text stringlengths 152 505k | id stringlengths 47 47 | dump stringclasses 95
values | url stringlengths 13 1.01k | date stringlengths 20 20 | file_path stringlengths 125 155 | language stringclasses 1
value | language_score float64 0.65 1 | token_count int64 40 127k |
|---|---|---|---|---|---|---|---|---|
For the second quarter Ultra Petroleum reported earnings of 52 cents a share, missing the Capital IQ Consensus Estimate of 53 cents a share by 1 cent. Revenue rose 13.3% from the year-ago quarter to $296.1 million, above analysts' estimates of $273.95 million.
The company produced 58.5 billion cubic feet equivalent (Bcfe) of natural gas and oil in the quarter. Ultra Petroleum expects production of 60 Bcfe to 62 Bcfe for the third quarter, and 243 Bcfe to 250Bcfe for the full year.
Must read: Warren Buffett's 25 Favorite StocksSTOCKS TO BUY: TheStreet Quant Ratings has identified a handful of stocks that can potentially TRIPLE in the next 12 months. Learn more. TheStreet Ratings team rates ULTRA PETROLEUM CORP as a Hold with a ratings score of C. TheStreet Ratings Team has this to say about their recommendation: "We rate ULTRA PETROLEUM CORP (UPL) a HOLD. The primary factors that have impacted our rating are mixed ? some indicating strength, some showing weaknesses, with little evidence to justify the expectation of either a positive or negative performance for this stock relative to most other stocks. The company's strengths can be seen in multiple areas, such as its revenue growth, expanding profit margins and good cash flow from operations. However, as a counter to these strengths, we find that the growth in the company's earnings per share has not been good." UPL data by YCharts STOCKS TO BUY: TheStreet Quant Ratings has identified a handful of stocks that can potentially TRIPLE in the next 12 months. Learn more.
Check Out Our Best Services for Investors
- $2.5+ million portfolio
- Large-cap and dividend focus
- Intraday trade alerts from Cramer
Access the tool that DOMINATES the Russell 2000 and the S&P 500.
- Buy, hold, or sell recommendations for over 4,300 stocks
- Unlimited research reports on your favorite stocks
- A custom stock screener
- Model portfolio
- Stocks trading below $10
- Intraday trade alerts | <urn:uuid:544925a7-a67b-4ca2-b58c-9b3dbe51ea21> | CC-MAIN-2014-42 | http://www.thestreet.com/story/12828964/1/why-ultra-petroleum-upl-stock-is-down-today.html?cm_ven=RSSFeed | 2014-10-22T13:02:09Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507446943.4/warc/CC-MAIN-20141017005726-00210-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.911836 | 457 |
FAST will present a new publication on the acceleration of migrations in virtual environments at the 11th Workshop on Virtualization in High-Performance Cloud Computing (VHPC). The VHPC workshop will be held on 23/6/2016 in Frankfurt, Germany, in conjunction with the International Supercomputing Conference - High Performance 2016 (ISC).
Title: Accelerating Application Migration in HPC
Authors: Ramy Gad, Simon Pickartz, Tim Süß, Lars Nagel, Stefan Lankes, André Brinkmann
Abstract: It is predicted that the number of cores per node will rapidly increase with the upcoming era of exascale supercomputers. As a result, multiple applications will have to share one node and compete for the (often scarce) resources available on this node. Furthermore, the growing number of hardware components causes a decrease in the mean time between failures. Application migration between nodes has been proposed as a tool to mitigate these two problems: Bottlenecks due to resource sharing can be addressed by load balancing schemes which migrate applications; and hardware errors can often be tolerated by the system if faulty nodes are detected and processes are migrated ahead of time.
VM migration currently seems to be the most promising technique for such approaches as it provides a strong level of isolation. However, the migration time of virtual machines is higher than the respective migration time on the process level. This can be explained by the additional virtualization layer in the memory hierarchy.
In this paper, we propose a technique for the acceleration of VM migration. We take advantage of the fact that freed memory regions within the guest system are not recognized by the hypervisor. Therefore, we fill them with zeros such that zero-page detection and compression can work more efficiently. We demonstrate that the approach reduces migration time by up to 8% with a negligible overhead for some applications. | <urn:uuid:41aae818-0ce4-47bc-8bf4-f523d9fc5907> | CC-MAIN-2021-25 | https://www.en.fast-project.de/2016/06/09/309/ | 2021-06-17T04:39:08Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487629209.28/warc/CC-MAIN-20210617041347-20210617071347-00598.warc.gz | en | 0.921977 | 378 |
It’s not just men that want to look great and be protected from the elements and road rash while riding their motorcycles. Women want something just as durable, functional, and perhaps even more stylish. This is where Schott leather motorcycle jackets for women come in. Schott NYC is one of the oldest American motorcycle gear companies. Started in 1913, they have had their hand in every major motorcycle fashion trend, from the flight and bomber jackets of the early forties, to the sleek, modern pieces that are popular today. Made with only quality, premium leathers and the best accents, these jackets are not just stylish, they are a true part of American history.
Brothers Jack and Irving Schott changed the way jackets are made by introducing a metal zipper to their jackets. The Perfecto jacket, one of the first designs to be made with a zipper, was popularized by the 1953 movie The Wild One, which embodied the spirt of American motorcycle aficionados. For more than a hundred years, Schott has been the standard against which all other leathers are judged, and for good reason. Schott’s leather motorcycle jackets for women come in a range of styles, colors, and materials, so every rider can find something that suits her perfectly, whether she prefers a stylish, vintage piece or an updated, sleek jacket. | <urn:uuid:44e1197b-5a0e-4421-a48f-a60afd4bd022> | CC-MAIN-2020-50 | https://bikersden.com/leather-motorcycle-gear/leather-motorcycle-jackets/womens-leather-motorcycle-jackets/schott-nyc-jackets-for-women/ | 2020-12-01T17:39:01Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141681209.60/warc/CC-MAIN-20201201170219-20201201200219-00677.warc.gz | en | 0.967064 | 273 |
TREAT ‘What to measure’ – eDelphi exercise and consensus meeting
As a first step on our journey, we recently conducted an international eDelphi exercise and a consensus meeting among 410 dermatologists, nurses, non-clinical researchers involved in AE, pharmaceutical industry representatives, regulatory body representatives and patients from 36 countries, including members of the International Eczema Council (IEC), the European Taskforce for Atopic Dermatitis (ETFAD), and the International Society for Atopic Dermatitis (ISAD). The study identified a final core set containing 19 domains with 69 domain items to be captured by national AE systemic therapy registries (Gerbens et al., 2017; Gerbens et al., 2018).
TREAT ‘How to measure’ – consensus meetings
Further work has been performed to define how these 68 domains and domain items should be measured. Three round table consensus meetings have taken place in London (27th March 2017), Amsterdam (15th May 2017) and Nantes (12th June 2017). The paper summarising the results will be published soon.
This short web-based survey aims to collect data on current therapeutic approaches for adult patients with moderate-to-severe AE and factors that influence the choice of therapy. The survey will complement our previous European and North American surveys (Proudfoot et al., 2013; Taylor et al., 2016; Totri et al., 2017).
TREAT national registries
See Spuls et al., 2017. Several national registries are currently ongoing or in the development phase. The best-practice guidelines of the European Commission funded PAtient REgistries iNiTiative joint action (PARENT JA) will be taken into account (Zaletel and Kralj, 2015).
Eligible patients will be children and adults diagnosed with AE who are starting on photo- or systemic immuno-modulatory therapy (conventional immuno-suppressive therapies as well as new biologics), taking into account the national and local eligibility criteria for these specific therapies. Patients receiving intensive topical therapy or screen failures for systemic therapy may also be included. Patients will be followed independently of stopping therapy or subsequent switch to other therapies. | <urn:uuid:92273351-7e6b-4a4d-9298-0867838614de> | CC-MAIN-2018-43 | https://treat-registry-taskforce.org/projects/ | 2018-10-22T03:02:08Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583514497.14/warc/CC-MAIN-20181022025852-20181022051352-00085.warc.gz | en | 0.888415 | 455 |
Smoker Keirran Francis was shocked when his electronic cigarette exploded as it was being charged.
Hundreds of pounds of damage were caused when the £15 device started a fire in the 22-year-old’s kitchen.
Keirran said yesterday: “It was lucky I was in the house, I am shocked.”
He put out the blaze at Neath, near Swansea, where he was eating with his girlfriend and her son aged four.
Fire safety officer Steve Davies said: “When charging e-cigarettes, don’t leave them unattended for long.” | <urn:uuid:b6409c7d-97f1-495f-b533-9b8aa1445b4b> | CC-MAIN-2014-52 | http://www.mirror.co.uk/news/uk-news/e-cigarette-explosion-sparks-house-fire-3144031 | 2014-12-27T01:11:36Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1419447550067.67/warc/CC-MAIN-20141224185910-00055-ip-10-231-17-201.ec2.internal.warc.gz | en | 0.992144 | 126 |
As Africa's third-largest producer of the commodity, Libya is in the midst of attempting to repel anti-government protests of the sort that earlier this month sacked the Hosni Mubarak, the former leader of Egypt, Libya's easterly neighbor. Muammar Gadhafi, who has held the reigns of power in Tripoli for the past 42 years, has vowed to remain and not bend to the will of protestors.
"We need to have a bit more clarity on how bad this oil situation could become," David Kelly, chief market strategist at JPMorgan Funds in New York, told Bloomberg.
Shortly before noon on Thursday, Brent crude oil futures were up 2.62 percent, a $2.91 increase to $114.16 per barrel.
"Fear itself in the oil markets is a very dangerous thing," Kelly told the news service. "In the long run, I don't see the world oil production being affected. If what's going on isn't enough to derail what seems to be a strengthening U.S. expansion, then, it's just a minor correction, not another bear market."
This material is conveyed as a solicitation for entering into a derivatives transaction.
This material has been prepared by a Daniels Trading broker who provides research market commentary and trade recommendations as part of his or her solicitation for accounts and solicitation for trades; however, Daniels Trading does not maintain a research department as defined in CFTC Rule 1.71. Daniels Trading, its principals, brokers and employees may trade in derivatives for their own accounts or for the accounts of others. Due to various factors (such as risk tolerance, margin requirements, trading objectives, short term vs. long term strategies, technical vs. fundamental market analysis, and other factors) such trading may result in the initiation or liquidation of positions that are different from or contrary to the opinions and recommendations contained therein.
Past performance is not necessarily indicative of future performance. The risk of loss in trading futures contracts or commodity options can be substantial, and therefore investors should understand the risks involved in taking leveraged positions and must assume responsibility for the risks associated with such investments and for their results.
Trade recommendations and profit/loss calculations may not include commissions and fees. Please consult your broker for details based on your trading arrangement and commission setup.
You should carefully consider whether such trading is suitable for you in light of your circumstances and financial resources. You should read the "risk disclosure" webpage accessed at www.DanielsTrading.com at the bottom of the homepage. Daniels Trading is not affiliated with nor does it endorse any third-party trading system, newsletter or other similar service. Daniels Trading does not guarantee or verify any performance claims made by such systems or service. | <urn:uuid:703dd2d7-f94e-4d94-b004-56d04565d9c3> | CC-MAIN-2021-04 | https://www.danielstrading.com/2011/02/24/oil-futures-scale-as-protests-grip-libya | 2021-01-23T08:27:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610703536556.58/warc/CC-MAIN-20210123063713-20210123093713-00756.warc.gz | en | 0.960758 | 553 |
A man who is accused of driving under the influence of butane and tramadol has failed to attend court.
Prosecution claimed that during interview the 45-year-old made admissions to having inhaled aerosols and when asked if the substances in his system could have impaired his driving replied: “Nah”.
Liam Caldwell, of Antrim Road in Belfast, had been due to appear charged with driving whilst unfit and breaching a traffic sign at Newry Magistrates’ Court.
The particulars allege that the offences were committed on September 27, of last year, in the vicinity of Merchants Quay, Newry.
Reading the alleged details, Deputy District Judge Philip Mateer outlined that police are said to have stopped this defendant in a BMW after driving through a red light.
Officers claim that Caldwell appeared drowsy and that his speech was slurred and a number of aerosol cans were seized from his vehicle.
A sample of blood was taken from the defendant which, upon analysis, was found to have butane and tramadol along with various other substances in his system.
Prosecution claimed that during interview Caldwell made admissions to having inhaled the aerosols and when asked if the substances in his system could have impaired his driving replied: “Nah.”
Deputy District Judge Mateer noted that the address in the outline was different from that recorded on the charge sheet.
He adjourned the case until April 21 for the addresses to be checked.
Sign up for our weekly newsletter here. | <urn:uuid:31db83de-6984-4b54-b119-de7de4dd72ff> | CC-MAIN-2021-39 | https://www.armaghi.com/news/newry-news/man-accused-of-driving-under-influence-of-butane-and-tramadol-fails-to-attend-court/131857 | 2021-09-22T00:12:21Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780057274.97/warc/CC-MAIN-20210921221605-20210922011605-00104.warc.gz | en | 0.990572 | 315 |
Unsafe electrical panel such as a Federal Pacific type panel. These panels commonly overheat and are huge fire hazards. If you have one, call us today for a free estimate. See for more: http://www.allabouthomes.com/FedPacPan.pdf
Weathered "Service Entrance Cable" on the side of your house, which is the cable that supplies all of your electricity. It can become weathered over time. If the protective outter casing wears away this can cause problems. BGE requires a licensed electrical contractor and a permit to fix this problem.
Too many extension cords. According to National Fire Protection Association, extension cords from 1994-1997 have caused 6900 fires, and have been responsible for $115.90 in property damage. Current Electrical code prevents this problem with certain provisions, but your house may not be up to date with those.Installing newly required ARC-fauly breakers can help with this problem. Please go to http://www.compliance.gov/forms-pubs/eresources/fastfacts_extensioncords.pdf for more information.
Too few smoke detectors or none at all. Depending on which county you are in the building code requires a varying amount of smoke and even carbon monoxide detectors if you have gas applicances. Remember to check your smoke detector batteries atleast every 6 months, please see more http://www.ehow.com/video_5112370_test-house-fire-alarm.html
Inquire about our "Silver Service" Program that we provide, which includes a yearly inspection of all you electrical systems.
And many more...
We fix eveything from the most common problems to the most complicated residential problems.
If you are looking for an electrical contractor that will take care of your house as he does his own then you have found the right place.
- Lights fixtures (Indoor or Outdoor) & Ceiling Fans
- Dimmers or Switches
- GFCI receptacles (the outlets in your bathroom with a test & reset button)
- AC units
- Pools, Hot Tubs, Pier Wiring
If it's an appliance in your house that runs on electricity and its broken we can fix it.
24 Hour Emergency Service
Have peace of mind knowing that SHS will meet your electrical needs at any hour.
Unexpected events can occur especially in older homes, when we are your electrical contractor your calls come directly a person.
Renovations and Rehabs
SHS specializes in rehabs and rennovations. We get the job done with the least amount of mess possible.
SHS knows how frustrating it can be to have people in your house leaving holes in walls. We respect your home and understand you have to live in it. We're not done until you are happy.
We are a licensed distributor, installer and servicer of standby generators for Generac Generators.
A standby Generator can prevent you from losing vital resources such as heat, power, light, water, and sewer depending on if you are on a well.
Please view this video for more information on the advantages of a standby generator: http://www.youtube.com/watch?v=FvR5d5XE5oc
We sell and service and provide full maintanece to keep you up and running according to warranty.
Energy Efficiency and Renewables
We can audit your homes' energy consumption and provide you with alternatives or increased energy efficency product. The U.S. Congress passed the Energy Independence and Security Act of 2007, which phases out the manufacture of incandescent bulbs by the year 2014.
We can provide the following energy efficent products:
- Energy Star Qualified Light Fixtures
- Solar Panels
- Electric Vechicle Charging Stations
- Tankless Hotwater Heaters (Also known as "Instahot water heaters"
- Replace Magnetic Ballasts
Home Entertainment Installation
Call us before you call a big box store we will give you the personal touch.
We can provide many different options for home entertainment.
We work with anything from the most high-tech systems to the most basic systems.
If you want in wall speakers all throughout the house that will stream pandora from your ipad we can do that.
Networking and Low Voltage Cabling
Let us provide service your with your networking and low-voltage solutions.
We'll conceal wires that the phone company, TV company, and most alarm companies won't.Networking
- Routers, Switches, and data outlets
- Licensed for Fiber-Optic Installations
- Keypad and Control Devices
- Door Protection
- Glass Break for Windows
- Interior Motion Sensors
- Panic Alarms
- Stand Alone Door Control System
- Video/Intercom Door Control System
We have references dating back from 1975. Please inquire upon scheduling your service call. | <urn:uuid:eadccb2c-20b0-461d-9aa7-26714e16eb07> | CC-MAIN-2018-13 | http://silverblattelectric.com/residentialservice.php | 2018-03-22T19:49:03Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257648000.93/warc/CC-MAIN-20180322190333-20180322210333-00001.warc.gz | en | 0.903077 | 1,020 |
I was recently playing around with my Zimbra installation and was specifically trying to figure out how to configure administrator accounts. By default, a single global administrator is configured during installation. While this is good, I needed the following:
- Change the global administrator to a different domain / account
- Add multiple administrators, one per domain
- Grant certain administrators administrator access to multiple domains
While playing around with the Zimbra configuration, I navigated to https://<FQDN>:5480 (I am running the appliance version) and logged in with the vmware user account. Upon selecting the Zimbra Administration tab, I was greeted by:
HTTP ERROR 400 Problem accessing /service/preauth. Reason: invalid request: domain is not configured for preauth
I had no issues in the past so I knew it had to have been something I changed. So what was causing the problem?
A quick Google search on the error brought me to: http://wiki.zimbra.com/index.php?title=Preauth. I tried everything, but was unable to resolve the error. I was about to revert back to a backup copy of the installation when I realized the system now had two administrator accounts, but only one unique one per domain. When I installed the system, I had to enter the first domain and user name and that pair was created as an administrator. I removed the second administrator account, which I had manually created leaving only the default and the error went away! I still need to research how to have multiple administrator accounts and not get the above error. I will keep you posted on my progress!
© 2011, Steve Flanders. All rights reserved. | <urn:uuid:03934c63-0b90-4da7-aafb-dbf9ac75820e> | CC-MAIN-2022-21 | https://sflanders.net/2011/02/13/invalid-request-domain-is-not-configured-for-preauth/ | 2022-05-16T10:56:26Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662510117.12/warc/CC-MAIN-20220516104933-20220516134933-00454.warc.gz | en | 0.964747 | 345 |
What happens when I experience load shedding?
Even though we are sensitive to the impact that load shedding or power outages can have on connectivity and class attendance, we should at all times consider the impact of absenteeism on academic performance.
All classes, tests and exams take place online at the Impaq Online School. It is, therefore, a requirement that a backup power system should be in place. This will allow for uninterrupted academic classes and/or assessment sessions. This backup system should also include an additional stable internet connection during power outages.
As per the SACAI guidelines, load shedding will not be accepted as a valid reason for any missed assessment.
Kindly note that in the case that learners are not able to write a test or exam due to prolonged power outages (not "normal" load shedding), a declaration form with supporting documents would need to be completed and submitted to the firstname.lastname@example.org
How do classes work at the Impaq Online School?
Impaq Online School learners attend live online classes presented by qualified teachers every day - you will need a laptop or PC with a working webcam and microphone. Classes typically start at 07:30 and end roughly 14:30, with regular breaks between ...
Which subjects are not offered by the Impaq Online School?
The Impaq Online School offers all subjects for learners in Grades 4 to 9. However, for Grades 10 to 12, the following subjects are unfortunately not offered: Agricultural Sciences Agricultural Management Practices Dramatic Arts
Does the Impaq Online School have a Code of Conduct?
The Impaq Online School and its affiliates subscribe to the following core values, which are the cornerstone on which the Code of Conduct is formulated: • Integrity: be honest and have strong moral principles • Mastery: have supreme mastery in our ...
How do Impaq Online School learners complete PATs and orals?
The Impaq Online School teacher acts as the assessor for PATs and orals, and these assessments take place online. Sessions are scheduled on MS Teams as per the time arranged between the learner and the teacher.
What are the hardware and/or software requirements for the Impaq Online School?
Stable internet access on a laptop or PC (a cellphone or laptop is not recommended) with a webcam and microphone is required for the online school. Due to the increased data use for video during sessions, the performance of your network will have a ... | <urn:uuid:fa7d6485-260a-4d69-b76b-8c2329beb7fd> | CC-MAIN-2023-50 | https://optimiimpaq.zohodesk.com/portal/en/kb/articles/what-happens-when-i-experience-load-shedding | 2023-12-05T16:04:33Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100551.2/warc/CC-MAIN-20231205140836-20231205170836-00076.warc.gz | en | 0.941387 | 509 |
Here’s a very early peek at another new chapter-in-progress for Windows Phone: This is the first chapter, Getting Started. It focuses on configuring a Microsoft account, choosing a Windows Phone handset, and initial phone set up.
As you may recall, I’m also currently working on Chapter 2: The Windows Phone User Experience. But I’m getting bored with all this introductory stuff, so I’m trying to mix it up. With more introductory stuff. (I’m running out of things to write about.) I’ll probably work in a little of the revised Chapter 16 soon, too.
Anyway … This is very basic stuff, and not a lot of writing, despite the page count. I’ve only written part of the Set up your phone section, which will include bits about initial phone setup (done) plus some post setup tasks, as well as restoring a phone from a backup.
Feedback is always appreciated.
Download Getting Started 0.1 (14 page PDF, 958 KB)
Download Windows Phone Book 0.059 (570 page PDF, 34.9 MB) | <urn:uuid:aa0eca80-adcc-4fc2-9ce3-937349b8265d> | CC-MAIN-2021-31 | https://www.itprotoday.com/mobile-management-and-security/windows-phone-book-getting-started-01 | 2021-08-05T11:28:50Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046155529.97/warc/CC-MAIN-20210805095314-20210805125314-00573.warc.gz | en | 0.900762 | 237 |
Louis Schmidt Award
The highest honor in BCA is to be selected a Louis Schmidt Laureate. Named for a founder and the second president of the Association this honor is bestowed "for outstanding contributions to the progress of biocommunications."
Symbols of the Schmidt Award include the BCA key inset with a diamond and the Gold Headed Cane – a traditional symbol in medicine of high achievement and honor.
A committee of the nine most recent Schmidt laureates makes the selection of the recipient subject to approval by the board of governors.
Ralph Creer Service Award
In honor of BCA's founding president, the Association has established the Ralph Creer Service Award. Recognizing those who have served the Association and its members with distinction, this award is given by BCA's President.
Nominations may be directed to the BCA President: Susanne Loomis.
Fellowship in BCA
As biocommunicators progress in their careers, the Association continues to honor their development of excellence. Fellowship in BCA is granted "for distinguished craftsmanship and meritorious contribution to the advancement of media in the life sciences." Over 200 people have been honored with the distinction of Fellow.
Nominations may be directed to the Chair, Fellowship Committee: Alan Goldstein
Emeritus Membership in the BCA is an honor. It recognizes distinguished craftsmanship, professional achievements and meritorious contribution in the visual communications media in the life sciences and medicine. Nominee must be an active BCA member for not less than twenty years (does not have to be consecutive), attained the age of 55 and retired from the field of biocommunications.
Nomination forms should be sent to firstname.lastname@example.org attention Emeritus Chair. | <urn:uuid:c6b221a2-a733-469d-a0ec-fd3afcc53ce7> | CC-MAIN-2018-51 | http://bca.org/honors/honors.html | 2018-12-13T18:43:37Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376825029.40/warc/CC-MAIN-20181213171808-20181213193308-00532.warc.gz | en | 0.93562 | 363 |
After this week's quasi-controversy about "G.I. Joe: The Rise of Cobra" not being screened for critics, Grand Rapids Press reviewer John Serba had to rush out Friday morning to see it for this week's New Movies Podcast.
He and sidekick/producer Cory Olsen then discuss "Julie and Julia," "(500) Days of Summer," "A Perfect Getaway," "The Stoning of Soraya M." and the new-to-DVD "Race to Witch Mountain."
Read the reviews
"G.I. Joe: The Rise of Cobra"
Serba: 'G.I. Joe: The Rise of Cobra' offers silly, explosive action
"Julie and Julia"
Serba: 'Julie and Julia' shows off Meryl Streep's abundant skills
"(500) Days of Summer"
Serba: '(500) Days of Summer' offers fantastically bittersweet tale of young love
"The Stoning of Soraya M."
Andrew Jefchak: 'The Stoning of Soraya M.' shows brutality of ancient practice
"A Perfect Getaway"
Jefchak: 'A Perfect Getaway' is perfect example of failed plot twists
New on DVD
"Race to Witch Mountain"
Serba: 'Race to Witch Mountain,' with Dwayne 'The Rock' Johnson, doesn't add up to hill of beans
Serba: 'The Soloist': Strains of Life story stars Jamie Foxx and Robert Downey Jr. | <urn:uuid:db47c377-6632-440b-8d5e-7c155f942c55> | CC-MAIN-2016-30 | http://www.mlive.com/movies/index.ssf/2009/08/new_movies_podcast_gi_joe_the.html | 2016-07-27T02:33:58Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257825358.53/warc/CC-MAIN-20160723071025-00020-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.831192 | 316 |
You must be registered to comment and vote on comments.
"Ivy & Bean Take the Case." Reading free, but book purchase required to get a signed copy. Signing reservations suggested, call 651-224-8320.
Red Balloon Bookshop
891 Grand Av.St. Paul, MN
Date: Ended 09/23/13
"The Secrets of Eastcliff-by-the-Sea."
More details »
Poll: What's your favorite movie with Dwayne "The Rock" Johnson?
425 Portland Av. S.
Minneapolis, MN 55488
© 2014 StarTribune. All rights reserved.
StarTribune.com is powered by Limelight Networks | <urn:uuid:e5b2b93a-64af-4a13-903a-4b35d68ce225> | CC-MAIN-2014-23 | http://cal.startribune.com/dynamic/calendars/event_detail.php?event_id=154915 | 2014-07-31T03:21:00Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1406510272329.26/warc/CC-MAIN-20140728011752-00337-ip-10-146-231-18.ec2.internal.warc.gz | en | 0.791064 | 146 |
MINNEAPOLIS — Entrepreneur-turned-filmmaker Bob Compton kicked off an American Solutions panel on education by showing a 13-minute clip of “2 Million Minutes,” a documentary that follows six students in India, China and the United States. The 2 million is a reference to the number of minutes a person has in a four-year time frame. Compton’s movie examines how two students from each country choose to spend their 2 million (hint: the U.S. kids spend a lot less time studying). You can watch a preview here. Compton said that education is “the biggest strategic issue we face” today. He said that if we do not do something about our education system we could become the Britain of the 21st century — and if we were unlucky, France.
Minnesota Gov. Tim Pawlenty spoke next, and he was a bit more specific about what needed to be done. First, he pointed out that in everything else Americans do, “choice” is only expanding. Instead of being held prisoner to the tastes of a few radio stations, today Americans can listen to anything they want on their iPods. Pawlenty was clear: “Choice is the future.” Pawlenty stressed that we needed to work with teachers unions, but that unions had to accept some major changes, especially on pay. Eighty-five percent of education dollars go to salaries and benefits of teachers. Thanks to unions, teacher pay is determined by seniority. But there is no correlation between teacher seniority and improved child learning. Pawlenty said this had to change: “We love our teachers. But they are working in a system that is 50 years old.” | <urn:uuid:fd4518e8-4e28-4506-b10c-f214194a71f3> | CC-MAIN-2014-10 | http://blog.heritage.org/2008/09/02/the-biggest-strategic-issue-we-face/ | 2014-03-12T15:56:45Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394021919409/warc/CC-MAIN-20140305121839-00051-ip-10-183-142-35.ec2.internal.warc.gz | en | 0.978579 | 356 |
If you follow me on twitter then you know yesterday started off as a pretty horrible day. My phone of less than two years finally decided to just completely die, ughs. So I had to go and get a new one, something I was not planning on especially after having to repair my car last month. I headed over to the Verizon store expecting to spend a fair amount of money on a new phone, but to my surprise at this store on Sundays have this truly bizarre discount game. You stick your hand into a jar and pull out a ping pong ball with a number on it and whatever the number is, is how much you get off your phone. I ended up getting $75 off! I was super excited, and it made me feel a whole lot better about having to get a new phone well before I was planning on getting one.
And now back to Sunday Snapshot (a day late)
As you can see this isn't the normal Sunday Snapshot. This is a comic Will made for me, in the Fall of 2008 when we were both living in LA. I was working this really boring day job, while I was trying to find work as an art teacher (which I had no luck with as the economy was in the crapper, and LA was laying off teachers left and right) and Will was working on his documentary (The Fish Belong to the People). We were both extremely busy and weren't able to see each other quite as much as would like to, so Will made me this comic and sent it to me at work, to tell me how much he missed me. It was probably the best day of work ever, hehe! I absolutely love coming across this type of thing years later because it always makes me feel the same way I felt the first time I saw it!
Hope everyone is having a wonderful Monday! x's and o's | <urn:uuid:f56eeb43-fa05-41d8-9907-d290cc950dfc> | CC-MAIN-2015-11 | http://littleladylittlecity.blogspot.com/2011/11/sunday-snapshot-8-day-late.html | 2015-03-06T07:27:54Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936465693.74/warc/CC-MAIN-20150226074105-00255-ip-10-28-5-156.ec2.internal.warc.gz | en | 0.991849 | 383 |
you decide what time it isBuy now
Oh dear! Oh dear! I’m going to be late. But, how can you be late if you don’t know what time it is? With Chalking O’Clock you can choose the time you want so you never arrive late, or you can bring forward something you’re waiting for.
Chalking O’Clock is a chalk board alarm clock for you to play with and write the time that others give you. The traditional clock with hands comes with a digital clock so you can write the same time digitally.
And, you can also learn the time in your own language or in others. And if you don’t like the time you put, rub it out and write another one. If you’re hungry, you can put the clock forward. If you’re sleepy in the morning, move it back.
Chalking O’Clock contains 10 beech wood pieces. The frame and the hands are painted with eco-friendly water-based paint. The clock face and the display are coated with chalkboard paint, so that you can write the time with 6 colored chalk sticks. Chalking O’Clock comes in a 19 cm x 14 cm x 14 cm box that weighs 0,4 kg.
3 years and up.
Here it is. Enjoy.
The pieces of Chalking O’Clock stick together because there are tiny magnets embedded in them.
Chalking O’Clock respects the environment with its 100% natural materials: chalk, beech wood and ecological paint.
Here at wodibow we want you to enjoy your Chalking products for life, but we wouldn’t want their pieces to be indestructible for 1,000 years.
Chalking O’Clock doesn’t require winding or batteries or plugs in order to work. The only thing it needs is your will to play with it. | <urn:uuid:cdb8c066-1706-4fc9-a789-ba7169b51212> | CC-MAIN-2019-35 | https://en.wodibow.com/chalking_oclock_en/ | 2019-08-21T18:01:56Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027316150.53/warc/CC-MAIN-20190821174152-20190821200152-00282.warc.gz | en | 0.888998 | 404 |
Aleksandr Alekseevich Viazemskii
Viazemskii, Aleksandr Alekseevich
Born Aug. 3, 1727; died Jan. 8, 1793, in St. Petersburg. Russian statesman, one of the high officials closest to Catherine II. He began his career with the suppression in 1763 of an uprising of peasants working in the mining-metallurgical plants in the Urals. From 1764 until 1793 he was general procurator. In this post he first supervised the administration and reported to the empress; later, in the 1780’s, Viazemskii’s authority expanded and he in fact was in charge of finance, justice, and internal affairs. In 1767 he was chairman of the Commission for the compilation of a New Code. In 1769 he was appointed to the Council of the Imperial Court. | <urn:uuid:8b512b50-2427-4e24-b50c-73562dc066bd> | CC-MAIN-2017-22 | http://encyclopedia2.thefreedictionary.com/Aleksandr+Alekseevich+Viazemskii | 2017-05-30T11:09:14Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463615093.77/warc/CC-MAIN-20170530105157-20170530125157-00481.warc.gz | en | 0.942112 | 188 |
Disneyland worker critically hurt in Space Mountain accident
A machinist for Disneyland was critically hurt earlier this month in an accident at the theme park's Space Mountain ride.
Details of the incident were still unclear.
Suzi Brown of the Disneyland Resort said the ride did not malfunction and that "it was cleared for normal operation."
"Our thoughts and prayers are with our cast member and his family," she said. "On behalf of his fellow cast members, we offer our heartfelt wishes for a full and speedy recovery."
The Oct. 3 accident occurred as the machinist was testing a vehicle on the popular high-speed ride, said Patricia Ortiz, a California Division of Occupational Safety and Health spokeswoman.
"Preliminary information that we heard was that he was struck by the vehicle ... how [is] still being determined," Ortiz said.
The Disney worker suffered critical back, chest and head injuries and was taken to UC Irvine Medical Center, authorities said.
The investigation could take up to six months, she said.
ALSO:New talks could decide fate of L.A./Ontario International Airport
-- Ari Bloomekatz | <urn:uuid:13848146-c406-41c4-8d51-0dec504928fb> | CC-MAIN-2016-44 | http://latimesblogs.latimes.com/lanow/2012/10/disneyland-worker-hurt-space-mountain-accident.html | 2016-10-24T20:23:00Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719754.86/warc/CC-MAIN-20161020183839-00025-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.981937 | 237 |
Coral Gables (April 09, 2012) — Book and food lovers converged to admire and enjoy tasty creations at the University of Miami Libraries’ third annual Edible Books Festival, held in the lobby of the Otto G. Richter Library on April 2. This year 24 entries were judged based on three separate categories: Wittiest Pun, Most Edible, and Best in Show. Close to 100 votes were tallied and the winners of this year’s festival were: Terri Robar, associate librarian professor, Best in Show for her submission “All Creatures Great and Small”; Ashley Ford and Tiffany Saulter for Wittiest Pun for their submission “As I Lay Frying,” based on Faulkner’s As I Lay Dying; and the team of Sherry Johnson, Andrew Prince, and Surya Cherian for Most Edible with “Sinful Delight,” based on Dante’s Inferno.
Combining readers and books in an unusual way, the event celebrates the International Edible Book Festival held each year on or around April 1. Participants create an “edible book,” which can be inspired by a favorite title, involve a pun, or simply be in the shape of a book, scroll, or tablet.
Entries were displayed in the Richter Library lobby. Participants and onlookers alike were then able to “eat their words” and dig into the entries.
« Back to News Releases | <urn:uuid:4fcfce14-14f9-4ff7-85a6-92cd169b2e47> | CC-MAIN-2016-44 | http://www.miami.edu/index.php/news/releases/cooking_the_books_edible_books_festival_showcases_tasty_creations/ | 2016-10-28T04:25:21Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721555.54/warc/CC-MAIN-20161020183841-00505-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.953228 | 306 |
An ideal Gift package. A C-type digital print of the well know Scent Bottles picture by Lee Miller and a lens cloth with her 'Fish Fashion' image on. The print comes inside the Lee Miller Archives brochure, which contains information on Lee Miller's life and reproductions of some of her other iconic images. Our C-type Digital prints are made from digital images with a wet process, printed on non-archival paper. The original image for this picture was sourced from Lee Miller's original vintage negative. The lenscloth is ideal for using on tablet screens as well as glasses and camera lenses. | <urn:uuid:beb59016-c7e9-496b-be7f-4815af987fa8> | CC-MAIN-2019-39 | https://www.leemiller.co.uk/media/An-ideal-Gift-package-A-C-type-digital-print-of-the-well-know-Scent-Bottles-picture-by-Lee-Miller-and-a-lens-cloth-with/vKXSxZX0Sf0mMy1FBnXJ5w..a?wosid=Rsh9ZB1pDxLvozewYKy6AM&woinst=8&ts=IG-52iH3YKKnh2Qag0r4kg..a | 2019-09-23T05:24:28Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514576047.85/warc/CC-MAIN-20190923043830-20190923065830-00531.warc.gz | en | 0.921687 | 124 |
Map/Chart > United Kingdom
Falmouth & Carreg Road with Helford Sound
Sayer and Bennett
|Hydrographer/Surveyor/Artist:||Sayer and Bennett|
|Size Of Original:||w 16” x h 22”|
|Paper Type||Hahnemuhle German Etching 310gsm|
This charming chart dates from a time when Falmouth was the home to the British Navy's all important packet boat service which had responsibility for delivering all dispatches, orders and mail to and from her forces stationed all over the Caribbean seas. | <urn:uuid:dca51740-5ab1-47c9-a5e4-0c23b7ca99a4> | CC-MAIN-2019-43 | https://www.heritagecharts.com/mapchart.php/258/23/falmouth___carreg_road_with_helford_sound/7692f76766c888a0777d6f63b236643a | 2019-10-22T07:18:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987803441.95/warc/CC-MAIN-20191022053647-20191022081147-00318.warc.gz | en | 0.82488 | 123 |
Hosting a Clothing Swap
Clear the Clutter and Upgrade your Closet!
- Include friends of all sizes & shapes.
- Host your swap at the end of the season – use Evite or Facebook invitation (save some trees).
- Note the minimum or maximum number of items each person should bring.
- Only items in good condition.
- Add accessories to the mix (handbags, scarves, shoes, belts) gently worn – this will ensure that everyone can find something.
- Designate one room for changing – have at least 2 full-length mirrors.
- Ask friends to throw everything in the dryer (handbags & shoes too) on high heat for 10 to 20 minutes – State on invite: if your items have already went through the dry cleaning process – skip this step.
- Find a local charity that will take the overflow – (Dress for Success, Goodwill)
- Have plenty of Wine, food and music, and you will get plenty of laughs, good time and your friends go home with a new outfit ….. Priceless!
- I wanted to add this – if you are friendly with your children’s teacher(s), please invite them, they are always looking for items for their classroom. Especially, if you have preschooler, the teachers are looking for clothing for Dramatic Play area, or an Art teacher – looking for shirts as smocks when creating, Dramatic teacher that puts on plays at the school, School Nurses to have extra clothes on-hand. These professionals struggle to get items for their students, and this is a good way to help!
Enjoy and Have fun!
Peace & Harmony, Cheryl | <urn:uuid:937a386b-ccb4-4063-bf1a-4abdd18d2c3b> | CC-MAIN-2021-43 | https://envision-designs.com/2016/02/23/how-to-host-a-clothing-swap/ | 2021-10-19T18:31:11Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585280.84/warc/CC-MAIN-20211019171139-20211019201139-00157.warc.gz | en | 0.922918 | 347 |
Slim 3 was released 3 months ago and it was significant. It is one of the first frameworks to integrate the latest standards and concepts in its core.
[...] While PSR-7 and middlewares are very interesting, what's more useful for us is the use of container-interop. That means Slim 3 can work with any dependency injection container. It is very easy to replace the default container (Pimple) with PHP-DI, but today we are releasing a "PHP-DI - Slim" bridge that goes a little further.
They then show how to use their new bridge to create controllers as services in the container and pass them parameters. The post ends with the instructions on getting the PHP-DI bridge installed and how to use it to replace the default
AppSlim creation of your application. | <urn:uuid:59f1c61d-99a4-40b4-99fd-21132174a8cb> | CC-MAIN-2019-43 | http://www.phpdeveloper.org/news/23758 | 2019-10-19T05:40:42Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986688826.38/warc/CC-MAIN-20191019040458-20191019063958-00140.warc.gz | en | 0.949848 | 169 |
You’re Invited to the 2018 Barn Dance Fundraiser!
Join Dave Considine, family, and friends for the annual barn dance to support his re-election to the State Assembly!
When: Saturday, Sept. 29
Where: Breezy Hill Farm
N6194 Breezy Hill Rd
Baraboo, WI 53913
All donations gratefully accepted. Please make donations out to Citizens for Dave, PO Box 525, Portage, WI 53901. You may also give online at: https://secure.actblue.com/donate/barndance2018
For more information, please call (608) 356-9695 or email firstname.lastname@example.org.
Authorized and paid for by Citizens of the 81st for Dave Considine, Tom Drury, Treasurer. | <urn:uuid:ed067f56-481b-45c6-a732-0509e8ec617d> | CC-MAIN-2022-27 | https://daveconsidine.com/2018/07/24/youre-invited-to-the-2018-barn-dance/ | 2022-07-03T20:04:06Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104249664.70/warc/CC-MAIN-20220703195118-20220703225118-00188.warc.gz | en | 0.834784 | 180 |
The AICP Show, The Art & Technique of the American Commercial, is more than just an awards show judging the best work of the year. It's an ongoing archival project with cultural and artistic significance. Since the Show's inception in 1992, the honored work is included in the archives of the Film Department at The Museum of Modern Art (MoMA), in New York. The Show is judged by close to 400 advertising and production professionals, and is assembled by a curatorial panel of prominent industry leaders.
The AICP Next Awards recognize outstanding work and the creative forces behind it, but are much more than an awards competition - it is a platform for thought leadership and analysis by those pushing boundaries and raising the bar higher on marketing content. The honored campaigns and single executions are on the leading edge of harnessing all types of media and technology to communicate the marketer's message. All work for the Next categories must be for a client and may be produced and aired globally. Categories include: Integrated Campaign, Social, Website/Microsite, Experiential, Cause Marketing, Viral/Web Film, Mobile and Product Integration.
We are delighted that you are registering for the site and entering work for consideration. Once you are signed in, you will be able to enter both the AICP Show and Next Awards. Under the tabs above, you will find information such as category descriptions, entry deadline, technical specs and other help documents such as an FAQ.
Aired: March 3, 2014 - February 22, 2015
Entry Deadline: February 27, 2015
If you have already registered for 2015, please sign in with your email and password to view your entries. If you are a new entrant, please select register below.
At any time in the process, please feel free to contact 212-929-3000 or firstname.lastname@example.org with any questions. | <urn:uuid:51b621c7-504f-49be-99b1-9356947d56d0> | CC-MAIN-2015-48 | http://www.awardcore.com/aicp/login.php | 2015-12-02T03:18:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398538144.64/warc/CC-MAIN-20151124205538-00253-ip-10-71-132-137.ec2.internal.warc.gz | en | 0.946608 | 382 |
You need to make sure that you factor in the services of a qualified and skilled electrician when you want to get your home wired. You need to know that for you to get that, identifying the right electrician in the market is not an easy task. It is not because there are few electricians in the market. What makes most of the individuals to have a hard time doing so is to identify the best regarding hands-on skills since they all seem similar in the concentration of their area of specialization.
In this regard you need to ensure that you do not look at the structural appearance of the electrical firm so that you can choose the electrician. Get to incorporate various factors when you want to receive the best electrical services. Also you need to induct an intensive research on the online platform for you to get the reviews and critics of the best electrician. You need the following outlines so that you can be able to make the right selection for better electrical wiring in your home.
First of all, you need to consider the longevity of the electrician. You need to make sure that you are aware of the lifespan of the expert you want to hire. For better services you need to ensure that you consider hiring a professional electrician who has an extended longevity in the field of electrical wiring in building, stationary machine and other related services.
Get to ask for the insurance policy that the electrician hold. Since you do not want to lose multiple cash during maintaining your electrical wiring condition you need to get an experienced and skilled electrician. Also you need to ensure that you have an electrician who is insured so that in case of damage of property during the project you would be able to receive compensation.
You need to ask for the license. At all time you need to ensure that you factor in checking the license held by the electrician. You need to be satisfied by the accreditation of the license so that you can hire the electrician. More so you need to get the terms of the contract. As you seek to get the best electrician you need to ensure that you are aware of the terms of the contract. It is crucial for you to choose an electrician who offers terms that you are comfortable with.
Get to ask for the leads. Source information from trusted friends and relatives about the best electrician they are aware of. Also get to have evidence from the electrician for the past clients which he/she has worked with. you need to ask for the available testimonies from the electrician. Get to select an expert who is reputable for you to experience the best and reliable services that you may desire. Get to consider the above outlines when you want to choose the right electrician for optimal electrical wiring services. | <urn:uuid:d25e823a-7700-4cb5-982c-70587889723b> | CC-MAIN-2019-43 | https://officialcoachoutletonline.com/a-brief-rundown-of-repair/ | 2019-10-17T02:40:59Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986672548.33/warc/CC-MAIN-20191017022259-20191017045759-00232.warc.gz | en | 0.963643 | 549 |
OneClickdigital is now RBdigital and shares an app with our RBDigital eMagazine Collection. Enjoy both downloadable magazines and classic eBooks on the new RBdigital app. If you already have a login and password for Zinio for libraries or OneClickdigital, it will remain the same for this platform.
The RBdigital eCollection offers 200 eAudiobook and 100 eBook classic titles for download or streaming on PCs, eReaders and mobile devices. The RBdigital app also gives you access to RBdigtal eMagzines.
For a mobile friendly experience, use the RBdigital app1 to download classic eAudio and eBooks as well as access to RBdigital eMagazines on your mobile devices and tablets.
1 Apple devices require iOS 5.0 or later. Android devices require OS 2.2 Froyo or later. | <urn:uuid:06d28d89-b8fa-4bc4-bd19-4c850ccf522c> | CC-MAIN-2019-09 | https://atlanticlibrary.org/eclassics?page=1 | 2019-02-20T18:38:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247495367.60/warc/CC-MAIN-20190220170405-20190220192405-00466.warc.gz | en | 0.826475 | 174 |
Kooskia Idaho fuck buddys ages 40 on.
Horny house wivies in Hudson Laguna Beach nude.
Local sluts fuck for free in witbank, the best pussy lips injections, fuck my hairy wife, sexy naked female dwarves.
Naked chicks from new hampsire. Women who show naked bodies.Couples looking for bi men or women or both I just want to find a hot women couple looking for man for fun.
Whores in paw Hayes valley girls nude.
Shelby Michigan hot big hip big nude ass in nude pantie woman.
Mexican sexy women naked over.
Swingers in sequin Ebensburg Texas, Silas Oakley Manchester Tennessee secrets sex club for people who don't like to waste time. The sluts next door, black uys love old horny pussies looking to fuck couple looking for man for fun! Couple sex stories free, amateur ugly nude wome!!!
Horny middle age ladys show.
Males for threesomes in South Caddo Parrish tonight meet, Brewster milfs ready for discreetsex, pissing cam females nude hostess at work.
Couples night strip club riv Laurel area.
Girl watches man suck g spot, hairly light skin black women fucking over things. Husband wants me nude, nude couple looking for man for fun women personals locanto sunshine coast. Gruop men fucking bussy by hand woman.
Take a chance on truly finding happiness.
A friend I work a lot I have little time for dating though I like to sing dance and hangout with friends. San Perlita TX girls big nipples, woman couple looking for man for fun that pose nude, wild women looking for good time out and around. Swingers in the nude shot.
Married women that swap partners.
Naked horny hairy white panties, Foley tire store couple looking for man for fun gloryholes, sex stories from horny cape flats sex stories marthi Alabama Scottsboro. Fort Covington housewives wants sex. Woman shagging great dane in sex.
Local women fucking men with a strapon.
Looking for males couple looking for man for fun naked.Different types of hand job and cuming.
Nangi girls body masas.
Adult sex match couple looking for man for fun with another per so were looking for a cute girl looking for a girl to fuck in 40272. Women fuck nude pict of women Lucedale MS 39452, best looking and tight, local girls real fuck buddys request.
Sex with marred woman in NM Farmington. Single horny women masturbating outside house nude. Fucking Villanueva in women mouth!!!
Attractive middle age woman.
Woman fuck on party fucking wife club, women couple looking for man for fun ok nude women over, women wanting men to eat their pussy daily motion flashing dare.
Naked women on new marriage, women who still enjoy sex. Swinging couple with 3 years of age fucking moms.
Adults service ads Biloxi discreet.
Horny women chat rooms, fucking sorry old mam fuked, over 50 horny women Dell Rapids SD party! Horny pussy & hot swingers couple looking for man for fun.
Sites like hidden masturbation. Couple seeks man to chuckold. Full figured women sexy!!!
Fairmont Montreal girls in special house.
66202 sexy mom fuck Junction TX at midnight.
Girl naked pussy sister real, medium sized swinging tits naked women, free nude web cams couple looking for man for fun tits and lips are my favorite curves is not a problem I have them but most of all time.
Discreet female for threesome Appleton.
Nude girls laying by the pool, South Carolina Columbia and couple looking for man for fun engaged, adult masturbation group clubs! Girl fuck contacts no signup.
Naked girls sex enjoy sabnur.
Find swingers and lovers, Galena thick from Merrill OR masturbating, pussy in my mouth and sucking on it slowly licking up your ass with the tip of my tongue till you. | <urn:uuid:f7518aab-1e7f-4825-924d-56ad3e4a18f9> | CC-MAIN-2023-23 | https://diabeticvillage.com/couple-looking.html | 2023-06-05T14:18:05Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224652116.60/warc/CC-MAIN-20230605121635-20230605151635-00692.warc.gz | en | 0.836726 | 857 |
Ongoing Technical Support
In our experience most new installations need “babysitting” for the initial period.
During this time machines “bed in”, operators get comfortable with the operating system, and maintenance staff get familiar with the equipment. As part of the overall project Horan Automation & Consulting provides free of charge 6 months telephone and online technical support to all client’s staff.
Following the 6 month period we can continue to supply this backup service for an annual charge if required. | <urn:uuid:b3a4f1e0-9de6-40e4-847c-5b606d2da969> | CC-MAIN-2019-43 | https://horanautomation.hu/uncategorized/469/ | 2019-10-15T12:26:36Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986658566.9/warc/CC-MAIN-20191015104838-20191015132338-00056.warc.gz | en | 0.858955 | 107 |
How to Record Your Desktop Video and Audio Using “Avconv” Tool in Ubuntu
Libav is a set of cross-platform libraries and tools that are used to deal with multimedia files, streams and protocols, it was originally forked from the ffmpeg project. Libav includes many sub-tools like:
- Avplay: a video & audio player.
- Avconv: a multimedia converter plus a video & audio recorder from different sources.
- Avprobe: a tool that connects to the multimedia file stream and returns many useful information and statistics about it.
- Libavfilter: a filtering API for different Libav tools.
In this article, we’ll explain how to record the Linux desktop’s video & audio using the ‘Avconv’ program on Debian/Ubuntu/Linux Mint distributions.
Step 1: Installing Avconv Tool
1. avconv is a part from the “libav-tools” package, which is available to install from the official repositories for all Debian-based distributions like Ubuntu and Mint, using following commands.
$ sudo apt-get update $ sudo apt-get install libav-tools
Note: Installing packages from default repositories, might give you a little older version of ‘avconv‘ tool. Thus, we recommend you to get the latest version from the official git repository, as shown below.
$ sudo apt-get install yasm $ git clone git://git.libav.org/libav.git $ cd libav $ ./configure $ make $ sudo make install
Note: You will have to run “./configure –help” in order to list all the available options for the configuration file and install codecs and libraries that you want, you will also need to do a lot of work in order to install the dependencies.
Also note, if you’re used the compile-from-source way, you’ll always have to use “sudo avconv” instead of “avconv” to run the tool.
Step 2: Start Video Recording of Desktop
2. You’re ready now, all what you have to do is to record your desktop video by issuing following command.
$ avconv -f x11grab -r 25 -s 1920x1080 -i :0.0 -vcodec libx264 -threads 4 $HOME/output.avi
Now let’s explain the command in short:
- avconv -f x11grab is the default command to capture video from the X server.
- -r 25 is the frame rate you want, you may change it if you like.
- -s 1920×1080 is your system’s screen resolution, change it to your current system resolution, it’s very important to do this.
- -i :0.0 is where we want to set our recording start point, leave it like this.
- -vcodec libx264 is the video codec that we’re using to record the desktop.
- -threads 4 is the number of threads, you may change it as well if you like.
- $HOME/output is the destination path where you want to save the file.
- .avi is the video format, you may change it to “flv”, “mp4”, “wmv”, “mov”, “mkv”.
3. After you enter the command, the recording will start automatically as a process running from the terminal, in order to stop it, hit “Ctrl + C” keys inside the terminal window.
4. Now, you may run the file using VLC or any other multimedia player, or you may run it using “avplay” tool which is a multimedia player from the same Libav package.
$ avplay $HOME/output.avi
Note: Don’t forget to replace the destination file path. The recording’s quality is pretty good.
Here’s a video that I’ve recorded using the “avconv” tool.
Step 3: Start Video & Audio Recording of Desktop
5. If you want to record the audio as well, first run this command to list all the available input sources for the audio.
$ arecord -l
It will give you some output like this.
In my case, I’ve one input source for audio only, and its number is “1”, that’s why I am going to use the following command to capture both video & microphone audio.
$ avconv -f alsa -i hw:1 -f x11grab -r 25 -s 1920x1080 -i :0.0 -vcodec libx264 -threads 4 output-file2.avi
You see that part which is colored in yellow? It’s the only modification that I did for the command. Now let’s explain the command in short:
- -f alsa is an option to capture the sound from the alsa device.
- -i hw:1 is an option to take the audio input source from the “hw:1” device which is the first – and the only – input sound device in my computer.
Note: Don’t forget to replace the “1” number with the number of the input device that you want when you list the available audio input sources using the arecord -l command.
To stop the recording, you may hit the “Ctrl + C” keys again.
Step 4: Start Audio Recording of Desktop
6. If you want to record the audio only, you may use the following command.
$ avconv -f alsa -i hw:1 out.wav
7. You may replace .mp3 with any supported audio format by Libav, you can now play the out.wav using any mutlimedia player like VLC.
“avconv” tool can be used to do many other things, not just to record the desktop’s video and audio. For further usage and details about the “avconv” tool, you may visit the official guide at.
Have you used the “avconv” tool before to record your desktop? What do you think about it? Is there any other tools that you use to record your desktop? Share them with us in the comments. | <urn:uuid:b8394569-7e24-4dc5-8042-e9f3b7e466b9> | CC-MAIN-2016-30 | http://www.tecmint.com/record-ubuntu-desktop-screen-using-avconv/ | 2016-07-27T17:12:39Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257826916.34/warc/CC-MAIN-20160723071026-00250-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.839737 | 1,370 |
You missed it This great deal for Junk King is over. But don't despair, we've got more great deals every day.
Related Deals That You May Like
Air Duct Cleaning Package
Reign Down Cleaning and Painting
Interior Painting Services for Up to 3 Rooms
Grass Roots Carpets
Steam Carpet Cleaning or Tile & Grout Cleaning
All Wires Hidden
Wall-Mount TV Installation with Wire Concealment
Junk Removal Services
- Save 50%
- 98 purchased
96% recommendedin LivingSocial customer ratings
Let the pros at Junk King free your home from unwanted rubbish any Monday through Saturday with this deal:
• $64 ($128 value) for junk-removal services
• Includes pickup, loading, and hauling of up to 3.33 cubic yards of most materials
• Available within 15 miles of Buckhead's 30328 zip code
Why We Love It
Don't waste time dragging heavy items out to the porch or curb; just describe what you want moved, and let these talented professionals do the rest -- including pickup, hauling, and cleanup afterward. Best of all, Junk King takes pride in being environmentally friendly, recycling a large portion of everything collected.
Junk King's Website
PAID VALUE EXPIRES ON January 18, 2022
PROMOTIONAL VALUE EXPIRES ON February 10, 2014
Service area includes a 15.0-mile radius from zip code 30328
Find out if you are eligible for service by entering your zip code below.
merchant will service you!
merchant out of area | <urn:uuid:bfad83d4-1f76-48de-b6e9-0ae8533df637> | CC-MAIN-2017-04 | https://www.livingsocial.com/deals/853682-junk-removal-services | 2017-01-18T08:30:07Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280242.65/warc/CC-MAIN-20170116095120-00248-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.85378 | 334 |
OpenCart CDN Integration
Updated on December 20, 2021
This tutorial shows how to complete an OpenCart CDN integration with KeyCDN.
- Create a Pull Zone or a Push Zone before you start the OpenCart CDN integration.
- Get the General CDN Solution web page extension from the OpenCart marketplace.
- Log in to your OpenCart admin panel. Navigate to Extensions -> Installer and upload your General CDN Solution extension.
- Navigate to Extensions. Under modules find Opencart CDN and click on Install(+).
- Edit the newly installed plugin.
- Enable SSL.
- Under Custom Domain enter your Zone URL that you get from the KeyCDN dashboard (e.g
example-hexid.kxcdn.com) or the Zone Alias (e.g.
- Choose Yes for CDN Delivers Images, CDN Delivers JS and CDN Delivers CSS
- Save all settings.
- Go to Extensions -> Modifications. In the right top corner click on the refresh button. | <urn:uuid:433cd590-9d6c-499c-8042-8bd43946d8af> | CC-MAIN-2023-50 | https://www.keycdn.com/support/opencart-cdn-integration | 2023-12-06T20:18:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00640.warc.gz | en | 0.673559 | 220 |
Columbia SC Moms Blog is honored to partner with My Gym to bring our readers the following post. All opinions are our own.
As a stay-at-home mom to a very busy 3-year-old, I’m always on the lookout for activities to involve my son in that I know he will love. The days can be very long, and as an only child, he definitely looks to me as his #1 playmate. As much as I love being there for him and watching him grow, I can only take so many games of hide-and-go seek, chase and endless requests for Blaze and the Monster Machines before my patience is short and I’m itching for some time to myself … and more structure for him.
I was exited to learn My Gym offers a Preschool Prep class for children between the ages of 2-5. What’s great about this class is it offers the flexibility I’m looking for as a parent who isn’t quite ready to fully commit to preschool, while also offering tons of learning opportunities balanced with play.
What Makes Preschool Prep Unique
Schedule-wise, you can choose to sign your child up for either one or two classes a week, and at 2 1/2 hours a session, it’s the perfect amount of time for me to run errands, grab a cup of coffee or just go home and RELAX if that’s what I need for myself that day. For him, the focus on emotional, social and cognitive development is the right fit before he enters kindergarten.
And he has the BEST time! My Gym offers exciting equipment and activities that challenge my adventurous and curious child – from the zipline and ball pit, to the trampoline and climbing wall, to the traditional slides and padded climbing equipment, he is truly engaged and loves learning all the new ways he can use his body. Not to mention the songs, stories, focus on the letter of the week, as well as arts and crafts. His time spent in Preschool Prep is the topic of conversation well after he leaves class, and it’s heartwarming to hear him talk about all his best friends “at school.”
What Our Family Loves About My Gym
And the true testament that he loves his time at My Gym? My 100% mama’s boy cries when I walk in the door to pick him up – not because he’s excited to see me but because he wants me to leave so he can stay longer! And after meeting the staff it’s easy to see why. From the second you walk in the door and it’s obvious their love for children and care towards development extends far beyond the classroom.
Overall, I can’t say enough good things about My Gym. If you are looking for a program that is fun and challenging, that your kids will love while also learning, Preschool Prep is the way to go! Here’s a sneak peak into what class is like…
The folks at My Gym are offering one lucky reader two free Preschool Prep classes! Enter now and experience for yourself all the fun and learning opportunities we loved so much!2 Preschool Prep Classes From My Gym | <urn:uuid:07e9c9e6-21ff-4cf2-ab57-5a635a7de8ed> | CC-MAIN-2017-13 | http://columbiasc.citymomsblog.com/preparing-classroom-beyond-preschool-prep-gym-giveaway-included/ | 2017-03-26T15:07:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189242.54/warc/CC-MAIN-20170322212949-00458-ip-10-233-31-227.ec2.internal.warc.gz | en | 0.967172 | 670 |
Next year, Denver is piloting the role of “associate teachers” in Denver Public Schools. These teachers will teach part-time in a high-poverty school and spend the rest of their time planning, observing, and learning.
The small pilot is part of a new district strategy to better prepare new teachers to work in Denver’s many high-poverty schools, which tend to hire more novices. The students in those schools are more likely to be behind academically and in need of top-notch teachers.
Denver officials hope that investing in novice teachers will allow the teachers to hone their craft faster and to stay at high-needs schools for longer.
“We know how challenging that first year can be for a new teacher, even when they’ve had high-quality training,” said Laney Shaler, the district’s director of new teacher pathways and development. “We want to extend that developmental runway.”
The teachers aren’t the only ones who stand to benefit. Some research shows high teacher turnover is detrimental to student learning, especially in high-poverty schools. For districts, it can be time-consuming and costly to hire more and more teachers each year.
Three [schools] – North High School, McAuliffe Manual Middle School, and Goldrick Elementary School – will have associate teachers this fall. They will be paid slightly less than regular first-year teachers: $38,000 as opposed to $41,689. The cost will be split between the schools and the district. In all, the district will spend $325,000 in 2018-19 to get the teaching academies up and running, with $150,000 going to associate teacher salaries.
Emily McNeil will be an associate math teacher at North. She’s already familiar with the school, having done her residency there while earning her teaching license. As an associate teacher, she’ll be teaching on her own for the first time, but for three periods a day rather than five. She and the other associate teachers will spend the rest of their time planning, observing other teachers, attending training sessions, and getting advice and feedback from mentors.
Experts said the approach seems promising. Having a gradual on-ramp for new hires is a common-sense approach used in many other professions, said Richard Ingersoll, a professor at the University of Pennsylvania Graduate School of Education, who has studied teacher preparation and remembers his own sparse training as a first-year teacher.
But the experts warned that not all high-poverty schools are fertile training grounds, especially since such schools tend to have higher turnover of teachers and principals. | <urn:uuid:9bf8545a-c978-4a25-9b78-fd707ce85d74> | CC-MAIN-2019-35 | http://www.coreeducationllc.com/blog2/denvers-new-experiment-with-the-first-year-of-teaching/ | 2019-08-24T20:56:06Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027321696.96/warc/CC-MAIN-20190824194521-20190824220521-00054.warc.gz | en | 0.969902 | 552 |
Rose McKenna is volunteering as a lunch mom at her daughter’s elementary school when there is a huge explosion in the cafeteria. In the confusion that follows, she makes some split-second decisions which seem heroic at the time, but for which she later faces public scorn and possible criminal charges. Her life is falling apart, until she learns some details about the explosion and begins to dig for the truth. Some of her heroics may seem like a stretch for a “suburban mom,” but the story keeps moving and is hard to put down.
Want to read more like this? Try…
- Handle With Care by Jodi Picoult
- Mothers and Other Liars by Amy Bourret
- These Things Hidden by Heather Gudenkauf | <urn:uuid:bd258af3-ba72-4b0c-85d0-6d5f6580cbef> | CC-MAIN-2018-05 | https://pinalbookclub.wordpress.com/2012/04/27/we-recommend-save-me-by-lisa-scottoline/ | 2018-01-16T09:29:32Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084886397.2/warc/CC-MAIN-20180116090056-20180116110056-00375.warc.gz | en | 0.966094 | 156 |
Event has passed
Styx, Foreigner with Don FelderSaturday, May 24th, 2014« view all past events
Spawned from a Chicago basement in the early 70s, STYX would eventually transform into the virtual arena rock prototype by the late ’70s and early ’80s, due to a fondness for big rockers and soaring power ballads. Over the course of their 38-year career theyve released 15 studio albums, six best-of compilations and four live albums, garnering eight Top Ten singles. STYX has sold over 30 million albums worldwide.
With ten multi-platinum albums and sixteen Top 30 hits, FOREIGNER is universally hailed as one of the most popular rock acts in the world with a formidable musical arsenal that continues to propel sold-out tours and album sales, now exceeding 75 million. Responsible for some of rock and rolls most enduring anthems including Juke Box Hero, Feels Like The First Time, Urgent, Head Games, Say You Will, Dirty White Boy, Long, Long Way From Home, and the worldwide #1 hit, I Want To Know What Love Is, FOREIGNER continues to rock the charts more than thirty years into the game.
DON FELDER–former guitarist of the Eagles, New York Times best-selling author and four-time Grammy® Award winnerreleased his second solo album (and first since 1983), ROAD TO FOREVER, in October 9, 2012 and has been on tour throughout the U.S. ever since. | <urn:uuid:38ed8212-53b8-41e8-afd9-a37ebf6ded37> | CC-MAIN-2018-22 | http://www.vzwamp.com/event/styx-foreigner-and-don-felder/ | 2018-05-26T07:53:19Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867374.98/warc/CC-MAIN-20180526073410-20180526093410-00074.warc.gz | en | 0.932765 | 322 |
Belgian soon-to-be CS:GO pro Kappa
Ce soir j'te ferais des prises à la JC Van Damme.
shouldn't be addicted to videogames but here I am...
Loading more plays...
Copyright © 2019 Plays.tv All rights reserved.
Terms of Service |
All trademarks referenced herein are the properties of their respective owners. | <urn:uuid:ab0f7768-be31-4065-9307-e5fa3d4b65b6> | CC-MAIN-2019-09 | https://plays.tv/game/FIFA19?game_id=b81ee2a7943b224130a12e93dc7e389a&hashtags=fut&sort=sort_popular | 2019-02-17T08:30:11Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247481766.50/warc/CC-MAIN-20190217071448-20190217093448-00543.warc.gz | en | 0.671273 | 82 |
Battle Creek Brawl was Jackie Chan's first feature for a Western audience. It's set in the 20's, with classic outfits. Original [cough] for a Jackie Chan movie somebody (his brother's fiancée) gets kidnapped and Jackie is forced to fight in a street fighting tournament. This provides some nice fight scenes. My favourite part of the movie is when they join a roller skate race through a factory.
Another recommended Jackie Chan movie!
Not rewatched yet.
Armour of God is one of my favourite Jacky Chan movies. The movie opens with a native tribe having some kind of sacrificial ceremony and Jacky talking in goobly goo to them when he is discovered. He escapes sledding down a grassy mountain. There are some great fight scenes in the movie and although the jump to the balloon is clearly made from two different shots (look at the height he is suddenly at, that must have been one massive mountain!) the action is great as you expect from Jacky Chan.
Not re-watched yet. | <urn:uuid:5c4cb092-6093-4a31-8f03-90710c973026> | CC-MAIN-2016-30 | http://www.popcornmoviereviews.com/node?page=2 | 2016-07-24T22:17:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257824185.14/warc/CC-MAIN-20160723071024-00240-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.955909 | 215 |
Tight Lace Homecoming Dresses
58 Tight Lace Homecoming Dresses Found
CUSTOMER REVIEWS (13)Tight Lace Homecoming Dresses
By rhonda clark
Well my dress had already been shipped and delivered before I was ever notified, but of course who's complaining about fast shipping? Lol definitely not me! I love the dress, obviously it came on time, great service- thanks alot!
By Renee Sutton
Purchased this dress for my baby shower the color was so beautiful! It fit like a glove, but very breathable material. I felt like Princess! Fast shipping! Great Customer Service!!!
By Kristin Paglione
Gorgeous! Gorgeous! Gorgeous! Seller was such a delight to communicate with.
By Heather Stovall
Gorgeous!!!! Exactly what I needed
By DeLora Morgan
By Jackie Cichy
Absolutely LOVE this dress. June was so nice and worked with me to make it entirely custom and it's exactly like I wanted. Can't wait to wear this! Thank you!!
By Grateful Customer
Sexy and shows curves. Love it just too big for me and so didn't want to spend much $$ on alteration
By Carrie VanDerhoof
Stunning dress and fits so wonderful, purchases for a cocktail style wedding in September, I am thrilled with this piece.
It fit perfectly and was exactly as described! Love it!
Beautiful dress. Very pleased with it. I'll post a photo later.
By Julia Granlund
Amazing dress!! Super happy with it! Thinking about buying it in different colors.
By Cici Wright
The material is such high quality, the fit is perfect, and the dress style is beautiful! I'm actually buying another one now for my next event:) I will be going to this shop for all my event dress needs in the future!!
The dress is amazing! I ordered one dress to inspect it. The material is really nice and thick. The shipper replies to all queries within a good time frame & I received it in Melbourne, Australia within 3 weeks of ordering. Thank you so much!!! | <urn:uuid:11ac0e3f-fc18-4046-9046-d1ebfbb07986> | CC-MAIN-2019-30 | https://www.ucenterdress.com/tight-lace-homecoming-dresses.html | 2019-07-19T09:06:38Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195526153.35/warc/CC-MAIN-20190719074137-20190719100137-00530.warc.gz | en | 0.952103 | 447 |
For a project of ours (project TLSiP) we need to evaluate a specific subset from the top one million most popular websites. This subset basically allows you to browse the webpages privately and securely, but they are not enforcing it. To improve the overall usage of secure and private communication we want to change that by creating rules for a particular browser extension: HTTPSEverywhere by the EFF and the Tor project.
Simple as that: if you have a few minutes, load the page and look at some websites whether or not they seem equal to you.
Every time you hit "compare" one of our rules is picked at random. The website for this rule is opened twice, once over regular HTTP (to the left) and once over HTTPS (to the right). If they seem equal to you, you can help us to validate our findings by pressing the green "equal" button. If they are not, please press "not equal".
Any web browser should do the job, we tested it on Chrome and Firefox. Please share with us your findings and/or problems by using other browsers.
HTTPS is a standard for secure communication and implemented in all browsers. If you surf the web and see a padlock somewhere, communication is encrypted and you can be sure you are talking to the correct server. Some recent publications on the security of HTTPS can be found here, here or here.
HTTPSEverywhere is a browser extension for Firefox, Chrome and Opera that can upgrade unencrypted communications to encrypted and secured ones. It uses a manually crafted set of rules to do so. You should install and use it!
If in doubt whether or not the two pages are equal, press "not-equal". At any time you can simply close all three browser windows and start over by surfing to tlscompare.org
If the structure and the visual impression are the same, this is good enough. Small portions can be different, like ads or other dynamic content.
If you use the regular interface, please press "non-equal" - a rule for HTTPSEverywhere would not make sense, however we will manually review these borderline cases specifically
Sometimes webpages have to be fetched from the other side of the world, this can take some seconds. If nothing happens for more than 10 seconds, please press "not-equal".
If both windows stay empty for more then 10 seconds, please press "not equal". We will have another look at them.
If you see an error message from Cloudflare, this means most likely that the server is currently not available. It's safe to press "not equal", and we'll have a look at it.
This page only makes sense if you have an appropriate display with a large-enough resolution. It doesn't work on smartphones and tablets.
The screen is too small.
The websites are a random subset of popular websites on the Internet. This includes porn. Viewer discretion is advised, this page is NSFW.
Beside the information your browser sends to us by default (UserAgent, operating system, IP adress) we store an encrypted cookie on your side to count the number of solved requests. You can delete this cookie in your browser preferences or by using the private mode of your browser.
Aside from that we do not use any form of tracking- or analytics service, i.e. no Google Analytics or any other third-party tracking.
The expert mode is for people that have experience with TLS and HTTPS. This allows us for collecting finer grained answers (like timeouts, certificate errors, ...)
By default the most interesting ruleset for us is selected, namely those pages that are somewhere close to being equal but our algorithms weren't sure (named "Generaded rules close to threshold"). The other sets are the current rules of HTTPSEverywhere named "existing rules", which all should be valid and euqal. The third set is "Generated valid rules", which are our contribution back to HTTPSEverywhere and which is by far the biggest dataset needing manual verification.
The more, the merrier! We are working on integrating Facebook and Twitter so that you can share this site with your social peers. Stay tuned for updates.
Please see the contact page. | <urn:uuid:3cfa53dc-15f4-4c75-8924-42bed419f1cc> | CC-MAIN-2020-10 | https://tlscompare.org/faq | 2020-02-25T22:24:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875146160.21/warc/CC-MAIN-20200225202625-20200225232625-00503.warc.gz | en | 0.920011 | 872 |
Beautiful display. I love how they're staggered on the ladders.
I have always loved the fragrance of hyacinths.
Happy Independence Day!Hugs
Happy Indpendance Day.
Beautiful! I <3 white flowers, especially so many together. 99 years of independence doesn't seem so long.
Thank you for coming by! Please leave a message.Kiva kun kävit, kerro minullekin. | <urn:uuid:d33fec4e-2ae4-43b1-b156-fee4fdaf7664> | CC-MAIN-2017-34 | https://kotkarankki.blogspot.com/2016/12/day-6.html | 2017-08-21T00:40:19Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886107065.72/warc/CC-MAIN-20170821003037-20170821023037-00160.warc.gz | en | 0.771314 | 95 |
If you were as wowed by the Austrack Telegraph X as we were at last year’s Camper Trailer of the Year competition, then you’ ll just love the additional space provided by the new Savannah X. Austrack’s premium presentation places them as one of the leaders in the forward fold category. The Savannah X has all of the bells, whistles and accessories that impressed us last year, but this time with an innovative rear slide for even greater facility.
I can’t believe the amount being offered for the price; and it’s not a compilation of cheap accessories – this is a seriously high quality package. The Savannah X really is a home away from home with a huge host of extras that will make your next holiday a hit.
I must admit that I was quite frustrated by some of the early forward fold campers with the amount of time and effort required to assemble all of the knick-knacks. Yet as is always the case, time has allowed the smart operators to evolve to overcome such problems. The Austrack Savannah X has a really convenient slide, almost like a big drawer that rolls out behind the hinged, gas strut assisted tailgate that houses twin spare wheels plus the trailer lighting. The sliding tracks glide smoothly, extending the internal length enormously. Inside, the tent folds out to tension up quite easily with minimal adjustment so you can assemble the camper for an easy overnighter in a reasonable amount of time and effort at the end of a long day on the road.
FROM THE GROUND UP
Austrack utilise a 100x50x3mm box section galvanised chassis peaking at the front with a 120x50x4mm A-frame drawbar. It is a very sturdy construction with great ground clearance created from the 16in alloy wheels, 6 stud hubs, heavy duty bearings and all-terrain or mud tyres, plus independent trailing arm suspension with twin gas struts and coil springs. You will stop on command with 12in electric brakes and a mechanical hand brake out in front, plus the 50A Anderson plug. The swing arm is retained by chains just in case you were to end up over centre in a diabolical offroad manoeuvre.
Out front we find the popular McHitch, a strong offroad coupling that has gained strong support in the camper trailer community, plus another popular newcomer in the Ark XO heavy duty dual jockey wheel. Immediately in front of the tub are mounting brackets for twin jerry cans, plus two gas bottle holders that are adjustable from four to nine kilos each. The gas bottles are connected with a dual hose regulator and the entire area is protected behind an aluminium checkerplate stone guard.
The undersides feature twin recovery points, wind down stabilisers and twin stainless steel water tanks, the rear 120L with 12V pump plumbed to the kitchen, and a further 50L stainless steel tank with pump plumbed to the drawbar to service the ensuite. Both are fully protected by alloy checkerplate shrouds and very neatly plumbed, however I would prefer to see a solid outlet replacing the flexible hose at the rear where logs have a habit of grabbing your attention.
RUB A DUB TUB
The Zincanneal steel tub is superbly finished on all external surfaces with a beautiful baked enamel finish with polished stainless steel trim that enhances the metallic bronze colour scheme that spells C-L-A-S-S. It not only looks great but it feels smooth and solid with neat folded edges and secure hatches, seals and locks. As we open the swing down doorway, out pops a cantilevered staircase. Immediately to the left is the pantry and pole carrier with two large sliding drawers for your pots, pans and non-perishables. In a separate compartment we find a 75L Evakool dual zone, double lid fridge/freezer set on quality slides and fully ventilated. The Evakool is part of the package price for the Savannah X increasing the value package even further.
To the rear of the “living” side of the unit, the pull out stainless steel kitchen is a ripper. It features three utility draws, electric pump tap, a large stainless steel sink, three-burner Smev stove, plus a foldaway shelving unit, quick connect fittings, pull out bench extension and stabiliser legs. It is worth noting the gas system is completely plumbed from the bottles to the kitchen, with dual bottle change-over valve and AGA gas certification certificate.
Around to the driver’s side of the tub we find a ripper three stage fold-over boat rack that is capable of loads up to 150kg and tilts all the way to ground for easy loading/unloading. The Austrack boys sensibly pointed out that it makes a great clothes line when the water toys are in use as well. Then there’s twin lockable water fillers, and in front of the axle is the electrical control centre complete with dual water tank level indicators, digital voltmeter, ammeter and battery management system, isolator, main switches with fuses and even an instruction sticker to fully explain the charging criteria. I was pleased to see an added Anderson plug inlet for the 160W solar panel, plus there’s a 240V input and a 20A battery charger. The next compartment reflects the pantry on the other side, however there is only a single drawer to cater for higher objects plus the pole compartment, accessible from both sides. Finally we find a cavernous storage compartment up front that is large enough to carry the porta-potti (standard), or perhaps the generator and plenty of other accessories. It even has a fire extinguisher as standard – see what I mean about sensible packaging?
THE LIVING ROOM
Austrack have created a huge footprint of comfortable living space with the Savannah X. The main tent is 5200x1900x1600mm plus an additional 5200x2400mm in the detachable awning that comes complete with side walls, PVC floor and draft skirts. There will be no complaints about the high quality 16oz canvas all around including the walls. A slightly lighter weight safari roof pops up instantly as the tent folds out. All of the main tent walls have inner and outer awnings with quality zips and midge mesh screens, and the “living” side of the tent opens right up for open plan living. I call it the donut shop window.
As we take the two steps up to the living area we find the main queen bed to the left complete with its canvas privacy screen and high density foam mattress. In the centre is the convertible dining area that seats six people on comfortable upholstered cushions that can also be set up as a double bed with the drop down portable table. Under the seats we find twin 100A AGM batteries and the interior is well serviced with USB and 12V power options. The large area created by the rear slide allows the opportunity for another double bed at the rear, or perhaps you would prefer a queen by dropping the hinged rear seat. All of the finishes are neat and tidy with more storage available under the seats. Austrack has also provided plenty of low energy lighting and charging options all around the Savannah X with strip lighting inside on individual switches.
The annexe is an absolute ripper that really makes this large living space complete. It extends all the way to the back of the rear slide so the kitchen area is very well protected. You can add the detachable side walls, floor and draft skirt as you desire. However one of the sides includes a huge ensuite for the porta-potti and portable Country Comfort gas hot water service supplying a nice hot shower at the end of a long day’s excitement. Yet again I emphasise that this is all included in the package price. I really liked the plastic windows in the annexe as well and I loved the idea that you could roll the internal awnings up halfway to get plenty of natural light and privacy at the same time.
HOW’S IT TOW?
I have to admit that we never really had the opportunity to scale a cliff, run through a quagmire or rattle down 10,000km of corrugations, however it sat like it was on rails on the bitumen, scrambled over inundations with ease, toddled through some creek crossings and climbed over a rocky ramp without a problem. Its Tare weight including the tent is a reasonable 1440kg with 120kg ball weight and an ATM of 2000kg. Once the water tanks are full you still have some payload opportunity. However should you load the boat rack it will reduce considerably. Yet the package is so complete you only need load some clothes, food and fishing rods and off you go.
THE WRAP UP
Austrack boasts that many trailers offering far less than the Savannah X retail for well over $30,000 and I must agree with them – their retail price is only $23,990.
This is a trailer for families. Two people travelling don’t need the added slide out or that much living space, and should perhaps consider the Austrack Telegraph X that stole our hearts at last year’s Camper Trailer Of The Year. However if travelling to your Utopian offroad destination and putting up camp for a week or two is your purpose, then the Savannah X gives you every conceivable facility including water and power generation ability, plus the huge “living” area that makes a house a home.
Yes, I forgot to mention that it comes complete with a TV/DVD/MP3 and all that stuff – I suppose it’s good for the kids, big and small. Give me a campfire, the moon and the stars please.
HITS AND MISSES
- Huge “living” footprint
- Premium presentation, manufacturing and accessories
- Easy rear slide and 16oz tent and annexe
- Power and water
- Boat rack
- Well assembled package at a great price
- Watch out on loading capacity
- Solid plumb the water outlet
- Leave the TV at home!
Suspension Independent trailing arm suspension with twin gas struts and coil springs
Brakes 12in electric
Chassis 100x50x3mm box section galvanised chassis
Drawbar 120x50x4mm box section galvanised A-frame
Body 1.6mm Zincanneal with baked enamel paint with stainless steel trim and fittings
Wheel/tyre 16in All Terrain or MT
Style Alloy mag wheels 6 stud hubs
Box size 1800x1200mm (fridge slide and pantry area)
Length 5200mm (hitch to tail lights)
Tent size1800x6000mm plus annexe of 2400x6000mm
Gas cylinders 2x4-9kg holders only
Water 120L stainless steel underfloor water tank with aluminium tank guard and 12V pump plumbed to kitchen. 50L stainless steel underfloor water tank with aluminium tank guard and 12v pump plumbed to cold water shower system
Cooktop Smev three-burner stove
Kitchen Stainless steel slide-out with draws, electric pump, tap, large sink
Battery 2x100A hour deep cycle batteries with 12V accessory and USB sockets.
PRICE AS SHOWN
Check out the full review in issue #121 of Camper Trailer Australia magazine. Subscribe today for all the latest camper trailer news, reviews and travel inspiration.
To buy your own camper, head to TradeRVs. | <urn:uuid:dff9b601-65ce-486c-bf78-07ebe48ec220> | CC-MAIN-2019-26 | http://camper.hemax.com/Reviews/646/2018_CTOTY_Austrack_Savannah_X_Review | 2019-06-25T03:46:11Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560627999787.0/warc/CC-MAIN-20190625031825-20190625053825-00210.warc.gz | en | 0.930408 | 2,398 |
There is not much to tell about myself really... But I will try.
I'm a gamer and a nerd. I love reading good fantasy books, watching movies, cartoons and tv shows.
I could not find path in my life yet, even though I'm 25 now. For my entire life everyone wanted me to be someone I did not want to become.
On december 2012 I decided to try myself at drawing. I have never drawn anything before. But I was lucky with the teacher who gave me confidence and here I am - learning to draw and I like it!
P.S. I've studied english all by myself so it is far from perfect. Just saying | <urn:uuid:f4472e54-8255-41ad-a08e-684141bc5f33> | CC-MAIN-2014-10 | http://kligan.deviantart.com/ | 2014-03-09T20:10:23Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394010303377/warc/CC-MAIN-20140305090503-00043-ip-10-183-142-35.ec2.internal.warc.gz | en | 0.988647 | 139 |
Our fabric calculator is to be used as a guide only. Please feel free to contact us either via phone or email. We are more than happy to work through with you the calculations for your project.
Sheer curtains are calculated in meters and using a standard length of sheer available. If you have long curtain lengths, you may have to railroad the sheer (create vertical joins. As such the calculations are different. Please contact us if this is the case.
Our calculator takes into account overlaps + returns. For those treatments the return allowance is added to the fullness.
Calculator makes allowances for 'returns' and 'overlaps' for all heading types except 'tab top', 'rod pocket' and 'eyelet' heading for both drapes and sheers. For those treatments where an allowance is made for returns and overlaps, the allowance has been added to the fullness.
Pattern repeats quoted for products are approximate only. They can vary slightly for each batch / shipment from the mill.
The calculator automatically adds 30cm allowances for drapery fabrics (15cm headings + 15cm hems)
The calculator automatically adds 15cm allowances for lining fabrics (7.5cm headings + 7.5cm hems)
The widths for drapes and meterage for sheers have been rounded up. e.g.; 2*4.85m sheer is 2*5m. Widths is rounded up to 2*3 widths.
If using a Valance rod you will need to allow for the returns.
The Allure series exhibits a luxurious affordable compilation of exquisite European jacquard sheers. This collection is the pinnacle of sheer sophistication utilising the latest innovative weaving, furnishings and design techniques.
Extensive development and research has been undertaken in an exclusive association to produce an array of intricate styles with a comprehensive decorative appeal.
The eight designs are all 300cm drop continuous, reversible and superbly finished with a gossamer delicate drape. A weighted base has been added to all designs for a clean contemporary finish. Several of the designs have a unique shearing process applied that “clips” the excess yarns from the motifs to showcase a wonderful dimensional and textured contour effect. This reverse side of the fabric may be used as a decorative feature or there may be a preference for the smoother side of the fabric.
The colour palette showcased throughout the collection will enhance the ambience and style of any interior with either classic pearlised neutrals, warm inviting earthen hues or modern smokey charcoals. Parade is broken stripes which interplays with varying textures for a fantastic studio styled sheer.
Width: 300cm Continuous
Composition: 98%Polyester, 1%Linen, 1%Viscose
Care Code: C4
Due to brand distribution licensing agreements in place, we can only supply this product (and cuttings) within AUSTRALIA ONLY at this time. Click HERE for a list of other brands we cannot export at this time. | <urn:uuid:80394a1e-921d-4548-86b6-72042681f883> | CC-MAIN-2018-43 | https://shop.idealdrapemakers.com.au/jw-design-parade-natural-sheer-300cm/ | 2018-10-16T13:59:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583510754.1/warc/CC-MAIN-20181016134654-20181016160154-00121.warc.gz | en | 0.90513 | 628 |
|My sturdy hiking crew, Big Sis, Brother, Little Sis and me, the Momma|
Perfect Day for a Hike...
...but then again, I sort of feel that way most of the time. We really needed it today though. More than half of our happy little mob, including the Dad, have been suffering from flu-like symptoms for a week and we ALL have been suffering from a serious case of cabin-fever for about the same amount of time. So when everyone woke up feeling pretty close to healthy and it was a mild winter day, weather-wise, we decided to jump on the opportunity to get out and get hiking.
We headed over to the NJ Audubon Plainsboro Preserve for the first time. Its a beautiful park with a really nice Nature Center right off of the parking lot. The hiking was pretty easy going, no elevation changes to speak of and the trails were all clearly marked. It was a good choice for us since we didn't know how long the mob would last having just been pretty sick and all. We almost had all the trails to ourselves and only passed a handful of other folks on our hike. The ground was soft from recent rain so we could spot a lot of animal tracks and even got to see a total of about 16 deer while we made our 2-mile trek.
I am so happy that we got up and got moving in this park today. It felt amazing to gather up all the kiddies and get outside. Like I said before, we needed it! Plus, we are determined to return and search out all of the Ranger Rick caches so the mob can complete their passports. What an awesome accomplishment that will be for my little hikers!
|Eureka! Big Sis and Brother spot a treasure!|
|Checking out the treasure box while the Dad signs the book.| | <urn:uuid:38d58504-31ee-41cc-a100-91d86bf818c1> | CC-MAIN-2017-26 | http://wholehappykids.blogspot.com/2013/01/perfect-day-for-hike.html | 2017-06-27T08:58:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128321306.65/warc/CC-MAIN-20170627083142-20170627103142-00665.warc.gz | en | 0.972062 | 386 |
Born near Dusseldorf, Germany in 1880, Joseph Pilates suffered from asthma, rickets and rheumatic fever as a child. His determination and drive to overcome those aliments led to the study of both Eastern and Western forms of exercise: including yoga, zen, ancient Grecian and Roman regimens. He took them on step further by combining engineering skills with his knowledge of exercise and anatomy, to design apparatus geared specifically to his philosophy.
Joseph Pilates – the name is of Greek origin – brought his revolutionary method of physical and mental conditioning to the United States in the early twenties. His studio in New York caught the attention of the dance community – and the Pilates techniques became an integral part of the dance training.
Pilates felt that his work was probably about fifty years ahead of its time, and although his name was not yet a household word, people from all walks of life were discovering and choosing the Pilates technique as their fitness program.
The Pilates Method
The Pilates Method is a conditioning program that improves muscle control, flexibility, coordination, strength and tone.
The basic principles of Pilates conditioning are to make people more aware of their bodies as single integrated units, to improve alignment and breathing, and to increase efficiency of movement. Unlike other exercise programs, the Pilates method does not require the repetition of exercises that people tire of quickly and subsequently abandon. The method consists of a sequence of carefully performed movements, some carried out on specifically designed equipment. Each exercise is designed to stretch and strengthen the muscles involved, opening the joints and releasing tension. There is a specific breathing pattern for each exercise to assist in directing energy to those areas while relaxing the rest of the body.
The Pilates Method works many of the deeper muscles together, improving coordination and balance, to achieve efficient and graceful movement. Rather than pursing the unrealistic goal of having an ideal body, the practitioner develops a healthy self-image, through the attainment of better posture, proper coordination and improved flexibility.
How is Pilates different from other forms of exercise?
Pilates is different from most exercises out there because it’s non-impact and safe, and it really works on using the body as a whole. You’re either lying on your back, on your side or kneeling on the floor where it’s safe. When you move the body, you’re trying to move it from the core, using your abdominal wall to protect your back. You’re also working the body very evenly and symmetrically, making sure one side is not working harder than the other.
How do I know if Pilates will benefit me?
I can’t say that it’s great for everyone in every scenario, but in my experience, I’ve only had clients feel better after doing it. Injuries begin to cause less discomfort or go away completely. Pilates can help you lose weight, get relief from back pain, tone your trouble spots, or recover from injury. It’s also being used more and more as therapy to help people with certain serious illnesses such as cancer.
Is Pilates a cardiovascular workout?
Initially the workout is slow moving because everything is being explained to you. Eventually, once you learn the workout and you’re going through the motions, it becomes aerobic. You can get a cardiovascular workout when you’re on the equipment and working on an advanced level because it’s more physical. And some classes and Pilates DVDs alternate classic Pilates moves with sequences of heart-rate boosting exercises for a double-duty effect. You have to work towards it, but Pilates can be cardiovascular.
How often should I do Pilates? Is it like weight training in that you need to rest your muscles for 48 hours between workouts?
Pilates is safe enough to do every day. Initially you may want to do it every day so you get a rhythm and become consistent; then a good goal is to do it every other day. Joseph Pilates used to say to do it three times a week.
Will my body be sore after a Pilates class?
Feeling sore is a very individual thing. Some people don’t feel sore. Pilates is what you put into it. If you’re really conscious and making an effort to make every movement count, you’ll most likely feel something the following day. It also has to do with your athleticism. If you’ve been sedentary, you’re probably going to feel it more than someone who’s very active. It’s all relative.
How can beginners get the most benefit from Pilates?
Be consistent, especially in the beginning. Don’t just try it once. Give it a few shots and do it in succession. Make it your reward, your break from a hectic day. Also, listen to your body and really concentrate — it makes for a better workout. | <urn:uuid:9b19ccbe-56c0-47e4-b6ac-09d882d5c3b8> | CC-MAIN-2021-31 | https://blacksaltpilates.co.uk/pilates/ | 2021-07-25T05:00:48Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046151638.93/warc/CC-MAIN-20210725045638-20210725075638-00369.warc.gz | en | 0.968818 | 1,023 |
Markham Lock & Key Service
People of Markham, Ontario are now getting the best locksmith services
by our Markham Lock & Key Service and relying on our best quality
We have different kind of locksmith services with emergency need of citizens of Markham city which might be working as the forces of our increasing popularity and reliability. We provide the best quality automotive locksmith, business locksmith, emergency locksmith, and house locksmith services to our citizens. Markham Lock & Key Service a licensed company, feels proud to serve you 24/7 at anywhere in the city. Our customers have the belief on us that we not only provide locksmith service also we do it as faster as possible and we give you the option best suited for you. We are better than any other locksmith service providers with most caring for our citizens.
In Toronto, Markham, Ontario is one of the biggest and largest growing communities with 262,000 citizens living in this city. This city has some awesome and enormous natural beauties and places to visit like the Markham Museum, the Frederick Horsman Varly Art Gallery etc. many tourists visits the Cathedral of the Transfiguration and Adventure Valley with a great and remarkable experience of tourism. At Markham Lock & Key Service we feel grateful to offer locksmith service to such a great community as Markham, Ontario.
Get a Quote
Commercial Locksmith Service
At Markham Lock & Key Service we are here to assist the cities business community with all of their commercial locksmith service requirements. Our customers know we are the licensed locksmith to turn too because we offer locksmith services businesses really need.
Commercial locations have expensive possessions to protect which is why they need heavier, more durable locks. However these locks present problems when used frequently and lockouts in such cases are harder to deal with. Our emergency lockout experts are just a phone call away.
For the most effective commercial locksmith service in Markham call our Markham Lock & Key Service today.
Residential Locksmith Service
Our highly skilled team of experts answers to all the calls every day of the resident of Markham city and provide excellent residential locksmith service and Markham Lock & Key Service. If you are in a lock and key problem; we are there instantly to break you through the situation. Anytime from anywhere in Markham, every day you call us; we will be there with our expert team to give you the most suitable and instant solution to your any lock and key situation. As a local licensed locksmith we provide exception residential locksmith service include: Deadbolt installation, house lockout service, lock change and lock fix.
Regardless of the residential locksmith service you need; our experts at Markham Lock & Key service can provide it for you.
Automotive Locksmith Service
At Markham Lock & Key Service we offer automobile locksmith service that is beyond compare.
Our 24 hour emergency locksmith service means we will be there any time you are locked out of your auto or need emergency locksmith needs.
At Markham Lock & Key Service our expert techs care about your safety and security and will respond immediately to your call for help.
Emergency Locksmith Service
Emergency locksmith service that we provide in Markham is characterized by some specialty. First of all, as emergency knows no time table, we offer this service 24/7. Second, we respond in minimal time possible. Markham Lock & Key Service is always ready to provide satisfactory service in the Markham area.
At Markham Lock & Key Service we want your business. Give us a call for any inquires at 647-499-3747. | <urn:uuid:a67a4455-3ccf-409b-8683-f5be367fb7c5> | CC-MAIN-2014-49 | http://www.markhamlockkeyservice.com/ | 2014-11-28T11:52:53Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-49/segments/1416931010166.36/warc/CC-MAIN-20141125155650-00028-ip-10-235-23-156.ec2.internal.warc.gz | en | 0.937131 | 747 |
If you walk on any sidewalk chances are it has happened to you.
STEPPING IN DOG POO.
Enough to instantly put you in a bad mood, the smell, the squish, the hassle of removing it from your shoe, oh your glorious shoe!!
One man from Queens in the USA had enough of his communities dog owners not picking up after their pet so he decided to take it upon himself to not only forwarn pedestrians to the brown, smelly landmines but to encourage dog owners to clean up!
And so THE POOP PROJECT was born
Dressed in an oversized hoodie and glasses for disguise this superhero poop fighter will spraypaint, (with temporary chalk) over the k9 landmine to ensure nobody steps in it.
Learn more from this news report | <urn:uuid:515f165f-1623-4dd9-a4d3-0e40c03e1470> | CC-MAIN-2020-24 | https://sausageandsanchez.com/2013/04/19/got-the-shts/ | 2020-06-04T20:30:55Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-24/segments/1590347458095.68/warc/CC-MAIN-20200604192256-20200604222256-00401.warc.gz | en | 0.970553 | 165 |
Get the Slide Deck
I've uploaded the slide deck and it can be downloaded HERE.
Any improvements with VMQ? Seems like in order for my HP hardware to work correctly, I have to disable VMQ to prevent issues. Or is this a NIC vendor specific issue?
Seems like Server 2016 is getting farther and farther away from SAN architecture. Do you see that continuing?
WS2016 still has improved functionality for SAN customers. For example, you can replicate your LUNs using Storage Replica without purchasing expensive SAN replication licensing, and Storage QoS will improve VM performance on CSVs. But Microsoft is making a big bet on commodity hardware. A lot of this comes from their learning from Azure (there are 0 SANs in the big 3 clouds). You can build storage bigger, faster, and cheaper using commodity hardware - sure it's not as packaged as a SAN but do you want to give those companies 80% margin? Anyone in the cloud business (internal or as a service provider) needs to be lean, and software-defined storage makes that possible. By the way, thanks to cluster-in-a-box, software-defined storage makes Hyper-V clustering affordable for the small-mid business too!
For SMEs, do you recommend running azure on premises?
No, I don't. Azure Stack will be just too big for a small-mid enterprise. Use on-premises virtualization (Hyper-V), and if you need cloud, then add on an Azure subscription. You can treat it as one stretched deployment with Azure AD Connect (shared sign-on for single username & password) and site-to-site VPN.
Can a 2 Server - ScaleOut Fileserver Storage Spaces configuration (2012R2 ) be upgraded in some sort to 2016 SOFS?
Can vCPU be modified live for a VM in Server 2016?
It's important to disable C-States for the hyper-v hosts?
The usual names in server tech (Dell, HP, etc) all have best practices for BIOS/UEFI configurations of their machines. All of them instruct you how to best configure the power setup. This is important to get the best possible performance for VMs and for Live Migration.
Any idea about required feature support at hardware level for new direct hardware (SR-IOV) exposure to VM's? Lots of older hardware might be capable of Hyper-V but not SR-IOV compatible. Will new virtualisation hardware exposure require whole new set of hardware?
WS2016 Hyper-V will require Second Leval Address Translation (SLAT) which comes on Nehalem or later processors, so really old hardware won't run the latest version of Hyper-V anyway. SR-IOV support from the host is a start - you need firmware and BIOS/UEFI support for DDA to function. The devices must also cooperate.
The following post goes into detail and links to a script that can test your hardware:https://blogs.technet.microsoft.com/virtualization/2015/11/20/discrete-device-assignment-machines-and-devices/
Can you boot directly from a PCIE SSD that has been passed through directly to the VM?
I thought checkpoints currently use VSS?
Currently VSS in 2012 R2 Hyper-V is primarily used via backup applications. Checkpoints themselves do not currently use this technology. The VM is simply put into a paused state briefly while the checkpoint file is created and the write redirection occurs. For more information on the process and how it's different in 2016, see the below links.
2012 R2 Checkpoints and Snapshots Overview
Using Checkpoints to Revert Virtual Machines to a Previous State (2016)
For DR, can you run a 2012 R2 or 2016 VM on a W10 Pro workstaton?
What is the release data for Windows Server 2016?
The answer to that question is unknown at this time. Microsoft has made no formal announcement on this, or provided any indication as to when the product will be released.
Is vm performance more in line with VMware with 2016?
From a performance stand point, the two vendors have been pretty neck and neck for the past couple of years. When talking with customers in the past, performance hardly ever came into the discussion. It always comes down to who's ecosystem you want to be a part of, and what management tools your familiar with.
Will there be feature discrepancy between Hyper-V Server and the Hyper-V role in full server 2016?
It looks like Hyper-V Server 2016 will have technical feature parity with Windows Server 2016 Standard Hyper-V. Some features will be Datacenter edition only, such as S2D, Storage Replica, and Network Controller.
Using DDA, can a VM now use serial ports on the Hyper-V host?
I don't believe so.
Any improvements with Hyper-V Replica?
Microsoft has announced that Hyper-V Replica will be supported with the new Shared VHDX format (guest clusters).
Do you know why Hyper-V are not capable to use USB host?
Actually, you can read how to do this on the Altaro blog: https://www.altaro.com/hyper-v/installing-and-running-hyper-v-from-a-usb-stick/. HOWEVER, Microsoft will not support this if it is not done by the OEM (the server manufacturer), but I have not heard of any OEMs offering this option for Hyper-V.
I'd be more interested in boot from SD, which is not possible now, but there is a lot of feedback for this - vote here: https://windowsserver.uservoice.com/forums/295050-virtualization/suggestions/8070120-support-to-boot-from-sd-card
Are there any plans or news about hyper-v host backup? VMs are already covered by Altaro. What's the best practice?
Our product is designed to backup and protect the VMs running on the hypervisor, not the hypervisor itself. Best practices state that the hypervisor ONLY be a hypervisor, with no other roles/features or file storage. This way, in the event of a host failure, you simple re-install the host operating system and recover your VMs.
How much bandwidth does Altaro VM backup need to run a backup/restore?
How do you anticipate Altaro licensing evolving with nested virtualization?
Altaro VM Backup will continue to be licensed at the host level, regardless of whether or not that host is a nested host or not. As an example, if you have 1 physical virtualization host, and 4 nested hosts running on top of it, and you would like to protect the VMs across all 5 of those hosts, you would need 5 licenses of Altaro VM Backup.
Is the Altaro change block tracking for backups likely to be supported for both Windows 2012 R2 as well as Windows 2016?
Yes. We will support CBT in 2012 R2 and we will be using the new built in Resilient Change Tracking (RCT) features in Windows Server 2016. | <urn:uuid:8595a408-84eb-4bbe-a545-f2fa1c628dcb> | CC-MAIN-2019-47 | https://www.altaro.com/hyper-v-backup/webinars/windows-server-2016-hyper-v.php | 2019-11-23T03:10:04Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496672313.95/warc/CC-MAIN-20191123005913-20191123034913-00340.warc.gz | en | 0.917635 | 1,491 |
ATLANTA -- Count Marlins manager Jack McKeon among those who would support a realignment proposal that would add another wild card team to the playoff mix.
"If I was voting for that, I'd vote for it," McKeon said.
With the Phillies trading for Hunter Pence and the Braves obtaining Michael Bourn, the disparity between the haves and the have nots in the National League is becoming even more pronounced than it was before, McKeon said.
"They needed a leadoff hitter and a center fielder," McKeon said of the Braves. "They got their guy, which will make them tougher, and it makes it tougher on clubs like the Mets, the Marlins and the Nationals to catch up down the road -- not now, but even in the future."
Adding an additional wild card team, like one that has been proposed, "would help," McKeon said.
"That's definitely going to help clubs like us and Washington and the Mets, and some of the other clubs in the Central.....because these clubs are just taking off, and they don't let you up," McKeon said. "Now you're seeing the Giants do it in the West. They're not letting up, either. They got (Carlos) Beltran and (Orlando) Cabrera. The Cardinals aren't letting up."
The Marlins began the day Sunday 10 1/2 games in back of the Braves in the NL Wild Card race. If an additional wild card team was in place this season, the Diamondbacks (58-49) would occupy that spot at the moment, with the Marlins six games behind them.
DAY OFF FOR LOGAN MORRISON -- Logan Morrison, who has been struggling at the plate, is getting a breather today. McKeon said he decided to give Morrison "a mental break," replacing him in left with Emilio Bonifacio, after spotting signals that Morrison is pressing.
"I saw him yesterday in the dugout with a towel over his head," McKeon said. "He just needs a break. Give him a mental break." | <urn:uuid:1e371b24-da0e-47ed-ad5a-9c2be248fc3b> | CC-MAIN-2014-10 | http://miamiherald.typepad.com/fish_bytes/2011/07/ | 2014-03-15T02:24:33Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394678695535/warc/CC-MAIN-20140313024455-00017-ip-10-183-142-35.ec2.internal.warc.gz | en | 0.984331 | 434 |
Worry-free hotels! Country houses, hotels, accommodations and apartments where you don´t have to take care of anything! Are you looking for Hotels, Country houses, chalets, lodgings or apartments tto fully relax and forget about it all? Rusticae has selected the best carefree hotels for you!
If you are looking for a hotel with the sole purpose of resting and being pampered, you are in the right place. In this category you will find the ideal hotel for these needs. Hoteliers can provide you with a foam bath, a massage, music, a drink on the terrace or a tasty dinner prepared with local products. There are so many possibilities!
In this category you´ll also find hotels with magnificent spas, thermal baths, saunas, jacuzzi or Turkish baths. Perfect for those who love to treat themselves. And if you want to take a different path, we also have hotels that focus on well-being. For example yoga and meditation sessions, or a spiritual retreat. Have a look in this category and get inspired!
Want to get away from it all and completely relax yourself? Let our hotels take care of you! | <urn:uuid:d97c061a-35d0-47b2-bfe5-0c803e6b4029> | CC-MAIN-2019-30 | https://www.rusticae.com/boutique-hotels/i-want-to-be-worry-free-01632 | 2019-07-18T19:15:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195525793.19/warc/CC-MAIN-20190718190635-20190718212635-00166.warc.gz | en | 0.941802 | 247 |
Sunday, September 29, 2013
Introducing the Tiramisu cake!!!!
It was a friends birthday 2 months ago (this is a very belated post XD) and she had requested a few months prior that she would like tiramisu for her birthday. I didn't want to just make it in a glass dish so decided to get a little creative.
I used the same recipe as my previous tiramisu (alcohol free) but instead cut the Savoirdi biscuits in half and used some left over chocolate ganache as "glue" to place them on the border of the cake tin. I used the rest of the biscuits to form the layers of the tiramisu and managed to get 2 layers of biscuit and cream~ Topped with MILO and coffee and some Oreo Cheesecake balls.
So happy the cake actually held together =D
Looking forward to next year's request... =p | <urn:uuid:603c1794-915e-4c32-9444-4982a9cdee59> | CC-MAIN-2019-47 | http://traybakingtray.blogspot.com/2013/09/introducing-tiramisu-cake.html | 2019-11-21T06:59:00Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496670731.88/warc/CC-MAIN-20191121050543-20191121074543-00539.warc.gz | en | 0.972319 | 190 |
Art holds a prominent place in society, reflecting cultural values, beliefs and identities. Yet even with all that considered, in the Middle Kingdom, it’s not that simple and art has traveled a rocky road.
Traditionally drawing on Chinese heritage, paintings (often inspired by poetry) and calligraphy were not only an important part of the artistic backdrop of China, but an imperative export for the country.
Since then, moving into 21st Century China, art and photography have become political and pack a powerful punch, mainly thanks to China’s underground artists who continue to create work with subversive and challenging meanings.
Art In Chinese Culture
In China, art has a prominent place in history with one of the highest forms of Chinese art being landscape painting. The time from the Five Dynasties Period up to the Northern Song Era (907–1127) is known as the “Great age of Chinese landscape painting”. Rolling hills, rivers and peaceful natural panoramic view are just a few things we might expect of these traditional paintings. Up in the northern regions of Mainland China, artists such as Jing Hao and Guo Xi painted pictures of towering mountains, using strong black lines and sharp, dotted, brushstrokes to suggest rough stone.
During Mao Zedong’s infamous Cultural Revolution (1966-1976), the production and publishing of art suffered. Art schools were closed, and publication of art journals and exhibitions ceased. Many artists and intellectuals were exiled or imprisoned, resulting in a number of traditional Chinese arts almost disappearing from the map altogether.
Luckily, for the sake of art, once the dark days of Revolution had come and gone, art schools and professional organizations were reinstated. Exchanges were even set up between groups of foreign and Chinese artists and China’s artistic clique slowly but surely began to experiment with new subjects and techniques.
We now enter modern-day China, a global and more open-minded society in which art has now become controversial, political and creative, culminating in one not to be underestimated and highly accoladed underground art scene.
Nevertheless, instead of the traditional intricate cartoons and simple narratives we may be familiar with in the Chinese manga strips, China’s artists are now creating works that are of increasingly significant socio-politico importance due to their direct depiction of political comments.
The Rise Of Chinese Comics
When we think of Chinese comics, Manhua (漫画| ) might be at the fore of your mind. Nevertheless, instead of the traditional intricate cartoons and simple narratives we may be familiar with in these comic strips, China’s artists are now creating works that are of increasingly significant socio-politico importance due to their direct depiction of political comments, often smack dab denouncing decisions from higher up leading to the present-day problems occupying the minds of China’s laobaixing (aka John and Jane Wang).
Badiucao [巴丢草 in Chinese; this article refers to the man as simply “B”], originally from Shanghai and now residing in Melbourne, is regarded as one of China’s most prolific and well-known political cartoonists — though very little is known about his real self given his pen-name has been adopted to protect his real (and “dissident”) identity. How very Banksy. B uses pop culture and references to get his point across, manipulating images taken from Communist Party propaganda in order to make subversive political statements. Often decked out in that revolutionary red.
His work is celebrated across various Chinese criticaster websites and among those Chinese citizens who know how to pierce the Great FireWall. This has meant his reputation and cartoons were able to break through into the broader global community.
Yet just how much social responsibility does Badiucao take, given his unknown identity?
Two Dimensional Characters And A Three Dimensional Identity
It’s not that uncommon for artists everywhere to hide their real names; we see the hiding of identity amongst musicians and writers alike — take musical genies such as Sia or Daft Punk, we have yet to see their faces. What’s more in this particular B case, according to China’s most famous cartoonist himself, he does this as to protect his family and friends back home in China and to avoid harassment while living in Australia. We guess it all makes sense.
It is safe to say his work is pretty controversial; cartoon images of Chinese leaders are banned on Mainland China, hence even a glimpse of one of B’s ultra-accurate caricatures packs a powerful punch with Chinese netizens. The Chinese government in July 2017 censored Winnie The Pooh and most recently (in May 2018) banned Peppa Pig from children’s gazes across the Mainland — as Peppa is apparently an “unruly slacker”… Right.
One doth thinks Badiucao’s work too falls under the contentious bracket.
MATE’s prints and pictures attempt to define modern and urban China under Xi Jinping’s rule in 2019, where art faces the challenge of breaking censorship to exist.
The Socio-Politico Power Of Art
Art holds a heavy socio-political power, as the saying goes, a picture speaks a thousand words. Such is true for MA TE (折|zhé is his Chinese pen name), a young artist who has created a unique style of photography using a mix of both black and white and colours. MATE finds a balance between poetic and powerful imagery, contrasting traditional Chinese motifs with modern ideas of life in the Far East.
His prints and pictures attempt to define modern and urban China under Xi Jinping’s rule in 2018, where art faces the challenge of breaking censorship to exist. “Forbidden Tradition”, as shown above, depicts two Peking opera stars gently kissing. This image is somewhat controversial, especially after Chinese state media regulators have laid out new rules for videos that “display homosexuality” to no longer “be allowed” in 2018.
MA TE’s work plays into present social issues and speaks of a modern China, ever struggling between lifelong traditions and the unknown changes that loom.
Sexuality and gender are key themes in the photographs of Lin Zhipeng, ever portraying his view of youth culture and lifestyles in contemporary China.
Last, but by no means least, there’s Lin Zhipeng, a professional Chinese photographer originally from Guangdong Province, who is currently based in Beijing. Sexuality and gender are key themes in his photographs, ever portraying his view of youth culture and lifestyles in contemporary China.
Even as a professional, Lin still asks his friends to pose for him and doesn’t work with professional models, adding a real and raw feel to his powerful pictures. His photos are not glamorous or dramatic and they often feature a playful and fun feel to them. Similar to MA TE, Lin’s artwork speaks of the East catching up with the West; perpetually continuing the progressive struggle of bridging cultures.
The underground art scene across Mainland China is booming with music, movies, art and the way they are produced and understood, all changing at the speed of a swift brush stroke. With this change coming around, we are able to view the world differently, not through rose tinted glasses, but wearing creative, artistic ones.
In communist capitalist Xi Thought China, the pursuit of art has never been and never will be an easy undertaking. Internet censorship is the main hurdle, but despite the odds Chinese artists continue to make their messages clear and get them across in a not to be mistaken unambiguous way. Out with the old, in with the new. From sub to super. | <urn:uuid:ed8c9748-8201-42f4-afc1-8925f0137043> | CC-MAIN-2019-39 | https://chinaundertheradar.com/2019/02/13/the-power-of-chinas-artistic-underground/ | 2019-09-18T13:28:52Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514573289.83/warc/CC-MAIN-20190918131429-20190918153429-00138.warc.gz | en | 0.963355 | 1,599 |
PART 14: The Moonlit Glade
Whiskers couldn't shake the image of the moonlit glade from his mind. Every time he closed his eyes, the starry-eyed figure beckoned him. There was an allure, a pull towards that mysterious location. Resolute in his need for answers, he decided to seek out this place.
Gathering a small group of trusted allies - Lily, the wise owl Alderan, and a nimble squirrel named Finnick - Whiskers set forth. The direction was unclear, but the Heartstone’s faint hum guided him, pulsing stronger as they drew closer.
As days turned into nights and nights into days, the group faced many challenges. They encountered treacherous terrains and puzzles of nature that tested their wits and resolve. Finnick, with his agility, often scouted ahead, climbing the highest trees to get a vantage point. Alderan, with his age-old wisdom, deciphered clues from the patterns of stars, while Lily, with her deep connection to the forest, could sense disturbances and pathways through her intricate web of fireflies.
After what felt like weeks, they reached a clearing bathed in the silvery glow of the moon. The glade was just as Whiskers had seen in his visions: serene, ethereal, and in the center stood the shadowy figure.
As they approached cautiously, the figure stepped into the moonlight, revealing herself to be a majestic lynx with fur as smooth as the night sky and eyes that held galaxies within them. "I am Lysandra," she spoke, her voice echoing the wisdom of ages. "Guardian of the Moondust Realm."
Whiskers was taken aback. The Moondust Realm was a legend, a tale passed down generations but believed by many to be just a myth. It was said to be a realm parallel to theirs, where the very essence of dreams and nightmares took form.
Lysandra continued, "The Heartstone’s power resonates beyond your realm, young Whiskers. Its awakening has stirred a great disturbance in mine."
Lily stepped forward, "How can we help, Lysandra?"
The lynx sighed, her starry eyes dimming slightly, "A force, darker than the deepest abyss, threatens to engulf both our realms. The Heartstone has the power to prevent this catastrophe, but it needs to be attuned to the energies of the Moondust Realm. Alderan, always curious, inquired, "What must we do?"
Lysandra led them to a stone dais. Atop it rested a crescent-shaped relic - the Moon Amulet. "This amulet is the key. It must be infused with the Heartstone's energy and returned here. Only then can the balance be restored."
Understanding the gravity of the situation, Whiskers and his team accepted the mission. As they set forth on their journey back to the sanctuary, they knew that the fate of not one, but two realms, now rested on their shoulders.
At Love4Cats, our practice involves consistent collaboration with licensed veterinarians and reputable industry experts. However, it's important to note that the content provided on Excited Cats is not intended as veterinary advice. While we strive to enhance your understanding of feline care, the information presented on this blog should not replace professional veterinary guidance. | <urn:uuid:1c4c5871-2e6e-42a8-bfb4-0757c03d6f89> | CC-MAIN-2023-40 | https://love4cats.org/blog/short-story-series-whiskers-adventures-part-14-the-moonlit-glade | 2023-09-29T06:13:01Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510498.88/warc/CC-MAIN-20230929054611-20230929084611-00109.warc.gz | en | 0.965531 | 710 |
Restoring The Landscape With Native Plants
Pollinators | Beneficial Insects | Landscape Restoration | Native Plants | Wildlife |
Pollinators & Insects
Discovering Native Bees
Read about some of the native bee discoveries I made this year on my post at
Native Plant Wildlife Gardens
© Heather Holm, 2015. | <urn:uuid:9990ccaa-38d2-47fa-81d1-9843809cb049> | CC-MAIN-2022-49 | http://www.restoringthelandscape.com/2012/09/discovering-native-bees.html | 2022-11-26T12:08:36Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446706291.88/warc/CC-MAIN-20221126112341-20221126142341-00491.warc.gz | en | 0.665773 | 102 |
Yesterday I wrote about the Parsley, and mentioned that I had been intending to remove it to make space for planting brassicas. If you read my post you will know that the Parsley got a reprieve, but the brassicas were planted anyway. I have put in four Brussels Sprouts and eight "de Ciccio" Broccoli plants. Here's a general view of the bed, with the Brussels Sprouts in a single row down the middle, the Broccoli at the edges and the Parsley still in place at the far end...
You will notice that the brassicas are protected by pieces of black plastic, so let me explain what this is about.
Young brassicas are often attacked by Cabbage Root Fly, which lay their eggs in the soil right next to the plants. When the eggs develop into larvae, they begin to feed on the roots and stems of the brassica plants, which often wither and die as a result. It is thus traditional to protect the brassicas with "collars", which make it hard for the flies to deposit their eggs near the plants.
You can of course buy Brassica Collars, but despite their unsophisticated nature they are quite expensive, so I have made my own. I cut some squares of plastic from an old compost bag. For the Broccoli plants I used ones about 6" square, but for the bigger Brussels Sprouts I made them about 8" square.
I cut a slit from one edge into approximately the centre of the square and then made a Y-shaped incision, like this:
You wrap the collar around the brassica seedling, with the stem coming up through the Y-shaped cut, and weight down the edges with soil, like this:
I made sure to water the plants thoroughly before putting their collars on, because the plastic collars will reduce the amount of water they get when (if) it rains. When the job was complete I scattered around a few slug-pellets.
The plant pictured above is a Brussels Sprout. I have planted only four, one each of "Napoleon", "Bosworth", "Cromwell" and "Brilliant".
The Brassica bed is now covered by netting to ward off the Cabbage White butterflies - of which I saw my first specimen only 5 minutes after completing the netting!
To supplement these defences I have just ordered some Nematodes - the general-purpose ones that fight back at many of the pests that are prone to attack one's veg. I think I am giving my brassicas as good a start as is reasonable to expect! | <urn:uuid:93c557f2-031d-4236-8306-5d1ca1c20b38> | CC-MAIN-2017-30 | http://marksvegplot.blogspot.com/2015/05/planting-brassicas.html | 2017-07-24T10:55:04Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549424846.81/warc/CC-MAIN-20170724102308-20170724122308-00295.warc.gz | en | 0.970006 | 539 |
Пролог Арки Тартарос: Девять Демонов Врат - 234 эпизод аниме 'Fairy Tail' и 59-й эпизод серии 2014 года. Вышел в эфир 23 Мая 2015.
The Magic Council members discuss on their conference room regarding the sudden loss of the Dark Guilds affiliated with Tartaros and the possible causes of such events. However, a member of said guild, Jackal, infiltrates their headquarters and successfully bombs it, consequently killing every member except for Doranbolt. The core members of Tartaros, the Nine Demon Gates, prepare to head out and show everyone the power of the underworld and their devotion to Zeref. Meanwhile, on the 8-Island Restaurant, Yajima and the Thunder God Tribe are attacked by a mysterious cloaked figure, who aims to kill even the former council members. | <urn:uuid:d54d4ce9-3fd3-41bc-abab-4df253eaf2b8> | CC-MAIN-2020-05 | https://fairytail.fandom.com/ru/wiki/%D0%AD%D0%BF%D0%B8%D0%B7%D0%BE%D0%B4_234 | 2020-01-21T06:57:08Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250601615.66/warc/CC-MAIN-20200121044233-20200121073233-00442.warc.gz | en | 0.866428 | 248 |
The Modern Viking is a single man. He is the new standard for the swinging and easygoing, yet reliable and understanding gentleman, but as his name indicates, the Modern Viking must be a Viking as well as being Modern. Therefore he is in touch with his heritage and nationality, and knows that an attitude of overtly unrestrained sexual activity, and the advertising thereof, is out of the question.
Thus, the Modern Viking finds himself trapped in a social conundrum of sorts. How is he to remain modest and good-natured whilst still indulging in the earthly delights available to most single and attractive young men? There are many different ways to achieve this, and Odin knows that the Modern Viking has attempted quite a few himself. To assist his fellow, less experienced Modern Vikings, he has decided to mention a couple of alternatives to common male cock-ups in the dating game.
Try to keep up-to-date with pertinent imformation
In order to strike up a conversation with an attractive woman of breeding age, it is important to keep abreast of issues which might interest an individual of her social stature. This may or may not include popular music (“Have you heard the new Raconteurs album? I hear it makes for the most invigorating listen.”), publicly known individuals (“A minute avian informed me that Jude Law and Sienna Miller have reconciliated.”), or in the event that you yourself are approached and questioned on a subject, any little tidbit that could be related (“A cigarette? Why, certainly, but I fear they may have adverse effects on your health, madame[oiselle].”)
Be advised, though, the lady in question may not take too well to a Modern Viking that appears too interested and/or knowledgeable in her affairs (“A cigarette? But I thought I heard you tell your friend you were quitting when you accompanied her to the bathroom.”) or any affairs at all, for that matter (“A cigarette? With you being a westerner, I can safely assure you that you would not be asking me for one if not for the advent of the Crimean War, during which Russian soldiers would ration their western captives cigarettes as a gesture of good faith, following their defeat at Sevastopol…”). Also, it is important to be truthful and not exaggerate your knowledge on a subject (“A cigarette? It’s a widely known fact that people who smoke cigarettes spontaneously combust when they come into contact with giraffes and certain other even-toed ungulates.”). Above all, do not dominate the conversation and be receptive to her questions (“Why, yes I do go skiing now and again, but I think David Williams played drums for Augie March.”), and most importantly: Maintain your dignity. Never allow yourself to attempt to sidestep the conversation into dubious territory (“I only go skiing after sexually satisfying a woman, thereby making me a very experienced skier.”). This will only indicate shallow desperation and a directness unbecoming of a Modern Viking.
Only indicate interest in one woman
No woman takes kindly to being a Modern Viking’s second choice. Thereby it is important for the Modern Viking to constrain his interest in companionship to one person. He should approach just the one he desires the most and hint at unique qualities you may perceive her to have; although not necessarily with words. The Modern Viking simply listens closely to what she has to say, and agrees, where applicable, (“Yes, I too feel that John Kerry bears a striking resemblance to Bruce Campbell.”) or elaborates further to continue the conversation (“He also looks slightly like Hugh Jackman.”), or alternately, he may want to disagree and engage in some harmless verbal sparring (“No, I don’t think they look at all alike.
In fact, I think John Kerry looks much more like Whoopi Goldberg than Bruce Campbell.”).
Above all, the Modern Viking should try to give the impression that he is interested in her and her opinions alone, and is not simply in pursuit of an individual who can be coerced into bed with him (“I’d rather not talk about John Kerry when I’m trying to get laid.”) or someone to listen to his problems (“John Kerry has more in common with me than anyone else – we’re both losers.”). This gives the impression that the Modern Viking is desperate for somebody – anybody – and makes the object of your affection feel like gutter trash.
Also, the Modern Viking does not try to inspire jealousy by pitting one potential ‘companion’ against another (“I believe I heard that young lady over there declare that she could supress her gag reflex for an indefinite amount of time.”) or attempt to portray those who have enjoyed his intimate affections as an elite society she should feel ‘honoured’ to be a part of (“These hands only make contact with the finest of breasts.”). These portay the Modern Viking as being promiscuous and sex-obsessed, neither of which are qualities of the true Modern Viking.
One more thing: Under no circumstances whatsoever does the Modern Viking attempt to seduce two (“You both look so ravishing that I can barely decide which one to grope first.”) or more (“Alright, who in here wants to fuck?”) women at the same time. The reasons for this are manifold and obvious.
Buy subscriptions, t-shirts and more from our shop right here! | <urn:uuid:3be42cb4-7225-439f-9055-329d96a4d5c1> | CC-MAIN-2020-45 | https://grapevine.is/mag/articles/2006/06/16/the-modern-viking-goes-hunting/ | 2020-10-22T01:45:37Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107878662.15/warc/CC-MAIN-20201021235030-20201022025030-00484.warc.gz | en | 0.967702 | 1,187 |
A MAN who had his head repeatedly stamped on until he lay unconscious in a vicious pub attack last night spoke of the horrific moment he thought he was going to die.
Neil Davies had to have reconstructive surgery to fix a shattered cheekbone, cracked eye socket and broken nose after his girlfriend’s ex-partner launched a brutal attack on him in his local pub.
The 24-year-old from Ruthin spoke of his ordeal yesterday as his attacker, Michael David Lewis, was put behind bars by a judge who said he was lucky he hadn’t killed his victim.
Lewis, of Ffordd Las in Denbigh, was jailed for two years nine months at Mold Crown court yesterday after he admitted wounding with intent to cause grievous bodily harm.
He’d punched Mr Davies in the face, and then kicked and stamped on his head at least three times as he lay helpless on the floor.
Still bearing some of the scars from the attack, Mr Davies, a service engineer, described how he was set upon as he was drinking with friends at the Seven Eyes pub in St Peter’s Square, Ruthin last September.
He told the Daily Post: "I was attacked once before by Lewis when he punched me while I was out in Denbigh – I took action and he was given a police caution.
"I had my back to him in the pub when he came over to me and held out his hand for me to shake it.
"I wanted to keep the peace and so I gave him my hand but that was when he disabled the use of my arm by pulling me towards him as he punched me.
"I was semi-conscious when I fell to the floor and he continued to throw punches at me.
"I must’ve passed out from the heavy impact by the time he started jumping on my head repeatedly."
He added: "My friends were terrified, it was awful.
"It’s scary to think that I could easily have been killed."
Neil said: "I suffered a cracked eye socket, and broken cheekbone.
"I had to have corrective surgery, my nose isn’t right and I’ve got a scar on my face now.
"The incident has made me very wary of my surroundings."
Sentencing Lewis, Judge John Rogers QC said it was only a matter of chance that Lewis had not caused more serious if not fatal injuries.
He would not have had a defence of manslaughter if his victim had died.
"He is very lucky that he did not kill him. If you stamp and kick with such force that you break bones in the face the chance of inflicting fatal injuries is great," Mr Rogers QC said.
He said the animosity arose because the victim was in a relationship with a girl who had previously been in a relationship with the defendant.
Although no weapon had been used, the judge said "the boot is a pretty formidable object when used to kick to the head and face."
In court Lewis’s qualifications and job testimonials were read out and he was described as reliable, friendly, polite, respectable and hard working.
Mr Davies added: "I am very happy with the verdict though it is no more than he deserves." | <urn:uuid:d4dd8dbc-06b8-462b-8f29-da570cd187ca> | CC-MAIN-2018-05 | http://www.dailypost.co.uk/news/north-wales-news/ruthin-man-thought-going-die-2791697 | 2018-01-18T00:25:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084887024.1/warc/CC-MAIN-20180117232418-20180118012418-00046.warc.gz | en | 0.993374 | 674 |
Eye care professionals specialize in understanding how the human eye really works, as well as diseases and conditions that affect your vision—many of which do not always have obvious symptoms. Eye doctors know how age and risk factors affect vision over time for young and old, and they understand the benefits and features of corrective lenses, both as eyeglass lenses and contact lenses.
Our optometrists take the time to explain the results of your eye exam, describe your options and listen to your eye care needs. Because maintaining good eye health is an ongoing partnership, we encourage you to ask questions and share your health information, which could be vital to monitoring, diagnosing and treating potential vision problems.
Meet our doctors:
Dr. Davis was born in Taiwan and moved to Paraguay with her family for 6 years. There she learned Spanish and the hispanic culture and dances...Whe she was 8 the moved to Southern California. She became interested in optometry when she started working in the field when she was 18 years old. She started studying Biology at the University of California Irvine in 1993 and the following year received a fellowship grant to conduct with a reforestation research in Costa Rica.
Upon graduating college Dr. Davis decided to back-pack throughout Europe and North Africa for 2 months.
Dr. Davis then took some time off to pursue her spiritual interests and attended a Bible program.
In 1999 she started Southern California College of Optometry where she earned her Doctor of Optometry degree in 2003. She managed a lot of ocular disease at her extership sites: Veterans Hospital in Spokane and West Los Angeles. She was also trained by top notch optometrists at Bethesda Naval Medical Center-yes, that's where the president goes for his health visits.
Dr. Davis was invited to be a Clinical Examiner for the National Boards of Optmetry from 2008 to 2010. She graded future optometrists on their clinincal skills in order for them to practice optometry.
Dr Davis spent the past 8 years working for opthalmology groups and optometry groups in Northern and southern california.
She finally moved to Austin, Texas to take over her own practice in Austin. In her spare time Dr. Davis loves to go to go to kickboxing and zumba classes. She also loves to spend time with her 3 year old daughter Hope and husband Micky. | <urn:uuid:938533a4-6586-417a-a00b-eda687dee704> | CC-MAIN-2015-32 | http://www.visionsourceaustin.com/our-eye-doctors | 2015-07-30T14:06:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042987228.91/warc/CC-MAIN-20150728002307-00228-ip-10-236-191-2.ec2.internal.warc.gz | en | 0.975397 | 478 |
The Colt Combat Unit™ carbine was developed with the help of legendary trainers Mike Pannone, Ken Hackathorn, and Daryl Holland. It features a Magpul® SL® buttstock and pistol grip as well as a MOE® trigger guard. The carbine is the first to feature Colt’s new mid-length gas system. It has a low profile gas block which allows for the use of its M-LOK® capable Centurion CMR free floated forend. The Colt Combat Unit™ carbine (SKU - LE6960-CCU) is available exclusively from TALO Distributors. | <urn:uuid:f784d7f0-9b05-4f4b-b664-2d66b8ab4675> | CC-MAIN-2016-50 | http://www.colt.com/Catalog/Rifles/Colt-Combat-Unit-Carbine | 2016-12-10T14:37:34Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543315.68/warc/CC-MAIN-20161202170903-00183-ip-10-31-129-80.ec2.internal.warc.gz | en | 0.907673 | 129 |
Set in landscaped grounds in the scenic Lincolnshire Wolds, this stylish, award-winning boutique hotel offers sumptuous bedrooms, free local leisure passes and a modern bistro.
With luxury decor and individual design, the stylish rooms at Brackenborough each provide free Wi-Fi and a private modern bathroom with complimentary toiletries. Some rooms also offer whirlpool baths or four-poster beds.
Surrounded by beautiful lawns and gardens, The Brackenborough Bistro and conservatory serves fresh, local, and seasonal produce. Guests can also enjoy a variety of wines or cask ales.
Guests receive free passes to the Meridian Fitness Centre in Louth, which is just 2 miles away. The centre features a 25-metre indoor swimming pool, sauna, spa and a modern fitness suite.
The Brackenborough Hotel is just 1 mile from the historic market town of Louth. There are 7 golf courses within a 10-mile radius, and both Grimsby and Lincoln are just 15 minutes’ drive away. | <urn:uuid:9193abe1-f15f-4101-978e-07a2ca7bb059> | CC-MAIN-2021-31 | https://www.visitcleethorpes.co/brackenborough-hotel/ | 2021-07-28T11:41:33Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046153709.26/warc/CC-MAIN-20210728092200-20210728122200-00191.warc.gz | en | 0.930883 | 221 |
Always a spouse, never the president might be how we end up remembering Hillary Clinton, whose near-thirty-year career ended, dramatically punctuated with a period, at Donald Trump’s inauguration. Her appearance was everything we expected: the tight, frozen smile, the deep intake of breath, the clenched jaw, the eyes looking out into a sea of faces that should have been her supporters.
Clinton was mostly following tradition: All living ex-presidents and their spouses are expected to sit behind the incoming head of state as he or she takes the oath of office. Given that this had been her second failed attempt at the presidency, and that this last election season had been one of the most heated and toxic, there was much speculation that she might not turn up at her husband’s side.
But turn up she did, and the white pantsuit she wore was instantly and briefly the object of discussion among journalists and commentators desperate to turn everything mundane into a trending topic. She had worn similar outfits to the Democratic National Convention and to the third presidential debate, and her choices were mistakenly regarded as an homage to suffragettes. In fact there’s no proof of this, and her sartorial decisions were most likely simply made to accommodate present-day, media-intensive optics because white is one of the few colours that stands out against all backgrounds. Both the Trump daughters also wore white.
The Clintons had clearly hoped for a dynastic turn as a set of modern-day Roosevelts or, to look eastwards, Gandhis. In August of 2016, they bought the three-bedroom house next door to their Chappaqua home for Chelsea Clinton, clearly the start of a long-term campaign to launch her political career. (Hillary Clinton never once doubted that she herself would win.) Chelsea Clinton is married to Marc Mezvinsky, and they live in a five-bedroom apartment that is reputed to be a block long, the longest in the city. In comparison, the ranch house purchased by her parents is a mere outhouse, and was clearly designed not as guest quarters (the elder Clintons have five bedrooms and three stories), but as a much-needed address should she decide to run on a statewide ticket.
Bill and Hillary Clinton made no secret of her political aspirations during his presidency, or of the fact that she was effectively a co-president. Their unofficial slogan was “Eight years of Bill, eight years of Hill.” Hillary worked alongside her husband to bring about health care reform, a disastrously failed effort. The two enabled NAFTA, considered by many on all sides to be equally disastrous, and eviscerated “welfare as we know it” to create generational poverty for the poorest and most marginal, mostly women, mostly women of color.
Clinton was damned either way: As she stepped onto the podium to take her seat, she was booed by Trump supporters, who chanted “Lock her up!” If she hadn’t attended, she’d have been denounced as a malignant sourpuss.
But appearing may also have been a way to signal that she is still literally close to the seat of power. It’s not hard to forget the infamous photograph of the Clintons and the Trumps, at the latter’s wedding, an event she was hard-pressed to explain. As I’ve written elsewhere, this last election was a jostling for power among elites. Leaked emails also indicate that Democratic Party key players worked to sabotage Bernie Sanders’ chances at the primary.
All of that was for naught: Clinton’s political career is over, despite those who want her to run for mayor of New York City. Only days after the election came the news that the controversial Clinton Global Initiative—described by NPR’s Adam Davidson, who has even presented at its panels, as something that exists for “buying access” to economic and political power—will be discontinued. The CGI was the jewel in the crown of the Clinton Foundation, and even the latter is facing a cut in donations. The myth of philanthropy as a generator of equality is a hard one to dismantle and the Foundation has some powerful backers, but it wouldn’t be surprising if something that has seen so much criticism eventually folds.
But the end of the Clinton era (barring the emergence of Chelsea Clinton’s children as political candidates) is hardly the end of oligarchic power.
Barack Obama is fifty five, only a year older than Bill Clinton when he exited, and Michelle Obama is fifty three. They’ll soon be empty nesters in their nine-bedroom rental home, free to focus on the nonprofit Obama Foundation and the Presidential Center, as they explained in a YouTube video. They claim that this will be a “living, working center for citizenship.” What that means is unclear—“Center for Citizenship” sounds an awful lot like a “Foundation for Global Prosperity” or a “Movement For World Peace,” the sort of thing you expect from a beauty contest winner as much as from one of the most neoliberal presidents. Although he came into office with promises of changing the system, Obama has, over the years, proved adept at maintaining neoliberal structures of power—emboldening, not reforming, the banking system, for instance, and ensuring the continuation of U.S. military aggression designed to preserve American economic and political interests.
The Clinton and Obama presidencies were dominated by a massive literal and metaphorical investment in disguised neoliberal policies.
The board of the foundation consists of people like Martin Nesbitt, who’s also on the board of the Noble Network of Charter Schools. Others members include Deval Patrick, former Governor of Massachusetts and now a Managing Director at Bain Capital, and David Plouffe, formerly senior vice president of Policy and Strategy for Uber and who now occupies a similar position at the Chan Zuckerberg Initiative, the social advocacy group founded by Mark Zuckerberg and his wife. In other words, this nonprofit will be as exemplary of neoliberal values as Obama, who was raised by a strong mother and who attended prep school on scholarship—but thinks that a leading problem facing young Black men is their lack of fathers as role models and who supports charter schools.
Despite what Obama says, the Center will not be based in the south side of Chicago, a historically African American part of a deeply segregated city. It will be based in Hyde Park, which is a unique neighborhood that happens to be located on the south side, an area from which it strenuously separates itself.
Hyde Park is home to the University of Chicago, home to Milton Friedman and the birthplace of neoliberalism. The university’s relationship to the mostly Black residents of the neighborhood it occupies is a fraught one, and the presence of a historic Black elite that has both acted against racism and colluded with white elites to keep out poorer Blacks is a complicated one. The University of Chicago Police Department is one of the largest private security firms in the country, and it routinely harasses and intimidates people who don’t look like students (read: white).
Linked to this hyper-surveillance of the community is the university’s systematic gentrification of the neighborhood, and the choice of Jackson Park for the Obama Center (which will also house his presidential library) brought the issue to the fore. The choice of Jackson Park raises concerns about its rapid privatization, as chunks are leased to private entities and closed to the public; it’s one of the last such places designed by the great Frederick Olmsted, who emphatically believed that everyone had the right to freely enjoy beautiful and scenic spaces to escape into, even in the midst of urban sprawl. When Obama describes his “Presidential Center,” it’s hard not to wonder whom and what it might benefit.
There’s no doubt that Trump represents yet another, bolder neoliberal takeover of the government—this is especially evident in his choice of cabinet appointees. But while protesters of Trump fervently want to believe that we are now embarking upon a ghastly new era of unchecked greed, the fact is that the Clinton and Obama presidencies, along with the Bush years in between, were dominated by a massive literal and metaphorical investment in neoliberal policies, disguised as “citizenship centers” and “entrepreneurship” and “revitalizing neighborhoods.”
On January 20, Obama stepped into the helicopter that took him away from his life and lifestyle in the White House; Hillary Clinton stayed on till the presidential luncheon, even standing up for an ovation to Trump’s words in praise of her, and eventually faded away into the evening. Clinton lost because she never showed any sign that she cared about anything so much as power for the sake of furthering her and her family’s influence. The day after the inauguration was dominated by offshoots of the Women’s March in Washington, in cities across the world. The Washington Women’s March website did not name Clinton as among the women who “inspired” it, but her famous words from the 1995 Beijing Women’s Conference formed its slogan: “Women’s rights are human rights, and human rights are women’s rights.” What remains of Clinton are ghostly reminders, pale as her pantsuit, of her ability to forge words that claim a more expansive politics than she ever practised. But while Clinton’s neoliberal aspirations are gone, they live on in the empty rhetoric of citizenship echoed by Obama as well as in the plainer words of military and expansion uttered by Trump.
You can also listen to this story on curio.io, a partner of The Baffler. | <urn:uuid:66a36302-361d-4272-9450-1de8ee23761f> | CC-MAIN-2018-17 | https://thebaffler.com/latest/dynasties-nair | 2018-04-21T17:17:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125945272.41/warc/CC-MAIN-20180421164646-20180421184646-00192.warc.gz | en | 0.976979 | 2,025 |
Take your beats wherever you go with Sony’s SRS-XB12 portable wireless speaker.
It features EXTRA BASS technology to bring out the very most from your tunes. With its deep bass, it’s perfect for your dance hits and club favourites. A passive radiator dials up low-end tones, delivering big sound despite the speaker’s compact size.
The Sony SRS XB12 is Bluetooth compatible, so you can easily connect from your mobile device. Simply pair with your speaker and you’re ready to start streaming your favourite music wirelessly. And if you connect with the Sony | Music Center app, you’ll be able to control essential speaker functions from your smartphone. Skip the track, crank up the volume, pause the party – it’s all just a tap away.
You’ll also find it’s ready to go anytime, anywhere, in any conditions. Waterproof, dustproof, sandproof and mudproof (IP67 rated), the speaker is tough enough to get the music going wherever you are. Whether you’re partying poolside or hanging out at the beach, you can be sure your speaker is protected.
With up to 16 hours of battery life, the speaker will keep the party going for longer. A full charge will take you through a whole day of fun – and beyond.
Small and lightweight, the Sony SRSXB12 is designed so you can carry it effortlessly wherever you go – and always keep your music with you. It also comes with a detachable, colour coordinated strap, so you can clip it to your backpack or bike handlebars and keep the tunes playing as you go.
You can even choose to buy two SRS-XB12 speakers and pair them together to play your tracks with stereo sound. This creates a better separation between left and right channels, giving your music greater depth and creating a more immersive effect.
The speaker comes in a selection of colours to suit your style, from understated shades to bold and bright tones.
Make sure this fits by entering your model number.
EXTRA BASS technology for powerful sound
Waterproof, dustproof, sandproof and mudproof (IP67 rated)
Compact & lightweight, but powerful
Pair two SRS-XB12 speakers together for stereo sound
Battery life of up to 16 hours | <urn:uuid:80394f01-c066-40a9-89e8-bed67d2cdf11> | CC-MAIN-2023-50 | https://dccbuyer.com/product/sony-srs-xb12-compact-and-portable-waterproof-wireless-speaker-with-extra-bass-black-srsxb12b-ce7 | 2023-12-02T16:07:47Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100427.59/warc/CC-MAIN-20231202140407-20231202170407-00206.warc.gz | en | 0.90749 | 491 |
|Damage|| 32 / 64 (56) (melee)|
42 / 84 (Ranged attack)
|Max Life||140 / 280 (308)|
|KB Resist||20% / 28%|
|Debuff duration||15 seconds / 30 seconds|
|Debuff tooltip||Decreased light vision|
|Internal NPC ID: 66|
A Voodoo Demon is an enemy found in The Underworld. They are identical to Demons in behavior, but differ slightly in appearance: a small Guide Voodoo Doll hangs from one of its talons, and it lacks the blue bracelets and anklets that are worn by Demons.
They also have 20 more health than standard Demons, but deal the same amount of damage. Instead of just having a chance to drop the Demon Scythe , they will also drop their Guide Voodoo Doll. Note that killing one over lava will likely cause the doll to fall into the lava, killing the Guide and making the Wall of Flesh spawn.
Notes[edit | edit source]
- Like normal Demons, Voodoo Demons take no damage from lava.
- They are immune to the On Fire!, Shadowflame, and Cursed Inferno debuffs.
- They tend to spawn less frequently in Hardmode.
- They have a fairly low spawn rate compared to Demons and Arch Demons.
- The Wall of Flesh will only be summoned if the Voodoo Doll is destroyed by lava. If the Voodoo Demon allows the Voodoo Doll to make contact with lava, without actually dropping it, the Voodoo Doll will not be destroyed, and the Wall of Flesh will NOT be summoned.
- They spawn less frequently in Expert Mode.
- Oddly enough, the "hurt" sound they make was not updated along with regular Demons in 188.8.131.52.
Tips[edit | edit source]
- It may be worth investing time into building a 1 block thick bridge over a large portion of the Underworld. This will both ensure that no Guide Voodoo Dolls accidentally fall in lava, also making the fights with the Wall of Flesh more manageable.
- In order to effectively farm Guide Voodoo Dolls, it may be worth utilizing the 1 block thick bridge as an arena for battling multiple Demons at once, due to the low spawn rate of Voodoo Demons.
History[edit | edit source]
- 184.108.40.206: Spawn rate increased.
- 220.127.116.11: Can now drop the Demon Banner.
- Damage decreased from 50 to 32.
- Life increased from 120 to 140.
- Spawn rate increased slightly.
- 1.0.5: Introduced. | <urn:uuid:e1febbd5-6d65-4ffd-96ce-b0b065cee390> | CC-MAIN-2017-04 | http://terraria.gamepedia.com/Voodoo_Demon | 2017-01-22T10:08:21Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281421.33/warc/CC-MAIN-20170116095121-00200-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.844148 | 548 |
Executive producers Mark McCorkle, Bob Schooley and Nick Filippi talk about the new season of their Emmy Award-nominated animated series, which premieres today on Disney XD and DisneyNOW, and how the Big Hero 6 team faces off against a new villain and his team of evil mascot robots.
With Season 3 of Big Hero 6 The Series premiering today on Disney XD and DisneyNOW, Hiro, his cutting-edge robot Baymax, and their friends Wasabi, Honey Lemon, Go Go and Fred once again embark on a season of high-tech adventures protecting their city from an array of scientifically enhanced villains. This time, to protect San Fransokyo, they face off against Noodle Burger Boy and his team of evil mascot robots.
The Emmy Award-nominated series is based on Walt Disney Animation Studios' 2014 Academy Award-winning feature film, Big Hero 6. In the series, when he’s not leading the legendary Big Hero 6 superhero team, in his normal day-to-day life, Hiro, our 14-year old genius, faces daunting academic challenges and social trials as the new prodigy at San Fransokyo Institute of Technology.
For the show’s executive producers, Mark McCorkle, Bob Schooley and Nick Filippi, the team behind the Emmy Award-winning hit Disney Channel series, Kim Possible, Season 3 will bring even more interesting stories as well as some different visual styles. “The new season explores the summer after graduation for Wasabi, Honey Lemon and GoGo,” Schooley shares. “So, it's taking us to some places we haven't been before and exploring the world outside of the school. We have an episode where we dig more into the Chibi world that we established in other episodes. In general, this season has a looser approach to the animation, in trying some different stylistic transitions.”
McCorkle reveals, “On the villain side, Noodle Burger Boy steps up to be the mastermind who creates this new family, to fill this void in his life. When he assembles this team, they are going to create a lot of mischief and chaos for our heroes and the city of San Fransokyo.”
“Visually, in Season 1 and 2, it would not be uncommon to do a split screen,” he continues. “But this season, our team pushed the boundaries where we might do a split screen and a character actually reached across the split and interacts with the scene they are next to. We're being a little more experimental in a lot of ways this season. Story ideas, they usually come out of character. It usually has to do with a character and a situation and deciding if it will generate the laughs and surprises that we want to happen.”
Each episode of the new season features two 11-minute stories. The series voice cast includes Maya Rudolph as Aunt Cass, Ryan Potter as Hiro, Scott Adsit as Baymax, Jamie Chung as Go Go, Khary Payton as Wasabi, Genesis Rodriguez as Honey Lemon and Brooks Wheelan as Fred. Returning this season is Jenifer Lewis as Professor Granville, Jane Lynch as Supersonic Sue, Horatio Sanz as El Fuego, Andy Richter as Globby, Alan Tudyk as Krei, Haley Tju as Karmi and David Shaughnessy as Heathcliff.
Season three guest voices include K-pop stars Nichkhun Horvejkul (2PM) as twins Dae and Hyun-Ki, one-half of boy band 4 2 Sing, and Jae Park (DAY6) as twins Kwang-Sun and Ye Joon, the other half of boy band 4 2 Sing; Kirby Howell-Baptiste (Killing Eve) as Cobra, a charming and crafty villain; and Nichole Bloom (Superstore) as Olivia, a passionate comic book fan.
Comparing Season 3 production to past years, Filippi explains they were able to reuse some assets, though his team “usually adjusted or added to them.” Noting episodes take around a year to produce, he goes on to say that the show’s design, and animation, have always been difficult, if for the simple reason that “we’re taking CG animated characters from a feature and translating them into hand-drawn, which has its challenges.”
Deriving a 2D animated series from an Oscar-winning 3D/CG Disney animated feature was no small feat, from the narrative to the technical, though the trio had plenty of material to start with. “On the one hand, a great deal of time, effort, work and a team of really talented people established characters and dynamics, so a lot of the heavy lifting already happened,” McCorkle says. “But then the challenge is, you have to live up to the quality of a Walt Disney Feature Animation piece. When we first saw the movie, we thought it lent itself perfectly to a series.”
“It's like they built this beautiful house and we get to come in and add some rooms to it,” Schooley continues. “A huge challenge is that you want the characters and the world to be as welcoming and as recognizable as the feature,” Filippi notes. “But you don't want it to be a rehash, you want it to be fresh, you want it to feel like something new, but with these characters that you love.”
In describing the show’s audience appeal, Schooley says, “I think the strength of these characters and their relationships…kids really relate to tight friendships and it's a very comforting situation that kids really respond to friends that are like family.” McCorkle concurs. ”Family,” he says, “is such a universal need. There are some situations that put you in a position where you count on your friends in a way that is above and beyond. It touches a strong emotional reaction.”
“We have an amazing team,” Filippi concludes. “Our crew is like a family, they go above and beyond to make compelling, impactful and fun episodes.”
Big Hero 6 The Series is a production of Disney Television Animation and carries a TVY7-FV parental guideline.
Dan Sarto is Publisher and Editor-in-Chief of Animation World Network. | <urn:uuid:30cfdbc4-806f-4e67-8f3f-a23b35f903da> | CC-MAIN-2022-21 | https://www.awn.com/animationworld/big-hero-6-series-season-3-protecting-san-fransokyo-noodle-burger-boy | 2022-05-17T20:26:11Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662520817.27/warc/CC-MAIN-20220517194243-20220517224243-00255.warc.gz | en | 0.960107 | 1,349 |
At Shinn Roofing, we make sure that you can choose from a wide selection of roofing materials to fit the appearance of your property and how much you’re looking to spend. Metal roofing is one of the most popular choices for residential and commercial roofing projects. Shinn Roofing is Licensed, Insured, and ready to install a metal roof for your property. Read below to find out more about why metal roofing is such a great choice for homes and businesses.
There are many great reasons to consider replacing your old shingle roof with a new metal roof. Metal roofing materials last years longer than many traditional materials, and require little upkeep or maintenance. Since metal roof materials come in large sheets as opposed to small shingles, they go up quickly, which saves you money on installation costs. Metal roofs are also quite durable, and unmatched when it comes to fire & wind resistance. They also reflect the heat from the hot San Antonio sun, making it an energy-efficient option. At Shinn Roofing, we would rather see profits go to your roof than our pockets. If your roof costs $10,000, it costs $10,000 regardless of who you choose. The difference is how much of this money is actually being allocated to your roof. That’s the main difference with Shinn Roofing. Obviously we are in the business of making money, but we are not greedy; we truly believe in taking care of customers. We are from San Antonio and respect and love its people. Call us today to schedule your estimate.
These days, metal roofing material comes in a variety of beautiful designs and colors. We can help you choose a style to match the aesthetic of your home and neighborhood. A metal roof can increase your property value, in addition to adding beauty & durability to your home or business.
Find out more about the benefits and cost of this material by contacting the team at Shinn Roofing today! | <urn:uuid:0da249ea-bfcc-49ba-aa08-1abf4a14b1e9> | CC-MAIN-2018-34 | https://shinnroofing.com/metal-roofing.html | 2018-08-16T18:33:56Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221211146.17/warc/CC-MAIN-20180816171947-20180816191947-00051.warc.gz | en | 0.955887 | 399 |
In the past 4 years that I have dealt with this pain. I have noticed that this pain goes away after dental work and then reappears always 2 days later.
After a root canal, no pain, then severe pain 2 days later in 2013 - my beginning of ATN. Then in 2015 after a year of remission I had a ultrasonic cleaning and 2 days later the pain started again. It has not gone in remission since. In 2017 I had cataract surgery on left eye, then facial pain appear severe on left cheek 2 days later.
A month later cataract eye surgery on the right side - 2 days later pain in that cheek. Finally I had a filling replaced this year because I would get severe shooting pain when I drink cold water or eat ice cream. I had the old dsilver filling taken out, which was very old.
Afterward no pain again until 2 days later. Then It hurted just as much as before the filling was replaced. So I figured it was not the tooth and it was ATN.
This pain continued for 2 to 3 weeks.
Then it went away completely. I continued to had the achy burning symptoms as before but not the same symptoms as before when drinking or eating anything cold.
I can predict when the pain will come after any procedure - always 2 days later.
Has any one ever experienced this ?
Absolutely. I don’t have dental work done when I’m flaring up so I can’t really speak to pain going away but I absolutely have problems after dental work and it doesn’t always start the same day, sometimes it takes several hours to several days to kick in. I’ve had it last anywhere from several days to several weeks before settling back down.
My new dentist uses a soft wedge to prop my mouth open. It takes no effort on my part to keep my mouth open with the wedge in place and this has basically stopped flare ups after dental work for me. He’s also very aware of the ATN and moves as fast as humanly possible, which has also helped avoid flare ups.
Thanks for your reply. I was wondering if I was the only one. Mine will settle down usually 1 to 2 weeks.
Really it’s a catch 22 – you tend to want to avoid dental care when you have TN/ATN but then you end up with a bigger dental problem in the long run!
oooooh yeah. every dental cleaning I have a horrible flare up from my standard baseline 24hour pain from having my mouth wide open. like others, it goes away in about a week, but I have to increase my gabapentin even though it helps barely a little. I suppose my muscle relaxer also helps in this regard.
That soft wedge is what started my tmd pushing against my trigeminal nerve pain. I will never let a dentist pry my mouth open again.
Linda: Sorry to hear of your pain. I am in remission for some 10-12 years now. Can’t explain why but I fully believe the 5000mcg of V-B12 I take daily, sublingually, is keeping me in remission. Can’t prove it but there is work going on based on the evidence that this vitamin helps to rebuild myelin. also, I am a Support Group Leader in Sacramento, Ca and have 2 others that I know of in our group that are in remission and also take this vitamin. Coincidence, maybe. You can buy it over the counter and is not expensive. Good luck.
I was taking it in high doses for about 6 months and my physio told me my blood was very thin.The only thing I can attribute it to was the B12-reduced it and I am not a gusher anymore.
maybe I am unusual.
For sure I am unusual
I did start in 2016 taking this vitamin B-12 5000 from Superior Source at the Vitamin Shoppe on line. but reduced because my B-12 blood test show I was way above 900. It was actually 1300. My internist told me to take it 3 to 4 Times a week.
Do you think I should go back to every day? He does not know much about atypical trigeminal neuralgia. I did not have any problem taking it. I use the one you put under the tongue. I am considering going back to 7 days.
I know that I have atypical trigeminal neuralgia following a root canal. I have the burning aching etc symptoms.I did have 1 year of remission. But just before I had my admission I had different symptoms - rapid sharpe jabs in tongue and back of mouth. The next day the jabs continued but not very painful. By the end of the week all symptoms were gone.
On the third day I went to my internist who was going to refer me a week later to an ENT if I did not get better.
When doctor examined my mouth, he saw no problem even though in the back - my upper and lower jaw on both sides were sore.
I know I have ATN, but could this be TN1? I have ATN on both sides.
The rapid stabbing in tongue was June 2015 and has never come back.
Could this be all ATN? Or do I have both and in remission for type 1?
It’s unusual to have both but ATN can have the symptoms of both with more burning and aching than stabbing but you can get bouts of shocks with it! TN1 almost never has the low burning ache all by itself like ATN does, it almost always includes the shocks.
TN1 tends to not respond to pain meds while ATN tends to respond to some degree, so that can be a helpful guide in figuring out what’s going on.
Ellen and Linda:
I did not consult any doctor before starting the V-B12. Did it on my own. My blood level is very high also, as you would expect,
but there is no effect because of that. Medical literature says extremely high levels cause no ill effects. I can’t associate high levels with any blood thinning. It is, of course, always the patient’s decision but for me I believ it helps keep me in remission so I will keep taking it daily.
Thanks for reply. My doctor said it would not cause any harm. This time after my remission ended I have not have as much pain as before. Mine is not as severe as most that I have read.
It could be part of the reason. I think I am going back to daily B12. I have read in other places good result for this.
Thanks for that information. I have gotten several different diagnosis.
2 neurologists said I didl not have trigeminal neuralgia at all. I disagreed with them. A neurosurgeon said I got trigeminal neuropathic pain due to injury. My first internist said I had trigeminal neuralgia. My 2nd internist that I saw when I had the rapid sharp jabs in back of tongue said it was the 9th nerve causing this. Then a year later when atn came back. I asked him again about the stabs in my tongue just one time . He said it was cause by trigeminal neuralgia. However. When I read my chart on line he always says atypical face pain which I don’t agree with. He also says I do have withdrawal symptoms from gabapentin.
He said my symptoms are caused by anxiety. It is hard to find a doctor who knows a lot about this disease.
Correction. Dr said I do NOT have withdrawal symptoms from gabapentin.
(Burning skin, insomnia, lost 20lbs, heighten anxiety). Same symptoms as withdrawal from Lyrica but not as bad this time
I’m having withdrawal from gabapentin right now! I dropped the dose by 100mg and have been dealing with chills ever since, about a month now. UGH. I work at pharmacy and believe me, all meds can cause withdrawal.
I agree with you but my doctor and Pharmcist said that compound creams do not get in your system. Therefore, no withdrawal symptoms. But I am proof that it does cause mild side effects and definitely withdrawal symptoms.
I feel like I am wasting my time trying to convince them that I am having withdrawals.
Doctor is totally convinced that it is all anxiety that is causing pain and symptoms.
My records show atypical face pain and generalized anxiety.
I hate that title! It is wrong. A neurosurgeon (who is chief professor at medical college) says I have trigeminal neuropathic pain. He is right
Oh my gosh linda, that makes no sense! If compound creams don’t get into your system then how do the work to treat you? They HAVE to be in your system to DO anything at all, be it treatment or causing withdrawal. Besides, in some cases topical application makes a medication work faster – it couldn’t be working faster if it wasn’t getting into your system.
Now, topicals don’t get “into” your system in terms of filtering through your kidney and liver like medications you ingest, maybe that’s what they’re thinking? I dunno. What I do know is that I don’t like the sound of any medical professional telling you a medication doesn’t go into your system. If it didn’t get into your system what would be the point of using it?
I agree but 2 Pharmcists where I get the compound cream said the same thing.
They said I would not get withdrawal symptoms, and I must have another problem. I asked them first since this was similar to my Lyrica withdrawal 2014.
Linda I would say change pharmacies. I work at a pharm in the usa and I just checked with two coworkers (whom I trust) who disagree with what you’ve been told. For a med to work it must be absorbed into your system and absorption opens the door to side effects just as it opens the door to the medication working. They both agree that if by side effects it was meant less burden on organs such as kidney/liver/stomach then that would be correct, topicals are much more gentle in terms of that category of side effects. But as for anything else, it’s fair game. | <urn:uuid:27e90c66-3527-45c6-8ca8-95d78c8a90e6> | CC-MAIN-2023-06 | https://www.livingwithfacialpain.org/t/unusual-pain-pattern-after-trigger-atn/14143 | 2023-01-28T16:26:26Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499646.23/warc/CC-MAIN-20230128153513-20230128183513-00159.warc.gz | en | 0.980606 | 2,196 |
You might have heard about marketers who mention your small business to perform SEO. You might be receiving emails from several SEO businesses about how to market your services, but none of them told why you are in need of SEO? This SEO plays a very important role in the success of your online business and contributes to search rankings. These are some of the reasons where your enterprise invests money to get listed in the organic search results.
Small Businesses Benefit from SEO
Mobile devices force people to find whatever businesses they need, regardless of where they are located. In addition to this, statistics have also made it clear that most consumers are looking at localized search results. Business owners take much time to optimize their websites instantly for performing local SEO.
Business Enterprises Online
Always think on behalf of your customers to satisfy their requirements. You will have to understand how easily your customers perform research through the Internet. Being a customer, you can search for an enterprise, review their products or services, or even make purchases. They can do all this either from the comfort of their home or office via using a mobile device or any other device. Therefore, if you want customers to find your business online, you should need to perform SEO.
Potential Customers are Mobile
Mobile traffic has increased quickly and SEO makes your business more visible to your customers who wish to look for products or services that you offer. Local SEO makes it much simpler for potential customers to look for your business. Just ensure your business website is well prepared for the purpose of mobile search.
SEO delivers High ROI to Small Businesses
A small business may not get success through SEO services if low-quality companies or agencies are approached. These Low-quality companies are important for a successful SEO campaign, which is incapable of delivering results. SEO is capable of providing instant traffic to your online website, and the scale of traffic simply costs much amount.
Build Credibility with SEO
Many internet users focus on organic search results. When you invest your time to perform SEO, you will not only get higher rankings but also consumers trust your company a lot. Whereas, high-quality content with qualified links will assist you in building your brand. Likewise, there are several reasons where you can make search engine optimization as a succeeding entrepreneur.
The bottom line:
If you are not on page one for the search terms your audience would use, you are not winning the click. If you decide to invest in the SEO services that Geeks5G provides you with a further understanding of how SEO works and we will get to work on your keyword development and integration, provide search engine ranking reports, register your site in several search engines, do the meta tag development and more and more. Get in touch with us today! | <urn:uuid:25bd7a43-0f21-455c-b7c8-d9010c92c753> | CC-MAIN-2023-40 | https://www.geeks5g.com/five-reasons-your-small-business-needs-seo-services/ | 2023-09-22T01:06:47Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233506320.28/warc/CC-MAIN-20230922002008-20230922032008-00265.warc.gz | en | 0.962166 | 555 |
At Cheshire Public Library’s weekly Drop-In Tech Help, I am often told that people don’t know where to begin with learning technology. They ask me what special resource of knowledge I use and where I went to school and how long it took me to learn all of these tricks and devices. The answer is simple: There is no secret knowledge! I use books and the internet, and you can, too.
If you recently got a new device or you feel overwhelmed by your device’s capabilities, start with a book. The library has a variety of books on popular devices, and we can always get something for you if we fail to carry it. Books are great for starting out with a new computer, smart phone, or tablet. You can look up topics like Setting Up Your Email or page through the whole book at your own pace. Most technology books are visual, and you can go through step-by-step instructions with your device at your side.
If you prefer video instruction, you can try Lynda.com, which is now available for all Cheshire Public Library resident cardholders. Lynda.com is an online learning site that hosts a constantly growing library of over 3,000 courses.
What are you waiting for? Here’s a small sample of the books we have available:
Covers all models with iOS 8.1 software, including iPhone 6 and 6 Plus.
Learn about all the incredible things your iPad can do with this friendly guide. Learn to make video calls, navigate with maps, find almost anything with Siri, and more!
Teach Yourself Visually: Android Phones and Tablets by Guy Hart-Davis
Includes customizing your phone or tablet, working with text and voice, making calls and instant messaging, enjoying social networking, working with apps, browsing the web and e-mailing, taking and using photos and videos, using maps, Google Earth, and clock, playing music and videos, troubleshooting your device.
Also covers the Kindle Fire HD!
An easy, full-color tutorial on the latest operating system from Microsoft.
Technology Help – Need device advice? Come to Drop-in Tech Help. No appointment necessary. We provide help with smartphones, laptops, tablets, ereaders, email, Facebook, social media, and more! Check out the calendar for our next session. | <urn:uuid:783fc5f7-8fc9-4684-9cad-16f5dafda646> | CC-MAIN-2021-43 | https://cheshirelibraryblog.com/2017/03/27/teach-yourself-technology/ | 2021-10-17T15:03:13Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585178.60/warc/CC-MAIN-20211017144318-20211017174318-00496.warc.gz | en | 0.929223 | 486 |
With networks like CBS and ABC s DIS) blocking Google TV devices from accessing its full episodes, one has to wonder what’s in store for future owners of the Boxee Box, some of which will receive their device as early as November 11. Boxee got in trouble for accessing Hulu content early on, and it’s hard to imagine that some of the networks that decided to block Google TV won’t try to prevent access from the Boxee Box as well.
So what do the folks at Boxee think about the current Google TV incident? I got in touch with Boxee CEO Avner Ronen, who sent me a statement straight from Israel, where a good part of Boxee’s development is being done. Here’s what he had to say:
“We think that it makes much more sense for the business model to be based on the content and not on the device or the screen size. If someone paid for a video (or is watching the video with ads) it should not matter which device (or) browser he is using.”
While we’re at it, check out the video interview I recently did with Ronen:
Related GigaOm Pro Content (subscription required): | <urn:uuid:1b815a2a-5094-4a16-9557-e8dc30eaab59> | CC-MAIN-2014-10 | http://gigaom.com/2010/10/23/boxee-ceo-blocking-google-tv-makes-no-sense/ | 2014-03-12T09:38:25Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394021587780/warc/CC-MAIN-20140305121307-00047-ip-10-183-142-35.ec2.internal.warc.gz | en | 0.964114 | 258 |
The recent typhoon that devastated the Philippines left thousands homeless and an entire city wiped out. Having garnered global attention, aid has started to come from all over the world.
The flash floods in India and Nepal and Central Europe earlier this year yielded billions of dollars in losses. In the hurricane-prone parts of the US, homebuilders actually consider natural disasters part of house-planning. And while no amount of preparation can thwart Mother Nature’s unwelcome plans, it certainly pays to prepare the best way you can to make your home as secure as possible. Your home houses your family so you must do everything in your power in order to protect it. After all, it is the biggest and perhaps the most important investment you will ever make.
Here are a few tips on how to make your home as safe as can be for disasters:
– Check for anything defective. Any part of the house or any equipment that could bring further danger must be handled prior. Clear out gutters and repair the roof, foundation, etc., if needed.
– Make sure all tools, including gardening tools such as shovels and shears are properly stored. Same goes for any power tool like core bit and saw blade. These things can cause injury if swept by strong winds.
– Laugh if you must but hard hats should be in your emergency gears collection. Better safe than sorry.
– Really, every home should have a fire extinguisher ready.
– See to it that your doors are equipped with a dead bolt lock and that the hinges are tightly secured. Any of those varieties of solid wood or hollow steel will make for a stronger door.
– Strong winds can break glass windows so it would be good to cover them with wood. Resistance shutters are an invaluable tool especially in areas frequented by hurricanes and tornadoes. Be sure any piece of furniture is nowhere near the windows when disaster strikes.
– Have an emergency kit ready and be sure everybody in the house knows where it is. The kit should include basic medicines, ready-to eat food and bottled water. Also, be sure you have an emergency lamp ready as well as the necessary gadgets for communication.
– Safeguard important papers. At the very moment the disaster strikes, you won’t be thinking about them fore sure.
– Secure things that may topple and can cause more accidents – things like the trash can, portable lamp post, barbecue stand, etc.
– Keep your car in the garage. If you come from a place that easily gets flooded, you may need to go out and park your car to a higher place where you feel it is secured. Do this BEFORE a strong typhoon strikes.
– If a tree lies close to a power line, call the attention of the electric utility company so they can take care of it. You should be able to do the trimming for the weak parts of the tree.
– In times of disasters, never leave your pets outside of the house. | <urn:uuid:36154eaf-2684-445e-99bb-3c53ba8633c9> | CC-MAIN-2016-07 | http://www.gilatools.com/blog/tips-disaster-proof-home/ | 2016-02-11T10:54:48Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-07/segments/1454701161942.67/warc/CC-MAIN-20160205193921-00225-ip-10-236-182-209.ec2.internal.warc.gz | en | 0.944904 | 605 |
Epitelial-to-mesenchimal transition and invasion are upmodulated by tumor-expressed granzyme B and inhibited by docosahexaenoic acid in human colorectal cancer cells
Journal of Experimental & Clinical Cancer Research volume 35, Article number: 24 (2016)
Granzyme B (GrB) is a serine protease, traditionally known as expressed by cytotoxic lymphocytes to induce target cell apoptosis. However, it is emerging that GrB, being also produced by a variety of normal and neoplastic cells and potentially acting on multiple targets, might represent a powerful regulator of a wide range of fundamental biological processes. We have previously shown that GrB is expressed in urothelial carcinoma tissues and its expression is associated to both pathological tumor spreading and EMT. We have also shown that docosahexaenoic acid (DHA), a dietary ω-3 polyunsaturated fatty acid with anti-tumor activity, while inhibiting urothelial and pancreatic carcinoma cell invasion also inhibited their GrB expression in vitro. In this study, we characterized a panel of colorectal carcinoma (CRC) cells, with different invasive capabilities, for GrB expression and for the contribution of GrB to their EMT and invasive phenotype. In addition, we investigated the effect of DHA on CRC cell-associated GrB expression, EMT and invasion.
The expression levels of GrB and EMT-related markers were evaluated by Western blotting. GrB knockdown was performed by Stealth RNAi small interfering RNA silencing and ectopic GrB expression by transfection of human GrB vector. Cell invasion was determined by the BioCoat Matrigel invasion chamber test.
GrB was produced in 57.1 % CRC cell lines and 100 % CRC-derived Cancer Stem Cells. Although GrB was constitutive expressed in both invasive and noninvasive CRC cells, GrB depletion in invasive CRC cells downmodulated their invasion in vitro, suggesting a contribution of GrB to CRC invasiveness. GrB loss or gain of function downmodulated or upmodulated EMT, respectively, according to the analysis of cancer cell expression of three EMT biomarkers (Snail1, E-cadherin, N-cadherin). Moreover, TGF-β1-driven EMT was associated to the enhancement of GrB expression in CRC cell lines, and GrB depletion led to downmodulation of TGF-β1-driven EMT. In addition, DHA inhibited GrB expression, EMT and invasion in CRC cells in vitro.
These findings present a novel role for GrB as upmodulator of EMT in CRC cells. Moreover, these results support the use of DHA, a dietary compound without toxic effects, as adjuvant in CRC therapy.
Colorectal cancer (CRC) represents the second most common cause of cancer-related death in the Western world . Although treatment outcomes in patients with CRC have improved over the past two decades, 5-year relative survival is slightly greater than 10 % in patients with metastatic CRC, being metastasis and drug resistance the primary cause of mortality and thus the most life-treating aspects .
Epithelial-to-mesenchymal transition (EMT) has been linked to the initiation of metastasis and to drug resistance across multiple organs, including CRC [2, 3]. A reciprocal relationship exists between EMT and Cancer Stem Cells (CSCs), in that CSCs often exhibit EMT and EMT can lead to the formation of CSCs [1, 2, 4]. EMT, consisting in the transdifferentiation of epithelial cells into mesenchymal cells, is physiological in embryonic development, where it takes place as a coordinated and organized process, leading epithelial cells to acquire the motile and invasive characteristics of mesenchymal cells. Potent initiators of EMT are some growth factors, including transforming growth factor (TGF)-β, whose activated receptors trigger intracellular signaling cascades ultimately resulting in the downregulation of epithelial (E)-cadherin, a major hallmark of EMT, often balanced by the increased expression of mesenchymal cell markers such as neural (N)-cadherin . The zinc finger molecule SNAI1/Snail 1 is one of the critical E-cadherin transcriptional repressors in EMT [2, 5]. Unlike developmental EMT, the molecular network in tumor-associated EMT is disregulated and EMT-activated carcinoma cells, depending on tissue, signaling and their context, may lose their epithelial characteristics partially (incomplete EMT) or completely (complete EMT), covering a range of changes in their differentiation markers as well as in their invasive migratory behavior [2, 6–8]. The molecular processes underlying EMT and linked to cancer progression are complex and still partially understood. Therefore, the advancing knowledge on molecules involved in tumor-associated EMT is essential to better understand the mechanisms underling tumor metastasis and drug resistance, as well as to improve cancer therapies.
Granzyme B (GrB) is a serine protease traditionally known as molecule expressed by cytotoxic lymphocytes to cause apoptosis in tumor and virally infected cells, primarily by activation of caspase-driven pathways [9, 10]. However, it is now recognized that GrB is also produced by other non-cytotoxic immune and nonimmune cells as well as neoplastic cells [11–19], and that consensus sites for GrB cleavage are present in several intra- and extra-cellular proteins [20, 21]. They include intracellular proteins involved in cell anchorage, signaling, and cycle regulation, as well as extracellular matrix (ECM) components, cell-surface receptors, pro-inflammatory cytokines and growth factors [12, 21–23]. Consequently, GrB is emerging as a multifunctional protease, acting with context dependence and potentially playing important roles in different diseases, including inflammatory and degenerative diseases .
We have previously demonstrated that GrB is expressed in urothelial carcinoma tissues and its expression is associated to both pathological tumor spreading and EMT . We have also shown that GrB expressed in bladder and pancreatic carcinoma cells promotes their invasion in vitro [18, 25]. Finally, we have observed that docosahexaenoic acid (DHA; 22:6), a long-chain ω-3 polyunsaturated fatty acid primarily found in dietary fish oil [26–29], inhibits tumor-associated GrB expression in bladder and pancreatic carcinoma cells while simultaneously suppresses their invasion in vitro, suggesting the involvement of GrB in the inhibition of tumor cell invasion by DHA . A large number of experimental and preclinical studies have shown that DHA exerts selective anticancer activity and inhibits the development and the progression of some types of cancers, including CRCs [26–31]. Currently, clinical trials underline the potential value of DHA as an effective adjuvant to cancer therapy [28, 32–35]. However, the mechanisms underlying the anticancer activity of DHA remain unclear. Taking into account the above mentioned data, in this study we report the characterization of a panel of CRC cells, with different invasive capabilities, for GrB expression and for the contribution of GrB to their EMT and invasive phenotype. In addition, the effect of DHA on GrB expression, EMT and invasion in CRC cells was analyzed in vitro.
Cells and cultures
Seven human established CRC cell lines (HT-29, SW480, SW620, Caco-2, LoVo, HCT 116, HCT-8), two human bladder (RT112, T24) and one pancreatic (PT45) cancer cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) or kindly provided by collaborators. Four CRC patient-derived CSCs were kindly provided by Prof. R. De Maria and G. Stassi [36, 37]. YT-S human cytotoxic NK leukemia cells and T24 human bladder cancer cells served as positive and negative controls for GrB expression, respectively. All cell lines were grown in RPMI-1640 (Sigma-Aldrich, St. Louis, MO, USA), but HT-29, SW480, Caco-2 and HCT 116 in DMEM (Sigma-Aldrich), supplemented with 10 % FCS (Hyclone, South Logan, UT, USA), 100 mg/ml streptomycin and 100 IU/ml penicillin (EuroClone S.p.A., MI, Italy), 25 mM HEPES and 2 mM L-glutamine (EuroClone S.p.A.). CSCs were grown as spheroids in non-adherent conditions, as previously described . To induce EMT, cells were incubated with 10 ng/ml TGF-β1 (PeproTech EC Ltd, London, UK). In some experiments, cells were pretreated with 30 μM brefeldin A (Sigma-Aldrich), and 4 mL of supernatants were collected and concentrated to approximately 0.15 mL, using a Centricon Amicon® Ultra-4 centrifugal filter unit (Merck Millipore, Darmstadt, Germany). In other experiments, cells were treated with 100 μM DHA (Sigma-Aldrich) dissolved in ethanol solution or with ethanol solution alone for 24 h.
Reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was isolated using the RNeasy mini Kit (Qiagen). cDNA was synthesized from using a M-MLTV RTase and amplified with GoTaq DNA polymerase (Promega). For the detection of Primer sequences are as follows: Lgr5-FW: CCCGAATCCCCTGCCCAGTCT; Lgr5-REV: TCATCCAGCCACAGGTGCCTCA; Bmi1-FW: CGCGCTGGTTGCCCATTGAC; Bmi1-REV: AGCACACACATCAGGTGGGGA; CD133-FW: GCAGCAGTCTGACCAGCGTGA; CD133-REV: GCCGCACACGCCACACAGTA; CD166-FW: CCCCTTGAAGGAGCGGTGGTC; CD166-REV: CCTCTGGGGGAGGGTTGCCAT; GAPDH-FW: AGCCTCCCGCTTCGCTCTCT; GAPDH-REV: GCCAGCATCGCCCCACTTGA.
GrB knockdown by small interfering RNA (siRNA)
Three 25-mer Stealth RNAi duplexes targeting human GrB and Control Stealth RNAi were obtained by the BLOCK-iT RNAi design program (Invitrogen, Carlsbad, CA, USA). For Stealth RNAi duplexes 1: 5′-CCU ACA UGG CUU AUC UUA UGA UCU G-3′ and 5′-CAG AUC AUA AGA UAA GCC AUG UAG G-3′; for Stealth RNAi duplexes 2: 5′-GCG AAU CUG ACU UAC GCC AUU AUU A-3′ and 5′-UAA UAA UGG CGU AAG UCA GAU UCG C-3′ and for Stealth RNAi duplexes 3: 5′-GCC UGC ACC AAA GUC UCA AGC UUU G-3′ and 5′-CAA AGC UUG AGA CUU UGG UGC AGG C-3′. A pool of 3 different nonsilencing, nonoverlapping RNAi duplexes with matched GC content, served as Control Stealth RNAi. Transfection was performed using INTERFERin™ reagent (Polyplus transfection SA, Illkirch, France). In addition, for siGrB#2, three 27-mer siRNA duplexes targeting human GrB (SR302035) and Universal scrambles negative control siRNA duplex (SR30004) were obtained by OriGene (OriGene Technologies, Rockville, MD, USA). For siRNA duplexes 1# (SR302035A): 5′-GGA AGA UCG AAA GUG CGA AUC UGA C-3′; for siRNA duplexes 2# (SR302035 B): 5′-GCA ACU GAA UAA AUA CCU CUU AGC T-3′; for siRNA duplexes 3# (SR302035C): 5′-ACC AUG AAA CGC UAC UAA CUA CAG G-3′.
GrB plasmid transfection
Vector for human GrB (Homo sapiens GranzymeB cDNA Clone, Sino Biological Inc, Beijing, China) and Mock were transfected into 70–80 % confluent cells in Opti-MEM (Gibco, Invitrogen), using Lipofectamine LTX and PLUS reagents (Invitrogen).
Cell lysates were prepared by a solution containing 50 mM Tris–HCl pH 7.6, 150 mM NaCl, 0.5 % TRITON X-100, 0.5 % Sodium deoxycolate, 0.1 % SDS and the protease inhibitor mixture “Complete” (Roche Diagnostic GmbH, Germany). Proteins (30–80 μg for CRC cells; 7.5 μg for YT-S cells) were separated by SDS-PAGE, blotted onto nitrocellulose (Whatman-Protan BA85, GE Healthcare, NJ, USA) and incubated with appropriated primary antibodies specific for: GrB (2C5/F5; Chemicon, Prodotti Gianni, Italy), E-cadherin (36; BD Transduction Laboratories, CA, USA), N-cadherin (3B9; Zymed, Invitrogen), SnaI1 (C15D3; Cell Signaling Technology, MA, USA) or β-actin Ac-40 (Sigma-Aldrich). The reaction was revealed by horseradish peroxidase (HRP)-coupled secondary reagents (Bio-Rad, Hercules, CA, USA) and developed by enhanced chemiluminescence (Amersham ECL Western Blotting Detection Reagent, GE Healthcare, MI, Italy). Band intensities (b.i.) = band volume/area x mean pixel intensity, normalized for β-actin, were quantified using Quantity One 1-D analysis software (Bio-Rad).
Cell growth and viability assessment
Cell growth was assessed determining, in triplicate, the cell number with a Neubauer cell counter (Brand West Germany). Cell viability was assessed by the trypan blue dye exclusion assay.
Cells, in serum free medium, were added in triplicate to the upper well in BioCoat Matrigel Invasion Chambers (Corning Inc, Corning, NY, USA), allowed to adhere for 2 h and to migrate toward 10 % FCS for 24–48 h (cell line-dependent time) at 37 °C. Cells underside of the membrane were fixed, stained with a solution containing 50 % isopropanol, 1 % formic acid and 0.5 % (wt/vol) brilliant blue R 250 (Bio-Rad), and counted using a light microscope. Results are presented by mean ± standard deviation (S.D.) of triplicates.
Student’s t test was used for all analyses; p < 0.05 was considered significant.
GrB expression in CRC cells and their invasive phenotype
We investigated GrB production in CRC cells and its role in their invasive capability. GrB expression was analyzed in a panel of 7 established CRC cell lines and in 4 CRC patient-derived CSCs [36, 37]. A band at ∼ 35 kDa corresponding to GrB was found by Western blotting (WB) in 4 (HT-29, Caco-2, HCT 116 and HCT-8) out of 7 (57.1 %) CRC cells (Fig. 1a, upper panel) and in 4 out of 4 (100 %) CSCs (Fig. 1b, right panel). As previously found for bladder carcinoma cells , different band intensities appeared in different CRC cells and they were always much weaker than that in YT-S cells (the NK leukemia cell line used as positive control), indicating that GrB levels vary among cancer cells and they are always significantly lower than that in cytotoxic lymphocytes. We also examined whether tumor-expressed GrB was released into the extracellular milieu. Conditioned media from GrB positive cell cultures were collected and GrB measured by WB. As shown in Fig. 1a (lower panel) and 1b (right panel), GrB was released by GrB positive cells. Moreover, pre-treatment of CRC cells with 30 μM brefeldin A, an inhibitor of protein transport from endoplasmic reticulum to Golgi apparatus, prevented GrB release, indicating the secretion of GrB by CRC cells (Fig. 1a, lower panel).
Next, to investigate the function of GrB in CRC cell invasion, we first characterized CRC cell lines for both their expression of three EMT biomarkers (i.e., Snail 1 transcription factor and E- and N-cadherin adhesion molecules) by WB (Fig. 1a, upper panel) and their invasive capability by the invasion assay (Fig. 1c). Consistent with the literature [38–41], SW480, HCT-8 and HCT 116 cells resulted the most invasive cells, while HT-29, Caco-2, SW620 and LoVo cells exhibited low or no invasiveness (Fig. 1c). Then, to investigate GrB function in CRC cell invasion, we selected HCT 116 out of the panel of CRC cells, because of both its GrB expression and its high invasiveness. According to the results obtained in RT112 bladder and PT45 pancreatic cancer cells [18, 25], GrB knockdown in HCT 116 cells significantly inhibited their invasion (Fig. 1d), indicating that GrB can also promote invasion in CRC cells. In addition, as illustrated in Fig. 1a and c , comparable levels of GrB constitutive expression were present in both invasive (HCT-8 and HCT 116) and very lowly invasive (HT-29 and CaCo-2) cells, suggesting that other factors linked to the cell context might interfere with the promotion of invasion by GrB.
GrB upmodulates tumor-associated EMT
To investigate the functional relationship between tumor-expressed GrB and EMT, we knocked-down GrB in highly (HCT-8 and HCT 116) and lowly (Caco-2 and HT-29) invasive GrB positive CRC cell lines as well as in RT112 bladder and PT45 pancreatic cancer cells. The transfectable CSC4 was also included in the experiment. Then, we evaluated EMT by WB, analyzing the expression of the three EMT biomarkers (Snail 1, E-cadherin and N-cadherin). As shown in Fig. 2a, GrB depletion was associated to the increase of epithelial E-cadherin expression and the decrease of the mesenchymal markers Snail 1 and N-cadherin (when present) in all tumor cells, independently of their invasive capability, suggesting a contribution of GrB in EMT promotion. Moreover, to exclude siRNA non-specific effects, another GrB siRNA (siGrB#2), targeting the same gene at different sequence, was used to deplete GrB in HCT 116 cells. As shown in Fig. 2b, GrB depletion was associated to the increase of EMT biomarkers, confirming the result obtained in Fig. 2a.
To further investigate GrB function in EMT, we examined whether GrB transfection in CRC cells affected their EMT phenotype. To this purpose, GrB negative (SW480, SW620 and LoVo) and positive (HT-29) CRC cells, with different invasive capabilities, were transfected with the human GrB vector and EMT biomarkers were evaluated by WB. As shown in Fig. 3a, ectopic GrB expression (compatible with the endogenous expression levels) upmodulated EMT in all CRC cells, driving epithelial tumor cells towards a mesenchymal phenotype. However, it might also be noted that N-cadherin was upmodulated in SW480 and HT-29 cell lines, both derived from primary tumors, but not in metastasis-derived SW620 and LoVo cells, which might not have the competence to undergo clear EMT since they have very likely passed through it before. In addition, we observed that upmodulation of EMT biomarkers by ectopic GrB was associated to the enhancement of invasion in HT-29 and LoVo cells, but not in SW480 and SW620 (Fig. 3b). This finding might further support both the hypothesis that other cell factors might interfere with the promotion of invasion by GrB and the data from the literature reporting that EMT-activated neoplastic cells may undergo incomplete EMT, not always coupled to the invasive cell migration behavior [2, 6–8]. Altogether, our results indicate that GrB can modulate the tumor EMT process.
GrB contributes to the induction of EMT driven by TGF-β1 in CRC cells
TGF- β1 signaling plays a key role in tumor progression via EMT in many tumors, including CRCs [2, 3]. To further investigate the functional relationship between GrB and EMT, CRC cells were induced to undergo EMT by TGF-β1 GrB expression was analyzed by WB. Among our CRC cell panel, it is known that HCT 116 and HCT-8 are unresponsive to TGF- β1 because of their lack of the TGF-β type II receptor, whereas HT-29 and SW480 are sensitive to TGF- β1 stimulation . Thus, GrB positive HT-29 and GrB negative SW480 cells were chosen to be treated with TGF-β1 for different time periods and, as expected , at 48–72 h they underwent morphologic changes consistent with EMT (e.g., increased intercellular separation and spindle-cell shape) (data not shown) associated with ∼ 3 fold invasion increase (p < 0.0001) (Fig. 4a). Consistent with the literature , WB analysis revealed the transition of carcinoma cells towards a mesenchymal phenotype, with the upregulation of Snail 1 expression at 24 h, associated with a time-dependent decrease of E-cadherin and increase of N-cadherin (Fig. 4b). Interestingly, in addition to the modulation EMT biomarkers, we observed a time-dependent accumulation of GrB expression in both cell lines (Fig. 4b). In particular, we observed a significant increase of GrB levels in GrB positive HT-29 cells and the induction of GrB expression in the GrB negative SW480 cell line. These results might suggest the involvement of GrB in TGF-β1-mediated EMT.
To directly assess the causative contribution of GrB to the induction of EMT driven by TGF-β1, we first knocked-down GrB in the GrB positive HT-29 cell line, then we treated cells with TGF-β1 and analyzed EMT. We choose HT-29 cells, because, unlike SW480, in HT-29 cells GrB can modulate both EMT biomarkers and invasive behavior (Fig. 3). Efficient GrB silencing was confirmed by WB (Fig. 5a). As shown in Fig. 5a, GrB depletion downmodulated TGF-β1-induced EMT, as assessed by E-cadherin increase and Snail 1 and N-cadherin decrease, as well as cell invasion inhibition (Fig. 5b). Taken together, these results confirm the contribution of GrB to the induction of EMT by TGF-β1.
DHA inhibits GrB expression, EMT and invasion in CRC cells
Finally, we investigated whether DHA, a dietary natural compound known for its selective anticancer properties [26–28], inhibited GrB expression as well as EMT and invasion in CRC cells. GrB positive HT-29, HCT-8, HT 116 cell lines and CSC4 were treated with 100 μM DHA for 24 h, and the expression of GrB and EMT biomarkers was analyzed by WB. This DHA concentration had no effects on cell proliferation, as verified by cell count and by the viability assay (data not shown). As shown in Fig. 6a, 100 μM DHA significantly inhibited GrB and modulated EMT biomarkers in all CRC cells tested. In addition, the same DHA dose inhibited invasion through Matrigel of the invasive HCT 116 and HCT-8 cell lines as well as of CSC4 (Fig. 6b).
It is emerging that the serine protease GrB, being produced by a variety of normal and neoplastic cells and potentially acting on multiple targets, might represent a powerful regulator of a wide range of fundamental biological processes [21–24, 43, 44]. Currently, GrB is widely used as activation marker for cytotoxic lymphocytes, and lymphocyte-derived GrB positive tumor immunostaining is associated with a favorable clinical outcome in a large spectrum of cancers . However, the relative importance of GrB in in vivo cytotoxicity by CTLs has been questioned , and, in some cases, GrB expression at the tumor site correlates to the severity of the disease, poor prognosis and resistance to therapy [45, 47–51]. We have previously documented that GrB is expressed by urothelial carcinoma tissues and its expression is associated to increasing pathological tumor spreading as well as to EMT . Significantly, GrB expression was concentrated in urothelial neoplastic cells undergoing EMT at the cancer invasion front .
Here, we showed the production and secretion of GrB in a panel of CRC cells and we presented a novel role for GrB as upmodulator of tumor-associated EMT. We documented the expression of GrB not only by 57.1 % of established CRC cell lines, but also, interestingly, by 4 out of 4 CRC patient-derived CSCs, which are known to play a pivotal role in tumor metastasis, tumor regeneration and drug resistance. We showed that GrB knockdown in CRC cells as well as in bladder and pancreatic carcinoma cells was sufficient to increase E-cadherin and decrease Snail and N-cadherin (when present) expression. Conversely, ectopic GrB expression led to the decrease of E-cadherin and the increase of Snail 1 expression, associated to the enhancement of N-cadherin in primary CRC cells. Altogether, these data indicate that GrB contributes to the activation of EMT in tumor cells.
GrB function in EMT was further supported by the results derived from TGF-β1-driven EMT in CRC cell lines. We found that TGF-β1 enhanced GrB expression while inducing EMT in CRC cells. Then, of interest, GrB depletion in TGF-β1-driven EMT resulted in the inhibition of EMT induced by TGF-β1 in HT-29 cells. These data indicate a contribution of GrB in the induction of TGF-β1-driven EMT. Moreover, our finding, showing the enhancement of GrB expression by TGF-β1 in neoplastic cells, is a new and interesting data. In fact, TGF-β1 is known to suppress tumor immune surveillance by different ways, including the inhibition of anti-tumor lymphocytes-mediated cytotoxicity by the suppression of the expression of several cytotoxic effector molecules among which GrB . The fact that TGF-β1 inhibits GrB expression in normal cells whereas enhances GrB expression in neoplastic cells (Fig. 4b) might fit with the phenomenon denominated “TGF-β paradox”, which consists in the bi-functional effects of TGF-β in normal vs tumor cells [53–55]. Although the mechanism underlying this paradox still remains unknown, Zhang et al. have recently proposed a deregulation of TGF-β signaling in tumor vs normal cells, caused by the high extracellular TGF-β level, which might be regulated by a positive feedback loop in cancer cells vs a negative feedback loop in normal cells. In line with this hypothesis, we can propose a reciprocal positive feedback loop between GrB and TGF-β1 in CRC cells, leading to high TGF-β1 levels in the tumor microenvironment. We assume that cancer cells not only display autocrine TGF-β production but also express and secrete GrB, which, as recently shown , induces the release of active TGF-β1 sequestrated by proteoglycans in ECM, leading to increase extracellular TGF-β1 levels. Thus, high TGF-β1 levels upmodulate tumor production of GrB, which further increases TGF-β1 levels in the tumor microenvironment (Fig. 7).
We have previously proposed that GrB expressed in bladder and pancreatic cancer cells promotes their invasion [18, 25]. Here, we showed that GrB depletion in HCT 116 cells significantly inhibited cell invasion through Matrigel, indicating that GrB also promotes CRC cell invasion, contributing to the CRC invasive phenotype. Consistent with these results, we found that GrB depletion in TGF-β1-driven EMT inhibited the invasion of HT-29 cells, indicating a contribution of GrB also in the promotion of invasion induced by EMT-driven TGF-β1. On the other hand, we found that constitutive expression of GrB in CRC cells was not always associated with their invasive capability, in that GrB was expressed at comparable levels in both invasive and lowly invasive CRC cells. Compatible with these results, we also found that ectopic GrB expression in CRC cells was not always associated with the enhancement of their invasion, in that invasion was upmodulated in LoVo and HT-29 cells, but not in SW480 and SW620. These results suggest that the promotion of invasion by GrB might depend on the cellular context and that a CRC subtype might exist in which additional factors might interfere with the upmodulation of invasion by GrB. To date, not much is known about the intracellular and the extracellular pathways, other than the apoptotic pathways, activated by GrB in normal and neoplastic cells. Research is needed to identify GrB targets involved in the mechanisms underlying the modulation of EMT and invasion by tumor-expressed GrB.
Lastly, here we observed that DHA, at a concentration achievable in vivo and that does not affect cell proliferation , is capable of inhibiting GrB expression and cell invasion in CRC cells. In addition, we showed that DHA inhibited EMT in CRC cells. These findings suggest that the inhibition of tumor-expressed GrB, EMT and invasion by DHA might represent at least some of the mechanisms underlying the anticancer activity of DHA.
We reported that tumor-associated GrB contributes to tumor cell EMT and invasion, uncovering a novel potential noncytotoxic role for GrB as upmodulator of EMT. This finding might open the door for a new research on GrB function in tumors, contributing to a better understanding of the mechanisms underlying tumor metastasis and drug resistance, as well as enabling the emergence of new therapeutic opportunities. To this regard, this study showed that DHA has the capability of inhibiting CRC cell-associated GrB expression, EMT and invasion, supporting the use of DHA, a cheap dietary compound without toxic effects, as adjuvant treatment in cancer therapies.
cancer stem cells
transforming growth factor-β
Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A, et al. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65:87–108.
Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;151:78–196.
Busch EL, McGraw KA, Sandler RS. The potential for markers of epithelial mesenchymal transition to improve colorectal cancer outcomes: a systematic review. Cancer Epidemiol Biomarkers Prev. 2014;23:1164–75.
Findlay VJ, Wang C, Watson DK, Camp ER. Epithelial-to-mesenchymal transition and the cancer stem cell phenotype: insights from cancer biology with therapeutic implications for colorectal cancer. Cancer Gene Ther. 2014;21:181–7.
Baulida J, García de Herreros A. Snail1-driven plasticity of epithelial and mesenchymal cells sustains cancer malignancy. Biochim Biophys Acta. 2015;1856:55–61.
Friedl P, Alexander S. Cancer invasion and the microenvironment: plasticity and reciprocity. Cell. 2011;147:992–1009.
Chen D, Sun Y, Yuan Y, Han Z, Zhang P, Zhang J, et al. MiR-100 induces epithelial mesenchymal transition but suppresses tumorigenesis, migration and invasion. PLoS Genet. 2014;10:e1004177.
Schaeffer D, Somarelli JA, Hanna G, Palmer GM, Garcia-Blanco MA. Cellular migration and invasion uncoupled: increased migration is not an inexorable consequence of epithelial-to-mesenchymal transition. Mol Cell Biol. 2014;34:3486–99.
Ewen CL, Kane KP, Bleackley RC. A quarter century of granzymes. Cell Death Differ. 2012;19:28–35.
Voskoboinik I, Whisstock JC, Trapani JA. Perforin and granzymes: function, dysfunction and human pathology. Nat Rev Immunol. 2015; doi:10.1038/nri3839.
Garcia-Sanz JA, Plaetinck G, Velotti F, Masson D, Tschopp J, MacDonald HR, et al. Perforin is present only in normal activated Lyt2+ T lymphocytes and not in L3T4+ cells, but the serine protease granzyme A is made by both subsets. EMBO J. 1987;6:933–8.
Afonina IS, Cullen SP, Martin SJ. Cytotoxic and non-cytotoxic roles of the CTL/NK protease granzyme B. Immunol Rev. 2010;235:105–16.
Prakash MD, Munoz MA, Jain R, Tong PL, Koskinen A, Regner M, et al. Granzyme B promotes cytotoxic lymphocyte transmigration via basement membrane remodeling. Immunity. 2014;41:960–72.
Bruno AP, Lautier D, d’Orgeix AT, Laurent G, Quillet-Mary A. Acute myeloblastic leukemic cells acquire cellular cytotoxicity under genotoxic stress: implication of granzyme B and perforin. Blood. 2000;96:1914–20.
Jahrsdörfer B, Blackwell SE, Wooldridge JE, Huang J, Andreski MW, Jacobus LS, et al. B-chronic lymphocytic leukemia cells and other B cells can produce granzyme B and gain cytotoxic potential after interleukin-21-based activation. Blood. 2006;108:2712–9.
Kontani K, Sawai S, Hanaoka J, Tezuka N, Inoue S, Fujino S. Involvement of granzyme B and perforin in suppressing nodal metastasis of cancer cells in breast and lung cancers. Eur J Surg Oncol. 2001;27:180–6.
Hu SX, Wang S, Wang JP, Millis GB, Zhou Y, Xu HJ. Expression of endogenous granzyme B in a subset of human primary breast carcinomas. Br J Cancer. 2003;89:135–9.
D’Eliseo D, Pisu P, Romano C, Tubaro A, De Nunzio C, Morrone S, et al. Granzyme B is expressed in urothelial carcinoma and promotes cancer cell invasion. Int J Cancer. 2010;127:1283–94.
Fang Y, Herrick EJ, Nicholl MB. A possible role for perforin and granzyme B in resveratrol-enhanced radiosensitivity of prostate cancer. J Androl. 2012;33:752–60.
Van Damme P, Maurer-Stroh S, Plasman K, Van Durme J, Colaert N, Timmerman E, et al. Analysis of protein processing by N-terminal proteomics reveals novel species-specific substrate determinants of granzyme B orthologs. Mol Cell Proteomics. 2009;8:258–72.
Joeckel LT, Bird PI. Are all granzymes cytotoxic in vivo? Biol Chem. 2014;395:181–202.
Froelich CJ, Pardo J, Simon MM. Granule-associated serine proteases: granzymes might not just be killer proteases. Trends Immunol. 2009;30:117–23.
Martin P, Pardo J, Schill N, Jöckel L, Berg M, Froelich CJ, et al. Granzyme B-induced and caspase 3-dependent cleavage of gelsolin by mouse cytotoxic T cells modifies cytoskeleton dynamics. J Biol Chem. 2010;285:18918–27.
Boivin WA, Cooper DM, Hiebert PR, Granville DJ. Intracellular versus extracellular granzyme B in immunity and disease: challenging the dogma. Lab Invest. 2009;89:1195–220.
D’Eliseo D, Manzi L, Merendino N, Velotti F. Docosahexaenoic acid inhibits invasion of human RT112 urinary bladder and PT45 pancreatic carcinoma cells via down-modulation of granzyme B expression. J Nutr Biochem. 2012;23:452–7.
Stephenson JA, Al-Taan O, Arshad A, Morgan B, Metcalfe MS, Dennison AR. The multifaceted effects of omega-3 polyunsaturated Fatty acids on the hallmarks of cancer. J Lipids. 2013;2013:261247.
Vaughan VC, Hassing MR, Lewandowski PA. Marine polyunsaturated fatty acids and cancer therapy. Br J Cancer. 2013;108:486–92.
Merendino N, Costantini L, Manzi L, Molinari R, D’Eliseo D, Velotti F. Dietary ω -3 polyunsaturated fatty acid DHA: a potential adjuvant in the treatment of cancer. Biomed Res Int. 2013;2013:310186.
Calder PC. Marine omega-3 fatty acids and inflammatory processes: effects, mechanisms and clinical relevance. Biochim Biophys Acta. 1851;2015:469–84.
Rao CV, Hirose Y, Indranie C, Reddy BS. Modulation of experimental colon tumorigenesis by types and amounts of dietary fatty acids. Cancer Res. 2001;61:1927–33.
Mocellin MC, Camargo CQ, Nunes EA, Fiates GM, Trindade EB. A systematic review and meta-analysis of the n-3 polyunsaturated fatty acids effects on inflammatory markers in colorectal cancer. Clin Nutr. 2015;doi:10.1016/j.clnu.2015.04.013.
Hajjaji N, Bougnoux P. Selective sensitization of tumors to chemotherapy by marine derived lipids: a review. Cancer Treat Rev. 2013;39:473–88.
Bougnoux P, Hajjaji N, Ferrasson MN, Giraudeau B, Couet C, Le Floch O. Improving outcome of chemotherapy of metastatic breast cancer by docosahexaenoic acid: a phase II trial. Br J Cancer. 2009;101:1978–85.
Cockbain AJ, Volpato M, Race AD, Munarini A, Fazio C, Belluzzi A, et al. Anticolorectal cancer activity of the omega-3 polyunsaturated fatty acid eicosapentaenoic acid. Gut. 2014;63:1760–8.
Sorensen LS, Thorlacius-Ussing O, Schmidt EB, Rasmussen HH, Lundbye-Christensen S, Calder PC, et al. Randomized clinical trial of perioperative omega-3 fatty acid supplements in elective colorectal cancer surgery. Br J Surg. 2014;101:33–42.
Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C, et al. Identification and expansion of human colon-cancer-initiating cells. Nature. 2007;445:111–5.
Ricci-Vitiani L, Fabrizi E, Palio E, De Maria R. Colon cancer stem cells. J Mol Med (Berl). 2009;87:1097–104.
Liu Y, Zhang F, Zhang XF, Qi LS, Yang L, Guo H, et al. Expression of nucleophosmin/NPM1 correlates with migration and invasiveness of colon cancer cells. J Biomed Sci. 2012;19:53.
Han HB, Gu J, Ji DB, Li ZW, Zhang Y, Zhao W, et al. PBX3 promotes migration and invasion of colorectal cancer cells via activation of MAPK/ERK signaling pathway. World J Gastroenterol. 2014;20:18260–70.
Frewer KA, Sanders AJ, Owen S, Frewer NC, Hargest R, Jiang WG. A role for WISP2 in colorectal cancer cell invasion and motility. Cancer Genomics Proteomics. 2013;10:187–96.
Shen X, Mula RV, Evers BM, Falzon M. Increased cell survival, migration, invasion, and Akt expression in PTHrP-overexpressing LoVo colon cancer cell lines. Regul Pept. 2007;141:61–72.
Pino MS, Kikuchi H, Zeng M, Herraiz MT, Sperduti I, Berger D, et al. Epithelial to mesenchymal transition is impaired in colon cancer cells with microsatellite instability. Gastroenterology. 2010;138:1406–17.
Hiebert PR, Granville DJ. Granzyme B in injury, inflammation, and repair. Trends Mol Med. 2012;18:732–41.
Wensink AC, Hack CE, Bovenschen N. Granzymes regulate proinflammatory cytokine responses. J Immunol. 2015;194:491–7.
Fridman WH, Pagès F, Sautès-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome. Nat Rev Cancer. 2012;12:298–306.
Regner M, Pavlinovic L, Koskinen A, Young N, Trapani JA, Mullbacher A. Cutting edge: rapid and efficient in vivo cytotoxicity by cytotoxic T cells is independent of granzymes A and B. J Immunol. 2009;183:37–40.
ten Berge RL, Oudejans JJ, Dukers DF, Meijer JW, Ossenkoppele GJ, Meijer CJ. Percentage of activated cytotoxic T-lymphocytes in anaplastic large cell lymphoma and Hodgkin’s disease: an independent biological prognostic marker. Leukemia. 2001;15:458–64.
Oudejans JJ, Harijadi H, Kummer JA, Tan IB, Bloemena E, Middeldorp JM, et al. High numbers of granzyme B/CD8-positive tumour-infiltrating lymphocytes in nasopharyngeal carcinoma biopsies predict rapid fatal outcome in patients treated with curative intent. J Pathol. 2002;198:468–75.
Asano N, Oshiro A, Matsuo K, Kagami Y, Ishida F, Suzuki R, et al. Prognostic significance of T-cell or cytotoxic molecules phenotype in classical Hodgkin’s lymphoma: a clinicopathologic study. J Clin Oncol. 2006;24:4626–33.
Guzman VB, Silva ID, Brenna SM, Carvalho CR, Ribalta JC, Gerbase-Delima M. High levels of granzyme B expression in invasive cervical carcinoma correlates to poor response to treatment. Cancer Invest. 2008;26:499–503.
Belfort-Mattos PN, Focchi GR, Speck NM, Taha NS, Carvalho CR, Ribalta JC. Immunohistochemical expression of granzyme B and vascular endothelial growth factor (VEGF) in normal uterine cervices and low and high grade squamous intraepithelial lesions. Eur J Gynaecol Oncol. 2010;31:459–61.
Thomas DA, Massagué J. TGF-beta directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell. 2005;8:369–80.
Ranganathan P, Agrawal A, Bhushan R, Chavalmane AK, Kalathur RK, Takahashi T, et al. Expression profiling of genes regulated by TGF-beta:differential regulation in normal and tumour cells. BMC Genomics. 2007;8:98.
Principe DR, Doll JA, Bauer J, Jung B, Munshi HG, Bartholin L, et al. TGF-β: duality of function between tumor prevention and carcinogenesis. J Natl Cancer Inst. 2014;106:djt369.
Zhang Q, Yu N, Lee C. Mysteries of TGF-β paradox in benign and malignant cells. Front Oncol. 2014;4:94.
Boivin WA, Shackleford M, Vanden Hoek A, Zhao H, Hackett TL, Knight DA, et al. Granzyme B cleaves decorin, biglycan and soluble betaglycan, releasing active transforming growth factor-β1. PLoS One. 2012;7:e33163.
This work was supported by grants from the Italian Association for Cancer Research (AIRC) (a “5 per mille” grant #9979 to SS; an Investigator grant and Special Program Molecular and Clinical Oncology–5 per Mille to AS). We thank Maria Pia Gentileschi for technical assistance.
The authors declare that they have no competing interests.
DDE performed the experiments and collected the data. GDR and RL participated in the experiments. FV, SS, AS, DDE and GDR participated in the data analysis and interpretation. FV conceived of the study and drafted the manuscript. SS participated to the study designed. FV, SS and AS supervised the whole experimental work and revised the manuscript. All authors read and approved the final manuscript.
About this article
Cite this article
D’Eliseo, D., Di Rocco, G., Loria, R. et al. Epitelial-to-mesenchimal transition and invasion are upmodulated by tumor-expressed granzyme B and inhibited by docosahexaenoic acid in human colorectal cancer cells. J Exp Clin Cancer Res 35, 24 (2016). https://doi.org/10.1186/s13046-016-0302-6 | <urn:uuid:060ae813-bbe3-41a1-9722-59127adaa2ef> | CC-MAIN-2023-50 | https://jeccr.biomedcentral.com/articles/10.1186/s13046-016-0302-6 | 2023-11-29T05:23:14Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100056.38/warc/CC-MAIN-20231129041834-20231129071834-00332.warc.gz | en | 0.890785 | 10,331 |
- 30th: Sweet Potato & Spinach Gratin, Lamb Steaks
- 29th: Tartiflette Pizza
- 28th: Everyone fend for yourself
- 27th: Plaice, Potatoes, Peas
- 26th: Mixed Bean Goulash (Alex cooking)
- 25th: Dumplings, Stir Fry Veg (Sarah cooking)
- 24th: Chicken with Creme Fraiche & Mustard
- 23rd: Roasted Cauliflower & Chickpeas
- 22nd: Potato & Carrot Tart
- 21st; Everyone find your own dinner
- 20th: Pasta with Bolognese Sauce
- 19th: Spaghetti with Courgettes
- 18th: Minty Lamb Flatbreads, Salad
- 17th: Cauliflower Fritters, Roast Cauliflower leaves
- 16th: Chicken Jalfrezi
- 15th: Thai Style Mince
- 14th: Brussels sprouts and blue cheese pizza
- 13th: Baked Risotto Primavera
- 12th: Leftover Chicken, Potatoes, salad
- 11th: Chickpea & Chorizo Stew
- 10th: Roast Chicken, roast potatoes, cabbage
- 9th: Away
- 8th: Away
- 7th: Away (Sweden)
- 6th: Macaroni Cheese
- 5th: Pea and New Potato Curry
- 4th: Tofu and Spring Veg Stir Fry
- 3rd: Austrian Hash
- 2nd: Ham, Potatoes, Broccoli
- 1st: Penne all' Arrabiata
Saturday, April 30, 2016
Not bad, though not so thrilling I'd rush right out and have it again next week (until last night's dinner). The gratin was cooked nicely, it just lacked zing. I put a lot more spinach in than the recipe called for as well; the amount in the recipe would barely have covered the bottom layer of sweet potatoes.
Continuing in 2016 to make inroads on the books I own (un-read) and not buy too many new ones. Progress to date:
- January: books removed from list: 7, books added: 2; net result -5
- February: books removed from list: 4, books added: 0; net result -4 (total YTD: -9)
- March: books removed from list: 8, books added:8; net result 0 (total YTD: -9)
- I read 5 titles from my list (Howards End by E M Forster, The Bees by Laline Paull, Lisette's List by Susan Vreeland, The Illusionists by Rosie Thomas, The Shock of the Fall by Nathan Filer)
- I re-read seven books we owned already (Harry Potter and the Goblet of Fire, J K Rowling, Summer of the Dragon by Elizabeth Peters, Last Act by Jane Aiken Hodge, Tregaron's Daughter by Madeleine Brent, Whose Body, Clouds of Witness and Unnatural Death by Dorothy L Sayers)
- I tried & abandoned one title from my list, which I just couldn't get into (Brighton Rock by Graham Greene)
- I read one book which is in the read-and-sent-to-the-charity-shop pile; apparently I've read this before, if I believe my own reading lists (in 2008), but I don't remember it at all, not even that sort of vague familiarity you get with something you read in the dim & distant past. (Bloodlines, Jan Burke)
- I bought one book in a bookshop in Lund while visiting Sweden and read it almost right away, so it didn't really get added to The List (Wolf Winter by Ceclia Ecback)
books read: 14
books removed from list: 6, books added: 0; net result -6
[Goal (no more than 1 book in for every two books removed) achieved/exceeded this month.]
[Goal (no more than 1 book in for every two books removed) achieved/exceeded this month.]
Here's the updated list of Books to Read in 2016. There were 55 books at the beginning of January, and now there are 40 - of those, only 5 are left from before 2015. [Books with an asterisk].
- Kate Atkinson, A God in Ruins (Waterstones Kingston, January 2016)
- Leigh Bardugo, Shadow and Bone (AbeBooks, March 2016)
- Philip Baruth, The Brothers Boswell (Waterstones Canterbury bargain bin, July 2015)
- Orson Scott Card, Speaker for the Dead (AbeBooks, October 2015)
- Wilkie Collins, The Haunted Hotel (birthday present, November 2015)
- Wilkie Collins, The Woman in White (Waterstones Kingston, Boxing Day 2015)
- Arthur Conan Doyle, Adventure of Sherlock Holmes (World of Books, October 2015)
- Rene Denfield, The Enchanted (Waterstones Reading, October 2015)
- Jean-Paul Didierlaurente, The Reader on the 6.27 (Waterstones Piccadilly, March 2016)
- Hans Fallada, Alone in Berlin (car boot sale, Bristol, Sept 2015)
- Elena Ferrante, My Brilliant Friend (Waterstones Piccadilly, March 2016)
- Ford Maddox Ford, Parade's End (Nov 2012 - birthday present - bought after the BBC adaptation - but I knew I wouldn't read it straight away as I wanted to let time pass from the adaptation. Enough time has probably passed now...) *
- Gabriel Garcia Marquez, One Hundred Years of Solitude (would be a re-read, bought shortly after his death - spring 2014 - as I was reminded how much I enjoyed it and I didn't seem to own a copy - think my old one fell apart, probably...) *
- Elizabeth Gaskell, North and South (2014)*
- Kate Grenville, The Lieutenant (charity shop, December 2015)
- Frances Hardinge, A Face Like Glass (Mother's Day present, March 2016)
- Melissa Harrison, At Hawthorn Time (Waterstones Piccadilly, March 2016)
- Georgette Heyer, A Christmas Party (from my mother, December 2015)
- Anthony Horowitz, Moriarty (Waterstones Kingston, Boxing Day 2015)
- Andrew Michael Hurley, The Loney (Waterstones Piccadilly, March 2016)
- Donna Leon, Doctored Evidence (charity shop, December 2015)
- Maria McCain, The Wilding (charity shop, December 2015)
- Cormac McCarthy, Blood Meridian (charity table, Wetland Centre, May 2015)
- Cormac McCarthy, No Country for Old Men (charity shop, December 2015)
- John McGregor, If Nobody Speaks of Remarkable Things (charity shop, April 2015 - will be a re-read as have read it in (apparently) October 2004 for a book group)
- Tom McNeal, Far Far Away (AbeBooks, January 2016)
- Philipp Meyer, American Rust (charity shop, December 2015)
- Alice Munro, Runaway (Waterstones Piccadilly, March 2016)
- Kim Newman, An English Ghost Story (The Last Bookshop, Brisol, Sept 2015)
- Flannery O'Connor, Complete Stories (charity shop, December 2015)
- Elizabeth Redfern, The Music of the Spheres (charity shop, December 2015)
- Peter Robinson, Bad Boy (charity shop, December 2015)
- Carlos Ruiz Zafon, The Prisoner of Heaven (charity shop, August 2015)
- Sunjeev Sahota, The Year of the Runaways (Mother's Day present, March 2016)
- Jane Smiley, Some Luck (Waterstones Reading, October 2015)
- Betty Smith, A Tree Grows in Brooklyn (Barnes & Noble (in MD), Summer 2013 - a re-read, as I read it when a teen) *
- Matthew Thomas, We Are Not Ourselves (Waterstones Kingston, Boxing Day 2015)
- Rose Tremain, Tresspass (charity shop, December 2015)
- Barry Unsworth, The Ruby in her Navel (2014) *
- William Wharton, Birdy (The Last Bookshop, Bristol, Sept 2016
Friday, April 29, 2016
Smashing. Though as Geoff so rightly says, what's not to like, with cheese, shallots & bacon together? The cheese was Reblochon, so it does duplicate a tartiflette in as much as you can on a pizza, and it was really extremely tasty. The recipe made two and we ate one and a slice from the second, so there's leftovers for lunch tomorrow. Yum.
Wednesday, April 27, 2016
No recipe on this one, just fish, veg and potatoes (mine exploded in the oven - can you tell?). Olivia was out at dinner time at a rehearsal for her drama exam, so it seemed a good time to have fish (she's not crazy about it).
Tuesday, April 26, 2016
This is a meal we've had before and honestly requires more assembly than cooking - it's largely tins of beans (and one of sweetcorn, which wasn't in the original recipe, but which I added to get some more veg in), with a chopped onion and some spices. But it's a good meal for a 13YO boy to put together on a busy night and it's tasty, healthy and cheap. We added some garlic bread on the side for interest.
Sunday, April 24, 2016
Nice, easy, one dish meal - everything goes in together and cooks. One we've had before and will no doubt have again.
Saturday, April 23, 2016
I've made this recipe before, but I changed it up a little this time, adding some chopped fresh spinach to the onion mixture and also, chopping up the leaves & stems (not the really thick central stem) of the cauliflower and roasting that separately as well before adding in to the mix. It was excellent, even better than last time. And if you left off the feta cheese sprinkle at the end, suitable for any dining vegans.
This one I think I've only read once before, and though I remembered more or less how it was done (and by whom, though I think that's fairly evident from early on; it's more the how and why which are the issues) it was still an excellent read. Sayers always weaves a nice story and it's great fun to watch it unfold. Next up in re-reading this series is a collection of short stories, so I will probably intersperse with something else, though first, another book entirely!
Friday, April 22, 2016
My friend Sharon pointed this gem out to me some years ago, and we've made it a number of times - we all like it. The recipe is here, though I've changed it - I make it bigger, basically, using 4 carrots or so - large ones - and more potatoes, however many I need to fill the tart dish. I adjust the rest of the ingredients up as necessary to go with the increased amount of filling.
I always enjoy the books in this series (the Irene Kelly series), and indeed, have read the early ones more than once. According to my reading logs/Goodread/etc, I have read this before (in 2008) but I didn't remember it at all - not even that sort of vague recognition you get when you know you've read something before but don't really remember how it all fits together. Which is fine; it feels like a brand new book, so that's ok. There are only a few more of them, I think - I have two on my shelf to read before finishing off the series - and as far as I know, that's it. This one was a little different than some as it tracks a very old mystery at different stages of life in some of the main characters (like Irene's mentor O'Connor, who we never actually meet, as he dies in the first book of the series). I really enjoyed it.
Wednesday, April 20, 2016
No recipe, just his usual (extremely tasty) ragu. With wholewheat pasta, though you wouldn't bet on it from this photo!
Tuesday, April 19, 2016
A very quick recipe, which doesn't even involve cooking the courgettes - you just grate them. Tasty and healthy. And I used my obsessive food blogging today to prove a point to my husband who said we'd just had this dish "a few weeks ago" - last occurance was indeed in March - 2015.
Monday, April 18, 2016
A very quick mid week meal - I think it took about 20 minutes start to finish. We are lucky to have a local shop with loads of Middle Eastern goods, so the flatbreads are always available, but you could use pita breads or tortillas or something instead if you didn't have access to Khobez flatbreads. Served with salad, not pictured...
As I mentioned, I'm re-reading this series in order. Trying not to simply whiz through them all, though the temptation is strong. Such an excellent series of detective stories.
Sunday, April 17, 2016
We had these a while back and thought them excellent, and in light of a recent conversation on Facebook about cauliflower leaves, I have been thinking about cauliflower lately and so decided to do them again.
Cauliflower leaves (and the thicker stem part of the leaves) are all perfectly edible, yet many of us throw them away without even thinking about it. I've used them before in a curry, and a friend recently used them in soup, but this time, I just (after some Googling by Geoff) washed them, trimmed off the really thick ends, sliced them up, tossed them in some olive oil with dill and garlic powder & seasoning and roasted them in the oven for about 20 minutes. They were really nice; next time I might try them with sesame oil and soy sauce, another suggestion. Cauliflower is an amazingly versatile vegetable and so many people never eat it in any other way than with cheese sauce (which, don't get me wrong, is also excellent).
For some reason, I've had it in the back of my mind lately that I want to re-read the Lord Peter Wimsey detective novels; finally decided to act on this thought. Going to do them all in order, and I think I might hunt out the short stories (which I don't own) and slot them in place as well as I go through the series. I don't think I've read most of the stories (though I have read some), so that should be fun. I may, in my old (ok, middle) age, be coming around to short stories, which I never used to like much. Read most of this one last night in a single sitting, only the last chapter or so to finish off this morning. Think I will go to the next one straight away!
Saturday, April 16, 2016
A curry we've had several times before - we really like the contrast between the main curry and the large vegetable chunks, which are only cooked a little at the end before adding to the main curry. And it's from one of the diet cookbooks by the Hairy Bikers, which means it's fairly good for you! Win-win.
A good solid, historical novel. I was slightly worried from the blurb and subject matter that it would be a little too pot-boiler-y, but it wasn't at all, which was a relief. A story of life among some rather temperamental theatre players in the Victorian age, with interesting bits of magic, and some insight (perhaps) into middle-class life, but mainly a story of the characters, their personalities, loves, etc. Enjoyable!
Friday, April 15, 2016
This is a dish we've had lots of times, sometimes with turkey mince, more often with pork mince. This time, I added both bamboo shoots and bean sprouts to the dish to bulk it out a bit, and to avoid having to do some sort of veg on the side. Both worked well, I think; I may include them in future, too.
Thursday, April 14, 2016
As odd as this may sound, it was actually excellent. The sprouts weren't too strong (though I like sprouts anyway) as they were shredded before topping the pizza, so only cooked lightly. I added a leek as well, as I had one which wanted using up. I made two pizzas, as we are hungry (some might say greedy) and with the second, I used other cheese than blue, as the kids aren't huge blue cheese fans (though I think it went really well with the sprouts).
Wednesday, April 13, 2016
Although we are back to school after the Easter Holidays, most of the activities which the kids have in the evenings (and indeed, my own yoga class, a Thursday evening item) are not back until next week, which means time to cook a little bit more time-consuming meals than usual. Usually, it's a very tight time window between when I finish doing my after-school tutoring and when someone has to be out of the house for something. Hence all the quick meals and other people cooking and what not. It's nice to get back into the swing of things a little more slowly.
Normal risotto isn't a dish which takes very long, to be sure, but a little too long for many weekdays. This one is done largely in the oven and it was nice to have a little bit of time in the oven when it didn't require attention, rather than the usual deal with risotto, which is constant stirring. I think I cooked this a bit too long, as the rice was a little more al dente than ideal, but on the whole, a successful approach.
I've tagged this as a vegetarian meal; as it happens, I used chicken stock in mine, because I had the carcass from last weekend's chicken to use, but you could easily make it vegetarian...
Monday, April 11, 2016
Picked this up recently while in Sweden; it's by a Swedish author (well, from Sweden, although writing in English originally) and set in the far north in 1717. Lots of superstition, religion and magic entwined with the real-feeling portrayal of ekeing out a survival in a wild, brutal land. Very compelling and atmospheric. A winner.
Sunday, April 10, 2016
This is a book I'd been waiting eagerly for, as I've enjoyed her other books very much; I'm not that sure about this one. The style is somewhat different (focusing on a completely fictional character rather than a real artist or person, though it's still highly steeped in real/realistic art) and I found the character of Lisette a little hard to get inside; she seemed quite naive and childlike, though perhaps she was just a woman of her time and I'm too far away from that time and place to really understand her (Vichy France). There were still many things I liked about the story and I did find it compelling, seeing if she would manage to find her paintings (hidden during the war to prevent the Nazis stealing/destroying them).
Saturday, April 09, 2016
Friday, April 08, 2016
Thursday, April 07, 2016
Not sure about this. I know I would have liked it quite a bit when I was younger, but I found myself a bit annoyed at many of the characters and how they behaved; perhaps I've just moved away from being interested in this sort of person, unless it's done with more humour and lightness of touch. I know it's supposed to be his masterpiece and I won't deny the writing is very good; I know it addresses issues of social convention and personal relationships and intellectualism and whatnot, but I just couldn't really make myself care all that much about any of the people involved.
Wednesday, April 06, 2016
And the final one (for now) in this comfort binge. I read all the Madeleine Brent books when I was younger - and I think they are probably aimed at a slightly younger audience than some of the other stories of this type - but I still find them nice to retreat to when your brain just wants a bit of a break.
Tuesday, April 05, 2016
Monday, April 04, 2016
Having got a bit bogged down in my current book (Howards End) I decided I needed to revisit some old favourites - the reading equivalent of watching a really good rom-com, I guess. So, my favourite Elizabeth Peters (well, one of them). And I adore the kitch cover, which is actually the cover my own ex-library copy has. One of these sorts of relaxing comfort books in a row isn't usually enough, so watch this space for a few more in the days to come!
* might be Cook Vegetarian magazine - it's not a style I recognise readily, meaning it's not a magazine I buy often, but its logo has a big green V...
Sunday, April 03, 2016
Saturday, April 02, 2016
I'm re-reading my way through Harry Potter this year, and am really enjoying the extra complexity of the books (compared to the films). I haven't read these in a while, and I'd forgotten just how good they actually are. Might re-read the Hunger Games trilogy this year as well, now that I've seen all the films. I reckon those books are better as well... (Don't get me wrong; I think they've done a good job with both film series.) | <urn:uuid:25c0e4dc-214a-4a88-b836-b1b1b31158ae> | CC-MAIN-2017-26 | http://katelnorth.blogspot.com/2016/04/ | 2017-06-24T17:15:06Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320270.12/warc/CC-MAIN-20170624170517-20170624190517-00202.warc.gz | en | 0.973589 | 4,592 |
Leonardo da Vinci: Caricature of a Man with Bushy Hair
Francisco de Goya: He Can No Longer at the Age of 98
From wicked caricatures to wry satirical observations of social and political injustice, drawings have incorporated humor for centuries. A Light Touch: Exploring Humor in Drawing, on view from September 23–December 7, 2008, at the J. Paul Getty Museum at theGetty Center
The exhibition is divided into categories of humor, beginning with caricature, one of the fundamental bases of drawn humor, in which the characteristic features of the human figure are exaggerated for amusement or criticism. Leonardo da Vinci was the first artist to popularize this art form. In Caricature of a Man with Bushy Hair, Leonardo emphasizes a man’s grotesque facial features, including his unkempt hair, jagged teeth, and oversized chin and nose, to comic effect.
Innuendo used in drawings exploits a double meaning, often with the help of a written caption. For example, Francisco de Goya’s He Can No Longer at the Age of 98 shows a frail old man hobbling along with theaid of two canes. As is often the case with Goya’s drawings, a Spanishinscription of the title gives the scene its meaning—suggesting the elderlyman’s mental and physical frailty, and hinting at his sexual impotence.
The Commedia dell’Arte was a widely popular form of improvisational theater that flourished across Europe in the 1600s and 1700s. The popularity of these comic performances inspired artists to depict the satirical characters and themes of these plays, which relied heavily on visual humor. Giovanni Battista Tiepolo’s Punchinellos Approaching a Woman uses one of the most popular comic figures, the Punchinello, who talks with squeaks or strange sounds and was capable of trickery, violence, and gluttony. Tiepolo’s drawing shows a group of Punchinellos accosting an apparently compliant drunken woman.
Drawings based on social and political satire are often exaggerated representations designed to denounce the plentiful vices, stupidities, and evils of humanity. Jacques de Gheyn’s A Frog Sitting on Coins and Holding a Sphere: Allegory of Avarice is an allegorical representation of the sin of avarice. de Gheyn gives the naturalistic frog the human personality trait of greed. The frog bears a haughty expression, while he grasps uncouthly for the coins between his legs. In the other hand, the frog holds a sphere, symbolic of the grasp of greed on the world.
Adding a light touch to a more serious theme creates playfulness in drawings. Guy Billout’s Quadrature, the only drawing included in the exhibition from after 1900, playfully parodies Richard Meier’s famous grid design of the Getty Center by showing a young boy dragging a stick across the enamel-covered aluminum paneling, threatening to pull the whole structure apart. This drawing appeared in the March 1998 edition of Atlantic Monthly to commemorate the opening of the Getty Center. | <urn:uuid:f6aa33af-6b72-4fd4-91b4-c9ea1cefa620> | CC-MAIN-2017-09 | http://www.theartwolf.com/exhibitions/light-touch-getty.htm | 2017-02-24T21:58:37Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171630.65/warc/CC-MAIN-20170219104611-00534-ip-10-171-10-108.ec2.internal.warc.gz | en | 0.925978 | 655 |
This paper explores the possibility of defining a non-utilitarian normative standard for assessments of welfare and deprivation. The paper contributes to this end in three ways. First, the paper formalises a key aspect of Prof. Sen’s critique of the assumption of consistent utility maximisation in the revealed preference theory. Secondly, the paper explores alternative formulations of the axiom of revealed preferences that are consistent with Prof. Sen’s critique and proposes a set of intuitive assumptions to characterise the relation between observed choices and underlying references in the absence of consistent utility maximisation. Finally, we use these to construct two alternative normative ranking rules that can be used in non-utilitarian welfare economics.
Citation: Silva-Leander, S. (2011). “Revealed Meta-Preferences: Axiomatic Foundations of Normative Assessments in the Capability Approach.” OPHI Working Papers 48, University of Oxford. | <urn:uuid:759ef48f-285d-4343-91f7-dbcd232aec07> | CC-MAIN-2021-43 | https://ophi.org.uk/revealed-meta-preferences-axiomatic-foundations-of-normative-assessments-in-the-capability-approach/ | 2021-10-24T22:16:06Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323587606.8/warc/CC-MAIN-20211024204628-20211024234628-00652.warc.gz | en | 0.841061 | 192 |
Keeping Up with the Joneses
Lifestyle inflation can be the enemy of wealth building. What could happen if you invested instead of buying more stuff?
A Primer on Irrevocable Life Insurance Trusts
Irrevocable life insurance trusts can be important tools that may accomplish a number of estate objectives.
Retiree Health Care Coverage Overseas
Retirees traveling abroad need to know that their health insurance travels with them.
The Fed and How It Got That Way
Here is a quick history of the Federal Reserve and an overview of what it does. | <urn:uuid:6d9bd764-2a62-4f7b-9e50-95adf6a9efbb> | CC-MAIN-2023-40 | https://www.lovasfinancial.com/resource-center/money/keeping-up-with-the-joneses | 2023-09-26T01:49:46Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510130.53/warc/CC-MAIN-20230926011608-20230926041608-00273.warc.gz | en | 0.911965 | 120 |
The Most Adorable Accessory
Lockets are a sweet way to hold something special near and dear to your heart. But you know what’s even better than a locket? A little DIY journal necklace, that’s what! You can write all kinds of special things on the pages of this real functional journal, and it will look awesome at the same time. This necklace lets others know that you’re a bookish nerd who is style savvy. You’ll get compliments at how cute it is and then you’ll get to impress your friends by saying you made it yourself. Plus, you can make this as long or short as you want to accommodate your taste. So how is it done? Why, it’s really quite simple! All you need are a few craft supplies and a willingness to work small, and you can whip up one of these babies in an hour or two. So let’s jump in!
What You’ll Need:
- Two pieces of different colored sponge paper
- White computer paper
- Crochet thread
- X-acto knife
- Cutting mat
- Waxed thread
Step 1: Cut several strips of white paper that are at least 2.5-cm wide. The number of paper strips will depend on how many pages you want your DIY journal necklace to have. This journal has 48 pages.
Step 2: Cut the strips down into 4 cm long rectangles. You should have 24 pieces of the small rectangle paper measuring 4-cm long and 2.5-cm wide.
Step 3: Divide the 24 pieces into three stacks, meaning 8 rectangles per stack. Then fold those stacks right in the middle. Now you have three mini signatures. Aren’t they cute?
Step 4: Punch a two holes in the crease of each filler sheet using an awl. Make sure the holes line up on each sheet! (If you don’t have an awl, you can use a heavy duty needle and it will get the job done – albeit with a little more effort)
Step 5: Cut a strip of blue sponge paper that is at least 3-cm in width. This will be cover of your DIY journal necklace.
Step 6: Fold the blue sponge cover in the middle.
Step 7: Unfold the sponge cover and scratch a guideline down the center using the awl and a ruler. Create additional guidelines on both sides of the middle guideline, both at an equal distance. When you’re done, you should have three lines down the middle of the paper.
Step 8: Use one of your pre-punched pieces of paper as a guide to punch holes in the sponge paper right along the center guideline.
Step 9: Punch holes on the sides of the center line’s holes.
Step 10: Load up your needle with the crochet thread, using only one long continuous thread. Knot the end.
Step 11: Insert the needle into one signature from the inside of the fold. Align the signature with one of the outside set of holes in the sponge paper and push the needle through.
Step 12: Insert the needle from the outside of the sponge paper cover through the top hole, pushing it through the signature’s aligned hole.
Step 13: Insert the needle again in the first hole, pushing through to the outside of the sponge paper.
Step 14: Insert the needle into the next hole over from the first one. Then push it through into the next signature.
Step 15: Repeat steps 11-14 until you bind the three filler sheets to the inside of the sponge cover. The bound part of the miniature journal should look like this when properly done, and your thread should finish on the inside of the journal.
Step 16: Knot off the remaining thread by weaving the needle through the stitches and creating a loop. Tighten the loop as much as you can and cut the thread.
Step 17: Cut one side of the sponge paper at least 1/2 centimeter away from the side of the filler sheet. This will be the front cover of your DIY journal necklace.
Step 18: Cut the other side of the cover at least 2.5 to 3.5-centimeter from the edge of the paper. This will be the back cover and will wrap around to close the journal.
Step 19: Cut a thin strip of the other color of sponge paper. This will be used to secure your DIY journal necklace and tie it closed.
Step 20: Round the corners of the with scissors. Be careful and go slowly! You can always trim away more if you want.
Step 21: Sew the orange strip right in the middle of the long side of the cover.
Step 22: Wrap the orange strip around the journal and tuck in the loose end snugly. Cut the excess from the strip diagonally.
Step 23: Create a hole in the middle of the top end of the spine.
Step 24: Measure and cut 40 inches of wax thread. This will be the necklace cord.
Step 25: Thread the wax cord through the hole in the journal’s spine and pull it to the center of the cord. Tie a knot to secure the DIY journal necklace.
Step 26: Lay the left end of the cord about 4 inches up the length of the right cord. Then wrap the left end tightly around the right cord and tuck the loose end through the coils. Pull it tightly to make sure it is secure. This type of knot is great for flexibility since it allows the wearer of the DIY journal necklace to adjust the length of the cord.
Step 27: Do the same process with the other loose thread end. **It occurred to me after I shot the photos that it’s hard to see exactly how to do this knot with images alone. If you want to see a video demonstrating this technique, this video by Wubbers Tutorials does a great job!**
Step 28: Your DIY journal necklace is finally done and ready to use!
You can get wildly creative using all kinds of different colors, materials, and patterns. If you wanted, you could even use thin suede for a gorgeous mini leather journal. And once you got the hang of the process, you can easily churn out lots of these little DIY journal necklaces to give out to friends and fellow notebook addicts. They make cute and unique Christmas or birthday presents. After all, who doesn’t love something handmade? So try your hand at this adorable little necklace and tell me what you think! I can’t wait to see what you create.
*This post contains affiliate links. That means that if you click on a link and buy something, I may get a portion of the sale at no cost to you. I have affiliate links so I can promote products and services that I think are excellent. It also helps me make a living off of this site so I can keep creating content for you. Thank you for helping me live my dream!* | <urn:uuid:f54d9edd-4e39-4f08-976b-cb0e8fbf8480> | CC-MAIN-2019-39 | https://littlecoffeefox.com/diy-journal-necklace/ | 2019-09-19T00:33:35Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514573385.29/warc/CC-MAIN-20190918234431-20190919020431-00155.warc.gz | en | 0.903872 | 1,448 |
With the ClickSmart 310, Logitech offers families and students solid Webcam capabilities and a full software package. You can also toss this camera in your bag and take pictures with it, though its still-image quality is nothing to write home about. With the ClickSmart 310, Logitech offers families and students solid Webcam capabilities and a full software package. You can also toss this camera in your bag and take pictures with it, though its still-image quality is nothing to write home about.
Simple and smart
A smart-looking little Webcam with a silver, gray, and bright-blue plastic body, the ClickSmart 310 is sturdily constructed. At 5.1 ounces with four AAA batteries installed, it's a compact snapshot camera when it's untethered. A comfortable grip makes the device easy to hold, and its tight-fitting lens cap protects the fixed-focus lens from getting a battering in your backpack. For Webcam use, the camera drops into a small cradle with a swiveling head and easily connects to your PC with the included USB cable. The cradle doesn't attach to the camera's tripod socket (as is the case with the ClickSmart 310's big brother, the ClickSmart 510), but a snug fit and a wide base make it surprisingly stable. Snapshooters will find using the ClickSmart 310 about as easy as it gets--there's just one Mode button that lets you cycle through the few camera settings on a small LCD.
As a digital camera, the ClickSmart 310 doesn't have many features to choose from, offering two resolution settings for still pictures, silent video-clip recording, and a fast, five-shot burst mode. There's 2MB of built-in memory, so you can store up to 160 still shots or 15 seconds of video. Transferring your pictures from the camera to a PC is easy. Once the Logitech software is installed, just plug in the USB cable and click the onscreen Download button. Then you can use the QuickCam software to view your pictures.
While the camera's features are very basic, the software that comes with it offers a fun array of options. There are simple photo-editing and photo-viewing tools, and the Web album software helps you build an HTML page and publish selected images to a SpotLife Web page. Logitech partners with SpotLife to offer camera users a free trial of Web space for albums, Webcams, and streaming video. Microsoft NetMeeting is included for videoconferencing, and broadcasting a live video show with the ClickSmart 310 is just a click away in the QuickCam software. Other options include creating movies, making animations, and our personal favorite: using the motion detector. Since it has no indicator lights when operating, you can use the ClickSmart 310 to spy on people without anyone knowing.
A Webcam at heart
As a Webcam, the 310 performs well when it comes to image quality, providing a clear, colorful picture even in low light. However, as a digital still camera, it falls into the toy-camera category. The snapshot functionality offers a nice novelty but isn't meant for serious picture taking. With no focusing, no flash, and no exposure settings, most images come out noisy and full of artifacts. The fixed-focus lens works best from five feet to infinity, but images are recognizable down to three feet.
For a durable Webcam with a generous software package and snapshot capability thrown in for fun, the ClickSmart 310 is a good value for students and families at its $79 list price. But if you need a dual cam that does a better job with still images and can also record sound, take a step up to Logitech's . | <urn:uuid:05ef513d-8c0b-4e07-a26d-3ef99317b6a3> | CC-MAIN-2017-30 | https://www.cnet.com/products/logitech-clicksmart-310/review/ | 2017-07-26T11:08:10Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549426133.16/warc/CC-MAIN-20170726102230-20170726122230-00288.warc.gz | en | 0.927661 | 761 |
8 Favourite Swim Out Suites!
Consequently, we get asked a lot about swim out suites when it comes to destination wedding guests and modern room upgrade options. Swim out Suites is a standard room feature given to newer properties, with older properties you’ll see more and more resorts renovating to include these fabulous suites due to popular vacation demand. We do have some favourite swim out suites!
We do recommend them, but each resort can vary in layout from an entirely private walk out suite pool to a shared pool area between suites that runs the length of several suites. A swim out suites is typically always heated only by the tropical sun. We’re here to help give you the information you need to determine if your resort choice has the perfect swim out for you!
#1 Dreams Las Mareas Costa Rica- Preferred Club
Firstly, I took this photo just a few weeks ago at Dreams Las Mareas in beautiful Costa Rica!
#2 Dreams Riviera Cancun Swim out Suite Section
Dreams Riviera Cancun is one of my truly favourite properties. Upscale, Great for families, Active and yet relaxing too.
#3 Majestic Colonial – Premium Section, Punta Cana
Resort swim out suite at Majestic Colonial in Punta Cana. I would highly recommend this Premium section for guests wanting a quieter, luxury stay.
#4 Royalton, Cancun Mexico
Consider your wedding at the new Royalton Cancun. It may be the perfect option for your wedding plans.
#5 Secrets Huatulco Swim out Suite Section
Relax in your Swim out after enjoying an incredible resort day at Secrets Huatulco. You’ll want go back and forth between this pool and experiencing the breathtaking views of this amazing property.
#6 Swim out Suites Sunrise Section of Moon Palace
Sunrise section at Moon Palace offers this private area with small pool perfect for enjoying a favourite book!
#7 Private Swim out Suites Dream Riviera Cancun
Truly a private swim out suite Dreams Riviera Cancun is the one for you if you are looking for that entirely private pool time, right off your living/bedroom.
#8 Casitas in the Casita Suite section
Last but not not least for our favourite swim out suites is the wonderful casita suites offered exclusively at El Dorado Casitas. These suites are the perfect weddingmoon option! | <urn:uuid:0fa1d152-38e2-4f48-944b-6ed52010d052> | CC-MAIN-2017-39 | https://www.lizmooredestinationweddings.com/blog/favourite-swim-out-suites/ | 2017-09-20T23:34:42Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818687582.7/warc/CC-MAIN-20170920232245-20170921012245-00008.warc.gz | en | 0.889082 | 503 |
Hollywood High (1976)
R · 1h 21min · Comedy · 1 December 1976
Four high school girls at Hollywood High are looking for fun. Together they frolic on the beach and cavort with their guys. In their search for a little privacy they meet up with a retired movie star whose mammoth house offers 10 private bedrooms. But, there's a catch. Life is good at Hollywood High.
- Written by
Brian D. Switzer
Director(s): Patrick WrightCast: Susanne Severeid, Sherry Hardin, Rae Sperling | <urn:uuid:6e0b87fb-cf52-4d30-a915-79250bdfca3d> | CC-MAIN-2016-44 | http://nachostime.net/lrex2h-hollywood-high | 2016-10-23T21:10:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719416.57/warc/CC-MAIN-20161020183839-00496-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.906288 | 117 |
A college professor (Jeffrey Nordling), who lost everything ? his career, his family, his reputation ? after being suspected of murdering one of his female students (Kaitlin Doubleday) in 1995, offers new information regarding the case that he hopes will clear his name. He believes the student’s death is connected to a copycat murder of a prostitute. Rush investigates the woman who was killed and the men in her life in order to discover which one of them killed her.
No recaps, be the first to add one below!
You must login to post a recap! | <urn:uuid:c9e34924-2896-4de7-a189-0b4ae0fcd830> | CC-MAIN-2017-43 | http://www.episodelist.com/episodes/cold-case/season-1/hubris/2372 | 2017-10-23T10:00:51Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187825889.47/warc/CC-MAIN-20171023092524-20171023112339-00010.warc.gz | en | 0.980345 | 122 |
While they are quite basic, I think the first one is actually really effective!
Two Free Corporate Identity Packs from MediaLoot
Posted February 11, 2010 in News
Well, it’s time for another freebie from MediaLoot :-) These two free sets were both designed by me (Mason) specifically to be really useful for freelancers in all industries. Everyone needs business cards, letterhead, and other corporate stationery, and for those freelancers out there who aren’t design savvy these could be just the ticket.
At launch MediaLoot will primarily be a site for designers — but we will regularly release designs that are useful for other people too (some free and some members-only versions). These two corporate identity packs are just one example of design resources that most everyone can benefit from.
To find out more about these stationery sets and download one for yourself, head on over to the MediaLoot resource page →
- Free Web UI and Button Set from MediaLoot
- MediaLoot Free UI Set
- How I Lowered The Costs Of Creating A Corporate Identity
- Coming Soon: A Premium Resource Toolbox for Designers
- 101 Free Icon Sets that Kick Ass
Unleash the true potential of your business. Get The Unlimited Freelancer and start transforming your freelance business,
now only $19.
February 11th, 2010 at 4:26 pm
February 12th, 2010 at 8:05 am
I agree with Tom
February 12th, 2010 at 9:56 am
Very interesting concept, I think the design is simple and impressionable.
Urvashi SFebruary 23rd, 2010 at 6:26 am
I like the simplicity… I think they work because they are so flexible
March 10th, 2010 at 3:13 am
Your designs as per the designing rules and regulation for the better source of action in the site promotion….Keep sharing.
July 7th, 2010 at 8:25 pm
Southeast pandora jewelry and main Asian countries have twisted pandora bracelets rubies for centuries, but research as to where, cheap pandora charms and how to find more deposits is spare, and production has figured out how pandora uk and mining companies,” Giuliani says, pandora sale to look at exactly the right time and place.Farther cheap pandora
- uberVU - social comments
- Two Free Corporate Identity Packs from MediaLoot | JobsMyriad.com - Employment Agency and Career Placement Service
- Valuable Internet Information » Two Free Corporate Identity Packs from MediaLoot | FreelanceFolder
- MediaLoot is Halting Sales of Unlimited Subscriptions on March 1st | World's Greatest T-Shirt
- Author Branding: Leave an Impression « Writing « Jen's Writing Journey
Sign up for our product discount list to get a free copy of Why Some Freelancers Thrive and Others Barely Survive. You can unsubscribe anytime.
- SEO Techniques All Top Websites Should Use
- When a Client Can't Afford You: Why It's Still Better to Bid High
- How To Stop Scrambling For Clients And Get A Steady Stream Of Paying Gigs
- A Simple Way To Stop Clients From Rejecting Your Proposals
- 3 Reasons Your Rates Are Still Low (And How To Start Raising Them) | <urn:uuid:cd8675ae-0f8e-44e9-b172-b1261e51d37a> | CC-MAIN-2013-20 | http://freelancefolder.com/two-free-corporate-identity-packs-from-medialoot/ | 2013-05-23T17:35:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703635016/warc/CC-MAIN-20130516112715-00000-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.897393 | 703 |
Photo by Chris Mathan
Is there such a thing as too much exercise for a young dog?
Jerry and I think, yes, there is. So does Turid Rugass, Norwegian dog trainer and behaviorist.
“It’s a common misconception that energetic dogs need a lot of activities and exercise, but in general the rule is that too much physical training and activities doesn’t use up excess energy, but creates more of it, leading to stress.”
In addition, the more exercise a dog gets, the more it needs. When the excessive activity level begins at a young age, the pattern can carry into adulthood and the result can be a stressed-out, high-strung, wound-up dog.
That stress can manifest itself in a couple ways in dogs. Some can’t maintain a healthy weight despite the proper amount of food. Poor digestion can lead to intermittent bowel problems.
We allow groups of puppies to spend half of each day in the exercise pens. They sleep as much as they play. Both rest and exertion are necessary for good health, mental stability and physical development.
Fenced-in back yards and invisible electric fences are wonderful options for dog owners. It’s easy to simply open the door and let a dog out. But it’s not healthy to allow it to free run all day.
As with most things in life—whether for people or for dogs—balance is essential.
Lucy (on left) is a young setter that recently swallowed a large quantity of TomCat rodent poison but is now recovering. Her kennel-mate in the background is four-year-old Beasley.
Jerry and I recently heard from Mike, a friend and client from Minnesota. Mike has bought two setters from us— Beasley in 2011 and last year, Lucy.
“Tuesday afternoon I was driving home, talking to my wife Cynthia who was at home. All of sudden Cynthia was telling Lucy to drop something. When she reached, Lucy swallowed the rest of the mouse poison.
“Within 10 minutes I was home and had the vet on the phone. Per the vet’s instructions I gave her hydrogen peroxide to induce vomiting. Within 5 minutes Lucy did and there was a lot of poison in her.”
Inducing vomiting in a dog is an extremely valuable medical skill and, fortunately, it’s relatively easy to do.
1. Have these two supplies on hand:
• 3% hydrogen peroxide
• syringe (without needle) or turkey baster
2. Fill the syringe or baster with straight hydrogen peroxide at the dosage of 1 teaspoon per 10 lbs. of dog weight. (One teaspoon equals 5 cc or 5 ml.)
3. Squirt into the back of the dog’s mouth.
4. Wait 15 minutes. If the dog hasn’t vomited, the dosage can be repeated once.
Due to quick thinking and action by Mike and Cynthia, Lucy is recovering. Last week, they took her back to their vet for a re-check.
“She is good! We will be giving vitamin K for the next 30 days to help her blood clot. They do want us to keep her quiet for a month. That will be a challenge!!”
Gert is surrounded by soft pillows and cushions after surgery to repair torn ligaments and reposition an out-of-socket hip.
Late in the afternoon last Wednesday in a remote area of central Minnesota, Dave Moore was grouse hunting with Gert, his eight-year-old, multiple champion English setter. Light was fading and he decided to walk the half hour back to his truck. He popped out of the woods and up onto a gravel road. Gert, meanwhile, was still hunting.
Just then, a pickup careens down the rural, dead-end road. Dave thinks to himself, “Gert, just stay in the woods,” and he stands in the middle of the road, waving his arms. Events unfolded rapidly—the pickup didn’t slow down, Gert sprang out of the woods onto the road and the speeding truck hit her. In a further, unthinkable behavioral breach, the four kids in the truck didn’t stop.
Gert was down and blood seemed to be everywhere. Dave rushed to her and ensured she was alive. He then gently lifted her, back legs dangling like broken sticks, and carried her for the half-hour walk back to the truck.
By now it was pitch dark and Dave drove directly to the veterinarian’s office. The diagnosis was serious—Gert’s right hip was grossly out of its socket, all four ligaments of her right knee were torn and her left leg suffered severe road rash, down to the bone. Incredibly, no bones were broken.
Dave and his wife Rochel own Gert (registered name I’m Blue Gert). They bought her from our 2006 breeding of Blue Silk to the rarely used but talented I’m Houston’s Image. The entire litter was outstanding, producing another grouse champion, Satin From Silk (owned by Greg and Dianne Gress), wonderfully sweet, now deceased Blue Ghost (owned by Mo and Randy O’Brien) and two cool dogs Jerry and I named Boomer and Moxie.
Gert has had quite a year. With full support and encouragement from Dave and Rochel, we leased Gert to breed to our young, handsome Northwoods Grits. During whelping, she had some difficultly and underwent a C-section operation. Within weeks of weaning her three female puppies, Gert was back at work getting in shape for the fall field trial season.
Outfitted with a new-fangled fabric cone, Gert rests in the arms of Rochel Moore.
Dave’s first message read: “Gert is so tough.”
On Thursday evening, Dave sent a second message with an uncanny, bittersweet note about Gert and their 14-year-old pointer, Tucker.
“She has surgery in the a.m. for the knee and they will put the hip back in place at the same time. Tucker passed away tonight—he went the Green Mile for Gerty.”
The last message from Dave came this morning: “She is using her leg just fine. I have her on a leash because she wants to go! I can’t believe it. I didn’t think she could walk for a month.”
It’s true; dogs are tough, as Dave wrote, but resilient and strong, too. And thanks to Dave and Rochel, Gert will get through this. There are still field trials to win. Don’t count her out.
We still store the traps Jerry used when he was young. The collection includes snare, leg-hold and Conibear traps as well as the necessary chains and stakes. The large trap in front is the 220 Conibear that caught Jerry’s Brittany spaniel in 1985.
Jerry will never forget the day in 1985 when he saved the life of his first bird dog, a female Brittany spaniel. While pheasant hunting in the river bottoms of southern Minnesota, he heard a brief, odd, exhaling yelp and then nothing. The sight was horrific. His dog’s neck was caught in the jaws of a 220 Conibear trap.
After a moment of panic and a good kick of adrenaline, he worked quickly, cursing a broken safety catch on one side, and pried the trap open. She was free but not breathing and her gums and tongue had turned blue. Jerry performed mouth-to-mouth resuscitation as the final step.
Fortunately for the dog, Jerry knew about traps and CPR.
From the ages of 11 to 18 years of age, Jerry was a trapper. He used Conibear (although never as large as a 220), snare and leg hold traps, matching trap to quarry—whether fox, raccoon, mink, beaver or muskrat. As required by law, he walked his trap lines every day during the season with a wicker pack basket on his back and gained valuable knowledge about the intricate workings of many kinds and sizes of traps.
Even though Jerry and I haven’t known of any dogs—either ours or dogs owned by friends and clients—killed in traps, we do know of some who were injured. But dogs do die as Doug Smith, outdoor writer for the Twin Cities-based Star Tribune, reported in a piece on January 15, 2013.
We think it behooves all hunters to become familiar with the types of traps they might encounter and how to free a trapped animal.
Cut the wire (Carry a Leatherman or other tool capable of cutting wire.)
Step on the spring(s) and the trap will release.
Conibear, also called Body Grip Trap
Print the instructions from the website below and carry with you, along with heavy-duty zip ties as specified at the bottom of the document.
Another life-saving technique that worked for Jerry and his Brittany spaniel is CPR. In addition to resuscitating a dog from a trap, CPR can be useful in other emergency situations.
Many thanks to Chris Bye for the idea of this post.
Dog food gets delivered to us by the pallet. When the kennel is humming, we go through about one bag every two days. We feed Pro Plan Sport All Life Stages Performance 30/20 to almost all dogs–whether young, old, dogs in for training, puppies or nursing dams.
It’s always disheartening when dogs come in for training and they’re overweight. Among other issues, they lack stamina and concentration and we immediately begin feeding them the proper amount to get them in shape. Just like people, dogs are what they eat and nutrition is key.
Betsy and I recently came across excellent information on the Purina Pro Club website about feeding and keeping dogs at a good weight and we want to share it.
Question answered by Purina Research Scientist Dottie Laflamme.
Question: How important is it to feed dogs on an individual basis versus simply feeding the amount of food suggested on the back of the package?
Answer: The feeding guidelines on a bag or can of food are suggested amounts to feed based on the average energy requirements of dogs. However, many dogs may need more or less than the amount suggested. If your dog is not very active, you might start with less food. If your dog is highly active, you could start with more food.
If you are starting a food for the first time and your dog seems “average,” you should use the guidelines to help you know how much to feed. Of course, if you are feeding other foods as well, such as treats, you should feed less. You should monitor your dog’s weight, then increase or decrease the amount of food offered to attain and maintain a lean body mass in your dog. If you do not have access to a scale, you can monitor changes by using a measuring tape to measure and record the circumference of your dog’s waist (just behind the ribs) and chest (just behind the elbows). These measures reflect body fat and will increase or decrease over time with weight changes.
We feed at about the same time every day. And we always measure!
Keeping Canine Athletes at a Healthy Weight
To perform their best, hardworking dogs must maintain an ideal body condition. Training activities, your dog’s metabolism and nutrition contribute to his body condition. It can be a challenge to keep weight on some canine athletes because regular exercise not only increases the calories an active dog burns, it also increases overall metabolism. Just like people, some dogs naturally have a higher metabolism.
“A dog that is losing weight, particularly muscle mass, is in a catabolic state and may be more susceptible to injury, illness or slower recovery,” says Purina Nutrition Scientist Brian Zanghi, Ph.D.
Intense training coupled with suboptimal nutrition, especially insufficient intake of protein, can cause a catabolic state. Since protein nourishes muscles, underweight canine athletes that do not receive adequate dietary protein may suffer from fatigue and inadequate recovery, which ultimately may impact their performance.
“If a dog is underweight, feeding a nutrient-dense food may help him in achieving a stable body weight and an ideal body condition,” Zanghi says. “If a dog seems fulfilled with his normal daily feeding portion, but still is underweight, feeding a food that is more nutrient-dense may help the dog ingest more calories with a smaller portion size.” This will help the dog get the calories needed before feeling full.
Dog food formulas that contain higher proportions of fat are more nutrient and calorie dense. Performance formulas with 28 to 30 percent protein and 18 to 20 percent fat will deliver more concentrated nutrition compared to maintenance formulas with 22 to 26 percent protein and 12 to 16 percent fat. For example, Purina® Pro Plan® SPORT Performance 30/20 Formula contains 30-percent protein and 20-percent fat to help fuel a dog’s metabolic needs and maintain lean muscle. It has omega-3 fatty acids from fish oil for healthy skin and coat and glucosamine to help support joint health and mobility.
“More important than enriched calorie content, the higher proportion of dietary fat in a performance formula helps ‘prime’ your dog’s muscles to better adapt to exercise and endurance,” says Zanghi.
Sometimes dogs that are underweight are not motivated by food, so it can be harder to get them to eat. Adding water or Purina Veterinary Diets® FortiFlora® as a palate enhancer to the dog’s food can stimulate a greater desire to eat, particularly when traveling or boarded in a kennel.
If a dog is routinely eating twice a day, it may be helpful to switch to once a day, such as after the dog is done exercising or training for the day. His post-workout appetite may improve his ingestion volume. You also should consider whether the dominant behavior of other dogs in the home or kennel may prevent access to food and thus contribute to a dog’s underweight condition. Feeding dogs in separate locations may correct the problem.
Evaluating Your Dog
When it comes to assessing your dog’s body condition, you need to know more than just a number on a scale.
“A dog’s scale body weight tells us nothing about the amount of body fat relative to muscle mass,” Zanghi explains.
By noting some simple features of your dog’s body, you can make a general assessment of his body condition and monitor his body fat. Dogs that are overweight are more susceptible to joint-related health concerns as added weight places extra stress on the joints of an active dog.
Purina veterinary nutritionists developed the nine-point Purina Body Condition System.
Typically, dogs with an ideal body condition of 4 or 5 score should have:
• An obvious waist behind the ribs when viewed from above
• A tuck in the belly when viewed from the side
• Ribs that are easily felt but not seen
To determine your dog’s body condition score, examine his physique by putting your hands on the dog and feeling his ribs. Place both thumbs on the dog’s backbone and spread your hands across the rib cage. You should be able to easily feel the ribs. You also should be able to view the dog’s waist behind the ribs, and an abdominal tuck should be apparent from the side. This is a convenient way to monitor your dog throughout the seasons to know if you should be adjusting your dog’s daily food portion to meet his caloric needs.
Monitoring your dog’s body condition and feeding a high-quality, nutrient-dense food will help ensure your canine athlete is performing at his best.
K9 Advantix II and Preventic tick collars are two products used to combat tick-borne diseases.
Tick-borne diseases are a hot issue across the country. Recently, local, city and state-wide newspapers have published articles about the subject. Even The New York Times deemed the issue worthy and wrote an editorial about Lyme disease in people on Sunday, September 22.
But I particularly noticed a feature story in the current issue of Purina ProClub’s Update . More than any other source, this piece was clear and concise. In addition, an excellent chart (Common Tick-Borne Diseases in Dogs) was included that detailed disease name, tick carrier, pathogen and signs for each of the seven common, tick-borne diseases in dogs.
From that article, listed below are some interesting facts about ticks and tick-borne diseases that all dog-owners need to understand.
• Tick populations are at an all-time high this year.
• Ticks don’t usually transmit disease until 24 to 48 hours after attachment.
• Ticks often transmit multiple diseases simultaneously.
Diagnosis is tricky and complicated.
• 50% or more of dogs living in Lyme disease endemic regions have positive titers (blood tests) but don’t show symptoms and so aren’t sick.
• Other tick-borne diseases can cause positive titers also but, again, the dog doesn’t show symptoms and so isn’t sick.
• The most common indicators of tick-borne disease are nonspecific, such as lethargy, decreased appetite and gastrointestinal signs.
• There is no perfect test* for tick-borne diseases. A veterinarian should use a combination of historical information, physical examination findings, laboratory tests and how well a dog responds to treatment.
Jerry and I are extremely pro-active about ticks throughout the year but especially during spring and fall when they seem to be most prevalent. We’ve cobbled together our own protocol.
1. We regularly monitor dogs for ticks, which isn’t difficult because they are easily noticed by petting and stroking.
2. After time in the woods or fields, we check for ticks. We use a narrow-toothed comb that works well.
3. We vaccinate puppies with LymeVax by Pfizer (requires two shots the first year) and then administer an annual booster.
4. During spring and fall, we apply the topical Canine Advantix II every three weeks. This repels and kills black-legged ticks (deer tick), brown dog ticks, American dog ticks and lone star ticks. Active ingredients are imidacloprid, permethrin and pyriproxyfen. It is waterproof but the dog must be dry for 24 hours both before and after application.
5. During spring and fall, we put on a Preventic Tick Collar by Virbac. This aids in the prevention of Lyme disease, Rocky Mountain spotted fever and babesiosis. Active ingredient is Amitraz. We have one serious precaution—don’t allow a dog to ingest the collar. It only took one time for Jerry and me to learn our lesson. We had two young dogs kenneled together and one chewed the tick collar off the other. All we found was the metal buckle. She became very ill but after induced vomiting and several worrisome days, she survived.
Seresto is a new tick collar from Bayer, introduced in January 2013. This collar slowly releases a chemical that stays on the coat of the dog for the eight-month protection period. Upon the recommendation of our vet, we didn’t try it. He was uncomfortable with the possibility of the chemical’s exposure to people through petting and handling. We’ll revisit this option as more information becomes available.
Even with all the monitoring Jerry and I do and the precautions we take, several of our dogs have become ill with a tick-borne disease. If we notice tell-tale symptoms, we consult with our vet and usually administer the antibiotic doxycycline for 28 days. For puppies, we use amoxicillin. Generally, the symptoms disappear within one or two days and the dog is on the mend.
* Dr. Linda Kidd, Western University of Health Sciences College of Veterinary Medicine in Pomona, California, is leading a one-year research project. Among other issues, her study will determine if comprehensive testing, i.e., using both tests (serology and PCR) instead of the current protocol wherein vets usually test one sample using one test. Another possibility is to test more than one sample.
The two tests are:
Serology detects the presence of antibody, which is one product of the body’s immune response against a pathogen.
PCR (Polymerase Chain Reaction) screening detects the nucleic acid, the DNA, of the organism itself.
This broken stick was embedded deep in the back of the mouth and into neck tissue of Northwoods Grits when he just a puppy. Our vet expertly removed the stick and Grits recovered perfectly.
The grouse woods are a tough place for a bird dog to work. Big, rotting logs and downed tree limbs are scattered everywhere. Young aspen cuttings and stands of hazel are tight and can be almost impenetrable and swamp edges can be thick with alders. Dogs must be nimble and be able to react quickly for they are constantly jumping over, ducking under and pushing through some sort of obstacle. Other hunting cover types such as field edges, wide open deserts and mowed pine plantations seem tame in comparison.
Grouse dogs have to make their own way in the woods and in addition to being physically demanding, it’s often hazardous.
Our dogs have run into plenty—from mere scrapes and bangs to some very serious situations—but (knock on wood), Betsy and I have yet to lose a dog. Listed below, in alphabetical order, are the hazards we’ve encountered and what we do. Our advice is based on years of experience and guidance from our veterinarians, so much so that we’re now able to handle many of the problems ourselves. When in doubt, though, please go to a vet and go quickly. Often, time is of the essence.
All manner of seeds–some even quite long–can enter a dog’s eye and cause problems.
Seeds and other debris often get in the corners of the eyes and sometimes under the eyelids. One of the worst culprits is a long, black seed that can get under the third eyelid and cause serious abrasion.
What we do: After each session, we rinse the eyes with sterile eye wash. A dampened Q-tip can be carefully run along the inside bottom of the eye to remove stubborn debris. If a dog develops matter in its eyes or reddened lower lids, we apply Terramycin (non-steroidal, antibiotic ophthalmic ointment) twice a day for 3-5 days.
If a dog paws at its eye or keeps the eye partially closed, something more serious is usually going on. Get the dog to the vet as soon as possible.
Warning: Never apply steroidal eye ointment on a dog’s eye without consulting a vet.
Eyes: fur worn off underneath
Certain, hard-driving dogs that would rather go through things than around are prone to wearing off the fur under their eyes. A secondary problem occurs when the area bloodies and scabs over.
What we do: Vaseline applied carefully (avoid the eyes) works fairly well for protection but usually the problem recurs especially if early in the season. Pace the dog’s time in the woods.
Occasionally, debris, seeds or sticks can actually scratch the cornea.
What we do: Some are small enough to heal themselves with assistance from Terramycin (non-steroidal, antibiotic ophthalmic ointment) applied twice a day for 3-5 days. But if the dog paws at its eye or keeps the eye partially closed, get the dog to a vet as soon as possible.
Warning: Never apply steroidal eye ointment on a dog’s eye without consulting a vet.
The damage to the right eye of Northwoods Rob Roy was caused by an infection that entered through a small scratch. The spot should slowly shrink so it’s barely noticeable.
Eyes: weird bacterial infection
Last fall, our six-month-old setter puppy Northwoods Rob Roy received what everyone thought was a simple scratch on his eye while hunting in north central Wisconsin. But some sort of bacteria entered the eye via the scratch and, within 24 hours, the situation grew very serious. An infection developed that basically ate away the eyeball until his eye was in danger of bursting. With hourly applications of antibiotic drops and miraculous assistance from Chris Bye and Dan Stadin, we kept Roy quiet until our vet performed a complicated corneal graft surgery. The surgery was successful but Roy is still on eye drops and will always have a small, grayish spot on his cornea.
Lesson learned: Be extremely vigilant of seemingly minor injuries.
Randy got an mouthful of porcupine quills.
Betsy and I have been fortunate to have few problems with porcupines but I’ve seen bad ones. Sometimes a dog (usually males…pointer males are the worst) will actually hunt for porcupines. A lot depends on the dog’s temperament and its first encounter. If the result is just a few quills, it usually doesn’t develop into an issue. But if the dog gets a mouthful because it’s trying to kill the porcupine, the problem can be life-long.
What we do: For just a few quills and a cooperative dog, remove the quills with a Leatherman tool or hemostat. Be careful to get them all and don’t break any. Quills left in the dog can migrate around the body and exit through the neck, jaw and eyes. If in doubt, get the dog to a vet to check for remaining quills. For a bad encounter, get the dog to a vet.
Scrapes: belly and inner thighs
Grasses, ferns and thorns can scrape the belly and inner thigh area and sometimes cause a secondary problem of small pustules. This is more common on certain breeds (pointers) and under certain conditions (early season or open fields and meadows).
What we do: Apply Bacitracin (first aid antibiotic ointment) and rest the dog.
Scrapes: knuckles and forelegs
Gear on the neck—whether ecollars, tracking collars, beepers, bells or Garmins— can hang too low, be too big or be too much. It can also be a matter of mechanics, i.e., a dog that runs with a low head and/or raises its front legs.
What we do: Make adjustments to the neck gear. Try switching from a bell to a beeper, place the bell on top of the neck and/or have the gear ride higher on the neck. Or use less gear.
Grasses, ferns and thorns can abrade fur and/or scrape legs. Foreleg (where the legs meet the chest) abrasion is caused by running through tall grass. Again, both are more common on certain breeds (pointers) and under certain conditions (early season or open fields and meadows).
What we do: Apply Bacitacin (first aid antibiotic ointment) and rest the dog.
The wrists are the part of the leg above and behind the pad. Abrasions and scrapes to this area are caused by woody stubs, thick brush, etc.
What we do: Apply Bacitracin (first aid antibiotic ointment) or EMT gel and rest the dog.
Some grass seeds can be ingested through the mouth as the dog pants or enter the body through the skin. The most dangerous seeds have small barbs that allow them to penetrate farther as muscles and skin contract. These seeds can become encapsulated near the skin surface and cause localized swelling, or worse, can migrate into the body cavity.
What we do: Be vigilant about masses near surface, especially at the end of the rib cage. All of our dogs that developed such a mass required a trip to the vet.
Sticks and other foreign stuff
Betsy and I have had several dogs get a puncture-type wound in the pad, foot and ankle area from sticks and stiff weeds. Dogs can also drive stuff into other body parts, such as mouth, nose, neck, throat and chest. While these are rarely life threatening, I’ve had two very close calls.
One of my first setters, Patch, got a stick in his neck. When I pulled the stick out, blood immediately gushed out. So I stuck my finger over the hole and hurried to a vet.
More recently, Northwoods Grits somehow got a five-inch stick embedded deep in his mouth and into his neck. I couldn’t see anything at first but when I checked later in the evening, he was definitely not feeling well. Wayne, a physician/friend/guiding client, felt what turned out to be the end of stick. We rushed him to the vet. Amazingly, no surgery was required; the vet simply sedated Grits and pulled the stick out.
What we do: All but the most obvious of these injuries will require a trip to the vet.
One ingenious method to protect a broken tail is an empty plastic syringe case.
Broken tails are an uncommon occurrence. The break usually occurs about ¼ to 1/3 from the tip and results in a slightly bend at the break. The fracture can be felt by very gently palpating the bent area.
What we do: While some breaks heal on their own with no long-term problems, we advise a trip to the vet. Our vets have successfully set severe breaks. One ingenuously covered the broken area with an empty syringe case. The difficult part is keeping the tail relatively quiet for 4 – 6 weeks.
Tails: fur worn off, bloody
Some breeds (pointers) and some dogs (very active tail…carried just so) are prone to wearing the fur off the tip of the tail. Eventually the skin becomes thin and the tail bleeds.
What we do: This is a tough one. Apply EMT gel for protection before heading into the woods. To help heal the area after hunting, apply more EMT gel. We’ve tried several methods of taping—all with limited success because tails move so much. Dave Hughes, pro grouse dog trainer, developed a method that worked fairly well for later in the season and/or if the tail was in bad shape. From the tip to just above the base, wrap loosely with masking tape. Then wind electrical tape in a candy-cane design over the masking tape. Be very careful when taping so there’s not too much weight or the tape isn’t too tight.
An entire post could be devoted to this subject as it is complicated and generally in flux as new discoveries are made. Here is the pertinent information…currently.
Lyme disease (caused by bacteria Borrelia burgdorferi sensu lato), ehrlichisos (caused by bacteria in the genera Erlichia), anaplasmosis (caused by bacteria in the genera Anaplasma ; very confusing taxonomy between Erlichia and Anaplasma with continual changes by the scientific community), babesiosis (caused by protozoa Babesia microti) and other tick borne diseases yet to be identified are a major problem in certain parts of the country.
One fall, several dogs in our kennel become symptomatic but nothing could be identified (even by Marshfield Labs!). Common signs of the diseases are lameness in one or more legs caused by joint pain or muscle pain, high fever (often over 104), intermittent elevated fever, loss of appetite and, depending on the specific disease, nausea and vomiting.
What we do: We administer the antibiotic doxycycline for 30 days. Within a day or two, the symptoms disappear. If a dog is under nine months of age, consult a vet about the correct antibiotic to use since doxycycline can cause problems with teeth in puppies.
Torn dew claws
Betsy and I think this is an extremely uncommon and overrated problem. In fact, for many reasons, we don’t remove dew claws on tiny puppies anymore. We’ve had less than a handful of these injuries and none was serious.
What we do: Clip off any remaining part of the nail and disinfect daily Bacitracin (first aid antibiotic ointment). Rest the dog for a day or two.
Accidents do happen—to people and to pets. At the very least they can be painful, expensive and disruptive to daily life. At their worst (ask Joe Mauer or Tom Brady) they can eliminate a star athlete from the roster for an entire season.
For a grouse hunter, the equivalent loss is an accident that removes a promising young dog from his string.
Monday, July 30 was a quintessential summer day in Minnesota—blue skies, bright sun and a slight breeze. Jerry was up early and out of the house to exercise a group of dogs from the four-wheeler. Some he would free-run; others would be harnessed to bars and roaded. Not one hour later, Jerry rushed back into the house, his face ashen and anxious. He exclaimed, “Carly is hurt!”
An accident had broken all four metatarsal bones in Carly’s rear right foot. The breaks were clean but severe. Pins were inserted into the two larger middle bones and the leg was encased in a hard cast. Stern rules were issued about no exercise. Only short walks on short leads to relieve herself would be allowed. She would have to be confined to the house and, for a good part of each day, a crate.
Northwoods Carly Simon was whelped in 2011 out of Blue Shaquille and Houston’s Belle’s Choice. (That was the year of naming puppies after rock stars and Bob, her owner, chose Carly Simon. The name fits her perfectly.) She had been stellar last fall as a puppy and had shown incredible talent earlier this year in Tennessee on bobwhite quail. Her pain and loss were keenly felt.
Throughout this ordeal, Carly has made the best of each challenge. She adapted effortlessly to her new routine and seemed, in fact, to gain confidence and strength. She stands stoically while we put on her big plastic bonnet. She was easy to house-break and, in fact, never had an accident. She even loves swallowing the endless rounds of antibiotics when hidden in small slices of wieners.
She has tolerated everything she’s had to endure not only with calmness but, judging by her tail, with happiness.
Some two months later, Carly is now on the home stretch. The pins have been removed and the hard cast has been replaced by a soft cast with a metal support. Soon even that will come off and we’ll begin exercise and rehabilitation.
The timing should be good. Carly will be ready to get into the grouse woods for some of that excellent, late-season hunting.
Even though the cupboard in our kennel office has shelves full of pills, bottles, solutions and salves, Jerry keeps his traveling first aid kit to about two dozen supplies. Whether he’s training, hunting or guiding, this red box (a fishing tackle box) is always handy. Over the years, Jerry has performed countless field dressing and stapling jobs which, not only help the dog in need, but speed recovery and reduce long-term complications.
Listed below are the general supplies and the field supplies Jerry considers essential for his traveling first aid kit.
- Amoxicillin: general antibiotic
- Benadryl: allergic reactions
- Buffered aspirin: pain
- Duct tape (of course!)
- Metronidazole: giardia
- Pepto Bismol: diarrhea
- Rimadyl: anti-inflammatory (by vet prescription only)
- Betadine: liquid disinfectant
- Dog Booties: protect pads
- EMT Gel: use on cuts, tips of tails
- Eye wash (sterile): flushes out seeds and other debris
- Nutri-cal: quick supplement for low blood sugar, weakness
- Triple antibiotic ointment: prevents infection and provides temporary pain relief due to cuts, scraps and burns
- Triple antibiotic ophthalmic ointment (non-steroidal): works for minor eye irritations but not scratches
- Tuf-Foot: heals and toughens pads
- Vet wrap
Many of the supplies are the same that people use and so are easily purchased. We also buy certain supplies from our vet, including the prescription-only Rimadyl. Otherwise, we order from catalogs such as Lambert Vet Supply and Lion Country Supply.
The weather doesn’t feel much like fall right now but come August, I’m dreaming about upcoming hunting plans and trips. Now is the time to prepare both you and your dog. You can have the best hunting spots and the nicest shotgun, but plans can quickly go awry if your dog isn’t ready.
Here are four things to do now to get everything in shape.
1. Check your dog’s weight.
This is absolutely crucial, not only during hunting season but for the dog’s all-around good health. An overweight dog can’t perform its best in the field and could get in trouble with overexertion, especially in extreme heat. A crash diet isn’t the best answer. Rather reduce your dog’s weight slowly. (See our entry titled “Feeding For Ideal Body Condition” for more information.)
2. Make sure your dog is in good health.
Lingering parasites and bacteria that don’t cause problems normally could become issues when your dog is stressed. Betsy and I have had had Lyme’s disease occur many months after a tick bite. It also might be a good idea to get a stool sample checked by your vet for giardia, coccidia and worms.
3. Get your dog in shape.
It takes a good 6 – 8 weeks of regular exercise to get a dog in top-notch shape. Start slowly with moderate exercise and progress to more strenuous routines as the dog improves. Conditioning your dog in the cooler part of the day will provide the most benefit.
4. Make time for training sessions.
Schedule training sessions to tune-up your dog on obedience and bird work. Expect your dog to be a little rusty. Don’t try to get all the training done in one or two sessions. Short sessions spread over a period of time will give the best results—and keep your dog happy and motivated, too!
Make sure your dog gear is in good working order. Check that your ecollar batteries still hold a charge. Better yet, technology improves all the time and perhaps it’s time to upgrade to newer equipment. Buy now and you’ll still have time to learn how it operates. | <urn:uuid:b12a11c8-9fc2-427c-8654-62e45f282081> | CC-MAIN-2017-17 | http://northwoodsbirddogs.com/category/42-Dog-Care/ | 2017-05-01T00:29:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917126237.56/warc/CC-MAIN-20170423031206-00225-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.952181 | 8,280 |
This blog is devoted to evaluating vulnerable Democratic candidates, political news, law and current affairs. Author is a Political consultant specializing in opposition research for conservative candidates, attorneys and PACS at the local, state, and federal level.
“The Constitution is not an instrument for the government to restrain the people, it is an instrument for the people to restrain the government - lest it come to dominate our lives and interests.”
― Patrick Henry
On Political Risk & Terrorism, U.S. Riskier Than Botswana
The Middle East and major oil producing nations in that part of the world remain the worst places for terrorism on Earth. But when it comes to political risk and social unrest, the United States isn’t much better than Botswana, says risk management consulting firm Aon Plc of the U.K.
When it comes to civilian unrest and the likelihood of being injurred in a terrorist attack, the United States still ranks as one of the safest around, but not as safe as — believe it or not — Botswana. Even Namibia is considered safer in terms of political risk, civilian unrest and acts of terrorism. So saysthe latest political risk map by U.K. based Aon Plc, a risk management firm.
Businesses often use political risk in assessing whether or not to invest in a country. On a scale from 1 to 5, with 5 being the most risky, the U.S ranks like most of Western Europe, at No. 2. While that number is low, it is not as safe as other countries, namely Japan, Australia, New Zealand, Denmark, Switzerland and Finland. | <urn:uuid:d73f465b-1503-46a2-8afd-876c06f0fff8> | CC-MAIN-2020-24 | http://politicalrisktoday.blogspot.com/2013/05/on-political-risk-terrorism-us-riskier.html | 2020-06-07T10:58:12Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-24/segments/1590348526471.98/warc/CC-MAIN-20200607075929-20200607105929-00400.warc.gz | en | 0.946641 | 335 |
The skin and bones of long-dead tigers from the days of the British Raj have helped reveal how the latest threat to the endangered species is their own DNA.
Taking DNA samples from game hunters' trophies in the Natural History Museum and National Museum of Scotland’s collections, researchers compared these with samples from modern tigers. They found that genetic diversity among the remaining Indian tigers may be low enough to make the population unviable.
The tiger population has dropped precipitously from around 40,000 in 1850 to fewer than 2,000 today, and as their numbers and habitat have shrunk, so has their choice of mating partners. The findings will come as a blow to the Indian government, whose conservationists believe that several years of rising numbers suggest the species has been saved from extinction.
The study, conducted by Samrat Mondol and Uma Ramakrishnan from the National Centre for Biological Sciences in Bangalore and Professor Michael W. Bruford from Cardiff University, was published in the Proceedings of the Royal Society B yesterday.
Bruford said, “The results were staggering. We found 93% of the DNA genetic variants we measured in the historical tigers are not found in modern tigers. This is a much bigger fall than we expected.”
For most mammal species, a population of more than 1,000 is a viable one. But Bruford explained it was more appropriate to think of them as pockets of much fewer numbers, as the tigers were spread thinly across the sub-continent.
The researchers divided the tigers they studied into two broad genotypes – those that live in the uplands of Nepal, Tibet and northern India, and those that live in the lush lowands of the south.
“If you look at modern tigers now, you’d assume they fell into two main genotypes. But when we overlaid them with historical populations, we realised that wasn’t the case at all – it’s just that all the intermediate populations have been exterminated,” Bruford explained.
“Not only have tigers lost a huge amount of genetic variation since the days of the Raj, they have also been partitioned. And because they cannot disperse around their habitat as they would normally, they are losing their genetic viability as a population even faster.”
Hunting by the British and by Indian and Mughal princes alongside rapid loss of habitat from agriculture and urbanisation is to blame for the tiger’s decline. Adding to their woes was that the biggest animals were taken by game hunters as trophies - removing the DNA of evolutionary winners from the genepool.
In the short term, Bruford said, the threat posed by poachers is still more concerning, but the declining quality of tiger genes was a long-term problem. “This won’t go away until wild spaces are managed coherently, with corridors to link up the habitats,“ he said. "When the Indian government measures its conversation success it needs to rely on more than just numbers.” | <urn:uuid:21e09c60-8b3d-45ad-a07c-c12ead940990> | CC-MAIN-2016-22 | http://theconversation.com/for-the-endangered-tiger-genetics-may-finish-what-the-raj-started-14327 | 2016-05-26T02:47:54Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-22/segments/1464049275437.19/warc/CC-MAIN-20160524002115-00198-ip-10-185-217-139.ec2.internal.warc.gz | en | 0.976299 | 620 |
Web 3.0 (or web3 as the kids call it) is one of those terms that always spurs debate. Most of us have heard something about it, though are not fully sure what it exactly stands for. On the other hand, there are those with a coherent point of view who will enthusiastically explain how it can revolutionize the web as we know it. However, they inevitably will be criticized by those who believe that it is a complete and utter fraud which will undoubtedly amount to nothing. In that regard, I found the recent tweetstorm involving Jack Dorsey, Elon Musk and others thought provoking.
But before we get in to it, let's shed some light on what Web 3.0 actually means, at least the minimal common ground most can agree upon:
The key concept behind Web 3.0 is decentralization. While Web 1.0 refers to the Internet in its origins, where most websites were a static source of information, Web 2.0 denotes the revolution that emanated from social networks empowering the people to create and share content at an unprecedented scale. While this sounds great on paper, in real life the web has become extremely centralized as most new markets underwent consolidation up to full control of new monopolies, i.e. the Big Techs, reaping the lion's share of the financial benefit. Therefore, Web 3.0 may be rightfully regarded as the reaction to that consolidation, providing not only a more equal platform, but one that is considered as more secure, scalable and providing enhanced user privacy. As blockchain, and especially cryptocurrency, have gained global momentum and are based on the same principles, it would be a no-brainer that they should be deeply intertwined, if not be the technological infrastructure of Web 3.0. Still, from this point on, things become more complicated.
2021 was an amazing year for blockchain - record breaking market cap valuations, DeFi booming, NFT emerging and so much more. Should these events and trends compound into Web 3.0? If so, how? Will it be led by decentralized autonomous organizations (DAOs)? How can self sovereign identity (SSI) be incorporated? The answers depend on who you ask.
Hence we reach the recent clash on Twitter. It started with Dorsey tweeting that Web 3.0 is promoted and owned by VCs, later replied by Chris Dixon, then replied by Elon Musk and on and on... You can guess where this further leads to.
As in so many aspects the Web 3.0 concept is so far from being fully-baked, I guess that the truth lies somewhere in between. Meaning that it is easy to be sceptical and negate the possibility of a decentralized internet (at least to some extent at some point), while in the meantime, the Big Techs, and other stakeholders, will surely maximize their levers to maintain their power positions whether it is in current Web 2.0 or a "new" Web 3.0. Whichever you believe is more likely, I see the following open questions for the most interesting for discussion:
Can it really happen? - I believe that at this day and age, living through the Internet (particularly mobile) revolution, it would be difficult even for the strictest conservative mind to rule out the possibility of any kind of new technology, let alone the evolution of existing ones. Taking into account Bitcoin and past year's blockchain milestones, which in my opinion both are still far from maximizing their potential, I believe that Web 3.0 is a feasible option that may happen in the foreseeable future. Having said that, while the concept is inspiring in many aspects, it still requires a lot of work in order to formalize into an improved version of the current web as we know it. Let us not forget that there are many highly powerful actors who are very happy with the web as-is, and would not take it lightly if someone tried to move their cheese.
What would it take? - Assuming we successfully made our leap of faith towards the possibility of a Web 3.0 that fully decentralized, I guess that here is where things get complicated. Naturally, there are many technical aspects like which protocols should be deployed, new user interfaces etc. This should not be taken lightly as it will have major significance on how everything will work and look to provide us the optimized experience. Still, in my opinion, this is all of secondary importance compared to the major change of perception Web 3.0 would require from all of us. It took some time for (most?) users to realize that most of the so-called "free" services we get on the web, whether on search engines or social networks, bear a grave price, as user privacy is the currency. As Web 3.0 will be based on blockchain it will require deployment of electronic wallets through which users will interact, whether being compensated for data or content they share or pay for services they consume. It is impossible to know how things will change when users are required to pay $0.0000001 (just guessing...) for the next search, or $0.00001 for posting a new post on a favorite social network.
Who would be the prime beneficiaries? - As mentioned above, this new concept aims to provide a better Web that is more equal and secure, while providing better user privacy, through selectively sharing user information and microtransactions. Naturally, as the market becomes more competitive new service providers could gain substantial market shares and provide new alternatives, in a virtuous cycle. Yet, probably, the main beneficiaries would be us, the users. As previously indicated, users will have better control on their private data, especially what they share, who they share it with and what they get in return. After all, isn't that the primary reason to embark on this journey?
Web 3.0 is still a concept that is under heavy debate and depends on many factors before it can even come close to fulfilling the vision it is based on. It holds great promises for the individual, and raises questions as to the future of the Big Techs. Only time will tell if the vision of the Web 3.0 community will succeed. I hope it does. | <urn:uuid:3cacc842-6224-4ff7-9096-36ddc3e53ab0> | CC-MAIN-2022-21 | https://www.orbs.com/Web/ | 2022-05-18T02:29:45Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662521041.0/warc/CC-MAIN-20220518021247-20220518051247-00380.warc.gz | en | 0.958799 | 1,282 |
These Grilled Steak Kabobs are a must make during the summer! The simple, flavorful steak marinade takes these kabobs to the next level! Lots of fresh veggies are skewered with juicy, tender pieces of steak for a dinner the whole family will love! Grilling this weekend? Check out my famous chicken marinade, steak seasoning and steak marinade!
When summer hits, we hit the grill and we hit it hard. I’m grilling multiple times a week during the summer (and quite honestly, year-round thanks to the California sunshine) and these easy steak kabobs are a family favorite.
It’s one of those meals that you can prep in the morning and then throw on the grill when you’re ready to eat.
The steak needs to be marinated for a minimum of an hour so if you can get the steaks in the marinade that morning, do. This will ensure your steak is extra tender and flavorful when dinner time rolls around.
What Sides Go With Kabobs?
Nothing better than an all in one meal like these beef kabobs. Serve over rice or with a simple side salad and dinner is done. If you want to go all in for the best meal of the week, these sides go great are some of our favorites:
- Twice Baked Potato Casserole
- Creamy Cucumber Salad
- Twice Baked Potatoes
- Broccoli Salad with Bacon
- Homemade Cornbread
Best Steak for Kabobs
You’ll notice from my ingredients list below that I opted for top sirloin steak for these kabobs. The reason sirloin works so great is that it is a very lean cut of meat without a lot of fat so the cubes of steak won’t shrink that much while they are cooking. Other options would be New York strip or tri-tip.
Steak Kabob Marinade Ingredients
This easy beef kabob marinade has a lot of the same ingredients that you’ll find in my chicken marinade and for one simple reason – they work! Here’s what you’ll need for the marinade:
- balsamic vinegar
- soy sauce
- Worcestershire sauce
- extra virgin olive oil
- fresh rosemary – you can also use dried rosemary, just reduce the amount to 2 teaspoons
- Dijon mustard
- black pepper
- onion powder
Steak Kabob Ingredients
This is where it gets fun. There is no right or wrong answer when it comes to kabobs. You can skewer almost any veggie you want along with the steak and have a tasty beef kabob recipe. I’ll share here what I used:
- top sirloin
- red, yellow, orange bell peppers
- red onion
- olive oil
- salt and pepper to taste
Other options would be cherry tomatoes or quartered tomatoes, zucchini, other squash, or red potatoes that have been parboiled.
Tips for the Best Beef Kabobs
- Cut all veggies and pieces of meat roughly the same size. Aim for about 1 inch.
- Space your veggies and meat out on the skewer when grilling so the heat can circulate around the food and the skewers can cook evenly.
- Give your steak time to marinate. A minimum of 1 hour but the longer the better with a maximum of 8 hours.
- Use skewers that make turning your kabobs easy. Try double skewering if you are using wooden skewers or pick up some metal skewers like these.
- Using wood skewers? Give them a good soaking in water (1 hour +) prior to grilling to keep them from burning.
- Do NOT overcook the steak. It will be tough if you do.
Can I cook kabobs in the oven or on a grill pan? Absolutely. If using a grill pan, follow the recipe below. If cooking in the oven, bake at 425F for 10 to 15 minutes, flipping over halfway through. (Line your baking sheet with foil for easy cleanup.)
How should I store leftovers? Remove meat and veggies from the skewers and place in an airtight container in the fridge.
Can I use something other than top sirloin steak? Yes. Other options would be New York strip or tri-tip.
Can I use veggies other than mushrooms, onions, and pepper? Yes. Cherry tomatoes or quartered tomatoes, zucchini, other squash, or red potatoes that have been parboiled.
More Dinner Favorites
- The BEST Homemade Baked Mac and Cheese
- Chicken Stir Fry
- The Ultimate Chicken Fried Steak
- Baked Salmon with Honey Dijon Glaze
- The Best Tuna Casserole with Noodles
How To Make Steak Kabobs
Grilled Steak Kabobs
- ⅓ cup balsamic vinegar
- ¼ cup soy sauce
- 3 tablespoons Worcestershire sauce
- 2 tablespoons extra virgin olive oil
- 2 tablespoons fresh rosemary finely chopped, or 2 teaspoons dried rosemary
- 3 cloves garlic minced
- 2 teaspoons Dijon mustard
- 1 teaspoon black pepper
- ¼ teaspoon onion powder
- 1 pound top sirloin cut into 1 inch pieces
- 8 ounces mushrooms cleaned and halved
- 2 bell peppers different colors cleaned and cut into 1 inch pieces
- 1 large red onion cleaned and cut into 1 inch pieces
- 1 to 2 tablespoons extra virgin olive oil
- salt and pepper to taste
- chopped fresh parsley optional garnish
- In a small bowl or glass measuring cup, whisk together all ingredients for the marinade.
- Cut steak into pieces and transfer to a large ziploc bag.
- Pour the marinade over the steak and refrigerate for at least 1 hour and up to 8 hours.
- Remove the steak from the bag and discard the excess marinade.
- Heat grill to medium-high heat.
- Thread steak and vegetables seasoned with salt and pepper onto skewers alternating between different types of veggies and the steak.
- Place steak kabobs onto the hot grill and cook for 3 to 5 minutes per side, turning as needed to make sure all sides are evenly cooked.
- Remove from grill and serve immediately. | <urn:uuid:397f8f10-ecb5-499e-8886-731c9f1bf0d1> | CC-MAIN-2021-43 | https://www.momontimeout.com/steak-kabobs-recipe/ | 2021-10-26T19:21:10Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323587915.41/warc/CC-MAIN-20211026165817-20211026195817-00677.warc.gz | en | 0.851921 | 1,335 |
Poverty in Lebanon has drastically increased over the past year and now affects about 74% of the population, warned the UN Economic and Social Commission for Western Asia (ESCWA) on Friday.
According to the new policy brief “Multidimensional Poverty in Lebanon: Painful Reality and Uncertain Prospects”, 82% of the population lives in multidimensional poverty, which takes into account factors other than income, such as access to health, education and public utilities.
🛑 About 74% of Lebanon’s residents plunge into poverty❗— ESCWA (@UNESCWA) September 3, 2021
Taking into account access to health, education & public utilities, increases the rate to 82% of the population living in multidimensional poverty, warns a new policy brief issued #today by #ESCWA👉https://t.co/iaGyrwEbV6 pic.twitter.com/OThEolS9eX
In an earlier report, published one year ago, ESCWA found that between 2019 and 2020, the headcount poverty rate had already jumped from 28% to 55%. According to the last update, the multidimensional poverty rate in Lebanon has nearly doubled from 42% in 2019, to 82% in 2021.
Social solidarity fund
ESCWA Executive Secretary, Rola Dashti, repeated her call for the establishment of a social solidarity fund for the crisis-ridden country.
She recalled a proposal ESCWA put forward last year, asking for the richest 10 per cent in Lebanon, who held nearly $91 billion of wealth at the time, to fund the gap for poverty eradication by making annual contributions of 1% of their net wealth.
According to the study, combined shocks exposed the Lebanese pound exchange rate to “tremendous pressures”, causing currency depreciation. Between June 2019 and June 2021, inflation soared to 281%.
This has led to a significant decrease in the living standards of both Lebanese and non-Lebanese, and to rampant deprivation.
“Extreme multidimensional poverty”, affects 34% of the population today, exceeding half, in some areas of the country.
Healthcare, education and housing
Given that the unprecedented socioeconomic crisis afflicts all segments of society, population groups at the highest and lowest ends of the educational ladder, now have similar poverty rates.
The study also shows that the share of households deprived of healthcare increased to 33%, and the share of those unable to obtain medicines, has also increased to more than half.
For Ms. Dashti, “mitigating the impact of the crisis requires solidarity and cooperation between all segments of the Lebanese society.”
She urged the development of effective social protection schemes that are more responsive to the needs of the poor, especially the hardest hit, and the expansion of their scope to include those out of work.
According to ESCWA, the progress of development research and the availability of more detailed surveys expanded the concept of poverty, to include real living conditions, and factors unrelated to income.
This concept has been formalized into the “multidimensional poverty” scale, and is measured by six key dimensions: education, health, public utilities, housing, assets and property, and employment and income. | <urn:uuid:b72e661a-974e-4e42-b311-c92c2e9db5b0> | CC-MAIN-2021-39 | https://news.un.org/en/story/2021/09/1099102 | 2021-09-24T22:52:53Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780057580.39/warc/CC-MAIN-20210924201616-20210924231616-00005.warc.gz | en | 0.938277 | 675 |
Dad Took Son With Cerebral Palsy to Over a Thousand Metal Shows
A father who took his son with cerebral palsy to an estimated 1,200 metal shows also organized a metal festival to raise awareness about the disability that affects the young rocker named Mason.
That's how Richard McDeid came to host Mason MetalFest 2, the second benefit show assembled by the prolific concertgoer. But it all started with Mason's love of Metallica as a baby, according to The Dad. When the child couldn't be consoled, the sounds of the Bay Area thrash kings lulled him into wonderment.
"He would simply not stop, so I put him in his chair and turned on the Metallica Binge and Purge VHS tape," McDeid explained of the initial discovery that his son's cries were soothed by heavy metal.
"A few minutes later I was washing the dishes and noticed he'd stopped crying," he continued. "Afterward, it started happening in the car whenever Metallica was on. He would calm down and relax. At first, it was only Metallica and then grew to other bands as he learned to recognize them, he instantly responded and it grew from there."
The led to Mason experiencing his first concert in 2008, which was Rage Against the Machine, McDeid said. But when Mason's condition took a turn for the worse in 2017, the father wanted to do more to help.
Since March is Cerebral Palsy Awareness Month, that's when McDeid organized the first concert in honor of his son. As reported by KARE 11, the second benefit was held in Minneapolis March 8.
What other metal does Mason and his father enjoy? "It was Judas Priest … and AC/DC back in the day," he said. "Then Metallica came along. It's Mason's favorite. He's seen them eight times in the front row."
66 Most Important Moments in Metal History | <urn:uuid:58ee789b-c6c6-48a2-876d-2cf0ab09f382> | CC-MAIN-2020-24 | https://q1077.com/dad-son-1200-metal-shows/ | 2020-05-27T16:23:48Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-24/segments/1590347394756.31/warc/CC-MAIN-20200527141855-20200527171855-00326.warc.gz | en | 0.987288 | 407 |
TERRA PAVE INC. is an equal opportunity employer. We are always on the lookout for qualified individuals with construction experience eager to develop their skills and apply them as part of our team.
If you are interested, please click on the position listed below. Please indicate the position you are applying for, attach your resume, a cover letter or any additional information about yourself. Once we have received your email, we will email or call you back in regards to your inquiry within 48 hours.
Thank you for your interest in joining the Terra Pave team and best of luck. | <urn:uuid:5d314268-79ca-4772-85c7-29f3bafbc6ab> | CC-MAIN-2022-40 | https://www.terrapave.com/page/career-opportunities | 2022-09-25T23:07:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030334620.49/warc/CC-MAIN-20220925225000-20220926015000-00399.warc.gz | en | 0.949704 | 125 |
WASHINGTON – The US Senate, in an overwhelming majority vote of 94-3, confirmed President Barack Obama’s choice of five-term Senator John Kerry to be secretary of state.
Kerry will be replacing retiring Secretary of State Hillary Clinton. Both Republicans and Democrats praised Kerry as her ideal successor.
- Kerry: US will do what it must to prevent nuclear Iran
- Clinton: Elections open new avenues for peace
- John Kerry: Supports pro-Israel laws
The Senate vote followed a similar successful one by the Foreign Relations Committee, which unanimously approved Kerry for the roll.
No date has been set for Kerry’s swearing-in, though a welcoming ceremony is planned at the State Department on Monday.
"Senator Kerry will need no introduction to the world’s political and military leaders and will begin Day One fully conversant not only with the intricacies of US foreign policy, but able to act on a multitude of international stages," said Senator Bob Menendez, (D-NJ), who will succeed Kerry as committee chairman.
Senator Bob Corker of Tennessee, the panel’s top Republican, called Kerry "a realist" who will deal with unrest in Egypt, civil war in Syria, the threat of al-Qaeda-linked groups in Africa and Iran’s pursuit of nuclear weapons.
Kerry, a forceful proponent of climate change legislation, also will have a say in whether the United States moves ahead on the Keystone XL pipeline from Canada, a divisive issue that has roiled environmentalists.
Three Republicans voted against Kerry's nomination: Jim Inhofe of Oklahoma and John Cornyn and Ted Cruz of Texas. Absent from the vote were senators Patty Murray (D-Washington) and John Hoeven (R-ND).
- Receive Ynetnews updates
directly to your desktop | <urn:uuid:c49a7191-02be-4765-b4e5-82fa90d5016b> | CC-MAIN-2017-04 | http://www.ynetnews.com/articles/0,7340,L-4338832,00.html | 2017-01-24T01:25:35Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283475.86/warc/CC-MAIN-20170116095123-00354-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.92353 | 372 |
Cyber Monday is about to arrive, and with it, retailers and businesses that sell online will be putting their e-commerce technology to the test.
BusinessNewsDaily asked small business owners to tell us what their biggest e-commerce mistake has been. Here’s what they had to say:
Our biggest mistake: doing very little research up front on shopping carts or e-commerce in general. We could have saved frustration, site iterations and money by spending more time researching the e-commerce landscape up front and not diving right in.
-- Brett Brohl, scrubadoo.com
[My] biggest e-commerce mistake [was] not offering PayPal right away to customers. Approximately 30 percent of all online sale transactions are with PayPal.
-- Jim Bahcall, papershower.com
The most important feature is having a cart that you can work with. For me, I need a cart that allows me to alter any piece of code I want (so I can) create the functionality that I need. It can be a big drain if you need to hire someone every time you want to make a small change to your website .
-- Kevin Canning, PearlsOfJoy.com
[The most important feature in a shopping cart is] being able to capture [customers’] email for your database. Whether they end up purchasing or not you can continue to communicate with them and drive referred business even if they never did end up buying.
-- Sue Ennis, lamabra.com
The biggest mistake we have made is having too many of very similar products for customers to choose from. We have found that too many choices lead to no choice.
-- Marc Joseph, dollardays.com
Make sure you get someone to actually test and use your site and e-cart. No
matter how much it makes sense to you that the site is "logical" and
"user-friendly" -- it doesn't matter if someone else finds it complicated and tough to navigate.
-- Jimmy Tomczak, paper-feet.com
The most important element of a shopping cart (other than a big, fat "proceed to checkout" button, of course) --active areas to up sell. In our shopping cart drop down, we have callouts for free shipping as well as for reward points earned. These two callouts are actively pushing people to buy more so that they will be rewarded.
-- Phil Edelstein, twoleavesandabud.com
It's got to be easy for the consumer. The product copy should clearly and directly communicate the product features and benefits — what makes it fun.
-- Ann Schwartz, tinylove.com
The advice I would give to someone starting an e-commerce site would be to understand the behavior of shoppers on the web. I would also recommend that they sell something that can't easily be purchased at Amazon, or another competitor, and they find ways to add value to what they sell.
-- Joan McCoy, littleonebooks.com
[The most important feature in a shopping cart is] a shipping calculator. It will save you lots of phone calls and emails asking about shipping rates and the customer will appreciate that there are no surprises during checkout.
-- Blair Rhodes, thepashminastore.com
If I had to do it all over again, I would get the branding and the shop just how I wanted it so not to spend money on doing things over. Know the features you need and search for the shopping cart that will fit your needs.
-- Hilary Chandler, kidecals.com
Don't require your customers to create an account before checking out; every additional step you require will drive cart abandonment higher.
-- Stephen Antisdel, netnitrox.com
[My] biggest mistake was designing the site first and the cart last. The site was beautiful but the cart was not. I would start with a merchant cart software first next time and build the site around that, rather than the other way around.
-- Sarah M. Kauss, swellbottle.com
[My] biggest mistake is that due to time zones, [I] needed a 24/7 live support help desk. That was our biggest mistake — not having that live, real-time interactivity.
-- Mitch Goldstone, scanmyphotos.com
Have automated emails sent to customers/almost customers. We have an email that goes out a day after someone abandons a cart (provided they got far enough into the checkout process to enter their email address), addressed from our customer service manager, asking if they had any problems with the checkout, if they have any questions about our products, etc. We get a fair number of replies to these emails, and it can help save a sale and/or provide a personal touch-point with more information about why a customer didn't purchase.
--Stephanie Pakrul, fusiondrupalthemes.com
- Shopping-Cart Savvy Can Keep Customers From Bolting Mid-Buy
- How to Build Your Business Web Site
- How to Choose a Web Host | <urn:uuid:66e4c1e3-6bba-4207-a814-9697f4cf7110> | CC-MAIN-2017-30 | http://www.businessnewsdaily.com/425-small-business-ecommerce-lessons-learned.html | 2017-07-28T10:51:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549448198.69/warc/CC-MAIN-20170728103510-20170728123510-00312.warc.gz | en | 0.948851 | 1,054 |
Chewbacca Furry Shoulder Bag
Messenger bag flap looks like Chewbacca’s fur; Strap looks like his bandolier;Just add bowcaster and you’re good to go. $49.99
Subscribe now to our FREE newsletter!
Subscribe NOW to 7Gadgets weekly newsletter! You will receive the weekly selection of the best gadgets!
It is FUN, it is COOL, it is 7Gadgets newsletter! | <urn:uuid:9bbd6812-0900-4bdd-a5f8-9c29b9fe5d17> | CC-MAIN-2018-05 | http://www.7gadgets.com/2016/03/08/chewbacca-furry-shoulder-bag/122713 | 2018-01-21T00:34:52Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084889798.67/warc/CC-MAIN-20180121001412-20180121021412-00596.warc.gz | en | 0.854005 | 98 |
It's easy to identify rage in people who lose their temper at traffic jams, unruly children, unresponsive coworkers, and unrealistic bosses. But we may not recognize more subtle manifestations of anger, such as being uncomfortable with loose ends, acting impatiently, or being overly critical. That is anger, too. And, as is so often the case, angry folks don't seem to realize that the behavior causing them problems at home or at work actually stems from unrecognized and unresolved pain and emotional injuries from the past. Is all this negative emotion inevitable, or are there choices about how to respond, choices that can improve personal relationships as well as emotional health?
The Anger Trap is a landmark book that strips away the myths and misconceptions about anger and reveals how you can learn to distinguish between healthy and unhealthy anger so that you may choose or help someone else to choose a better, more spiritually enlightened path. The Anger Trap examines the root causes of anger and can help you realize your patterns and break the destructive cycles of criticism, frustration, and irritation that hurt you and others around you.
Drawing insight from timeless spiritual wisdom as well as cutting-edge research, Dr. Carter offers practical techniques to free you from anger, its hidden insecurities, fears, and selfishness and thereby improve the quality of your home and workplace life. The book clearly illustrates how the change process works and The Anger Trap is filled with real-life examples of the ways people have come to terms with their anger by applying the concepts Dr. Carter outlines.
We've sent an email with your order details. Order ID #:
To access this title, visit your library in the app or on the desktop website.
Ok, But No Actual Tools to Help
It was a good read as to 'why' you get angry and then spend the whole book to convince you not to get angry. It was appealing to your rational brain and rather than any emotional brain. I found no tools here at all to help when you are in a difficult spot to calm yourself down. So I was pleased with the 'psychology of anger', but not much actual useful help.
- Stephanie G
Simply the best anger management book | <urn:uuid:f32c6170-2480-4db3-854f-a0cc51a75164> | CC-MAIN-2017-04 | https://mobile.audible.com/pd/Self-Development/The-Anger-Trap-Audiobook/B008R0J9T8 | 2017-01-18T06:29:34Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280239.54/warc/CC-MAIN-20170116095120-00565-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.959117 | 443 |
Curtis D Ferriman
Dr. Curtis D Ferriman is an Optometry Specialist in Wellington, Ohio. He graduated with honors from Ohio State University - College Of Optometry in 1992. Having more than 25 years of diverse experiences, especially in OPTOMETRY, Dr. Curtis D Ferriman affiliates with no hospital, and cooperates with other doctors and specialists without joining any medical groups. Call Dr. Curtis D Ferriman on phone number (440) 647-2112 for more information and advises or to book an appointment.
|Full Name||Curtis D Ferriman|
|Experience||25+ years of diverse experiences|
|Sole Proprietor||Yes - He owns an unincorporated business by himself.|
|Accepts Medicare Assignment||He does accept the payment amount Medicare approves and not to bill you for more than the Medicare deductible and coinsurance.|
- Doctor of Optometry (OD)
Education & Training
- Dr. Curtis D Ferriman attended to Ohio State University - College Of Optometry and then graduated in 1992
- NPI #: 1083696108
- Enumeration Date: Nov 15th, 2005
- Last Update Date: Oct 31st, 2008
Quality ReportingParticipated programs include
- Medicare Electronic Health Record (EHR).
Dr. Curtis D Ferriman has been primarily specialised is Optometry for over 25 years.
|Specialization||License Number||Issued State|
|Eye and Vision Services Providers / Optometrist||4350/T256||Ohio|
Wellington, Ohio 44090-1300
Phone: (440) 647-2112
Fax: (440) 647-6135
- Monday - Friday: 8:00 AM - 5:00 PM
- Saturday - Sunday: Closed
This doctor profile was extracted from the dataset publicized on Jan 5th, 2017 by the Centers for Medicare and Medicaid Services (CMS) and from the corresponded NPI record updated on Oct 31st, 2008 on NPPES website. If you found out anything that is incorrect and want to change it, please follow this Update Data guide. | <urn:uuid:3121a8a9-550c-4087-9ebe-cc400e54a2cc> | CC-MAIN-2017-04 | http://www.healthcare4ppl.com/physician/ohio/wellington/curtis-d-ferriman-1083696108.html | 2017-01-19T21:49:04Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280746.40/warc/CC-MAIN-20170116095120-00040-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.862481 | 455 |
My sixth annual Girls Night In was actually an afternoon in this year. The idea is to stay in and donate the money you would have spent on a night out towards the fight against women’s cancers. It’s a cause close to my heart and I’m lucky to have family and friends so willing to contribute. And, of course, it’s a good excuse to get together and have fun! In the past, we’ve had dinner and played a game like Taboo or poker. This year, it was an afternoon of pink treats baked by me and shared between the eight of us.
Two of my guests are gluten-intolerant so I provided a selection of gluten-free treats as part of the spread. My aim with any gluten-free baking is to make something that everyone can enjoy, rather than a poor alternative to desserts with gluten. Sometimes I modify a recipe I have and other times I bake a treat that does not require flour of any kind. It’s easy to modify many recipes by using gluten-free flour mix instead of wheat flour. I’ve had good results with most recipes, especially the Hawaiian carrot cake I made back in July. This pink cake is from the same recipe I used for the rainbow cake in June; however, this time I used gluten-free flour mix and made three layers instead of six. Each layer baked for about 30 minutes. I had no real issues with the gluten-free flour; the taste and texture of the cake were comparable to one with gluten. To assemble the cake, I made a big batch of pink-tinted buttercream frosting. The cake held together well when sliced; popping it in the fridge for just a short while can help the frosting “set” and make it easier to cut.
The other gluten-free treat I baked was pink macarons. Most macaron recipes are gluten-free, as they call for almond meal, icing/confectioner’s sugar and egg whites, so I didn’t have to modify the recipe at all to make it gluten-free friendly. (Check your icing sugar is gluten-free, as the manufacturer may have blended it with something other than corn or tapioca starch.) I tried unsuccessfully to make macarons once before but I’m pleased to say this time went smoothly. Some leftover swiss meringue buttercream between the biscuits was the finishing touch. These were the most popular sweets on the table, I should have made twice as many to keep up with the demand!
The recipe for the chocolate cupcakes was the German chocolate cake recipe from the Baked Explorations cookbook. I used milk chocolate instead of dark and baked 36 cupcakes for about 25 minutes. This is definitely my favourite chocolate cake recipe to date, so expect to see it some more in Katie’s Kitchen. The frosting is swiss meringue buttercream piped on with an open-star tip. Remember to serve the buttercream at room temperature. Sweetapolita has some great tips to help you make this light and fluffy frosting.
My mission every October is to find the special edition pink-and-white M&Ms in stores. Last year I missed out, so this time I started looking early in the month. They are now sold exclusively in IGA stores in Australia, so that makes them a little hard to come across. I called five IGA stores before I found some in stock. Of course, I then raced over and bought a fairly restrained amount of four bags. Thirty cents from each packet goes to the McGrath Foundation. I just love colour-themed M&Ms in general! (I’ve already stocked up on the red and green Christmas packs.)
At the supermarket, I also picked up some tasty berry yoghurt coated rice cakes, as they are gluten-free and most importantly pink. Fresh strawberries, musk sticks, cheese, dip and crackers rounded out the afternoon’s snacks. Each guest went home with a goody bag of chocolates and a mini bottle of body lotion or body wash in sugary-sweet scents. As a result of the afternoon, the Cancer Council will receive a nice-sized donation from my family and me. Thank you to my grandmother, aunties and cousins for their generosity again this year. | <urn:uuid:7f3b1af5-791d-40ca-acbe-99af8c78f27b> | CC-MAIN-2020-45 | http://katieskitchenblog.com/tag/swiss-meringue-buttercream/ | 2020-10-24T00:41:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107881551.11/warc/CC-MAIN-20201023234043-20201024024043-00373.warc.gz | en | 0.967956 | 905 |
Today Jacqui from TickledPinkSims informed me that she had the Arezzo Bathroom Counter in her game. What's so special about this then? Well, she doesn't use CC (custom content) in her game. So this counter in her game shouldn't be there. Recently she installed a couple of Sims from the exchange though, something she usually doesn't do. And guess what, one (or more?) of those Sims contained the Arezzo Bathroom Counter. I am a bit like Jacqui in that sense. I feel like I don't need CC, except for the few items I have made myself. | <urn:uuid:a2cd0a4f-f516-4790-a03e-a3279dc946e7> | CC-MAIN-2014-41 | http://www.simsnetwork.com/tags/official-exchange?page=1 | 2014-09-15T09:27:45Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657104131.95/warc/CC-MAIN-20140914011144-00063-ip-10-196-40-205.us-west-1.compute.internal.warc.gz | en | 0.9862 | 127 |
We spend 78 hours on researching and comparing 39 of popular models to determine the Best Cometron 114Az Telescope 2020 you can buy. We will be continually updating this page as we launch new reviews. Once we’ve tested a sufficient number we’ll start to compile lists of the Top Rated Cometron 114Az Telescope.
Best Cometron 114Az Telescope 2020 – Top 10 Rated
2,525 Reviews Scanned
Last update on 2021-02-28 / Affiliate links / Images from Amazon Product Advertising API | <urn:uuid:ba6f156a-8068-4863-a9db-c405d144ac2b> | CC-MAIN-2021-17 | https://www.6to23.com/cometron-114az-telescope/ | 2021-04-10T11:09:23Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038056869.3/warc/CC-MAIN-20210410105831-20210410135831-00000.warc.gz | en | 0.763751 | 105 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.