a266562a5e8a66a15ea2c1232e38df0
[ "MIT" ]
2
2017-03-23T23:08:51.000Z
2017-08-05T01:10:38.000Z
src/terrain_features/TerrainFeature.cpp
nathanial/Craft
63ac73aa2a266562a5e8a66a15ea2c1232e38df0
[ "MIT" ]
2
2017-03-23T22:21:39.000Z
2017-04-22T23:00:33.000Z
src/terrain_features/TerrainFeature.cpp
nathanial/VGK
63ac73aa2a266562a5e8a66a15ea2c1232e38df0
[ "MIT" ]
null
null
null
// // Created by nathan on 2/19/17. // #include "TerrainFeature.h" #include "../chunk/chunk.h" void TerrainFeature::add_to_chunk(TransientChunk &chunk, int x, int h, int z){ for(auto &kv : this->create()){ int ox , y, oz; std::tie(ox,y,oz) = std::get<0>(kv); chunk.set_block(x + ox, h + y, z + oz, std::get<1>(kv)); } }
23.6
78
0.567797
nathanial
ab52417ed6d1229ffeee28d63b97369049868a73
2,969
cpp
C++
tests/libappimage/desktop_integration/integrator/TestDesktopIntegration.cpp
srevinsaju/libappimage
3682efb71847391f75ce6999e94b01b8b8434748
[ "MIT" ]
28
2018-08-24T07:49:19.000Z
2022-02-21T07:46:02.000Z
tests/libappimage/desktop_integration/integrator/TestDesktopIntegration.cpp
marcin543/libappimage
f7abf4756911d8967dbd4d856dfc2c90bb6914f4
[ "MIT" ]
143
2018-08-21T14:14:01.000Z
2022-03-27T15:38:21.000Z
tests/libappimage/desktop_integration/integrator/TestDesktopIntegration.cpp
marcin543/libappimage
f7abf4756911d8967dbd4d856dfc2c90bb6914f4
[ "MIT" ]
22
2018-11-12T07:36:46.000Z
2022-02-18T11:57:30.000Z
// system #include <sstream> // library headers #include <gtest/gtest.h> #include <boost/filesystem.hpp> #include <XdgUtils/DesktopEntry/DesktopEntry.h> // local #include "appimage/desktop_integration/exceptions.h" #include "integrator/Integrator.h" #include "utils/hashlib.h" #include "utils/path_utils.h" using namespace appimage::desktop_integration::integrator; namespace bf = boost::filesystem; class DesktopIntegrationTests : public ::testing::Test { protected: bf::path userDirPath; void SetUp() override { userDirPath = bf::temp_directory_path() / boost::filesystem::unique_path(); bf::create_directories(userDirPath); ASSERT_FALSE(userDirPath.empty()); } void TearDown() override { bf::remove_all(userDirPath); } }; TEST_F(DesktopIntegrationTests, integrateEchoAppImage) { std::string appImagePath = TEST_DATA_DIR "Echo-x86_64.AppImage"; appimage::core::AppImage appImage(appImagePath); Integrator i(appImage, userDirPath.string()); i.integrate(); std::string md5 = appimage::utils::hashPath(appImagePath.c_str()); bf::path expectedDesktopFilePath = userDirPath / ("applications/appimagekit_" + md5 + "-Echo.desktop"); ASSERT_TRUE(bf::exists(expectedDesktopFilePath)); bf::path expectedIconFilePath = userDirPath / ("icons/hicolor/scalable/apps/appimagekit_" + md5 + "_utilities-terminal.svg"); ASSERT_TRUE(bf::exists(expectedIconFilePath)); } TEST_F(DesktopIntegrationTests, integrateAppImageExtract) { std::string appImagePath = TEST_DATA_DIR "AppImageExtract_6-x86_64.AppImage"; appimage::core::AppImage appImage(appImagePath); Integrator i(appImage, userDirPath.string()); i.integrate(); std::string md5 = appimage::utils::hashPath(appImagePath.c_str()); bf::path expectedDesktopFilePath = userDirPath / ("applications/appimagekit_" + md5 + "-AppImageExtract.desktop"); ASSERT_TRUE(bf::exists(expectedDesktopFilePath)); bf::path expectedIconFilePath = userDirPath / ("icons/hicolor/48x48/apps/appimagekit_" + md5 + "_AppImageExtract.png"); ASSERT_TRUE(bf::exists(expectedIconFilePath)); } TEST_F(DesktopIntegrationTests, integrateEchoNoIntegrate) { appimage::core::AppImage appImage(TEST_DATA_DIR "Echo-no-integrate-x86_64.AppImage"); Integrator i(appImage, userDirPath.string()); ASSERT_THROW(i.integrate(), appimage::desktop_integration::DesktopIntegrationError); } TEST_F(DesktopIntegrationTests, emtpyXdgDataDir) { appimage::core::AppImage appImage(TEST_DATA_DIR "Echo-no-integrate-x86_64.AppImage"); ASSERT_THROW(Integrator(appImage, ""), appimage::desktop_integration::DesktopIntegrationError); } TEST_F(DesktopIntegrationTests, malformedDesktopEntry) { appimage::core::AppImage appImage(TEST_DATA_DIR "broken-desktop-file-x86_64.AppImage"); ASSERT_THROW(Integrator(appImage, userDirPath.string()), appimage::desktop_integration::DesktopIntegrationError); }
34.126437
118
0.746716
srevinsaju
ab5727322eef21d72eef2a063a1f9fe70fadb375
4,905
hpp
C++
dart/dynamics/TemplatedJacobianNode.hpp
axeisghost/DART6motionBlur
23387b0422bf95b75a113dbf5facc5f10d4a3305
[ "BSD-2-Clause" ]
4
2021-02-20T15:59:42.000Z
2022-03-25T04:04:21.000Z
dart/dynamics/TemplatedJacobianNode.hpp
axeisghost/DART6motionBlur
23387b0422bf95b75a113dbf5facc5f10d4a3305
[ "BSD-2-Clause" ]
1
2021-04-14T04:12:48.000Z
2021-04-14T04:12:48.000Z
dart/dynamics/TemplatedJacobianNode.hpp
axeisghost/DART6motionBlur
23387b0422bf95b75a113dbf5facc5f10d4a3305
[ "BSD-2-Clause" ]
2
2019-10-29T12:41:16.000Z
2021-03-22T16:38:27.000Z
/* * Copyright (c) 2015-2016, Humanoid Lab, Georgia Tech Research Corporation * Copyright (c) 2015-2017, Graphics Lab, Georgia Tech Research Corporation * Copyright (c) 2016-2017, Personal Robotics Lab, Carnegie Mellon University * All rights reserved. * * This file is provided under the following "BSD-style" License: * Redistribution and use in source and binary forms, with or * without modification, are permitted provided that the following * conditions are met: * * Redistributions of source code must retain the above copyright * notice, this list of conditions and the following disclaimer. * * Redistributions in binary form must reproduce the above * copyright notice, this list of conditions and the following * disclaimer in the documentation and/or other materials provided * with the distribution. * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND * CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, * INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF * MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE * DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, * SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT * LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF * USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED * AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN * ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE * POSSIBILITY OF SUCH DAMAGE. */ #ifndef DART_DYNAMICS_TEMPLATEDJACOBIANENTITY_HPP_ #define DART_DYNAMICS_TEMPLATEDJACOBIANENTITY_HPP_ #include "dart/dynamics/JacobianNode.hpp" namespace dart { namespace dynamics { /// TemplatedJacobianNode provides a curiously recurring template pattern /// implementation of the various JacobianNode non-caching functions. These /// functions are easily distinguished because they return by value instead of /// returning by const reference. /// /// This style of implementation allows BodyNode and EndEffector to share the /// implementations of these various auxiliary Jacobian functions without any /// penalty from dynamic overload resolution. template <class NodeType> class TemplatedJacobianNode : public JacobianNode { public: // Documentation inherited math::Jacobian getJacobian( const Frame* _inCoordinatesOf) const override final; // Documentation inherited math::Jacobian getJacobian( const Eigen::Vector3d& _offset) const override final; // Documentation inherited math::Jacobian getJacobian( const Eigen::Vector3d& _offset, const Frame* _inCoordinatesOf) const override final; // Documentation inherited math::Jacobian getWorldJacobian( const Eigen::Vector3d& _offset) const override final; // Documentation inherited math::LinearJacobian getLinearJacobian( const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::LinearJacobian getLinearJacobian( const Eigen::Vector3d& _offset, const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::AngularJacobian getAngularJacobian( const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::Jacobian getJacobianSpatialDeriv( const Frame* _inCoordinatesOf) const override final; // Documentation inherited math::Jacobian getJacobianSpatialDeriv( const Eigen::Vector3d& _offset) const override final; // Documentation inherited math::Jacobian getJacobianSpatialDeriv( const Eigen::Vector3d& _offset, const Frame* _inCoordinatesOf) const override final; // Documentation inherited math::Jacobian getJacobianClassicDeriv( const Frame* _inCoordinatesOf) const override final; // Documentation inherited math::Jacobian getJacobianClassicDeriv( const Eigen::Vector3d& _offset, const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::LinearJacobian getLinearJacobianDeriv( const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::LinearJacobian getLinearJacobianDeriv( const Eigen::Vector3d& _offset, const Frame* _inCoordinatesOf = Frame::World()) const override final; // Documentation inherited math::AngularJacobian getAngularJacobianDeriv( const Frame* _inCoordinatesOf = Frame::World()) const override final; protected: /// Constructor TemplatedJacobianNode(BodyNode* bn); }; } // namespace dynamics } // namespace dart #include "dart/dynamics/detail/TemplatedJacobianNode.hpp" #endif // DART_DYNAMICS_TEMPLATEDJACOBIANENTITY_HPP_
37.442748
78
0.759429
axeisghost
ab58fe89c39e03b6f75d2fa0a252cb292628c7c4
2,331
cpp
C++
Assignment/LibOVR/Src/Kernel/OVR_Math.cpp
C14427818/GamesEngine1
8e8114378b5e96f6330b00cb69245194f171aa4d
[ "MIT" ]
null
null
null
Assignment/LibOVR/Src/Kernel/OVR_Math.cpp
C14427818/GamesEngine1
8e8114378b5e96f6330b00cb69245194f171aa4d
[ "MIT" ]
null
null
null
Assignment/LibOVR/Src/Kernel/OVR_Math.cpp
C14427818/GamesEngine1
8e8114378b5e96f6330b00cb69245194f171aa4d
[ "MIT" ]
null
null
null
/************************************************************************************ Filename : OVR_Math.h Content : Implementation of 3D primitives such as vectors, matrices. Created : September 4, 2012 Authors : Andrew Reisse, Michael Antonov, Anna Yershova Copyright : Copyright 2014 Oculus VR, Inc. All Rights reserved. Licensed under the Oculus VR Rift SDK License Version 3.1 (the "License"); you may not use the Oculus VR Rift SDK except in compliance with the License, which is provided at the time of installation or download, or which otherwise accompanies this software in either electronic or hard copy form. You may obtain a copy of the License at http://www.oculusvr.com/licenses/LICENSE-3.1 Unless required by applicable law or agreed to in writing, the Oculus VR SDK distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. *************************************************************************************/ #include "OVR_Math.h" #include "OVR_Log.h" #include <float.h> namespace OVR { //------------------------------------------------------------------------------------- // ***** Constants template<> const Vector3<float> Vector3<float>::ZERO = Vector3<float>(); template<> const Vector3<double> Vector3<double>::ZERO = Vector3<double>(); template<> const Matrix4<float> Matrix4<float>::IdentityValue = Matrix4<float>(1.0f, 0.0f, 0.0f, 0.0f, 0.0f, 1.0f, 0.0f, 0.0f, 0.0f, 0.0f, 1.0f, 0.0f, 0.0f, 0.0f, 0.0f, 1.0f); template<> const Matrix4<double> Matrix4<double>::IdentityValue = Matrix4<double>(1.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 1.0); } // Namespace OVR
39.508475
93
0.490776
C14427818
ab5f89c95e314cd88e214bd1534caf3e1a716371
63,607
cpp
C++
wznmcmbd/IexWznm/JobWznmIexDbs.cpp
mpsitech/wznm-WhizniumSBE
4911d561b28392d485c46e98fb915168d82b3824
[ "MIT" ]
3
2020-09-20T16:24:48.000Z
2021-12-01T19:44:51.000Z
wznmcmbd/IexWznm/JobWznmIexDbs.cpp
mpsitech/wznm-WhizniumSBE
4911d561b28392d485c46e98fb915168d82b3824
[ "MIT" ]
null
null
null
wznmcmbd/IexWznm/JobWznmIexDbs.cpp
mpsitech/wznm-WhizniumSBE
4911d561b28392d485c46e98fb915168d82b3824
[ "MIT" ]
null
null
null
/** * \file JobWznmIexDbs.cpp * job handler for job JobWznmIexDbs (implementation) * \copyright (C) 2016-2020 MPSI Technologies GmbH * \author Alexander Wirthmueller (auto-generation) * \date created: 28 Nov 2020 */ // IP header --- ABOVE #ifdef WZNMCMBD #include <Wznmcmbd.h> #else #include <Wznmd.h> #endif #include "JobWznmIexDbs.h" #include "JobWznmIexDbs_blks.cpp" using namespace std; using namespace Sbecore; using namespace Xmlio; // IP ns.cust --- INSERT using namespace IexWznmDbs; /****************************************************************************** class JobWznmIexDbs ******************************************************************************/ JobWznmIexDbs::JobWznmIexDbs( XchgWznm* xchg , DbsWznm* dbswznm , const ubigint jrefSup , const uint ixWznmVLocale ) : JobWznm(xchg, VecWznmVJob::JOBWZNMIEXDBS, jrefSup, ixWznmVLocale) { jref = xchg->addJob(dbswznm, this, jrefSup); // IP constructor.cust1 --- INSERT // IP constructor.cust2 --- INSERT changeStage(dbswznm, VecVSge::IDLE); // IP constructor.cust3 --- INSERT }; JobWznmIexDbs::~JobWznmIexDbs() { // IP destructor.spec --- INSERT // IP destructor.cust --- INSERT xchg->removeJobByJref(jref); }; // IP cust --- INSERT void JobWznmIexDbs::reset( DbsWznm* dbswznm ) { if (ixVSge != VecVSge::IDLE) changeStage(dbswznm, VecVSge::IDLE); }; void JobWznmIexDbs::parseFromFile( DbsWznm* dbswznm , const string& _fullpath , const bool _xmlNotTxt , const string& _rectpath ) { if (ixVSge == VecVSge::IDLE) { fullpath = _fullpath; xmlNotTxt = _xmlNotTxt; rectpath = _rectpath; changeStage(dbswznm, VecVSge::PARSE); }; }; void JobWznmIexDbs::import( DbsWznm* dbswznm ) { if (ixVSge == VecVSge::PRSDONE) changeStage(dbswznm, VecVSge::IMPORT); }; void JobWznmIexDbs::reverse( DbsWznm* dbswznm ) { if (ixVSge == VecVSge::IMPERR) changeStage(dbswznm, VecVSge::REVERSE); }; void JobWznmIexDbs::collect( DbsWznm* dbswznm , const map<uint,uint>& _icsWznmVIop ) { if (ixVSge == VecVSge::IDLE) { icsWznmVIop = _icsWznmVIop; changeStage(dbswznm, VecVSge::COLLECT); }; }; void JobWznmIexDbs::exportToFile( DbsWznm* dbswznm , const string& _fullpath , const bool _xmlNotTxt , const bool _shorttags ) { if ((ixVSge == VecVSge::IDLE) || (ixVSge == VecVSge::CLTDONE)) { fullpath = _fullpath; xmlNotTxt = _xmlNotTxt; shorttags = _shorttags; changeStage(dbswznm, VecVSge::EXPORT); }; }; void JobWznmIexDbs::handleRequest( DbsWznm* dbswznm , ReqWznm* req ) { if (req->ixVBasetype == ReqWznm::VecVBasetype::CMD) { reqCmd = req; if (req->cmd == "cmdset") { } else { cout << "\tinvalid command!" << endl; }; if (!req->retain) reqCmd = NULL; }; }; void JobWznmIexDbs::changeStage( DbsWznm* dbswznm , uint _ixVSge ) { bool reenter = true; do { if (ixVSge != _ixVSge) { switch (ixVSge) { case VecVSge::IDLE: leaveSgeIdle(dbswznm); break; case VecVSge::PARSE: leaveSgeParse(dbswznm); break; case VecVSge::PRSERR: leaveSgePrserr(dbswznm); break; case VecVSge::PRSDONE: leaveSgePrsdone(dbswznm); break; case VecVSge::IMPORT: leaveSgeImport(dbswznm); break; case VecVSge::IMPERR: leaveSgeImperr(dbswznm); break; case VecVSge::REVERSE: leaveSgeReverse(dbswznm); break; case VecVSge::COLLECT: leaveSgeCollect(dbswznm); break; case VecVSge::CLTDONE: leaveSgeCltdone(dbswznm); break; case VecVSge::EXPORT: leaveSgeExport(dbswznm); break; case VecVSge::DONE: leaveSgeDone(dbswznm); break; }; setStage(dbswznm, _ixVSge); reenter = false; // IP changeStage.refresh1 --- INSERT }; switch (_ixVSge) { case VecVSge::IDLE: _ixVSge = enterSgeIdle(dbswznm, reenter); break; case VecVSge::PARSE: _ixVSge = enterSgeParse(dbswznm, reenter); break; case VecVSge::PRSERR: _ixVSge = enterSgePrserr(dbswznm, reenter); break; case VecVSge::PRSDONE: _ixVSge = enterSgePrsdone(dbswznm, reenter); break; case VecVSge::IMPORT: _ixVSge = enterSgeImport(dbswznm, reenter); break; case VecVSge::IMPERR: _ixVSge = enterSgeImperr(dbswznm, reenter); break; case VecVSge::REVERSE: _ixVSge = enterSgeReverse(dbswznm, reenter); break; case VecVSge::COLLECT: _ixVSge = enterSgeCollect(dbswznm, reenter); break; case VecVSge::CLTDONE: _ixVSge = enterSgeCltdone(dbswznm, reenter); break; case VecVSge::EXPORT: _ixVSge = enterSgeExport(dbswznm, reenter); break; case VecVSge::DONE: _ixVSge = enterSgeDone(dbswznm, reenter); break; }; // IP changeStage.refresh2 --- INSERT } while (ixVSge != _ixVSge); }; string JobWznmIexDbs::getSquawk( DbsWznm* dbswznm ) { string retval; // IP getSquawk --- RBEGIN if ( (ixVSge == VecVSge::PARSE) || (ixVSge == VecVSge::PRSDONE) || (ixVSge == VecVSge::IMPORT) || (ixVSge == VecVSge::REVERSE) || (ixVSge == VecVSge::COLLECT) || (ixVSge == VecVSge::CLTDONE) || (ixVSge == VecVSge::EXPORT) ) { if (ixWznmVLocale == VecWznmVLocale::ENUS) { if (ixVSge == VecVSge::PARSE) retval = "parsing database structure"; else if (ixVSge == VecVSge::PRSDONE) retval = "database structure parsed"; else if (ixVSge == VecVSge::IMPORT) retval = "importing database structure (" + to_string(impcnt) + " records added)"; else if (ixVSge == VecVSge::REVERSE) retval = "reversing database structure import"; else if (ixVSge == VecVSge::COLLECT) retval = "collecting database structure for export"; else if (ixVSge == VecVSge::CLTDONE) retval = "database structure collected for export"; else if (ixVSge == VecVSge::EXPORT) retval = "exporting database structure"; }; } else if ( (ixVSge == VecVSge::PRSERR) || (ixVSge == VecVSge::IMPERR) ) { retval = lasterror; } else { retval = VecVSge::getSref(ixVSge); }; // IP getSquawk --- REND return retval; }; uint JobWznmIexDbs::enterSgeIdle( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::IDLE; fullpath = ""; xmlNotTxt = false; rectpath = ""; lineno = 0; impcnt = 0; icsWznmVIop.clear(); imeicrelation.clear(); imeimrelation.clear(); imeimstub.clear(); imeimtable.clear(); imeimvector1.clear(); imeirmstubmstub.clear(); return retval; }; void JobWznmIexDbs::leaveSgeIdle( DbsWznm* dbswznm ) { // IP leaveSgeIdle --- INSERT }; uint JobWznmIexDbs::enterSgeParse( DbsWznm* dbswznm , const bool reenter ) { uint retval; nextIxVSgeSuccess = VecVSge::PRSDONE; retval = nextIxVSgeSuccess; nextIxVSgeFailure = VecVSge::PRSERR; try { IexWznmDbs::parseFromFile(fullpath, xmlNotTxt, rectpath, imeicrelation, imeimrelation, imeimstub, imeimtable, imeimvector1, imeirmstubmstub); } catch (SbeException& e) { if (e.ix == SbeException::PATHNF) e.vals["path"] = "<hidden>"; lasterror = e.getSquawk(VecWznmVError::getIx, VecWznmVError::getTitle, ixWznmVLocale); retval = nextIxVSgeFailure; }; return retval; }; void JobWznmIexDbs::leaveSgeParse( DbsWznm* dbswznm ) { // IP leaveSgeParse --- INSERT }; uint JobWznmIexDbs::enterSgePrserr( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::PRSERR; // IP enterSgePrserr --- INSERT return retval; }; void JobWznmIexDbs::leaveSgePrserr( DbsWznm* dbswznm ) { // IP leaveSgePrserr --- INSERT }; uint JobWznmIexDbs::enterSgePrsdone( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::PRSDONE; // IP enterSgePrsdone --- INSERT return retval; }; void JobWznmIexDbs::leaveSgePrsdone( DbsWznm* dbswznm ) { // IP leaveSgePrsdone --- INSERT }; uint JobWznmIexDbs::enterSgeImport( DbsWznm* dbswznm , const bool reenter ) { uint retval; nextIxVSgeSuccess = VecVSge::DONE; retval = nextIxVSgeSuccess; nextIxVSgeFailure = VecVSge::IMPERR; ImeitemICRelation* relC = NULL; ImeitemIMRelation* rel = NULL; ImeitemIMStub* stb = NULL; ImeitemIMTable* tbl = NULL; ImeitemIMVector1* vec1 = NULL; ImeitemIRMStubMStub* stbRstb = NULL; ImeitemIAMRelationTitle* relAtit = NULL; ImeitemIAMTableLoadfct* tblAlfc = NULL; ImeitemIAMTableTitle* tblAtit = NULL; ImeitemIAMVectorTitle1* vecAtit1 = NULL; ImeitemIMCheck* chk = NULL; ImeitemIMSubset* sbs = NULL; ImeitemIMTablecol* tco = NULL; ImeitemIMVector2* vec2 = NULL; ImeitemIMVectoritem1* vit1 = NULL; ImeitemIRMTableMVector1* tblRvec1 = NULL; ImeitemIAMSubsetTitle* sbsAtit = NULL; ImeitemIAMTablecolTitle* tcoAtit = NULL; ImeitemIAMVectorTitle2* vecAtit2 = NULL; ImeitemIJMVectoritem1* vitJ1 = NULL; ImeitemIMVectoritem2* vit2 = NULL; ImeitemIRMSubsetMSubset* sbsRsbs = NULL; ImeitemIRMTableMVector2* tblRvec2 = NULL; ImeitemIJMVectoritem2* vitJ2 = NULL; set<ubigint> irefs0; uint num1, num2; // IP enterSgeImport.prep --- IBEGIN ImeitemIMTable* tbl2 = NULL; ImeitemIMSubset* sbs2 = NULL; ImeitemIMRelation* rel2 = NULL; ubigint ref; ubigint refWznmMVersion; string preflcl; refWznmMVersion = xchg->getRefPreset(VecWznmVPreset::PREWZNMREFVER, jref); Wznm::getVerlclsref(dbswznm, refWznmMVersion, preflcl); ListWznmMLocale lcls; dbswznm->tblwznmmlocale->loadRstBySQL("SELECT * FROM TblWznmMLocale", false, lcls); // IP enterSgeImport.prep --- IEND try { // IP enterSgeImport.traverse --- RBEGIN // -- ImeIMVector1 for (unsigned int ix0 = 0; ix0 < imeimvector1.nodes.size(); ix0++) { vec1 = imeimvector1.nodes[ix0]; vec1->ixVBasetype = VecWznmVMVectorBasetype::getIx(vec1->srefIxVBasetype); if (vec1->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",vec1->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(vec1->lineno)}}); vec1->refWznmMVersion = refWznmMVersion; vec1->hkIxVTbl = VecWznmVMVectorHkTbl::TBL; //vec1->sref: TBL //vec1->osrefWznmKTaggrp: TBL //vec1->srefsKOption: TBL dbswznm->tblwznmmvector->insertRec(vec1); impcnt++; for (unsigned int ix1 = 0; ix1 < vec1->imeiamvectortitle1.nodes.size(); ix1++) { vecAtit1 = vec1->imeiamvectortitle1.nodes[ix1]; vecAtit1->refWznmMVector = vec1->ref; vecAtit1->x1IxVType = VecWznmVAMVectorTitleType::getIx(vecAtit1->srefX1IxVType); if (vecAtit1->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",vecAtit1->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(vecAtit1->lineno)}}); //vecAtit1->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == vecAtit1->srefX2RefWznmMLocale) { vecAtit1->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (vecAtit1->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",vecAtit1->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(vecAtit1->lineno)}}); //vecAtit1->Title: TBL dbswznm->tblwznmamvectortitle->insertRec(vecAtit1); impcnt++; }; num1 = 1; for (unsigned int ix1 = 0; ix1 < vec1->imeimvectoritem1.nodes.size(); ix1++) { vit1 = vec1->imeimvectoritem1.nodes[ix1]; vit1->vecRefWznmMVector = vec1->ref; vit1->vecNum = num1++; //vit1->sref: TBL //vit1->Avail: TBL //vit1->Implied: TBL //vit1->refJ: SUB //vit1->Title: TBL //vit1->Comment: TBL dbswznm->tblwznmmvectoritem->insertRec(vit1); impcnt++; if (((vit1->Title != "") || (vit1->Comment != "")) && vit1->imeijmvectoritem1.nodes.empty()) { vitJ1 = new ImeitemIJMVectoritem1(); vit1->imeijmvectoritem1.nodes.push_back(vitJ1); vitJ1->refWznmMVectoritem = vit1->ref; vitJ1->Title = vit1->Title; vitJ1->Comment = vit1->Comment; }; for (unsigned int ix2 = 0; ix2 < vit1->imeijmvectoritem1.nodes.size(); ix2++) { vitJ1 = vit1->imeijmvectoritem1.nodes[ix2]; vitJ1->refWznmMVectoritem = vit1->ref; //if (vitJ1->srefX1RefWznmMLocale == "") vitJ1->srefX1RefWznmMLocale: CUSTOM DEFVAL if (vitJ1->srefX1RefWznmMLocale == "") vitJ1->srefX1RefWznmMLocale = preflcl; //vitJ1->x1RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == vitJ1->srefX1RefWznmMLocale) { vitJ1->x1RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (vitJ1->x1RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",vitJ1->srefX1RefWznmMLocale}, {"iel","srefX1RefWznmMLocale"}, {"lineno",to_string(vitJ1->lineno)}}); //vitJ1->Title: TBL //vitJ1->Comment: TBL dbswznm->tblwznmjmvectoritem->insertRec(vitJ1); impcnt++; if (ix2 == 0) { vit1->refJ = vitJ1->ref; vit1->Title = vitJ1->Title; vit1->Comment = vitJ1->Comment; dbswznm->tblwznmmvectoritem->updateRec(vit1); }; }; }; for (unsigned int ix1 = 0; ix1 < vec1->imeirmtablemvector1.nodes.size(); ix1++) { tblRvec1 = vec1->imeirmtablemvector1.nodes[ix1]; //tblRvec1->refWznmMTable: IMPPP //tblRvec1->refWznmMSubset: IMPPP tblRvec1->refWznmMVector = vec1->ref; dbswznm->tblwznmrmtablemvector->insertRec(tblRvec1); impcnt++; }; }; // -- ImeIMTable for (unsigned int ix0 = 0; ix0 < imeimtable.nodes.size(); ix0++) { tbl = imeimtable.nodes[ix0]; tbl->ixVBasetype = VecWznmVMTableBasetype::getIx(tbl->srefIxVBasetype); if (tbl->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tbl->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(tbl->lineno)}}); tbl->refWznmMVersion = refWznmMVersion; tbl->refIxVTbl = VecWznmVMTableRefTbl::getIx(tbl->srefRefIxVTbl); if (tbl->refIxVTbl == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tbl->srefRefIxVTbl}, {"iel","srefRefIxVTbl"}, {"lineno",to_string(tbl->lineno)}}); //tbl->refUref: IMPPP //tbl->sref: TBL //tbl->Short: TBL //tbl->unqSrefsWznmMTablecol: TBL //tbl->Comment: TBL dbswznm->tblwznmmtable->insertRec(tbl); impcnt++; for (unsigned int ix1 = 0; ix1 < tbl->imeiamtabletitle.nodes.size(); ix1++) { tblAtit = tbl->imeiamtabletitle.nodes[ix1]; tblAtit->refWznmMTable = tbl->ref; tblAtit->x1IxVType = VecWznmVAMTableTitleType::getIx(tblAtit->srefX1IxVType); if (tblAtit->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tblAtit->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(tblAtit->lineno)}}); //tblAtit->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == tblAtit->srefX2RefWznmMLocale) { tblAtit->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (tblAtit->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tblAtit->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(tblAtit->lineno)}}); tblAtit->ixWznmVGender = VecWznmVGender::getIx(tblAtit->srefIxWznmVGender); if (tblAtit->ixWznmVGender == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tblAtit->srefIxWznmVGender}, {"iel","srefIxWznmVGender"}, {"lineno",to_string(tblAtit->lineno)}}); //tblAtit->Title: TBL dbswznm->tblwznmamtabletitle->insertRec(tblAtit); impcnt++; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimsubset.nodes.size(); ix1++) { sbs = tbl->imeimsubset.nodes[ix1]; sbs->refWznmMTable = tbl->ref; //sbs->sref: TBL //sbs->Short: TBL //sbs->Cond: TBL //sbs->Comment: TBL dbswznm->tblwznmmsubset->insertRec(sbs); impcnt++; for (unsigned int ix2 = 0; ix2 < sbs->imeiamsubsettitle.nodes.size(); ix2++) { sbsAtit = sbs->imeiamsubsettitle.nodes[ix2]; sbsAtit->refWznmMSubset = sbs->ref; sbsAtit->x1IxVType = VecWznmVAMSubsetTitleType::getIx(sbsAtit->srefX1IxVType); if (sbsAtit->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",sbsAtit->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(sbsAtit->lineno)}}); //sbsAtit->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == sbsAtit->srefX2RefWznmMLocale) { sbsAtit->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (sbsAtit->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",sbsAtit->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(sbsAtit->lineno)}}); sbsAtit->ixWznmVGender = VecWznmVGender::getIx(sbsAtit->srefIxWznmVGender); if (sbsAtit->ixWznmVGender == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",sbsAtit->srefIxWznmVGender}, {"iel","srefIxWznmVGender"}, {"lineno",to_string(sbsAtit->lineno)}}); //sbsAtit->Title: TBL dbswznm->tblwznmamsubsettitle->insertRec(sbsAtit); impcnt++; }; for (unsigned int ix2 = 0; ix2 < sbs->imeirmsubsetmsubset.nodes.size(); ix2++) { sbsRsbs = sbs->imeirmsubsetmsubset.nodes[ix2]; sbsRsbs->asbRefWznmMSubset = sbs->ref; //sbsRsbs->bsbRefWznmMSubset: IMPPP sbsRsbs->ixVReltype = VecWznmVRMSubsetMSubsetReltype::getIx(sbsRsbs->srefIxVReltype); if (sbsRsbs->ixVReltype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",sbsRsbs->srefIxVReltype}, {"iel","srefIxVReltype"}, {"lineno",to_string(sbsRsbs->lineno)}}); dbswznm->tblwznmrmsubsetmsubset->insertRec(sbsRsbs); impcnt++; }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimvector2.nodes.size(); ix1++) { vec2 = tbl->imeimvector2.nodes[ix1]; vec2->ixVBasetype = VecWznmVMVectorBasetype::getIx(vec2->srefIxVBasetype); if (vec2->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",vec2->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(vec2->lineno)}}); vec2->refWznmMVersion = refWznmMVersion; vec2->hkIxVTbl = VecWznmVMVectorHkTbl::TBL; vec2->hkUref = tbl->ref; //vec2->sref: TBL //vec2->osrefWznmKTaggrp: TBL //vec2->srefsKOption: TBL dbswznm->tblwznmmvector->insertRec(vec2); impcnt++; for (unsigned int ix2 = 0; ix2 < vec2->imeiamvectortitle2.nodes.size(); ix2++) { vecAtit2 = vec2->imeiamvectortitle2.nodes[ix2]; vecAtit2->refWznmMVector = vec2->ref; vecAtit2->x1IxVType = VecWznmVAMVectorTitleType::getIx(vecAtit2->srefX1IxVType); if (vecAtit2->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",vecAtit2->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(vecAtit2->lineno)}}); //vecAtit2->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == vecAtit2->srefX2RefWznmMLocale) { vecAtit2->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (vecAtit2->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",vecAtit2->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(vecAtit2->lineno)}}); //vecAtit2->Title: TBL dbswznm->tblwznmamvectortitle->insertRec(vecAtit2); impcnt++; }; num2 = 1; for (unsigned int ix2 = 0; ix2 < vec2->imeimvectoritem2.nodes.size(); ix2++) { vit2 = vec2->imeimvectoritem2.nodes[ix2]; vit2->vecRefWznmMVector = vec2->ref; vit2->vecNum = num2++; //vit2->sref: TBL //vit2->Avail: TBL //vit2->Implied: TBL //vit2->refJ: SUB //vit2->Title: TBL //vit2->Comment: TBL dbswznm->tblwznmmvectoritem->insertRec(vit2); impcnt++; if (((vit2->Title != "") || (vit2->Comment != "")) && vit2->imeijmvectoritem2.nodes.empty()) { vitJ2 = new ImeitemIJMVectoritem2(); vit2->imeijmvectoritem2.nodes.push_back(vitJ2); vitJ2->refWznmMVectoritem = vit2->ref; vitJ2->Title = vit2->Title; vitJ2->Comment = vit2->Comment; }; for (unsigned int ix3 = 0; ix3 < vit2->imeijmvectoritem2.nodes.size(); ix3++) { vitJ2 = vit2->imeijmvectoritem2.nodes[ix3]; vitJ2->refWznmMVectoritem = vit2->ref; //vitJ2->x1RefWznmMLocale: RST //if (vitJ2->srefX1RefWznmMLocale == "") vitJ2->srefX1RefWznmMLocale: CUSTOM DEFVAL if (vitJ2->srefX1RefWznmMLocale == "") vitJ2->srefX1RefWznmMLocale = preflcl; for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == vitJ2->srefX1RefWznmMLocale) { vitJ2->x1RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (vitJ2->x1RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",vitJ2->srefX1RefWznmMLocale}, {"iel","srefX1RefWznmMLocale"}, {"lineno",to_string(vitJ2->lineno)}}); //vitJ2->Title: TBL //vitJ2->Comment: TBL dbswznm->tblwznmjmvectoritem->insertRec(vitJ2); impcnt++; if (ix3 == 0) { vit2->refJ = vitJ2->ref; vit2->Title = vitJ2->Title; vit2->Comment = vitJ2->Comment; dbswznm->tblwznmmvectoritem->updateRec(vit2); }; }; }; for (unsigned int ix2 = 0; ix2 < vec2->imeirmtablemvector2.nodes.size(); ix2++) { tblRvec2 = vec2->imeirmtablemvector2.nodes[ix2]; //tblRvec2->refWznmMTable: IMPPP //tblRvec2->refWznmMSubset: IMPPP tblRvec2->refWznmMVector = vec2->ref; dbswznm->tblwznmrmtablemvector->insertRec(tblRvec2); impcnt++; }; }; num1 = 1; for (unsigned int ix1 = 0; ix1 < tbl->imeimtablecol.nodes.size(); ix1++) { tco = tbl->imeimtablecol.nodes[ix1]; tco->ixVBasetype = VecWznmVMTablecolBasetype::getIx(tco->srefIxVBasetype); if (tco->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tco->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(tco->lineno)}}); tco->tblRefWznmMTable = tbl->ref; tco->tblNum = num1++; //tco->refWznmMSubset: IMPPP //tco->refWznmMRelation: IMPPP tco->fctIxVTbl = VecWznmVMTablecolFctTbl::getIx(tco->srefFctIxVTbl); if (tco->fctIxVTbl == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tco->srefFctIxVTbl}, {"iel","srefFctIxVTbl"}, {"lineno",to_string(tco->lineno)}}); //tco->fctUref: IMPPP //tco->sref: TBL //tco->Short: TBL tco->ixVSubtype = VecWznmVMTablecolSubtype::getIx(tco->srefIxVSubtype); if (tco->ixVSubtype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tco->srefIxVSubtype}, {"iel","srefIxVSubtype"}, {"lineno",to_string(tco->lineno)}}); tco->ixVAxisfct = VecWznmVMTablecolAxisfct::getIx(tco->srefIxVAxisfct); if (tco->ixVAxisfct == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tco->srefIxVAxisfct}, {"iel","srefIxVAxisfct"}, {"lineno",to_string(tco->lineno)}}); //tco->srefsKOption: TBL //tco->Principal: TBL //tco->Eponymous: TBL dbswznm->tblwznmmtablecol->insertRec(tco); impcnt++; for (unsigned int ix2 = 0; ix2 < tco->imeiamtablecoltitle.nodes.size(); ix2++) { tcoAtit = tco->imeiamtablecoltitle.nodes[ix2]; tcoAtit->refWznmMTablecol = tco->ref; tcoAtit->x1IxVType = VecWznmVAMTablecolTitleType::getIx(tcoAtit->srefX1IxVType); if (tcoAtit->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tcoAtit->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(tcoAtit->lineno)}}); //tcoAtit->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == tcoAtit->srefX2RefWznmMLocale) { tcoAtit->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (tcoAtit->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tcoAtit->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(tcoAtit->lineno)}}); //tcoAtit->Title: TBL dbswznm->tblwznmamtablecoltitle->insertRec(tcoAtit); impcnt++; }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeiamtableloadfct.nodes.size(); ix1++) { tblAlfc = tbl->imeiamtableloadfct.nodes[ix1]; tblAlfc->refWznmMTable = tbl->ref; tblAlfc->ixVLoadtype = VecWznmVAMTableLoadfctLoadtype::getIx(tblAlfc->srefIxVLoadtype); if (tblAlfc->ixVLoadtype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tblAlfc->srefIxVLoadtype}, {"iel","srefIxVLoadtype"}, {"lineno",to_string(tblAlfc->lineno)}}); //tblAlfc->Fctname: TBL //tblAlfc->ldSrefWznmMTablecol: TBL //tblAlfc->lbySrefsWznmMTablecol: TBL //tblAlfc->ordSrefsWznmMTablecol: TBL tblAlfc->ixVLimtype = VecWznmVAMTableLoadfctLimtype::getIx(tblAlfc->srefIxVLimtype); if (tblAlfc->ixVLimtype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",tblAlfc->srefIxVLimtype}, {"iel","srefIxVLimtype"}, {"lineno",to_string(tblAlfc->lineno)}}); dbswznm->tblwznmamtableloadfct->insertRec(tblAlfc); impcnt++; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimcheck.nodes.size(); ix1++) { chk = tbl->imeimcheck.nodes[ix1]; chk->ixVBasetype = VecWznmVMCheckBasetype::getIx(chk->srefIxVBasetype); if (chk->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",chk->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(chk->lineno)}}); chk->refWznmMTable = tbl->ref; //chk->refWznmMTablecol: PREVIMP if (chk->srefRefWznmMTablecol != "") { for (unsigned int i = 0; i < tbl->imeimtablecol.nodes.size(); i++) { tco = tbl->imeimtablecol.nodes[i]; if (tco->sref == chk->srefRefWznmMTablecol) { chk->refWznmMTablecol = tco->ref; break; }; }; if (chk->refWznmMTablecol == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",chk->srefRefWznmMTablecol}, {"iel","srefRefWznmMTablecol"}, {"lineno",to_string(chk->lineno)}}); }; //chk->sref: TBL //chk->Comment: TBL dbswznm->tblwznmmcheck->insertRec(chk); impcnt++; }; }; // -- ImeICRelation irefs0.clear(); for (unsigned int ix0 = 0; ix0 < imeicrelation.nodes.size(); ix0++) { relC = imeicrelation.nodes[ix0]; if (irefs0.find(relC->iref) != irefs0.end()) throw SbeException(SbeException::IEX_IDIREF, {{"idiref",to_string(relC->iref)}, {"ime","ImeICRelation"}, {"lineno",to_string(relC->lineno)}}); relC->ref = dbswznm->tblwznmcrelation->getNewRef(); irefs0.insert(relC->iref); impcnt++; }; // -- ImeIMRelation irefs0.clear(); for (unsigned int ix0 = 0; ix0 < imeimrelation.nodes.size(); ix0++) { rel = imeimrelation.nodes[ix0]; if (irefs0.find(rel->iref) != irefs0.end()) throw SbeException(SbeException::IEX_IDIREF, {{"idiref",to_string(rel->iref)}, {"ime","ImeIMRelation"}, {"lineno",to_string(rel->lineno)}}); rel->ixVBasetype = VecWznmVMRelationBasetype::getIx(rel->srefIxVBasetype); if (rel->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",rel->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(rel->lineno)}}); //rel->refWznmCRelation: PREVIMP if (rel->irefRefWznmCRelation != 0) { for (unsigned int ix1 = 0; ix1 < imeicrelation.nodes.size(); ix1++) { relC = imeicrelation.nodes[ix1]; if (relC->iref == rel->irefRefWznmCRelation) { rel->refWznmCRelation = relC->ref; break; }; }; if (rel->refWznmCRelation == 0) throw SbeException(SbeException::IEX_IREF, {{"iref",to_string(rel->irefRefWznmCRelation)}, {"iel","irefRefWznmCRelation"}, {"lineno",to_string(rel->lineno)}}); }; rel->refWznmMVersion = refWznmMVersion; //rel->supRefWznmMRelation: IMPPP rel->supIxVSubrole = VecWznmVMRelationSupSubrole::getIx(rel->srefSupIxVSubrole); if (rel->supIxVSubrole == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",rel->srefSupIxVSubrole}, {"iel","srefSupIxVSubrole"}, {"lineno",to_string(rel->lineno)}}); if (rel->srefFrRefWznmMTable != "") { //rel->frRefWznmMTable: PREVIMP for (unsigned int i = 0; i < imeimtable.nodes.size(); i++) { tbl = imeimtable.nodes[i]; if (tbl->sref == rel->srefFrRefWznmMTable) { rel->frRefWznmMTable = tbl->ref; if (rel->srefFrsRefWznmMSubset != "") { //rel->frsRefWznmMSubset: PREVIMP for (unsigned int j = 0; j < tbl->imeimsubset.nodes.size(); j++) { sbs = tbl->imeimsubset.nodes[j]; if (sbs->sref == rel->srefFrsRefWznmMSubset) { rel->frsRefWznmMSubset = sbs->ref; break; }; }; if (rel->frsRefWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",rel->srefFrsRefWznmMSubset}, {"iel","srefFrsRefWznmMSubset"}, {"lineno",to_string(rel->lineno)}}); }; break; }; }; if (rel->frRefWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",rel->srefFrRefWznmMTable}, {"iel","srefFrRefWznmMTable"}, {"lineno",to_string(rel->lineno)}}); }; if (rel->srefToRefWznmMTable != "") { //rel->toRefWznmMTable: PREVIMP for (unsigned int ix1 = 0; ix1 < imeimtable.nodes.size(); ix1++) { tbl = imeimtable.nodes[ix1]; if (tbl->sref == rel->srefToRefWznmMTable) { rel->toRefWznmMTable = tbl->ref; if (rel->srefTosRefWznmMSubset != "") { //rel->tosRefWznmMSubset: PREVIMP for (unsigned int ix2 = 0; ix2 < tbl->imeimsubset.nodes.size(); ix2++) { sbs = tbl->imeimsubset.nodes[ix2]; if (sbs->sref == rel->srefTosRefWznmMSubset) { rel->tosRefWznmMSubset = sbs->ref; break; }; }; if (rel->tosRefWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",rel->srefTosRefWznmMSubset}, {"iel","srefTosRefWznmMSubset"}, {"lineno",to_string(rel->lineno)}}); }; break; }; }; if (rel->toRefWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",rel->srefToRefWznmMTable}, {"iel","srefToRefWznmMTable"}, {"lineno",to_string(rel->lineno)}}); }; //rel->refWznmMTable: PREVIMP if (rel->srefRefWznmMTable != "") { for (unsigned int ix1 = 0; ix1 < imeimtable.nodes.size(); ix1++) { tbl = imeimtable.nodes[ix1]; if (tbl->sref == rel->srefRefWznmMTable) { rel->refWznmMTable = tbl->ref; break; }; }; if (rel->refWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",rel->srefRefWznmMTable}, {"iel","srefRefWznmMTable"}, {"lineno",to_string(rel->lineno)}}); }; //rel->Prefix: TBL //rel->srefsKOption: TBL dbswznm->tblwznmmrelation->insertRec(rel); impcnt++; for (unsigned int ix1 = 0; ix1 < rel->imeiamrelationtitle.nodes.size(); ix1++) { relAtit = rel->imeiamrelationtitle.nodes[ix1]; relAtit->refWznmMRelation = rel->ref; relAtit->x1IxVType = VecWznmVAMRelationTitleType::getIx(relAtit->srefX1IxVType); if (relAtit->x1IxVType == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",relAtit->srefX1IxVType}, {"iel","srefX1IxVType"}, {"lineno",to_string(relAtit->lineno)}}); //relAtit->x2RefWznmMLocale: RST for (unsigned int i = 0; i < lcls.nodes.size(); i++) { if (lcls.nodes[i]->sref == relAtit->srefX2RefWznmMLocale) { relAtit->x2RefWznmMLocale = lcls.nodes[i]->ref; break; }; }; if (relAtit->x2RefWznmMLocale == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",relAtit->srefX2RefWznmMLocale}, {"iel","srefX2RefWznmMLocale"}, {"lineno",to_string(relAtit->lineno)}}); //relAtit->Title: TBL dbswznm->tblwznmamrelationtitle->insertRec(relAtit); impcnt++; }; }; // -- ImeIMStub for (unsigned int ix0 = 0; ix0 < imeimstub.nodes.size(); ix0++) { stb = imeimstub.nodes[ix0]; stb->ixVBasetype = VecWznmVMStubBasetype::getIx(stb->srefIxVBasetype); if (stb->ixVBasetype == 0) throw SbeException(SbeException::IEX_VSREF, {{"vsref",stb->srefIxVBasetype}, {"iel","srefIxVBasetype"}, {"lineno",to_string(stb->lineno)}}); //stb->refWznmMTable: PREVIMP for (unsigned int ix1 = 0; ix1 < imeimtable.nodes.size(); ix1++) { tbl = imeimtable.nodes[ix1]; if (tbl->sref == stb->srefRefWznmMTable) { stb->refWznmMTable = tbl->ref; if (stb->srefRefWznmMSubset != "") { //stb->refWznmMSubset: PREVIMP for (unsigned int ix2 = 0; ix2 < tbl->imeimsubset.nodes.size(); ix2++) { sbs = tbl->imeimsubset.nodes[ix2]; if (sbs->sref == stb->srefRefWznmMSubset) { stb->refWznmMSubset = sbs->ref; break; }; }; if (stb->refWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",stb->srefRefWznmMSubset}, {"iel","srefRefWznmMSubset"}, {"lineno",to_string(stb->lineno)}}); }; break; }; }; if (stb->refWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",stb->srefRefWznmMTable}, {"iel","srefRefWznmMTable"}, {"lineno",to_string(stb->lineno)}}); //stb->sref: TBL //stb->Hierarch: TBL if (stb->srefRefWznmMTablecol != "") { //stb->refWznmMTablecol: PREVIMP for (unsigned int ix1 = 0; ix1 < imeimtable.nodes.size(); ix1++) { tbl = imeimtable.nodes[ix1]; if (tbl->ref == stb->refWznmMTable) { for (unsigned int ix2 = 0; ix2 < tbl->imeimtablecol.nodes.size(); ix2++) { tco = tbl->imeimtablecol.nodes[ix2]; if (tco->sref == stb->srefRefWznmMTablecol) { stb->refWznmMTablecol = tco->ref; break; }; }; break; }; }; if (stb->refWznmMTablecol == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",stb->srefRefWznmMTablecol}, {"iel","srefRefWznmMTablecol"}, {"lineno",to_string(stb->lineno)}}); }; //stb->Localized: TBL //stb->Example: TBL dbswznm->tblwznmmstub->insertRec(stb); impcnt++; }; // -- ImeIRMStubMStub for (unsigned int ix0 = 0; ix0 < imeirmstubmstub.nodes.size(); ix0++) { stbRstb = imeirmstubmstub.nodes[ix0]; //stbRstb->supRefWznmMStub: PREVIMP for (unsigned int ix1 = 0; ix1 < imeimstub.nodes.size(); ix1++) { stb = imeimstub.nodes[ix1]; if (stb->sref == stbRstb->srefSupRefWznmMStub) { stbRstb->supRefWznmMStub = stb->ref; break; }; }; if (stbRstb->supRefWznmMStub == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",stbRstb->srefSupRefWznmMStub}, {"iel","srefSupRefWznmMStub"}, {"lineno",to_string(stbRstb->lineno)}}); //stbRstb->subRefWznmMStub: PREVIMP for (unsigned int ix1 = 0; ix1 < imeimstub.nodes.size(); ix1++) { stb = imeimstub.nodes[ix1]; if (stb->sref == stbRstb->srefSubRefWznmMStub) { stbRstb->subRefWznmMStub = stb->ref; break; }; }; if (stbRstb->subRefWznmMStub == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",stbRstb->srefSubRefWznmMStub}, {"iel","srefSubRefWznmMStub"}, {"lineno",to_string(stbRstb->lineno)}}); dbswznm->tblwznmrmstubmstub->insertRec(stbRstb); impcnt++; }; // IP enterSgeImport.traverse --- REND // IP enterSgeImport.ppr --- IBEGIN // -- ImeIMVector1 for (unsigned int ix0 = 0; ix0 < imeimvector1.nodes.size(); ix0++) { vec1 = imeimvector1.nodes[ix0]; for (unsigned int ix1 = 0; ix1 < vec1->imeirmtablemvector1.nodes.size(); ix1++) { tblRvec1 = vec1->imeirmtablemvector1.nodes[ix1]; if (tblRvec1->srefRefWznmMTable != "") { for (unsigned int ix2 = 0; ix2 < imeimtable.nodes.size(); ix2++) { tbl = imeimtable.nodes[ix2]; if (tbl->sref == tblRvec1->srefRefWznmMTable) { tblRvec1->refWznmMTable = tbl->ref; if (tblRvec1->srefRefWznmMSubset != "") { for (unsigned int ix3 = 0; ix3 < tbl->imeimsubset.nodes.size(); ix3++) { sbs = tbl->imeimsubset.nodes[ix3]; if (sbs->sref == tblRvec1->srefRefWznmMSubset) { tblRvec1->refWznmMSubset = sbs->ref; break; }; }; if (tblRvec1->refWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tblRvec1->srefRefWznmMSubset}, {"iel","srefRefWznmMSubset"}, {"lineno",to_string(tblRvec1->lineno)}}); }; break; }; }; if (tblRvec1->refWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tblRvec1->srefRefWznmMTable}, {"iel","srefRefWznmMTable"}, {"lineno",to_string(tblRvec1->lineno)}}); else dbswznm->tblwznmrmtablemvector->updateRec(tblRvec1); }; }; }; // -- ImeIMTable for (unsigned int ix0 = 0; ix0 < imeimtable.nodes.size(); ix0++) { tbl = imeimtable.nodes[ix0]; if ((tbl->refIxVTbl == VecWznmVMTableRefTbl::REL) && (tbl->irefRefUref != 0)) { for (unsigned int ix1 = 0; ix1 < imeimrelation.nodes.size(); ix1++) { rel = imeimrelation.nodes[ix1]; if (rel->iref == tbl->irefRefUref) { tbl->refUref = rel->ref; break; }; }; if (tbl->refUref == 0) throw SbeException(SbeException::IEX_IREF, {{"iref",to_string(tbl->irefRefUref)}, {"iel","irefRefUref"}, {"lineno",to_string(tbl->lineno)}}); else dbswznm->tblwznmmtable->updateRec(tbl); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimsubset.nodes.size(); ix1++) { sbs = tbl->imeimsubset.nodes[ix1]; for (unsigned int ix2 = 0; ix2 < sbs->imeirmsubsetmsubset.nodes.size(); ix2++) { sbsRsbs = sbs->imeirmsubsetmsubset.nodes[ix2]; if (sbsRsbs->srefBsbRefWznmMSubset != "") { for (unsigned int i = 0; i < tbl->imeimsubset.nodes.size(); i++) { sbs2 = tbl->imeimsubset.nodes[i]; if (sbs2->sref == sbsRsbs->srefBsbRefWznmMSubset) { sbsRsbs->bsbRefWznmMSubset = sbs2->ref; break; }; }; if (sbsRsbs->bsbRefWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",sbsRsbs->srefBsbRefWznmMSubset}, {"iel","srefBsbRefWznmMSubset"}, {"lineno",to_string(sbsRsbs->lineno)}}); else dbswznm->tblwznmrmsubsetmsubset->updateRec(sbsRsbs); }; }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimvector2.nodes.size(); ix1++) { vec2 = tbl->imeimvector2.nodes[ix1]; for (unsigned int ix2 = 0; ix2 < vec2->imeirmtablemvector2.nodes.size(); ix2++) { tblRvec2 = vec2->imeirmtablemvector2.nodes[ix2]; if (tblRvec2->srefRefWznmMTable != "") { for (unsigned int i = 0; i < imeimtable.nodes.size(); i++) { tbl2 = imeimtable.nodes[i]; if (tbl2->sref == tblRvec2->srefRefWznmMTable) { tblRvec2->refWznmMTable = tbl2->ref; if (tblRvec2->srefRefWznmMSubset != "") { for (unsigned int j = 0; j < tbl2->imeimsubset.nodes.size(); j++) { sbs2 = tbl2->imeimsubset.nodes[j]; if (sbs2->sref == tblRvec2->srefRefWznmMSubset) { tblRvec2->refWznmMSubset = sbs2->ref; break; }; }; if (tblRvec2->refWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tblRvec2->srefRefWznmMSubset}, {"iel","srefRefWznmMSubset"}, {"lineno",to_string(tblRvec2->lineno)}}); }; break; }; }; if (tblRvec2->refWznmMTable == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tblRvec2->srefRefWznmMTable}, {"iel","srefRefWznmMTable"}, {"lineno",to_string(tblRvec2->lineno)}}); }; dbswznm->tblwznmrmtablemvector->updateRec(tblRvec2); }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimtablecol.nodes.size(); ix1++) { tco = tbl->imeimtablecol.nodes[ix1]; if (tco->srefRefWznmMSubset != "") { for (unsigned int i = 0; i < tbl->imeimsubset.nodes.size(); i++) { sbs = tbl->imeimsubset.nodes[i]; if (sbs->sref == tco->srefRefWznmMSubset) { tco->refWznmMSubset = sbs->ref; break; }; }; if (tco->refWznmMSubset == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tco->srefRefWznmMSubset}, {"iel","srefRefWznmMSubset"}, {"lineno",to_string(tco->lineno)}}); }; if (tco->irefRefWznmMRelation != 0) { for (unsigned int i = 0; i < imeimrelation.nodes.size(); i++) { rel = imeimrelation.nodes[i]; if (rel->iref == tco->irefRefWznmMRelation) { tco->refWznmMRelation = rel->ref; break; }; }; if (tco->refWznmMRelation == 0) throw SbeException(SbeException::IEX_IREF, {{"iref",to_string(tco->irefRefWznmMRelation)}, {"iel","irefRefWznmMRelation"}, {"lineno",to_string(tco->lineno)}}); }; if ((tco->fctIxVTbl == VecWznmVMTablecolFctTbl::TBL) && (tco->srefFctUref != "")) { for (unsigned int i = 0; i < imeimtable.nodes.size(); i++) { tbl2 = imeimtable.nodes[i]; if (tbl2->sref == tco->srefFctUref) { tco->fctUref = tbl2->ref; break; }; }; if (tco->fctUref == 0) throw SbeException(SbeException::IEX_TSREF, {{"tsref",tco->srefFctUref}, {"iel","srefFctUref"}, {"lineno",to_string(tco->lineno)}}); } else if ((tco->fctIxVTbl == VecWznmVMTablecolFctTbl::VEC) && (tco->srefFctUref != "")) { if (dbswznm->tblwznmmvector->loadRefByVerSrf(refWznmMVersion, tco->srefFctUref, ref)) tco->fctUref = ref; else throw SbeException(SbeException::IEX_TSREF, {{"tsref",tco->srefFctUref}, {"iel","srefFctUref"}, {"lineno",to_string(tco->lineno)}}); }; dbswznm->tblwznmmtablecol->updateRec(tco); }; }; // -- MRelation for (unsigned int ix0 = 0; ix0 < imeimrelation.nodes.size(); ix0++) { rel = imeimrelation.nodes[ix0]; if (rel->irefSupRefWznmMRelation != 0) { for (unsigned int i = 0; i < imeimrelation.nodes.size(); i++) { rel2 = imeimrelation.nodes[i]; if (rel2->iref == rel->irefSupRefWznmMRelation) { rel->supRefWznmMRelation = rel2->ref; break; }; }; if (rel->supRefWznmMRelation == 0) throw SbeException(SbeException::IEX_IREF, {{"iref",to_string(rel->irefSupRefWznmMRelation)}, {"iel","irefSupRefWznmMRelation"}, {"lineno",to_string(tco->lineno)}}); else dbswznm->tblwznmmrelation->updateRec(rel); }; }; // IP enterSgeImport.ppr --- IEND } catch (SbeException& e) { lasterror = e.getSquawk(VecWznmVError::getIx, VecWznmVError::getTitle, ixWznmVLocale); retval = nextIxVSgeFailure; }; return retval; }; void JobWznmIexDbs::leaveSgeImport( DbsWznm* dbswznm ) { // IP leaveSgeImport --- INSERT }; uint JobWznmIexDbs::enterSgeImperr( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::IMPERR; // IP enterSgeImperr --- INSERT return retval; }; void JobWznmIexDbs::leaveSgeImperr( DbsWznm* dbswznm ) { // IP leaveSgeImperr --- INSERT }; uint JobWznmIexDbs::enterSgeReverse( DbsWznm* dbswznm , const bool reenter ) { uint retval; nextIxVSgeSuccess = VecVSge::IDLE; retval = nextIxVSgeSuccess; ImeitemIMRelation* rel = NULL; ImeitemIMStub* stb = NULL; ImeitemIMTable* tbl = NULL; ImeitemIMVector1* vec1 = NULL; ImeitemIRMStubMStub* stbRstb = NULL; ImeitemIAMRelationTitle* relAtit = NULL; ImeitemIAMTableLoadfct* tblAlfc = NULL; ImeitemIAMTableTitle* tblAtit = NULL; ImeitemIAMVectorTitle1* vecAtit1 = NULL; ImeitemIMCheck* chk = NULL; ImeitemIMSubset* sbs = NULL; ImeitemIMTablecol* tco = NULL; ImeitemIMVector2* vec2 = NULL; ImeitemIMVectoritem1* vit1 = NULL; ImeitemIRMTableMVector1* tblRvec1 = NULL; ImeitemIAMSubsetTitle* sbsAtit = NULL; ImeitemIAMTablecolTitle* tcoAtit = NULL; ImeitemIAMVectorTitle2* vecAtit2 = NULL; ImeitemIJMVectoritem1* vitJ1 = NULL; ImeitemIMVectoritem2* vit2 = NULL; ImeitemIRMSubsetMSubset* sbsRsbs = NULL; ImeitemIRMTableMVector2* tblRvec2 = NULL; ImeitemIJMVectoritem2* vitJ2 = NULL; // -- ImeICRelation // -- ImeIMRelation for (unsigned int ix0 = 0; ix0 < imeimrelation.nodes.size(); ix0++) { rel = imeimrelation.nodes[ix0]; if (rel->ref != 0) dbswznm->tblwznmmrelation->removeRecByRef(rel->ref); for (unsigned int ix1 = 0; ix1 < rel->imeiamrelationtitle.nodes.size(); ix1++) { relAtit = rel->imeiamrelationtitle.nodes[ix1]; if (relAtit->ref != 0) dbswznm->tblwznmamrelationtitle->removeRecByRef(relAtit->ref); }; }; // -- ImeIMStub for (unsigned int ix0 = 0; ix0 < imeimstub.nodes.size(); ix0++) { stb = imeimstub.nodes[ix0]; if (stb->ref != 0) dbswznm->tblwznmmstub->removeRecByRef(stb->ref); }; // -- ImeIMTable for (unsigned int ix0 = 0; ix0 < imeimtable.nodes.size(); ix0++) { tbl = imeimtable.nodes[ix0]; if (tbl->ref != 0) dbswznm->tblwznmmtable->removeRecByRef(tbl->ref); for (unsigned int ix1 = 0; ix1 < tbl->imeiamtableloadfct.nodes.size(); ix1++) { tblAlfc = tbl->imeiamtableloadfct.nodes[ix1]; if (tblAlfc->ref != 0) dbswznm->tblwznmamtableloadfct->removeRecByRef(tblAlfc->ref); }; for (unsigned int ix1 = 0; ix1 < tbl->imeiamtabletitle.nodes.size(); ix1++) { tblAtit = tbl->imeiamtabletitle.nodes[ix1]; if (tblAtit->ref != 0) dbswznm->tblwznmamtabletitle->removeRecByRef(tblAtit->ref); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimcheck.nodes.size(); ix1++) { chk = tbl->imeimcheck.nodes[ix1]; if (chk->ref != 0) dbswznm->tblwznmmcheck->removeRecByRef(chk->ref); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimsubset.nodes.size(); ix1++) { sbs = tbl->imeimsubset.nodes[ix1]; if (sbs->ref != 0) dbswznm->tblwznmmsubset->removeRecByRef(sbs->ref); for (unsigned int ix2 = 0; ix2 < sbs->imeiamsubsettitle.nodes.size(); ix2++) { sbsAtit = sbs->imeiamsubsettitle.nodes[ix2]; if (sbsAtit->ref != 0) dbswznm->tblwznmamsubsettitle->removeRecByRef(sbsAtit->ref); }; for (unsigned int ix2 = 0; ix2 < sbs->imeirmsubsetmsubset.nodes.size(); ix2++) { sbsRsbs = sbs->imeirmsubsetmsubset.nodes[ix2]; if (sbsRsbs->ref != 0) dbswznm->tblwznmrmsubsetmsubset->removeRecByRef(sbsRsbs->ref); }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimtablecol.nodes.size(); ix1++) { tco = tbl->imeimtablecol.nodes[ix1]; if (tco->ref != 0) dbswznm->tblwznmmtablecol->removeRecByRef(tco->ref); for (unsigned int ix2 = 0; ix2 < tco->imeiamtablecoltitle.nodes.size(); ix2++) { tcoAtit = tco->imeiamtablecoltitle.nodes[ix2]; if (tcoAtit->ref != 0) dbswznm->tblwznmamtablecoltitle->removeRecByRef(tcoAtit->ref); }; }; for (unsigned int ix1 = 0; ix1 < tbl->imeimvector2.nodes.size(); ix1++) { vec2 = tbl->imeimvector2.nodes[ix1]; if (vec2->ref != 0) dbswznm->tblwznmmvector->removeRecByRef(vec2->ref); for (unsigned int ix2 = 0; ix2 < vec2->imeiamvectortitle2.nodes.size(); ix2++) { vecAtit2 = vec2->imeiamvectortitle2.nodes[ix2]; if (vecAtit2->ref != 0) dbswznm->tblwznmamvectortitle->removeRecByRef(vecAtit2->ref); }; for (unsigned int ix2 = 0; ix2 < vec2->imeimvectoritem2.nodes.size(); ix2++) { vit2 = vec2->imeimvectoritem2.nodes[ix2]; if (vit2->ref != 0) dbswznm->tblwznmmvectoritem->removeRecByRef(vit2->ref); for (unsigned int ix3 = 0; ix3 < vit2->imeijmvectoritem2.nodes.size(); ix3++) { vitJ2 = vit2->imeijmvectoritem2.nodes[ix3]; if (vitJ2->ref != 0) dbswznm->tblwznmjmvectoritem->removeRecByRef(vitJ2->ref); }; }; for (unsigned int ix2 = 0; ix2 < vec2->imeirmtablemvector2.nodes.size(); ix2++) { tblRvec2 = vec2->imeirmtablemvector2.nodes[ix2]; if (tblRvec2->ref != 0) dbswznm->tblwznmrmtablemvector->removeRecByRef(tblRvec2->ref); }; }; }; // -- ImeIMVector1 for (unsigned int ix0 = 0; ix0 < imeimvector1.nodes.size(); ix0++) { vec1 = imeimvector1.nodes[ix0]; if (vec1->ref != 0) dbswznm->tblwznmmvector->removeRecByRef(vec1->ref); for (unsigned int ix1 = 0; ix1 < vec1->imeiamvectortitle1.nodes.size(); ix1++) { vecAtit1 = vec1->imeiamvectortitle1.nodes[ix1]; if (vecAtit1->ref != 0) dbswznm->tblwznmamvectortitle->removeRecByRef(vecAtit1->ref); }; for (unsigned int ix1 = 0; ix1 < vec1->imeimvectoritem1.nodes.size(); ix1++) { vit1 = vec1->imeimvectoritem1.nodes[ix1]; if (vit1->ref != 0) dbswznm->tblwznmmvectoritem->removeRecByRef(vit1->ref); for (unsigned int ix2 = 0; ix2 < vit1->imeijmvectoritem1.nodes.size(); ix2++) { vitJ1 = vit1->imeijmvectoritem1.nodes[ix2]; if (vitJ1->ref != 0) dbswznm->tblwznmjmvectoritem->removeRecByRef(vitJ1->ref); }; }; for (unsigned int ix1 = 0; ix1 < vec1->imeirmtablemvector1.nodes.size(); ix1++) { tblRvec1 = vec1->imeirmtablemvector1.nodes[ix1]; if (tblRvec1->ref != 0) dbswznm->tblwznmrmtablemvector->removeRecByRef(tblRvec1->ref); }; }; // -- ImeIRMStubMStub for (unsigned int ix0 = 0; ix0 < imeirmstubmstub.nodes.size(); ix0++) { stbRstb = imeirmstubmstub.nodes[ix0]; if (stbRstb->ref != 0) dbswznm->tblwznmrmstubmstub->removeRecByRef(stbRstb->ref); }; return retval; }; void JobWznmIexDbs::leaveSgeReverse( DbsWznm* dbswznm ) { // IP leaveSgeReverse --- INSERT }; uint JobWznmIexDbs::enterSgeCollect( DbsWznm* dbswznm , const bool reenter ) { uint retval; nextIxVSgeSuccess = VecVSge::CLTDONE; retval = nextIxVSgeSuccess; ImeitemICRelation* relC = NULL; ImeitemIMRelation* rel = NULL; ImeitemIMStub* stb = NULL; ImeitemIMTable* tbl = NULL; ImeitemIMVector1* vec1 = NULL; ImeitemIRMStubMStub* stbRstb = NULL; ImeitemIAMRelationTitle* relAtit = NULL; ImeitemIAMTableLoadfct* tblAlfc = NULL; ImeitemIAMTableTitle* tblAtit = NULL; ImeitemIAMVectorTitle1* vecAtit1 = NULL; ImeitemIMCheck* chk = NULL; ImeitemIMSubset* sbs = NULL; ImeitemIMTablecol* tco = NULL; ImeitemIMVector2* vec2 = NULL; ImeitemIMVectoritem1* vit1 = NULL; ImeitemIRMTableMVector1* tblRvec1 = NULL; ImeitemIAMSubsetTitle* sbsAtit = NULL; ImeitemIAMTablecolTitle* tcoAtit = NULL; ImeitemIAMVectorTitle2* vecAtit2 = NULL; ImeitemIJMVectoritem1* vitJ1 = NULL; ImeitemIMVectoritem2* vit2 = NULL; ImeitemIRMSubsetMSubset* sbsRsbs = NULL; ImeitemIRMTableMVector2* tblRvec2 = NULL; ImeitemIJMVectoritem2* vitJ2 = NULL; uint ixWznmVIop; vector<ubigint> refs; Stcch* stcch = new Stcch(false); // IP enterSgeCollect.traverse --- BEGIN // -- ImeICRelation for (unsigned int ix0 = 0; ix0 < imeicrelation.nodes.size(); ix0++) { relC = imeicrelation.nodes[ix0]; if (relC->ref != 0) { relC->iref = ix0+1; }; }; // -- ImeIMRelation for (unsigned int ix0 = 0; ix0 < imeimrelation.nodes.size(); ix0++) { rel = imeimrelation.nodes[ix0]; if (rel->ref != 0) { rel->iref = ix0+1; //rel->irefRefWznmCRelation: IREF //rel->irefSupRefWznmMRelation: IREF rel->srefFrRefWznmMTable = StubWznm::getStubTblStd(dbswznm, rel->frRefWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); rel->srefFrsRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, rel->frsRefWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); rel->srefToRefWznmMTable = StubWznm::getStubTblStd(dbswznm, rel->toRefWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); rel->srefTosRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, rel->tosRefWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); rel->srefRefWznmMTable = StubWznm::getStubTblStd(dbswznm, rel->refWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMRELATIONTITLE, ixWznmVIop)) { dbswznm->tblwznmamrelationtitle->loadRefsByRel(rel->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) rel->imeiamrelationtitle.nodes.push_back(new ImeitemIAMRelationTitle(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < rel->imeiamrelationtitle.nodes.size(); ix1++) { relAtit = rel->imeiamrelationtitle.nodes[ix1]; if (relAtit->ref != 0) { relAtit->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, relAtit->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; // -- ImeIMStub for (unsigned int ix0 = 0; ix0 < imeimstub.nodes.size(); ix0++) { stb = imeimstub.nodes[ix0]; if (stb->ref != 0) { stb->srefRefWznmMTable = StubWznm::getStubTblStd(dbswznm, stb->refWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); stb->srefRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, stb->refWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); stb->srefRefWznmMTablecol = StubWznm::getStubTcoSref(dbswznm, stb->refWznmMTablecol, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; // -- ImeIMTable for (unsigned int ix0 = 0; ix0 < imeimtable.nodes.size(); ix0++) { tbl = imeimtable.nodes[ix0]; if (tbl->ref != 0) { //tbl->irefRefUref: IREF }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMTABLELOADFCT, ixWznmVIop)) { dbswznm->tblwznmamtableloadfct->loadRefsByTbl(tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeiamtableloadfct.nodes.push_back(new ImeitemIAMTableLoadfct(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeiamtableloadfct.nodes.size(); ix1++) { tblAlfc = tbl->imeiamtableloadfct.nodes[ix1]; if (tblAlfc->ref != 0) { }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMTABLETITLE, ixWznmVIop)) { dbswznm->tblwznmamtabletitle->loadRefsByTbl(tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeiamtabletitle.nodes.push_back(new ImeitemIAMTableTitle(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeiamtabletitle.nodes.size(); ix1++) { tblAtit = tbl->imeiamtabletitle.nodes[ix1]; if (tblAtit->ref != 0) { tblAtit->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, tblAtit->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMCHECK, ixWznmVIop)) { dbswznm->tblwznmmcheck->loadRefsByTbl(tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeimcheck.nodes.push_back(new ImeitemIMCheck(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimcheck.nodes.size(); ix1++) { chk = tbl->imeimcheck.nodes[ix1]; if (chk->ref != 0) { chk->srefRefWznmMTablecol = StubWznm::getStubTcoSref(dbswznm, chk->refWznmMTablecol, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMSUBSET, ixWznmVIop)) { dbswznm->tblwznmmsubset->loadRefsByTbl(tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeimsubset.nodes.push_back(new ImeitemIMSubset(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimsubset.nodes.size(); ix1++) { sbs = tbl->imeimsubset.nodes[ix1]; if (sbs->ref != 0) { }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMSUBSETTITLE, ixWznmVIop)) { dbswznm->tblwznmamsubsettitle->loadRefsBySbs(sbs->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) sbs->imeiamsubsettitle.nodes.push_back(new ImeitemIAMSubsetTitle(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < sbs->imeiamsubsettitle.nodes.size(); ix2++) { sbsAtit = sbs->imeiamsubsettitle.nodes[ix2]; if (sbsAtit->ref != 0) { sbsAtit->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, sbsAtit->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIRMSUBSETMSUBSET, ixWznmVIop)) { dbswznm->tblwznmrmsubsetmsubset->loadRefsByAsb(sbs->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) sbs->imeirmsubsetmsubset.nodes.push_back(new ImeitemIRMSubsetMSubset(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < sbs->imeirmsubsetmsubset.nodes.size(); ix2++) { sbsRsbs = sbs->imeirmsubsetmsubset.nodes[ix2]; if (sbsRsbs->ref != 0) { sbsRsbs->srefBsbRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, sbsRsbs->bsbRefWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMTABLECOL, ixWznmVIop)) { dbswznm->tblwznmmtablecol->loadRefsByTbl(tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeimtablecol.nodes.push_back(new ImeitemIMTablecol(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimtablecol.nodes.size(); ix1++) { tco = tbl->imeimtablecol.nodes[ix1]; if (tco->ref != 0) { tco->srefRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, tco->refWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); //tco->irefRefWznmMRelation: IREF tco->srefFctUref = StubWznm::getStubTblStd(dbswznm, tco->fctUref, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMTABLECOLTITLE, ixWznmVIop)) { dbswznm->tblwznmamtablecoltitle->loadRefsByTco(tco->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tco->imeiamtablecoltitle.nodes.push_back(new ImeitemIAMTablecolTitle(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < tco->imeiamtablecoltitle.nodes.size(); ix2++) { tcoAtit = tco->imeiamtablecoltitle.nodes[ix2]; if (tcoAtit->ref != 0) { tcoAtit->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, tcoAtit->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMVECTOR2, ixWznmVIop)) { dbswznm->tblwznmmvector->loadRefsByHktHku(VecWznmVMVectorHkTbl::TBL, tbl->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) tbl->imeimvector2.nodes.push_back(new ImeitemIMVector2(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < tbl->imeimvector2.nodes.size(); ix1++) { vec2 = tbl->imeimvector2.nodes[ix1]; if (vec2->ref != 0) { }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMVECTORTITLE2, ixWznmVIop)) { dbswznm->tblwznmamvectortitle->loadRefsByVec(vec2->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec2->imeiamvectortitle2.nodes.push_back(new ImeitemIAMVectorTitle2(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < vec2->imeiamvectortitle2.nodes.size(); ix2++) { vecAtit2 = vec2->imeiamvectortitle2.nodes[ix2]; if (vecAtit2->ref != 0) { vecAtit2->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, vecAtit2->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMVECTORITEM2, ixWznmVIop)) { dbswznm->tblwznmmvectoritem->loadRefsByVec(vec2->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec2->imeimvectoritem2.nodes.push_back(new ImeitemIMVectoritem2(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < vec2->imeimvectoritem2.nodes.size(); ix2++) { vit2 = vec2->imeimvectoritem2.nodes[ix2]; if (vit2->ref != 0) { }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIJMVECTORITEM2, ixWznmVIop)) { dbswznm->tblwznmjmvectoritem->loadRefsByVit(vit2->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) if (refs[i] == vit2->refJ) {refs[i] = refs[0]; refs[0] = vit2->refJ; break;}; for (unsigned int i = 0; i < refs.size(); i++) vit2->imeijmvectoritem2.nodes.push_back(new ImeitemIJMVectoritem2(dbswznm, refs[i])); }; for (unsigned int ix3 = 0; ix3 < vit2->imeijmvectoritem2.nodes.size(); ix3++) { vitJ2 = vit2->imeijmvectoritem2.nodes[ix3]; if (vitJ2->ref != 0) { vitJ2->srefX1RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, vitJ2->x1RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIRMTABLEMVECTOR2, ixWznmVIop)) { dbswznm->tblwznmrmtablemvector->loadRefsByVec(vec2->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec2->imeirmtablemvector2.nodes.push_back(new ImeitemIRMTableMVector2(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < vec2->imeirmtablemvector2.nodes.size(); ix2++) { tblRvec2 = vec2->imeirmtablemvector2.nodes[ix2]; if (tblRvec2->ref != 0) { tblRvec2->srefRefWznmMTable = StubWznm::getStubTblStd(dbswznm, tblRvec2->refWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); tblRvec2->srefRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, tblRvec2->refWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; }; // -- ImeIMVector1 for (unsigned int ix0 = 0; ix0 < imeimvector1.nodes.size(); ix0++) { vec1 = imeimvector1.nodes[ix0]; if (vec1->ref != 0) { }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIAMVECTORTITLE1, ixWznmVIop)) { dbswznm->tblwznmamvectortitle->loadRefsByVec(vec1->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec1->imeiamvectortitle1.nodes.push_back(new ImeitemIAMVectorTitle1(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < vec1->imeiamvectortitle1.nodes.size(); ix1++) { vecAtit1 = vec1->imeiamvectortitle1.nodes[ix1]; if (vecAtit1->ref != 0) { vecAtit1->srefX2RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, vecAtit1->x2RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIMVECTORITEM1, ixWznmVIop)) { dbswznm->tblwznmmvectoritem->loadRefsByVec(vec1->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec1->imeimvectoritem1.nodes.push_back(new ImeitemIMVectoritem1(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < vec1->imeimvectoritem1.nodes.size(); ix1++) { vit1 = vec1->imeimvectoritem1.nodes[ix1]; if (vit1->ref != 0) { }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIJMVECTORITEM1, ixWznmVIop)) { dbswznm->tblwznmjmvectoritem->loadRefsByVit(vit1->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) if (refs[i] == vit1->refJ) {refs[i] = refs[0]; refs[0] = vit1->refJ; break;}; for (unsigned int i = 0; i < refs.size(); i++) vit1->imeijmvectoritem1.nodes.push_back(new ImeitemIJMVectoritem1(dbswznm, refs[i])); }; for (unsigned int ix2 = 0; ix2 < vit1->imeijmvectoritem1.nodes.size(); ix2++) { vitJ1 = vit1->imeijmvectoritem1.nodes[ix2]; if (vitJ1->ref != 0) { vitJ1->srefX1RefWznmMLocale = StubWznm::getStubLocSref(dbswznm, vitJ1->x1RefWznmMLocale, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; if (getIxWznmVIop(icsWznmVIop, VecVIme::IMEIRMTABLEMVECTOR1, ixWznmVIop)) { dbswznm->tblwznmrmtablemvector->loadRefsByVec(vec1->ref, false, refs); for (unsigned int i = 0; i < refs.size(); i++) vec1->imeirmtablemvector1.nodes.push_back(new ImeitemIRMTableMVector1(dbswznm, refs[i])); }; for (unsigned int ix1 = 0; ix1 < vec1->imeirmtablemvector1.nodes.size(); ix1++) { tblRvec1 = vec1->imeirmtablemvector1.nodes[ix1]; if (tblRvec1->ref != 0) { tblRvec1->srefRefWznmMTable = StubWznm::getStubTblStd(dbswznm, tblRvec1->refWznmMTable, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); tblRvec1->srefRefWznmMSubset = StubWznm::getStubSbsStd(dbswznm, tblRvec1->refWznmMSubset, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; }; // -- ImeIRMStubMStub for (unsigned int ix0 = 0; ix0 < imeirmstubmstub.nodes.size(); ix0++) { stbRstb = imeirmstubmstub.nodes[ix0]; if (stbRstb->ref != 0) { stbRstb->srefSupRefWznmMStub = StubWznm::getStubStbStd(dbswznm, stbRstb->supRefWznmMStub, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); stbRstb->srefSubRefWznmMStub = StubWznm::getStubStbStd(dbswznm, stbRstb->subRefWznmMStub, ixWznmVLocale, Stub::VecVNonetype::VOID, stcch); }; }; // IP enterSgeCollect.traverse --- END // IP enterSgeCollect.ppr --- INSERT delete stcch; return retval; }; void JobWznmIexDbs::leaveSgeCollect( DbsWznm* dbswznm ) { // IP leaveSgeCollect --- INSERT }; uint JobWznmIexDbs::enterSgeCltdone( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::CLTDONE; // IP enterSgeCltdone --- INSERT return retval; }; void JobWznmIexDbs::leaveSgeCltdone( DbsWznm* dbswznm ) { // IP leaveSgeCltdone --- INSERT }; uint JobWznmIexDbs::enterSgeExport( DbsWznm* dbswznm , const bool reenter ) { uint retval; nextIxVSgeSuccess = VecVSge::DONE; retval = nextIxVSgeSuccess; IexWznmDbs::exportToFile(fullpath, xmlNotTxt, shorttags, imeicrelation, imeimrelation, imeimstub, imeimtable, imeimvector1, imeirmstubmstub); return retval; }; void JobWznmIexDbs::leaveSgeExport( DbsWznm* dbswznm ) { // IP leaveSgeExport --- INSERT }; uint JobWznmIexDbs::enterSgeDone( DbsWznm* dbswznm , const bool reenter ) { uint retval = VecVSge::DONE; // IP enterSgeDone --- INSERT return retval; }; void JobWznmIexDbs::leaveSgeDone( DbsWznm* dbswznm ) { // IP leaveSgeDone --- INSERT };
36.597814
226
0.669518
mpsitech
ab63318049c59604c4202e5c0c01e64d6bb57272
23,362
cpp
C++
src/lib/sema/SemanticAnalyzer.cpp
LittleLaGi/p2llvm
549b82c2e89c2cc1324a3d8b8d7760bb96ba0ba3
[ "MIT" ]
null
null
null
src/lib/sema/SemanticAnalyzer.cpp
LittleLaGi/p2llvm
549b82c2e89c2cc1324a3d8b8d7760bb96ba0ba3
[ "MIT" ]
null
null
null
src/lib/sema/SemanticAnalyzer.cpp
LittleLaGi/p2llvm
549b82c2e89c2cc1324a3d8b8d7760bb96ba0ba3
[ "MIT" ]
null
null
null
#include "sema/SemanticAnalyzer.hpp" #include "sema/error.hpp" #include "visitor/AstNodeInclude.hpp" #include <algorithm> #include <cassert> static constexpr const char *kRedeclaredSymbolErrorMessage = "symbol '%s' is redeclared"; void SemanticAnalyzer::visit(ProgramNode &p_program) { m_symbol_manager.pushGlobalScope(); m_context_stack.push(SemanticContext::kGlobal); m_returned_type_stack.push(p_program.getTypePtr()); auto success = m_symbol_manager.addSymbol( p_program.getName(), SymbolEntry::KindEnum::kProgramKind, p_program.getTypePtr(), static_cast<Constant *>(nullptr)); if (!success) { logSemanticError(p_program.getLocation(), kRedeclaredSymbolErrorMessage, p_program.getNameCString()); m_has_error = true; } p_program.visitChildNodes(*this); p_program.setSymbolTable(m_symbol_manager.getCurrentTable()); m_returned_type_stack.pop(); m_context_stack.pop(); m_symbol_manager.popGlobalScope(); } void SemanticAnalyzer::visit(DeclNode &p_decl) { p_decl.visitChildNodes(*this); } SymbolEntry::KindEnum SemanticAnalyzer::determineVarKind(const VariableNode &p_variable) { if (isInForLoop()) { return SymbolEntry::KindEnum::kLoopVarKind; } if (isInFunction()) { return SymbolEntry::KindEnum::kParameterKind; } // global or local return p_variable.getConstantPtr() ? SymbolEntry::KindEnum::kConstantKind : SymbolEntry::KindEnum::kVariableKind; } SymbolEntry *SemanticAnalyzer::addSymbol(const VariableNode &p_variable) { auto kind = determineVarKind(p_variable); auto *entry = m_symbol_manager.addSymbol(p_variable.getName(), kind, p_variable.getTypePtr(), p_variable.getConstantPtr()); if (!entry) { logSemanticError(p_variable.getLocation(), kRedeclaredSymbolErrorMessage, p_variable.getNameCString()); m_has_error = true; } return entry; } static bool validateDimensions(const VariableNode &p_variable) { bool has_error = false; auto validate_dimension = [&](const auto dimension) { if (dimension == 0) { logSemanticError(p_variable.getLocation(), "'%s' declared as an array with an index that is " "not greater than 0", p_variable.getNameCString()); has_error = true; } }; for_each(p_variable.getTypePtr()->getDimensions().begin(), p_variable.getTypePtr()->getDimensions().end(), validate_dimension); return !has_error; } void SemanticAnalyzer::visit(VariableNode &p_variable) { auto *entry = addSymbol(p_variable); p_variable.visitChildNodes(*this); if (entry && !validateDimensions(p_variable)) { m_error_entry_set.insert(entry); m_has_error = true; } } void SemanticAnalyzer::visit(ConstantValueNode &p_constant_value) { p_constant_value.setInferredType( p_constant_value.getTypePtr()->getStructElementType(0)); } void SemanticAnalyzer::visit(FunctionNode &p_function) { auto success = m_symbol_manager.addSymbol( p_function.getName(), SymbolEntry::KindEnum::kFunctionKind, p_function.getTypePtr(), &p_function.getParameters()); if (!success) { logSemanticError(p_function.getLocation(), kRedeclaredSymbolErrorMessage, p_function.getNameCString()); m_has_error = true; } m_symbol_manager.pushScope(); m_context_stack.push(SemanticContext::kFunction); m_returned_type_stack.push(p_function.getTypePtr()); auto visit_ast_node = [this](auto &ast_node) { ast_node->accept(*this); }; for_each(p_function.getParameters().begin(), p_function.getParameters().end(), visit_ast_node); // directly visit the body to prevent pushing duplicate scope m_context_stack.push(SemanticContext::kLocal); p_function.visitBodyChildNodes(*this); m_context_stack.pop(); p_function.setSymbolTable(m_symbol_manager.getCurrentTable()); m_returned_type_stack.pop(); m_context_stack.pop(); m_symbol_manager.popScope(); } void SemanticAnalyzer::visit(CompoundStatementNode &p_compound_statement) { m_symbol_manager.pushScope(); m_context_stack.push(SemanticContext::kLocal); p_compound_statement.visitChildNodes(*this); p_compound_statement.setSymbolTable(m_symbol_manager.getCurrentTable()); m_context_stack.pop(); m_symbol_manager.popScope(); } static bool validatePrintTarget(const PrintNode &p_print) { const auto *const target_type_ptr = p_print.getTarget().getInferredType(); if (!target_type_ptr) { return false; } if (!target_type_ptr->isScalar()) { logSemanticError(p_print.getTarget().getLocation(), "expression of print statement must be scalar type"); return false; } return true; } void SemanticAnalyzer::visit(PrintNode &p_print) { p_print.visitChildNodes(*this); if (!validatePrintTarget(p_print)) { m_has_error = true; } } static bool validateOperandsInArithmeticOp(const Operator op, const PType *const p_left_type, const PType *const p_right_type) { if (op == Operator::kPlusOp && p_left_type->isString() && p_right_type->isString()) { return true; } if ((p_left_type->isInteger() || p_left_type->isReal()) && (p_right_type->isInteger() || p_right_type->isReal())) { return true; } return false; } static bool validateOperandsInModOp(const PType *const p_left_type, const PType *const p_right_type) { return p_left_type->isInteger() && p_right_type->isInteger(); } static bool validateOperandsInBooleanOp(const PType *const p_left_type, const PType *const p_right_type) { return p_left_type->isBool() && p_right_type->isBool(); } static bool validateOperandsInRelationalOp(const PType *const p_left_type, const PType *const p_right_type) { return (p_left_type->isInteger() || p_left_type->isReal()) && (p_right_type->isInteger() || p_right_type->isReal()); } static bool validateBinaryOperands(BinaryOperatorNode &p_bin_op) { const auto *left_type_ptr = p_bin_op.getLeftOperand().getInferredType(); const auto *right_type_ptr = p_bin_op.getRightOperand().getInferredType(); if (left_type_ptr == nullptr || right_type_ptr == nullptr) { return false; } switch (p_bin_op.getOp()) { case Operator::kPlusOp: case Operator::kMinusOp: case Operator::kMultiplyOp: case Operator::kDivideOp: if (validateOperandsInArithmeticOp(p_bin_op.getOp(), left_type_ptr, right_type_ptr)) { return true; } break; case Operator::kModOp: if (validateOperandsInModOp(left_type_ptr, right_type_ptr)) { return true; } break; case Operator::kAndOp: case Operator::kOrOp: if (validateOperandsInBooleanOp(left_type_ptr, right_type_ptr)) { return true; } break; case Operator::kLessOp: case Operator::kLessOrEqualOp: case Operator::kEqualOp: case Operator::kGreaterOp: case Operator::kGreaterOrEqualOp: case Operator::kNotEqualOp: if (validateOperandsInRelationalOp(left_type_ptr, right_type_ptr)) { return true; } break; default: assert(false && "unknown binary op or unary op"); } logSemanticError(p_bin_op.getLocation(), "invalid operands to binary operator '%s' ('%s' and '%s')", p_bin_op.getOpCString(), left_type_ptr->getPTypeCString(), right_type_ptr->getPTypeCString()); return false; } static void setBinaryOpInferredType(BinaryOperatorNode &p_bin_op) { switch (p_bin_op.getOp()) { case Operator::kPlusOp: case Operator::kMinusOp: case Operator::kMultiplyOp: case Operator::kDivideOp: if (p_bin_op.getLeftOperand().getInferredType()->isString()) { p_bin_op.setInferredType( new PType(PType::PrimitiveTypeEnum::kStringType)); return; } if (p_bin_op.getLeftOperand().getInferredType()->isReal() || p_bin_op.getRightOperand().getInferredType()->isReal()) { p_bin_op.setInferredType( new PType(PType::PrimitiveTypeEnum::kRealType)); return; } case Operator::kModOp: p_bin_op.setInferredType( new PType(PType::PrimitiveTypeEnum::kIntegerType)); return; case Operator::kAndOp: case Operator::kOrOp: p_bin_op.setInferredType( new PType(PType::PrimitiveTypeEnum::kBoolType)); return; case Operator::kLessOp: case Operator::kLessOrEqualOp: case Operator::kEqualOp: case Operator::kGreaterOp: case Operator::kGreaterOrEqualOp: case Operator::kNotEqualOp: p_bin_op.setInferredType( new PType(PType::PrimitiveTypeEnum::kBoolType)); return; default: assert(false && "unknown binary op or unary op"); } } void SemanticAnalyzer::visit(BinaryOperatorNode &p_bin_op) { p_bin_op.visitChildNodes(*this); if (!validateBinaryOperands(p_bin_op)) { m_has_error = true; return; } setBinaryOpInferredType(p_bin_op); } static bool validateUnaryOperand(const UnaryOperatorNode &p_un_op) { const auto *const operand_type = p_un_op.getOperand().getInferredType(); if (!operand_type) { return false; } switch (p_un_op.getOp()) { case Operator::kNegOp: if (operand_type->isInteger() || operand_type->isReal()) { return true; } break; case Operator::kNotOp: if (operand_type->isBool()) { return true; } break; default: assert(false && "unknown binary op or unary op"); } logSemanticError(p_un_op.getLocation(), "invalid operand to unary operator '%s' ('%s')", p_un_op.getOpCString(), operand_type->getPTypeCString()); return false; } static void setUnaryOpInferredType(UnaryOperatorNode &p_un_op) { switch (p_un_op.getOp()) { case Operator::kNegOp: p_un_op.setInferredType(new PType( p_un_op.getOperand().getInferredType()->getPrimitiveType())); return; case Operator::kNotOp: p_un_op.setInferredType(new PType(PType::PrimitiveTypeEnum::kBoolType)); return; default: assert(false && "unknown binary op or unary op"); } } void SemanticAnalyzer::visit(UnaryOperatorNode &p_un_op) { p_un_op.visitChildNodes(*this); if (!validateUnaryOperand(p_un_op)) { m_has_error = true; return; } setUnaryOpInferredType(p_un_op); } static const SymbolEntry * checkSymbolExistence(const SymbolManager &p_symbol_manager, const std::string &p_name, const Location &p_location) { const auto *entry = p_symbol_manager.lookup(p_name); if (entry == nullptr) { logSemanticError(p_location, "use of undeclared symbol '%s'", p_name.c_str()); } return entry; } static bool validateFunctionInvocationKind( const SymbolEntry::KindEnum kind, const FunctionInvocationNode &p_func_invocation) { if (kind != SymbolEntry::KindEnum::kFunctionKind) { logSemanticError(p_func_invocation.getLocation(), "call of non-function symbol '%s'", p_func_invocation.getNameCString()); return false; } return true; } static bool validateArguments(const SymbolEntry *const p_entry, const FunctionInvocationNode &p_func_invocation) { const auto &parameters = *p_entry->getAttribute().parameters(); const auto &arguments = p_func_invocation.getArguments(); if (arguments.size() != FunctionNode::getParametersNum(parameters)) { logSemanticError(p_func_invocation.getLocation(), "too few/much arguments provided for function '%s'", p_func_invocation.getNameCString()); return false; } FunctionInvocationNode::ExprNodes::const_iterator argument_iter = arguments.begin(); for (const auto &parameter : parameters) { const auto &variables = parameter->getVariables(); for (const auto &variable : variables) { auto *expr_type_ptr = (*argument_iter)->getInferredType(); if (!expr_type_ptr) { return false; } if (!expr_type_ptr->compare(variable->getTypePtr())) { logSemanticError( (*argument_iter)->getLocation(), "incompatible type passing '%s' to parameter of type '%s'", expr_type_ptr->getPTypeCString(), variable->getTypePtr()->getPTypeCString()); return false; } argument_iter++; } } return true; } static void setFuncInvocationInferredType(FunctionInvocationNode &p_func_invocation, const SymbolEntry *p_entry) { p_func_invocation.setInferredType( new PType(p_entry->getTypePtr()->getPrimitiveType())); } void SemanticAnalyzer::visit(FunctionInvocationNode &p_func_invocation) { p_func_invocation.visitChildNodes(*this); const SymbolEntry *entry = nullptr; if ((entry = checkSymbolExistence( m_symbol_manager, p_func_invocation.getName(), p_func_invocation.getLocation())) == nullptr) { m_has_error = true; return; } if (!validateFunctionInvocationKind(entry->getKind(), p_func_invocation)) { m_has_error = true; return; } if (!validateArguments(entry, p_func_invocation)) { m_has_error = true; return; } setFuncInvocationInferredType(p_func_invocation, entry); } static bool validateVariableKind(const SymbolEntry::KindEnum kind, const VariableReferenceNode &p_variable_ref) { if (kind != SymbolEntry::KindEnum::kParameterKind && kind != SymbolEntry::KindEnum::kVariableKind && kind != SymbolEntry::KindEnum::kLoopVarKind && kind != SymbolEntry::KindEnum::kConstantKind) { logSemanticError(p_variable_ref.getLocation(), "use of non-variable symbol '%s'", p_variable_ref.getNameCString()); return false; } return true; } static bool validateArrayReference(const VariableReferenceNode &p_variable_ref) { for (const auto &index : p_variable_ref.getIndices()) { if (index->getInferredType() == nullptr) { return false; } if (!index->getInferredType()->isInteger()) { logSemanticError(index->getLocation(), "index of array reference must be an integer"); return false; } } return true; } static bool validateArraySubscriptNum(const PType *p_var_type, const VariableReferenceNode &p_variable_ref) { if (p_variable_ref.getIndices().size() > p_var_type->getDimensions().size()) { logSemanticError(p_variable_ref.getLocation(), "there is an over array subscript on '%s'", p_variable_ref.getNameCString()); return false; } return true; } void SemanticAnalyzer::visit(VariableReferenceNode &p_variable_ref) { p_variable_ref.visitChildNodes(*this); const SymbolEntry *entry = nullptr; if ((entry = checkSymbolExistence(m_symbol_manager, p_variable_ref.getName(), p_variable_ref.getLocation())) == nullptr) { return; } if (!validateVariableKind(entry->getKind(), p_variable_ref)) { return; } if (m_error_entry_set.find(const_cast<SymbolEntry *>(entry)) != m_error_entry_set.end()) { return; } if (!validateArrayReference(p_variable_ref)) { return; } if (!validateArraySubscriptNum(entry->getTypePtr(), p_variable_ref)) { return; } p_variable_ref.setInferredType(entry->getTypePtr()->getStructElementType( p_variable_ref.getIndices().size())); } static bool validateAssignmentLvalue(const AssignmentNode &p_assignment, const SymbolManager &p_symbol_manager, const bool is_in_for_loop) { const auto &lvalue = p_assignment.getLvalue(); const auto *const lvalue_type_ptr = lvalue.getInferredType(); if (!lvalue_type_ptr) { return false; } if (!lvalue_type_ptr->isScalar()) { logSemanticError(lvalue.getLocation(), "array assignment is not allowed"); return false; } const auto *const entry = p_symbol_manager.lookup(lvalue.getName()); if (entry->getKind() == SymbolEntry::KindEnum::kConstantKind) { logSemanticError(lvalue.getLocation(), "cannot assign to variable '%s' which is a constant", lvalue.getNameCString()); return false; } if (!is_in_for_loop && entry->getKind() == SymbolEntry::KindEnum::kLoopVarKind) { logSemanticError(lvalue.getLocation(), "the value of loop variable cannot be modified inside " "the loop body"); return false; } return true; } static bool validateAssignmentExpr(const AssignmentNode &p_assignment) { const auto &expr = p_assignment.getExpr(); const auto *const expr_type_ptr = expr.getInferredType(); if (!expr_type_ptr) { return false; } if (!expr_type_ptr->isScalar()) { logSemanticError(expr.getLocation(), "array assignment is not allowed"); return false; } const auto *const lvalue_type_ptr = p_assignment.getLvalue().getInferredType(); if (!lvalue_type_ptr->compare(expr_type_ptr)) { logSemanticError(p_assignment.getLocation(), "assigning to '%s' from incompatible type '%s'", lvalue_type_ptr->getPTypeCString(), expr_type_ptr->getPTypeCString()); return false; } return true; } void SemanticAnalyzer::visit(AssignmentNode &p_assignment) { p_assignment.visitChildNodes(*this); if (!validateAssignmentLvalue(p_assignment, m_symbol_manager, isInForLoop())) { m_has_error = true; return; } if (!validateAssignmentExpr(p_assignment)) { m_has_error = true; return; } } static bool validateReadTarget(const ReadNode &p_read, const SymbolManager &p_symbol_manager) { const auto *const target_type_ptr = p_read.getTarget().getInferredType(); if (!target_type_ptr) { return false; } if (!target_type_ptr->isScalar()) { logSemanticError( p_read.getTarget().getLocation(), "variable reference of read statement must be scalar type"); return false; } const auto *const entry = p_symbol_manager.lookup(p_read.getTarget().getName()); assert(entry && "Shouldn't reach here. This should be catched during the" "visits of child nodes"); if (entry->getKind() == SymbolEntry::KindEnum::kConstantKind || entry->getKind() == SymbolEntry::KindEnum::kLoopVarKind) { logSemanticError(p_read.getTarget().getLocation(), "variable reference of read statement cannot be a " "constant or loop variable"); return false; } return true; } void SemanticAnalyzer::visit(ReadNode &p_read) { p_read.visitChildNodes(*this); if (!validateReadTarget(p_read, m_symbol_manager)) { m_has_error = true; } } static bool validateConditionExpr(const ExpressionNode &p_condition) { const auto *const type_ptr = p_condition.getInferredType(); if (!type_ptr) { return false; } if (!type_ptr->isBool()) { logSemanticError(p_condition.getLocation(), "the expression of condition must be boolean type"); return false; } return true; } void SemanticAnalyzer::visit(IfNode &p_if) { p_if.visitChildNodes(*this); if (!validateConditionExpr(p_if.getCondition())) { m_has_error = true; } } void SemanticAnalyzer::visit(WhileNode &p_while) { p_while.visitChildNodes(*this); if (!validateConditionExpr(p_while.getCondition())) { m_has_error = true; } } static bool validateForLoopBound(const ForNode &p_for) { auto initial_value = p_for.getLowerBound().getConstantPtr()->integer(); auto condition_value = p_for.getUpperBound().getConstantPtr()->integer(); if (initial_value >= condition_value) { logSemanticError(p_for.getLocation(), "the lower bound and upper bound of iteration count " "must be in the incremental order"); return false; } return true; } void SemanticAnalyzer::visit(ForNode &p_for) { m_symbol_manager.pushScope(); m_context_stack.push(SemanticContext::kForLoop); p_for.visitChildNodes(*this); if (!validateForLoopBound(p_for)) { m_has_error = true; } p_for.setSymbolTable(m_symbol_manager.getCurrentTable()); m_context_stack.pop(); m_symbol_manager.popScope(); } static bool validateReturnValueType(const ExpressionNode &p_retval, const PType *const p_expected_return_type) { const auto *const retval_type_ptr = p_retval.getInferredType(); if (!retval_type_ptr) { return false; } if (!p_expected_return_type->compare(retval_type_ptr)) { logSemanticError(p_retval.getLocation(), "return '%s' from a function with return type '%s'", retval_type_ptr->getPTypeCString(), p_expected_return_type->getPTypeCString()); return false; } return true; } void SemanticAnalyzer::visit(ReturnNode &p_return) { p_return.visitChildNodes(*this); const auto *const expected_return_type_ptr = m_returned_type_stack.top(); if (expected_return_type_ptr->isVoid()) { logSemanticError(p_return.getLocation(), "program/procedure should not return a value"); m_has_error = true; return; } if (!validateReturnValueType(p_return.getReturnValue(), expected_return_type_ptr)) { m_has_error = true; return; } }
31.741848
80
0.62653
LittleLaGi
036814d1a97748599afba9b31b875766beed3e52
1,204
cpp
C++
networkit/cpp/io/ThrillGraphBinaryWriter.cpp
tsapko3628/networkit
2953c9f30b676f930e301953f00f014c47edcf69
[ "MIT" ]
1
2019-08-15T10:35:07.000Z
2019-08-15T10:35:07.000Z
networkit/cpp/io/ThrillGraphBinaryWriter.cpp
tsapko3628/networkit
2953c9f30b676f930e301953f00f014c47edcf69
[ "MIT" ]
null
null
null
networkit/cpp/io/ThrillGraphBinaryWriter.cpp
tsapko3628/networkit
2953c9f30b676f930e301953f00f014c47edcf69
[ "MIT" ]
null
null
null
/* * ThrillGraphBinaryWriter.hpp * * @author Michael Hamann <michael.hamann@kit.edu> */ #include <fstream> #include <networkit/io/ThrillGraphBinaryWriter.hpp> namespace NetworKit { void ThrillGraphBinaryWriter::write(const Graph &G, const std::string &path) { if (G.upperNodeIdBound() > std::numeric_limits<uint32_t>::max()) { throw std::runtime_error("Thrill binary graphs only support graphs with up to 2^32-1 nodes."); } std::ofstream out_stream(path, std::ios::trunc | std::ios::binary); std::vector<uint32_t> neighbors; for (node u = 0; u < G.upperNodeIdBound(); ++u) { neighbors.clear(); if (G.hasNode(u)) { G.forEdgesOf(u, [&](node v) { if (u <= v) { neighbors.push_back(v); } }); } size_t deg = neighbors.size(); // Write variable length int for the degree if(!deg) { out_stream << uint8_t(0); } while(deg) { size_t u = deg & 0x7F; deg >>= 7; out_stream << uint8_t(u | (deg ? 0x80 : 0)); } for (uint32_t v : neighbors) { // write neighbor as little endian for (size_t i = 0; i < sizeof(uint32_t); ++i) { out_stream << uint8_t(v); v >>= 8; } } } out_stream.close(); } } // namespace NetworKit
20.758621
96
0.620432
tsapko3628
0368abdcaa74444faedefb6f776d1dc78de63cb1
1,946
hpp
C++
modules/viewer/src/Viewer/gmPointListModel.hpp
GraphMIC/GraphMIC
8fc2aeb0143ee1292c6757f010fc9e8c68823e2b
[ "BSD-3-Clause" ]
43
2016-04-11T11:34:05.000Z
2022-03-31T03:37:57.000Z
modules/viewer/src/Viewer/gmPointListModel.hpp
kevinlq/GraphMIC
8fc2aeb0143ee1292c6757f010fc9e8c68823e2b
[ "BSD-3-Clause" ]
1
2016-05-17T12:58:16.000Z
2016-05-17T12:58:16.000Z
modules/viewer/src/Viewer/gmPointListModel.hpp
kevinlq/GraphMIC
8fc2aeb0143ee1292c6757f010fc9e8c68823e2b
[ "BSD-3-Clause" ]
14
2016-05-13T20:23:16.000Z
2021-12-20T10:33:19.000Z
#pragma once #include "gmViewerExport.hpp" #include "mitkDataNode.h" #include "mitkPointSet.h" #include <QAbstractListModel> namespace gm { namespace ViewItem { class GM_VIEWER_EXPORT PointListModel: public QAbstractListModel { Q_OBJECT protected: mitk::DataNode* m_pointSetNode; unsigned int m_pointSetModifiedObserverTag; unsigned int m_pointSetDeletedObserverTag; int m_timeStep; public: PointListModel( mitk::DataNode* = NULL, int t = 0, QObject* parent = 0 ); ~PointListModel(); int rowCount( const QModelIndex& parent = QModelIndex() ) const override; QVariant data(const QModelIndex& index, int role) const override; QVariant headerData(int section, Qt::Orientation orientation, int role = Qt::DisplayRole) const override; auto setPointSetNode(mitk::DataNode* pointSetNode) -> void; auto getPointSet() -> const mitk::PointSet*; auto setTimeStep(int t) -> void; auto getTimeStep() -> const int; auto onPointSetChanged(const itk::EventObject &e) -> void; auto onPointSetDeleted(const itk::EventObject &e) -> void; auto getPointForModelIndex(const QModelIndex &index, mitk::PointSet::PointType &p, mitk::PointSet::PointIdentifier &id) const -> bool; auto getModelIndexForPointID(mitk::PointSet::PointIdentifier id, QModelIndex &index) const -> bool ; public slots: void moveSelectedPointUp(); void moveSelectedPointDown(); void removeSelectedPoint(); signals: void signalUpdateSelection(); protected: auto observeNewPointSet(mitk::DataNode* pointSetNode) -> void; auto checkForPointSetInNode(mitk::DataNode* node) const -> mitk::PointSet::Pointer; }; } }
39.714286
146
0.63001
GraphMIC
036a8c4921bc8c9deb1b7043bd6ebf94059d9ef3
2,525
cpp
C++
Visual Mercutio/zModelBP/PSS_RiskProbabilityContainer.cpp
Jeanmilost/Visual-Mercutio
f079730005b6ce93d5e184bb7c0893ccced3e3ab
[ "MIT" ]
1
2022-01-31T06:24:24.000Z
2022-01-31T06:24:24.000Z
Visual Mercutio/zModelBP/PSS_RiskProbabilityContainer.cpp
Jeanmilost/Visual-Mercutio
f079730005b6ce93d5e184bb7c0893ccced3e3ab
[ "MIT" ]
2
2021-04-11T15:50:42.000Z
2021-06-05T08:23:04.000Z
Visual Mercutio/zModelBP/PSS_RiskProbabilityContainer.cpp
Jeanmilost/Visual-Mercutio
f079730005b6ce93d5e184bb7c0893ccced3e3ab
[ "MIT" ]
2
2021-01-08T00:55:18.000Z
2022-01-31T06:24:18.000Z
/**************************************************************************** * ==> PSS_RiskProbabilityContainer ----------------------------------------* **************************************************************************** * Description : Provides a risk probability container * * Developer : Processsoft * ****************************************************************************/ #include "stdafx.h" #include "PSS_RiskProbabilityContainer.h" // processsoft #include "zBaseLib\PSS_TextFile.h" #ifdef _DEBUG #define new DEBUG_NEW #undef THIS_FILE static char THIS_FILE[] = __FILE__; #endif //--------------------------------------------------------------------------- // PSS_RiskProbabilityContainer //--------------------------------------------------------------------------- PSS_RiskProbabilityContainer::PSS_RiskProbabilityContainer() : CObject() {} //--------------------------------------------------------------------------- PSS_RiskProbabilityContainer::~PSS_RiskProbabilityContainer() { RemoveAllElements(); } //--------------------------------------------------------------------------- BOOL PSS_RiskProbabilityContainer::LoadFile(const CString& fileName) { if (fileName.IsEmpty()) return FALSE; m_FileName = fileName; PSS_TextFile textFile; if (!textFile.OpenRead(m_FileName)) return FALSE; BOOL endReached = FALSE; CString text; while (!endReached) { textFile >> text; if (!text.IsEmpty()) m_Set.Add(text); else endReached = TRUE; } textFile.CloseFile(); return TRUE; } //--------------------------------------------------------------------------- CString PSS_RiskProbabilityContainer::GetFileName() const { return m_FileName; } //--------------------------------------------------------------------------- CStringArray* PSS_RiskProbabilityContainer::GetElementsArray() { return &m_Set; } //--------------------------------------------------------------------------- CString PSS_RiskProbabilityContainer::GetElementAt(std::size_t index) const { if (index < GetElementCount()) return m_Set.GetAt(index); return _T(""); } //--------------------------------------------------------------------------- void PSS_RiskProbabilityContainer::RemoveAllElements() { m_Set.RemoveAll(); } //---------------------------------------------------------------------------
29.705882
78
0.406337
Jeanmilost
036b71e2cb216c6ba9b3abdfebc3a217827c5242
1,078
cpp
C++
tests/Helpers/Helpers.cpp
matheuspf/handy
3c33c2bfc947567d1be483cf1b5ad63716479357
[ "MIT" ]
4
2018-08-06T12:26:43.000Z
2020-09-11T09:59:07.000Z
tests/Helpers/Helpers.cpp
matheuspf/Handy
3c33c2bfc947567d1be483cf1b5ad63716479357
[ "MIT" ]
2
2020-03-24T00:57:46.000Z
2021-02-02T04:53:27.000Z
tests/Helpers/Helpers.cpp
matheuspf/Handy
3c33c2bfc947567d1be483cf1b5ad63716479357
[ "MIT" ]
1
2017-12-05T18:33:22.000Z
2017-12-05T18:33:22.000Z
#include "handy/Helpers/Helpers.h" #include "gtest/gtest.h" #include <fstream> #include <sstream> #include <vector> namespace { TEST(HelpersTest, IsInheritedTest) { struct A {}; struct B : A {}; struct C {}; struct D : B {}; EXPECT_EQ((handy::IsInherited<B, A>::value), true); EXPECT_EQ((handy::IsInherited<C, A>::value), false); EXPECT_EQ((handy::IsInherited<C, B>::value), false); EXPECT_EQ((handy::IsInherited<D, B>::value), true); EXPECT_EQ((handy::IsInherited<D, A>::value), true); EXPECT_EQ((handy::IsInherited<A, A>::value), true); EXPECT_EQ((handy::IsInherited<B, B>::value), true); EXPECT_EQ((handy::IsInherited<C, C>::value), true); EXPECT_EQ((handy::IsInherited<D, D>::value), true); } TEST(HelpersTest, GetArgTest) { EXPECT_EQ((std::is_same<handy::GetArg_t<1, int, char, double>, char>::value), true); EXPECT_EQ((std::is_same<handy::GetArg_t<0, int, char, double>, char>::value), false); EXPECT_EQ((std::is_same<handy::GetArg_t<2, int, char, double>, double>::value), true); } }
21.56
90
0.636364
matheuspf
0371babcf570722a9dbfa507437e132a9ae3af21
10,211
cpp
C++
tests/Unit/PointwiseFunctions/AnalyticSolutions/GeneralRelativity/Test_KerrSchild.cpp
macedo22/spectre
97b2b7ae356cf86830258cb5f689f1191fdb6ddd
[ "MIT" ]
1
2018-10-01T06:07:16.000Z
2018-10-01T06:07:16.000Z
tests/Unit/PointwiseFunctions/AnalyticSolutions/GeneralRelativity/Test_KerrSchild.cpp
macedo22/spectre
97b2b7ae356cf86830258cb5f689f1191fdb6ddd
[ "MIT" ]
4
2018-06-04T20:26:40.000Z
2018-07-27T14:54:55.000Z
tests/Unit/PointwiseFunctions/AnalyticSolutions/GeneralRelativity/Test_KerrSchild.cpp
macedo22/spectre
97b2b7ae356cf86830258cb5f689f1191fdb6ddd
[ "MIT" ]
null
null
null
// Distributed under the MIT License. // See LICENSE.txt for details. #include "Framework/TestingFramework.hpp" #include <algorithm> #include <array> #include <cstddef> #include <limits> #include <string> #include <type_traits> #include "DataStructures/DataBox/Prefixes.hpp" #include "DataStructures/DataVector.hpp" #include "DataStructures/Tensor/EagerMath/Magnitude.hpp" #include "DataStructures/Tensor/Tensor.hpp" #include "Framework/TestCreation.hpp" #include "Framework/TestHelpers.hpp" #include "Helpers/PointwiseFunctions/AnalyticSolutions/GeneralRelativity/VerifyGrSolution.hpp" #include "Helpers/PointwiseFunctions/AnalyticSolutions/TestHelpers.hpp" #include "NumericalAlgorithms/LinearOperators/PartialDerivatives.tpp" #include "PointwiseFunctions/AnalyticSolutions/GeneralRelativity/KerrSchild.hpp" #include "PointwiseFunctions/GeneralRelativity/Tags.hpp" #include "Utilities/ConstantExpressions.hpp" #include "Utilities/MakeWithValue.hpp" #include "Utilities/TMPL.hpp" #include "Utilities/TaggedTuple.hpp" // IWYU pragma: no_forward_declare Tags::deriv namespace { template <typename Frame, typename DataType> tnsr::I<DataType, 3, Frame> spatial_coords( const DataType& used_for_size) noexcept { auto x = make_with_value<tnsr::I<DataType, 3, Frame>>(used_for_size, 0.0); get<0>(x) = 1.32; get<1>(x) = 0.82; get<2>(x) = 1.24; return x; } template <typename Frame, typename DataType> void test_schwarzschild(const DataType& used_for_size) noexcept { // Schwarzschild solution is: // H = M/r // l_mu = (1,x/r,y/r,z/r) // lapse = (1+2M/r)^{-1/2} // d_lapse = (1+2M/r)^{-3/2}(Mx^i/r^3) // shift^i = (2Mx^i/r^2) / lapse^2 // g_{ij} = delta_{ij} + 2 M x_i x_j/r^3 // d_i H = -Mx_i/r^3 // d_i l_j = delta_{ij}/r - x^i x^j/r^3 // d_k g_ij = -6M x_i x_j x_k/r^5 + 2 M x_i delta_{kj}/r^3 // + 2 M x_j delta_{ki}/r^3 // Parameters for KerrSchild solution const double mass = 1.01; const std::array<double, 3> spin{{0.0, 0.0, 0.0}}; const std::array<double, 3> center{{0.0, 0.0, 0.0}}; const auto x = spatial_coords<Frame>(used_for_size); const double t = 1.3; // Evaluate solution gr::Solutions::KerrSchild solution(mass, spin, center); const auto vars = solution.variables( x, t, typename gr::Solutions::KerrSchild::tags<DataType, Frame>{}); const auto& lapse = get<gr::Tags::Lapse<DataType>>(vars); const auto& dt_lapse = get<Tags::dt<gr::Tags::Lapse<DataType>>>(vars); const auto& d_lapse = get<typename gr::Solutions::KerrSchild::DerivLapse<DataType, Frame>>( vars); const auto& shift = get<gr::Tags::Shift<3, Frame, DataType>>(vars); const auto& d_shift = get<typename gr::Solutions::KerrSchild::DerivShift<DataType, Frame>>( vars); const auto& dt_shift = get<Tags::dt<gr::Tags::Shift<3, Frame, DataType>>>(vars); const auto& g = get<gr::Tags::SpatialMetric<3, Frame, DataType>>(vars); const auto& dt_g = get<Tags::dt<gr::Tags::SpatialMetric<3, Frame, DataType>>>(vars); const auto& d_g = get< typename gr::Solutions::KerrSchild::DerivSpatialMetric<DataType, Frame>>( vars); // Check those quantities that should be zero. const auto zero = make_with_value<DataType>(x, 0.); CHECK(dt_lapse.get() == zero); for (size_t i = 0; i < 3; ++i) { CHECK(dt_shift.get(i) == zero); for (size_t j = 0; j < 3; ++j) { CHECK(dt_g.get(i, j) == zero); } } const DataType r = get(magnitude(x)); const DataType one_over_r_squared = 1.0 / square(r); const DataType one_over_r_cubed = 1.0 / cube(r); const DataType one_over_r_fifth = one_over_r_squared * one_over_r_cubed; auto expected_lapse = make_with_value<Scalar<DataType>>(x, 0.0); get(expected_lapse) = 1.0 / sqrt(1.0 + 2.0 * mass / r); CHECK_ITERABLE_APPROX(lapse, expected_lapse); auto expected_d_lapse = make_with_value<tnsr::i<DataType, 3, Frame>>(x, 0.0); for (size_t i = 0; i < 3; ++i) { expected_d_lapse.get(i) = mass * x.get(i) * one_over_r_cubed * cube(get(lapse)); } CHECK_ITERABLE_APPROX(d_lapse, expected_d_lapse); auto expected_shift = make_with_value<tnsr::I<DataType, 3, Frame>>(x, 0.0); for (size_t i = 0; i < 3; ++i) { expected_shift.get(i) = 2.0 * mass * x.get(i) * one_over_r_squared * square(get(lapse)); } CHECK_ITERABLE_APPROX(shift, expected_shift); auto expected_d_shift = make_with_value<tnsr::iJ<DataType, 3, Frame>>(x, 0.0); for (size_t j = 0; j < 3; ++j) { expected_d_shift.get(j, j) = 2.0 * mass * one_over_r_squared * square(get(lapse)); for (size_t i = 0; i < 3; ++i) { expected_d_shift.get(j, i) -= 4.0 * mass * x.get(j) * x.get(i) * square(one_over_r_squared) * square(get(lapse)) * (1 - mass / r * square(get(lapse))); } } CHECK_ITERABLE_APPROX(d_shift, expected_d_shift); auto expected_g = make_with_value<tnsr::ii<DataType, 3, Frame>>(x, 0.0); for (size_t i = 0; i < 3; ++i) { for (size_t j = i; j < 3; ++j) { expected_g.get(i, j) = 2.0 * mass * x.get(i) * x.get(j) * one_over_r_cubed; } expected_g.get(i, i) += 1.0; } CHECK_ITERABLE_APPROX(g, expected_g); auto expected_d_g = make_with_value<tnsr::ijj<DataType, 3, Frame>>(x, 0.0); for (size_t k = 0; k < 3; ++k) { for (size_t i = 0; i < 3; ++i) { for (size_t j = i; j < 3; ++j) { // Symmetry expected_d_g.get(k, i, j) = -6.0 * mass * x.get(i) * x.get(j) * x.get(k) * one_over_r_fifth; if (k == j) { expected_d_g.get(k, i, j) += 2.0 * mass * x.get(i) * one_over_r_cubed; } if (k == i) { expected_d_g.get(k, i, j) += 2.0 * mass * x.get(j) * one_over_r_cubed; } } } } CHECK_ITERABLE_APPROX(d_g, expected_d_g); } template <typename Frame, typename DataType> void test_tag_retrieval(const DataType& used_for_size) noexcept { // Parameters for KerrSchild solution const double mass = 1.234; const std::array<double, 3> spin{{0.1, -0.2, 0.3}}; const std::array<double, 3> center{{1.0, 2.0, 3.0}}; const auto x = spatial_coords<Frame>(used_for_size); const double t = 1.3; // Evaluate solution const gr::Solutions::KerrSchild solution(mass, spin, center); TestHelpers::AnalyticSolutions::test_tag_retrieval( solution, x, t, typename gr::Solutions::KerrSchild::template tags<DataType, Frame>{}); } template <typename Frame> void test_einstein_solution() noexcept { // Parameters // ...for KerrSchild solution const double mass = 1.7; const std::array<double, 3> spin{{0.1, 0.2, 0.3}}; const std::array<double, 3> center{{0.3, 0.2, 0.4}}; // ...for grid const std::array<double, 3> lower_bound{{0.82, 1.24, 1.32}}; const double time = -2.8; gr::Solutions::KerrSchild solution(mass, spin, center); TestHelpers::VerifyGrSolution::verify_consistency( solution, time, tnsr::I<double, 3, Frame>{lower_bound}, 0.01, 1.0e-10); if constexpr (std::is_same_v<Frame, ::Frame::Inertial>) { // Don't look at time-independent solution in other than the inertial // frame. const size_t grid_size = 8; const std::array<double, 3> upper_bound{{0.8, 1.22, 1.30}}; TestHelpers::VerifyGrSolution::verify_time_independent_einstein_solution( solution, grid_size, lower_bound, upper_bound, std::numeric_limits<double>::epsilon() * 1.e5); } } void test_serialize() noexcept { gr::Solutions::KerrSchild solution(3.0, {{0.2, 0.3, 0.2}}, {{0.0, 3.0, 4.0}}); test_serialization(solution); } void test_copy_and_move() noexcept { gr::Solutions::KerrSchild solution(3.0, {{0.2, 0.3, 0.2}}, {{0.0, 3.0, 4.0}}); test_copy_semantics(solution); auto solution_copy = solution; // clang-tidy: std::move of trivially copyable type test_move_semantics(std::move(solution), solution_copy); // NOLINT } void test_construct_from_options() { const auto created = TestHelpers::test_creation<gr::Solutions::KerrSchild>( "Mass: 0.5\n" "Spin: [0.1,0.2,0.3]\n" "Center: [1.0,3.0,2.0]"); CHECK(created == gr::Solutions::KerrSchild(0.5, {{0.1, 0.2, 0.3}}, {{1.0, 3.0, 2.0}})); } } // namespace SPECTRE_TEST_CASE("Unit.PointwiseFunctions.AnalyticSolutions.Gr.KerrSchild", "[PointwiseFunctions][Unit]") { test_copy_and_move(); test_serialize(); test_construct_from_options(); test_schwarzschild<Frame::Inertial>(DataVector(5)); test_schwarzschild<Frame::Inertial>(0.0); test_tag_retrieval<Frame::Inertial>(DataVector(5)); test_tag_retrieval<Frame::Inertial>(0.0); test_einstein_solution<Frame::Inertial>(); test_schwarzschild<Frame::Grid>(DataVector(5)); test_schwarzschild<Frame::Grid>(0.0); test_tag_retrieval<Frame::Grid>(DataVector(5)); test_tag_retrieval<Frame::Grid>(0.0); test_einstein_solution<Frame::Grid>(); } // [[OutputRegex, Spin magnitude must be < 1]] SPECTRE_TEST_CASE("Unit.PointwiseFunctions.AnalyticSolutions.Gr.KerrSchildSpin", "[PointwiseFunctions][Unit]") { ERROR_TEST(); gr::Solutions::KerrSchild solution(1.0, {{1.0, 1.0, 1.0}}, {{0.0, 0.0, 0.0}}); } // [[OutputRegex, Mass must be non-negative]] SPECTRE_TEST_CASE("Unit.PointwiseFunctions.AnalyticSolutions.Gr.KerrSchildMass", "[PointwiseFunctions][Unit]") { ERROR_TEST(); gr::Solutions::KerrSchild solution(-1.0, {{0.0, 0.0, 0.0}}, {{0.0, 0.0, 0.0}}); } // [[OutputRegex, In string:.*At line 2 column 9:.Value -0.5 is below the lower // bound of 0]] SPECTRE_TEST_CASE("Unit.PointwiseFunctions.AnalyticSolutions.Gr.KerrSchildOptM", "[PointwiseFunctions][Unit]") { ERROR_TEST(); TestHelpers::test_creation<gr::Solutions::KerrSchild>( "Mass: -0.5\n" "Spin: [0.1,0.2,0.3]\n" "Center: [1.0,3.0,2.0]"); } // [[OutputRegex, In string:.*At line 2 column 3:.Spin magnitude must be < 1]] SPECTRE_TEST_CASE("Unit.PointwiseFunctions.AnalyticSolutions.Gr.KerrSchildOptS", "[PointwiseFunctions][Unit]") { ERROR_TEST(); TestHelpers::test_creation<gr::Solutions::KerrSchild>( "Mass: 0.5\n" "Spin: [1.1,0.9,0.3]\n" "Center: [1.0,3.0,2.0]"); }
36.730216
94
0.652042
macedo22
037310778e911323870cd8107f3ecc37a31bddd0
639
cpp
C++
core/bookmarks/cbookmark.cpp
VioletGiraffe/FasterThanSight
f23d2e4a3e4f8abcee3d4691dbb35a0823da56e3
[ "MIT" ]
34
2016-06-13T18:38:54.000Z
2022-02-21T00:04:54.000Z
core/bookmarks/cbookmark.cpp
probonopd/FasterThanSight
f23d2e4a3e4f8abcee3d4691dbb35a0823da56e3
[ "MIT" ]
54
2016-05-20T07:38:51.000Z
2019-03-15T17:23:09.000Z
core/bookmarks/cbookmark.cpp
probonopd/FasterThanSight
f23d2e4a3e4f8abcee3d4691dbb35a0823da56e3
[ "MIT" ]
11
2016-12-19T13:14:24.000Z
2022-02-20T23:58:25.000Z
#include "cbookmark.h" #include "assert/advanced_assert.h" DISABLE_COMPILER_WARNINGS #include <QStringBuilder> #include <QStringList> RESTORE_COMPILER_WARNINGS CBookmark::CBookmark(const QString & serializedBookmark) { const QStringList components = serializedBookmark.split(';'); assert_and_return_r(components.size() == 2, ); filePath = components[0]; wordIndex = (size_t)components[1].toULongLong(); } CBookmark::CBookmark(const QString& path, const size_t position) : filePath(path), wordIndex(position) { } QString CBookmark::toString() const { return filePath % ';' % QString::number(wordIndex); }
24.576923
103
0.733959
VioletGiraffe
03738de4a35439a2089b392e1772330b8a3225b7
2,439
cpp
C++
tc 160+/DequeSort.cpp
ibudiselic/contest-problem-solutions
88082981b4d87da843472e3ca9ed5f4c42b3f0aa
[ "BSD-2-Clause" ]
3
2015-05-25T06:24:37.000Z
2016-09-10T07:58:00.000Z
tc 160+/DequeSort.cpp
ibudiselic/contest-problem-solutions
88082981b4d87da843472e3ca9ed5f4c42b3f0aa
[ "BSD-2-Clause" ]
null
null
null
tc 160+/DequeSort.cpp
ibudiselic/contest-problem-solutions
88082981b4d87da843472e3ca9ed5f4c42b3f0aa
[ "BSD-2-Clause" ]
5
2015-05-25T06:24:40.000Z
2021-08-19T19:22:29.000Z
#include <algorithm> #include <cassert> #include <cstdio> #include <iostream> #include <sstream> #include <string> #include <vector> #include <cstring> #include <utility> using namespace std; class DequeSort { public: int minDeques(vector <int> data) { vector< pair<int, int> > v; v.push_back(make_pair(data[0], data[0])); for (int i=1; i<(int)data.size(); ++i) { bool done = false; for (int j=0; j<(int)v.size(); ++j) { int l = v[j].first; int r = v[j].second; if (data[i]>l && data[i]<r) continue; l = min(l, data[i]); r = max(r, data[i]); bool ok = true; for (int k=i+1; k<(int)data.size(); ++k) if (data[k]>l && data[k]<r) { ok = false; break; } if (ok) { v[j].first = l; v[j].second = r; done = true; break; } } if (!done) v.push_back(make_pair(data[i], data[i])); } return v.size(); } // BEGIN CUT HERE public: void run_test(int Case) { if ((Case == -1) || (Case == 0)) test_case_0(); if ((Case == -1) || (Case == 1)) test_case_1(); if ((Case == -1) || (Case == 2)) test_case_2(); } private: template <typename T> string print_array(const vector<T> &V) { ostringstream os; os << "{ "; for (typename vector<T>::const_iterator iter = V.begin(); iter != V.end(); ++iter) os << '\"' << *iter << "\","; os << " }"; return os.str(); } void verify_case(int Case, const int &Expected, const int &Received) { cerr << "Test Case #" << Case << "..."; if (Expected == Received) cerr << "PASSED" << endl; else { cerr << "FAILED" << endl; cerr << "\tExpected: \"" << Expected << '\"' << endl; cerr << "\tReceived: \"" << Received << '\"' << endl; } } void test_case_0() { int Arr0[] = {50, 45, 55, 60, 65, 40, 70, 35, 30, 75}; vector <int> Arg0(Arr0, Arr0 + (sizeof(Arr0) / sizeof(Arr0[0]))); int Arg1 = 1; verify_case(0, Arg1, minDeques(Arg0)); } void test_case_1() { int Arr0[] = {3, 6, 0, 9, 5, 4}; vector <int> Arg0(Arr0, Arr0 + (sizeof(Arr0) / sizeof(Arr0[0]))); int Arg1 = 2; verify_case(1, Arg1, minDeques(Arg0)); } void test_case_2() { int Arr0[] = {0, 2, 1, 4, 3, 6, 5, 8, 7, 9}; vector <int> Arg0(Arr0, Arr0 + (sizeof(Arr0) / sizeof(Arr0[0]))); int Arg1 = 5; verify_case(2, Arg1, minDeques(Arg0)); } // END CUT HERE }; // BEGIN CUT HERE int main() { DequeSort ___test; ___test.run_test(-1); } // END CUT HERE
31.675325
309
0.540795
ibudiselic
037688bd186cf13ba183f3656aa337b6fa8ad0f1
5,072
cpp
C++
nau/src/nau/scene/iScene.cpp
Khirion/nau
47a2ad8e0355a264cd507da5e7bba1bf7abbff95
[ "MIT" ]
29
2015-09-16T22:28:30.000Z
2022-03-11T02:57:36.000Z
nau/src/nau/scene/iScene.cpp
Khirion/nau
47a2ad8e0355a264cd507da5e7bba1bf7abbff95
[ "MIT" ]
1
2017-03-29T13:32:58.000Z
2017-03-31T13:56:03.000Z
nau/src/nau/scene/iScene.cpp
Khirion/nau
47a2ad8e0355a264cd507da5e7bba1bf7abbff95
[ "MIT" ]
10
2015-10-15T14:20:15.000Z
2022-02-17T10:37:29.000Z
#include "nau/scene/iScene.h" #include "nau.h" #include "nau/math/matrix.h" using namespace nau::math; using namespace nau::scene; bool IScene::Init() { // MAT4 Attribs.add(Attribute(TRANSFORM, "TRANSFORM", Enums::MAT4, true)); // VEC4 Attribs.add(Attribute(SCALE, "SCALE", Enums::DataType::VEC4, false, new vec4(1.0f, 1.0f, 1.0f, 1.0f))); Attribs.add(Attribute(TRANSLATE, "TRANSLATE", Enums::DataType::VEC4, false, new vec4(0.0f, 0.0f, 0.0f, 0.0f))); Attribs.add(Attribute(ROTATE, "ROTATE", Enums::DataType::VEC4, false, new vec4(0.0f, 1.0f, 0.0f, 0.0f))); // VEC3 Attribs.add(Attribute(BB_MAX, "BB_MAX", Enums::DataType::VEC3, true, new vec3(-1.0f, -1.0f, -1.0f))); Attribs.add(Attribute(BB_MIN, "BB_MIN", Enums::DataType::VEC3, true, new vec3(1.0f, 1.0f, 1.0f))); Attribs.add(Attribute(BB_CENTER, "BB_CENTER", Enums::DataType::VEC3, true, new vec3(0.0f, 0.0f, 0.0f))); // ENUM Attribs.add(Attribute(TRANSFORM_ORDER, "TRANSFORM_ORDER", Enums::ENUM, false, new NauInt(T_R_S))); Attribs.listAdd("TRANSFORM_ORDER", "T_R_S", T_R_S); Attribs.listAdd("TRANSFORM_ORDER", "T_S_R", T_S_R); Attribs.listAdd("TRANSFORM_ORDER", "R_T_S", R_T_S); Attribs.listAdd("TRANSFORM_ORDER", "R_S_T", R_S_T); Attribs.listAdd("TRANSFORM_ORDER", "S_R_T", S_R_T); Attribs.listAdd("TRANSFORM_ORDER", "S_T_R", S_T_R); // UINT Attribs.add(Attribute(TRIANGLE_COUNT, "TRIANGLE_COUNT", Enums::DataType::UINT, true, new NauUInt(0))); //#ifndef _WINDLL NAU->registerAttributes("SCENE", &Attribs); //#endif return true; } AttribSet & IScene::GetAttribs() { return Attribs; } AttribSet IScene::Attribs; bool IScene::Inited = Init(); void IScene::updateTransform() { mat4 tis; switch (m_EnumProps[TRANSFORM_ORDER]) { case T_R_S: tis.setIdentity(); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); break; case T_S_R: tis.setIdentity(); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); break; case R_T_S: tis.setIdentity(); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); break; case R_S_T: tis.setIdentity(); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); break; case S_R_T: tis.setIdentity(); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); break; case S_T_R: tis.setIdentity(); tis.scale(m_Float4Props[SCALE].x, m_Float4Props[SCALE].y, m_Float4Props[SCALE].z); tis.translate(m_Float4Props[TRANSLATE].x, m_Float4Props[TRANSLATE].y, m_Float4Props[TRANSLATE].z); tis.rotate(m_Float4Props[ROTATE].w, m_Float4Props[ROTATE].x, m_Float4Props[ROTATE].y, m_Float4Props[ROTATE].z); break; } setTransform(tis); std::shared_ptr<nau::event_::IEventData> e3 = nau::event_::EventFactory::Create("String"); std::string * name = new std::string(m_Name); e3->setData(name); delete name; EVENTMANAGER->notifyEvent("SCENE_TRANSFORM", "SCENE", "", e3); } void IScene::setPropf4(Float4Property prop, vec4& aVec) { switch (prop) { case SCALE: case ROTATE: case TRANSLATE: m_Float4Props[prop] = aVec; updateTransform(); break; default: AttributeValues::setPropf4(prop, aVec); } } void IScene::setPrope(EnumProperty prop, int v) { switch (prop) { case TRANSFORM_ORDER: m_EnumProps[prop] = v; updateTransform(); break; default: AttributeValues::setPrope(prop, v); } } vec3 & IScene::getPropf3(Float3Property prop) { switch (prop) { case BB_MIN: m_Float3Props[BB_MIN] = getBoundingVolume().getMin(); return m_Float3Props[BB_MIN]; case BB_MAX: m_Float3Props[BB_MAX] = getBoundingVolume().getMax(); return m_Float3Props[BB_MAX]; case BB_CENTER: m_Float3Props[BB_CENTER] = getBoundingVolume().getCenter(); return m_Float3Props[BB_CENTER]; default: return AttributeValues::getPropf3(prop); } } const std::string & IScene::getClassName() { return m_Type; } void nau::scene::IScene::recompile() { m_Compiled = false; compile(); }
30.554217
113
0.728312
Khirion
03771e226fc07a62e8940cd572287eeebf5bebda
967
cc
C++
src/import_manager.cc
ioperations/cquery
0b99257bb8f5f19d979b6c0cf916758beca1bcd9
[ "MIT" ]
null
null
null
src/import_manager.cc
ioperations/cquery
0b99257bb8f5f19d979b6c0cf916758beca1bcd9
[ "MIT" ]
null
null
null
src/import_manager.cc
ioperations/cquery
0b99257bb8f5f19d979b6c0cf916758beca1bcd9
[ "MIT" ]
null
null
null
#include "import_manager.h" #include <mutex> #include <ostream> #include "assert.h" std::ostream& operator<<(std::ostream& os, const PipelineStatus& status) { switch (status) { case PipelineStatus::kNotSeen: os << "kNotSeen"; break; case PipelineStatus::kProcessingInitialImport: os << "kProcessingInitialImport"; break; case PipelineStatus::kImported: os << "kImported"; break; case PipelineStatus::kProcessingUpdate: os << "kProcessingUpdate"; break; default: assert(false); } return os; } PipelineStatus ImportManager::GetStatus(const std::string& path) { // Try reading the value { std::shared_lock<std::shared_timed_mutex> lock(m_status_mutex); auto it = m_status.find(path); if (it != m_status.end()) return it->second; } return PipelineStatus::kNotSeen; }
26.135135
74
0.594623
ioperations
0378c4d26e1cb319d8fd740c05e8c3b7f6dbf715
6,573
cpp
C++
include/types/image.cpp
nathanmullenax83/rhizome
e7410341fdc4d38ab5aaecc55c94d3ac6efd51da
[ "MIT" ]
1
2020-07-11T14:53:38.000Z
2020-07-11T14:53:38.000Z
include/types/image.cpp
nathanmullenax83/rhizome
e7410341fdc4d38ab5aaecc55c94d3ac6efd51da
[ "MIT" ]
1
2020-07-04T16:45:49.000Z
2020-07-04T16:45:49.000Z
include/types/image.cpp
nathanmullenax83/rhizome
e7410341fdc4d38ab5aaecc55c94d3ac6efd51da
[ "MIT" ]
null
null
null
#include "image.hpp" namespace rhizome { namespace types { void image_demo() { std::cout << "Image Demo." << std::endl; Image x; x.set_size(500,500); x.checker_board( 16,16, Color(1,1,1,1), Color(1,0,0,1)); x.save_png("test.png"); Image y; y.freeimage_load("include/image/back.png"); y.freeimage_save("withfreeimage.png"); } Image::~Image() { } void Image::set_size( size_t width, size_t height ) { this->width = width; this->height = height; while( pixels.size() < width*height ) { pixels.push_back( Color() ); } } void Image::open_png_alpha( string const &path ) { png::image< png::rgba_pixel > image( path.c_str() ); size_t height = image.get_height(); size_t width = image.get_width(); set_size(width,height); for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { png::rgba_pixel p = image[y][x]; pixels[x+y*width] = Color(p.red/256.0,p.green/256.0,p.blue/256.0,p.alpha/256.0 ); } } } void Image::open_png( string const &path ) { png::image< png::rgb_pixel > image(path.c_str()); size_t height = image.get_height(); size_t width = image.get_width(); set_size(width,height); for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { png::rgb_pixel p = image[y][x]; Color &d = pixels[x+y*width]; d.r = rhizome::types::clamp(p.red/256.0); d.g = rhizome::types::clamp(p.green/256.0); d.b = rhizome::types::clamp(p.blue/256.0); d.a = 1.0; } } } void Image::save_png_alpha( string const &path ) { png::image< png::rgba_pixel > im(height,width); for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { png::rgba_pixel p; p.red = std::floor(pixels[x+y*width].r*256.0); p.green = std::floor(pixels[x+y*width].g*256.0); p.blue = std::floor(pixels[x+y*width].b*256.0); p.alpha = std::floor(pixels[x+y*width].a*256.0); im[y][x] = p; } } im.write(path.c_str()); } void Image::save_png( string const &path ) { png::image< png::rgb_pixel > im( height, width ); for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { png::rgb_pixel p; Color c = pixels[x+y*width]; p.red = std::floor(c.r*256.0); p.green = std::floor(c.g*256.0); p.blue = std::floor(c.b*256.0); im[y][x] = p; } } im.write( path.c_str() ); } void Image::pset( size_t x, size_t y, Color const &c ) { pixels[x + y*width] = c; } rhizome::types::Color Image::pget( size_t x, size_t y ) { return pixels[x+y*width]; } void Image::checker_board( size_t h, size_t w, Color const &a, Color const &b ) { for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { pset(x,y,(y/h + x/w)%2==0 ? a : b ); } } } rhizome::types::Color from_quad( RGBQUAD const &q ) { rhizome::types::Color c; c.r = q.rgbRed/255.0; c.g = q.rgbGreen/255.0; c.b = q.rgbBlue/255.0; return c; } RGBQUAD from_color( rhizome::types::Color const &c) { RGBQUAD q; q.rgbRed = (unsigned char) std::floor( 255.0*c.r ); q.rgbGreen = (unsigned char) std::floor( 255.0*c.g ); q.rgbBlue = (unsigned char) std::floor( 255.0*c.b ); return q; } bool Image::freeimage_load( string const &path ) { fipImage im; if(im.load( path.c_str() )) { set_size(im.getWidth(), im.getHeight()); for(size_t y=0; y<im.getHeight(); ++y) { for(size_t x=0; x<im.getWidth(); ++x) { RGBQUAD color; im.getPixelColor(x,y,&color); if( x==y && x==250 ) { std::cout << ((int)color.rgbGreen) <<"\n"; } pset( x,y, from_quad(color)); } } return true; } else { throw runtime_error("freeimage_load: could not load image"); } } void Image::freeimage_save( string const &path ) { fipImage im; im.setSize(FREE_IMAGE_TYPE::FIT_BITMAP,width,height,8); for(size_t y=0; y<height; ++y) { for(size_t x=0; x<width; ++x) { RGBQUAD q; q = from_color(pget(x,y)); if( x==y && x==250 ) { std::cout << ((int)q.rgbGreen)<<"\n"; } im.setPixelColor(x,y,&q); } } if( !FreeImage_Save(FIF_PNG,im, path.c_str()) ) { throw runtime_error("Couldn't save image."); } } void Image::serialize_to( size_t level, ostream &out ) const { (void) level; out << "Image"; throw runtime_error("Not implemented."); } Thing * Image::clone() const { Image *copy = new Image(*this); return copy; } string Image::rhizome_type() const { return "Image"; } bool Image::has_interface(string const &w) { return (w==rhizome_type()||w=="Thing"); } Thing * Image::invoke( Thing *context, string const &method, Thing *arg ) { (void)method;(void)arg;(void)context; throw runtime_error("Nothing to invoke."); } } }
33.030151
101
0.42492
nathanmullenax83
037adaa2e26c1d7621f8bbef0811f7ea02d14ba3
2,914
cpp
C++
android/android_42/native/services/sensorservice/OrientationSensor.cpp
yakuizhao/intel-vaapi-driver
b2bb0383352694941826543a171b557efac2219b
[ "MIT" ]
null
null
null
android/android_42/native/services/sensorservice/OrientationSensor.cpp
yakuizhao/intel-vaapi-driver
b2bb0383352694941826543a171b557efac2219b
[ "MIT" ]
null
null
null
android/android_42/native/services/sensorservice/OrientationSensor.cpp
yakuizhao/intel-vaapi-driver
b2bb0383352694941826543a171b557efac2219b
[ "MIT" ]
null
null
null
/* * Copyright (C) 2011 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ #include <stdint.h> #include <math.h> #include <sys/types.h> #include <utils/Errors.h> #include <hardware/sensors.h> #include "OrientationSensor.h" #include "SensorDevice.h" #include "SensorFusion.h" namespace android { // --------------------------------------------------------------------------- OrientationSensor::OrientationSensor() : mSensorDevice(SensorDevice::getInstance()), mSensorFusion(SensorFusion::getInstance()) { } bool OrientationSensor::process(sensors_event_t* outEvent, const sensors_event_t& event) { if (event.type == SENSOR_TYPE_ACCELEROMETER) { if (mSensorFusion.hasEstimate()) { vec3_t g; const float rad2deg = 180 / M_PI; const mat33_t R(mSensorFusion.getRotationMatrix()); g[0] = atan2f(-R[1][0], R[0][0]) * rad2deg; g[1] = atan2f(-R[2][1], R[2][2]) * rad2deg; g[2] = asinf ( R[2][0]) * rad2deg; if (g[0] < 0) g[0] += 360; *outEvent = event; outEvent->orientation.azimuth = g.x; outEvent->orientation.pitch = g.y; outEvent->orientation.roll = g.z; outEvent->orientation.status = SENSOR_STATUS_ACCURACY_HIGH; outEvent->sensor = '_ypr'; outEvent->type = SENSOR_TYPE_ORIENTATION; return true; } } return false; } status_t OrientationSensor::activate(void* ident, bool enabled) { return mSensorFusion.activate(this, enabled); } status_t OrientationSensor::setDelay(void* ident, int handle, int64_t ns) { return mSensorFusion.setDelay(this, ns); } Sensor OrientationSensor::getSensor() const { sensor_t hwSensor; hwSensor.name = "Orientation Sensor"; hwSensor.vendor = "Google Inc."; hwSensor.version = 1; hwSensor.handle = '_ypr'; hwSensor.type = SENSOR_TYPE_ORIENTATION; hwSensor.maxRange = 360.0f; hwSensor.resolution = 1.0f/256.0f; // FIXME: real value here hwSensor.power = mSensorFusion.getPowerUsage(); hwSensor.minDelay = mSensorFusion.getMinDelay(); Sensor sensor(&hwSensor); return sensor; } // --------------------------------------------------------------------------- }; // namespace android
32.021978
78
0.609815
yakuizhao
03857f744a5c019760a1a6de89003afbd4abe00b
8,545
cpp
C++
lazy-code/Teensy4LazyBoard/src/MessageManagement.cpp
william-redenbaugh/lazy-board
945d2c4c59a560141ee37f4d4eff84014eb997d7
[ "MIT" ]
3
2020-06-07T04:09:27.000Z
2020-08-19T04:33:06.000Z
lazy-code/Teensy4LazyBoard/src/MessageManagement.cpp
william-redenbaugh/lazy-board
945d2c4c59a560141ee37f4d4eff84014eb997d7
[ "MIT" ]
4
2020-06-09T18:15:44.000Z
2020-08-31T22:00:24.000Z
lazy-code/Teensy4LazyBoard/src/MessageManagement.cpp
william-redenbaugh/lazy-board
945d2c4c59a560141ee37f4d4eff84014eb997d7
[ "MIT" ]
null
null
null
/* Author: William Redenbaugh Last Edit Date: 7/3/2020 */ #include "MessageManagement.hpp" /**************************************************************************/ /*! @brief Starts up our serial interface for doing message management stuff */ /**************************************************************************/ void MessageManagement::begin(void){ // Doesn't really matter what we put in here // It's always running at 12 megabits anyway! Serial.begin(115200); } /**************************************************************************/ /*! @brief Serial message unpacker the message management class. Will then connect data to other message unpacking functions. */ /**************************************************************************/ bool MessageManagement::run(void){ if(Serial.available() >= 16){ // Scoping the serial read and decoding so that it gets // popped off the stack asap. uint8_t message_instr_arr[16]; // Popping off the oldest 16 bytes of information // for the message instruction data. for(uint8_t i = 0; i < 16; i++) message_instr_arr[i] = Serial.read(); // Message instruction unpacking // Message unpacking instructions. pb_istream_t msg_in = pb_istream_from_buffer(message_instr_arr, 16); pb_decode(&msg_in, MessageData_fields, &this->latest_message_data); return true; } return false; } /**************************************************************************/ /*! @brief Serial message unpacker the message management class. Will then connect data to other message unpacking functions. @returns MessageData information */ /**************************************************************************/ MessageData_MessageType MessageManagement::latest_message_enum(void){ return this->latest_message_data.message_type; } /**************************************************************************/ /*! @returns the latest boolean value of the return message. */ /**************************************************************************/ bool MessageManagement::latest_return_message(void){ return this->latest_message_data.return_message; } /**************************************************************************/ /*! @returns the latest size value of the return message. */ /**************************************************************************/ int32_t MessageManagement::return_message_size(void){ return this->latest_message_data.message_size; } /**************************************************************************/ /*! @brief Unpacks message general instruction enumerated types. */ /**************************************************************************/ void MessageManagement::process_general_instructions(void){ // Array with latest package information. uint8_t general_instr_buff[this->latest_message_data.message_size]; // Get latest data off serial device. for(uint8_t i = 0; i < this->latest_message_data.message_size; i++) general_instr_buff[i] = Serial.read(); pb_istream_t msg_in = pb_istream_from_buffer(general_instr_buff, this->latest_message_data.message_size); pb_decode(&msg_in, GeneralInstructions_fields, &this->general_instructions); } /**************************************************************************/ /*! @brief Processes keybinding information. */ /**************************************************************************/ void MessageManagement::process_keybinding_information(void){ uint8_t keybinding_buff[this->latest_message_data.message_size]; // Get latest data off serial device. for(uint8_t i = 0; i < this->latest_message_data.message_size; i++) keybinding_buff[i] = Serial.read(); pb_istream_t msg_in = pb_istream_from_buffer(keybinding_buff, this->latest_message_data.message_size); pb_decode(&msg_in, ProgramKeybindings_fields, &this->latest_keybinding_info); } /**************************************************************************/ /*! @returns latest keybinding information. should be called after process_keybinding_informatio() */ /**************************************************************************/ ProgramKeybindings MessageManagement::get_keybinding_information(void){ return this->latest_keybinding_info; } /**************************************************************************/ /*! @returns latest image flash information. Should be called after the "process_image_data()" function */ /**************************************************************************/ ImageFlash MessageManagement::image_data_instructions(void){ return this->latest_image_flash_data; } /**************************************************************************/ /*! @brief processes our latest image instruction data. @note This does not process the actual image information, that data should still be in the Serial buffer. Might be changed later. */ /**************************************************************************/ void MessageManagement::process_image_data(void){ uint8_t image_data_buff [this->latest_message_data.message_size]; // Deserialize our instructions. for(uint8_t i = 0; i < this->latest_message_data.message_size; i++) image_data_buff[i] = Serial.read(); pb_istream_t msg_in = pb_istream_from_buffer(image_data_buff, this->latest_message_data.message_size); pb_decode(&msg_in, ImageFlash_fields, &this->latest_image_flash_data); } /**************************************************************************/ /*! @brief Processes rgb instructions */ /**************************************************************************/ void MessageManagement::process_rgb_instructions(void){ uint8_t rgb_data_buff[this->latest_message_data.message_size]; // Get latest data off serial device. for(uint8_t i = 0; i < this->latest_message_data.message_size; i++) rgb_data_buff[i] = Serial.read(); pb_istream_t msg_in = pb_istream_from_buffer(rgb_data_buff, this->latest_message_data.message_size); pb_decode(&msg_in, GeneralRGBData_fields, &this->latest_general_rgb_data); } /**************************************************************************/ /*! @returns latest keybinding information. should be called after process_keybinding_informatio() */ /**************************************************************************/ GeneralRGBData MessageManagement::get_rgb_general_instructions(void){ return latest_general_rgb_data; } /**************************************************************************/ /*! @returns The latest general instruction data, should be called right after we know we got new general instruction data. */ /**************************************************************************/ GeneralInstructions_MainInstrEnum MessageManagement::get_latest_general_instructions(void){ this->process_general_instructions(); return this->general_instructions.main_instructions; } /**************************************************************************/ /*! @brief Tests to make sure that protbuffer serialization and deserialization is working properly. @returns boolean value that test was successful. */ /**************************************************************************/ bool MessageManagement::testing_message_protobuffers(void){ MessageData message_data_out; message_data_out.message_size = 32; message_data_out.message_type = MessageData_MessageType_GENERAL_INSTRUCTIONS; // Put data into serialized format. uint8_t buffer[16]; memset(buffer, 0, sizeof(buffer)); pb_ostream_t msg_out = pb_ostream_from_buffer(buffer, sizeof(buffer)); pb_encode(&msg_out, MessageData_fields, &message_data_out); // Unpack serialsed data. pb_istream_t msg_in = pb_istream_from_buffer(buffer, sizeof(buffer)); MessageData message_data_in; pb_decode(&msg_in, MessageData_fields, &message_data_in); if(message_data_in.message_size == message_data_out.message_size && message_data_in.message_type == message_data_out.message_type) return true; return false; }
42.512438
135
0.536337
william-redenbaugh
03878367d1516b142bd72beac2ad6a9f334095d0
1,391
cpp
C++
numerical_methods/qr_decomposition.cpp
dvijaymanohar/C-Plus-Plus
c987381c25858f08d0fe9301712ab6c1a10b433f
[ "MIT" ]
null
null
null
numerical_methods/qr_decomposition.cpp
dvijaymanohar/C-Plus-Plus
c987381c25858f08d0fe9301712ab6c1a10b433f
[ "MIT" ]
null
null
null
numerical_methods/qr_decomposition.cpp
dvijaymanohar/C-Plus-Plus
c987381c25858f08d0fe9301712ab6c1a10b433f
[ "MIT" ]
null
null
null
/** * @file * \brief Program to compute the [QR * decomposition](https://en.wikipedia.org/wiki/QR_decomposition) of a given * matrix. * \author [Krishna Vedala](https://github.com/kvedala) */ #include <array> #include <cmath> #include <cstdlib> #include <ctime> #include <iostream> #include "./qr_decompose.h" using qr_algorithm::qr_decompose; using qr_algorithm::operator<<; /** * main function */ int main(void) { unsigned int ROWS, COLUMNS; std::cout << "Enter the number of rows and columns: "; std::cin >> ROWS >> COLUMNS; std::cout << "Enter matrix elements row-wise:\n"; std::valarray<std::valarray<double>> A(ROWS); std::valarray<std::valarray<double>> Q(ROWS); std::valarray<std::valarray<double>> R(COLUMNS); for (int i = 0; i < std::max(ROWS, COLUMNS); i++) { if (i < ROWS) { A[i] = std::valarray<double>(COLUMNS); Q[i] = std::valarray<double>(COLUMNS); } if (i < COLUMNS) { R[i] = std::valarray<double>(COLUMNS); } } for (int i = 0; i < ROWS; i++) for (int j = 0; j < COLUMNS; j++) { std::cin >> A[i][j]; } std::cout << A << "\n"; clock_t t1 = clock(); qr_decompose(A, &Q, &R); double dtime = static_cast<double>(clock() - t1) / CLOCKS_PER_SEC; std::cout << Q << "\n"; std::cout << R << "\n"; std::cout << "Time taken to compute: " << dtime << " sec\n "; return 0; }
23.576271
76
0.588066
dvijaymanohar
0387a307cd2e5a042924d2516566ba5618be1686
29
hpp
C++
src/boost_icl_set.hpp
miathedev/BoostForArduino
919621dcd0c157094bed4df752b583ba6ea6409e
[ "BSL-1.0" ]
10
2018-03-17T00:58:42.000Z
2021-07-06T02:48:49.000Z
src/boost_icl_set.hpp
miathedev/BoostForArduino
919621dcd0c157094bed4df752b583ba6ea6409e
[ "BSL-1.0" ]
2
2021-03-26T15:17:35.000Z
2021-05-20T23:55:08.000Z
src/boost_icl_set.hpp
miathedev/BoostForArduino
919621dcd0c157094bed4df752b583ba6ea6409e
[ "BSL-1.0" ]
4
2019-05-28T21:06:37.000Z
2021-07-06T03:06:52.000Z
#include <boost/icl/set.hpp>
14.5
28
0.724138
miathedev
03881eba2599fe39462ca635eb0a3e54fa74b7e6
4,912
cpp
C++
src/load_texture.cpp
joeld42/hexplanet
7450651c6bae0e490fecf26485c1e893e36c19b2
[ "BSD-3-Clause" ]
74
2015-01-07T21:22:07.000Z
2022-02-24T00:49:08.000Z
src/load_texture.cpp
mikicompany/hexplanet
7450651c6bae0e490fecf26485c1e893e36c19b2
[ "BSD-3-Clause" ]
2
2015-02-27T01:52:57.000Z
2016-06-09T21:09:50.000Z
src/load_texture.cpp
mikicompany/hexplanet
7450651c6bae0e490fecf26485c1e893e36c19b2
[ "BSD-3-Clause" ]
16
2015-02-27T00:19:40.000Z
2021-09-26T03:04:16.000Z
#ifdef WIN32 #include <windows.h> #endif #include <assert.h> #include <stdio.h> //#include <SDL.h> //#include <SDL_endian.h> #include <sys/types.h> #include <GL/glew.h> #include <GL/gl.h> #include <GL/glu.h> //#include "debug.h" #include "load_texture.h" #include <cstring> #include <cstdlib> #ifdef WIN32 typedef unsigned __int8 Uint8; typedef unsigned __int16 Uint16; typedef unsigned __int32 Uint32; #else #include <inttypes.h> typedef uint8_t Uint8; typedef uint16_t Uint16; typedef uint32_t Uint32; #endif // Most of the DDS code comes from from the NVidia Whitepaper // "Using Texture Compression in OpenGL" by Sebastien Domine #define DDS_MAKEFOURCC(a, b, c, d) \ ((Uint32)(Uint8)(a) | ((Uint32)(Uint8)(b) << 8) | \ ((Uint32)(Uint8)(c) << 16) | ((Uint32)(Uint8)(d) << 24 )) // Structs needed to read DDS files are described here: // // http://msdn.microsoft.com/archive/default.asp?url= // /archive/en-us/directx9_c/directx/graphics // /reference/ddsfilereference/ddsfileformat.asp // FOURCC codes for DX compressed-texture pixel formats #define DDS_FOURCC_DXT1 (DDS_MAKEFOURCC('D','X','T','1')) #define DDS_FOURCC_DXT2 (DDS_MAKEFOURCC('D','X','T','2')) #define DDS_FOURCC_DXT3 (DDS_MAKEFOURCC('D','X','T','3')) #define DDS_FOURCC_DXT4 (DDS_MAKEFOURCC('D','X','T','4')) #define DDS_FOURCC_DXT5 (DDS_MAKEFOURCC('D','X','T','5')) #define DDS_GL_COMPRESSED_RGBA_S3TC_DXT1_EXT 0x83F1 #define DDS_GL_COMPRESSED_RGBA_S3TC_DXT3_EXT 0x83F2 #define DDS_GL_COMPRESSED_RGBA_S3TC_DXT5_EXT 0x83F3 // structs struct DDPIXELFORMAT_INFO { Uint32 dwSize; // should be 32 Uint32 dwFlags; Uint32 dwFourCC; Uint32 dwRGBBitCount; Uint32 dwRBitMask; Uint32 dwGBitMask; Uint32 dwBBitMask; Uint32 dwAlphaBitMask; }; struct DDCAPS2_INFO { Uint32 dwCaps1; Uint32 dwCaps2; Uint32 dwReserved[2]; }; struct DDSURFACEDESC2_INFO { Uint32 dwSize; // should be 124 Uint32 dwFlags; Uint32 dwHeight, dwWidth; Uint32 dwLinearSize; // or pitch for uncompressed Uint32 dwDepth; Uint32 dwMipMapCount; Uint32 dwReserved1[11]; DDPIXELFORMAT_INFO ddpfPixelFormat; DDCAPS2_INFO ddsCaps; Uint32 dwReserved2; }; struct GenericImage { Uint32 w, h; Uint32 comp; // components, 3 or 4 GLuint format; Uint8 *pixeldata; }; GenericImage *ReadDDSFile( const char *filename, Uint32 *bufsize, Uint32 *numMipmaps ) { GenericImage *img; DDSURFACEDESC2_INFO ddsd; char *filecode[4]; FILE *fp; // try to open the file fp = fopen( filename, "rb" ); if (fp == NULL) return NULL; // verify the file type fread( filecode, 1, 4, fp ); if (strncmp( (const char *)filecode, "DDS ", 4)!=0) { fclose(fp); return NULL; } // read the file fread( &ddsd, sizeof(ddsd), 1, fp ); // Get the image data img = (GenericImage*)malloc(sizeof(GenericImage)); memset( img, 0, sizeof(GenericImage)); // calculate image size *bufsize = ddsd.dwMipMapCount > 1? ddsd.dwLinearSize * 2 : ddsd.dwLinearSize; // load image data img->pixeldata = (Uint8*)malloc( *bufsize * sizeof(Uint8) ); fread( img->pixeldata, 1, *bufsize, fp ); fclose( fp ); // get image information img->w = ddsd.dwWidth; img->h = ddsd.dwHeight; img->comp = (ddsd.ddpfPixelFormat.dwFourCC == DDS_FOURCC_DXT1) ? 3 : 4; *numMipmaps = ddsd.dwMipMapCount; switch( ddsd.ddpfPixelFormat.dwFourCC) { case DDS_FOURCC_DXT1: img->format = DDS_GL_COMPRESSED_RGBA_S3TC_DXT1_EXT; break; case DDS_FOURCC_DXT3: img->format = DDS_GL_COMPRESSED_RGBA_S3TC_DXT3_EXT; break; case DDS_FOURCC_DXT5: img->format = DDS_GL_COMPRESSED_RGBA_S3TC_DXT5_EXT; break; default: //DBG::error( "Texture %s has unknown DDS pixel format! ", filename ); free( img->pixeldata ); free( img ); img = NULL; break; } return img; } GLuint loadTextureDDS( const char *filename ) { GLuint glTexID; Uint32 ddsBufSize; Uint32 numMipmaps; GenericImage *ddsImage = ReadDDSFile( filename, &ddsBufSize, &numMipmaps ); assert( ddsImage && "Could not load texture" ); Uint32 width, height, offset, size; Uint32 blocksize = (ddsImage->format == DDS_GL_COMPRESSED_RGBA_S3TC_DXT1_EXT) ? 8 : 16; glGenTextures( 1, &glTexID ); glBindTexture( GL_TEXTURE_2D, glTexID ); // Load the mipmap levels offset = 0; width = ddsImage->w; height = ddsImage->h; for (Uint32 i=0; i < numMipmaps && (width || height); i++) { if (width==0) { width = 1; } if (height==0) { height = 1; } size = ((width+3)/4) * ((height+3)/4) * blocksize; glCompressedTexImage2DARB( GL_TEXTURE_2D, i, ddsImage->format, width, height, 0, size, ddsImage->pixeldata + offset ); //GLErrorReport() // probably a good idea offset += size; width >>= 1; height >>= 1; } return glTexID; }
23.84466
89
0.667345
joeld42
0389994bab6e2f4250852f92faced8ab6ab7fe9b
4,025
cpp
C++
cppwinrt/Scenario5_TimeZone.cpp
lyahdav/CppWinRtUwpSandbox
aad073b768031589cb1165ce8e95cdf8897e35f6
[ "MIT" ]
2,504
2019-05-07T06:56:42.000Z
2022-03-31T19:37:59.000Z
cppwinrt/Scenario5_TimeZone.cpp
lyahdav/CppWinRtUwpSandbox
aad073b768031589cb1165ce8e95cdf8897e35f6
[ "MIT" ]
314
2019-05-08T16:56:30.000Z
2022-03-21T07:13:45.000Z
cppwinrt/Scenario5_TimeZone.cpp
lyahdav/CppWinRtUwpSandbox
aad073b768031589cb1165ce8e95cdf8897e35f6
[ "MIT" ]
2,219
2019-05-07T00:47:26.000Z
2022-03-30T21:12:31.000Z
//********************************************************* // // Copyright (c) Microsoft. All rights reserved. // This code is licensed under the MIT License (MIT). // THIS CODE IS PROVIDED *AS IS* WITHOUT WARRANTY OF // ANY KIND, EITHER EXPRESS OR IMPLIED, INCLUDING ANY // IMPLIED WARRANTIES OF FITNESS FOR A PARTICULAR // PURPOSE, MERCHANTABILITY, OR NON-INFRINGEMENT. // //********************************************************* #include "pch.h" #include "Scenario5_TimeZone.h" #include "Scenario5_TimeZone.g.cpp" using namespace winrt; using namespace Windows::Foundation; using namespace Windows::Globalization; using namespace Windows::UI::Xaml; namespace { void ReportCalendarData(std::wostream& results, Calendar const& calendar) { // Display individual date/time elements. results << L"In " << std::wstring_view(calendar.GetTimeZone()) << L" time zone: " << std::wstring_view(calendar.DayOfWeekAsSoloString()) << L" " << std::wstring_view(calendar.MonthAsSoloString()) << L" " << std::wstring_view(calendar.DayAsPaddedString(2)) << L", " << std::wstring_view(calendar.YearAsString()) << L" " << std::wstring_view(calendar.HourAsPaddedString(2)) << L":" << std::wstring_view(calendar.MinuteAsPaddedString(2)) << L":" << std::wstring_view(calendar.SecondAsPaddedString(2)) << L" " << std::wstring_view(calendar.PeriodAsString()) << L" " << std::wstring_view(calendar.TimeZoneAsString(3)) << L"\n"; } } namespace winrt::SDKTemplate::implementation { Scenario5_TimeZone::Scenario5_TimeZone() { InitializeComponent(); } void Scenario5_TimeZone::ShowResults_Click(IInspectable const&, RoutedEventArgs const&) { // This scenario illustrates time zone support in Windows.Globalization.Calendar class // Displayed time zones in addition to the local time zone. std::array timeZones{ L"UTC", L"America/New_York", L"Asia/Kolkata" }; // Store results here. std::wostringstream results; // Create default Calendar object Calendar calendar; hstring localTimeZone = calendar.GetTimeZone(); // Show current time in local time zone results << L"Current date and time:\n"; ReportCalendarData(results, calendar); results << L"\n"; // Show current time in additional time zones for (auto&& timeZone : timeZones) { calendar.ChangeTimeZone(timeZone); ReportCalendarData(results, calendar); } results << L"\n"; // Change back to local time zone calendar.ChangeTimeZone(localTimeZone); // Show a time on 14th day of second month of next year. // Note the effect of daylight saving time on the results. results << L"Same time on 14th day of second month of next year:\n"; calendar.AddYears(1); calendar.Month(2); calendar.Day(14); ReportCalendarData(results, calendar); for (auto&& timeZone : timeZones) { calendar.ChangeTimeZone(timeZone); ReportCalendarData(results, calendar); } results << L"\n"; // Change back to local time zone calendar.ChangeTimeZone(localTimeZone); // Show a time on 14th day of tenth month of next year. // Note the effect of daylight saving time on the results. results << L"Same time on 14th day of tenth month of next year:\n"; calendar.AddMonths(8); ReportCalendarData(results, calendar); for (auto&& timeZone : timeZones) { calendar.ChangeTimeZone(timeZone); ReportCalendarData(results, calendar); } results << L"\n"; // Display the results OutputTextBlock().Text(results.str()); } }
36.926606
95
0.59354
lyahdav
038bcc76f8b5878b30a9e9afed1879afa03d5161
98
hpp
C++
day07/part2.hpp
Moremar/advent_of_code_2016
dea264671fc2c31baa42b1282751dfd1ae071a7d
[ "Apache-2.0" ]
null
null
null
day07/part2.hpp
Moremar/advent_of_code_2016
dea264671fc2c31baa42b1282751dfd1ae071a7d
[ "Apache-2.0" ]
null
null
null
day07/part2.hpp
Moremar/advent_of_code_2016
dea264671fc2c31baa42b1282751dfd1ae071a7d
[ "Apache-2.0" ]
null
null
null
#pragma once #include "part1.hpp" namespace Part2 { int solve(const vector<IPv7> &ipv7s); }
12.25
41
0.683673
Moremar
03900391b39ebbac190e8d503c4f16e1759061c9
1,127
cpp
C++
LinkedList/27 Flatten a Linked List.cpp
i-am-grut/LoveBabbar-450-Questions
08faaa70198363c6ac481a67c548e1e7e4c7c591
[ "MIT" ]
2
2021-06-25T07:26:23.000Z
2022-01-28T22:24:34.000Z
LinkedList/27 Flatten a Linked List.cpp
i-am-grut/LoveBabbar-450-Questions
08faaa70198363c6ac481a67c548e1e7e4c7c591
[ "MIT" ]
null
null
null
LinkedList/27 Flatten a Linked List.cpp
i-am-grut/LoveBabbar-450-Questions
08faaa70198363c6ac481a67c548e1e7e4c7c591
[ "MIT" ]
null
null
null
Node* merge(Node* head1, Node* head2){ if(head1==NULL){ return head2; } if(head2==NULL){ return head1; } Node* head; Node* tail; if(head1->data<head2->data){ head=head1; head1=head1->bottom; } else{ head=head2; head2=head2->bottom; } tail=head; while(head1!=NULL && head2!=NULL){ if(head1->data<head2->data){ tail->bottom=head1; head1=head1->bottom; } else{ tail->bottom=head2; head2=head2->bottom; } tail=tail->bottom; } while(head1!=NULL){ tail->bottom=head1; head1=head1->bottom; tail=tail->bottom; } while(head2!=NULL){ tail->bottom=head2; head2=head2->bottom; tail=tail->bottom; } return head; } /* Function which returns the root of the flattened linked list. */ Node *flatten(Node *root) { if(root==NULL || root->next==NULL){ return root; } root->next=flatten(root->next); //Merge root=merge(root,root->next); return root; }
20.490909
40
0.515528
i-am-grut
0393fe9403b7546e128cac1e9ab9542942c930c0
814
cpp
C++
source/GUIEventHandler.cpp
mackron/GTGameEngine
380d1e01774fe6bc2940979e4e5983deef0bf082
[ "BSD-3-Clause" ]
31
2015-03-19T08:44:48.000Z
2021-12-15T20:52:31.000Z
source/GUIEventHandler.cpp
mackron/GTGameEngine
380d1e01774fe6bc2940979e4e5983deef0bf082
[ "BSD-3-Clause" ]
19
2015-07-09T09:02:44.000Z
2016-06-09T03:51:03.000Z
source/GUIEventHandler.cpp
mackron/GTGameEngine
380d1e01774fe6bc2940979e4e5983deef0bf082
[ "BSD-3-Clause" ]
3
2017-10-04T23:38:18.000Z
2022-03-07T08:27:13.000Z
// Copyright (C) 2011 - 2014 David Reid. See included LICENCE. #include <GTGE/GUIEventHandler.hpp> #include <GTGE/GTEngine.hpp> namespace GT { GUIEventHandler::GUIEventHandler(Context &context) : context(context) { } GUIEventHandler::~GUIEventHandler() { } void GUIEventHandler::OnError(const char* msg) { g_Context->LogErrorf("%s", msg); } void GUIEventHandler::OnWarning(const char* msg) { g_Context->Logf("%s", msg); } void GUIEventHandler::OnLog(const char* msg) { g_Context->Logf("%s", msg); } void GUIEventHandler::OnChangeCursor(Cursor cursor) { if (cursor != Cursor_None) { context.GetWindow()->SetCursor(cursor); } } }
20.35
63
0.565111
mackron
03949325044207fb77e58a6a962d4325237da81e
6,311
cpp
C++
ibtk/src/solvers/interfaces/GeneralOperator.cpp
MSV-Project/IBAMR
3cf614c31bb3c94e2620f165ba967cba719c45ea
[ "BSD-3-Clause" ]
2
2017-12-06T06:16:36.000Z
2021-03-13T12:28:08.000Z
ibtk/src/solvers/interfaces/GeneralOperator.cpp
MSV-Project/IBAMR
3cf614c31bb3c94e2620f165ba967cba719c45ea
[ "BSD-3-Clause" ]
null
null
null
ibtk/src/solvers/interfaces/GeneralOperator.cpp
MSV-Project/IBAMR
3cf614c31bb3c94e2620f165ba967cba719c45ea
[ "BSD-3-Clause" ]
null
null
null
// Filename: GeneralOperator.cpp // Created on 18 Nov 2003 by Boyce Griffith // // Copyright (c) 2002-2013, Boyce Griffith // All rights reserved. // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions are met: // // * Redistributions of source code must retain the above copyright notice, // this list of conditions and the following disclaimer. // // * Redistributions in binary form must reproduce the above copyright // notice, this list of conditions and the following disclaimer in the // documentation and/or other materials provided with the distribution. // // * Neither the name of New York University nor the names of its // contributors may be used to endorse or promote products derived from // this software without specific prior written permission. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" // AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE // IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE // ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE // LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR // CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF // SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS // INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN // CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) // ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE // POSSIBILITY OF SUCH DAMAGE. /////////////////////////////// INCLUDES ///////////////////////////////////// #include <stddef.h> #include <limits> #include <ostream> #include "GeneralOperator.h" #include "SAMRAIVectorReal.h" #include "ibtk/namespaces.h" // IWYU pragma: keep /////////////////////////////// NAMESPACE //////////////////////////////////// namespace IBTK { /////////////////////////////// STATIC /////////////////////////////////////// /////////////////////////////// PUBLIC /////////////////////////////////////// GeneralOperator::GeneralOperator( const std::string& object_name, bool homogeneous_bc) : d_object_name(object_name), d_is_initialized(false), d_homogeneous_bc(homogeneous_bc), d_solution_time(std::numeric_limits<double>::quiet_NaN()), d_current_time(std::numeric_limits<double>::quiet_NaN()), d_new_time(std::numeric_limits<double>::quiet_NaN()), d_hier_math_ops(NULL), d_hier_math_ops_external(false), d_enable_logging(false) { // intentionally blank return; }// GeneralOperator() GeneralOperator::~GeneralOperator() { deallocateOperatorState(); return; }// ~GeneralOperator() const std::string& GeneralOperator::getName() const { return d_object_name; }// getName bool GeneralOperator::getIsInitialized() const { return d_is_initialized; }// getIsInitialized void GeneralOperator::setHomogeneousBc( bool homogeneous_bc) { d_homogeneous_bc = homogeneous_bc; return; }// setHomogeneousBc bool GeneralOperator::getHomogeneousBc() const { return d_homogeneous_bc; }// getHomogeneousBc void GeneralOperator::setSolutionTime( double solution_time) { d_solution_time = solution_time; return; }// setSolutionTime double GeneralOperator::getSolutionTime() const { return d_solution_time; }// getSolutionTime void GeneralOperator::setTimeInterval( double current_time, double new_time) { d_current_time = current_time; d_new_time = new_time; return; }// setTimeInterval std::pair<double,double> GeneralOperator::getTimeInterval() const { return std::make_pair(d_current_time,d_new_time); }// getTimeInterval double GeneralOperator::getDt() const { return d_new_time-d_current_time; }// getDt void GeneralOperator::setHierarchyMathOps( Pointer<HierarchyMathOps> hier_math_ops) { d_hier_math_ops = hier_math_ops; d_hier_math_ops_external = d_hier_math_ops; return; }// setHierarchyMathOps Pointer<HierarchyMathOps> GeneralOperator::getHierarchyMathOps() const { return d_hier_math_ops; }// getHierarchyMathOps void GeneralOperator::applyAdd( SAMRAIVectorReal<NDIM,double>& x, SAMRAIVectorReal<NDIM,double>& y, SAMRAIVectorReal<NDIM,double>& z) { // Guard against the case that y == z. Pointer<SAMRAIVectorReal<NDIM,double> > zz = z.cloneVector(z.getName()); zz->allocateVectorData(); zz->copyVector(Pointer<SAMRAIVectorReal<NDIM,double> >(&z,false)); apply(x,*zz); z.add(Pointer<SAMRAIVectorReal<NDIM,double> >(&y,false),zz); zz->freeVectorComponents(); zz.setNull(); return; }// applyAdd void GeneralOperator::initializeOperatorState( const SAMRAIVectorReal<NDIM,double>& /*in*/, const SAMRAIVectorReal<NDIM,double>& /*out*/) { d_is_initialized = true; return; }// initializeOperatorState void GeneralOperator::deallocateOperatorState() { d_is_initialized = false; return; }// deallocateOperatorState void GeneralOperator::setLoggingEnabled( bool enable_logging) { d_enable_logging = enable_logging; return; }// setLoggingEnabled bool GeneralOperator::getLoggingEnabled() const { return d_enable_logging; }// getLoggingEnabled void GeneralOperator::printClassData( std::ostream& stream) { stream << "\n" << "object_name = " << d_object_name << "\n" << "is_initialized = " << d_is_initialized << "\n" << "homogeneous_bc = " << d_homogeneous_bc << "\n" << "solution_time = " << d_solution_time << "\n" << "current_time = " << d_current_time << "\n" << "new_time = " << d_new_time << "\n" << "hier_math_ops = " << d_hier_math_ops.getPointer() << "\n" << "hier_math_ops_external = " << d_hier_math_ops_external << "\n" << "enable_logging = " << d_enable_logging << "\n"; return; }// printClassData /////////////////////////////// PRIVATE ////////////////////////////////////// ////////////////////////////////////////////////////////////////////////////// }// namespace IBTK //////////////////////////////////////////////////////////////////////////////
28.427928
78
0.658533
MSV-Project
0395586291b97b7d6d42c0e646a979e6113a48c2
43,546
cxx
C++
main/jvmfwk/source/elements.cxx
Grosskopf/openoffice
93df6e8a695d5e3eac16f3ad5e9ade1b963ab8d7
[ "Apache-2.0" ]
679
2015-01-06T06:34:58.000Z
2022-03-30T01:06:03.000Z
main/jvmfwk/source/elements.cxx
Grosskopf/openoffice
93df6e8a695d5e3eac16f3ad5e9ade1b963ab8d7
[ "Apache-2.0" ]
102
2017-11-07T08:51:31.000Z
2022-03-17T12:13:49.000Z
main/jvmfwk/source/elements.cxx
Grosskopf/openoffice
93df6e8a695d5e3eac16f3ad5e9ade1b963ab8d7
[ "Apache-2.0" ]
331
2015-01-06T11:40:55.000Z
2022-03-14T04:07:51.000Z
/************************************************************** * * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, * software distributed under the License is distributed on an * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * KIND, either express or implied. See the License for the * specific language governing permissions and limitations * under the License. * *************************************************************/ // MARKER(update_precomp.py): autogen include statement, do not remove #include "precompiled_jvmfwk.hxx" #include "elements.hxx" #include "osl/mutex.hxx" #include "osl/file.hxx" #include "osl/time.h" #include "fwkutil.hxx" #include "fwkbase.hxx" #include "framework.hxx" #include "libxmlutil.hxx" #include "osl/thread.hxx" #include <algorithm> #include "libxml/parser.h" #include "libxml/xpath.h" #include "libxml/xpathInternals.h" #include "rtl/bootstrap.hxx" #include "boost/optional.hpp" #include <string.h> // #define NS_JAVA_FRAMEWORK "http://openoffice.org/2004/java/framework/1.0" // #define NS_SCHEMA_INSTANCE "http://www.w3.org/2001/XMLSchema-instance" using namespace osl; namespace jfw { rtl::OString getElement(::rtl::OString const & docPath, xmlChar const * pathExpression, bool bThrowIfEmpty) { //Prepare the xml document and context OSL_ASSERT(docPath.getLength() > 0); jfw::CXmlDocPtr doc(xmlParseFile(docPath.getStr())); if (doc == NULL) throw FrameworkException( JFW_E_ERROR, rtl::OString("[Java framework] Error in function getElement " "(elements.cxx)")); jfw::CXPathContextPtr context(xmlXPathNewContext(doc)); if (xmlXPathRegisterNs(context, (xmlChar*) "jf", (xmlChar*) NS_JAVA_FRAMEWORK) == -1) throw FrameworkException( JFW_E_ERROR, rtl::OString("[Java framework] Error in function getElement " "(elements.cxx)")); CXPathObjectPtr pathObj; pathObj = xmlXPathEvalExpression(pathExpression, context); rtl::OString sValue; if (xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) { if (bThrowIfEmpty) throw FrameworkException( JFW_E_ERROR, rtl::OString("[Java framework] Error in function getElement " "(elements.cxx)")); } else { sValue = (sal_Char*) pathObj->nodesetval->nodeTab[0]->content; } return sValue; } rtl::OString getElementUpdated() { return getElement(jfw::getVendorSettingsPath(), (xmlChar*)"/jf:javaSelection/jf:updated/text()", true); } // Use only in INSTALL mode !!! rtl::OString getElementModified() { //The modified element is only written in INSTALL mode. //That is NodeJava::m_layer = INSTALL return getElement(jfw::getInstallSettingsPath(), (xmlChar*)"/jf:java/jf:modified/text()", false); } void createSettingsStructure( xmlDoc* document, bool* pbNeedsSave) { rtl::OString sExcMsg("[Java framework] Error in function createSettingsStructure " "(elements.cxx)."); xmlNode * root = xmlDocGetRootElement(document); if (root == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); bool bFound = false; xmlNode * cur = root->children; while (cur != NULL) { if (xmlStrcmp(cur->name, (xmlChar*) "enabled") == 0) { bFound = true; break; } cur = cur->next; } if (bFound) { *pbNeedsSave = false; return; } //We will modify this document *pbNeedsSave = true; // Now we create the child elements ------------------ //Get xsi:nil namespace xmlNs* nsXsi = xmlSearchNsByHref( document, root,(xmlChar*) NS_SCHEMA_INSTANCE); //<enabled xsi:nil="true" xmlNode * nodeEn = xmlNewTextChild( root,NULL, (xmlChar*) "enabled", (xmlChar*) ""); if (nodeEn == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlSetNsProp(nodeEn,nsXsi,(xmlChar*) "nil",(xmlChar*) "true"); //add a new line xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); //<userClassPath xsi:nil="true"> xmlNode * nodeUs = xmlNewTextChild( root,NULL, (xmlChar*) "userClassPath", (xmlChar*) ""); if (nodeUs == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlSetNsProp(nodeUs,nsXsi,(xmlChar*) "nil",(xmlChar*) "true"); //add a new line nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); //<vmParameters xsi:nil="true"> xmlNode * nodeVm = xmlNewTextChild( root,NULL, (xmlChar*) "vmParameters", (xmlChar*) ""); if (nodeVm == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlSetNsProp(nodeVm,nsXsi,(xmlChar*) "nil",(xmlChar*) "true"); //add a new line nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); //<jreLocations xsi:nil="true"> xmlNode * nodeJre = xmlNewTextChild( root,NULL, (xmlChar*) "jreLocations", (xmlChar*) ""); if (nodeJre == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlSetNsProp(nodeJre,nsXsi,(xmlChar*) "nil",(xmlChar*) "true"); //add a new line nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); //<javaInfo xsi:nil="true" autoSelect="true"> xmlNode * nodeJava = xmlNewTextChild( root,NULL, (xmlChar*) "javaInfo", (xmlChar*) ""); if (nodeJava == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlSetNsProp(nodeJava,nsXsi,(xmlChar*) "nil",(xmlChar*) "true"); // xmlSetProp(nodeJava,(xmlChar*) "autoSelect",(xmlChar*) "true"); //add a new line nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); } //==================================================================== VersionInfo::VersionInfo(): arVersions(NULL) { } VersionInfo::~VersionInfo() { delete [] arVersions; } void VersionInfo::addExcludeVersion(const rtl::OUString& sVersion) { vecExcludeVersions.push_back(sVersion); } rtl_uString** VersionInfo::getExcludeVersions() { osl::MutexGuard guard(FwkMutex::get()); if (arVersions != NULL) return arVersions; arVersions = new rtl_uString*[vecExcludeVersions.size()]; int j=0; typedef std::vector<rtl::OUString>::const_iterator it; for (it i = vecExcludeVersions.begin(); i != vecExcludeVersions.end(); i++, j++) { arVersions[j] = vecExcludeVersions[j].pData; } return arVersions; } sal_Int32 VersionInfo::getExcludeVersionSize() { return vecExcludeVersions.size(); } //================================================================== NodeJava::NodeJava(Layer layer): m_layer(layer) { //This class reads and write to files which should only be done in //application mode if (getMode() == JFW_MODE_DIRECT) throw FrameworkException( JFW_E_DIRECT_MODE, "[Java framework] Trying to access settings files in direct mode."); if (USER_OR_INSTALL == m_layer) { if (BootParams::getInstallData().getLength() > 0) m_layer = INSTALL; else m_layer = USER; } else { m_layer = layer; } } void NodeJava::load() { const rtl::OString sExcMsg("[Java framework] Error in function NodeJava::load" "(elements.cxx)."); if (SHARED == m_layer) { //we do not support yet to write into the shared installation //check if shared settings exist at all. jfw::FileStatus s = checkFileURL(BootParams::getSharedData()); if (s == FILE_INVALID) throw FrameworkException( JFW_E_ERROR, "[Java framework] Invalid file for shared Java settings."); else if (s == FILE_DOES_NOT_EXIST) //Writing shared data is not supported yet. return; } else if (USER == m_layer || INSTALL == m_layer) { prepareSettingsDocument(); } else { OSL_ASSERT("[Java framework] Unknown enum used."); } //Read the user elements rtl::OString sSettingsPath = getSettingsPath(); //There must not be a share settings file CXmlDocPtr docUser(xmlParseFile(sSettingsPath.getStr())); if (docUser == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode * cur = xmlDocGetRootElement(docUser); if (cur == NULL || cur->children == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); CXmlCharPtr sNil; cur = cur->children; while (cur != NULL) { if (xmlStrcmp(cur->name, (xmlChar*) "enabled") == 0) { //only overwrite share settings if xsi:nil="false" sNil = xmlGetNsProp( cur, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if (sNil == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg);; if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) { CXmlCharPtr sEnabled( xmlNodeListGetString( docUser, cur->children, 1)); if (xmlStrcmp(sEnabled, (xmlChar*) "true") == 0) m_enabled = boost::optional<sal_Bool>(sal_True); else if (xmlStrcmp(sEnabled, (xmlChar*) "false") == 0) m_enabled = boost::optional<sal_Bool>(sal_False); } } else if (xmlStrcmp(cur->name, (xmlChar*) "userClassPath") == 0) { sNil = xmlGetNsProp( cur, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if (sNil == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) { CXmlCharPtr sUser(xmlNodeListGetString( docUser, cur->children, 1)); m_userClassPath = boost::optional<rtl::OUString>(rtl::OUString(sUser)); } } else if (xmlStrcmp(cur->name, (xmlChar*) "javaInfo") == 0) { sNil = xmlGetNsProp( cur, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if (sNil == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) { if (! m_javaInfo) m_javaInfo = boost::optional<CNodeJavaInfo>(CNodeJavaInfo()); m_javaInfo->loadFromNode(docUser, cur); } } else if (xmlStrcmp(cur->name, (xmlChar*) "vmParameters") == 0) { sNil = xmlGetNsProp( cur, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if (sNil == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) { if ( ! m_vmParameters) m_vmParameters = boost::optional<std::vector<rtl::OUString> >( std::vector<rtl::OUString> ()); xmlNode * pOpt = cur->children; while (pOpt != NULL) { if (xmlStrcmp(pOpt->name, (xmlChar*) "param") == 0) { CXmlCharPtr sOpt; sOpt = xmlNodeListGetString( docUser, pOpt->children, 1); m_vmParameters->push_back(sOpt); } pOpt = pOpt->next; } } } else if (xmlStrcmp(cur->name, (xmlChar*) "jreLocations") == 0) { sNil = xmlGetNsProp( cur, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if (sNil == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) { if (! m_JRELocations) m_JRELocations = boost::optional<std::vector<rtl::OUString> >( std::vector<rtl::OUString>()); xmlNode * pLoc = cur->children; while (pLoc != NULL) { if (xmlStrcmp(pLoc->name, (xmlChar*) "location") == 0) { CXmlCharPtr sLoc; sLoc = xmlNodeListGetString( docUser, pLoc->children, 1); m_JRELocations->push_back(sLoc); } pLoc = pLoc->next; } } } cur = cur->next; } } ::rtl::OString NodeJava::getSettingsPath() const { ::rtl::OString ret; switch (m_layer) { case USER: ret = getUserSettingsPath(); break; case INSTALL: ret = getInstallSettingsPath(); break; case SHARED: ret = getSharedSettingsPath(); break; default: OSL_ASSERT("[Java framework] NodeJava::getSettingsPath()"); } return ret; } ::rtl::OUString NodeJava::getSettingsURL() const { ::rtl::OUString ret; switch (m_layer) { case USER: ret = BootParams::getUserData(); break; case INSTALL: ret = BootParams::getInstallData(); break; case SHARED: ret = BootParams::getSharedData(); break; default: OSL_ASSERT("[Java framework] NodeJava::getSettingsURL()"); } return ret; } void NodeJava::prepareSettingsDocument() const { rtl::OString sExcMsg( "[Java framework] Error in function prepareSettingsDocument" " (elements.cxx)."); createSettingsDocument(); rtl::OString sSettings = getSettingsPath(); CXmlDocPtr doc(xmlParseFile(sSettings.getStr())); if (!doc) throw FrameworkException(JFW_E_ERROR, sExcMsg); bool bNeedsSave = false; createSettingsStructure(doc, & bNeedsSave); if (bNeedsSave) { if (xmlSaveFormatFileEnc( sSettings.getStr(), doc,"UTF-8", 1) == -1) throw FrameworkException(JFW_E_ERROR, sExcMsg); } } void NodeJava::write() const { rtl::OString sExcMsg("[Java framework] Error in function NodeJava::writeSettings " "(elements.cxx)."); CXmlDocPtr docUser; CXPathContextPtr contextUser; CXPathObjectPtr pathObj; prepareSettingsDocument(); //Read the user elements rtl::OString sSettingsPath = getSettingsPath(); docUser = xmlParseFile(sSettingsPath.getStr()); if (docUser == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); contextUser = xmlXPathNewContext(docUser); if (xmlXPathRegisterNs(contextUser, (xmlChar*) "jf", (xmlChar*) NS_JAVA_FRAMEWORK) == -1) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode * root = xmlDocGetRootElement(docUser); //Get xsi:nil namespace xmlNs* nsXsi = xmlSearchNsByHref(docUser, root, (xmlChar*) NS_SCHEMA_INSTANCE); //set the <enabled> element //The element must exist if (m_enabled) { rtl::OString sExpression= rtl::OString( "/jf:java/jf:enabled"); pathObj = xmlXPathEvalExpression((xmlChar*) sExpression.getStr(), contextUser); if ( ! pathObj || xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode * nodeEnabled = pathObj->nodesetval->nodeTab[0]; xmlSetNsProp(nodeEnabled, nsXsi, (xmlChar*) "nil", (xmlChar*) "false"); if (m_enabled == boost::optional<sal_Bool>(sal_True)) xmlNodeSetContent(nodeEnabled,(xmlChar*) "true"); else xmlNodeSetContent(nodeEnabled,(xmlChar*) "false"); } //set the <userClassPath> element //The element must exist if (m_userClassPath) { rtl::OString sExpression= rtl::OString( "/jf:java/jf:userClassPath"); pathObj = xmlXPathEvalExpression((xmlChar*) sExpression.getStr(), contextUser); if ( ! pathObj || xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode * nodeEnabled = pathObj->nodesetval->nodeTab[0]; xmlSetNsProp(nodeEnabled, nsXsi, (xmlChar*) "nil",(xmlChar*) "false"); xmlNodeSetContent(nodeEnabled,(xmlChar*) CXmlCharPtr(*m_userClassPath)); } //set <javaInfo> element if (m_javaInfo) { rtl::OString sExpression= rtl::OString( "/jf:java/jf:javaInfo"); pathObj = xmlXPathEvalExpression((xmlChar*) sExpression.getStr(), contextUser); if ( ! pathObj || xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) throw FrameworkException(JFW_E_ERROR, sExcMsg); m_javaInfo->writeToNode( docUser, pathObj->nodesetval->nodeTab[0]); } //set <vmParameters> element if (m_vmParameters) { rtl::OString sExpression= rtl::OString( "/jf:java/jf:vmParameters"); pathObj = xmlXPathEvalExpression((xmlChar*) sExpression.getStr(), contextUser); if ( ! pathObj || xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode* vmParameters = pathObj->nodesetval->nodeTab[0]; //set xsi:nil = false; xmlSetNsProp(vmParameters, nsXsi,(xmlChar*) "nil", (xmlChar*) "false"); //remove option elements xmlNode* cur = vmParameters->children; while (cur != NULL) { xmlNode* lastNode = cur; cur = cur->next; xmlUnlinkNode(lastNode); xmlFreeNode(lastNode); } //add a new line after <vmParameters> if (m_vmParameters->size() > 0) { xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(vmParameters, nodeCrLf); } typedef std::vector<rtl::OUString>::const_iterator cit; for (cit i = m_vmParameters->begin(); i != m_vmParameters->end(); i++) { xmlNewTextChild(vmParameters, NULL, (xmlChar*) "param", CXmlCharPtr(*i)); //add a new line xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(vmParameters, nodeCrLf); } } //set <jreLocations> element if (m_JRELocations) { rtl::OString sExpression= rtl::OString( "/jf:java/jf:jreLocations"); pathObj = xmlXPathEvalExpression((xmlChar*) sExpression.getStr(), contextUser); if ( ! pathObj || xmlXPathNodeSetIsEmpty(pathObj->nodesetval)) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode* jreLocationsNode = pathObj->nodesetval->nodeTab[0]; //set xsi:nil = false; xmlSetNsProp(jreLocationsNode, nsXsi,(xmlChar*) "nil", (xmlChar*) "false"); //remove option elements xmlNode* cur = jreLocationsNode->children; while (cur != NULL) { xmlNode* lastNode = cur; cur = cur->next; xmlUnlinkNode(lastNode); xmlFreeNode(lastNode); } //add a new line after <vmParameters> if (m_JRELocations->size() > 0) { xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(jreLocationsNode, nodeCrLf); } typedef std::vector<rtl::OUString>::const_iterator cit; for (cit i = m_JRELocations->begin(); i != m_JRELocations->end(); i++) { xmlNewTextChild(jreLocationsNode, NULL, (xmlChar*) "location", CXmlCharPtr(*i)); //add a new line xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(jreLocationsNode, nodeCrLf); } } if (INSTALL == m_layer) { //now write the current system time ::TimeValue curTime = {0,0}; if (::osl_getSystemTime(& curTime)) { rtl::OUString sSeconds = rtl::OUString::valueOf((sal_Int64) curTime.Seconds); xmlNewTextChild( root,NULL, (xmlChar*) "modified", CXmlCharPtr(sSeconds)); xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(root, nodeCrLf); } } if (xmlSaveFormatFile(sSettingsPath.getStr(), docUser, 1) == -1) throw FrameworkException(JFW_E_ERROR, sExcMsg); } void NodeJava::setEnabled(sal_Bool bEnabled) { m_enabled = boost::optional<sal_Bool>(bEnabled); } void NodeJava::setUserClassPath(const rtl::OUString & sClassPath) { m_userClassPath = boost::optional<rtl::OUString>(sClassPath); } void NodeJava::setJavaInfo(const JavaInfo * pInfo, bool bAutoSelect) { if (!m_javaInfo) m_javaInfo = boost::optional<CNodeJavaInfo>(CNodeJavaInfo()); m_javaInfo->bAutoSelect = bAutoSelect; m_javaInfo->bNil = false; if (pInfo != NULL) { m_javaInfo->m_bEmptyNode = false; m_javaInfo->sVendor = pInfo->sVendor; m_javaInfo->sLocation = pInfo->sLocation; m_javaInfo->sVersion = pInfo->sVersion; m_javaInfo->nFeatures = pInfo->nFeatures; m_javaInfo->nRequirements = pInfo->nRequirements; m_javaInfo->arVendorData = pInfo->arVendorData; } else { m_javaInfo->m_bEmptyNode = true; rtl::OUString sEmpty; m_javaInfo->sVendor = sEmpty; m_javaInfo->sLocation = sEmpty; m_javaInfo->sVersion = sEmpty; m_javaInfo->nFeatures = 0; m_javaInfo->nRequirements = 0; m_javaInfo->arVendorData = rtl::ByteSequence(); } } void NodeJava::setVmParameters(rtl_uString * * arOptions, sal_Int32 size) { OSL_ASSERT( !(arOptions == 0 && size != 0)); if ( ! m_vmParameters) m_vmParameters = boost::optional<std::vector<rtl::OUString> >( std::vector<rtl::OUString>()); m_vmParameters->clear(); if (arOptions != NULL) { for (int i = 0; i < size; i++) { const rtl::OUString sOption(static_cast<rtl_uString*>(arOptions[i])); m_vmParameters->push_back(sOption); } } } void NodeJava::setJRELocations(rtl_uString * * arLocations, sal_Int32 size) { OSL_ASSERT( !(arLocations == 0 && size != 0)); if (! m_JRELocations) m_JRELocations = boost::optional<std::vector<rtl::OUString> > ( std::vector<rtl::OUString>()); m_JRELocations->clear(); if (arLocations != NULL) { for (int i = 0; i < size; i++) { const rtl::OUString & sLocation = static_cast<rtl_uString*>(arLocations[i]); //only add the path if not already present std::vector<rtl::OUString>::const_iterator it = std::find(m_JRELocations->begin(), m_JRELocations->end(), sLocation); if (it == m_JRELocations->end()) m_JRELocations->push_back(sLocation); } } } void NodeJava::addJRELocation(rtl_uString * sLocation) { OSL_ASSERT( sLocation); if (!m_JRELocations) m_JRELocations = boost::optional<std::vector<rtl::OUString> >( std::vector<rtl::OUString> ()); //only add the path if not already present std::vector<rtl::OUString>::const_iterator it = std::find(m_JRELocations->begin(), m_JRELocations->end(), rtl::OUString(sLocation)); if (it == m_JRELocations->end()) m_JRELocations->push_back(rtl::OUString(sLocation)); } const boost::optional<sal_Bool> & NodeJava::getEnabled() const { return m_enabled; } const boost::optional<std::vector<rtl::OUString> >& NodeJava::getJRELocations() const { return m_JRELocations; } const boost::optional<rtl::OUString> & NodeJava::getUserClassPath() const { return m_userClassPath; } const boost::optional<std::vector<rtl::OUString> > & NodeJava::getVmParameters() const { return m_vmParameters; } const boost::optional<CNodeJavaInfo> & NodeJava::getJavaInfo() const { return m_javaInfo; } jfw::FileStatus NodeJava::checkSettingsFileStatus() const { jfw::FileStatus ret = FILE_DOES_NOT_EXIST; const rtl::OUString sURL = getSettingsURL(); //check the file time ::osl::DirectoryItem item; File::RC rc = ::osl::DirectoryItem::get(sURL, item); if (File::E_None == rc) { ::osl::FileStatus stat( FileStatusMask_Validate | FileStatusMask_CreationTime | FileStatusMask_ModifyTime); File::RC rc_stat = item.getFileStatus(stat); if (File::E_None == rc_stat) { // This //function may be called multiple times when a java is started. //If the expiretime is too small then we may loop because every time //the file is deleted and we need to search for a java again. if (INSTALL == m_layer) { //file exists. Check if it is too old //Do not use the creation time. On Windows 2003 server I noticed //that after removing the file and shortly later creating it again //did not change the creation time. That is the newly created file //had the creation time of the former file. // ::TimeValue modTime = stat.getModifyTime(); ::TimeValue curTime = {0,0}; ret = FILE_OK; if (sal_True == ::osl_getSystemTime(& curTime)) { //get the modified time recorded in the <modified> element sal_uInt32 modified = getModifiedTime(); OSL_ASSERT(modified <= curTime.Seconds); //Only if modified has a valued then NodeJava::write was called, //then the xml structure was filled with data. if ( modified && curTime.Seconds - modified > BootParams::getInstallDataExpiration()) { #if OSL_DEBUG_LEVEL >=2 fprintf(stderr, "[Java framework] Settings file is %d seconds old. \n", (int)( curTime.Seconds - modified)); rtl::OString s = rtl::OUStringToOString(sURL, osl_getThreadTextEncoding()); fprintf(stderr, "[Java framework] Settings file is exspired. Deleting settings file at \n%s\n", s.getStr()); #endif //delete file File f(sURL); if (File::E_None == f.open(OpenFlag_Write | OpenFlag_Read) && File::E_None == f.setPos(0, 0) && File::E_None == f.setSize(0)) ret = FILE_DOES_NOT_EXIST; else ret = FILE_INVALID; } else { ret = FILE_OK; } } else // osl_getSystemTime { ret = FILE_INVALID; } } else // INSTALL == m_layer { ret = FILE_OK; } } else if (File::E_NOENT == rc_stat) { ret = FILE_DOES_NOT_EXIST; } else { ret = FILE_INVALID; } } else if(File::E_NOENT == rc) { ret = FILE_DOES_NOT_EXIST; } else { ret = FILE_INVALID; } return ret; } void NodeJava::createSettingsDocument() const { const rtl::OUString sURL = getSettingsURL(); //make sure there is a user directory rtl::OString sExcMsg("[Java framework] Error in function createSettingsDocument " "(elements.cxx)."); // check if javasettings.xml already exist if (FILE_OK == checkSettingsFileStatus()) return; //make sure that the directories are created in case they do not exist FileBase::RC rcFile = Directory::createPath(getDirFromFile(sURL)); if (rcFile != FileBase::E_EXIST && rcFile != FileBase::E_None) throw FrameworkException(JFW_E_ERROR, sExcMsg); //javasettings.xml does not exist yet CXmlDocPtr doc(xmlNewDoc((xmlChar *)"1.0")); if (! doc) throw FrameworkException(JFW_E_ERROR, sExcMsg); //Create a comment xmlNewDocComment( doc, (xmlChar *) "This is a generated file. Do not alter this file!"); //Create the root element and name spaces xmlNodePtr root = xmlNewDocNode( doc, NULL, (xmlChar *) "java", (xmlChar *) "\n"); if (root == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlNewNs(root, (xmlChar *) NS_JAVA_FRAMEWORK,NULL) == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlNewNs(root,(xmlChar*) NS_SCHEMA_INSTANCE,(xmlChar*)"xsi") == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlDocSetRootElement(doc, root); //Create a comment xmlNodePtr com = xmlNewComment( (xmlChar *) "This is a generated file. Do not alter this file!"); if (com == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlAddPrevSibling(root, com) == NULL) throw FrameworkException(JFW_E_ERROR, sExcMsg); const rtl::OString path = getSettingsPath(); if (xmlSaveFormatFileEnc(path.getStr(), doc,"UTF-8", 1) == -1) throw FrameworkException(JFW_E_ERROR, sExcMsg); } //===================================================================== CNodeJavaInfo::CNodeJavaInfo() : m_bEmptyNode(false), bNil(true), bAutoSelect(true), nFeatures(0), nRequirements(0) { } CNodeJavaInfo::~CNodeJavaInfo() { } void CNodeJavaInfo::loadFromNode(xmlDoc * pDoc, xmlNode * pJavaInfo) { rtl::OString sExcMsg("[Java framework] Error in function NodeJavaInfo::loadFromNode " "(elements.cxx)."); OSL_ASSERT(pJavaInfo && pDoc); if (pJavaInfo->children == NULL) return; //Get the xsi:nil attribute; CXmlCharPtr sNil; sNil = xmlGetNsProp( pJavaInfo, (xmlChar*) "nil", (xmlChar*) NS_SCHEMA_INSTANCE); if ( ! sNil) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sNil, (xmlChar*) "true") == 0) bNil = true; else if (xmlStrcmp(sNil, (xmlChar*) "false") == 0) bNil = false; else throw FrameworkException(JFW_E_ERROR, sExcMsg); if (bNil == true) return; //Get javaInfo@manuallySelected attribute CXmlCharPtr sAutoSelect; sAutoSelect = xmlGetProp( pJavaInfo, (xmlChar*) "autoSelect"); if ( ! sAutoSelect) throw FrameworkException(JFW_E_ERROR, sExcMsg); if (xmlStrcmp(sAutoSelect, (xmlChar*) "true") == 0) bAutoSelect = true; else if (xmlStrcmp(sAutoSelect, (xmlChar*) "false") == 0) bAutoSelect = false; else throw FrameworkException(JFW_E_ERROR, sExcMsg); xmlNode * cur = pJavaInfo->children; while (cur != NULL) { if (xmlStrcmp(cur->name, (xmlChar*) "vendor") == 0) { CXmlCharPtr xmlVendor; xmlVendor = xmlNodeListGetString( pDoc, cur->children, 1); if (! xmlVendor) return; sVendor = xmlVendor; } else if (xmlStrcmp(cur->name, (xmlChar*) "location") == 0) { CXmlCharPtr xmlLocation; xmlLocation = xmlNodeListGetString( pDoc, cur->children, 1); sLocation = xmlLocation; } else if (xmlStrcmp(cur->name, (xmlChar*) "version") == 0) { CXmlCharPtr xmlVersion; xmlVersion = xmlNodeListGetString( pDoc, cur->children, 1); sVersion = xmlVersion; } else if (xmlStrcmp(cur->name, (xmlChar*) "features")== 0) { CXmlCharPtr xmlFeatures; xmlFeatures = xmlNodeListGetString( pDoc, cur->children, 1); rtl::OUString sFeatures = xmlFeatures; nFeatures = sFeatures.toInt64(16); } else if (xmlStrcmp(cur->name, (xmlChar*) "requirements") == 0) { CXmlCharPtr xmlRequire; xmlRequire = xmlNodeListGetString( pDoc, cur->children, 1); rtl::OUString sRequire = xmlRequire; nRequirements = sRequire.toInt64(16); #ifdef MACOSX //javaldx is not used anymore in the mac build. In case the Java //corresponding to the saved settings does not exist anymore the //javavm services will look for an existing Java after creation of //the JVM failed. See stoc/source/javavm/javavm.cxx. Only if //nRequirements does not have the flag JFW_REQUIRE_NEEDRESTART the //jvm of the new selected JRE will be started. Old settings (before //OOo 3.3) still contain the flag which can be safely ignored. nRequirements &= ~JFW_REQUIRE_NEEDRESTART; #endif } else if (xmlStrcmp(cur->name, (xmlChar*) "vendorData") == 0) { CXmlCharPtr xmlData; xmlData = xmlNodeListGetString( pDoc, cur->children, 1); xmlChar* _data = (xmlChar*) xmlData; if (_data) { rtl::ByteSequence seq((sal_Int8*) _data, strlen((char*)_data)); arVendorData = decodeBase16(seq); } } cur = cur->next; } if (sVendor.getLength() == 0) m_bEmptyNode = true; //Get the javainfo attributes CXmlCharPtr sVendorUpdate; sVendorUpdate = xmlGetProp(pJavaInfo, (xmlChar*) "vendorUpdate"); if ( ! sVendorUpdate) throw FrameworkException(JFW_E_ERROR, sExcMsg); sAttrVendorUpdate = sVendorUpdate; } void CNodeJavaInfo::writeToNode(xmlDoc* pDoc, xmlNode* pJavaInfoNode) const { OSL_ASSERT(pJavaInfoNode && pDoc); rtl::OString sExcMsg("[Java framework] Error in function NodeJavaInfo::writeToNode " "(elements.cxx)."); //write the attribute vendorSettings //javaInfo@vendorUpdate //creates the attribute if necessary rtl::OString sUpdated = getElementUpdated(); xmlSetProp(pJavaInfoNode, (xmlChar*)"vendorUpdate", (xmlChar*) sUpdated.getStr()); //javaInfo@autoSelect xmlSetProp(pJavaInfoNode, (xmlChar*)"autoSelect", (xmlChar*) (bAutoSelect == true ? "true" : "false")); //Set xsi:nil in javaInfo element to false //the xmlNs pointer must not be destroyed xmlNs* nsXsi = xmlSearchNsByHref((xmlDoc*) pDoc, pJavaInfoNode, (xmlChar*) NS_SCHEMA_INSTANCE); xmlSetNsProp(pJavaInfoNode, nsXsi, (xmlChar*) "nil", (xmlChar*) "false"); //Delete the children of JavaInfo xmlNode* cur = pJavaInfoNode->children; while (cur != NULL) { xmlNode* lastNode = cur; cur = cur->next; xmlUnlinkNode(lastNode); xmlFreeNode(lastNode); } //If the JavaInfo was set with an empty value, //then we are done. if (m_bEmptyNode) return; //add a new line after <javaInfo> xmlNode * nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the vendor element xmlNewTextChild(pJavaInfoNode, NULL, (xmlChar*) "vendor", CXmlCharPtr(sVendor)); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the location element xmlNewTextChild(pJavaInfoNode, NULL, (xmlChar*) "location", CXmlCharPtr(sLocation)); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the version element xmlNewTextChild(pJavaInfoNode, NULL, (xmlChar*) "version", CXmlCharPtr(sVersion)); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the features element rtl::OUString sFeatures = rtl::OUString::valueOf( (sal_Int64)nFeatures, 16); xmlNewTextChild(pJavaInfoNode, NULL, (xmlChar*) "features", CXmlCharPtr(sFeatures)); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the requirements element rtl::OUString sRequirements = rtl::OUString::valueOf( (sal_Int64) nRequirements, 16); xmlNewTextChild(pJavaInfoNode, NULL, (xmlChar*) "requirements", CXmlCharPtr(sRequirements)); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); //Create the features element rtl::ByteSequence data = encodeBase16(arVendorData); xmlNode* dataNode = xmlNewChild(pJavaInfoNode, NULL, (xmlChar*) "vendorData", (xmlChar*) ""); xmlNodeSetContentLen(dataNode, (xmlChar*) data.getArray(), data.getLength()); //add a new line for better readability nodeCrLf = xmlNewText((xmlChar*) "\n"); xmlAddChild(pJavaInfoNode, nodeCrLf); } JavaInfo * CNodeJavaInfo::makeJavaInfo() const { if (bNil == true || m_bEmptyNode == true) return NULL; JavaInfo * pInfo = (JavaInfo*) rtl_allocateMemory(sizeof(JavaInfo)); if (pInfo == NULL) return NULL; memset(pInfo, 0, sizeof(JavaInfo)); pInfo->sVendor = sVendor.pData; rtl_uString_acquire(pInfo->sVendor); pInfo->sLocation = sLocation.pData; rtl_uString_acquire(pInfo->sLocation); pInfo->sVersion = sVersion.pData; rtl_uString_acquire(pInfo->sVersion); pInfo->nFeatures = nFeatures; pInfo->nRequirements = nRequirements; pInfo->arVendorData = arVendorData.getHandle(); rtl_byte_sequence_acquire(pInfo->arVendorData); return pInfo; } sal_uInt32 NodeJava::getModifiedTime() const { sal_uInt32 ret = 0; if (m_layer != INSTALL) { OSL_ASSERT(0); return ret; } rtl::OString modTimeSeconds = getElementModified(); return (sal_uInt32) modTimeSeconds.toInt64(); } //================================================================================ MergedSettings::MergedSettings(): m_bEnabled(sal_False), m_sClassPath(), m_vmParams(), m_JRELocations(), m_javaInfo() { NodeJava settings(NodeJava::USER_OR_INSTALL); settings.load(); //Check if UNO_JAVA_JFW_INSTALL_DATA is set. If so, then we need not use user and //shared data. const ::rtl::OUString sInstall = BootParams::getInstallData(); if (sInstall.getLength() == 0) { NodeJava sharedSettings(NodeJava::SHARED); sharedSettings.load(); merge(sharedSettings, settings); } else { merge(NodeJava(), settings); } } MergedSettings::~MergedSettings() { } void MergedSettings::merge(const NodeJava & share, const NodeJava & user) { if (user.getEnabled()) m_bEnabled = * user.getEnabled(); else if (share.getEnabled()) m_bEnabled = * share.getEnabled(); else m_bEnabled = sal_True; if (user.getUserClassPath()) m_sClassPath = * user.getUserClassPath(); else if (share.getUserClassPath()) m_sClassPath = * share.getUserClassPath(); if (user.getJavaInfo()) m_javaInfo = * user.getJavaInfo(); else if (share.getJavaInfo()) m_javaInfo = * share.getJavaInfo(); if (user.getVmParameters()) m_vmParams = * user.getVmParameters(); else if (share.getVmParameters()) m_vmParams = * share.getVmParameters(); if (user.getJRELocations()) m_JRELocations = * user.getJRELocations(); else if (share.getJRELocations()) m_JRELocations = * share.getJRELocations(); } sal_Bool MergedSettings::getEnabled() const { return m_bEnabled; } const rtl::OUString& MergedSettings::getUserClassPath() const { return m_sClassPath; } ::std::vector< ::rtl::OString> MergedSettings::getVmParametersUtf8() const { ::std::vector< ::rtl::OString> ret; typedef ::std::vector< ::rtl::OUString>::const_iterator cit; for (cit i = m_vmParams.begin(); i < m_vmParams.end(); i++) { ret.push_back( ::rtl::OUStringToOString(*i, RTL_TEXTENCODING_UTF8)); } return ret; } const ::rtl::OString & MergedSettings::getJavaInfoAttrVendorUpdate() const { return m_javaInfo.sAttrVendorUpdate; } JavaInfo * MergedSettings::createJavaInfo() const { return m_javaInfo.makeJavaInfo(); } #ifdef WNT bool MergedSettings::getJavaInfoAttrAutoSelect() const { return m_javaInfo.bAutoSelect; } #endif void MergedSettings::getVmParametersArray( rtl_uString *** parParams, sal_Int32 * size) const { osl::MutexGuard guard(FwkMutex::get()); OSL_ASSERT(parParams != NULL && size != NULL); *parParams = (rtl_uString **) rtl_allocateMemory(sizeof(rtl_uString*) * m_vmParams.size()); if (*parParams == NULL) return; int j=0; typedef std::vector<rtl::OUString>::const_iterator it; for (it i = m_vmParams.begin(); i != m_vmParams.end(); i++, j++) { (*parParams)[j] = i->pData; rtl_uString_acquire(i->pData); } *size = m_vmParams.size(); } void MergedSettings::getJRELocations( rtl_uString *** parLocations, sal_Int32 * size) const { osl::MutexGuard guard(FwkMutex::get()); OSL_ASSERT(parLocations != NULL && size != NULL); *parLocations = (rtl_uString **) rtl_allocateMemory(sizeof(rtl_uString*) * m_JRELocations.size()); if (*parLocations == NULL) return; int j=0; typedef std::vector<rtl::OUString>::const_iterator it; for (it i = m_JRELocations.begin(); i != m_JRELocations.end(); i++, j++) { (*parLocations)[j] = i->pData; rtl_uString_acquire(i->pData); } *size = m_JRELocations.size(); } const std::vector<rtl::OUString> & MergedSettings::getJRELocations() const { return m_JRELocations; } }
33.678268
132
0.580145
Grosskopf
0397ae90f653d88bd3c81a9856111d9fcefea45d
574
hpp
C++
android-jni-support/src/main/cpp/includes/public/android-jni-support/jni_all.hpp
sephiroth74/android-jni-support
226018619f471af55e7d7eeb4aa67dcff0cba4f4
[ "MIT" ]
null
null
null
android-jni-support/src/main/cpp/includes/public/android-jni-support/jni_all.hpp
sephiroth74/android-jni-support
226018619f471af55e7d7eeb4aa67dcff0cba4f4
[ "MIT" ]
null
null
null
android-jni-support/src/main/cpp/includes/public/android-jni-support/jni_all.hpp
sephiroth74/android-jni-support
226018619f471af55e7d7eeb4aa67dcff0cba4f4
[ "MIT" ]
null
null
null
#include <android-jni-support/jni_bindings.hpp> #include <android-jni-support/jni_boxed.hpp> #include <android-jni-support/jni_context.hpp> #include <android-jni-support/jni_env.hpp> #include <android-jni-support/jni_exceptions.hpp> #include <android-jni-support/jni_file_manager.hpp> #include <android-jni-support/jni_helper.hpp> #include <android-jni-support/jni_io.hpp> #include <android-jni-support/jni_locale.hpp> #include <android-jni-support/jni_references.hpp> #include <android-jni-support/jni_shared_preferences.hpp> #include <android-jni-support/jni_thread.hpp>
41
57
0.810105
sephiroth74
039db6e23a95d6439e07df9af53a11ae3c185261
7,395
cpp
C++
src/OrbitGl/GpuTrack.cpp
idfumg/orbit
578b20d3647b483b0d7834072b76933891c442fc
[ "BSD-2-Clause" ]
1
2021-09-02T05:51:50.000Z
2021-09-02T05:51:50.000Z
src/OrbitGl/GpuTrack.cpp
jayant99acharya/orbit
f713721e33448a6b0dc8ea4c5aa587855337e32c
[ "BSD-2-Clause" ]
null
null
null
src/OrbitGl/GpuTrack.cpp
jayant99acharya/orbit
f713721e33448a6b0dc8ea4c5aa587855337e32c
[ "BSD-2-Clause" ]
null
null
null
// Copyright (c) 2020 The Orbit Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. #include "GpuTrack.h" #include <absl/strings/str_format.h> #include <absl/time/time.h> #include <algorithm> #include <memory> #include "App.h" #include "Batcher.h" #include "ClientData/CaptureData.h" #include "OrbitBase/Logging.h" #include "OrbitBase/ThreadConstants.h" #include "TimeGraph.h" #include "TimeGraphLayout.h" #include "TriangleToggle.h" #include "Viewport.h" #include "capture_data.pb.h" using orbit_client_protos::TimerInfo; namespace orbit_gl { std::string MapGpuTimelineToTrackLabel(std::string_view timeline) { std::string queue_pretty_name; std::string timeline_label(timeline); if (timeline.rfind("gfx", 0) == 0) { queue_pretty_name = "Graphics queue"; timeline_label = absl::StrFormat(" (%s)", timeline); } if (timeline.rfind("sdma", 0) == 0) { queue_pretty_name = "DMA queue"; timeline_label = absl::StrFormat(" (%s)", timeline); } if (timeline.rfind("comp", 0) == 0) { queue_pretty_name = "Compute queue"; timeline_label = absl::StrFormat(" (%s)", timeline); } if (timeline.rfind("vce", 0) == 0) { queue_pretty_name = "Video Coding Engine"; timeline_label = absl::StrFormat(" (%s)", timeline); } return absl::StrFormat("%s%s", queue_pretty_name, timeline_label); } } // namespace orbit_gl GpuTrack::GpuTrack(CaptureViewElement* parent, TimeGraph* time_graph, orbit_gl::Viewport* viewport, TimeGraphLayout* layout, uint64_t timeline_hash, OrbitApp* app, const orbit_client_data::CaptureData* capture_data, orbit_client_data::TrackData* submission_track_data, orbit_client_data::TrackData* marker_track_data) : Track(parent, time_graph, viewport, layout, capture_data), string_manager_{app->GetStringManager()}, submission_track_{std::make_shared<GpuSubmissionTrack>(this, time_graph, viewport, layout, timeline_hash, app, capture_data, submission_track_data)}, marker_track_{std::make_shared<GpuDebugMarkerTrack>( this, time_graph, viewport, layout, timeline_hash, app, capture_data, marker_track_data)}, timeline_hash_{timeline_hash} { // Gpu are collapsed by default. Their subtracks are expanded by default, but are however not // shown while the Gpu track is collapsed. collapse_toggle_->SetCollapsed(true); } void GpuTrack::OnTimer(const TimerInfo& timer_info) { switch (timer_info.type()) { case TimerInfo::kGpuActivity: [[fallthrough]]; case TimerInfo::kGpuCommandBuffer: submission_track_->OnTimer(timer_info); break; case TimerInfo::kGpuDebugMarker: marker_track_->OnTimer(timer_info); break; default: UNREACHABLE(); } } void GpuTrack::UpdatePositionOfSubtracks() { const Vec2 pos = GetPos(); if (collapse_toggle_->IsCollapsed()) { submission_track_->SetPos(pos[0], pos[1]); return; } float current_y = pos[1] + layout_->GetTrackTabHeight(); if (!submission_track_->IsEmpty()) { current_y += layout_->GetSpaceBetweenSubtracks(); } submission_track_->SetPos(pos[0], current_y); if (!marker_track_->IsEmpty()) { current_y += (layout_->GetSpaceBetweenSubtracks() + submission_track_->GetHeight()); } marker_track_->SetPos(pos[0], current_y); } float GpuTrack::GetHeight() const { if (collapse_toggle_->IsCollapsed()) { return submission_track_->GetHeight(); } float height = layout_->GetTrackTabHeight(); if (!submission_track_->IsEmpty()) { height += submission_track_->GetHeight(); height += layout_->GetSpaceBetweenSubtracks(); } if (!marker_track_->IsEmpty()) { height += marker_track_->GetHeight(); height += layout_->GetSpaceBetweenSubtracks(); } return height; } // TODO(b/176216022): Make a general interface for capture view elements for setting the width to // every child. void GpuTrack::SetWidth(float width) { Track::SetWidth(width); submission_track_->SetWidth(width); marker_track_->SetWidth(width); } void GpuTrack::Draw(Batcher& batcher, TextRenderer& text_renderer, const DrawContext& draw_context) { Track::Draw(batcher, text_renderer, draw_context); if (collapse_toggle_->IsCollapsed()) { return; } const DrawContext sub_track_draw_context = draw_context.IncreasedIndentationLevel(); if (!submission_track_->IsEmpty()) { submission_track_->Draw(batcher, text_renderer, sub_track_draw_context); } if (!marker_track_->IsEmpty()) { marker_track_->Draw(batcher, text_renderer, sub_track_draw_context); } } void GpuTrack::UpdatePrimitives(Batcher* batcher, uint64_t min_tick, uint64_t max_tick, PickingMode picking_mode, float z_offset) { const bool is_collapsed = collapse_toggle_->IsCollapsed(); if (!submission_track_->IsEmpty()) { submission_track_->UpdatePrimitives(batcher, min_tick, max_tick, picking_mode, z_offset); } if (is_collapsed) { return; } if (!marker_track_->IsEmpty()) { marker_track_->UpdatePrimitives(batcher, min_tick, max_tick, picking_mode, z_offset); } } std::vector<orbit_gl::CaptureViewElement*> GpuTrack::GetVisibleChildren() { std::vector<CaptureViewElement*> result; if (collapse_toggle_->IsCollapsed()) { return result; } if (!submission_track_->IsEmpty()) { result.push_back(submission_track_.get()); } if (!marker_track_->IsEmpty()) { result.push_back(marker_track_.get()); } return result; } std::string GpuTrack::GetTooltip() const { return "Shows scheduling and execution times for selected GPU job " "submissions and debug markers"; } const TimerInfo* GpuTrack::GetLeft(const TimerInfo& timer_info) const { switch (timer_info.type()) { case TimerInfo::kGpuActivity: [[fallthrough]]; case TimerInfo::kGpuCommandBuffer: return submission_track_->GetLeft(timer_info); case TimerInfo::kGpuDebugMarker: return marker_track_->GetLeft(timer_info); default: UNREACHABLE(); } } const TimerInfo* GpuTrack::GetRight(const TimerInfo& timer_info) const { switch (timer_info.type()) { case TimerInfo::kGpuActivity: [[fallthrough]]; case TimerInfo::kGpuCommandBuffer: return submission_track_->GetRight(timer_info); case TimerInfo::kGpuDebugMarker: return marker_track_->GetRight(timer_info); default: UNREACHABLE(); } } const TimerInfo* GpuTrack::GetUp(const TimerInfo& timer_info) const { switch (timer_info.type()) { case TimerInfo::kGpuActivity: [[fallthrough]]; case TimerInfo::kGpuCommandBuffer: return submission_track_->GetUp(timer_info); case TimerInfo::kGpuDebugMarker: return marker_track_->GetUp(timer_info); default: UNREACHABLE(); } } const TimerInfo* GpuTrack::GetDown(const TimerInfo& timer_info) const { switch (timer_info.type()) { case TimerInfo::kGpuActivity: [[fallthrough]]; case TimerInfo::kGpuCommandBuffer: return submission_track_->GetDown(timer_info); case TimerInfo::kGpuDebugMarker: return marker_track_->GetDown(timer_info); default: UNREACHABLE(); } }
31.602564
100
0.69263
idfumg
039dc891ad557e6d811b7b8890a9398b0ed2462f
1,050
cpp
C++
cities.cpp
mlkra/sa_tsp
eaaea134e8f4c670fc823b777c37fd3735f5ca94
[ "BSD-3-Clause" ]
null
null
null
cities.cpp
mlkra/sa_tsp
eaaea134e8f4c670fc823b777c37fd3735f5ca94
[ "BSD-3-Clause" ]
null
null
null
cities.cpp
mlkra/sa_tsp
eaaea134e8f4c670fc823b777c37fd3735f5ca94
[ "BSD-3-Clause" ]
null
null
null
#include "cities.hpp" #include <iostream> #include <cmath> using namespace std; short n; city_t* cities; float maxDistance; float **distances; inline float calculateDistanceBetweenCities(int city1, int city2) { city_t c1 = cities[city1]; city_t c2 = cities[city2]; return sqrt(pow(c1.x - c2.x, 2) + pow(c1.y - c2.y, 2)); } void calculateDistances() { maxDistance = 0; distances = new float*[n]; for (int i = 0; i < n; i++) { distances[i] = new float[n-i]; } for (int i = 0; i < n - 1; i++) { for (int j = i + 1; j < n; j++) { float distance = calculateDistanceBetweenCities(i, j); distances[i][j-i] = distance; if (distance > maxDistance) { maxDistance = distance; } } } } void loadCities() { cin >> n; cities = new city_t[n]; for (int i = 0; i < n; i++) { cin >> cities[i].label; cin >> cities[i].x; cin >> cities[i].y; } } float getDistance(int c1, int c2) { if (c1 < c2) { return distances[c1][c2-c1]; } else { return distances[c2][c1-c2]; } }
19.811321
67
0.57619
mlkra
039f817ea9d050bc3e500b111467d3d27f79882a
19
cpp
C++
Direct2DNet/GUIDs.cpp
SansyHuman/Direct2DNet
345d981a07fd8cbdf7cf7e6ca9d7b493439dbd17
[ "MIT" ]
null
null
null
Direct2DNet/GUIDs.cpp
SansyHuman/Direct2DNet
345d981a07fd8cbdf7cf7e6ca9d7b493439dbd17
[ "MIT" ]
null
null
null
Direct2DNet/GUIDs.cpp
SansyHuman/Direct2DNet
345d981a07fd8cbdf7cf7e6ca9d7b493439dbd17
[ "MIT" ]
null
null
null
#include "GUIDs.h"
9.5
18
0.684211
SansyHuman
03a20e55b7b062645a7ffa6b031e7937ef71e49f
1,467
hpp
C++
Siv3D/src/ThirdParty/boost/geometry/extensions/util/get_cs_as_radian.hpp
yumetodo/OpenSiv3D
ea191438ecbc64185f5df3d9f79dffc6757e4192
[ "MIT" ]
709
2016-03-19T07:55:58.000Z
2022-03-31T08:02:22.000Z
Siv3D/src/ThirdParty/boost/geometry/extensions/util/get_cs_as_radian.hpp
yumetodo/OpenSiv3D
ea191438ecbc64185f5df3d9f79dffc6757e4192
[ "MIT" ]
623
2015-01-02T23:45:23.000Z
2022-03-09T11:15:23.000Z
Siv3D/src/ThirdParty/boost/geometry/extensions/util/get_cs_as_radian.hpp
yumetodo/OpenSiv3D
ea191438ecbc64185f5df3d9f79dffc6757e4192
[ "MIT" ]
215
2015-01-14T15:50:38.000Z
2022-02-23T03:58:36.000Z
// Boost.Geometry (aka GGL, Generic Geometry Library) // Copyright (c) 2007-2012 Barend Gehrels, Amsterdam, the Netherlands. // Copyright (c) 2008-2012 Bruno Lalande, Paris, France. // Copyright (c) 2009-2012 Mateusz Loskot, London, UK. // Parts of Boost.Geometry are redesigned from Geodan's Geographic Library // (geolib/GGL), copyright (c) 1995-2010 Geodan, Amsterdam, the Netherlands. // Use, modification and distribution is subject to the Boost Software License, // Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) #ifndef BOOST_GEOMETRY_UTIL_GET_CS_AS_RADIAN_HPP #define BOOST_GEOMETRY_UTIL_GET_CS_AS_RADIAN_HPP // obsolete? It is not used anymore (get_as_radian is usually OK) #include <boost/geometry/core/cs.hpp> namespace boost { namespace geometry { #ifndef DOXYGEN_NO_DETAIL namespace detail { /*! \brief Small meta-function defining the specified coordinate system, but then in radian units */ template <typename CoordinateSystem> struct get_cs_as_radian {}; template <typename Units> struct get_cs_as_radian<cs::geographic<Units> > { typedef cs::geographic<radian> type; }; template <typename Units> struct get_cs_as_radian<cs::spherical<Units> > { typedef cs::spherical<radian> type; }; } // namespace detail #endif }} // namespace boost::geometry #endif // BOOST_GEOMETRY_UTIL_GET_CS_AS_RADIAN_HPP
26.196429
79
0.72938
yumetodo
03a280593c4e17359e982b44a061bdc4ee8562ed
860
cpp
C++
Dynamic Programming/Edit Distance.cpp
razouq/cses
82534f4ac37a690b5cd72ab094d5276bd01dd64e
[ "MIT" ]
3
2021-03-14T18:47:13.000Z
2021-03-19T09:59:56.000Z
Dynamic Programming/Edit Distance.cpp
razouq/cses
82534f4ac37a690b5cd72ab094d5276bd01dd64e
[ "MIT" ]
null
null
null
Dynamic Programming/Edit Distance.cpp
razouq/cses
82534f4ac37a690b5cd72ab094d5276bd01dd64e
[ "MIT" ]
null
null
null
#include "bits/stdc++.h" #pragma GCC optimize ("O3") #pragma GCC target ("sse4") #define ll long long #define ull unsigned long long #define F first #define S second #define PB push_back #define POB pop_back using namespace std; int main(){ // freopen("input.in", "r", stdin); // freopen("output.out", "w", stdout); ios::sync_with_stdio(0); cin.tie(); string a, b; cin>>a>>b; if(a.size() < b.size()) swap(a, b); int n = a.size(); int m = b.size(); vector<vector<int>> mat(n+1, vector<int> (m+1, 0)); for(int i = 0; i <= n; i++) mat[i][0] = i; for(int i = 0; i <= m; i++) mat[0][i] = i; for(int i = 1; i <= n; i++) { for(int j = 1; j <= m; j++) { int diff = (a[i-1] != b[j-1]); mat[i][j] = min(mat[i-1][j] + 1, mat[i][j-1] + 1); mat[i][j] = min(mat[i][j], mat[i-1][j-1] + diff); } } cout<<mat[n][m]<<endl; return 0; }
20
53
0.537209
razouq
03a5ca67f0112bbcc173c272cb09bd5798558b96
1,753
cpp
C++
euphony/src/main/cpp/tests/packetWithFSKTest.cpp
aiclaudev/euphony
a1ad79a8c3d89aaa7e33b41623a65d1e0830f88b
[ "Apache-2.0" ]
18
2019-07-08T16:44:15.000Z
2021-08-03T04:28:55.000Z
euphony/src/main/cpp/tests/packetWithFSKTest.cpp
aiclaudev/euphony
a1ad79a8c3d89aaa7e33b41623a65d1e0830f88b
[ "Apache-2.0" ]
39
2021-08-09T14:09:51.000Z
2021-10-19T15:18:44.000Z
euphony/src/main/cpp/tests/packetWithFSKTest.cpp
aiclaudev/euphony
a1ad79a8c3d89aaa7e33b41623a65d1e0830f88b
[ "Apache-2.0" ]
20
2019-11-25T13:08:09.000Z
2021-08-03T09:28:17.000Z
#include <gtest/gtest.h> #include <Definitions.h> #include <Packet.h> #include <FSK.h> #include <FFTProcessor.h> #include <tuple> #include <ASCIICharset.h> #include <Base16.h> using namespace Euphony; typedef std::tuple<string, string> TestParamType; class PacketWithFSKTestFixture : public ::testing::TestWithParam<TestParamType> { public: void createFSK() { EXPECT_EQ(fsk, nullptr); fsk = new FSK(); ASSERT_NE(fsk, nullptr); } FSK* fsk = nullptr; Packet* pkt = nullptr; }; TEST_P(PacketWithFSKTestFixture, PacketFSKTest) { createFSK(); string source; string expectedResult; std::tie(source, expectedResult) = GetParam(); HexVector hv = ASCIICharset().encode(source); pkt = new Packet(hv); string actualResultCode = pkt->toString(); EXPECT_EQ(actualResultCode, expectedResult); auto modulateResult = fsk->modulate(pkt->getPayloadStr()); EXPECT_EQ(modulateResult.size(), source.size() * 2); auto demodulateResult = fsk->demodulate(modulateResult); EXPECT_EQ(expectedResult, demodulateResult->toString()); pkt->clear(); } INSTANTIATE_TEST_CASE_P( PacketFSKTestSuite, PacketWithFSKTestFixture, ::testing::Values( TestParamType("a", "S6197"), TestParamType("b", "S6284"), TestParamType("c", "S6375"), TestParamType("abc", "S61626386"), TestParamType("lmno", "S6c6d6e6f20"), TestParamType("efg", "S656667c2"), TestParamType("abcdefghijklmnopqrstuvwxyz", "S6162636465666768696a6b6c6d6e6f707172737475767778797aaa"), TestParamType("ABC", "S414243e4"), TestParamType("ABCDEFGHIJKLMNOPQRSTUVWXYZ", "S4142434445464748494a4b4c4d4e4f505152535455565758595aea") ));
27.390625
111
0.685682
aiclaudev
03a63668aad34b79c614e7504a8601cee18e6fbc
4,172
cpp
C++
Step1/skip_list/calcSimilaritySL.cpp
ediston/Link-Clustering-Algorithm
e93a4b92f50bedae75c779937b5242d487075043
[ "Unlicense" ]
2
2015-05-20T09:05:30.000Z
2017-11-08T09:23:54.000Z
Step1/skip_list/calcSimilaritySL.cpp
ediston/Link-Clustering-Algorithm
e93a4b92f50bedae75c779937b5242d487075043
[ "Unlicense" ]
null
null
null
Step1/skip_list/calcSimilaritySL.cpp
ediston/Link-Clustering-Algorithm
e93a4b92f50bedae75c779937b5242d487075043
[ "Unlicense" ]
null
null
null
#include <bits/stdc++.h> #include <ctime> using namespace std; #define MAX_HIEGHT 32 #define ONEIN 2 #define INFINITY 99999999 //long long totalComparisons; int getRandom(){ return rand() % ONEIN; } struct node{ long long nodeId; node *next; node *below; }; struct skipList{ int height; long long listId; long long length; node **head; }; node *getNewNode(long long nodeId){ node * newnode = new node; newnode->nodeId = nodeId; newnode->next = NULL; newnode->below = NULL; return newnode; } skipList *getNewSkipList(){ skipList * newSkipList = new skipList; newSkipList->height = 0; // head has the maximum height newSkipList->head = new node*[MAX_HIEGHT]; for(int i=0; i<MAX_HIEGHT; i++){ newSkipList->head[i] = getNewNode(-INFINITY); if(i==0) newSkipList->head[i]->below = NULL; else newSkipList->head[i]->below = newSkipList->head[i-1]; } newSkipList->length = 0; return newSkipList; } void printSkipList(skipList *s){ if(!s) return; cout << "Skiplist #" << s->listId << endl; node *current = getNewNode(0); for(int lvl = s->height-1; lvl>= 0; lvl-- ){ cout << "Height " << lvl << ": "; current = s->head[lvl]; while(current){ cout << " - " << current->nodeId ; current = current->next; } cout << endl; } cout << endl; } void addNode(skipList *s, long long newNodeId){ // first we decide the height of the new node // height = level+1 int newNodeLevel = 0, level ; for(;getRandom() >= 1 ; newNodeLevel++) { if(newNodeLevel==MAX_HIEGHT-1) { break; } } // change the height of the skiplist if needed if(newNodeLevel+1 > s->height){ s->height = newNodeLevel+1; } node *prev = getNewNode(0); ; node *current = getNewNode(0); prev = NULL; // start from max height of the skip list level = s->height-1; current = s->head[level]; // A good video explaining the insertion // https://www.youtube.com/watch?v=Dx7Hk8-8Kdw // Loop while we go through all levels while(current){ // This will help us reach the appropriate node already while(current->next && current->next->nodeId < newNodeId){ current = current->next; } // if this level is greater than new level // then we add the a new node to next of current if(level <= newNodeLevel){ node *newNode = getNewNode(newNodeId); if(prev){ prev->below = newNode; } newNode->next = current->next; current->next = newNode; prev = newNode; } current = current->below; level--; } // increase the length of the skip list s->length++; } node * searchAndGetNearestNode(node *curr, long long &nodeId){ if(!curr) return NULL; if(curr->nodeId >= nodeId) return curr; while(curr->next && curr->next->nodeId < nodeId){ curr = curr->next; } if(curr->nodeId >= nodeId) return curr; if(!curr->below) return curr->next; return searchAndGetNearestNode(curr->below, nodeId); } long long getCommonNodesCount(skipList *s1, skipList *s2){ long long count = 0; int lvl1=0, lvl2= 0; if(s1->length > s2->length) swap(s1, s2); node *nextn1 = getNewNode(0); node *n1 = getNewNode(0); node *n2 = getNewNode(0); n1 = s1->head[0]->next; n2 = s2->head[s2->height-1]; while(n1 && n2){ if(n1->nodeId > n2->nodeId){ n2 = searchAndGetNearestNode(n2, n1->nodeId); }else if(n1->nodeId < n2->nodeId){ n1 = n1->next; }else{ count++; n1 = n1->next; } } return count; } void deleteLL(skipList *s){ for(int i=0; i<s->height; i++){ node *ll1node = s->head[i]; node *ll2node = ll1node; while(ll1node){ ll2node = ll1node; ll1node = ll1node->next; delete ll2node; } } }
25.595092
66
0.55489
ediston
03a6370a87b8c07123e50f574eb49096e7812a65
49,081
cc
C++
EventFilter/SiStripRawToDigi/plugins/SiStripRawToDigiUnpacker.cc
gputtley/cmssw
c1ef8454804e4ebea8b65f59c4a952a6c94fde3b
[ "Apache-2.0" ]
2
2020-05-09T16:03:43.000Z
2020-05-09T16:03:50.000Z
EventFilter/SiStripRawToDigi/plugins/SiStripRawToDigiUnpacker.cc
gputtley/cmssw
c1ef8454804e4ebea8b65f59c4a952a6c94fde3b
[ "Apache-2.0" ]
26
2018-10-30T12:47:58.000Z
2022-03-29T08:39:00.000Z
EventFilter/SiStripRawToDigi/plugins/SiStripRawToDigiUnpacker.cc
gputtley/cmssw
c1ef8454804e4ebea8b65f59c4a952a6c94fde3b
[ "Apache-2.0" ]
3
2017-06-07T15:22:28.000Z
2019-02-28T20:48:30.000Z
#include "SiStripRawToDigiUnpacker.h" #include "CondFormats/SiStripObjects/interface/SiStripFedCabling.h" #include "DataFormats/Common/interface/DetSet.h" #include "DataFormats/FEDRawData/interface/FEDRawDataCollection.h" #include "DataFormats/FEDRawData/interface/FEDNumbering.h" #include "DataFormats/FEDRawData/interface/FEDHeader.h" #include "DataFormats/FEDRawData/interface/FEDTrailer.h" #include "DataFormats/SiStripCommon/interface/SiStripConstants.h" #include "DataFormats/SiStripCommon/interface/SiStripEventSummary.h" #include "DataFormats/SiStripDigi/interface/SiStripDigi.h" #include "DataFormats/SiStripDigi/interface/SiStripRawDigi.h" #include "EventFilter/SiStripRawToDigi/interface/TFHeaderDescription.h" #include "FWCore/Utilities/interface/Exception.h" #include "FWCore/MessageLogger/interface/MessageLogger.h" #include <iostream> #include <sstream> #include <iomanip> #include <boost/format.hpp> #include <ext/algorithm> #include "FWCore/Utilities/interface/RunningAverage.h" namespace sistrip { RawToDigiUnpacker::RawToDigiUnpacker(int16_t appended_bytes, int16_t fed_buffer_dump_freq, int16_t fed_event_dump_freq, int16_t trigger_fed_id, bool using_fed_key, bool unpack_bad_channels, bool mark_missing_feds, const uint32_t errorThreshold) : headerBytes_(appended_bytes), fedBufferDumpFreq_(fed_buffer_dump_freq), fedEventDumpFreq_(fed_event_dump_freq), triggerFedId_(trigger_fed_id), useFedKey_(using_fed_key), unpackBadChannels_(unpack_bad_channels), markMissingFeds_(mark_missing_feds), event_(0), once_(true), first_(true), useDaqRegister_(false), quiet_(true), extractCm_(false), doFullCorruptBufferChecks_(false), doAPVEmulatorCheck_(true), errorThreshold_(errorThreshold), warnings_(sistrip::mlRawToDigi_, "[sistrip::RawToDigiUnpacker::createDigis]", edm::isDebugEnabled()) { if (edm::isDebugEnabled()) { LogTrace("SiStripRawToDigi") << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Constructing object..."; } if (unpackBadChannels_) { edm::LogWarning("SiStripRawToDigi") << "Warning: Unpacking of bad channels enabled. Only enable this if you know what you are doing. " << std::endl; } } RawToDigiUnpacker::~RawToDigiUnpacker() { if (edm::isDebugEnabled()) { LogTrace("SiStripRawToDigi") << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Destructing object..."; } } namespace { edm::RunningAverage localRA(10000); void maskFED(DetIdCollection& maskedModules, SiStripFedCabling::ConnsConstIterRange fedConnections) { maskedModules.reserve(maskedModules.size() + fedConnections.size()); for (const auto& conn : fedConnections) { if (conn.detId() && (conn.detId() != sistrip::invalid32_)) { maskedModules.push_back(conn.detId()); //@@ Possible multiple entries (ok for Giovanni) } } } } // namespace void RawToDigiUnpacker::createDigis(const SiStripFedCabling& cabling, const FEDRawDataCollection& buffers, SiStripEventSummary& summary, RawDigis& scope_mode, RawDigis& virgin_raw, RawDigis& proc_raw, Digis& zero_suppr, DetIdCollection& detids, RawDigis& cm_values) { // Clear done at the end assert(zs_work_digis_.empty()); zs_work_digis_.reserve(localRA.upper()); // Reserve space in bad module list detids.reserve(100); // Check if FEDs found in cabling map and event data if (cabling.fedIds().empty()) { warnings_.add("No FEDs found in cabling map!"); if (edm::isDebugEnabled()) { // Check which FED ids have non-zero size buffers std::vector<uint16_t> feds; for (uint16_t ifed = FEDNumbering::MINSiStripFEDID; ifed < FEDNumbering::MAXSiStripFEDID; ifed++) { if (ifed != triggerFedId_ && buffers.FEDData(static_cast<int>(ifed)).size()) { feds.push_back(ifed); } } LogTrace("SiStripRawToDigi") << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Found " << feds.size() << " FED buffers with non-zero size!"; } } // Flag for EventSummary update using DAQ register bool first_fed = true; // Retrieve FED ids from cabling map and iterate through std::vector<uint16_t>::const_iterator ifed = cabling.fedIds().begin(); for (; ifed != cabling.fedIds().end(); ifed++) { // ignore trigger FED if (*ifed == triggerFedId_) { continue; } // Retrieve FED raw data for given FED const FEDRawData& input = buffers.FEDData(static_cast<int>(*ifed)); // Some debug on FED buffer size if (edm::isDebugEnabled()) { if (first_ && input.data()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Found FED id " << std::setw(4) << std::setfill(' ') << *ifed << " in FEDRawDataCollection" << " with non-zero pointer 0x" << std::hex << std::setw(8) << std::setfill('0') << reinterpret_cast<const uint32_t*>(input.data()) << std::dec << " and size " << std::setw(5) << std::setfill(' ') << input.size() << " chars"; LogTrace("SiStripRawToDigi") << ss.str(); } } // Dump of FEDRawData to stdout if (edm::isDebugEnabled()) { if (fedBufferDumpFreq_ && !(event_ % fedBufferDumpFreq_)) { std::stringstream ss; dumpRawData(*ifed, input, ss); edm::LogVerbatim(sistrip::mlRawToDigi_) << ss.str(); } } // get the cabling connections for this FED auto conns = cabling.fedConnections(*ifed); // check FEDRawData pointer, size, and more const auto st_buffer = preconstructCheckFEDBuffer(input); // construct FEDBuffer if (FEDBufferStatusCode::SUCCESS != st_buffer) { if (FEDBufferStatusCode::BUFFER_NULL == st_buffer) { warnings_.add("NULL pointer to FEDRawData for FED", (boost::format("id %1%") % *ifed).str()); } else if (!input.size()) { warnings_.add("FEDRawData has zero size for FED", (boost::format("id %1%") % *ifed).str()); } else { warnings_.add("Exception caught when creating FEDBuffer object for FED", (boost::format("id %1%: %2%") % *ifed % st_buffer).str()); } // FED buffer is bad and should not be unpacked. Skip this FED and mark all modules as bad. maskFED(detids, conns); continue; } FEDBuffer buffer{input}; const auto st_chan = buffer.findChannels(); if (FEDBufferStatusCode::SUCCESS != st_chan) { warnings_.add("Exception caught when creating FEDBuffer object for FED", (boost::format("id %1%: %2%") % *ifed % st_chan).str()); maskFED(detids, conns); continue; } buffer.setLegacyMode(legacy_); if ((!buffer.doChecks(true)) && (!unpackBadChannels_ || !buffer.checkNoFEOverflows())) { warnings_.add("Exception caught when creating FEDBuffer object for FED", (boost::format("id %1%: FED Buffer check fails for FED ID %1%.") % *ifed).str()); maskFED(detids, conns); continue; } if (doFullCorruptBufferChecks_ && !buffer.doCorruptBufferChecks()) { warnings_.add("Exception caught when creating FEDBuffer object for FED", (boost::format("id %1%: FED corrupt buffer check fails for FED ID %1%.") % *ifed).str()); maskFED(detids, conns); continue; } // Check if EventSummary ("trigger FED info") needs updating if (first_fed && useDaqRegister_) { updateEventSummary(buffer, summary); first_fed = false; } // Check to see if EventSummary info is set if (!quiet_ && !summary.isSet()) { warnings_.add( "EventSummary is not set correctly! Missing information from both \"trigger FED\" and \"DAQ registers\"!"); } // Check to see if event is to be analyzed according to EventSummary if (!summary.valid()) { if (edm::isDebugEnabled()) { LogTrace("SiStripRawToDigi") << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " EventSummary is not valid: skipping..."; } continue; } /// extract readout mode const sistrip::FEDReadoutMode mode = buffer.readoutMode(); const sistrip::FEDLegacyReadoutMode lmode = (legacy_) ? buffer.legacyReadoutMode() : sistrip::READOUT_MODE_LEGACY_INVALID; // Retrive run type const sistrip::RunType runType_ = summary.runType(); if (runType_ == sistrip::APV_LATENCY || runType_ == sistrip::FINE_DELAY) { useFedKey_ = false; } // Dump of FED buffer if (edm::isDebugEnabled()) { if (fedEventDumpFreq_ && !(event_ % fedEventDumpFreq_)) { std::stringstream ss; buffer.dump(ss); edm::LogVerbatim(sistrip::mlRawToDigi_) << ss.str(); } } // Iterate through FED channels, extract payload and create Digis std::vector<FedChannelConnection>::const_iterator iconn = conns.begin(); for (; iconn != conns.end(); iconn++) { /// FED channel uint16_t chan = iconn->fedCh(); // Check if fed connection is valid if (!iconn->isConnected()) { continue; } // Check DetId is valid (if to be used as key) if (!useFedKey_ && (!iconn->detId() || iconn->detId() == sistrip::invalid32_)) { continue; } // Check FED channel if (!buffer.channelGood(iconn->fedCh(), doAPVEmulatorCheck_)) { if (!unpackBadChannels_ || !(buffer.fePresent(iconn->fedCh() / FEDCH_PER_FEUNIT) && buffer.feEnabled(iconn->fedCh() / FEDCH_PER_FEUNIT))) { detids.push_back(iconn->detId()); //@@ Possible multiple entries (ok for Giovanni) continue; } } // Determine whether FED key is inferred from cabling or channel loop const uint32_t fed_key = (summary.runType() == sistrip::FED_CABLING) ? ((*ifed & sistrip::invalid_) << 16) | (chan & sistrip::invalid_) : ((iconn->fedId() & sistrip::invalid_) << 16) | (iconn->fedCh() & sistrip::invalid_); // Determine whether DetId or FED key should be used to index digi containers const uint32_t key = (useFedKey_ || (!legacy_ && mode == sistrip::READOUT_MODE_SCOPE) || (legacy_ && lmode == sistrip::READOUT_MODE_LEGACY_SCOPE)) ? fed_key : iconn->detId(); // Determine APV std::pair number (needed only when using DetId) const uint16_t ipair = (useFedKey_ || (!legacy_ && mode == sistrip::READOUT_MODE_SCOPE) || (legacy_ && lmode == sistrip::READOUT_MODE_LEGACY_SCOPE)) ? 0 : iconn->apvPairNumber(); const auto& fedChannel = buffer.channel(iconn->fedCh()); #ifdef EDM_ML_DEBUG std::stringstream smode; if (!legacy_) smode << mode; else smode << lmode; LogDebug("SiStripRawToDigi") << "Unpacking FED " << *ifed << " channel " << iconn->fedCh() << ((!legacy_) ? " " : " legacy ") << "data in mode " << smode.str() << " for module " << iconn->detId() << " pair " << ipair; #endif if (fedchannelunpacker::isZeroSuppressed(mode, legacy_, lmode)) { Registry regItem(key, 0, zs_work_digis_.size(), 0); const auto isNonLite = fedchannelunpacker::isNonLiteZS(mode, legacy_, lmode); const uint8_t pCode = (isNonLite ? buffer.packetCode(legacy_, iconn->fedCh()) : 0); if (isNonLite) LogDebug("SiStripRawToDigi") << "Non-lite zero-suppressed mode. Packet code=0x" << std::hex << uint16_t(pCode) << std::dec; const auto st_ch = fedchannelunpacker::unpackZeroSuppressed( fedChannel, std::back_inserter(zs_work_digis_), ipair * 256, isNonLite, mode, legacy_, lmode, pCode); if (fedchannelunpacker::StatusCode::ZERO_PACKET_CODE == st_ch || fedchannelunpacker::StatusCode::BAD_PACKET_CODE == st_ch) { warnings_.add((boost::format("Invalid packet code %1$#x for zero-suppressed data") % uint16_t(pCode)).str(), (boost::format("FED %1% channel %2%") % *ifed % iconn->fedCh()).str()); } else if (fedchannelunpacker::StatusCode::SUCCESS != st_ch) { warnings_.add("Clusters are not ordered", (boost::format("FED %1% channel %2%: %3%") % *ifed % iconn->fedCh() % toString(st_ch)).str()); detids.push_back(iconn->detId()); //@@ Possible multiple entries (ok for Giovanni) continue; } if (regItem.index != zs_work_digis_.size()) { regItem.length = zs_work_digis_.size() - regItem.index; regItem.first = zs_work_digis_[regItem.index].strip(); zs_work_registry_.push_back(regItem); } // Common mode values if (isNonLite && extractCm_) { if ((pCode == PACKET_CODE_ZERO_SUPPRESSED) || (pCode == PACKET_CODE_ZERO_SUPPRESSED10) || (pCode == PACKET_CODE_ZERO_SUPPRESSED8_BOTBOT) || (pCode == PACKET_CODE_ZERO_SUPPRESSED8_TOPBOT)) { Registry regItem2(key, 2 * ipair, cm_work_digis_.size(), 2); cm_work_digis_.push_back(SiStripRawDigi(fedChannel.cmMedian(0))); cm_work_digis_.push_back(SiStripRawDigi(fedChannel.cmMedian(1))); cm_work_registry_.push_back(regItem2); } else { detids.push_back(iconn->detId()); //@@ Possible multiple entries (ok for Giovanni) warnings_.add("Problem extracting common modes", (boost::format("FED %1% channel %2%:\n Request for CM median from channel with non-ZS " "packet code. Packet code is %3%.") % *ifed % iconn->fedCh() % pCode) .str()); } } } else { auto st_ch = fedchannelunpacker::StatusCode::SUCCESS; if (fedchannelunpacker::isVirginRaw(mode, legacy_, lmode)) { Registry regItem(key, 256 * ipair, virgin_work_digis_.size(), 0); LogDebug("SiStripRawToDigi") << "Virgin raw packet code: 0x" << std::hex << uint16_t(buffer.packetCode(legacy_)) << " 0x" << uint16_t(fedChannel.packetCode()) << std::dec; st_ch = fedchannelunpacker::unpackVirginRaw( fedChannel, std::back_inserter(virgin_work_digis_), buffer.packetCode(legacy_)); if (regItem.index != virgin_work_digis_.size()) { regItem.length = virgin_work_digis_.size() - regItem.index; virgin_work_registry_.push_back(regItem); } } else if (fedchannelunpacker::isProcessedRaw(mode, legacy_, lmode)) { Registry regItem(key, 256 * ipair, proc_work_digis_.size(), 0); st_ch = fedchannelunpacker::unpackProcessedRaw(fedChannel, std::back_inserter(proc_work_digis_)); if (regItem.index != proc_work_digis_.size()) { regItem.length = proc_work_digis_.size() - regItem.index; proc_work_registry_.push_back(regItem); } } else if (fedchannelunpacker::isScopeMode(mode, legacy_, lmode)) { Registry regItem(key, 0, scope_work_digis_.size(), 0); st_ch = fedchannelunpacker::unpackScope(fedChannel, std::back_inserter(scope_work_digis_)); if (regItem.index != scope_work_digis_.size()) { regItem.length = scope_work_digis_.size() - regItem.index; scope_work_registry_.push_back(regItem); } } else { // Unknown readout mode! => assume scope mode warnings_.add((boost::format("Unknown FED readout mode (%1%)! Assuming SCOPE MODE...") % mode).str()); Registry regItem(key, 0, scope_work_digis_.size(), 0); st_ch = fedchannelunpacker::unpackScope(fedChannel, std::back_inserter(scope_work_digis_)); if (regItem.index != scope_work_digis_.size()) { regItem.length = scope_work_digis_.size() - regItem.index; scope_work_registry_.push_back(regItem); if (edm::isDebugEnabled()) { std::stringstream ss; ss << "Extracted " << regItem.length << " SCOPE MODE digis (samples[0] = " << scope_work_digis_[regItem.index] << ") from FED id/ch " << iconn->fedId() << "/" << iconn->fedCh(); LogTrace("SiStripRawToDigi") << ss.str(); } } else { warnings_.add("No SM digis found!"); } } if (fedchannelunpacker::StatusCode::SUCCESS != st_ch) { warnings_.add(toString(st_ch), (boost::format("FED %1% channel %2%:") % *ifed % iconn->fedCh()).str()); } } } // channel loop } // fed loop // bad channels warning unsigned int detIdsSize = detids.size(); if (edm::isDebugEnabled() && detIdsSize) { std::ostringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Problems were found in data and " << detIdsSize << " channels could not be unpacked. " << "See output of FED Hardware monitoring for more information. "; edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } if ((errorThreshold_ != 0) && (detIdsSize > errorThreshold_)) { edm::LogError("TooManyErrors") << "Total number of errors = " << detIdsSize; } // update DetSetVectors update(scope_mode, virgin_raw, proc_raw, zero_suppr, cm_values); // increment event counter event_++; // no longer first event! if (first_) { first_ = false; } // final cleanup, just in case cleanupWorkVectors(); } void RawToDigiUnpacker::update( RawDigis& scope_mode, RawDigis& virgin_raw, RawDigis& proc_raw, Digis& zero_suppr, RawDigis& common_mode) { if (!zs_work_registry_.empty()) { std::sort(zs_work_registry_.begin(), zs_work_registry_.end()); std::vector<edm::DetSet<SiStripDigi> > sorted_and_merged; sorted_and_merged.reserve(std::min(zs_work_registry_.size(), size_t(17000))); bool errorInData = false; std::vector<Registry>::iterator it = zs_work_registry_.begin(), it2 = it + 1, end = zs_work_registry_.end(); while (it < end) { sorted_and_merged.push_back(edm::DetSet<SiStripDigi>(it->detid)); std::vector<SiStripDigi>& digis = sorted_and_merged.back().data; // first count how many digis we have size_t len = it->length; for (it2 = it + 1; (it2 != end) && (it2->detid == it->detid); ++it2) { len += it2->length; } // reserve memory digis.reserve(len); // push them in for (it2 = it + 0; (it2 != end) && (it2->detid == it->detid); ++it2) { digis.insert(digis.end(), &zs_work_digis_[it2->index], &zs_work_digis_[it2->index + it2->length]); } it = it2; } // check sorting if (!__gnu_cxx::is_sorted(sorted_and_merged.begin(), sorted_and_merged.end())) { // this is an error in the code: i DID sort it already! throw cms::Exception("Bug Found") << "Container must be already sorted!\nat " << __FILE__ << ", line " << __LINE__ << "\n"; } std::vector<edm::DetSet<SiStripDigi> >::iterator iii = sorted_and_merged.begin(); std::vector<edm::DetSet<SiStripDigi> >::iterator jjj = sorted_and_merged.end(); for (; iii != jjj; ++iii) { if (!__gnu_cxx::is_sorted(iii->begin(), iii->end())) { // this might be an error in the data, if the raws from one FED are not sorted iii->clear(); errorInData = true; } } // output error if (errorInData) edm::LogWarning("CorruptData") << "Some modules contained corrupted ZS raw data, and have been skipped in unpacking\n"; // make output DetSetVector edm::DetSetVector<SiStripDigi> zero_suppr_dsv(sorted_and_merged, true); zero_suppr.swap(zero_suppr_dsv); } // Populate final DetSetVector container with VR data if (!virgin_work_registry_.empty()) { std::sort(virgin_work_registry_.begin(), virgin_work_registry_.end()); std::vector<edm::DetSet<SiStripRawDigi> > sorted_and_merged; sorted_and_merged.reserve(std::min(virgin_work_registry_.size(), size_t(17000))); bool errorInData = false; std::vector<Registry>::iterator it = virgin_work_registry_.begin(), it2, end = virgin_work_registry_.end(); while (it < end) { sorted_and_merged.push_back(edm::DetSet<SiStripRawDigi>(it->detid)); std::vector<SiStripRawDigi>& digis = sorted_and_merged.back().data; bool isDetOk = true; // first count how many digis we have int maxFirstStrip = it->first; for (it2 = it + 1; (it2 != end) && (it2->detid == it->detid); ++it2) { // duplicated APV or data corruption. DO NOT 'break' here! if (it2->first <= maxFirstStrip) { isDetOk = false; continue; } maxFirstStrip = it2->first; } if (!isDetOk) { errorInData = true; it = it2; continue; } // skip whole det // make room for 256 * (max_apv_pair + 1) Raw Digis digis.resize(maxFirstStrip + 256); // push them in for (it2 = it + 0; (it2 != end) && (it2->detid == it->detid); ++it2) { // data corruption. DO NOT 'break' here if (it->length != 256) { isDetOk = false; continue; } std::copy(&virgin_work_digis_[it2->index], &virgin_work_digis_[it2->index + it2->length], &digis[it2->first]); } if (!isDetOk) { errorInData = true; digis.clear(); it = it2; continue; } // skip whole det it = it2; } // output error if (errorInData) edm::LogWarning("CorruptData") << "Some modules contained corrupted virgin raw data, and have been skipped in unpacking\n"; // check sorting if (!__gnu_cxx::is_sorted(sorted_and_merged.begin(), sorted_and_merged.end())) { // this is an error in the code: i DID sort it already! throw cms::Exception("Bug Found") << "Container must be already sorted!\nat " << __FILE__ << ", line " << __LINE__ << "\n"; } // make output DetSetVector edm::DetSetVector<SiStripRawDigi> virgin_raw_dsv(sorted_and_merged, true); virgin_raw.swap(virgin_raw_dsv); } // Populate final DetSetVector container with VR data if (!proc_work_registry_.empty()) { std::sort(proc_work_registry_.begin(), proc_work_registry_.end()); std::vector<edm::DetSet<SiStripRawDigi> > sorted_and_merged; sorted_and_merged.reserve(std::min(proc_work_registry_.size(), size_t(17000))); bool errorInData = false; std::vector<Registry>::iterator it = proc_work_registry_.begin(), it2, end = proc_work_registry_.end(); while (it < end) { sorted_and_merged.push_back(edm::DetSet<SiStripRawDigi>(it->detid)); std::vector<SiStripRawDigi>& digis = sorted_and_merged.back().data; bool isDetOk = true; // first count how many digis we have int maxFirstStrip = it->first; for (it2 = it + 1; (it2 != end) && (it2->detid == it->detid); ++it2) { // duplicated APV or data corruption. DO NOT 'break' here! if (it2->first <= maxFirstStrip) { isDetOk = false; continue; } maxFirstStrip = it2->first; } // skip whole det if (!isDetOk) { errorInData = true; it = it2; continue; } // make room for 256 * (max_apv_pair + 1) Raw Digis digis.resize(maxFirstStrip + 256); // push them in for (it2 = it + 0; (it2 != end) && (it2->detid == it->detid); ++it2) { // data corruption. DO NOT 'break' here if (it->length != 256) { isDetOk = false; continue; } std::copy(&proc_work_digis_[it2->index], &proc_work_digis_[it2->index + it2->length], &digis[it2->first]); } // skip whole det if (!isDetOk) { errorInData = true; digis.clear(); it = it2; continue; } it = it2; } // output error if (errorInData) edm::LogWarning("CorruptData") << "Some modules contained corrupted proc raw data, and have been skipped in unpacking\n"; // check sorting if (!__gnu_cxx::is_sorted(sorted_and_merged.begin(), sorted_and_merged.end())) { // this is an error in the code: i DID sort it already! throw cms::Exception("Bug Found") << "Container must be already sorted!\nat " << __FILE__ << ", line " << __LINE__ << "\n"; } // make output DetSetVector edm::DetSetVector<SiStripRawDigi> proc_raw_dsv(sorted_and_merged, true); proc_raw.swap(proc_raw_dsv); } // Populate final DetSetVector container with SM data if (!scope_work_registry_.empty()) { std::sort(scope_work_registry_.begin(), scope_work_registry_.end()); std::vector<edm::DetSet<SiStripRawDigi> > sorted_and_merged; sorted_and_merged.reserve(scope_work_registry_.size()); bool errorInData = false; std::vector<Registry>::iterator it, end; for (it = scope_work_registry_.begin(), end = scope_work_registry_.end(); it != end; ++it) { sorted_and_merged.push_back(edm::DetSet<SiStripRawDigi>(it->detid)); std::vector<SiStripRawDigi>& digis = sorted_and_merged.back().data; digis.insert(digis.end(), &scope_work_digis_[it->index], &scope_work_digis_[it->index + it->length]); if ((it + 1 != end) && (it->detid == (it + 1)->detid)) { errorInData = true; // let's skip *all* the detsets for that key, as we don't know which is the correct one! do { ++it; } while ((it + 1 != end) && (it->detid == (it + 1)->detid)); } } // output error if (errorInData) edm::LogWarning("CorruptData") << "Some fed keys contained corrupted scope mode data, and have been skipped in unpacking\n"; // check sorting if (!__gnu_cxx::is_sorted(sorted_and_merged.begin(), sorted_and_merged.end())) { // this is an error in the code: i DID sort it already! throw cms::Exception("Bug Found") << "Container must be already sorted!\nat " << __FILE__ << ", line " << __LINE__ << "\n"; } // make output DetSetVector edm::DetSetVector<SiStripRawDigi> scope_mode_dsv(sorted_and_merged, true); scope_mode.swap(scope_mode_dsv); } // Populate DetSetVector with Common Mode values if (extractCm_) { // Populate final DetSetVector container with VR data if (!cm_work_registry_.empty()) { std::sort(cm_work_registry_.begin(), cm_work_registry_.end()); std::vector<edm::DetSet<SiStripRawDigi> > sorted_and_merged; sorted_and_merged.reserve(std::min(cm_work_registry_.size(), size_t(17000))); bool errorInData = false; std::vector<Registry>::iterator it = cm_work_registry_.begin(), it2, end = cm_work_registry_.end(); while (it < end) { sorted_and_merged.push_back(edm::DetSet<SiStripRawDigi>(it->detid)); std::vector<SiStripRawDigi>& digis = sorted_and_merged.back().data; bool isDetOk = true; // first count how many digis we have int maxFirstStrip = it->first; for (it2 = it + 1; (it2 != end) && (it2->detid == it->detid); ++it2) { // duplicated APV or data corruption. DO NOT 'break' here! if (it2->first <= maxFirstStrip) { isDetOk = false; continue; } maxFirstStrip = it2->first; } if (!isDetOk) { errorInData = true; it = it2; continue; } // skip whole det // make room for 2 * (max_apv_pair + 1) Common mode values digis.resize(maxFirstStrip + 2); // push them in for (it2 = it + 0; (it2 != end) && (it2->detid == it->detid); ++it2) { // data corruption. DO NOT 'break' here if (it->length != 2) { isDetOk = false; continue; } std::copy(&cm_work_digis_[it2->index], &cm_work_digis_[it2->index + it2->length], &digis[it2->first]); } if (!isDetOk) { errorInData = true; digis.clear(); it = it2; continue; } // skip whole det it = it2; } // output error if (errorInData) edm::LogWarning("CorruptData") << "Some modules contained corrupted common mode data, and have been skipped in unpacking\n"; // check sorting if (!__gnu_cxx::is_sorted(sorted_and_merged.begin(), sorted_and_merged.end())) { // this is an error in the code: i DID sort it already! throw cms::Exception("Bug Found") << "Container must be already sorted!\nat " << __FILE__ << ", line " << __LINE__ << "\n"; } // make output DetSetVector edm::DetSetVector<SiStripRawDigi> common_mode_dsv(sorted_and_merged, true); common_mode.swap(common_mode_dsv); } } } void RawToDigiUnpacker::cleanupWorkVectors() { // Clear working areas and registries localRA.update(zs_work_digis_.size()); zs_work_registry_.clear(); zs_work_digis_.clear(); zs_work_digis_.shrink_to_fit(); assert(zs_work_digis_.capacity() == 0); virgin_work_registry_.clear(); virgin_work_digis_.clear(); proc_work_registry_.clear(); proc_work_digis_.clear(); scope_work_registry_.clear(); scope_work_digis_.clear(); cm_work_registry_.clear(); cm_work_digis_.clear(); } void RawToDigiUnpacker::triggerFed(const FEDRawDataCollection& buffers, SiStripEventSummary& summary, const uint32_t& event) { // Pointer to data (recast as 32-bit words) and number of 32-bit words const uint32_t* data_u32 = nullptr; uint32_t size_u32 = 0; // Search mode if (triggerFedId_ < 0) { uint16_t ifed = 0; while (triggerFedId_ < 0 && ifed < 1 + FEDNumbering::lastFEDId()) { const FEDRawData& trigger_fed = buffers.FEDData(ifed); if (trigger_fed.data() && trigger_fed.size()) { const uint8_t* temp = trigger_fed.data(); data_u32 = reinterpret_cast<const uint32_t*>(temp) + FEDHeader::length / sizeof(uint32_t) + 1; size_u32 = trigger_fed.size() / sizeof(uint32_t) - FEDHeader::length / sizeof(uint32_t) - 1; const FEDTrailer fedTrailer(temp + trigger_fed.size() - FEDTrailer::length); if (fedTrailer.conscheck() == 0xDEADFACE) { triggerFedId_ = ifed; if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Search mode for 'trigger FED' activated!" << " Found 'trigger FED' info with id " << triggerFedId_; LogTrace("SiStripRawToDigi") << ss.str(); } } } ifed++; } if (triggerFedId_ < 0) { triggerFedId_ = 0; if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Search mode for 'trigger FED' activated!" << " 'Trigger FED' info not found!"; edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } } } // "Trigger FED" id given in .cfg file else if (triggerFedId_ > 0) { const FEDRawData& trigger_fed = buffers.FEDData(triggerFedId_); if (trigger_fed.data() && trigger_fed.size()) { const uint8_t* temp = trigger_fed.data(); data_u32 = reinterpret_cast<const uint32_t*>(temp) + FEDHeader::length / sizeof(uint32_t) + 1; size_u32 = trigger_fed.size() / sizeof(uint32_t) - FEDHeader::length / sizeof(uint32_t) - 1; const FEDTrailer fedTrailer(temp + trigger_fed.size() - FEDTrailer::length); if (fedTrailer.conscheck() != 0xDEADFACE) { if (edm::isDebugEnabled()) { edm::LogWarning(sistrip::mlRawToDigi_) << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Unexpected stamp found in DAQ trailer (ie, not 0xDEADFACE)!" << " Buffer appears not to contain 'trigger FED' data!"; } triggerFedId_ = 0; } } } else { triggerFedId_ = 0; data_u32 = nullptr; size_u32 = 0; } // Populate summary object with commissioning information if (triggerFedId_ > 0) { // Some checks if (!data_u32) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " NULL pointer to 'trigger FED' data"; edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } return; } if (size_u32 < sizeof(TFHeaderDescription) / sizeof(uint32_t)) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Unexpected 'Trigger FED' data size [32-bit words]: " << size_u32; edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } return; } // Write event-specific data to event const TFHeaderDescription* header = (const TFHeaderDescription*)data_u32; summary.event(static_cast<uint32_t>(header->getFedEventNumber())); summary.bx(static_cast<uint32_t>(header->getBunchCrossing())); // Write commissioning information to event uint32_t hsize = sizeof(TFHeaderDescription) / sizeof(uint32_t); const uint32_t* head = &data_u32[hsize]; summary.commissioningInfo(head, event); summary.triggerFed(triggerFedId_); } // Some debug if (summary.isSet() && once_) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " EventSummary built from \"trigger FED\":" << std::endl << summary; LogTrace("SiStripRawToDigi") << ss.str(); } once_ = false; } } void RawToDigiUnpacker::locateStartOfFedBuffer(const uint16_t& fed_id, const FEDRawData& input, FEDRawData& output) { // Check size of input buffer if (input.size() < 24) { output.resize(input.size()); // Return UNadjusted buffer start position and size memcpy(output.data(), input.data(), input.size()); if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "] " << "Input FEDRawData with FED id " << fed_id << " has size " << input.size(); edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } return; } // Iterator through buffer to find DAQ header bool found = false; uint16_t ichar = 0; while (ichar < input.size() - 16 && !found) { uint16_t offset = headerBytes_ < 0 ? ichar : headerBytes_; // Negative value means use "search mode" to find DAQ header const uint32_t* input_u32 = reinterpret_cast<const uint32_t*>(input.data() + offset); const uint32_t* fed_trailer = reinterpret_cast<const uint32_t*>(input.data() + input.size() - 8); // see info on FED 32-bit swapping at end-of-file bool old_vme_header = (input_u32[0] & 0xF0000000) == 0x50000000 && (fed_trailer[0] & 0xF0000000) == 0xA0000000 && ((fed_trailer[0] & 0x00FFFFFF) * 0x8) == (input.size() - offset); bool old_slink_header = (input_u32[1] & 0xF0000000) == 0x50000000 && (fed_trailer[1] & 0xF0000000) == 0xA0000000 && ((fed_trailer[1] & 0x00FFFFFF) * 0x8) == (input.size() - offset); bool old_slink_payload = (input_u32[3] & 0xFF000000) == 0xED000000; bool new_buffer_format = (input_u32[2] & 0xFF000000) == 0xC5000000; if (old_vme_header) { // Found DAQ header at byte position 'offset' found = true; output.resize(input.size() - offset); memcpy(output.data(), // target input.data() + offset, // source input.size() - offset); // nbytes if (headerBytes_ < 0) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Buffer for FED id " << fed_id << " has been found at byte position " << offset << " with a size of " << input.size() - offset << " bytes." << " Adjust the configurable 'AppendedBytes' to " << offset; LogTrace("SiStripRawToDigi") << ss.str(); } } } else if (old_slink_header) { if (old_slink_payload) { // Found DAQ header (with MSB and LSB 32-bit words swapped) at byte position 'offset' found = true; output.resize(input.size() - offset); uint32_t* output_u32 = reinterpret_cast<uint32_t*>(output.data()); uint16_t iter = offset; while (iter < output.size() / sizeof(uint32_t)) { output_u32[iter] = input_u32[iter + 1]; output_u32[iter + 1] = input_u32[iter]; iter += 2; } if (headerBytes_ < 0) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Buffer (with MSB and LSB 32-bit words swapped) for FED id " << fed_id << " has been found at byte position " << offset << " with a size of " << output.size() << " bytes." << " Adjust the configurable 'AppendedBytes' to " << offset; LogTrace("SiStripRawToDigi") << ss.str(); } } } else if (new_buffer_format) { // Found DAQ header at byte position 'offset' found = true; output.resize(input.size() - offset); memcpy(output.data(), // target input.data() + offset, // source input.size() - offset); // nbytes if (headerBytes_ < 0) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Buffer for FED id " << fed_id << " has been found at byte position " << offset << " with a size of " << input.size() - offset << " bytes." << " Adjust the configurable 'AppendedBytes' to " << offset; LogTrace("SiStripRawToDigi") << ss.str(); } } } else { headerBytes_ < 0 ? found = false : found = true; } } else { headerBytes_ < 0 ? found = false : found = true; } ichar++; } // Check size of output buffer if (output.size() == 0) { // Did not find DAQ header after search => return buffer with null size output.resize(0); //@@ NULL SIZE memcpy(output.data(), input.data(), 0); //@@ NULL SIZE if (edm::isDebugEnabled()) { std::stringstream ss; if (headerBytes_ < 0) { ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " DAQ header not found within buffer for FED id: " << fed_id; } else { const uint32_t* input_u32 = reinterpret_cast<const uint32_t*>(input.data()); ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " DAQ header not found at expected location for FED id: " << fed_id << std::endl << " First 64-bit word of buffer is 0x" << std::hex << std::setfill('0') << std::setw(8) << input_u32[0] << std::setfill('0') << std::setw(8) << input_u32[1] << std::dec << std::endl << " Adjust 'AppendedBytes' configurable to '-1' to activate 'search mode'"; } edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } } else if (output.size() < 24) { // Found DAQ header after search, but too few words if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Unexpected buffer size! FEDRawData with FED id " << fed_id << " has size " << output.size(); edm::LogWarning(sistrip::mlRawToDigi_) << ss.str(); } } } void RawToDigiUnpacker::updateEventSummary(const sistrip::FEDBuffer& fed, SiStripEventSummary& summary) { summary.event(fed.daqHeader().l1ID()); summary.bx(fed.daqHeader().bxID()); // Retrieve contents of DAQ registers sistrip::FEDDAQEventType readout_mode = fed.daqEventType(); uint32_t daq1 = sistrip::invalid32_; uint32_t daq2 = sistrip::invalid32_; if (fed.headerType() == sistrip::HEADER_TYPE_FULL_DEBUG) { const sistrip::FEDFullDebugHeader* header = nullptr; header = dynamic_cast<const sistrip::FEDFullDebugHeader*>(fed.feHeader()); daq1 = static_cast<uint32_t>(header->daqRegister()); daq2 = static_cast<uint32_t>(header->daqRegister2()); } // If FED DAQ registers contain info, update (and possibly overwrite) EventSummary if (daq1 != 0 && daq1 != sistrip::invalid32_) { summary.triggerFed(triggerFedId_); summary.fedReadoutMode(readout_mode); summary.commissioningInfo(daq1, daq2); if (summary.isSet() && once_) { if (edm::isDebugEnabled()) { std::stringstream ss; ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " EventSummary built from FED DAQ registers:" << std::endl << summary; LogTrace("SiStripRawToDigi") << ss.str(); } once_ = false; } } } void RawToDigiUnpacker::dumpRawData(uint16_t fed_id, const FEDRawData& buffer, std::stringstream& ss) { ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " Dump of buffer for FED id " << fed_id << std::endl << " Buffer contains " << buffer.size() << " bytes (NB: payload is byte-swapped)" << std::endl; if (false) { const uint32_t* buffer_u32 = reinterpret_cast<const uint32_t*>(buffer.data()); unsigned int empty = 0; ss << "Byte-> 4 5 6 7 0 1 2 3\n"; for (uint32_t i = 0; i < buffer.size() / 8; i++) { unsigned int temp0 = buffer_u32[i * 2] & sistrip::invalid32_; unsigned int temp1 = buffer_u32[i * 2 + 1] & sistrip::invalid32_; if (!temp0 && !temp1) { empty++; } else { if (empty) { ss << " [ empty words ]" << std::endl; empty = 0; } ss << std::dec << std::setfill(' ') << std::setw(6) << i * 8 << ": " << std::hex << std::setfill('0') << std::setw(8) << temp0 << std::setfill('0') << std::setw(8) << temp1 << std::dec << std::endl; } } } else { ss << " Byte | <---- Byte order ----< | Byte" << std::endl; ss << " cntr | 7 6 5 4 3 2 1 0 | cntr" << std::endl; for (uint32_t i = 0; i < buffer.size() / 8; i++) { //if ( i>=20 && ((i+4)<(buffer.size()/8)) ) { continue; } uint16_t tmp0 = buffer.data()[i * 8 + 0] & 0xFF; uint16_t tmp1 = buffer.data()[i * 8 + 1] & 0xFF; uint16_t tmp2 = buffer.data()[i * 8 + 2] & 0xFF; uint16_t tmp3 = buffer.data()[i * 8 + 3] & 0xFF; uint16_t tmp4 = buffer.data()[i * 8 + 4] & 0xFF; uint16_t tmp5 = buffer.data()[i * 8 + 5] & 0xFF; uint16_t tmp6 = buffer.data()[i * 8 + 6] & 0xFF; uint16_t tmp7 = buffer.data()[i * 8 + 7] & 0xFF; // if ( !tmp0 && !tmp1 && !tmp2 && !tmp3 && // !tmp4 && !tmp5 && !tmp6 && !tmp7 ) { empty++; } // else { // if ( empty ) { // ss << " [.." // << std::dec << std::setfill('.') << std::setw(4) << empty // << " null words....]" << std::endl; // empty = 0; // } ss << std::dec << std::setfill(' ') << std::setw(6) << i * 8 + 7 << " : " << std::hex << std::setfill('0') << std::setw(2) << tmp7 << " " << std::setfill('0') << std::setw(2) << tmp6 << " " << std::setfill('0') << std::setw(2) << tmp5 << " " << std::setfill('0') << std::setw(2) << tmp4 << " " << std::setfill('0') << std::setw(2) << tmp3 << " " << std::setfill('0') << std::setw(2) << tmp2 << " " << std::setfill('0') << std::setw(2) << tmp1 << " " << std::setfill('0') << std::setw(2) << tmp0 << std::dec << " :" << std::setfill(' ') << std::setw(6) << i * 8 << std::endl; // } } } ss << "[sistrip::RawToDigiUnpacker::" << __func__ << "]" << " End of FED buffer"; } } // namespace sistrip /* Some info on FED buffer 32-bit word swapping. Table below indicates if data are swapped relative to the "old" VME format (as originally expected by the Fed9UEvent class). ------------------------------------------- | SWAPPED? | DATA FORMAT | | (wrt "OLD") | OLD (0xED) | NEW (0xC5) | | | VME | SLINK | VME | SLINK | ------------------------------------------- | DAQ HEADER | N | Y | Y | Y | | TRK HEADER | N | Y | N | N | | PAYLOAD | N | Y | N | N | | DAQ TRAILER | N | Y | Y | Y | ------------------------------------------- So, in code, we check in code order of bytes in DAQ header/trailer only: -> if "old_vme_header", then old format read out via vme, so do nothing. -> else if "old_slink_header", then data may be wrapped, so check additionally the TRK header: ---> if "old_slink_payload", then old format read out via slink, so swap all data; ---> else if "new_buffer_format", then new format, handled internally by Fed9UEvent, so do nothing. Pattern matching to find DAQ and tracker headers, and DAQ trailer: DAQ header, 4 bits, in field |BOE_1| with value 0x5 DAQ trailer, 4 bits, in field |EOE_1| with value 0xA TRK header, 8 bits, in field |Hdr format| with value 0xED or 0xC5 ------------------------------------------------------------------------------------------- | SWAPPED? | DATA FORMAT | | (wrt "OLD") | OLD (0xED) | NEW (0xC5) | | | VME | SLINK | VME | SLINK | ------------------------------------------------------------------------------------------- | DAQ HEADER | ........5....... | 5............... | 5............... | 5............... | | TRK HEADER | ........ED...... | ED.............. | ........C5...... | ........C5...... | | PAYLOAD | ..........EA.... | ..EA............ | ..EA............ | ............EA.. | | DAQ TRAILER | ........A....... | A............... | A............... | A............... | ------------------------------------------------------------------------------------------- */
44.217117
120
0.556325
gputtley
03aa24232976241ad41da7c39d7bcc78ffdd407a
125,010
cpp
C++
src/KScripts/New/assign_KSVGs.cpp
HonzaMD/Krkal2
e53e9b096d89d1441ec472deb6d695c45bcae41f
[ "OLDAP-2.5" ]
1
2018-04-01T16:47:52.000Z
2018-04-01T16:47:52.000Z
src/KScripts/assign_KSVGs.cpp
HonzaMD/Krkal2
e53e9b096d89d1441ec472deb6d695c45bcae41f
[ "OLDAP-2.5" ]
null
null
null
src/KScripts/assign_KSVGs.cpp
HonzaMD/Krkal2
e53e9b096d89d1441ec472deb6d695c45bcae41f
[ "OLDAP-2.5" ]
null
null
null
////////////////////////////////////////////////////////////////////////////// /// /// A s s i g n K S V G S /// /// Pridam vsechny KSVGs a jejich alokacni a rirazovaci fce /// do hashovaci tabulky /// A:Generated Automatically /// ///////////////////////////////////////////////////////////////////////////// void KSAssignKSVGs() { CKSKSVG *tmp; // New lines added 05/31/18 at 20:38:59. tmp = new CKSKSVG("_KSVG_0_placeable_0001_FFFF_0001_0001",&KSAlloc_KSVG_0_placeable_0001_FFFF_0001_0001,&KSSetV_KSVG_0_placeable_0001_FFFF_0001_0001,sizeof(_KSVG_0_placeable_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_1_smejdic_0001_FFFF_0001_0001",&KSAlloc_KSVG_1_smejdic_0001_FFFF_0001_0001,&KSSetV_KSVG_1_smejdic_0001_FFFF_0001_0001,sizeof(_KSVG_1_smejdic_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_smejdic_0001_FFFF_0001_0001__M__KN_ANoConnect_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_2_LezeNadVecma_0001_FFFF_0001_0001",&KSAlloc_KSVG_2_LezeNadVecma_0001_FFFF_0001_0001,&KSSetV_KSVG_2_LezeNadVecma_0001_FFFF_0001_0001,sizeof(_KSVG_2_LezeNadVecma_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_3_Veci_0001_FFFF_0001_0001",&KSAlloc_KSVG_3_Veci_0001_FFFF_0001_0001,&KSSetV_KSVG_3_Veci_0001_FFFF_0001_0001,sizeof(_KSVG_3_Veci_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_4_floors_0001_FFFF_0001_0001",&KSAlloc_KSVG_4_floors_0001_FFFF_0001_0001,&KSSetV_KSVG_4_floors_0001_FFFF_0001_0001,sizeof(_KSVG_4_floors_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_5_floor_0001_FFFF_0001_0001",&KSAlloc_KSVG_5_floor_0001_FFFF_0001_0001,&KSSetV_KSVG_5_floor_0001_FFFF_0001_0001,sizeof(_KSVG_5_floor_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_6_wall_0001_FFFF_0001_0001",&KSAlloc_KSVG_6_wall_0001_FFFF_0001_0001,&KSSetV_KSVG_6_wall_0001_FFFF_0001_0001,sizeof(_KSVG_6_wall_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_wall_0001_FFFF_0001_0001__M__KN_ANoConnect_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_7_EditTest_0001_FFFF_0001_0001",&KSAlloc_KSVG_7_EditTest_0001_FFFF_0001_0001,&KSSetV_KSVG_7_EditTest_0001_FFFF_0001_0001,sizeof(_KSVG_7_EditTest_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M__KN_ANoConnect_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_a_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_probability_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_Affects_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_Objects_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_str_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_ch_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_obj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_inty_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_chary_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_doubly_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_EditTest_0001_FFFF_0001_0001__M_namesy_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_8_PAutoTest_0001_FFFF_0001_0001",&KSAlloc_KSVG_8_PAutoTest_0001_FFFF_0001_0001,&KSSetV_KSVG_8_PAutoTest_0001_FFFF_0001_0001,sizeof(_KSVG_8_PAutoTest_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_9_otrigger_0001_FFFF_0001_0001",&KSAlloc_KSVG_9_otrigger_0001_FFFF_0001_0001,&KSSetV_KSVG_9_otrigger_0001_FFFF_0001_0001,sizeof(_KSVG_9_otrigger_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_NumCellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_NumCellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_otrigger_0001_FFFF_0001_0001__M__KN_MsgRedirect_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_10_ovybuch_0001_FFFF_0001_0001",&KSAlloc_KSVG_10_ovybuch_0001_FFFF_0001_0001,&KSSetV_KSVG_10_ovybuch_0001_FFFF_0001_0001,sizeof(_KSVG_10_ovybuch_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_ovybuch_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_ovybuch_0001_FFFF_0001_0001__M__KN_NumCellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_ovybuch_0001_FFFF_0001_0001__M__KN_NumCellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_ovybuch_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_11_oVybuch1_0001_FFFF_0001_0001",&KSAlloc_KSVG_11_oVybuch1_0001_FFFF_0001_0001,&KSSetV_KSVG_11_oVybuch1_0001_FFFF_0001_0001,sizeof(_KSVG_11_oVybuch1_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oVybuch1_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oVybuch1_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oVybuch1_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oVybuch1_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_12_OPosmrtnaAnimace_0001_FFFF_0001_0001",&KSAlloc_KSVG_12_OPosmrtnaAnimace_0001_FFFF_0001_0001,&KSSetV_KSVG_12_OPosmrtnaAnimace_0001_FFFF_0001_0001,sizeof(_KSVG_12_OPosmrtnaAnimace_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_OPosmrtnaAnimace_0001_FFFF_0001_0001__M_StylGrafiky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_OPosmrtnaAnimace_0001_FFFF_0001_0001__M_StylSmrti_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_13_oVybuchuje_0001_FFFF_0001_0001",&KSAlloc_KSVG_13_oVybuchuje_0001_FFFF_0001_0001,&KSSetV_KSVG_13_oVybuchuje_0001_FFFF_0001_0001,sizeof(_KSVG_13_oVybuchuje_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_14_mina_0001_FFFF_0001_0001",&KSAlloc_KSVG_14_mina_0001_FFFF_0001_0001,&KSSetV_KSVG_14_mina_0001_FFFF_0001_0001,sizeof(_KSVG_14_mina_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_mina_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_15_oPointTr_0001_FFFF_0001_0001",&KSAlloc_KSVG_15_oPointTr_0001_FFFF_0001_0001,&KSSetV_KSVG_15_oPointTr_0001_FFFF_0001_0001,sizeof(_KSVG_15_oPointTr_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPointTr_0001_FFFF_0001_0001__M__KN_MsgRedirect_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_16_oDira_0001_FFFF_0001_0001",&KSAlloc_KSVG_16_oDira_0001_FFFF_0001_0001,&KSSetV_KSVG_16_oDira_0001_FFFF_0001_0001,sizeof(_KSVG_16_oDira_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oDira_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_17_oLava_0001_FFFF_0001_0001",&KSAlloc_KSVG_17_oLava_0001_FFFF_0001_0001,&KSSetV_KSVG_17_oLava_0001_FFFF_0001_0001,sizeof(_KSVG_17_oLava_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oDira_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_18_oPropadlo_0001_FFFF_0001_0001",&KSAlloc_KSVG_18_oPropadlo_0001_FFFF_0001_0001,&KSSetV_KSVG_18_oPropadlo_0001_FFFF_0001_0001,sizeof(_KSVG_18_oPropadlo_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPropadlo_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPropadlo_0001_FFFF_0001_0001__M_StavPropadnuti_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_19_oSeSmerem_0001_FFFF_0001_0001",&KSAlloc_KSVG_19_oSeSmerem_0001_FFFF_0001_0001,&KSSetV_KSVG_19_oSeSmerem_0001_FFFF_0001_0001,sizeof(_KSVG_19_oSeSmerem_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_20_oSeSmerem2_0001_FFFF_0001_0001",&KSAlloc_KSVG_20_oSeSmerem2_0001_FFFF_0001_0001,&KSSetV_KSVG_20_oSeSmerem2_0001_FFFF_0001_0001,sizeof(_KSVG_20_oSeSmerem2_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oSeSmerem2_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_21_oMagnet_0001_FFFF_0001_0001",&KSAlloc_KSVG_21_oMagnet_0001_FFFF_0001_0001,&KSSetV_KSVG_21_oMagnet_0001_FFFF_0001_0001,sizeof(_KSVG_21_oMagnet_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_mforce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_x_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_y_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_x2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnet_0001_FFFF_0001_0001__M_y2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_22_oLaser_0001_FFFF_0001_0001",&KSAlloc_KSVG_22_oLaser_0001_FFFF_0001_0001,&KSSetV_KSVG_22_oLaser_0001_FFFF_0001_0001,sizeof(_KSVG_22_oLaser_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_23_oklic_0001_FFFF_0001_0001",&KSAlloc_KSVG_23_oklic_0001_FFFF_0001_0001,&KSSetV_KSVG_23_oklic_0001_FFFF_0001_0001,sizeof(_KSVG_23_oklic_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oklic_0001_FFFF_0001_0001__M_barva_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_24_oAreaTest_0001_FFFF_0001_0001",&KSAlloc_KSVG_24_oAreaTest_0001_FFFF_0001_0001,&KSSetV_KSVG_24_oAreaTest_0001_FFFF_0001_0001,sizeof(_KSVG_24_oAreaTest_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_x1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_y1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_z1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_x2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_y2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_z2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_x_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTest_0001_FFFF_0001_0001__M_y_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_25_oStartsMove_0001_FFFF_0001_0001",&KSAlloc_KSVG_25_oStartsMove_0001_FFFF_0001_0001,&KSSetV_KSVG_25_oStartsMove_0001_FFFF_0001_0001,sizeof(_KSVG_25_oStartsMove_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_26_oMoveable_0001_FFFF_0001_0001",&KSAlloc_KSVG_26_oMoveable_0001_FFFF_0001_0001,&KSSetV_KSVG_26_oMoveable_0001_FFFF_0001_0001,sizeof(_KSVG_26_oMoveable_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_27_oMoves_0001_FFFF_0001_0001",&KSAlloc_KSVG_27_oMoves_0001_FFFF_0001_0001,&KSSetV_KSVG_27_oMoves_0001_FFFF_0001_0001,sizeof(_KSVG_27_oMoves_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_banning_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_path_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_pathp_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_DeBlockAreaX1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_DeBlockAreaY1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_DeBlockAreaX2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_DeBlockAreaY2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoves_0001_FFFF_0001_0001__M_LastDirs_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_28_oBlockedPath_0001_FFFF_0001_0001",&KSAlloc_KSVG_28_oBlockedPath_0001_FFFF_0001_0001,&KSSetV_KSVG_28_oBlockedPath_0001_FFFF_0001_0001,sizeof(_KSVG_28_oBlockedPath_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M_Father_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_29_oBlockedPath_0001_FFFF_0001_0001__M_Veci_0001_FFFF_0001_0001",&KSAlloc_KSVG_29_oBlockedPath_0001_FFFF_0001_0001__M_Veci_0001_FFFF_0001_0001,&KSSetV_KSVG_29_oBlockedPath_0001_FFFF_0001_0001__M_Veci_0001_FFFF_0001_0001,sizeof(_KSVG_29_oBlockedPath_0001_FFFF_0001_0001__M_Veci_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M_Father_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_30_oBlockedPath_0001_FFFF_0001_0001__M_LezeNadVecma_0001_FFFF_0001_0001",&KSAlloc_KSVG_30_oBlockedPath_0001_FFFF_0001_0001__M_LezeNadVecma_0001_FFFF_0001_0001,&KSSetV_KSVG_30_oBlockedPath_0001_FFFF_0001_0001__M_LezeNadVecma_0001_FFFF_0001_0001,sizeof(_KSVG_30_oBlockedPath_0001_FFFF_0001_0001__M_LezeNadVecma_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M_Father_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBlockedPath_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_31_oPas_0001_FFFF_0001_0001",&KSAlloc_KSVG_31_oPas_0001_FFFF_0001_0001,&KSSetV_KSVG_31_oPas_0001_FFFF_0001_0001,sizeof(_KSVG_31_oPas_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPas_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPas_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_32_oOnOff_0001_FFFF_0001_0001",&KSAlloc_KSVG_32_oOnOff_0001_FFFF_0001_0001,&KSSetV_KSVG_32_oOnOff_0001_FFFF_0001_0001,sizeof(_KSVG_32_oOnOff_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oOnOff_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_33_oLed_0001_FFFF_0001_0001",&KSAlloc_KSVG_33_oLed_0001_FFFF_0001_0001,&KSSetV_KSVG_33_oLed_0001_FFFF_0001_0001,sizeof(_KSVG_33_oLed_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oLed_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_34_oPrisera_0001_FFFF_0001_0001",&KSAlloc_KSVG_34_oPrisera_0001_FFFF_0001_0001,&KSSetV_KSVG_34_oPrisera_0001_FFFF_0001_0001,sizeof(_KSVG_34_oPrisera_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_35_oPriseraOt_0001_FFFF_0001_0001",&KSAlloc_KSVG_35_oPriseraOt_0001_FFFF_0001_0001,&KSSetV_KSVG_35_oPriseraOt_0001_FFFF_0001_0001,sizeof(_KSVG_35_oPriseraOt_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPriseraOt_0001_FFFF_0001_0001__M_Tocivost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_36_oLineTr_0001_FFFF_0001_0001",&KSAlloc_KSVG_36_oLineTr_0001_FFFF_0001_0001,&KSSetV_KSVG_36_oLineTr_0001_FFFF_0001_0001,sizeof(_KSVG_36_oLineTr_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_NumCellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_NumCellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oLineTr_0001_FFFF_0001_0001__M__KN_MsgRedirect_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_37_oMagnetForce_0001_FFFF_0001_0001",&KSAlloc_KSVG_37_oMagnetForce_0001_FFFF_0001_0001,&KSSetV_KSVG_37_oMagnetForce_0001_FFFF_0001_0001,sizeof(_KSVG_37_oMagnetForce_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oMagnetForce_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnetForce_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnetForce_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnetForce_0001_FFFF_0001_0001__M__KN_NumCellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMagnetForce_0001_FFFF_0001_0001__M__KN_NumCellY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_38_oAntiMagnet_0001_FFFF_0001_0001",&KSAlloc_KSVG_38_oAntiMagnet_0001_FFFF_0001_0001,&KSSetV_KSVG_38_oAntiMagnet_0001_FFFF_0001_0001,sizeof(_KSVG_38_oAntiMagnet_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_40_oManik_0001_FFFF_0001_0001",&KSAlloc_KSVG_40_oManik_0001_FFFF_0001_0001,&KSSetV_KSVG_40_oManik_0001_FFFF_0001_0001,sizeof(_KSVG_40_oManik_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_muflon_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ziju_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SKlice_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SBomby_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SMiny_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyBombaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyMinaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_koliznik_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_Focus_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SZnacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ZmacknutoA_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_41_oDracek_0001_FFFF_0001_0001",&KSAlloc_KSVG_41_oDracek_0001_FFFF_0001_0001,&KSSetV_KSVG_41_oDracek_0001_FFFF_0001_0001,sizeof(_KSVG_41_oDracek_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oDracek_0001_FFFF_0001_0001__M_VeVode_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oDracek_0001_FFFF_0001_0001__M_veVodeCounter_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oDracek_0001_FFFF_0001_0001__M_trigerVoda_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oDracek_0001_FFFF_0001_0001__M_trigerHelper_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_muflon_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ziju_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SKlice_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SBomby_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SMiny_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyBombaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyMinaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_koliznik_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_Focus_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SZnacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ZmacknutoA_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizSmrtCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizMez_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_42_oExit_0001_FFFF_0001_0001",&KSAlloc_KSVG_42_oExit_0001_FFFF_0001_0001,&KSSetV_KSVG_42_oExit_0001_FFFF_0001_0001,sizeof(_KSVG_42_oExit_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oExit_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_43_oManikControler_0001_FFFF_0001_0001",&KSAlloc_KSVG_43_oManikControler_0001_FFFF_0001_0001,&KSSetV_KSVG_43_oManikControler_0001_FFFF_0001_0001,sizeof(_KSVG_43_oManikControler_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_ManikCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_ZmacknutTab_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Klic1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Klic2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Klic3_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Bomba_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Mina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Znacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManikControler_0001_FFFF_0001_0001__M_Manici_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_46_oHlina_0001_FFFF_0001_0001",&KSAlloc_KSVG_46_oHlina_0001_FFFF_0001_0001,&KSSetV_KSVG_46_oHlina_0001_FFFF_0001_0001,sizeof(_KSVG_46_oHlina_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_49_oKamen_0001_FFFF_0001_0001",&KSAlloc_KSVG_49_oKamen_0001_FFFF_0001_0001,&KSSetV_KSVG_49_oKamen_0001_FFFF_0001_0001,sizeof(_KSVG_49_oKamen_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_50_oZnicitelnaStena_0001_FFFF_0001_0001",&KSAlloc_KSVG_50_oZnicitelnaStena_0001_FFFF_0001_0001,&KSSetV_KSVG_50_oZnicitelnaStena_0001_FFFF_0001_0001,sizeof(_KSVG_50_oZnicitelnaStena_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_51_oSebratelnaBomba_0001_FFFF_0001_0001",&KSAlloc_KSVG_51_oSebratelnaBomba_0001_FFFF_0001_0001,&KSSetV_KSVG_51_oSebratelnaBomba_0001_FFFF_0001_0001,sizeof(_KSVG_51_oSebratelnaBomba_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_52_oSebratelnaMina_0001_FFFF_0001_0001",&KSAlloc_KSVG_52_oSebratelnaMina_0001_FFFF_0001_0001,&KSSetV_KSVG_52_oSebratelnaMina_0001_FFFF_0001_0001,sizeof(_KSVG_52_oSebratelnaMina_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_53_oBomba_0001_FFFF_0001_0001",&KSAlloc_KSVG_53_oBomba_0001_FFFF_0001_0001,&KSSetV_KSVG_53_oBomba_0001_FFFF_0001_0001,sizeof(_KSVG_53_oBomba_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_54_oZamek_0001_FFFF_0001_0001",&KSAlloc_KSVG_54_oZamek_0001_FFFF_0001_0001,&KSSetV_KSVG_54_oZamek_0001_FFFF_0001_0001,sizeof(_KSVG_54_oZamek_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oZamek_0001_FFFF_0001_0001__M_barva_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_55__KN_ScrollObj_0001_FFFF_0001_0001",&KSAlloc_KSVG_55__KN_ScrollObj_0001_FFFF_0001_0001,&KSSetV_KSVG_55__KN_ScrollObj_0001_FFFF_0001_0001,sizeof(_KSVG_55__KN_ScrollObj_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV__KN_ScrollObj__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV__KN_ScrollObj__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV__KN_ScrollObj__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_56_oVoda_0001_FFFF_0001_0001",&KSAlloc_KSVG_56_oVoda_0001_FFFF_0001_0001,&KSSetV_KSVG_56_oVoda_0001_FFFF_0001_0001,sizeof(_KSVG_56_oVoda_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oVoda_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_57_oKrabice_0001_FFFF_0001_0001",&KSAlloc_KSVG_57_oKrabice_0001_FFFF_0001_0001,&KSSetV_KSVG_57_oKrabice_0001_FFFF_0001_0001,sizeof(_KSVG_57_oKrabice_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrulezny_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_58_oPneumatika_0001_FFFF_0001_0001",&KSAlloc_KSVG_58_oPneumatika_0001_FFFF_0001_0001,&KSSetV_KSVG_58_oPneumatika_0001_FFFF_0001_0001,sizeof(_KSVG_58_oPneumatika_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_59_oBalonek_0001_FFFF_0001_0001",&KSAlloc_KSVG_59_oBalonek_0001_FFFF_0001_0001,&KSSetV_KSVG_59_oBalonek_0001_FFFF_0001_0001,sizeof(_KSVG_59_oBalonek_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_60_oHemr_0001_FFFF_0001_0001",&KSAlloc_KSVG_60_oHemr_0001_FFFF_0001_0001,&KSSetV_KSVG_60_oHemr_0001_FFFF_0001_0001,sizeof(_KSVG_60_oHemr_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_muflon_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ziju_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SKlice_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SBomby_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SMiny_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyBombaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyMinaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_koliznik_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_Focus_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SZnacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ZmacknutoA_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizSmrtCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizMez_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_61_oPasovec_0001_FFFF_0001_0001",&KSAlloc_KSVG_61_oPasovec_0001_FFFF_0001_0001,&KSSetV_KSVG_61_oPasovec_0001_FFFF_0001_0001,sizeof(_KSVG_61_oPasovec_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_muflon_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ziju_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SKlice_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SBomby_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SMiny_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyBombaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyMinaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_koliznik_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_Focus_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SZnacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ZmacknutoA_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizSmrtCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizMez_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_62_oTeleport_0001_FFFF_0001_0001",&KSAlloc_KSVG_62_oTeleport_0001_FFFF_0001_0001,&KSSetV_KSVG_62_oTeleport_0001_FFFF_0001_0001,sizeof(_KSVG_62_oTeleport_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_63_oStrkatelne_0001_FFFF_0001_0001",&KSAlloc_KSVG_63_oStrkatelne_0001_FFFF_0001_0001,&KSSetV_KSVG_63_oStrkatelne_0001_FFFF_0001_0001,sizeof(_KSVG_63_oStrkatelne_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_64_oStrka_0001_FFFF_0001_0001",&KSAlloc_KSVG_64_oStrka_0001_FFFF_0001_0001,&KSSetV_KSVG_64_oStrka_0001_FFFF_0001_0001,sizeof(_KSVG_64_oStrka_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_65_oHajzl_0001_FFFF_0001_0001",&KSAlloc_KSVG_65_oHajzl_0001_FFFF_0001_0001,&KSSetV_KSVG_65_oHajzl_0001_FFFF_0001_0001,sizeof(_KSVG_65_oHajzl_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oHajzl_0001_FFFF_0001_0001__M_MeniNa_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_67_oTeleport2_0001_FFFF_0001_0001",&KSAlloc_KSVG_67_oTeleport2_0001_FFFF_0001_0001,&KSSetV_KSVG_67_oTeleport2_0001_FFFF_0001_0001,sizeof(_KSVG_67_oTeleport2_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oTeleport2_0001_FFFF_0001_0001__M_CoTeleportuje_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTeleport_0001_FFFF_0001_0001__M_DestY_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_68_oUmiraNaSlizu_0001_FFFF_0001_0001",&KSAlloc_KSVG_68_oUmiraNaSlizu_0001_FFFF_0001_0001,&KSSetV_KSVG_68_oUmiraNaSlizu_0001_FFFF_0001_0001,sizeof(_KSVG_68_oUmiraNaSlizu_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizSmrtCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizMez_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_69_oSliz_0001_FFFF_0001_0001",&KSAlloc_KSVG_69_oSliz_0001_FFFF_0001_0001,&KSSetV_KSVG_69_oSliz_0001_FFFF_0001_0001,sizeof(_KSVG_69_oSliz_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oSliz_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_70_oPriseraSNavadeci_0001_FFFF_0001_0001",&KSAlloc_KSVG_70_oPriseraSNavadeci_0001_FFFF_0001_0001,&KSSetV_KSVG_70_oPriseraSNavadeci_0001_FFFF_0001_0001,sizeof(_KSVG_70_oPriseraSNavadeci_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_71_oManikSliz_0001_FFFF_0001_0001",&KSAlloc_KSVG_71_oManikSliz_0001_FFFF_0001_0001,&KSSetV_KSVG_71_oManikSliz_0001_FFFF_0001_0001,sizeof(_KSVG_71_oManikSliz_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_muflon_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ziju_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SKlice_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SBomby_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SMiny_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyBombaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyMinaDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_koliznik_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_cellY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_Focus_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_SZnacky_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_KeyZnackyDown1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oManik_0001_FFFF_0001_0001__M_ZmacknutoA_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M_CoStrka_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrka_0001_FFFF_0001_0001__M__KN_clzFceGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizSmrtCount_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oUmiraNaSlizu_0001_FFFF_0001_0001__M_SlizMez_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_72_oZnacky_0001_FFFF_0001_0001",&KSAlloc_KSVG_72_oZnacky_0001_FFFF_0001_0001,&KSSetV_KSVG_72_oZnacky_0001_FFFF_0001_0001,sizeof(_KSVG_72_oZnacky_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_73_oZnSmerova_0001_FFFF_0001_0001",&KSAlloc_KSVG_73_oZnSmerova_0001_FFFF_0001_0001,&KSSetV_KSVG_73_oZnSmerova_0001_FFFF_0001_0001,sizeof(_KSVG_73_oZnSmerova_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_74_oZnZakazVjezdu_0001_FFFF_0001_0001",&KSAlloc_KSVG_74_oZnZakazVjezdu_0001_FFFF_0001_0001,&KSSetV_KSVG_74_oZnZakazVjezdu_0001_FFFF_0001_0001,sizeof(_KSVG_74_oZnZakazVjezdu_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_75_oZnSedesat_0001_FFFF_0001_0001",&KSAlloc_KSVG_75_oZnSedesat_0001_FFFF_0001_0001,&KSSetV_KSVG_75_oZnSedesat_0001_FFFF_0001_0001,sizeof(_KSVG_75_oZnSedesat_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_76_oZnNeSedesat_0001_FFFF_0001_0001",&KSAlloc_KSVG_76_oZnNeSedesat_0001_FFFF_0001_0001,&KSSetV_KSVG_76_oZnNeSedesat_0001_FFFF_0001_0001,sizeof(_KSVG_76_oZnNeSedesat_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_Veci_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_77_oPriseraZnackova_0001_FFFF_0001_0001",&KSAlloc_KSVG_77_oPriseraZnackova_0001_FFFF_0001_0001,&KSSetV_KSVG_77_oPriseraZnackova_0001_FFFF_0001_0001,sizeof(_KSVG_77_oPriseraZnackova_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPriseraZnackova_0001_FFFF_0001_0001__M_Rychlost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_78_oPriseraDopravni_0001_FFFF_0001_0001",&KSAlloc_KSVG_78_oPriseraDopravni_0001_FFFF_0001_0001,&KSSetV_KSVG_78_oPriseraDopravni_0001_FFFF_0001_0001,sizeof(_KSVG_78_oPriseraDopravni_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPriseraZnackova_0001_FFFF_0001_0001__M_Rychlost_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_79_oPriseraKlaustrofobni_0001_FFFF_0001_0001",&KSAlloc_KSVG_79_oPriseraKlaustrofobni_0001_FFFF_0001_0001,&KSSetV_KSVG_79_oPriseraKlaustrofobni_0001_FFFF_0001_0001,sizeof(_KSVG_79_oPriseraKlaustrofobni_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPriseraZnackova_0001_FFFF_0001_0001__M_Rychlost_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_84_oScriptedTest_0001_FFFF_0001_0001",&KSAlloc_KSVG_84_oScriptedTest_0001_FFFF_0001_0001,&KSSetV_KSVG_84_oScriptedTest_0001_FFFF_0001_0001,sizeof(_KSVG_84_oScriptedTest_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oScriptedTest_0001_FFFF_0001_0001__M_blb_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oScriptedTest_0001_FFFF_0001_0001__M_chr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oScriptedTest_0001_FFFF_0001_0001__M_pole_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_85_oPrepinace_0001_FFFF_0001_0001",&KSAlloc_KSVG_85_oPrepinace_0001_FFFF_0001_0001,&KSSetV_KSVG_85_oPrepinace_0001_FFFF_0001_0001,sizeof(_KSVG_85_oPrepinace_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_86_oPrepinac_0001_FFFF_0001_0001",&KSAlloc_KSVG_86_oPrepinac_0001_FFFF_0001_0001,&KSSetV_KSVG_86_oPrepinac_0001_FFFF_0001_0001,sizeof(_KSVG_86_oPrepinac_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPrepinac_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinac_0001_FFFF_0001_0001__M_prepnuto_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinac_0001_FFFF_0001_0001__M_time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_87_oTriggerPrepinac_0001_FFFF_0001_0001",&KSAlloc_KSVG_87_oTriggerPrepinac_0001_FFFF_0001_0001,&KSSetV_KSVG_87_oTriggerPrepinac_0001_FFFF_0001_0001,sizeof(_KSVG_87_oTriggerPrepinac_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_citac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_Reaguje_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_88_oFotobunka_0001_FFFF_0001_0001",&KSAlloc_KSVG_88_oFotobunka_0001_FFFF_0001_0001,&KSSetV_KSVG_88_oFotobunka_0001_FFFF_0001_0001,sizeof(_KSVG_88_oFotobunka_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_citac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_Reaguje_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_89_oNaslapnaPodlaha_0001_FFFF_0001_0001",&KSAlloc_KSVG_89_oNaslapnaPodlaha_0001_FFFF_0001_0001,&KSSetV_KSVG_89_oNaslapnaPodlaha_0001_FFFF_0001_0001,sizeof(_KSVG_89_oNaslapnaPodlaha_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_citac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_Reaguje_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_90_oAreaTrigger_0001_FFFF_0001_0001",&KSAlloc_KSVG_90_oAreaTrigger_0001_FFFF_0001_0001,&KSSetV_KSVG_90_oAreaTrigger_0001_FFFF_0001_0001,sizeof(_KSVG_90_oAreaTrigger_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeX1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeY1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeZ1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeX2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeY2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_BCubeZ2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_clzAddGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oAreaTrigger_0001_FFFF_0001_0001__M__KN_MsgRedirect_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_91_oDracekTriggerHelper_0001_FFFF_0001_0001",&KSAlloc_KSVG_91_oDracekTriggerHelper_0001_FFFF_0001_0001,&KSSetV_KSVG_91_oDracekTriggerHelper_0001_FFFF_0001_0001,sizeof(_KSVG_91_oDracekTriggerHelper_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oDracekTriggerHelper_0001_FFFF_0001_0001__M_dracek_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_92_oGlobalniPrepinac_0001_FFFF_0001_0001",&KSAlloc_KSVG_92_oGlobalniPrepinac_0001_FFFF_0001_0001,&KSSetV_KSVG_92_oGlobalniPrepinac_0001_FFFF_0001_0001,sizeof(_KSVG_92_oGlobalniPrepinac_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_x1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_y1_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_x2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_y2_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_Reaguj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniPrepinac_0001_FFFF_0001_0001__M_Ignoruj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_PocetAkci_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_DruhAkce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Pusobnost_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Prepina_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Nekoliduj_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrepinace_0001_FFFF_0001_0001__M_Akce_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_citac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_Reaguje_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oTriggerPrepinac_0001_FFFF_0001_0001__M_triger_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_93_oOpatrnaPrisera_0001_FFFF_0001_0001",&KSAlloc_KSVG_93_oOpatrnaPrisera_0001_FFFF_0001_0001,&KSSetV_KSVG_93_oOpatrnaPrisera_0001_FFFF_0001_0001,sizeof(_KSVG_93_oOpatrnaPrisera_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_94_oSvetlo_0001_FFFF_0001_0001",&KSAlloc_KSVG_94_oSvetlo_0001_FFFF_0001_0001,&KSSetV_KSVG_94_oSvetlo_0001_FFFF_0001_0001,sizeof(_KSVG_94_oSvetlo_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_r_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_g_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_b_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_radius_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_vyska_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M_svetlo_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSvetlo_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_95_oGlobalniSvetlo_0001_FFFF_0001_0001",&KSAlloc_KSVG_95_oGlobalniSvetlo_0001_FFFF_0001_0001,&KSSetV_KSVG_95_oGlobalniSvetlo_0001_FFFF_0001_0001,sizeof(_KSVG_95_oGlobalniSvetlo_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oGlobalniSvetlo_0001_FFFF_0001_0001__M_r_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniSvetlo_0001_FFFF_0001_0001__M_g_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oGlobalniSvetlo_0001_FFFF_0001_0001__M_b_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_96_oPriseraSeZvukem1_0001_FFFF_0001_0001",&KSAlloc_KSVG_96_oPriseraSeZvukem1_0001_FFFF_0001_0001,&KSSetV_KSVG_96_oPriseraSeZvukem1_0001_FFFF_0001_0001,sizeof(_KSVG_96_oPriseraSeZvukem1_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_97_oPriseraSeZvukem2_0001_FFFF_0001_0001",&KSAlloc_KSVG_97_oPriseraSeZvukem2_0001_FFFF_0001_0001,&KSSetV_KSVG_97_oPriseraSeZvukem2_0001_FFFF_0001_0001,sizeof(_KSVG_97_oPriseraSeZvukem2_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_98_oBouraDoSten_0001_FFFF_0001_0001",&KSAlloc_KSVG_98_oBouraDoSten_0001_FFFF_0001_0001,&KSSetV_KSVG_98_oBouraDoSten_0001_FFFF_0001_0001,sizeof(_KSVG_98_oBouraDoSten_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_99_oPrulezny_0001_FFFF_0001_0001",&KSAlloc_KSVG_99_oPrulezny_0001_FFFF_0001_0001,&KSSetV_KSVG_99_oPrulezny_0001_FFFF_0001_0001,sizeof(_KSVG_99_oPrulezny_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_oPrulezny_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_100_oProlejza_0001_FFFF_0001_0001",&KSAlloc_KSVG_100_oProlejza_0001_FFFF_0001_0001,&KSSetV_KSVG_100_oProlejza_0001_FFFF_0001_0001,sizeof(_KSVG_100_oProlejza_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_LezeNadVecma_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_101_oPruleznaStena_0001_FFFF_0001_0001",&KSAlloc_KSVG_101_oPruleznaStena_0001_FFFF_0001_0001,&KSSetV_KSVG_101_oPruleznaStena_0001_FFFF_0001_0001,sizeof(_KSVG_101_oPruleznaStena_0001_FFFF_0001_0001)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oPrulezny_0001_FFFF_0001_0001__M__KN_clzSubGr_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_102_OMap_0001_000F_0001_1001",&KSAlloc_KSVG_102_OMap_0001_000F_0001_1001,&KSSetV_KSVG_102_OMap_0001_000F_0001_1001,sizeof(_KSVG_102_OMap_0001_000F_0001_1001)); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_leftx_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_lefty_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_rightx_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_righty_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_lowerlevel_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_upperlevel_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_startx_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_starty_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_sizex_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_sizey_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_CellType_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_csizeX_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_csizeY_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_csizeZ_0001_000F_0001_1001"); tmp->AddAttribute("_KSOV_OMap_0001_000F_0001_1001__M_grid_0001_000F_0001_1001"); tmp = new CKSKSVG("_KSVG_103_oSkakavaStena_E3CB_FBA9_E57B_1ECD",&KSAlloc_KSVG_103_oSkakavaStena_E3CB_FBA9_E57B_1ECD,&KSSetV_KSVG_103_oSkakavaStena_E3CB_FBA9_E57B_1ECD,sizeof(_KSVG_103_oSkakavaStena_E3CB_FBA9_E57B_1ECD)); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_stav_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_faze_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_PauzaPredZapnutim_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_DobaSkoku_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_DobaNaZemi_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_OpravduSkace_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M_JaOdebiram_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M__KN_ObjPosZ_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_oSkakavaStena_E3CB_FBA9_E57B_1ECD__M__KN_CollisionCfg_E3CB_FBA9_E57B_1ECD"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_104_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73",&KSAlloc_KSVG_104_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73,&KSSetV_KSVG_104_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73,sizeof(_KSVG_104_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73)); tmp->AddAttribute("_KSOV_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73__M_stav_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73__M_r_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73__M_g_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oMenicGlobalnihoSvetla_3436_6AFC_3322_FB73__M_b_3436_6AFC_3322_FB73"); tmp = new CKSKSVG("_KSVG_105_oDynamickeSvetlo_3436_6AFC_3322_FB73",&KSAlloc_KSVG_105_oDynamickeSvetlo_3436_6AFC_3322_FB73,&KSSetV_KSVG_105_oDynamickeSvetlo_3436_6AFC_3322_FB73,sizeof(_KSVG_105_oDynamickeSvetlo_3436_6AFC_3322_FB73)); tmp->AddAttribute("_KSOV_oDynamickeSvetlo_3436_6AFC_3322_FB73__M_svetlo_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oDynamickeSvetlo_3436_6AFC_3322_FB73__M_faze_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oDynamickeSvetlo_3436_6AFC_3322_FB73__M__KN_CollisionCfg_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oDynamickeSvetlo_3436_6AFC_3322_FB73__M_Spojak_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_106_oCasovac_3436_6AFC_3322_FB73",&KSAlloc_KSVG_106_oCasovac_3436_6AFC_3322_FB73,&KSSetV_KSVG_106_oCasovac_3436_6AFC_3322_FB73,sizeof(_KSVG_106_oCasovac_3436_6AFC_3322_FB73)); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_Casy_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_NahRozptyl_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_NahRozptyly_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_Objekty_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_Zprava_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_Zpravy_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_Opakuj_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oCasovac_3436_6AFC_3322_FB73__M_faze_3436_6AFC_3322_FB73"); tmp->AddAttribute("_KSOV_oOnOff_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_107_oHrbolataP_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_107_oHrbolataP_A1CF_6963_8DA6_D822,&KSSetV_KSVG_107_oHrbolataP_A1CF_6963_8DA6_D822,sizeof(_KSVG_107_oHrbolataP_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_108_oSeSmerem3_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_108_oSeSmerem3_A1CF_6963_8DA6_D822,&KSSetV_KSVG_108_oSeSmerem3_A1CF_6963_8DA6_D822,sizeof(_KSVG_108_oSeSmerem3_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oSeSmerem3_A1CF_6963_8DA6_D822__M_smer_A1CF_6963_8DA6_D822"); tmp = new CKSKSVG("_KSVG_109_oProud_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_109_oProud_A1CF_6963_8DA6_D822,&KSSetV_KSVG_109_oProud_A1CF_6963_8DA6_D822,sizeof(_KSVG_109_oProud_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oProud_A1CF_6963_8DA6_D822__M_Otec1_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oProud_A1CF_6963_8DA6_D822__M_Otec2_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oProud_A1CF_6963_8DA6_D822__M__KN_CollisionCfg_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oProud_A1CF_6963_8DA6_D822__M_triger_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem3_A1CF_6963_8DA6_D822__M_smer_A1CF_6963_8DA6_D822"); tmp = new CKSKSVG("_KSVG_110_oElektroda_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_110_oElektroda_A1CF_6963_8DA6_D822,&KSSetV_KSVG_110_oElektroda_A1CF_6963_8DA6_D822,sizeof(_KSVG_110_oElektroda_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oElektroda_A1CF_6963_8DA6_D822__M_Prouduju_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oElektroda_A1CF_6963_8DA6_D822__M_Proudy_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oElektroda_A1CF_6963_8DA6_D822__M_StartDelay_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem_0001_FFFF_0001_0001__M_smer_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oOnOff_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_111_oNitroGlycerin_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_111_oNitroGlycerin_A1CF_6963_8DA6_D822,&KSSetV_KSVG_111_oNitroGlycerin_A1CF_6963_8DA6_D822,sizeof(_KSVG_111_oNitroGlycerin_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oNitroGlycerin_A1CF_6963_8DA6_D822__M_cas2_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_112_oDvere_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_112_oDvere_A1CF_6963_8DA6_D822,&KSSetV_KSVG_112_oDvere_A1CF_6963_8DA6_D822,sizeof(_KSVG_112_oDvere_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_ReagujeNa_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_citac_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_triger_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_blokovac_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_OdebiramJa_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M__KN_CollisionCfg_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oDvere_A1CF_6963_8DA6_D822__M_StavOtevreni_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oOnOff_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oSeSmerem3_A1CF_6963_8DA6_D822__M_smer_A1CF_6963_8DA6_D822"); tmp = new CKSKSVG("_KSVG_113_oBlokovacProudu_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_113_oBlokovacProudu_A1CF_6963_8DA6_D822,&KSSetV_KSVG_113_oBlokovacProudu_A1CF_6963_8DA6_D822,sizeof(_KSVG_113_oBlokovacProudu_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oBlokovacProudu_A1CF_6963_8DA6_D822__M__KN_CollisionCfg_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_114_oSavePoint_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_114_oSavePoint_A1CF_6963_8DA6_D822,&KSSetV_KSVG_114_oSavePoint_A1CF_6963_8DA6_D822,sizeof(_KSVG_114_oSavePoint_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oSavePoint_A1CF_6963_8DA6_D822__M_triger_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oSavePoint_A1CF_6963_8DA6_D822__M_JenJednou_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_floors_0001_FFFF_0001_0001__M__KN_CollisionCfg_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oOnOff_0001_FFFF_0001_0001__M_OnOff_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_115_oLedovaKoule_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_115_oLedovaKoule_A1CF_6963_8DA6_D822,&KSSetV_KSVG_115_oLedovaKoule_A1CF_6963_8DA6_D822,sizeof(_KSVG_115_oLedovaKoule_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosX_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_ObjPosY_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_placeable_0001_FFFF_0001_0001__M__KN_APicture_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_WillCalculate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_Moving_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fsource_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fdir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fpriority_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_ftype_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fspeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_fstate_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockedPath_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_BlockingObjs_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastDir_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LastMTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oMoveable_0001_FFFF_0001_0001__M_LSpeed_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_LastStrkac_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTime_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_StrkTimeOut_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oStrkatelne_0001_FFFF_0001_0001__M_Time_0001_FFFF_0001_0001"); tmp->AddAttribute("_KSOV_oBouraDoSten_0001_FFFF_0001_0001__M_cas_0001_FFFF_0001_0001"); tmp = new CKSKSVG("_KSVG_116_oLevelIntro_A1CF_6963_8DA6_D822",&KSAlloc_KSVG_116_oLevelIntro_A1CF_6963_8DA6_D822,&KSSetV_KSVG_116_oLevelIntro_A1CF_6963_8DA6_D822,sizeof(_KSVG_116_oLevelIntro_A1CF_6963_8DA6_D822)); tmp->AddAttribute("_KSOV_oLevelIntro_A1CF_6963_8DA6_D822__M_FileName_A1CF_6963_8DA6_D822"); tmp->AddAttribute("_KSOV_oLevelIntro_A1CF_6963_8DA6_D822__M_Header_A1CF_6963_8DA6_D822"); }
93.710645
358
0.891873
HonzaMD
03aa71e8c7a29034e90e505bfa83c2e2a3adc259
2,569
cpp
C++
02-03_Pseudo-Var-Decide/Wk3-1_Var-Decide.cpp
jwatson-CO-edu/CSCI1300-105_Demo
49cbdc54b510288e52e18d70daa519a0b3f949a3
[ "MIT" ]
null
null
null
02-03_Pseudo-Var-Decide/Wk3-1_Var-Decide.cpp
jwatson-CO-edu/CSCI1300-105_Demo
49cbdc54b510288e52e18d70daa519a0b3f949a3
[ "MIT" ]
null
null
null
02-03_Pseudo-Var-Decide/Wk3-1_Var-Decide.cpp
jwatson-CO-edu/CSCI1300-105_Demo
49cbdc54b510288e52e18d70daa519a0b3f949a3
[ "MIT" ]
null
null
null
// Include libraries with useful functions #include <iostream> // Input and output #include <cmath> // -- pow #include <stdlib.h> // srand, rand #include <time.h> // - time /* You don't have to use an entire namespace, you can use specific variables and functions within the namespace. This will make compilation times *shorter*. */ using std::cout; using std::cin; using std::endl; /* block comments can span multiple lines */ // Main program function int main(){ // 1. Create/declare/initialize variables // a. Declare variables without initializing double quotient; double quotOfInts; // b. Declare and initialize in a single statement int important = 1; const int NUMLOOPS = 5; // Modify variables quotient = 2.0 / 5; // double/int quotOfInts = 2 / 5; // int/int // Produce output cout << endl; cout << "quotient: ___ " << quotient << endl; cout << "quotOfInts: _ " << quotOfInts << endl; cout << "What is 5/2?: " << 5/2 << endl << endl; // int/int // Get input cout << "What is the most important number?: "; // Do not HAVE to end with `endl` cin >> important; cout << endl; // Print an empty line // cout << "How many loops to run?: "; // cin >> NUMLOOPS; // Why does this result in an error? // Check for true/false and make decisions if( important > NUMLOOPS ){ cout << "`important` is greater than `NUMLOOPS`" << endl; }else if( important < NUMLOOPS ){ cout << "`important` is lesser than `NUMLOOPS`" << endl; }else // We don't have to put a single statement in { curly braces } cout << "`important` is equal `NUMLOOPS`" << endl; cout << endl; // Repeat a block of instructions (if needed) for( int i = 0 ; i < NUMLOOPS ; i++ ){ // `i++` same as `i=i+1` cout << "On loop " << i+1 << " of " << NUMLOOPS << ", i= " << i << ", i^2= " << pow( i , 2 ) << endl; } cout << endl; // http://www.cplusplus.com/reference/cstdlib/rand/ srand( time(NULL) ); /* initialize random seed: */ int dieRoll = rand() % 100 + 1; // Obtain int in [1,100] // While the random die roll is >= our `important` number, keep rolling while( dieRoll >= important ){ cout << "Rolled " << dieRoll << ", "; dieRoll = rand() % 100 + 1; // Roll again } cout << endl << "Rolled " << dieRoll << ", Lesser than " << important << endl; return 0; // Common to return 0 from `main` if nothing has gone wrong }
33.802632
85
0.574153
jwatson-CO-edu
03b42bb2a9da0dbde0aed8332502363b92e2161c
870
cpp
C++
0461. Hamming Distance.cpp
RickTseng/Cpp_LeetCode
6a710b8abc268eba767bc17d91d046b90a7e34a9
[ "MIT" ]
1
2021-09-13T00:58:59.000Z
2021-09-13T00:58:59.000Z
0461. Hamming Distance.cpp
RickTseng/Cpp_LeetCode
6a710b8abc268eba767bc17d91d046b90a7e34a9
[ "MIT" ]
null
null
null
0461. Hamming Distance.cpp
RickTseng/Cpp_LeetCode
6a710b8abc268eba767bc17d91d046b90a7e34a9
[ "MIT" ]
null
null
null
#include <algorithm> #include <vector> #include <string> #include <map> #include <queue> using namespace std; class Solution { public: int hammingDistance(int x, int y) { vector<unsigned long> table(32,1); for(int i = 1;i<32;i++){ table[i] = table[i-1] * 2; } unsigned long z = x^y; int idx = 31; int count = 0; while (z>0) { while (table[idx]>z) { idx--; } z-=table[idx]; count++; } return count; } }; int main(){ Solution sol; int ans = sol.hammingDistance(7,0); } /* 0 <= x, y <= 2^31 - 1 Runtime: 0 ms, faster than 100.00% of C++ online submissions for Hamming Distance. Memory Usage: 6 MB, less than 24.75% of C++ online submissions for Hamming Distance. */
21.219512
84
0.502299
RickTseng
03b52bc22b044d681d96ac4ed7ba0b1670943a4d
5,351
cpp
C++
src/bindings/swig/wrapped/WrappedInterpreterMonitor.cpp
alexzhornyak/uscxml
82b44ceeefbe1dc12fc606dc1948f9cebaf67a08
[ "BSD-2-Clause" ]
1
2020-01-09T13:51:21.000Z
2020-01-09T13:51:21.000Z
src/bindings/swig/wrapped/WrappedInterpreterMonitor.cpp
galaxy1978/uscxml
8be7b9cb67177bb0e34ca5c5cdb8508319bcda2d
[ "BSD-2-Clause" ]
1
2021-05-18T12:13:30.000Z
2021-05-18T12:14:50.000Z
src/bindings/swig/wrapped/WrappedInterpreterMonitor.cpp
galaxy1978/uscxml
8be7b9cb67177bb0e34ca5c5cdb8508319bcda2d
[ "BSD-2-Clause" ]
1
2021-04-08T08:57:40.000Z
2021-04-08T08:57:40.000Z
/** * @file * @author 2012-2014 Stefan Radomski (stefan.radomski@cs.tu-darmstadt.de) * @copyright Simplified BSD * * @cond * This program is free software: you can redistribute it and/or modify * it under the terms of the FreeBSD license as published by the FreeBSD * project. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * * You should have received a copy of the FreeBSD license along with this * program. If not, see <http://www.opensource.org/licenses/bsd-license>. * @endcond */ #include "WrappedInterpreterMonitor.h" #include "uscxml/util/Predicates.h" #include "uscxml/util/DOM.h" #include <xercesc/dom/DOM.hpp> #include <ostream> namespace uscxml { using namespace XERCESC_NS; WrappedInterpreterMonitor::WrappedInterpreterMonitor() {} WrappedInterpreterMonitor::~WrappedInterpreterMonitor() {} void WrappedInterpreterMonitor::beforeExitingState(Interpreter& interpreter, const XERCESC_NS::DOMElement* state) { std::stringstream ss; ss << *state; beforeExitingState(ATTR(state, kXMLCharId), DOMUtils::xPathForNode(state), ss.str()); } void WrappedInterpreterMonitor::afterExitingState(Interpreter& interpreter, const XERCESC_NS::DOMElement* state) { std::stringstream ss; ss << *state; afterExitingState(ATTR(state, kXMLCharId), DOMUtils::xPathForNode(state), ss.str()); } void WrappedInterpreterMonitor::beforeExecutingContent(Interpreter& interpreter, const XERCESC_NS::DOMElement* content) { std::stringstream ss; ss << *content; beforeExecutingContent(TAGNAME(content), DOMUtils::xPathForNode(content), ss.str()); } void WrappedInterpreterMonitor::afterExecutingContent(Interpreter& interpreter, const XERCESC_NS::DOMElement* content) { std::stringstream ss; ss << *content; afterExecutingContent(TAGNAME(content), DOMUtils::xPathForNode(content), ss.str()); } void WrappedInterpreterMonitor::beforeUninvoking(Interpreter& interpreter, const XERCESC_NS::DOMElement* invoker, const std::string& invokeid) { std::stringstream ss; ss << *invoker; std::string invokeId; if (invoker->getUserData(kXMLCharInvokeId) != NULL) { invokeId = (char*)invoker->getUserData(kXMLCharInvokeId); } beforeUninvoking(DOMUtils::xPathForNode(invoker), invokeId, ss.str()); } void WrappedInterpreterMonitor::afterUninvoking(Interpreter& interpreter, const XERCESC_NS::DOMElement* invoker, const std::string& invokeid) { std::stringstream ss; ss << *invoker; std::string invokeId; if (invoker->getUserData(kXMLCharInvokeId) != NULL) { invokeId = (char*)invoker->getUserData(kXMLCharInvokeId); } afterUninvoking(DOMUtils::xPathForNode(invoker), invokeId, ss.str()); } void WrappedInterpreterMonitor::beforeTakingTransition(Interpreter& interpreter, const XERCESC_NS::DOMElement* transition) { XERCESC_NS::DOMElement* sourceState = getSourceState(transition); const XERCESC_NS::DOMElement* root = DOMUtils::getNearestAncestor(transition, "scxml"); std::list<XERCESC_NS::DOMElement*> targetStates = getTargetStates(transition, root); std::stringstream ss; ss << *transition; std::list<std::string> targets; for (auto t : targetStates) { targets.push_back(ATTR_CAST(t, kXMLCharId)); } beforeTakingTransition(DOMUtils::xPathForNode(transition), ATTR_CAST(sourceState, kXMLCharId), targets, ss.str()); } void WrappedInterpreterMonitor::afterTakingTransition(Interpreter& interpreter, const XERCESC_NS::DOMElement* transition) { XERCESC_NS::DOMElement* sourceState = getSourceState(transition); const XERCESC_NS::DOMElement* root = DOMUtils::getNearestAncestor(transition, "scxml"); std::list<XERCESC_NS::DOMElement*> targetStates = getTargetStates(transition, root); std::stringstream ss; ss << *transition; std::list<std::string> targets; for (auto t : targetStates) { targets.push_back(ATTR_CAST(t, kXMLCharId)); } afterTakingTransition(DOMUtils::xPathForNode(transition), ATTR_CAST(sourceState, kXMLCharId), targets, ss.str()); } void WrappedInterpreterMonitor::beforeEnteringState(Interpreter& interpreter, const XERCESC_NS::DOMElement* state) { std::stringstream ss; ss << *state; beforeEnteringState(ATTR(state, kXMLCharId), DOMUtils::xPathForNode(state), ss.str()); } void WrappedInterpreterMonitor::afterEnteringState(Interpreter& interpreter, const XERCESC_NS::DOMElement* state) { std::stringstream ss; ss << *state; afterEnteringState(ATTR(state, kXMLCharId), DOMUtils::xPathForNode(state), ss.str()); } void WrappedInterpreterMonitor::beforeInvoking(Interpreter& interpreter, const XERCESC_NS::DOMElement* invoker, const std::string& invokeid) { std::stringstream ss; ss << *invoker; std::string invokeId; if (invoker->getUserData(kXMLCharInvokeId) != NULL) { invokeId = (char*)invoker->getUserData(kXMLCharInvokeId); } beforeInvoking(DOMUtils::xPathForNode(invoker), invokeId, ss.str()); } void WrappedInterpreterMonitor::afterInvoking(Interpreter& interpreter, const XERCESC_NS::DOMElement* invoker, const std::string& invokeid) { std::stringstream ss; ss << *invoker; std::string invokeId; if (invoker->getUserData(kXMLCharInvokeId) != NULL) { invokeId = (char*)invoker->getUserData(kXMLCharInvokeId); } afterInvoking(DOMUtils::xPathForNode(invoker), invokeId, ss.str()); } }
36.155405
144
0.766773
alexzhornyak
03b6354095f6839d15c64f51d3145156f59ad565
2,893
cpp
C++
src/mayaToLux/src/textures/gaussianTexture.cpp
haggi/OpenMaya
746e0740f480d9ef8d2173f31b3c99b9b0ea0d24
[ "MIT" ]
42
2015-01-03T15:07:25.000Z
2021-12-09T03:56:59.000Z
src/mayaToLux/src/textures/gaussianTexture.cpp
haggi/OpenMaya
746e0740f480d9ef8d2173f31b3c99b9b0ea0d24
[ "MIT" ]
66
2015-01-02T13:28:44.000Z
2022-03-16T14:00:57.000Z
src/mayaToLux/src/textures/gaussianTexture.cpp
haggi/OpenMaya
746e0740f480d9ef8d2173f31b3c99b9b0ea0d24
[ "MIT" ]
12
2015-02-07T05:02:17.000Z
2020-07-10T17:21:44.000Z
#include "gaussianTexture.h" #include <math.h> #include <maya/MPlug.h> #include <maya/MDataBlock.h> #include <maya/MDataHandle.h> #include <maya/MFnNumericAttribute.h> #include <maya/MFnEnumAttribute.h> #include <maya/MFnGenericAttribute.h> #include <maya/MFnMessageAttribute.h> #include <maya/MFnTypedAttribute.h> #include <maya/MFloatVector.h> MTypeId gaussian::id( 0x0011EF4D ); MObject gaussian::outColor; //---------------------------- automatically created attributes start ------------------------------------ MObject gaussian::wavelength; MObject gaussian::energy; MObject gaussian::width; MObject gaussian::luxOutColor; //---------------------------- automatically created attributes end ------------------------------------ #define MAKE_INPUT(attr) \ CHECK_MSTATUS ( attr.setKeyable(true) ); \ CHECK_MSTATUS ( attr.setStorable(true) ); \ CHECK_MSTATUS ( attr.setReadable(true) ); \ CHECK_MSTATUS ( attr.setWritable(true) ); #define MAKE_OUTPUT(attr) \ CHECK_MSTATUS ( attr.setKeyable(false) ); \ CHECK_MSTATUS ( attr.setStorable(false) ); \ CHECK_MSTATUS ( attr.setReadable(true) ); \ CHECK_MSTATUS ( attr.setWritable(false) ); // // DESCRIPTION: void gaussian::postConstructor( ) { setMPSafe(true); } // // DESCRIPTION: gaussian::gaussian() { } // // DESCRIPTION: gaussian::~gaussian() { } // // DESCRIPTION: void *gaussian::creator() { return new gaussian(); } // // DESCRIPTION: MStatus gaussian::initialize() { MFnNumericAttribute nAttr; MFnTypedAttribute tAttr; MFnGenericAttribute gAttr; MFnEnumAttribute eAttr; MFnMessageAttribute mAttr; MStatus status; outColor = nAttr.createColor("outColor", "outColor"); MAKE_OUTPUT(nAttr); CHECK_MSTATUS(addAttribute( outColor )); //---------------------------- automatically created attributes start ------------------------------------ wavelength = nAttr.create("wavelength", "wavelength", MFnNumericData::kFloat, 550.0); MAKE_INPUT(nAttr); CHECK_MSTATUS(addAttribute( wavelength )); energy = nAttr.create("energy", "energy", MFnNumericData::kFloat, 1.0); MAKE_INPUT(nAttr); CHECK_MSTATUS(addAttribute( energy )); width = nAttr.create("width", "width", MFnNumericData::kFloat, 50.0); MAKE_INPUT(nAttr); CHECK_MSTATUS(addAttribute( width )); luxOutColor = nAttr.createColor("luxOutColor", "luxOutColor"); MAKE_OUTPUT(nAttr); CHECK_MSTATUS(addAttribute( luxOutColor )); CHECK_MSTATUS ( attributeAffects( wavelength, luxOutColor)); CHECK_MSTATUS ( attributeAffects( wavelength, outColor)); //---------------------------- automatically created attributes end ------------------------------------ return MS::kSuccess; } // // DESCRIPTION: MStatus gaussian::compute(const MPlug &plug, MDataBlock &block) { return MS::kSuccess; }
26.3
106
0.639475
haggi