id int64 8.34M 9.85M | text stringlengths 30 13.9k | __index_level_0__ int64 0 50k |
|---|---|---|
9,086,477 | 1. An anti-jamming subsystem comprising: a. a horizontal two-dimensional array of antennas configured to have a horizontal circular reception pattern and receive signals originating along the horizon and to be positioned in close proximity to a reference antenna having a half hemispherical reception pattern and positioned to have an upward looking view of the sky; b. one or more processors that are configured to process signals received by the reference antenna and the signals received by the respective antennas in the array and actively combine the signals received by the respective antennas in the array to produce one or more anti-jamming signals that combine with the signals received by the reference antenna to substantially cancel interference from jamming signals originating along the horizon and preserve phase and timing information in signals originating from higher elevation transmitters. | 13,477 |
9,753,067 | 1. A method for determining a phase and a frequency of an electric quantity being associated with an operation of an electrical device, the method comprising: providing an electric machine or a power grid; providing an AC-to-DC stage for converting a first AC power signal being generated by the electric power machine into a DC power signal; providing a DC-to-AC stage for converting the DC power signal into a second AC power signal being received from the power grid; extracting a fundamental component of the electric quantity from the electric machine or power grid, wherein the electric quantity is a counter electromotive force; calculating a positive sequence component of the counter electromotive force based on the extracted fundamental component of the electric machine or power grid; determining the phase and the frequency or oscillation of the counter electromotive force based on the calculated positive sequence component of the electric machine or power grid; providing a feedback loop providing the determining unit and the calculating unit with the determined frequency so as to improve an accuracy of the determined phase, frequency or oscillation; and performing a change in the phase, the frequency or the oscillation of the electric machine or power grid based upon the determined phase, frequency, or oscillation. | 14,239 |
9,437,974 | 1. A combined connector body and electrical terminal assembly comprising: a connector body having a passageway formed therein that includes an installation feature; and an electrical terminal including a contact portion having a contact arm, a spring arrangement having a spring arm engaged with the contact arm, and a one way installation feature provided on the spring arm that is engaged with the installation feature provided in the passageway of the connector body to prevent the electrical terminal from being inserted into the passageway in an incorrect orientation relative to the connector body. | 49,422 |
9,362,823 | 1. A switch-mode power supply comprising a converter, a controller and a charging current source, wherein the switch-mode power supply is configured to convert an input voltage to an output voltage, and wherein the charging current source comprises: a multi-functional pin, coupled to the input voltage or a system reference ground via a first resistor, wherein the multi-functional pin outputs a frequency signal, and an initial value of the frequency signal is generated according to the input voltage or a zero voltage on the system reference ground; a logic circuit coupled to the multi-functional pin, wherein the logic circuit generates a logic control signal according to the initial value of the frequency signal and an enable signal, and wherein the logic control signal is coupled to the controller configured to indicate either of two operation modes of the controller; a first current source coupled to the logic circuit and the multi-functional pin, wherein the first current source generates a first output current according to the frequency signal, the enable signal and the logic control signal; a second current source coupled to the logic circuit and the multi-functional pin, wherein the second current source generates a second output current according to the frequency signal, the enable signal and the logic control signal; and wherein the first output current is incorporated with the second output current to comprise a charging current provided to the controller, wherein the charging current is proportional to the input voltage. | 45,722 |
8,972,291 | 1. A method of monitoring inventory of a product in a storage bin, the method comprising steps of: receiving input from a user of a processing device; comparing the input to records stored in a database, each of the records including at least one of a name of a product stored in a storage bin, an identity of a camera associated with the storage bin, a source path used to gain access to an image or video captured by the camera, an identifier associated with the storage bin, a SKU number associated with the product, an image of the product, or a location of the storage bin; displaying on the processing device a location of at least one product based on the comparison of the input to the records in the database; and displaying on the processing device at least one of an image or a video showing contents of a storage bin associated with the at least one product. | 23,305 |
8,674,395 | 1. An optical device comprising: an electrically insulating substrate defining an opening, the opening having an interior surface; a conductive layer overlying a portion of the interior surface, a portion of the conductive layer being characterized by a thickness of at least 15 μm; an LED device electrically coupled to the portion of the conductive layer; a layer of insulating material overlying the interior surface and the conductive layer; and a reflective layer overlying the layer of insulating material, wherein the reflective layer comprises an opening for a bond pad. | 22,209 |
9,262,235 | 1. A process comprising the steps of: a thread X in an application calling an interruptible completion-awaiting routine of a message passing interface (MPI) library, the called interruptible completion-awaiting routine being configured to return successfully from a blocked condition after a specified message passing completion condition is satisfied, the completion condition specifying a list of requests which have not yet been completed; a message passing interface library progress engine executing while the interruptible completion-awaiting routine is in the blocked condition; a thread Y interrupting the interruptible completion-awaiting routine prior to satisfaction of the completion condition; and the interruptible completion-awaiting routine returning control in response to interruption by the thread Y, as part of an interruptible wait enhancement which (a) is not an asynchronous callback enhancement, (b) allows an interruption of the completion-awaiting routine without canceling the completion-awaiting routine, and wherein the interruptible completion-awaiting routine returns with a completion indicator which indicates that at least one of the listed requests was completed prior to the interruption and also indicates that at least one of the listed requests was not completed prior to the interruption, and (c) allows the application to make progress; wherein the interruptible wait enhancement of the interrupted completion-awaiting routine returns control to the thread X in conjunction with an indication specifying that more than 1 and less than N messaging operations in the list of N messaging operations had completed when the thread Y interrupted the completion-awaiting routine, with N being an integer greater than 2. | 20,670 |
8,749,918 | 1. A magnetic recording system, comprising: a perpendicular exchange spring media; and a ring head having an air bearing surface, wherein the ring head further comprises: | 24,424 |
8,713,422 | 1. A method for evaluating a plurality of conditional formatting rules applied to a user interface, the method comprising: identifying first and second conditional formatting rules for formatting cells in a user interface, wherein the first conditional formatting rule has a first priority and a first formatting, wherein the second conditional formatting rule has a second priority and a second formatting, and wherein the first priority is greater than the second priority; identifying a cell contained in the user interface associated with the first and second conditional formatting rules; determining with the computing device if the first and second conditional formatting rules are satisfied for the cell; and if determined that the first and second conditional formatting rules are satisfied, applying the first formatting to the cell based on the ranking of the first priority and determining whether the second formatting and the first formatting belong to a single group of conflicting formats prior to applying the second formatting associated with the second conditional formatting rule. | 18,342 |
9,196,161 | 1. A method of guiding a parking space for an electronic device on a vehicle, the method comprising: obtaining location information of the parking space; calculating a destination position according to the location information; determining a movement of the vehicle via at least one sensor of the electronic device to generate a determination result; and generating a guiding indication for guiding the vehicle to the destination position according to the determination result and the destination position; wherein the step of obtaining location information of the parking space comprises obtaining the location information of the parking space according to an mobile barcode, and the step of generating the guiding indication comprises generating the guiding indication on a display screen of the electronic device for guiding the vehicle to the destination position according to the determination result and the destination position, and displaying the guiding indication in an augmented reality (AR) manner via the display screen according to a real-time image related to the movement of the vehicle obtained by the electronic device. | 3,166 |
9,848,667 | 1. An article of headgear comprising: a head-covering article; a lens moveably attached to the head-covering article by a frame; and a seal attached to the lens, the seal comprising a first polymeric material and a second polymeric material, the first polymeric material having a greater tensile modulus than the second material; wherein the lens is moveable from a first, lowered position to a second, raised position, and when in the first, lowered position, the seal engages the head covering article. | 22,561 |
9,524,210 | 1. A memory device, comprising: a controller device that interfaces to a host device and to an array of memory cells, wherein each memory cell comprises a multi-level cell (MLC), wherein the MLC is characterized by a plurality of measurable states represented by multiple bits of data; a splitter component that generates split data characterized by assigning a first bit of the multiple bits of data to a first codeword of a page of memory and a second bit of the multiple bits of data to a second codeword of the page of memory; and an error-correcting code (ECC) component that detects and corrects bit errors associated with the multiple bits of data in response to the first codeword, the second codeword and an ECC algorithm. | 23,178 |
9,422,555 | 1. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO: 207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping; or a pharmaceutically acceptable salt thereof. | 16,673 |
9,548,408 | 1. An infrared detector device comprising: a first contact layer; an absorber layer adjacent to the first contact layer; and a tunneling structure comprising a barrier layer adjacent to the absorber layer and a second contact layer adjacent to the barrier layer, wherein the barrier layer has a tailored valence band offset such that: | 27,547 |
8,655,586 | 1. A method for displaying either a one-way driving range or a two-way driving range for a vehicle having a processor and a display, the method comprising: determining, using the processor, a first location corresponding to a location of the vehicle; determining, using the processor, a proximity between the first location and a second location or destination; automatically determining, using the processor and based upon an energy level of the vehicle, at least one of the one-way driving range or the two-way driving range; automatically selecting, using the processor and based on the determined proximity, only one of a one-way display mode for displaying the one-way driving range or a two-way display mode for displaying the two-way driving range; and selectively displaying, using the display, either the one-way driving range, but not the two-way driving range, when the one-way display mode is automatically selected or the two-way driving range, but not the one-way driving range, when the two-way display mode is automatically selected. | 42,994 |
9,593,616 | 1. An exhaust pipe fuel injector for injecting fuel into an exhaust pipe in order to regenerate a diesel particulate filter of a diesel engine, the exhaust pipe fuel injector comprising: a fuel injection nozzle configured to inject the fuel into the exhaust pipe; a supply pipe configured to allow the fuel or air to be supplied through the supply pipe into the fuel injection nozzle; and a control unit, wherein the control unit has a function for continuing combustion until no fuel remains inside of the supply pipe during regeneration of the diesel particulate filter, wherein, when the diesel particulate filter is regenerated, the supply pipe is configured to supply the fuel to the fuel injection nozzle, and wherein, when the generation of the diesel particulate filter is interrupted, the supply pipe is configured to continue to supply the air to the fuel injection nozzle until an exhaust gas temperature becomes lower than a threshold value. | 27,680 |
9,325,177 | 1. An apparatus for balancing a plurality of cells in a battery, said apparatus comprising: a first common bus, a connector for connecting the first common bus to another common bus of another battery; a plurality of balancing circuits, each comprising a bidirectional voltage converter connected to a given cell of the plurality of cells, and a linear current regulator arrangement for varying a magnitude of current flowing between the bidirectional voltage converter and the first common bus; and a controller operatively connected to the first common bus, the plurality of cells and the plurality of balancing circuits, the controller configured to determine the magnitude of current flowing between the bidirectional voltage converter and the first common bus based on a desired voltage level for the first common bus. | 22,851 |
9,181,787 | 1. A radio frequency (RF) antenna assembly configured to be positioned within a wellbore in a subterranean formation for hydrocarbon resource recovery, the RF antenna assembly comprising: a series of tubular dipole antennas to be positioned within the wellbore, each tubular dipole antenna comprising a pair of dipole elements; an RF transmission line extending within said series of tubular dipole antennas; and a respective coupling structure between each pair of dipole elements and between said series of tubular dipole antennas, each coupling structure comprising | 45,826 |
9,614,449 | 1. A flyback power converter for supplying a programmable output voltage, wherein the flyback power converter switches the output voltage between at least a first voltage and a second voltage according to a setting signal, the first voltage being higher than the second voltage, the flyback power converter comprising: a transformer circuit, which includes: a power switch circuit, which is coupled to the primary winding, for operating a power switch therein according to an operation signal, so as to convert the input voltage to the output voltage; a current sense circuit, which is coupled to the power switch circuit, for generating a current sense signal according to a switch current flowing through the power switch; an opto-coupler circuit, which is coupled to the secondary winding, for generating a feedback signal according to an output power and the setting signal; and a control circuit, which is coupled to the tertiary winding, the current sense circuit, the opto-coupler circuit, and the power switch circuit, for generating the operation signal according to the voltage sense signal, the current sense signal, and the feedback signal; wherein the control circuit reduces an operation frequency of the operation signal when the feedback signal is lower than a frequency reduction point; wherein the control circuit further adaptively adjusts the operation signal by at least one of the following methods according to the voltage sense signal, such that the flyback power converter maintains a same or relatively higher operation frequency of the operation signal and provides a same output current when the output voltage is switched to the second voltage as compared with when the output voltage is switched to the first voltage, to maintain a phase margin: (1) adaptively adjusting the frequency reduction point of the feedback signal according to the voltage sense signal; (2) adaptively adjusting a current gain according to the voltage sense signal, and amplifying the current sense signal with the current gain to generate a current sense gain signal, such that the current sense gain signal when the output voltage is switched to the second voltage, is higher than the current sense gain signal when the output voltage is switched to the first voltage; (3) adaptively adjusting a feedback attenuation according to the voltage sense signal, and attenuating the feedback signal with the feedback attenuation to generate a feedback attenuation signal, such that the feedback attenuation signal when the output voltage is switched to the second voltage, is lower than the feedback attenuation signal when the output voltage is switched to the first voltage; and (4) adaptively adjusting a slope compensation signal according to the voltage sense signal, and compensating a slope of the current sense signal with the slope compensation signal to generate a current sense compensation signal, such that the current sense compensation signal when the output voltage is switched to the second voltage, is higher than the current sense compensation signal when the output voltage is switched to the first voltage. | 22,628 |
8,938,078 | 1. A method of enhancing an acoustic signal, comprising steps of: sensing an acoustic signal using a microphone in an electronic device, the acoustic signal emitted in response to a primary sound signal and transmitted through a space; converting the sensed acoustic signal to a digitized acoustic signal; receiving, using an antenna in the electronic device, a wireless signal encoded with the primary sound signals; decoding the primary sound signal encoded in the wireless signal as a digital primary sound signal; estimating an impulse response for the space based on the digitized acoustic signal and the digital primary sound signal; calculating a delay between the digitized acoustic signal and the digital primary sound signal by scanning the estimated impulse response to identify a peak magnitude of the estimated impulse response; calculating an average magnitude of the estimated impulse response; comparing the average magnitude of the estimated impulse response to the peak magnitude of the estimated impulse response to determine a peak-to-average ratio; delaying the digital primary sound signal using the calculated delay if the peak-to-average ratio exceeds a predetermined value; and reproducing the delayed digital primary sound signal to enhance the acoustic signal heard by a user of the electronic device. | 23,031 |
9,355,748 | 1. A rotary actuator comprising: a driven element comprising an axis of rotation and a plurality of recesses, the recesses being spaced around the axis of rotation by a spacing angle; and first, second and third latch elements, each latch element being movable between a retracted position, and an extended position in which it engagingly locates against one or more of the plurality of recesses; wherein the first latch element is angularly offset from the second and third latch elements respectively in rotationally opposite directions around the axis of rotation by an offset angle, the offset angle being greater than the spacing angle; whereby sequential movement of the first, second and third latch elements between respective retracted and extended positions causes rotation of the driven element. | 5,750 |
8,999,101 | 1. Method for mutually adhering moulded articles of at least partially vulcanized rubber polymers, which method comprises at least the following steps of (A) providing a rubber composition which comprises a peroxide with an initiating temperature lower than the vulcanization temperature of the rubber polymers; (B) arranging an adhesive layer of the rubber composition on the surface of the moulded articles which are to be adhered; (C) bringing the surfaces for adhering together under pressure; and (D) vulcanizing the rubber composition of the adhesive layer at an increased temperature, with the proviso that the rubber composition is vulcanized at the position of the surfaces for adhering at a maximum set temperature that is lower than the vulcanization temperature of the rubber polymers, wherein the method comprises the following additional steps of: (E) providing a film; (F) arranging at least part of the film between the two surfaces prior to step (C), with the proviso that the temperature in step (D) is lower than the melting or degradation temperature of the film, and wherein the film constitutes one or more inflatable bellows of plastic film. | 33,656 |
8,797,169 | 1. An apparatus, comprising: electronic circuits; an enclosure for housing the electronic circuits, the enclosure having a plurality of heat sink fins positioned on an outer surface of the enclosure; an orientation sensor configured to sense an orientation of the enclosure; and logic configured to indicate whether a longitudinal axis of at least one of the heat sink fins is within a predefined range of a direction of buoyant airflow based on the sensed orientation. | 29,941 |
8,935,554 | 1. An electronic device provided with an upper housing and a lower housing, wherein the upper housing and the lower housing are slidably connected via a slide mechanism such that an operation key provided on a front face of the lower housing can be in at least two states: an open state where the operation key is exposed to the outside; and a closed state where the operation key is not exposed to the outside, comprising: an opening/closing detection unit configured to detect a transition of the state of the electronic device; an application processing unit configured to execute an application; an electrical-power control unit configured to set an operation mode of the application processing unit; and an operation switch configured to be operated by a user, said operation switch is a physical switch located on a side face of the lower housing, thereby providing easy access to the switch regardless of whether the device is an open state, closed state, face up, or face down, wherein when a transition from the open state to the closed state is detected while the operation switch is in an OFF state, the electrical-power control unit switches the operation mode of the application processing unit from a normal mode to a sleep mode, and when a transition from the open state to the closed state is detected while the operation switch is in an ON state, the electrical-power control unit does not switch the operation mode of the application processing unit from the normal mode to the sleep mode, thereby allowing any application, including a game, to continue running in the closed state, and wherein said slide mechanism allows the upper housing and lower housing to slidably converge or diverge along parallel planes. | 30,273 |
8,698,361 | 1. An arrangement for cooling of an electrical machine, comprising: a stator-arrangement mounted on an outer surface of a support structure; a rotor-arrangement; and a cooling channel arranged between the stator-arrangement and support structure such that the cooling-channel is pressed between the stator-arrangement and the support structure, wherein the cooling channel is pressed against the support structure by the stator arrangement or vice versa, such that the cooling channel is squeezed or deformed. | 46,833 |
8,407,052 | 1. A method of correcting transcribed text utilizing a computer-processing system, the computer-processing system having a browser-based user interface, the method comprising: receiving a first plurality of audio data sets from one or more audio data sources, wherein at least two of the first plurality of audio data sets are associated with different speakers; transcribing the first plurality of audio data sets based on a voice-independent model to generate a plurality of text data sets, wherein at least two of the plurality of text data sets are associated with different speakers; storing the plurality of text data sets; making the plurality of text data sets available to a plurality of users over at least one computer network through the browser-based user interface; receiving a plurality of corrected text data sets over the at least one computer network from at least one of the plurality of users through the browser-based user interface, wherein the plurality of corrected text data sets are associated with the plurality of text data sets and at least two of the plurality of corrected text data sets are associated with different speakers; updating the voice-independent model based on the plurality of corrected text data sets received through the browser-based interface; and transcribing a second plurality of audio data sets based on the voice-independent model as updated, wherein at least two of the second plurality of audio data sets are associated with different speakers. | 17,901 |
8,680,784 | 1. A dimmable LED driver apparatus comprising: an input interface coupled to a power source and dimmer, the input interface receives an input voltage from the power source and dimmer; a sensor coupled to the power source and dimmer, the sensor detects a first voltage on the input voltage and generates a sensed voltage signal representative of a voltage drop on the input voltage caused by a dimmer; a control loop coupled to receive the sensed voltage and compare the sensed voltage to a first threshold level and a second threshold level, the control loop generating a control signal based on a comparison of the sensed voltage to the first threshold level and the second threshold level; a regulator and control block coupled to receive the control signal, the regulator and control block generates an LED driver signal based at least in part on the control signal; and an output interface comprising a capacitor, the LED driver signal is provided to an LED array at the output interface. | 25,911 |
9,567,581 | 1. A method of activating an inactive X-linked allele in a cell, the method comprising administering to the cell an inhibitory oligonucleotide targeting a PRC2 binding site in a region of a gene encoding the allele on the X Chromosome that is marked concurrently by H3K4me3 and H3K27me3 and coincides with a CpG island. | 28,860 |
8,865,186 | 1. An isolated, physiologically active Clostridial neurotoxin comprising: a light chain terminating at its C-terminus with a lysine residue of a highly specific protease cleavage site comprising three or more specific adjacent amino acid residues that are recognized by a highly specific protease to enable cleavage and a heavy chain, wherein the light chain and the heavy chain are linked by a disulfide bond. | 20,710 |
8,430,916 | 1. A spinal rod connector adapted to connect two spinal rods, the spinal rod comprising: a U-shaped housing with first and second arms with first and second elongated lengths respectively, which first and second elongated lengths are about parallel to each other; said housing including a first channel that defines a spherical socket and a second channel that is cylindrical and includes a gap where the first arm is spaced from the second arm; a rod mount with a bore positioned in said first channel, which rod mount can move relative to the first channel, and said rod mount is a compression ball with a slot; a fastener provided through the housing between the first channel and the second channel and wherein the gap is located distally from said fastener and the fastener does not come in contact with the gap, whereby the first channel and rod mount are adapted to capture a first spinal rod provided through the bore of said rod mount, and said second channel is adapted capture a second spinal rod when the fastener is actuated to bring together said first arm and said second arm and thereby closing the gap and with the first rod being one of parallel and non-parallel to the second rod. | 19,802 |
9,214,667 | 1. A lithium-ion secondary battery comprising: a cathode; an anode including an anode active material layer; and an electrolytic solution, wherein, | 5,276 |
8,435,797 | 1. An electroluminescent sensor system, comprising: an electroluminescent diode sensing element, wherein said electroluminescent diode sensing element is configured with a heater and emits electroluminescent light proximate to a sample of explosive compound; a photodetector configured to detect electroluminescent light resulting from said electroluminescent diode sensing element proximate to a sample of explosive compound, and output a detection signal; a computer to process a detection signal from said photodetector; and a power supply to power at least said electroluminescent diode sensing element, wherein said detector detects electroluminescent light resulting from said electroluminescent diode sensing element proximate to a sample of explosive compound for said computer to process said detection signal and determine the presence of nitroaromatic molecules from any one of gaseous, liquid or solid samples which may affect the luminescence intensity of the electroluminescent diode sensing element. | 19,075 |
9,312,549 | 1. A fuel cell cooling system for a vehicle comprising: a first air inlet provided in a front portion of a vehicle; an air supply path which supplies air, as taken in from said first air inlet, to a fuel cell which supplies electric power to a driving motor; a regulating member which is provided in said air supply path and regulates an amount of air to be supplied from the air supply path to said fuel cell; a blower which provides an air flow to said fuel cell; and a control portion which controls said regulating member and said blower to regulate an amount of air supplied from the air supply path and the blower to the fuel cell; a second air inlet which takes air into said air supply path from beneath the vehicle; an opening/closing member which opens or closes said second air inlet; and a rain detecting portion which detects rain fall, wherein when the rain fall is detected by said rain detecting portion, said control portion stops supplying the air from said air supply path to the fuel cell through said regulating member and also opens the second air inlet through the opening/closing member. | 36,784 |
8,387,916 | 1. A galley unit for an aircraft comprising: a galley body being fixed on a cabin floor for accommodating a plurality of storage boxes and appliances; and a plurality of storage boxes for storing goods; wherein said galley body has a plurality of vertical levels that are substantially equidistant from each other, wherein each of said vertical levels is subdivided into a plurality of laterally adjacent compartments for accommodating the storage boxes, wherein the horizontal and vertical dimensions of said compartments are equal to an integer multiple of the respective dimensions of a single one of said storage boxes, and wherein a transfer table is mounted in front of said galley body slidable in vertical and horizontal directions. | 35,976 |
8,656,198 | 1. A method comprising: monitoring requests for access to a memory of a memory subsystem directly asserted by one or more processor cores, wherein the memory is a main memory of a computer system; monitoring requests for access to the memory conveyed by an input/output (I/O) unit; asserting a first signal if at least a first amount of time has elapsed since any one of the processor cores has asserted a memory access request and at least a second amount of time has elapsed since the I/O unit has conveyed a memory access request; asserting a second signal if an amount of data stored in a display buffer exceeds a threshold value; filling the display buffer with an amount of data that exceeds the threshold value if the amount of data in the display buffer is less than the threshold value; transitioning the memory subsystem from a full power state to a first low power state responsive to assertion of the first and second signals; draining the display buffer of data; de-asserting the second signal responsive to the amount of data in the display buffer falling below the threshold value; and transitioning from the first low power state to the full power state responsive to the de-assertion of the second signal. | 43,294 |
9,822,332 | 1. A system for digesting biodigestible feed comprising: a) a digestion vessel; b) a feed inlet for introducing biodigestible feed into the digestion vessel; c) a gas inlet for introducing a gas into the digestion vessel; d) a bacteria inlet for introducing bacteria to the digestion vessel for digestion of the biodigestible feed; e) a digested feed outlet for digested feed; and f) a control system for changing (i) the composition of the gas introduced into the digestion vessel from the gas inlet, from an oxygen containing gas to a gas not containing oxygen for changing the contents of the digestion vessel from aerobic operation to either anoxic or anaerobic operation without changing the bacteria in the digestion vessel for different bacteria and (ii) the composition of the gas introduced into the digestion vessel from the gas inlet from a gas not containing oxygen to a gas containing oxygen for changing the contents of the digestion vessel from anaerobic or anoxic operation to aerobic operation without changing the bacteria in the digestion vessel for different bacteria. | 4,276 |
9,764,717 | 1. A slope-descending speed control device for a vehicle having a control unit which is configured to control a deceleration of a vehicle, when a predetermined condition for starting a slope-descending speed control is satisfied, so that an actual vehicle speed conforms to a target vehicle speed in accordance with at least a target deceleration of an integral term of a PID feedback control executed in accordance with a difference between a target vehicle speed and an actual vehicle speed, wherein said control unit calculates a component in a hill-descending direction of gravitational acceleration of the vehicle when an actual vehicle speed is higher than a target vehicle speed, with a reference value for determining a magnitude of a component in a hill-descending direction of gravitational acceleration of the vehicle being referred to a determination reference value, said control unit suppresses the increase of a target deceleration of said integral term in accordance with the magnitude of a difference between a component in a hill-descending direction of gravitational acceleration of the vehicle and said determination reference value. | 13,908 |
9,355,684 | 1. A method comprising: recording, at a client device, media content; generating from the media content, during an initial recording of the media content and before a recorded portion of the media content exceeds a threshold portion of the media content, a temporary thumbnail representative of the media content from a frame in the media content; presenting, by the client device, the temporary thumbnail within an electronic program guide (EPG) listing; determining, by the client device, that the recorded portion of the media content exceeds the threshold portion of the media content; generating from the recorded portion of the media content, a permanent thumbnail representative of the recorded portion of the media content based at least in part on selecting a representative frame in the recorded portion of the media content; and presenting, by the client device, the permanent thumbnail within the EPG listing instead of the temporary thumbnail. | 8,887 |
9,720,483 | 1. A data transfer apparatus comprising: a data transfer unit configured to perform data transfer between each of a plurality of master modules and a slave module in response to a data transfer request of each of the master modules; a detection unit configured to detect the data transfer request of each of the master modules; and a control unit configured to control the data transfer unit from a normal operation mode to a power saving mode and to return the data transfer unit from the power saving mode to the normal operation mode, wherein, in a case where a first data transfer request of a first master module included in the master modules is detected and then a second data transfer request of a second master module included in the master modules is detected by the detection unit after the data transfer unit is shifted from the normal operation mode to the power saving mode by the control unit, the control unit returns the data transfer unit from the power saving mode to the normal operation mode, and the data transfer unit collectively transmits the first data transfer request and the second data transfer request to the slave module and collectively performs data transfer processing corresponding to the first data transfer request and data transfer processing corresponding to the second data transfer request. | 16,293 |
8,408,618 | 1. Gripping pliers ( 1 ) for grasping and holding an object, comprising at least two gripping jaws ( 2 ), movable in reference to each other, a drive that moves the gripping jaws in an opening direction and a closing direction, at least one of the gripping jaws ( 2 ) comprising more than two fingers ( 3 ), arranged side-by-side and the fingers on the gripping jaw ( 2 ) are movable together in the opening and closing directions, and each of the fingers is individually adjustable against a restoring force that acts approximately in the opening or the closing direction, the gripping jaws ( 2 ) are each formed in one piece with the respective fingers ( 3 ), each of the gripping jaws ( 2 ) comprises the fingers ( 3 ) that are individually adjustable, and the fingers ( 3 ) are each individually connected via a spring-elastic, restoring force generating material section ( 6 ) to a base area ( 7 ) of the gripping jaws. | 35,499 |
9,068,206 | 1. A system for the production of ethanol from pre-treated biomass comprising: a source of pre-treated biomass; a centrifuge in fluid communication with the source of pre-treated biomass, wherein the centrifuge is configured to separate the pre-treated biomass into a liquid component and a solid component, wherein the liquid component comprises sugars; a filter comprising a pore size of between 25 microns and 100 microns, wherein the filter is in fluid communication with the centrifuge to receive the liquid component to provide a filtered liquid component; an apparatus configured to remove one or more inhibitors from the filtered liquid component, thereby yielding a first treated liquid component, wherein the apparatus is in fluid communication with the filter to receive the filtered liquid component; an evaporation system in fluid communication with the apparatus to receive the first treated liquid component to remove water from the first treated liquid component and produce a second treated liquid component; and a fermentation system in fluid communication with the evaporation system to receive the second treated liquid component, wherein the fermentation system comprises an ethanologen to ferment the sugars into ethanol; wherein the apparatus comprises an ion exchange system comprising a resin bed; wherein the resin bed comprises a resin capable of binding said inhibitors; wherein the biomass comprises lignocellulosic material; wherein the lignocellulosic material comprises at least one of corn cobs, corn plant husks, corn plant leaves and corn plant stalks. | 44,560 |
8,808,223 | 1. A device for subcutaneous implantation within a human or animal body to divert fluid in a selectively controllable manner from a first part of the human or animal body to a second part thereof, the device comprising: an inlet adapted to communicate with a first part of a human or animal body; an outlet adapted to communicate with a second part of the human or animal body; and a resistance member that communicates with the inlet and the outlet, the resistance member including: a first plate including a surface having a groove; a second plate that abuts the surface of the first plate and cooperates with the groove to define a resistance flow channel having an entry that communicates with the inlet and at least first and second exits that define different effective lengths of the resistance flow channel from the entry; and a rotor supported on one the first plate or the second plate for rotation between at least a first rotational position, wherein communication is provided between the first exit of the resistance flow channel and the outlet, and a second rotational position that position, wherein communication is provided between the second exit of the resistance flow channel and the outlet, the rotor being magnetically excitable so that it can be selectively rotated between the first and second rotational positions by a magnet located proximate the device. | 22,894 |
8,923,158 | 1. A method, comprising: receiving a plurality of flow records, the flow records comprising data about traffic in a network; caching the plurality of flow records in temporary storage; analyzing the plurality of flow records to determine a number of bytes of traffic that each of the plurality of flow records represents; and selecting a subset of the plurality of flow records to forward to permanent storage based on the determined number of bytes of each of the flow records, wherein said selecting comprises selecting the subset of flow records that represent a top five percent of the plurality of flow records in terms of the number of bytes, wherein the caching comprises caching the plurality of flow records during a predetermined amount of time and for a predetermined number of flow records. | 8,347 |
9,777,274 | 1. An antisense molecule or salt thereof that inhibits the growth of Staphylococcus aureus comprising a polynucleotide sequence that is antisense to the coding region of a Staphylococcus aureus membrane stability protein and hybridizes to said coding region under physiological conditions, wherein said antisense molecule has a sequence selected from the group consisting of SEQ ID NOs: 1-9 and 11-16, and wherein said antisense molecule is conjugated to a cell penetration molecule. | 36,415 |
8,715,026 | 1. A method for disassembling a plasma display device, the plasma display device including: a metal support plate bonded to the rear plate of the plasma display panel with a bonding member interposed therebetween; and the method comprising: | 23,725 |
9,275,381 | 1. A charging and billing system for performing billing according to an amount of electric power supplied upon charging, the system comprising: a plurality of charging devices each for performing charging by supplying electric power to a subject; a single billing device provided separately from the charging devices; and a transmission path for connecting the plurality of charging devices and the single billing device that processes payments for the plurality of charging devices in a manner that allows transmission of information, wherein the single billing device comprises: a charging initiator that makes the charging device to initiate charging the subject by transmitting initiation information for making the charging device to initiate charging to the charging device via the transmission path; a bill calculating unit for calculating bill corresponding to the amount of electric power to be supplied to the subject by the charging device; a display unit for indicating the bill calculated by the bill calculating unit; beverages to be vended by the single billing device; and a payment unit that processes payment of the bill calculated by the bill calculating unit and that processes payment for the beverages. | 30,719 |
8,950,155 | 1. A pool stair form for forming stairs in a pool including pool wall panels, the pool stair form including: at least one pool wall insert configured to be coupled between adjacent pool wall panels; at least one stair form brace configured to couple to the at least one pool wall insert and extend therefrom in a first direction, the at least one stair form brace including first fixation points; and a plurality of elongate riser forms including a front face and second fixation points at least a first end thereof, wherein the at least one stair form brace and riser forms are configured to couple at the first and second fixation points such that the riser forms extend in a second direction substantially contrasting the first direction and span substantially between opposing pool wall panels when the at least one stair form brace is coupled to the at least one wall panel insert, and wherein the front face of the riser forms form the riser portion of the stairs when the riser forms are coupled to the at least one stair form brace and the at least one stair form brace is coupled to the at least one wall panel insert. | 28,334 |
8,579,788 | 1. An intraventricular balloon pump system, comprising: an intraventricular balloon; a housing comprising a rotating disc and a tubule, said tubule fluidly connected with said balloon; wherein a revolution of said rotating disc compresses said tubule and forces fluid held within said tubule to enter said balloon. | 49,302 |
8,500,396 | 1. A turbine blade comprising: a hollow airfoil, platform, and integral dovetail; said airfoil including opposite pressure and suction sides extending in span from root to tip and in chord between leading and trailing edges; said tip including first and second ribs extending outwardly from a tip floor along said pressure and suction sides, respectively, and joined together at said leading and trailing edges; and a cascade tip baffle transversely bridging said first and second ribs in a one-piece metal casting above said tip floor forward of the maximum width of said tip to partition said tip chordally into corresponding tip pockets on opposite sides of said baffle wherein said tip baffle is spaced aft from said leading edge along both said first and second ribs to define a forward tip pocket directly behind said leading edge, and said baffle is disposed obliquely to said leading edge to transversely distribute flow streamlines in a cascade aft over said baffle toward said trailing edge wherein said tip baffle obliquely joins said first and second ribs behind said leading edge, and said forward tip pocket diverges in width aft from said leading edge, and an aft tip pocket converges in width between said baffle and trailing edge; and wherein said first and second ribs and tip baffle are coplanar in elevation above said tip floor and fully surround said tip pockets. | 8,057 |
8,636,839 | 1. An ink jet ink comprising: a pigment and a polyurethane polymer, wherein the polyurethane polymer contains units derived from a polyisocyanate, a polyol, a compound having a carboxy group, and a compound having a sulfo group, and wherein the acid value of the polyurethane polymer is 20 mgKOH/g or more and 100 mgKOH/g or less. | 23,745 |
9,496,074 | 1. A laser etching method for a transparent conductive plate, comprising: providing a transparent conductive plate, wherein the transparent conductive plate has a transparent insulating substrate and a transparent conductive layer formed on the insulating substrate; defining a predetermined etching path on the conductive layer, wherein the predetermined etching path has at least a predetermined end connection path, a predetermined T-shaped path, or a predetermined right angle path; and emitting a plurality of laser beams at a sustained manner from a laser apparatus onto the conductive layer of the transparent conductive plate, and controlling the center points of the laser beams onto the conductive layer in part of the predetermined etching path; wherein when etching the conductive layer corresponding to the predetermined end connection path, controlling the center points of the laser beams to move in a front path and a rear path partially overlapping a beginning portion of the front path, thereby forming an end connection groove on the transparent conductive plate, wherein when etching the conductive layer corresponding to the predetermined T-shaped path, controlling the center points of the laser beams to move in a transverse path and a longitudinal path without overlapping the transverse path, thereby forming a T-shaped groove on the transparent conductive plate, and wherein when etching the conductive layer corresponding to the predetermined right angle path, controlling the center points of the laser beams to sequentially move in a first path, a curve path, and a second path substantially perpendicular to the first path, thereby forming a curve groove on the transparent conductive plate. | 15,655 |
9,597,626 | 1. A method for reducing the concentration of controlled pollutants in clinker kiln emissions, comprising: providing a clinker kiln, wherein the clinker kiln comprises a gas conditioning system configured to process exhaust gases from the clinker kiln, wherein, the exhaust gases comprise controlled pollutants and entrained dust; and the gas conditioning system comprises: a preheater exhaust exit; a gas conditioning tower directly coupled to the preheater exhaust exit; and an inlet to a dust filter directly coupled to the gas conditioning tower; and introducing bypass dust generated during operation of the clinker kiln: between the preheater exhaust exit and the gas conditioning tower; into the gas conditioning tower; between the gas conditioning tower and the inlet to the dust filter; or a combination of any of the foregoing, thereby reducing the concentration of controlled pollutants in the clinker kiln emissions. | 6,438 |
8,809,019 | 1. A transformed microorganism capable of: (i) converting xylose to a xylulose at a higher rate than the equivalent microorganism prior to transformation; and/or (ii) a higher growth rate in the presence of xylose than the equivalent microorganism prior to transformation; and/or (iii) a higher metabolism of xylose than the equivalent microorganism prior to transformation; wherein said microorganism has been transformed with a promoter that enables the microorganism to overexpress an endogenous aldose-1-epimerase, and/or wherein said microorganism has been transformed with a nucleotide sequence encoding an aldose-1-epimerase, and said microorganism has been transformed with at least one expression vector comprising a heterologous nucleotide sequence encoding xylose isomerase, or said microorganism has been transformed with at least one expression vector comprising a heterologous nucleotide sequence encoding a xylose isomerase and a xylulokinase, or said microorganism has been transformed with at least one expression vector comprising a heterologous nucleotide sequence encoding a xylose isomerase wherein said microorganism has been transformed with a promoter that enables the microorganism to overexpress an endogenous xylulokinase, and wherein said microorganism is a transformed yeast. | 36,553 |
8,757,710 | 1. A roof assembly for a vehicle having a roof opening in its roof, comprising: a pair of guide rails extending at least in part in a non-parallel generally longitudinal way and at a distance from each other; at least one closure element , being adjustable in order to at least cover and at least partly open the opening in said vehicle roof, said closure element having two opposite sides adjacent to the guide rails; at least one pair of sliding elements opposite of each other disposed on each of said sides of the closure element so as to engage in the respective guide rail , said sliding elements being slidably connected to the closure element in a substantially lateral direction generally orthogonal to the longitudinal direction; and a biasing device comprising a spring coupled to the sliding elements and configured so as to bias the sliding elements relative to the closure element each in a substantially lateral direction, wherein the biasing device is attached to the closure element on one end and is operatively connected to said at least one pair of opposite sliding elements on the other end with interposition of a synchronizing device comprising pull elements operatively biased by the spring, the pull elements connected to and configured to equalize the movements of the sliding elements. | 8,900 |
8,790,818 | 1. A multi-functional composite comprising a plurality of cloth layers and a penetrating matrix material and having at least one cell for energy storage incorporated therein, wherein the cell is integrally deposited upon at least one of the cloth layers and comprises first and second electrodes separated by a porous, separator layer that has a liquid electrolyte-permeable, matrix-free intra-electrode region. | 3,395 |
8,384,400 | 1. A capacitance measurement circuit, comprising: an operation amplifier having a first input terminal, a second input terminal and an output terminal; a reference capacitor having a first terminal coupled to the first input terminal of the operation amplifier and a second terminal selectively coupled to a first reference voltage or a second reference voltage; a sensor capacitor having a first terminal coupled to the second input terminal of the operation amplifier and a second terminal selectively coupled to the first reference voltage or the second reference voltage; an approximation unit having an output terminal and an input terminal coupled to the output terminal of the operation amplifier; a conversion unit having an output terminal and an input terminal coupled to the output terminal of the approximation unit; a coupling capacitor having a first terminal coupled to the first input terminal or the second input terminal of the operation amplifier and a second terminal coupled to the output terminal of the conversion unit; a first switch having a first terminal coupled to the second terminal of the reference capacitor and a second terminal coupled to the first reference voltage or the second reference voltage; a second switch having a first terminal coupled to the second terminal of the sensor capacitor and a second terminal coupled to the first reference voltage or the second reference voltage; a third switch having a first terminal coupled to the second input terminal of the operation amplifier and a second terminal selectively coupled to the second reference voltage; a fourth switch having a first terminal coupled to the first input terminal of the operation amplifier and a second terminal selectively coupled to the second reference voltage; a first parasitic capacitor having a first terminal coupled to the first input terminal of the operation amplifier and a second terminal coupled to the second reference voltage; a second parasitic capacitor having a first terminal coupled to the second input terminal of the operation amplifier and a second terminal coupled to the second reference voltage; and a match coupling capacitor having a first terminal coupled to the first input terminal or the second input terminal of the operation amplifier and a second terminal coupled to the second reference voltage. | 27,312 |
8,826,544 | 1. A tool for removal of sealant from grooves adjacent aircraft inspection panels comprises a handle and a plurality of removable polymeric cutting tool elements wherein said handle further comprises a hand grip and an elongated shank protruding from one end of said hand grip, said elongated shank provided with a means for connecting on a free end thereof, said cutting tool element provided with a cooperating means for connecting disposed into a proximal end of said cutting tool element, said removable polymeric cutting tool elements provided with at least one sharply defined cutting edge and a plurality of sharply defined cutting points, one said sharply defined cutting edge of said cutting tool element disposed at a bottom edge of a sloped chisel surface on a distal end of said tool element, said bottom edge terminating in two said sharply defined cutting points, said proximal end of said cutting tool element provided with one said sharply defined cutting point disposed at at least one corner of a back wall thereof, said plurality of polymeric cutting tool elements thus providing varied tool point designs to permit greater and more efficient removal of said sealant from grooves between aircraft panels and adjacent aircraft skin without marring said aircraft skin. | 18,449 |
9,840,808 | 1. A wire strand comprising a plurality of wires, the wires comprising: a central king wire formed of steel having a carbon content in the range of 0.3 wt % to 0.6 wt %; a first layer of wires arranged around the king wire, the first layer comprising a plurality of wires formed of steel having a carbon content in the range of 0.05 wt % to 0.2 wt %; and a second layer of wires arranged around the first layer, the second layer comprising a plurality of wires formed of steel having a carbon content in the range of 0.05 wt % to 0.2 wt %. | 3,060 |
9,582,590 | 1. A method comprising: presenting a navigation path representing one or more sequences of resource identifiers that are related based on selection information provided by a user in navigating, via a browser application, the resource identifiers of the one or more sequences of the navigation path, wherein the navigation path is presented to permit direct selection of one of the resource identifiers of the one or more sequences for acquiring content associated with the selected resource identifier, and wherein the navigation path is presented as route indicators directly linking nodes corresponding to specific resource identifiers that were selected by the user, and wherein at least one route indicator linking nodes that were selected by the user is displayed different in appearance to indicate that a subsequently linked node corresponds to a resource identifier that is unrelated to the resource identifier of the node from which it is immediately linked. | 42,836 |
8,532,670 | 1. A method for managing a location sensing operation for at least one location-based application executed on a portable device, comprising: activating a first sensor disposed in the portable device so as to provide the location sensing operation requested by the at least one location-based application; periodically determining whether the portable device is moving by a second sensor disposed in the portable device; suppressing the location sensing operation of the first sensor in response to determining that the portable device is not moving by the second sensor; and determining a confidence value associated with a current mobility profile of the portable device, wherein the confidence value is based at least in part on whether a current location or route is a location or route that is frequently traversed by the portable device; wherein the length of an interval for which the location sensing operation is suppressed is based on the determined confidence value. | 15,976 |
8,583,032 | 1. A communication relay apparatus configured to relay a signal from a first communication apparatus to a second communication apparatus, the communication relay apparatus comprising: a first acquiring section configured to acquire a first channel condition between the first communication apparatus and the communication relay apparatus; a receiver configured to receive a threshold value changed in accordance with a second channel condition between the communication relay apparatus and the second communication apparatus; and a deciding section configured to decide to perform a relay when the first channel condition is greater than or equal to the threshold value and to decide not to perform the relay when the first channel condition is less than the threshold value, wherein the threshold value used to compare with the first channel condition for deciding whether or not the relay is to be performed by the deciding section is changed to a lower value when the second channel condition is better than a previous second channel condition, and the threshold value used to compare with the first channel condition for deciding whether or not the relay is to be performed by the deciding section is changed to a higher value when the second channel condition is worse than the previous second channel condition. | 19,670 |
8,580,206 | 1. Apparatus for the removal of one or more contaminants selected from the group consisting of SO 2 and NO x from gaseous carbon dioxide, said apparatus comprising: an oxyfuel boiler for producing steam for power generation, and gaseous carbon dioxide; a compressor capable of elevating the pressure of gaseous carbon dioxide from said oxyfuel boiler to at least 3 bar; at least one counter current gas/liquid contact device for washing said gaseous carbon dioxide with water at elevated pressure in the presence of molecular oxygen and, when SO conduit means for feeding gaseous carbon dioxide at elevated pressure from said compressor to the or each respective gas/liquid contact device; and conduit means for recycling aqueous sulfuric acid solution and/or aqueous nitric acid solution to the or each respective gas/liquid contact device, wherein said at least one counter current gas/liquid contact device comprises at least one packed section. | 22,872 |
9,389,542 | 1. A unit assembly that is configured insertably/removably with respect to an apparatus main body of an image forming apparatus to perform electrophotographic image forming processing, comprising: an image forming unit including: an intermediate transfer unit that bears the developer images formed using the plurality of first processing units and transfers the developer images to a transfer position to a sheet, the intermediate transfer unit being held by the image forming unit, wherein the intermediate transfer unit and the joint member have a first positioning section for mutually relative positioning; and the second processing units are developing, units. | 32,476 |
8,420,586 | 1. A cleaner composition formulated to be capable of removing one or more soils from a surface wherein the one or more soils originate from a fat and/or oil, the cleaner composition comprising: A) one or more alkalinity sources present in an amount sufficient to provide a free alkalinity (expressed as Na B) from about 0.1 wt % to about 5.0 wt % of one or more chelants selected from the group consisting of glutamic acid salt and disodium ethanol diglycine based on the total weight of the cleaner composition; C) from about 0.1 wt % to about 3.0 wt % of one or more surfactants selected from the group consisting of an alcohol ethoxylate, an alkyl amphoacetate, and an alkyl sulfate, based on the total weight of the cleaner composition; D) from about 0.1 wt % to about 2.0 wt % of thickening agent consisting of a polyacrylic acid in order to provide a viscosity of greater than about 300 cps; E) from about 0.01 wt % to about 5.0 wt % of buffer, based on the total weight of the cleaner composition; and F) from about 0 wt % to about 1.5 wt % of hydrotrope, based on the total weight of the cleaner composition; the remainder to 100 wt % of water, based on the total weight of the cleaner composition. | 4,825 |
9,713,805 | 1. A catalyst for exhaust gas purification comprising a carrier and a platinum group element supported on the carrier, the carrier comprising a modified aluminum borate which contains aluminum borate and at least one oxide of an element selected from the group consisting of Zr, Si, Fe, and Ti, and the modified aluminum borate containing the oxide in a concentration of 0.06% to 18% by mass relative to the mass of the modified aluminum borate. | 12,408 |
8,468,816 | 1. A hybrid working machine comprising: an engine; a hydraulic pump connected to the engine, the hydraulic pump driving a hydraulic actuator; a power machine connected to the engine, the power machine performing a generator function and a motor function; an electric storage device charged by the generator function of the power machine, the electric storage device discharging power that drives and makes the power machine perform the motor function so as to assist driving of the hydraulic pump; pump flow rate instruction means that outputs an instruction of a pump flow rate determined in accordance with an operation amount of operation means for operating the hydraulic actuator or in accordance with a load pressure of the hydraulic pump; a regulator that controls a flow rate of the hydraulic pump on the basis of the instruction of the determined pump flow rate output from the pump flow rate instruction means; and a power unit for the hybrid working machine in which a set value of the maximum input of the hydraulic pump is set to be larger than a maximum engine output, the power unit including wherein the correction means is configured to change, in an abnormal state, the set value of the maximum input of the hydraulic pump to a value equal to or lower than the maximum engine output by decreasing a minimum pump flow rate to a value equal to or lower than a value in an ordinary state, the abnormal state being a state in which the level of charge that is detected is equal to or lower than a set level, the normal state being a state in which the level of charge that is detected is higher than the set level, and whrein the pump flow rate instruction means (A) determines and outputs the instruction of the pump flow rate by selecting a lower of the pump flow rate determined in accordance with the operation amount and the pump flow rate determined in accordance with the load pressure, (B) determines and outputs a standby flow rate as a minimum flow rate in controlling the pump flow rate in accordance with the operation amount, the standby flow rate being lower than a minimum flow rate in controlling the pump flow rate in accordance with the load pressure, and (C) sets the minimum pump flow rate at a value lower than the standby flow rate in the abnormal state. | 20,385 |
8,593,788 | 1. A supercapacitor assembly comprising a first non-porous electrode comprising first electrode active particles bound together by a first block copolymer electrolyte that contains a first salt, the first electrode having a first interior surface and a first exterior surface, a second non-porous electrode comprising second electrode active particles bound together by a second block copolymer electrolyte that contains a second salt, the second electrode having a second interior surface and a second exterior surface, and a electrolyte layer between the first electrode and the second electrode, adjacent the first interior surface and the second interior surface; wherein the electrolyte layer comprises a third block copolymer electrolyte that contains a third salt, different from the first salt. | 42,939 |
9,063,754 | 1. A system having a processor comprising: circuitry for implementing an instruction set of the processor; and circuitry for implementing a register file; wherein the register file provides operand inputs for instructions of the instruction set; wherein the instruction set comprises a profiling instruction that receives a first input and a second input from the register file and a third input either from the register file or from a special register whose value was set by a previous instruction; wherein the profiling instruction further causes the processor to: | 23,994 |
9,643,849 | 1. A carbon nanotube film supporting structure comprising: a first sub-supporting structure comprising: a second sub-supporting structure spaced with the first sub-supporting structure, the second sub-supporting structure comprising: a carbon nanotube film structure located on the first and second support regions between the first and second sub-supporting structures; wherein the carbon nanotube film structure directly faces the first surface of the first substrate and the second surface of the second substrate; and a hollow space is defined by the carbon nanotube film structure, the first substrate and adjacent first protruding structures, and a height of the hollow space is substantially a same as a height of the first protruding structures; wherein a ratio of a sum of a plurality of first surface areas, defined by a top of the plurality of first protruding structures away from the first substrate, to an area of the first support region, is less than or equal to 20%. | 8,838 |
9,820,367 | 1. A method for protecting a structure surface against damage from incident directed energy, the structure surface comprising a coating and at least one enclosure, the coating comprising a sensing layer, and the enclosure further comprising a contained amount of an incident energy-dissipating material in the enclosure, the enclosure in communication with the sensing layer, the method comprising the steps of: locating the coating at predetermined locations on the structure surface; locating the enclosure at predetermined locations on the structure surface; sensing incident directed energy at the sensing layer; activating a predetermined amount of the contained amount of the incident energy-dissipating material at a predetermined locations on the structure surface; and releasing incident energy-dissipating material from the coating, said incident energy-dissipating material released from the coating to at least a predetermined distance from the structure surface; wherein the incident directed energy does not contact the incident energy-dissipating material before release of the incident energy-dissipating material from the enclosure. | 42,428 |
9,187,523 | 1. A method of detecting omptin bacterial protease activity, comprising: contacting a sample with an omptin bacterial protease substrate having an amino acid sequence of SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11, 12, or 13, the substrate comprising (i) 3 to 6 amino acid residues, and (ii) an amino terminal quencher and a carboxy terminal fluorophore, or a carboxy terminal quencher and an amino terminal fluorophore; and measuring cleavage of the substrate by the protease to determine the presence or absence of the bacterial protease activity in the sample. | 23,886 |
8,361,043 | 1. A device to treat a region of a patient having a skin fold, comprising: a base layer comprising a first surface, a second surface, an interior region and an outer perimeter, and a non-planar sealing region located about the outer perimeter of the base layer; tubing directly attached to the second surface of the base layer; and an adhesive located on the base layer and on at least a portion of the sealing region. | 24,401 |
9,563,778 | 1. A method for managing public and private data input on a device comprising interconnected electronic components comprising: a data-peripheral configured to accept data input by a user; an open environment comprising the device's operating system; a secure environment configured to not be accessible by a user of the device in order to download applications thereto or run applications therefrom and to not be accessible by the open environment of the device; and a controller connected to the data-input peripheral, to the open environment, and to the secure environment; wherein the method comprises: receiving, by the controller, data accepted at the data-input peripheral, the accepted data being data input by a user of the device; determining, by the controller, based on instructions provided by the secure environment whether the received data comprises private data; and when the received data comprises private data, then providing by the controller to the secure environment a secured access to the private data, the controller causing the secure environment to access the received private data by: detecting a length of the private data; generating operative data having a same length as the length of the private data; and sending the operative data to the secure environment via the open environment; wherein the operative data comprises data associated with the private data that indicates that the received data comprises private data and the private data; and wherein the operative data is data that is shared only between the interconnected electronic components of the device. | 45,247 |
9,112,216 | 1. An apparatus for managing a battery pack having a plurality of battery modules and a bus bar coupled between the battery modules to electrically connect the battery modules, the apparatus comprising: a coupling detection unit configured to detect the coupling state of the bus bar to the battery modules, wherein the coupling detection unit includes a voltage sensor for measuring the voltage at both ends of the bus bar; and a controlling unit configured to: | 24,592 |
9,655,657 | 1. A polyaxial bone anchor assembly, comprising: a shank having a spherical head formed on a proximal end thereof; a receiver member adapted to receive a spinal rod and having a distal opening though which the shank extends and a distal seat in which the head of the shank is polyaxially seated; and a compression cap having an axial slot formed therein configured to allow the compression cap to be contracted, and wherein the receiver member includes first and second deformable portions that, upon deformation, are effective to cause the compression cap to contract and thereby frictionally engage the spherical head of the shank. | 23,677 |
9,492,557 | 1. A compound which is an amino-terminal polysaccharide derivative of granulocyte colony-stimulating factor (GCSF), wherein the polysaccharide is attached to the amino terminus of the GCSF, wherein the polysaccharide is anionic and comprises between 2 and 200 saccharide units and has a weight average molecular weight in the range of 2 to 200 kDA. | 27,644 |
8,709,972 | 1. A method of forming an activated carbon: providing a carbon material which is either a carbon or a carbon precursor, wherein the carbon material is a fiber having a diameter that has a value in the range from about 7 microns to 20 microns; coating the carbon material with nanoparticles; if the carbon material is a carbon precursor, then the following processes are performed subsequent to the coating the carbon material with nanoparticles: if the carbon material is not a carbon precursor, then the following processes are performed subsequent to the coating the carbon material with nanoparticles: | 13,332 |
9,269,503 | 1. A titanium oxide composite, comprising: a granular titanium oxide including titanium oxide granules; and a graphene formed on a surface of the individual titanium oxide granules, the graphene surrounding the individual titanium oxide granules, wherein the granular titanium oxide includes a granular Li wherein the titanium oxide granules have an average particle size of about 4 μm to about 60 μm and a specific surface area of about 4 m wherein the graphene has a specific surface area of about 500 m | 28,208 |
9,013,051 | 1. A construction machine comprising: a lower traveler; an upper slewing body mounted on the lower traveler so as to be capable of being slewed; an engine having an output shaft; an engine assist motor connected to the output shaft of the engine to be capable of assisting the engine with a consumption of an electric power; a slewing electric motor for slewing the upper slewing body and regenerating a regeneration power when the upper slewing body is braked; a regeneration power detector for detecting the regeneration power; an electrical storage device electrically connected to the engine assist motor and the slewing electric motor to be capable of being charged with the regeneration power and discharging electricity; a charging rate detector for detecting a charging rate of the electrical storage device; a maximum-allowable-charge-amount calculator for calculating a maximum allowable charge amount which is a maximum amount of the electric power within which the electrical storage device is allowed to be charged, on the basis of the charging rate detected by the charging rate detector; and an assist controller which causes the engine assist motor to assist the engine to consume an electric power equal to or more than an electric power equal to a difference between the regeneration power and the maximum allowable charge amount, in a case where the regeneration power detected by the regeneration power detector is equal to or more than the maximum allowable charge amount calculated by the maximum-allowable-charge-amount calculator. | 22,191 |
9,587,870 | 1. An ice making module for a kitchen appliance, the ice making module comprising: a conductive ice tray including at least one ice piece forming cavity wherein the conductive ice tray has an outward surface and an inward surface; an electrical circuit in electrical communication with the conductive ice tray, wherein the electrical circuit includes a power source in selective electrical communication with the conductive ice tray; a switch in electrical communication with the power source and the conductive ice tray, wherein the switch is configured to selectively release an electrical charge through the conductive ice tray in the form of an electromagnetic pulse; a water dispensing mechanism configured to selectively dispose water into the at least one ice piece forming cavity of the conductive ice tray, and wherein the conductive ice tray is in communication with the water selectively disposed within the conductive ice tray; and a cooling apparatus configured to selectively decrease the temperature of the water in the at least one ice piece forming cavity so that the water is substantially solidified to form at least one ice piece, wherein the at least one ice piece is configured to be in selective electromagnetic communication with the conductive ice tray, and wherein the electromagnetic pulse selectively released through the conductive ice tray generates an induced electrical current through the at least one ice piece and a repelling electromagnetic force between the conductive ice tray and the at least one ice piece, wherein the repelling electromagnetic force biases the at least one ice piece away from the at least one bottom surface of the conductive ice tray, thereby ejecting at least one ice piece from the at least one ice piece forming cavity. | 22,922 |
8,743,450 | 1. A method for making an electrowetting display device comprising a plurality of picture elements; a first support plate and a second support plate, each picture element comprising a space between the first support plate and the second support plate, the method comprising the steps of: providing the first support plate with an electrode structure; arranging an insulating layer on the electrode structure, the insulating layer having a thickness and a hydrophobic surface facing the space; temporarily applying an electric field across the thickness of the insulating layer to reduce permanently the hydrophobicity of a predetermined area of the surface. | 30,694 |
8,760,222 | 1. An adjustable filter system comprising: a first integrated circuit comprising a first filter that is characterized by a first passband used to pass at least one desired frequency component of an input signal that is within the first passband, a first stopband used to attenuate at least one undesired frequency component of the input signal that is within the first stopband, and at least one corner frequency between the first passband and the first stopband, wherein first integrated circuit is an envelope tracking power supply circuit, and wherein the input signal is an envelope tracking signal generated from a baseband signal; a second integrated circuit comprising a filter control circuit configured to generate a first filter adjustment value to move the at least one corner frequency of the first filter, wherein the second integrated circuit is a transceiver integrated circuit, wherein the second integrated circuit further comprises: an interface coupled between the first and second integrated circuits and configured to communicate the first filter adjustment value from the filter control circuit to the first filter. | 4,755 |
8,755,208 | 1. A system, comprising: an input circuit configured to i) receive a current provided from a power supply, and ii) provide, based on the current from the power supply, an output voltage to a load; and a power factor corrector configured to | 34,682 |
9,193,017 | 1. A method for producing a sliding bearing in which lead-free aluminium-iron-silicon alloy comprising up to 10% iron, up to 3% silicon, up to 20% of tin and up to 0.2% of strontium or sodium, the iron/silicon ratio being between 2:1 and 4:1, is processed by the following steps in the specified order: (A) melting the aluminium-iron-silicon alloy, (B) casting the material produced in step (A), (C) heating the material produced in step (B) at a temperature of 450 to 550° C. for 10 to 20 hours, (D) rolling the material produced in step (C), (E) rolling the first material rolled in step (D) onto a steel support which later forms at least a part of a steel back, and (F) heating the material produced in step (E). | 12,847 |
9,775,335 | 1. A method of applying mosquito pesticide coated objects into water holding areas, comprising the steps of: providing a polymer coating with an imbedded pesticide, the pesticide comprising at least a larvicide which directly kills mosquito larvae over time; applying the polymer coating with the imbedded pesticide to a surface on a side of a strip; exposing an adhesive surface on another side of the strip; and applying the adhesive surface of the strip against a surface that is exposed to water; and leaching out the larvicide into the water to treat and directly kill the mosquito larvae over time. | 30,337 |
8,673,222 | 1. A hydrogen generator comprising: a reformer including a reforming catalyst containing nickel and configured to generate a hydrogen-rich fuel gas by using a raw material and steam; a temperature detector configured to detect a temperature of the reforming catalyst; a purge gas supplying device configured to supply a purge gas to the reformer; and a controller, wherein the controller controls the purge gas supplying device such that the reformer is purged with the purge gas when the temperature detected by the temperature detector is a first predetermined temperature or higher, wherein the first predetermined temperature is a temperature at which a decomposition rate of a compound comprising the nickel and carbon monoxide contained in the fuel gas is higher than a generation rate of the compound. | 34,468 |
8,824,724 | 1. An audio transducer, comprising: a single rectangular diaphragm film with a centrally-disposed fold-line with a first, second and third circular hole and a first and second rectangular hole located on the fold line, said diaphragm film folded in the middle along said fold-line to form a pair of hemi-cylindrical lobes, each lobe having a distal end and proximal end, wherein the first and second rectangular holes form first and second rectangular slots when said diaphragm film is folded; one or more energy absorbent dampers positioned inside one or both the lobes; and a voice coil secured to the diaphragm film by the first and second rectangular slots; further wherein the first, second and third circular holes form semi-circular notches when said diaphragm film is folded, the first circular hole disposed centrally between the first and second rectangular slots, the first rectangular slot disposed between the second and first circular holes, and the second rectangular slot disposed between the third and first circular holes. | 21,931 |
8,940,257 | 1. A method for collection of ruthenium or a ruthenium compound, comprising the steps of: putting an aqueous solution containing ruthenium or a ruthenium compound into contact with an inorganic adsorbent; dissolving the entirety or a part of the inorganic adsorbent under an acidic condition; and adding an alkali to deposit the dissolved inorganic adsorbent while causing the inorganic adsorbent to adsorb ruthenium or the ruthenium compound. | 1,228 |
8,949,500 | 1. In a bridge coupling between a first bus and a second bus, a method for communicating between the first and second buses comprising: A) receiving from the first bus a candidate request having an identification field, the identification field having a value; B) selecting one of a plurality of buffers based on the identification field value; C) entering the candidate request into the selected buffer; D) reading a request from a specified one of the buffers; E) transmitting the read request over the second bus; F) receiving a response to the transmitted request from the second bus; G) transmitting the received response over the first bus; and H) removing the read request from the specified one of the buffers; wherein the first bus is an AXI-compatible bus and the second bus is a PLB-compatible bus. | 46,369 |
8,938,441 | 1. A computer-implemented method comprising: receiving a web page that includes text and images; selecting a first subset of the images that are not excluded content-type images, wherein an excluded content-type image is an image that is boilerplate content or that is advertising content; determining, for each of the images in the first subset, (I) whether the image has a size ratio that is within a predetermined size ratio range, (II) whether the image has greater than a predetermined quantity of pixels, or (III) whether the image is located between a defined minimum altitude and a defined maximum altitude on the web page; selecting a second subset of the images in the first subset based on the determinations for the images in the first subset; determining (i) a quantity of images in the second subset, and (ii) a ratio of the area of the web page that is covered by the images of the second subset to the total area of the web page; generating a score for the web page based at least on (i) the quantity of the images in the second subset, and (ii) the ratio of the area of the web page that is covered by the images to the total area of the web page; classifying the web page as a gallery web page based on the score for the web page meeting a predefined threshold; and based on classifying the web page as a gallery web page, formatting a search result that references the web page, among a set of search results that each reference a different web page, using a search result format that is designated for web pages that are classified as gallery web pages. | 6,518 |
9,515,613 | 1. A Doherty amplifier comprising: a first Doherty amplifier gain element; a first transmission line coupled to a first output of the first Doherty amplifier gain element, wherein the first transmission line comprises, for a first frequency band, a first series of a first number of quarter-wave transmission line elements; a second Doherty amplifier gain element; a second transmission line coupled to a second output of the second amplifier gain element, wherein the second transmission line comprises, for the first frequency band, a second series of a second number of quarter-wave transmission line elements, wherein the first number is not equal to the second number, wherein the first series provides, for a second frequency band, a third number of quarter-wave transmission line elements and the second series provides, for the second frequency band, a fourth number of quarter-wave transmission line elements, a first difference between the first number and the third number and a second difference between the second number and the fourth number based on a difference of wavelengths between the first band and the second band; and a gate bias circuit for providing a first bias signal to the first Doherty amplifier gain element and a second bias signal to the second Doherty amplifier gain element when a signal being amplified by the Doherty amplifier is in the first frequency band and for providing the first bias signal to the second Doherty amplifier gain element and the second bias signal to the first Doherty amplifier gain element when the signal is in the second frequency band. | 25,945 |
9,752,729 | 1. A system for generating swirl, comprising: a pipe; at least two circular orifice plates located perpendicular to a longitudinal axis of the pipe and defining a swirl generation area, each orifice plate comprising an off-set orifice or hole and being configured to have a position that is adjustable within the swirl generation area, and a directional baffle connected to one orifice plate and extending into the swirl generation area, wherein each orifice plate is oriented at an angle variable to each other to generate a variable degree of swirl as fluid flow exits the swirl generation area. | 21,772 |
9,014,740 | 1. A method comprising: changing from a first network active mode to a first network idle mode for a first subscriber identity module (SIM) network connection; while in the first network idle mode, compensating for inaccuracy in an idle mode time base, where the idle mode time base is less accurate than an active mode time base, by: | 31,997 |
9,224,903 | 1. A method for manufacturing a photoelectric converter, comprising: forming a first buffer layer comprising a metal sulfide on a light-absorbing layer comprising a Group I-III-VI compound or a Group I-II-IV-V I compound; and contacting a surface of the first buffer layer with a first solution comprising an alkali metal compound and having a pH of 8 to 11 by immersing the first buffer layer in the first solution. | 12,411 |
9,632,956 | 1. A method of operation within a memory-control integrated circuit (IC) having internal data conductors and distinct first and second data interfaces coupled, respectively, to first and second memory module sockets, the first data interface having twice as many input/output (I/O) transceivers as the second data interface, the method comprising: coupling all the internal data conductors exclusively to the I/O transceivers of the first data interface if only the first of the first and second memory module sockets is populated by a memory module, and coupling a first half of the internal data conductors exclusively to the I/O transceivers of the second data interface while a second half of the internal data conductors remains exclusively coupled to half the I/O transceivers of the first data interface if both the first and second memory module sockets are populated by memory modules. | 15,375 |
9,662,523 | 1. A metallic oxysalt fire extinguishing composition, characterized in that the fire extinguishing composition contains a metallic oxysalt compound and a flame-retardant extinguishing component, wherein the proportions are respectively as follows: Metallic oxysalt compound 60%˜95%, Flame-retardant extinguishing component 5%˜35%; the metallic oxysalt compound is one or more of a metallic oxyacid copper salt, a metallic oxyacid calcium salt, a metallic oxyacid aluminium salt, a metallic oxyacid magnesium salt, a metallic oxyacid nickel salt, a metallic oxyacid ferric salt, and a metallic oxyacid lithium salt; a pyrotechnic agent in a fire extinguishing apparatus is used as a heat source and a power source of the fire extinguishing composition during the application of the fire extinguishing composition; by igniting the pyrotechnic agent, the fire extinguishing composition heated by the high temperature generated from the combustion of the pyrotechnic agent is subjected to a decomposition reaction, producing a large amount of fire extinguishable substances, which are ejected out together with the pyrotechnic agents to extinguish the fire. | 19,538 |
9,578,857 | 1. A harness for pets comprising: a unitary piece of laminar textile material, the unitary piece of laminar textile material including a first section, a central section, a second section, an inner side, and an outer side, the first section being opposite to the second section; the unitary piece of laminar textile material laterally extends forming a first front vertex on the first section and a second front vertex on the second section, the first front vertex extends angularly from the central section forming a first front ear which includes a first set of connecting devices, the second front vertex extends angularly from the central section forming a second front ear which includes a first set of connecting devices, the first front vertex and the second front vertex are adapted to be wrapped around a neck of the pet; the unitary piece of laminar textile material laterally extends forming a first back vertex on the first section and a second back vertex on the second section, the first back vertex extends angularly from the central section forming a first back ear which includes a first set of connecting devices, the second back vertex extends angularly from the central section forming a second back ear—which includes a second set of connecting devices, the back vertexes are adapted to be wrapped around a belly of the pet; an opening located on the first section of the piece of laminar textile material, the opening having an oblong shape, the opening is adapted to receive a front leg of the pet; a girdle with fasteners located on the second section of the piece of the laminar textile material, wherein the girdle is adapted to be connected to a leash; wherein in a working position, the front leg of the pet is introduced through the opening, then the front vertexes are wrapped around the neck of the pet and secured to the neck by interconnecting the first set of connecting devices and the back vertexes are wrapped around the belly of the pet and secured to the belly by interconnecting the second set of connecting devices and wherein a hole for a second leg of the pet is created when the front vertexes are brought together. | 28,506 |
9,580,344 | 1. A burner comprising: a first conduit comprising a first end, a second end, a longitudinal bore having a longitudinal axis, and an external surface; a second conduit substantially concentric with the first conduit, the second conduit comprising a first end, a second end, and an internal surface; the first and second conduits configured to form a primary annulus between the external surface of the first conduit and the internal surface of the second conduit; an adjustable structure comprising a body having an upper surface, a lower surface, a circumferential surface abutting a portion of the internal surface of the second conduit, and a generally cylindrical central hub concentric with the longitudinal axis and extending axially away from the lower surface of the body, the structure adjustable axially in relation to and removably attached to the first end of the first conduit via the generally cylindrical central hub, the generally cylindrical central hub defining a substantially central passage having an exit at the upper surface, the substantially central passage comprising an angled section and a vertical connector section connecting the angled section with a threaded section of the generally cylindrical central hub, the angled section forming an angle γ to the longitudinal axis ranging from about 10 degrees to about 45 degrees, the body comprising one or more non-central through passages extending from the lower to the upper surface, the one or more non-central passages configured such that flow of a first fluid through the one or more non-central passages causes the first fluid to intersect a flow of a second fluid in a mixing region above the upper surface of the body. | 22,639 |
8,806,829 | 1. An anchoring device comprising: an anchor that anchors adjacent planks to each other and to a support, comprising: said bottom element to maintain a separation between the planks and the support, and said top element, said bottom element, and said groove height tolerance compensator strap made of a resilient material, said top element sized for insertion into a joining slot of a laid plank, and said top element and said bottom element having one or more fastening apertures therethrough, and said top element having a core component of one or more units of non-resilient, hard but not brittle material. | 37,335 |
9,658,613 | 1. A computer-readable medium not constituting transitory propagating signals per se, having contents configured to cause a computing system to perform a method in a computing system for generating a tool path to cause a target waterjet cutting tool to perform a cutting project on a workpiece of a distinguished material using at least one designated operating parameter, the method comprising: accessing a cutting model for the distinguished material that, for each of one or more aspects of a waterjet's effect on a workpiece of the distinguished material using the designated operating parameters, specifies a relation adapted to predict the value of the aspect based on the value of one or more independent variables, the relations having been established using a plurality of cutting test observations selected from a multiplicity of cutting test observations, each of the multiplicity of cutting test observations identifying a material and one or more operating parameters for which a corresponding cutting test was performed, the plurality of cutting test observations selected on the basis that their identified material and operating parameters are the same as or similar to the distinguished material and designated operating parameters; and using the accessed cutting model to generate a tool path for the cutting project. | 41,174 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.