text string | size int64 | token_count int64 |
|---|---|---|
'''
@author: Josh Payne
Description: For creating multiple overlaid charts
'''
from mpl_toolkits.axes_grid1 import host_subplot
import mpl_toolkits.axisartist as AA
import matplotlib.pyplot as plt
import numpy as np
### Get values from performance.py, input here ###
x = [4, 5, 8, 9, 16, 32, 64]
lst = [(2.585895228... | 1,600 | 902 |
"""Utilities to download and import datasets.
* **Dataset loaders** can be used to load small datasets that come
pre-packaged with the pulse2percept software.
* **Dataset fetchers** can be used to download larger datasets from a given
URL and directly import them into pulse2percept.
.. autosummary::
:toct... | 804 | 310 |
#
# PySNMP MIB module TIMETRA-SAS-IEEE8021-PAE-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/TIMETRA-SAS-IEEE8021-PAE-MIB
# Produced by pysmi-0.3.4 at Wed May 1 15:21:45 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python vers... | 7,452 | 2,997 |
#!/usr/bin/env python
""" mk_all_level1_fsf.py - make fsf files for all subjects
USAGE: python mk_all_level1_fsf_bbr.py <name of dataset> <modelnum> <basedir - default is staged> <nonlinear - default=1> <smoothing - default=0> <tasknum - default to all>
"""
## Copyright 2011, Russell Poldrack. All rights reserved.
... | 7,093 | 2,491 |
import tweepy
import csv
class dealWithTwitter:
def __init__(self):
self.access_token = ""
self.access_token_secret = ""
self.consumer_key = ""
self.consumer_secret = ""
self.api = ""
def loadTokens(self):
tokens = []
with open('pwd.txt') as pwd_file:
... | 2,492 | 791 |
import json
import random
import numpy as np
import os
import time
import os.path
import networkx as nx
import users_endpoint.users
import grn_endpoint.grn_info
import move_endpoint.movement
import reward_endpoint.rewards
import matplotlib.pyplot as plt
from matplotlib.backends.backend_pdf import PdfPages
# Global var... | 22,175 | 7,656 |
# TODO:
# - allow inheritance from GDScript class
# - overload native method ?
import pytest
from godot.bindings import ResourceLoader, GDScript, PluginScript
def test_native_method(node):
original_name = node.get_name()
try:
node.set_name("foo")
name = node.get_name()
ass... | 2,384 | 811 |
# Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not u... | 1,880 | 695 |
"""The Worker class, which manages running policy evaluations."""
import datetime
import grpc
import gym
import os
from google.protobuf import empty_pb2
from proto.neuroevolution_pb2 import Evaluation, Individual
from proto.neuroevolution_pb2_grpc import NeuroStub
from worker.policy import Policy
ENVIRONMENT = os.ge... | 3,350 | 988 |
# -*- coding: utf-8 -*-
"""
Created on Sat Feb 16 17:05:36 2019
@author: Utente
"""
#Chapter 4
#docstring
import turtle
import math
bob = turtle.Turtle()
print(bob)
def polyline(t, n, lenght, angle):
#documentation string--->
"""Draws n line segments with the given lenght
and angle... | 836 | 300 |
x = 0
y = 0
aim = 0
with open('input') as f:
for line in f:
direction = line.split()[0]
magnitude = int(line.split()[1])
if direction == 'forward':
x += magnitude
y += aim * magnitude
elif direction == 'down':
aim += magnitude
elif directio... | 378 | 112 |
from . import type_checker
from .dtodescriptor import DTODescriptor
class DTOMeta(type):
def __init__(cls, name, bases, namespace, partial: bool = False):
super().__init__(name, bases, namespace)
def __new__(cls, name, bases, class_dict, partial: bool = False):
descriptors = {k: v for k, v i... | 2,329 | 633 |
#!/usr/bin/python3
import json
import pprint
import sys
import os
import numpy as np
import traceback
import random
import argparse
import json
import tensorflow
import keras
from keras import optimizers
from keras.models import Sequential
from keras.models import load_model
from keras.layers import Conv2D, MaxPooling... | 10,158 | 3,681 |
# vim: tabstop=4 shiftwidth=4 softtabstop=4
# Copyright (c) 2014 Thoughtworks.
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
#... | 43,498 | 12,497 |
from dataclasses import dataclass, field
from typing import List
from xml.etree.ElementTree import QName
__NAMESPACE__ = "http://schemas.microsoft.com/2003/10/Serialization/"
@dataclass
class Array:
class Meta:
namespace = "http://schemas.microsoft.com/2003/10/Serialization/"
item: List[object] = fi... | 1,239 | 373 |
#
# PySNMP MIB module PRIVATE-SW0657840-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/PRIVATE-SW0657840-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:33:18 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (def... | 54,161 | 27,874 |
from __future__ import print_function
try:
import h5py
WITH_H5PY = True
except ImportError:
WITH_H5PY = False
try:
import zarr
WITH_ZARR = True
from .io import IoZarr
except ImportError:
WITH_ZARR = False
try:
import z5py
WITH_Z5PY = True
from .io import IoN5
except ImportError:
... | 14,005 | 4,713 |
class MinDiffList:
# def __init__(self):
# self.diff = sys.maxint
def findMinDiff(self, arr):
arr.sort()
self.diff = arr[len(arr) - 1]
for iter in range(len(arr)):
adjacentDiff = abs(arr[iter + 1]) - abs(arr[iter])
if adjacentDiff < self.diff:
... | 481 | 177 |
"""
Add the taxonomy to the patric metadata file
"""
import os
import sys
import argparse
from taxon import get_taxonomy_db, get_taxonomy
c = get_taxonomy_db()
if __name__ == '__main__':
parser = argparse.ArgumentParser(description="Append taxonomy to the patric metadata file. This adds it at column 67")
par... | 2,075 | 648 |
from __future__ import division
import numpy as np
from rawADCPclass import rawADCP
from datetime import datetime
from datetime import timedelta
import scipy.io as sio
import scipy.interpolate as sip
import matplotlib.pyplot as plt
import seaborn
def date2py(matlab_datenum):
python_datetime = datetime.fromordinal(... | 11,450 | 4,177 |
"""
Author: CaptCorpMURICA
Project: 100DaysPython
File: module1_day06_lists.py
Creation Date: 6/2/2019, 8:55 AM
Description: Learn the basic of lists in python.
"""
list_1 = []
list_2 = list()
print("List 1 Type: {}\nList 2 Type: {}".format(type(list_1), type(list_2)))
... | 1,923 | 845 |
class MagicDice:
def __init__(self, account, active_key):
self.account = account
self.active_key = active_key
| 131 | 40 |
# ========================
# Information
# ========================
# Direct Link: https://www.hackerrank.com/challenges/repeated-string/problem
# Difficulty: Easy
# Max Score: 20
# Language: Python
# ========================
# Solution
# ========================
import os
# Complete the repeatedStrin... | 708 | 244 |
#!/usr/bin/python
from fvregress import *
import string # really? you have to do this?
if len(sys.argv) > 1 :
wantPause = True
timeout=9999999
valgrindArgs= []
else:
wantPause = False
timeout=5
valgrindArgs= None
# start up a flowvisor with 1 switch (default) and two guests
#h= HyperTest(guests=[('localhost'... | 6,056 | 3,860 |
"""
Writing actual code might be hard to understand for new-learners. Pseudocode is a tool
for writing algorithms without knowing how to code. This module contains classes and
methods for parsing pseudocode to AST and then evaluating it.
Example:
If you installed this module with pip you can run pseudocode from fi... | 1,325 | 404 |
from talon import (
Module,
Context,
)
mod = Module()
mod.tag("deep_sleep", desc="Enable deep sleep")
ctx = Context()
@mod.action_class
class Actions:
def enable_deep_sleep():
"""???"""
ctx.tags = ["user.deep_sleep"]
def disable_deep_sleep():
"""???"""
ctx.tags = []
| 320 | 111 |
"Module 'upip_utarfile' on firmware 'v1.10-247-g0fb15fc3f on 2019-03-29'"
DIRTYPE = 'dir'
class FileSection(): ...
def read():
pass
def readinto():
pass
def skip():
pass
REGTYPE = 'file'
TAR_HEADER = None
class TarFile(): ...
def extractfile():
pass
def next():
... | 396 | 151 |
from zeit.cms.i18n import MessageFactory as _
import zope.formlib.interfaces
import zope.interface
@zope.interface.implementer(zope.formlib.interfaces.IWidgetInputError)
class DuplicateAuthorWarning(Exception):
def doc(self):
return _(
u'An author with the given name already exists. '
... | 482 | 138 |
def countWord(word):
count = 0
with open('test.txt') as file:
for line in file:
if word in line:
count += line.count(word)
return count
word = input('Enter word: ')
count = countWord(word)
print(word, '- occurence: ', count) | 237 | 89 |
import random
import os
import logging
import pickle
import numpy as np
import torch
import torch.nn as nn
import torch.nn.functional as F
import torch.backends.cudnn as cudnn
# import faiss
################################################################################
# General-... | 9,190 | 3,092 |
header = """/*
Icebreaker and IceSugar RSMB5 project - RV32I for Lattice iCE40
With complete open-source toolchain flow using:
-> yosys
-> icarus verilog
-> icestorm project
Tests are written in several languages
-> Systemverilog Pure Testbench (Vivado)
-> UVM testbench (Vivado)
-> PyUvm (Icarus)
-> Formal ... | 7,009 | 2,530 |
import feedparser
def read_rss_feed(feed_url):
feed = feedparser.parse(feed_url)
return [trim_entry(entry) for entry in feed.entries]
def trim_entry(entry):
return {
'date': "{}/{}/{}".format(entry.published_parsed.tm_year, entry.published_parsed.tm_mon, entry.published_parsed.tm_mday),
't... | 438 | 149 |
import asyncio
import datetime
import json
import logging
import os
import sys
import typing
from pathlib import Path
from typing import Any, Dict, Optional, Tuple
import discord
import toml
from discord.ext.commands import BadArgument
from pydantic import BaseModel
from pydantic import BaseSettings as PydanticBaseSet... | 9,229 | 2,767 |
# plot rotation period vs orbital period
import os
import numpy as np
import matplotlib.pyplot as plt
import pandas as pd
import glob
import re
from gyro import gyro_age
import teff_bv as tbv
import scipy.stats as sps
from calc_completeness import calc_comp
# np.set_printoptions(threshold=np.nan, linewidth=9)
plotpar... | 5,851 | 2,496 |
# Copyright 2016, 2017 California Institute of Technology
# Users must agree to abide by the restrictions listed in the
# file "LegalStuff.txt" in the PROPER library directory.
#
# PROPER developed at Jet Propulsion Laboratory/California Inst. Technology
# Original IDL version by John Krist
# Python transla... | 9,911 | 3,809 |
__author__ = 'cmantas'
from tools import *
# Kmeans mahout vs spark
m_q = """select mahout_kmeans_text.documents/1000, mahout_kmeans_text.time/1000
from mahout_tfidf inner join mahout_kmeans_text
ON
mahout_tfidf.documents=mahout_kmeans_text.documents AND
mahout_tfidf.dimensions=mahout_kmeans_text.dimensions
where ... | 1,571 | 683 |
# Copyright 2021 Huawei Technologies Co., Ltd
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to... | 1,818 | 594 |
# -*- coding: utf-8 -*-
# Copyright (c) 2016, 2017, 2018, 2019 Sqreen. All rights reserved.
# Please refer to our terms for more information:
#
# https://www.sqreen.io/terms.html
#
import logging
import traceback
from datetime import datetime
from ..runtime_storage import runtime
from ..utils import is_string
LO... | 3,338 | 995 |
# Copyright (c) 2021, Roona and Contributors
# See license.txt
# import frappe
import unittest
class TestRoonaAppSetting(unittest.TestCase):
pass
| 149 | 54 |
# coding=utf-8
# noinspection PyUnresolvedReferences
import maya.cmds as cmds
from LxBasic import bscMtdCore, bscObjects, bscMethods
#
from LxPreset import prsConfigure, prsOutputs
#
from LxCore.config import appCfg
#
from LxCore.preset.prod import assetPr
#
from LxDatabase import dtbMtdCore
#
from LxDatabase.data imp... | 37,505 | 10,428 |
import json
class Service(object):
id: int = None
name: str = None
type: int = None
type_name: str = None
repeat_period: int = 5 # repeat period by second
metadata = {}
def __init__(self, arr: list):
self.id = arr[0]
self.name = arr[1]
self.type = arr[2]
... | 441 | 148 |
import json
import pickle
import re
from copy import copy, deepcopy
from functools import lru_cache
from json import JSONDecodeError
from os import system, walk, sep
from abc import ABC, abstractmethod
from pathlib import Path
import time
from subprocess import check_output
from tempfile import NamedTemporaryFile
from ... | 22,422 | 6,302 |
# encoding=utf8
from load_to_db import *
save_list = []
import random
import string
def randomString(url, stringLength=20):
"""Generate a random string of fixed length """
Letters = string.ascii_lowercase + string.ascii_uppercase + string.digits
url_split = url.split(".")
format_ = url_split[-1]
... | 801 | 258 |
num = int(input())
x = 0
if num == 0:
print(1)
exit()
while num != 0:
x +=1
num = num//10
print(x)
| 124 | 61 |
import math
from stable_baselines_model_based_rl.wrapper.step_handler import StepRewardDoneHandler
class ContinuousMountainCarStepHandler(StepRewardDoneHandler):
goal_position = 0.45
goal_velocity = 0
def get_done(self, step: int) -> bool:
s = self.observation.to_value_list()
... | 786 | 268 |
from django.core.exceptions import FieldError
from django.db import ProgrammingError
from stats.models import Tour, Sortie
from django.db.models import Max
import config
RETRO_COMPUTE_FOR_LAST_TOURS = config.get_conf()['stats'].getint('retro_compute_for_last_tours')
if RETRO_COMPUTE_FOR_LAST_TOURS is None:
RETRO_C... | 3,305 | 908 |
## -*- coding: utf-8 -*-
#
# Copyright (c) 2016, Veritomyx, Inc.
#
# This file is part of the Python SDK for PeakInvestigator
# (http://veritomyx.com) and is distributed under the terms
# of the BSD 3-Clause license.
from .base import BaseAction
class RunAction(BaseAction):
"""This class is used to make a RUN cal... | 2,016 | 577 |
#!/usr/bin/env python3
import os
import sys
import json
from datetime import datetime
from submitty_utils import dateutils
def generatePossibleDatabases():
current = dateutils.get_current_semester()
pre = 'submitty_' + current + '_'
path = "/var/local/submitty/courses/" + current
return [pre + name for name in ... | 3,757 | 1,344 |
class SpecValidator:
def __init__(self, type=None, default=None, choices=[], min=None,
max=None):
self.type = type
self.default = default
self.choices = choices
self.min = min
self.max = max
| 252 | 71 |
#
# levelpy/async/__init__.py
#
import asyncio
| 48 | 22 |
# -*- coding: utf-8
# Models
from ..models import Channel, ChannelUser, Message
async def test_channel_model(channel_data):
channel = Channel(
owner_id=1,
name='General')
channel = await channel.create()
assert repr(channel) == "<Channel: 'General'>"
async def test_channel_user_model(c... | 751 | 237 |
from ._base import BaseModel, BaseModelMeta, BaseTableModel
from ._schema import BaseField, ModelSchema, ModelSchemaMeta, Pluck, fields
from .attachment import AttachmentModel
from .table import TableModel
| 206 | 53 |
"""FactoryAggregate provider prototype."""
class FactoryAggregate:
"""FactoryAggregate provider prototype."""
def __init__(self, **factories):
"""Initialize instance."""
self.factories = factories
def __call__(self, factory_name, *args, **kwargs):
"""Create object."""
ret... | 506 | 141 |
"""Test cnlunardate."""
import unittest
import pickle
from cnlunardate import cnlunardate
from cnlunardate import MIN_YEAR, MAX_YEAR
from datetime import timedelta
pickle_loads = {pickle.loads, pickle._loads}
pickle_choices = [(pickle, pickle, proto)
for proto in range(pickle.HIGHEST_PROTOCOL + 1)... | 27,385 | 10,009 |
# -*- coding: utf-8 -*-
import time
def time_now():
"""returns current unix time as an integer"""
return int(time.time())
def get_day_times(num_days=1, end_time=time_now()):
"""returns a list of tuples, where each tuple contains the start and end
times (in unix time format, as integers) of the day(s... | 756 | 257 |
# Copyright (c) 2017, IGLU consortium
# All rights reserved.
#
# Redistribution and use in source and binary forms, with or without modification,
# are permitted provided that the following conditions are met:
#
# - Redistributions of source code must retain the above copyright notice,
# this list of conditions and... | 4,593 | 1,624 |
import logging
import sqlite3
from logging import Logger
from sqlite3 import Connection
from typing import Optional
from slack_sdk.oauth.installation_store.async_installation_store import (
AsyncInstallationStore,
)
from slack_sdk.oauth.installation_store.installation_store import InstallationStore
from slack_sdk.... | 9,244 | 2,213 |
from django.contrib import admin
from parler.admin import TranslatableAdmin
from .models import Address, Municipality, Street
@admin.register(Municipality)
class MunicipalityAdmin(TranslatableAdmin):
pass
@admin.register(Street)
class StreetAdmin(TranslatableAdmin):
pass
@admin.register(Address)
class Ad... | 381 | 112 |
from collections import Iterable
from h5py import RegionReference
from .form.utils import docval, getargs, ExtenderMeta, call_docval_func, popargs
from .form import Container, Data, DataRegion, get_region_slicer
from . import CORE_NAMESPACE, register_class
from six import with_metaclass
def set_parents(container, p... | 7,704 | 2,317 |
import os
import pandas as pd
from open_geo_engine.src.get_google_streetview import GetGoogleStreetView
def test_get_google_streetview():
size = "600x300"
heading = "151.78"
pitch = "-0.76"
key = os.environ.get("GOOGLE_DEV_API_KEY")
image_folder = "tests/test_data"
links_file = "tests/test_da... | 2,246 | 978 |
#!/usr/bin/env python
"""
_selfupdate_
Util command for updating the cirrus install itself
Supports getting a spefified branch or tag, or defaults to
looking up the latest release and using that instead.
"""
import sys
import argparse
import arrow
import os
import requests
import inspect
import contextlib
from cirru... | 6,186 | 1,863 |
from base_bot import log
def atoi(text):
return int(text) if text.isdigit() else text
def bool_to_emoticon(value):
return value and "✅" or "❌"
# https://stackoverflow.com/questions/7204805/how-to-merge-dictionaries-of-dictionaries
# merges b into a
def merge(a, b, path=None):
if path is None: path = [... | 1,335 | 468 |
from jsgf import parse_grammar_string
def main(args):
# Parse input grammar file.
with open(args.input_file_path, "r") as fp:
text = fp.read()
print("\ninput grammar: ")
print(text)
grammar = parse_grammar_string(text)
# Print it.
print("\noutput grammar: ")
text = ... | 877 | 295 |
# coding: utf-8
import os
import logging.config
from webspider import setting
LOG_FILE_PATH = os.path.join(setting.BASE_DIR, 'log', 'spider_log.txt')
LOGGING_CONFIG = {
'version': 1,
'disable_existing_loggers': True,
'formatters': {
'default': {
'format': '%(asctime)s- %(module)s:%(l... | 2,685 | 848 |
# Copyright (c) 2015 Hitachi Data Systems, Inc.
# All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# U... | 53,851 | 19,080 |
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""Generate dummy data for tests/examples
"""
import numpy as np
def dummy_gauss_image(x=None, y=None,
xhalfrng=1.5, yhalfrng=None, xcen=0.5, ycen=0.9,
xnpts=1024, ynpts=None, xsigma=0.55, ysigma=0.25,
nois... | 2,978 | 1,118 |
from approximate_equilibrium.optimize.optimization import de_optimizer, objective_function, brute_force_optimizer, objective_function_iccn, gradient_optimizer
| 159 | 43 |
"""
Copyright 2021 Dynatrace LLC
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
... | 4,295 | 1,253 |
from .. import Check
from .common import common_checks
def check(db):
for org in db.organizations.find({"classification": "legislature"}):
for check in common_checks(org, 'organization', 'organizations'):
yield check
jid = org.get('jurisdiction_id')
if jid is None:
... | 2,984 | 821 |
from sdk.color_print import c_print
from tqdm import tqdm
#Migrate
def compare_trusted_networks(source_networks, clone_networks):
'''
Accepts the source trusted alert network list and a clone trusted alert network list.
Compares the source tenants network list to a clone tenant networks list.
'''
... | 5,165 | 1,680 |
# Copyright 2015 Google Inc. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or ag... | 4,004 | 1,068 |
from typing import Any, Dict, List, Tuple
from unittest import TestCase
from ..cterm import CTerm
from ..kast import TRUE, KApply, KInner, KVariable
from ..kcfg import KCFG
from ..prelude import token
def nid(i: int) -> str:
return node(i).id
# over 10 is variables
def term(i: int) -> CTerm:
inside: KInner... | 7,047 | 2,732 |
from cortexpy.tesserae import Tesserae
class TestTesserae:
def test_mosaic_alignment_on_short_query_and_two_templates(self):
# given
query = "GTAGGCGAGATGACGCCAT"
targets = ["GTAGGCGAGTCCCGTTTATA", "CCACAGAAGATGACGCCATT"]
# when
t = Tesserae()
p = t.align(query, ta... | 645 | 260 |
try:
from ._version import version as __version__
except ImportError:
__version__ = "unknown"
from . import _key_bindings
del _key_bindings
| 151 | 49 |
import numpy as np
from numpy.random import RandomState
from numpy.testing import assert_allclose
from nnlib.l_layer.backward import linear_backward, linear_backward_activation, model_backward
from nnlib.utils.derivative import sigmoid_backward, relu_backward
from nnlib.utils.activation import sigmoid, relu
def test... | 8,544 | 4,825 |
"""Uploaded data to nuuuwan/news_lk:data branch."""
from news_lk import scrape
if __name__ == '__main__':
scrape.scrape_and_dump()
| 137 | 56 |
from schematics import Model
from schematics.types import IntType, UUIDType, StringType, BooleanType
from ingredients_db.models.region import RegionState, Region
from ingredients_http.schematics.types import ArrowType, EnumType
class RequestCreateRegion(Model):
name = StringType(required=True, min_length=3)
... | 1,814 | 556 |
#!/usr/bin/env python3
from src.cli import Cli
from src.core import Orchestrator
def main():
config, args = Cli.parse_and_validate()
Orchestrator.launch_modules(config, args.modules, args.targets, args.audit)
if __name__ == '__main__':
main() | 257 | 91 |
# -*- coding: utf-8 -*-
# DO NOT EDIT THIS FILE!
# This file has been autogenerated by dephell <3
# https://github.com/dephell/dephell
try:
from setuptools import setup
except ImportError:
from distutils.core import setup
import os.path
readme = ''
here = os.path.abspath(os.path.dirname(__file__))
readme_... | 1,696 | 654 |
#!/cm/shared/languages/python-3.3.2/bin/python
# submit script for submission of mizuRoute simualtions
# Peter Uhe Oct 29 2019
#
# call this script from 'run_mizuRoute_templated_mswep050calib.py which creates a qsub job to submit to the HPC queue
# This script is actually called from 'call_pythonscript.sh' (which is n... | 1,505 | 542 |
from xml.etree.ElementTree import iterparse, ParseError
from io import StringIO
from os.path import isfile
from re import findall
class XmlParser:
def __init__(self, source=""):
self.source = source
self.proces_file = False
self.use_io = False
self.encoding = 'UTF-8'
self.... | 17,968 | 4,550 |
from flask import Flask, request
from flask_restful import Resource
from .models import Order, orders
class OrderDetals(Resource):
def get(self, id):
order = Order().get_order_by_id(id)
if not order:
return {"message":"Order not found"}, 404
return {"order": ord... | 1,404 | 408 |
from typing import Mapping, Any, Sequence
import numpy as np
import heapq
import math
from tqdm import tqdm
import scipy.optimize
import cvxpy as cvx
def n_bias(x_count: np.ndarray, bias: float):
# return np.sum(x_count[x_count >= bias])
clipped = np.clip(x_count - bias, a_min=0, a_max=None)
return n... | 5,198 | 2,148 |
import json, os
## base spawner config
try:
c.Spawner.cmd = \
json.loads(os.environ['SPAWNER_CMD'])
except KeyError:
c.Spawner.cmd = [
'jupyterhub-singleuser', # OAuth wrapped jupyter instance server
'--KernelManager.transport=ipc', # -- all kernel comms over UNIX sockets
'--Ma... | 874 | 310 |
__all__ = ['get_dataset']
def get_dataset(params):
if params['name'] == 'multimodal_points':
from datasets.multimodal_gaussian_2d import Dataset
return Dataset(params)
elif params['name'] == 'kicks':
from datasets.kicks import Dataset
return Dataset(params)
assert False and... | 339 | 103 |
# coding: utf-8
"""
Memsource REST API
Welcome to Memsource's API documentation. To view our legacy APIs please [visit our documentation](https://wiki.memsource.com/wiki/Memsource_API) and for more information about our new APIs, [visit our blog](https://www.memsource.com/blog/2017/10/24/introducing-rest-apis... | 8,419 | 2,600 |
def f(x):
#return 1*x**3 + 5*x**2 - 2*x - 24
#return 1*x**4 - 4*x**3 - 2*x**2 + 12*x - 3
return 82*x + 6*x**2 - 0.67*x**3
print(f(2)-f(1))
#print((f(3.5) - f(0.5)) / -3)
#print(f(0.5)) | 188 | 133 |
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
import collections
import functools
import itertools
import threading
import numpy as np
from six.moves import zip # pylint: disable=redefined-builtin
from google.protobuf import json_format
from tensorflow.... | 19,194 | 4,850 |
import pytest
@pytest.fixture
def config_yaml():
return """
local_sender:
cls: aioworkers.net.sender.proxy.Facade
queue: queue1
queue1:
cls: aioworkers.queue.base.Queue
worker:
cls: aioworkers.net.sender.proxy.Worker
autorun: true
input: queue1
... | 761 | 258 |
import torch
import torchvision
import numpy as np
import lib.model
from lib.model import MetadataModel, train_model
import lib.dataset
import lib.dirs as dirs
import lib.utils as utils
import lib.vis_utils as vutils
import lib.defines as defs
if __name__ == "__main__":
data_path = dirs.data... | 2,794 | 930 |
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""Parse tree and find files matching owncloud forbidden characters.
Rename in place or move into a specific folder
"""
import KmdCmd
import KmdFiles
import os, re
import logging
class KmdOwncloudRename(KmdCmd.KmdCommand):
regexp = r'[\*:"?><|]+'
def extendParser... | 1,533 | 474 |
import random
def get_random_bag():
"""Returns a bag with unique pieces. (Bag randomizer)"""
random_shapes = list(SHAPES)
random.shuffle(random_shapes)
return [Piece(0, 0, shape) for shape in random_shapes]
class Shape:
def __init__(self, code, blueprints):
self.code = code
self.... | 13,975 | 4,384 |
import sys
input = sys.stdin.readline
n = int(input())
if n < 2:
print(n)
exit(0)
d = [0] * (n+1)
d[1] = 1
d[2] = 3
for i in range(n+1):
if i < 3:
continue
d[i] = (d[i-1] % 10007 + (d[i-2]*2) % 10007) % 10007
print(d[n])
| 249 | 146 |
import Light
__author__ = 'adilettad'
print("---------------")
print("----Welcome----")
print("------to-------")
print("-----Saber-----")
print("---------------")
sab = Light.Saber()
while True:
command = raw_input('Your command:')
if command == "blink":
sab.demoLED()
elif command == "dist" or... | 1,074 | 346 |
# Copyright 2021 Nokia
# Licensed under the BSD 3-Clause License.
# SPDX-License-Identifier: BSD-3-Clause
import a10.structures.constants
import a10.structures.identity
import a10.structures.returncode
import a10.asvr.db.core
import a10.asvr.db.announce
import a10.asvr.elements
def getTypes():
"""Gets a list of... | 739 | 270 |
# Generated by Django 2.2.12 on 2021-04-16 10:13
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('packages', '0003_auto_20210416_1007'),
]
operations = [
migrations.AlterField(
model_name='address',
name='street_n... | 456 | 158 |
from django.shortcuts import render
# Python functions - user is going to request an url
# Create your views here.
from django.http import HttpResponse
def index(request):
return HttpResponse("<h1> This is the music app homepage</h1>") | 241 | 65 |
'''
@author Tian Shi
Please contact tshi@vt.edu
'''
import math
import torch
class PositionalEmbedding(torch.nn.Module):
'''
Implementation of Positional Embedding.
'''
def __init__(self, hidden_size, device=torch.device("cpu")):
super().__init__()
self.hidden_size = hidden_size
... | 1,073 | 410 |
from tor4 import tensor
def test_tensor_sum():
a = tensor(data=[-1, 1, 2])
a_sum = a.sum()
assert a_sum.tolist() == 2
assert not a_sum.requires_grad
def test_tensor_sum_backward():
a = tensor(data=[-1, 1, 2.0], requires_grad=True)
a_sum = a.sum()
a_sum.backward()
assert a_sum.tolis... | 3,108 | 1,406 |
import numpy as np
import matplotlib.pyplot as plt
def aprbs(**parms):
# Generate an Amplitude modulated Pseudo-Random Binary Sequence (APRBS)
#
# The Pseudo-Random Binary Sequence (PRBS) is extensively used as an
# excitation signal for System Identification of linear systems. It is
# cha... | 3,150 | 1,063 |