id int64 8.34M 9.85M | text stringlengths 30 13.9k | __index_level_0__ int64 0 50k |
|---|---|---|
9,391,221 | 1. A solar cell module comprising: a solar cell panel comprising at least one solar cell, wherein the solar cell panel includes a front surface where light is incident, a back surface opposite to the front surface, and a side surface connecting the front surface and the back surface; and a frame at a periphery of the solar cell panel, wherein the frame comprises an align mark for alignment, wherein the align mark is on a side surface of the frame that is at the side surface of the solar cell panel, wherein the side surface of the frame comprising the align mark faces another solar cell module or faces a fixer for fixing the solar cell module to another solar cell module; and wherein the align mark comprises a first align mark to indicate a position of the fixer and a second align mark having a scale. | 10,192 |
9,632,363 | 1. A method for rubbing an alignment layer, comprising: performing at least three rubbings on the alignment layer of a liquid crystal display; wherein the performing at least three rubbings on the alignment layer of the liquid crystal display includes: wherein N is an integer greater than 1; the second rubbing direction is an arrangement direction of liquid crystal molecules when the liquid crystal molecules are arranged correctly on the alignment layer; and the second rubbing direction is different from the first rubbing direction. | 47,558 |
8,642,741 | 1. An isolated human antibody or antigen-binding fragment thereof that specifically binds human TNF-like ligand 1 A (hTL1A), comprising a heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 sequence combination of SEQ ID NO:20/22/24; and/or a light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 sequence combination of SEQ ID NO:28/30/32. | 4,775 |
8,867,921 | 1. A system for optical communications, comprising: a first optical communication module to output a first optical signal; an optical link optically coupled to the first optical communication module to receive and transmit the first optical signal; a second optical communication module optically coupled to the fiber to reflect the first optical signal back into the link towards the first optical communication module as a second optical signal to be received by the first optical communication module; and one or more optical amplifiers coupled between the first and second communication modules to amplify the second optical signal to maintain, at least on average, a power level for the second optical signal equal to the power level of the first optical signal, wherein the one or more optical amplifiers include a first optical amplifier coupled at a first location on the optical link, wherein the first location is determined based on maximizing an optical signal to noise ratio (OSNR) computed as the ratio of the power level of the second optical signal to an optical noise power comprising both a first Rayleigh backscattering noise generated at the first optical communication module and a second Rayleigh backscattering noise generated at the first optical amplifier. | 24,451 |
9,363,864 | 1. A method of large area lighting for a lighting application comprising: a. providing illumination from an electrically-powered lighting system at a first level; b. upon a power interruption to the lighting system providing: c. if the power interruption ceases providing: d. if the power interruption continues providing; | 14,124 |
9,041,435 | 1. A method of forming an electronic component, comprising: providing a first switch and a second switch of a half bridge, the half bridge adapted for operation with an electrical load having an operating frequency, the first switch and the second switch each having a switching frequency, the first switch and the second switch each including a first terminal, a second terminal, and a control terminal; connecting the first terminal of the first switch and the second terminal of the second switch to a node; providing a filter having a 3 dB roll-off frequency which is less than the switching frequency of the switches but greater than the operating frequency of the electrical load; and electrically coupling a first terminal of the filter to the node; wherein the first switch or the second switch comprises a high-voltage depletion-mode transistor and a low-voltage enhancement-mode transistor, the high-voltage depletion-mode transistor comprising a source electrode, and the low-voltage enhancement-mode transistor being mounted directly on top of the source electrode of the high-voltage depletion-mode transistor. | 21,601 |
9,304,915 | 1. A method of operating a virtualization system, the method comprising: supplying underlying hardware with indications of those locations in physical memory for which the virtualization system is to receive buffered write information, the indicated locations corresponding to those that encode page mapping information of a guest operating system executing in a virtual machine of the virtualization system; and asynchronous with write-type accesses performed for the guest operating system which target the indicated locations, but responsive to a coherency-inducing operation of the guest operating system, updating a virtualization system page table based on the buffered write information, the virtualization system page table mapping addresses to machine addresses in physical memory. | 5,951 |
9,591,564 | 1. A method of energy efficient scheduling through transmit point (TP) wideband muting, the method comprising: determining an initial scheduling assignment for a cloud radio access network (CRAN) comprising a plurality of access points (APs), the initial scheduling assignment assigning a plurality of user equipments (UEs) to the APs during a time interval; selecting, from the plurality of APs, at least a first AP to operate in a sleep mode during the time interval, wherein the first AP is wideband muted when operating in the sleep mode, and wherein the initial scheduling assignment assigns UEs in a first subset of UEs to the first AP during the time interval; re-assigning the UEs in the first subset of UEs to one or more APs in the plurality of APs for at least a portion of the time interval, thereby obtaining a modified scheduling assignment, wherein the one or more APs exclude the first AP; and instructing the one or more APs to operate in accordance with the modified assignment during the portion of the time interval, wherein the first AP operates in a sleep mode during the portion of the time interval. | 1,712 |
9,344,000 | 1. A power module comprising: a power factor correction stage switching input power to correct a power factor thereof; a DC/DC conversion stage switching power having a corrected power factor from the power factor correction stage to convert the power into pre-set DC power in a powering mode in which normal power is output; a standby stage converting the power having a corrected power factor from the power factor correction stage into pre-set standby power in a cold standby mode in which the DC/DC conversion stage outputs power having a level lower than that of normal power; and a variable bias supply unit, provided with the converted pre-set standby power in a cold standby mode, varying a voltage level of bias power for controlling DC/DC power conversion and supplying the same to the DC/DC conversion stage in the cold standby mode and the powering mode, wherein the DC/DC conversion stage comprises: | 14,295 |
8,371,086 | 1. A modular wall block adapted for being assembled together with a number of other blocks in stacked courses to form a retaining wall, said wall block comprising: a front and rear, top and bottom, and opposing sides, said top and bottom defining respective substantially planar stacking surfaces; a shear lug projecting from one of said planar stacking surfaces of said top and bottom; a block-locating jut formed with at least one of said opposing sides, and comprising a plurality of converging planar surfaces projecting from said side beginning at a point intermediate said top and bottom, and extending at an outward angle towards one of said planar stacking surfaces, and said converging planar surfaces intersecting at an apex spaced apart from said side beginning at said point intermediate said top and bottom, and said apex is substantially co-planar to one of said stacking surfaces; and said block-locating jut further defining a lug-engaging shoulder adapted for engaging a shear lug of a wall block located in an adjacent stacked course. | 39,539 |
8,457,448 | 1. A method of removing inserted text from a digital image comprising, with a computer system: recognizing said inserted text in said digital image using optical character recognition; replacing pixels of said digital image corresponding to said inserted text so as to remove said inserted text from said digital image; and, after said replacing pixels corresponding to said inserted text, blending replacement pixels with adjacent pixels; wherein recognizing said inserted text further comprises presenting presumed inserted text to a user for validation, and in which replacing pixels of said digital image corresponding to said inserted text so as to remove said inserted text from said digital image comprises determining a brightness value for the replacement pixels by separately averaging brightness values of pixels in each layer of pixels of a pixel square, each layer of pixels in said pixel square being defined by distance from said replacement pixel. | 30,123 |
9,724,638 | 1. A method for evaporating waste water and reducing acid gas emissions in a combustion flue gas, comprising: supplying waste water to a heat exchanger for heating of the waste water to produce heated waste water; evaporating the heated waste water in a flash vessel and collecting remaining waste water in the flash vessel; supplying the remaining waste water to an evaporator device arranged with a flow of the flue gas through the evaporator device for evaporation of the remaining waste water in the evaporator device; and supplying the flue gas to a wet flue gas desulfurization system for absorption of acid gas from the flue gas to produce treated flue gas for release to the environment. | 18,711 |
9,481,360 | 1. A vehicle comprising: an electric machine; a torque converter including a damper; and a controller programmed to operate the electric machine to apply a regenerative torque based on a parameter indicative of a deflection of the damper and a parameter indicative of a difference between a rotor speed of the electric machine and an output speed of the torque converter. | 36,334 |
9,605,029 | 1. A polypeptide exhibiting binding activity to an Fc region of immunoglobulin G, wherein the polypeptide comprises the amino acid sequence represented by the following formula 1: where x represents any amino acid residue; and amino acid residues within the square brackets indicate that any one of the amino acid residues is selected. | 1,197 |
9,566,493 | 1. A golf simulation apparatus, comprising: a housing which is comprised of front, rear, upper and left and right side with an internal space including a monitor installation section that is provided in the direction of the rear side from the said front side; a golf simulation computer which is provided in the said internal space; a monitor to be seated in the said monitor installation section; a monitor protection plate to be installed separating from the said front housing to protect the said monitor from the hit golf ball; and additional supporting means to support the said monitor protection plate so that the said monitor protection plate can be erected at a required angle. | 16,094 |
9,784,477 | 1. An apparatus for reflecting incident light, the apparatus comprising: a plurality of reflector assemblies arranged next to one another rows extending in two mutually perpendicular directions, each assembly having a movable coupling element pivotally connected to all of the lower ends and common to all of the reflector assemblies with center points of all the lower spherical joints in a common plane at the lower ends of the rods; a stationary base common to all of the reflector assemblies, below the upper ends, and above the lower ends; a respective middle spherical joint between the upper end and the lower end of each rod, each middle joint pivotally supporting the respective rod to the stationary base and carrying the reflector assembly movably about a respective dedicated stationary joint center point thereof with the joint center points of all the middle spherical joints in a common plane such that, on movement of the coupling element beneath the base, the reflector surfaces of all of the reflector assemblies move simultaneously in the same direction and to the same extent; a first motor connected to one of the middle joints of one of the rows extending in one of the directions and through the coupling element to all the lower joints for tipping all of the reflector surfaces about an axis parallel to the one direction; and a second motor connected to another of the middle joints of another of the rows extending in the other of the directions and and through the coupling element to all the lower joints for tipping all of the reflector surfaces about an axis parallel to the other direction. | 36,947 |
8,479,030 | 1. A method for managing power consumption of a component that uses a processed clock signal produced by a clock processing circuit, comprising: changing a frequency of a clock signal supplied as input to the clock processing circuit in order to manage power consumption of the component; and generating digital period values each of which describes a period of the clock signal at a cycle of the clock signal, wherein the clock signal is produced by a digital waveform synthesizer that is capable of changing a frequency of the clock signal every clock cycle in response to a digital period value received as an input thereto; wherein changing comprises changing the digital period values supplied as input to the digital waveform synthesizer in order to reduce a time interval required for a transition of the processed clock signal from a first frequency to a second frequency. | 5,568 |
8,938,219 | 1. A method, comprising: receiving a request to be sent to a wireless device in a network of wireless devices, the request to be received via a remote terminal unit application executed on a processor within a flow computer; communicating the request to the wireless device via a communications interface module, the communications interface module to be communicatively coupled to the processor via a backplane contained within a housing of the flow computer, the backplane to provide communications according to a high speed data bus communications protocol; preparing, via the communications interface module, request information corresponding to the request according to a wireless communication protocol implemented by the network of wireless devices, the request information to contain address data and command data; providing the address and command data to a server application within the communications interface module, the server application to interpret the address data and the command data and communicate the request information to a network manager within the communications interface module; and transmitting the request information to the wireless device, wherein the network manager controls a timing of the transmitting. | 3,670 |
8,818,634 | 1. A control apparatus for a vehicle, comprising: a directional indicator configured to detect a driving direction indicated by a driver; and a controller configured to generate an assist torque in a generation direction to perform a lane keeping control such that the vehicle follows a target driving route; wherein the controller stops the lane keeping control in response to detecting that the generation direction is different than the indicated direction, and continues the lane keeping control in response to detecting that the generation direction is the same as the indicated direction. | 13,812 |
9,620,990 | 1. An electricity supply management device comprising: a solar cell; a storage battery; and a power control device, wherein the power control device includes: an operation unit; and a power consumption amount storage unit configured to store a total power consumption amount by a plurality of load devices, wherein, in response to a request from the power control device, the storage battery is charged by an electric power from the solar cell, and a power from at least one of the solar cell, the storage battery, and a commercial Alternating Current (AC) power source is supplied to of the load devices, wherein the operation unit of the power control device is configured to controls a power consumption level by the load devices based on a comparison result between a power generation amount by the solar cell, the total power consumption amount by the load devices, and a charge level of the storage battery indicative of a ratio of charged amount of the storage battery to capacity of the storage battery, and wherein controlling the power consumption level by the load devices includes limiting the total power consumption amount by the load devices by a predetermined fraction thereof so as to not exceed a preset power level. | 34,804 |
8,927,383 | 1. A supported polymer heterostructure, wherein the heterostructure comprises a cross-linked polymer immobilized on a substrate and a further material deposited on said polymer to form said polymer heterostructure, wherein the supported polymer heterostructure is a phase separated nanostructure with a length scale between 10 nm and 1000 nm. | 14,885 |
9,534,081 | 1. A crosslinkable composition comprising a base crosslinking catalyst and reactive components A, A2 and B, wherein A and B each comprising at least 2 reactive groups wherein the at least 2 reactive groups of component A are acidic protons (C—H) in activated methylene or methine groups and the at least 2 reactive groups of component B are activated unsaturated groups (C═C) to achieve crosslinking by Real Michael Addition (RMA) reaction, wherein the component A2 comprises reactive acidic protons, and wherein A2 has a higher acidity than component A and is reactive towards component B with an RMA reaction. | 16,626 |
9,778,206 | 1. A defect inspection method, comprising: imaging a same region of a sample in a plurality of image acquisition conditions using an image acquiring section comprising a plurality of image acquiring portions each of which is configured for a different image acquisition condition with respect to each other to acquire a plurality of images for said same region of the sample; storing said plurality of images in a plurality of image storing buffers corresponding to said plurality of image acquiring portions; extracting a defect candidate from each of the plurality of images using a defect candidate extracting section comprising a plurality of defect extracting portions each coupled to a corresponding one of the plurality of image storing buffers; clipping a partial image including the extracted defect candidate and a neighboring image of the defect candidate from the plurality of acquired images stored in a corresponding plurality of said image storing buffers using a controller configured to clip said partial image based on coordinate position information of the extracted defect candidate; obtaining feature quantities of the defect candidates in the plurality of clipped partial images using at least one defect determining section, said feature quantities comprising one or more of a difference between an inspection image and a reference image, a brightness variation between dies having same coordinates, a differential image variation in a pattern similar to a defect candidate of the reference image, and an edge strength of the reference image; associating, using said at least one defect determining section, the defect candidates that have the same coordinates and are detected in conditions in which the image acquisition condition is different among the extracted defect candidate; extracting, using a defect extracting section, a defect from among the associated defect candidates based on multi-dimensional feature quantity space data of feature quantities of the associated defect candidates; and outputting using a display information of the extracted defect. | 41,335 |
9,088,631 | 1. A game streaming server comprising: a game executer configured to execute a plurality of games, each game being executed in response to an input received from an associated user terminal, respectively; a display unit configured to display contents of each game of the plurality of games executed by the game executer, each game in one respective area among a plurality of areas of the display unit; a capture unit configured to capture, from the display unit, a respective image of the contents of each game of the plurality of games displayed in the display unit; an encoder configured to encode the respective image of each game captured by the capture unit in accordance with a resolution of the respective user terminal associated with each game; and a transmitter configured to transmit the encoded respective image of each game to the respective user terminal associated with each game, wherein a number of areas of the display unit is varied according to a number of user terminals associated with one or more games of the plurality of games. | 4,344 |
9,371,007 | 1. A method executed by one or more servers of a cloud system, comprising, receiving by one of the servers, from time to time, discounts published by merchants for presentation to a network of charging units (CUs), each of the CUs being associated to a geo-location; receiving by one of the servers, an identification of an electric vehicle that is associated to a user account, the identification of the electric vehicle is made upon detecting that the electric vehicle has parked over a charging pad of a particular CU, the charging pad being at a geo-location of the particular CU; identifying by one of the servers, at least one discount to be presented to a device of the electric vehicle, the identifying being a result of filtering discounts based on user preferences associated with the user account and a proximity of a merchant location to the particular CU having the charging pad over which the vehicle has parked; and sending by one of the servers, the at least one discount to the device of the electric vehicle upon receiving an indication that charge is transferred from the charging pad to a battery of the electric vehicle, the method being executed by a processor of one or more of the servers. | 43,431 |
9,106,326 | 1. A method for determining imperfections of a transmit pathway and of a receive pathway of an apparatus, the transmit pathway comprising a first device for frequency transposition of an analogue sequence to an analogue signal, using a first transposition frequency, said receive pathway comprising a second device for frequency transposition of an analogue signal to an analogue sequence, using a second transposition frequency different from the first transposition frequency, said method comprising the following sequential steps: generating at least two different first analogue sequences, performing a frequency transposition at said first transposition frequency of the first analogue sequences to analogue signals, by the transmit pathway, transmitting the analogue signals of the transmit pathway to the receive pathway, performing a frequency transposition from said second transposition frequency of the analogue signals received to second analogue sequences, by the receive pathway, calculating first amplitudes and first phases, of a plurality of spectral components of at least two of the first analogue sequences at first frequencies of interest and second amplitudes and second phases, of a plurality of spectral components of at least two of the second analogue sequences at second frequencies of interest, said method comprising at least one of the following two independent steps: determining the imperfections of the transmit pathway on the basis solely of the first amplitudes, first phases, second amplitudes and second phases, and determining the imperfections of the receive pathway on the basis solely of the second amplitudes and second phases. | 42,593 |
9,237,022 | 1. A method for verifying data for use on an aircraft, comprising: receiving, by a processor unit disposed on one or more chips, a plurality of digital certificates associated with the data; selecting, from a selected number of the plurality of digital certificates, the selected number including a quorum rule selected from quorum rules that are based upon a system on the aircraft by which the data will be used and a location of the aircraft when the data is loaded into the aircraft, a quorum rule, from a number of quorum rules in the processor unit, for selecting a number of digital certificates from among the plurality of digital certificates; and verifying, as uncompromised, by the processor unit, the data for use on the aircraft using a selected number of the plurality of digital certificates, via determining which of the plurality of digital certificates are received from an acceptable certificate authority; and wherein the selected number of certificates is defined by the quorum rule, the quorum rule being further containing of one, or more, of: a quorum rule for an operator of an aircraft; a quorum rule for an aircraft maintenance entity; a quorum rule for an aircraft type; a quorum rule for an aircraft system on which data will be used; a quorum rule for the number of aircraft systems on which data will be used; and a quorum rule for use when a certificate authority is known to be, or suspected of being compromised. | 37,673 |
9,076,570 | 1. A polymer-free nano-composite electrode comprising purified carbon nanotubes and germanium nanoparticles or purified carbon nanotubes and silicon nanoparticles, wherein the nanoparticles are non-covalently incorporated into the nano-composite electrode on exterior surfaces of the carbon nanotubes, such that the silicon nano-composite electrode comprises a reversible lithium ion charge capacity exceeding 900 milliamp-hours per gram of electrode and the germanium nano-composite electrode comprises a reversible lithium ion charge capacity exceeding 400 milliamp-hours per gram of electrode. | 18,689 |
8,961,731 | 1. A manufacturing method of a three-dimensional display device in which a liquid crystal parallax barrier panel is stacked on a display region liquid crystal display panel, the display region liquid crystal display panel having a pixel formed of three sub-pixels arranged in a lateral direction of a screen at a pixel pitch P, and the liquid crystal parallax barrier panel sandwiching liquid crystals between a barrier substrate formed with a barrier electrode and a counter substrate formed with a counter electrode, the method comprising the steps of: aligning the liquid crystal display panel with the liquid crystal parallax barrier panel using an alignment mark formed on the liquid crystal display panel and an alignment mark formed on the liquid crystal parallax barrier panel as a first step; aligning the liquid crystal display panel with the liquid crystal parallax barrier panel as a second step in which a signal forming a white pattern in a width of two pixels on the liquid crystal display panel is inputted, at a location at which the white pattern has a color pattern having a color different from a color of a center white pattern or black pattern and a white pattern is formed on both sides of the color pattern different from the white pattern or black pattern in bringing an observer's eyes close to the screen, according to relationship between a width d after the alignment of the second step, finally fixing the liquid crystal display panel to the liquid crystal parallax barrier panel. | 18,558 |
9,729,983 | 1. A hearing device comprising: a processing unit configured to compensate for hearing loss of a user of the hearing device; and a memory unit; wherein the memory unit has stored therein: wherein the processing unit is configured to: | 28,150 |
8,939,143 | 1. A solar array column cap comprising: a main body extending between a left side and a right side to define a channel, the channel configured to at least partially receive a vertical column of a solar array support structure such that the main body surrounds the vertical column; a left flange extending radially outwardly from the left side of the channel; a right flange extending radially outwardly from the right side of the channel; a left upper flap extending from a top edge of the left flange; and a right upper flap extending from a top edge of the right flange, the right upper flap and left upper flap being co-planar, the left upper flap configured to receive a first end of a U-bolt and the right upper flap configured to receive a second end of the U-bolt such that the solar array column cap is configured to retain a horizontal beam in a position above the solar array column cap, wherein the left upper flap and the right upper flap are not directly connected. | 20,962 |
8,898,487 | 1. A method of coordinating tasks of a mobile computing device, the method comprising: detecting a trigger event at a first time, the trigger event indicating that the mobile computing device or a mobile computing device component is to subsequently transition from a low-power state to an active state; determining that the first time of the trigger event is within an expiration window associated with an expiration window timer, the expiration window timer being associated with one or more tasks, wherein: based at least in part on the determination that the first time of the trigger event is within the second time and the third time of the expiration window associated with the expiration window timer, with the mobile computing device, initiating performance of the one or more tasks associated with the expiration window timer. | 14,098 |
8,814,666 | 1. A gaming system, comprising: a network host that determines and transmits a pre-determined payout amount prior to a game play sequence on a gaming machine, wherein the payout amount is mapped to a plurality of end game states selected from a universe of game end states; and a plurality of gaming machines in communication with the network host, wherein each gaming machine is configured to receive the pre-determined payout amount from the network host and to present at least one apparent game of skill and a secondary game regardless of interactions made by a player during the apparent game of skill, the secondary game being independent and separate of the at least one apparent game of skill and having different goals and rules than the at least one apparent game of skill, wherein the gaming system allows a player to interact with the apparent game of skill and wherein a game outcome for the apparent game of skill and a game outcome for the secondary game each correspond to the pre-determined payout amount received from the network host regardless of the interactions made by the player during the apparent game of skill such that a first portion of the pre-determined payout amount is received by the player upon completion of the apparent game of skill and a second portion of the pre-determined payout amount is received by the player upon completion of the secondary game, the first and second portions adding up to the pre-determined payout amount, wherein each gaming machine employs an algorithm to apportion off payout amounts from awards won during the at least one apparent game of skill to reserve a portion of the pre-determined payout amount for the secondary game that must be won by the player in the secondary game. | 38,832 |
9,411,371 | 1. A support structure assembly for supporting a portable computing device comprising: a harness assembly including a strap and a plurality of connectors extending from said strap; a platform defining a first support surface configured to support the portable computing device; two first step structures extending from said platform and located at opposite ends of said first support surface, each first step structure defining (i) a first socket formed in a first outer step surface and configured to releasably retain a connector of said plurality of connectors, and (ii) a second support surface opposite from said first outer step surface, non-coplanar with said first support surface, and configured to support the portable computing device; and a support bar connected to said platform; the support structure assembly, further comprising: two second step structures extending from said platform, located at opposite ends of said first support surface, and spaced apart from said first step structures, each second step structure defining (i) a second socket formed in a second outer step surface and configured to releasably retain a connector of said plurality of connectors, and (ii) a third support surface opposite from said second outer step surface, non-coplanar with said first support surface, and configured to support the portable computing device; wherein at least one of said two first step structures is slidably movable relative to said platform, such that a first distance between said second support surfaces is selectable, and at least one of said two second step structures is slidably movable relative to said platform, such that a second distance between said third support surfaces is selectable. | 28,278 |
8,704,396 | 1. A wave power unit including a submerged station, at least one floating body ( 1 ) and flexible connection means ( 3 ) wherein the submerged station includes a linear generator ( 2 ) with a reciprocating translator ( 6 ) and being arranged to be anchored to a sea bottom, the at least one floating body ( 1 ) being arranged to float on the sea surface, the flexible connection means ( 3 ) connecting the at least one floating body ( 1 ) to the translator ( 6 ), the direction of movement of the translator ( 6 ) defining a center axis (C) and whereby the station further includes a guiding device ( 9 ) for the flexible connection means ( 3 ), which guiding device ( 9 ) includes a plurality of rollers ( 15 a - 18 c ), each roller ( 15 a - 18 c ) being rotatable around a respective axis, which rollers ( 15 a - 18 c ) are arranged to form a passage for the flexible connection means ( 3 ), which passage has an upper end and a lower end, whereby a group of at least three rollers forms a set, said set includes at least three rollers that have their axes in the same plane forming a polygon, or said set includes two pairs of rollers, the rollers in each pair having their axes in a common plane perpendicular to the center axis and one pair being located above the other, the axes of the four rollers forming a polygon that is a quadrangle in a projection perpendicular to the center axis, and whereby the guiding device includes a plurality of sets of which at least two adjacent sets of rollers have different size of the polygon. | 46,243 |
8,509,094 | 1. A loss-of-signal (LOS) detector, comprising: at least one sampler to sample data bits carried by an incoming data signal and to sample the incoming data signal at a time between two consecutive data bits; and circuitry to determine based on outputs of the at least one sampler whether an edge glitch has occurred between the two consecutive data bits and to generate a LOS signal based on the determination. | 39,841 |
8,480,569 | 1. An enhanced flexibility auxiliary endoscope assembly for use with an endoscope having an instrument channel, the assembly comprising: a coil spring; and a flexible sleeve having a first lumen for accommodating a distal portion of an endoscope having an instrument channel, each of said sleeve, said first lumen, said endoscope and said instrument channel being capable of assuming at least a first curvature, and a second lumen for accommodating said coil spring, said second lumen having a generally saddle-shaped cross-section, said second lumen being configured to allow said coil spring to assume said at least first curvature as well as at least a second curvature about said first curvature, thereby to enhance flexibility of said auxiliary endoscope assembly, and said coil spring lying radially outside said first lumen and being angularly misaligned with respect to said first lumen when said endoscope is assuming said at least a first curvature. | 17,006 |
9,611,065 | 1. A container comprising a semi-rigid sheet material having a tubular main body and a gable-form part closing said body at one end thereof, said gable-form part comprising an outermost sealing fin, first and second diverging walls extending away from said fin and whereof at least the first wall has outwardly curved inner and outer surfaces, the first wall further having a pour spout fitment attached thereto, first and second gable end walls each extending from the first to the second of said diverging walls and each having at least an upper part which is of substantially triangular outline as seen in end elevation, with an edge thereof at the curved inner surface of said first wall being curved and closely following the curved inner surface, wherein the gable end walls further comprise a lower line of weakness extending substantially across a width of the gable end walls and forming a lower part of said gable-form part. | 48,339 |
9,653,673 | 1. A system comprising: a motor; a shaft connected to the motor, the shaft having a support mechanically coupled thereto; a plurality of capacitors mechanically coupled to the support, the plurality of capacitors each comprising a dielectric material having a Curie temperature, wherein the Curie temperature is the same for each of the plurality of the capacitors, the plurality of capacitors each exhibiting an increased capacitance at a temperature below the Curie temperature and exhibiting a decreased capacitance at a temperature above the Curie temperature; a liquid source positioned adjacent to the plurality of capacitors and having a liquid at a temperature above the Curie temperature; a voltage source electrically connected to the plurality of capacitors; a voltage storage electrically connected to the plurality of capacitors; and a controller connected to the motor, the controller configured to cause the motor to move the shaft to expose the plurality of capacitors to the liquid for a predetermined time such that the temperature of the dielectric material of the plurality of capacitors exceeds the Curie temperature, the controller further configured to operate the voltage source to charge the plurality of capacitors prior to the plurality of capacitors being exposed to the liquid. | 10,906 |
8,456,770 | 1. A control method of an objective lens of a microscope apparatus, the method comprising: performing an observation of a specimen on a stage with one of an immersion objective lens and a dry objective lens; selecting to switch from the immersion objective lens to the dry objective lens; changing a relative position of the immersion objective lens in a direction perpendicular to an optical axis so as to dispose the immersion objective lens in a non-observation region of the dry objective lens while keeping liquid between the immersion objective lens and the specimen due to surface tension, before switching the immersion objective lens to the dry objective lens; switching from the immersion objective lens to the dry objective lens; changing the relative position in the direction perpendicular to the optical axis back to an original position; and performing an observation of the specimen with the dry objective lens. | 11,580 |
9,416,992 | 1. A clamp assembly for mounting a solar module to a mounting structure, the clamp assembly comprising: a base configured to couple to the mounting structure, the base having a pivot portion and a fastening portion; a clamp body coupled to the base, the clamp body having a clamping member and a pivoting member, the pivoting member pivotally engaged with the pivot portion of the base to pivot about a pivot axis, the clamp body comprising a clamping surface that extends outwardly beyond the base in a direction parallel to the pivot axis, the clamping surface configured to clamp a frame of the solar module to the mounting structure; and a connecting portion configured to secure the clamping member of the clamp body to the fastening portion of the base. | 23,972 |
8,984,910 | 1. A process for manufacturing flat glass rich in lead oxide, comprising: continuously floating a ribbon of glass containing at least 30% lead oxide by weight on a bath of molten metal comprising tin which bath of molten metal has a density higher than that of the glass; wherein said floating occurs in a float plant with a neutral gaseous atmosphere above the ribbon of glass and bath of molten metal. | 46,867 |
9,325,735 | 1. A system for selective sinkholing of malware domains by a security device via DNS poisoning, comprising: a processor configured to: a memory coupled to the processor and configured to provide the processor with instructions. | 16,944 |
8,652,041 | 1. A fatigue risk assessment and modification system for assessing fatigue risk of an individual, the system comprising: an input device which receives at least one of current work-rest pattern and sleep data from of an individual; a data aggregation and processing system which combines the at least one of the current work-rest pattern and the sleep data with previous data related to the individual to generate at least one of a fatigue risk assessment result from the combination of the at least one of the current work-rest pattern and the sleep data and previous data related to the individual, a diagnostic assessment report that includes a causation of any excessive fatigue risk, and a corrective intervention plan for reducing excessive future fatigue risk of the individual based on at least one of the fatigue risk assessment result and the diagnostic assessment report; and at least one output display which outputs at least one of the fatigue risk assessment result, the diagnostic assessment report, and the corrective intervention plan in a user-readable format to a user. | 34,956 |
8,530,715 | 1. A method of producing a hydrocarbon product, the method comprising: hydrotreating a feedstock comprising at least one of a renewable triacylglyceride (TAG), renewable fatty acid, renewable fatty acid C controlling the temperature of the hydrotreating to be a first temperature such that a weight ratio of the hydrocarbons having an even-number of carbon atoms to the hydrocarbons having an odd-number of carbon atoms is greater than 1:1, and then further comprising increasing the first temperature by an amount of about 8° C. to about 55° C., such that the weight ratio of the hydrocarbons having an even-number of carbon atoms to the hydrocarbons having an odd-number of carbon atoms decreases to less than 1:1; wherein the renewable TAG, renewable fatty acid, and renewable C | 41,842 |
8,847,521 | 1. An inverter unit that supplies alternating-current power for driving four motors, comprising: four inverters each including a U-phase circuit, a V-phase circuit, and a W-phase circuit, each inverter for driving a corresponding one of the four motors, wherein each phase of each of the four inverters comprises a semiconductor device package including at least two semiconductor switching elements; a heat receiving plate having a surface to which the U-phase circuits, the V-phase circuits, and the W-phase circuits of the four inverters are attached; and a heat radiator that radiates heat from the heat receiving plate; wherein the U-phase circuits, the V-phase circuits, and the W-phase circuits of the four inverters are laid out in a matrix pattern on the heat receiving plate such that (1) the U-phase circuit, the V-phase circuit, and the W-phase circuit for each respective of the four inverters is laid out in a line on the heat receiving plate, and (2) the U-phase circuits of each of the four inverters are laid out in a line, (3) the V-phase circuits of each of the four inverters are laid out in a line, and (4) the W-phase circuits of each of the four inverters are laid out in a line. | 11,343 |
9,201,737 | 1. A non-transitory computer readable medium having computer-executable instructions for execution by a processing system, the computer-executable instructions for: creating a process table in a shared memory to store information about each process of at least one application group; triggering a checkpoint thread to initiate an application group checkpoint; and launching an initial application of the at least one application group; wherein one or more command line arguments are provided by one or more of: using a shell or programmatically; wherein the at least one application group is comprised of one or more applications, and the one or more applications each are comprised of one or more processes; and wherein a new application joins an application group by first sending a join message and then launching, and where upon receipt of said join message a checkpoint lock is acquired, the processes of said new application are added to the process table in shared memory, said checkpoint lock is released, and said checkpoint lock prevents checkpointing from occurring while said new application is being launched. | 1,035 |
9,194,363 | 1. An aerodynamic component for a wind turbine configured to be mounted to said wind turbine, wherein at least one rotor blade is connected to a hub of said wind turbine and defines an inner portion and a profiled outer portion, the aerodynamic component comprising: a front portion configured to be positioned in front of the inner portion of the at least one rotor blade of the wind turbine in operation; wherein the aerodynamic component is structurally configured to: | 2,705 |
8,529,663 | 1. A process for removing a target gas component from a gas mixture containing said target gas component and a second gas component, which process comprises: a) conducting said gas mixture to a swing adsorption gas separation unit wherein the gas separation unit contains at least one adsorbent contactor comprising a gas inlet and a gas outlet, wherein the gas inlet and the gas outlet are in fluid connection by a plurality of open flow channels wherein the surfaces of the open flow channels are comprised of an adsorbent material that has a selectivity for said target gas component over said second gas component greater than 5, wherein the contactor has less than about 20% of its open pore volume in pores with diameters greater than about 20 angstroms and less than about 1 micron, and wherein at least a portion of said target gas component is adsorbed into said adsorbent material, thereby resulting in a product stream depleted of said target gas component; b) collecting said the product stream; c) desorbing the adsorbed gases from said adsorbent material, thereby resulting in a waste gas stream rich in said target gas component; and d) collecting said waste gas stream. | 17,985 |
8,633,661 | 1. A time-delayed power switching device comprising: a power source input; a first conductive pathway; a second conductive pathway; a timing circuit; one relay; a circuit board; one housing occupying a volume of about 12 inches; and potting material including an epoxy resin; wherein: the power source input is electrically coupled to the first conductive pathway and the one relay; the one relay is electrically coupled to the timing circuit and the second conductive pathway, the one relay (i) having a first position adapted to energize the second conductive pathway when receiving a first signal from the timing circuit, (ii) having a second position adapted to de-energize second conductive pathway when receiving a second signal from the timing circuit, and (iii) being configured to conduct at least 4800 watts of power; the timing circuit, the one relay, and the circuit board are substantially contained within the one housing; and timing circuit, the one relay, a first end of the power source input, a first end of the first conductive pathway, and a first end of the second conductive pathway are mounted on the circuit board. | 2,062 |
8,746,263 | 1. A parasol which includes a parasol shank body formed of a lower shank part to which a handle is engaged to its lower side, and an upper shank part which flexibly slides long the lower shank part, and engaging shoulders are formed at an upper side of the lower shank part and a lower side of the upper shank part, and engaging holes are formed above the engaging shoulders and overlap as the parasol shank body prolongs, and the parasol shank body is fixed in a prolonged state with the aid of an engaging protrusion elastically supported by means of a spring installed at an inner upper side of the engaging shoulder of the lower shank part, and a plurality of inner ribs are rotatably engaged in radial shape to a fixing member fixed at the top of the upper shank part, and the other end of each inner rib is pinned at a pin engaging part formed at an outer rib, and the outer rib is configured in such a way that the outer rib is exposed to the outside in a folded state, and at an inner end of the outer rib is formed a support part which is prolonged from a pin engaging part, and the support part can be supported on the lower side of the inner rib in an unfolded state of the outer ribs, and both ends of each of a plurality of support ribs of the parasol rib assembly are rotatably engaged in a radial shape to an ascending and descending member which ascends and descends along the intermediate portion of the inner rib and the upper shank part of the parasol shank body, comprising: a second ascending and descending member which slides along an upper shank part at a lower side of the ascending and descending member and is inserted into the handle when the parasol shank body is contracted in a folded state of the parasol rib assembly; and an inner pulling piece and an outer pulling piece interconnected by means of ring parts are rotatably engaged to the second ascending and descending member and the support part formed at the inner side of the outer rib; and at the second ascending and descending member are installed an upper engaging part and a lower engaging part at an angle interval of 90° in a circumferential direction which are pressurized toward the upper shank part by means of an elastic force of a spring; and with an engaging shoulder being formed at its lower side, the upper engaging part is inserted into a first fixing hole formed at the top of the upper shank part of the parasol shank body in a state that the parasol rib assembly is unfolded, and with an engaging shoulder being formed at its upper side, the lower engaging part is inserted into a second fixing hole formed at a lower side of the upper shank part in a state that the parasol rib assembly is folded. | 1,196 |
9,010,097 | 1. An exhaust purification system of an internal combustion engine comprising: an engine exhaust passage; a hydrocarbon feed valve for feeding hydrocarbons arranged inside of the engine exhaust passage; an exhaust purification catalyst for reacting NO a precious metal catalyst carried on an exhaust gas flow surface of the exhaust purification catalyst; a basic exhaust gas flow surface part formed around the precious metal catalyst; an NO an electronic control unit, wherein the electronic control unit is configured to control a vibration of a concentration of hydrocarbons flowing into the exhaust purification catalyst within a predetermined range of amplitude and within a predetermined range of period, and is configured to control the vibration period of the hydrocarbon concentration longer than the predetermined range of period, wherein | 20,198 |
9,781,118 | 1. An apparatus to differentiate web content, comprising: a browser interface to receive the web content; a container designation module to determine a trust level associated with the web content; and an environment module to map the web content to an execution environment based at least in part on the trust level; wherein the container designation module is to obtain a real-time trust level assessment; wherein the trust level is to be determined based at least in part on the real-time trust level assessment; and wherein the web content is to be mapped to a first processor based on a first determined trust level and a determination that an execution latency is tolerated, and the web content is to be mapped to a second processor based on a second determined trust level and a determination that the execution latency is not tolerated. | 14,829 |
9,714,355 | 1. An inkjet composition comprising at least one photoinitiator, polymerizable components, and a multifunctional amino acrylate having a total functionality of greater than 2 wherein: (a) at least 40% (w/w) of the total photoinitiator content comprises one or more photoinitiator having a molecular weight of less than 500 amu; (b) said composition is a free radical UV-curable composition; and (c) wherein greater than 50% by weight of the polymerizable component is a blend of difunctional monomers. | 4,536 |
9,169,177 | 1. A process for the production of tetrachloromethane comprising catalyzing the chlorination of a feedstream comprising methylene chloride and/or methyl chloride, and not comprising chloroform or methane, with a free radical initiator to provide a product stream comprising chloroform and tetrachloromethane at a ratio of from 4:1 to 1:2. | 10,817 |
9,499,843 | 1. A method of producing oil, comprising contacting a culture medium comprising a micro-organism consisting of the removing the oil from the culture medium. | 25,836 |
8,639,380 | 1. A control system for carriers that are movable in a network of guideways to automatically carry loads from entrance stations to exit stations along said guideways, wherein said network includes convergent Y-junctions in each of which first and second entrance guideways merge into an exit guideway, said control system comprising: monitoring means for monitoring carriers moving along said guideways to develop speed data that is related to the speeds of said carriers, said monitoring means including processor means operative for periodically determining from said speed data arrival data that includes the expected times of arrival at a merge point of a convergent Y-junction of carriers that are moving along said first and second entrance guideways of said convergent Y-junction and that are within a certain distance behind said merge point, said monitoring means including means for temporarily storing said arrival data when so determined, and said processor means being operative to develop comparison data from comparisons of arrival data currently determined as to carriers moving along one of said entrance guideways with arrival data previously obtained and stored as to carriers moving along the other of said entrance guideways, and said processor means being operative to develop from said comparison data deceleration data usable to so decelerate each carrier moving along said one of said entrance guideways as may be required to avoid eventual collision with any carrier moving on the other of said entrance guideways, and control means for applying said deceleration data to decelerate the corresponding carrier moving along said one of said entrance guideways. | 40,628 |
9,217,586 | 1. A ground energy collection system, comprising: a well configured to absorb ground energy and provide the absorbed ground energy to a first heat transferring fluid; a pump fluidly coupled to the well, the pump configured to facilitate circulating movement of the first heat transferring fluid; an evaporator fluidly coupled to the pump and the well, the evaporator configured to: a compressor fluidly coupled to the evaporator, the compressor configured to compress the second heat transferring fluid to increase temperature and pressure of the second heat transferring fluid; an electricity generator fluidly coupled to the compressor, the electricity generator configured to generate electricity based on the second heat transferring fluid received from the compressor; a condenser fluidly coupled to the electricity generator, the condenser configured to retrieve heat and liquefy the second heat transferring fluid; and an expansion valve fluidly coupled to the condenser and the evaporator, the expansion valve configured to regulate pressure of the second heat transferring fluid received from the condenser and return the second heat transferring fluid to the evaporator. | 29,321 |
8,466,723 | 1. A data processing system comprising: a plurality of sub-circuits, each sub-circuit in the plurality of sub-circuits having a clock input; a clock generator comprising: a power mode controller coupled to the control circuit and a controllable power supply facility, the power mode controller configured to select an operating point of a sub-circuit to match measured performance of the sub-circuit with a requested performance of the sub-circuit, the operating point defining a clock signal with a predetermined frequency and a supply voltage of a predetermined voltage level, wherein, responsive to selection of the operating point by the power mode controller, the controllable power supply facility providing the sub-circuit with the defined supply voltage of the predetermined voltage level and the control circuit generating the control output causing the multiplexing circuit to couple the sub-circuit with one of the plurality of the oscillator circuits that generate a clock signal of the predetermined frequency. | 10,843 |
9,113,000 | 1. A computing system for filtering a plurality of records and transmitting one or more filtered records from the plurality of records to a remote device, comprising: an online-accessible record database containing the plurality of records; a usage factor database containing one or more usage factors; and one or more computer processors including: | 32,803 |
9,621,092 | 1. An induction motor control apparatus for controlling an induction motor connected to drive wheels by setting a motor torque command value on the basis of vehicle information, the induction motor control apparatus comprising: a current command value calculating unit of a vibration damping control calculator configured to calculate a first torque current command value and a first excitation current command value on the basis of the motor torque command value; a rotor magnetic flux estimating unit of the vibration damping control calculator configured to estimate a rotor magnetic flux on the basis of the first excitation current command value; a first torque command value calculating unit of the vibration damping control calculator configured to calculate a first torque command value on the basis of an estimated value of the rotor magnetic flux and the first torque current command value; a second torque command value calculating unit of the vibration damping control calculator configured to calculate a nonlinear second torque command value by applying filter processing to the first torque command value, a natural vibration frequency component of a drive shaft torque transmission system in a vehicle being removed in the filter processing; a torque current command value calculating unit of the vibration damping control calculator configured to calculate a second torque current command value on the basis of the second torque command value and the estimated value of the rotor magnetic flux; and a control unit configured to control drive of the induction motor on the basis of the first excitation current command value and the second torque current command value. | 39,072 |
9,223,365 | 1. A method comprising: initiating a ring oscillator of a processor responsive to receiving a power up signal from a power management integrated circuit coupled to the processor; generating a calibrated ring oscillator signal by calibrating a frequency of a ring oscillator signal with a reference clock signal; responsive to detecting a calibrated ring oscillator signal error below a threshold value: | 19,324 |
8,738,227 | 1. A dark current cutoff method for a vehicle junction box, the dark current cutoff method comprising: monitoring, by a controller of the junction box, signal input through a controller area network (CAN) communication module to determine when other modules in the vehicle enter a sleep mode; cutting off battery power to a load device by turning off a switching element by the controller once the controller determines that the other modules in the vehicle are in the sleep mode; ignoring, by the controller, all CAN signals input through the CAN communication module for a preset period of time immediately after the step of cutting off battery power to the load device; and forcibly maintaining, by the controller of the junction box, the off state of the switching element for the preset period of time after the step of cutting off battery power to the load device, regardless of signal input through the CAN communication module; and after elapse of the preset period of time, again monitoring, by the controller of the junction box, signal input through the CAN communication module, so that the controller continuously maintains a power cut state while the other modules are in the sleep mode. | 864 |
8,917,671 | 1. Method, comprising: determining whether a computerized wireless node (CWN) detects a wireless mesh network (WMN); responsive to a determination that the CWN does not detect the WMN, establishing the CWN as either it mobile node or a stationary node of a WMN; causing the CWN, pursuant to being established as either a mobile node or a stationary node of a WMN, to periodically emit a beacon to enable identification of a WMN by any newly-added electronics devices; responsive to the CWN detecting a WMN, causing the CWN to transmit a frit discovery message as a broadcast or multicast to all identified wireless ad hoc networks in an attempt to identify a WMN local to the CWN, with existing nodes of the WMN responding to the discovery message to establish a new connection; causing an electronics device that desires to join a WMN to send to one or more detected wireless ad hoc networks a network discovery message to find an existing WMN from among detected wireless ad hoc networks, the network discovery message being proprietary to a manufacturer of the WMN, wherein the network discovery message includes a 64-bit security field to protect the WMN from denial-of-service (DOS) attack from devices not made by manufacturer. | 46,154 |
9,428,765 | 1. A recombinant corn plant, seed, cell or part thereof comprising event MON89034, a representative sample of seed comprising event MON89034 having been deposited under ATCC Accession No. PTA-7455. | 29,836 |
8,943,068 | 1. A method in a computer system for providing a matrix interface to a data store of entries, the entries having a first field, a second field, and a third field, the method comprising: generating an index for the first field of the data store, the index mapping values of the first field to entries of the data store that contain those values for the first field; receiving a request to retrieve an element from a matrix for a source first dimension and a source second dimension, each entry of the data store representing an element of the matrix that does not have a distinguished value, the first field representing a first dimension of the matrix, the second field representing a second dimension of the matrix, and the third field representing a value for the element of the matrix at the represented first dimension and second dimension; identifying, from the index, entries of the data store that have a value for the first field that matches the source first dimension; determining whether any of the identified entries has a value for the second field that matches the source second dimension; upon determining that an identified entry has a value for the second field that matches the source second dimension, providing the value of the third field of that entry as the value of the element of the matrix for the source first dimension and the source second dimension; and upon determining that no identified entry has a value for the second field that matches the source second dimension, providing the distinguished value as the value of the element of the matrix for the source first dimension and the source second dimension wherein each first dimension of the matrix and each second dimension of the matrix may be considered to represent a node of a graph and the value of the element at a first dimension and a second dimension of the matrix may be considered to represent a link between nodes. | 22,075 |
9,708,646 | 1. An in vitro method of regulating production of a target RNA from a precursor RNA in a eukaryotic cell, the method comprising: introducing into said eukaryotic cell a recombinant expression vector comprising a nucleotide sequence encoding an enzymatically active sequence-specific Csy4 endoribonuclease, wherein the Csy4 endoribonuclease comprises an amino acid sequence having at least 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:8, wherein the target RNA comprises a GUUCACUGCCGUAUAGGCAG (SEQ ID NO:103) cleavage site in a precursor RNA comprising the target RNA, and wherein said Csy4 endoribonuclease is produced in the cell and cleaves said target RNA from the precursor RNA at the cleavage site, thereby regulating production of the target RNA. | 7,176 |
8,726,632 | 1. A method of achieving a slim-line nacelle on a gas turbine engine, comprising the steps of: (a) sensing a windmilling condition; and (b) increasing a discharge airflow area of a variable area fan nozzle in response to the windmilling condition from the sensing step. | 7,951 |
8,474,223 | 1. An apparatus for transferring a palletized load between a pallet truck and a load wrapping surface, comprising: an inclined ramp configured to support at least a portion of the pallet truck; and an inclined conveyor adjacent to the ramp, the conveyor including a conveying surface configured to support the palletized load and including at least one drag chain assembly configured to convey the palletized load between the ramp and the load wrapping surface. | 11,909 |
9,028,823 | 1. A method for inducing or enhancing an immune response in a subject, the method comprising: administering to the subject an agonistic GITR (glucocorticoid-induced TNFR family-related receptor)-binding antibody, or an antigen-binding fragment thereof, such that an immune response or an enhanced immune response occurs; and administering to the subject an additional antibody or antigen-binding fragment thereof or giving the subject a treatment selected from the group consisting of chemotherapy and hormonal therapy. | 19,832 |
8,359,249 | 1. A locker system comprising: a top compartment formed by at least sidewalls, and a bottom compartment that is located below the top compartment formed by at least the sidewalls, and a top door for opening and closing the top compartment; a bottom door for opening and closing the bottom compartment; and a triangular panel covering at least a portion of the top compartment that extends to a lower half of the locker system, the triangular panel being located just behind the bottom door in a closed position, the triangular panel thus restricting access to the top locker, from the lower half of the locker system when the bottom door is in an open position. | 22,312 |
8,548,113 | 1. An upper tie plate for use in debris mitigation, the upper tie plate comprising: a plurality of bosses, each boss shaped to receive an end of a nuclear fuel rod; and a plurality of debris capture elements above the plurality of bosses and configured to overlap such that a flow area is formed therebetween. | 12,813 |
8,407,162 | 1. An arrangement for network management and adapted to be provided in, associated with or in communication with, a network node to be managed, wherein the arrangement comprises, or is in communication with, modelling means adapted to, using non-formal descriptions, model network domain and behaviour using formal ontologies comprising inference capabilities by means of an inference engine, thus providing a formal ontology model describing domain and behaviour and annotating means adapted to add semantic information to the formal domain and behaviour ontology model, generating means adapted to, using said formal ontology model and said inference engine, elaborate an algorithm adapted to generate and update a probabilistic causal network graph structure representing the domain and its behaviour. | 29,021 |
9,016,458 | 1. A conveyor comprising: a carryway; a conveyor belt having an outer conveying surface supporting a layer of bulk products and advancing the layer of bulk products along the carryway; a sensor mounted in the conveyor belt and having a sensor probe extending into the layer of bulk products above the outer conveying surface of the conveyor belt to detect a condition of the products, the sensor providing sensor signals representing the condition of the products detected by the sensor probe; a transmitter mounted in the conveyor belt to transmit the sensor signals to a remote location. | 39,514 |
9,156,069 | 1. A rotary autoclave having an interior for treating solid waste, which is downwardly inclined towards its discharge end and which has a door at the discharge end, means in said door being provided for injecting steam through said door via a plenum chamber in said door into the interior of said rotary autoclave to treat a load of said solid waste, the plenum chamber communicating with the interior of the autoclave through at least one one-way device leading directly from the plenum chamber into the interior of the autoclave, the at least one one-way device being configured to prevent the solid waste from entering the plenum chamber from the interior of the autoclave, said plenum chamber being defined between a region of the door and a plate secured to the door at a small spacing inwardly of said door, at least one outlet being defined in the plate, and said at least one one-way device being fitted to said at least one outlet. | 34,859 |
9,061,760 | 1. A rotorcraft, comprising: a body; a power train coupled to the body and comprising a power source and a drive shaft coupled to the power source; a rotor system coupled to the power train and comprising a rotor blade; and a rotary actuator coupled to the at least one rotor blade, the rotary actuator comprising: | 8,364 |
8,883,927 | 1. A process for making a radial multi-block copolymer, comprising the steps of: (a) anionically polymerizing styrene monomer A (b) adding an alkyl aluminum compound after initiating anionic polymerization in step (a) and before reaching peak reaction temperature in step (a), wherein the molar ratio of the alkyl aluminum compound to lithium ranges from 2:1 to 5:1, wherein a polymerization system is used in steps (a) and (b), and wherein the polymerization system may or may not include a tertiary amine and/or an ether compound but otherwise consists of the lithium-based initiator and the alkyl aluminum compound for promoting a coupling reaction; and (c) adding a coupling agent to form the radial multi-block copolymer, wherein the coupling agent is a polyester, polyacrylate, polymethacrylate or a polyketone compound, and wherein the radial multi-block copolymer comprises a residue Z derived from the coupling agent and block copolymer chains from step (b) coupled to the residue Z. | 3,139 |
8,869,316 | 1. Articulated body armour comprising: an upper harness including a left shoulder strap and a right shoulder strap and a chassis having at least a front bridge and a back bridge, each of the front bridge and the back bridge formed as a separate component from the shoulder straps and each of said front bridge and said back bridge made from a rigid member having opposing ends, each of said front bridge and said back bridge spacing the left shoulder strap from the right shoulder strap, the upper harness assembled through intercoupling of the left and right shoulder straps via the front bridge and back bridge, the intercoupling achieved through at least four pivoting joints that allow each shoulder strap to rotate relative to both the front bridge and the back bridge, each one of said four pivoting joints located at each end of each shoulder strap and each pivoting joint coupling the end of its respective shoulder strap to one of said opposing ends of one of the front bridge and the back bridge, wherein intercoupling of the left shoulder strap and the right shoulder strap through the front bridge and the back bridge and via each pivoting joint allows for independent movement of each shoulder strap and rotation about each pivot joint; a generally flat front plate; a coupling mounting the front plate to the front bridge, the coupling allowing the front plate to rotate relative to the front bridge; and a back plate; wherein the chassis produces a closed circuit within the upper harness of the body armour and the chassis supports both the front plate and the back plate. | 16,121 |
8,745,274 | 1. A storage device comprising: a control unit that carries out a communication process with a host device that is connected via a bus; a storage unit into which data from the host device is written; and a storage control unit that controls access to the storage unit, wherein the storage device is connected to the host device via bus; and the control unit returns an acknowledgment to the host device in the case where the control unit has received acknowledgment return request information broadcasted from the host device to a plurality of storage devices after a period in which data is written into the plurality of storage devices and the data has been successfully written into the storage unit; wherein the control unit returns the acknowledgment to the host device in a return period that, of first through nth (where n is an integer greater than or equal to 2) return periods that follow the reception of the acknowledgment return request information, is an mth (where m is an integer greater than or equal to 1 and less than n) return period that corresponds to ID information of the storage device. | 36,836 |
9,795,592 | 1. A pharmaceutical formulation comprising; a) vildagliptin or pharmaceutically acceptable salt thereof, and b) a diluent comprising dibasic calcium phosphate, wherein the ratio of vildagliptin to diluent is in the range of 0.04 to 0.24 (w/w) and wherein when the pharmaceutical formulation is pressed into a tablet, the tablet has a friability of 0.1. | 41,929 |
8,365,436 | 1. System for drying a water-containing substance by means of an air stream, the system comprising: a first heat exchanger ( a unit for separating the heated air stream which is saturated to a first level into a first and a second air stream; a heating unit ( a drying unit ( a second heat exchanger ( a mixing unit for mixing the second air stream cooled to the temperature level of the first cooling liquid and saturated to the second level and the first air stream, resulting in a mixed air stream; a third heat exchanger ( | 7,786 |
9,778,173 | 1. An optical sensor system, comprising: a source module including a source housing having a source window and a source shielding member, the source module to emit a detection signal through the source window, the source shielding member surrounding the source window and extending in an outward direction from the source window; a detection module including a detection housing having a detection window and a detection shielding member, the detection module spaced apart from the source module and to detect the detection signal emitted from the source module and passed through the detection window, the detection shielding member surrounding the detection window and extending in an outward direction from the detection window; and a guide member between the source module and the detection module, the source module and the detection module slideable along the guide member to adjust a distance between the source module and the detection module. | 8,183 |
9,179,266 | 1. A computer-implemented method for determining an estimated user location, implemented in a computing system programmed to perform the method comprising: receiving, in the computer system, an indoor map database associated with an indoor geographic location including a plurality of indoor map features; determining, in the computer system, an estimated first user location within the indoor geographic location; receiving, in the computer system, a first plurality of physical perturbations from a plurality of physical sensors in response to the physical perturbations of the computer system; determining, in the computer system, an estimated second user location within the indoor geographic location in response to the estimated first user location and to the first plurality of physical perturbations; determining, in the computer system, a wander zone constraint in response to the first plurality of physical perturbations and the indoor geographic location, wherein the wander zone constraint is based on whether a user is positioned in an open indoor space within the indoor geographic location with a plurality of possible routes; determining, in the computer system, a modified estimated second user location in response to the estimated second user location and to at least one indoor map feature from the plurality of indoor map features while the wander zone constraint is inactive; determining, in the computer system a modified estimated second user location in response to the estimated second user location while deemphasizing the plurality of indoor map features while the wander zone constraint is active; and providing, in the computer system, an indication of the modified estimated second user location with regards to the indoor geographic location. | 5,829 |
8,466,883 | 1. A method of input of a computing system including a touch sensing surface, the method comprising: obtaining touch sensing information of a scan of the touch sensing surface; determining, based on the touch sensing information of the scan, contact information of a set of one or more contacts, each contact corresponding to a touch object on or near the surface; determining, based on the contact information, a first orientation of a first contact of the set; obtaining touch sensing information of another scan of the touch sensing surface; determining, based on the touch sensing information of the other scan, a second orientation of the first contact; determining a rotation of the first contact based on the first orientation and the second orientation; and generating input of the computing system based on the first orientation, including generating the input based on the rotation. | 33,034 |
8,578,194 | 1. A method of controlling a data buffer having a plurality of data banks, comprising: monitoring respective utilization limits of active data banks of the data buffer; powering on an inactive data bank of the data buffer when a number of active data banks with utilization limits below a first utilization limit becomes below a first threshold; and powering down an active data bank of the data buffer when the active data bank is empty and a number of active data with utilization limits below a second utilization limit becomes equal to or greater than a second threshold. | 19,268 |
9,037,521 | 1. A method, comprising: ingesting, as input data, weather information, crop-specific information for a crop to be harvested, and field-specific information for a location where the crop is planted, the weather information including past, current and expected field-level weather data, and the crop-specific information including at least one of crop type data, crop state data that includes at least the standing or windrowed status of the crop, and harvest data that at least includes reported threshability data in one or more time periods representing temporal harvest windows; modeling the input data in a plurality of data processing modules within a computing environment in which the plurality of data processing modules are executed in conjunction with at least one processor, the data processing modules configured to profile time-varying threshability of the crop to be harvested, by 1) predicting expected weather conditions relative to plant wetness characteristics in the crop over the one or more time periods representing temporal harvest windows, 2) applying the expected weather conditions, the crop-specific information, and the field-specific information to at least one of an agricultural model of one or more physical and empirical characteristics impacting threshability characteristics, and an artificial intelligence model of time-varying threshability of the crop to be harvested to simulate the threshability characteristics over the one or more time periods representing forthcoming temporal harvest windows, 3) comparing the reported threshability data with the associated past and current weather data, and associated simulations of threshability characteristics, to identify relationships between the weather data, the simulations of threshability characteristics, and the reported threshability data, and 4) predicting daily windows of harvest opportunity based on the expected weather conditions, associated simulations of threshability, and the identified relationships; generating, as output data, one or more advisories representing a forecast of threshability of the crop to be harvested on both a current day and future days within the one or more time periods representing temporal harvest windows in a harvest output condition profile. | 47,157 |
8,979,123 | 1. A utility vehicle, comprising: a chassis frame; a single-row seat arranged on the chassis frame; and a R.O.P.S. surrounding a riding space in which the single-row seat is arranged, wherein: the R.O.P.S. includes a right side unit and a left side unit, and a plurality of cross members for detachably coupling the right side unit and the left side unit, each of the right side unit and the left side unit includes a front pole portion extending upward from a vicinity of a dashboard, an upper beam portion extending rearward from an upper end of the front pole portion, a mid pole portion extending downward to a vicinity of a rear part of the single-row seat from an intermediate part of the upper beam portion in a longitudinal direction of the utility vehicle, and a rear pole portion extending downward from a rear end of the upper beam portion, the front pole portion, the rear pole portion, and the upper beam portion being defined by a one-piece, bent pipe member having a circular cross section and being substantially U shaped in the longitudinal direction, and a lower end of the front pole portion of the right side unit, a lower end of the mid pole portion of the right side unit, a lower end of the rear pole portion of the right side unit, a lower end of the front pole portion of the left side unit, a lower end of the mid pole portion of the left side unit, and a lower end of the rear pole portion of the left side unit, are individually and detachably coupled to the chassis frame. | 14,292 |
8,933,074 | 1. A compound of Formula (I) or pharmaceutically acceptable salt thereof wherein: HET is a heterocyclic ring selected from Formulas A1-A26 and A29-A42 below and the left most radical is connected to the X group; X is selected from C Y is a bond or a divalent linker group selected from —CH Z is optionally substituted heteroaryl; R R each R R R R n is independently selected from 1 and 2. | 37,717 |
9,224,789 | 1. An image pickup device comprising: a plurality of first electrode films configured as separate islands formed on a substrate; a continuous organic photoelectric conversion film configured to convert light into electrical charge, wherein the organic photoelectric conversion film is substantially parallel to the substrate, formed above the plurality of first electrode films and portions of the substrate therebetween, and is common to the plurality of first electrode films; a continuous second electrode film substantially parallel to the substrate; a metal wiring film electrically connected to the second electrode film; and a protective film coating side surfaces of the organic photoelectric conversion film and side surfaces of the second electrode film, wherein the plurality of first electrode films, the organic photoelectric conversion film, and the second electrode film are provided on the substrate in this order, and wherein a portion of the protective film is between the metal wiring film and the organic photoelectric conversion film. | 28,121 |
8,768,157 | 1. A device comprising: at least one first MEMS actuator configured to move a platform in translation along a first axis; and at least one second MEMS actuator configured to move the first MEMS actuator in a direction that is generally perpendicular to the first axis; wherein at least one of the at least one first and second MEMS actuators comprises a fixed frame and a moveable frame, at least one of the movable frame and the fixed frame being deployed at an angle relative to a plane of the device and the moveable frame being rotatable relative to the fixed frame about a hinge line lying in the plane of the device and passing through a portion of the fixed frame, and wherein the second MEMS actuator(s) define a plane and at least a portion of each first MEMS actuator is deployed to a position out of the plane to define a rotational comb drive. | 27,180 |
8,916,544 | 1. A compound of formula I, or pharmaceutically acceptable salt thereof: wherein, | 19,054 |
9,356,946 | 1. A computer-implemented method for analyzing webpages for malware, the method comprising: receiving a uniform resource locator (URL); performing analysis on a webpage associated with the URL to determine programming languages and plug-ins used on the webpage; accessing the webpage on a web browser in an emulated environment, the emulated environment simulating a mobile device; observing and storing behaviors of the simulated mobile device after accessing the webpage; and classifying the mobile webpage as malicious or non-malicious based on the observed and stored behaviors. | 38,191 |
9,539,268 | 1. A method of treating arthritis comprising orally administering a dosage form to a mammal in need thereof, wherein the dosage form comprises: (Ion B) in a salt form, in an amount that is less than 0.1% w/w and greater than 0% w/w; or (Ion C) in a salt form, in an amount that is less than 0.1% w/w and greater than 0% w/w; | 32,258 |
9,853,797 | 1. A method for time division based coexistence in an unlicensed radio frequency (RF) band, the method comprising: by a wireless communication device: establishing a connection between the wireless communication device and an eNodeB of a wireless network using a primary component carrier of a primary cell in a licensed radio frequency band; obtaining a configuration for a secondary cell from the eNodeB, the secondary cell operating in the unlicensed radio frequency band, and the configuration for the secondary cell including a set of timers indicating a pattern of on cycles and off cycles for use of the secondary cell, wherein the configuration for the secondary cell synchronizes communication for all wireless communication devices communicating with the secondary cell of the eNodeB to use the pattern of on cycles and off cycles of the secondary cell; configuring a secondary component carrier for the secondary cell to supplement the primary component carrier for the connection between the wireless communication device and the eNodeB, the first and second component carriers used together for communication via carrier aggregation; communicating with the eNodeB via both the primary component carrier of the primary cell and the secondary component carrier of the secondary cell in parallel during at least one of the on cycles of the secondary cell; communicating with the eNodeB using only the primary component carrier during at least one of the off cycles of the secondary cell; and inhibiting communication with the eNodeB via the secondary component carrier during the off cycles of the secondary cell, wherein the eNodeB schedules the wireless communication device to communicate via the secondary component carrier of the secondary cell to not overlap in time with communication by other wireless communication devices configured to communicate with the secondary cell during the on cycles of the secondary cell. | 31,502 |
8,576,996 | 1. A method, comprising: determining a proximity determining that a user device is within proximity of an in-progress call between two or more communication devices, further comprising, determining the user device is able to connect to the in-progress call and determining a secondary proximity of the user device to at least one communication device; receiving a request from the user device to join the in-progress call; determining that the user device is allowed to join the in-progress call; and providing the user device with a message which enables the user device to join the in-progress call; and wherein determining an acceptable secondary proximity of the user device to the at least one communication device comprises detecting a substantially simultaneous bump between the user device and the at least one communication device. | 25,204 |
9,288,598 | 1. A method comprising: forming a pipe including a hole in the pipe configured to receive a headset mount, a first end and a second end by forming couplings between a plurality of sections of pipe, each coupling comprises a union configured to join adjacent sections of the plurality of sections of pipe, the adjacent sections being positioned in an inside diameter of a respective union, and the adjacent sections in each union being spaced apart from each other by a gap; connecting a loudspeaker to the first end, wherein the loudspeaker is a mouth simulator loudspeaker; placing an electronic device having a plurality of microphones substantially within a receptacle of the headset mount; holding the electronic device securely to the receptacle using a firm foam piece substantially disposed at an end of a toggle clamp; positioning the headset mount in the hole in the pipe with each of the plurality of microphones substantially disposed a third distance inside an inside surface of the pipe, the receptacle being positioned in the pipe a first distance from the first end and a second distance from the second end; generating an acoustic output at the loudspeaker; and generating at least one calibration filter using outputs of the plurality of microphones produced in response to the acoustic output. | 14,148 |
9,786,916 | 1. An anode for secondary batteries comprising: a coating layer of a conductive material having a thickness of 30 to 80 μm on a current collector, and an anode mixture comprising an anode active material, a binder and the same conductive material of the coating layer, wherein the conductive material is at least one of carbon nanotube or graphene. | 4,586 |
8,641,911 | 1. A centrifugal bowl comprising: a base configured to rotate about an axis of rotation, wherein the base includes a grating disk used to grate an object into a mixture of fluids and solids; and a filter sieve in the shape of a perforated peripheral side sieve wall coupled to the base, wherein the perforated peripheral side sieve wall extends from an open end of the filter sieve to the base, the filter sieve further including a plurality of vanes disposed in a predominantly radial direction on an inner surface of the perforated peripheral side sieve wall proximate the base, wherein each vane comprises a surface that pushes against the mixture to (i) increase centrifugal forces, giving rise to a coriolis effect, acting on the mixture and preventing slippage of the mixture in a rotational direction of the filter sieve, (ii) increase a separation efficiency of fluids from solids of the object and provide sufficient force to blow separated fluids from the perforated peripheral side sieve wall to an outlet and (iii) enhance a catching efficiency to counter spray of the mixture in a vertical direction. | 44,966 |
9,289,548 | 1. An ambulatory medical device, the ambulatory medical device comprising: a function module to provide the intended functionality of the device; a controller module to control the device; a sound generation module with an acoustic transducer to produce an acoustic signal; a signal generator to drive the acoustic transducer with a certain frequency, wherein the sound generation module is arranged within a housing of the device; and a tuning module that varies the frequency used by the signal generator to drive the acoustic transducer and determines one or more frequencies that correspond to an optimum sound level of the acoustic signal, wherein the optimum sound level of the acoustic signal is a maximum sound level outside of the housing of the device and/or a maximum perceivable sound level as determined by a user, wherein the tuning module measures an electrical, or mechanical, parameter of the acoustical transducer as a measure for the sound level generated by the transducer and calculates the sound level outside of the housing of the device based on the sound level generated by the transducer and a given sound attenuation function of the housing. | 14,110 |
9,533,694 | 1. A railway vehicle floor assembly for a railway vehicle comprising: a railway vehicle floor base frame including hollow edge profiles, wherein floor surfaces of the hollow edge profiles form a portion of a floor surface of the railway vehicle floor assembly, and the hollow edge profiles located at longitudinal sides of the railway vehicle floor assembly each includes an arched and upwardly drawn wall portion extending to an elevation above the floor surfaces; a core layer positioned between the hollow edge profiles; a lower end plate positioned beneath at least one of the hollow edge profiles; and at least one heating unit positioned above the core layer and between the hollow edge profiles for heating the railway vehicle floor assembly, with the at least one heating unit forming a load-bearing sandwich structure together with the hollow edge profiles, the core layer and the lower end plate, wherein the heating unit, the edge profiles, the core layer and the lower end plate together form a modular construction unit, wherein the edge profiles together form the base frame which receives the heating unit on an upper side of the base frame such that a top surface of the heating unit is flush with floor surfaces of the edge profiles to form the floor surface of the railway vehicle floor assembly, and the base frame receives the lower end plate on a lower side of the base frame that opposes the heating unit, wherein the heating unit has an upper and lower cover layer and a heating element sandwiched between the upper and lower cover layers, and wherein the core layer, which has a lower heat conductivity than the base frame, is arranged between the lower cover layer of the heating unit and the lower end plate, and wherein the construction units are configured to be positioned and fixed relative to one another in the railway vehicle by connecting elements. | 47,787 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.