id int64 8.34M 9.85M | text stringlengths 30 13.9k | __index_level_0__ int64 0 50k |
|---|---|---|
9,035,367 | 1. A method of fabricating both a multijunction solar cell and an inverted metamorphic multijunction solar cell in a single process using a MOCVD reactor comprising: providing a semiconductor substrate; forming a first multijunction solar cell on said semiconductor substrate; forming a release layer over the first solar cell; forming an inverted metamorphic second solar cell including: (i) growing a first solar subcell having a first band gap on said release layer; (ii) growing a second solar subcell over said first subcell having a second band gap smaller than said first band gap; growing a first grading interlayer over said second solar subcell; (iii) growing a third solar subcell over said grading interlayer having a fourth band gap smaller than said second band gap such that said third solar subcell is lattice mismatched with respect to said second solar subcell; and etching the release layer so as to separate the multijunction first solar cell and the inverted metamorphic second solar cell. | 22,190 |
8,577,530 | 1. A method of operating a trolley assist-capable mining truck comprising the steps of: receiving data via an electronic control unit indicative of a prospective directional change in an on-trolley availability corridor to be traversed by the mining truck while electrically connected with an overhead trolley line coinciding with the corridor; outputting a control command via the electronic control unit to a steering mechanism of the mining truck responsive to the data; and steering the mining truck via the steering mechanism responsive to the control command from a first heading accordant with a first part of the corridor preceding the directional change, toward a second heading accordant with a second part of the corridor succeeding the directional change, and such that the steering commences while the mining truck is within the first part of the corridor. | 7,879 |
9,423,445 | 1. A method of identifying the location of a fault in a power distribution system, the method comprising: in response to a fault located at one of a plurality of distributed resources on one or more feeders of a power distribution system comprising a distribution grid, wherein at least one of the distributed resources is a solar panel and wherein a distance of each of the plurality of distributed resources relative to the distribution grid is known, generating a current by a controllable voltage source converter of one or more distributed resources not located at the fault and injecting the current into the power distribution system; measuring a voltage level at each of the plurality of distributed resources resulting from the current injected into the power distribution system by each of the one or more distributed resources not located at the fault on the feeder; generating a voltage profile from the voltage measurements at each of the one or more distributed resources, wherein the voltage profile comprises the voltage level at each of the plurality of distributed resources relative to the distance of each of the plurality of distributed resources from the distribution grid of the power distribution system; and analyzing the voltage profile to identify the location of the fault in the power distribution system, wherein analyzing the voltage profile further comprises identifying a voltage level drop at one of the plurality of distributed resources located at a first distance from the distribution grid and a corresponding voltage rise at one or more of the plurality of distributed resources located at a second distance from the distribution grid, wherein the second distance is greater than the first distance. | 27,726 |
8,779,923 | 1. A battery management system for use in a vehicle comprising: a battery checker to determine if a battery in a battery driven device is compliant to a maker-specified requirement, wherein the battery-driven device is the vehicle, wherein the battery checker includes a first checker to determine if the battery is a genuine product based on identification information of the battery including at least one of a code for indicating whether the battery is a genuine battery or a code for indicating whether the battery module was distributed through an authorized distribution channel, and a second checker to determine if the battery is functional based on management information of the battery including at least one of a warranty period, a maximum number of charge operations, a charge condition, or a discharge condition indicating non-compliance with the maker-specified requirement when at least one of the first checker and the second checker yields a negative check result; a transmission unit to send out information indicative of a use condition of the battery from the battery-driven device and a check result of the battery by the battery checker indicating non-compliance with the maker-specified requirement when at least one of the first checker and the second checker yields a negative check result; a receiver in an organization that is related to the battery-driven device or the battery for receiving a transmission from the transmission unit; a recorder in the organization for recording the information received by the receiver via the transmission; and a contact in the organization for sending a message to a user of the battery-driven device based on the information recorded by the recorder, wherein the message encourages the user to use a battery that is compliant to the maker-specified requirement; wherein the battery checker is further configured to determine whether the management information of the battery further includes a battery manufacturer information; and cause the transmission unit to send out further information indicating non-compliance of the battery and including vehicle information to identify the vehicle, and battery information about the battery which was determined not to include the battery manufacturer information. | 47,459 |
9,379,415 | 1. An entire solid lithium secondary battery comprising: a cathode; an anode; and a solid electrolyte layer disposed between the cathode and the anode; wherein the solid electrolyte layer is formed of a Li | 32,134 |
9,482,146 | 1. A system for regulating engine power in an internal combustion aircraft engine having a turbocharger, the system comprising: a heat exchanger configured to receive air input from the turbocharger, said heat exchanger including a fluid link distinct from the bypass element and positioned between the output of the turbocharger and the control mechanism, the fluid link being a passage in fluid communication with both the output of the turbocharger and the control mechanism, the control mechanism including a control cylinder and a bypass valve, the control cylinder of the control mechanism configured to increasingly open the bypass valve of the control mechanism when a fluid pressure in the fluid link is decreasing, the control cylinder including a pneumatic ram cylinder. | 18,659 |
8,961,782 | 1. A grey water filtering system comprising: a tank having an internal cavity for receiving water, an inlet for conveying water into the tank, and an outlet for conveying water out of the tank; a filter assembly received in the tank and including a filter disposed between the inlet and outlet and constructed and arranged such that water passing from the tank inlet to the tank outlet passes through the filter, the filter having an inlet surface exposed to water from the tank inlet and an outlet surface exposed to water that has passed through the filter; and a backwash assembly including at least one nozzle, a float carrying the at least one nozzle for movement up and down in reaction to an increase and decrease in the level of water in the tank, and a pump supplying water under pressure to the at least one nozzle, the at least one nozzle being mounted to direct pressurized water at the outlet surface of the filter for a backwash cleaning effect. | 46,238 |
9,299,822 | 1. A semiconductor device comprising: a first semiconductor layer formed with i-GaN on a substrate; a second semiconductor layer formed on the first semiconductor layer, wherein the first semiconductor layer and the second semiconductor layer have a common opening, wherein the opening forms a fifth semiconductor layer that fills the recess in the first semiconductor layer, the fifth semiconductor layer formed with GaN different from i-GaN; a third semiconductor layer formed on the fifth semiconductor layer inside the through-hole in the second semiconductor layer; a fourth semiconductor layer formed on the third semiconductor layer; a gate electrode formed on the fourth semiconductor layer in an area immediately above the through-hole in the second semiconductor layer; and a source electrode and a drain electrode formed in contact with the second semiconductor layer, wherein the fourth semiconductor layer is formed with a p-type semiconductor material, and the second semiconductor layer and the third semiconductor layer are formed with AlGaN, and the third semiconductor layer has a lower composition ratio of Al than that of the second semiconductor layer. | 41,537 |
9,231,262 | 1. A fuel cell voltage monitor ( 12 a , 12 b , 40 , 140 ), comprising: a rectilinearly-shaped fuel cell ( first and second voltage leads ( voltage comparing circuitry ( | 11,527 |
9,412,336 | 1. A tileable display panel comprising: a screen layer upon which a unified image is projected from a backside; an illumination layer including a two-dimensional array of lamps to generate lamp light; a display layer disposed between the screen layer and illumination layer, the display layer including a plurality of pixelets separated from each other by spacing regions, wherein each of the pixelets is positioned to be illuminated by a corresponding lamp from the illumination layer to project a magnified image sub-portion corresponding to one of a plurality of received subsets of pixel data onto the backside of the screen layer such that the magnified image sub-portions collectively blend together to form the unified image which covers the spacing regions on the display layer; and a controller including illumination layer control logic coupled to: | 46,684 |
8,719,389 | 1. An information handling system comprising: a processor; a memory communicatively coupled to the processor; and an access controller integrated in the information handling system and communicatively coupled to the processor, the access controller having stored thereon a general pre-boot execution environment (gPXE) binary file, the access controller configured to: | 3,663 |
9,290,431 | 1. A process for preparing highly pure, non-yellowing (meth)acrylic acid, comprising: a) condensing a (meth)acrylic acid-containing gas phase obtained via a gas phase oxidation process of a C4-compound to generate an aqueous (meth)acrylic acid solution; b) separating the (meth)acrylic acid from the aqueous (meth)acrylic acid solution to obtain crude (meth)acrylic acid; c) rectifying the crude (meth)acrylic acid in a rectification column to obtain pure (meth)acrylic acid via a sidestream outlet of the rectification column; d) treating the pure (meth)acrylic acid generated in c) with an ion exchange resin; and e) distilling the (meth)acrylic acid generated in d). | 19,782 |
8,547,509 | 1. A transflective type liquid crystal display (LCD) device comprising: a plurality of gate lines and a plurality of data lines formed on a first substrate to define at least one pixel region having a reflection area and a transmission area; a thin film transistor formed on a crossing point of the plurality of gate lines and the plurality of data lines; a passivation layer formed on the first substrate including the thin film transistor, and having a contact hole; a pixel electrode formed at an overall area of the pixel region on the passivation layer and electrically connected with the thin film transistor through the passivation layer; a dielectric layer contacting a portion of a top surface of the pixel electrode in the reflection area of the pixel region and around the contact hole and having a dielectric constant of about 2-5; a reflection plate contacting an overall area of the dielectric layer; a common electrode on an entire area of a second substrate that faces with the first substrate; and a liquid crystal layer between the first substrate and the second substrate, wherein an entire bottom surface of the pixel electrode directly contacts a flat top surface of the passivation layer, an inner surface of the contact hole and the thin film transistor in the contact hole, wherein the dielectric layer comprises an organic insulator and is disposed between the reflection layer and the pixel electrode to form a capacitance which causes a voltage supplied to the pixel electrode to be dropped, wherein the dielectric layer has a top surface, the top surface including a plurality of protrusions protruding from the top surface and a plurality of flat surfaces between the protrusions, and wherein a first distance between the pixel electrode of the first substrate and the common electrode of the second substrate in the transmission area is substantially identical to a second distance between the reflection plate of the first substrate and the common electrode of the second substrate in the reflection area. | 49,870 |
8,800,307 | 1. A method for operating a refrigeration system for a container for refrigerating chilled cargo, the method comprising: providing a refrigeration system including a compressor, a condenser, and an evaporator connected in series, an evaporator fan associated with the evaporator, and a heater, the refrigeration system operable to discharge supply air to the container and to receive return air from the container; determining the temperature of the supply air; determining the temperature of the return air; determining one of a requirement for heating and a requirement for cooling based on the temperature of the return air and the temperature of the supply air; activating the evaporator fan when a requirement for heating is determined and increasing the speed of the evaporator fan when increased heating is determined; and activating the compressor and the evaporator fan when a requirement for cooling is determined and increasing the power supplied to the compressor and maintaining the evaporator fan at a first speed when increased cooling is determined. | 14,816 |
9,120,388 | 1. A rotating electrical machine drive system for driving at least one three-phase rotating electrical machine of a plurality of drive sources included in a rotary shaft drive system for applying separate drive forces to one rotary shaft acting on a target object or for applying the drive forces to a plurality of rotary shafts acting on the same target object in an overlapping manner, the rotating electrical machine drive system comprising: a specific rotating electrical machine which is one of the at least one three-phase rotating electrical machine; a rotation speed calculator configured to calculate a rotation speed of the specific rotating electrical machine; a control current sensor configured to detect a current of at least one phase of the specific rotating electrical machine, the detected current being used for control of the specific rotating electrical machine; and a control apparatus configured to control the drive forces by controlling energization of the at least one three-phase rotating electrical machine, wherein the at least one phase of the specific rotating electrical machine, the current of which is detected by the control current sensor and capable of being used for the control of the specific rotating electrical machine, is defined as an effective sensor-phase of the specific rotating electrical machine, when the number of the effective sensor-phases is one, the control apparatus drives the specific rotating electrical machine in a one-phase control mode based on the current of the effective sensor-phase under a condition where the specific rotating electrical machine rotates in a forward direction and the rotation speed is greater than a predetermined positive threshold value or under a condition where the specific rotating electrical machine rotates in a reverse direction and the rotation speed is smaller than a predetermined negative threshold value, and when the number of the effective sensor-phases is one, the control apparatus drives the specific rotating electrical machine by using the drive force of at least one of the plurality of drive sources other than the specific rotating electrical machine under a condition where the specific rotating electrical machine rotates in the forward direction and the rotation speed is not greater than the positive threshold value or under a condition where the specific rotating electrical machine rotates in the reverse direction and the rotation speed is not smaller than the negative threshold value. | 33,363 |
8,373,302 | 1. An electric power transmission system of regional geographic extent, comprising: means for generating electric power via wind located in at least one geographic area having rich wind asset resources; means for generating electric power via solar radiation located in at least one geographic area having rich solar radiation asset resources; means for generating electric power via biomass located in at least one geographic area having rich biomass asset resources; a plurality of region-wide transmission facilities with each region-wide transmission facility of said plurality of region-wide transmission facilities having at least one collection facility for collecting electric power from at least one of said means for generating electric power via wind, said means for generating electric power via solar radiation and said means for generating electric power via biomass; inter-regional transmission facilities having means for selectively coupling the electric power generated by at least two of said means for generating electric power via wind, said means for generating electric power via solar radiation and said means for generating electric power via biomass at said at least one collection facility; and, at least one substation electrical facility coupled to each said collection facility of each said region-wide transmission facility for providing means for downloading the electrical power generated to a local electrical transmission grid. | 39,445 |
9,019,796 | 1. A front-end gear for connecting a set of streamers to a towing vessel, the front-end gear comprising: ropes for connecting a first sub-set of streamers to the vessel; lead-ins for connecting a second sub-set of streamers to the vessel; and a back loop cable electrically connected between tails of first and second adjacent streamers, wherein the first streamer belongs to the first sub-set of streamers and the second streamer belongs to the second sub-set of streamers. | 20,687 |
9,585,127 | 1. A method of transmitting uplink data by a user equipment in a wireless communication system, the method comprising: coding uplink control information (UCI) and a plurality of transport blocks (TBs) each containing the uplink data to generate a plurality of codewords (CWs), wherein channel quality information (CQI) of the UCI is multiplexed with the uplink data of only one TB from among the plurality of TBs and a rank indicator (RI) of the UCI is multiplexed in all the TBs; and transmitting the plurality of codewords (CWs) through a plurality of layers. | 13,214 |
9,222,718 | 1. A refrigerator made by the process of: providing a cabinet having an interior space defined by top, bottom, left side, right side, and back walls; molding a plastic liner into generally a box shape having top, bottom, left side, right side and back walls with an open front while applying heat in a vacuum box; moving a three dimensional plug relative to the plastic liner to deform the plastic liner and create an indented notch in an upper corner of the box shape, wherein the indented notch extends from the back of the box shape proximate to the open front of the box shape and further comprises: cooling the liner; punching out an aperture at the front of the box shape in alignment with the indented notch; fitting the molded plastic liner into an upper portion of the interior space of the cabinet; inserting a sleeve through the punched out aperture and along the indented notch; and foaming the sleeve in place. | 9,966 |
8,575,349 | 1. A compound of Formula I: wherein n is an integer of 1; R R X is nitrogen; R or R | 34,102 |
9,208,120 | 1. A data processing system comprising: a plurality of processing cores, said processing cores at least one processing core having a first bus protocol and at least one processing core having a second bus protocol; a bus converter connected to an address bus and a command address bus of each of said at least one processing core having a first bus protocol for converting said address from said first bus protocol to said second bus protocol supplied to said command address bus; a plurality of memory endpoints, each memory endpoint adapted for connection to a memory; and a crossbar connector connected to said plurality of processing cores, said bus converter and said plurality of memory endpoints for routing access requests from said processing cores to said memory endpoints having addresses converted from said first bus protocol to said second bus protocol by said bus converter and routing data between said processing cores and said memory endpoints. | 42,818 |
9,407,478 | 1. A bootstrapped, passive, differential, frequency conversion IQ mixer comprising: two buffers having a predetermined gain, each connected to one of positive and negative differential mixer inputs; differential In-phase, I, and Quadrature, Q, mixer circuits, each comprising wherein the shared bootstrap circuits in the I mixer circuit are each operative to charge their capacitor during each first half-period of a clock signal and, during each second half-period of the clock signal, to bootstrap an enabled one of the mixing transistors of the connected pair by connecting the charged capacitor between the connected buffer and a gate terminal of the enabled mixing transistor; wherein the shared bootstrap circuits in the Q mixer circuit are each operative to charge their capacitor during each second half-period of the clock signal and, during each first half-period of the clock signal, to bootstrap an enabled one of the mixing transistors of the connected pair by connecting the charged capacitor between the connected buffer and a gate terminal of the enabled mixing transistor; and wherein, during each alternate half-period of the clock signal in which the connected shared bootstrap circuit is not charging its capacitor, first the positive mixing transistors of the two pair in each of the I and Q mixer circuits are enabled, and then both negative mixing transistors of the two pair in each of the I and Q mixer circuits are enabled. | 690 |
9,249,689 | 1. A method for operating a combined cycle power plant (CCPP) having a gas turbine and a heat recovery steam generator (HRSG) with a flue gas recirculation system, comprising: calculating a target value for a flue gas recirculation rate as a function of at least one of combustion pressure and a hot gas temperature of a combustion chamber; controlling a flue gas recirculation rate (rFRG) of flue gases recirculated into a compressor inlet gas of the gas turbine by the flue gas recirculation system as a function of at least one of the combustion pressure and the hot gas temperature (Thot) of the combustion chamber; and adjusting the flue gas recirculation rate based on measured CO emissions, wherein a control band establishes an allowable flue gas recirculation rate as a function of at least one of the combustion pressure and the hot gas temperature around the target value. | 16,845 |
9,024,138 | 1. A plant of soybean cultivar 38141102, representative seed of said soybean cultivar having been deposited under ATCC Accession No. PTA-1212681. | 36,126 |
8,372,657 | 1. A microfluidic system for detecting a biological entity in a sample volume, the microfluidic system comprising: a chamber configured to receive the sample volume, wherein the chamber comprises a detection region for detecting the biological entity; a first port in fluid communication with the chamber; and a second port comprising a filter in fluid communication with the chamber; and wherein a fluid provided to the first port or the second port flows between the first port and the second port through the chamber such that the fluid provided to the first port passes the sample volume through the detection region and the filter to retain the biological entity at the filter, and the fluid provided to the second port transfers the biological entity retained at the filter to the detection region. | 47,760 |
8,935,620 | 1. A method of dynamically loading and unloading content for a Web page, comprising: receiving a first request relating to objects to be included on a Web page in a Web browser of a client device; providing a value corresponding to a total number of the objects to be included in response to the first request; receiving a second request relating to at least a first subset of the total number of objects, the first subset corresponding to at least a first viewing location of the Web page in the Web browser; providing an object identifier for individual objects in the first subset; for any remaining objects in the first subset that are not stored in cache on the client device, receiving a third request including the object identifiers for the remaining objects and returning the remaining objects to the client device in response thereto, whereby the Web browser is able to load the objects in the first subset to be viewable on the Web page near the first viewing location, and objects outside the first subset need not be loaded regardless of positions on the Web page; receiving a fourth request from the client device relating to at least a second subset of the total number of objects in response to a change from the first viewing location to a second viewing location, the second subset corresponding to the second viewing location, the objects in the first subset being unloaded from the Web browser and stored in cache in response thereto; providing an object identifier for individual objects in the second subset; and for any remaining objects in the second subset that are not stored in cache on the client device, receiving a fifth request including the object identifiers for the remaining objects and returning the remaining objects to the client device in response thereto, whereby the Web browser is able to load the objects in the second subset to be viewable on the Web page near the second viewing location, and objects outside the second subset need not be loaded regardless of positions on the Web page. | 22,430 |
9,677,449 | 1. A system for controlling the temperature of an exhaust reductant used within an exhaust treatment system of a work vehicle, the system comprising: a tank including a plurality of walls defining an enclosed volume for containing the exhaust reductant, the tank further including a threaded port defined through a first wall of the plurality of walls and a secondary port defined through one of the plurality of walls, the secondary port having a first crosswise width; and an electric heating device extending lengthwise within the tank between a first end and a second end, the electric heating device including a mounting portion at the first end and a heating element extending between the mounting portion and the second end, the mounting portion being configured to be screwed into the threaded port to couple to the electric heating device to the tank, the mounting portion extending from an interior of the tank at least partially through the threaded port, the heating element having a second crosswise width that is less than the first crosswise width where the heating element is inserted into the tank via the secondary port; and a controller communicatively coupled to the electric heating device, the controller being configured to control the operation of the electric heating device based on a temperature associated with the tank. | 42,685 |
9,747,165 | 1. A method for recovering a process in an application, the method comprising: running, within an application executing at a computing device, a guest process, the guest process storing and processing untrusted content; running, within the application and in parallel with the guest process, an embedder process, the embedder process storing and processing trusted content and a guest process state, the guest process state comprising stored or displayed values and data of the guest process for re-loading the guest process; signaling for updating the guest process state in the embedder process based on asynchronous communication between the guest process and the embedder process controlled or triggered by a user input event corresponding to an event to be handled by the guest process; signaling for adding the event to be handled to a queue for processing by the guest process, the queue comprising multiple events to be handled by the guest process; signaling for receiving, at the embedder process, an indication of an execution failure of the guest process; signaling for recovering the guest process after the execution failure based on the guest process state stored by the embedder process; signaling for handling, by the embedder process, the event added to the queue until the guest process is recovered; and if the guest process has become operational after the indication of the execution failure of the guest process, then signaling for handling, by the guest process, unprocessed events in the queue. | 10,132 |
8,444,087 | 1. An aerospace vehicle comprising: a fiber-reinforced composite stringer having reinforcing fibers positioned in a plurality of adjacent plies, a first one of the plies having reinforcing fibers oriented at a first non-zero angle between approximately zero degrees to twenty degrees relative to a direction of loading, a second one of the plies having reinforcing fibers oriented at about +65 degrees relative to the loading direction, and a third one of the plies having reinforcing fibers oriented at about −65 degrees relative to the loading direction; and a skin member secured to a flange of the stringer. | 34,449 |
9,478,319 | 1. A method of operating a nuclear reactor comprising: determining a concentration of a noble metal substance in oxides on a heat transfer surface of the nuclear reactor, the oxides being in an oxide layer formed directly on a heat transfer surface and in a crud layer formed on the oxide layer; determining a value correlating to an amount of oxides on the heat transfer surface of the nuclear reactor as a function of the concentration of the noble metal substance in the oxides using an expression representing an inducement of corrosion by the noble metal substance; subsequent to the determination of the value correlating to the amount of oxides on the heat transfer surface, determining that the value correlating to the amount of oxides on the heat transfer surface has reached a predetermined value; and altering operation of the nuclear reactor in response to the value correlating to the amount of oxides on the heat transfer surface reaching the predetermined value, the value correlating to the amount of oxides on the heat transfer surface of the nuclear reactor being a thickness of the oxide layer and the crud layer, the determining the concentration of the noble metal substance in the oxides comprising: the determination that the thickness of the oxide layer and the crud layer has reached a predetermined value including determining that the oxide layer thickness plus the crud layer thickness has reached the predetermined value, the altering operation of the nuclear reactor in response to the thickness of the oxide layer and the crud layer reaching the predetermined value including altering operation of the nuclear reactor in response to the oxide layer thickness plus the crud layer thickness reaching the predetermined value. | 22,565 |
8,988,038 | 1. A rolling luggage apparatus incorporating a means for charging electronic devices, comprising: a) a plurality of drive wheels, said drive wheels are mechanically attached to at least one axle, a rotation of the drive wheels produces rotational energy which is mechanically transferred via the axle to a gear ratio, said gear ratio is in mechanical communication with the axle; b) a plurality of generators, the generators having a rotor connected mechanically to the gear ratio; the generators thereby convert the rotational energy provided by the gear ratio into an AC output; c) a rectifier circuit, said rectifier circuit is electrically connected to the generators and converts the AC output into a DC output; d) a constant DC output circuit, said constant DC output circuit is electrically connected to the rectifier circuit and limits the DC output to USB standards; e) a charging circuit, said charging circuit is electronically connected to the constant DC output circuit, the charging circuit controls the charging of a plurality of batteries, f) a USB interface, said USB interface is electronically connected to the charging circuit, and allows for the mechanical insertion of a USB cable provided by the user wherein the USB cable is mechanically and electronically connected to an electronic device provided by the user, like a phone; g) an internal battery, said internal battery is electronically connected to the charging circuit; and h) a charge level indicator circuit, said charge level indicator circuit is electronically connected to the charging circuit, said charge level indicator circuit comprising a LED control circuit electronically connected to the charge level indicator circuit and a LED array. | 13,424 |
8,811,141 | 1. A communication system comprising a plurality of RF channels, wherein the RF channels comprise dissimilar channel bandwidths, the communication system comprising: an inverse fast Fourier transform module operable for transforming a plurality of frequency domain data symbols into a plurality of time domain data symbols respectively; a cyclic prefix selector module operable for selecting a cyclic prefix from a plurality of variable length cyclic prefixes to obtain a selected cyclic prefix; an add cyclic prefix module operable for adding the selected cyclic prefix into each of the time domain data symbols to obtain a plurality of OFDM frames; and a processor module operable for: providing a plurality of variable size sub-frames formed from a subset of the OFDM frames; providing a plurality of radio frames for transmitting a subset of the variable size sub-frames through at least one of the RF channels; and calculating a plurality of timing gaps associated with at least one of the variable size sub-frames for providing a protection for timing variations at signal reception, wherein the timing gaps are calculated based at least in part on a cyclic prefix duration of the selected cyclic prefix. | 37,822 |
9,335,809 | 1. An apparatus comprising: a memory; and a system on chip (SOC) integrated circuit comprising a first region having a processing core and a second region electrically isolated from the first region and comprising an always on domain power island with a power control block, the processing core configured to, responsive to receipt of a sleep command, transfer system data to the memory followed by the power control block opening a main switch to transition from a normal operational mode to a low power mode during which no electrical power is supplied to the first region and electrical power is continuously supplied to the second region, the power control block further configured to monitor the electrical power supplied to the second region during the low power mode and, responsive to receipt of a wake up command, close the main switch to resume application of electrical power to the first region and communicate status information to the processing core, the processing core further configured to perform a reinitialization operation to transition back to the normal operational mode responsive to the status information communicated to the processing core from the power control block, the processing core utilizing the transferred system data in the memory during the reinitialization operation responsive to the status information indicating a lack of a voltage fluctuation in the monitored electrical power, the processing core not utilizing the transferred system data in the memory during the reinitialization operation responsive to the status information indicating a presence of a voltage fluctuation in the monitored electrical power, the memory characterized as a volatile memory adapted to continuously receive power during the low power mode from a power supply module that also supplies the electrical power to the power control block, the power control block indicating the presence of a voltage fluctuation in said electrical power responsive to a voltage of the electrical power falling below a threshold determined to potentially corrupt the system data stored in the volatile memory. | 9,189 |
8,694,213 | 1. A construction machine having an upper revolving structure with a plurality of inertia objects each corresponding to each predetermined function, and a lower traveling body, the upper revolving structure comprising: a hybrid drive unit; a plurality of hydraulic actuators that drive each of the plurality of inertia objects; a hydraulic pump that supplies pressure oil to the plurality of hydraulic actuators; an engine that drives the hydraulic pump; a controller that enters the operational intention of an operator; a directional control valve unit that supplies the pressure oil supplied from the hydraulic pump to each of the hydraulic actuators in response to a pressure oil signal generated from the controller; an electric motor/power generator that drives the upper revolving structure either in cooperation with at least a corresponding one of the plurality of hydraulic actuators or independent of the plurality of hydraulic actuators; a servo driver that drives the electric motor/power generator; an electrostatic capacitor that supplies/receives electrical power to/from the servo driver; and a control unit that directs the generated torque to the servo driver in response to the pressure oil signal generated from the controller, and that switches over the control mode either to the power supply mode or to the regenerative power generation mode to direct the servo driver in accordance with the control mode, wherein the control unit determines the control mode of the control unit in accordance with the rotation direction of the upper revolving structure, the operating direction of the controller, the actual rotational velocity of the upper revolving structure, and the manipulated variable of the controller. | 18,281 |
9,313,966 | 1. A zucchini plant comprising at least a first set of the chromosomes of zucchini line ZGN-166-8012, a sample of seed of said line having been deposited under ATCC Accession Number PTA-13141. | 11,128 |
8,401,219 | 1. A headset configured to interface with a headset accessory including at least two headset accessory electrical contacts, the headset comprising: a connector plate formed from a ferromagnetic material and comprising: a non-conductive casing forming at least two protruding members, each protruding member extending through a respective one of the at least two apertures to form a distal end; and at least two electrical contacts, each contact disposed on the distal end of a respective one of the protruding members and electrically insulated from the connector plate, wherein: | 36,349 |
9,322,645 | 1. A rotary angle sensor used to determine a relative angular position as compared to a reference position, said rotary angle sensor comprising: a housing, at least one rotor that is rotatably mounted inside the housing and a circuit board with electronic components as well as one or more stators corresponding to the amount of used rotors, wherein bearing surfaces for the circuit board are provided in the direct radial vicinity of the stator inside the housing and wherein clamping structures are radially aligned with the stator in order to position the circuit board, and wherein there are sharable lamellae on every clamping structure. | 28,401 |
8,883,774 | 1. A method for increasing the cellular immune response of a subject, comprising administering to a subject an effective amount of one or more HIF-1α prolyl hydroxylase inhibitors having the formula: wherein Z is phenyl substituted with from 1 to 5 halogens chosen from fluorine and chlorine; R or a pharmaceutically acceptable salt thereof. | 24,937 |
8,811,284 | 1. A method of performing power management at a user equipment configured with a primary frequency resource and one or more non-primary frequency resources in a wireless communication system, the method comprising: configuring a Discontinuous Reception (DRX) cycle, the DRX cycle including an active time and a DRX time; and performing Physical Downlink Control Channel (PDCCH) monitoring on one or more activated frequency resources during the active time of every DRX cycle, wherein the same active time is applied to all of the one or more activated frequency resources, wherein the primary frequency resource is always activated, and the one or more non-primary frequency resources can be activated or deactivated, and wherein activation/deactivation of the one or more non-primary frequency resources is indicated using a field of Layer 2 (L2 ) message, the field having a fixed bit size regardless of a number of configured frequency resources. | 26,824 |
9,488,760 | 1. A highly reflective mirror for use in the wavelength range of 0.4 μm to 15 μm, the mirror comprising: a substrate, the substrate comprising fused silica; a barrier layer on the substrate, the barrier layer comprising Si a first interface layer on top of the barrier layer, the first interface layer comprising Al a reflective layer on top of the first interface layer, the reflective layer comprising Ag; a second interface layer on top of the reflective layer, the second interface layer comprising Al at least one tuning layer on top of the second interface layer, the at least one tuning layer comprising at least one from the group consisting of (i) YbF at least one protective layer on top of the tuning layer, the at least one protective layer comprising YbF said mirror have a reflectivity of at least 96% over the wavelength ranges of 0.4 μm to 1.8 μm and 3 μm to 15 μm at an AOI 45°. | 28,008 |
9,184,324 | 1. A solar energy collection system comprising: at least first and second solar modules, each comprising a solar collection member including an upper surface configured to receive sunlight for conversion into electrical energy and a lower surface opposite the upper surface, each of the first and second solar modules also comprising a support frame connected to the lower surface of the solar collection member; and a torque member having a longitudinal axis supported above the ground so as to be pivotable through a range of pivot motion of at least about 20° of rotation about the longitudinal axis; a plurality of solar module retention members fixed to the torque member and comprising a tool-less connection, the tool-less connections having sufficient strength to remain engaged with the support frames of the first and second solar modules as the torque member is tilted through the range of motion of at least about 20° about the longitudinal axis. | 40,687 |
9,359,628 | 1. A genetically engineered Pichia strain, which lacks a functional enzyme involved in production of high mannose structures, and comprises an exogenous nucleic acid encoding and expressing an exogenous enzyme for production of Man 5 GlcNAc 2 , wherein said enzyme involved in production of high mannose structures is α-1,6-mannosyltransferase encoded by the OCH1 gene, said exogenous enzyme for production of Man 5 GlcNAc 2 is α-1,2-mannosidase or an enzymatically active fragment thereof and is targeted to the endoplasmic reticulum (ER), wherein said OCH1 gene is disrupted in said strain and the OCH1 gene disruption is the sole genetic disruption of genes coding for Golgi mannosyl transferases acting in N-glycosylation of said strain, and wherein said strain produces Man 5 GlcNAc 2 as a N-glycan structure or an intermediate N-glycan structure. | 6,891 |
8,382,435 | 1. A vertical-axis wind generator, comprising: at least two pairs of horizontally rotating wind gathering blades having opposed ends said wind gathering blades on each end are oriented at a 90 degree rotation from each other; each pair of horizontal rotating wind gathering blades further has a complementary adjacent wind gathering blade wherein said set of complimentary wind gathering blades fold essentially flat together and 180 degrees opposed wherein; said folding is with a transmission that pivots vertically from a vertical driveshaft and links said complimentary blades together such that they operate in unison wherein; said transmission is with lever arms having a two-hinge assembly; said wind gathering blades are counter balanced; said wind gathering blades are counter-weighted; whereby (a) a wind drives said wind gathering blades around a drive shaft; (b) as each of said wind gathering blade comes into said wind, a respective one of said wind gathering blades is driven flat by said wind; whereby (c) tipping a corresponding one of said wind gathering blades opposing said respective one of said wind gathering blades on a wind gathering side to a vertical orientation to harness energy from said wind, and (d) said vertical-axis wind generator is weight balanced to reduce energy loss. | 37,669 |
9,638,483 | 1. An ammunition magazine for use with a reciprocally-cycled weapon for delinking and firing cartridges in close-end linked ammunition belts, comprising: a housing with an ammunition indexing mechanism fixed to one side of the housing, the housing configured to store the close-end linked ammunition belts and the ammunition indexing mechanism configured to feed the close-end linked ammunition belts; and a magazine feed box disposed above the ammunition indexing mechanism, the magazine feed box including a movable follower having an upper and a lower position and cam pins that engage cam slots in the magazine feed box, the movable follower being configured to receive a cartridge from the weapon, and wherein the ammunition indexing mechanism is a rotating sprocket that rotates about an axis and engages the close-end linked ammunition belts, and wherein the rotating sprocket is driven by the weapon, and wherein the movable follower is biased to the lower position by a spring-loaded follower return. | 33,969 |
8,628,836 | 1. An assembly comprising: a substrate arrangement, the substrate arrangement including: a non-metal layer, the non-metal layer being formed over the at least one protruding feature, wherein the non-metal layer engages the at least one protruding feature. | 15,647 |
9,556,776 | 1. A supply system for supplying urea comprising: a urea tank, a line to supply urea, a urea pump, a filter, and a mechanism to purge the line, the urea pump, and the filter and that comprises a non-return device including a bell/siphon combination and preventing urea from entering into the line, the urea pump, and the filter once they have been purged, wherein the urea pump, the filter, and the non-return device are combined in a compact module, the compact module comprising a common housing that surrounds the filter and at least one part of the urea pump, the non-return device being an integral part of the common housing. | 23,754 |
9,447,258 | 1. A composition comprising: at least one organosilicon compound A comprising at least two identical or different hydrolyzable and condensable groups, or at least two silanol functions ≡SiOH, at least one crosslinking agent B, optionally at least one filler C, and a catalytically effective amount of at least one polycondensation catalyst M which is a zinc complex comprising in its structure two types of ligand: carboxylate and amine, in which the polycondensation catalyst(s) M is obtained: a) by reacting per 1 mol of at least one zinc dicarboxylate of formula [Zn(carboxylate) b) after optionally removing the solvent and the residual amine, the polycondensation catalyst(s) M are recovered in the form of at least one zinc complex A, at least one zinc complex B or a mixture of zinc complex A and of zinc complex B, with optionally a residual amount of X | 38,741 |
9,525,630 | 1. A method comprising: receiving information indicative of allocation to a first memory cluster of a subset of processing resources in each of one or more other memory clusters; storing, in the first memory cluster, the information indicative of resources allocated to the first memory cluster; and facilitating management of transport operations between the first memory cluster and the one or more other memory clusters based at least in part on the information indicative of resources allocated to the first memory cluster, each transport operation comprising transfer of data, related to a corresponding processing operation, between the first memory cluster and one of the other memory clusters, work for the corresponding processing operation at least partially executed on the first memory cluster. | 30,642 |
8,535,330 | 1. A method of knee reconstruction, the method comprising the steps of: inserting a tibial sizer through an arthroscopic portal into a knee joint, the tibial sizer comprising a flexible, uninterrupted loop attached to a handle, and a point indicator indicating a center of the loop, the loop being configured to collapse while being inserted through the arthroscopic portal and to expand to its original diameter while exiting the arthroscopic portal and once within the knee joint; assessing dimensions of a defect in the tibial plateau by matching the point indicator with a center of the defect in the tibial plateau; forming a tibial socket in the tibia based on the dimensions of the defect; forming at least one cut on the femoral condyle; and securing at least at a tibial component of a knee implant in the socket of the tibia, wherein the size of the tibial component is based upon the dimensions of the defect in the tibial plateau. | 46,142 |
9,110,007 | 1. An optical sensor system, comprising: a source module including a source housing unit having a source window member, the source module to emit a detection signal through the source window member; a first detection module including a first detection housing unit having a first detection window member, the first detection module spaced apart from the source module to receive the detection signal to determine an amount of volatile organic compounds (VOC) present in a path of the detection signal between the source module and the first detection module; and a second detection module including a second detection housing unit including a second detection window member, the second detection module spaced apart from the source module to receive the detection signal to determine at least one of a presence and the amount of deposit formation of the VOC on the source window member and the second detection window member. | 76 |
8,748,625 | 1. A process for preparing an anhydrous crystal form of 3-[5-(2-fluorophenyl)-[1,2,4]oxadiazol-3-yl]-benzoic acid comprising Form A crystals characterized by at least one of the following: (a) unit cell parameters when measured at 150 K: a=24,220 Å; b=3,74640 Å; c=27,4678 Å; α=90°; β=92,9938°; γ=90°; V=2489,38(17) Å (b) an X-ray powder diffraction pattern comprising at least three peak positions (°2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: (c) a thermogravimetric analysis thermogram which has a mass loss of less than 1% of the total mass of the sample upon heating from 33° C. to 205° C.; (d) a differential scanning calorimetry thermogram which has an endothermic event with a peak temperature at 244° C.; and (e) fractional atomic coordinates equal to the following coordinates: (f) an X-ray powder diffraction pattern comprising at least three peak positions (°2θ±0.2), when calculated from single crystal data, selected from the group consisting of: wherein the process comprises: (1) subliming or heating a Form A crystal or crystallizing Form A from a solvent; or (2) exposing a Form B crystal to a relative humidity of 79% at 60° C. to convert Form B to Form A; or (3) milling a Form B crystal at ambient or sub-ambient temperature to convert Form B to Form A; or (4) slurrying a Form B crystal in methyl isobutyl ketone, or a 1:1 mixture of dioxane and water to convert Form B to Form A; or (5) subliming or heating a Form B crystal to convert Form B to Form A, wherein the Form B crystal is characterized by one or more X-ray powder diffraction patterns selected from an X-ray powder diffraction pattern comprising at least three peak positions (° 2±0.2), when measured using Cu Kα radiation, selected from the group consisting of: wherein the Form B crystal is characterized by an X-ray powder diffraction pattern comprising at least three peak positions (° 2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: wherein the Form B crystal is characterized by an X-ray powder diffraction pattern comprising at least three peak positions (° 2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: wherein the Form B crystal is characterized by an X-ray powder diffraction pattern comprising at least three peak positions (° 2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: wherein the Form B crystal is characterized by an X-ray powder diffraction pattern comprising at least three peak positions (° 2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: wherein the Form B crystal is characterized by an X-ray powder diffraction pattern comprising at least three peak positions (° 2θ±0.2), when measured using Cu Kα radiation, selected from the group consisting of: | 30,098 |
8,686,205 | 1. A process for making styrene comprising: converting methanol to formaldehyde in one or more first reactors to form a first product stream comprising formaldehyde; passing the first product stream to a first separation stage for separating formaldehyde from the first product stream; and reacting toluene and said formaldehyde in one or more second reactors over a catalyst comprising a zeolite selected from the group consisting of ZSM-5, ZSM-11, ZSM-22, ZSM-48, and ZSM-57, and promoted with Ru, Rh, Ni, Co, Pd, Pt, Mn, Ti, Zr, V, Nb, K, Cs, or Na to form a second product stream comprising styrene. | 38,186 |
8,407,386 | 1. A method comprising: accessing a shared memory associated with a reader-writer lock according to a first concurrency mode during execution of a first thread of a transaction in a software transactional memory (STM) system; determining if a value of the reader-writer lock has changed at commitment of the first thread; and if so, updating a count of a number of changed lock values for one of a set of locks, and re-executing the first thread of the transaction if the count is less than a threshold. | 25,290 |
9,397,362 | 1. A modular fuel cell power system comprising: a plurality of fuel cell modules each including a fuel cell stack and a fluid distribution plant in fluid communication with the fuel cell stack and configured to control the flow of reactant and air between reactant and air sources and the fuel cell stack, the fuel cell modules configured to selectively electrically connect the fuel cell stacks in parallel during certain periods and series during other periods. | 1,410 |
9,460,892 | 1. A charged particle beam writing method comprising: storing in a charged particle beam writing apparatus a specific position coordinate; storing in the charged particle beam writing apparatus a first time interval pattern defining first time intervals to diagnose a drift amount of a charged particle beam and a second time interval pattern associated with the specific position coordinate and defining second time intervals to diagnose a drift amount of the charged particle beam; performing a first writing by irradiating a target object with the charged particle beam using the charged particle beam writing apparatus, and writing a first predetermined writing pattern on the target object diagnosing a drift amount of the charged particle beam repeatedly with the first time intervals defined in the first time interval pattern during the first writing; diagnosing a drift amount of the charged particle beam when the first writing reaches the specific position coordinate; and performing a second writing by irradiating the target object with the charged particle beam after the first writing reaches the specific position coordinate, and writing a second predetermined writing pattern on the target object diagnosing a drift amount of the charged particle beam repeatedly with the second time intervals defined in the second time interval pattern during the second writing, wherein the first time intervals increase as time passes since start of application of the first interval pattern, and the second time intervals increase as time passes since start of application of the second interval pattern. | 49,790 |
8,902,188 | 1. A digitizer comprising: an input unit in which a magnet is embedded; a driving coil in which source supplies to induce a line of magnetic force; a sensing coil in which voltage or current is induced by the line of magnetic force; and a controlling unit supplying the source to the driving coil and measuring the voltage or the current induced in the sensing coil, wherein the controlling unit senses a change amount in the voltage or the current induced in the sensing coil to calculate a coordinate, when the voltage or the current induced in the sensing coil is changed by the magnet, and when the magnet embedded in the input unit approaches the sensing coil, the line of magnetic force induced in the driving coil is distorted by a line of magnetic force of the magnet to change the voltage induced in the sensing coil, and wherein the driving coil and the sensing coil perpendicularly intersect with each other. | 15,386 |
9,331,175 | 1. A method of stressing a semiconductor layer, comprising: depositing a layer of material to form a stressed layer over a semiconductor on insulator (SOI) structure, the SOI structure having a semiconductor layer in contact with an insulating layer; locally stressing said semiconductor layer by forming one or more openings in said stressed layer, said openings exposing first regions of said semiconductor layer in which transistor channels are to be formed; and in an annealing step at temperatures between 950° C. and 1150° C., deforming second regions of said insulating layer adjacent to said first regions by temporarily decreasing a viscosity of said insulating layer, thereby causing visco-plastic transformation in the second regions without causing visco-plastic deformation in at least some regions of the insulating layer outside the second regions, wherein the annealing step fixes the local stress in the semiconductor layer. | 7,543 |
9,653,641 | 1. A light emitting device comprising: an active layer configured to generate light in correspondence with a current injected thereinto; a first cladding layer and a second cladding layer sandwiching the active layer therebetween; and a first electrode and a second electrode configured to inject the current into the active layer, wherein the active layer constitutes a light waveguide through which the light is guided, wherein the light waveguide is provided with: wherein the second cladding layer includes a plurality of noncontact regions that are not electrically connected to the second electrode, wherein the plurality of noncontact regions intersect the light waveguide in a plan view, and wherein, in the plan view, a ratio of an area in which the plurality of noncontact regions overlap the first region to an area of the first region is greater than a ratio of an area in which the plurality of noncontact regions overlap the second region to an area of the second region, and is greater than a ratio of an area in which the plurality of noncontact regions overlap the third region to an area of the third region. | 5,619 |
9,425,327 | 1. A semiconductor device, comprising: a junction field effect transistor cell comprising a top gate region, a lateral channel region and a buried gate region arranged along a vertical direction, wherein the lateral channel region comprises first zones of a first conductivity type and second zones of a second conductivity type, the first and second zones alternating along a lateral direction perpendicular to the vertical direction, and the top and buried gate regions have the second conductivity type and the second zones directly adjoin the top gate region. | 44,148 |
9,604,609 | 1. An emergency in-lane steering assist system for maintaining a motor vehicle moving at a velocity within a lane to reduce a linear distance traveled by the motor vehicle during a braking event, the system comprising: an object sensor for detecting the presence of an object at a distance from the motor vehicle in a present path of the motor vehicle and from which the distance from the object to the motor vehicle may be determined, the object sensor transmitting a signal in response to the presence of the object in front of the motor vehicle and providing data from which the distance from the object to the motor vehicle is determined; a velocity sensor transmitting a signal and providing data from which the velocity of the motor vehicle is determined; a controller in communication with the object sensor and the velocity sensor, the controller calculating a Time to Contact (TTC) with the detected object; and a steering system responsive at least in part to operation by the controller; wherein if the calculated TTC is less than a predetermined TTC, the controller provides a lateral steering input to the steering system as an oscillating side-to-side steering input expressed as an oscillating wave modulated within a defined range of frequencies and amplitudes during the braking event to reduce the linear distance traveled by the motor vehicle relative to a predetermined path in the lane. | 30,991 |
9,404,152 | 1. A method of monitoring a solution flow in a microfluidic channel comprising: (a) moving a solution through the microfluidic channel in a chip to fill the channel with a solution and stop the solution flow to thermally cycle the entire length of the channels to perform a polymerase chain reaction (PCR) on the solution flow when the solution flow is stopped; (b) introducing a flow marker into the channel; (c) illuminating the channel at two measuring points; and (d) measuring the movement of the flow marker within the channel between the two measuring points. | 47,605 |
8,661,147 | 1. A content monitoring method comprising: receiving a request from a viewer to receive multimedia content; responsive to determining from metadata indicative of the multimedia content that the multimedia content does not comply with content criteria associated with the viewer, sending a first message to a communication device associated with an administrator wherein the first message includes: a streaming portion of the multimedia content for display as a video on the communication device and an indication of a title, a rating, and a program type of the multimedia content; responsive to determining that the multimedia content complies with content criteria associated with the viewer: monitoring an access parameter associated with the viewer and the request; responsive to determining that an access parameter does do not comply with an access criterion associated with the user, sending the first message to the communication device; responsive to receiving message input from the administrator, overlaying the multimedia content being displayed to the viewer with an administrative message indicative of the message input; wherein content criteria includes a criterion based on at least one of: the rating and the program type; and wherein the access parameter is indicative of a parameter selected from: a number of times the multimedia content is accessed by the user, a number of times a channel associated with the multimedia content is accessed by the user, and an amount of time the channel is accessed by the user. | 47,118 |
9,170,304 | 1. A battery state detecting method for estimating at least a quantity of a state of a battery, at least a state of charge (SOC) and a state of health (SOH), wherein the method comprises the steps of: generating reference data associated with a reference relaxation function F forming a relaxation function F estimating the quantity of the state of the battery after the completion of the charge or the discharge based on the relaxation function F wherein the relaxation function per reaction speed fi | 22,870 |
8,723,458 | 1. A soft start apparatus for a three phase motor using an alternator driven by a prime mover, wherein the apparatus comprises: a. an alternator operatively connected to the prime mover; b. a rectifier connected with the alternator; c. a variable speed drive comprising an input and an output, wherein the input is connected to the rectifier, wherein the output is connected to the three phase motor, and wherein the variable speed drive is configured to drive the three phase motor at selective rotational speeds, wherein the variable speed drive is configured to soft start the three phase motor with high torque and low revolutions per minute, wherein the soft start occurs at a slip frequency of the motor; and d. a logic and alternator field drive configured to sense voltage leaving the rectifier and controlling the alternator to maintain a predetermined output from the rectifier, wherein the logic and alternator field drive: e. a control circuit in communication with the rectifier, the alternator, the three phase motor, and the logic and alternator field drive, wherein the control circuit communicates with, and controls the alternator, and further wherein the control circuit comprises a circuit that communicates a presence of a power source causing the variable speed drive to actuate the three phase motor. | 38,154 |
9,029,693 | 1. A flexible solar cell photovoltaic module with a flexible substrate, comprising: a silicon series thin-film solar cell chip including: the flexible substrate, a transparent conductive film on the flexible substrate, a PIN-type silicon thin-film stack on the transparent conductive film, and a metal film layer on the PIN-type silicon thin-film stack; and packaging materials including a transparent front plate and a transparent rear plate, wherein, in the silicon series thin-film solar cell chip: the flexible substrate is a transparent modified polymer PI (polyimide) substrate with a substantially high light transmittance, and has light-passing through-holes pre-fabricated and distributed in a front electrode pattern region of the transparent, modified polymer PI substrate; the light-passing through-holes in the transparent, modified polymer PI substrate are one-to-one corresponding to through-holes distributed in a front electrode pattern region of a stainless steel template, and the light-passing through-holes are through each of the transparent modified polymer PI substrate, the transparent conductive film, the PIN-type silicon thin-film stack, and the metal film layer, and are distributed in each of the transparent modified polymer PI substrate, the transparent conductive film, the PIN-type silicon thin-film stack, and the metal film layer; and wherein the flexible solar cell photovoltaic module is formed by placing the silicon series thin-film solar cell chip between the transparent front plate, and the transparent rear plate with affinity and with pressure. | 2,830 |
8,994,210 | 1. A driver circuit for an electric vehicle, comprising: a first voltage driver having a first input line and a first output line, the first input line coupled to a microprocessor, the first output line coupled to a first side of a contactor coil of a contactor; a second voltage driver having a second input line, a second output line, and a second voltage sense line; the second input line coupled to the microprocessor, the second output line coupled to a second side of the contactor coil, the second voltage sense line coupled to the microprocessor; the microprocessor configured to generate a first pulse width modulated signal on the first input line to induce the first voltage driver to output a second pulse width modulated signal on the first output line that is received by the first side of the contactor coil to energize the contactor coil; the microprocessor further configured to iteratively measure a voltage on a first side of a contact in the contactor over time to obtain a first plurality of voltage values; the microprocessor further configured to determine a first filtered voltage value based on the first plurality of voltage values; the microprocessor further configured to iteratively measure a voltage on a second side of the contact in the contactor over time to obtain a second plurality of voltage values; the microprocessor further configured to determine a second filtered voltage value based on the second plurality of voltage values; the microprocessor further configured to iteratively measure a voltage on the second voltage sense line over time to obtain a third plurality of voltage values indicative of an amount of electrical current flowing through the second voltage driver; the microprocessor further configured to determine a first filtered current value based on the third plurality of voltage values; and the microprocessor further configured to stop generating the first pulse width modulated signal to de-energize the contactor coil if both the first filtered voltage value is substantially equal to the second filtered voltage value, and the first filtered current value is less than a threshold current value, indicating that an electrical short circuit to a ground voltage is present between the contactor coil and the second voltage driver. | 5,101 |
8,712,185 | 1. A method for numerically generating a centered discrete fractional Fourier transform matrix on a computer for use in processing an image, the centered discrete fractional Fourier transform matrix of size N by N where N is an odd integer, the method comprising: numerically calculating the N eigenvectors of an N by N discrete fractional Fourier transform matrix from a closed-form mathematical formula, the calculation performed on a computer; performing a barrel shift operation on each of the N eigenvectors to produce N shifted eigenvectors; performing a Gram-Schmidt orthogonalization procedure on the N shifted eigenvectors to produce a first set of improved-orthogonal shifted eigenvectors, the Gram-Schmidt orthogonalization procedure; testing the resulting first set of improved-orthogonal shifted eigenvectors for mutually orthogonality performed on the computer; if the first set of improved-orthogonal shifted eigenvectors does not possess enough mutually orthogonality, applying another Gram-Schmidt orthogonalization procedure on the first set of improved-orthogonal shifted eigenvectors to produce a second set of improved-orthogonal shifted eigenvectors, and testing the resulting second set of improved-orthogonal shifted eigenvectors for mutually orthogonality; wherein if the first set of improved-orthogonal shifted eigenvectors does not possess enough mutually orthogonality, applying another Gram-Schmidt orthogonalization procedure, and testing the resulting improved-orthogonal shifted eigenvectors for mutually orthogonality, continuing until a resulting set of improved-orthogonal shifted eigenvectors is sufficiently orthogonal, and wherein the resulting set of improved-orthogonal shifted eigenvectors that is sufficiently orthogonal is used to create a centered discrete fractional Fourier transform matrix for use in processing the image. | 37,754 |
9,051,903 | 1. A method for controlling an internal combustion engine, the engine including an engine block defining a plurality of cylinders, an intake manifold, an exhaust manifold, a controller and an exhaust gas recirculation (EGR) system, the EGR system including a cold EGR valve in communication with the intake manifold and a hot EGR valve in communication with the exhaust manifold, the EGR system circulating a portion of exhaust gases from the exhaust manifold to the intake manifold through the cold EGR valve, the controller communicating with the hot and cold EGR valves, the EGR system further including a high pressure turbine (HPT) disposed downstream of the hot EGR valve, the HPT coupled to a high pressure compressor (HPC) for driving the HPC, the EGR system further including a low pressure turbine (LPT) disposed downstream of the HPT turbine, the LPT coupled to a low pressure compressor (LPC) for driving the LPC, the LPC in communication with the HPC and an air inlet, the HPC also in communication with a bypass line that is in communication with the air inlet, the bypass line including a bypass valve for controlling air flow from the air inlet to the HPC, the method comprising: as the engine torque increases, at least partially closing the hot EGR valve and at least partially closing the bypass valve for a given engine speed; as the engine torque decreases, at least partially opening the hot EGR valve and at least partially opening the bypass valve for the given engine speed; wherein the portion of exhaust gases provided to the plurality of cylinders by the EGR system is greater than 40% of the total exhaust gases output from all of the cylinders. | 38,977 |
9,129,958 | 1. A semiconductor package, comprising: a substrate; a top semiconductor die disposed above the substrate; an interposer having a window, the interposer disposed between and interconnected to the substrate and the top semiconductor die; and a bottom semiconductor die disposed in the window of the interposer, and interconnected to the top semiconductor die, wherein, from a top-down perspective, the top semiconductor die only partially overlaps the bottom semiconductor die, and wherein the top semiconductor die is disposed above the bottom semiconductor die, and the bottom semiconductor die is disposed above external conductive contacts of the interposer. | 40,740 |
9,483,291 | 1. An integrated circuit, comprising: virtual function hardware accelerator modules that serve to improve performance for at least some virtual machine; and a virtualization accelerator management module that maintains a hierarchical accelerator resource availability registry, wherein the hierarchical accelerator resource availability registry specifies latency information corresponding to different types of hardware acceleration resources that are available to the integrated circuit for assisting with Network Functions Virtualization (NFV), wherein the hierarchical accelerator resource availability registry is configured to assign a first speed grade to hardware acceleration resources that are presently active on the integrated circuit and to assign a second speed grade to hardware acceleration resources that can be retrieved from a local storage device, and wherein the second speed grade is different than the first speed grade. | 38,029 |
9,409,120 | 1. A process for removal and recovery of CO 2 from a post-combustion flue gas, comprising: pre-concentrating a CO in a CO stripping absorbed CO | 41,857 |
9,113,298 | 1. A method of geofencing, comprising: a Kalman filter module to filter a plurality of past individual location fixes retrieved for a target device and produce a latest Kalman-filtered location of said target device; determining a predictive heading and velocity of said target device based on a plurality of Kalman-filtered locations; detecting a geofence boundary crossing by said target device based on said latest Kalman-filtered location of said target device together with said predictive heading and velocity; and dynamically determining time intervals between location fixes for said Kalman filter module using said predictive heading and velocity of said target device. | 5,769 |
9,649,011 | 1. An apparatus for cleaning and sterilizing an interior of a shoe, the apparatus comprising: a housing opened or closed with a door; a shoe supporting member mounted on a top end of a support pillar having a predetermined length and vertically installed in an inner space of the housing, wherein the shoe supporting member is configured to be inside the shoe and to support the shoe by hanging the shoe thereto; a vibration guide pipe fixed to an inside of the shoe supporting member; and a nozzle tube having a predetermined length, which is movably installed on a central axis of the vibration guide pipe in a horizontal state and formed of a hose, wherein compressed air and chemical solution are mixed at a rear end of the nozzle tube and sprayed through a front end nozzle of the nozzle tube so that the nozzle tube vibrates and collides with an inner wall surface of the vibration guide pipe. | 39,265 |
8,396,469 | 1. A method of associating a mobile user identifier identifying a mobile interface of a mobile phone and a radio identifier identifying a radio interface of said mobile phone, said mobile interface being based on a mobile technology and said radio interface being based on a radio technology different from said mobile technology, comprising: a) detecting, by a device configured to communicate with said radio interface, that said mobile phone is located within a coverage area of said device, thus recovering said radio identifier; b) establishing a radio connection based on said radio technology between said device and said mobile phone; c) transmitting to said mobile phone through said radio connection a command to access a mobile service for transmitting to an association server a message comprising said radio identifier; d) storing at said device a transmission time when said command has been transmitted to said mobile phone and information indicative of an outcome of said transmitting; e) upon reception of said command, automatically transmitting, by said mobile phone, said message to said association server through said mobile service; f) retrieving, by said association server, said mobile user identifier through said mobile service and reading said radio identifier from said message, thereby associating said mobile user identifier and said radio identifier; and g) estimating, based on the transmission time, a successive time when a refresh of the association is to be performed. | 45,800 |
9,089,597 | 1. A method of treating malaria comprising: (a) identifying a patient with malaria; (b) obtaining a garlic solution comprising garlic juice and water; and (c) injecting the garlic solution and a hydrocortisone solution into the patient. | 11,930 |
9,575,657 | 1. A computer-implemented method of replica migration of a dataset, comprising: identifying a first compute node and a second compute node; starting an application session on the first compute node when a first user-defined metric is met; determining an absence of a first replica of a dataset on the first compute node, wherein the first replica of the dataset is to be accessed by the application session, and wherein the first replica of the dataset comprises a set of data blocks; identifying the first replica of the dataset on the second compute node; creating a second replica of the dataset, the second replica of the dataset to be co-located with the first compute node, wherein the set of data blocks are absent from the second replica of the dataset; requesting, by the application session on the first compute node, a first data block of the dataset by the application session; identifying, in the second replica of the dataset, an absence of a copy of the first data block of the first replica of the dataset; retrieving a first data block of the first replica of the dataset from the second compute node; copying the retrieved first data block to the second replica; reading, in response to a request for the first data block by the application session, the first data block from the second replica, writing a second data block created by the application session to the second replica; writing the second data block to the first replica, wherein writing the second data block to the first replica depends on a consistency model of the data block, wherein when the consistency model is a full consistency model, then the second data block will be written to the first replica when the second data block is written to the second replica, wherein when the consistency model is an eventual consistency model, then the second data block is written to the second replica and after a second user-defined metric is met, the second data block is written to the first replica, wherein when the consistency model is a no consistency model, then the second data block is written to the second replica, wherein in the full consistency model all data block is consistent at all times from an application's viewpoint, wherein in the eventual consistency model a replica diverges for a limited period of time and is made consistent again with other replicas after a defined timespan. | 48,448 |
8,550,742 | 1. An anti-unlock screw device for a connector configured to maintain the connection between two connection elements, the device comprising: a cylindrical sleeve mounted to be fixed in translation and free in rotation around a first of the connection elements, said sleeve comprising an internal ring mounted coaxially in the rear portion of the cylindrical sleeve and positioned between the cylindrical sleeve and the first connection element, the internal ring comprising a blocking device configured to block by friction and configured to cooperate with a friction wall and a circular spacer, the friction wall and the circular spacer both configured to be fixed relative to the first connection element to keep said internal ring fixed in rotation relative to the cylindrical sleeve in a first direction of rotation so that the internal ring rotates at the same time as the first connection element, and, inversely, configured to keep said internal ring free in rotation relative to the cylindrical sleeve in a second direction of rotation opposite the first direction of rotation to permit the at least one catch to engage into the saw-tooth notches of the cylindrical sleeve, the blocking device comprising | 32,140 |
8,987,968 | 1. A power generator comprising: a rotor core provided with a permanent magnet; a stator core arranged to be radially opposed to said rotor core and provided with a plurality of slots; and wires wound in said slots of said stator core, and so formed that a number q of slots per pole per phase obtained by dividing the number of said slots by the number of poles of said permanent magnet and the number of phases of voltages is a fraction satisfying 1<q≦ 3/2, wherein each phase winding is wound across a plurality of teeth and said wire of each phase being wound between two non-adjacent slots, wherein said number q of slots per pole per phase is 8/7, by setting said number of said slots to 48, setting said number of permanent magnets to 14, and said number of phases of said voltages to 3, said wires include wires of a plurality of phases, each wire of said plurality of phases has a pair of wire portions to be wound in said slots so as to overlap each other, and said pair of wire portions is arranged in said stator core so as to face each other. | 28,395 |
9,082,495 | 1. A memory system comprising: a nonvolatile memory module including a plurality of nonvolatile memory devices; and a memory module controller configured to control the nonvolatile memory module, wherein at least two nonvolatile memory devices of the plurality of nonvolatile memory devices are configured to store serial presence detect (SPD) information; and wherein the memory module controller is configured to read the SPD information from the nonvolatile memory module and to set a communication mode with the nonvolatile memory module based on the read SPD information. | 34,764 |
9,577,231 | 1. A lithium-ion battery module comprising: a housing having a perimeter and one or more integral dividing walls extending between portions of the perimeter to define a plurality of compartments within the housing, wherein the housing comprises a base material that is electrically insulative; and a plurality of unformed lithium-ion cell elements, which are uncharged, wherein each unformed lithium-ion cell element of the plurality of unformed lithium-ion cell elements is disposed in a corresponding compartment of the plurality of compartments, and wherein each unformed lithium-ion cell element comprises a first terminal and a second terminal configured to enable formation of the unformed lithium-ion cell element while the unformed lithium-ion cell element is within the corresponding compartment by routing electrolyte through a cover of the housing; and a plurality of open-ended metal foil pouches, wherein each uniformed lithium-ion cell element of the plurality of unformed lithium-ion cell elements is disposed in a corresponding open-ended metal foil pouch of the plurality of open-ended metal foil pouches. | 13,730 |
9,284,625 | 1. A method of increasing stability of a pregnant liquor of a Bayer process comprising: adding to the pregnant liquor of a Bayer process a hyperbranched polyglycerol having a molecular weight of from 1,000 to 1,000,000 in an amount of no less than 0.1 ppm. | 34,120 |
9,458,472 | 1. A composition comprising a vector for transfecting a cell, the vector comprising: a) a first nucleic acid sequence encoding an antisense agent, said antisense agent comprising a first RNA interference target for a transcript of a gene endogenous to the cell, and b) a second nucleic acid sequence comprising wherein said third nucleic acid sequence is fused to said fourth nucleic acid sequence, and wherein said antisense agent does not alter protein translation by said second RNA interference target, and wherein 1) said first RNA interference target is selected from the group consisting of GATA3 antisense sequences CGAGTCGCTGAAGAGGTTCTG (SEQ ID NO:1), CGAGTCGCTGAAGAGGTTCTGCUUCAAGAGAGCAGAACCTCTTCAGC GACTCG (SEQ ID NO:3), GTAAGTGGTATAATTGTCTGG (SEQ ID NO:6), and 2) said cell-killing agent is selected from the group consisting of BAK protein and BAX protein, and 3) said second RNA interference target is selected from the group consisting of GATA3 mRNA sequences CAGAACCTCTTCAGCGACTCG (SEQ ID NO:5) and CCAGACAATTATACCACTTAC (SEQ ID NO:10). | 4,921 |
9,553,499 | 1. A cooling apparatus, comprising: a housing; a first inductor positioned in said housing; a potting material positioned about said first inductor, within said housing, and within a quarter inch of said first inductor, said potting material comprising: | 26,787 |
8,629,255 | 1. An isolated nucleic acid molecule, which confers enhanced ethanol tolerance to a microorganism and encodes a protein comprising a mutant alcohol dehydrogenase (ADH) domain of an acetaldehyde-CoA/alcohol dehydrogenase or alcohol dehydrogenase, said mutant ADH domain comprising an amino acid alteration at one or more residues corresponding to positions 494, 552, 553, 554, 557, 560, 604, 605, 607, 626, 627, 647, 653, 660, 664, 704, 730, 734, or 744 of SEQ ID NO:1. | 358 |
9,301,857 | 1. A method of performing an orthopaedic surgical procedure, comprising: securing an anchor to a tibial prosthetic component implanted in a proximal end of a patient's tibia, the tibial prosthetic component including a tibial tray and a tibial sleeve secured to the tibial tray, moving a separator posteriorly toward the anchor to position a tip of the separator between a lower side of the tibial tray and an upper end of the tibial sleeve, advancing the separator from anterior to posterior between the lower side of the tibial tray and the upper end of the tibial sleeve to detach the tibial tray from the tibial sleeve, and removing the tibial tray from the proximal end of the patient's tibia. | 18,817 |
9,843,891 | 1. A method of determining a position of a mobile device using positioning assistant data, the mobile device comprising a graphical user interface, the method comprising: prior to receiving the positioning assistance data, receiving a list of approved position reference devices through the graphical user interface of the mobile device; receiving positioning assistance data from a short-range position reference device, the positioning assistance data comprising a position of the position reference device; determining that the position reference device is in the list of approved position reference devices before setting the position of the mobile device to the position of the position reference device; and at the mobile device, setting the position of the mobile device to the position of the position reference device. | 9,268 |
9,774,059 | 1. A method to adjust a lithium supply of a battery cell including a negative working electrode, a positive working electrode, and an auxiliary electrode, the method comprising: measuring an open circuit potential of each of the two working electrodes using the auxiliary electrode as a reference electrode during an equilibrium state of the working electrodes at open circuit; determining a state of charge of each of the two working electrodes based on the measured open circuit potential of each of the two working electrodes; and based on the determined state of charge, transferring lithium between the auxiliary electrode and the positive working electrode without the lithium passing through the negative working electrode; wherein: | 49,235 |
9,316,124 | 1. A generating system by combining medium-and-low temperature solar energy and fossil fuel with thermochemical process, comprising: a material supply device configured to store fossil fuel and output the stored fossil fuel to a material mixing device; a material mixing device configured to receive and mix the fossil fuel from the material supply device with non-reacted reactant separated from a gas-liquid separating device and output the resultant mixture to a material metering device; a material metering device configured to control an amount of material fed to a material preheating device in unit time, so as to output the mixed material received from the material mixing device in a certain rate to a material preheating device; a material preheating device configured to heat the material received from the material metering device by using the exhaust heat from the power generating apparatus, to generate fossil fuel vapor and output it to a solar energy absorption and reaction device; a solar energy absorption and reaction device configured to drive the fossil fuel vapor received from the material preheating device by using solar thermal energy absorbed to make a decomposition reaction or reforming reaction by catalysts, through which the solar energy is converted to chemical energy of hydrogen-rich fuel, obtaining solar-energy fuel; a solar energy heat collecting device configured to collect the solar energy with low energy flux density to medium-and-low temperature solar thermal energy with high energy flux density in manner of line focus, so as to provide heat to the reaction of conversion of a fossil fuel to a solar energy in the solar energy absorption and reaction device; a condenser configured to cool reaction products from the solar energy absorption and reaction device and output the cooled reaction products to the gas-liquid separating device; a gas-liquid separating device configured to perform gas-liquid separation for the cooled mixture received from the condenser and output the separated gas phase reaction products and liquid phase reaction products to the fuel bypassing device and the material mixing device, respectively; a fuel bypassing device configured to control the flow of the solar-energy fuel to the power generating apparatus and the gas storing tank according to the solar energy source and energy demands from user, so as to achieve adjustment and control of the power generating system by combining solar energy and fossil fuel with thermochemical process; a gas storing tank configured to store the excess solar-energy fuel when solar energy source is abundant, achieving chemical energy storage, and, when solar energy source is not sufficient, complement the solar-energy fuel in the gas storing tank to the power generating apparatus, thereby achieving output control of the system; and a power generating apparatus configured to drive a generating set to generate by using solar-energy fuel as fuel and output electrical power. | 40,295 |
8,984,839 | 1. A reflecting-parabolic-splice-solar-smelter created by a parabolic-curve; said parabolic-curve rotated to form a revolution-of-a-parabolic-curve; the parabolic-curve rotated axially about a focal; the parabolic-curve spliced by a first-plane; said first-plane splices the parabolic-curve at an approximately 30 degree tangent; the first-plane splices the revolution-of-a-parabolic-curve created by said rotation; the parabolic-curve spliced by a second-plane; said second-plane splices the parabolic-curve at an approximately 45 degree tangent; the second-plane splices the revolution-of-a-parabolic-curve created by the rotation; the parabolic-curve rotated parallel and concentrically to the second-plane; the intersection of the first-plane angled from the second-plane at approximately 60 degrees at said focal; the approximately 45 degree tangent and the approximately 30 degree tangent angled at said approximately 60 degrees at the focal; the focal formed by the focus of the parabolic-curve; the focal formed by the focus of the revolution-of-a-parabolic-curve; an interior of the revolution-of-a-parabolic-curve creating a wall; said wall being reflective; the revolution-of-a-parabolic-curve interior, a first-plane interior and the second-plane form boundaries that create an open-void; said open-void is tilted approximately 60 degrees at the focal; the open-void capturing a sun's light; the revolution-of-a-parabolic-curve capturing said sun's light; the revolution-of-a-parabolic-curve is capable of reflecting the sun's light to the focal; the revolution-of-a-parabolic-curve reflecting the sun's light from sunset, sunrise, late morning, early morning, and noon to the focal; a crucible located at the focal; a tiled-floor to capture any stray rays not captured by said crucible; said tiled-floor parallel to the first-plane; the tiled-floor adjacent, and containing, centrally located, the crucible; the revolution-of-a-parabolic-curve is capable of reflecting the sun's light from sunset, sunrise, late morning, early afternoon, and noon to the tiled-floor; the revolution-of-a-parabolic-curve is capable of reflecting the sun's light from sunset, sunrise, late morning, early afternoon, and noon to the crucible; the revolution-of-a-parabolic-curve orient-able to the East or West direction; the open-void orient-able to the East or West direction; the exterior of the revolution-of-a-parabolic-curve is made of masonry; the splice of the first-plane and the revolution-of-a-parabolic-curve forming a base, or foundation; said base, or said foundation, is made of masonry; the revolution-of-a-parabolic-curve is static with zero degrees of freedom; the revolution-of-a-parabolic-curve is without the need for moving components; the revolution-of-a-parabolic-curve creating said reflecting-parabolic-splice-solar-smelter; the focal is formed by the focus of the reflecting-parabolic-splice-solar-smelter; the reflecting-parabolic-splice-solar-smelter is capable of reflecting stray rays to the tiled-floor. | 2,795 |
8,821,965 | 1. A method for depositing nano-objects on a surface, comprising: depositing and aligning the nano-objects at functionalized areas on a surface of a transfer layer comprising a polymer that is decomposable into evaporating units, wherein the transfer layer is on a substrate with surface patterns, and wherein each functionalized area corresponds to a respective surface pattern; and thinning down the transfer layer by energetic stimulation to decompose the polymer into the evaporating units until the nano-objects reach the surface of the substrate. | 45,211 |
9,721,749 | 1. An X-ray generator, comprising: an X-ray tube radiating primary X-rays to a specimen; a housing accommodating the X-ray tube; an X-ray radiation area controller limiting a radiation area of the primary X-rays from the X-ray tube to the specimen; and a device holder holding the X-ray radiation area controller with respect to the housing, wherein the X-ray tube includes a vacuumized case, an electron ray source disposed as a cathode in the case and generating electron rays, and a target unit disposed as an anode facing the electron ray source in the case, with a base fixed to the case, and receiving electron rays through a protruding free end, the device holder has a fixed-base fixed to the housing, directly under the base of the target unit, and a supporting extension extending from the fixed-base in a protrusion direction of the target unit and supporting the X-ray radiation area controller, a thermal expansion rate in an extension direction of the supporting extension from the fixed-base in the same direction as the protrusion direction of the target unit is the same as a thermal expansion rate in the protrusion direction of the target unit, and a distance from a portion of the supporting extension fixed to the housing to a central axis of the X-ray radiation area controller is the same as a distance from the base to an X-ray generation position at the free end of the target unit. | 49,265 |
9,630,158 | 1. A method of delivering a solution flow, comprising: causing a reagent and a primer to flow into a first mixing channel; stopping the reagent and the primer in the first mixing channel by keeping both ends of the first mixing channel at the same pressure for at least a threshold amount of time so as to allow the reagent and the primer to mix, thereby forming a reagent/primer mixture; causing a buffer to flow into a second mixing channel, the first and second mixing channels being located on a mixing chip, wherein the mixing chip is separate and in fluid communication with a PCR chip through an interface chip, wherein the PCR chip is configured for performing an amplification reaction; after holding the reagent and the primer in the first mixing channel for at least the threshold amount of time, drawing, from the first mixing channel, the reagent/primer mixture into a common exit channel located on the mixing chip; and adding DNA samples to the reagent/primer mixture while the reagent/primer mixture is in the interface chip. | 27,191 |
8,964,348 | 1. An actuator device ( 6 ) with an electromagnetic actuator ( 2 ) which has first and second magnet coils ( 4 , 5 ), as well as a shift element ( 3 ) which is linearly shifted by the first and the second magnet coils between three stable positions, the actuator device ( each of the three parallel connected bridge branches (B the first magnet coil ( | 13,907 |
8,536,799 | 1. A method comprising: receiving an input signal representing a supply voltage signal; detecting a dimmer affecting the supply voltage signal; generating a dimmer detection signal representing detection of the dimmer; determining a type of the dimmer affecting the supply voltage; and generating a dimmer type detection signal; wherein determining a type of the dimmer affecting the supply voltage comprises at least one of (A) and (B): | 48,467 |
9,219,102 | 1. A flexible organic electroluminescent device comprising: a flexible substrate; a buffer layer entirely formed on the flexible substrate; a thin film transistor formed on the buffer layer and configured to include an active layer; a planarization film formed to cover the thin film transistor; an organic light emitting diode formed on the planarization film and configured to include a first electrode, an organic emission layer and a second electrode; and at least one silicon nitride layer formed above the active layer of the thin film transistor but under the planarization film and patterned into a plurality of island patterns. | 44,234 |
9,357,472 | 1. A method, comprising: (a) detecting a temporal event by a source sensor node of a wireless sensor network comprising a multiplicity of sensor nodes; (b) in response to said source sensor detecting said temporal event, said source sensor converting data relating to the temporal event to a set of data packets and identifying multiple paths from said source sensor node to a sink of said wireless sensor network, said multiple paths consisting of sensor node to sensor node hops; and after (b), (c) using a processor of said source sensor node, said source node determining a distribution of each data packet of said set of data packets among each path of said multiple paths by simultaneously reducing (i) power consumed by sensor nodes in each path of said multiple paths and (ii) a time to transmit said data packets from said source sensor node to said sink using an optimization algorithm that optimizes the balance between power consumption of each path of said multiple paths and transmission delay through each path of said multiple paths. | 34,664 |
8,652,644 | 1. A lid for closing a cup along a circumferential sealing rim, the lid comprising: an aluminum foil; and a functional layer coextruded onto the aluminum foil; wherein the functional layer comprises one or more layers of a polymer film that is based upon polyethylene (PE), polypropylene (PP), or a mixture thereof; the polymer film including a cohesive line of weakness introduced by means of a CO wherein the aluminum foil is adjoined to the polymer film by a bonding agent that includes ethylene-acrylic acid copolymers. | 38,527 |
9,674,038 | 1. A method for automatically configuring network devices of a data network which includes at least two configurable network devices whose configuration parameters are deployable over the data network to configure the configurable network devices from a respective initial configuration state to a respective desired configuration state, at least one of the configurable network devices being from a first type of network devices whose configuration requires a predefined series of at least one intermediate configuration state in between the initial configuration state and the desired configuration state, the method comprising: operating a central deployment network device with a central deployment software-tool running thereon to perform or initiate the following: determining an actual state of each of the configurable network devices; comparing the actual states with respective desired states of the configurable network devices; in case of a difference, determining at least one respective subsequent intermediate or respective subsequent desired configuration state for at least one of the configurable network devices wherein the actual states of the configurable network devices are considered; deploying respective configuration parameters for the respective subsequent intermediate or desired configuration state to the respective configurable network device; and repeating the operation until all configurable network devices are configured as desired. | 43,046 |
8,810,328 | 1. A circuit arrangement for the inductive transfer of energy comprising: an oscillator; a device for detecting the load of the oscillator and for setting the circuit arrangement into one of multiple operating states depending on the detected load; wherein the device determines the load of the oscillator using an electrical variable occurring in the oscillator, wherein the device has a comparator that compares the detected load with a reference value, wherein the comparator is realized by a reset IC; and a power adaptor supplying the oscillator with energy and having complex input resistance that may be varied by a controllable switch. | 25,369 |
8,586,400 | 1. A fabricating method of an organic photodetector and an organic thin film transistor (OTFT), comprising: forming a first electrode and a gate on a substrate; forming a first insulation layer on the first electrode and forming a second insulation layer on the gate, wherein the second insulation layer further covers a side surface of the gate; forming a first organic layer on the substrate and the first insulation layer and forming a second organic layer on the second insulation layer, wherein the first organic layer further covers the first insulation layer and a side surface of the first electrode; and forming a second electrode on the first organic layer and forming a source/drain on the second organic layer, wherein the second electrode is disposed above the first insulation layer. | 25,579 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.