text stringlengths 152 505k | id stringlengths 47 47 | dump stringclasses 95
values | url stringlengths 13 1.01k | date stringlengths 20 20 | file_path stringlengths 125 155 | language stringclasses 1
value | language_score float64 0.65 1 | token_count int64 40 127k |
|---|---|---|---|---|---|---|---|---|
CHECK IT OUT!! The 2016 Idaho Mountain Festival--Powered by Asana--is celebrating its 5th anniversary and is scheduled for Sept 22-25. Once again, we'll be hosting the even inside Castle Rocks State Park near Almo, ID and the notorious City of Rocks National Reserve.
Be sure to save the date on your calendar, persuade all your friends to attend with you, and prepare to come out and party with us. Only 350 spots are available at the festival this year. Online reservations will open in June. Plan on making your reservations early before we sellout...which happens every year.
Currently on the sponsor line-up, we've got Asana as our presenting sponsor, Edelweiss as our exclusive rope sponsor, La Sportiva as our exclusive shoe sponsor, Goal Zero as our power sponsor, and Camp Chef as our outdoor-kitchen sponsor. More sponsor announcements coming soon.
Photo by Micah Ness of Silverline Films | <urn:uuid:8b63e1f3-d028-4cbd-8668-e9dc6bd3166f> | CC-MAIN-2019-43 | http://www.seekouttheadventure.com/adventure/save-the-date-imf | 2019-10-14T15:21:27Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986653876.31/warc/CC-MAIN-20191014150930-20191014174430-00065.warc.gz | en | 0.953244 | 195 |
30 Jul, 2012 04:14PM
cupofjoe (edit) Topic created 11 months ago Edit Topic
Hey all, I’m happy to check out your API and dream about the possibility of mashups I can create. Looking around for some documentation… I’ll check back later.
Message edited by cupofjoe (edit) 10 months ago
Mike (edit) – 10 months ago Edit Post
Hey there cupofjoe, welcome to our Developer Network! Have you found what you’re looking for yet? If not, read our Getting Started post. That should help points you in the right direction. | <urn:uuid:53583b40-ce12-4f4c-97d3-027d2ca19cf3> | CC-MAIN-2017-17 | https://dev.sierratradingpost.com/forum/topics/looking-for-some-documentation | 2017-04-29T05:29:29Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123276.44/warc/CC-MAIN-20170423031203-00306-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.772828 | 133 |
The German Shepherd
WUSV Breed Standard
SV Show placings
Articles by Linda Shaw
Founding Breeders- First Sieger
At the beginning stood men of passion:
(L-R) Otto Weber, Schafmeister [sheep expert] from Saxony, his colleague Goyman, Rittmeister von Stephanitz, and Arnold, also a Schafmeister from Saxony.
Glancing through the first Breed Books of the organization formed by Stephanitz is as exciting as researching the ancestral records and genealogies of European royalty. We discover how an old breed gained a new look.
In the year 1900 dog people behaved much like today's politicians embroiled in campaigning with mud slinging and personal insults. The opponent's common sense and national pride came under attack in books, pamphlets, and at shows.
In his book "German Dogs" published in Munich the cynologist [gr. cyno= dog, logos= study; the study of canines] Richard Strebel lamented, "When will we Germans finally learn to value what we produce at home?" With respect to German Shepherd Dogs he envisioned a model borrowed from British Collie breeders.
He felt that there should be at least two separate breeds - one being the luxury model for urbanites and the upper classes, some of whom, in the form of minor royalty, owners of hunting estates, and retired sea captains, had already expressed an interest in such animals. The second breed should live in the country - with sheep herders and farmers. He thought it meaningful to suggest three "classes or sub-classes": wirehair, stock hair, and longhair.
These assessments were shared by the other great canine researcher of that time, Ludwig Beckman of Düsseldorf, a painter of hunting scenes and animals. The only difference between these two influential men was Beckman's categorical insistence that the three "classes" of dogs proposed by Strebel would have to be "separated into three completely different breeds ".
An entirely different decision was made by Max von Stephanitz, president of the "mightily blossoming Verein für Deutsche Schäferhunde (S.V.)" as noted rather tartly by Strebel in 1905.
The man "of legendary vision in matters of club politics" held the opinion that only one breed should be fashioned from suitable lines within the Reich.
This tribute, bestowed upon its founder by the SV, was amplified in 1969 with accolades still valid in our 100th anniversary year. "In those days the Rittmeister thrust open doors which lead to German and international study of dogs, studies which were then just germinating but sprouted under his tutelage to bloom into their first Spring." He chose the Herding Dog [Hütehund] of Württemberg and Thuringia-Saxony as foundation for the German Shepherd Dog breed.
In the Brenz valley in Württemberg were two breeding kennels of old standing: "v.d. Krone" in Heidenheim and "vom Brenztal" in Giengen. Saxony was the home of the HGH kennel "vom Klostermansfeld" [Monk's Field].
While a larger, stronger, more utilitarian dog was preferred in Württemberg the dogs of central Germany were of a slighter build. A combination of the two forms was soon achieved under the influence of the SV.
Entries in the early Breed Books focused largely on the external characteristics of the breed standard. Representative dogs from many well-known and unknown lines are listed with an emphasis on Herding Utility dogs deemed suitable for breeding. The kennel "von der Krone", owned by Anton Eiselen of Heidenheim, is shown most often in the first few volumes.
Hence, the pairing of SV dog No.1 "Horand von Grafrath" with different bitches from the Krone kennel founded many of the Horand lines. A closer look into those years is well worth it. As far back as 1900/01 Horand, winning First Place in Karslruhe in 1899, produced a Sieger who would become an significant influence in GSD breeding. This was his son "Hektor von Schwaben", SZ 13, out of an unknown bitch "Mores Plieningen", SZ 159 (owner Franz of Werra). "Hektor von Schwaben" was a medium tall, long bodied dog on a good trotting frame, noble in appearance. One of his sons out of "Flora I von Karlsruhe" became the 1903 Sieger: "Roland v. Park" (formerly "vom Goldsteintal"), SZ 245, a dog whose build, the "structural form", embodied the correct utility dog characteristics.
The club learns from experience
One of Hektor's sons was Beowulf, SZ 10, out of the Horand daughter "Thekla von der Krone". He sired "Heinz von Starkenburg" whose son, the 1906/07 Sieger "Roland von Starkenburg", SZ 1537, is well known to the GSD breeding community.
Roland was the product of very close inbreeding and although, in appearance, he was the most beautiful dog of that time, his temperament left much to be desired. Stephanitz blamed incorrect handling in his critical observation that the owner, Spielman, mollycoddled "his dear little Roland".
VA-Erich von Grafenwerth
Nonetheless, this dog frequently stood at stud because of his superior form. His top son was the 1909 Sieger "Hettel Uckermark", SZ 3897. Through his son "Alex v. Westfahlenheim" Hettel produced the 1920 Sieger, "Erich von Grafenwerth", PH, SZ 71141. It is unfortunate that this Sieger also inherited the temperament faults of his father and great-grandfather.
This after-the-fact realization brought an immediate response from the club: temperament testing at trials, shows, and breed surveys was tightened. Erich's top son "Klodo vom Boxberg", SZ 135239, took the Sieger title in 1925. Stephanitz chose a dog whose measurements represented the correct type of medium size. Previous Sieger titles had been given to dogs at the upper size limits. This was also true for his [Klodo's] son "Utz v. Haus Schütting", two-thirds inbred on "Erich v. Grafenwerth", the beauty winner. His breeder, Dr. Werner Funk of Hannover, had attempted to moderate the temperament faults of the paternal line by blending it with the sound temperament of the maternal Horst line.
The last Sieger in this succession was "Hussan vom Haus Schütting", ZPr., SZ 375476. The "Glockenbrink" line is an outcross leading back to "Erich v. Grafenwerth". Erich [v.Glockenbrink] was a dog of correct structure and temperament within the utility dog type. He became Sieger in 1926 and 1928.
Breeding progress continues to improve quality
One of the Horand lines, through "Graf Eberhard vom Hohen Esp", SZ 1135, produced the 1908 Sieger "Luchs vom Kalsmunt Wetzlar", SZ 3371. This line was continued through two Luchs sons, one of whom was "Wotan vom Emstal", SZ 6813, the 1910 Sieger in Dortmund. A sensation-causing 280 entries were recorded at this show! The Open Class alone had 72 males entered. Another branch of the Graf Eberhard line, through "Munko von Boll", led to "Horst von Boll", PH, SZ 8306.
"Horst von Boll" was most commonly used in his home region in Württenberg. The "vom Blasienberg" kennel, owned by Tobias Ott in Bietigheim, owes its well temperamented, solidly built, "dry" dogs to Horst. It is true that the various Horand lines were overused in those first decades of the breed. Max v. Stephanitz recognized the danger inherent in close line breeding and changed his breeding program to outcross with minimally related dogs who were healthy and hardy with an excellent temperament.
Like-minded breeders supported him in that they brought together utility dogs from distant branches of the diverse working lines and formed the highlines so advantageous to the breed. This was a significant contribution to the future development of the breed. It is worthwhile to examine the anatomical development of the German Shepherd Dog.
Initially the breed standard specified a height of 50-55 cm for females and 55-60cm for males. However, just a few years after commencing a goal-oriented breeding program these specifications could no longer be adhered to. The upper limits were raised to 55-60 cm for females and 60-65 cm for males.
While all of the early top dogs were of pleasing form it was now time to make structural improvements in the general GSD population. Massive heads with weak or "friendly" ears were rejected. Other characteristics unsuitable to the breed standard were poor tail carriage, angled and curved tails, and curled tips.
The perpetuation of such faults had to be carefully avoided in each breeding. That which didn't please was immediately apparent and that which pleased found quick and unanimous definition: noble heads with dark eyes, upright ears and saber-straight tails were to be the markings which characterized the animals of the SV.
The basic components to meet these goals had been present in the breed from its beginning. Herding work had defined it: its "structure" was, in general, acceptable. Its front was consistently well formed and only rarely did one find weak pasterns.
Occasionally the rear left something to be desired and still missing was good overall angulation, the proper positioning of joints. This was important because it produces the typical motion of the breed and was a prerequisite to achieve correct movement in German Shepherd Dogs.
Breeder diligence and knowledge brought about change
The first over-sized dogs were noted as far back as 1909. Dogs heavily used in breeding such as "Hettel Uckermark" and "Horst von Boll" exceeded the size limits. The taller dogs were also heavier which was detrimental to their overall agility. On the other end of the spectrum were the toe walkers, dogs with narrow, receding chests who no longer had any resemblance to the utility dog characteristics.
Breeding activities during the post-WW I inflationary period contributed to the increased numbers of these apparitions.
VA-Klodo vom Boxberg
At the 1925 Sieger show Stephanitz chose "Klodo vom Boxberg", an animal of only medium size, much to the consternation of owners who had entered the larger dogs. Thus he demonstrated to his club members how the typical German Shepherd Dog was expected to look.
The lesson was quickly learned. Overly large dogs were rarely seen in subsequent years and had not been admitted to breed surveys in some time.
During the '30s and '40s there repeatedly appeared under-sized animals which were to be "Mendeled out" — eliminated from the gene pool — with equal fervor. It was this very group of dogs which, as a rule, lacked substance and bone strength and had overly refined heads.
The club went to battle against what they felt was a degeneration in appearance and functionality and, not surprisingly, brought itself squarely into dissent with many breeders.
Stephanitz and his loyalists prevailed. They cautioned against breeding dogs who received show evaluations of a kind which diminished their appeal to the breeding program. That they were excluded from breed surveys was a given. Dogs with tooth- and testicular faults were dealt with in the same manner.
Yesterday's Truth still holds to this day: the breeding goal was, is, and always will be the "normal dog" defined by the breed standard.
Translation copyright 2000 by Eclectic Translations. The translator gratefully acknowledges historical research provided by Bits & Bytes GSD Pedigree Research. | <urn:uuid:32c78988-c6e5-4a2a-81a2-2343217b8bd2> | CC-MAIN-2016-36 | http://www.gsscc.ca/the-german-shepherd.aspx | 2016-08-30T22:27:34Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-36/segments/1471983026851.98/warc/CC-MAIN-20160823201026-00038-ip-10-153-172-175.ec2.internal.warc.gz | en | 0.963715 | 2,565 |
Okta enables users to securely access the applications they need, wherever and whenever they need them. Cloud app and mobile device adoption in the enterprise have created a world where people can work from anywhere, and enjoy incredible experiences that make them more productive. Employees are no longer sitting behind a proxy or firewall when they need this access. Organizations need a more modern approach to access control to ensure the security of their sensitive and proprietary information. They need a next-generation access management architecture centered on people and designed for the principle of a zero-trust network.
That architecture has to be aware of the device that the person is using. I often get asked about how or whether our Identity Management service supports these device aware access scenarios and how we integrate with Enterprise Mobility Management products in that context. This post elaborates a bit more on our answer to these questions.
Device Trust: A critical input for Contextual Access Management
As the traditional network-based perimeter erodes, device context is a critical input to ensuring that the right person has access to the right information, at the right time. Understanding the security profile of a device – i.e. that it’s encrypted, not jailbroken or rooted – adds a layer of trust that’s a fundamental input to a secure access decision.
As people within an organization access applications from a wide range of devices, operating systems and browsers, we need a device trust framework that provides broad application coverage, best of breed interoperability, a great user experience, and a simple user experience.
Over the past year Okta has released a series of device trust capabilities including:
Use of Exchange ActiveSync certificates to prevent unmanaged devices from accessing Office 365; and
Device trust for Windows to ensure that only users on managed, domain-joined Windows computers can seamlessly SSO into Okta protected apps, securing corporate data even when there is no defined network boundary.
Moving forward in 2018, we’ll be expanding the breadth and depth of our support for device trust. We will tap into these device trust signals through vendor specific integrations as well as some integration methods that are agnostic to any vendor. The result will give our customers a broad range of options to meet their requirements.
A Perfect Combination: Best of Breed Identity & Mobility Management
A big part of our device trust strategy is ensuring Okta integrates well with Enterprise Mobility management products. Together, our products provide a more powerful, secure solution to support the needs of our joint customers. These integrations allow us to optimize for end user experience and productivity, while also giving our joint admins a simple setup process. This best-of-breed approach gives our customers the broadest set of access controls over the devices and platforms they care about. It also enables enterprises to leverage their existing investments in Okta’s Identity Management and their Enterprise Mobility Management vendor of choice.
Here is how our partners at MobileIron and Jamf are describing our collaboration:
“Organizations are working to address security vulnerabilities, ward off cyber threats and protect intellectual property. Jamf and Okta are tightly integrating our services to provide a people-friendly, secure experience that ensures the right people have access to the right data at the right time on any Apple device.” - Joe Bloom, Product Manager, Jamf
“Cloud services are a mandate for many organizations but companies are losing data every day to unauthorized devices and apps. Okta and MobileIron are partnering closely to provide our joint customers with contextual access policies that secure access to apps, data and devices.” - Ojas Rege, Chief Strategy Officer, MobileIron
Our rollout of these integrations will begin in early 2018, and we’ll share supporting documentation as those are released. Feel free to reach out to your Okta representative if you’d like more information in the interim, or if you are an Okta customer and are interested in participating in our iOS or upcoming Android device trust beta, please sign up here. | <urn:uuid:4c86cb3e-47ac-4588-b5a7-c1044b56d113> | CC-MAIN-2018-09 | https://www.okta.com/blog/2018/01/device-aware-access/ | 2018-02-24T10:17:59Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891815544.79/warc/CC-MAIN-20180224092906-20180224112906-00554.warc.gz | en | 0.921884 | 811 |
One of the best features about the Internet is the
ability to Shop at Home. It allows you to compare prices, services and even make the final purchase
without ever leaving your computer chair. On this page we have listed many of the places you can shop
online. The Holiday season is here once again
and it's time to start thinking about purchasing gifts for your
loved ones. In most cases, purchasing products online is no different then purchasing them over a
telephone from a catalog. Visit our "Safety Guide for Online Shopping"
Here are a few simple things to consider before making that online purchase:
When ordering online, make sure you have entered a "Secure Server"
before entering in your credit card number.
The MS Explorer will show a "closed lock"
at the bottom of the browser when on a secure site and the Netscape
browser will show a "solid key" at the bottom.
Before ordering a product, make sure the company you are ordering from is legitimate. Browse the rest of their
web site first and make sure they have a way of contacting them either through a telephone number, fax and/or a
Always remember what you ordered,
how much it was and who you ordered it from. Print out the online
and/or email "Order Confirmations" you receive when ordering and compare them to you credit card statement when you receive it.
By following these few simple rules, you can have a safe enjoyable experience shopping online.
(Back to the Stores)
As time goes on, we will be adding new links to
this page. If you know of a link that should be added to this page, please send your suggestion by email to
webmaster @ wzrd.com.
graphics and content on this web site are copyrighted by Wizard Communication
Wizard Communication Systems, Inc.
2 Main Street
Tonawanda, N.Y. 14150 | <urn:uuid:c70e46d5-0fa4-4c60-b357-5d1554486a0b> | CC-MAIN-2017-17 | http://www.wzrd.com/shopping/shopping.html | 2017-04-29T05:21:27Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123276.44/warc/CC-MAIN-20170423031203-00591-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.9145 | 398 |
KinoSearch1::Store::RAMInvIndex - in-memory InvIndex
my $invindex = KinoSearch1::Store::RAMInvIndex->new( path => '/path/to/invindex', ); # or... my $invindex = KinoSearch1::Store::RAMInvIndex->new;
RAMInvIndex is an entirely in-memory implementation of KinoSearch1::Store::InvIndex. It serves two main purposes.
First, it's possible to load an existing FSInvIndex into memory, which can improve search-speed -- if you have that kind of RAM to spare. Needless to say, any FSInvIndex you try to load this way should be appropriately modest in size.
Second, RAMInvIndex is handy for testing and development.
Create a RAMInvIndex object.
new takes one optional parameter,
path is supplied, KinoSearch1 will try to read an FSInvIndex at that location into memory.
Copyright 2005-2010 Marvin Humphrey
LICENSE, DISCLAIMER, BUGS, etc.
See KinoSearch1 version 1.01. | <urn:uuid:688c33af-9022-4bb1-b837-feead4097b8d> | CC-MAIN-2016-18 | https://metacpan.org/pod/KinoSearch1::Store::RAMInvIndex | 2016-05-03T09:41:31Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860121090.75/warc/CC-MAIN-20160428161521-00000-ip-10-239-7-51.ec2.internal.warc.gz | en | 0.732862 | 234 |
The Viento-G Thermal Camera is an easy-to-use feature packed thermal imager designed for a wide range of thermal applications. The camera provides uncompressed digital data through the Gig-E Vision® interface. One-click setup is fast and simple for an easy out-of-the-box experience.
Available in several form factors and resolutions and with a variety of lenses, the Viento-G is ideal for custom OEM applications. The Viento-G excels where a high reliability, high resolution, and low-cost thermal imager is required.
The camera is available in two form factors, enclosed and split board, and each form factor can use either the 320 x 240 or 640 x 480 resolution detectors.
- High Resolution
- Uncompressed digital video output
- 8-bit and 16-bit digital video options
- Network Enabled
- Power, Control, and Video over a single cable (Ethernet)
- Wide array of lens options
- 2-year warranty
- Compact and Low Power
- Easy Export Models Available
- Included: PoE (power-over-ethernet) injector, Viento-G UI software, developer’s documentation | <urn:uuid:43f9bd7e-6a2f-40a3-a4fd-37beaff53c8a> | CC-MAIN-2020-05 | https://www.sierraolympic.com/products/details/viento-g | 2020-01-18T11:17:28Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250592565.2/warc/CC-MAIN-20200118110141-20200118134141-00381.warc.gz | en | 0.824662 | 253 |
Bharat Book Bureau Provides the Trending Market Research Report on “2012-2023 Global Apple Juice Market Research Report by Manufacturers, Regions, Types and Applications” under Food & Beverage category. The report offers a collection of superior market research, market analysis, competitive intelligence and industry reports.
The report provides an in-depth analysis of the Global Apple Juice Market. It presents the latest data of the market value, consumption, domestic production, exports and imports, price dynamics and food balance.
Geographically, this report is segmented into several key Regions, with production, consumption, revenue (million USD), market share and growth rate of Apple Juice in these regions, from 2012 to 2023 (forecast), covering
- North America
- Southeast Asia
Request a free sample copy of Apple Juice Market Report @ https://www.bharatbook.com/MarketReports/Sample/Reports/1198602
Global Apple Juice market competition by top manufacturers, with production, price, revenue (value) and market share for each manufacturer; the top players including
- Martinelli’s Gold Medal
- Simply Orange Juice
- Eden Foods
- Manzana Products
- Santa Cruz
- Minute Maid (Coca-Cola)
- James White Drinks
On the basis of product, this report displays the production, revenue, price, market share and growth rate of each type, primarily split into
- Unfiltered Apple Juice
- Filtered Apple Juice
On the basis on the end users/applications, this report focuses on the status and outlook for major applications/end users, consumption (sales), market share and growth rate of Apple Juice for each application, including
- Home Use
If you have any special requirements, please let us know and we will offer you the report as you want.
Browse our full report with Table of Contents : https://www.bharatbook.com/MarketReports/2012-2023-Global-Apple-Juice-Market-Research-Report-by-Manufacturers-Regions-Types-and-Applications/1198602
About Bharat Book Bureau:
Bharat Book is Your One-Stop-Shop with an exhaustive coverage of 4,80,000 reports and insights that includes latest Market Study, Industry Trends & Analysis, Forecasts & Customized Intelligence, Newsletters and Online Databases. Overall a comprehensive coverage of major industries with a further segmentation of 100+ subsectors.
Contact us at:
Bharat Book Bureau
Tel: +91 22 27810772 / 27810773 | <urn:uuid:102b4588-5eef-449c-b4ae-3fca946c1da9> | CC-MAIN-2019-18 | https://area-info.net/global-apple-juice-market-industry-analysis-size-share-growth-trends-and-forecast-2012-2023/ | 2019-04-23T01:02:43Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578583000.29/warc/CC-MAIN-20190422235159-20190423021159-00286.warc.gz | en | 0.845821 | 538 |
GIMP Your Photos
GIMP is an acronym for GNU Image Manipulation Program. Now, I now what you're thinking..."huh?". I had the same reponse, and I'll admit I had to look up the meaning of GNU (a computer operating system comprised entirely of free software). Basically, this means that GIMP, despite it's rather unfortunate name, is a super-duper, Photoshop like, photo editing software that is completely free. That's right, free!
The program does require a quick download to your computer, and it offers many of the same capapabilities of Photoshop to create dynamic, layered images, without the large price tag. Now, is it going to do everything Photoshop can do? No, but if you're interested in more advanced photo editing, this is a great free tool to start with before moving on to the big ticket programs.
Now, despite how great GIMP can be for budding visual artists, it is not the easiest program to learn. There is a very brief online manual available. I would even suggest checking out a few books about Photoshop, since several of the functions availabe in GIMP mirror those in Photoshop.
Now, go forth and photo edit! | <urn:uuid:0c79ddea-bfba-4285-922b-bb6d1f741a48> | CC-MAIN-2015-06 | http://www.hcpl.net/content/gimp-your-photos | 2015-01-31T03:57:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422118888119.65/warc/CC-MAIN-20150124170128-00029-ip-10-180-212-252.ec2.internal.warc.gz | en | 0.953871 | 253 |
Jing Ulrich is someone who knows the future when it comes to
regulatory changes in China.
The People’s Bank of China may cut reserve ratio levels for
major banks on three more occasions this year after reductions
in December and February, Ulrich said. Property prices and real
estate transaction volumes will begin to improve in the second
half of the year, she said.
China is keeping in place measures aimed at reining in property
prices as the government targets slower economic growth and
attempts to replace exports with domestic demand as the main
driver of expansion. Premier Wen Jiabao in his report to the
National People’s Congress this week said that regulation of the
real estate market is at a “crucial stage.”
Ulrich said she is cautiously optimistic about the outlook for the
country’s property market. High inventories may put pressure on
cement and steel companies and she is concerned about construction
stocks, she said. | <urn:uuid:74248cb1-1f45-48e8-ae4c-59470fb7f738> | CC-MAIN-2017-26 | http://www.thechinamoneyreport.com/2012/03/07/ulrich-sees-more-easing-tax-reform-from-china/ | 2017-06-28T03:30:05Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128322320.8/warc/CC-MAIN-20170628032529-20170628052529-00378.warc.gz | en | 0.952328 | 208 |
Ray White Killcare Peninsula
Sweeping Ocean Views
- 3 Beds
- 2 Baths
This NE facing 3 bedroom brick and tile property is just perfect for renovating into a fantastic holiday home. The entry level has a rumpus room and bedroom and bathroom. Upstairs are 2 bedrooms, bathroom and huge open plan dining, living and kitchen area with cathedral ceilings leading out to a deck. Just sit back, relax and take in the sweeping views up the beach and out to the ocean. Only 2 minutes walk to the beach and a short stroll to the bay, shops and restaurants.
Do you want to find out more about this suburb? Enter your details to receive a free comprehensive suburb report. | <urn:uuid:d1d70e84-9176-4a13-9110-ebe777cb3273> | CC-MAIN-2017-30 | http://raywhitekillcare.com.au/properties/leased/nsw/killcare-2257/house/462601 | 2017-07-24T18:49:31Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549424909.50/warc/CC-MAIN-20170724182233-20170724202233-00378.warc.gz | en | 0.905835 | 144 |
Tours are available by appointment for groups of 5 to 25 guests.
The average tour last between 30 and 60 minutes.
Themes for these tours are varied, past groups have enjoyed tours focusing on:
The Art Collection
These tours may include the basement, first, and second floors of the library.
The building's third floor is storage and public access to this area is limited.
The fourth floor (ballroom) is managed and maintained by the City of Piqua and based on city events and permission, may not be available at the time of your visit.
Contact: email@example.com for further information,
or call Beth or James Oda at 937-773-6753. | <urn:uuid:3c5a3638-96e1-4cfc-8435-a7905736fd72> | CC-MAIN-2020-34 | https://piqualibrary.org/content/tours | 2020-08-06T00:34:04Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-34/segments/1596439735990.92/warc/CC-MAIN-20200806001745-20200806031745-00227.warc.gz | en | 0.922052 | 152 |
Hello! I have wanted to write with the links to new recipes on family.com.
But then Birdy was home sick all week. The poor girl had to spend all day every day with her cat. Misery all around.
Oh right. But the recipes.
These, for instance. Which are, apparently, lemon *squares*, not lemon bars (thank you for your corrective emails). In my cookbook, the recipe is in my mother's handwriting but is called "Robert's Lemon Bars." My brother works 16 hours a day and still finds time to make lemon bars. You do the math.
And this. Which is rated NC-Carnivore, if you catch my drift, you vegetarian sweethearts out there. But I cried again a little, just now, looking at the pictures.
And this. Which might seem silly--who needs a recipe for hot chocolate? But if you aren't making it with real chocolate, I encourage you to try it. I don't even really like hot chocolate? But this I like.
A couple other things. Books. Who recommended Without a Map here? Man that was a killer good book. And I am about to finish Tracy Kidder's Mountains Beyond Mountains, which is about Haiti and Paul Farmer, and which is so good I wake up at 4 in the morning to read a few chapters. If you are in need of inspiration, I can't think of a better way to get it.
Randomly, some PR people sent me a giant box of Cabot cheese and a giant box of Olivia's Organics salads. I don't usually do promotional pitches here, but I had to laugh because we already buy and eat both Cabot cheese and Olivia's Organics salads. So I thought I'd say: they're both good. There. Now I can gorge guiltlessly on cheddar and arugula.
Enjoy your weekend. And please keep the book recommendations coming. There's no better midwinter tonic than a great read.
Wednesday, January 13, 2010
I will write a real blog update soon. But if you're thinking about Haiti, and I know that you are, I wanted to mention that Partners in Health seems like a fantastic organization, and might be a good place to give money to, if a relief donation is something you're able to consider. Tracy Kidder has written about them, both in his book, and in tomorrow's Times. I know that resources are tight, but all those photographs in the newspaper--those faces devastated by grief and pain and fear, all those kids--really focus my perspective. You know what I mean. xo | <urn:uuid:d0f5b615-4354-41cc-9632-948d311a9fa8> | CC-MAIN-2017-39 | http://benandbirdy.blogspot.de/2010_01_01_archive.html | 2017-09-22T06:19:30Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818688671.43/warc/CC-MAIN-20170922055805-20170922075805-00154.warc.gz | en | 0.972697 | 544 |
"Dine & Wine" Event at Hotel Castel*****
The season of our cooperation partner, the 5-star Hotel Castel in South Tyrol, is over now. The season ended with the popular event "Dine & Wine", which has become a good tradition for the host family Dobitsch and their guests.
The wine to the menu on Wednesday came completely out of the range of ALPINA wine. Burkard Bovensiepen personally presented its wine selection by the motto "Old and New World in Big Bottles". | <urn:uuid:526f97b4-1c2d-48af-ad76-7c1d975459b0> | CC-MAIN-2017-04 | http://www.alpina-automobiles.com/en/alpina/news/news-detail/p/dine-wine-event-at-hotel-castel/ | 2017-01-19T08:39:43Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280504.74/warc/CC-MAIN-20170116095120-00055-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.965866 | 108 |
7 Warning Signs of Depression That You Need To Know
Are you wondering what signs of depression look like? Are you feeling not yourself and wondering if you are depressed?
Below a list of 7 warning signs of depression that are important for you to know right now! The earlier you diagnose depression, the easier it is to treat.
#1 – Hopelessness.
Are you struggling with feelings of hopelessness? When you think about the future are you filled with dread because your future looks so bleak?
When we are depressed, looking to the future in a positive way is literally impossible. When we are depressed it’s hard to imagine that we will ever feel any differently than we do right now so the idea that the future might be bright is impossible to imagine.
It’s important that we recognize that hopelessness is one of the signs of depression because hopelessness is one of most insidious signs of depression because it can lead to thoughts of suicide.
So, understand that your hopelessness is in your head because of your depression and that seeking help is the best thing you can do to manage it.
#2 – Changes in sleeping patterns.
Are you having trouble sleeping? Are you sleeping way more than you used to?
Changes in sleeping patterns is one of the major signs of depression. We sleep less because we often lie awake with thoughts of hopelessness and dread keeping us up.
On the other hand, we sleep more because our body feels heavy and our mind is tired and sleep is the ultimate escape, if only for a bit.
If your sleep patterns have changed, recognize that it is one of the signs of depression and seek treatment.
#3 – Lack of interest.
Are the things that have always made you happy things that you now find unthinkable to do?
I know when I get depressed doing things that I have always loved to do, like hiking or reading or life coaching, are almost impossible. Instead, I lay around and watch TV and shut myself off from the things that make me happy.
And lying around watching TV actually sinks me into a deeper depression then I had before. Ironic, no?
So, if you are struggling to do the things that you love, you might be suffering from depression and it’s time to seek help.
#4 – Listlessness.
One of the easiest signs of depression to notice is a distinct listlessness.
Do you have less energy than you used to? Does getting off the couch or out of bed seem simply impossible?
I always say that my depression is a 100lb gorilla on my back, one who comes along with me doing my everyday day tasks but who makes doing them way more difficult because of it’s weight
So, if you are struggling more than before with having the energy to live your life, you might be depressed and, again, seeking help would be a good idea.
#5 – Anger & impatience.
Do you find yourself quick to anger or impatient with those you love more than you used to?
Are your co-workers complaining because you are difficult to work with? Is your husband staying away because your irritation with him has grown? Do you find the kid’s bedtime routine can enrage you in a way that it hasn’t before?
Being more angry and impatient than usual can be one of the signs of depression and seeking help will be important before that anger harms your life and your relationships.
#6 – Isolating.
One of major signs of depression is that tendency to isolate.
When we are depressed, the idea of spending time with other people is almost unbearable. The thought of interacting with people in any way fills us with such a feeling of hopelessness and dread that we just can’t do it.
Ironically, one of the best coping skills for managing depression is to spend time with those you love, to laugh and live and push that depression to the side, if only for a while.
Are you finding yourself wanting to keep away from others more than usual? If you do, you could be depressed and I encourage you to get help before your isolation makes everything worse.
#7 – Self-loathing.
One of the biggest signs of depression but one of the hardest to spot is self-loathing.
People who are depressed, people who are hopeless, listless, angry and isolated, are people who don’t like themselves.
They don’t like the behaviors they are displaying, the hurt they are causing people, the lack of interest in things that make them happy. They feel bad because getting up off the coach is truly impossible and what a loser they must be.
Furthermore, because there is such a stigma around depression, people who are depressed blame themselves for their mind set. They believe it when people tell them to Suck it up or Snap out of it.
They believe that, because they can’t manage their mood, they are in fact a loser.
And believing that you are a loser will only exacerbates your depression.
So, if you are struggling with your self-esteem right now, in a way that you haven’t before, then you could very well be depressed.
I want you to know, very clearly, that this depression is NOT your fault. It is something that has happened because of a chemical change or a life occurrence. It’s not something that you can just brush off. But it is something that you can deal with by seeking help.
So, do it!
Noticing the signs of depression is a key part of accepting that you might be depressed.
An important part of managing your depression is accepting it and you can more easily do that by looking out for the signs.
So, notice if you are feeling hopeless, have a change in your sleeping patterns, if you have no energy or interest in doing things, if you are quick to anger and you if really don’t like yourself.
The quicker that you seek treatment, the easier your depression will be to manage.
I struggled my whole life with depression but wasn’t diagnosed until I was 42. Think of all of the life that I wasted being sad. Don’t let that be you!
Do you want to know more about how to recognize depression?
Let me help you, NOW, before it’s too late!
Email me at firstname.lastname@example.org and let’s get started!
I am a NYC based Certified Life Coach and mental health advocate. My writing has been published on The Huffington Post, Prevention, Psych Central, Pop Sugar, MSN and The Good Man Project, among others. I work with all kinds of people to help them go from depressed and overwhelmed to confident and happy in their relationships and in their world. | <urn:uuid:1f28f5be-65a1-4b8b-8402-421f3bdd3e65> | CC-MAIN-2023-14 | https://letyourdreamsbegin.com/mental-health/signs-of-depression/ | 2023-03-27T23:42:42Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948708.2/warc/CC-MAIN-20230327220742-20230328010742-00314.warc.gz | en | 0.955205 | 1,411 |
Universal Primary Education: MDG 2
- In 2008, enrolment in primary education in developing regions reached 89 per cent, up from 83 per cent in 2000.
- Roughly 69 million school-age children are not in school, down considerably from 106 million in 1999. Among the remaining unenrolled group, almost half (31 million) live in sub-Saharan Africa, while another quarter (18 million) reside in South Asia.
Global enrolment in primary education continues to rise, reaching 89 per cent in the developing world in 2008. Between 1999 and 2008, enrolment increased by 18 percentage points in sub-Saharan Africa, and by 11 and 8 percentage points in South Asia and North Africa, respectively.
In 2011, the Council held its Annual Ministerial Review on the theme of education and adopted a strong Ministerial Declaration, highlighting key policies to better promote access to education and improve its quality. Ministers from ten countries ― Bangladesh, Belarus, Germany, Mauritius, Pakistan, Qatar, Senegal, Turkey, and Venezuela ― delivered “National Voluntary Presentations”, which detailed their countries’ recent efforts to achieve universal primary education, while offering case studies on successful initiatives. In 2013, ECOSOC will again return to the issue of education with an AMR devoted to promoting science, technology and innovation.
- The UN Educational, Scientific and Cultural Organization (UNESCO) helps nations build quality, universal primary education systems. UNESCO’s “Basic Education in Africa Programme”, for example, encourages countries to adopt legal frameworks guaranteeing 8-10 years of uninterrupted basic education.
- The UN Population Fund (UNFPA) supports an Ethiopian programme called “Berhane Hewan”, which discourages child marriages and promotes measures aimed at keeping girls in school. In Malawi, UNFPA is working with Youth Councils to repeal a law allowing girls as young as 16 to be married and to support campaigns to keep girls in school.
- The World Food Programme (WFP) provides school meals, which both encourages attendance and makes children more productive in the classroom.
- The UN Economic and Social Commission for Western Asia (ESCWA) partnered with UNESCO to address problems affecting education in politically unstable environments. | <urn:uuid:ef963a7f-adbc-44cd-aa48-886d5a5ce479> | CC-MAIN-2016-44 | http://www.un.org/en/ecosoc/about/mdg2.shtml | 2016-10-26T07:28:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00067-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.91244 | 459 |
More Expansive Search
By David McKelvey
We’re working our way through some updates to the search engine — you might have noticed it’s dominated our recent posts — and today have tweaked the engine just a little more.
Some of the recent changes are necessary to drive our prototype search engine that will launch late this summer, and others are immediate search upgrades. Friday, we made the search engine ranking more consistent across datatypes (pages, people, news, etc.) for the future engine and today, we changed one of the default settings in the search engine to be more expansive in its comparisons.
You might not notice the difference we made today in your average search, but one day when you’re looking for that obscure bit of information you know you’ve seen somewhere on the site, this expanded comparison method will help you bridge the gap when you’re not quite typing the whole or most matchable version of that idea.
Thank Tom Krattenmaker for this change. It was his feedback on a search for a trustee bio that prompted us to tweak the engine. So if you have some feedback on search, be sure and use the search results feedback. We listen and use your feedback to make judgments about the search upgrades.
And speaking of which, if you’re going to be on campus this summer and want a sneak peek at the new prototype email us about becoming a beta-tester. | <urn:uuid:d7a50fcf-45b5-44c1-b677-48f3103ec7e9> | CC-MAIN-2017-51 | https://www.lclark.edu/live/news/18959-more-expansive-search | 2017-12-13T05:39:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948521292.23/warc/CC-MAIN-20171213045921-20171213065921-00659.warc.gz | en | 0.915826 | 297 |
"Last week i bought a couple of suits from Mensusa. I want to tell the truth that both the suits are looking good and the stitching is nice. ..."
"I have been recommending this shop for a very long time. Since then, the level of quality they have when it comes to the things they sell is ..."
"Excellent Customer Service from them. Mensusa is really great. I bought two suits from them last weak and both are looking good. if i wear that i fell ..."
"Awesome store! That's the place to go if you are looking for Army clothing and Military gear. They got a big warehouse there, and prices are much cheaper ..."
"Wow! This dance studio really has it together. Non-intimidating, fantastic pole dance classes. I am a little-larger then some of the students, but felt right at home with ..."
"Excellent, courteous service. Very professional! Great job!"
"This place is great for the average guy who never dresses formally and needs it for a special occassion. They make you feel very comfortable and do not ..."
"I'm new to this world of printing and DTLA Print really helped me out. I can't explain to you how much they have taught me. I had contacted ..."
"Great store with great people. If you are to purchase a musical instrument, come visit this place and I'm sure that you won't regret."
"I love Danny's Warehouse and Danny is so nice. Being that I am a dance teacher I always use them for shows. Yes, you have to be patient ..." | <urn:uuid:5ad1b081-05dc-4dab-9c0b-772b8ce04294> | CC-MAIN-2019-39 | http://ec2.insiderpages.com/s/CA/LosAngeles/SpecialtyClothing | 2019-09-23T15:36:03Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514577363.98/warc/CC-MAIN-20190923150847-20190923172847-00456.warc.gz | en | 0.980062 | 332 |
Girls and Horses
By Leslie Potter
Wednesday, February 9, 2011
In my daily scanning of the horse-world news, I came across an NPR article about the unsolvable mystery of why girls love horses. It's a human-interest piece, not a scientific study, and it doesn't really make any serious attempts at answering the question, but it offers some interesting opinions.
I think it's really hard to make sweeping generalizations about girls. When I worked as a riding instructor, the vast majority of the students were girls and of course they were all horse-obsessed, but that's where the similarities ended. There were outgoing, popular girls, painfully shy girls, class clowns, and even a few (dare I say it?) mean girls. Step into any lesson barn, and it's bound to be the same sort of mix. So it's especially weird that a love of horses is so overwhelmingly a female trait, but that it seems to transcend everything else.
Another thing to bear in mind is that the absence of boys in the barn is mostly an American phenomenon. In many other countries, boys and men ride as much or more than woman. There are also still pockets of the American west where the cowboy tradition is alive and well, and men and women both ride. Certainly, there's a cultural factor that you have to keep in mind.
So, back to the NPR article. In it, writer Peggy Orenstein suggests that girls identify with horses because they are a symbol of power, and through them, girls find a way to express their own power. I suppose that's one possibility, but it doesn't explain why boys don't have the same attraction. Is it because boys are allowed to be powerful in their own right while girls are still, to a certain extent, expected to be polite princesses and not strong superheroes? On the other hand, how many of my fellow children of the 80s only wanted to be She-Ra, Princess of Power, not because of the power but because of her awesome horse?
Another writer quoted in the article, MIT grad student Laurel Braitman, suggests that horses fuel girls' imaginations. With a horse, a mild-mannered suburban girl can become a cowgirl on the frontier. Fair enough, but young boys are no less imaginative than girls, so it still doesn't explain the discrepancy.
I've been pondering this one, and I can't come up with a solid answer. Maybe it has something to do with the nurturing instinct hard-wired in women. I think everyone, regardless of gender, wants to feel powerful sometimes. Boys and girls can both want to feel the wind on their faces. But maybe after the exhilaration of a great ride, girls want the added experience of being able to take care of and form a bond with a sensitive, independent being while boys are okay with just putting the motorcycle in the garage and moving on to the next activity.
What do you think? Why is horse-craziness so common in little girls but so rare in little boys? Click "Submit a Comment" below and share your thoughts.
<< Previous Entry
Back to The Near Side
Give us your opinion on
Girls and Horses | <urn:uuid:8b8f83d9-4490-4757-94e1-1817513e9574> | CC-MAIN-2017-09 | http://www.horsechannel.com/the-near-side-blog/2011/0209-girls-and-horses.aspx | 2017-02-26T06:15:36Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171936.2/warc/CC-MAIN-20170219104611-00603-ip-10-171-10-108.ec2.internal.warc.gz | en | 0.972502 | 659 |
I prayed my heart out on Yom Kippur.
Since Toby got sick, I’ve had an ambivalent relationship with God. On good days, I understand that God didn’t send this disease. On bad days I rail against God’s silence. And most days I feel a tremendous loss in my connection to God.
I haven’t been able to pray on my own. And so on Yom Kippur, I went to synagogue, in search of my community, in search of warmth, in search of a space where I could have a talk with God. I chanted the melodies and let my soul be lifted by the beauty of ritual. I felt myself enter the lines of text, winding through the letterforms like the paths of a most beautiful garden.
It was during the amidah that I felt myself open up to the possibility of something. So I covered my face with the prayerbook and let God know how I felt. When I came up for air, Yoni remarked that I had tattooed the book with my tears.
What happened next surprised me.
As is customary, the ark remains open during the entire concluding service of ne’ilah. But at PSJC there’s a wonderful opportunity for families, couples and individuals to ascend the bimah during this time, to share a moment alone/together in front of the open ark and Torah scrolls. For more than an hour, I watched as the ark became a shaftway to God. Again and again, parents wrapped themselves around their children, whispering their wishes and prayers and dreams. Couples embraced, hands reached out to touch the scrolls. It was pure theater and I watched hungrily, with joy and sadness. Personal became public and intimacy crowded out every other feeling in my heart.
I desperately wanted to be one of the families hugging each other in the sweep of narrative, history and hope.
In many ways uncertainty has crowded out intimacy in our lives. We wake up each day, unsure of what will happen by evening. And this morning, for the first time in a long while, I can unequivocally say that Stephen and I feel hopeless.
Yesterday we met with Dr. Kushner, to discuss the much-anticipated next phase of treatment: 3f8 antibodies. After 6 cycles of high-dose, highly toxic chemotherapy and after 14 rounds of radiation to Toby’s shoulder, we are ready to move on. Toby still has refractory disease, but some children do go into antibody therapy without being completely “clean.”
Instead we heard more bad news. Although most of the scans came back stable, one of the bone marrow aspirates showed neuroblastoma cells. This is very, very unusual and Kushner is uncomfortable giving Toby antibodies at this stage. He would like to do a 7th cycle of chemotherapy, in a final, super-aggressive, off-the-charts attempt to kill the cells in the marrow. He admitted that MSK doesn’t do this often. He admitted that Toby is highly unusual. And he admitted that he doesn’t have much data to show whether this will be an effective course of treatment.
We still have a lot of unanswered questions and are unsure what our next steps will be. My brother will most likely post some of the medical details over the next few days.
Intimacy is what makes me feel human, but it is uncertainty that sits on all our shoulders. Yoni worries, asks a million questions, demands the whole truth with no sugar coating. Stephen and I open a bottle of wine at 5 pm, walk to the corner together and stand in the middle of the sidewalk as the tears fall. Toby senses the vibrations of uncertainty and cannot sleep. Last night I lay in bed with him after he told me that he was nervous and scared. I reminded him to think of good things: Randy and the whoopee cushion, the mango smoothies at Lonelyville, harvesting a potato in Prospect Park. But he cried and said, “the bad things are too big, Mommy.” Over and over I tell him that everything will be alright, We curl up together and see the moon through the blinds. It’s a full moon, full with experience and life and quiet. Toby eventually fell asleep.
And today we blink into the wide gaping hole of a new day, heavy in our hearts, craving intimacy for our family.
We ask again for your support, presence and love. You have done so much for us already that I hesitate to ask again. I will never be able to write all the thank-yous for the beautiful, thoughtful gifts, the delicious meals, the blood, the money, the letters and visits. Please forgive me. And know that through you, we can experience life as it should be.
Love, mooki and stephen
Ed Clark, Christmas Guest
7 months ago | <urn:uuid:008eeee0-81aa-4ed6-a7bf-5c30243716b2> | CC-MAIN-2017-34 | http://tobypannone.blogspot.com/2007/09/intimacy-and-uncertainty.html | 2017-08-23T14:00:27Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886120573.0/warc/CC-MAIN-20170823132736-20170823152736-00274.warc.gz | en | 0.96365 | 1,015 |
11 Faqs You Needs To Know About Xenon Lighting
These end up being usual usages for basements, after all, given due to the fact they are the area least accessible in the guests. The basement could even be considered as the blue collar portion of the home, where dirty tasks are usually handled. And why not? Your guests won't be able to see the mess, anyhow, right?
To minimize or eliminate this, try tilting this specific unit. In extreme cases it might be necessary to relocate the screen to another location altogether. Moving lights that cause the reflection or glare will help, or at least turning them down. Fluorescent lights are particular offenders, so covering them or turning them off will have a positive effect on eye stress.
Here's all there for you to it. Anyone decide to sit at most and every position inside your space, is definitely to say you to utilise every seat in your parking space that you're currently lighting and the each and any one light source from that position. Not surprisingly each with the light sources has for you to become on at the moment. When seem strait in that light source is there any glare? Does it hurt the eyes even the actual planet slightest in order to straight at the light? Is the light shinning directly at you from below the shade?
Will precise cup lay on the desk light or even chandelier using a circular bridal ring or even tripod? You almost certainly would like students trim. Calculate the actual diamond ring, outdoors advantage for you to outdoors advantage. Regular dimensions tend to be 5", 6", 7", 8", 10", 12" and also 14". At this time there is workbenches often location regarding any fireplace so that you can sit down inside the larger diamond baskeball hoop. Once again, calculate which owner, outdoors advantage in order to outdoors advantage.
You in addition want to position your desk so your back isn't facing the actual. You want to be able to to view people passing by or coming clamp lamps within talk for. Always open to business! You also want try to your wise to keep your desk away from facing wall surfaces.
Lets talk about the price of bankers desk lamps uk - really should mention that it really is pretty varieties of. It depends on your budget in any way. If you are willing to pay a little fortune in order to achieve good results you ought to know that you can find bankers desk lamps uk for 300-400 $ and more but if you do not intend to waste much money you can get a cheap one for approximately 30 dollars. No matter what is your decision you should recognize that such lamps are an absolute must have for every office or house. It's possible to work even in low-light rooms thanks to lamps' light density, and if you need to go for one's office you'll be able to take system with you because individuals small may well be moved pretty commonly.
Learn these 5 camera adjustments: Aperature (f-number), Sensitivity (ISO number), Shutter Speed (Exposure), White Balance, and look. These 5 are your bread and butter.
Vitamins. Regardless if your school has a gourmet cafeteria, you won't always be eating the perfect. Vitamins will help cover what you do not get from a 4-day diet of chips and coca-cola. | <urn:uuid:c96cb65c-54a4-4d94-8cc6-b4d2c00f6809> | CC-MAIN-2017-43 | http://wallinside.com/post-96323-11-faqs-you-needs-to-know-about-xenon-lighting.html | 2017-10-24T02:38:05Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187827853.86/warc/CC-MAIN-20171024014937-20171024034937-00413.warc.gz | en | 0.951835 | 689 |
Please feel welcome to look around. We have many things do to while here, you can read some game reviews in our Blog. See upcoming PlayStation Home events in our Calendar, talk with other HOMEinformer members in our discussion forums or play some arcade games in our Arcade room!
HOMEinformer is a PlayStation Home team and club (HOMEinformer) founded by Sophronia and Jersquall. There will be weekly meetings all about PlayStation Home and the PlayStation Network, pretty much anything PlayStation3. So please sign-up and let us know what you like or send us any suggestions you may have.
We are proud to announce our new HOMEmemories blog! It's the place for your PlayStation Home memories. Check it out today at: HOMEinformer.blogspot.com!
Please contact us at email@example.com if you have any questions about HOMEinformer or the HOMEmemories blog. For opportunities please visit the [About us] > [Applications] tab on our site.
You can now find us @HOMEinformer on Twitter! | <urn:uuid:06ac2abe-3ec4-47f2-9bda-79f566f49fe6> | CC-MAIN-2017-22 | http://homeinformer.webs.com/ | 2017-05-25T10:33:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608058.57/warc/CC-MAIN-20170525102240-20170525122240-00563.warc.gz | en | 0.847558 | 225 |
We recognize that some of our patients may feel some apprehension about receiving dental care. Our doctors and staff work hard to make sure your experience is a comfortable and pleasant one. We believe that feeling anxious should never prevent you from enjoying the dental health and beautiful smile you deserve. We are pleased to offer our patients the option of comfortable, safe, and effective sedation dentistry.
Patients who benefit from sedation dentistry have:
- A fear or anxiety of being at the dentist
- A hard time sitting still for long periods of time
- A hard time getting (and staying) numb from anesthetics
What is sedation dentistry?
Sedation dentistry allows your doctor to provide a variety of dental treatments safely and comfortably for patients who experience anxiety when visiting the dentist. There are several benefits to sedation dentistry, including:
- No memory of undergoing the procedure
- No sense of time while under sedation
- No sense of smell or sound
- No fear or anxiety during treatment
Patients who have undergone a procedure using sedation dentistry will tell you it is a simple, relaxing way to experience dentistry.
I am nervous about being unconscious. What levels of sedation are available to me?
There is no need to be nervous about having sedation dentistry at our practice. Sedation dentistry is closely regulated, and there are three sedative states at which your dentist can administer your treatment: mild sedation, moderate sedation, and deep sedation.
- Mild Sedation — Anxiolysis is the lightest form of sedation dentistry and is often used for patients with mild anxiety, longer procedures, or more complex situations. Mild sedation is usually administered orally. You remain awake or very sleepy throughout the entire procedure and are able to breathe on your own, but you will feel a great sense of relaxation. Patients typically recover from anxiolysis sedation within a few hours after the procedure is complete. Nitrous oxide inhalation (laughing gas) is another form of mild to moderate sedation that results in relaxation during treatment.
- Moderate Sedation — Used for patients with moderate dental anxiety and for patients who need longer or more complex procedures, conscious sedation often refers to the use of light IV sedation. With conscious sedation, you will remain awake throughout your procedure, but will be in a deep state of relaxation. It is required that patients who receive conscious sedation have a parent, spouse, or friend accompany them to appointments because it can take several hours for the sedative to wear off and driving is unsafe.
- Deep Sedation — Patients receiving deep sedation go between consciousness and unconsciousness during their dental procedure. It is required that patients who receive deep sedation have a parent, spouse, or friend accompany them to appointments because it can take several hours for the sedative to wear off and driving is unsafe.
How are sedatives administered?
- Inhalation — Nitrous oxide, or laughing gas, is the most frequently used method for easing mild to moderate anxiety. Recovery is quick so you can resume your normal activities immediately.
- Oral — An extremely common technique for dental sedation is oral sedation. It is easy and does not require the use of needles. You will be given a prescription pill which, taken about an hour before your appointment, will have you fully relaxed by the time you arrive at our office.
- Intravenous — The doctor will gently place an IV and administer medication to help you into a deeper state of relaxation. Using IV sedation dentistry, we may be able to complete several different procedures in just one visit. When the treatment is over and you wake up, you will have little or no memory of the procedure and a new beautiful smile.
Please contact our practice to schedule a consultation, learn more about sedation dentistry, and find out which sedation dentistry method may be right for you. | <urn:uuid:75422b57-4e3d-41b7-95ae-2b35fd9eee22> | CC-MAIN-2018-13 | http://www.lifetimedentalnwa.com/sleep-dentistry | 2018-03-22T16:01:10Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647892.89/warc/CC-MAIN-20180322151300-20180322171300-00237.warc.gz | en | 0.936799 | 807 |
Raise your level of abstraction
I wish to share and discuss this point with all of you (as inspired by an old statement by F. Steimann). Is modeling an oversimplification of reality that cannot lead to satisfactory end product?I…Continue
Started this discussion. Last reply by Pedro J. Molina Mar 7, 2011.
The Kindle edition of the book "Model Driven Software Engineering in Practice" by Marco Brambilla, Jordi Cabot and Manuel Wimmer is now available on Amazon.
You can find it here:
The Kindle edition is available at 10$.
Posted on February 7, 2013 at 8:58
The MDWE workshop on Model Driven and Agile Web Engineering will be held tomorrow in Berlin.
We have also set up an instant community system that will let you interact and participate online to the event at:
All papers are already available online on the community site!
You can signup and participate to the community! You will find a "follow" button for…Continue
Posted on July 24, 2012 at 14:42
I've posted a quick writeup of the LWC challenge competition highlights presented at the Code Generation main event.
Here is the post:
Posted on May 27, 2011 at 14:04
Posted on October 8, 2010 at 12:39 | <urn:uuid:0377999a-a2c4-49fd-886b-6da038548696> | CC-MAIN-2019-43 | http://modeldrivensoftware.net/profile/MarcoBrambilla | 2019-10-21T22:23:09Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987795253.70/warc/CC-MAIN-20191021221245-20191022004745-00551.warc.gz | en | 0.907209 | 274 |
At World Pulse, we recognize the need for ongoing learning—for you and for your community! Our toolkits are all available here.
We are especially excited to share our signature Citizen Journalism and Digital Empowerment Curriculum. Start learning today!
Join us in supporting women who are using the Internet to transform the world. Submit to our Women Weave the Web Digital Action Campaign!
Learn More »
by MOMMY | February 24, 2009 at 5:03 AM
My Vision for the Future:
TO MAKE THE WORLD A BETTER PLACE FOR RURAL YOUNG MOTHERS AND CHILDREN. A WORLD FREE OF VIOLENCE,POVERTY
Welcome to PulseWire! I am interested to hear more of your voice and about the work that you do with Mom's Club International Nigeria.
Moms Club International is a non-political, non-religious and non-governmental charitable organization for mothers and has satisfactorily fulfilled the entire requirement for registration as a voluntary/non-governmental organization prepared to work for the welfare of women and children and the society at large. It was first registered with the Onitsha North L.G.A in 2002 with Reg. NO: ONLG/SWD/CR/12/2002 and Anambra State Women Affairs Ministry on 8th March 2004 with number 135 and finally with the CAC of the Federal Republic of Nigeria on the 21st of August 2004 with Registration NO; CAC/IT/NO17339
Specific areas of interest include:
Women Empowerment/Skill acquisition programme
Health awareness campaign
Education programmes for women and youth
Community Development programme
MISSION: To improve the quality of life of women and children especially women of child bearing age in rural communities through empowerment in order to utilize, indigenize and safeguard their potentials.
AIMS AND OBJECTIVES:
(1) To lobby all agencies involved so that women and children can lead a life free of violence and discrimination against them.
(2) To create awareness on all Health issues affecting women and children such as maternal health, HIV/AIDS, FGM, Rape, Malaria etc.
(3) To have training to upgrade or optimize the skills of young mothers
(4) To pursue occupational goals for young mothers especially in the family through creating good jobs etc.
(5) To establish structures that would be used to inform and educate our women on political, economic and cultural development.
Thank you for explaining the important work of Moms Club International. I am so inspired by your work as it encompasses all aspects of empowerment for women and children from economic development to maternal health.
We've missed your presence on PulseWire and it's so great to see you back in our community! I encourage you to use your journal as a place to introduce yourself, your work and your passions to the PulseWire community. Think of your journal as a blog, where you can speak your mind and reach an audience of over 3000 women and supporters of women's initiatives. Check out what others are writing about in Voices Rising. I think that you will find PulseWire to be an exciting place to garner support, make connections and share your story.
I just came across you page, and with your background in public service, I thought you might be interested in this opportunity in the United States.
Travel, accommodation, and meals are paid.
Deadline to apply is February 1, 2013
Here is the link: http://worldpulse.com/pulsewire/exchange/post/62087
World Pulse Online Community Management Volunteer
Read global coverage through women's eyes
Letters to a Better World
Connect with women on the ground worldwide
POEM: War Is Not My Language - الحرب ليست لُغتي
Be heard at influential forums
WWW: Women Weave the Web
Help us train women citizen journalists
World Pulse Voices of Our Future
Read the latest from World Pulse headquarters
World Pulse Launches our Inaugural Community Advisory Board!
Join forces with our wide network of partners
Nobel Women's Initiative
| About Us
Share This Site
| Link to Us
Copyright © 2014 World Pulse. All rights reserved. | <urn:uuid:4e4d4a11-aa6e-4199-9e32-265faa1d01bf> | CC-MAIN-2014-23 | http://worldpulse.com/node/6576 | 2014-07-26T04:29:37Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1405997894976.0/warc/CC-MAIN-20140722025814-00227-ip-10-33-131-23.ec2.internal.warc.gz | en | 0.916303 | 880 |
D&B Hoovers provides sales leads and sales intelligence data on over 120 million companies like SENZA VIA DI SHAMPOO SNC DI MECCA MARIA LOURDES E CANONE FRANCESCA around the world, including contacts, financials, and competitor information. To witness the full depth and breadth of our data and for industry leading sales intelligence tools, take D&B Hoovers for a test drive.
SENZA VIA DI SHAMPOO SNC DI MECCA MARIA LOURDES E CANONE FRANCESCA
See detailed business credit reports on other businesses or your own.
Get in Touch with 2 Principals*
MARIA LOURDES MECCAPartner | <urn:uuid:89362549-b578-4c98-afb3-b5aa9c771fc1> | CC-MAIN-2020-50 | https://www.dnb.com/business-directory/company-profiles.senza_via_di_shampoo_snc_di_mecca_maria_lourdes_e_canone_francesca.28d20379cf9358f3045d48f4aa9c8834.html | 2020-12-01T09:50:59Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141672314.55/warc/CC-MAIN-20201201074047-20201201104047-00318.warc.gz | en | 0.801313 | 149 |
Patients Carers Visitors
The Royal Hospital for Women is committed to providing innovative patient care which doesn't end when you leave the door.
The Royal Hospital for Women has been one of Australia's foremost specialist hospitals for women and babies, since its early beginnings as New South Wales first 'lying-in' hospital for women in 1820.
As a principal teaching hospital of the University of NSW in the fields of obstetrics, gynaecology and neonatology the Royal has a history of innovation in women's health care services, teaching and research.
The Hospital is also affiliated with the University of Sydney collaborating on research in maternal, perinatal and women's health. Research conducted by the Midwifery & Women's Health Nursing Research Unit leads to the translation of findings into clinical practice.
The main areas of specialisation include breast care, gynaecology, gynaecological oncology, maternity, maternal fetal medicine, menopause, newborn intensive care and reproductive medicine.
Each year the Hospital delivers more than 4,200 babies; cares for more than 600 premature babies; treats more than 400 women for gynaecological cancer; provides surgery for more than 80 women with breast cancer; attends to over 450 women requiring acute care services; helps more than 600 women through gynaecological procedures. | <urn:uuid:a0e042bc-f535-47bb-b81a-e21babf0a748> | CC-MAIN-2020-16 | http://www.seslhd.health.nsw.gov.au/royal-hospital-for-women/patients-carers-visitors | 2020-04-07T10:50:28Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371700247.99/warc/CC-MAIN-20200407085717-20200407120217-00311.warc.gz | en | 0.936062 | 271 |
We are recruiting Chefs to work in St Anton and Courchevel 1850.
WHO ARE WE?
Kaluma Travel is a small, luxury tour operator, focussed on our specialist regions of St Anton and Courchevel 1850. As an owner-managed company we have built a loyal following of clients that appreciate our stunning properties and unique in-resort concierge service.
In our staff we look for professionals who believe in a positive “can do” attitude, exceeding expectations and going that little bit further to provide a level of service that makes a difference.
Kaluma places a lot of weight on the quality of food we provided. For our guests, the food in their luxury chalet is often as important as the skiing and we believe that what we offer is sets us apart from our competitors. All chefs working in Kaluma catered chalets are experienced professionals, hired due to their professionalism and experience in the industry. We provide a generous budget and allow our chefs menu autonomy, expecting in return well-balanced, flavoursome and beautifully presented dishes.
KITCHEN POSITIONS AVAILABLE:
- Head Chefs (Catering for up to 24 guests)
- Chalet Chef (Catering for up to 12 guests)
- Sous Chef (Working underneath a Head Chef)
MAIN DUTIES AND RESPONSIBILITIES:
- Preparation of breakfast, afternoon tea and a gourmet evening dinner. Meals should be fresh, creative, balanced and well presented, following the below format:
- Breakfast: A continental breakfast buffet (7 days a week) and a healthy hot ‘special’ and traditional English breakfast. (6 days a week)
- Afternoon Tea: A homemade sweet or savory dish. (7 days a week).
- 5 Course evening dinner: Consisting of at least 2 variations of canapés, starter, main course, dessert and cheese board.
- Ordering and/or shopping for all food items from nominated suppliers and checking that any goods delivered to the chalet are quality checked and as ordered.
- Running an efficient and cost effective kitchen. Managing kitchen budgets, ensuring maximum use of all food stocks and limiting wastage through stock-takes and menu planning.
- Maintaining the hygiene and cleanliness of the kitchen and dining area, paying particular attention to health and hygiene standards & HAACP requirements.
- A recognised qualification in professional cookery and/or a training background in professional kitchens (2AA rosette rated and above).
- Post training, a solid experience in restaurant kitchens, private households, super yachts or luxury chalet companies.
- Minimum age of 21 years
- UK or EU passport, a National Insurance Number, UK bank account
- A full, clean UK drivers licence (Courchevel only)
** Please send a menu plan and photographs of your food with your application ** | <urn:uuid:c82f9c35-c8c1-425c-bd97-631eec3de622> | CC-MAIN-2018-47 | http://jobs.natives.co.uk/job/chef-5614423409180/10155352 | 2018-11-19T07:09:56Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039745486.91/warc/CC-MAIN-20181119064334-20181119090334-00101.warc.gz | en | 0.908437 | 607 |
|Developer(s)||RJ Ryan, Owen Williams, Sean Pappalardo, Daniel Schürmann, S. Brandt, Ilkka Tuohela, Max Linke, Marcos Cardinot, Nicu Badescu|
2.1 / April 16, 2018
|Operating system||Windows, macOS, Ubuntu|
|Available in||17 languages|
Mixxx is free and open-source software for DJing. It is cross-platform and supports most common music file formats. Mixxx can be controlled with MIDI and HID controllers and timecode vinyl records in addition to computer keyboards and mice.
Mixxx is a DJ Automation and digital DJ performance application and includes many features common to digital DJ solutions as well as some unique ones: It natively supports advanced MIDI and HID DJ controllers, is licensed under the GPL (v2.0 or later) and runs on all major desktop operating systems. The project was started in early 2001 for a doctoral thesis as one of the first digital DJing systems. Over 1,000,000 downloads of the app occur annually and as of Mixxx 1.10.0, 100 developers and artists have helped create Mixxx. Recent versions support harmonic mixing and beatmatching, both manually and automatically.
Mixxx can read most popular audio formats, including MP3, Vorbis, Opus, AIFF and FLAC. v1.8 introduces a plug-in system to be able to read other formats, including patent-encumbered ones whose decoders cannot legally be distributed in binary form with Mixxx, such as Advanced Audio Coding (AAC). Any such plug-ins are automatically loaded at run-time if present.
Any sound card that is supported by the operating system is usable in Mixxx. Mixxx supports various software APIs for using sound cards on different operating systems, namely ASIO, WASAPI, and DirectSound on Windows; OSS, ALSA, and JACK on Linux; and CoreAudio on Mac OS X, all via PortAudio.
Mixxx is one of the first[weasel words] free and open-source applications available in the Mac App Store. In less than 48 hours since it went live in February 2011 Mixxx has become the #1 Top Free App in the USA, Germany, and Italy.
- mixxx.org 16 April 2018
- James, Daniel. "Drafting Digital Media". Apress, 2009, p. 213.
- Digital Dj Tips: "Get Your Mixxx for Free!" 14 October 2010, Retrieved on 4 Nov 2011
- Skratchworx: "Mixxx with 3 Xs - one for each supported OS" 7 Aug 2009, Retrieved on 4 Nov 2011
- "Archived copy". Archived from the original on 2011-10-07. Retrieved 2012-05-24.
- Source code of a simple implementation
- Mixxx Wiki, hardware compatibility page. Retrieved on 4 Nov 2011.
- Create Digital Music: "Turntablism in the Digital Age: DJ Jungleboy with Stanton SCS.3d; Open Scratch Scripting" Section: "Open Source SCS.3d Scripting?" Jun 9 2009, retrieved on 4 Nov 2011
- Mixxx blog: App store availability announcement 18 February 2011, Retrieved on 4 Nov 2011
- MusicRadar.com: "Free Mixxx DJing app hits number one in the Mac App Store" 22 February 2011, Retrieved on 4 Nov 2011
|Wikimedia Commons has media related to Mixxx.| | <urn:uuid:94b54c30-0cb5-4eb5-919c-c4cc497ff976> | CC-MAIN-2018-30 | https://en.wikipedia.org/wiki/Mixxx | 2018-07-16T07:35:48Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676589222.18/warc/CC-MAIN-20180716060836-20180716080836-00532.warc.gz | en | 0.830804 | 735 |
So the 2012 World Series of Poker has commenced and I’m far removed from the action. Today I’d normally be packing 90% of my belongings into my giant blue suitcase, withdrawing a large sum of cash from the bank and steeling myself for a summer in the desert.
[edit: I started writing this thing last week. Because it takes me so long to compose and post blog entries these days, I am in fact packing and going to Las Vegas tomorrow.]
Instead, I’m doing what gainfully employed recreational poker players do: devising plans to play a small number of WSOP events and otherwise going about my usual business. I’m playing a couple of prelims next [this] week, coming back home then resurfacing again a few days before the Main Event.
I’m not especially upset about this, at least not in the traditional sense. I am not envious of the people I know who are spending the next six weeks in Vegas. I am not feeling any remorse about my decision to retire from full time play. I haven’t really bothered to reflect on that choice just yet; my inevitable period of nostalgic rumination about my time as a poker pro has not begun.
Through the years I’ve been open about having mixed feelings about the WSOP. There’s a lot to dislike about the WSOP, ranging from constant mild physical discomfort (outside’s way too hot, inside’s too cold) to severe homesickness (which acquires a strong new dimension when you have children) to the continuous presence of Clark Grizwald bozos, Southern California dillweeds and hookers in your field of vision.
For the first time since moving to Carroll Gardens, I will be spending the summer of 2012 here in Brooklyn, and I’m excited for it. This is where my family lives. This is where the best pizza and chicken parm is. Where I can walk my dog and chill on my stoop. Where vibrant weekend daytime parties pop off on rooftops, in parks, in vacant lots, on boats—not in contrived megaclubs overrun with noobs and fake boobs. I love summer in New York. When half the neighborhood retreats to the Hamptons or the Berkshires or Point Pleasant or wherever and leaves the rest of us to handle things (and park our cars wherever we want)… those are the days I really love. As long as it’s not 95 degrees.
Still, there’s also a lot to love about the WSOP. It’s a truly singular event in its scale. If you took a snapshot of the Amazon Room at the start of a NLHE tournament, photoshopped the cards and chips out of the frame then asked a randomly selected stranger to guess what was depicted, what would they say? Hundreds of tables, each with nine people gathered around one guy in a uniform… probably “third world governmental processing center”—perhaps a Chinese inoculation clinic or the Department of Motor Vehicles in Mumbai? That’s how enormous and orderly everything is. During the meet there is a staggering amount of money being wagered under one roof at all times. Each and every day a handful of people will win a life-changing portion of that money. That’s intoxicating to those disposed to gambling. The WSOP is heaven for big gamblers.
Scaling my involvement down a few notches is an easy decision for me. My priority now is my family, and to miss time with them would make me sad. Ivy’s 17 months old and in a stage of hyper-development. I’m witnessing daily changes as her brain soaks everything up and she turns from one of the world’s silent witnesses into a real conversationalist. She surprises Janeen and I with new words every day. Meanwhile, Maxwell is now four months old and has decided to make his presence felt. He’s exiting the beanbag with eyes stage and entering the terrestrial human stage. He smiles and laughs at practically everything. Looking at a table leg fascinates little Max. Must be nice!
I’m feeling extremely sentimental about this time in my life, even as it unfolds. I know that Janeen and I will never again have two children of Ivy and Max’s formative ages. During the times that I’m not consumed with some child-care related chore, I am dismayed with each passing minute that this time in our life will never return. How am I supposed to fade a 2,800 player field under these circumstances? And why would I want to?
But wait… things are not perfect: I am experiencing a mixture of good days and bad days. I am learning on the job in my new (old) position, which brings both daily stress and occasional satisfaction. I’m earning a solid living, unfazed by the lack of variation each day. Getting up early does not bother me at all. Nor does wearing a suit (although I enjoy being treated as an oddity when I appear in a NYC card club after work—my friends view me with curious affection, as if a suit and tie were assless chaps and a ten gallon hat). The rhythm of my current world is agreeable. Still, there are lots of days where I feel “blah” for no apparent reason. Why?
I’ve considered this quite a bit, and I’ve concluded that my problem is what inveterate gamblers might call a lack of “juice” in my daily existence. I’m not talking about freshly squeezed OJ here. Saying there’s “no juice” in my life is a euphemistic way of saying that I’m experiencing withdrawal. And withdrawal is of course a physiological ailment.
In an effort to self-diagnose my inner feelings of juicelessness, I did what I usually do: read stuff. I’m a sporadic but voracious reader; in this instance I read a bunch of medical journals about the neurological effects of gambling. These types of documents typically devote more space to footnotes than actual text and are crammed full of terms I’ve never heard and have no hope of ever understanding. Laypeople don’t bother to read this stuff. Yet I somehow find these articles riveting.
Anyway, as usual I am short on time. One day I am going to write a full blog entry about the things I’ve learned about the neurological side of gambling. I am fascinated by this info and feel that it may have useful applications in gambling games that involve predicting the actions of other humans—like poker, sports betting and the stock market. So instead of a full treatment, here is my spin on a few of the things I’ve learned about the neurological side of gambling. In bullet points.
-Dopamine (the same chemical that is released when we have sex, eat a good meal, etc.) flow is responsive to gambling. Our brains come equipped with complex risk/reward machinery, rewards produce dopamine. When an agent that randomizes rewards is introduced, our brains continue to seek the dopamine release associated with the rewards.
-The randomizing of the reward in gambling games is a key element. The part of our brain that is designed to detect patterns, solve problems and achieve things goes a little bit haywire due to the non-predictability of rewards in gambling games. Because the reward (“winning”) happens so haphazardly, the anticipation of the reward becomes stimulating. Not only does anticipating a reward become stimulating (and dopamine spew-inducing), simply thinking about gambling or sitting there observing the game becomes stimulating. At least for some of us.
-The human drive to achieve in skill-based pursuits is hijacked by gambling games. This is why normal, intelligent people gamble in -EV situations; the games mimic skill-based problem solving situations. “Near miss” results are especially potent. While near misses portend improvement in skill-based games, they are destructive (and dangerous) in gambling games. Examples of near misses in skill games would be shooting just one stroke over par for the first time in golf, coming just short of the high score in a video game and losing to your older sister by just one point in Scrabble. These results motivate people to continue playing and even to try harder.
-In gambling games, “near misses” correlate with absolutely nothing but nevertheless motivate people to continue playing and “try harder,” just as they do in skill-based games. The gambling game hijacks your drive to succeed and overrides your logical side that way. Examples would be a guy betting a $25 ‘yo’ and watching the dice land on twelve on the next roll, someone betting on a number on roulette and watching the ball land in the very next slot, and the most insidious of all: having the first two reels of a slot machine produce jackpots and watching the last reel brick out. The first two are completely random events that ought to be viewed independently from your wager–the twelve is no different from a seven for the purpose of your ‘yo’ bet, but your brain is telling you that you came close. As for the slot machine, it is actually programmed to produce near misses with enough frequency to keep the dopamine flowing so that the customers act illogically (irresponsibly?). Near misses great the illusion of control in games of chance, and drive gamblers crazy. Or drive them to gamble more. They fry the circuitry. And you wonder why so many people will not shut their goddamn pieholes about all bad beats they’ve suffered? That’s the dopamine talkin’. Junkies.
-Poker is gambling too, and it does the same thing to your brain. The hilarious fallacy that poker is not gambling is torn to shreds by the neurological evidence. You can lionize poker all you want, talk about maximizing expectation and couch the game’s strategies in whatever esoteric terms that you like best. It doesn’t change the fact that when you checkraise the turn with an open ended straight flush draw, get flatted and are left sitting there waiting for the river card to turn, your brain is furiously pumping out the same chemicals that those blue-haired old ladies sitting at the Blazing Sevens slot machines are on. So light up a Virgina Slim and enjoy yourself, you wizard.
What was my point? Oh yeah, that I’ve been going through gambling withdrawal.
Vegas tomorrow. That might help. | <urn:uuid:ffda685d-e0ea-4f91-903f-5775aa31059b> | CC-MAIN-2019-35 | https://davidzeitlin.com/2012/06/04/mincashing-every-day/ | 2019-08-25T11:29:07Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027323328.16/warc/CC-MAIN-20190825105643-20190825131643-00248.warc.gz | en | 0.947687 | 2,214 |
Spin formula India's best bet
An American football coach once had the basic principle of sports writing explained to him by a reporter: "When you lose, we make fun of you. When you win, we make fun of the other guy."
Much fun, therefore, is being made of Australia's bloopers in the Chennai Test and India are spared the pincushion treatment for now. They would hope the respite lasts for another few months at least.
Victory in the Chennai Test has brought relief rather than fist-pumping 'payback' celebration. Three Tests and three months of introspection lay between India's last Test victory in Ahmedabad against England and the Chennai Test. This was a victory they needed as much as they wanted. It was eked out through a fairly simple formula, one that India hopes will keep working through the rest of the series.
Chennai was dusted and done, in that order, 90 minutes into day five. After MS Dhoni's brutal double-century on Sunday, the Indian spinners brought their brand of business into play on day four. R Ashwin, Harbhajan Singh and Ravinder Jadeja ran through the Australian batting on a track that spat, bit and either leapt with venom or sizzled with zip.
This is the way this series is going to go, in all likelihood. The focus is on pitches that will allow India to successfully play three spinners, including Jadeja. As long as their batsmen can hold out (Dhoni did far more than hold out in Chennai, he led a surge) and the inexperienced Australians keep sweating, India will control the series.
It is, it appears, India's best chance of securing a result that stays true to script and overturns their own overturning by England.
Before Chennai, India's last Test victory had come on a sluggish surface and led to complaints about the man-hours and sweat-buckets required by India's spinners to get 20 wickets. The turner that was demanded, rather openly, backfired on them in Mumbai after England re-grouped, played Monty Panesar ahead of Tim Bresnan and roared back.
The only similarity between Panesar and Australia's Xavier Doherty is that they are quickish left-arm spinners. Doherty is more of a limited-overs specialist and, not surprisingly, Panesar has played over 100 first-class matches more than him. India will be on the lookout for any copycat approaches from Australia which, if unsuccessful, will no doubt be mocked too.
So far so good. Chennai was originally the venue of the fourth and final Test of the series. The venues were switched around to open the series in the south when it was decided that Hyderabad would host the second Test instead of Kanpur (Cricket Australia had expressed dissatisfaction over the facilities in Kanpur). The ideal script for India would be Australia heading into a north Indian spring, in Mohali and Delhi, 0-2 down.
VVS Laxman's succinct description on television of what the pitch in his home town for the second Test would be was "hard, firm and crumbling". In the previous Test played in Hyderabad, New Zealand were beaten soon after tea on the fourth day, with Ashwin and Ojha taking 18 of the 20 wickets.
Word from the Indian camp is that injury to one quick bowler after another meant that spin became the only 20-wicket option available to the hosts for this series. One tally even has the number of injured at ten but in real terms the list includes Zaheer Khan, Umesh Yadav, Varun Aaron, Vinay Kumar, Irfan Pathan and a fittish RP Singh (who comes with wishful longing for a 2007 version).
The Chepauk track was called 'decent' by Dhoni and 'typically Indian' by Jadeja, while Clarke said it "looked a lot worse than it played". There were 1243 runs and 32 wickets over four-and-a-bit days, evidence, it was said, of its perfectly respectable nature. What cannot be denied though is that - barring Pattinson's manful effort in the first innings - the pitch largely favoured a type of bowler, rather than give both quicks and slow men their moments over five days.
Ironically, the species of bowler Chennai favoured is the kind that is sadly going out of vogue in India to the point that the national selectors couldn't find a surprise newcomer to throw into the mix. Laxman's estimate of the number of quality spinners - and he knew how to play them - in the country numbered at "seven or eight", rather than the "two or three per domestic team" that he remembered running into in the 1990s.
To say that a dry, slow, crumbling, unpredictable pitch equates to what other sides do - play to the home team's 'strength' - is somewhat misleading. If India had more confidence in the spinners they consider their 'strength', the surfaces would not require, as the Chennai curator delightfully explained in the Indian Express on Wednesday morning, "selective watering". This is more a reflection of India's limited options and the weakness of a new, raw generation of Australian batsmen. And not wanting to be made fun of.
Sharda Ugra is senior editor at ESPNcricinfo | <urn:uuid:0e06f765-cf48-458b-a92e-725f3b28f5e7> | CC-MAIN-2015-18 | http://www.espncricinfo.com/india-v-australia-2013/content/current/story/622872.html | 2015-05-05T05:29:20Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1430455235303.29/warc/CC-MAIN-20150501044035-00026-ip-10-235-10-82.ec2.internal.warc.gz | en | 0.973091 | 1,113 |
I read the other day about the famous duel between Alexander Hamilton and Aaron Burr, the duel in which Hamilton was mortally wounded and Burr politically ruined.
This tragedy is a bit of a mystery. No one can say why, at some point, they didn’t withdraw from the duel. But I have a good guess.
They lacked the humility.
Humility is associated with religious values. It is generally thought to be a private concern. But humility has cross-over value. It is a virtue that is in service to others, because humility is the essence of dialogue. And politics without dialogue is mere tyranny.
A humble dialogue presumes a simple skill. Listening. That simple skill, however, has some demanding habits. The habit of validating the concerns of others. The habit of suspending one’s own bias. The habit of recognizing the full humanity of another. All these have serious implications for civic discourse.
True humility is liberating, because it allows citizens to understand their role within the larger community. In this sense, humility is the quintessential civic virtue.
Civic humility begins in a question. Is public discourse better served by my silence?
Sometimes the answer is yes, sometimes no. But history is not lacking for instances wherein the community, religious and secular, would have been better served by more silence and less chutzpah.
The Catholic Church would be better-off if most bishops had listened to victims of sexual abuse, if bishops had let the justice system do its work.
Iraq would be better-off if Pres. Bush had listened to, well, the world.
Humility might have given our country some insight into the history and culture of Vietnam.
And, yes, Hamilton and Burr might have had many more years of public service if they practiced a bit of humility.
Civic humility is a virtue in service to the local level as well. Aldermen, for example, would be better served by listening to the poor rather than dictating to them.
It is worth taking a moment to note what humility is not. Humility is not a neurosis that leaves one immobile. Humility is not self-loathing. Nor does humility imply that people devalue their insight, lucidity or expertise. Above all else, humility is not a disguised version of pride. Thomas Jefferson didn’t invent democracy. He listened to great philosophers, then took-up his pen.
It is worth repeating that humility is not self-effacement. For example, the G. I. Bill transformed the nation, and this veteran, for one, is glad people spoke forcefully in favor of it. I am equally grateful to the people who listened.
As music is defined by sound and silence, so too is dialogue made-up of respectful speech and humble listening. And I mourn for the loss, these days, of this respect, this humility.
With the exception of the Watergate crisis, I cannot recall a time when the divisions in our country were so rigid and acrimonious. Everybody has the answer, and nobody has the answer. Bishops tell parishioners to sit-down and shut-up, and parishioners tell bishops to sit-down and shut-up. The poor live on one side of town, and the rich on the other. CEO vs. union. The US vs. the UN. Rural vs. urban. Does anyone doubt that, during the next election, there will be vicious attack ads that mislead the public?
Where’s the humility?
A republic is defined by its dynamic dialogue. Such a dialogue presumes the give-and-take of loyal opposition. To put it differently, we are a great nation because we have the freedom of speech. But that’s only the first half of the equation. When we are at our best, when we are at our most democratic, we are a great nation because we have the humility to listen.
And when we think of the leaders we love, when we ponder a Lincoln or a Washington, don’t we love them more for their humility than their army? | <urn:uuid:055ac475-be41-4933-8e80-8ade3e4f37d2> | CC-MAIN-2023-06 | https://coalhillreview.com/a-commentary-2/ | 2023-02-03T00:51:42Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500041.2/warc/CC-MAIN-20230202232251-20230203022251-00441.warc.gz | en | 0.9591 | 846 |
My Brother Sam Is Dead
When I woke up somebody was shouting. I sat up in bed. It was Father. I couldn't hear the words, but I could hear the sound—his heavy, hard voice going on and on. Then there was Sam's voice and he was shouting, too, and then Father again. (1.140)
Then Betsy Read said, "Timmy are you on your father's side or Sam's?"
I wished she hadn't asked me that question. I didn't want to answer it; in fact, I didn't know how to answer it. "I don't understand what it's all about," I said.
"It's simple," Sam said. "Either we're going to be free or we're not."
Betsy touched his arm. "It isn't that simple, Sam. There's more to it." (2.40-43)
I still hadn't made up my mind which side I was on in the war, and I didn't care whether Sam was a Patriot or a Tory or what. All I could think about was snuggling up to him and listening to him talk about scoring telling points. (3.21) | <urn:uuid:73c3046a-f690-4217-bbb2-4967e744e33c> | CC-MAIN-2014-35 | http://www.shmoop.com/my-brother-sam-is-dead/family-quotes.html | 2014-08-27T15:09:50Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-35/segments/1408500829421.59/warc/CC-MAIN-20140820021349-00069-ip-10-180-136-8.ec2.internal.warc.gz | en | 0.996626 | 248 |
When does the 2023 IPL season start?
Friday, March 31
Where to watch the 2023 IPL season
All 74 IPL matches are live on Sky Sports
Gujarat Titans v Chennai Super Kings
Sky Sports Cricket, 3pm Friday
Best bets for the 2023 IPL season
2pts 7-1 bet365, BoyleSports, Hills
1pt each-way 12-1 Hills
- Paddy Power are giving away free bets to new and existing customers and all you need is an account. Sign up here
- Sky Bet are offering new customers multiple free bets when they sign up. Click here for free bets, money-back specials and BuildABet free bets
- Betfair have lots of offers and money back offers. Sign up for a new account here
- To get free bets from Ladbrokes today, simply sign up to a new account here
- Don’t have a Coral account? They have an offer for new customers here
- New William Hill customers can claim free bets and benefit from their daily offers including Scratch Of The Day by clicking here
IPL 2023 season predictions
Gujarat Titans begin the defence of their Indian Premier League title against Chennai Super Kings on Friday but Rajasthan Royals, beaten by the Titans in last year’s final, could go one better in 2023.
Gujarat were one of two new franchises, along with Lucknow Super Giants, who joined the IPL in 2022 and they enjoyed a magnificent debut season, topping the regular-season table with ten wins out of 14 before a seven-wicket victory over Rajasthan in the final.
Captain Hardik Pandya leads a well-balanced side including India batsman Shubman Gill, ace Afghanistan all-rounder Rashid Khan and hard-hitting South Africa finisher David Miller but Gujarat look short enough given the volatility of the Twenty20 format.
The two most successful teams in the IPL’s history – Mumbai Indians and Chennai – finished bottom of the pile last term, both losing ten of their 14 league fixtures, but Rajasthan’s blend of talent and experience should help them shake off their 2022 disappointment.
Captain Sanju Samson is an explosive batsman who has a wealth of tactical nous to draw on with coach Kumar Sangakkara and current or former international captains Jos Buttler, Joe Root and Jason Holder in the Rajasthan set-up.
Buttler, led England to T20 World Cup glory last year, was the leading runscorer in the 2022 IPL, racking up four centuries, and there should be more to come from Indian batsmen Devdutt Padikkal, Yashasvi Jaiswal and Riyan Parag, all aged 22 or younger.
An injury to fast bowler Prasidh Krishna is a blow but Holder, Trent Boult, Ravichandran Ashwin, Yuzvendra Chahal and Adam Zampa provide world-class bowling options for Samson and the Royals are a tempting bet at 7-1.
Mumbai have fast bowler Jofra Archer back fit but Jasprit Bumrah is out for the season and their star-studded top order may be undermined by a lack of depth in the bowling department.
Chennai, led by 41-year-old MS Dhoni, are banking on Ben Stokes recapturing the form that saw him named player of the tournament at the 2017 IPL although a knee problem is likely to restrict his bowling. Sam Curran, another star of England’s T20 World Cup victory, has been snapped up by Punjab Kings, who have not qualified for the playoffs since finishing as runners-up in 2014.
Delhi Capitals and Kolkata Knight Riders are missing injured captains Rishabh Pant and Shreyas Iyer – Pant was involved in a serious car crash in December – while Lucknow and Royal Challengers Bangalore will be hoping to kick on after defeats in last season’s playoffs.
Bangalore’s squad, as ever, is loaded with big-name players as they aim to break their IPL duck at the 16th attempt but Sunrisers Hyderabad, outsiders of the ten franchises, could exceed expectations.
The Sunrisers start a new era under coach Brian Lara and captain Aiden Markram and their strong Indian core is a major positive as only four overseas players are permitted in the playing 11.
Fast bowler Umran Malik caused havoc in last season’s IPL and Hyderabad’s signings include two of the most exciting youngsters in world cricket – England’s Harry Brook and South Africa all-rounder Marco Jansen.
Substitutions are being introduced in this season’s IPL so teams are permitted to bring in an Impact Player, one of the four substitutes named at the toss, during matches. The sub must be an Indian if four overseas players are already in the team. Most bookmakers will settle top runscorer and wicket-taker bets based on the starting 11s, voiding any bets on Impact Players, but bets will stand with Coral and Ladbrokes on Impact Players who bat or bowl.
Indian Premier League team guide
Captains/Key players are from India unless stated
Chennai Super Kings
Coach Stephen Fleming
Captain MS Dhoni
Key players Ben Stokes, Moeen Ali (both England), Ravindra Jadeja, Devon Conway (NZ), Deepak Chahar
Coach Ricky Ponting
Captain David Warner (Australia)
Key players Rovman Powell (WI), Prithvi Shaw, Mitchell Marsh (Australia), Anrich Nortje (SA), Axar Patel
Coach Ashish Nehra
Captain Hardik Pandya
Key players Rashid Khan (Afghanistan), Mohammed Shami, Shubman Gill, David Miller (SA), Kane Williamson (NZ)
Kolkata Knight Riders
Coach Chandrakant Pandit
Captain Nitish Rana
Key players Sunil Narine, Andre Russell (both WI), Umesh Yadav, Shardul Thakur, Lockie Ferguson (NZ)
Lucknow Super Giants
Coach Andy Flower
Captain KL Rahul
Key players Quinton de Kock (SA), Nicholas Pooran (WI), Marcus Stoinis (Australia), Mark Wood (England), Avesh Khan
Coach Mark Boucher
Captain Rohit Sharma
Key players Suryakumar Yadav, Ishan Kishan, Cameron Green, Tim David (both Australia), Jofra Archer
Coach Trevor Bayliss
Captain Shikhar Dhawan
Key players Sam Curran, Liam Livingstone (both England), Kagiso Rabada (SA), Arshdeep Singh, Rahul Chahar
Coach Kumar Sangakkara
Captain Sanju Samson
Key players Jos Buttler (England), Jason Holder (WI), Ravichandran Ashwin, Yuzvendra Chahal, Trent Boult (NZ)
Royal Challengers Bangalore
Coach Sanjay Bangar
Captain Faf du Plessis (SA)
Key players Virat Kohli, Glenn Maxwell (Australia), Mohammed Siraj, Wanindu Hasaranga (SL), Harshal Patel
Coach Brian Lara
Captain Aiden Markram (SA)
Key players Mayank Agarwal, Rahul Tripathi, Umran Malik, Adil Rashid, Harry Brook (both England)
Sign up to emails from Racing Post Sport and get all the latest news and tips
Today’s top sports betting stories
Follow us on Twitter @racingpostsport | <urn:uuid:1dab71f2-73fd-4779-be87-c26feaf24b80> | CC-MAIN-2023-50 | https://www.theheraldnewstoday.com/indian-premier-league-2023-season-predictions-and-cricket-betting-tips-royals-can-claim-ipl-crown/ | 2023-12-01T19:40:32Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100304.52/warc/CC-MAIN-20231201183432-20231201213432-00694.warc.gz | en | 0.91114 | 1,575 |
See I told you, this would help!
- SC = Store Coupon
- MC = Manufacturer Coupon
- SS = Smart Source
- RMN = Retail Me Not
- PG = Proctor and Gamble
- WYB = When You Buy
- B1G1 = Buy One Get One Free
- .75/1 = 75 cents off one item
- .75/3 = 75 cents off three items
- EXP = Expiration Date
This post may contain affiliate links. Read our disclosure here.
Check out these fun Amazon deals from Earth’s Best Baby food, Tide Detergent, Veggie Tales and more! Many of the deals have coupons available plus when you combine them with Subscribe & Save and Amazon Mom, you can get some great deals!
Also, if you have a Facebook friend who is celebrating a birthday in the next few weeks, you can purchase (1) or more gifts through Amazon Birthday Gift for your friend by 9/22. You can get a FREE $5 Amazon credit in return, so make sure to check that out!
Cotton Swabs (3pk) $9 or $3 ea.
Nutiva Organic Coconut Oil (2pk) $5.09 per jar w/ S&S & 15% coupon
Earth’s Best 2nd Fruit Variety Pack 12 pk. $7.55 or 63¢ ea. w/ S&S & 10% coupon
American Girl Scrapbook Kit $13.24 (reg. $32.99)
Tide Laundry Detergent 50 oz (2 pk) $4.04 ea. w/coupon & S&S
Veggietales: All the Shows 10 Disc DVD $32.18 ( reg.$55.56)
Free shipping is available with Amazon Prime or Super Saver Shipping with a $25 purchase.
Remember that Amazon prices change frequently, so verify before you checkout.
See more Amazon deals.
- Latest Articles | <urn:uuid:148e9b06-a7e9-4b57-b40a-e1dfc0c8629c> | CC-MAIN-2018-43 | https://www.southernsavers.com/amazon-deals-2/ | 2018-10-20T23:49:15Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583513508.42/warc/CC-MAIN-20181020225938-20181021011438-00329.warc.gz | en | 0.842196 | 418 |
Free Shipping Outdoor Router
OutdoorRouter.com hires DHL, FedEx, and UPS shipping courier to process the ship the orders of outdoor router. The free shipping services cover over 40 countries including the USA, Southeast Asia, and European countries.
We guarantee the shipment will arrive safely in the destination country. You may need to pay the customs import tax which depends on the destination customs.
Tracking Your Shipment
Once your product leaves our doors, we keep on tracking it until it reaches yours. OutdoorRouter.com customer service team is always working to deal with your demand and query. We track your shipments real-time and are available at your convenience to answer any questions. No matter the issue, we’re always here to serve you.
Delivery Failure Scenarios
If the package is lost, broken, or stolen before it reaches you, OutdoorRouter.com will re-send the goods or give a full refund. In practice, such cases are sporadic, perhaps 1 in 5000 shipments, when using courier services. Please note confirmation of such situations can take some time, so in such an event you may be advised to place a new order at your expense while the original shipment is investigated pending compensation.
If you receive products in a damaged condition, in such a scenario you must raise the issue immediately with the courier or delivery company. Through the correct reporting process, the goods can be handed back to the courier and OutdoorRouter.com will send new goods or give a refund. If you do not immediately follow the carrier’s reporting procedure, and thus no adequate documentation is available to prove the goods arrived damaged, we will offer advice on a case-by-case basis about whether you can return the goods for replacements or a refund.
If a shipment is a delay, turned back, or seized by Customs and the customs issue was your responsibility, you are liable. If the failed delivery were due to mishandling by OutdoorRouter.com, you would receive compensation when resolving the case. Such cases are unusual, but it is important you are aware of your responsibilities in such a situation.
General Delivery Failure Cases Where You Accept Liability
You (or the consignee) must take delivery of the goods and comply with any applicable procedures/charges from your local Customs.
If the delivery fails because:
You were not at home, or the courier could not contact you
The delivery details were wrong
The recipient fails to accept the goods
The carrier cannot satisfactorily verify
The identity of the person attempting to receive the goods
The courier cannot deliver to a remote area or invalid address delivery fails due to war, disaster, etc
other similar scenarios beyond our control
There are also several situations in which you accept liability when the goods do not arrive due to customs issues. | <urn:uuid:bcb92509-b4c7-4fe7-bc11-1c5a42408602> | CC-MAIN-2019-13 | https://www.outdoorrouter.com/free-shipping-outdoor-router-service/ | 2019-03-24T19:52:34Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912203491.1/warc/CC-MAIN-20190324190033-20190324212033-00081.warc.gz | en | 0.948855 | 574 |
Meeko My Sugar Glider with some Oak Leaves Meeko playing with some Oak Leaves from a fresh cut tree.
1 Carlshamn Oakleaves vs Hässleholm Hurricanes Short Screenpass. Nice move by Ryssen (#28) Short gain!
Natural Food Preservation Using Oak Leaves Project Natural Food Preservation Using Oak Leaves Project 219 at the Michigan Tech Undergraduate Research Expo; More info: www.expo.mtu.edu
Oak leaves of the Pine Barrens, part 2 In this video, I show and describe the leaves of a few more species of oak from the Pine Barrens, and then describe the Fall coloring and other things about them before finishing up. Part 2 of 2.
Many yellow oak leaves falling, water dripping
Knights cross holders with Oak Leafs and vet 3 officer in EuropeinRuiins Testing t3 doctrine choice and vet 3 upgrade.
Carlshamn Oakleaves exhibition match
Why red oak leaves yellow in summer: Central Texas Gardener Guy LeBlanc Why are your red oaks turning yellow in summer? Arborist Guy LeBlanc explains how red oaks suffer from iron chlorosis and how to correct it. He also identifies nitrogen deficiency and how to tell which problem affects your trees.
Carving Oak Leaves and Acorns This is an overview of a carving I did in a large Oak newel post. It was a very intricate carving in a very challenging medium.
Belleplain State Forest oak leaves slideshow See if you can ID these leaves. This forest (as far as I can tell) contains White Oak, Black Oak, Spanish Oak (also called Southern Red Oak), Post Oak, Willow Oak and possibly Scarlet Oak. There were some leaves that could have been either Chestnut Oak, Swamp White Oak or Swamp Chestnut...
Dukes u13 tourney , Final. Carlshamn Oakleaves vs Arlanda Jets Part 2 Dukes u13 Tourney, The final match. Carlshamn Oakleaves vs Arlanda Jets Part 2
Skövde Dukes Tourney, Carlshamn Oakleaves vs. Stockholm MeanMachines. Part 1 Skövde Dukes Tourney, Carlshamn Oakleaves vs. Stockholm MeanMachines. Part 1 Peewee
THE BASICS by Paul Byron Downs - How To Make an Oak Leaf Wreath In this video, Paul Byron Downs will demonstrate how to create a wreath frame and festive Autumn wreath made of Oak Leaves.
2 Carlshamn Oakleaves vs Hässleholm Hurricanes Nice return by Hurricanes Nr 30!
Daphne figures out skeletonized oak leaves: Central Texas Gardener Are your leaves a little see-through? Is it a fungus, an insect or what? Get Daphne's answer on this common leaf problem. Featured plant: Gregg's blue mist flower Eupatorium/Conoclinium greggii, a perennial groundcover that attracts all kinds of butterflies, especially Queen butterflies.
3 Carlshamn Oakleaves vs Hässleholm Hurricanes Robert (Me) short gain! Nice block by Ryssen (RB)! www.oakleaves.se
HANS ULRICH RUDEL STUKA KANONENVOGEL GOLDEN OAK LEAVES SWORDS
Mulching Live Oak Leaves With The Grasshopper 329 61" mower Groundskeeper,LLC, Andrew on Mower, Jonathon Abrahams Owner, Grasshopper Mower 329 bigblock 29hp Vangaurd
WHEN OAK LEAVES CLUSTER, BELIEFS FALL ... this is one of my favourite visions because of Lisa Gerrard.. a strong and inspiring voice from the BooK of KeLLs... the OriginiL text of the Fair E folk .. .. this should give you a fair idea of what i stated when i first came onto the Net... i call it Indra's Net ... the Truth is very simple but people are in the habit of 'gilding the lily' .. needless and confusing details that bury the message and the vision... 'the Devils in the Details' ... details details.. .. in my Universe there are no children produced through this method of dividing the Spirit each time male and female unite... A man's 'sword' is made of gelled light.. and it's the same colour as ivory .. in fact it even looks like an elephants tusk... to give life to another being one must be overflowing in light to give a child his birthright.. eternal life without constantly dying and forgetting all that has gone before... .. i've even heard people say that they were happy they weren't gods because .. O it's so grand to have all this variety of experience .. blah blah blah.. the ignorant grunting believing themselves superior in their rationalizations.. it's wears very thin after a few moments of that tripe.
Dukes Tourney peewee, Carlshamn Oakleaves vs Arlanda Jets Part 1 Carlshamn Oakleaves vs Arlanda Jets Part 1
Carlshamns Oakleaves American Football, Swedish Junior u-13 team playing Carlshamn Oakleaves vs. Limhamn Griffins Carlshamn Oakleaves vs. Göteborg Marvels
Dukes u13 Tourney, Final. Carlshamn Oakleaves vs Arlanda Jets Part 1 Dukes u13 Tourney, The final match. Carlshamn Oakleaves vs Arlanda Jets Part 1
Oakleaves Senior vs U17 träningsmatch
Slideshow- Pine Barrens oak leaves Here is a slide show of the leaves of all the common oak trees of the New Jersey Pine Barrens. The leaves are from my collection. Some I've had for several years. There are 9 1/2 inches of the ruler visible in the photos. This should give you an idea of the size of the leaves. 1) Scrub Oak- Quercus ilicifolia, a shrub 2) Spanish Oak- Quercus falcata 3) Blackjack Oak- Quercus marilandica 4) Chestnut Oak- Quercus prinus = Quercus montana (my pine barrens field guide says they are one in the same) 5) Post Oak- Quercus stellata 6) Willow Oak- Quercus phellos (not listed in my pine barrens field guide) 7) Scarlet Oak- Quercus coccinea 8) White Oak- Quercus alba 9) Black Oak- Quercus velutina 10) Possibly Saul's Oak, a hybrid, but I'm still not sure. I've found the trees growing in at least 3 places in the wild. All have leaves like in the slideshow. There are 9 species of oak trees represented here (including one hybrid), plus Scrub Oak, which is not a tree but a shrub. I did not put in captions of the species names.
Tawny Owl eating oak leaves Our first rehabbed owl, Owly, shown about an hour after his release in July 2003, appearing to tuck into some oak leaves. Apologies for the inane commentary -- we'd been filming for some time and most of the time he was doing . . well, nothing very much at all. He was just over 3 months old at the time. This should be compared with the movie of Stripey the Great Horned Owl eating grapes, also on my channel. You could say that for carnivores these owls sometimes consume some very strange things. All three young tawnies I've looked after have enjoyed and even stolen fruit. Owly's younger sister, Sophie, used to fly off with nectarines in her talons and usually managed to eat at least half before abandoning the shredded fruit. Strawberries are another favourite. Going back to Owly in this video, I once found a pellet, probably dropped by his mother, that appeared to consist entirely of fragments of oak leaves.
Skövde Dukes Tourney, Carlshamn Oakleaves vs. Stockholm MeanMachines. Part 2 Skövde Dukes Tourney, Carlshamn Oakleaves vs. Stockholm MeanMachines. Part 2 Peewee
Battlefield 2: Irishpride vs Oakleaves Irishpride Vs Oakleaves The Game is Battlefield 2: Modern combat, all footage is taken from Online Gameplay and includes Infantry footage, Jet footage, Guides, tips & tutorials. Some videos may also include Stunts, glitches, choppers/helis & armour.
Dukes Tourney peewee, Carlshamn Oakleaves vs Arlanda Jets Part 2 Carlshamn Oakleaves vs Arlanda Jets, First match Part 2
My Oak Leaf collection I dont have much, but I have mostly Blackjack and Post Oak leaves since they are my favorites. I also show you that Pitch Pine cone I found today. Sorry about the poor lighting, I should have done this video when it was still light out, I guess.
Fire drill at the Oak Leaves The fire alarm went off at the Oak Leaves World Headquarters at 11:50 am June 23, 2009. We evacuated. John P. Huston took some video. Don't worry. There was no fire. But it was terribly exciting. And by "terribly exciting," I really mean, "a complete waste of time." For more, visit
4 Carlshamn Oakleaves vs Hässleholm Hurricanes Robert (Me) sending a guy to get me a hotdog! www.oakleaves.se
CM #110 - Acorn Oak Leaves - How to Cut Creative Memories Cheerful Seasons Cricut Cartridge Hello and thank you for stopping by :) In this video I show the Cheerful Seasons Cricut Cartridge acorn and oak leaves die cuts. I make the cuts on the Cricut Expression. The same cut will work on a Create or regular Cricut. The paper I use for each layer matches the handbook, so it is easy to see the different layers. The layers are separately and then layered together. The Size Dial is set at 3". Colors: 1. The shadow is green (Cactus). 2. The base cut is orange (Carrot). This is the color that covers over the shadow. This cut provides the vien color for the leaves. 3. The red is the color for the leaves. The leaves have the viens cut out to show the base underneath. 4. The brown is for the top of the acorns only. It is the smallest cut. For a 3" Dial Size, I thought the cut was "small". Thank you for joining me. You can contact me on my blog for more information on this Cricut Cartridge. Thank you for joining me :) Lisa at
Rockets cup Oakleaves vs Oaks
Oak Leaves (2004) A better future awaits! Animation and Editing by Noah Albert.
carlshamns oakleaves a tribute to my home team the carlshamn okaleaves :D:D:D:D:D music = iron maiden - wasted years
Wet Oak Leaves No Problem 4 the Dooly TwindStorm Dooly with wet oak leaves : Visit Web @
Carlshamn Oakleaves, Swedish champions. u13 A little movie I made about my team at 2009 when we won the Swedish Championship.
Post Oak leaves In this video I show several leaves from a Post Oak tree in our yard next to the woods. Post Oak is one of the native oaks of the New Jersey Pine Barrens. This video goes along with my previous oak leaf videos.
John Voight Knight's Cross with Oak Leaves (~ ODESSA file) John Voight in the Odessa File - Key scene: Knight's Cross with Oak Leaves (mit Eichenlaub) Beer drinking song "Schwarzbraun Ist Die Haselnuss. (Dark brown is the Hazelnut) Story based on events after WWII. IMDB says... If it's not as good as Forsyth's book, the film suffers from the same faults. The improbability of the scenes grows more apparent with repeat viewings, but a first-timer will likely be too involved much of the time to pay this much mind. And, like the novel, "Odessa File" the movie has a good heart. And what an ending! Don't let anyone spoil that for you, if you are the least bit tempted about seeing this; see it for yourself. Jon Voight ... Peter Miller Maximilian Schell ... Eduard Roschmann Eduard Roschmann was a real-life wanted war criminal living in South America. He became even more wanted after the book and movie, and he turned up dead, rumoured to have been killed by Odessa to stop the search for him that the media had begun. He died in 1977. The real Edward Roschmann (also Eduard Roschmann) (25 August 1908 - 10 August 1977) was an SS commander, holding the rank of Hauptsturmführer and one of the heads of the concentration camp at Riga, used to persecute German Jews. Infamous as "The Butcher of Riga," Roschmann was sought for war crimes and remained a fugitive for the rest of his life. Hiding for the most part in Argentina, Roschmann is speculated to have been a leader of the post-war ODESSA network of fugitive SS officers. The Iron Cross is solely ...
Oak leaves of the Pine Barrens, part 1 In this video I show you and describe the leaves of a few species of oak that are native to the New Jersey Pine Barrens. Part 1 of 2. I apologize if my hands or fingers look dirty. But I'm always in the dirt! lol | <urn:uuid:12564f4f-43ef-439e-8a7a-90dc13726e8d> | CC-MAIN-2017-47 | http://crosswords911.com/oakleaves.html | 2017-11-20T19:18:02Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934806124.52/warc/CC-MAIN-20171120183849-20171120203849-00673.warc.gz | en | 0.923262 | 2,862 |
RSS Feed | iTunes
Receive free advice, how-to videos and recipes from Moti!
He'll tell you what you can do:
Iraqi Food Recipes
Q & A:
out what else is sooo good...
Tip. Hover your cursor over a recipe item to see
Appetizers and breads that are sooo
Rice dishes and side dishes galore
From the frying pan:
Things that are stuffed:
Soups and stews :
Desserts from the ol' | <urn:uuid:a71a33ef-8c0c-4af3-a445-fe05495ed436> | CC-MAIN-2018-34 | https://www.sooogood.org/recipe.html | 2018-08-15T07:42:46Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221209980.13/warc/CC-MAIN-20180815063517-20180815083517-00450.warc.gz | en | 0.849397 | 110 |
- ALREADY SUBSCRIBED?
Fill in your credentials below.
The world is a big place, but when you are looking to settle down somewhere—and this time without work-related constraints—you tend to quickly eliminate certain countries because they are too remote or too cold or too unstable or too foreign from your own culture, and pretty soon you realize that the world is not so big after all.
Early retirement allowed us to anticipate another 25 to 30 years of life, so why not look for a pleasant place to make the best of what was left? Our natural inclination directed us toward Southern Europe (France, Italy, Spain) and a point-by-point comparison led to France. Not so much because we were sure that this was the best of all possible worlds but because we felt it was worth a try. If it turned out to be disappointing we could always make another choice.
Culture, pleasant climate, natural beauty and easy access to international travel were all “conditions” in our search, but above all we looked for quality of life—seemingly simple, yet so hard to find, especially in the richer countries where money buys a certain level of comfort that might be confused with quality of life but often fails to provide that most important ingredient of all: freedom of worry.
We found it in Provence where all our conditions were met, and then some. Passing up the pleasures and burdens of the countryside, we looked for a city and chose Aix-en-Provence. This small city is more sophisticated than we thought, more international in scope, and rich in culture—the world-class Opera Festival alone worth the price of admission. Being half an hour away from the Mediterranean is an added benefit, as is the relaxed pace of the place. This is the slow lane, all the better to enjoy the beauty and pleasures that surround you, such as the daily markets where we do our hunting and gathering every morning, or the mills where we buy our olive oil and the chateaux where we buy our wine.
One unexpected gift was the discovery of the French national health system, which some people have called a model to the world. Health care is considered a right, not a privilege, and should be accessible and affordable to all. The French Sécurité Sociale makes sure that it is. As foreign residents in this country with American health insurance, we have both had the “pleasure” to compare the two systems in minor and major ways, and have nothing but praise for what we found here: excellent care at a fraction of the cost we used to pay, and doctors who still make house calls! Prescription drugs are often so inexpensive that we do not bother to send in our bills for partial reimbursement. This, too, is quality of life.
One day we had a car accident here when a distracted driver ran into us. He immediately admitted it was his fault, but in a reflexive gesture I flagged down a passing gendarme expecting him to write an accident report for our insurance. “Is anybody hurt?” he asked, and when I answered “No” he said “Alors?…” and got back on his motorcycle. In a collision such as ours (more than a simple fender bender, two doors to be replaced), the two drivers concerned simply complete an insurance form (to be carried in every car), agree on the facts and sign. The insurance companies do the rest. Our car got repaired and I never saw a bill. No need for lawyers.
My French friends react with surprise when I marvel at all of this. “C’est normal” they say, and of course it is. It’s just one more of those things (like affordable education and health care) that enhance the quality of life in these parts and that are totally taken for granted.
Sometimes the French don’t seem to know how good they have it, but—keep it under your hat—we do. More than ten years after settling here, fluent in the ways of the locals and a French driver’s license in our wallet, we can confidently say that our choice of Aix-en-Provence was the right one. We are definitely chez nous.
Anne-Marie Simons has worked as a translator, teacher, journalist, sportswriter (covering Formula One races) and director of corporate communications. Now happily retired, she lives in the south of France. | <urn:uuid:28a3b08d-6903-42f5-bd18-af4086c1e79d> | CC-MAIN-2022-49 | https://bonjourparis.com/archives/why_provence/ | 2022-11-28T18:35:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446710534.53/warc/CC-MAIN-20221128171516-20221128201516-00410.warc.gz | en | 0.96875 | 942 |
I lead Arup's energy business in the UKMEA...
How do you decide on the perfect energy source to meet all your future needs?
Anyone familiar with the global energy debate knows it can be impenetrable, volatile, subtle and highly complex – often simultaneously.
Yet at its heart lie three basic issues – affordability, security and climate impact.
It is this ‘trilemma’ that keeps engineers, economists, environmentalists, NGOs, politicians and consumers in a constant state of heated debate as the parties argue their case for the best way of meeting our energy needs now and in the future.
It is certainly a tricky balancing act. People worried about carbon emissions argue for greater use of nuclear, solar, wind and tidal power to reduce our reliance on fossil fuels and keep the spirit of the Kyoto Protocol alive.
Anyone interested in geopolitics will point to arguments over energy security; the influence of OPEC; or the ability of certain states to turn off the gas taps if they don’t feel that they are being accorded enough respect, to take just a few examples. In these cases, they might favour domestic solutions such as hydro, coal and shale gas where available.
And pity the poor consumers who have to pay for it all. Over the generations we have been told that practically limitless free energy lies just around the corner, if only the technology can just be refined for nuclear fusion / fission / solar / wind / biofuels (delete according to age / location).
All this while populations in many regions worry more about whether they can even afford energy to cook or heat their homes rather than how it might impact climate change effects or be vulnerable to geopolitical insecurity.
Like Goldilocks’ porridge, the best energy must not be too expensive, not too unreliable and not too carbon intensive. Unlike Goldilocks, however, few are likely to see a fairy tale ending to this story any time soon.
For most of us in the real world, the only answer to meeting our future energy needs lies in diversity. A balanced energy mix that provides affordable, reliable energy that is sourced with an appreciation of the trade-offs needed to tackle climate change.
Utilising a sensible mix of energy resources means making well thought out, hard-won compromises and creating bespoke solutions tailored for specific geographies and markets.
So in the US, the shale gas revolution is important in providing affordable energy at a time of insecurity across many of the oil-producing nations of the Middle East.
In the UK, solar and onshore and offshore wind are essential. Yet it is only as part of a diversified energy mix that they can consistently deliver in conjunction with a reliable base load, whether that is from nuclear, natural gas, shale gas or coal utilising carbon capture technologies.
And in the emerging economies of Asia and Africa there is huge potential for low carbon, inexpensive energy solutions, but they must be viewed in conjunction with optimising the balance between all three elements of the ‘trilemma’, affordability in particular.
Of course, the best answer of all must not be overlooked when it comes to meeting our future needs – that is for everyone to become far more energy efficient while building dynamic links between the supply and demand sides of the energy equation to increase their mutual efficiency.
If we can all do more to improve energy-efficiency standards in buildings and infrastructure and reduce the amount of power needed to run our appliances, homes, offices, vehicles and cities, we will have gone a long way toward easing our current trilemma.
Reducing energy consumption and boosting efficiency is the best way to decouple growing populations and increasing power consumption.
And this is a point that needs no mixed messages. | <urn:uuid:cbd50a98-582b-4e7b-832a-fda864270bb7> | CC-MAIN-2016-18 | http://thoughts.arup.com/post/details/282/solving-the-energy-trilemma | 2016-04-30T03:24:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860111592.84/warc/CC-MAIN-20160428161511-00099-ip-10-239-7-51.ec2.internal.warc.gz | en | 0.938572 | 762 |
Physicians in Auburn Hills, MI
Comprehensive list of Auburn Hills, Michigan physicians, doctors & medical clinics, centers and hospitals.
Welcome to the Auburn Hills, Michigan, office of Dr. Michael Milan, an experienced Board Certified plastic surgeon! Dr. Milan is recognized as a professional in breast augmentation, tummy tucks, facelifts, eyelid surgery and liposuction. He constantly stays educated on the latest developments in plastic surgery so he can bring the finest to his patients in the suburban Detroit area.
Welcome to the home page of Wilkinson Eye Center an eye care supplier you can trust! We care about your precious gift of sight and it is our mission to improve your quality of life by delivering the highest standards of complete eye care services. At Wilkinson Eye Center our doctors have been delivering care in Oakland County for more than forty years.
- Actually, if I remember correctly, I've only seen the optometrist here, and it was for
Expertise, caring, and quality go hand in hand. Therefore, we encourage you to examine the qualities of our group members. From your 1st visit to our office or your 1st visit by one of our surgeons or nurses in the hospital, we trust that you'll find compassion, caring, and insight from us to assist you or your family member through what can be an unknown or scary time.
Dr. Bahu grew up in the Detroit area, his father was a life long auto worker, and his mother a housewife. With a modest background, his parents stressed the importance of higher education and instilled a tremendous work ethic in their sons. He followed in the footsteps of his 3 older brothers who are all physicians practicing locally in and around Detroit.
Our practice was set up in 1978 to supply urological medical services to men, women, and kids of all ages. Our practice is committed to improving the quality of life and reaching to cure potentially fatal illnesses. The health care and comfort of our patients always comes 1st. Everything that we do is committed to the health and well being of our patients.
Get top-quality health care and other medical services at The Rochester Hills Medical Center. We aim to provide our patients a prompt and pleasant experience. Our compassionate and competent clinical team is ready to help you with prompt medical care. From physicals to pain management, our expert team is here to supply high-quality treatment at an competitive price.
ARC is the proud vision of its partners and surgeons. Founded in 1971, we're one of the biggest retina subspecialty practices in the US, with 15 doctors practicing in 14 locations across Michigan. The information on this website is offered in the spirit of making ARC user friendly.
The Rochester Center for Behavioral Medicine RCBM brings together a staff of more than a dozen mental health specialists with a huge range of clinical backgrounds and interests. Our approach is based firmly on an integrated psychiatric and behavioral model and we provide complete diagnostic and treatment services for kids, adolescents, and adults. | <urn:uuid:0e72fc63-0914-40ae-96af-1d7f0bd29997> | CC-MAIN-2021-39 | http://www.allpractices.com/in/auburn-hills-mi | 2021-09-27T11:06:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780058415.93/warc/CC-MAIN-20210927090448-20210927120448-00564.warc.gz | en | 0.956943 | 611 |
You are your brand! Your personality, your fashion sense, your talk, your walk, all these things make up who you are and how you present yourself to others. So, the question is.. how are you presenting yourself to others? How is your brand being advertised?
Most people say, “I don’t care what other people think of me.” “I’m my own person.” Great, you have a strong enough mind to not let the opinions of others influence or dictate your life, but lo siento (I’m sorry) to break it to you, you care. Your reputation is very important, how people precieve you is very important. Now, don’t get me wrong be you and be happy in the midst of doing you, but know that others are watching.
Have you ever heard people say, “she wouldn’t do that” or “that sounds just like something he would say” ? That’s because those people have set their brand high enough where their advertisement is engraved on the minds of people who know them.
Your entire being makes up your brand! Don’t like what you’re advertising? You, and only you, have the ability to change it, to change what others see from you. Think of yourself as a business. You should only want the best for your company, you should make sure that marketing is being well advertised, that the proper research is being handled to improve the establishment as a whole and that people know your brand!!
Let’s put it like this, you are on the most important interview of your life, show them the best you that you have to offer!!
Have a fantastic day people! 🙂 | <urn:uuid:36d3fe6a-1182-44e3-8607-18b8f84d9d07> | CC-MAIN-2017-34 | https://justalkblogs.com/2016/07/13/who-are-you/ | 2017-08-20T17:29:44Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886106865.74/warc/CC-MAIN-20170820170023-20170820190023-00042.warc.gz | en | 0.973361 | 365 |
By adopting a sliding disk cover, the new PS3 continues with the characteristic sleek curved body design
Sony Computer Entertainment (SCE) has announced that the new PlayStation 3 (PS3) computer entertainment system (body color: charcoal black / classic white), featuring a new design and a downsized form factor, is now available across Europe. The new PS3 comes in 3 models including extended built in Hard Disk Drive (HDD) capacity of 500GB model and 250GB model, and a newly added 12GB flash memory model initially for Europe only.
Thanks to a complete redesign of the internal architecture, the volume and weight of the new PS3 has been reduced by more than half compared to the very first PS3 model with a 60GB HDD, and by 20% and 25% respectively compared to the current PS3. A video showing the new PS3 is locally mirrored. | <urn:uuid:f428dd43-fcce-4b33-8284-f974f2353225> | CC-MAIN-2015-18 | http://www.gamershell.com/news_143835.html | 2015-04-25T17:21:31Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246650195.9/warc/CC-MAIN-20150417045730-00259-ip-10-235-10-82.ec2.internal.warc.gz | en | 0.936781 | 178 |
0847 Tokio Jockstrap is perfect for the guy who likes a sporty-meets-sexy style, incorporating a low rise, lean cut brief with a cut-out back that mimics the straps of a jockstrap. You're left with a look that's body flattering and oh so sexy, perfect for any occasion.
Hand made in Colombia - South America with USA and Colombian fabrics. Please refer to size chart to ensure you choose the correct size.
Composition: 96% Polyester 4% Spandex. Stretch sports mesh provides semi-sheer coverage and superior breathability.
Wide elastic logo waistband. Unique hybrid design of brief and jockstrap features cut-out back. | <urn:uuid:a247709d-25e4-4817-ac23-12098eb4e5a6> | CC-MAIN-2019-47 | https://mpiremen.com/collections/underwear-jockstraps/products/jor-0847-tokio-jockstrap | 2019-11-17T03:41:08Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496668782.15/warc/CC-MAIN-20191117014405-20191117042405-00053.warc.gz | en | 0.866795 | 147 |
A new variant of the Sober worm emerged over the weekend and is spreading, primarily in German-speaking countr...
By submitting your personal information, you agree that TechTarget and its partners may contact you regarding relevant content, products and special offers.
Antivirus vendor McAfee and e-mail filtering outsourcer MessageLabs Inc. said that 80% of Sober-C infections are coming from Germany. The mass-mailing worm does not carry a destructive payload, and it can send messages in either English or German.
McAfee has rated the worm as a medium risk. Antivirus software vendors Symantec Corp. and F-Secure Corp. each have it as a level 2 risk.
Sober-C is a straightforward mass mailer. It sends copies of itself as an attachment to an e-mail message and attaches with one of the following file extensions: .bat, .cmd, .pif, .scr, .exe and .com.
Administrators are urged to update their antivirus signatures and block the offending file extensions in order to avoid infection. Sober-C attacks systems running Windows 2000, Windows 95, Windows 98, Windows Me, Windows NT, Windows Server 2003 and Windows XP.
The worm uses a variety of subject lines, message bodies and attachment names. It searches infected machines for e-mail addresses from a variety of files, including cached Web pages and Microsoft Word documents. If an address contains a domain that may be a German-speaking country, like Germany (.de), Austria (.at), Belgium (.be) or Switzerland (.ch), then the worm mails itself with a message written in German.
The first time the worm executes, users see a bogus error message with the subject "Microsoft" and the text "
Bilingual worms are not new. In May, Fizzer-A used German, English and Dutch subject lines and messages to entice people into opening the attached worm. Sober-A also arrived with English or German subject lines and pretended to be a fix for a bogus worm.
The English message text should make most users suspicious, because English doesn't appear to be the creator's first language. Some messages offer free games; others warn recipients that their systems are insecure. Others purport to come from law enforcement agencies investigating software piracy. | <urn:uuid:bd83836a-93dc-4f8e-9573-00b3e4106e31> | CC-MAIN-2017-22 | http://searchsecurity.techtarget.com/news/942306/Sober-C-worm-speaks-German | 2017-05-23T10:51:38Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463607620.78/warc/CC-MAIN-20170523103136-20170523123136-00477.warc.gz | en | 0.895152 | 476 |
PRIMA PAINT v. FLOOD & CONKLIN
Legal provision: 9 U.S.C. 1
Argument of Robert P. Herzog
Chief Justice Earl Warren: Number 343 Prima-Paint-Corporation petitioner versus Flood and Conklin Manufacturing Company.
Mr. Robert P. Herzog: Mr. Chief Justice, may it please the Court.
A milestone in constitutional law was reached by this Court in 1938 when it held in Erie against Tompkins Railroad Company that in cases involving disputes between citizens of different states the Federal Court hearing such a case will settle the case on the basis of the applicable state substantive law.
This ruling was made to inform uniformity, that we show uniformity of decision in litigation.
This case brings again the problem of Erie before this Court and in particularly, it's application to the Federal Arbitration Act and contracts concerning that Act in litigation between citizens.
The facts in this case are that these bodies entered into a contract, an employment contract, which contained the an arbitration clause.
The petitioners subsequently discovered or alleged that it had been fraudulently induced to make this agreement.
The petitioner instituted an action in the Court below in the Southern District of New York alleging equitable fraud and sought a recession of the contract.
The jurisdiction of the Court below was based solely upon diversity of the parties and jurisdictional amount.
The respondent had immediately prior to the institution of this action demanded arbitration pursuant to the statutes and laws of the State of New York, Section 7503(c) of the New York State Civil Rules and Procedure.
The Respondent additionally has disputed throughout these proceedings the factual allegations of fraud made by the petitioner.
These factual allegations pertinent here is that the petitioner would have never made this contract, had it had not been for the representation by the respondent that it was a solvent corporation?
Seven days after the respondent and petitioner made this contract the respondent filed a voluntary petition in Chapter 11 in the District Court of New Jersey, and suffered a receivership of its property.
In fact the agreement which was signed on October 7th had been accelerated at the request of the respondent, and seven days later a Chapter 11 proceeding suit and receivership.
In the federal action, which the petitioner brought motions were made simultaneously with its institution.
A motion was made by the petitioner under the Federal Rules of Civil Procedure to stay the demand for arbitration.
This was required because New York Law or under the Law of New York petitioner would have been substantively prevented from challenging the validity of the contract.
The respondent made a cross motion to stay the Federal action and on the other hand compelled arbitration pursuant to the arbitration clause contained in the contract.
Thus the essential question presented here is what tribunal in the first instance is going to investigating the site, a preliminary threshold question of fraud, will it be a Court of Law or it will be an arbitration panel.
The differences I don't think are pertinent at the moment because this Court in Bernhardt and in Wilko v. Swan has gone into the radical difference between arbitration in a Court of Law and the substantial effect that each tribunal can have on the result and outcome of the course of action.
The courts below in this matter have uniformly applied the precedent established by Judge Medina in the Second Circuit in the case of Robert Lawrence Company versus Devonshire Fabrics.
This case is incidentally is in conflict with decisions in the Sixth and Ninth Circuit and has been criticized by the First Circuit for some of its proposition.
Judge Medina in the Lawrence case, and I should say the courts below invoking the Robert Lawrence proposition against the petitioner here relegated the petitioner as a matter of federal substantive law to the arbitration panel.
The question of the very validity and existence of this contract and whether the petitioner would have made and entered it was therefore to be decided by the arbitrators under the clause in the contract.
This proposition of law is contrary to the Law of state of New York where this diversity action was prosecuted.
Now Judge Medina reached this result by the following legal reasoning in the Lawrence case.
The reason that the Federal Arbitration Act created national substantive law and to support this substantive -- national substantive law because it would conflict or clash with the Erie doctrine, he devised a doctrine of separability of the causes of the contract.
He reasoned that Congress intended or referred to in an Arbitration Act as an agreement to arbitrate that, that meant the very clause.
Through this reasoning he claimed that the contract to arbitrate was separable provision and therefore if you do not allege a fraud as to the clause, then a fraud as to any portion of the agreement, no matter what materiality it had, no matter what the reliances, you are relegated to the informal tribunal of arbitration, notwithstanding the contrary state law which Judge Medina recognized at that time at 1960 to be that a fraud permeates the entire agreement and a fraud as to any other portion of the agreement would therefore -- therefore the whole agreement would fall completely.
The second reasoning, he said it was clearly constitutional and the petitioner says that this result of Judge Medina's which conflicts with the Erie principle is obviously unconstitutional, in that you put a premium on the fact that these parties were of diverse citizenship and that further you encourage forum shopping and all the resultant wrongs that Erie sought to correct and third, petitioner asserts that Judge Medina notwithstanding Section 4 which set up a whole procedure for a preliminary hearing on the question of validity of contract said as a matter of law and we feel that he violated the whole intent of Congress in cutting out this problem of a hearing effectively the only hearing you can have under Judge Medina's proposition is if you alleged fraud as the arbitration clause, you don't allege any such fraud, any other issues for the arbitrators.
We submit that Judge Medina's legal reasoning is erroneous and conflict with -- except to constitutional limitations announced by this Court.
Now a preliminary question, we recognize and which is one of the issues here is that in order for the Federal Arbitration Act to apply in the first instance, the Court my preliminarily make a determination that the contract evidence as a transaction and interstate commerce or a maritime transaction which is not the issue here.
The petitioner maintains that this contract is a mere employment contract and the contract speaks for itself and for that reason, I will not venture in to this point, I think the briefs are adequate on it.
But we continue to say and we move to the second proposition assuming this Court were to find that this case is not four squared in point with Bernhardt versus Polygraphic Company of the United States.
That decision of 1956 written by Mr. Justice Douglas held that Section 3 was not to be construed by Second Circuit as to be so broad as to reach all contracts and that Section 2 was definition on its scope and that therefore Section 3 could only reach those contracts defined in Section 2.
This Court speaking through Mr. Justice Douglas specifically pointed out that we hold this way to avoid the constitutional implications.
We hold that this a Bernhardt case, it's an employment contract it's not a transaction, it's not a contract evidencing a transaction in interstate commerce.
Notwithstanding that if the contract were assumed to be in commerce and the Federal Arbitration Act to be applicable, we feel that the Court further erred below in concluding that the Federal Arbitration Act created national substantive law.
There is no intent of Congress specified in this Act, either in the act itself or in any of the sub-committee hearings and in the writings of contemporary authors.
In fact, quite the opposite, the hearings in the Congressional record allude to this Act as being procedural and relating to the law of remedy.
We further maintain that this Court in the Bernhardt case has already indicated that Section 2 was procedural, when it said it was definitional in scope.
We further point out to the Court that all the other sections of the Federal Arbitration Act 1 through 14, I should say 3 through 14 are procedural in all of their application and could not possibly be legally construed to have an substantive effect.
We therefore feel -- now one other point I'd like to make in 1924 just prior to the passage of the Federal Arbitration Act, the Court passed a decision down on this Red Cross Line case by Mr. Justice Brandeis, in that case Mr. Brandeis for the first time established that contracts containing arbitration clauses and arbitration agreements themselves were valid and created a perfect obligation.
In 1925, we believe the Congress relied on the precedent to the Red Cross case and therefore when Congress created the Federal Arbitration Act and specifically referred to in Section 2, the Act that -- the section of the Act that we are looking at, we say that they didn't intend to create substantive rights because these existed because of the Red Cross -- the Red Cross Line case.
The validity of a contract was now the law of the land; we therefore say that Congress was merely roaring a procedural statute to enforce what was now an existing right, that is the right to have arbitration contracts recognized as valid and not an ouster of Judicial Court jurisdiction.
For more --
Justice Abe Fortas: Just hold on, can I ask you this question?
I suppose it's essential in your case to establish that New York Law would permit you access to the courts rather than remitting you to the arbitration.
Mr. Robert P. Herzog: That's correct Mr. Justice Fortas.
Justice Abe Fortas: And is there a difference between you and your adversary as to what New York Law is on this subject?
To say to you that my attention has been called to application of case of application of Amphenol Corporation 266 New York supplement, second, 768 that was later affirmed in the appellant division, is quite a recent case and that states New York Law to be in accordance with Judge Medina's announcement that is to say that in this sort of a situation even though you are relying on fraud and inducement you've got to got arbitrated.
Are you are familiar with that?
Mr. Robert P. Herzog: Yes.
Justice Abe Fortas: I haven't seen it cited in the brief.
Mr. Robert P. Herzog: I didn't cite it in the reply brief but I know it is distinguishable as are the other cases, when the facts of the case are pierced out.
Appendix A to the reply has a recent 1965 unpublished opinion by Judge Inzer Wyatt of the Southern District of New York in which all these cases were analyzed by the district judge.
The only case cited in these proceedings by the Circuit Court, was in the Circuit Court of Appeals was fabrics and Judge --
Justice Abe Fortas: In this case?
Mr. Robert P. Herzog: That's right, the only New York case and Judge Wayte concludes that fabrics if not distinguishable then the decision must be considered with great -- that's appendix 8A in the reply brief Your Honor.
It says the fabrics is not -- if not so distinguishable then the decision must be considered with great deference to be wrong, now this was the sole New York case relied on--
Justice Abe Fortas: That's still another case.
Mr. Robert P. Herzog: Yes, Your Honor but to get you --
Justice Abe Fortas: That is a case in 200 New York something in an earlier case.
Mr. Robert P. Herzog: Yes, Your Honor.
Now this decision of Wayte, of Judge Wayte goes through all the cases, all the material cases and stands for the proposition that New York Law is unchanged and still is, that recession for fraud vitiates the entire agreement.
We submit that the Amphenol case is not distinguishable Your Honor is certainly not the law as an inferior Court decision it's only an appellate provision.
Justice Abe Fortas: It was approved by the appellate division.
Mr. Robert P. Herzog: Yeah, but the highest court here is the Court of Appeals which has annunciated the (Inaudible) which is discussed at length in Judge Wyatt decision which is a part of the appendix and we say that this Court, the Federal Courts must look to the highest Court of the State in order to determine what its precedent is.
It maybe and this is to be conceded, it may be the New York law is slowly changing, this Court even changes the law, but at the present time and in the context of this case, New York law is contrary.
Justice Abe Fortas: In the Amphenol case, Justice (Inaudible) distinguishes the (Inaudible) case.
Mr. Robert P. Herzog: That is correct.
Justice Abe Fortas: He says that in that case there's very narrow arbitration clause.
Mr. Robert P. Herzog: Well, the petitioner relies on the analysis of (Inaudible) which Judge Waytt sets forth there.
It was a 3:4 decision, but he has a very incisive analyzation of that case and shows that the action can be practically considered -- the decision can be practically considered a unanimous decision because addictive in the dissenting opinion.
Justice Abe Fortas: And I suppose when we have to rely on what you had said a moment ago that is to say that maybe some movement in New York Law.
Mr. Robert P. Herzog: There may be Your Honor, but I want to point out that the Lawrence case which is the precedent, here the petitioner is seeking to revoke or overturn in 1960 Judge Medina admitted in the record in the decision that New York Law was contrary and use that as an assumption arriving at its decision.
The petitioner maintains that if you look at all this procedural discussion, the intent of the Congress, the hearings, the writers, the fact that the legislation originated out of the judiciary committees of both houses obviously perhaps Article 3 legislation, although Article 1 may have been used for the commerce, course used to buttress this legislation and thus give it a broader legislative base.
If you read Bernhardt and the decisions of this Court and the other sections of the Federal Arbitration Act plus a Red Cross Line, we conclude that it's only susceptible of one conclusion that this Act is procedural in it's application where diversity of citizenship applies.
Even though the Act evidences a contract in interstate commerce.
By reaching this conclusion, the Court again avoids any constitutional problem that Erie would present.
Justice Abe Fortas: (Inaudible)
Mr. Robert P. Herzog: Yes, Your Honor, it was.
Justice Abe Fortas: (Inaudible)
Mr. Robert P. Herzog: I believe only three or four had Arbitration Acts New Jersey, New York and perhaps one of them.
Justice Abe Fortas: (Inaudible)
Mr. Robert P. Herzog: No, Your Honor the Arbitration Act that Congress passed was patented on the New York Act which had been passed five years earlier.
The New York Courts have characterized the Act when it was being constitutional and the cases cited, -- slip my mind at any rate that the Act was remedial on its application and procedure.
Congress now passed this act under the sponsorship of the American Bar Association in an attempt to try and permit citizens in the various states to have the same procedural remedies that the states returning to these are regular tribunals of arbitration and particularly and it was more important in the commercial centers of this country.
Arbitration, if you look at the expansion of it expanded sort of West, its thoughts in the urban centers and then goes throughout the country.
So New York possibly being a principle urban center and New Jersey and various other states rapidly fell into law and passing arbitration acts at the insistence of their citizens for whatever commercial needs they needed.
And Congress was persuaded of course to undertake similar legislations so there would be problem -- pardon me no problem in the Federal Court coming up with perhaps different results.
We say Congress even recognized there that in a sense to have different system of procedure might work wrongs but we say it was procedural, and it's wholly procedure and even Judge Medina in the Lawrence case and the other lower Courts have held that the Federal arbitration has independent Federal basis for jurisdiction and this is essentially the Erie problem, we're coming to because if you hold it substantive and apply Erie and New York and Oregon the cases involving procedure certain parts of the procedural laws can have substantive outcome on a litigation.
We are going to find a situation where the opposite of Erie occurs.
It's not the fact that you are diverse citizen that works so wrong, it's the fact that the contract is between citizens of the same states, the new two New Yorkers that have an that have arbitration and fraud will vitiate it have a different result.
A hypothetical would be, if I contract with my opponent here to ship interstate goods to California and it's under $10,000, there is no independent right to get into Court and we arbitrate and an attempt to arbitrate is made in New York, I have worked in New York law to my favor and the contract falls under current law.
But if we were diverse citizens, if he was a Jersey resident we could then forum shop and pick our Court, go into the Federal Court and a different result would follow if you follow Judge Medina's Lawrence holding.
Therefore we say the proper rule of law to apply to this type of litigation is a rule of common law or the state common law that fraud vitiates the entire agreement.
Now, we say the Congress intended to because they saved this in Section 2 of the Act.
The section says that arbitration agreements are valid save upon such grounds as exist at lower end equity for the revocation there of.
Justice Byron R. White: What would you think if the state statute said arbitration agreements shall not be enforceable?
Mr. Robert P. Herzog: I would say that, that is a policy of the state and its citizens to (Inaudible).
Justice Byron R. White: And then you have a transaction affecting commerce and the contract calling for arbitration and one of the party sues the other in a contest of dispute to enforce arbitration.
In the Federal Court, in the state that has the statute.
Mr. Robert P. Herzog: I would say that the Federal Court should apply the state law because --
Justice Byron R. White: And they are not enforced --
Mr. Robert P. Herzog: That's correct your honor I don't believe that the Court applying the common law of the state can possibly be considered invidious restraint on interstate commerce, if we the commerce –-
Justice Byron R. White: Are you saying that Congress doesn't have the power to require arbitration agreements to be enforced in transactions effect of commerce.
Mr. Robert P. Herzog: Well, I think Congress may have but they didn't intend it, when they framed this act.
The Act is not as drafted as to permit.
Justice Byron R. White: That they shall be valid and enforceable.
Mr. Robert P. Herzog: Well that means that they are revocable but it doesn't mean that they are well, I should say that they are not revocable that they are valid and I say that the state Court that the Federal Court sitting in such a situation your honor, must find it must apply the state law and then perhaps in those cases a policy decision what we have to be made as to whether the contract is to be deemed valid because of the commerce powers or the powers the Congress to regulate contracts touching on these or to determine that this was not the intent of Congress to legislate into this area and to deem it that the state law to apply and the contract will thus be move forward as far as the arbitration cause concerned.
Justice Byron R. White: What if the Court decided that this statute was to be construed as meaning that Congress really didn't intend to enforce arbitration contracts in interstate transaction despite provisions of local law you would -- would you, is part of your position that that is an unconstitutional.
Mr. Robert P. Herzog: Well, I would say if you are going to find a constitutional basis that it was article 1 the Commerce Clause, and that the Act was then substantive, you than run into the Erie doctrine in where you are going to have the situation that non citizens are going to have a different result as opposed to litigation involving diversity of citizens.
And so I think it's equally objectionable.
Further than that you have to find a preemption of the Act and you're going to have to enforce this unique separability doctrine that Judge Medina imposed and thus throw out the whole concept of the intrical nature of a contract.
Justice Byron R. White: And nobody suggests that Erie means that a dependent in the diversity suit may not invoke a federal statute as a defense.
Mr. Robert P. Herzog: Well, with the preemption doctrine Your Honor you could then claim that the Court could then find that the state law was preempted to the extent of the federalization of the arbitration and that thus the contract, the arbitration clause itself was valid, irrevocable and enforceable.
Justice Byron R. White: There is a question -- very much different here is that, what we --.
Mr. Robert P. Herzog: Yes, I think so there is no national policy involved sir in this case, Lincoln Mills and the other cases will come under the NLRA and the Labor Acts in which there was a strong national policy.
Here the only, there is no restraint on commerce being imposed.
Justice Byron R. White: Now is that's supposed to be -- one simply said the labor contracts are to be enforceable but (Inaudible) enforced.
This contract, this statute says, arbitration agreements will be enforced.
Mr. Robert P. Herzog: Yes, but we still feel that there was that the rational differences that there is a concurrent power here between the state Congress and arbitration didn't want to outlaw all interstate, all state contacts with commerce -- they just wanted to prevent restrains that would impede the free flow of commerce and we don't see how this policy of holding the Federal Act that the state law is applicable can be considered impeding of commerce.
It's merely relegating you to a Court either a Court in the first instance to the try the issue of fraud or the arbitrators and we feel that the substantial difference between arbitration and a Court of law should have this preliminary threshold question, the existence, the meeting of a mind, there certainly can't be an arbitration contract if there is no meeting of the mind.
If Your Honor please, I'd like to reserve the balance of my time for rebuttal.
Chief Justice Earl Warren: Mr. Coleman.
Argument of Martin A. Coleman
Mr. Martin A. Coleman: Mr. Chief Justice, May it please this honorable Court.
The question before this Court is one of congressional intent, did Congress intend to enact a national law of governing arbitration agreements in contracts involving interstate commerce.
If this Court finds affirmatively on that question, we've then reached a second question as to whether the second circuit properly applied the national law.
We submit that the approach taken to the problem by the second circuit is the correct approach.
Congress endorsed the policy of arbitration, it spoke, it wanted to make arbitration available for the businessman who simply cannot afford the delays and the expense which litigation afford him.
Whether we like it or not the commercial litigation these days is the luxury for the wealthy.
A small businessman needs speed and he cannot afford the money or the time for the lengthy litigation process.
Congress recognized this, it made arbitration available.
Section 2 of the Act speaks to interstate commerce and admiralty.
In other words it speaks to the full substantive powers of Congress in those areas and only in those areas.
Congress said that arbitration agreements shall be valid, irrevocable and enforceable.
In answer to Mr. Justice Fortas as to whether the result of this case might or might not be the same in New York law, we believe there is a conflict, but we believe -- we believe there is a conflict in the decisions but the latest decision which is affirmance by the appellate division would seem to indicate that New York state law would send this matter to arbitration.
Justice Abe Fortas: In the Amerteron case.
Mr. Martin A. Coleman: Yes sir, but I submit that that's irrelevant, because had this case come out of the state of Vermont which as this Court found in Bernhardt would not have sent it to arbitration.
The matter should still go to arbitration, it's -- in other words its Federal law that the Court looks to, not the state court.
Justice Abe Fortas: Except that it's kind of a lot of argument about nothing if the result would be the same under the national law or the state law.
Mr. Martin A. Coleman: Your Honor that's exactly right, and in our brief in opposition to granting of certiorari in this case we pointed that out.
That in this particular case, we think it is an argument about nothing.
Justice Potter Stewart: Yeah but that's -- you would concede that is not crystal clear, the law of New York is not crystal clear.
Mr. Martin A. Coleman: Certainly, certainly the Court of Appeals has not yet spoken.
Justice Potter Stewart: And as far as the Court of Appeals has spoken, it's spoken the other way.
Mr. Martin A. Coleman: That is correct, well they clearly haven't spoken the other way, it spoke to an arbitration agreement which was not nearly as to this point.
Justice Potter Stewart: Of a different time.
Mr. Martin A. Coleman: And it's under that arbitration agreement, the parties did not agree to sent through it to the arbitrator, that's what it said.
Justice Byron R. White: What Courts of Appeals agree with the Second Circuit?
Mr. Martin A. Coleman: Excuse me sir.
Justice Byron R. White: What Courts of Appeals agree with the Second Circuit?
Mr. Martin A. Coleman: Well, since Robert Lawrence was decided the Third Circuit explicitly endorsed it, the Fifth Circuit endorsed it although they endorsed it in a case which was then reversed by this Court on other grounds, that's the Mosley case.
In Mosley, this Court found that the fraud went to the arbitration agreement itself.
If it did not the Fifth Circuit would have followed this.
The Sixth Circuit we believe supports the exact same result.
The Sixth Circuit in American Airlines which came down three or four weeks --
Justice Byron R. White: So there are several others who have very expressly disagreed with it?
Mr. Martin A. Coleman: Since the decision in Robert Lawrence came down in 1959 the First Circuit questioned it in a case where it really didn't matter because they sent the matter to arbitration anyway.
Justice Byron R. White: What about the Ninth Circuit?
Mr. Martin A. Coleman: The Ninth Circuit has not spoken since Robert Lawrence Your Honor.
Justice Byron R. White: Has any circuit disagreed with Robert Lawrence before of course?
Mr. Martin A. Coleman: Not to my knowledge Your Honor.
And the lower courts, the Federal District court throughout --
Justice Byron R. White: There was conflict on what Robert Lawrence was granted.
Mr. Martin A. Coleman: Yes, well, yes that is correct when Robert Lawrence was granted the Ninth Circuit had previously said that they were --
Justice Byron R. White: Now they changed their mind about that.
Mr. Martin A. Coleman: Well, they never -- apparently, they never had another case dealing with the question one way or the other.
Justice Byron R. White: So there is an outstanding concept in the Second and Ninth Circuit.
Mr. Martin A. Coleman: And the ninth that is correct, that is correct.
I might point out however that when the Ninth Circuit decided to apply California law, again it really didn't matter because California does have an arbitration statute.
So that it wasn't the situation where the question was do you go to arbitration under Federal law or don't you under state law.
I don't think that they gave the matter indifference as much consideration as they should have.
Justice Byron R. White: How do you get the federal court to enforce an interstate arbitration agreement in accordance with the Federal Arbitration Act?
Mr. Martin A. Coleman: The only way you get into Federal Court is under Title 28 which includes of course diversity of citizenship.
If there is no diversity and if you are not in Federal court for other reason such as a Federal contract you do not get into the Federal --
Justice Byron R. White: Well why is that?
If you think that Arbitration Act is substantive, it gives people the formative rights of raising a federal question.
Mr. Martin A. Coleman: You mean in order to get into Federal court, well if I may answer you in a roundabout way, I like to --
Justice Byron R. White: The statute here and that this was a diversity case, in fact the plaintiff didn't plead in the Federal question, but you pleaded a -- well you pleaded Federal defense.
Mr. Martin A. Coleman: That's correct.
Justice Byron R. White: Now what if that had been turn around would you, why could you – you sued in the Federal court, if the Federal question to enforce your arbitration.
Mr. Martin A. Coleman: No, Section 4 of the Act, which is the section that allows a Federal court to order arbitration, seems to state quite clearly that you need grounds other than the arbitration act to get into the Federal court, but I don't think that meets our problem.
Justice Potter Stewart: The suit they brought against you in the state court.
Mr. Martin A. Coleman: That's exactly --
Justice Potter Stewart: But it was certainly fair --
Mr. Martin A. Coleman: Yes sir, we say we could have and we say that there is no problem of forum shopping because the state courts --
Justice Potter Stewart: Could you have gone into the state courts and asked it on the basis of --
Mr. Martin A. Coleman: This is definitely our contention that the state courts will now have to apply this Federal law because Congress exercised its commerce power --
Justice Potter Stewart: It compliments to what we have held is the case of (Inaudible)
Mr. Martin A. Coleman: Exactly, exactly.
Now, the problems in this case are problems which come about because we have a statute enacted in 1925 long before Congress or anyone else thought about hearing.
The Act however was clearly intended to apply to diversity cases in the Federal court.
Section 2 of the Act in making all agreements to arbitrate in contracts involving interstate commerce valid, irrevocable, enforceable provides for no exceptions to that, all agreements.
What little legislative history --
Justice Byron R. White: Yet you don't well seem to argue in your brief or discuss the question whether or not this particular contract under the commerce law, whether this is commerce, this employment commission.
Mr. Martin A. Coleman: Yes, Sir, we do mention this in our brief.
Justice Byron R. White: You mentioned it, I don't see any development.
Mr. Martin A. Coleman: We really --
Justice Byron R. White: I would think you are fair and would make almost any employment contract with any industrial company in interstate commerce contract.
Mr. Martin A. Coleman: Mr. Justice Douglas we do not argue that we have an employment contract here, this is a characterization put on the contract by petitioner not by us.
Justice Byron R. White: I know but I think you take your position, I don't see how we could avoid calling that almost any employment contract with any company like General Electric, DuPont.
Mr. Martin A. Coleman: No sir, no sir.
Justice Byron R. White: In interstate commerce.
Mr. Martin A. Coleman: No sir, because this is not an employment contract we have, what we have here --
Justice Byron R. White: I know it isn't but I'd say if we take your position I don't see how we can help taking the next one, what would be the distinction?
Mr. Martin A. Coleman: The distinction --
Justice Byron R. White: If your case had an employment -- my employment contract with General Electric, you must --
Mr. Martin A. Coleman: All right in my case I filled assets and those assets were located in number of the states, those assets were the lists of my customers.
I agreed to give consulting services in transferring the servicing of those assets from New Jersey to Baltimore, Maryland.
Now the Second Circuit in their opinion said that beyond her adventure, this is a contract involving interstate commerce.
After all we did have customer lists in many, many states.
The record doesn't indicate how many, it just said several states and then we sold them.
Justice Hugo L. Black: Did the contract state law building?
Mr. Martin A. Coleman: No sir it did not.
Justice Hugo L. Black: Did it give the right that I understand that many contracts here in New York, order who made the contract to accept service on part of other people who lived in other states.
Mr. Martin A. Coleman: No sir it does not.
This is a fully –-
Justice Hugo L. Black: If that is kind of law in New York in order you have arbitration agreement followed thereafter and we tear it out having abandoned a new contract was made as a trainee in fact for a man located in the state of Washington, is that a part of the law of New York?
Mr. Martin A. Coleman: Your Honor, I don't know, but I would hope it's not.
Justice Hugo L. Black: Well, I think maybe you will find it here.
Mr. Martin A. Coleman: However, however here --
Justice Hugo L. Black: Except that some sense being provided for by the person to whom the contract was made, a person living in California or even in China, I won't say China, but other eastern countries.
Mr. Martin A. Coleman: Well, Your Honor I believe you are referring to this National Equipment Rental case of this court two or three years ago.
But that is not our situation --
Justice Hugo L. Black: But that is the Law of New York.
Mr. Martin A. Coleman: Well, that was the law of this court --
Justice Hugo L. Black: Was that -- it was clearly not written by Judge Medina.
Mr. Martin A. Coleman: The National Equipment Rental case Your Honor is a case of this court in 1964, where in a 5:4 decision, the court upheld a clause in a form contract where a Michigan Farmer authorized somebody in New York to accept service for him for a --
Justice Hugo L. Black: And the relative of the President of the company, the contract was made excepted to serve.
Mr. Martin A. Coleman: That's correct, that is a holding of this court in a five to four --
Justice Hugo L. Black: That is under arbitration law of New York.
Mr. Martin A. Coleman: No sir, no sir that was not under arbitration law that was to avail oneself of the courts of New York.
Justice Hugo L. Black: Of the courts –- but wasn't an arbitration, it was not an arbitration?
Mr. Martin A. Coleman: Was not an arbitration, it was litigation.
Justice Hugo L. Black: But they have had arbitrations done in the same way it happened in New York under its law.
Mr. Martin A. Coleman: I don't know of that Your Honor, I would say, I would say if they did, I wouldn't be happy with it.
I think that if a party agrees to arbitrate he has to agree knowingly, willingly he has to know exactly what he is doing.
Justice Hugo L. Black: Why does he have to agree, why couldn't New York have the law that all occasions rising out of interstate commerce.
Now the arbitrary, I am not referring to the board.
Mr. Martin A. Coleman: Well, that would be taking away a person's right to, I think they would be denying a person a constitutional right to go to court.
Nobody, nobody has to arbitrate unless he agreed to and then that I think you have to keep in mind -- Now this is a big step, if you have not agreed to arbitrate or if you can even say I didn't even know the clause was in the contract and if you can demonstrate that, then t we would have a different case, but we have a case where we had attorneys on both sides, we had a fully negotiated contract when we got to the arbitration clause, we took the broadest clause known to the bar and then we made changes in the clause.
We made changes to provide before whom the arbitration would be, so that at least one of the arbitrators must be an attorney, another must be an accountant where we tampered with the clause to provide that the costs of arbitration would be shared equally no matter what the arbitrators did.
When we agreed to arbitrate, we knew precisely what we were doing.
Justice Hugo L. Black: They made pretty strong provisions in the law which get powers from the old doctrine that a person could not in advance of a law suit waive his right to have a trial in court.
Mr. Martin A. Coleman: That is correct, that was the common law here, the common law for as far as I know from the ancient days before this republic had a hostility to arbitration on the theory that it divested the courts of its jurisdiction.
Justice Hugo L. Black: Which it does.
Mr. Martin A. Coleman: Which it does and the common law in the few states today which do not have arbitration statutes is still that way.
But Congress passed this statute in derogation of the common law and in the statute.
Justice Hugo L. Black: Which was subjected to charges that was unconstitutional.
Mr. Martin A. Coleman: The statute—
Justice Hugo L. Black: Wasn't it?
Mr. Martin A. Coleman: I don't believe so Your Honor.
Justice Hugo L. Black: Wasn't it in the Erie?
Mr. Martin A. Coleman: Erie did not speak to this statute to the arbitration.
Justice Hugo L. Black: I am talking about the Congressional enactment.
Mr. Martin A. Coleman: The Congressional enactment.
Justice Hugo L. Black: That arbitrational law.
Mr. Martin A. Coleman: That arbitration has to my knowledge which maybe incomplete as to my knowledge never been challenged as unconstitutional.
The New York statute when that was enacted in 1920 was challenged in the New York Courts as unconstitutional and the New York Courts upheld it because, because the important thing you have to keep in mind with arbitration is that it's entirely voluntary, if you don't want to arbitrate, you don't have to arbitrate.
But once you've agreed to arbitrate --
Justice Hugo L. Black: You could think about that in event of the contract being made or a law suit having arisen.
Mr. Martin A. Coleman: That is right, well, if you first have to wait for a dispute to arise before you agreed on whether or not you will arbitrate it is usually to the advantage of one party, not to arbitrate because he is in no hurry for a quick result.
Arbitration to have any effectiveness must make agreements to arbitrate future disputes irrevocable and the point is that Congress did this, the Act, the Act couldn't be clearer, Section 2--
Justice Hugo L. Black: Not any doubt about that --
Mr. Martin A. Coleman: And I do not believe that in this case we are challenging the Act as unconstitutional, petitioner argues that the Act runs up against Erie problems we don't believe it does.
We don't believe it does because the Act was clearly intended to apply to diversity cases that's in the legislative history of the Act, that's in the law review articles written at that time by attorneys who are members of committees which sponsored the act --
Justice Potter Stewart: Tell me Mr. Coleman, as you said earlier that you couldn't get into Federal Court really on the basis that the Act itself, I gather that's because of that phrase that is Section 4, say for such agreement.
Mr. Martin A. Coleman: Yes sir.
Justice Potter Stewart: Well that, is that tied against your proposition?
Mr. Martin A. Coleman: I don't believe, no I don't believe --
Justice Potter Stewart: What does that clause mean?
You couldn't get into the court --
Mr. Martin A. Coleman: We couldn't get into --
Justice Potter Stewart: The court without an agreement -- without an arbitration given to this context.
Mr. Martin A. Coleman: That's correct.
Justice Potter Stewart: In this context you can't get in without--
Mr. Martin A. Coleman: So you need to see any two things, you need the arbitration agreement or you need three things, you need the arbitration agreement, you need a contract in interstate commerce and you need diversity of citizenship to get into the Federal Court, without the diversity --
Justice Potter Stewart: Why would the Congress say, if this, if I think we have already -- we have positioned it that this creates a Federal right.
Mr. Martin A. Coleman: That is correct.
Justice Potter Stewart: And that it's a right that has to be applied by state court.
Mr. Martin A. Coleman: Absolutely.
Justice Potter Stewart: And yet you conceive that because of this language you can't get into the Federal Court merely on that basis to enforce that Federal right.
Mr. Martin A. Coleman: Well, there you are Your Honor, you have with arbitration -- you have something--
Justice Potter Stewart: Well I mean --
Mr. Martin A. Coleman: Quite unique.
Justice Potter Stewart: Why did Congress do that?
Why would Congress have created a Federal right of a substantive nature and enforceable in a state court and yet not based on the agreement itself enforceable to the federal law?
Mr. Martin A. Coleman: Well, I don't, -- I frankly don't think the Congress when it passed this law gave – thought one way or the other as to its applications to the state.
Justice Potter Stewart: Is there any, is there any history why that's safe with agreement --?
Mr. Martin A. Coleman: No sir, I know of no reason.
Your Honor, in my few remaining minutes I have agreed to yield them to Mr. Aksen of the American Arbitration Association who is here to say a few words to the court.
Thank you very much.
Argument of Gerald Aksen
Mr. Gerald Aksen: Mr. Chief Justice, May it please the court.
Chief Justice Earl Warren: Mr. Aksen.
Mr. Gerald Aksen: Please the court.
Amicus wishes to make clear in this case that it has a no opinion whatsoever with reference to the facts whether or not interstate commerce is involved.
Amicus is terribly concerned the effect, the decision of this court would have on commercial arbitration in this country.
It is also terribly concerned with the attitude of the courts for the concept of a voluntary arbitration, which must be severely differentiated from compulsory arbitration, which exists in this country only to a very, very limited extent.
Outside of the State of Pennsylvania and the railway labor cases we do not have compulsory arbitration in this country.
We are speaking about here --
Justice Hugo L. Black: Is there an association favor.
Mr. Gerald Aksen: No sir, the arbitration--
Justice Hugo L. Black: Is your association the one that worked to get the original arbitration law for its members?
Mr. Gerald Aksen: No sir, the arbitration association was formed the year after the arbitration statute was passed.
This Act was enacted January 1, 1926; the arbitration association was formed in March of 1926.
Justice Hugo L. Black: Had it not been an association before?
Mr. Gerald Aksen: No sir.
Justice Hugo L. Black: It was entirely new.
Mr. Gerald Aksen: This was an entirely new association formed in 1926 after the enactment of the Federal Act.
The associations that sponsored this law will be found at the back of the amicus brief.
There are 122, that we were able to locate today from our files and records of 1923, 24 and 25, all business concerns and Chambers of Commerce throughout almost every state in the United States at the time.
Justice Hugo L. Black: That was the organization (Inaudible) through the Congress.
Mr. Gerald Aksen: That is correct Your Honor.
Justice Hugo L. Black: It is supposed the business then and Chamber of Commerce to do business in interstate fashion.
Mr. Gerald Aksen: Exactly correct.
It is interesting for us to note that this Court very forcefully 1957 and 1960, set forth a national policy on labor arbitration, they had no difficulty with that, we are now faced with the crossroads in American history, but whether or not the common law hostility will now once and for all be discarded.
Congress made it perfectly clear in 1920, this has been observed by one justice.
There were only two states in 1920 that had a provision which made arbitration agreements valid, irrevocable and enforceable.
It will be an absurdity to think that all these business organizations wanted a law which would enforce only a state created right of two states.
Justice Hugo L. Black: May I ask in your association what state law is set to govern in the form you provide –
Mr. Gerald Aksen: The rules provide Your Honor at the moment in this case we're referring to the commercial arbitration rules, that unless the law provides for the contrary.
Justice Hugo L. Black: The law provides for the contrary.
Mr. Gerald Aksen: Right, that's what the rules specify, unless the law provides for the contrary.
If the law had prohibit arbitration in any state, the arbitration association would not be operating in that particular state.
The association is not merely an administrator of commercial arbitrations, it is the largest single private organization in the country responsible for administering labor arbitration, commercial arbitration and insurance arbitrations.
Justice Hugo L. Black: Does it have anything to do with the provisions that appear in most of the large number of the arbitration contract, that the party agrees that the law of the state of the seller -- of the goods, shall govern?
Mr. Gerald Aksen: Nothing whatsoever Your Honor.
You'll find our clause mentioned on the inside cover of the rules.
It has no specific reference to what law should prevail.
I believe Mr. Justice Black is referring to the clause used generally by the textile industry of the United States because of its history, the textile industry has particularly desired to stay out of court, they have provided --
Justice Hugo L. Black: Referring to contract made in the state of New York by New York business who sell goods to people in districts, states and provide in the contrary that the arbitration governed by the laws of New York and be held at such place as a seller of the goods designate to try the case.
Mr. Gerald Aksen: This is not our preference or our clause in anyway.
The parties wish to put that in the contract, we regard it as an item of negotiation as any other part of the contract, we are assuming we are talking about negotiated contracts, if the buyer refuses to sign that part of the clause, he should attempt to change it, but clearly they voluntarily intend and in the bar case and our interest in this matter is, the arbitration association has sponsored what it considers to be the broadest possible arbitration clause to show the parties attempt to arbitrate every dispute that arises out of that contract unless one party can clearly show that the arbitration agreement itself was fraudulently induced.
We in no way intend to deprive the Court of deciding whether the agreement to arbitrate was itself fraudulently induced, but both Congress in the very Federal Arbitration Act, and the fact of arbitration itself necessitate that the arbitration clause be looked to, to make this determination.
The doctrine of separability is one of constructive intent that must be followed and we hardly recommend that the view endorsed by Lawrence, if commercial arbitration is to exist in this country the way the businessmen desire it.
It is a voluntary contract between two parties, to go to arbitration.
There is no requirement but they put this clause in, they may narrow it in anyway they like, we're not saying to the Court to use this clause or interpret it this way if it's narrow, only where the party is saying, as we claim they say here, as if it was said in haec verba the parties intend to arbitrate everything including fraudulent inducement of the contract, but not fraudulent inducement of the arbitration clause.
Justice Potter Stewart: Mr. Aksen, can you enlighten us on how come they're saying for this agreement language in Section 4?
Mr. Gerald Aksen: I can only recommend the alignment set forth by Judge Medina.
Justice Potter Stewart: And that is?
Mr. Gerald Aksen: Who used it basically to bolster the substantive intent of the law.
Had it been a procedural law only, he said this sentence would not have been necessary.
But this sentence plus the very fact that Section 14, in the law which says this law shall not apply to contracts signed before January 1, 1926 to him completely shows the substantive intent necessary in 1924 before Erie.
Justice Potter Stewart: Your position is then that the Court around the country including the state courts should sanction a, fashioned law with respect to commercial arbitration without any particular legislative guidance or anything else except that the arbitration agreements are enforceable and the court should enforce them in accordance to the rule they make or what?
Mr. Gerald Aksen: Well, it's our position that the Federal Act clearly shows under Federal substantive law, what the attitude of the United States is with regard to arbitration agreements and if in fact, the Act was substantive the states will follow that, and this Court can settle the question now once and for all as it did Lincoln Mills case in 1957.
Justice Byron R. White: So your answer is yes, you should take the same course?
Mr. Gerald Aksen: Yes, Mr. Justice White it is.
It is our opinion that labor arbitration is, despite the fact that it's a substitute for industrial strike, it is nevertheless we administer 5,000 of these cases every year purely a dispute between a grievance and this company.
As a matter of fact many of the disputes between commercial businessmen are quite more important time and in money.
And if one company goes out of business because he can't get a prompt decision, many employees union or not may lose their job as a result.
Justice Potter Stewart: (Inaudible)
Mr. Gerald Aksen: No sir I have no figures on that.
Chief Justice Earl Warren: All right, we'll recess now. | <urn:uuid:87096a6f-89ca-4cf0-813a-7bd8aa672f48> | CC-MAIN-2015-06 | http://www.oyez.org/cases/1960-1969/1966/1966_343 | 2015-01-30T07:58:26Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422115926769.79/warc/CC-MAIN-20150124161206-00115-ip-10-180-212-252.ec2.internal.warc.gz | en | 0.959916 | 10,677 |
He Cheated On Me, How Much Alimony Can I Get In New York
The recent tax overhaul passed by Congress will reach every corner of American life — even divorce. One provision throws out a 75-year-old deduction for alimony. The new laws won’t go into effect until 2019, so anyone divorcing before then is safe.
Divorce experts are worrying the change will make divorce negotiations harder and end in less spousal support. Congressional tax writers claim the law will only be fair to married couples.
In a divorce which begins after December 31, 2018, the alimony-paying spouse will not be able to deduct alimony payments. The spouse receiving alimony will not have to pay taxes on maintenance accepted.
Before December 31, 2018, the opposite is in effect.
In New York as in many state-level jurisdictions, adultery is a common factor in divorce. Adultery can be taken by the judge to be an integral factor when it comes to alimony and divorce.
Divorcing couples, in New York, may pursue a ‘no-fault’ split or a ‘fault’ divorce. In the first, the party seeking the dissolution merely has to show the union has been doomed for a minimum of six months. “Irretrievably broken” means the duo just don’t get along and their differences have grown so sweeping as to render any hope of reconciling moot.
In a fault divorce, the spouse wanting the divorce must show:
- Cruel and inhuman abuses, or
- Alienation or desertion for at least twelve months, or
- Incarceration which lasted for at least 36-consecutive months, or
New York explains adultery as an espoused individual having sexual relations with someone, not their spouse. A person filing for a divorce founded on adultery must be ready for a greater-conflict case. The rule mandates that evidence is offered, and the resulting emotional impact can be significant.
Throughout the divorce procedures, one spouse might petition the court to award economic support for the post-divorce era. The two-people involved might concur on the total, or there could be a prenuptial agreement that spells out the amounts. If no deal exist or can be reached the court will evaluate various portions and determine if there ought to be a financial award and if so the amount.
While deciding the issue of alimony, the judge will review:
- Salary or wages and assets, and
- Duration of the union, and
- Age and fitness of both people, and
- Current (and future) income potential of both parties, and
- The necessity for a spouse to further education, and
- What may preclude a spouse’s capability of finding employment, and
- Where any kids (from the union) live, and
- The obligation to attend to family (other than kids), and
- Any necessity to fund extraordinary costs, such as the children’s medical care.
State laws have not established direction used by the judge in making the decision, and both parties may introduce testimony to support their argument.
How Does Adultery Hit Alimony?
In New York, marital fault, which is the umbrella under which adultery falls, is not often recognized by the courts when granting alimony. Infidelity does not guarantee an alimony award. New York courts watch for “egregious” conduct and have determined that infidelity alone is not “egregious” enough.
Despite that, when one party perpetrates adultery, and a significant portion of marital assets is used during the affair, the judge often finds a “wasteful dissipation” of the marital property and would become a factor considered by the judge in deciding the alimony issue. | <urn:uuid:637135ee-8bd7-415d-866a-44527b90bc1a> | CC-MAIN-2019-09 | https://nydivorcefirm.com/cheated-much-alimony-can-get-new-york/ | 2019-02-18T22:20:52Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247488490.40/warc/CC-MAIN-20190218220415-20190219002415-00219.warc.gz | en | 0.94912 | 788 |
Our evening sipper last night was the 2008 Michael Shaps Chardonnay. We paired this one with a creamy Brie smeared on baguette slices. Recently we’ve gotten into having our cheeses with bread instead of crackers. The creamy brie with its slight nutty flavor seemed a perfect match with the fuller-bodied Chardonnay.
Has anyone noticed that I’m trying to include the Virginia Wine Month coaster in many of my pictures this month?
The 2008 Michael Shaps Chardonnay presented pear mores, toasted hazelnut, and pineapple on the nose. We noticed similar flavors in the mouth with a touch of apple and a creamy mouth feel. The texture of the cheese went really well with the mouth feel of the wine. This is one really nice Chardonnay. Tell us what gems you are finding during Virginia Wine Month. This is our first post for Regional Wine Week. Yay! | <urn:uuid:0860da1c-5c01-4dae-bb19-cebdd06d473c> | CC-MAIN-2015-35 | http://www.virginiawinetime.com/2010/10/10/ | 2015-09-01T16:07:35Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440645195983.63/warc/CC-MAIN-20150827031315-00181-ip-10-171-96-226.ec2.internal.warc.gz | en | 0.950617 | 197 |
Note: The following information is contained in the website http://www.circinfo.net/ , and it has been copied with permission. This is not an exact copy of all the information found on the website http://www.circinfo.net/ . For an exact text of the information contained in that site, please go onto the above mentioned site.
Circumcision of the neonate
There is no evidence of any long-term psychological harm arising from circumcision. The risk of damage to the penis is extremely rare and avoidable by using a competent, experienced doctor. Unfortunately, because it is such a simple, low-risk procedure, it had once been the practice to assign this job to junior medical staff, with occasional devastating results. Anecdotes of such rare events from the past should be viewed in perspective. Parents or patients nevertheless need to have some re-assurance about the competence of the operator. Also the teaching of circumcision to medical students and practitioners needs to be given greater attention because it is performed so commonly and needs to be done well. A model to teach interns has, moreover, been produced .
Surgical methods often use a procedure that protects the penis during excision of the foreskin. In the USA the most commonly used devices are the GOMCO clamp (67%), MOGEN clamp (10%) and PlastiBell (19%) . Pictures of these can be found in refs [8, 204], and the latter in particular discusses the procedure, as well as contraindications.
The Plastibell (Hollister Inc, USA ) provides a `no scalpel' circumcision. In this method, the foreskin is stretched over a protective plastic cap which covers the glans, and a ligature is tied around the base of the foreskin. The compression against the underlying plastic shield causes the foreskin tissue to necrose and the foreskin and Plastibell then get sloughed off within a week, thus eliminating the need to actually cut the foreskin off [124, 159]. Cosmetic results have met with unanimous parental acceptance .
Dr Terry Russell, OAM, in Australia, has developed a simple, pain-free method involving 2 hours EMLA cream with the penis wrapped in cling wrap (done by the parents), followed by a modified Plastibell circumcision . The technique is described in detail on his website (http://www.circumcision.com.au). Dr Russell has used it in over 17,000 circumcisions on boys of all ages from neonate to puberty. These were all a complete success with no serious or moderate complication. In collaboration with Prof Roger Short, a video ("no scalpel circumcision") that teaches the Russell method has been produced for Botswana , and another, filmed in a Pacific Island nation, is in production for New Guinea . These were aimed primarily at AIDS minimization. Moreover, since this simple plastic device is now off patent it can be produced at very low cost to help reduce AIDS in poor countries .
The Gomco and Mogen clamps serve to protect the penis when excising the prepuce. The type of clamp used affects the time taken for the procedure, being on average 81 seconds for the Mogen clamp and 209 seconds for the Gomco clamp . In a head-to-head trial of length of procedure the Mogen took 12 minutes, compared with 20 minutes for the Plastibell . Although simpler to use and more pain-free than the other two [181, 197, 350], the Mogen removes less foreskin. The Gomco is the oldest, having been invented in 1935, and is the most refined instrument . Since some of these more elaborate methods can take up to 30 min to perform they therefore expose the baby to a greater period of discomfort. In contrast, a circumcision can be completed in 15-30 seconds by a competent practitioner using methods that are part of traditional cultures. Interestingly, strict sterile conditions were reported not to be necessary to prevent infection in ritual neonatal circumcision in Israel . Also, rather than tightly strapping the baby down, swaddling and a pacifier has been suggested [154, 161, 162]. A special padded, 'physiological' restraint chair has moreover been devised and shown to reduce distress scores by more than 50% . Exposure to a familiar odor (their mother's milk or vanilla) reduces distress after common painful procedures in newborns [130, 286].
Dr Tom Wiswell and other experts strongly advocate the neonatal period as being the best time to perform circumcision, pointing out that the child will not need ligatures (owing to the thinness of the foreskin ) or general anesthesia, nor additional hospitalization [391, 392, 394, 396, 397]. Without an anesthetic the child experiences pain and pain is also present for from a few up to a maximum of 12-24 hours afterwards. The child does not, however, have any long-term memory of having had a circumcision performed. A greater responsiveness to subsequent injection for routine immunization may suggest, however, that the baby could remember for a short time . Anesthesia is therefore advocated (see below). Healing is rapid in infancy , complication rate is very low (0.2%), and cost is about one-tenth (discussed later).
For children aged 4 months to 15 years a general anesthetic is generally used and this carries a small risk. Also, ligatures are usually needed, although use of a tissue glue has proven to an effective alternative [261, 344]. The latter also reduces operating time and gives a better cosmetic appearance . Excellent cosmetic results were reported for all of 346 patients aged 14 to 38 months using electro-surgery, which presents a bloodless operative field . Metal of any kind (such as the Gomco clamp) has to of course be avoided in this procedure. Gentle tissue dissection with simultaneous hemostasis was achieved using an ultrasound dissection scalpel for circumcision . Circumcision later obviously requires a separate (occasionally overnight) visit to hospital. Rate of complications is also greater, but still low (1.7%). The incidence of penile adhesions decreases with age, however, but at any age they often resolve spontaneously . Pain sometimes can last for days afterwards and those older than 1-2 years may remember. Cost is also much greater than for neonatal circumcision.
For boys with hemophilia, a satisfactory outcome can be achieved with a specialized cost-effective device .
In adults circumcision is more expensive, but can be performed on an outpatient basis (so reducing costs), sometimes with local anesthetic (so reducing anesthetists charges), and pain can last for up to a week or so, during which time absence from work is required. Some however report no pain, just minor discomfort from the stitches.
Thus when considering when is the best time, it would appear that circumcision in the newborn period is safe and technically easy. It is also cheap, as discussed in the next section, as well as providing the maximum lifetime benefit. | <urn:uuid:193bd5f0-3ba4-48b1-8974-a1e24c211d46> | CC-MAIN-2018-13 | http://www.britpro.com/default.asp?p=information_procedure | 2018-03-21T03:20:56Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647567.36/warc/CC-MAIN-20180321023951-20180321043951-00499.warc.gz | en | 0.945468 | 1,430 |
What Are Restylane & Juvederm Fillers?
Restylane® and Juvederm are safe and natural cosmetic dermal fillers that restore volume to the skin to fill in facial lines and folds, lifts the cheeks and creates fuller, sexier lips. Restylane and Juvederm are clear synthetic gels made with hyaluronic acid, (HA), a substance that is naturally found in your skin that diminishes with age. There is no need for skin testing as hyaluronic acid dermal fillers carries little risk of allergic reaction.
What Areas Of The Body Can Be Treated With Restylane & Juvederm?
The most common areas for treatment are the nasolabial folds (lines between the nose and mouth) and marionette lines (lines from the angle of the mouth to the chin). Thin lips can be enhanced to create a natural, fuller look, and for those who wish, full lips can be made even poutier. Depressed scars due to acne or chicken pox can easily be eliminated. Dr. Mattone also uses dermal fillers to enhance and contour your cheeks, brows, jaw line and even ear lobes. The results are almost instantaneous, with little or no downtime.
How To Maximize Your Results With Restylane & Dysport
To extend the results of your filler Dr. Mattone highly recommends the use of a patented award-winning liquid collagen/HA matrix nutracosmetic supplement, it directly stops the enzyme that your body uses to breakdown HA while increasing your own HA levels by 6000% in one month. This supplement supplies your body with the collagen it needs to be a super collagen producing machine to achieve and maintain superior results. | <urn:uuid:f6d5851f-fc84-476f-a6fe-1aa5b8d8c7dd> | CC-MAIN-2023-06 | https://www.aesthetic-associates.com/services/fillers/ | 2023-02-07T13:58:51Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500619.96/warc/CC-MAIN-20230207134453-20230207164453-00414.warc.gz | en | 0.902487 | 356 |
Forgot your password?
Not a TCM Member? Sign Up Now.
Please enter your information below to create your own personal account with tcm.com
We will send you an email to confirm your account upon completion.
Already have a TCM Profile? Sign In.
Then get an Ultraviolet account and set your movies FREE!
Your social account may not have provided your email to us. Please confirm or enter it below to complete your profile.
We found your email in our system.
Please provide your site password to link to your existing account.
Forgot your password? Enter your email address and we'll send you instructions on how to access your account.
Not a TCM.com Member? Sign Up Now.
We have not verified that the email belongs to you. Please check your inbox for
the verification email.
To resend the verification email, please enter your email address and click Submit.
Or sign in with a different account.
Check your inbox...
You will receive an email shortly to confirm your email address.
FOR Frank Bongiorno YOU CAN
Post your comments here
ADD YOUR COMMENT>
In a world where money, guns and drugs are a way of life, two old enemies, Ryan...
Academy Award nominated Danny Aiello stars as Frank Tramontana, a hearse driver...
Students at a performing arts high school struggle with personal problems in...more
Students at a performing arts high school struggle with personal problems in Fame (1980). less
Please support TCMDB by adding to this information. | <urn:uuid:bf5a54aa-1fae-4700-8970-064921bfe173> | CC-MAIN-2017-22 | http://www.tcm.com/tcmdb/person/18917%7C0/Frank-Bongiorno/videos.html | 2017-05-28T03:38:32Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463609409.62/warc/CC-MAIN-20170528024152-20170528044152-00357.warc.gz | en | 0.867349 | 329 |
The Voices of Zion Choir
“Let the word of Christ dwell in you richly in all wisdom; teaching and admonishing one another in psalms and hymns and spiritual songs, singing with grace in your hearts to the Lord. And whatsoever ye do in word or deed, do all in the name of the Lord Jesus, giving thanks to God and the Father by him.” (Colossians 3:16-17 KJV)
The members of the Mt. Zion Baptist Church Music Ministry are responsible for providing multigenerational music to our multigenerational congregation. This music consists of psalms, hymns and spiritual songs that are biblically based and appropriate for the worship and the liturgical calendar.
Each member of the music ministry has accepted their calling as worship leaders. In this capacity, each person is responsible for uplifiting the name of Jesus and ushering in the spirit of praise, worship, and thanksgiving where ever they abide.
Currently the music ministry consists of the mass choir, The Voices of Zion and the Men of Valor chorus. The members of these groups strive to be spiritually alert and emotionally aware of the needs of their fellow choir members and church members. These singers are physically able to stand, raise, clap their hands and move their feet in a manner that would foster an outward exhibit of praise and worship unto God.
The choir’s presentation is uplifting, fulfilling and provides a musical nugget for our parishioners to carry home and reflect upon during the week. | <urn:uuid:f761b033-f264-4fff-a981-d5af88c605b9> | CC-MAIN-2019-47 | http://www.mtzionbc.org/ministries/the-voices-of-zion-choir/ | 2019-11-15T23:20:49Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496668716.22/warc/CC-MAIN-20191115222436-20191116010436-00046.warc.gz | en | 0.96268 | 321 |
2019 BMW 3 Series vs Audi A4 vs Mercedes C-Class car test drive and comparison
The Geneva Motor Show 2019 is taking place these days and will definitely pay a bit more attention to the car world and everything new for 2019. For today we have chosen a very interesting car review, comparing three of the most popular and successful luxury and sport sedans on the market - BMW 3 Series vs Audi A4 vs Mercedes C-Class.
We can call all of them best sellers because they have proved to be successful throughout the years and all of them make a big impact in the car industry once a new model is released.
Not to waste any more of your time, take a look at the video and let us know what is your favorite of these three and why:
2019 BMW 3 Series vs Audi A4 vs Mercedes C-Class - video comparison test
I would also recommend you to check the rest of our car test drives and reviews. | <urn:uuid:4e7b23a1-422b-4486-99cd-d7b04ff59bf6> | CC-MAIN-2019-30 | https://www.testproductreview.com/2019/03/one-auto-test-you-shouldnt-skip-2019.html | 2019-07-22T16:08:39Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195528141.87/warc/CC-MAIN-20190722154408-20190722180408-00150.warc.gz | en | 0.941697 | 192 |
Translate Recent Cars Support Forums › Support Forums › CarDealer WordPress Theme › Translate Recent Cars Tagged: Translate Recent Cars This topic contains 5 replies, has 4 voices, and was last updated by jack 6 months, 4 weeks ago. Viewing 6 posts - 1 through 6 (of 6 total) Author Posts May 19, 2016 at 5:26 pm #14922 AlmaSuarezParticipant Hi, in which file can i translate these fields ? Please let me know, thank you ! Attachments:You must be logged in to view attached files. May 19, 2016 at 10:35 pm #14929 jackModerator Hello Alma, Please be advised your support period is expired and we would recommend you to renew it in order to get further assistance from our support team, thank you. Regards, Jack December 20, 2016 at 5:13 pm #15782 firstname.lastname@example.orgParticipant same problems please help! December 20, 2016 at 7:16 pm #15783 jackModerator Replied via ticket. Regards, Jack June 21, 2018 at 3:11 pm #16736 henaresmotorParticipant Desde España, ¿Cómo se puede traducir “Recent Cars” en página de Inicio? Gracias June 25, 2018 at 8:41 pm #16737 jackModerator Hi there, Plea be advised we provide support in English so please post your comment in English, thank you Regards, Jack Author Posts Viewing 6 posts - 1 through 6 (of 6 total) You must be logged in to reply to this topic. | <urn:uuid:e185de9c-454d-4935-8d4f-f95e0529c0f7> | CC-MAIN-2019-04 | http://forums.webtemplatemasters.com/forums/topic/translate-recent-cars/ | 2019-01-20T17:14:50Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583728901.52/warc/CC-MAIN-20190120163942-20190120185942-00492.warc.gz | en | 0.859638 | 341 |
Create an infographic on the importance of vaccines for older adults. Include at least (2) two scholarly sources, add the references at the bottom of the infographic.
Choose one older adult community population (Examples: men, women, certain ethnic groups, etc.) and create an infographic on a topic of preventative screenings or vaccines for this population. Choose to focus on one specific preventative screening (like colonoscopy) or one specific vaccine (like pneumovax). | <urn:uuid:1bc2517e-2cee-4b3a-95e0-5b489ca035b5> | CC-MAIN-2023-40 | https://essayachievers.com/vaccines/ | 2023-10-03T17:06:14Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233511170.92/warc/CC-MAIN-20231003160453-20231003190453-00798.warc.gz | en | 0.803606 | 94 |
The average listing price on SpeedList for this year, make, and model is $20,647.
This vehicle has been on SpeedList for 305 days.
Transmission W/Driver Selectable Mode 3.07 Axle Ratio Gas-Pressurized Shock Absorbers Electric Power-Assist Speed-Sensing Steering 16.5 Gal. Fuel Tank Transmission W/Driver Selectable Mode 3.07 Axle Ratio Gas-Pressurized Shock Absorbers Electric Power-Assist Speed-Sensing Steering 16.5 Gal. Fuel Tank 4-Wheel Disc Brakes W/4-Wheel Abs Front Vented Di Brake Actuated Limited Slip Differential Tires: P215/60R16 Bsw All Season Wheels W/Silver Accents Compact Spare Tire Mounted Inside Under Cargo Body-Colored Front Bumper Chrome Side Windows Trim Body-Colored Door Handles Fixed Rear Window W/Defroster Fully Galvanized Steel Panels Trunk Rear Cargo Access 1 Lcd Monitor In The Front Sync Services Selective Service Internet Access Rear Cupholder Manual Air Conditioning Illuminated Locking Glove Box Full Floor Console W/Covered Storage Mini Overhea Fade-To-Off Interior Lighting Perimeter Alarm 3 12V Dc Power Outlets Airbag Occupancy Sensor Rear Child Safety Locks Transmission: 6-Speed Automatic Rear Defrost Intermittent Wipers Steering Wheel Audio Controls Adjustable Steering Wheel Air Conditioning Passenger Vanity Mirror Driver Air Bag Front Head Air Bag Front-Wheel Drive Strut Front Suspension W/Coil Springs Multi-Link Rear Suspension W/Coil Springs Clearcoat Paint Body-Colored Rear Bumper Speed Sensitive Variable Intermittent Wipers Perimeter/Approach Lights Manual Tilt/Telescoping Steering Column Front Cupholder Remote Releases -Inc: Power Cargo Access Hvac -Inc: Underseat Ducts Full Cloth Headliner Metal-Look Gear Shift Knob Front And Rear Map Lights Delayed Accessory Power Systems Monitor Analog Display Seats W/Cloth Back Material Air Filtration Side Impact Beams Tire Specific Low Tire Pressure Warning Curtain 1St And 2Nd Row Airbags Mykey System -Inc: Top Speed Limiter Audio Volume 4 Cylinder Engine Gasoline Fuel Front Wheel Drive Power Steering Tires - Rear All-Season Temporary Spare Tire Rear Bench Seat Passenger Air Bag Manual Adjustable Rear Head Restraints Instrument Panel Bin Driver / Passenger And Rear Cargo Space Lights Day-Night Rearview Mirror Cloth Door Trim Insert Driver Foot Rest Fuel Consumption: City: 21 Mpg Fuel Consumption: Highway: 32 Mpg Remote Power Door Locks Power Windows Cruise Controls On Steering Wheel Cruise Control 4-Wheel Abs Brakes Front Ventilated Disc Brakes 1St And 2Nd Row Curtain Head Airbags Passenger Airbag Side Airbag Bluetooth Wireless Phone Connectivity In-Dash Single Cd Player Sync Mp3 Player Am/Fm Stereo Radio Data System Speed Sensitive Audio Volume Control Total Number Of Speakers: 4 Braking Assist Abs And Driveline Traction Control Stability Control Privacy Glass: Light Silver Aluminum Rims Wheel Diameter: 16 Wheel Width: 6.5 Driver And Passenger Knee Airbags Urethane Steering Wheel Trim Metal-Look Shift Knob Trim Metal-Look Dash Trim Metal-Look Door Trim Metal-Look/Piano Black Center Console Trim Video Monitor Location: Front Trip Computer Tachometer Manufacturer's 0-60Mph Acceleration Time (Seconds): 8.5 S Power Remote Driver Mirror Adjustment Power Remote Passenger Mirror Adjustment Dual Illuminated Vanity Mirrors Daytime Running Lights Remote Window Operation Audio Controls On Steering Wheel 911 Assist Power Remote Trunk Release Front And Rear Reading Lights Anti-Theft Alarm System Cloth Seat Upholstery Bucket Front Seats Rear Bench Fold Forward Seatback Rear Seats Tilt And Telescopic Steering Wheel Speed-Proportional Electric Power Steering Suspension Class: Regular Interior Air Filtration Manual Front Air Conditioning Tire Pressure Monitoring System: Tire Specific Remote Activated Exterior Entry Lights Cargo Area Light Max Cargo Capacity: 16 Cu.Ft. Vehicle Emissions: Lev3-Ulev70 Fuel Type: Regular Unleaded Fuel Capacity: 16.5 Gal. Instrumentation: Low Fuel Level Clock: In-Radio Display Headlights Off Auto Delay Dusk Sensing Headlights Coil Front Spring Regular Front Stabilizer Bar Independent Front Suspension Classification Strut Front Suspension Four-Wheel Independent Suspension Coil Rear Spring Rear Stabilizer Bar: Regular Independent Rear Suspension Multi-Link Rear Suspension Read More…
You can Buy with Absolute Confidence at Santos Ford! Everyone of our Pre-Owned Vehicles undergo a Rigid 120 Point Inspection and Serviced by Experienced Ford Certified Technicians. We take Great Pride in Attention to Detail for all our Pre-Owned V...
You can Buy with Absolute Confidence at Santos Ford! Everyone of our Pre-Owned Vehicles undergo a Rigid 120 Point Inspection and Serviced by Experienced Ford Certified Technicians. We take Great Pride in Attention to Detail for all our Pre-Owned Vehicles. We ensure they are Dependable, Clean and will make you, our Customer, Satisfied! Please come in, call or e-mail us right now! CARFAX One-Owner. Clean CARFAX. White 2017 Ford Fusion S FWD 6-Speed Automatic 2.5L iVCT 6-Speed Automatic. Odometer is 24392 miles below market average! 32/21 Highway/City MPG Awards: * 2017 KBB.com 10 Best Sedans Under $25,000 * 2017 KBB.com Brand Image Awards * 2017 KBB.com 10 Most Awarded Brands Santos Ford -- No Suits! No Ties! No Lies! Reviews: * Fuel-efficient turbocharged engines; sharp handling; quiet cabin; advanced technology and safety features; improved touchscreen interface; available all-wheel drive. Source: Edmunds * Great mix of sharp handling and composed ride; turbo engines provide punchier acceleration compared to most competitors; quiet and elegantly designed interior with high-quality materials; available all-wheel drive Source: Edmunds | <urn:uuid:d7753dc0-8020-44a3-a0f6-937a41cf3e7d> | CC-MAIN-2018-39 | https://www.speedlist.com/cars/ford-fusion-2017-los-banos-ca-5a0ff7d2f7c798ec01009539 | 2018-09-19T16:31:19Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267156252.62/warc/CC-MAIN-20180919161420-20180919181420-00318.warc.gz | en | 0.707353 | 1,279 |
Light years ahead of the fashion game, Pretty Polly has created the ultimate pair of tights that pay homage to all things embellished and out of this world!
Their Cosmic Scatter Embellished Tights are your fast track way to earn style points, as a glamorous alternative to your normal opaques. Gorgeous clusters of metallic disks can be found on your tights, beginning just above the ankle and finishing just above the knee. Glued onto the 50 denier fabric, the clusters have been made for varying sized discs for a charming effect. Hues of baby blue, pink and a bronzed gold make an appearance, introducing subtle colour against the black base colour.
Remaining the same thickness all the way to the soft 4cm waistband, the Pretty Polly embellished tights come with a reinforced toe which adds a touch of durability. With a slight sheen, these are ideal contenders for that office-to-bar ensemble. Just add metallic accessories to keep up the galactic tribute!
Satisfying our need for all things embellished and gorgeous, these galactic-inspired opaques from Pretty Polly come complete with a 3D gem cluster design.
Sheer to Waist Brief | <urn:uuid:38b8713f-20b4-491a-b85a-4377d7a486d6> | CC-MAIN-2015-48 | http://www.mytights.com/us/pretty-polly-cosmic-scatter-embellished-tights.html | 2015-12-01T15:04:52Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398468233.50/warc/CC-MAIN-20151124205428-00007-ip-10-71-132-137.ec2.internal.warc.gz | en | 0.890044 | 242 |
Julian Schnabel's take on the tormented artist finds beauty in a lack of flow.
Works as a rebuttal to fan service, living on its own with no fault. (✯✯✯✯)
Doesn't let down from its title. (✯✯✯✯)
Too inconsistent as both a socio-political commentary and too ugly as a comedy. (✯½) | <urn:uuid:88df83a6-4061-49d0-8813-7167c18ae551> | CC-MAIN-2019-18 | https://cinemafromthespectrum.com/tag/oscar-isaac/ | 2019-04-19T17:12:19Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578527865.32/warc/CC-MAIN-20190419161226-20190419183226-00189.warc.gz | en | 0.961283 | 89 |
By Dan Shriner
Even though this season may be a rebuilding one for Lake Orion’s girls varsity tennis team, the young Dragons are 3-1 and looking for more success.
The girls defeated Royal Oak on Monday, 5-3.
Coach Eric Bracciano said he has been pleased with the effort and hard work by the team this season.
“We had a huge turnout this year. There were 62 girls try out. It was wonderful to have so much interest and excitement in the program. There is a lot of excitement in tennis now at Lake Orion.”
Three of the team’s top singles players last season graduated and Bracciano said the group now has only four seniors. The bulk of the players are juniors with one sophomore and one freshman.
The three captains are senior Sophie Partington and juniors Kaila McCormack and Alyssa Bowden.
“We graduated quite a few of our girls, three of our four singles players. Sophie Partington would usually be playing number one single but she is battling some injuries and is playing on number one doubles,” Bracciano said.
Partington and Bowden won their doubles match on Monday, defeating their Royal Oak opponents, 7-5, 6-3.
“We are rebuilding but things are going great. Girls are working hard,” he said.
The team competes in the OAA White Division. They have wins against Ortonville, Farmington Hills Harrison as well as the one against Royal Oak. Their one loss came against Berkley and Bracciano said that squad was very good.
Kayla Bruner is playing number one singles. McCormack is the number two singles. Jessica Laconis is number three and Kendra Nylen is number four singles. Gabrielle Garlicki is also expected to contribute to the team’s success. Both Laconis and Nylen won their matches against Royal Oak.
Gabrielle Hamay and Payge Lindow are the number two doubles. Junior Elizabeth Cunningham and freshman Sarah VanRooyen are the number three doubles and Emily Kulkis and Skylar Dawson are number four.
Hamay and Lindow won their match against Royal Oak, 6-3, 6-3.
“The team is doing really well together working as a team. They get along and support each other. That’s very important. It’s been a lot of fun so far. They want to work hard and even though it’s a rebuilding year, they are learning a lot and are excited about this season and next year,” Bracciano said.
By Dan Shriner | <urn:uuid:37200580-8c9b-4618-8ec3-3601504949b5> | CC-MAIN-2019-43 | https://lakeorionreview.com/girls-varsity-tennis-is-3-1-in-oaa-white/ | 2019-10-23T20:27:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987836295.98/warc/CC-MAIN-20191023201520-20191023225020-00150.warc.gz | en | 0.977843 | 561 |
Awesome Change Came About In
Oh am I ever grateful for places like this! Bless you for your efforts here. You do give a great deal to people on their journey. I became aware of crystal life about 10 months ago so I am a newbie, albeit completely totally hooked on the passion invoked by these beings of wonder :)
I bought a Smoky Quartz from a private collection that is a smallish jewel looking very light beauty! Rather like a vogel cut but definitely not. I don't know what this cut is called.
It had a small pool in the mid top region with a clear spear going right thru it! I was so enthralled with this and was lost for long periods in studying it. I carried it everywhere. As things go I bought more crystals and spent time with each one, leaving my Smoky to itself for about 6 weeks.
I picked it up the other day and was amazed at what I saw! ANOTHER pool was started, a few silver mica circles, spears hanging in mid air so to speak. It is beautiful beyond words. I'm just awestruck and looking for answers. Its full of rainbows, blue and gold and silver pieces that look like glass from 1 view yet when turned... you can see this brightly hued landscape of wonder!
How can this be? How did it change and why? Is this normal? Do all crystal quartz change and this fast? I have several pieces showing awesome changes! A raw/rough India green moss agate that I am so attached to - it has awesome healing properties and communicates well, has manifested what appears to be a face!! 2 eyes showed up and the light colored crystals started forming around the eyes!!!
I just don't know what I am experiencing with these crystals. I use a pendulum and am informed that yes sometimes crystals do manifest a face to give humans a focal point. SO FAST??
I have a small clear fairy stone that has a lodite tree in it and this stone has manifested some rapid beautiful changes as well! Full of the brightest colors, white strings, clouds with flower crystals ALL NEW!!
All who read this will think I'm crazy but I assure you I am the kindest, most understanding compassionate person who works as a caregiver for those who suffer debilitating chronic diseases.
I am fairly well read and have an above average IQ. I have always been curious about mysteries of life and finally I find the crystal path! LOL! I am so grateful for my recent journeys... I have used my crystals on occasion with patients willing to explore and the results have been so full of Light it inspires me! The stories...oh I could share some Life! :)
Sorry to make this so long but I wanted you all to get a feel for who I am altho I don't think I am directly responsible for these fast paced manifestations I am so so perplexed by it all. Hoping I can give you all the info you need to give me a clue of why this happens. I know it has had to happen to others. I'm just so new to it.... Well, thanks you for any help you can offer! I am deeply grateful for any input! Blessings! | <urn:uuid:36c7fc90-0e6b-45a1-b9ad-1570061c3188> | CC-MAIN-2018-39 | https://www.healing-crystals-for-you.com/awesome-change-came-about-in-smoky-quartz.html | 2018-09-24T07:30:55Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267160233.82/warc/CC-MAIN-20180924070508-20180924090908-00471.warc.gz | en | 0.963669 | 656 |
a/n Again, thank you to everyone reading/following/favoriting and especially reviewing this! It really means a lot to me! And an enormous thank you to my fantastic beta firewordsparkler. :)
Well, here we are, the last chapter, I hope it lives up to your expectations. This chapter references several events from previous chapters, and since I realize it may have been awhile since some of you have read them, I thought I'd mention a few of the key ones:
1. As children, Sherlock and Mycroft would often sit in Sherlock's closet, originally to comfort Sherlock when he was upset, but it eventually became a safe haven for both of them where they would sit, talk, and escape from the world. (Ch 2+3)
2. Sherlock called this closet their Palace. It was here that Mycroft taught Sherlock how to build a Mind Palace. (Ch 4)
3. Sherlock made a sign their closet-palace, but he got rid of it once Mycroft left for University. (Ch 4+5)
3. When Mycroft left for University, Sherlock told him that his Mind Palace had become a Mind Laboratory. Mycroft assumed that it had remained a Mind Laboratory for the rest of Sherlock's life until John mentioned Sherlock's Mind Palace, which stunned and confused Mycroft. (Ch. 5+7)
And finally, this chapter is dedicated to the memory of Nelson Mandela. May one of earth's greatest sons rest in peace.
"Mycroft," Mummy closed the album and laid her wrinkled hand on Mycroft's own, "Mycroft, what is wrong?"
"What makes you say something is wrong?" Mycroft murmured without thinking.
"Mycroft," Mummy sighed reproachfully, "I'm not half as clever as either of my sons, but I am no fool either. You come home, unannounced, in the middle of the night for the first time in six months, and I find you looking through a photo album…something is wrong, and you cannot bring yourself to tell me." She hesitated, "What happened to Sherlock?"
Mycroft forced himself to meet his mother's eyes. They were calm, but anguished, as if she had been fighting tears for hours. Strange he had not noticed until now. "How do you know something happened to Sherlock?"
"Nothing else could make you this upset," she paused, "And earlier today he sent me a text." She pulled out her iPhone, tapped a few icons, and handed it to Mycroft.
The message was brief.
I am sorry. -SH
Mycroft glanced at the time the message was sent…almost half an hour before Sherlock jumped. Something between a sigh and a groan forced itself through his lips. He handed the phone back to Mummy without looking at her and buried his face in his hands, "Do you know," he began slowly, "That I promised myself years ago that Sherlock would always be my first priority."
"I made a mistake," Mycroft whispered, "And I broke my promise. I told Jim Moriarty Sherlock's life story in exchange for information critical to national security."
He waited as the implication of what he had done descended upon Mummy: "What did he do?" she finally gasped.
"He used the information to convince the world that Sherlock was a fraud. The story ran in the papers this morning." Mycroft had prevented said papers from reaching their doorstep and intercepted all calls or visits from snooping acquaintances.
"Surely you can stop it! Surely you can prove that he is not!" Mummy demanded furiously.
"I can," Mycroft admitted, "And I will, but…it hardly matters now."
"How can you say that? Of course it matters!"
"Mummy," Mycroft had never been gentle with anyone before, except Sherlock twenty-five years ago, and it felt strange, but not as strange as he might have thought….his mother's eyes were the same as his, "He is…" his lips refused to form the word "dead," although it was the truth. But is he really dead a small, desperate corner of his mind asked. There were a few details as he toured the scene and examined the CCTV footage…little things that did not quite add up…or perhaps he simply was not brave enough to tell his mother the truth… "Gone," Mycroft completed, "Sherlock's gone."
"Did Moriarty kill him?" Mummy whispered, tears running down her cheeks.
"We are not certain," Mycroft said carefully, "Moriarty's body was found with a bullet in his head on the roof of Bart's. The angle of the wound leaves no doubt that it was self-inflicted."
"I do not understand," Mummy breathed, "That is good, right?"
Mycroft took a deep breath, "Sherlock was on the roof with him," he said, "Almost immediately after Moriarty shot himself, he threw himself off the building."
"He what!" Mummy spluttered, "Mycroft, your wrong!"
"I'm sorry," Mycroft whispered, and for once, it was the truth, "I could not get there in time."
"No!" Mummy's voice was firm, defiant, as she wiped the tears away from her eyes, "No. He would never do something like that-no matter what happened."
"There were warrants out for his arrest."
"Shut up, Mycroft! Shut Up!" Mycroft did not know his mother was even aware of such colloquialisms, "Sherlock would never kill himself, and you know it!"
There was a pregnant pause, "You are right," Mycroft sighed, "I suspect-and there is no way to prove this-but I suspect that Moriarty forced him to jump."
"How?" Mummy's face was fierce, almost vicious.
"By threatening the lives of John Watson, Mrs. Hudson, and perhaps Greg Lestrade," Mycroft said heavily, "If faced with that choice…I think it is clear what he would do."
Another pause. Mummy's face collapsed back into stunned sorrow, "He died saving his friends," she whispered, simultaneously anguished and awe-struck, "And he brought Moriarty down with him…my brave, brave son."
"Yes," Mycroft agreed, though Moriarty's words 'It wouldn't make a difference if I died,' forced their way to his mind. He did not repeat them.
Mummy did not reply. Instead, she sighed heavily, stood, and left the room. Mycroft did not bother deducing where she had gone off to, so he was surprised when she returned barely a minute later, clutching two crystal glasses and a decanter of their finest scotch in both her hands. Seating herself back on the couch, she filled the glasses and handed one to Mycroft. He accepted it without a word and immediately drained it, relishing the burn of the alcohol on his throat and not caring that he was wasting a hundred pounds worth of liquid without really bothering to taste it. A bottle of American moonshine would suit his current purposes just as well.
"This is what people do, when someone they care about dies, is it not?" Mummy mused, staring pensively at her glass without drinking any, "Sit around and drink."
Mycroft nodded, poured himself another glass, and took a large drink. He had pretended to get wasted many times throughout his years at school and University, but he had never done it properly himself.
Now seemed the ideal time to do so.
"Why is that, do you think?" Mummy mused, still staring at the dark liquid in her glass.
Mycroft pulled the glass he was about to drain from his lips; despite his new found determination to drink until he lost every ounce of self-awareness, he had no desire to do so in front of Mummy.
Perhaps if he answered her question, she could go away, and he could devote his attention to the decanter. "You mean why do people drink when someone dies?" When Mummy nodded, he shrugged, "I suppose they wish to forget."
"Do they?" Mummy frowned at the dark liquid and then glanced at the photo album lying on the coffee table. She set the glass on the table with a loud thunk, "I do not want to forget."
She ran her hand over the soft leather of the album; Mycroft finished his second glass of scotch in a single gulp. He reached again for the decanter, but Mummy grabbed it first. "No, Mycroft."
It was the first time she had tried to tell him "no" since he was four years old. Mycroft sniffed dismissively and reached again for decanter. Before he could reach it, however, Mummy stood and strode to the bathroom. A minute later, she returned, holding a now-empty decanter.
"That bottle was worth several thousand pounds," Mycroft noted, "There was no need to pour it down the drain."
"I do not want to forget," Mummy repeated, "And neither do you."
He raised his eyebrows, "How would you know?" He knew she would understand what remained unsaid: You have never truly known me.
Mummy sighed heavily and sank back into the couch. Then she picked up the photo album again and turned to the picture of her and Sherlock in the hospital, "He was a mistake; did you know that? The result of a single night of madness..." She smiled humorlessly at Mycroft's lack of reaction, "Of course you did. I suppose Sherlock did too."
"Naturally," Mycroft murmured.
"I was not ready," she continued, "I never was, but I thought that, if I loved him enough, it would be alright. I would still be able to give him everything he needed." She gave a short, humorless laugh, "I was wrong, of course, absolutely wrong. He needed, he deserved so much more than love…he needed understanding. He needed you, and you needed him. You still need him," She sighed again, "That is why you do not want to forget, Mycroft, why you will never be able to forget…my son of ice and my son of fire, simultaneously destroying and sustaining each other. It seems impossible, but then I look at you two…" She sighed, "When the fire is gone it becomes all the more important to remember its heat."
Mycroft did not respond to this, but he knew Mummy did not expect him to. Instead, she sighed again, picked up the album, and stood, "I am sure you're busy dear, thank you for telling me yourself…I am going to try to sleep," she gave him a rueful smile, "Though more likely I am going to sit and remember my son." Mycroft nodded. She hesitated, stroking the album absently with her wrinkled fingers, "Will you be making the…arrangements."
Mycroft nodded. Sherlock had always been his responsibility; even death would not change that.
Mummy gave him her familiar, relieved smile, "Thank you," she sighed before slowly heading to her bedroom.
It was a long time before Mycroft moved. His mind supplied him with a thousand matters that needed his attention: sabotaging the North Korean missile program, yet again, saving DI Lestrade's career, mediating a dispute in Parliament, ensuring the assassins vanished from Baker Street, organizing a trade summit with India, arranging the funeral…
Sherlock was dead.
Mycroft supposed this is what grief felt like; it was an emotion he had needed to mimic on occasion but never felt himself. It was a week, volatile state of being that hijacked logic, dismantled efficiency, and eradicated practicality. It made one unforgivably weak.
Since Mummy had ensured that alcohol no longer remained an option, he tried to simply push the emotion away, to remind himself of all the hours of worry and frustration, of every barbed argument, of the thousands of dollars he had spent over the years just to keep Sherlock alive, of the fact that his brother had long ceased to love him.
Then why were the only arguments he could remember their silent but heated battles over whether the important men Father had over for dinner had one or two mistresses? Why were the only late nights that seemed to matter were the ones he and Sherlock spent as children reading in comfortable silence until dawn? Why was the only note-worthy expense the suit Sherlock had purchased with the credit card he stole from Mycroft because, "If one is to work as a Consulting Detective, one must look the part?" Why were the only drugs busts that seemed of any importance were those carried out by an exasperated Lestrade recovering evidence? Why could he not forget the three-year-old toddler burying his face in Mycroft's shoulder as they both hid from the terrors of the mundane world in their tiny Palace?
It was another long moment before Mycroft realized this new, immobilizing, emotion was not grief at all. Only good men, the John Watson's of the world, were allowed to grieve. Mycroft was left with something far bitterer.
Because he had failed.
All the years as he guided, enticed, pushed, pulled, dragged Sherlock through over twenty-five years of living. After dealing with self-righteous teachers and insecure bullies, with gossiping acquaintances and jealous fathers, with cocaine and heroin Sherlock's self-destructive personality until Sherlock finally reached something that could almost be described as happy.
After all this, when the greatest battles had seemed to be over, he had failed.
And he would never be able to fix it.
Because Sherlock was dead.
The words seemed wrong, as if they violated some unspoken law of nature; Sherlock was a force of nature unto himself. He could not simply die.
You saw the body, he berated himself. You stood with Molly in the morgue and saw the body. You checked for a pulse, knowing you would not find one, then you ran your fingers through his hair and kissed his brow, and you told him how sorry you were as Molly said in a trembling voice that he did not suffer much. Then you looked at her, this unimportant girl with her silly crush, and she looked so inexplicably guilty, and even a little afraid, and you wondered why she seemed more guilty than sad. One more detail that did not make sense, almost as if he was not…
Mycroft jumped to his feet (he most certainly had not done that for several decades) and nearly ran to the stairs. It was absurd, ridiculous, impossible to even entertain the notion that his brother was still alive, and yet there were so many things, so many tiny details that did not quite add up, something that made the whole blasted situation seem so…Sherlock-like. If he had Miss Hooper's help…Mycroft could just see a way he could have done it...and there was one place the Elder Holmes thought his brother might go.
He burst into Sherlock's room, breathing harder than he ever had in his life. The room was completely dark, but the light in the hall allowed him to just distinguish the outline of the open closet door, and sitting in the closet, without so much as a scratch…
"Shut the door," Sherlock Holmes commanded.
Swallowing his shout of relief, Mycroft obeyed. He then crossed the room and made sure the curtains were completely shut before switching on a desk lamp. Sherlock scowled as the room was bathed in shadowy light but did not comment. Mycroft stared at his brother, taking in the every dark curl, every fold of his coat, the navy scarf folded around his neck, "You're here," Mycroft whispered.
Sherlock's scowl deepened, "Believe me, dear brother," he sneered- Mycroft had never heard anyone's voice drip with such loathing: "It is only because I had nowhere else to go." Despite his glee, Mycroft also felt as if he had been punched in the gut; he would never be forgiven for what he had done. Sherlock closed his eyes, "Moriarty's men are still out there," he said, most of his hatred replaced with crushing weariness that Mycroft found more terrible than his rage. He had rarely seen anyone so exhausted, so dejected. Sherlock face was that of a man who had lost everything. The strange and unwelcome feelings of guilt, of regret, assaulted him once more, "They will be searching, making sure I am actually dead; I cannot even contact the homeless network. The only place I am reasonably confident his men would not, and could not, look is…here," he completed with another scowl, "Unless, of course, you are entertaining them…seeing as you are such great pals."
"Sherlock," Mycroft murmured, "Sherlock I am so…"
"Don't," Sherlock snarled, his eyes snapping open as he glared at his brother, "Just don't." There are not words enough his eyes completed.
Mycroft nodded, fighting the insane urge to sit next to Sherlock in the closet and wrap his arms around him until all their problems disappeared, as if they were children again. It was ridiculous, of course. These problems would not simply go away, and, in any case, Mycroft was certain Sherlock's would throttle him if he got close. Instead, Mycroft seated himself on the edge of the bed. "We have an extensive file on Moriarty's organization," he said carefully, "Not complete by any means, but enough to give you a place to start."
Wordlessly, Sherlock reached into the folds his coat and pulled out a thick file. Mycroft opened his mouth to ask how on earth is brother had gotten it before deciding the he did not want to know. "It is a passable attempt," Sherlock sniffed, flicking through the file, "But you are clearly missing most of the critical threads."
"I know," Mycroft agreed, "I am certain you are the only who capable of unraveling it completely."
"Then why not give it to me before now?"
Mycroft shot his brother a rueful smile, "Would you believe that I was trying to protect you?"
Sherlock glanced up sharply, his blue-grey eyes boring into Mycroft's. "Well, you certainly botched that up," he said finally.
Sherlock sighed and closed the file, "I'm assuming he offered you information on the key code, and perhaps a few tidbits about some prominent terrorist cells."
Sherlock starred up at the ceiling, "It's no real, you know, they key code. He just made it up."
Fifty curses in a dozen language surged through Mycroft's head all at once. He made use of a few choice ones before finally asking, "When did you figure it out?"
"Sooner than Moriarty thought, just before I went to the roof…but not soon enough."
"He really is dead then?" Jim Moriarty seemed too inhuman to die, almost like Sherlock.
"Yes," Sherlock said matter-of-factly, still inspecting the ceiling, "He went to the rooftop ready to die. It was simple enough to convince him to go through with the suicide."
"You convinced him to shoot himself," Mycroft breathed, "How?"
"I promised to shake hands with him in hell," Sherlock said with a small, fierce smile.
"There was something in Sherlock's eyes…a wild darkness that had always lurked beneath the surface but was rarely called to the forefront…that made the Elder Holmes shudder involuntarily: "I do not doubt you would."
Sherlock shot his brother a look that resembled both a grimace and a mirthless smile before returning to his study of the ceiling.
The silence dragged on for several uncomfortable minutes, "Mummy got your message," Mycroft said finally.
A strange look-was it guilt?-flickered across Sherlock's features before being buried beneath his expressionless façade, "Yes."
"Do you wish to tell her?"
"Sherlock, she was heartbroken."
"And you think John isn't," Sherlock hissed, his eyes flashing with renewed rage
Of course, Sherlock was right. "He does not believe you were a fraud," Mycroft murmured.
"I know," Sherlock sighed, "I hoped that lie would make it easier for him…it is far simpler to hate a fraud…but it was unlikely."
They lapsed, once again, into silence. Sherlock resumed his inspection of the ceiling with a small, broken, frown, and Mycroft studied Sherlock. He wondered when his little brother had finally grown up, when he had finally found something he cared about more than himself, more than the Work, his reputation, everything that had, not long ago, made him Sherlock. When had the cold, tormented, self-destructive youth been replaced with the man who threw himself off a building to save the people he loved? How had Mycroft missed the change?
"Did you tell him about this place?" Sherlock's words came in a rush as he indicated the closet (though Mycroft still thought of it as The Palace) around him, but his gaze did not waver from the ceiling.
"Moriarty? No," Mycroft said firmly.
"Why not?" Mycroft read the silent accusation on his brother's features: You told him everything else.
It was several seconds before Mycroft could bring himself to speak: "For the same reason you never told John why you still keep your closet in 221b empty." He knew Sherlock would hear what remained unsaid: Those memories are sacred.
Sherlock did not answer. Instead, he turned the full force of his gaze on Mycroft. It was a terribly uncomfortable experience; the Elder Holmes felt as if the blue-grey eyes were piercing his soul, but Mycroft did not look away. After a long moment that seemed also to be an eternity, Sherlock nodded.
Mycroft sighed again, in relief this time, as the weight of twenty years' worth of silent conversations, of battles and betrayals with their endless cycles of hatred, forgiveness, resentment, and affection eased a little. He felt both ancient and young. The past, especially the recent past, was by no means forgotten or forgiven…far from it, but the memory of a long-gone childhood resuscitated the hope that, perhaps, they would one day call each other brothers. It was more than Mycroft had dared hope for five minutes ago.
"When do you intend to leave?" Mycroft said finally. As always, Sherlock understood. I am so glad to have you home, please do not feel you need to leave quickly.
Sherlock stood, "I should leave immediately. It has been twelve hours; most of Moriarty's men will have stopped searching." I know, but I have another home, and another family, and I will not rest until they are safe.
"Stay the night at least." You need to rest.
"I can't." I won't.
"Sherlock," Mycroft half-growled, half-pleaded."Stay just a few hours, and I will be able to procure you a new identity, which will save you far more time than you will be spending here." Let me help you. Please.
Sherlock scowled, "Fine." But only for John's sake.
Mycroft nodded, pulled out his phone, and began making calls. Sherlock sat back down in the closet, leaned his head against the wall, and closed his eyes-clearly more exhausted than he had been letting on.
"Finished," Mycroft announced fifteen minutes later. Sherlock's eyes snapped open, all traces of weariness gone. "You are now officially a special agent deep undercover in Her Majesty's service…It is merely a technicality," Mycroft rolled his eyes at this brother's scowl: "You are not accountable to anyone, but it will give you access to all the government's resources, should you ever feel you need them. Your new identification papers, along with a debit card with a million pounds, will be dropped in the post box in approximately six hours. And before you ask, I was more than discreet. You are a ghost in the system; no one, not even the people making the papers, have enough information to know you are alive." Sherlock nodded in satisfaction, and Mycroft stood and stretched his limbs. The conversation was over, and they were both due for some sleep. "Do try to get some rest," he said as he laid his hand on the door handle.
Sherlock stood and glided across the room, stopping a few feet away from his brother, "Eventually."
It was the best Mycroft could hope for, so he nodded and turned to leave. He hesitated, his hand pulling the door open before he snapped it shut and whirled around again. Perhaps it was because this was the first time they were both in Sherlock's bedroom since Mycroft had first visited after starting University, perhaps it was because they were both exhausted, perhaps it was the hope-inducing words of a certain army doctor, perhaps the observations of a distraught mother, or perhaps it was because he was so relieved that Sherlock was really, truly alive, but Mycroft found himself asking, "When did you change it back?"
Sherlock blinked, "What?" Mycroft could not tell if his brother's confusion was genuine, or if he simply did not want to talk about it. Mycroft hesitated; Holmes' did not discuss emotions, the past….sentiment. More to the point, he and Sherlock never discussed such trivial, normal things.
Then again, Sherlock was about to embark on the most dangerous and difficult case of his life; both of them knew it was possible that he would never return, and Mycroft was the only one, with the exception of Miss Hooper, who knew that he was alive.
Much as they both rued change, a slight adjustment in their relationship seemed necessary.
"Your Mind Palace," Mycroft said finally, "You told me you changed it to a Laboratory, but John referred to it as a Palace." Sherlock's face was expressionless, and it took all of Mycroft's considerable will to hold his gaze, "When did you change it back?"
Sherlock cocked his head and stared at Mycroft with narrowed eyes. It was nearly half a minute before he sighed, a deep, tired sigh that seemed to say everything and nothing. Then he straightened himself, and said slowly, "It was always a Palace." Then he smirked, a strange smirk that was both conceited and strangely sad. How foolish you are to think I am able to simply delete you.
"Ah," because even emotionally competent individuals would not be able to describe the staggering wave of…was there even a word? Relief, gratitude, love? None of them sufficed.
Nevertheless, he could not simply walk out now, so he settled on saying something trite, mundane, normal…"Good luck." Good luck, dear brother, and know that I love you more than I can say, and you could never make me prouder.
Sherlock's lips peaked up in something that vaguely resembled a smile, "I thought we agreed caring is not an advantage."
Mycroft smiled. You know you were always the exception. "Goodbye Sherlock."
"Goodbye Mycroft," Sherlock said, without any sarcasm. And thank you.
The Elder Holmes nodded, because he knew what his brother's silent gratitude really meant. A strange, foreign lump rose in his throat; it was time to leave before he broke down competely. With a final nod to his brother, Mycroft turned and left the room.
He did not try to be there when Sherlock slipped away. Everything there was to say (and not say) had been said (and spoken in silence), and Mycroft knew his brother would prefer to begin his journey in solitude. Instead, the Elder Holmes got nine-and-a-half hours of sleep-by far the longest night's rest he had had in nearly three years-showered, and dressed leisurely before heading downstairs.
The house was silent; perhaps Mummy had finally drifted off to sleep. Mycroft felt a brief twang of guilt for their deception, but Sherlock was right, it could not be helped, so Mycroft deleted the feeling.
He instructed the cook to prepare him an omelet and, while he waited, wandered outside to check the post box. He opened the box and smiled; Sherlock had taken everything, including the mobile Mycroft had ordered placed there. Still smiling, he strolled back into the house, settled himself at the dining room table with his laptop, his omelet, and a cup of tea, and began attacking his mountain of work. The first order of business was to set up level four protection around John Watson, Mrs. Hudson, Molly Hooper, and Greg Lestrade. While he had no doubt Sherlock successfully convinced the world that he was dead, once he started eliminating some of the key strands of Moriarty's web, someone would undoubtedly realize the truth, and the lives of Sherlock's friends would be in peril again. Mycroft was determined to prevent this eventuality, without their knowledge of course. John in particular was already more than ready to kill him.
The next few hours passed peacefully as Mycroft methodically worked through his barrage of emails. It was only after he had given the go-ahead for the North Korean sabotage operation that he realized it was nearly noon, and Mummy really should be up.
Sighing, he closed his laptop, stood, and made his way upstairs. To his mild surprise, Mummy was not in her room, and, judging by the state of her bed, she had not slept the night before.
His phone pinged. Mycroft pulled it out of his pocket and read the message with a small smile.
Departing. Take care of John -SH
Smiling, Mycroft quickly typed a response.
Naturally. – MH
The response was nearly instantaneous.
Disabled the GPS tracker in this. - SH
Needed to give you something to do while you waited for your flight. -MH
As Mycroft anticipated, there was no reply. Pocketing the phone, he resumed his search for Mummy.
He found her, unsurprisingly, in Sherlock's room. She was finally asleep, curled under the covers of his bed. The photo album was clutched to her chest. Mycroft briefly considered waking her before deciding that there was really no need. "Imagine that," he murmured to her, "Fire and ice do sustain each other after all." Then turned to leave, his thoughts already forming his newest strategy to mediate the latest squabble in Parliament, but a flicker in the corner of his eye made him pause and enticed him to turn towards the closet-palace.
The closet door was ajar; Mycroft was just able to see a corner of the blue blanket, folded neatly on the floor. It took him another moment to realize what had changed.
Since the closet door was partially open, the front of it was not immediately visible. Mycroft had trained himself to avoid looking at the door anyway, not wanting to be reminded of the sign that had once hung there before it was torn off and destroyed in Sherlock's rage, leaving the door, and their relationship, burned, destroyed, empty.
Except the door was not empty.
Hardly daring to breathe, Mycroft approached the closet door and ran his trembling fingers over the paper now hanging there. The sign was abused: wrinkled, stained, torn, and burned. Yet Mycroft could still make out the words painstakingly written by a five-year-olds unsteady hand nearly twenty-five years ago, words that an eleven-year-old had miraculously decided not to destroy, words that a twenty-eight-year-old had returned to their original home.
My and Sherlock's Palace
Fumbling for his phone, Mycroft typed a message. His fingers hovered over the keys for a moment before he finally pressed "Send".
You are still my first priority. –MH
Then, for the first time since he comforted his hysterical three-year-old brother all those years ago, a tear ran down Mycroft Holmes' cheek.
a/n Again, thank you so much for all of your support. This is the first time I have shared my personal writing to the public, and it has been an amazing experience...mostly because of all of you. :)
As always, I'd love to hear your thoughts, especially on this chapter. It was incredibly complicated writing any type of a reunion for these two without going completely OOC, and I'd love to know how you think I did/how I could improve.
Thank you so much for reading :) | <urn:uuid:7fd82b59-feb9-4094-984f-f38ee86327a9> | CC-MAIN-2017-26 | https://www.fanfiction.net/s/9716507/10/Of-Palaces-and-Memories | 2017-06-25T20:55:18Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320582.2/warc/CC-MAIN-20170625203122-20170625223122-00695.warc.gz | en | 0.990633 | 6,921 |
Grew Up... poor, in Dundee, Scotland. Logan’s mother was widowed and eventually sent him off to be raised in Quebec, Canada by his aunt and uncle. Logan has a tense relationship with his estranged brother Ewan.
Living... with absurd wealth, in New York City. Logan lives in a stunning two-story penthouse apartment on Fifth Avenue.
Visiting... anywhere his work takes him or anywhere he wants his private jet to go. As Logan knows, “Money wins.”
Profession... founder and CEO of Waystar Royco. It’s the fifth-largest media conglomerate in the world, with branches including a TV news station, a film production studio, amusement parks, and cruise ships. In his position as CEO, Logan can hobnob with everyone from top international businessmen to the President of the United States.
Interests... baseball and collecting war medals.
Relationship Status... remarried… again. Logan’s eldest son Connor was born during his first marriage. He next married British aristocrat Caroline Collingwood and they had Kendall, Roman, and Siobhan. Logan is currently married to his third wife Marcia. They seem to have a strong partnership, if perhaps an unusually pragmatic one.
Challenge... surviving a stroke and saving his company. Though Logan promised to pass on the CEO position to Kendall, he has second thoughts about giving up control. On his 80th birthday, he makes the decision to stay on as CEO for a few more years only to unexpectedly have a stroke. As Logan recovers, he finds himself locked in a power struggle with his son, who fears his dad just isn’t up for the job anymore.
Personality... bullish, cutthroat, and utterly ruthless. Logan would much rather be feared than loved. He lacks any natural sense of compassion or empathy. His signature way to end a conversation is, “F*ck off.” He sees life as a series of power games to be won—and he’s happy to make those games as twisted as powerful. Logan is a smart, strategic businessman, and humiliation is just another tool in his arsenal. Yet Logan’s arrogance is also his weakness. He refuses to acknowledge that he has limits or flaws, even when it’s clear his health is declining.
Fans of him also like: | <urn:uuid:d269da40-c575-4f06-83e0-1bec82d327a5> | CC-MAIN-2023-06 | https://www.charactour.com/hub/characters/view/Logan-Roy.Succession | 2023-02-02T20:39:39Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500041.18/warc/CC-MAIN-20230202200542-20230202230542-00663.warc.gz | en | 0.985474 | 504 |
I’d lusted after the 2m module for my Elecraft KX3 for some time now and finally succumbed after good reports from Michael (G0POT). I wanted the transverter for two main reasons; one for VHF SOTA activations and two for 2m contests. The receive performance on the Elecraft KX3 blows my Yaesu 857 and 817 out of the water and I wanted to make use of this better performance during contests.
This post won’t outline all of the steps to install the module but will talk about my experiences during installation. Elecraft have already written an excellent installation guide.
The first step was to fit the SMA connector, the KX3 uses the existing BNC connector for 160m-6m and the SMA for 2m. To do this I had to remove the ATU module and then struggle for some time to make space for the connector. The location of the toroids was right next to where the connector comes in and I had to move these as carefully as I could to make some room:
The 2m module comes with ultra-miniature coax (UMC) cable to take the signal from the SMA connector to the main KX3 board and another one to connect the module to the main board. I’d never worked with these UMC SMA connectors before and they are difficult to line up properly, so that you can snap them into place. The make a distinctive snapping noise once fitted correctly, but this requires a worrying amount of force employing the use of the flat end of a pen, as they’re too small to use your fingers!
The next step was to refit the ATU module and then fit the 2m Module on top of this. If you have an Elecraft KX3 you’ll know it packs a lot of performance for such a small portable rig, this means there’s very little space to work with inside. I found the fit to be extremely tight when I added the 2m module and it took some getting right to ensure everything was correctly aligned.
Once I had finished the installation I needed to setup the transverter options in the KX3 menu system. The installation guide takes you through all of this and I found it easy enough. With this I had completed the installation and my KX3 is now ready for 2m… I just need to test it in anger now!
In conclusion the installation was harder than expected. I had built my KX3 from a kit and found this quite straight forward, but I did have difficulty with this module due to the tight fitting components and the UMC coax connectors. In hindsight I should have had it installed by Water Stantons for a couple of quid, but instead sweated for about an hour! | <urn:uuid:8cd0ebc7-1c77-4033-909c-90957082b731> | CC-MAIN-2019-09 | http://www.hamblog.co.uk/installing-the-elecraft-kx3-2m-module/ | 2019-02-23T22:09:02Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550249550830.96/warc/CC-MAIN-20190223203317-20190223225317-00408.warc.gz | en | 0.967151 | 582 |
Roccat has launched a new gaming mouse this week in the form of the Kone XP a wired mouse with a translucent casing offering 15 programmable buttons and a maximum of 29 different possible functions. As you would expect the mouse is equipped with RGB lighting featuring 22 LEDs and features a Roccat Owl-Eye 19K DPI optical sensor.
Now available to preorder the Roccat Kone XP gaming mouse is priced at $90 and will officially launch next month on March 29, 2022. Available in both black-and-white the gaming mouse is compatible with NVIDIA Reflex and features a lightweight flexible PhantomFlex cable.
“The Kone XP is the latest mouse in ROCCAT’s best-selling Kone Range. The refined ergonomic shape and 15 programmable buttons provide unprecedented customization and comfort, while the 22 LED’s and 8 light guides deliver a revolutionary 3D lighting experience. The superb ergonomics of the refined, iconic Kone shape ensure comfort. The Kone XP features 15 buttons, and thanks to Easy-Shift[+]™ duplicator technology there are 29 possible button functions. The translucent shell sets the stage for the Kone XP’s 22 LEDs and 8 light guides, creating an unprecedented deep and immersive lighting experience.”
Roccat Kone XP gaming mouse specifications:
- Refined Kone shape with multi-button design
- 15 programmable buttons with 29 possible functions
- 3D RGB lighting with 22 LEDs
- Krystal 4D wheel provides deeper customization
- ROCCAT® Owl-Eye 19K DPI optical sensor
- Tactile & fast Titan Switch Optical
- Lightweight & Flexible PhantomFlex cable
- Heat-treated pure PTFE glides for a smoother motion
- 2-year limited manufacturer warranty
- NVIDIA Reflex compatible
“Left and right lateral inputs add to the standard vertical click and scroll functionality, all delivered with our signature tactile feel. Made from translucent materials, the Krystal 4D Wheel beautifully diffuses the RGB lighting. Providing a tactile and responsive click, with speed-of-light actuation for unprecedented speed and precision. It’s faster than any mechanical switch, has a 100 million click life cycle and has twice the durability, giving you the competitive edge game after game. “
Source : Roccat | <urn:uuid:56da3c12-f6c2-497b-971e-d0024c83695a> | CC-MAIN-2022-21 | https://www.geeky-gadgets.com/roccat-kone-xp-gaming-mouse-25-02-2022/ | 2022-05-18T02:42:02Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662521041.0/warc/CC-MAIN-20220518021247-20220518051247-00406.warc.gz | en | 0.836433 | 482 |
7/29/16 - DEUCE Lifestyle: Introducing the Pitmaster
It’s not the first time we’ve been graced with the presence and food of Three Ten BBQ. In fact, we ate like kings a this past annual Memorial Day “Murph” thanks to head pitmaster Tom Paccioretti. Tom trains at DEUCE in the GPP program and uses his training to represent DEUCE Racing while he competes in his sport.
What’s his sport you ask? It’s competitive BBQ, of course.
Expect to see the smoker rolling on Thursday afternoons. Tom will be dishing out fine smoked meats and even BBQ classes because, well, it’s not always all about push ups and barbells.
Find a 1RM Front Squat
Then, complete the following for time: | <urn:uuid:c31b217f-45af-4e31-a722-675ce746ca6f> | CC-MAIN-2019-09 | http://www.deucegym.com/2016/07/ | 2019-02-17T23:55:44Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247483873.51/warc/CC-MAIN-20190217233327-20190218015327-00267.warc.gz | en | 0.905902 | 185 |
An improved method for extraction and purification of termite endo[beta]-1,4-glucanase from FTA[R] cards.
Termites (Physiological aspects)
Bujang, Nurmastini Sufina
Harrison, Nigel A.
|Publication:||Name: Florida Entomologist Publisher: Florida Entomological Society Audience: Academic Format: Magazine/Journal Subject: Biological sciences Copyright: COPYRIGHT 2011 Florida Entomological Society ISSN: 0015-4040|
|Issue:||Date: June, 2011 Source Volume: 94 Source Issue: 2|
|Geographic:||Geographic Scope: United States Geographic Code: 1USA United States|
FTA[R] technology is an approach designed to expedite and simplify
the collection, preservation, storage, shipment, and recovery of nucleic
acid from the storage matrix (Whatman Inc. 2002a). FTA[R] cards have
been used and evaluated for DNA archiving of various biological sources
(Moscoso et al. 2004; Harvey 2005). However, this method is expensive
($1.14/sample) and preparations can be elaborate, thus pushing
researchers to devise alternative and cheaper methods for DNA
preservation and storage (Owens & Szalanski 2005). Furthermore, in
some cases, DNA retrieval from the FTA[R] cards is complex and requires
highly selective conditions (Hide et al. 2003; Adams et al. 2008).
Hence, some researchers have had to modify the protocols to retrieve DNA
from the FTA[R] cards in their studies (Silva et al. 2004; Smith &
For termites, we have failed to obtain successful amplifications from the nucleic acid processed using any of the manufacturer-recommended procedures. Thus, we have developed a new combination of methods for DNA recovery from FTA[R] cards.
In our study, the gene of interest was a cellulase of termite origin in the glycoside hydrolase 9 superfamily. These endo-[beta]-1,4-glucanases are produced by the termite itself to digest cellulose. Seven species of termites from the family Termitidae were analyzed. Nasutitermes corniger (Motschulsky) was obtained from a laboratory culture collected from Dania Beach, Florida, USA. Nasutitermes sp., Macrotermes gilvus (Hagen), M. carbonarius (Hagen), Microcerotermes crassus Snyder, Microtermes pakistanicus Ashmead and Odontotermes sp. were all fresh specimens collected at Universiti Sains Malaysia, Pulau Pinang, Malaysia.
After collection, termite workers were rinsed with 85% EtOH to remove any surface debris and then allowed to air-dry for several minutes. Nucleic acid from the head capsules of 10 termite workers was released and preserved on the FTA[R] Plantsaver Card (Whatman Inc., Newton, MA) according to the manufacturer's protocol. Only termite heads were used to avoid sample contamination by DNA of resident gut microorganisms.
Using a sterile blade and forceps to prevent contamination, we excised a 1-[cm.sup.2] piece containing dried nucleic acid extract from the FTA[R] card sample area and placed it in a 1.5-mL microcentrifuge tube containing 300 [micro]L TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) as elution buffer. The tube was then vortexed for 20 s before storage in a refrigerator at 4[degrees]C for 1 h. Each hydrated strip of FTA[R] card was squeezed with sterile forceps to release as much nucleic acid as possible into the elution buffer before the strip was discarded. The eluate was then purified with the Wizard[R] DNA Clean-Up System (Promega Corp., Madison, WI) following the manufacturer's procedure. As a negative control, a similar strip of FTA[R] card containing no sample was processed in the same manner to ascertain that the FTA[R] card alone did not yield positive results.
PCR was performed with specifically-designed endo-[beta]-1,4-glucanase primers NTf3 (Tokuda et al. 1999) and NTr7 (Tokuda et al. 2004). Amplifications were conducted in 50 [micro]L final reaction volumes, each containing standard PCR Buffer with 1.5 mM Mg[Cl.sub.2] (Innis & Gelfand 1990), 2 [micro]L DNA template, 50 ng of each primer, 125 [micro]M of each dNTP and 1 U EconoTaq DNA polymerase (Lucigen Corp., Middleton, WI). Apart from the standard positive control DNA (NC-Q) extracted with DNeasy[R] Blood & Tissue Kit, an additional positive control (1 [micro]L NC-Q + 1 [micro]L FTA[R] negative control) was performed to dismiss the possibility of inhibition solely by FTA[R] cards. The primers used for PCR are available as supplemental information. The temperature profile for the first cycle was 94[degrees]C for 2 min, 52[degrees]C for 2 min, and 72[degrees]C for 3 min. For the remaining 44 cycles, the temperature profile was 94[degrees]C for 1 min, 52[degrees]C for 2 min, and 72[degrees]C for 3 min.
The endo-[beta]-1,4-glucanase form 7 species of higher termites was successfully amplified from the DNA retrieved from the FTA[R] card, as determined by electrophoresis of PCR products through 1% agarose gels and visualization of products by UV transillumination after staining with ethidium bromide (Fig. 1). Aliquots (1 [micro]L) of purified PCR products were quantified by comparison with serial dilutions of uncut lambda DNA (Promega) in 1% agarose gels (Fig. 2) and sequenced.
[FIGURE 1 OMITTED]
Our DNA retrieval method offers a few advantages over the processing method recommended by the manufacturer. For example, the latter's standard process necessitates the use of FTA[R] Purification Reagent (Whatman Inc., Newton, MA; $232.18), TE buffer (10 mM Tris HCl, 0.1 mM EDTA, pH 8) and Harris Micro Punches ($312.88) (or Harris Uni-Core Punches; $95.84). Our processing requires none of these, only the Wizard[R] DNA Clean-Up System ($1.38/prep) instead. The genomic DNA elution by a room temperature pH method (Whatman Inc. 2002b) is similar in concept to our method, but requires previous washing with the FTA[R] Purification Reagent, and the added use of 2 different solutions; namely 0.1 N NaOH, 0.3 mM EDTA (pH 13), and 0.1 M Tris-HCl (pH 7). In addition, sample disc size is a critical factor because insufficient DNA affects amplification while excessive DNA may cause inhibition. However, despite these considerations, neither the 1.2-mm, 2.0-mm nor the 3.0mm diameter discs with the manufacturer's method has ever produced successful amplification of endo-[beta]-1,4-glucanase in our experience.
[FIGURE 2 OMITTED]
In conclusion, we report an improved method for extraction and purification of termite nucleic acid from the FTA[R] Plantsaver Card (Whatman), which involves elution with TE buffer (pH 8) and purification with Wizard[R] DNA Clean-Up System (Promega). Our DNA recovery protocol requires less material, equipment, preparation, and manipulation, and reduces processing time, costs and chances for contamination compared with the manufacturer-recommended FTA[R] purification protocol. Most important, in relation to our study, it has been consistently effective in obtaining termite nucleic acid permitting further DNA analysis when all other methods have failed.
Adams, E. R., Hamilton, P. B., Malele, I. I., and Gibson, W. C. 2008. The identification, diversity and prevalence of trypanosomes in field caught tsetse in Tanzania using ITS-1 primers and fluorescent fragment length barcoding. Infect. Genet. Evol. 8: 439-444.
Harvey, M. L. 2005. An alternative for extraction and storage of DNA from insects in forensic entomology. J. Forensic Sci. 50(3): 627-629.
Hide, G., Hughes, J. M., and McNuff, R. 2003. A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilization on FTA[R] paper. BMC Ecol. 3: 7.
INnis, M. A., and Gelfand, D. H. 1990. Optimization of PCRs, pp. 3-12 In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White [eds.], PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 482 pp.
Moscoso H., Thayer, S. G., Hofacre, C. L., and Kleven, S. H. 2004. Inactivation, storage, and PCR detection of Mycoplasma on FTA[R] filter paper. Avian Dis. 48: 841-850.
Owens, C. B., and Szalanski, A. L. 2005. Filter paper for preservation, storage, and distribution of insect and pathogen DNA samples. J. Med. Entomol. 42(4): 709-711.
Silva E. S., Gontijo, C. M. F., Pacheco, R. S., and Brazil, R. P. 2004. Diagnosis of human visceral leishmaniasis by PCR using blood samples spotted on filter and. Genet. Mol. Res. 3: 251-257.
Smith, L. M., And Burgoyne, L. A. 2004. Collecting, archiving and processing DNA from wildlife samples using FTA[R] databasing paper. BMC Ecol. 4: 4.
Tokuda, G., Lo, N., Watanabe, H., Slaytor, M., Mat SUMOTO, T., AND NODA, H. 1999. Metazoan cellulase genes from termites: intron/exon structures and sites of expression. Biochim. Biophys. Acta. 1447: 146-159.
Tokuda, G., Lo, N., Watanabe, H., Arakawa, G., Mat-SUMOTO, T., AND NODA, H. 2004. Major alteration of the expression site of endogenous cellulases in members of an apical termite lineage. Mol. Ecol. 13: 3219-3228.
WHATMAN, INC. 2002a. FTA[R] protocols: collect, transport, archive and access nucleic acids--all at room temperature; WB120047. Copyright Whatman Inc.
WHATMAN, INC. 2002b. Whatman Application Note: Eluting Genomic DNA from FTA[R] Cards Using Room Temperature pH Treatment. Copyright Whatman Inc.
NURMASTINI SUFINA BUJANG (1) *, NIGEL A. HARRISON (2) AND NAN-YAO SU (1)
(1) Department of Entomology and Nematology, Fort Lauderdale Research and Education Center, University of Florida, Institute of Food and Agricultural Sciences, 3205 College Avenue, Fort Lauderdale, FL 33314-7719, USA
(2) Department of Plant Pathology, Fort Lauderdale Research and Education Center, University of Florida, Institute of Food and Agricultural Sciences, 3205 College Avenue, Fort Lauderdale, FL 33314-7719, USA
Supplemental material online at http://www.fcla.edu/FlaEnt/fe942.htm#InfoLink2
Table 1: Primers used in the study by NURMASTINI SUFINA BUJANG, NIGEL A. HARRISON AND NAN-YAO SU entitled AN IMPROVED METHOD FOR EXTRACTION AND PURIFICATION OF TERMITE ENDO-[beta]-1,4-GLUCANASE FROM FTA[R] CARDS. Florida Entomol. Vol 94, No. 2. Primer Direction Gene Sequence (5' to 3') References name 16br Forward 16S CGCCTGTTTAACAAAAACAT 16ar Reverse 16S CCGGTCTGAACTCAGATCACGT NTf3 Forward EG GGCCGGCGAAACAGCCGCCGCCCTCGCTG Tokuda et al. 1999 NTr7 Reverse EG GGCCGGCGAAACAGCCGCCGCCCTCGCTG Tokuda et al. 2004 TOKUDA, G., LO, N., WATANABE, H., SLAYTOR, M., MATSUMOTO, T., AND NODA, H. 1999. Metazoan cellulase genes from termites: intron/exon structures and sites of expression. Biochim. Biophys. Acta. 1447: 146-159. TOKUDA, G., LO, N., WATANABE, H., ARAKAWA, G., MATSUMOTO, T., AND NODA, H. 2004. Major alteration of the expression site of endogenous cellulases in members of an apical termite lineage. Mol. Ecol. 13:3219-3228.
|Gale Copyright:||Copyright 2011 Gale, Cengage Learning. All rights reserved.| | <urn:uuid:e4a07253-213d-4cdb-aab8-051d43726ada> | CC-MAIN-2017-09 | http://www.biomedsearch.com/article/improved-method-extraction-purification-termite/263441295.html | 2017-02-24T02:23:10Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171271.48/warc/CC-MAIN-20170219104611-00604-ip-10-171-10-108.ec2.internal.warc.gz | en | 0.82175 | 2,968 |
The simplicity starts with its design: a single button with a scrolling dial underneath an LED interface. That button is the only one on the entire machine. With it, you set the time, set the water temperature, set how many cups you want brewed, and when you want the brewing to start. It takes a second to get the hang of it, but we were impressed with how intuitive it is — a stark contrast to a machine like the Moccamaster KBT 10-Cup Coffee Brewer, which had so many extra pieces, it required constant consultation of the instruction manual.
Percolators began to be developed from the mid-nineteenth century. In the United States, James H. Mason of Massachusetts patented an early percolator design in 1865. An Illinois farmer named Hanson Goodrich is generally credited with patenting the modern percolator. Goodrich's patent was granted on August 16, 1889, and his patent description varies little from the stovetop percolators sold today. With the percolator design, water is heated in a boiling pot with a removable lid, until the heated water is forced through a metal tube into a brew basket containing coffee. The extracted liquid drains from the brew basket, where it drips back into the pot. This process is continually repeated during the brewing cycle until the liquid passing repeatedly through the grounds is sufficiently steeped. A clear sight chamber in the form of a transparent knob on the lid of the percolator enables the user to judge when the coffee has reached the proper color and strength.
Try a new way to brew coffee if you’re tired of the same-old, same-old. We offer a variety of ways to brew up tasty hot beverages to fill your favorite coffee cup. Choose from standard drip machines with high volume carafes or durable thermal carafes. Pour-over brewers come in manual and automatic versions to create fast, hot cups of java goodness. Automatic versions heat water to industry standards in mere seconds and allow plenty of contact between hot water and beans to develop the coffee essences you love. Manual pour-over brewers have everything you need but the hot water to make your own coffee wherever you are. Order a teapot or automatic kettle to make quick cups of coffee without waiting for a machine to brew it for you. Go retro with a siphon-style coffee maker. You never have to use the stove for the electric versions of siphon brewers. A flip of a switch starts the process. Hot water vapor pushes through the top of the appliance to soak the ground coffee beans, and then the brew slowly drips back down into the carafe for a perfect cup of coffee. | <urn:uuid:63bd9df1-d371-4634-b5ff-7a268ceb4693> | CC-MAIN-2018-47 | http://elitetvstream.com/2-cup-coffee-maker-cuisinart-8-cup-pour-over-coffee-maker.html | 2018-11-15T10:47:48Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039742666.36/warc/CC-MAIN-20181115095814-20181115121814-00519.warc.gz | en | 0.940293 | 544 |
Border Electronics is an exporter from United States,the company sell CONTACTOR ELECTRICO and related products to United States market.
The comany exports goods from United States and lading goods at ,the products and country of origin is United States.
Company Name: Border Electronics
Business Type: trading,export,wholesale
Main Products: CONTACTOR ELECTRICO
Telephone: Search Phone Number
Email: Search Email Address
Port Of Lading:
Address and More: CAMPILLO STREET, CALEXICO, 92231, United States
Country: United States
The Related Information Of Border Electronics On Internet | <urn:uuid:ef6c19ec-f92b-4730-bbb5-03369f4b888c> | CC-MAIN-2016-44 | http://www.diigen.com/supplier/border-electronics-united-states-6940122/ | 2016-10-21T22:24:53Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718309.70/warc/CC-MAIN-20161020183838-00107-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.747986 | 135 |
Get the herbal nutrients you need for stronger bones, beautiful skin, and healthy hair & nails. Horsetail is a natural source of silica, manganese and other minerals, which are crucial for healthy bones, cartilage and connective tissue.
Horsetail has also been used for centuries as an herbal diuretic to support urinary health. In fact, the Cherokee, Chippewa and the Potawatomi people, all utilized Horsetail preparations for kidney and bladder support. Get results you can see and feel with Nature’s Wonderland’s premium quality Horsetail. COMMON NAMES: Bottle Brush, Colla de Caballo, Kangaskorte (Finnish), Pewterwort, Scouring Rush, Shave Grass, Zinnkraut.
Hair, skin & nails support; split ends; bone & joint health; supports healthy urinary tract; promotes kidney & bladder health; supports healthy blood circulation.
As an addition to the diet, take 1 or 2 capsules three times daily with water at mealtime. HORSETAIL SHOULD NOT BE USED BY PERSONS WITH CARDIAC OR RENAL DYSFUNCTION. NOT RECOMMENDED FOR LONG TERM USE OR USE BY CHILDREN.
We want you to be completely satisfied with every purchase from us. If you are not 100% satisfied, please contact our customer service department within 30 days of receipt of your order for a prompt refund, credit or exchange (less shipping charges). | <urn:uuid:8fb0e72e-6c4c-4a36-a1d9-7e2c828ac2c7> | CC-MAIN-2021-25 | https://www.pennherb.com/horsetail-capsules-400-mg-60-P205X | 2021-06-19T09:07:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487647232.60/warc/CC-MAIN-20210619081502-20210619111502-00548.warc.gz | en | 0.875055 | 315 |
Parents! Please Read
- Learning about computer science; including the history and influence of technology on modern culture.
- Learning how to use a computer. (Tablet use can be very different from a standard desktop or laptop computer)
- Learning about healthy and responsible technology use. For example: balance, safety, and digital citizenship.
- Learning how technology can be used to improve our lives in a variety of ways.
- Learning about possible careers inside of the STEM job fields.
- And others; such as: typing, coding, collaborating, and creating with tech tools!
All Specials work can now be found on fligrid for the remainder of school away from school!
To get FlipGrid on your student's iPad, please go to the Mozyle Manager app.
and choose FlipGrid
Once installed, choose STUDENT, then allow microphone and camera access.
It will ask you to "join a grid" by using the following Flip Code that is unique to your student's grade level.
5th Grade: specials305
4th grade: specials304
3rd grade: specials303
2nd grade: specials302
1st grade: specials301
It will then ask for your student ID, please use your student's first initial then their full last name. If your student has two last names it will be the second one as listed in their registration in Powerschool.
We look forward to seeing you on Flipgrid soon!! | <urn:uuid:bb70e30c-9276-4c18-a030-93a377d943cd> | CC-MAIN-2022-27 | https://reagan.nsd131.org/apps/pages/index.jsp?uREC_ID=1216185&type=d&pREC_ID=1451336 | 2022-06-24T21:44:57Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103033816.0/warc/CC-MAIN-20220624213908-20220625003908-00726.warc.gz | en | 0.893815 | 315 |
Police release sketch of man wanted after shooting at Upstate inn
Laurens Police and SLED are asking for any information on the person in the sketch above.
Police said he is a suspect in the Monday night shooting of a man at the Rodeway Inn on Bolt Drive in Laurens.
Laurens police said the victim was shot in the back of the head.
The victim was flown to Greenville Memorial Hospital in critical condition and was stable, investigators said. | <urn:uuid:6b6e4fd7-a452-49c9-afa6-d07538a572f7> | CC-MAIN-2017-30 | http://www.wyff4.com/article/police-release-sketch-of-man-wanted-after-shooting-at-upstate-inn/7024411 | 2017-07-28T05:10:54Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549436330.31/warc/CC-MAIN-20170728042439-20170728062439-00015.warc.gz | en | 0.964879 | 97 |
We are 6 days and counting until SCGMC 2016! And I just finished this little bugger! Not the best work, but it was fun to get a fairly quick build done. Last time I updated was right before a business trip to Toronto; so I’ve just been focused on getting the damn thing done. This would have been done a little bit sooner, but we recently added another corgi to the army. But his cuteness and all that happy jazz will slip in here and there so that the girls reading this over their guy’s monitors can all scream kawaii!!!! So there will be little corg interruption throughout the rest of this post.
There was quite a bit of work on the Saz since the last update. I’ve been doing more pictorial updates from the potato camera posted up on our TGG FB page so the little corgi addition is really at fault for the lack of a proper intermediate update. But here it is finally, and it’s also done! SCGMC, here we come!
Now this handsome fellow is Bob the Corgi. The site is basically a skeleton for the little bugger as we watch him grow and annoy the shit out of Hugo and Ken. He was born September 1st and we picked him up on Oct 27; which coincidentally is Hugo’s birthday. I don’t think he was overly happy with his 13th year birthday present. | <urn:uuid:7f3bdc0c-984c-4108-8cfa-25e47b501353> | CC-MAIN-2020-05 | https://gamerabaenre.com/?tag=sazabi | 2020-01-27T06:11:47Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579251694908.82/warc/CC-MAIN-20200127051112-20200127081112-00014.warc.gz | en | 0.9789 | 298 |
Thursday's 6th Extractive Industries Transparency Initiative (EITI) Global Conference in Sydney will see oil, gas and mining executives, campaigners, investors and government officials ratify improvements in transparency standards for the industry.
Global Witness has issued a statement welcoming the improvements whilst warning that the significant gaps remaining in the initiative could render it obsolete if it fails to keep at the forefront of reform.
“The EITI’s influence rests on its being seen as a totemic reformers club which governments and companies want to be part of. This attraction will fade if the initiative is seen to be merely playing catch-up with more dynamic reforms taking place elsewhere,” said Corinna Gilfillan, Head of Global Witness' US office.
For further comment please contact:
Corinna Gilfillan at [email protected]; or +1-202-725-8705
Brendan O'Donnell at [email protected]; or +44 7912-517-128 | <urn:uuid:8f3f8564-4d74-4dff-a91f-04340c248c7c> | CC-MAIN-2022-21 | https://www.globalwitness.org/en/archive/eiti-be-bold-stay-rigorous-and-help-citizens-use-data/ | 2022-05-23T10:38:23Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662558015.52/warc/CC-MAIN-20220523101705-20220523131705-00555.warc.gz | en | 0.912341 | 202 |
Informatica Sets The Stage For A New Chapter In Its History
Informatica held its annual industry analyst day February 26th to 27th, 2013 at the Rosewood Sandhill in Menlo Park. The event showcased Informatica’s go-forward strategy and road map for growth over the next three years. Key highlights include:
- Capturing a $6.5B market opportunity in license and subscription revenues. Marge Breya, Informatica’s new CMO, set the stage with a vision of how Informatica is poised to capture a $6.5B addressable market. Key use cases include analytics, operational integration, cloud integration, master data management, and data governance. Achieving these results will require $3.6B in installed base plays, $1,9B in new logo plays, and $1B in geographic expansion. Key markets for geographic expansion include replacing hand coding in Brazil, China, Japan, Mexico, and Russia.
Point of View (POV): Constellation estimates a $300B enterprise software market for 2013 with $130B in applications and $170B in infrastructure software. Informatica intends to go after a $6.5B addressable market that includes analytics, cloud data integration, operational data integration, master data management, and messaging. Success will require an expansion in focus from the traditional IT leaders and developer buyers to the emerging needs of business leaders.
- Supporting a world of Hybrid IT. Juan Carlos Soto, SVP & GM for Informatica Cloud, discussed how clients now see Hybrid IT as the new norm. In fact, cloud based adoption has shifted from line of business (LOB) owned to IT led adoption of cloud over the past three years. Soto sees three pillars of success that include delivery of a platform for hybrid IT, cloud services for all, and Informatica inside. Key features for 2013 include data masking, process automation, integration with Microsoft Dynamics AX, integration with NetSuite, integration with Workday, integration with Oracle CRM On Demand, integration with Amazon RedShift, and integration with Ultimate Software (which was announced March 13th).
(POV): In a world of Hybrid IT, Constellation expects integration to be a core requirement for success. Consumerization of IT has led to a proliferation of mobile and cloud endpoints that require sophisticated data integration capabilities among all possible connections, data flows, business processes, and access. Informatica’s success depends on its ability to attract the cloud integration decision makers and users for basic cloud integration for enterprise and those seeking more complicated enterprise cloud integration use cases. The platform for a Hybrid IT play via a Virtual Data Machine (VDM) has the most potential for success in creating new business models. Informatica Inside will succeed so long Informatica is seen as “the Switzerland” for integration in cloud stacks and solutions.
- Providing the integration and quality requirements for a big data world. Ash Kulkarni, SVP & GM for Data Integration and Data Quality, addressed the analytical integration, operational integration, and data governance strategy. Informatica’s themes for next generation data integration include agility in development, flexibility for deployment, and confidence in management. New features in analytical data integration include built-in data virtualization, complex event processing, support for decision making, and big data integration for Hadoop customers. The data governance features include improved inference for data domain discovery, automated enterprise data discovery, business friendly glossaries with rich metadata lineage, streamlined workflow and task management, data masking, visual exception auditing, audit data retention policies for production and legacy apps archiving,
(POV): Efforts to bolster the flagship integration business focus on the faster, better, and cheaper mantra. Customers can expect greater ease of use with the core PowerCenter platform. Data integration features tied to work flows bring integration to life. Data governance features are robust in design and place Informatica among the top vendors for depth and breadth of functionality. As integration remains the key cash cow, customers can expect more derivative solutions to simplify the growing enterprise complexity.
- Expanding leadership in master data management. Dennis Moore, SVP & GM for Informatica MDM, took stage with Ravi Shankar the VP of MDM product marketing, and Dmitri Korablev the VP of MDM product strategy. The latest release, Informatica MDM 9.5.1 includes support for the social customer master, mobile client support, effective date support, big data matching, unified data governance, and bulk data import and export. In the Cloud MDM Winter 2013 release, features include multi-dimensional hierarchy support, enhanced matching, drag and drop hierarchy management, and an improved setup wizard. The Spring 2013 release will include a much needed Salesforce.com multi-org consolidation and Informatica Cloud Contact validation service.
(POV): Informatica MDM has show significant success on a multitude of dimensions including vertical expansion, geographical expansion, and push into multiple domain master data management. Informatica has invested in deeper industry solutions for MDM including counterparty/LEI risk management for banking, securities data management for banking, data management for healthcare, data management for insurance, abd clinical trials and compounds data management for pharma. More importantly, Informatica has encouraged a partner ecosystem that includes manufacturing solutions from Wipro, oil and gas well master from Tata Consulting Services, media master from Serene, ICD-10 conversion from Highpoint, and CPG BPO from Capgemini. Meanwhile, the pending Heiler acquisition should bolster the multi-domain story with supplier collaboration, strong cataloging capabilities, and improved product data management.
The Bottom Line: Informatica’s Investment In Growth Amidst A World Of Disruption Is Good News For Customers
Prospects and customers should find comfort in the investments Informatica is making to expand its product line portfolio to support a more complex world of social business, mobile enterprise, cloud computing, and big data. Informatica’s use cases of analytics, operational integration, cloud integration, master data management, and data governance, provide customers with a neutral, one-stop shop to manage their information life cycle requirements. How Informatica innovates with its customers, partners, and alliances will determine the go forward growth path. Customers will measure success by how easily the line of business executives and IT can bring order to chaos.
Are you an Informatica customer? Do you plan to invest more or less with them in 2013? What do you think about their strategy? Add your comments to the blog or send us a comment at R (at) SoftwareInsider (dot) org or R (at) ConstellationRG (dot) com
Please let us know if you need help with your integration or MDM strategy. Sign up for a Constellation Academy Workshop or let us assist with:
- Assessing readiness
- Designing MDM strategy
- Assessing integration capability
- Vendor selection
- Connecting with other pioneers
- News Analysis: Informatica Launches MDM 9.5
- Monday’s Musings: Using MDM To Build A Complete Customer View In A Social Era
- Monday’s Musings: Mastering When and How High End Brands Should Use Daily Deal Sites Such As Groupon
- News Analysis: Salesforce.com Acquires Radian6 For $316M
- Monday’s Musings: Q1 2011 State of Social CRM and CRM From An EMEA Point Of View
- Best Practices: Applying Social Business Challenges To Social Business Maturity Models
- Research Report: Constellation’s Research Outlook For 2011
- Research Report: How The Five Pillars Of Consumer Tech Influence Enterprise Innovation
- Event Report: Salesforce.com Pushes Social CRM Technology — But Don’t Expect Companies To Be Successful With Tools Alone
- Monday’s Musings: Why Every Social CRM Initiative Needs An MDM Backbone
Reprints can be purchased through Constellation Research, Inc. To request official reprints in PDF format, please contact Sales .
Although we work closely with many mega software vendors, we want you to trust us. For the full disclosure policy, stay tuned for the full client list on the Constellation Research website.
* Not responsible for any factual errors or omissions. However, happy to correct any errors upon email receipt.
Copyright © 2001 – 2013 R Wang and Insider Associates, LLC All rights reserved.
Contact the Sales team to purchase this report on a a la carte basis or join the Constellation Customer Experience!
(Cross-posted @ A Software Insider's Point of View) | <urn:uuid:1711f4db-eb55-4959-a97c-9053dc3a3e0e> | CC-MAIN-2019-13 | https://www.enterpriseirregulars.com/60029/event-report-informatica-analyst-day-reveals-a-growth-strategy/ | 2019-03-23T21:17:41Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912203021.14/warc/CC-MAIN-20190323201804-20190323223804-00151.warc.gz | en | 0.876862 | 1,804 |
Semiconductor Manufacturing First Fully Pressure-Insensitive Pressure-Based Mass Flow Controller
Brooks Instrument has launched the new GP200 Series, the first fully pressure-insensitive pressure-based mass flow controller for etch and chemical vapor deposition processes in the semiconductor manufacturing industry. The new pressure-based mass flow controller claims to improve flow measurement accuracy and repeatability in the specialized sector.
Brooks Instrument has released the new GP200 Series, the first fully pressure-insensitive pressure-based mass flow controller (P-MFC) designed specifically for etch and chemical vapor deposition (CVD) processes in semiconductor manufacturing.
Mass flow controllers (MFCs) are the most important component in the gas delivery systems used to produce silicon wafers. MFCs must precisely deliver inert, corrosive and reactive gases to the process chamber, even when operating at very low vapor pressures.
The P-MFC operates well in high-vacuum conditions and above atmospheric pressure conditions that are intrinsic to etch and CVD processes, states the company. In comparison, conventional discrete P-MFCs can operate under high-vacuum conditions but degrade in performance and control range as the outlet pressures increase. By offering a greater operating range than conventional P-MFCs, the new Series can improve etch process performance and expand the application scope to include CVD processes, adds the firm.
The company specifically designed its pressure-insensitive Series to optimize etch and CVD processes with highly precise, repeatable gas delivery. According to the firm, the new P-MFC unit features a patented architecture that overcomes the limitations of conventional P-MFCs to provide the most precise process gas delivery even when delivering low vapor pressure process gases. It includes several unique design aspects, including:
Integrated Differential Pressure Sensor: The GP200 Series uses an integrated differential pressure sensor paired with an absolute pressure sensor to compute pressure drop, instead of using two discrete pressure sensors, typically found in conventional P-MFCs. This combination reduces measurement uncertainty from calibration issues and improves the accuracy, repeatability and drift performance in semiconductor processes.
Laminar Flow Element: The new Series also features a laminar flow element designed for low pressure drop, with a differential pressure sensor that is optimally ranged. This design makes it possible to accurately measure the flow of challenging low vapor pressure process gases used in etch processes, including silicon tetrachloride, boron trichloride and hexafluorobutadiene. Whereas conventional P-MFCs require high inlet pressures to operate, the high accuracy and repeatability of the GP200 Series in all operating conditions make it suitable for both standard pressure and critical low vapor pressure gases.
Downstream Valve Architecture: By positioning the control valve downstream of the flow restrictor, the new Series is essentially immune to downstream pressure fluctuations as well as upstream pressure fluctuations This enables flow delivery into pressures as high as 1200 Torr.
Ultra-Fast, Highly Repeatable Transient Response: This downstream valve architecture also enables rapid shutdown and switching of recipe set points for pulsed gas delivery. Fast response times enable tighter process control, providing precise, highly repeatable gas flow delivery with matched transient response.
As the GP200 Series supports such a broad range of process conditions, it can be used as a drop-in replacement and upgrade for many traditional P-MFCs and thermal MFCs. It reduces the complexity and cost of ownership of the gas delivery system because it eliminates the need for components such as pressure regulators and transducers, concludes the firm. | <urn:uuid:8c52633b-8cb6-4c61-9937-c4fb606911da> | CC-MAIN-2022-40 | https://www.process-worldwide.com/first-fully-pressure-insensitive-pressure-based-mass-flow-controller-a-1051287/ | 2022-10-07T21:52:01Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030338280.51/warc/CC-MAIN-20221007210452-20221008000452-00182.warc.gz | en | 0.902783 | 753 |
Baratunde Thurston’s book begins with a disclaimer; he announces straight-off that if you bought this book hoping to change your race, there will be no refunds.
It sounds funny when he says it. Well, humour is hard to predict, right? But I thought it was funny when he said it.
And, after all, Baratunde Thurston is a comedian.
And, as he observes, he has more than 30 years of experience being black.
That conjunction of facts might be enough to recommend this book to you.
If you truly believe that humour can be one powerful agent of change?
And if you want to know about one man’s experience of being black?
How To Be Black is definitely worth a look.
I didn’t know anything about Baratunde Thurston when I picked up this book. But readers do feel, with only a couple of dozen pages, that they could start to know him.
He has the air of being forthright and charismatic, self-deprecating and proud, and demonstrative and intimate: all sorts of contradictions in one person.
“At twelve years old, I was a bass-playing, tofu-eating, weekend-camping, karate-chopping, apartheid-hating, top grade-getting, generally trouble-avoiding agent of blackness.”
See, maybe he’s not what you were expecting as an advisor on this matter?
He was raised in Washington D.C. and attended Sidwell Friends (where Chelsea Clinton and the Obama girls attend/ed) and Harvard University; he co-founded the LOC-archived blog, Jack and Jill Politics, and he works as Director of Digital at The Onion.
All this in just one man. Just one set of life experiences.
And the author acknowledges that having the experience of more than individual on this matter might be helpful.
So he has selected a panel of seven people who each represent their own personal experience of being black / being too-black / being not-black-enough / being white — yes, that too — and the spectrum between and surrouding these various states.
Because, of course, identity is exceptionally tricky stuff.
It doesn’t get more complicated than that.
To assist in sorting out the complications, Thurston imagines a “special edition LEGO™ Negro Identity Building Set”:
“Build the black identity that works for you! Tired of being pressured by black people and others to fit their ideal of blackness? Don’t wear the ‘right’ clothes? Don’t listen to the ‘right’ music? Don’t commit the ‘right’ crimes? This set will liberate you. Inside you’ll find every country, every type of food, every genre of film, all granting you the unlimited power to be whoever you want to be while maintaining your strong sense of blackness.”
In further efforts to coach the reader, Thurston and his panelists offer ideas on “How to Be the Black Friend” and “How to Be the Black Employee”.
(He also talks about swimming, movies, going back to Africa, student unions, parenting styles, sports, wine, and wealth-related horse violence.)
But perhaps one of the most useful bits comes from the section in his book entitled “How to Be the (Next) Black President”.
(It’s ironic because of all the twenty-one essays, this is the one that I enjoyed the least because the talk of congress and voting systems is patently American, so it didn’t have the same sense of pressing relevance that the other twenty essays had for me.)
Still, the advice is useful. And I expect that Baratunde Thurston was expecting to need it and heed it himself, in publishing a satirical work like How To Be Black.
That piece of advice?
“Expect Haters from all sides.”
“The Black Panel, including its white Canadian member, universally agreed with me that post-racial America is indeed some bullshit…”
There might be some agreement within the binding that holds these pages together (though, to be fair, even in this instance, each member answered the ‘why’ part differently) but this is bound to be a divisive work.
There will be haters on all sides.
There are plenty of statements in this book to which readers may take offense.
But the inverse is also true: there are plenty of statements in this book which will not offend.
And, as one panel member states, “If people aren’t talking, there’s no progress.”
And as a reader who believes that talking about what you read can unequivocally change the world — one book at a time, one reader at a time — I see a work like this being full of potential for conversation.
But back to that disclaimer; Baratunde Thurston was very clear with his disclaimer at the beginning of the book, but I expect that there will be actual rewards as outlined in Thurston’s introductory chapter, based on one’s skill level in celebrating Black History Month.
Because the rewards that he outlines — and it’s not *all* about the free totebag either — for those of us who have ten activites planned for February are un-missable in my book. (I thought this section was very funny indeed.)
Thurston’s book is strategically marketed to those celebrants that Thurston so aptly describes, because if you’re “like most people, you buy one piece of black culture per year during this month”. Obviously Thurston hopes that the one piece will be his book.
(And if there are key elements that you are concerned that you may have missed about BeingBlack, there is an e-book available as well, designed to meet the needs of the reader who is NotBlackEnough in mere moments.)
But what comes after that — what comes after February — that’s when those rewards can really start to pay off.
Have you been offended by / inspired by / amused by How to Be Black?
If you want to see more, you can Browse Inside HarperCollins here. | <urn:uuid:67f92b3e-8de4-4464-b2a1-6b3e705b7ffe> | CC-MAIN-2014-42 | http://www.buriedinprint.com/?p=5928 | 2014-11-01T13:41:23Z | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414637906909.58/warc/CC-MAIN-20141030025826-00235-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.961472 | 1,328 |
A maxi maze without a trace
Where to begin to find the Inn !
some Seekers (who have had a long drink in the Black Boar Inn)
On 7th of february 2015 : I start a new adventure in the Divinity world of Original Sin,
it's a Fantastic Freaking Fabulous Funny ... it's my All Time Favorite One ! | <urn:uuid:99f63b47-09ac-480f-9205-1473a29aaea6> | CC-MAIN-2020-45 | https://forums.larian.com/ubbthreads.php?ubb=showthreaded&Number=454855&an= | 2020-10-24T03:55:29Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107881640.29/warc/CC-MAIN-20201024022853-20201024052853-00597.warc.gz | en | 0.882675 | 76 |
Black Halo Design
Carl Frampton: The Jackal Spatter Box Framed Canvas #CarlFrampton #TheJackal
These have been designed and made to order by Black Halo Design, and can only be purchased from us.
High-quality canvases, specifically designed for printing - scratch & splash-resistant and durable.
Solid Canvas Frame
Canvas prints include 2 cm solid stretcher frames. All Canvases are of high quality and are delivered fully assembled.
State of the art Latex ink
We print with solvent-free and environmentally friendly Latex inks for durable prints and a pin sharp and vibrant print quality.
We use high quality canvases which are designed specifically for canvas printing. Our canvas is a white semi-gloss artists canvas.
Delivery can take 10-14 working days from order date, so please allow this time during your purchase, although we will endeavour to have them delivered within 6-7 days working days after purchase. | <urn:uuid:54f800f7-9de3-443a-a75f-2bdc05f76718> | CC-MAIN-2022-27 | https://blackhalodesign.co.uk/products/carl-frampton-the-jackal-union-jack-box-framed-canvas-carlframpton-thejackal-2 | 2022-06-28T08:30:37Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103360935.27/warc/CC-MAIN-20220628081102-20220628111102-00572.warc.gz | en | 0.932777 | 200 |
Access to the information contained on this website may be restricted by laws and regulations applicable to the user. Persons in respect of whom such prohibitions apply must not access the Soter Capital Advisors website. You have reached the webpage of the soter-capital.com domain for Soter Capital Advisors.
Country or regulatory requirements may prevent certain visitors from (1) being solicited, (2) offered certain services or financial products and (3) engage in business with Soter Capital Advisors.
The value of investments and the income from them may go down as well as up and investors may not get back the amount invested. Past performance is not necessarily a guide to future performance. Soter Capital Advisors is not intending to provide investment or other advice to you or any other party, and no information or material at the site is to be relied upon for the purpose of making or communicating investments or other decision.
The Soter Capital Advisors website collects technical data about visitors, such as their provenance, the number of pages visited, the type of device and browser being used. No personal data is collected or stored, with the exception of the IP address. The IP address is used only to determine the location of visitors and is then deleted. We do not communicate or share IP addresses. Cookies are used for the same purpose only while visiting the Soter Capital Advisors website and are never saved.
Neither the information nor any opinion expressed in this website constitutes a solicitation, an offer or a recommendation to buy, sell or dispose of any investment, to engage in any other transaction or to provide any investment advice or service. None of the services, investments or mutual funds referred to in this site are available to persons resident in any country, state or jurisdiction where it would be contradictory to local laws and/or regulations to publicly offer such products. Prospectuses in respect of such products/services will not be distributed in any country, state or jurisdiction in which it would not be lawful to do so.
The Soter Capital Advisors website is not directed at any person in any jurisdiction where (by reason of that person’s nationality, residence or otherwise) the publication or availability of the Soter Capital Advisors website is prohibited.
Although Soter Capital Advisors and its information providers seek to ensure that the information on this website is accurate and complete at the time of publication and has been obtained from sources believed to be reliable, no warranty expressed or implied is made to its accuracy, reliability, actuality and completeness by Soter Capital Advisors and its information providers. Opinions and any other contents on the site are subject to change without notice.
Soter Capital Advisors and its information providers expressly disclaim all liability to any person in respect of anything and in respect of the consequences of anything done or omitted to be done wholly or partly in reliance upon the whole or any part of the contents on the Pictet site. Moreover, Soter Capital Advisors and its information providers shall have no liability for any losses or damage arising from the use of or reliance on the information contained on the site, including, without limitation, any loss of profit or any other direct or indirect damage. | <urn:uuid:8262a2bc-1df5-4fe4-ba92-9d821ad653d9> | CC-MAIN-2023-23 | https://www.soter-capital.com/en/legal-disclaimer/ | 2023-05-27T23:09:20Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224643388.45/warc/CC-MAIN-20230527223515-20230528013515-00669.warc.gz | en | 0.924865 | 672 |
Event Date/Time: Oct 21, 2012
End Date/Time: Oct 23, 2012
The Shared Services Exchange is the elite event for senior level shared services and sourcing practitioners who are evolving their service delivery strategies, capabilities and operations
The Shared Services Exchange is the elite event for senior level shared services and sourcing practitioners who are evolving their service delivery strategies, capabilities and operations. The content agenda goes far beyond the typical cost cutting transaction machine to a program designed with transformation in mind and adding value to the business.
It’s about safeguarding against market volatility and risk, creating an agile enterprise that can change focus quickly without renegotiating. It’s about data & predictive analytics that will provide the insight needed to maintain a competitive advantage. It's about creating the next level of value through global business services, enabling cost reductions up to 60% and 75% in improvement delivery. It’s about balancing risk and arbitrage with a combination of near shore, on shore and off shore delivery. It’s about delivering continuous improvement that affect your bottom line beyond the pricing already in the deal. It's about making the right decision that will impact your delivery chains in 2012 & Beyond.
With tremendous growth and interest in Shared Services, IQPC Exchange will be hosting two Shared Services Exchange- one in June on the East Coast, and one in October on the West Coast, continuing it’s ongoing tradition of offering cutting-edge, interactive learning opportunities for pre-qualified practitioners. This unique event combines topical sessions, one-on-one business meetings and strategic networking opportunities allowing you to maximize your time out of the office. | <urn:uuid:c7085e89-be75-4f2a-ab48-0d7a5e003b68> | CC-MAIN-2017-04 | http://www.allconferences.com/conferences/2012/20120312160000 | 2017-01-17T09:10:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00426-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.922146 | 336 |
Sumatra Mandheling is an Indonesian coffee that displays a great aroma with an earthy flavor and a low acid mellowness. Satisfying as a single origin coffee, Sumatra is also used to add body to blends.
Please note that all of our whole bean and ground Coffee products are sold in 1 Pound bags. If by chance you have a Keurig © K-Cup © Brewer, our entire Coffee menu is available in our Single Cup Serving 10 pack selection!
Interested in learning more about our roasting process? | <urn:uuid:0512bd7f-5d50-4b50-9c22-7b256343f55d> | CC-MAIN-2019-47 | https://www.pollys.com/collections/origins/products/sumatra-mandheling | 2019-11-20T12:45:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496670558.91/warc/CC-MAIN-20191120111249-20191120135249-00080.warc.gz | en | 0.93693 | 109 |
Periodontal Treatment (Oral Hygiene)
Periodontal treatment for your gums is a VERY important step in your overall health and well being. Dental hygiene and preventative dentistry takes into consideration individual health, daily practice with brushing and flossing, treating advanced gum disease, and long term care to prevent plaque and tartar from building up on your teeth, above and below the gum line.
Preventing gum disease
Certain conditions such as diabetes can increase your risk for gum disease and we work closely with patients to ensure overall prevention of advanced periodontal disease keeps your smile healthy and bright.
Our experienced Dental Hygiene team works closely with you to learn more about keeping gums healthy and how to recognize changes or abnormal conditions in your mouth. In addition to healthy practice at home, you should have your teeth professionally cleaned as recommended. During these cleaning appointments, our Hygienists will perform a comprehensive checklist that includes examining your head and neck area for signs of swelling or abnormalities that could identify a more serious health concern.
Oral Cancer Screening
Oral cancer screening is included with your regular hygiene visits using the most current techniques available today. Recognized by the World Health Organization, the award-winning VELscope® Vx is the world’s most widely used adjunctive device for the enhanced visualization of oral mucosal abnormalities, such as oral cancer or pre-malignant dysplasia. The early discovery of potentially life-threatening conditions helps to ensure that a patient can be quickly referred to a specialist for follow-up and treatment.
Schedule a Consultation Today!
If you’re interested in learning more about periodontal treatment please contact us for a consultation at 705.737.2381 or schedule a consultation via our contact us form here. We will discuss your needs and concerns, and determine your best course of action. | <urn:uuid:319d5401-06f8-4d0f-9cfc-676a04201fac> | CC-MAIN-2020-40 | https://www.mrdentalgroup.com/smiles-that-heal/oral-hygiene/ | 2020-09-24T19:52:22Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400220495.39/warc/CC-MAIN-20200924194925-20200924224925-00253.warc.gz | en | 0.930272 | 390 |
SGMUSO is proud to present SONGWRITERS WEEK
Our friend Adam Lyons (Lyon Apprentice/FAIRCHILD, Alumni of Music Matters Live) has informed us that he will be coming to town for a week in October for a songwriting collaboration project with a few Singaporean acts at the amazing Beep Studios! At his request, SGMUSO will be helping to facilitate a couple of side events to open up the opportunity to even more Singaporean musicians to get together, know their community, perform and also encourage cross-collaboration amongst each other locally and internationally.
SONGWRITERS OPEN CIRCLE
7th October 2014, TUESDAY
7PM – 9.30PM
LITHE PARALOGUE STUDIO
We will be kicking off the week with an intimate SONGWRITERS OPEN CIRCLE, a sharing session in which we would like to invite all songwriters, producers and music-makers to join us for a chat and jam. We hope to provide a small creative space for everyone to get together to know their community, discuss and exchange ideas, stories and processes, tips on getting ideas on paper and then in the studio, to collaborate musically – all in an relaxed and improvised setting. The intimate vibe of the songwriter’s circle will allow for a unique discussion and improvised performance. Musicians can choose to bring along their own instruments to share a couple of songs at the open circle. Musicians that attend will be encouraged to sign up for our open jam at the Songwriters Night at Timbre Barbershop at the end of the week. Special guest, Adam Lyons will be present to drive this Open Circle session!
Big shout-out and love to Lithe Paralogue Studio for letting us use their lovely space!
*Limited seats only. Send your RSVPs to email@example.com by 6th Oct to reserve a seat!
Bring your own food and booze!!
… still there’s more … | <urn:uuid:a0bb8042-aa97-421b-ab9c-4aabf4308dde> | CC-MAIN-2020-05 | https://www.powerofpop.com/songwriters-week/ | 2020-01-20T23:54:31Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250601040.47/warc/CC-MAIN-20200120224950-20200121013950-00089.warc.gz | en | 0.942604 | 416 |
Children-for-sex offered for sale on Net
FBI arrests man
The FBI has arrested a US man for attempting to buy two children on the Net for the purpose of engaging in sex.
Fifty-three year-old Jonathan Christopher Wood, from Georgia, was prepared to pay £8,000 for the boys, according to Reuters.
The FBI's Crimes Against Children Taskforce, which monitors paedophile activity, made the arrest earlier this month.
Wood was caught after the FBI tracked his activities in an Internet chat room.
It's not known whether children were genuinely for sale, or whether the incident was part of an FBI sting to snare paedophiles.
However, no one else has been arrested in connection with the sale.
Wood had recently moved to Georgia from Arizona, where he had owned a company that provided Internet access.®
You can read the full Reuters story here. | <urn:uuid:ac8c1b67-cf11-4acd-8eb3-7d477b18b0d8> | CC-MAIN-2015-48 | http://www.theregister.co.uk/2000/06/25/childrenforsex_offered_for_sale/ | 2015-12-01T12:38:03Z | s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398466260.18/warc/CC-MAIN-20151124205426-00113-ip-10-71-132-137.ec2.internal.warc.gz | en | 0.978823 | 185 |
All most all bingo software allows player to chat among them self and the chat host. This means that the chat host are first point of contact for any player. He/she is the one who is representing from your brand. Serving the players in a most friendly manner would impress the player and make them to return back. Players at bingo room come for fun and entertainment. The chat host must be more funny and make other to enjoy his/her company with them. How to achieve this would be a big question. I have few suggestions here
Giving one to one Care.
Showing more personal care toward each player would be good . But again too much is also not good. So chat hosts can speak twice in a week with the players over private message.
Giving away a unofficial bonus credit to players.
Chat host can give away a small bonus credit to there players. Here I am not speaking about chat bonus. This would be like a gift from a chat host to players. This would be said as a unofficial to players , but that is know to the company.
Two chat hosts in a room.
Generally an public show would have 2 anchors. They would speak in a funny manner , do some dramas and then announces the chief guest of the program or a celebrity on the dais. The viewers of the show would enjoy the anchors. They would bring a smile on the viewers by teasing them self in one other the other way. The same must be implemented in the bingo rooms. There must be 2 chat hosts in a single room. Players would enjoy the chit chat of chat host and will also join them.This would give players a different world other than bingo. | <urn:uuid:438cca13-dbb8-4390-b845-1a8945db462b> | CC-MAIN-2019-35 | https://sachingkulkarni.com/bingo-chat-hosts-can-build-better-brand-image/ | 2019-08-24T20:04:58Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027321696.96/warc/CC-MAIN-20190824194521-20190824220521-00490.warc.gz | en | 0.97955 | 344 |
In March 2012, Greece became the first modern, advanced economy to default on its debts since World War II. On Wednesday, the IMF published a post-mortem (pdf) about its attempts to bail out the country with other members of the so-called troika—the European Central Bank and representatives of other euro zone countries.
The IMF still contends that bailing out Greece was a “necessity.” But not only does the report show that the Fund dramatically underestimated the scale of the crisis caused by Greece, it explains why the IMF had to leave its better judgment behind to manage a new systemic threat. In truth, however, the IMF’s screw-ups hint at why the Fund never should have been involved in the euro zone at all.
The IMF is used to working in situations in which it is the ultimate authority, and can act quickly to make decisions. Normally, a struggling country and its creditors are desperate for help and don’t have much leverage in negotiations.
The IMF usually works with weak, developing economies, but even in its work with developed economies, it has typically had the upper hand. In 1976, it loaned the United Kingdom £2.3 billion ($3.5 billion). More recently, the Fund even helped out Iceland. But in both cases, recipients had little choice but to accept the help.
In the case of Greece, the country was desperate enough, but there were too many cooks in the kitchen for the IMF to take control. In its report, the IMF cited disagreements with the ECB, the European Commission, and European leaders, which risked slowing down the implementation of the bailout program:
From the Fund’s perspective, the EC, with the focus of its reforms more on compliance with EU norms than on growth impact, was not able to contribute much to identifying growth enhancing structural reforms. In the financial sector, the ECB had an obvious claim to take the lead, but was not expert in bank supervision where the Fund had specialist knowledge.
Although the IMF has been involved in major crises before, it admits it had never faced a problem of this magnitude. The Fund knew that Greece posed a systemic risk, and that’s why it relaxed its standards for offering bailouts to help the country. But it seriously misread the kind of support Greece actually needed to stifle a crisis of confidence across the euro area.
Initially, it offered Greece what’s called a “Stand-By Agreement,” an emergency borrowing program limited to three years. In retrospect, the report says, it should have offered something else—an “Extended Fund Facility”—which would have allowed Greece to make adjustments over a longer period. Had the IMF stepped in sooner with a long-term plan, Greece may not have been forced to live up to the impossible standards of a three-year deal. That’s why the subject of a Greek default or Greek exit from the euro came up over and over again, adding to pressures on countries like Ireland, Portugal, Spain, and Italy.
Even beyond this oversight, the IMF just isn’t built to tackle problems that have to do with financial contagion in the world’s biggest banks. It recognized that Greece’s problems were not limited to Greece, but the Fund had little power to impose deeper reforms on the euro area as a whole.
The IMF doesn’t have a good track record for winning hearts and minds, and that was evident in the case of Greece. “Reform efforts in Greece under the program might have been more enduring if more visible progress had been made with regard to getting those on high incomes to pay their taxes,” the IMF noted. Limited political support undermined public involvement, with riots in early 2012 and repeat parliamentary elections later that year.
Instead of serving as a liaison between Greeks and northern Europeans, the IMF’s report shows it mostly took the side of the angry creditors, even at the expense of the Greeks. Reforms may have been inevitable, but Germany, France, and others could have imposed them on their own.
In its report, the IMF suggests that if Greece had defaulted on its debt early on in the euro crisis, yet remained in the euro currency, its problems would have been more contained. Greek GDP has always been a small fraction of total euro area output, and its problems stem from fundamental imbalances between northern and southern Europe. But instead of looking to itself for support, the euro area turned outwards, beseeching the IMF to mitigate the Greek disaster. In retrospect, the IMF should have refused to get involved. | <urn:uuid:541796d4-e6f3-4470-859f-7f0805420a54> | CC-MAIN-2023-40 | https://qz.com/91475/imfs-own-greece-post-mortem-shows-why-it-should-have-steered-clear-of-the-euro-crisis | 2023-09-24T18:54:14Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233506658.2/warc/CC-MAIN-20230924155422-20230924185422-00338.warc.gz | en | 0.979536 | 946 |
April 12, 2018
Consumers can eat an abundance of fruits and vegetables that are largely free of pesticide residue, but they will have to shop carefully, according to a new report from the Environmental Working Group (EWG), a nonprofit organization based in Washington, D.C. The report, EWG’s 2018 Shopper’s Guide to Pesticides in Produce, found that almost 70 percent of conventionally grown, not organic, produce contained pesticide residues even after washing and peeling.
The analysis, which was based on tests conducted by the U.S. Department of Agriculture (USDA), found significant differences in pesticide residue among various fruits and vegetables, probably as a result of how the food is grown. At the top of the EWG’s “Dirty 12” list are strawberries, followed by spinach, nectarines, apples, grapes, peaches, cherries, pears, tomatoes, celery, potatoes, and sweet bell peppers.
According to the EWG, more than one-third of strawberry samples contained 10 or more pesticides. More than 98 percent of the samples of strawberries, peaches, potatoes, nectarines, cherries, and apples contained the residue of at least one pesticide. Spinach had almost twice as much pesticide residue by weight compared with any other type of produce.
Report Also Lists 'Clean' Produce
The EWG’s “Clean 15” list of produce least likely to contain pesticides was topped by avocados, followed by sweet corn, pineapples, cabbages, onions, sweet peas, papayas, asparagus, mangoes, eggplant, honeydews, kiwis, cantaloupes, cauliflower, and broccoli. Less than 1 percent of avocados and sweet corn contained pesticide residue.
The lists are created to help consumers eat plenty of produce while minimizing pesticide exposure, says lead author Sonya Lunder, MPH. “It’s a shopping guide so people can make choices appropriate for their diets, their budget, where they live and what’s in season,” she says.
Some Consumers More at Risk
Careful produce selection and washing produce is particularly important to the health of pregnant women and young children, she says.
“These are the places where choices have the most impact,” Lunder says, noting that children consume more pesticides per pound of body weight compared with adults. “We are interested in less use of the highly toxic pesticides and more regulations and consideration of kids’ vulnerability.”
Downside of a 'Dirty' List
But the report, which is released annually by EWG, can do more harm than good, says Teresa Thorne, executive director of the Alliance for Food and Farming in Watsonville, California, a nonprofit organization that represents both organic and conventional farmers. Lists like the “Dirty 12” may only serve to scare consumers away from eating fruits and vegetables, according to Thorne.
“Residues, if they are present at all, are already exceptionally low,” Thorne says. “Peer-reviewed studies have indicated that if you follow the EWG’s advice and substitute organic, you are not reducing your risk at all” because pesticide residues are already very low in conventionally grown produce.
The USDA requires farmers to follow “stringent regulations set forth to protect the safety of consumers, farm workers, and the environment,” Thorne says. The data show that 99.8 percent of residue is well below the USDA safety threshold, she adds.
“We strongly support consumer choice. But it’s also important that you know that any produce that is accessible and affordable that day is safe and wholesome,” Thorne says.
Pesticide Dangers Continue
While farmers have ceased using some of the most dangerous pesticides and must adhere to USDA safety thresholds, consumers eating recommended daily servings of produce are exposed to a wide mixture of pesticides that can add up over time, Lunder says.
Tighter regulations to reduce pesticide residue are still needed, Lunder says. She notes that the U.S. Environmental Protection Agency (EPA) recently denied a petition to ban an insecticide called chlorpyrifos, which studies show may impact the body’s central nervous system, particularly in children.
Consumers can still eat plenty of produce while minimizing their risks, Lunder notes. The EWG recommends opting for organic produce, especially if it's a fruit or vegetable on the “Dirty 12” list, and always wash any produce thoroughly. | <urn:uuid:ab6a8c43-79ea-4e95-8455-298159cc5373> | CC-MAIN-2019-04 | https://www.everydayhealth.com/diet-nutrition/strawberries-top-dirty-list-contaminated-produce/ | 2019-01-22T23:37:14Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583875448.71/warc/CC-MAIN-20190122223011-20190123005011-00563.warc.gz | en | 0.942323 | 962 |
USDA’s newest round of grain export inspection data, out Monday morning and covering the week through Nov. 11, had mixed but mostly positive data for traders to digest. Soybeans trended moderately lower but still stayed within the range of trade guesses as the grain continues a robust pace overall. Corn trended moderately higher from a week ago and surpassed the entire ranged of analyst estimates. Wheat saw a similar situation – moving moderately higher week-over-week and coming in higher than all trade guesses.
Corn export inspections improved 32% from a week ago to reach 33.7 million bushels. That was better than the entire range of trade guesses, which came in between 19.1 million and 29.5 million bushels. Cumulative totals for the 2021/22 marketing year remain moderately behind last year’s pace, meantime, reaching 274.7 million bushels.
Mexico was the No. 1 destination for U.S. corn export inspections last week, with 13.7 million bushels. Colombia, Japan, Guatemala and El Salvador rounded out the top five.
Soybean export inspections faded 28% lower week-over-week, dropping to 76.2 million bushels. That was good enough to stay near the middle of trade estimates, which ranged between 59.7 million and 91.9 million bushels. Cumulative totals for the 2021/22 marketing year remain substantially behind last year’s pace after reaching 594.8 million bushels.
China remains the dominant destination for U.S. soybean export inspections, accounting for another 48.4 million bushels last week. Mexico, Germany, Thailand and Italy filled out the top five.
Wheat export inspections climbed 55% higher week-over-week, reaching 14.3 million bushels. That was better than all trade guesses, which ranged between 5.5 million and 13.8 million bushels. Cumulative totals for the 2021/22 marketing year are still trailing last year’s pace, moving to 378.7 million bushels.
Nigeria was the No. 1 destination for U.S. wheat export inspections, with 4.8 million bushels. Ethiopia, Mexico, Guatemala and Japan rounded out the top five.
Click here to read more from the latest USDA grain export inspection report, which covers the week through Nov. 11. | <urn:uuid:28450775-aa06-470d-9b9c-5f97f5b2da0d> | CC-MAIN-2022-40 | https://www.farmprogress.com/exports/weekly-grain-movement-corn-climbs-soybeans-slide-lower | 2022-09-26T14:50:42Z | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030334912.28/warc/CC-MAIN-20220926144455-20220926174455-00746.warc.gz | en | 0.943831 | 493 |
Just to be clear? It's not that the excitement surrounding EP & co-writer Neil Gaiman (Good Omens); EP, co-writer & showrunner Allan Heinberg (Wonder Woman); and EP & co-writer David S. Goyer's The Sandman being renewed for a second season has died down. It's more like it shifted from overall euphoria to now getting down to the business of casting the characters viewers will be introduced to when the streaming series returns. One of those characters is Delirium, the personification of all delirium & sanity, as well as Dream's (Tom Sturridge) youngest sister and the youngest of the Endless. It's a character that a lot of fans have theories on when it comes to who should lock down the part. And it's a part that a lot of folks of the acting persuasion have apparently been pitching themselves to Gaiman to get a chance at. So Gaiman took to Twitter to offer everyone interested in the role some very important intel about how the casting works for the series.
As you can see below, the first thing that folks need to know is that casting for the second season hasn't started yet. And when it does, all casting looks go through Lucinda Syson first. Here's a look:
Neil Gaiman on The Sandman Season 2 Gameplan & Beyond
"Well, we told the first 400 pages of a 3,000-page arc in the first 10 episodes. So there's a kind of a "you do the math" on that. But then the other answer is, how long is a piece of string? What we know that we would like to do, in a perfect world, as long as the audience is there and people come out for it and people want it, is we want to tell the whole story of 'Sandman' that went through to 'The Wake.' And after that we want to tell 'Sandman: Overture,' and somewhere in there, possibly, even as a special or whatever, we'd love to do things like 'The Dream Hunters.' We quite probably weave the stories that are in 'Sandman: Endless Nights' into the body of the whole. What is nice is we have the entirety of 'Sandman' to draw on," Gaiman explained during an interview with Variety.
Gaiman continued, "We also have the 'Death' books. It might be great to go off and do one of those as a sideline, in addition to which, anybody who has seen 'Sandman' Episode 3 has sidled over to us at some point or other in the last six months and said, 'Do you think there's any possibility that we could do a Johanna Constantine show with Jenna Coleman?' And, oh my God, she's a star, and you just want to see her going through battling demons and destroying other people's lives. So that's in there, too. We can keep going on this for a long time to come. But this isn't us going, it's eight seasons exactly and then out — or five seasons and out. We want to tell the story. Which feels wonderfully familiar for me because when I was writing 'Sandman,' people go, 'So how long does 'Sandman' go?' And I'd go, 'I don't know, maybe Issue #50?' And I'd be at Issue #50 and go, 'I don't know, Issue #75, maybe?' But when you get there, there's still be more story to tell after that." | <urn:uuid:c121f0e1-e614-4056-9616-56933916ca17> | CC-MAIN-2023-06 | https://bleedingcool.com/tv/the-sandman-season-2-neil-gaiman-offers-fyi-on-delirium-casting/ | 2023-02-02T08:57:28Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499967.46/warc/CC-MAIN-20230202070522-20230202100522-00236.warc.gz | en | 0.979925 | 723 |
Science Activities for K-5: For Georgia Performance Standards
by John Cramer
K-5 teachers often feel uncomfortable teaching science, especially physical sciences. This book is for them. I emphasize teaching by activities so the book is a compendium of activities and demonstrations in all the science areas covered by the Georgia Performance Standards. Students come to love the course and materials and you will too. The book covers every science GPS and more. | <urn:uuid:7c44f26a-614a-4964-83fe-8c9c7d61d201> | CC-MAIN-2017-17 | https://www.smashwords.com/books/tags/k_through_5 | 2017-04-27T18:13:51Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917122619.60/warc/CC-MAIN-20170423031202-00444-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.948469 | 87 |
Raw Juce is an organic cold pressed juice bar that also serves smoothies, shots, acai bowls, oatmeal parfaits, salads and treats. Everything is vegan apart from the use of honey in some items. Dishes include a Go-Go-Goji Crunch Acai Bowl, Raw "Tuna" Salad, Avo-Quinoa Salad and Raw Energy Bars.
They have several locations in Florida.
(can vary during public holidays) | <urn:uuid:4bcf703b-c7f9-4a79-8ce3-61873592d44a> | CC-MAIN-2019-39 | https://www.vanilla-bean.com/localities/59ba90d6000e12692cbd422e | 2019-09-20T14:30:15Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514574039.24/warc/CC-MAIN-20190920134548-20190920160548-00036.warc.gz | en | 0.883171 | 94 |
Quayola: Pleasant Places
Borrowing its title from the first series of landscape prints produced in Holland in the 17th Century, ‘Pleasant Places’ is a multi-channel (moving) digital painting that explores the boundary between pictorial representation and code as abstract image.
The countryside of Provence serves as a point of departure for Quayola’s spectacular staging of landscape and the machinic gaze: through the misuse of image-analysis and manipulation algorithms, ‘Pleasant Places’ challenges the photographic image and proposes alternative modes of vision and synthesis.
To see at:
Morton H. Meyerson Symphony Center
Quayola is a visual artist based in London. He investigates dialogues and the unpredictable collisions, tensions and equilibriums between the real and artificial, the figurative and abstract, the old and new. His work explores photography, geometry, time based digital sculptures and immersive audiovisual installations.
Quayola’s work has been exhibited at the Venice Biennale; Victoria & Albert Museum, London; British Film Institute, London; Park Ave Armory, New York; Bozar, Brussels; Palais de Tokyo, Paris; Cité de la Musique, Paris; Palais des Beaux Arts, Lille; MNAC, Barcelona; National Art Center, Tokyo; UCCA, Beijing; Paco Das Artes, Sao Paulo; Triennale, Milan; Grand Theatre, Bordeaux; Ars Electronica, Linz; Elektra Festival, Montreal and Sonar Festival, Barcelona. | <urn:uuid:4ef87165-6b20-4f41-b361-e8f46b71c176> | CC-MAIN-2018-22 | https://www.dallasaurora.com/highlights/quayola-pleasant-places/ | 2018-05-23T12:47:34Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794865651.2/warc/CC-MAIN-20180523121803-20180523141803-00273.warc.gz | en | 0.832035 | 330 |
SOLVED Failed to pull image: Nextcloud package v2.1.4
I just reconfigured my out-dated Nextcloud app, but got errored out because it
Failed to pull image.
Could it be that the image is no longer available? If so, could it be republished for a while?
Lots of thanks
I have repushed that image. If it does not work, please include the docker pull error when trying to install the app, just so I can verify the image id is the correct one.
necrevistonnezr last edited by
@nebulon Could https://git.cloudron.io/cloudron/nextcloud-app/issues/61 be related? | <urn:uuid:29998f11-a8a9-41f8-9c87-32cb82bd014d> | CC-MAIN-2021-04 | https://forum.cloudron.io/topic/1670/failed-to-pull-image-nextcloud-package-v2-1-4 | 2021-01-27T16:23:50Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610704828358.86/warc/CC-MAIN-20210127152334-20210127182334-00084.warc.gz | en | 0.866049 | 153 |
WASHINGTON -- The lack of greater movement toward universal healthcare coverage -- especially a single-payer system -- in the U.S. can be boiled down to four letters: AFIG, according to Philip Caper, MD.
The "A" stands for Apathy, Caper said Wednesday during a briefing on barriers to healthcare reform sponsored by the National Academy of Social Insurance (NASI). Caper is with Maine AllCare, an organization devoted to getting universal healthcare in Maine.
The attitude of many people is "'I've got mine; why should I worry about anyone else?'" said Caper, a founding member of NASI, whose mission is to increase public understanding of how social insurance contributes to economic security.
"Or think of young invincibles, who think it's worth the risk to go uncovered," continued Caper, who was speaking by phone from Maine. "Perhaps apathy is the result of our emphasis on personal liberty and personal responsibility."
The "F" stands for fear, Caper continued -- "fear of change; the fear of losing coverage they already have; or the fear of loss of income or profitability" on the part of those working in the healthcare industry.
"I" is for ignorance, he said, making it clear that he was not equating ignorance with stupidity, rather a lack of information and understanding. "Most Americans don't understand the healthcare system and don't understand there are better ways of financing this," Caper said.
"I definitely include doctors in this group," he added. "I can tell you from personal experience that it's almost impossible to get health policy into the medical school curriculum, where the focus is rightly on clinical medicine."
And finally, there is the "G" -- for greed. "This may seem harsh [but] the widely accepted view of healthcare as just another business is uniquely American, at least in degree," he said. "I have heard some people say the healthcare system is becoming a wealth extraction machine. This view is reinforced by news stories of opportunistic pricing of drugs for chronic diseases such as hepatitis."
Satisfied With the Status Quo
Another barrier to changing the way health insurance is delivered comes from the fact that many people are satisfied with their employer-provided health insurance, said Laurence Seidman, PhD, professor of economics at the University of Delaware in Newark.
"But they don't seem to realize two things," he continued. "First, what would happen if they lose their job? And second, [they don't realize] that the rising premiums for medical care that their employers are paying is a key reason why their wage and salary growth has been so low."
Many people also believe that using the private sector to provide services is better than using the public sector, "but it's not better for things like national defense or health insurance," he continued. "Many people also believe prices should be set without interference by government. I agree that's true for most goods and services, but medical care is different [because] consumers can't shop around; the best mechanism is for the government to represent consumers and negotiate prices for medical care with doctors, hospitals, and drug companies."
Merton Bernstein, emeritus professor of law at Washington University in St. Louis, pointed out that most of the crowd at the meeting consisted of older people. "Millennials are not here, and that's the problem," he said. "How do we reach them to make them understand their stake in universal healthcare that's affordable and comprehensive?"
Mischaracterization of the issues is another barrier to reform, Bernstein said. "One [mischaracterization] is that Medicare is not adaptable to the entire population because one size doesn't fit all. People have to be told what in fact Medicare does -- it is a massive program that's the basis of the well-being of tens of millions of people, and it's enormously popular, and yet it's treated by many as if it's an impediment to appropriate care."
Suspicion of Government
Marcia Angell, MD, of Harvard Medical School in Boston, noted that "We distribute healthcare like a market economy, according to ability to pay, and not like a social service, which would be distributed according to medical need. But the people who most need healthcare are precisely those least able to pay."
In terms of barriers, "much of the public often opposes the health reform law and [people] claim it expresses their antipathy toward big government. I believe that's largely a canard promulgated by [the healthcare industry] and much of the media," said Angell, who is also a past editor of the New England Journal of Medicine. "The issue for the public, I suspect, is not the size of government but the feeling that it doesn't often work for their benefit and instead serves special interests."
"Americans have no problems with programs [they consider beneficial] but are very suspicious of the private healthcare industry, which has the largest lobby in Washington," she added. "So the major barrier ... is the 'medical industrial complex,' as my late husband, Arnold Relman, pointed out in the New England Journal of Medicine 35 years ago."
Joseph White, PhD, director of the Center for Policy Studies at Case Western Reserve University in Cleveland, said that three things needed for a policy to work were "technical capacity, institutional capacity, and political capacity ... Most of the barriers to [single-payer] are political barriers; most barriers to other kinds of reform are technical barriers."
The only way to overcome the political barriers would be to get businesses on board and make them realize that single-payer healthcare would be advantageous to them because they wouldn't have to provide health benefits any more, "but business finds it easier to cut benefits," White said. "I think it's fair to say that the people who would be most necessary to cooperate, to overcome the power of the medical industrial complex, are much more interested right now in cutting benefits."
Joe Antos, PhD, scholar in healthcare and retirement policy at the American Enterprise Institute, a right-leaning think tank here, said it is not clear what kind of reform people want, "for lots of reasons. One of the reasons is, not everybody's going to agree to everything, so you have to decide who you want to listen to. So I think it is a good question ... what is it that people prefer? The partial answer is, they just want something that works."
Donald Berwick, MD, former administrator of the Centers for Medicare and Medicaid Services (CMS) in the Obama administration, said that after he left the agency and decided to run for governor of Massachusetts, "I did not enter the race as single-payer advocate, but my mind got changed very early" as he looked at the state's budget and saw the increasing amounts of money going to healthcare. During his tenure at CMS, Berwick was criticized by Republicans for stating his admiration of the British healthcare system, which they said indicated support of rationing healthcare.
When he was campaigning, Berwick said he encountered a lot of confusion about the issue. "The first was confusion between the consolidation of payment in single-payer, and socialized medicine, where the government takes over delivery of care. People thought single-payer meant that the government becomes the provider of healthcare."
In addition, the rising cost of healthcare was kind of buried, Berwick said. "People sort of know their own contributions to healthcare are going up, but when they actually do the subjective math, they can see the problem." | <urn:uuid:c06544ae-88f5-4714-aa1b-46535a357709> | CC-MAIN-2018-34 | https://www.medpagetoday.com/washington-watch/reform/49764 | 2018-08-20T18:36:55Z | s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221216724.69/warc/CC-MAIN-20180820180043-20180820200043-00246.warc.gz | en | 0.980063 | 1,547 |
Many times, we consider our actors and actresses to be very rich but they are also like us, they get a monthly salary but the difference is they get paid much higher than what we think. Now if all are insisting so much then we brought to you the net worth of the Naagin couple, Pearl V Puri and Surbhi Jyoti.
How can we forget the best Jodi so far seen in the Naagin franchise, Surbhi Jyoti and Pearl V Puri? Well, every season has some new Jodi’s but not all make it to the end. We have seen various Jodis like Arjun Bijlani-Mouni Roy, Surbhi Chandna-Mohit Sehgal, Nia Sharma- Vijendra Kumeria, and so on but Surbhi Jyoti and Pearl V Puri definitely stood out from all and how! The duo played the roles of Bela and Mihir and their chemistry was well appreciated by their ardent fans.
Surbhi Jyoti has earned enough over the years with her various hit TV shows like Qubool hai and Naagin 3 while Pearl V Puri’s acting accolades were praised in Bepanah Pyaar, Naagin 3 and now we see him in Brahmarakshas 2.
Well, Surbhi Jyoti charges around 70k per day while Pearl V Puri charges around 40k per day. Well, that makes sense as according to the media reports, the net worth of Surbhi Jyoti and Pearl V Puri is approximately around 1-5 Million Dollars. So the combined net worth becomes between 2-10 Million Dollars, wow! | <urn:uuid:665250e8-3e82-4e25-a51c-f3bb1e7472b5> | CC-MAIN-2021-17 | https://www.iwmbuzz.com/television/news/wow-combined-net-worth-naagin-star-pearl-v-puri-surbhi-jyoti-will-shock/2020/09/26 | 2021-04-23T02:58:01Z | s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618039626288.96/warc/CC-MAIN-20210423011010-20210423041010-00379.warc.gz | en | 0.973522 | 355 |
Certification in the Embodiment Tradition
The enneagram is a powerful tool for working through painful patterns, becoming free from the contracted sense of self, and embodying the open and expanded qualities of our human expressions.
This program is strongly recommended for healing professionals, educators, and facilitators looking to add this system to their treatment modalities. It is also strongly recommended for personal growth and awakening. The next program is scheduled to begin fall 2016.
If you are interested in joining our 1-year certification program, the first step is to attend the Enneagram Embodiment Workshops Part 1 and 2.
Major Components of the Program
Processing our enneatype patterns and exploring our deeper truths
Learning to demonstrate the energetic feeling and behavior of each of the enneatypes including subtypes
Learning to integrate the enneagram into professional practice, whether as a teacher, healer, or facilitator
Each day long class (12 total) is $125 payable in monthly installments.
The final weekend intensive is $200 + boarding for non-commuters.
A 10% discount is applied to full certification payments received by the first class.
Students are obligated to pay for every class. If a class is missed, the instructors schedule a private meeting to cover missed material, but payment is due at the date of the class.
There are sliding scale spots reserved for students who are unable to afford the full cost.
Observe non-verbal aspects (energetics) of types
Explore your own type bias (enneatype countertransference)
Develop interviewing and presentation skills
Assessment of your strengths and growth areas
Body awareness and centering practices
Learn how to embody each type
Understand the enneagram deeply
Learn how to teach, facilitate, and/or provide consultation using the enneagram effectively
Awaken from the dream of enneatype fixation
This program provides over 70 face to face Continuing Education Credits CEUs that can be applied to a variety of professional licenses through the North Carolina Board of Behavioral Sciences.
Upon completion, participants will receive endorsement from the Enneagram Center of Asheville including internationally renowned enneagram teacher, Lissa Friedman, PhD to teach, facilitate, and consult in the Embodiment Tradition.
- 12 monthly 5 hour classes on Saturdays or Sundays
- 1 final intensive weekend retreat: Friday – Sunday
Participants are encouraged to engage in a regular on-going virtual discussion group created for each cohort
Program cohorts are kept small 8-12 people to provide an intense learning experience. Participants tend to bond closely and form connections that last beyond the program. The inter-cohort dynamics enhance both formal and informal learning components of the training.
We schedule all the meetings together in advance at the beginning of the year. When participants are unable to attend a class for extenuating circumstances, they are still obligated to pay for the class due at the date of the class and schedule a private meeting with the instructors to cover missed material.
Each monthly class focuses on either a triad or enneatype. The triad or type is described and demonstrated by a panel. Program participants are encouraged to invite friends and family they believe have the enneatype of the month to sit on the panels. Panel volunteers are interviewed with respect and compassion to make their experience as comfortable as possible.
Each class is split in two parts. The first half of the day is a recorded panel teaching. Participants receive a recording from each meeting, the cost is part of the tuition. During the second half of the day, the core students (8-12) meet with the instructors to process the featured enneatype, discuss reactions from their own fixations, learn how to embody the pattern, and on-going work at releasing patterns.
The final step is a weekend intensive retreat in Asheville NC, which provides the final supportive structure needed to move out into the world as an enneagram teacher, facilitator, and consultant in the Embodiment Tradition.
Participants in this program will learn how to teach the Part 1 workshop, including descriptions and demonstrations the 9 patterns, subtypes, movement, and pattern release. Participants will learn some of the part 2 workshop involving the hierarchy of subtypes, wings, movement and a second stage of pattern release.
In Part 1 people are introduced to the idea that they are born with a pattern – a way of seeing, understanding, and responding to the world and life. This pattern is not personal, unique or individual. Everyone with the same pattern has a very similar dynamic. A simplistic glimpse of how to be free of the pattern is presented. The most important first step is the recognition and acceptance that there is a pattern.
In Part 1, people are offered individualized help to figure out their enneatype. For some people it can take a few workshops before they are sure of their fixation. This is an important element of the Part 1 and Part 2 teaching.
If the Part 1 workshop is done well and the teaching resonates, people often go on to delve deeper into their healing process. If it is not done well people may find the information interesting but not understand its deep importance and power. When the enneagram teaching is clear and deep it is a path to breaking free of the ego.
The teaching in Part 1 should be dynamic and demonstrative. The energetic expression of each pattern should be acted out so that participants can see and feel the difference between each pattern. When the enneagram is taught only descriptively it is often confusing because we all share so many behaviors, tendencies, and emotions. When the energetic dynamic is embodied and acted out, people get a feel for what is deeper than the personality or behavior. The underlying motivations influencing each type are presented in body language, talking style, and general demeanor. A clear teacher has processed and transcended enough of their own enneatype pattern to cleanly embody each of the other patterns. | <urn:uuid:9e657443-36c5-4bc5-9bec-1511dc0a3f07> | CC-MAIN-2017-26 | http://enneagramasheville.com/certification-program/ | 2017-06-28T03:44:40Z | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128322320.8/warc/CC-MAIN-20170628032529-20170628052529-00046.warc.gz | en | 0.930199 | 1,220 |
Aspen Multi-System Corporation offers advance analytical laboratory solutions to its clientele across the Philippine Archipelago. As turn-key provider of laboratory design, fixtures, and furniture, Aspen understands that analytical instruments must produce reliable data to enable scientists, researchers, and engineers to perform their research and product development with confidence, manage and control manufacturing quality, and optimize their output.
Aspen Multi-System Corporation represents various brands that are considered experts in their field. We offer solutions in the following disciplines:
Workflows for comprehensive and reliable, pesticide testing and analysis Solutions for antibiotic, hormone and veterinary drug residue testing Surveillance tools to find food adulteration Simultaneously screen for egg, milk, and peanut allergens Ingredient Authenticity and Profiling Meat Speciation and Halal Food Testing Detect and quantify naturally-occurring food toxins like mycotoxins and more Chemical migration testing […]
Fast, Selective and Sensitive Screening of More Than 1000 Pesticides in Environmental Samples Automated Analysis of Underivatized Glyphosates and Other Polar Pesticides in Crops Analysis of Contaminants of Emerging Concerns – Disinfection by-products , Endocrine disruptors, Industrial Chemicals , Natural Toxin Analysis , Persistent Organic Pollutants (POPs), Pesticide Analysis , Pharmaceuticals and Personal Care Products […]
All your Genetic Analysis Needs on One Instrument For every researcher there is an ideal analytical technology. The GenomeLab™ GeXP Genetic Analysis System (GeXP) is a DNA sequencer and qPCR system ALL in ONE. Get the flexibility to achieve your goals immediately by bringing your analysis in-house and taking control of your data. Whether you […]
Concentrate on the Science Rather Than the Technology The CESI 8000 Plus offers a revolutionary approach to discovering previously undetectable characteristics from the minutest amount of precious samples, faster than ever before. You’ve worked hard to get your sample this far. Get the most from that precious material and hunt down the hidden information you […]
Advanced Biopharmaceutical Analysis That You Can Count On Variations in biotherapeutics affect the safety and efficacy of patient treatment and the reputation of your organization. We can help! With the PA 800 Plus Pharmaceutical Analysis System, you can confidently safeguard the success of your biologics. Robust, Automated, and quantitative assays for purity, charge heterogeneity and […] | <urn:uuid:bb31a7d9-d73b-4da5-9c59-ab046f45c922> | CC-MAIN-2019-18 | http://aspensystem.com.ph/category/analytical/ | 2019-04-24T14:41:17Z | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578643556.86/warc/CC-MAIN-20190424134457-20190424160457-00007.warc.gz | en | 0.876498 | 494 |
NJFCU Supports Hurricane Katrina Relief
TOTOWA, N.J. - (From left) North Jersey Federal Credit Union President/CEO Lourdes Garcia and Director of Marketing/Operations Maria Alves-Schmetow present a check for $2,500 to the National Credit Union Foundation's National Disaster Relief Fund to help support Hurricane Katrina relief efforts. Accepting on behalf of the organization is New Jersey Credit Union Foundation Board Director Ann South and New Jersey Credit Union League Vice President of Governmental Affairs/General Counsel Scott Rekant. In the aftermath of Hurricane Katrina, the New Jersey Credit Union League reached out to NJFCU and other New Jersey credit unions to help assist those devastated by Hurricane Katrina. NJFCU staff and members made donations. "This is a tragedy that has touched all Americans. We wanted to involve our members and the community, while embracing the `People Helping People' credit union philosophy," said Alves-Schemetow. | <urn:uuid:06a2d574-c0cc-49f7-a22f-917402974654> | CC-MAIN-2016-30 | http://www.cutimes.com/2006/02/01/njfcu-supports-hurricane-katrina-relief | 2016-07-29T22:12:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257832385.29/warc/CC-MAIN-20160723071032-00055-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.908494 | 197 |
No front page content has been created yet.
If Given The Chance To Travel, Always Take It!
October 9, 2021 - 12:00am
Harmony Travel and Sweet Adelines International have joined together to provide non-dues revenue... more
April 30, 2021 - 7:36pm
A fantastic tour from start to finish. We met some new & fabulous friends, and re-connected with some... more
February 4, 2020 - 12:00am
New, Exciting Adventures Are Waiting For You....! Travel has an unmatched abillity to crystalize memories... more | <urn:uuid:0b49b68a-4990-4281-b532-80e0c067cb7b> | CC-MAIN-2023-23 | https://harmony-travel.net/ | 2023-05-29T14:53:09Z | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224644867.89/warc/CC-MAIN-20230529141542-20230529171542-00495.warc.gz | en | 0.891545 | 123 |
(R/010/3/0293) 04/20 (A6686)
The Foundation in Life Sciences programme is a one-year pre-university programme delivered through engaging lectures, designed to guide students to actively seek knowledge. In this programme, lectures are supplemented with laboratory work to help students develop their practical skills, working confidence and ability to work effectively in a group. Collectively, these subjects provide a holistic, inspiring and balanced educational experience which equip students with a solid foundation for higher levels of learning and nurture their potential for future academic excellence at the tertiary level.
After completion of the Foundation in Life Sciences programme you can opt for Bachelor of Science (Hons.) (Bioinformatics) degree programme. | <urn:uuid:d55217d6-4d81-49c7-818c-9f34bb909954> | CC-MAIN-2020-16 | https://www.mmu.edu.my/melaka/undergraduate-melaka/information-technology-computer-science/foundation-in-life-sciences/ | 2020-04-02T18:44:24Z | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585370507738.45/warc/CC-MAIN-20200402173940-20200402203940-00299.warc.gz | en | 0.913096 | 148 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.