filename
string | cleaned_text
string |
|---|---|
PMC1971868.txt
|
TITLE: c-erbB- oncoprotein expression in primary and advanced breast cancer. AUTHORS: C. Lovekin, I. O. Ellis, A. Locker, J. F. Robertson, J. Bell, R. Nicholson, W. J. Gullick, C. W. Elston, R. W. Blamey ABSTRACT: Immunoreactivity for c-erbB- oncogene product expression has been investigated in patients with breast cancer using the polyclonal antibody 21N. Three series of patients were studied, presenting with primary operable cancer, with stage and with stage disease. Representative tissue sections of each primary tumour were stained using a standard immunoperoxidase technique. Invasive tumour membrane immunoreactivity was assessed and identified in % of patients with primary operable cancer and % in the advanced breast cancer group. The results demonstrate a relationship between poorer survival and oncogene expression in all three patient groups. Patients in the primary operable cancer group with membrane oncoprotein expression had a poorer outcome, % -year survival, compared with those in which membrane expression was absent, % -year survival. The median survival of patients with stage disease with c-erbB- membrane positivity was months compared to months with membrane negativity. In stage disease median survival with membrane expression was . months compared to . months with no membrane expression. In addition in the series of primary cancers a correlation existed between histological grade and membrane immunoreactivity. Multivariate analysis showed histological grade to be a more powerful prognostic factor than c-erbB- protein expression. In conclusion, this study demonstrates, in a large series of patients presenting to one centre, that c-erbB- protein expression is a prognostic indicator in patients with primary operable and advanced breast disease.ImagesFigure BODY:
|
PMC1779275.txt
|
TITLE: Nectin--mediated entry of a syncytial strain of herpes simplex virus via pH-independent fusion with the plasma membrane of Chinese hamster ovary cells AUTHORS: Mark G Delboy, Jennifer L Patterson, Aimee M Hollander, Anthony V Nicola ABSTRACT: BackgroundHerpes simplex virus (HSV) can utilize multiple pathways to enter host cells. The factors that determine which route is taken are not clear. Chinese hamster ovary (CHO) cells that express glycoprotein D (gD)-binding receptors are model cells that support a pH-dependent, endocytic entry pathway for all HSV strains tested to date. Fusion-from-without (FFWO) is the induction of target cell fusion by addition of intact virions to cell monolayers in the absence of viral protein expression. The receptor requirements for HSV-induced FFWO are not known. We used the syncytial HSV- strain ANG path as a tool to evaluate the complex interplay between receptor usage, membrane fusion, and selection of entry pathway.ResultsInhibitors of endocytosis and endosome acidification blocked ANG path entry into CHO cells expressing nectin- receptors, but not CHO-nectin- cells. Thus, under these conditions, nectin- mediates pH-independent entry at the plasma membrane. In addition, CHO-nectin- cells supported pH-dependent, endocytic entry of different strains of HSV-, including rid1 and HFEM. The kinetics of ANG path entry was rapid (t1/ of – min) regardless of entry route. However, HSV- ANG path entry by fusion with the CHO-nectin- cell plasma membrane was more efficient and resulted in larger syncytia. ANG path virions added to the surface of CHO-nectin- cells, but not receptor-negative CHO cells or CHO-nectin- cells, induced rapid FFWO.ConclusionHSV- ANG path can enter CHO cells by either endocytic or non-endocytic pathways depending on whether nectin- or nectin- is present. In addition to these cellular receptors, one or more viral determinants is important for the selection of entry pathway. HSV-induced FFWO depends on the presence of an appropriate gD-receptor in the target membrane. Nectin- and nectin- target ANG path to divergent cellular pathways, and these receptors may have different roles in triggering viral membrane fusion. BODY: BackgroundProductive entry of HSV into host cells proceeds following endocytosis [] or by direct penetration at the cell surface []. The viral and cellular factors that determine which pathway is utilized are not clear. The viral envelope glycoproteins gB, gD, and gH-gL are required for entry by both endocytic and non-endocytic routes [-]. Expression of a cellular entry receptor is required for both penetration at the plasma membrane and for penetration following endocytosis [,-]. Such receptors function individually and can mediate entry into non-permissive cells, such as Chinese hamster ovary (CHO) cells []. The viral ligand for HSV entry receptors is gD [-]. In the absence of a gD-receptor, HSV is still endocytosed by CHO cells, but fails to penetrate the endosomal membrane and is degraded [].The known gD-receptors include nectins, which belong to a subgroup of the immunoglobulin (Ig) superfamily [-]. They are broadly distributed cell-cell adhesion molecules that are components of cadherin-based adherens junctions []. Nectin- and nectin- are ~% identical, and their N-terminal Ig-like variable (V) domains are critical for gD-binding [,-] and for viral entry [,-]. All HSV strains tested to date [,,] are able to utilize nectin- as an entry receptor. Nectin- mediates entry of several laboratory strains and clinical isolates of HSV- and HSV-, including HSV- isolates from the CNS of patients with herpes simplex encephalitis [,]. Amino acid changes in gD at residues , , or confer the ability to utilize nectin- [,,,]. Additional gD-receptors include HVEM, a member of the TNF-receptor superfamily [] and heparan sulfate that has been modified by -O-sulfotransferase- []. Nectin- [] and B5 [] also mediate HSV entry, but their viral ligand(s) is not clear.Following endocytosis from the cell surface, HSV entry into a subset of cell types also requires intracellular low pH [,,,,]. CHO cells expressing gD-receptors are a widely used, well-characterized model system to study pH-dependent, endocytic entry. Inhibitors of endosomal acidification block HSV entry at a step subsequent to endocytic uptake but prior to penetration of the capsid into the cytosol []. It has been proposed that HSV utilizes distinct cellular pathways to enter its relevant target cells []. Alphaherpesviruses undergo pH-dependent, endocytic entry into certain epithelial cells [,,], including primary human epidermal keratinocytes [], yet utilize a pH-independent entry pathway into neurons [,,]. Recently, Whitbeck et al. showed that in vitro binding of HSV to liposomes could be triggered by a combination of receptor-binding and low pH [].Direct study of the membrane fusion activity of herpesvirions has proven difficult. Fusion-from-without (FFWO) is the induction of target cell fusion by addition of intact virions to the monolayer surface in the absence of viral protein expression. Virus-cell fusion during entry and virion-induced FFWO are analogous inasmuch as both involve similar effector (virion) membranes and target membranes. Several syncytial strains of HSV-, such as ANG path, are capable of triggering FFWO []. HSV-induced FFWO is cell type-dependent [], but the receptor requirements of FFWO are not known. In the present study, ANG path is used as a tool to investigate the influence of viral and cellular proteins on the route that HSV takes into cells. The ANG path-CHO cell model system allows examination of the inter-relatedness of gD-receptor usage, HSV-induced fusion, and selection of entry pathway.ResultsHSV- strain ANG path can utilize nectin- or nectin- for entry into CHO cellsFirst we determined that nectin- or nectin- can each function to mediate HSV- ANG path entry into CHO cells. All strains of HSV- and HSV- can utilize nectin- for entry. The HSV- strain ANG path and its parent ANG have alterations in gD at positions and that are predictive of nectin- utilization [,,,]. ANG utilizes both nectin- and nectin- for entry into CHO cells [,]. Monolayers of CHO cells expressing nectin- or nectin- were infected with serial dilutions of HSV- ANG path. As expected, ANG path failed to infect receptor-negative CHO cells (Fig. 1A), but formed syncytia on CHO nectin- and CHO-nectin- cells (Fig. 1B and 1C). Similar results were obtained using a beta-galactosidase reporter assay for HSV entry (data not shown). The ANG path syncytia that formed on CHO-nectin- cells were ~% larger than those that formed on CHO-nectin- cells (Fig. 1B and 1C). The larger plaque size may reflect enhanced entry activity and/or cell-to-cell spread mediated by nectin-.Figure 1Syncytium formation of HSV- strain ANG path on CHO cells expressing nectin- or nectin-. HSV- ANG path was added to wild type CHO (A), CHO-nectin- (B) or CHO-nectin- cells (C) for h. Based on the titration of ANG path on Vero cells, the MOIs were (A), (B), or (C). Visualization of syncytia was facilitated by immunoperoxidase staining with HR50 antibody to HSV. Magnification, ×.HSV- strain ANG path has enhanced plating efficiency on nectin- cells relative to nectin- cellsPlaque-forming strains of HSV such as KOS and KOS-rid1 do not form substantial plaques on receptor-expressing CHO cells. Hence, to determine the plating efficiency of ANG path we employed the syncytial HSV- strain MP [] for comparison. Unlike many other strains, HSV- MP enters receptor-negative CHO cells with low efficiency []. The expression of nectin-, but not nectin-, enhances MP entry [,] in the CHO cell background. MP is not a FFWO strain.The plating efficiency of ANG path on CHO-nectin- cells was approximately two logs greater than on CHO-nectin- cells (Table ). The plating efficiency on CHO-nectin- cells was approximately two logs less than that obtained on Vero cells. MP formed syncytia on wild type CHO cells at reduced efficiency (approximately two logs) as compared to Vero cells (Table ). The presence of nectin- did not enhance MP infection above the CHO cell background, but instead reduced the plating efficiency for reasons that are not clear. MP had a log enhanced plating efficiency on CHO-nectin- cells relative to CHO-nectin- cells (Table ), which is consistent with previous reports. Importantly, as CHO-nectin- cells support MP entry and syncytium formation, the reduced efficiency of ANG path entry is not due to receptor expression levels or some other defect of the CHO-nectin- cells. Also in support of this notion, CHO-nectin- cells are equivalent to CHO-nectin- cells in their ability to support entry of HSV- rid1 []. Together, the results indicate that ANG path can use either nectin- or nectin- for entry into the CHO cell lines, but it utilizes nectin- more efficiently.Table 1Plating efficiency of HSV- syncytial strainsCell typeVeroCHOCHO-nectin-1CHO-nectin-2VirusTiter (PFU/ml)ANG path8. × . × . × 106MP7. × . × . × . × 102Viruses were titered by limiting dilution. Similar results were obtained in at least three independent experiments.HSV- ANG path entry mediated by nectin- or nectin- receptors occurs via distinct cellular pathwaysThe entry of wild type strains of HSV- and HSV- into CHO cells expressing gD-receptors is blocked by agents that affect endosome acidification [], and is consequently considered pH-dependent. Entry of ANG path into CHO-nectin- cells was inhibited significantly by the weak base ammonium chloride (Fig. 2A). Surprisingly, entry of ANG path into the nectin--expressing cells was refractory to inhibition by the low-pH-altering agents. Similar results were obtained with MOIs ranging from . to (data not shown). Thus, ANG path stands out as the only HSV strain known to enter a CHO cell line (CHO-nectin- cells) by a pH-independent pathway. This suggests that nectin- and nectin- direct HSV- ANG path to distinct entry pathways in the CHO cell.Figure 2Dependence of ANG path entry on intracellular low pH and endocytosis. (A) Effect of alteration of intracellular pH on ANG path entry. CHO cells expressing either nectin- or nectin- were treated with the indicated concentrations of ammonium chloride (NH4Cl) for min. HSV- strain ANG path was added (MOI of ) for h in the continued presence of NH4Cl. Cells contain the lacZ gene under the control of an HSV-inducible promoter. Entry was measured as the % of beta-galactosidase activity relative to that obtained in the absence of agent. Data shown are means of quadruplicate determinations with standard deviation. (B) Effect of inhibition of endocytic uptake on ANG path infection. ANG path was added to CHO-nectin- or CHO-nectin- cells ( PFU/well) in control medium (A) or hypertonic medium containing . M sucrose. At min post-infection, medium was removed, extracellular virus was acid-inactivated, and plates were incubated for h. Syncytia were detected by immunoperoxidase staining and quantified. Shown are representative data from at least three independent experiments.ANG path enters CHO-nectin- cells by pH-independent fusion with the plasma membraneThe pH-independence of entry does not necessarily indicate entry at the plasma membrane. For example, entry of Epstein Barr virus into B cells is pH-independent, yet it proceeds via an endocytic pathway [,]. In addition, Milne et al. demonstrated that HSV enters murine melanoma cells by a pH-independent, endocytic pathway []. To assess directly the role of endocytosis, we used cell treatments that selectively block HSV entry by endocytosis. First, we analyzed the effect of high sucrose (hypertonic) medium, which inhibits endocytic uptake of HSV from the plasma membrane, but has no effect on HSV penetration at the plasma membrane []. Treatment of CHO-nectin- cells with hypertonic medium during virus entry inhibited syncytium formation of HSV- ANG path (Fig. 2B). In contrast, hypertonic treatment of CHO-nectin- cells had no inhibitory effect (Fig. 2B), suggesting that ANG path penetrates the CHO-nectin- plasma membrane in a pH-independent, non-endocytic manner. Thus, deposit of the HSV capsid under the plasma membrane of CHO cells can lead to productive entry.CHO-nectin- cells can support either endocytic or non-endocytic entry of HSV depending on the virus strainThe phosphatidyl inositol -kinase inhibitor wortmannin selectively inhibits pH-dependent, endocytic entry of HSV [,,,], possibly at a step involving endosomal trafficking []. To study the effect of wortmannin on ANG path entry, we included the HSV- strain KOS-rid1 [] as a control because it also utilizes both nectin- and nectin- for entry [,]. Wortmannin inhibited rid1 entry into CHO-nectin- cells, but had little inhibitory effect on ANG path entry into these cells (Fig. 3A). Entry of both ANG path and rid1 viruses into CHO-nectin- cells was inhibited by wortmannin in a concentration-dependent manner (Fig. 3B). We also tested treatment of CHO-nectin- cells with monensin, a carboxylic ionophore that inhibits endosome acidification. Monensin inhibited rid1 entry into CHO-nectin- cells as previously reported [], but ANGpath entry was refractory to this treatment (Fig. 3C). These results confirm that nectin- supports a pH-dependent, endocytic pathway for ANG path, and that nectin- supports pH-independent fusion of ANG path with the plasma membrane of CHO cells. As a single cell line, CHO-nectin-, supports distinct entry pathways for two different HSV- strains, this indicates that HSV contains one or more determinants for the selection of entry pathway. Further, receptor-expressing CHO cells can support HSV entry by multiple pathways.Figure 3CHO cell entry pathways of HSV- rid1 and ANG path mediated by nectin-. CHO-nectin- (A, C) or CHO-nectin- cells (B) were treated with the indicated concentrations of wortmannin (A, B) or monensin (C) for min. HSV- strains rid1 or ANG path were added (MOI of ) for h in the continued presence of agent. Entry (beta-galactosidase activity) was measured as in the legend to Figure .Rapid entry kinetics of HSV- ANG path by either endocytic or non-endocytic pathwaysThe kinetics of entry of a single virus strain by two distinct pathways in the CHO cell background was measured. The entry of ANG path mediated by either nectin- or nectin- was rapid, with a t1/ of – min (Fig. ). By min p.i., greater than % of infectious virus had disappeared from the surface of cells regardless of which receptor was present or which pathway was used (Fig. ).Figure 4Kinetics of ANG path entry via distinct entry routes. HSV- ANG path was bound to CHO-nectin- or CHO-nectin- cells in well dishes for h at °C ( PFU/well). Cells were washed with PBS and then shifted to °C. At the indicated times post-infection, extracellular virus was inactivated by treatment with sodium citrate buffer (pH .). Cells were washed with PBS and incubated for h at °C. Cells were fixed in methanol:acetone, and syncytia were quantified by immunoperoxidase staining. Data shown are the mean of quadruplicate samples +/- standard deviation.ANG path virion-induced fusion of CHO cells is mediated by nectin-2ANG path is among the subset of syncytial HSV- strains that cause fusion-from-without. Addition of ANG path to Vero cells at high multiplicity causes rapid cell fusion (FFWO) in the absence of viral protein synthesis [,,]. Receptor-negative CHO cells are an ideal model system to test the role of gD-receptors. Since ANG path utilizes nectin-, but not nectin-, for fusion with plasma membrane during entry, we asked whether nectin- would selectively trigger FFWO when ANG path virions were added to the surface of CHO cells. Fusion-from-without was not detected when ANG path virions were added to receptor-negative CHO cells (Fig. 5A). Similarly, FFWO was not detected when ANG path virions were added to CHO-nectin- cells (Fig. 5B), even after overnight incubation with an MOI of (data not shown). However, by h p.i. in the presence of cycloheximide, ANG path virions induced dramatic FFWO of CHO-nectin- cells (Fig. 5C). Fusion of cells was evident as early as – min p.i. (data not shown). As there was no viral protein synthesis, it is likely that the viral particles themselves triggered the fusion of cells.Figure 5Receptor-dependence of fusion-from-without induced by HSV-. ANG path virions (MOI of ) were added to receptor-negative CHO cells (A) or CHO cells expressing either nectin- (B) or nectin- (C) in the presence of mM cycloheximide. Cells were incubated at °C for h, and were then fixed with methanol and stained with Giemsa. Magnification, ×. Approximately % of CHO-nectin- cells were fused under these conditions. Results with receptor-negative CHO cells (< % fusion) were indistinguishable from CHO-nectin- cells. (D) Antibodies to nectin- block ANG path-mediated fusion-from-without. Anti-nectin- polyclonal antibody R154 or anti-nectin- polyclonal antibody R143 was added to CHO-nectin- cells in well dishes at °C for min. HSV- ANG path was added to the monolayers for °C for h in the presence of a : dilution of antibody. Cells were fixed, photographed, and quantified for ANG path-induced FFWO. Experiments were repeated at least three times with similar results.To demonstrate that nectin- was specifically responsible for triggering FFWO, CHO-nectin- cells were pretreated with antibody to nectin- and assessed for fusion. The anti-nectin- polyclonal antibody R143 inhibited ANG path virion-induced FFWO of CHO-nectin- cells (Fig. 5D). The control anti-nectin- antibody R154 had no inhibitory effect on this fusion process (Fig. 5D). Thus, HSV-induced FFWO depends on an appropriate gD-receptor in the target membrane. The results suggest that the ability of nectin- to mediate rapid, pH-independent entry at the plasma membrane (Fig. and Fig. ) correlates with its ability to trigger rapid, pH-independent FFWO (Fig. ).The HSV- FFWO strain HFEM does not cause detectable nectin- mediated pH-independent fusionWe examined HSV- HFEMsyn to determine whether the entry and fusion phenotypes of ANG path were shared by another strain. Like ANG path, HFEMsyn has a syncytial phenotype and causes FFWO []. Receptor-negative CHO cells were refractory to infection by HSV- HFEMsyn (Fig. 6A). Both CHO-nectin- cells and CHO-nectin- cells supported syncytium formation by HFEMsyn (Fig. 6B and 6C). HFEMsyn utilized nectin- three logs less efficiently than nectin-. HFEM entry into either CHO-nectin- or CHO-nectin- cells was inhibited by both ammonium chloride and monensin (Fig. 6D and 6E), indicating pH-dependent entry in both cell types. ANG path may have a unique determinant that enables entry by fusion with the plasma membrane of CHO-nectin- cells.Figure 6Entry and FFWO activities of HSV- strain HFEMsyn. As in the legend to Figure , syncytium formation of HFEMsyn was determined on wild type CHO (A), CHO-nectin- (B) or CHO-nectin- cells (C). Images represent MOIs of (A, C) or (B). Effect of lysosomotropic agents on HFEMsyn entry. Virus entry into CHO-nectin- or CHO-nectin- cells in the presence of ammonium chloride (D) or monensin (E) was assayed as in the legend to Figure . Cells were infected with HFEMsyn at equivalent multiplicities based on the plating efficiency of HFEMsyn on the respective cell types. Based on Vero cell titer, this corresponds to MOIs of and for CHO nectin- and CHO-nectin- cells, respectively. Receptor-triggered FFWO of HFEMsyn. As in the legend to Figure , HFEMsyn was added to CHO-nectin- (F) or CHO-nectin- cells (G).Unlike ANG path, HFEMsyn triggered detectable FFWO on the CHO-nectin- cells, but not the CHO-nectin- cells (Fig. 6F and 6G). Nectin- can thus trigger HSV-induced FFWO. The results suggest that FFWO does not correlate with plasma membrane fusion during entry. Instead, the ability of a FFWO strain to efficiently utilize a given receptor may correlate with its ability to cause FFWO triggered by that receptor.DiscussionA given animal virus can enter cells by multiple pathways []. HSV can enter its host cells by endocytosis or by direct penetration at the plasma membrane. How a particular pathway is selected is of fundamental importance. CHO cells that express gD-receptors support pH-dependent, endocytic entry of HSV. We identified a laboratory strain of HSV-, ANG path, that can enter CHO cells by pH-independent fusion with the plasma membrane in a receptor-specific manner. Our results indicate that gD-receptors are required for FFWO. Viral determinants, cellular gD-receptors, and the background of the target cell all contribute to the entry route taken by HSV.Host cell determinants of HSV entry pathwayPrevious studies have indicated a role for the target cell in determination of HSV entry pathway [,,,]. Murine melanoma cells are non-permissive for HSV entry. Expression of a gD-receptor results in endocytic uptake of HSV from the cell surface and subsequent pH-independent penetration from an endosome []. In contrast, initial endocytic uptake from the surface of CHO cells occurs independently of the known gD-receptors []. CHO cells may contain unidentified cellular receptors needed for internalization of HSV from the surface. BHK-derived, J cells that express nectin- support pH-independent entry of HSV []. Fusion of nectin- with either carboxy-terminal sequences of epidermal growth factor or with a glycosylphoshatidylinositiol anchor resulted in chimeric receptors that support pH-dependent entry into J cells []. Thus, alternate forms of nectin- can mediate different entry routes.The current study indicates that nectin- and nectin- differ functionally in their ability to target incoming ANG path virions in CHO cells. These receptors interact with distinct yet overlapping regions of gD [,,,,]. In our experimental system, nectin- and nectin- may mediate pH-dependent and pH-independent membrane fusion, respectively. We are currently investigating the receptors and entry pathways that ANG path utilizes in other target cells.Viral determinants of HSV entry pathwayHSV contains one or more determinants for the selection of entry pathway (Fig. ). Candidate determinants include gB, gD, and gH-gL which are essential for entry [-]. Compared to the wild type HSV- KOS strain, the gB [] and gD [] of ANG path have and amino acid differences, respectively. Alterations in gD at positions and [] as well as ectodomain and cytoplasmic tail mutations in gB [,] have been proposed to be important for FFWO activity. The role of these residues in the selection of entry route is currently being evaluated.The composition of the ANG path virion allows direct triggering of fusion by nectin-, at least in the context of the CHO cells tested. One possibility is that ANGpath interaction with nectin- is sufficient to functionally substitute for the combination of nectin- interaction and exposure to intracellular low pH. Analysis of the difference between these receptor interactions may lead to a better understanding of how membrane fusion is triggered during HSV entry. Interestingly, ANG path entry into Vero cells is also unique in that it is highly resistant to inhibition by soluble, ectodomain forms of gD [].Fusion-from-without as a model for membrane fusion during HSV entryA current model of HSV entry posits that gD binding to receptor triggers a cascade of events culminating in fusion [-]. The viral and cellular requirements for HSV entry have been largely recapitulated in a cell-to-cell fusion assay [,-]. In this surrogate assay, transfected cells that express gB, gD, gH and gL on the cell surface are mixed with untransfected target cells. Comparisons of cell-cell fusion with virus-cell fusion must be drawn cautiously. Herpesviral envelopes are derived from internal cellular membranes, not the plasma membrane. It is possible that glycoproteins displayed on the plasma membrane of transfected cells have distinct roles in fusion (i.e., are activated differently) than glycoproteins that are actually incorporated into virions.FFWO is an underutilized model to analyze the membrane fusion activity of HSV particles. Although a high MOI is required to detect FFWO, virus-cell fusion during entry and FFWO have significant similarities. The effector membrane and target cell membrane are analogous for both fusion processes. Furthermore, FFWO, like HSV entry, is gD-receptor dependent.ConclusionTwo members of the nectin family of HSV receptors, nectin- and nectin- can target the same laboratory strain of HSV to endocytic and non-endocytic pathways, respectively. The combination of ANGpath and nectin- at the surface of a CHO cell line triggers rapid, pH-independent membrane fusion that can lead to viral entry or FFWO. An appropriate gD-receptor is required for HSV-induced FFWO. This is similar to the receptor requirement for the membrane fusion processes that accompany viral entry or cell-to-cell fusion. Together, the results indicate that viral factors, in addition to cellular factors such as nectins, contribute to the selection of HSV entry route. This report demonstrates that the ANG path-CHO cell system can serve as a model to study the molecular connections between receptor usage, membrane fusion, and choice of entry pathway.MethodsCells and virusesVero cells (American Type Culture Collection; ATCC; Rockville, Md.) were propagated in Dulbecco's Modified Eagle's Medium (Invitrogen, Grand Island, NY) supplemented with % fetal bovine serum (FBS; Gemini Bio-Products, West Sacramento, Calif.). CHO-K1 cells stably transformed with the Escherichia coli lacZ gene under the control of the HSV ICP4 promoter are designated CHO IEβ8 []. CHO IEβ8 cells stably transformed to express nectin- (M3A cells) or nectin- (M2A cells) [,,] (provided by G. Cohen and R. Eisenberg, University of Pennsylvania) were propagated in complete medium, Ham's F12 nutrient mixture (Invitrogen) supplemented with % FBS, μg/ml puromycin (Sigma, St. Louis, Mo.), and μg/ml G418 sulfate (Fisher Scientific, Fair Lawn, NJ). % of cells expressed nectin- or nectin- on the cell surface as determined by immunofluorescence. Cells were subcultured in non-selective medium prior to use in all experiments.HSV- strains ANG path [] and KOS were obtained from T. Holland, Wayne State University. HSV- MP [] was obtained from ATCC. HSV- HFEM [] and KOS-rid1 were obtained from P. Spear, Northwestern University. Rid1 is a KOS derivative with a Q27P mutation in gD []. Virus stocks were grown and titered on Vero cells.Plaque assayAt – h p.i. culture medium was removed, and cells were fixed with ice-cold methanol-acetone solution (: ratio) for min at -°C and air-dried. Virus titers or syncytium formation were determined by immunoperoxidase staining with anti-HSV polyclonal antibody HR50 (Fitzgerald Industries, Concord, Mass.).Beta-galactosidase reporter assay for HSV entryConfluent cell monolayers grown in well dishes were infected with HSV- and incubated at °C for h. .% Nonidet P- (Sigma) cell lysates were prepared, chlorophenol red-b-D-galactopyranoside (Roche Diagnostic, Indianapolis, In.) was added, and beta-galactosidase activity was read at nm with a microtiter plate reader (BioTek Instruments, Winooski, Vt.). Mean results and standard deviations were calculated for four replicate samples.Inhibition of uptake from cell surfaceHSV was prebound to cells in well dishes ( PFU/well) in culture medium containing mM HEPES and .% BSA at °C for h. Cells were treated with medium containing . M sucrose (hypertonic), or control complete medium for min at °C. Cells were washed with phosphate buffered saline (PBS), and the remaining surface-bound virions were inactivated by sodium citrate buffer (pH .) for min at °C. Cells were incubated in normal medium for h, and then syncytia were quantified.Treatments with lysosomotropic agentsPerformed as reported previously []. Briefly, cells were treated with medium containing ammonium chloride or monensin for min at °C. Virus was added, and cells were incubated in the constant presence of agent for h. Beta-galactosidase activity indicated successful entry.Virion-induced fusion-from-without assayConfluent cell monolayers grown in or well dishes were pretreated with growth medium containing . mM cycloheximide (Sigma) for min. Cell-free supernatant preparations of HSV- ANG path were added to cells at multiplicities from to for up to h at °C in the constant presence of cycloheximide. Cells were rinsed with PBS, and then fixed in % methanol. Monolayers were air dried, and then nuclei were stained with Giemsa.To measure inhibition of fusion by anti-receptor antibodies, cells were chilled to °C for min. Rabbit polyclonal serum against nectin- (R154) or nectin- (R143) (obtained from R. Eisenberg and G. Cohen, University of Pennsylvania) were added for min at °C at a : dilution in culture medium adjusted to mM HEPES. HSV- ANG path was added, and plates were incubated for h at °C in the presence of antibody.Micrographs were taken with a Zeiss Axiovert 40C microscope equipped with a Canon PowerShot G6 digital camera. Digital images were processed with Adobe Photoshop CS2 version .. To quantitate fusion, photomicrographs of random fields from triplicate wells (> cells/well) were scored. The number of nuclei present in clusters of or more divided by the total number of nuclei yielded the % fusion.Competing interestsThe author(s) declare that they have no competing interests.Authors' contributionsMD carried out HSV- rid1, HFEM, and wortmannin analyses. JP carried out fusion-from-without studies. AH performed energy depletion experiments. AN conceived of the study, carried out plating efficiency, kinetics, and lysosomotropic agent experiments, and supervised the work.
|
PMC1762327.txt
|
TITLE: Physiological Mouse Brain Aβ Levels Are Not Related to the Phosphorylation State of Threonine- of Alzheimer's APP AUTHORS: Yoshitake Sano, Tadashi Nakaya, Steve Pedrini, Shizu Takeda, Kanae Iijima-Ando, Koichi Iijima, Paul M. Mathews, Shigeyoshi Itohara, Sam Gandy, Toshiharu Suzuki ABSTRACT: BackgroundAmyloid-β peptide species ending at positions and (Aβ40, Αβ42) are generated by the proteolytic processing of the Alzheimer's amyloid precursor protein (APP). Aβ peptides accumulate in the brain early in the course of Alzheimer's disease (AD), especially Aβ42. The cytoplasmic domain of APP regulates intracellular trafficking and metabolism of APP and its carboxyl-terminal fragments (CTFα, CTFβ). The role of protein phosphorylation in general, and that of the phosphorylation state of APP at threonine- (Thr668) in particular, has been investigated in detail by several laboratories (including our own). Some investigators have recently proposed that the phosphorylation state of Thr668 plays a pivotal role in governing brain Aβ levels, prompting the current study.MethodologyIn order to evaluate whether the phosphorylation state of Thr668 controlled brain Aβ levels, we studied the levels and subcellular distributions of holoAPP, sAPPα, sAPPβ, CTFα, CTFβ, Aβ40 and Aβ42 in brains from “knock-in” mice in which a non-phosphorylatable alanyl residue had been substituted at position , replacing the threonyl residue present in the wild-type protein.ConclusionsThe levels and subcellular distributions of holoAPP, sAPPα, sAPPβ, CTFα, CTFβ, Aβ40 and Aβ42 in the brains of Thr668Ala mutant mice were identical to those observed in wild-type mice. These results indicate that, despite speculation to the contrary, the phosphorylation state of APP at Thr668 does not play an obvious role in governing the physiological levels of brain Aβ40 or Αβ42 in vivo. BODY: IntroductionAlzheimer's disease (AD) is characterized by abnormalities in post-translational processing of two proteins, the amyloid precursor protein (APP) and the microtubule associated protein tau []. A “unifying hypothesis for Alzheimer's disease” has been suggested, according to which the aberration of a single post-translational modification, such as protein phosphorylation, might underlie both pathologies []–[]. Both proteins are phosphoproteins []–[], and cyclin-dependent protein kinase (cdk5) and glycogen synthase kinase 3β (GSK-3β) are examples of protein kinases that can potentially phosphorylate both APP and tau []–[].A recent review summarizes the extensive literature linking protein phosphorylation and APP metabolism []. First messengers, such as neurotransmitters and hormones, impinge upon neurons and direct APP toward the cell surface and away from the trans Golgi network (TGN) and endocytic pathway, and hence away from the Aβ-generating β-/γ-secretase pathway [ibid]. At the cell surface, APP can be processed by a nonamyloidogenic pathway, known as the α-secretase pathway, via a process known as “regulated APP ectodomain shedding” [ibid]. With regard to Aβ generation, the regulated shedding phenomenon is noteworthy because hyperactivation of the α-secretase pathway can lead to relatively greater cleavage of APP by α-secretase(s), thereby reducing or completely abolishing Aβ generation [ibid]. Despite the well-documented observation that the same protein kinase (i.e., protein kinase C) controls both regulated shedding by α-secretase and the phosphorylation state of the APP cytoplasmic tail at serine- (Ser655), the phosphorylation state of APP at Ser655 is not involved in controlling regulated shedding of the APP ectodomain. Primary citations for this summary are included in [].The exclusion of an important role for the APP phosphorylation state in controlling regulated APP ectodomain shedding process raised an obvious question: “What role is played by physiological regulation of the direct phosphorylation of APP?”. First of all, in brain, APP phosphorylation predominantly involves Thr668, not Ser655 []–[]. Phosphorylation at Thr668 is detectable in mature APP (mAPP) but not immature APP (imAPP) [], suggesting that the phosphorylation state of Thr668 may regulate some aspect of APP maturation in the early secretory pathway. In addition to cdk5 and GSK-3β mentioned above, phosphorylation at Thr668 can be regulated by c-jun N-terminal kinases (JNK) [], []. With regard to the physiological role of APP phosphorylation, the phosphorylation state of Thr668 has been reported to modulate outgrowth of neurites in PC12 cells [], [], the tethering to APP of the adaptor proteins FE65 [], [] and X11-L [], and the interaction of APP intracellular domain fragment (AICD) with FE65 [], []. Based on these data, we have proposed a model wherein the phosphorylation state of APP at Thr668 may govern the state of activation of an intracellular signaling cascade across APP that leads to generation and translocation of AICD, analogous to the well-characterized signaling cascade across Notch that leads to generation and translocation of the Notch intracellular domain [].Recently, the phosphorylation state of APP Thr668 has been proposed to control interaction of the APP cytoplasmic tail with the prolyl isomerase Pin1 [], [], []. Interaction of Pin1 with APP Thr668 has been predicted to have important effects on generation of the Aβ peptide that not only accumulates in amyloid plaques but also forms oligomers that have recently been proposed to be the proximate mediators of neurotoxicity []. One report indicated that Aβ levels were decreased in the brains of Pin1-deficient mice [], while another report described the opposite effect, i.e., that Pin1 deficiency increased Aβ generation []. In work unrelated to Pin1, Tsai et al proposed a model wherein the phosphorylation state of APP Thr668 would be pivotal in modulating the subcellular distribution of APP and generation of Aβ [] and/or the amyloidogenic γ-secretase cleavage of APP CTFs []. The potential importance of APP Thr668 phosphorylation was further emphasized in a recent review []. Because all these reports and reviews hinged on attribution of some biological significance to the phosphorylation state of APP Thr668, we investigated in vivo brain APP metabolism and Aβ levels in mutant mice generated by knocking into their genome an APP gene containing a non-phosphorylatable alanyl substitution at position . Here we report characterization of these mice, including the quantification and subcellular distribution of all standard APP metabolites.ResultsGeneration of threonine- phosphorylation-site mutant miceWe constructed targeting vectors in which an alanine (A) was substituted for threonine (T) at position in exon (Fig. 1A). Targeted C57BL/-derived MS12 embryonic stem (ES) cells were injected into Balb/c blastocysts. Chimeras were bred to C57BL/ mice to generate heterozygotes. Fertilized eggs from the heterozygotes were then injected with a Cre-expression plasmid vector to delete the Pgk-neo gene cassette from the germ line via the Cre-loxP system [], and resulting progeny carrying a substituted allele without the Pgk-neo gene cassette were backcrossed to C57BL/ mice for at least generations, and then intercrossing was performed to produce Thr668Ala homozygous mice. Thus, the mutant lines used in this study were coisogenic to the C57BL/ strain. Seven generations of crossing is considered acceptable for mice generated by a coisogenic strategy []. The success of the mutagenesis was confirmed by sequencing (Fig. 1B), Southern blot, and polymerase chain reaction (PCR) analysis (Fig. 1C). We also confirmed the mutation by immunoblot analysis using anti-phospho-APP Thr668 specific antibody (Fig. 1D). There was no anti-phospho-APP Thr668 antibody staining in homozygotes (A/A), while heterozygotes (T/A) had approximately half the level of the staining that was observed in wild-type (T/T). Anti-pan APP-specific antibody staining revealed unaltered expression levels of APP in all genotypes (Fig. 1D)../journal.pone..g001Figure 1Generation of Thr668Ala Knock-in Mutant Mice.(A) The targeting vector (a1), a partial map of the APP gene (a2), the resultant targeted allele (a3), and the knock-in allele after Cre recombination (a4) are illustrated.Filled boxes denote coding sequences of exons and .Shaded parts in exon18 correspond to the ′ non-coding region.A substitution is represented by a dot in exon .B, BamHI; X, XhoI.Probes for Southern blot analysis for screening of targeted ES clones are indicated with small bars in (a2–).PCR primers (E1 and E2) for genotyping of mice are indicated with small arrows in (a2 and a4).(B) Verified sequences from wild-type (T/T), and Thr668Ala mutation homozygotes (A/A).The Thr668 flanking genomic region was amplified using mouse tail DNA as the template by PCR and sequenced.(C) Southern blot analysis for targeted ES cells and PCR analysis for genotyping wild-type and knock-in mouse lines.DNA from G418-selected ES cells was digested with XhoI and analyzed by Southern blotting with a ′ external probe.The -kb and -kb fragments represent wild-type and targeted alleles, respectively. PCR fragments of -bp and -bp represent wild-type and knock-in alleles, respectively.(D) Immunoblot analysis of mouse whole brain.APP was immunoprecipitated with anti-pan APP polyclonal antibody followed by immunoblotting with anti-pan APP antibody UT- or anti-phospho-Thr668-specific antibody UT- [].APP from homozygotes has no immunoreactivity with UT- although the APP expression levels detected by UT- were indistinguishable from those of wild-type mice.Mature APP (mAPP; N- and O-glycosylated form), immature APP (imAPP; N-glycosylated form), and phosphorylated APP (pAPP) are indicated with arrows.Thr668Ala mutation did not affect brain development or structureThe A/A mice had no gross cytoarchitectural abnormalities as revealed in Nissl-stained sections of the hippocampal region from A/A mice (Fig. 2A). Other brain regions were also histologically normal (data not shown). Furthermore, immunohistochemical and/or immunoblotting analyses for synaptophysin (presynaptic marker), microtubule-associated protein (MAP2; dendritic marker), glial fibrillary acidic protein (GFAP; astroglial marker), X11L (APP binding protein), and PSD95 (postsynaptic marker) revealed no abnormalities in A/A mice, even at ages of mo or older (Fig. 2B and C). These results contrast to those from APP-null mutant mice that showed marked decreases of synaptophysin, synapsin, and MAP- [], a reduction in dendrite length [], and gliosis []. The normal phenotype of APP Thr668Ala mice suggests that this mutation does not cause a major loss-of-function of APP../journal.pone..g002Figure 2Normal brain structure and expression and distribution of proteins related to neuron and glia in Thr668Ala mutant mice. (A) Nissl-stained hippocampal sections show no difference between wild-type (T/T) and Thr668Ala mutation homozygotes (A/A).Scale bars represent µm.(B) Immunohistochemical analysis in CA1 hippocampal region of aged (> mo-old) mice.Immunostaining for GFAP (astroglial marker), synaptophysin (presynaptic marker), and MAP- (neuronal dendritic marker) in hippocampal CA1 region of wild-type (T/T) and Thr668Ala mutant (A/A) mice are shown.S.o., stratum oriens; Py, pyramidal cell; Rad, stratum radiatum. Scale bars represent µm.(C) Western blot analysis of APP, X11L, MAP2, synaptophysin, PSD95 (postsynaptic marker), and GFAP from the brains of mo-old wild-type (T/T) and Thr668Ala mutant (A/A) mice.Analysis of APP and its metabolites in APP Thr668Ala knock-in miceThe brains of APP Thr668Ala knock-in mice were analyzed for expression of APP and for steady-state levels of its metabolites (Figs. and ; Table ). APP Thr668 phospho-state specific antibodies were used to establish that the knocked-in protein was not phosphorylated at Thr668 (Fig. and Fig. 4A). Amino-terminal fragments of APP cleaved by α- (sAPPα) and β- (sAPPβ) secretases were quantified and compared with those of wild-type mouse brain (Fig. ). No differences of total amount of sAPP, sAPPα, and sAPPβ were detected between Thr668Ala knock-in and wild-type mice../journal.pone..g003Figure 3APP and sAPP in wild-type and Thr668Ala mutant mouse brain.(Left) APP and sAPP in wild-type (W) and mutant (M) mouse brain. Homogenates of brains taken from -month-old mice were fractionated as described and analyzed by immunoblotting for sAPP and APP holoprotein (22C11), APP (APP/C), phosphorylated APP (pThr668APP), sAPPα, sAPPβ and MAP2B.Protein bands observed in the insoluble fraction (ppt panel) of sAPPβ are non-specific.(Right) sAPP and APP levels are displayed.The densities of the bands from soluble APP (sAPP) were standardized to the densities of MAP2B, and those from APP were standardized to the densities of actin.All were normalized to unity for wild-type mice (.). The bars indicate means±S.D. (N.S.; n = )../journal.pone..g004Figure 4Aging-dependent phosphorylation of APP and APP CTFs and quantification of CTFs in wild-type and Thr668Ala mutant mice brain.(A) APP phosphorylation state in brains of post-natal day (P0), young adult (-month), and aged adult (-month) mice.The upper panel was probed with anti-pan-APP C-terminal antibody G369, and the lower panel was probed with an anti-phospho-threonine--specific antibody.W, wild-type mouse; M, Thr668Ala mutant mouse.(B) APP carboxyl-terminal fragments (APP CTFs) in wild-type (W) and mutant (M) mouse brain.C99 and C89 are products resulting from cleavage of APP by BACE, while C83 results from cleavage of APP by ADAM-/-.PhosphoC99 (pC99), phosphoC89 (pC89), and phosphoC83 (pC83) are all mono-phosphorylated at Thr668, and these peptides are numbered here according to standard APP695 nomenclature.(C) Expression levels of CTFα and CTFβ in middle aged wild-type and Thr668A mutant mouse brain.Various species of CTF are schematically represented at the left and indicated at right with bars.Samples were electrophoresed after treatment with either buffer or λ phosphatase (λ PPase).The amounts were normalized to unity for wild-type mice (.).The bars indicate means±S.D. (N.S.; n = )../journal.pone..t001Table 1Table . Aβ40 and Aβ42 levels in brains from -month-old wild-type and Thr668Ala mutant mice.Aβ40 (pM)p valueAβ42 (pM)p value pM Wildtype ±.±. Mutant ±.76p>.±.84p>.72Results of ELISA for murine Aβ [] are expressed as means±S.E.M. (N.S.; student's t) and are representative of results obtained from three independent assays, using five individual mice of each genotype in each assay.Next, we examined protein levels of APP C-terminal fragments (CTFs) by immunoblot analysis using anti-APP cytoplasmic tail antibodies (Fig. ). The phosphorylation levels of APP and CTFs are relatively lower at the birth (P0), they increase during growth (-mo), and they slightly decrease during aging (-mo). Cleavage by α-secretase generates CTFα, which is composed of the carboxyl-terminal amino acids of APP and is also known as C83. β-secretase can cleave APP at either the peptide bond N-terminal to D1 (preferred) or at the bond N-terminal to E11; hence, CTFβ and CTFβ′ fragments, C99 and C89 [], respectively, are generated, with the preponderant species being CTFβ′/C89 []. Because these CTFs are phosphorylated at Thr668 (Fig. 4B) and generate complicated patterns [], [], we treated samples with lambda protein phosphatase (λPPase) in order to identify and quantify phospho- and dephospho-CTF species precisely (Fig. 4C). Treatment of immunoprecipitates containing these CTFs with λPPase resulted in the appearance of three discrete bands corresponding to dephospho-forms of C99, C89, and C83, all of which were present at identical levels in both wild-type and Thr668Ala knock-in mice.Endogenous murine Aβ40 and Aβ42 levels were also detected in brain. Rodent Aβ is much less prone to aggregation than is human Aβ [], and therefore little, if any, insoluble Aβ is typically detected in the wild-type mouse brain. Nevertheless, we extracted mouse brain Aβ with M guanidine chloride/TBS (the standard protocol for dissolving insoluble Aβ), and we quantified the solubilized Aβ. The levels of Aβ40 and Aβ42 in the brains of wild-type and Thr668Ala knock-in mice were indistinguishable (Table ).We fractionated mouse brains using an iodixanol gradient fractionation system identical to that described in the published cell culture study [] (Fig. ). Using homogenates of wild-type mouse brains, we observed that total mAPP as well as the corresponding phosphorylated form were largely recovered in fractions –, where GM130 (Golgi marker protein, concentrated in fractions –) and EEA1 (early endosomal protein, concentrated in fractions –) were co-distributed (upper panel). Total Thr668Ala mAPP in knock-in mutant mouse brains was identical in levels and distribution except that, as expected, there was no detectable phospho-mAPP (Fig. ). These data do not support the prediction [] that the phosphorylation state of APP at Thr668 modulates its subcellular distribution in brain in vivo../journal.pone..g005Figure 5Hemi-brains from wild-type (upper panel of six blots, labeled “Wild-type”, far left) or mutant (lower panel of six blots; labeled “Mutant T668A”, far left) -month old mice were used for fractionation on iodixanol density-gradients as described ().Equal aliquots (according to volume) were analyzed by immunoblotting with antibodies as specified: anti-early endosome antigen (Transduction laboratories, EEA1, top panel), anti-cis-Golgi matrix protein (Transduction laboratories, GM130, second panel), anti-protein disulfide isomerase (Stressgen, PDI, a marker for the endoplasmic reticulum, third panel), anti-post synaptic density (Transduction laboratories, PSD95, a synaptic membrane marker, fourth panel), anti-pan-APP (G369, fifth panel) and anti-phospho-threonine668 APP (Cell Signaling, bottom panel).DiscussionGeneration, aggregation, and deposition of Aβ are key steps in the pathogenesis of AD []. Aβ is generated in the process of intracellular trafficking of APP, which is type I membrane protein. Following biosynthesis of APP, APP enters the endoplasmic reticulum where the protein is subjected to N-glycosylation (imAPP) and then transported to Golgi and subjected to O-glycosylation (mAPP). In neurons, membrane vesicles containing mAPP may be transported to nerve terminals along the axon using a kinesin-dependent motor system or else may be transcytosed and localized in dendrites []. At least some APP is exposed on the plasma membrane. This cell-surface APP, as well as APP in the trans Golgi network, is conveyed to the endocytic system via clathrin-coated vesicles []. Thus, APP might possibly be cleaved in one or several of compartments; i.e., the constitutive secretory pathway, the plasma membrane, and/or the endocytic system.The short cytoplasmic domain of APP plays an important role in the regulation of intracellular APP trafficking and contains several functional motifs such as -GYENPTY-, where several regulatory proteins interact []. One motif in the cytoplasmic domain of APP that has been proposed to be functionally important is -VTPEER- which forms a type I β-turn and amino-terminal helix capping box structure and contributes to the stability of a carboxyl-terminal helix structure [], []. The phosphorylation of Thr668, situated within this motif, induces significant conformational change in the cytoplasmic domain, changing its interaction with FE65 [], []. Because of these structural phenomena, phosphorylation of APP at Thr668 has been proposed by various groups to control either the metabolism of APP, some APP-related physiological function(s), and/or some FE65-mediated events.Some biological phenomena appear to correlate with APP phosphorylation. Neurite outgrowth in PC12 cells has been reported to correlate with the phosphorylation of APP, and a Thr668Glu substitution remarkably reduced neurite extension response following treatment with NGF []. Membrane proteins, including APP, act to tether FE65 to Golgi membranes, and phosphorylation of APP releases FE65 from its membrane-protein anchor [], []. The released FE65 may translocate into the nucleus and activate gene expression [].However, the role for the phosphorylation state of APP at Thr668 in the regulation of APP metabolism in brain in vivo has not been clarified. As mentioned above, Tsai and colleagues reported that amino acid substitutions at Thr668 alter the intracellular distribution of APP in cultured cells []. Alternatively, a recent model from Lu and colleagues holds that the prolyl isomerase Pin1 interacts with the phosphorylated form of APP at Thr668 , and that the interaction of Pin1 with APP Thr668 has important effects on Aβ levels [; for review, see ]. Aβ levels in Pin1-deficient brains have been studied not only by Lu and colleagues [], but they have also been studied independently by Akiyama and colleagues []. These groups reported directly contradictory results, however, with one group reporting that Aβ levels were decreased in the brains of Pin1-deficient mice, while the other reported that Aβ levels were increased in the brains of Pin -deficient mice [], []. Thus, since four recent and highly visible papers [, ,; rev in ] have emphasized the potential importance of APP Thr668 phosphorylation state in controlling brain Aβ levels, we investigated brain APP metabolism and Aβ levels in mutant mice generated by knocking into the mouse genome an APP gene containing a non-phosphorylatable alanine substitution at position of APP.The levels and subcellular distribution of APP and all its metabolites (sAPPα, sAPPβ, CTFα, CTFβ, Aβ40, Aβ42) from the brains of wild-type and APP Thr668Ala mutant mice were indistinguishable. Hence, contrary to widely publicized models [, , , rev in ], the phosphorylation state of APP Thr668 does not play an obvious role in governing physiological levels of brain Aβ in vivo.Of note, during the final stages of production of this manuscript, a report appeared from Cruz et al [] in which a revised model is presented wherein changes in APP metabolism caused by cdk5 are attributed to increased levels of β-APP-site cleaving enzyme (BACE) in contrast to this group's previous proposal [] that the state of phosphorylation of Thr668 was the most important modulator of Aβ levels and subcellular distribution of APP and its derivatives. This revised model of Tsai and colleagues, focusing on BACE levels rather than APP phospho-Thr668 levels [], is entirely consistent with what we have reported here.It is worth noting that we cannot, of course, rule out the possibility that pathological changes in APP Thr668 phosphorylation state might modulate its function or metabolism. Presently, we favor a model in which APP phosphorylation at Thr668 may regulate either some important physiological function of APP that is not directly linked to the proteolytic processing pathways that control Aβ levels in brain neurons in vivo. Evidence already exists that such functions might well include modulation of neurite outgrowth [], [] and/or intracellular signaling via AICD or FE65 [], [].Materials and MethodsProduction of mutant miceMutant mice were generated by a standard gene knock-in method using MS12 ES cell line derived from mice of the C57BL/ background []. Briefly, a -kb genomic fragment from C57BL/ mice containing exons and was used for constructing targeting vectors. The T668A point mutation (see Figure 1B) was introduced by PCR mutagenesis. For positive selection, the Pgk-neo gene cassette flanked by loxP sites was inserted at the EcoR1 site in the ′ non-coding region of APP-exon . For negative selection, the diphtheria toxin A-fragment gene cassette derived from pMC1DT-A was added to the ′ end of the targeting vector. After transfection of MS12 ES cells derived from the C57BL/ mouse strain and selection with G418, targeted clones were identified by Southern blot analyses. Chimeras, generated by injection of the targeted MS12 ES cells into Balb/c blastocysts, were mated with C57BL/ mice to obtain mutant heterozygotes. The Pgk-neo cassette flanked by loxP sites was excised by injecting the Cre recombinase expression vector, pCAGGS-Cre [] into the pronucleus of heterozygous fertilized eggs. The mouse genotypes were determined by PCR, using tail DNA as the template and the primers (E1: ′-CACATTGATTTCTTTGTGCCTG-′ and E2; ′-TCTGTACAATCATCCTGCAG-′), which anneal to the loxP flanking regions. Fragments of bp and bp were amplified from wild-type and knock-in mutant alleles, respectively.Immunoblot analysesBrains were homogenized in radioimmunoprecipitation (RIPA) lysis buffer containing µM microcystin-LR, µg/ml chymostatin, and µg/ml leupeptin, and the clear supernatants were used for immunoblot analysis. Aliquots of the lysates ( µg protein) were separated on SDS-PAGE (% (w/v) polyacrylamide for APP, X11L, MAP2 and PSD95, or .% (w/v) polyacrylamide for synaptophysin and GFAP, and analyzed by immunoblotting with anti-APP cytosolic domain-specific polyclonal antibody (pAb) G369, anti-phospho Thr668 (pAPP)-specific pAb (Cell Signaling Technology, MA), anti-X11L cytoplasmic domain (-AMFRLLTGQETPLYI- of human X11L)–specific monoclonal antibody (mAb), anti-MAP2 mAb HM- (Sigma, St. Louis, MO), anti-synaptophysin mAb SVP- (Sigma), anti-PSD95 mAb Clone16 (Transduction Laboratories), anti-actin MAB1501 (Chemicon International Inc., CA) and anti-GFAP mAb GF12. (Progen, Germany), respectively. Immunoreactive proteins were visualized with an enhanced chemiluminescence system (ECL; Amersham Pharmacia Biotech, Uppsala, Sweden).APP CTFs were detected by immunoblotting as described [], with modifications as described. Equal aliquots of homogenates ( µg) were separated by electrophoresis in a Tris-tricine gel (% [w/v] polyacrylamide). The separated proteins were transferred to nitrocellulose membranes, the membranes were boiled in PBS for min, and probed with anti-APP cytoplasmic domain antibody (Sigma). Immunoreactive proteins were again visualized with an ECL detection system (Amersham Pharmacia Biotech). For sAPP detection, brains of mice of various ages (∼ month-old and month-old) were homogenized in TBS buffer ( mM Tris-HCl, mM NaCl containing µM microcystin-LR, µg/mL chymostatin, and µg/mL leupeptin) and centrifuged at ,× g for min at °C. The pellets were subjected to two additional cycles of resuspension in equal volumes of TBS and centrifugation for min at ,× g at °C. Samples were then lysed in an equal volume of × RIPA buffer and sonicated. Protein concentrations were quantified using a BCA protein assay kit (Pierce). Aliquots containing µg protein were separated in % (w/v) Tris-glycine SDS-polyacrylamide gels, transferred to nitrocellulose, probed with anti-sAPPβ (kindly provided by T. C. Saido), or anti-sAPPα antibody 2B3 (IBL, Takasaki, Japan) and immunoreactive protein species were detected using an ECL detection system.ImmunocytochemistryAged mice ( mo-old or older) were deeply anesthetized with Avertin and transcardially perfused with physiologic saline and then % (w/v) paraformaldehyde in . M Na-phosphate buffer pH7. at °C for min. The brain was excised and post-fixed with the same fixative at °C overnight and cryoprotected in % (w/v) sucrose/phosphate-buffered saline (PBS). The brains were embedded into OCT compound (Sakura Fine Technical Co. Ltd., Tokyo, Japan) and frozen coronal sections ( µm) were prepared. Immunohistochemical staining was performed using the ABC method (Vector Laboratories, Burlingame, CA). Sections were incubated with .% (v/v) Triton X- in PBS for min at room temperature followed by incubation with .% (v/v) hydrogen peroxide in PBS for min at room temperature to quench endogenous peroxidase activity. The sections were then blocked with % (v/v) horse serum in PBS at °C overnight. After an overnight incubation at °C with anti-GFAP (clone GF12.), anti-synaptophysin (DAKO Corp., CA; clone SY38), or anti-MAP2 (Chemicon International, Inc., CA; clone MAB378) mAbs, the sections were further incubated with horse anti-mouse IgG conjugated to biotin (Vector Laboratories) for h at room temperature, followed by the ABC complex. The peroxidase activity was revealed using diaminobenzidine as the chromogen.Quantification of AβEndogenous mouse brain Aβ40 and Aβ42 were quantified with the ELISA system developed by Mathews and colleagues as described [].
|
PMC2375061.txt
|
TITLE: CALENDAR AUTHORS: No authors listed ABSTRACT: No Abstract BODY: No Body Content
|
PMC2011273.txt
|
TITLE: Epidemiology of melanoma of the eye in the Oxford Region, -. AUTHORS: A. J. Swerdlow ABSTRACT: No Abstract BODY:
|
PMC545208.txt
|
TITLE: Painful Horner Syndrome as a Harbinger of Silent Carotid Dissection AUTHORS: Amit Nautiyal, Sonal Singh, Michael DiSalle, John O'Sullivan ABSTRACT: A painful Horner's syndrome should alert clinicians to the possibilty of a silent carotid dissection BODY: PRESENTATION of CASEA -y-old white female presented to the hospital in July with pain in the left eye and left upper lid ptosis. She did not perceive any difference in perspiration between the two halves of her face. She was a nonsmoker and denied any history of head or neck trauma, or ocular, cardiac, vascular, or neurologic disease. Neuro-ophthalmological examination was normal except for mm of left upper eyelid ptosis (drooping of the eyelid), miosis (constriction of the pupil), and mild enophthalmos (recession of the eyeball into the orbit) consistent with classic left-sided Horner syndrome (Figure ). There was no carotidynia (a neck pain syndrome associated with tenderness to palpation over the carotid bifurcation) or carotid bruit. A chest radiograph obtained to rule out an underlying left apical superior sulcus tumor was normal. Magnetic resonance imaging/magnetic resonance angiography of the brain with cross-sectional imaging of the neck was obtained, which revealed extracranial left internal carotid artery dissection (Figures and ). The patient was treated with unfractionated heparin and coumadin and made an uneventful recovery. The patient was seen in the clinic a few months later and did not have any complications at follow-up.Figure 1Photograph of Patient Showing Left-Sided Horner SyndromeFigure 2Magnetic Resonance Imaging/Magnetic Resonance Angiography of the Neck Showing Left Internal Carotid Artery DissectionFigure 3T2-Weighted Magnetic Resonance Imaging Showing Blood in the Arterial Wall and Narrowing of the Lumen of the Left Internal Carotid ArteryThis is also known as the “crescent sign,” a hallmark of internal carotid artery dissection.DISCUSSIONHorner syndrome—characterized by the constellation of miosis, ptosis, anhidrosis (lack of sweating), enophthalmos, and anisocoria (unequal pupil size)—is present in up to % of internal carotid artery dissections []. Most patients experience neck, facial, and head pain ipsilateral to the lesion because of ischemia or stretching of the trigeminal pain fibers surrounding the carotid arteries []. Ophthalmic manifestations have been reported to occur in up to % of patients with internal carotid artery dissection []. Common findings in descending order of frequency are painful partial Horner syndrome (due to disruption of the third-order neuron oculosympathetic fibers) as seen in our patient, transient monocular vision loss, and permanent visual loss [].De Bray et al. studied the prognosis of cases of isolated Horner syndrome due to internal carotid artery dissection []. They found that % of cases of Horner syndrome due to internal carotid artery dissection were painful. The risk of an early ischemic stroke within the first wk was high (around %) without initial antithrombotic treatment [].Internal carotid artery dissection is a potentially life-threatening condition and carries a substantial risk of disabling stroke []. Carotid dissection is under-recognized as a cause of Horner syndrome and can be missed []. It is important to diagnose dissection because anticoagulation can prevent carotid thrombosis and embolism []. The investigation of choice is magnetic resonance imaging and angiography scan of the head and neck [].The treatment advocated for dissection is anticoagulation for – mo [].Learning PointsPainful Horner syndrome should alert clinicians to the possibility of a silent carotid dissection until proven otherwise [].Magnetic resonance imaging and angiography scan of the head and neck is the imaging modality of choice to look for dissection [].For patients with carotid dissection, anticoagulation with warfarin and coumadin is recommended for – mo to prevent carotid thrombosis and embolism [].
|
PMC1968596.txt
|
TITLE: Classical disseminated Kaposi's sarcoma in HIV-negative patients; an unusually indolent subtype. AUTHORS: I. G. Ron, A. Kuten, N. Wigler, G. Fried, S. Nitezky, M. J. Inbar, J. Dale, S. Chaitchik ABSTRACT: Kaposi's sarcoma is a rare neoplasm of characteristic chronicity. The classical form which occurs most often in elderly men of Eastern European origin, comprises both an indolent, cutaneous type marked by spontaneous regression with prolonged survival, and a rarer, disseminated variant is more fulminant. Seven elderly Jewish patients with classical, disseminated, visceral Kaposi's sarcoma were studied; they were neither homosexual nor drug-abusers. All immunologic parameters were normal and serum tests for HIV antibodies, CMV, and EBV were negative. Five of these patients were treated and four responded well, including two complete remissions. The prolonged survival of these patients (% at years) suggests the existence of an indolent subtype or forme fruste of the usually aggressive form of classical Kaposi's sarcoma. BODY:
|
PMC2241642.txt
|
TITLE: Yarrowia lipolytica vesicle-mediated protein transport pathways AUTHORS: Dominique Swennen, Jean-Marie Beckerich ABSTRACT: BackgroundProtein secretion is a universal cellular process involving vesicles which bud and fuse between organelles to bring proteins to their final destination. Vesicle budding is mediated by protein coats; vesicle targeting and fusion depend on Rab GTPase, tethering factors and SNARE complexes. The Génolevures II sequencing project made available entire genome sequences of four hemiascomycetous yeasts, Yarrowia lipolytica, Debaryomyces hansenii, Kluyveromyces lactis and Candida glabrata. Y. lipolytica is a dimorphic yeast and has good capacities to secrete proteins. The translocation of nascent protein through the endoplasmic reticulum membrane was well studied in Y. lipolytica and is largely co-translational as in the mammalian protein secretion pathway.ResultsWe identified S. cerevisiae proteins involved in vesicular secretion and these protein sequences were used for the BLAST searches against Génolevures protein database (Y. lipolytica, C. glabrata, K. lactis and D. hansenii). These proteins are well conserved between these yeasts and Saccharomyces cerevisiae. We note several specificities of Y. lipolytica which may be related to its good protein secretion capacities and to its dimorphic aspect. An expansion of the Y. lipolytica Rab protein family was observed with autoBLAST and the Rab2- and Rab4-related members were identified with BLAST against NCBI protein database. An expansion of this family is also found in filamentous fungi and may reflect the greater complexity of the Y. lipolytica secretion pathway. The Rab4p-related protein may play a role in membrane recycling as rab4 deleted strain shows a modification of colony morphology, dimorphic transition and permeability. Similarly, we find three copies of the gene (SSO) encoding the plasma membrane SNARE protein. Quantification of the percentages of proteins with the greatest homology between S. cerevisiae, Y. lipolytica and animal homologues involved in vesicular transport shows that % of Y. lipolytica proteins are closer to animal ones, whereas they are only % in the case of S. cerevisiae.ConclusionThese results provide further support for the idea, previously noted about the endoplasmic reticulum translocation pathway, that Y. lipolytica is more representative of vesicular secretion of animals and other fungi than is S. cerevisiae. BODY: BackgroundYarrowia lipolytica is a hemiascomycetous dimorphic yeast, generally regarded as safe (GRAS), which has been used for biotechnological applications. It is able to produce large amounts of several metabolites such as citric acid and to secrete a variety of extracellular proteins (alkaline or acid proteases, RNase, lipases etc.) []. Its good protein secretion capacities have allowed the engineering of powerful heterologous protein expression systems [reviewed in []]. Y. lipolytica is also a conveniently tractable model organism, of which the secretion pathway was studied for several years in our laboratory []. We focused on the early steps of protein translocation in the endoplasmic reticulum [-], on the quality control of protein folding [] and on the glycosylation pathway []. Several genes involved in these steps were cloned and analysed.The results of the Génolevures II sequencing project of four hemiascomycetous yeasts [] allowed us to search for proteins involved in the secretion pathway of Y. lipolytica and we compared them to the proteins of the three other yeasts, Candida glabrata, Kluyveromyces lactis and Debaryomyces hansenii. C. glabrata has become the second most common cause of candidiasis after Candida albicans. C. glabrata is not dimorphic, in contrast to other Candida species, and is phylogenetically closer to Saccharomyces cerevisiae []. K. lactis is less closely related to S. cerevisiae and has the capacity to grow on lactose as a sole carbon source, it has been used for industrial applications [,]. D. hansenii is a cryotolerant marine yeast which grows at salinities up to %. D. hansenii is the most common yeast found in cheese and provides proteolytic and lipolytic activities during cheese ripening []. In this work, we first established the list of proteins, predicted from whole genome analysis, which are potentially involved in vesicular transport in Y. lipolytica. Candidates were identified through BLAST searches against S. cerevisiae protein sequences. We then search for homologues of these proteins in the predicted protein set encoded by the three other genomes. Among the differences observed, we noticed a number of plasma membrane SNARE proteins (three Ssop) in Y. lipolytica compared to the four other yeasts. S. cerevisiae and C. glabrata have two SSO genes whilst in K. lactis and D. hansenii, we detected only one gene. We finally focused on one specific feature of the Y. lipolytica secretory pathway, namely the existence of a Rab4-related protein. In mammalian cells, the GTP binding protein Rab4p is involved in the regulation of plasma membrane protein recycling []. A Rab4-related protein is also found in Schizosaccharomyces pombe and in filamentous fungi such as Neurospora crassa, Aspergillus fumigatus or Phaenerochaete chrysosporium but is absent from S. cerevisiae, Candida albicans [] and the three other hemiascomycetous yeasts. We constructed a strain of Y. lipolytica deleted for the RAB4 gene and analysed its phenotypic pattern.Results and discussionVesicle-mediated protein transport pathwaysThe only membrane that a secretory protein must traverse is the membrane of the endoplasmic reticulum, the transport of the protein to its final destination continues through vesicles which bud and fuse between organelles [for reviews: [,]]. Vesicle budding is mediated by protein coats; vesicle targeting and fusion depend on Rab GTPase, tethering factors and SNARE complexes.Vesicle buddingProtein coats (see Additional file )Endoplasmic reticulum to Golgi transportEndoplasmic reticulum to Golgi transport is mediated by the action respectively of the COPII and COPI coat complexes [[-] for reviews]. The COPII coat is assembled on the endoplasmic reticulum membrane and allows cargo selection and membrane budding []. The COPI complex is involved in retrieval of recycled proteins back to the endoplasmic reticulum []. COP I subunits could also have a role in vacuolar sorting [].COPII coat vesicles (see Additional file -)Vesicle budding is initiated by the activation of the GTPase Sar1p by the endoplasmic reticulum integral membrane guanine exchange factor Sec12p [,]. Sar1p initiates membrane curvature [[], for mammalian Sar1p see []]. The membrane-bound Sar1p-GTP recruits the heterodimer complex Sec23p-Sec24p. These pre-budding complexes are gathered by the Sec13p-Sec31p complex into nascent vesicles [see []: the mammalian Sec13p-Sec31p structure]. The Sec23p subunit activates the hydrolysis of GTP by Sar1p and reverses the assembly process. Sec16p stabilizes the coat against premature disassembly after Sar1p hydrolyses GTP []. Using fluorescence resonance energy transfer to monitor the assembly and disassembly of COPII coat, it was suggested that a kinetically stable prebudding complex was maintained during multiple Sar1p GTPase cycles []. In S. cerevisiae, there are one Sec23p, one Sec23p-related protein, one Sec24p, two Sec24p-related proteins (Sfb2p and Sfb3p) and one Sec12p homologue (Sed4p). In Y. lipolytica and D. hansenii, all the COP II coat components are well conserved and we find two Sec23p-homologues, two Sec24p-homologues but no Sed4p proteins. In C. glabrata, there are two Sec23p-homologues, three Sec24p-homologues and two Sec13p-homologues and in K. lactis we found the same proteins as in S. cerevisiae with the exception of Sfb2p and Sed4p.COP I coat vesicles (see Additional file -)The COP I coat assembles by the same process as COP II complex involving an Arfp-GTPase [for a review about Arf1p: []; mammalian Arf1p: []; mammalian COPI assembly review: []]. All the S. cerevisiae components are conserved in Y. lipolytica, though the Y. lopolytica Sec28p is only weakly related to the S. cerevisiae protein. In K. lactis, the Arf1 protein homologue was not identified but another Arf protein could play the role of Arf1p (see Additional file -).Post-Golgi transportIn the trans-Golgi network, the proteins are sorted to the plasma membrane, the endosomal/vacuolar system or recycled back from the endosome. Coated vesicle adaptors facilitate cargo selection [for reviews: [,]].Adaptor protein complex (see Additional file -)In S. cerevisiae, by homology to the mammalian adaptor protein (AP) subunit sequences, three potential heterotetrameric adaptor protein complexes have been identified []. Each complex is composed of two large (Aplp), one medium (Apmp) and one small (Apsp) subunits. The AP- complex is associated with clathrin-coated vesicles and is involved in retention of late Golgi membrane proteins [] and trafficking to the vacuole []. This complex is alone able to associate with clathrin [,]. Unlike the mammalian AP- complex which associates with endocytic clathrin-coated vesicles, the AP- complex of S. cerevisiae is apparently not involved in endocytosis. The AP- complex is involved in independent clathrin-coated vesicle transport of membrane proteins from Golgi to vacuoles []. In Y. lipolytica, we also identified three potential AP complexes. As in S. cerevisiae, two AP- medium subunits were found, but only two small subunits could be identified which could correspond to the AP- and AP- small subunits. The three other yeasts have the same set of proteins as S. cerevisiae for their adaptor protein complexes.GGA proteins (Golgi-localized, γ ear-containing, ARF-binding proteins) (see Additional file -)GGA proteins are implicated in Golgi to endosomes clathrin-coated vesicle transport and bind to ubiquitin to facilitate this sorting [,]. In S. cerevisiae, the GGA gene is duplicated but in the four yeasts studied, as in C. elegans and D. melanogater, there is only one gene: GGA2 which, evolutionary, is closer to the hypothetical common ancestor [].Synaptojanin-like protein (see Additional file -)The S. cerevisiae Inp53p, a synaptojanin-like protein acts together with the AP- complex in the Golgi to endosome clathrin-dependant pathway which is distinct from the direct Golgi to prevacuolar compartment mediated by GGA proteins [].Retromer complex (see Additional file -) and sorting nexins (see Additional file -)Sorting nexins play a role in retrieval of proteins from the prevacuolar compartment or post-Golgi endosomes and different nexins operate in different classes of endosomes [reviewed in [-]]. The sorting nexins Snx4p, Snx41p and Snx42p are required for the retrieval of the SNARE Snc1p from the post-Golgi endosome; Grd19p and the retromer complex are involved in the retrieval of endosomal SNARE Pep12p from the prevacuolar compartment []. The retromer complex consists of five proteins: Vps5p, Vps17p, two sorting nexins which form a dimer and associate with the complex formed by Vps26p, Vps29p and Vps35p [see [,] for mammalian retromer complex structure].Vesicle targeting and fusionRabGTPase (see Additional file and Additional file -)Rab proteins are small monomeric guanosine triphosphatase (GTPase) which are membrane-associated and cycle between an active GTP-bound state and an inactive GDP-bound protein. These switches regulate all the steps in the secretion pathway. Mammalian Rab proteins belong to the Ras superfamily of GTPase. All the members of this superfamily have conserved nucleotide, phosphate and magnesium binding sequences but the Rab sequences can be distinguish by their C-terminal prenylation site and five Rab-specific regions (RabF) []. Pereira-Leal and Seabra [] have also identified Rab subfamily specific regions (RabSF). They studied the evolution of the Rab family [] and by their analysis, they observed that Rab proteins co-segregating in the phylogenetic trees showed a pattern of similar cellular localisation and/or function. In S. cerevisiae, Ypt1p, Ypt31p/32p and Sec4p are the essential Rab GTPases which regulate the exocytic pathway and Ypt6p, Ypt7p and Ypt51p/52p/53p are involved in the endocytic pathway. S. cerevisiae also has two other Rab GTPase, Ypt10p and Ypt11p which are also present in C. glabrata and we can find Ypt11p in K. lactis. Ypt10p seems to be involved in endocytic function and Ypt11p is required for endoplasmic reticulum inheritance []. In C. glabrata, a Ypt53p homologue could not be identified and in K. lactis it is Ypt32p which was not found. In Y. lipolytica, we can find homologues of the nine S. cerevisiae proteins necessary for the secretion pathway. Ypt10p and Ypt11p are absent but we can find two other Rab-related proteins, Rab2p and Rab4p as in the filamentous fungi []. The analysis of the phylogenic tree (Fig. ) obtained after alignment of several human Rabp, S. cerevisiae and Y. lipolytica Yptp sequences revealed that human Rab1p, Rab2p, Rab4p, Rab5p and Rab11p cosegregate with Y. lipolytica proteins. As N. crassa [] and other filamentous fungi, Y. lipolytica has a large protein secretion capacity and is able to switch from a yeast life cycle to a filamentous form in response to environmental conditions; in this latter form it needs a better capacity of secretion and of recycling plasma membrane material. In mammalian cells, Rab2p has been proposed to regulate the retrograde transport between the Golgi and the endoplasmic reticulum [] and Rab4p is involved in the recycling of plasma membrane proteins [see [,] for a review about recycling pathways]. The comparison of the mouse, rat, human, N. crassa, Schizosaccharomyces pombe and Y. lipolytica sequences (Fig. and Additional file ) shows that the nucleotide, phosphate and magnesium binding regions, the RabF and RabSF sequences are well conserved. We also compared these Rab4p sequences with other proteins of the mammalian Ras superfamily (data not shown) and we identified a sequence GIQYG next to the RabSF4 region, and particularly the tyrosine residue only present in the Rab4p sequences. The analysis with the NetPhos program (CBS prediction server) identified this tyrosine as a potential phosphorylation site. We suggest that this tyrosine could be important in the regulation of Rab4p activity. In order to get more information about this filamentous fungi specificity, we analysed the effects of a deletion of the gene coding for the Y. lipolytica Rab4-related protein. This deletion showed only slight phenotypic changes. The aspect of the colony on rich medium plate was slightly different (Fig. ). The ability to make the dimorphic transition was not impaired but at OD600 of , we quantified that the percentage of cells undergoing a dimorphic transition for the wild type strain was % and % for the mutant strain and the cells in the yeast form had a more spherical appearance in the mutant strain than in the wild type and aggregated more readily (Fig. ). The round morphological aspect is also observed in the Y. lipolytica rac mutant, the Rac protein is another member of the Ras superfamily which is implicated in the induction of the hyphal growth []. The slight differences in the morphology of the mutant strains suggested a potential modification of the wall composition. This was confirmed by the increased sensitivity of the strain to calcofluor white (Fig. ), implicating an increase in chitin composition of the wall. We also observed a decrease in the sensitivity to SDS (Fig. ) suggesting a decrease in the porosity of the wall. These two events are also encountered when the genes coding for a heterotrimeric G-proteins of Aspergillus nidulans are mutated, these mutations in this filamentous fungus confer resistance to the antifungal plant PR- (Pathogenesis-Related) protein []. We suggest that the Y. lipolytica Rab4 protein could be important to recycle the receptor associated with a heterotrimeric G-protein. The mutant Y. lipolytica rab4 strains were able to produce diploids as well as the wild type strain (data not shown) indicating that the recycling of the pheromone receptor, associated with a G-protein, was not impaired. The Y. lipolytica Rab4p does not regulate endocytosis as the incorporation of FM4- was the same as the wild type strain compared to a sls2 mutant strain in which the FM4- incorporation is delayed (Fig. ). Y. lipolytica Sls2p is homologous to the S. cerevisiae Rcy1p which plays a role in the recycling pathway (see "The vesicle-SNARE Snc1p recycling" section below).Figure 1Phylogenetic tree of some human Rabp, S. cerevisiae and Y. lipolytica Yptp. "]" indicates when Y. lipolytica protein sequences are closer to human ones. The tree was obtained with ClustalX program, . version [] and presented with Treeview program, .. version [].Figure 2Ypt4p/Rab4p protein sequences alignment. The figure shows the upper quartile, for the full image, see Additional file . Mus musculus (Mm), Rattus norvegicus (Rn), Homo sapiens (Hs), Drosophila melanogaster (Dm), Neurospora crassa (Nc), Schizosaccharomyces pombe (Sp) and Yarrowia lipolityca (Yl) Ypt4/Rab4 protein sequences alignment was obtained with ClustalX program, . version [] and presented with GeneDoc program, .. version [].Figure 3Colony morphology of Y. lipolytica strains. Wild type (wt) and two independent clones of rab4Δ (-,-) strains were grown as isolated colonies on solid YPD rich medium. Observation (×) of a five days culture by binocular microscopy.Figure 4Disruption of Y. lipolytica RAB4 gene does not impair hyphal growth but affects dimorphic transition. Microscope observation of the wild type (wt) and the mutant (rab4Δ) strains in liquid rich YPD medium exponential growth (OD600:) and stationary phase (OD600:).Figure 5SDS and Calcofluor white sensitivity. The rab4Δ (-,-) mutant strains are more sensitive to calcofluor white (CW) and more resistant to SDS than the wild type (wt) strain.Figure 6Endocytosis in the rab4Δ mutant strain is not impaired. The incorporation of FM4- in the rab4Δ- mutant strain is the same as in the wild type (wt) strain compared to a sls2 mutant strain in which the FM4- incorporation is delayed. Y. lipolytica Sls2p is homologous to the S. cerevisiae Rcy1p which plays a role in the recycling pathway (see "The vesicle-SNARE Snc1p recycling" section). Low panel: Nomarski.Regulation of Rab-GTPase [for reviews see [-]]Rab proteins cycle between cytosolic inactive GDP-bound form and active membrane associated GTP-bound form. The cytosolic form exists in a complex with a GDP dissociation inhibitor (GDI). Post-translational prenylation of the protein is important for its activity and prenylated Rabp is recruited to the appropriate membrane by a GDI displacement factor (GDF) which catalyses the dissociation step. The nucleotide exchange is favoured by the guanine nucleotide exchange factor (GEF). GTP-bound Rabp is then activated and can interact with its effectors. The recycling of the Rab protein is stimulated by the GTPase activating protein (GAP) and the GDP-bound Rab protein is released from the membrane by GDI.Prenylation [[], see [] for mammalian prenylation] (see Additional file -)Most of Rab proteins contain two C-terminal cysteine residues which are isoprenylated with two geranylgeranyl moieties. This reaction is catalyzed by geranylgeranyl transferase II (GGTase II), this enzyme has two subunits, a third subunit, Rab escort protein (REP), is a chaperone.GDP dissociation inhibitor (GDI) (see Additional file -)Gdi1p recycles the Yptp/Sec4p proteins from their target membranes back to the vesicular pool [].GDI displacement factor (GDF) (see Additional file -)In vitro experiments with mammalian proteins identified that Yip3p catalyses the dissociation of endosomal Rab proteins from GDI []. The Yip family (Yip1p, Yip2p, Yip3p, Yip4p, Yip5p and Yif1p) are membrane proteins which interact with prenylated Rab proteins []. In S. cerevisiae, Yip1p has been identified through a two-hybrid screen as a protein interacting with Ypt1p and Ypt31p in their GDP form []. With a similar screen, Yif1p has been identified as a Yip1p-interacting protein []. These two proteins form an integral membrane complex that bind Ypt1p and is required for Golgi membrane fusion by interaction with the Golgi SNARE proteins []. Yos1p (Yip One Suppressor ) associates with Yip1p-Yif1p complex []. This protein was only identified in D. hansenii.Guanine exchange factor (GEF) (see Additional file -)The activation and membrane stabilisation of the Rab protein are accompanied by exchange of the GDP for the GTP, this activity being catalysed by the guanine exchange factor. Each GEF is specific for a Rab protein and seems to be recruited by the activated Rabp playing a role immediately upstream in the secretion pathway [,]. The TRAPP I protein complex binds the COP II vesicles and activates Ypt1p by guanine exchange []. TRAPP II Trs120p-Trs130p subunits join the TRAPP I complex to switch the GEF activity from Ypt1p to Ypt31p-Ypt32p acting in late Golgi [,]. Sec2p [see [] for the crystal structure and for the crystal structure of the Sec2p/Sec4p complex] is a highly efficient guanine exchange factor of Sec4p [], the Rabp essential for exocytosis [[], see [] for Sec4p regulation cascade, [] for Sec2p association with exocyst]. Vps9p is the Ypt51p GEF []. The Ric1/Rgp1p is the Ypt6p GEF [], the BLAST against the S. cerevisiae proteins showed only one subunit in Y. lipolytica, Rgp1p, but by comparison with the D. hansenii protein we could identify a potential Y. lipolytica Ric1p. And Vps39p is the Ypt7p GEF [].GTPase activating protein (GAP) (see Additional file -)The recycling of the Rab protein is favoured by the GTPase activating protein. In S. cerevisiae, eight GTPase activating proteins have been identified and are not specific for one Rab protein in in vitro experiments (Gyp1p, Gyp6p, Gyp7p: []; Gyp2p, Gyp3p, Gyp4p: []; Gyp5p, Gyp8p: []). In the four yeasts, the Gyp3p homologue, Gyp4p was not identified. Gyl1p is Gyp-like protein interacting with Gyp5p involved in the control of polarized exocytosis [], this protein has an homologue only in C. glabrata but not in the three other yeasts.Tethering factors (see Additional file ), [reviewed in [-]]The secretory vesicles are tethered to their target membrane by two classes of molecules: coiled-coil proteins able to form homodimeric complex as long as several times the diameter of the vesicle and large multisubunit complexes.Endoplasmic reticulum-cis-Golgi-networkSeveral factors are involved in the tethering of vesicles to the Golgi, TRAPP complex (see Additional file -), COG complex (see Additional file -) and Uso1p (see Additional file -). TRAPP is associated with the Golgi and two forms of the complex exist: TRAPP I ( subunits) acts in the endoplasmic reticulum to Golgi transport and TRAPP II which contains the TRAPP I subunits together with three other proteins acts in Golgi traffic. In Y. lipolytica only two TRAPP II specific subunits were identified by comparison with the S. cerevisiae protein sequences but for the Trs65p we used the protein identified in D. hansenii to detect a potential Y. lipolytica protein. Both complexes are able to interchange guanine nucleotide on Ypt1p. In vitro, TRAPP I can bind COPII vesicles by binding the coat Sec23p subunit [] and this could be the first event before interaction of the vesicle with its target []. The crystal structure of the mammalian Bet3p, the most conserved TRAPP protein, reveals a dimeric structure with hydrophobic channels and a covalent modification with a palmitate [,], the crystallographic study of the complex Bet3p-Trs33p reveals specific interactions between these subunits []. This subunit could be responsible for the targeting and the anchoring in the Golgi membrane and could direct the other TRAPP components to the Golgi [,]. Trs120p, a TRAPP II subunit, is required for vesicle traffic from the early endosome to the late Golgi []. Trs120p and Trs130p TRAPP II subunits are conserved from yeast to mammals; the Trs65p subunit is conserved only in some fungi and unicellular eukaryotes []. The other tethering factors, Uso1p, a long coiled-coil protein and the COG complex composed of eight subunits in S. cerevisiae are recruited before the last step of membrane fusion. Uso1p and the COG complex also have a function in sorting of endoplasmic reticulum-vesicles containing GPI-anchored proteins [see [] for a review about differential ER exit] and in retrograde vesicular trafficking within the Golgi [reviewed in []]. The Uso1 protein consists of an N-terminal globular head region, a coiled-coil tail which mediates dimerisation and a C-terminal acidic region. The NCBI Conserved Domain Architecture Retrieval Tool has identified in the Y. lipolytica Uso1 protein the first two domains but not the C-terminal acidic region. When we compare the consensus sequence of this region with the Y. lipolytica sequence, only the last residues of this domain are well conserved. The Saccharomyces cerecisiae and the mammalian COG complex are composed of eight subunits, a multiple of four subunits, as one the GARP and the exocyst complexes (see below), which could reflect an interaction with a four-component complex such as the trans SNARE complex []. In Y. lipolytica, only five subunits were identified as probable COG proteins by comparison with the S. cerevisiae proteins. Cog1p, Cog2p and Cog7p were not detected by BLAST searches but in mammals these proteins were identified by their function as their sequence similarity with the S. cerevisiae proteins is low []. Cog2p was found in D. hansenii and its sequence used to make the BLAST search with the Y. lipolytica proteins. This allowed the identification of a potential Y. lipolytica Cog2p homologue, but Cog1p and Cog7p were not found in Y. lipolytica, and in D. hansenii, Cog1p was not found. These proteins probably exist but should be identified by another means.Cis-Golgi-network-Endoplasmic reticulum (see Additional file -)Dsl1p complex is a large complex composed of the peripheral endoplasmic reticulum membrane proteins Dsl1p, Dsl3p (Sec39p) and Tip20p [,]. Dsl1p contains three domains, an N-terminal coiled-coil region of aminoacids which interacts with Tip20p, a central highly acidic region of interaction with Ret2p and Ret1p (two COP I subunits) and a conserved C-terminal sequence which could recruit cytoskeletal elements []. The amino acid N-terminus from the Dsl1p protein identified in Y. lipolytica does not align with the S. cerevisiae sequence. Nevertheless the Y. lipolytica sequence also contains potential coiled-coil regions (as determined by the coiled-coil prediction program, NPS@:Network Protein Sequence Analysis, []). The Tip20p sequence of Y. lipolytica has only % identities with the S. cerevisiae sequence. This could explain the divergent N-terminal sequence of Dsl1p which is involved in the interaction of the two proteins. Dsl1p, Tip20p and Dsl3p are required for the stability of the SNARE complex at the endoplasmic reticulum [].GolgiS. cerevisiae TRAPP II complex (see Additional file -) is composed of ten subunits and could have a role in retrograde transport of Golgi vesicles []. The trs130 mutant (coding for a TRAPP II subunit) displays synthetic interaction with mutation in a COPI subunit (Ret2p) and a deletion of ARF1 (see Additional file -) is implicated in COPI formation [].A role of the COG complex (see above) has also been found in retrograde transport to early Golgi vesicles [].The VFT/GARP complex (see Additional file -) localizes to the trans-Golgi network and is required for retrograde traffic from early endosomes to the Golgi [,]. The S. cerevisiae complex is composed of four subunits [,], it is the effector of Ypt6p and interacts with the SNARE Tlg1p. Only three subunits were identified in Y. lipolytica and D. hansenii but the undetected Vps51p unit also has no homologue in mammalian [] and seems to be a regulatory subunit [] which could be replaced by another protein as suggested by Liewen, et al. []. The structural analysis of the interaction between S. cerevisiae Tlg1p and Vps51p has determined an N-terminal peptide of Vps51p which deletion does not block transport to the late Golgi from endosomes [].Golgins (see Additional file -, -) [reviewed in [,]] are coiled-coil proteins which organize the structure and the trafficking pathways in the Golgi. These proteins have mainly been studied in mammalian cells but in Sacharomyces cerevisiae several homologues have been identified: Uso1p is the homologue of the mammalian p115 required for endoplasmic reticulum-to-Golgi transport; Grh1p, the GRASP65-homologue, a Golgi localized protein component of the spindle assembly checkpoint []; Imh1p, involved in transport between an endosomal compartment and the Golgi, Imh1p contains a Golgi-localization (GRIP) domain that interacts with activated Arl1p-GTP to be localized to the Golgi, this is regulated by Arl3p [[,]] and Arl3p requires the N-terminal acetyltransferase NatC complex and the protein Sys1p to be targeted to the Golgi [] [for a review about Arl proteins see []]; Coy1p, the CASP homologue, a Golgi membrane protein related to Giantin, its deletion in S. cerevisiae restores normal growth to cells lacking the SNARE Gos1p [] and Rud3p, a golgin--related protein, is a Golgi matrix protein that is involved in the structural organization of the cis-Golgi [].Golgi-Endosome, Endosome-Vacuole []The TRAPP II subunit Trs120p is required for vesicle traffic from early endosome to the late Golgi [].The Vps Class C/HOPS complex [reviewed in: [,]) (see Additional file -):The HOPS complex composed of Vps11p, Vps18p, Vps16p, Vps41p with the protein Vps19p are the effectors of Ypt51p in endosomal traffic. In vacuolar transport, the complex seems to recruit the Rab Ypt7p GEF Vps39p which activates Ypt7p. Activated Ypt7p acts on the HOPS complex to promote tethering and binding to the SNARE Vam3p through the interaction with the SNARE-binding protein, Vps33p. Vps33p together with other HOPS complex subunits is found in complex with Vps8p, a hydrophilic membrane-associated protein []. HOPS complex binds phosphoinositides and SNARE Vam7p [].Golgi-Plasma MembraneThe Exocyst (see Additional file -, -)The S. cerevisiae exocyst complex is composed of eight subunits (Sec3p, Sec5p, Sec6p, Sec8p, Sec10p, Sec15p, Exo70p and Exo84p), a quatrefoil complex as in the COG and the GARP complexes []. The activated Rab protein, Sec4p, present on the secretory vesicles, binds the exocyst subunit Sec15p in subcomplex with Sec10p resulting in the association with the other subunits and Sec3p []. Sec3p is the spatial landmark defining the sites of polarized exocytosis []. The localization of Sec3p is mediated by Rho GTPases, Rho1p [] and Cdc42p []. Rho3p plays a role in exocytosis through its interaction with Exo70p ([-]). These Rho proteins also have a role in actin polymerisation. Assembly of the exocyst occurs when the subcomplex associated with the vesicles joins Sec3p and Exo70p on the plasma membrane []. The Sec6p subunit dimerizes and interacts with the SNARE Sec9p, playing a role in SNARE complex regulation []. A cyclical regulatory network contributes to the establishment and maintenance of polarized cell growth []. Bem1p interacts with Sec15p and is involved in the Cdc42p-mediated polarity [].SNARE (Soluble N-ethylmaleimide-sensitive factor Attachment protein REceptor) proteins [see reviews: [,,-] for mammalian SNAREs] (see Additional file and Additional file -)After the tethering of the vesicle close to its target membrane, the fusion of the membranes is initiated through the action of SM (Sec1/Munc18, see below) and SNARE proteins. SNARE proteins share one conserved sequence called the SNARE motif which contains – amino acids that include heptads repeat typical of coiled coils. They contain a C-terminal transmembrane domain or a hydrophobic post-translational modification motif. SNARE proteins associate to form complex undergoing conformational changes. Free SNARE motifs are unstructured and when they are associated in a complex they assemble into elongated four-helical bundles. SNAREs are present on the vesicle and the target membranes and the formation of the complex pulls the membrane close together. SNARE proteins are classified in to subfamilies based on a highly conserved layer of interacting amino acids (three glutamines: Qa-, Qb-, Qc-, one arginine: R-) in the centre of the helix bundle. All complexes contain one copy of each SNARE motif. In S. cerevisiae, twenty-four SNARE-encoding genes have been identified [reviewed in []]. Twenty-two of these genes could be found in Y. lipolytica by sequence homology. As in other fungi [], Vam3p and Spo20p were not detected. Spo20p, which seems specific to S. cerevisiae (also not identified in the three other yeasts), contains both Qb and Qc SNARE motifs and is required during sporulation for the prospore membrane formation [,]. Vam3p SNARE is required for homotypic vacuole fusion in S. cerevisiae and there is no homologue outside the Saccharomycetes, the Saccharomycetaceae, K. lactis, has a Vam3p SNARE, but in D. hansenii, another Saccharomycetaceae as in Y. lipolytica (Dipodascaceae) the Vam3 protein was not detected. The mitosporic Saccharomycetales, C. glabrata, possess a Vam3 protein. Pep12p is a late endosomal Qa SNARE with sequence similarity with Vam3p, that can complement vam3 mutants []. In Y. lipolytica and in D. hansenii, the BLAST searches allowed us to identify the Pep12p SNARE and another SNARE we propose to name Pep12p-like because its sequence is closer to Pep12p than to Vamp3p. This Pep12p-like SNARE could play the role of the S. cerevisiae Vam3p in both yeasts. A specificity of Y. lipolytica is the presence of three SSO genes resulting probably from gene triplication, and this seems unique to Y. lipolytica. The Sso proteins are implicated in the fusion of the secretory vesicles to the plasma membrane and S. cerevisiae Sso1p also has sporulation-specific functions []. The multiplicity of SSO genes in Y. lipolytica could reflect its good secretion capacity and its capacity to induce hyphal growth which needs better recycling of plasma membrane material. On the contrary, only one Sso protein (Sso2p) and one Snc protein (Snc2p) were found in K. lactis and D. hansenii. The SSO and SNC genes of K. lactis have been cloned by complementation in S. cerevisiae of sso2- and snc1Δ snc2Δ sem1Δ mutant strains. The K. lactis Ssop can perform both of the S. cerevisiae Ssop functions and the K. lactis Sncp seems to perform only the S. cerevisiae Sncp functions []. Sft1p was not detected in C. glabrata, Syn8p was not detected in C. glabrata and K. lactis and Nyv1p was not detected in D. hansenii.Regulation of fusionThe Sec1/Munc18 (SM) proteins (see Additional file -) [reviewed in []]The SM proteins confer specificity to membrane fusion through their binding to the N-terminal domain of the Qa SNARE protein. Four SM proteins have been found in S. cerevisiae, Sly1p acting between the endoplasmic reticulum and Golgi [] and Sec1 at the final step of exocytosis, Vps45p and Vps33p playing a role between Golgi and endosomes and between endosomes and vacuole. Each SM protein can bind several Qa SNARE but also other SNARE implicated in the same complex, as has been shown for Sly1p []. In addition one SNARE can bind two SM proteins at the same organelle: Vps45p and Vps33p with Pep12p []. Mso1p, a Sec1p-interacting protein, binds to SNARE complex and plays an essential role for vesicle fusion during prospore membrane formation [,].Vsm1p (see Additional file -)The phosphorylation of SNAREs by the cAMP-dependent protein kinase (PKA) regulates their ability to assemble into functional complexes [,]. Phosphorylation of the Sed5p t-SNARE regulates endoplasmic reticulum-Golgi transport as well as Golgi morphology []. The Ssop phosphorylation allows the binding of Vsm1p, a negative regulator of secretion which prevents the formation of the SNARE complex []. Dephosphorylation of Ssop by ceramide activated protein phosphatase (CAPP) increases its ability to form a complex with Sec9p []. Three S. cerevisiae genes code for a PKA but only one gene could be identified in Y. lipolytica and D. hansenii and two were identified in C. glabrata and K. lactis. The CAPP is composed of two regulatory subunits (Tpd3p and Cdc55p) and one catalytic subunit (Sit4p) which were found by sequence homology in the four yeasts in addition to further one Tpd3p-like in C. glabrata.SNARE recyclingSNARE complex dissociation (see Additional file -):After the membrane fusion step, the trans-SNARE complex becomes a cis-SNARE complex whose dissociation requires the ATPase Sec18p and the soluble NSF-attachment protein (Sec17p) as cofactor [,]. In vacuole fusion, Sec17p may displace HOPS from SNAREs to permit subsequent rounds of fusion []. Two Sec18 proteins were detected in C. glabrata.The vesicle-SNARE Snc1p recycling (see Additional file -)The S. cerevisiae RCY1 gene has been identified with a screen for mutants affected in membrane traficking along the endocytic pathway []. Rcy1p contains an amino-terminal F box and a CAAX box motif in its carboxyl-terminal sequence. The F box region of the protein is required for the recycling of the vesicle-SNARE Snc1p. The CAAX box is required for its localization in polar growth regions. Rcy1p interacts with Skp1p through the F box motif and both proteins form a complex necessary for the recycling function []. Rcy1p is a positive regulator of Ypt6p []. Gyp1p, the Ypt1p GTPase activator is also involved in the recycling of Snc1p [], as well as Snx4p, Snx41p and Snx42p []. The ARF-GAP Gcs1p facilitates the incorporation of the Snc1p into COPI recycling vesicles []. Rcy1p is a downstream effector of Ypt31, 32p [].In Schizosaccharomyces pombe, Pof6p, the Rcy1p-homologue, has been identified through a two-hybrid interaction with Skp1. Both proteins are required for normal septum processing and cell separation [], a function which may also require the exocyst function [].Previous to these works, a mutation sls2-, was isolated in Y. lipolytica that causes synthetic lethality when combined with the conditional lethal mutation in the 7S RNA of the signal recognition particle []. Rcy1p and Pof6p are the homologues of Sls2p.ConclusionThe sequencing of four hemiascomycetous yeasts has allowed us to search for proteins involved in vesicular transport by comparison with proteins identified in S. cerevisiae. The method used does not allow the identification of a protein which does not exist in S. cerevisiae or does not belong to a protein family. To identify new candidates, a list from other organism should be established or experimental approach should be performed. The proteins identified are highly conserved between the five yeasts but we have brought to light several specificities of Y. lipolytica in keeping with its good protein secretion capacities and its dimorphic aspect. In Table , we summarize these differences. Some of the proteins for which we did not find homologues have probably a too divergent sequence to be identified through the BLAST searches and may be identified in the future by functional screens. But, the presence of Rab2p- and Rab4p-related proteins as is found in fungi, a potential role of Rab2-related protein and Ypt1p in vesicular transport between endoplasmic reticulum and Golgi and of Rab4-related protein in addition to Sls2p/Rcy1p in membrane recycling reflect the greater complexity of the Y. lipolytica secretion pathway, which is probably dictated by the necessity to secrete and recycle membrane material needed for its filamentous growth. In this work, we have shown that the Rab4p-related protein could have a role in this membrane recycling since a modification of the aspect of the colony, the decrease of the number of cells undergoing dimorphic transition and the change of the wall permeability of the rab4 deleted strain were observed. The three Sso proteins are also indicative of a large secretion capacity and a study of this specificity would be interesting. As previously shown through the diverse studies of Y. lipolytica, this dimorphic yeast has a secretion pathway closer to the mammalian one than has S. cerevisiae. Its translocation apparatus is largely devoted to the co-translational translocation of nascent peptides through the endoplasmic reticulum membrane as is seen in mammalian cells. C. glabrata and K. lactis are the closest to S. cerevisiae for the proteins listed. We found among the C. glabrata proteins, COPII coat protein Sec13p-homologues and Sec18p-homologues implicated in the SNARE recycling and this seems to be specific to this yeast. For K. lactis and D. hansenii, only one Ssop and one Sncp were detected. Though D. hansenii is classified in Saccharomycetaceae, as is S. cerevisiae, and Y. lipolytica is a Dipodascacae, these two yeasts seem closer at least for the proteins involved in vesicular transport. These results are in agreement with the phylogenetic tree presented by Dujon et al []. In Fig. 7a, we have shown the proportion of the Y. lipolytica protein sequences listed (see Additionnal file : Y. lipolytica column) with the greatest homology to S. cerevisiae, C. glabrata, K. lactis, D. hansenii, Schizosaccharomyces pombe, N. crassa, other fungi, animals and plants sequences (see Additional file ). % of these proteins are closest to fungi and N. crassa. If we exclude animals, plants and fungi (keeping only N. crassa) from this search (Fig. 7b), we observed that % of the Y. lipolytica proteins listed are closer to N. crassa. The last comparison is performed without N. crassa (Fig. 7c): in this case, % of the proteins are closer to D. hansenii. This could reflect their common physiology, the filamentous growth and good secretion ability for Y. lipolytica and N. crassa and their proteolytic and lipolytic activities and high salt tolerance [] for Y. lipolytica and D. hansenii. These results confirm that considering the identified proteins playing a role in vesicular transport, Y. lipolytica is closer to the fungi than to S. cerevisiae. The proteins that are the best conserved between S. cerevisiae and Y. lipolytica, are the SNARE proteins (see Additional file ). In Fig. 8a, we have presented the percentage of the Y. lipolytica proteins with the greatest homology to the S. cerevisiae and animal: % of these proteins are closer to the animal ones, particularly, proteins of the AP complexes, Ypt and Arf proteins, TRAPP and HOPS complexes (see Additional file ), whereas for S. cerevisiae, only % of these proteins are closer to animals than to Y. lipolytica (Fig. 8b, see Additional file ). Koumandou and coworkers [] have analysed the protein sequences of tethering complexes and SM proteins from five eukaryotic supergroups. They conclude that the most recent common eukaryotic ancestor had a complex endomembrane system with COG, Exocyst, Dsl1, GARP tethering complexes which could have originated from one common ancestral complex, TRAPP and HOPS complexes which are independently derived and all four SM protein families represented. The phylogenetic tree presented by Dujon et al [] indicates that Y. lipolytica may be less distant from the last common eukaryotic ancestor and the observation of a good sequence conservation between Y. lipolytica and animal TRAPP and HOPS subunits for example, suggests that these complexes are required for the evolution of multicellular organisms. Similarly, Hall et al. [] showed that Rab4p was an ancient component of the endomembrane trafficking system since it exists, and its recycling function is conserved, in Trypanosoma brucei which belongs to an eukaryotic supergroup separated from that of yeast, fungi and animals. In Y. lipolytica also, the presence and the possible recycling role of a Rab4-like protein was observed while in S. cerevisiae and in the three other hemiascomycetous yeasts, this protein has been lost. These observations indicate that S. cerevisiae has diverged further from the last common eukaryotic ancestor than has Y. lipolytica, as far as vesicle-mediated protein transport pathways are concerned and that Y. lipolytica has retained the complexity of the trafficking system allowing evolution to a multicellular organization. So as has been said for fungi [], we can say that «Yarrowia lipolytica and humans are closer than you think» and that this yeast constitutes an interesting model to study the secretion pathway.Table 1Differences observed for the five hemiascomycetous yeasts.S. cerevisiaeY. lipolyticaC. glabrataK. lactisD. hanseniiCOPIISec24p, Sfb2,3p (Sec24p-related) proteins3 proteins2 proteins2 proteinsSec13p1 protein2 proteins1 protein1 proteinSed4pno hits1 proteinno hitsno hitsAdaptorAps1,,3p2 proteins3 proteins3 proteins3 proteinsGga1,2p1 protein (Gga2p) protein (Gga2p) protein (Gga2p) protein (Gga2p)Sorting NexinSnx41,42p1 protein2 proteins2 proteins2 proteinsYptpYpt7p1 protein1 protein1 protein2 proteinsYpt10pno hits1 proteinno hitsno hitsYpt11pno hits1 protein1 proteinno hitsYpt31-32p2 proteins2 proteins1 protein (Ypt31p) protein (Ypt32p)Ypt51,,53p3 proteins2 proteins3 proteins3 proteinsno hitsRab2,4p-relatedno hitsno hitsno hitsYptp regulationYos1pno hitsno hitsno hits1 proteinGyp4pno hitsno hitsno hitsno hitsGyl1pno hits1 proteinno hitsno hitsCOG complexCog1pno hits1 protein1 proteinno hitsCog2p1 protein1 protein1 protein1 proteinCog7pno hits1 protein1 protein1 proteinArfpArf1,,3p2 proteins(Arf1,3p) proteins(Arf1,2p) proteins (Arf2,3p) proteinsArl1p2 proteins1 protein1 protein1 proteinArl3p localizationNatC complex ( proteins) proteins3 proteins3 proteins3 proteinsGARP complexVps51pno hits1 protein1 proteinno hitsSNARE-QaVam3pPep12p-like1 protein1 proteinPep12p-likeSso1,2p3 proteins2 proteins1 protein (Sso2p) protein (Sso2p)SNARE-Qb,QcSpo20pno hitsno hitsno hitsno hitsSNARE-QcSft1p1 proteinno hits1 protein1 proteinSyn8p1 proteinno hitsno hits1 proteinSNARE-RNyv1p1 protein1 protein1 proteinno hitsSnc1,2p2 proteins2 proteins1 protein (Snc2p) protein (Snc2p)Exocytosis SNARE regulation proteinsTpd3p (CAPP regulatory subunit) protein2 proteins1 protein1 proteinTpk1,,3p (PKA) protein2 proteins2 proteins1 proteinSNARE recyclingSec18p1 protein2 proteins1 protein1 proteinSee Additional file for the list of proteins potentially implicated in vesicular transport.Figure 7The percentage of Y. lipolytica proteins with the greatest homology: a: to Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii, Schizosaccharomyces pombe, Neurospora crassa, other fungi, animals, plants proteins; b: to Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii, Schizosaccharomyces pombe, Neurospora crassa proteins; c: to Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii, Schizosaccharomyces pombe proteins. See Additional file for the list of E-values obtained with BLAST of Y. lipolytica proteins against NCBI eukaryotic sequences.Figure 8Percentages of greatest homology. a: The percentage of Y. lipolytica proteins with the greatest homology to S. cerevisiae and animal proteins; b: The percentage of S. cerevisiae proteins with the greatest homology to Y. lipolytica and animal proteins. See Additional file for the list of E-values obtained with BLAST of the S. cerevisiae proteins against NCBI eukaryotic protein sequences.MethodsStrains and growth conditionsEscherichia coli strains DH5alpha (F'/endA1 hsdR17 (rK- mK+) supE44 thi- recA1 gyrA (Nalr) relA1 Δ (lacIZYA-argF) U169deoR (φ 80dlacΔ (lacZ)M15) was used as host strain for bacterial transformations and plasmid propagation.The Yarrowia lipolytica strain INAG136463 (MatB, scr1 : : ADE1, SCR2, his-, leu-, ura3) was used for the inactivation of RAB4-related gene.Escherichia coli cells were grown in LB medium (% bactotryptone, % yeast extract, .% NaCl), μg/ml ampicillin, °C. Yarrowia lipolytica cells were cultivated either on rich YPD medium (% yeast extract, % bactopeptone, % glucose), °C, or on minimal medium: .% yeast nitrogen base without amino acids (Difco laboratories), % glucose as carbon source, mM phosphate buffer pH ., °C with amino acids required and , mg/ml '-fluoroorotic acid for ura3- strain selection.Gene inactivationDisruption was performed using the two-step «pop-in/pop-out» method []. The disrupted gene was obtained by the deletion of the BstEII-ClaI fragment of the RAB4-related gene cloned between the HindIII-KpnI sites of the p0 vector [].DNA techniquesStandard techniques were used according to Sambrook et al. []. Enzymes were supplied by New England Biolabs. All vectors inserts were checked by sequencing by Genome express (France).Transformation proceduresThe E. coli strains were transformed by the method of Chung and Miller [].Y. lipolytica strain transformations were carried out according to Xuan et al. [].Sensitivity to SDS and Calcofluor WhiteCells of the INAG136463 (wt) and two clones (, ) of the deleted rab4-related strains were grown in YPD medium. μl droplets of serial dilutions of exponential growing cultures of each strain were inoculated on the surface of YPD plates containing . μg/ml, μg/ml, μg/ml Calcofluor White (CW) or . %, .%, .% sodium dodecyl sulfate (SDS).FM4- stainingFor the strains of yeast cells, OD600 units of exponential growth in YPD medium (OD600 .–) were resuspended in μl of YPD containing μM FM4-. Cells were incubated min. at °C and washed three times in ice-cold medium. Cells were resuspended in YPD and incubated at °C. Aliquots were taken at various times and internalization was stopped with mM NaN3 and mM NaF. Stained cells were visualized using fluorescence optics [adapted from []].Informatic analysesHemiascomycetous yeast genome sequences, BLAST searches of vesicular secretion proteins and BLAST results (performed Apr , with ,, sequences) were obtained from the Génolevures web site []. S. cerevisiae sequences were collected from Saccharomyces Genome Database []. BLASTs against protein databases were obtained from NCBI (BLAST with ,, sequences) [] and Infobiogen web site []. Protein analyses were done with NCBI Conserved Domain Architecture Retrieval Tool [], ExPASy Proteomics tools [] and CBS Prediction Servers [].A list of proteins implicated in S. cerevisiae vesicular secretion was made from literature. These S. cerevisiae protein sequences were used for BLAST searches with the Génolevures web site. For protein families such as Rab protein, autoBLAST, which means BLAST of a sequence against its own genome, were made to identify all the members of the family. The protein sequences of the new members were identified by BLAST searches against the NCBI eukaryotic protein sequences.The percentages of proteins with the greatest homology (Fig. and ) were determined by quantification of the best E-values obtained with the BLAST searches against the NCBI eukaryotic protein sequences.AbbreviationsY. lipolytica,Yl: Yarrowia lipolytica; C. glabrata, Cg: Candida glabrata; K. lactis, Kl: Kluyveromyces lactis; D. hansenii, Dl: Debaryomyces hansenii; S. cerevisiae, Sc: Saccharomyces cerevisiae; N. crassa, Nc: Neurospora crassa; SNARE: Soluble N-ethylmaleimide-sensitive factor Attachment protein Receptor.Authors' contributionsDS conceived the study, carried out the molecular genetic studies, the sequence analyses and drafted the manuscript. JMB participated in the sequence analyses. All authors read and approved the final manuscript.Supplementary MaterialAdditional file 1Drawing of Yarrowia lipolytica identified proteins coats. PM: plasma membrane, ER: endoplasmic reticulum, RE: recycling endosome, EE: early endosome, LE: late endosome, MVB: multi-vesicular bodies, SV: secretory vesicle.Click here for fileAdditional file 3Drawing of Yarrowia lipolytica identified Ypt/Rab GTPases. PM: plasma membrane, ER: endoplasmic reticulum, RE: recycling endosome, EE: early endosome, LE: late endosome, MVB: multi-vesicular bodies, SV: secretory vesicle.Click here for fileAdditional file 4Full image of Figure 2Click here for fileAdditional file 5Drawing of Yarrowia lipolytica identified tethering factors. PM: plasma membrane, ER: endoplasmic reticulum, RE: recycling endosome, EE: early endosome, LE: late endosome, MVB: multi-vesicular bodies, SV: secretory vesicle.Click here for fileAdditional file 6Drawing of Yarrowia lipolytica identified SNARE and SM proteins. PM: plasma membrane, ER: endoplasmic reticulum, RE: recycling endosome, EE: early endosome, LE: late endosome, MVB: multi-vesicular bodies, SV: secretory vesicle.Click here for fileAdditional file 7E-values. E-values found for BLAST of Yarrowia lipolytica proteins against Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii, Schizosaccharomyces pombe (Sp),Neurospora crassa, other fungi, animals, plants, obtained with NCBI web site. Numbers between brackets indicate the order of best BLAST hits. Fungi: Ashbya gossypii (Ag), Aspergillus clavatus (Ac), Aspergillus fumigatus (Af), Aspergillus nidulans (Asn), Aspergillus niger (An), Aspergillus orizae (Ao), Aspergillus parasiticus (Ap), Aspergillus terreus (Ast), Chaetomium globosum (Chg), Coccidioides immitis (Ci), Coprinopsis cinerea (Cc), Cryptococus neoformans (Cn), Gibberzlla zeae (Gz), Hypocrea lixii (Hl), Magnaporthe grisea (Mg), Neosartorya fischeri (Nf), Neurospora crassa (Nc), Paracoccidioides brasiliensis (Pb), Phaeosphaeria nodorum (Pn), Ustilago maydis (Um). Animals: Aedes aegypti (Aa), Aiptasia pulchella (Ap), Anopheles gambiae (Ang), Apis mellifera (Am), Bombyx mori (Bm), Bos taurus (Bt), Caenorhabditis briggsae (Cb), Caenorhabditis elegans (Ce), Canis familiaris (Cf), Danio rerio (Dr), Drosophila grimshawi (Dg), Drosophila melanogaster (Dm), Drosophila pseudoobscura (Dp), Gallus gallus (Gg), Homo sapiens (Hs), Macaca mulatta (Mam), Mus musculus (Mm), Oryzias latipes (Ol), Pan troglodytes (Pt), Pongo pygmaeus (Pp), Rattus norvegicus (Rn), Strongylocentrus purpuratus (Stp), Xenopus laevis (Xl), Xenopustropicalis (Xt). Plants: Arabidopsis thaliana (At), Brassica oleracea (Bo), Brassica rapa (Br), Hyacinthus orientalis (Ho), Lotus japonicus (Lj), Medicago truncatula (Mt), Nicotiana tabacum (Nt), Oenothera odorata (Oo), Oriza sativa (Os), Pisum sativum (Ps), Solanum chacoense (Soc), Solanum tuberosum (St), Zea mays (Zm). (As Debaryomyces hansenii Vps35p, Snx3p, Gyp2p, Sec20p, Sec18p sequences were absent from the NCBI database when the comparison was done, the e-values were obtained with the NCBI BLAST of the Debaryomyces hansenii protein sequence against Yarrowia lipolytica sequences).Click here for fileAdditional file 8E-values. E-values found for NCBI BLAST of Saccharomyces cerevisiae proteins against Yarrowia lipolytica and animal proteins (see Additional file legend for list of abbreviations).Click here for fileAdditional file 2List of Yarrowia lipolytica genes coding for the proteins potentially implicated in vesicular transport. They were obtained by comparison against Saccharomyces cerevisiae protein sequences, BLAST results come from Génolevures web site, if Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii protein was found is indicated (see Additional file for the list of the Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii genes).Click here for fileAdditional file 9List of Candida. glabrata, Kluyveromyces lactis, Debaryomyces hansenii genes coding for the proteins potentially implicated in vesicular transport.Click here for file
|
PMC2738435.txt
|
TITLE: Chikungunya Virus, Cameroon, AUTHORS: Christophe N. Peyrefitte, Dominique Rousset, Boris A.M. Pastorino, Regis Pouillot, Maël Bessaud, Fabienne Tock, Helene Mansaray, Olivier L. Merle, Aurelie M. Pascual, Christophe Paupy, Aurelia Vessiere, Patrice Imbert, Patrice Tchendjou, Jean-Paul Durand, Hugues J. Tolou, Marc Grandadam ABSTRACT: We report the isolation of chikungunya virus from a patient during an outbreak of a denguelike syndrome in Cameroon in . The virus was phylogenetically grouped in the Democratic Republic of the Congo cluster, indicating a continuous circulation of a genetically similar chikungunya virus population during years in Central Africa. BODY: Chikungunya virus (CHIKV), formerly only an anecdotally described arbovirus, is now a worldwide public health problem (). Recently, numerous cases of CHIKV infection have been reported from a major outbreak of febrile illness around the Indian Ocean, which included Comoros, Mauritius, Réunion Island (,), and southern India ().CHIKV is widely distributed in tropical Africa (,) and in Asia (). In Africa, until , the virus was described as endemic, perpetuated through a sylvatic cycle involving wild primates, humans, and mosquitoes of the genus Aedes (,). During the past years, the urban cycle has also tended to play a role in Central Africa (). Nevertheless, although recent serologic surveys suggest a high prevalence of Togaviridae, Flaviviridae, and Bunyaviridae (,), understanding of the circulation and effects of arboviruses in Cameroon remains imprecise. This lack of understanding may reflect confusion between arboviral infections and hyperendemic Plasmodium falciparum infection.We report the first isolation, to our knowledge, of CHIKV in Cameroon. The virus was identified during an outbreak of a febrile syndrome in French soldiers in Douala and in patients from an urban medical center in Yaoundé. We also found evidence of cocirculation of CHIKV and dengue virus (DENV).The StudyIn Douala, Cameroon, sporadic cases of a denguelike syndrome were recorded in French soldiers (patients and ) on April and May , , respectively (Table). From the end of May through the end of July , more cases of denguelike syndrome, which included fever, asthenia, maculopapular rashes, and arthralgia, were observed in Yaoundé. The number of patients who sought treatment at the Yaoundé Medical Center peaked in mid-June . Blood samples were collected from of the patients who visited the medical center. The patients’ ages ranged from to years. The delay between the onset of symptoms and the sampling ranged from to days with a median of days (Table). All but patient lived in Yaoundé, and none of these patients had a history of travel abroad or from Yaoundé. Nine patients were Cameroonian, and all other patients were from other countries; patients were female. A blood sample from a -year-old woman who returned to France from Yaoundé was also received. All patients had negative results for P. falciparum according to rapid test (Core Malaria Pf, Core Diagnostics, Birmingham, UK) and thick smear examination.TableCharacteristics of patients with febrile acute denguelike syndrome, Cameroon, *Patient no.Sex/ageCitySymptom onsetSampling dateDelay, daysIgM†IgG†PCR‡1M/35Douala3 Apr7 Apr4NegNegNeg1M/35Douala3 Apr11 May21Pos CHIKPos CHIKVNeg2§M/36Douala22 May23 May1NegNegPos CHIK3F/54Yaoundé11 Jun12 Jun1NegNegNeg4F/49Yaoundé10 Jun13 Jun3NegNegNeg5F/42Yaoundé11 Jun12 Jun1NegNegNeg6F/41Yaoundé7 Jun7 Jun0NegPos FlaviNeg7M/38Yaoundé15 Jun19 Jun4NegNegNeg8M/30Yaoundé18 Aug19 Jun1NegNegNeg9M/21Yaoundé15 Jun19 Jun4NegNegNeg10F/32Yaoundé21 Jun22 Jun1NegNegNeg11F/22Yaoundé19 Jun26 Jun7Pos CHIKVNegNeg12F/53Imported case20 Jun26 Jun6Pos CHIKVPos CHIKNeg13M/42Yaoundé24 Jun27 Jun3NegPos FlaviNeg14F/42Yaoundé18 Jun28 Jun10NegNegNeg15F/27Yaoundé18 Jun29 Jun11NegPos FlaviNeg16F/43Yaoundé26 Jun30 Jun4NegNegNeg17M/31Yaoundé16 Jun30 Jun14NegNegNeg18F/37Yaoundé22 May30 Jun39Pos CHIKPos CHIKNeg19F/45Yaoundé10 Jun30 Jun20NegNegNeg20M/45Yaoundé22 Jun30 Jun8NegPos Flavi and CHIKVNeg21M/1Yaoundé23 Jun30 Jun7NegNegNeg22F/9Yaoundé10 Jun30 Jun20NegNegNeg23M/4Yaoundé26 Jun30 Jun4NegNegNeg24M/54Yaoundé4 Jul6 Jul2NegNegNeg25F/45Yaoundé14 Jun5 Jul21NegNegNeg26M/48Yaoundé24 Jun6 Jul12NegNegNeg27M/20Yaoundé30 Jun1 Jul1NegNegNeg28M/37Yaoundé4 Jul11 Jul7Pos CHIKPos CHIKVNeg29M/36Yaoundé9 Jul11 Jul2NegNegNeg30M/33Yaoundé28 Jun10 Jul12NegNegNeg31M/32Yaoundé10 Jul12 Jul2NegNegPos DENV32F/38Yaoundé16 Jul17 Jul1NegNegNeg33M/45Yaoundé21 Jul26 Jul5NegNegNeg*IgM, immunoglobulin M; Neg, negative; Pos, positive; CHIKV, chikungunya virus; Flavi, flavivirus; DENV, dengue virus. †CHIKV isolation successful. ‡DENV, West Nile virus, Wesselsbron virus, Rift Valley fever virus, Bunyamwera virus, and CHIKV antibodies tested. §DENV, West Nile virus, CHIKV tested by real-time RT-PCR.Serum specimens were tested for immunoglobulin M (IgM) and IgG antibodies specific for DENV, West Nile virus (WNV), Wesselsbron virus, Rift Valley fever virus, Bunyamwera virus, and CHIKV by IgM-antibody capture (MAC-ELISA) and IgG sandwich ELISA, respectively (). A serum sample was consider positive if the optical density (OD) ratio of viral antigen to uninfected cells was >. The presence of CHIKV, DENV, and WNV genomes was tested for by specific real-time reverse transcription PCR (RT-PCR) (). Virus isolation on C6/ and Vero cells was attempted on samples that were positive by RT-PCR ().The serologic follow up of patient (Table) for a -week period detected seroconversion to a virus antigenically related to CHIKV virus (the OD ratios obtained with the second sample were >) for IgM and IgG. A sample from patient was obtained the day after the onset of symptoms, and no antibodies to all tested arboviruses were detected. However, the specimen was positive by real-time RT-PCR for CHIKV. The patient’s sample yielded CHIKV when cultured, and the envelope gene was partially sequenced (position ,–,, GenBank accession no. Bankit851776). The .-kb sequence genetic analysis did not show any codon deletion or insertion when compared with other African CHIKV sequences available in the GenBank database (,,). A high degree of identity was observed when the sequence was compared with the Democratic Republic of the Congo (DRC) strains isolated in (). Paired identity ranged from % to .% at the nucleotide level and from .% to .% at the amino acid level. The Cameroon isolate displayed a higher nucleotide divergence (paired identity ranging from % to .%) when compared with the Réunion Island strains (,,). However, amino acid sequences were highly conserved (%–.%). The sequence identity among these isolates highlights their common origin and particularly the genetic stability of CHIKV despite the years and the geographic distance from the DRC outbreaks. As shown in the phylogenetic tree (Figure), the CHIKV Cameroon strain clustered with DRC CHIKV strains with a high bootstrap value of . This genotype of CHIKV was closely related to strains from the Central African Republic and the Uganda isolate (,). The close genetic relationship suggests a continuous circulation of a homologous CHIKV population in Central Africa with a high degree of genetic stability. The genetic stability of the Central African CHIKV strains during years, whether associated with epidemic or sporadic cases, highlights the peculiar importance of the few mutations detected in the recent Réunion Island isolates (). This also suggests that the Central African strain CHIKV zone of circulation now includes India (), the Indian Ocean, and Cameroon.FigurePhylogenetic tree of chikungunya virus (CHIKV) based on partial nucleotide sequences (′ extremity of E1/′-UTR, position ,–,). Phylogram was constructed with MEGA program and tree drawing used the Jukes-Cantor algorithm for genetic distance determination and the neighbor-joining method. The percentage of successful bootstrap replicates (, bootstrap replications, confidence probability >%) is indicated at the nodes. The length of branches is proportional to the number of nucleotide changes (% of divergence). Asterisk (*) and arrow indicate the strains isolated in this work. The dark triangle corresponds to viruses clustering together. O’nyong-nyong virus (ONNV) sequence has been introduced for correct rooting of the tree. The GenBank reference no. for the Cameroon CHIKV isolate is EF051584.The phylogenetic tree also illustrates the differences between the Cameroon isolates and the Asian subgroup isolates. Moreover, when compared with Asian CHIKV, including the isolates, the Cameroon strain showed %–.% and .%–.% identity at the nucleotide and amino acid levels, respectively. Despite the similarity, cross-neutralization experiments must be conducted to confirm the protective effect of the Asian CHIKV-based vaccine against Central African strains ().Among patients from Yaoundé, (patient ) had only IgM antibodies specific to CHIKV, while patients and had both IgM and IgG antibodies specific to CHIKV (Table). One patient from Cameroon (patient ) had IgG specific to both CHIKV and flavivirus. Three patients (nos. , , and ), of whom were Cameroonian, had antibodies specific for flavivirus. All samples were negative for WNV and CHIKV by RT-PCR. One sample (from patient ) was positive for DENV; however, no virus was detected by cell culture. These results suggested a cocirculation of CHIKV and dengue virus during the same period, which is consistent with the suspected circulation of dengue virus, CHIKV, and yellow fever virus observed in a study from through in Cameroon ().In Cameroon, as in DRC (), patients were likely infected in urban or periurban centers (Yaoundé, the capital of Cameroon; Douala, a major city). These infections occurred in a context where Aedes albopictus tends to replace indigenous Ae. aegypti in rural and urban Cameroonian environments (). This finding suggests that urban cycles and urban vectors, in addition to the traditional forest-dwelling vectors, may play an important role in the maintenance and amplification of CHIKV in Africa.ConclusionsSince its first isolation in (), CHIKV has been isolated in different Central African countries (,). Until now, only alphavirus strains antigenically suspected to be CHIKV had been isolated from human patients in Cameroon (). Recent serosurvey studies suggested a possible CHIKV circulation in Cameroon (,). Our Cameroon CHIKV isolate confirmed its circulation in this country. Our study suggests a -year continuous circulation of genetically stable and indigenous strains in Central Africa rather than importation of CHIKV from the recent Indian Ocean or Asian outbreaks. Moreover, the genetic stability of the Central African CHIKV highlights the importance of the unique molecular features that was shown in Réunion Island isolates ().
|
PMC2394270.txt
|
TITLE: Constitutive activation of STAT3 and STAT5 is present in the majority of nasopharyngeal carcinoma and correlates with better prognosis AUTHORS: J-R Hsiao, Y-T Jin, S-T Tsai, A-L Shiau, C-L Wu, W-C Su ABSTRACT: Constitutively activated signal transducers and activators of transcription (STAT) factors, in particular STAT1, STAT3 and STAT5, have been demonstrated in a variety of human tumours and cancer cell lines. However, data on the expression of these STATs in nasopharyngeal carcinoma (NPC) are limited. In this study, the expression patterns of STAT1, STAT3 and STAT5 were immunohistochemically examined on the archival specimens from patients with NPC. Staining results of each STATs were then correlated with the clinical parameters and prognosis of these patients. The results showed that constitutive activation of STAT3 and STAT5 was detected in the majority, . and .%, respectively, of the tumour specimens. Furthermore, coexpression of activated STAT3 and STAT5 was found in .% of the specimens. In contrast, constitutive activated STAT1 could only be detected in (.%) cases. Surprisingly, following radiotherapy, patients with constitutive STAT5 activation, or activation of both STAT3 and STAT5, had better disease-free survival and overall survival than those without activated STAT5. To our knowledge, this is the first report providing the overall expression patterns and prognostic significance of specific STATs in NPC. BODY: Signal transducers and activators of transcription (STAT) proteins comprise a family of transcription factors and function as downstream effectors of many cytokine and growth factor receptors (Darnell, ). Signalling pathways mediated by STATs are critical for many normal cellular functions, including embryonic development, organogenesis, immunological interaction, growth, differentiation and survival (Buettner et al, ). During cytokine or growth factor stimulation, STATs are tyrosine phosphorylated, dimerise, and translocate into the nucleus to regulate target gene expression (Darnell, ). The activation duration of STATs under physiological conditions is usually temporary and is tightly regulated by a number of cellular mechanisms, such as tyrosine dephosphorylation, ubiquitin/proteosome-mediated degradation, negative feedback loop mediated by CIS/SOCS/JAB/SSI family of proteins, or inhibition of STAT DNA-binding activity through association with protein inhibitor of activated STAT (PIAS) proteins (Lin and Leonard, ). However, constitutively activated STATs, especially STAT1, STAT3 and STAT5, have been found in a variety of human tumours and cancer cell lines, including blood malignancies and solid tumours (Turkson and Jove, ). In various tumour cell lines, persistent signalling of specific STATs, in particular STAT3 and STAT5, has been shown to stimulate cell proliferation and prevent apoptosis through upregulating a number of target genes, such as c-Myc, cyclins and bcl-x. In contrast, inhibition of constitutively activated STAT3 or STAT5 leads to growth suppression or apoptosis (Buettner et al, ).Nasopharyngeal carcinoma (NPC) is endemic in South-east Asia and closely associated with Epstein–Barr virus (EBV) (Tsai et al, ). Epstein–Bars virus resides in NPC cells in a status called type II latency, with only a few latent genes expressed (Brooks et al, ). One of these latent genes, latent membrane protein (LMP-), has been shown to have transforming potential (Baichwal and Sugden, ; Kaye et al, ) and is implicated in the oncogenesis of various EBV-associated malignancies, including NPC. LMP- can also interact with Janus Kinase (JAK3) and activate STAT proteins (Gires et al, ). In a recent study, the JAK/STAT pathway was shown to play a role in maintaining in vivo latency of EBV (Chen et al, ). Aberrant STAT activation has also been proposed as a necessary and predisposing event for EBV-driven tumorigenesis in immunocompetent individuals (Chen et al, ).Although the presence of constitutive STAT1, STAT3 and STAT5 activation has been demonstrated in NPC tissue (Chen et al, ), data on the levels of expression of these STATs in NPC are lacking. Thus, whether expression of these constitutively activated STATs affects prognosis after treatment remains unclear. This study used immunohistochemical methods to examine the expression pattern of STAT1, STAT3 and STAT5 in biopsy specimens of patients with NPC and correlated the results with clinical parameters of these patients.MATERIALS AND METHODSPatients and specimensA total of NPC patients with complete follow-up records and available archival nasopharyngeal biopsy specimens were recruited in this study. All of the patients, including males and females, were histologically confirmed to have WHO type II (nonkeratinising) or WHO type III (undifferentiated) NPC (Shanmugaratnam et al, ). The clinical status of these patients was determined using the UICC/AJCC staging system (Sobin and Wittekind, ) after reviewing their clinical records and image studies which included chest X-ray, abdominal sonography, bone scan and CT scan. All patients were previously untreated and received radiation treatment with curative intention between and at the Department of Radiation Oncology of National Cheng Kung University Hospital. In all, patients received radiotherapy as their sole treatment modality. The other five patients received concurrent chemotherapy with bolus infusion of cisplatin mg m− day− on the beginning day of weeks , and after the start of the radiotherapy regimen. All patients completed the full-course of radiation therapy within weeks without any interruption and received regular follow-up at our hospital. Among the patients, remained disease-free for a median follow-up period of . months, ranging from . to months. In total, patients suffered from loco-regional relapse and/or distant metastasis after treatment, including nine patients with local recurrence (one also with distant metastasis), eight patients with recurrence in the neck (five also with distant metastasis), two patients with both local and neck recurrence (one also with distant metastasis) and one patient with distant metastasis without loco-regional relapse. All the archival nasopharyngeal biopsy specimens used in this study were obtained from the Department of Pathology of National Cheng Kung University Hospital.Immunohistochemical studySerial -μm histological sections were cut, mounted on glass slides coated with -aminopropyltriethoxysilane, and air-dried overnight at room temperature. The sections were then deparaffinised in xylene and rehydrated in ethanol. Haematoxylin and eosin (H&E) staining was first performed in each specimen to confirm the presence of tumour cells. Endogenous peroxidase activity was then blocked with methanol containing % H2O2 for min. For all sections used in this study, the antigen retrieval procedure was performed by immersing the slides in citrate buffer (pH .) and then heating the slides in a microwave oven for min. The sections were then incubated with primary antibodies using : dilution for STAT1, STAT3 and STAT5 (mouse anti-human IgG1, Santa Cruz, CA, USA) at °C overnight, followed by staining with Universal Immuno-peroxidase polymer (UIP) solution (Simple Stain MAX PO MULTI, Nichirei, Tokyo, Japan) for min. The sections were finally reacted with AEC (-amino--ethylcarbazole) substrate solution (DAKO, Glostrup, Denmark) and then counterstained with haematoxylin before being mounted. Non-human reactive mouse IgG1 (DAKO, Glostrup, Denmark) was used as an isotype negative control.The sections were then observed under a light microscope by a pathologist (IT Jin) who was blinded to the clinical characteristics of the patients. The degree of expression of each STAT was then determined independently with the following rules. Intranuclear staining of tumour cells was considered to indicate the presence of constitutively activated STATs. Using high magnification power (× ), five representative fields in each section were evaluated. In total, tumour cells were counted in each field. In sections containing less than five tumour nests, all tumour nests were evaluated. The percentage of immunoreactive tumour cells with nuclear staining was then calculated. When equal or more than % of the counted tumour cells on one slide showed identifiable nuclear staining, the slide was classified as ‘positive’ for significant constitutive STATs activation. If less than % of tumour cells showed a nuclear staining pattern, the slide was considered to show no significant constitutive activation of STATs and was classified as ‘negative’. Staining results of the specimens were then correlated with the clinical characteristics of the patients.Statistical analysisχ2 test was used to calculate the significance of the relation between expression of each STAT and clinical characteristics. The Kaplan–Meier method was used in the survival analysis. Log-rank test was used to calculate the significance of differences in the survival analysis. Cox's proportional hazards regression model was used to study the influence of covariates on survival time. A probability level of less than . (P<.) was considered to indicate a significant difference.RESULTSConstitutive activation of STAT3 and STAT5 in the majority of NPC specimensBoth STAT3 and STAT5 were significantly activated in a high proportion of the NPC specimens included in this study. Significant constitutive STAT3 activation was noted in (.%) of the samples studied, while significant constitutive STAT5 activation was noted in (.%) of the specimens (Table 1Table 1Patient characteristics and the staining results of STAT3 and STAT5 Constitutive STAT3 activationConstitutive STAT5 activation (+)(−)P-value(+)(−)P-valueNumber of specimens (.%) (.%) (.%) (.%) Clinical parameters AgeMean±s.d. (years).±..±...±..±.. SexMale34150.. Female93 TT11360.31a1360.55a T22512 T300 T450 NN01770.73b1590.84b N1189 N261 N321 StageI740.46c830.98c II2612 III51 IV51 WHO subtypeII1470.. III2911 Treatment modalityR/T only39170.. Concurrent C/T+R/T41 Prognosis after treatment Disease-free ..* Recurrence of disease aT1+T2 vs T3+T4.bN0+N1 vs N2+N3.cStage I+II vs Stage III+IV.*Statistically significant (P<.).). In contrast, constitutive STAT1 activation could only be detected in eight (.%) of the cases. The intensity of intranuclear staining varied among the specimens, and differences of staining intensity were also noted among tumour nuclei within the same histological section. However, strong intranuclear staining, or intranuclear and cytoplasmic staining, was noted in of the specimens classified as ‘positive’ for significant constitutive STAT3 activation (Figure 1A, BFigure 1Staining of STAT1, STAT3 and STAT5 on serial pathological sections of a NPC biopsy specimen. (A) H&E stain. Large, vesicular nucleus with prominent nucleolus (arrow) is noted in majority of the tumour cells. (B) Strong intranuclear (arrowheads) and cytoplasmic staining of STAT3. (C) intranuclear (arrows) and faint cytoplasmic staining of STAT5. Nuclear STAT5 staining is also noted in endothelial cells of a nearby vessel (arrowheads). (D) No nuclear staining of STAT1 in the tumour cells (arrows). Nuclear staining of STAT1 is noted in an infiltrating lymphocyte (arrowhead) (original magnification × ).) and in of the specimens classified as ‘positive’ for significant constitutive STAT5 activation (Figure 1C). In contrast, most of the specimens showed no intranuclear staining of STAT1 protein in tumour cells (Figure 1D).Frequent coactivation of both STAT3 and STAT5Among the specimens classified as ‘positive’ for significant STAT3 activation, were also classified as ‘positive’ for STAT5 activation. Among the remaining specimens that were classified as ‘negative’ for STAT3 activation, were also classified as ‘negative’ for constitutive STAT5 activation (Table 2Table 2Results of STAT3 and STAT5 staining on the NPC specimens Constitutive STAT3 activation (+)(−)TotalConstitutive STAT5 activation(+) (.%) (.%) (−) (.%) (.%) Total ). The proportion of specimens with same STAT3 and STAT5 classification was .% ( out of ), suggesting that STAT3 and STAT5 might be coactivated.Constitutive activation of STAT5, or both STAT3 and STAT5, correlates with better prognosisAmong the 61specimens stained for STAT5 protein, specimens were classified as ‘positive’ and as ‘negative’ for significant constitutive STAT5 activation. As shown in Table , no difference was found in the clinical parameters of these two groups of patients, including age, sex, TNM stage, WHO subtype classification and treatment modalities. However, comparison of treatment outcome among these two groups revealed that patients whose biopsy specimens showed significant constitutive STAT5 activation had better prognosis after treatment (χ2 test, P=.). Patients who had no significant constitutive STAT5 activation on histological sections were more likely to suffer from loco-regional relapse and/or distant metastasis. On the other hand, the STAT1 and STAT3 staining results showed no such correlation (χ2 test, P=. and ., respectively). This result still held true in the survival analysis. Patients whose biopsy specimens showed significant constitutively activated STAT5 also had better disease-free survival and overall survival than those patients who had ‘negative’ results on their biopsy specimens (Figure 2A, BFigure 2Survival of NPC patients as a function of the staining results of STAT5, or both STAT3 and STAT5: (A) Overall survival as a function of results of STAT5 staining, (B) disease-free survival as a function of results of STAT5 staining, (C) overall survival as a function of results of both STAT3 and STAT5 staining, and (D) disease-free survival as a function of results of both STAT3 and STAT5 staining.; log-rank test, P<. and <.). Since activation of both STAT3 and STAT5 was frequently noted in the same specimen, we then explored whether this coactivation could have an impact on treatment outcome. Interestingly, patients who had ‘positive’ staining results for both activated STAT3 and STAT5 ( patients) had significantly better overall survival and disease-free survival than those are ‘negative’ for both staining ( patients) (Figure 2C, D; †log-rank test, P<.). However, the double-positive group did not significantly predict better prognosis than the STAT5 positivity only group, both in overall survival and disease-free survival. On the contrary, the double-positive group significantly predicted better prognosis than the STAT3 positivity only group in overall survival (Figure 2C, ‡log-rank test, P<.), implying that STAT5 is more important in predicting prognosis than STAT3. In figure 2C and D, although the STAT5 positivity only group has a favourable survival curve than the other groups, there was no statistical significance detected. This might be due to the small number of patients in the STAT5 positivity only group (five patients). To clarify whether the better prognostic prediction was due to STAT5 positivity only or due to simultaneous activation of STAT3 and STAT5, multivariate analysis was performed. In the Cox's regression model, only STAT5 was selected to be an independent variable for both overall survival (hazard ratio ., P=.) and disease-free survival (hazard ratio ., P=.), suggesting that STAT5 is the major determinant of better prognosis.DISCUSSIONConstitutively activated STATs have been detected in a variety of human tumours and cancer cell lines, including blood malignancies and solid tumours. Most studies demonstrating constitutive activation of STATs in solid human malignancies have used either Western blot analysis and/or electrophoretic mobility shift assay (EMSA) as the main methodology. However, considering the ‘lymphoepithelioma-like’ nature of NPC (Shanmugaratnam et al, ), applicability of these methods might be confounded by the infiltrating lymphocytes in this tumour and is not suitable under such conditions. Therefore, we decided to use immunohistochemical methods to study the expression patterns of STATs in NPC. The suitability of this strategy is further supported by the fact that, in addition to their presence in lymphocytes (Figure 1D), constitutively activated STATs are also noted in other nontumour cells (Figure 1C).A recent study found persistent STAT1, STAT3 and STAT5 activation in NPC tissue (Chen et al, ). However, insufficient data have been reported to provide an overall picture of the expression of these STATs in NPC. This study has provided the first evidence that significant constitutively activated STAT3 and STAT5 are present in over half of NPC patients (Table ), while STAT1 activation is present in only a minor proportion of these patients. The intranuclear staining intensity of STAT3 and STAT5 was strong in many of the tissue specimens (Figure ), suggesting that STAT signalling is very active in this malignancy. We also noted that constitutively activated STAT3 and STAT5 frequently coexisted in the same specimen. It has been shown that different STATs can be activated by the same ligand and/or intracellular tyrosine kinase (Ruff-Jamison et al, ; Carlesso et al, ; Olayioye et al, ). Simultaneously persistent STATs activation is also noted in a variety of human cancers (Turkson and Jove, ). As many cellular genes regulating cell cycle and apoptosis, such as c-Myc, cyclin D and bcl-x are downstream targets of STAT3 and STAT5 (Buettner et al, ), it is reasonable to speculate that persistent signalling of STATs, particularly STAT3 and STAT5, may play a role in tumorigenesis of NPC.Although STAT1 activation has been reported in some tumours and cell lines, STAT1 activation is associated with tumour suppression rather than proliferation in most conditions (Buettner et al, ). In a recent study, activated STAT1 was also shown to negatively regulate angiogenesis, tumorigenicity and metastasis of tumour cells (Huang et al, ). STAT1 deficiency has also been found in a variety of tumour cell lines and this deficiency is responsible for the lack of INF-γ-mediated tumour suppression effects (Wong et al, ; Abril et al, ; Sun et al, ; Pansky et al, ). Therefore, it was not unexpected that constitutively activated STAT1 was found in only eight (.%) of the NPC specimens. In our study, only one of the patients suffering from disease recurrence had significant STAT1 activation.The presence of constitutively activated STAT5 and coactivation of STAT3 and STAT5 was correlated with better prognosis in this study. Using Cox's regression model, STAT5 was identified to be an independent prognosis-predicting factor. Although STAT3 was found in .% of these NPC patients, it is not an independent prognostic factor for survival. The lack of statistical significance for STAT3 might result from the frequent co-activation of STAT3 and STAT5, or the relative small number of patients in this series. It is also possible that STAT5 is truly the only determinant of better prognosis. The prognostic significance of each STATs in NPC deserves further investigation.In most conditions, activation of STAT3 or STAT5 up-regulates cell cycle progression and antiapoptotic genes in cells. Therefore, recognizing the constitutive activation of STAT5 as a good prognostic factor is out of our expectation. However, in a number of different studies, activated STATs have been reported to play a role in differentiation and apoptosis (Bromberg and Darnell, ). Activated STAT3 has been proposed to facilitate mammary gland involution by inducing extensive epithelial apoptosis through upregulating IGFBP- (Chapman et al, ). Transfection of a constitutively activated STAT5 mutant into an IL--dependent Ba/F3 cell line induces expression of bcl-xL and pim- and renders the cell line factor-independent. However, IL- treatment of the factor-independent cell line resulted in apoptosis within h, or differentiation followed by cell death. This apoptosis might have been due to the concomitant upregulation of JAB/SOCS-/SSI- and p21 by the super-active STAT5 signaling (Nosaka et al, ). Thus, differences in the fate of cells might be determined by the activation intensity and duration of specific STATs and may be cell-type specific. It has been shown that cellular STATs can also be activated through interactions between JAK3 and LMP- protein of EBV (Gires et al, ). LMP- can also upregulate expression of epidermal growth factor receptor (EGFR) (Miller et al, ), which may then modulate expression of specific STATs upon ligand stimulation (Petersen and Haldosen, ; Kloth et al, ; Leong et al, ). Interestingly, in line with our findings, despite the fact that LMP- of EBV is known for its transforming ability and promotes cellular proliferation in various studies (Baichwal and Sugden, ; Kaye et al, ), tumours with LMP- expression tend to have better prognosis in EBV-associated malignancies such as Hodgkin's disease (Montalban et al, ; Glavina-Durdov et al, ) and NPC (Hu et al, ). Regarding the intimate association between STATs and NPC, further clarification of the relation between STAT signalling and the gene expression pattern of EBV may shed light on the pathogenesis of this unique malignancy and might have future therapeutic applications.In conclusion, by using immunohistochemical methods, we demonstrated that constitutive activation of STAT3 and STAT5 was present in the majority of biopsy specimens from patients with NPC. Besides, constitutive coactivation of STAT3 and STAT5 was frequently noted in the same specimen. By Cox's regression analysis, activation of STAT5 is an independent factor that predicts better prognosis in NPC patients after radiotherapy.
|
PMC3004891.txt
|
TITLE: S. Typhimurium sseJ gene decreases the S. Typhi cytotoxicity toward cultured epithelial cells AUTHORS: A Nicole Trombert, Liliana Berrocal, Juan A Fuentes, Guido C Mora ABSTRACT: BackgroundSalmonella enterica serovar Typhi and Typhimurium are closely related serovars as indicated by >% DNA sequence identity between shared genes. Nevertheless, S. Typhi is a strictly human-specific pathogen causing a systemic disease, typhoid fever. In contrast, S. Typhimurium is a broad host range pathogen causing only a self-limited gastroenteritis in immunocompetent humans. We hypothesize that these differences have arisen because some genes are unique to each serovar either gained by horizontal gene transfer or by the loss of gene activity due to mutation, such as pseudogenes. S. Typhi has % of genes as pseudogenes, much more than S. Typhimurium which contains %. As a consequence, S. Typhi lacks several protein effectors implicated in invasion, proliferation and/or translocation by the type III secretion system that are fully functional proteins in S. Typhimurium. SseJ, one of these effectors, corresponds to an acyltransferase/lipase that participates in SCV biogenesis in human epithelial cell lines and is needed for full virulence of S. Typhimurium. In S. Typhi, sseJ is a pseudogene. Therefore, we suggest that sseJ inactivation in S. Typhi has an important role in the development of the systemic infection.ResultsWe investigated whether the S. Typhi trans-complemented with the functional sseJ gene from S. Typhimurium (STM) affects the cytotoxicity toward cultured cell lines. It was found that S. Typhi harbouring sseJSTM presents a similar cytotoxicity level and intracellular retention/proliferation of cultured epithelial cells (HT- or HEp-) as wild type S. Typhimurium. These phenotypes are significantly different from wild type S. TyphiConclusionsBased on our results we conclude that the mutation that inactivate the sseJ gene in S. Typhi resulted in evident changes in the behaviour of bacteria in contact with eukaryotic cells, plausibly contributing to the S. Typhi adaptation to the systemic infection in humans. BODY: BackgroundSalmonella enterica serovar Typhi (S. Typhi) is a human-restricted pathogen that causes enteric fever or typhoid. Salmonella enterica serovar Typhimurium (S. Typhimurium) is considered a broad host range pathogen that causes gastroenteritis in several warm-blooded animals such as calves and humans, but produces a typhoid-like systemic infection in mice [-]. Although the mechanism by which serovar Typhimurium causes gastroenteritis is well studied, less is known about the pathogenesis of the serovar Typhi. One limitation to the study of typhoid fever is the absence of a good animal model. For this reason, although the S. Typhimurium - mouse model has been used to infer S. Typhi important virulence mechanisms by the expression of S. Typhi genes in S. Typhimurium, the information derived from infection of mice is limited mainly because the virulence factors are tested in an heterologous system. Furthermore, S. Typhimurium does not cause typhoid in humans, suggesting that genetic differences between both serovars are crucial for disease development.The evolution of a broad host pathogen, such as S. Typhimurium, to a host-restricted pathogen, such as S. Typhi, might have occurred by (i) the acquisition of genetic material through horizontal gene transfer, (ii) genome degradation (i.e., the loss of genetic information by deletion or pseudogene formation) or (iii) a combination of both of these mechanisms [,]. The acquisition and persistence of DNA segments containing genes with pathogenicity or virulence functions (i.e., pathogenicity islands) will depend on the advantage they confer to the pathogen infectious cycle. Thus, bacteria with a great ability to colonise different environments, such as Pseudomonas aeruginosa, generally have larger genomes than those that survive in restricted niches [].The phenomenon by which a microorganism becomes adapted to its host involves the loss of genetic functions resulting in pseudogene generation, a process termed "reductive evolution". This process has been observed in human-adapted pathogens such as Shigella flexneri, Mycobacterium leprae and Salmonella Typhi [,]. For example, the loss of the ompT gene in Shigella confers a virulent phenotype by allowing bacteria to transmigrate across eukaryotic cells [,]. In the case of Salmonella, some serovars have accumulated mutations that enhance their survival within their respective hosts. For example the poultry-adapted S. Pullorum and S. Gallinarum serovars are non-motile because they have a point mutation in the flgK gene [,]. When S. Enteritidis and S. Typhimurium are isolated from infected poultry, these bacteria are frequently non-motile, suggesting that the niche occupied in birds can select against flagellation []. These non-motile S. Typhimurium strains have been shown to be non-virulent when used to infect mice. Thus, in the S. enterica, the adaptation to a particular vertebrate host seems to drive the loss of virulence factors for some serovars. The result of this adaptation may contribute to the narrowing of the host range and to the development of host specificity [].S. Typhi is an intracellular facultative pathogen that contains over pseudogenes, nearly % of its whole genome [,]. Several of the mutations that gave rise to these pseudogenes occur in systems related to pathogenicity mechanisms. For example, the S. Typhimurium sseJ gene encodes an effector protein regulated by Salmonella pathogenicity island (SPI-) [,]. SPI- regulated genes are related to bacterial intracellular trafficking and proliferation, and encode a protein complex known as the type III secretion system (T3SS). The T3SS mediates the injection of effector proteins from bacteria into eukaryotic cells [-]. These effector proteins modulate the S. Typhimurium endocytic pathway and allow the establishment of bacteria in a specialised vacuole termed the Salmonella-containing vacuole (SCV) []. Late stages of SCV synthesis include the formation of tubular membrane extensions known as Salmonella-induced filaments (Sifs). Sifs are thought to result from the fusion of late endocytic compartments with the SCV and their formation requires at least five SPI--dependent effectors: SifA, SseF, SseG, SopD2 and SseJ [-]. In this context, S. Typhimurium sseJ encodes an acyltransferase/lipase that participates in SCV biogenesis in human epithelial cell lines [,-]. The coordination of SseJ and SifA is required for bacterial intracellular proliferation []. Some studies have shown that SseJ is needed for full virulence of S. Typhimurium in mice and for proliferation within human culture cells [].S. Typhi lacks several effector proteins that are crucial for the pathogenicity of the generalist serovar S. Typhimurium []. The absence of these proteins could contribute to the specificity of the human-restricted serovars, and could play a role in evolutionary adaptation. In S. Typhi, sseJ is considered a pseudogene. In this work, we studied the effect of trans-complementing S. Typhi with the S. Typhimurium sseJ gene and assessed the phenotype in human cell lines. Our results show that the presence of the sseJ gene induces phenotypic changes in cytotoxicity and in intracellular proliferation of S. Typhi in human epithelial cell lines. Our results suggest that the loss of SseJ function contributes to the development of a systemic infection in S. Typhi.ResultssseJ is a pseudogene in S. TyphiTo assess whether the sseJ locus is a pseudogene in the serovar Typhi, we compared the available sequences of S. Typhi Ty2, S. Typhi CT18 and S. Typhimurium LT2 [,,]. We observed that the sequence corresponding to sseJ in S. Typhi is a ' partial remnant of bp, in contrast with the complete ORF found in S. Typhimurium ( bp). In order to corroborate these bioinformatics results, we designed a PCR assay with two sets of primers. The primers SseJ1Tym + SseJ2Tym yield a bp amplicon only when sseJ is complete, while the primers SseJRT1 + SseJRT2 yield a bp amplicon if the ' sseJ locus is present (Figure ). As shown in Table we observed a PCR product with the SseJRT1 + SseJRT2 primers in all the strains tested, including the reference strains (S. Typhi CT18, S. Typhi Ty2 and S. Typhimurium LT2) and S. Typhi clinical strains obtained from Chilean patients (STH collection). Nevertheless, we observed a PCR amplicon with the SseJ1Tym + SseJ2Tym primers only when the S. Typhimurium genomic DNA was used as template, strongly suggesting that the sseJ gene is an incomplete gene (i.e., a pseudogene) not only in the S. Typhi Ty2 and CT18 strains, but in all the Typhi clinical strains tested. To independently assess this hypothesis, we performed a Southern blot using the bp amplicon as a specific probe (Figure ). The annealing of the probe with the EcoRV digested genome of S. Typhimurium yielded a bp fragment, while in S. Typhi, we observed a bp fragment. As shown in Figure our data indicated that the presence of the pseudogene in S. Typhi CT18 is conserved in the S. Typhi clinical collection (STH). Therefore, the sseJ pseudogene seems to be a feature in serovar Typhi that distinguishes it from the serovar Typhimurium. S. Typhi STH007 presents no hibridisation with the probe, showing that this strain presents a larger deletion in the sseJ locus compared with other strains tested. S. Typhi STH2370 showed a slightly larger fragment than the other S. Typhi clinical strains presumably because of point mutations that changed the EcoRV restriction sites. Therefore, serovar Typhi has a genetic mutation in sseJ gene correlating with the previous studies made in strain CT18. We reasoned that the sseJ gene in the serovar Typhi is inactivated.Table 1PCR and Southern blot analysis of sseJ gene in S. Typhimurium vs. S. Typhi isolatesStrainPCR1460 bpPCR127 bpStrainsSerovar TyphimuriumATCC14028s++LT2++Serovar TyphiSTH2370-+STH001-+STH004-+STH005-+STH006-+STH007-+STH008-+STH009-+Ty2-+Figure 1Genomic organization of sseJ in S. Typhi and S. Typhimurium. The figure shows the annealing localization of the primers designed (small arrows), the recognition sites of EcoRV and the sseJ probe hibridisation site (thick black line labelled bp for S. Typhimurium and bp for S. Typhi). The data were obtained from S. Typhi CT18 and S. Typhimurium LT2 genomes, available in public databases www.ncbi.nih.gov.Figure 2Southern blot analysis of sseJ in S. Typhimurium and S. Typhi strain collection. Genomic DNA digested with EcoRV was electrophoresed on an agarose gel and analyzed by Southern. Bands correspond to S. Typhimurium sseJ gene (. Kb) or S. Typhi sseJ pseudogene (. Kb).S. Typhi harbouring the S. Typhimurium sseJ gene exhibits a decreased disruption of HT- polarised monolayersIf the loss of SseJ function in S. Typhi is advantageous for the interaction of bacteria with host cells, we should observe that wild type S. Typhi will present a different behaviour than the S. Typhi harbouring the S. Typhimurium sseJ gene when they are in contact with eukaryotic cells. This hypothesis was first tested by infecting polarised HT- monolayers with the strains under study using a modified transepithelial migration assay that included addition of gentamicin (after h of infection, see Materials and Methods) into the upper chamber (black arrow, Figure ). As shown in Figure the recovered CFU × ml- represented the bacteria which migrated to the lower chamber and survived the presence of the gentamicin that passed through the cell monolayer. If the integrity of the monolayer is disrupted by bacteria, gentamicin will leak through the lower chamber decreasing the recovered CFU × ml-. If the monolayer is not disrupted, the recovered CFU × ml- should remain essentially constant over the same time course. As observed in Figure the recovered CFU × ml- corresponding to S. Typhimurium 14028s presented a slight decline over the time course of the assay (white diamonds), suggesting that the monolayer integrity is not largely affected by bacteria. In contrast, the CFU × ml- of S. Typhi STH2370 recovered from the lower chamber abruptly decreased until they became undetectable, strongly suggesting that the gentamicin leaked into the lower chamber due to a monolayer disruption (black squares). When S. Typhi were complemented with the S. Typhimurium sseJ gene (sseJSTM) (in the pNT005 plasmid, see Materials and Methods), and used to infect the monolayer, we observed that the corresponding recovered CFU × ml- remained essentially constant, marking a sharp difference with the otherwise isogenic wild type strain and highly resembling the S. Typhimurium phenotype (compare the white diamonds and black triangles).Figure 3Cell permeability assay of S. Typhi and S. Typhimurium through H-T29 human cell line monolayers. (White diamonds) S. Typhimurium 14028s, (black squares) S. Typhi STH2370, (black triangles) S. Typhi STH2370/pNT005. The arrow indicates the time at which gentamicin was added. The results represent the average of three independent experiments. Each experiment was performed in duplicate. The values are expressed as the means ± SD of three independent experiments (asterisks represent p < .). The CFU × ml- numbers from infected cells with S. Typhi carrying empty plasmid (pSU19 or pCC1) showed no differences with respect to the wild type strain (data not shown).In order to independently assess whether S. Typhi harbouring the S. Typhimurium sseJ gene shows a decreased disruptive effect toward cultured cell monolayers than the wild type S. Typhi, we measured the transepithelial electrical resistance (TER). TER is a measure of the movement of ions across the paracellular pathway. Measurement of TER across cells grown on permeable membranes can provide an indirect assessment of tight junction establishment, stability and monolayer integrity []. As shown in Figure after h of infection wild type S. Typhi efficiently disrupted the monolayer as inferred by the lower TER measured compared with the control without bacteria. However, when HT- cells were infected with S. Typhi/pNT005, TER values were similar to those obtained with S. Typhimurium 14028s. This result indicates that S. Typhi/pNT005 was less disruptive on the monolayer than S. Typhi wild type, supporting the result shown in Figure . To discard a possible gene dosage effect by the vector copy number, we infected cells with S. Typhi/pNT006 (complemented with a single-copy vector harbouring sseJSTM) and the TER obtained was similar to that of S. Typhi/pNT005. This result demonstrated that the effect on cell permeability was due to the presence of sseJSTM and not to an artifact produced by gene dosage.Figure 4The presence of the sseJ gene in S. Typhi promotes the disruption of the epithelial monolayer. HT- cells were grown in transwells for - days. Polarised HT- cells were apically infected with the wild type S. Typhi or the respective complemented strains. TER h post-infection reported as a percentage of the initial TER value and is expressed as the means ± SD of three different experiments, each performed in duplicate. The percentages of TER values from cells infected with S. Typhi carrying each empty plasmid (pSU19 or pCC1) showed no differences with respect the wild type strain (data not shown).S. Typhi harbouring sseJSTM was less cytotoxic than wild type S. TyphiKops et al. demonstrated that S. Typhi Ty2 causes rapid death of some C2BBe cells in monolayers []. Because cell monolayer permeability may be increased due to cell death during infection, we wanted to assess whether the presence of sseJSTM in S. Typhi contributes to decrease cytotoxicity, as the results of the Figure and strongly suggest. Cell membrane damage due to cytotoxicity leads to the release of cytoplasmic enzymes, and the measurement of lactate dehydrogenase (LDH) release is a well-accepted assay to estimate cell membrane integrity and quantify cell cytotoxicity [,]. Then, the LDH release induced by S. Typhimurium, S. Typhi, S. Typhi/pNT005 or S. Typhi/pNT006 was compared. As shown in Figure we found that wild type S. Typhi STH2370 was the most cytotoxic strain among all bacteria tested. This result suggests that the SseJ effector protein decreased S. Typhi cytoxicity when bacteria interact with human cell lines, resulting in increased cell permeability.Figure 5Analyses of cytotoxicity HT- infected with complemented and wild type S. Typhi strains. HT- cells were grown in transwells for - days. Polarised HT- cells were apically infected with the S. Typhi wild type or the respective complemented strains. Released LDH was measured h post-infection and reported as percentage relative to the S. Typhi wild type. The values correspond to the means ± SD of three independent experiments, each performed in duplicate. The percentages of each S. Typhimurium 14028s, S. Typhi STH2370/pNT005 and S. Typhi STH2370/pNT006, have significantly differences respect S. Typhi STH2370 wild type. LDH release from infected cells with S. Typhi carrying empty plasmid (pSU19 or pCC1) showed no differences with respect to the wild type strain (data not shown).The presence of sseJSTM in S. Typhi increased bacterial intracellular retention/proliferation within HEp- cellsIt has been reported that sseJ contributes to the intracellular proliferation of S. Typhimurium [,]. Moreover, the decreased cell death produced by the presence of sseJSTM in S. Typhi strains (Figure ) may lead to an increased proliferation of intracellular bacteria because of a decreased cytotoxicity. A less cytotoxic pathogen should be retained inside eukaryotic cells over time, allowing an increased bacterial proliferation. If this hypothesis is correct, S. Typhi carrying sseJSTM should exhibit increased CFUs in the gentamicin protection assay (see Materials and Methods). As expected, Figure shows that the presence of sseJSTM yielded a significantly increase in the CFUs recovered from the infected cells compared to the wild type.Figure 6Gentamicin protection assay of complemented and wild type strains of S. Typhi. HEp- cells were grown and infected with the S. Typhimurium 14028s, S. Typhi STH2370 or the respective S. Typhi complemented strains. The recovered CFUs were counted h post-infection. The values correspond to the means ± SD of three different experiments, each performed in triplicate. The CFUs recovered from infected cells with S. Typhi with each empty plasmid (pSU19 or pCC1) showed no differences with respect to the wild type strain (data not shown).DiscussionIn the process of adaptation to humans, genes no longer compatible with the lifestyle of S. Typhi within the host were selectively inactivated. These inactivated genes are called "antivirulence genes" and their loss of function results in the adaptation to a given host []. S. Typhi is a facultative bacterial pathogen that has accumulated a high number of pseudogenes (approximately % of the genome) and over % of them have completely lost their functions [,]. When compared with the genome of free-living organisms, facultative pathogens harbour several pseudogenes and a population structure that promotes the maintenance of the mutations. In this context, S. Typhi represents an intermediate step between obligate bacterial parasites and free living bacteria, exhibiting some genome erosion directed to inactivate and lose detrimental or non-essential functions for their environment (i.e. host) []. Thus, we hypothesized that the loss of some of these genes contributed to the adaptation of S. Typhi to the systemic infection.Our results suggest that the loss of the fully functional SseJ protein in S. Typhi contributed to the adaptation to the systemic infection by increasing bacterial cytotoxicity in epithelial cells. The increased cytotoxicity presented by S. Typhi compared with S. Typhimurium is not only related to the loss of functions, as we showed here with the sseJ pseudogene; but also to the acquisition of new functions. It has been reported that S. Typhi presents a pathogenicity island (named SPI-) that harbours hlyE. The hlyE gene encodes a cytolysin that has proved to be cytotoxic toward different cell types [-]. SPI- is shared by other Salmonella enterica serovars that have been shown to cause systemic infections in humans, but is absent from S. Typhimurium []. In addition, the functional transfer of the S. Typhi hlyE gene to S. Typhimurium promotes deep organ infection in mice []. All this evidence suggests that S. Typhi has been selected for an increased cytotoxicity inside its host in order to perform a successful systemic infection. Thus, an increased cytotoxicity toward the epithelial barrier may guarantee the development of a deeper infection and a decreased retention inside epithelial cells at the bacterial entry point.On the other hand, the presence of the sseJSTM gene in S. Typhi significantly enhances the retention time within epithelial cells and/or the intracellular proliferation as we showed in Figure in agreement with previous reports that indicate that SseJ enzymatic activitycontributes to intracellular replication in host tissues [,]. Accordingly, it is possible that the sseJ loss of function was selected in S. Typhi in order to promote a decreased retention/proliferation of bacteria inside the eukaryotic cells. It is known that the intracellular proliferation is essential for the virulence of S. Typhimurium []. Nevertheless, recent studies revealed that the magnitude of the CD8+ T cell response correlates directly to the intracellular proliferation in Salmonella enterica, showing that a reduced intracellular proliferation limits antigen presentation and development of a rapid CD8+ T cell response, indicating that reduced intracellular proliferation of virulent pathogens may be an important mechanism of immune evasion. []. Accordingly, Salmonella presents several responses directed to downregulate the intracellular proliferation, reinforcing the concept that a state of low proliferation within the host cell is strategy to enhance virulence in a determined niche []. Actually, it has been shown that Salmonella expands its population in the liver by increasing the number of infection foci rather than undergoing massive intracellular growth in individual host cells, where the bacterial spreading from the initial infection foci to nearby cells may be facilitated by inducing cytotoxic effects in the infected cells [,].How sseJSTM reduces the cytotoxicity in S. Typhi is not clear. It is known that the lipid imbalance associated to the presence of lipid alcohols, fatty acid and sterols is related to cytotoxicity and apoptosis [,]. Any process that limits the accumulation of these species is likely to be cytoprotective []. One such process involves the presence of different acyltransferase gene families that generate neutral lipids or steryl esters from these lipid alcohols []. SseJ, that presents glycerophospholipid: cholesterol acyltransferase (GCAT) activity in eukaryotic cells [], might plausibly contribute to the reduction of the lipid-associated cytoxicity. The precise mechanisms underlying this process is unknown, but one possibility is that the presence of sseJSTM in S. Typhi is affecting the lipid remodelling in the infected cells, in turn reducing the cytotoxicity.All our results together suggest that the loss of the sseJ gene in S. Typhi contributed to the adaptation to the systemic infection by increasing the bacterial-induced cytotoxicity and by decreasing the retention/proliferation inside the epithelial cells.ConclusionsBased on our results we conclude that the mutation that inactivate the sseJ gene in S. Typhi resulted in evident changes in the behaviour of bacteria in contact with eukaryotic cells, plausibly contributing to the S. Typhi adaptation to the systemic infection in humans.MethodsBacterial strains, media and growth conditionsThe S. Typhi and S. Typhimurium strains used in this study are described in Table . Strains were routinely grown in Luria-Bertani (LB) medium (Bacto Tryptone g × l-; Bacto Yeast Extract g × l-, NaCl g × l-) at °C, with vigorous shaking, or anaerobically by adding an overlay of μl of sterile mineral oil as a barrier to oxygen prior to invasion assays with cultured human cells. When required, the medium was supplemented with antibiotics at the following concentrations: chloramphenicol μg × ml-, ampicillin μg × ml- and kanamycin μg × ml-. Media were solidified by the addition of agar ( g × l- Bacto agar).Table 2Bacteria strains and plasmids used in this studyStrain or plasmidRelevant characteristicReference or SourceStrainsSerovar TyphimuriumATCC14028sWild-type strain, virulentATCCLT2Wild-type strainS. MaloySerovar TyphiSTH2370Clinical strain, virulentHospital Dr Lucio CórdovaSTH001Clinical strain, virulentHospital Dr Lucio CórdovaSTH004Clinical strain, virulentHospital Dr Lucio CórdovaSTH005Clinical strain, virulentHospital Dr Lucio CórdovaSTH006Clinical strain, virulentHospital Dr Lucio CórdovaSTH007Clinical strain, virulentHospital Dr Lucio CórdovaSTH008Clinical strain, virulentHospital Dr Lucio CórdovaSTH009Clinical strain, virulentHospital Dr Lucio CórdovaTy2Wild-type strainInstituto de Salud PúblicaPlasmidspGEM-TeasyHigh-copy-number cloning vectorPromegapCC1Single-copy vector, F plasmid derivedStratagenepNT002pGEM-Teasy carrying the S. Typhimurium sseJ geneThis workpSU19Medium-copy-number cloning vector[]pNT005pSU19 carrying the S. Typhimurium sseJ geneThis workpNT006pCC1 carrying the S. Typhimurium sseJ geneThis workConstruction of plasmidsThe sseJ PCR product was initially cloned into pGEM-T Easy (Promega) to yield plasmid pNT002, and the presence of the gene was confirmed by PCR amplification and restriction endonuclease assays. The DNA fragment containing the sseJ gene was obtained from pNT002 and cloned into the EcoRI site of the medium-copy number vector pSU19 [] to yield the plasmid pNT005. The presence of the gene and its promoter region was confirmed in all plasmids by PCR amplification and restriction endonuclease analyses. The PCR product was directly cloned in the pCC1 vector according to manufacturer's instructions (CopyControl™ PCR Cloning Kit, Stratagene) to yield the plasmid pNT006. The expression of sseJ gene from each plasmid was confirmed by Western blotting (data not shown).Bioinformatic analysesComparative sequence analyses were made with the complete genome sequences of S. enterica serovar Typhi strains CT18 (GenBank: AL627270.) and Ty2 (GenBank: AL513382), serovar Typhimurium LT2 (GenBank: AE006468.). The sequences were analyzed using the BLAST, alignment, and phylogeny tools available at http://www.ncbi.nlm.nih.gov/ and by visual inspection to improve alignments.PCR amplificationPCR amplifications were performed using an Eppendorf thermal cycler and Taq DNA polymerase (Invitrogen Cat. N° -). Reaction mixtures contained × PCR buffer, . mM MgCl2, each dNTP ( mM), primers ( mM), ng of template DNA, and U polymerase. Standard conditions for amplification were cycles at °C for seconds, °C for min and °C for min seconds, followed by a final extension step at °C for min. Template S. Typhi chromosomal DNA was prepared as described []. Primers SseJ1Tym (CATTGTATGTATTTTATTGGCGACG) and SseJ2Tym (AATCGGCAGCAAAGATAGCA) were used to amplify bp, and were designed from the S. Typhimurium LT2 sseJ reported sequence. The conditions for amplification of bp were cycles at °C for seconds, °C for seconds and °C for min, followed by a final extension step at °C for min. Primers SseJRT1 (GCTAAAGACCCTCAGCTAGA) and SseJRT2 (CAGTGGAATAATGATGAGCT) were designed from the S. Typhimurium LT2 sseJ reported sequence.Southern hybridisationsHybridisation probes for sseJ were generated by PCR amplification and were purified and labelled using the Detector™ Random Primer DNA Biotinylation Kit (KPL). Genomic DNA from Salmonella serovars was prepared as described by Maloy [], cleaved with EcoRV (Invitrogen) and the fragments were resolved on a .% agarose gel. The DNA was then transferred to a nylon membrane and cross-linked by UV irradiation. Hybridisation was performed according to the protocol described in the chemiluminescent system, using a DNA Detector™ HRP Southern Blotting Kit (KPL) and Kodak XAR- film.Cell permeability assayWe used an in vitro assay modified from the method described by McCormick []. Briefly, the colon carcinoma HT- cell line was grown to confluence (- days) on . μm pore-size filters ("transwells", Millicell®, Millipore) with glucose-free RPMI (Gibco). Each transwell was inoculated individually to the apical surface with μl of approximately × CFU ml- of bacterial cultures and immediately incubated for min at °C. After extensive washing with sterile PBS (NaCl .% w/v; KCl .% w/v; Na2HPO4 2H2O .% w/v; KH2PO4 .% w/v), the extracellular bacteria were killed by treatment of monolayers with gentamicin ( μg × ml-). Immediately after gentamicin treatment, the medium from basal compartment of the epithelial cell monolayer was collected and plated for colony forming units (CFU) to assess the number of bacteria that passed through the cell monolayer. The polarisation of cells was confirmed by transepithelial electrical resistance (TER) and transmission electron microscopy (data not shown).Transepithelial electrical resistanceTER was used to monitor changes in epithelial cell culture integrity. TER in HT- enterocytes was studied using an EVOM electrode (World Precision Instruments). The enterocytes were grown to confluence (- days) on . μm pore-size filters ("transwells", Millicell®, Millipore). The electrical resistance readings were recorded after subtracting the average resistance of two membranes in the absence of enterocytes at the beginning of the assay (t0) and h post-infection (t1). Controls included the incubation of the cells with EDTA and Triton X- (% PBS). The reading was expressed as percentages and calculated as follows:%TER(1h)=×(TER t0×TER t1−)We verified the HT- polarisation by TER and transmission electron microscopy.LDH Cytotoxicity AssayCytotoxicity of infected HT- cells was assayed using a lactate dehydrogenase (LDH) Kit (Valtek), which measures the extracellular release of LDH into the media by dead cells, according to the manufacturer's instructions. The absorbance values of treated cells were expressed as a percentage relative to the wild type S. Typhi after correcting for background from media without cells at nm.Gentamicin protection AssayTo measure bacterial invasion, the method described by Lissner [] and modified by Contreras [] was used. Briefly, HEp- monolayers ( × cells/well) were grown at °C in a % CO2/% air mixture in RPMIFS (RPMI medium supplemented with % fetal bovine serum pre-treated for min at °C). The tested bacterial strains were grown anaerobically to mid-exponential phase and then harvested by centrifugation prior to infect the monolayers in -well microtiter plates at a multiplicity of infection of :. After incubation of h to allow bacterial entry into the cells, monolayers were washed twice with phosphate-buffered saline (PBS), and μL of RPMI containing gentamicin ( μg × ml-) was added to each well. The plates were then incubated for h to kill any remaining extracellular bacteria. In the case of the strains carrying vectors, the medium was supplemented additionally with chloramphenicol during the entire assay. The medium was removed and cells were washed twice with PBS. Then, the cells were lysed with sodium deoxycholate (.% w/v, in PBS). The number of intracellular bacteria (CFU at t3) was determined plating onto LB agar plates with chloramphenicol (the strains carrying plasmid) or without antibiotic (the wild type strains). Quantitative invasion assay values were calculated as follows: h post infection index=×(intracellular CFU mL−1at t3×CFU mL−1added)StatisticsAll results are expressed as means ± SD of an individual experiment performed in triplicate. P values were calculated according to Student's t-test, and values p < . or p < . were considered statistically significant.Authors' contributionsAT: designed the studies, performed the experiments and wrote the manuscript; LB: performed the transepithelial electrical resistance experiment, contributing significantly in the development of the other experiments and in the preparation of manuscript; JAF: participated in writing the paper; GCM: designed the studies and participated in the revision of the manuscript. All authors read and approved the final manuscript.
|
End of preview. Expand
in Data Studio
No dataset card yet
- Downloads last month
- -