hexsha stringlengths 40 40 | size int64 19 11.4M | ext stringclasses 13
values | lang stringclasses 1
value | max_stars_repo_path stringlengths 3 270 | max_stars_repo_name stringlengths 5 110 | max_stars_repo_head_hexsha stringlengths 40 40 | max_stars_repo_licenses listlengths 1 9 | max_stars_count float64 1 191k ⌀ | max_stars_repo_stars_event_min_datetime stringlengths 24 24 ⌀ | max_stars_repo_stars_event_max_datetime stringlengths 24 24 ⌀ | max_issues_repo_path stringlengths 3 270 | max_issues_repo_name stringlengths 5 116 | max_issues_repo_head_hexsha stringlengths 40 78 | max_issues_repo_licenses listlengths 1 9 | max_issues_count float64 1 67k ⌀ | max_issues_repo_issues_event_min_datetime stringlengths 24 24 ⌀ | max_issues_repo_issues_event_max_datetime stringlengths 24 24 ⌀ | max_forks_repo_path stringlengths 3 270 | max_forks_repo_name stringlengths 5 116 | max_forks_repo_head_hexsha stringlengths 40 78 | max_forks_repo_licenses listlengths 1 9 | max_forks_count float64 1 105k ⌀ | max_forks_repo_forks_event_min_datetime stringlengths 24 24 ⌀ | max_forks_repo_forks_event_max_datetime stringlengths 24 24 ⌀ | content stringlengths 19 11.4M | avg_line_length float64 1.93 229k | max_line_length int64 12 688k | alphanum_fraction float64 0.07 0.99 | matches listlengths 1 10 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
38846959d5bf379d9561e83129412060a412a297 | 32,539 | cc | C++ | lib/packet.cc | MacWR/Click-changed-for-ParaGraph | 18285e5da578fbb7285d10380836146e738dee6e | [
"Apache-2.0"
] | 1 | 2020-02-13T07:15:58.000Z | 2020-02-13T07:15:58.000Z | lib/packet.cc | MacWR/Click-changed-for-ParaGraph | 18285e5da578fbb7285d10380836146e738dee6e | [
"Apache-2.0"
] | null | null | null | lib/packet.cc | MacWR/Click-changed-for-ParaGraph | 18285e5da578fbb7285d10380836146e738dee6e | [
"Apache-2.0"
] | 4 | 2021-11-11T21:47:10.000Z | 2021-12-03T00:05:15.000Z | // -*- related-file-name: "../include/click/packet.hh" -*-
/*
* packet.{cc,hh} -- a packet structure. In the Linux kernel, a synonym for
* `struct sk_buff'
* Eddie Kohler, Robert Morris, Nickolai Zeldovich
*
* Copyright (c) 1999-2001 Massachusetts Institute of Technology
* Copyright (c) 2008-2011 Regents of the University of California
*
* Permission is hereby granted, free of charge, to any person obtaining a
* copy of this software and associated documentation files (the "Software"),
* to deal in the Software without restriction, subject to the conditions
* listed in the Click LICENSE file. These conditions include: you must
* preserve this copyright notice, and you cannot mention the copyright
* holders in advertising related to the Software without their permission.
* The Software is provided WITHOUT ANY WARRANTY, EXPRESS OR IMPLIED. This
* notice is a summary of the Click LICENSE file; the license in that file is
* legally binding.
*/
#include <click/config.h>
#define CLICK_PACKET_DEPRECATED_ENUM
#include <click/packet.hh>
#include <click/packet_anno.hh>
#include <click/glue.hh>
#include <click/sync.hh>
#if CLICK_USERLEVEL || CLICK_MINIOS
# include <unistd.h>
#endif
CLICK_DECLS
/** @file packet.hh
* @brief The Packet class models packets in Click.
*/
/** @class Packet
* @brief A network packet.
* @nosubgrouping
*
* Click's Packet class represents network packets within a router. Packet
* objects are passed from Element to Element via the Element::push() and
* Element::pull() functions. The vast majority of elements handle packets.
*
* A packet consists of a <em>data buffer</em>, which stores the actual packet
* wire data, and a set of <em>annotations</em>, which store extra information
* calculated about the packet, such as the destination address to be used for
* routing. Every Packet object has different annotations, but a data buffer
* may be shared among multiple Packet objects, saving memory and speeding up
* packet copies. (See Packet::clone.) As a result a Packet's data buffer is
* not writable. To write into a packet, turn it into a nonshared
* WritablePacket first, using uniqueify(), push(), or put().
*
* <h3>Data Buffer</h3>
*
* A packet's data buffer is a single flat array of bytes. The buffer may be
* larger than the actual packet data, leaving unused spaces called
* <em>headroom</em> and <em>tailroom</em> before and after the data proper.
* Prepending headers or appending data to a packet can be quite efficient if
* there is enough headroom or tailroom.
*
* The relationships among a Packet object's data buffer variables is shown
* here:
*
* <pre>
* data() end_data()
* | |
* |<- headroom() ->|<----- length() ----->|<- tailroom() ->|
* | v v |
* +================+======================+================+
* |XXXXXXXXXXXXXXXX| PACKET CONTENTS |XXXXXXXXXXXXXXXX|
* +================+======================+================+
* ^ ^
* |<------------------ buffer_length() ------------------->|
* | |
* buffer() end_buffer()
* </pre>
*
* Most code that manipulates packets is interested only in data() and
* length().
*
* To create a Packet, call one of the make() functions. To destroy a Packet,
* call kill(). To clone a Packet, which creates a new Packet object that
* shares this packet's data, call clone(). To uniqueify a Packet, which
* unshares the packet data if necessary, call uniqueify(). To allocate extra
* space for headers or trailers, call push() and put(). To remove headers or
* trailers, call pull() and take().
*
* <pre>
* data() end_data()
* | |
* push() | pull() take() | put()
* <======= | =======> <======= | =======>
* v v
* +===========+================================+===========+
* |XXXXXXXXXXX| PACKET CONTENTS |XXXXXXXXXXX|
* +===========+================================+===========+
* </pre>
*
* Packet objects are implemented in different ways in different drivers. The
* userlevel driver has its own C++ implementation. In the linuxmodule
* driver, however, Packet is an overlay on Linux's native sk_buff
* object: the Packet methods access underlying sk_buff data directly, with no
* overhead. (For example, Packet::data() returns the sk_buff's data field.)
*
* <h3>Annotations</h3>
*
* Annotations are extra information about a packet above and beyond the
* packet data. Packet supports several specific annotations, plus a <em>user
* annotation area</em> available for arbitrary use by elements.
*
* <ul>
* <li><b>Header pointers:</b> Each packet has three header pointers, designed
* to point to the packet's MAC header, network header, and transport header,
* respectively. Convenience functions like ip_header() access these pointers
* cast to common header types. The header pointers are kept up to date when
* operations like push() or uniqueify() change the packet's data buffer.
* Header pointers can be null, and they can even point to memory outside the
* current packet data bounds. For example, a MAC header pointer will remain
* set even after pull() is used to shift the packet data past the MAC header.
* As a result, functions like mac_header_offset() can return negative
* numbers.</li>
* <li><b>Timestamp:</b> A timestamp associated with the packet. Most packet
* sources timestamp packets when they enter the router; other elements
* examine or modify the timestamp.</li>
* <li><b>Device:</b> A pointer to the device on which the packet arrived.
* Only meaningful in the linuxmodule driver, but provided in every
* driver.</li>
* <li><b>Packet type:</b> A small integer indicating whether the packet is
* meant for this host, broadcast, multicast, or some other purpose. Several
* elements manipulate this annotation; in linuxmodule, setting the annotation
* is required for the host network stack to process incoming packets
* correctly.</li>
* <li><b>Performance counter</b> (linuxmodule only): A 64-bit integer
* intended to hold a performance counter value. Used by SetCycleCount and
* others.</li>
* <li><b>Next and previous packet:</b> Pointers provided to allow elements to
* chain packets into a doubly linked list.</li>
* <li><b>Annotations:</b> Each packet has @link Packet::anno_size anno_size
* @endlink bytes available for annotations. Elements agree to use portions
* of the annotation area to communicate per-packet information. Macros in
* the <click/packet_anno.hh> header file define the annotations used by
* Click's current elements. One common annotation is the network address
* annotation -- see Packet::dst_ip_anno(). Routing elements, such as
* RadixIPLookup, set the address annotation to indicate the desired next hop;
* ARPQuerier uses this annotation to query the next hop's MAC.</li>
* </ul>
*
* New packets start wth all annotations set to zero or null. Cloning a
* packet copies its annotations.
*/
/** @class WritablePacket
* @brief A network packet believed not to be shared.
*
* The WritablePacket type represents Packet objects whose data buffers are
* not shared. As a result, WritablePacket's versions of functions that
* access the packet data buffer, such as data(), end_buffer(), and
* ip_header(), return mutable pointers (<tt>char *</tt> rather than <tt>const
* char *</tt>).
*
* WritablePacket objects are created by Packet::make(), Packet::uniqueify(),
* Packet::push(), and Packet::put(), which ensure that the returned packet
* does not share its data buffer.
*
* WritablePacket's interface is the same as Packet's except for these type
* differences. For documentation, see Packet.
*
* @warning The WritablePacket convention reduces the likelihood of error
* when modifying packet data, but does not eliminate it. For instance, by
* calling WritablePacket::clone(), it is possible to create a WritablePacket
* whose data is shared:
* @code
* Packet *p = ...;
* if (WritablePacket *q = p->uniqueify()) {
* Packet *p2 = q->clone();
* assert(p2);
* q->ip_header()->ip_v = 6; // modifies p2's data as well
* }
* @endcode
* Avoid writing buggy code like this! Use WritablePacket selectively, and
* try to avoid calling WritablePacket::clone() when possible. */
Packet::~Packet()
{
// This is a convenient place to put static assertions.
static_assert(addr_anno_offset % 8 == 0 && user_anno_offset % 8 == 0,
"Annotations must begin at multiples of 8 bytes.");
static_assert(addr_anno_offset + addr_anno_size <= anno_size,
"Annotation area too small for address annotations.");
static_assert(user_anno_offset + user_anno_size <= anno_size,
"Annotation area too small for user annotations.");
static_assert(dst_ip_anno_offset == DST_IP_ANNO_OFFSET
&& dst_ip6_anno_offset == DST_IP6_ANNO_OFFSET
&& dst_ip_anno_size == DST_IP_ANNO_SIZE
&& dst_ip6_anno_size == DST_IP6_ANNO_SIZE
&& dst_ip_anno_size == 4
&& dst_ip6_anno_size == 16
&& dst_ip_anno_offset + 4 <= anno_size
&& dst_ip6_anno_offset + 16 <= anno_size,
"Address annotations at unexpected locations.");
static_assert((default_headroom & 3) == 0,
"Default headroom should be a multiple of 4 bytes.");
#if CLICK_LINUXMODULE
static_assert(sizeof(Anno) <= sizeof(((struct sk_buff *)0)->cb),
"Anno structure too big for Linux packet annotation area.");
#endif
#if CLICK_LINUXMODULE
panic("Packet destructor");
#else
if (_data_packet)
_data_packet->kill();
# if CLICK_USERLEVEL || CLICK_MINIOS
else if (_head && _destructor)
_destructor(_head, _end - _head, _destructor_argument);
else
delete[] _head;
# elif CLICK_BSDMODULE
if (_m)
m_freem(_m);
# endif
_head = _data = 0;
#endif
}
#if !CLICK_LINUXMODULE
# if HAVE_CLICK_PACKET_POOL
// ** Packet pools **
// Click configurations usually allocate & free tons of packets and it's
// important to do so quickly. This specialized packet allocator saves
// pre-initialized Packet objects, either with or without data, for fast
// reuse. It can support multithreaded deployments: each thread has its own
// pool, with a global pool to even out imbalance.
# define CLICK_PACKET_POOL_BUFSIZ 2048
# define CLICK_PACKET_POOL_SIZE 1000 // see LIMIT in packetpool-01.testie
# define CLICK_GLOBAL_PACKET_POOL_COUNT 16
namespace {
struct PacketData {
PacketData* next; // link to next free data buffer in pool
# if HAVE_MULTITHREAD
PacketData* batch_next; // link to next buffer batch
unsigned batch_pdcount; // # buffers in this batch
# endif
};
struct PacketPool {
WritablePacket* p; // free packets, linked by p->next()
unsigned pcount; // # packets in `p` list
PacketData* pd; // free data buffers, linked by pd->next
unsigned pdcount; // # buffers in `pd` list
# if HAVE_MULTITHREAD
PacketPool* thread_pool_next; // link to next per-thread pool
# endif
};
}
# if HAVE_MULTITHREAD
static __thread PacketPool *thread_packet_pool;
struct GlobalPacketPool {
WritablePacket* pbatch; // batches of free packets, linked by p->prev()
// p->anno_u32(0) is # packets in batch
unsigned pbatchcount; // # batches in `pbatch` list
PacketData* pdbatch; // batches of free data buffers
unsigned pdbatchcount; // # batches in `pdbatch` list
PacketPool* thread_pools; // all thread packet pools
volatile uint32_t lock;
};
static GlobalPacketPool global_packet_pool;
#else
static PacketPool global_packet_pool;
# endif
/** @brief Return the local packet pool for this thread.
@pre make_local_packet_pool() has succeeded on this thread. */
static inline PacketPool& local_packet_pool() {
# if HAVE_MULTITHREAD
return *thread_packet_pool;
# else
// If not multithreaded, there is only one packet pool.
return global_packet_pool;
# endif
}
/** @brief Create and return a local packet pool for this thread. */
static inline PacketPool* make_local_packet_pool() {
# if HAVE_MULTITHREAD
PacketPool *pp = thread_packet_pool;
if (!pp && (pp = new PacketPool)) {
memset(pp, 0, sizeof(PacketPool));
while (atomic_uint32_t::swap(global_packet_pool.lock, 1) == 1)
/* do nothing */;
pp->thread_pool_next = global_packet_pool.thread_pools;
global_packet_pool.thread_pools = pp;
thread_packet_pool = pp;
click_compiler_fence();
global_packet_pool.lock = 0;
}
return pp;
# else
return &global_packet_pool;
# endif
}
WritablePacket *
WritablePacket::pool_allocate(bool with_data)
{
PacketPool& packet_pool = *make_local_packet_pool();
(void) with_data;
# if HAVE_MULTITHREAD
// Steal packets and/or data from the global pool if there's nothing on
// the local pool.
if ((!packet_pool.p && global_packet_pool.pbatch)
|| (with_data && !packet_pool.pd && global_packet_pool.pdbatch)) {
while (atomic_uint32_t::swap(global_packet_pool.lock, 1) == 1)
/* do nothing */;
WritablePacket *pp;
if (!packet_pool.p && (pp = global_packet_pool.pbatch)) {
global_packet_pool.pbatch = static_cast<WritablePacket *>(pp->prev());
--global_packet_pool.pbatchcount;
packet_pool.p = pp;
packet_pool.pcount = pp->anno_u32(0);
}
PacketData *pd;
if (with_data && !packet_pool.pd && (pd = global_packet_pool.pdbatch)) {
global_packet_pool.pdbatch = pd->batch_next;
--global_packet_pool.pdbatchcount;
packet_pool.pd = pd;
packet_pool.pdcount = pd->batch_pdcount;
}
click_compiler_fence();
global_packet_pool.lock = 0;
}
# endif /* HAVE_MULTITHREAD */
WritablePacket *p = packet_pool.p;
if (p) {
packet_pool.p = static_cast<WritablePacket*>(p->next());
--packet_pool.pcount;
} else
p = new WritablePacket;
return p;
}
WritablePacket *
WritablePacket::pool_allocate(uint32_t headroom, uint32_t length,
uint32_t tailroom)
{
uint32_t n = headroom + length + tailroom;
if (n < CLICK_PACKET_POOL_BUFSIZ)
n = CLICK_PACKET_POOL_BUFSIZ;
WritablePacket *p = pool_allocate(n == CLICK_PACKET_POOL_BUFSIZ);
if (p) {
p->initialize();
PacketData *pd;
PacketPool& packet_pool = local_packet_pool();
if (n == CLICK_PACKET_POOL_BUFSIZ && (pd = packet_pool.pd)) {
packet_pool.pd = pd->next;
--packet_pool.pdcount;
p->_head = reinterpret_cast<unsigned char *>(pd);
} else if ((p->_head = new unsigned char[n]))
/* OK */;
else {
delete p;
return 0;
}
p->_data = p->_head + headroom;
p->_tail = p->_data + length;
p->_end = p->_head + n;
}
return p;
}
void
WritablePacket::recycle(WritablePacket *p)
{
unsigned char *data = 0;
if (!p->_data_packet && p->_head && !p->_destructor
&& p->_end - p->_head == CLICK_PACKET_POOL_BUFSIZ) {
data = p->_head;
p->_head = 0;
}
p->~WritablePacket();
PacketPool& packet_pool = *make_local_packet_pool();
# if HAVE_MULTITHREAD
if ((packet_pool.p && packet_pool.pcount == CLICK_PACKET_POOL_SIZE)
|| (data && packet_pool.pd && packet_pool.pdcount == CLICK_PACKET_POOL_SIZE)) {
while (atomic_uint32_t::swap(global_packet_pool.lock, 1) == 1)
/* do nothing */;
if (packet_pool.p && packet_pool.pcount == CLICK_PACKET_POOL_SIZE) {
if (global_packet_pool.pbatchcount == CLICK_GLOBAL_PACKET_POOL_COUNT) {
while (WritablePacket *p = packet_pool.p) {
packet_pool.p = static_cast<WritablePacket *>(p->next());
::operator delete((void *) p);
}
} else {
packet_pool.p->set_prev(global_packet_pool.pbatch);
packet_pool.p->set_anno_u32(0, packet_pool.pcount);
global_packet_pool.pbatch = packet_pool.p;
++global_packet_pool.pbatchcount;
packet_pool.p = 0;
}
packet_pool.pcount = 0;
}
if (data && packet_pool.pd && packet_pool.pdcount == CLICK_PACKET_POOL_SIZE) {
if (global_packet_pool.pdbatchcount == CLICK_GLOBAL_PACKET_POOL_COUNT) {
while (PacketData *pd = packet_pool.pd) {
packet_pool.pd = pd->next;
delete[] reinterpret_cast<unsigned char *>(pd);
}
} else {
packet_pool.pd->batch_next = global_packet_pool.pdbatch;
packet_pool.pd->batch_pdcount = packet_pool.pdcount;
global_packet_pool.pdbatch = packet_pool.pd;
++global_packet_pool.pdbatchcount;
packet_pool.pd = 0;
}
packet_pool.pdcount = 0;
}
click_compiler_fence();
global_packet_pool.lock = 0;
}
# else /* !HAVE_MULTITHREAD */
if (packet_pool.pcount == CLICK_PACKET_POOL_SIZE) {
::operator delete((void *) p);
p = 0;
}
if (data && packet_pool.pdcount == CLICK_PACKET_POOL_SIZE) {
delete[] data;
data = 0;
}
# endif /* HAVE_MULTITHREAD */
if (p) {
++packet_pool.pcount;
p->set_next(packet_pool.p);
packet_pool.p = p;
assert(packet_pool.pcount <= CLICK_PACKET_POOL_SIZE);
}
if (data) {
++packet_pool.pdcount;
PacketData *pd = reinterpret_cast<PacketData *>(data);
pd->next = packet_pool.pd;
packet_pool.pd = pd;
assert(packet_pool.pdcount <= CLICK_PACKET_POOL_SIZE);
}
}
# endif /* HAVE_PACKET_POOL */
bool
Packet::alloc_data(uint32_t headroom, uint32_t length, uint32_t tailroom)
{
uint32_t n = length + headroom + tailroom;
if (n < min_buffer_length) {
tailroom = min_buffer_length - length - headroom;
n = min_buffer_length;
}
# if CLICK_USERLEVEL || CLICK_MINIOS
unsigned char *d = new unsigned char[n];
if (!d)
return false;
_head = d;
_data = d + headroom;
_tail = _data + length;
_end = _head + n;
# elif CLICK_BSDMODULE
//click_chatter("allocate new mbuf, length=%d", n);
if (n > MJUM16BYTES) {
click_chatter("trying to allocate %d bytes: too many\n", n);
return false;
}
struct mbuf *m;
MGETHDR(m, M_DONTWAIT, MT_DATA);
if (!m)
return false;
if (n > MHLEN) {
if (n > MCLBYTES)
m_cljget(m, M_DONTWAIT, (n <= MJUMPAGESIZE ? MJUMPAGESIZE :
n <= MJUM9BYTES ? MJUM9BYTES :
MJUM16BYTES));
else
MCLGET(m, M_DONTWAIT);
if (!(m->m_flags & M_EXT)) {
m_freem(m);
return false;
}
}
_m = m;
_m->m_data += headroom;
_m->m_len = length;
_m->m_pkthdr.len = length;
assimilate_mbuf();
# endif /* CLICK_USERLEVEL || CLICK_BSDMODULE */
return true;
}
#endif /* !CLICK_LINUXMODULE */
/** @brief Create and return a new packet.
* @param headroom headroom in new packet
* @param data data to be copied into the new packet
* @param length length of packet
* @param tailroom tailroom in new packet
* @return new packet, or null if no packet could be created
*
* The @a data is copied into the new packet. If @a data is null, the
* packet's data is left uninitialized. The resulting packet's
* buffer_length() will be at least @link Packet::min_buffer_length
* min_buffer_length @endlink; if @a headroom + @a length + @a tailroom would
* be less, then @a tailroom is increased to make the total @link
* Packet::min_buffer_length min_buffer_length @endlink.
*
* The new packet's annotations are cleared and its header pointers are
* null. */
WritablePacket *
Packet::make(uint32_t headroom, const void *data,
uint32_t length, uint32_t tailroom)
{
#if CLICK_LINUXMODULE
int want = 1;
if (struct sk_buff *skb = skbmgr_allocate_skbs(headroom, length + tailroom, &want)) {
assert(want == 1);
// packet comes back from skbmgr with headroom reserved
__skb_put(skb, length); // leave space for data
if (data)
memcpy(skb->data, data, length);
# if PACKET_CLEAN
skb->pkt_type = HOST | PACKET_CLEAN;
# else
skb->pkt_type = HOST;
# endif
WritablePacket *q = reinterpret_cast<WritablePacket *>(skb);
q->clear_annotations();
return q;
} else
return 0;
#else
# if HAVE_CLICK_PACKET_POOL
WritablePacket *p = WritablePacket::pool_allocate(headroom, length, tailroom);
if (!p)
return 0;
# else
WritablePacket *p = new WritablePacket;
if (!p)
return 0;
p->initialize();
if (!p->alloc_data(headroom, length, tailroom)) {
p->_head = 0;
delete p;
return 0;
}
# endif
if (data)
memcpy(p->data(), data, length);
return p;
#endif
}
#if CLICK_USERLEVEL || CLICK_MINIOS
/** @brief Create and return a new packet (userlevel).
* @param data data used in the new packet
* @param length length of packet
* @param destructor destructor function
* @param argument argument to destructor function
* @param headroom headroom available before the data pointer
* @param tailroom tailroom available after data + length
* @return new packet, or null if no packet could be created
*
* The packet's data pointer becomes the @a data: the data is not copied
* into the new packet, rather the packet owns the @a data pointer. When the
* packet's data is eventually destroyed, either because the packet is
* deleted or because of something like a push() or full(), the @a
* destructor will be called as @a destructor(@a data, @a length, @a
* argument). (If @a destructor is null, the packet data will be freed by
* <tt>delete[] @a data</tt>.) The packet has zero headroom and tailroom.
*
* The returned packet's annotations are cleared and its header pointers are
* null. */
WritablePacket *
Packet::make(unsigned char *data, uint32_t length,
buffer_destructor_type destructor, void* argument, int headroom, int tailroom)
{
# if HAVE_CLICK_PACKET_POOL
WritablePacket *p = WritablePacket::pool_allocate(false);
# else
WritablePacket *p = new WritablePacket;
# endif
if (p) {
p->initialize();
p->_head = data - headroom;
p->_data = data;
p->_tail = data + length;
p->_end = p->_tail + tailroom;
p->_destructor = destructor;
p->_destructor_argument = argument;
}
return p;
}
/** @brief Copy the content and annotations of another packet (userlevel).
* @param source packet
* @param headroom for the new packet
*/
bool
Packet::copy(Packet* p, int headroom)
{
if (headroom + p->length() > buffer_length())
return false;
_data = _head + headroom;
memcpy(_data,p->data(),p->length());
_tail = _data + p->length();
copy_annotations(p);
set_mac_header(p->mac_header() ? data() + p->mac_header_offset() : 0);
set_network_header(p->network_header() ? data() + p->network_header_offset() : 0, p->network_header_length());
return true;
}
#endif
//
// UNIQUEIFICATION
//
/** @brief Create a clone of this packet.
* @return the cloned packet
*
* The returned clone has independent annotations, initially copied from this
* packet, but shares this packet's data. shared() returns true for both the
* packet and its clone. Returns null if there's no memory for the clone. */
Packet *
Packet::clone()
{
#if CLICK_LINUXMODULE
struct sk_buff *nskb = skb_clone(skb(), GFP_ATOMIC);
return reinterpret_cast<Packet *>(nskb);
#elif CLICK_USERLEVEL || CLICK_BSDMODULE || CLICK_MINIOS
# if CLICK_BSDMODULE
struct mbuf *m;
if (this->_m == NULL)
return 0;
if (this->_m->m_flags & M_EXT
&& ( this->_m->m_ext.ext_type == EXT_JUMBOP
|| this->_m->m_ext.ext_type == EXT_JUMBO9
|| this->_m->m_ext.ext_type == EXT_JUMBO16)) {
if ((m = dup_jumbo_m(this->_m)) == NULL)
return 0;
}
else if ((m = m_dup(this->_m, M_DONTWAIT)) == NULL)
return 0;
# endif
// timing: .31-.39 normal, .43-.55 two allocs, .55-.58 two memcpys
# if HAVE_CLICK_PACKET_POOL
Packet *p = WritablePacket::pool_allocate(false);
# else
Packet *p = new WritablePacket; // no initialization
# endif
if (!p)
return 0;
Packet* origin = this;
if (origin->_data_packet)
origin = origin->_data_packet;
memcpy(p, this, sizeof(Packet));
p->_use_count = 1;
p->_data_packet = origin;
# if CLICK_USERLEVEL || CLICK_MINIOS
p->_destructor = 0;
# else
p->_m = m;
# endif
// increment our reference count because of _data_packet reference
origin->_use_count++;
return p;
#endif /* CLICK_LINUXMODULE */
}
WritablePacket *
Packet::expensive_uniqueify(int32_t extra_headroom, int32_t extra_tailroom,
bool free_on_failure)
{
assert(extra_headroom >= (int32_t)(-headroom()) && extra_tailroom >= (int32_t)(-tailroom()));
#if CLICK_LINUXMODULE
struct sk_buff *nskb = skb();
// preserve this, which otherwise loses a ref here
if (!free_on_failure)
if (!(nskb = skb_clone(nskb, GFP_ATOMIC)))
return NULL;
// nskb is now not shared, which psk_expand_head asserts
if (!(nskb = skb_share_check(nskb, GFP_ATOMIC)))
return NULL;
if (pskb_expand_head(nskb, extra_headroom, extra_tailroom, GFP_ATOMIC)) {
kfree_skb(nskb);
return NULL;
}
// success, so kill the clone from above
if (!free_on_failure)
kill();
return reinterpret_cast<WritablePacket *>(nskb);
#else /* !CLICK_LINUXMODULE */
// If someone else has cloned this packet, then we need to leave its data
// pointers around. Make a clone and uniqueify that.
if (_use_count > 1) {
Packet *p = clone();
WritablePacket *q = (p ? p->expensive_uniqueify(extra_headroom, extra_tailroom, true) : 0);
if (q || free_on_failure)
kill();
return q;
}
uint8_t *old_head = _head, *old_end = _end;
# if CLICK_BSDMODULE
struct mbuf *old_m = _m;
# endif
if (!alloc_data(headroom() + extra_headroom, length(), tailroom() + extra_tailroom)) {
if (free_on_failure)
kill();
return 0;
}
unsigned char *start_copy = old_head + (extra_headroom >= 0 ? 0 : -extra_headroom);
unsigned char *end_copy = old_end + (extra_tailroom >= 0 ? 0 : extra_tailroom);
memcpy(_head + (extra_headroom >= 0 ? extra_headroom : 0), start_copy, end_copy - start_copy);
// free old data
if (_data_packet)
_data_packet->kill();
# if CLICK_USERLEVEL || CLICK_MINIOS
else if (_destructor)
_destructor(old_head, old_end - old_head, _destructor_argument);
else
delete[] old_head;
_destructor = 0;
# elif CLICK_BSDMODULE
m_freem(old_m); // alloc_data() created a new mbuf, so free the old one
# endif
_use_count = 1;
_data_packet = 0;
shift_header_annotations(old_head, extra_headroom);
return static_cast<WritablePacket *>(this);
#endif /* CLICK_LINUXMODULE */
}
#ifdef CLICK_BSDMODULE /* BSD kernel module */
struct mbuf *
Packet::steal_m()
{
struct Packet *p;
struct mbuf *m2;
p = uniqueify();
m2 = p->m();
/* Clear the mbuf from the packet: otherwise kill will MFREE it */
p->_m = 0;
p->kill();
return m2;
}
/*
* Duplicate a packet by copying data from an mbuf chain to a new mbuf with a
* jumbo cluster (i.e., contiguous storage).
*/
struct mbuf *
Packet::dup_jumbo_m(struct mbuf *m)
{
int len = m->m_pkthdr.len;
struct mbuf *new_m;
if (len > MJUM16BYTES) {
click_chatter("warning: cannot allocate jumbo cluster for %d bytes", len);
return NULL;
}
new_m = m_getjcl(M_DONTWAIT, m->m_type, m->m_flags & M_COPYFLAGS,
(len <= MJUMPAGESIZE ? MJUMPAGESIZE :
len <= MJUM9BYTES ? MJUM9BYTES :
MJUM16BYTES));
if (!new_m) {
click_chatter("warning: jumbo cluster mbuf allocation failed");
return NULL;
}
m_copydata(m, 0, len, mtod(new_m, caddr_t));
new_m->m_len = len;
new_m->m_pkthdr.len = len;
/* XXX: Only a subset of what m_dup_pkthdr() would copy: */
new_m->m_pkthdr.rcvif = m->m_pkthdr.rcvif;
# if __FreeBSD_version >= 800000
new_m->m_pkthdr.flowid = m->m_pkthdr.flowid;
# endif
new_m->m_pkthdr.ether_vtag = m->m_pkthdr.ether_vtag;
return new_m;
}
#endif /* CLICK_BSDMODULE */
//
// EXPENSIVE_PUSH, EXPENSIVE_PUT
//
/*
* Prepend some empty space before a packet.
* May kill this packet and return a new one.
*/
WritablePacket *
Packet::expensive_push(uint32_t nbytes)
{
static int chatter = 0;
if (headroom() < nbytes && chatter < 5) {
click_chatter("expensive Packet::push; have %d wanted %d",
headroom(), nbytes);
chatter++;
}
if (WritablePacket *q = expensive_uniqueify((nbytes + 128) & ~3, 0, true)) {
#ifdef CLICK_LINUXMODULE /* Linux kernel module */
__skb_push(q->skb(), nbytes);
#else /* User-space and BSD kernel module */
q->_data -= nbytes;
# ifdef CLICK_BSDMODULE
q->m()->m_data -= nbytes;
q->m()->m_len += nbytes;
q->m()->m_pkthdr.len += nbytes;
# endif
#endif
return q;
} else
return 0;
}
WritablePacket *
Packet::expensive_put(uint32_t nbytes)
{
static int chatter = 0;
if (tailroom() < nbytes && chatter < 5) {
click_chatter("expensive Packet::put; have %d wanted %d",
tailroom(), nbytes);
chatter++;
}
if (WritablePacket *q = expensive_uniqueify(0, nbytes + 128, true)) {
#ifdef CLICK_LINUXMODULE /* Linux kernel module */
__skb_put(q->skb(), nbytes);
#else /* User-space and BSD kernel module */
q->_tail += nbytes;
# ifdef CLICK_BSDMODULE
q->m()->m_len += nbytes;
q->m()->m_pkthdr.len += nbytes;
# endif
#endif
return q;
} else
return 0;
}
Packet *
Packet::shift_data(int offset, bool free_on_failure)
{
if (offset == 0)
return this;
// Preserve mac_header, network_header, and transport_header.
const unsigned char *dp = data();
if (has_mac_header() && mac_header() >= buffer()
&& mac_header() <= end_buffer() && mac_header() < dp)
dp = mac_header();
if (has_network_header() && network_header() >= buffer()
&& network_header() <= end_buffer() && network_header() < dp)
dp = network_header();
if (has_transport_header() && transport_header() >= buffer()
&& transport_header() <= end_buffer() && transport_header() < dp)
dp = network_header();
if (!shared()
&& (offset < 0 ? (dp - buffer()) >= (ptrdiff_t)(-offset)
: tailroom() >= (uint32_t)offset)) {
WritablePacket *q = static_cast<WritablePacket *>(this);
memmove((unsigned char *) dp + offset, dp, q->end_data() - dp);
#if CLICK_LINUXMODULE
struct sk_buff *mskb = q->skb();
mskb->data += offset;
mskb->tail += offset;
#else /* User-space and BSD kernel module */
q->_data += offset;
q->_tail += offset;
# if CLICK_BSDMODULE
q->m()->m_data += offset;
# endif
#endif
shift_header_annotations(q->buffer(), offset);
return this;
} else {
int tailroom_offset = (offset < 0 ? -offset : 0);
if (offset < 0 && headroom() < (uint32_t)(-offset))
offset = -headroom() + ((uintptr_t)(data() + offset) & 7);
else
offset += ((uintptr_t)buffer() & 7);
return expensive_uniqueify(offset, tailroom_offset, free_on_failure);
}
}
#if HAVE_CLICK_PACKET_POOL
static void
cleanup_pool(PacketPool *pp, int global)
{
unsigned pcount = 0, pdcount = 0;
while (WritablePacket *p = pp->p) {
++pcount;
pp->p = static_cast<WritablePacket *>(p->next());
::operator delete((void *) p);
}
while (PacketData *pd = pp->pd) {
++pdcount;
pp->pd = pd->next;
delete[] reinterpret_cast<unsigned char *>(pd);
}
assert(pcount <= CLICK_PACKET_POOL_SIZE);
assert(pdcount <= CLICK_PACKET_POOL_SIZE);
assert(global || (pcount == pp->pcount && pdcount == pp->pdcount));
}
#endif
void
Packet::static_cleanup()
{
#if HAVE_CLICK_PACKET_POOL
# if HAVE_MULTITHREAD
while (PacketPool* pp = global_packet_pool.thread_pools) {
global_packet_pool.thread_pools = pp->thread_pool_next;
cleanup_pool(pp, 0);
delete pp;
}
unsigned rounds = global_packet_pool.pbatchcount;
if (rounds < global_packet_pool.pdbatchcount)
rounds = global_packet_pool.pdbatchcount;
assert(rounds <= CLICK_GLOBAL_PACKET_POOL_COUNT);
PacketPool fake_pool;
while (global_packet_pool.pbatch || global_packet_pool.pdbatch) {
if ((fake_pool.p = global_packet_pool.pbatch))
global_packet_pool.pbatch = static_cast<WritablePacket*>(fake_pool.p->prev());
if ((fake_pool.pd = global_packet_pool.pdbatch))
global_packet_pool.pdbatch = fake_pool.pd->batch_next;
cleanup_pool(&fake_pool, 1);
--rounds;
}
assert(rounds == 0);
# else
cleanup_pool(&global_packet_pool, 0);
# endif
#endif
}
CLICK_ENDDECLS
| 32.967579 | 114 | 0.664987 | [
"object"
] |
38876477a64112755d3e96881e0e341dcb316b03 | 997 | cpp | C++ | LuckBalance.cpp | sachanakshat/Competitive_Practice | 63170d87398bf5bd163febecdcfef8db21c632c7 | [
"MIT"
] | null | null | null | LuckBalance.cpp | sachanakshat/Competitive_Practice | 63170d87398bf5bd163febecdcfef8db21c632c7 | [
"MIT"
] | null | null | null | LuckBalance.cpp | sachanakshat/Competitive_Practice | 63170d87398bf5bd163febecdcfef8db21c632c7 | [
"MIT"
] | null | null | null | #include <iostream>
#include <algorithm>
#include <vector>
#include <chrono>
#include<bits/stdc++.h>
using namespace std;
using namespace std::chrono;
void print(vector<vector<int>> vect)
{
for(int i = 0; i< vect.size(); i++)
{
for(int j = 0; j<vect[0].size(); j++)
cout<<vect[i][j]<<" ";
cout<<"\n";
}
}
bool sortcol( const vector<int>& v1,
const vector<int>& v2 ) {
return v1[0] > v2[0];
}
int main()
{
auto start = high_resolution_clock::now();
vector<vector<int>> arr{{5,1},
{2,1},
{1,1},
{8,1},
{10,0},
{5,0}};
cout<<"\n";
print(arr);
sort(arr.begin(), arr.end(), sortcol);
cout<<"\n";
print(arr);
auto stop = high_resolution_clock::now();
auto duration = duration_cast<microseconds>(stop - start);
cout <<"\nExecution time: "<<duration.count() <<" microseconds"<<endl;
return 0;
} | 22.659091 | 74 | 0.503511 | [
"vector"
] |
388ab4699ab20439452134f3703a6322e930685a | 6,321 | cpp | C++ | pthread/Implementation.cpp | dpocheng/CPP-Sobel-Filter-for-edge-detection | 609fb98f010af60ee66a1cbb3f1963602f153634 | [
"Apache-2.0"
] | null | null | null | pthread/Implementation.cpp | dpocheng/CPP-Sobel-Filter-for-edge-detection | 609fb98f010af60ee66a1cbb3f1963602f153634 | [
"Apache-2.0"
] | null | null | null | pthread/Implementation.cpp | dpocheng/CPP-Sobel-Filter-for-edge-detection | 609fb98f010af60ee66a1cbb3f1963602f153634 | [
"Apache-2.0"
] | null | null | null | // Copyright 2017 Pok On Cheng
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
/***************************
* Pok On Cheng (pocheng) *
* 74157306 *
* CompSci 131 Lab 1 B *
***************************/
#include <algorithm>
#include <cstdlib>
#include <cctype>
#include <cmath>
#include <sstream>
#include <fstream>
#include <iostream>
#include <vector>
#include <mutex>
#include <thread>
/* Global variables, Look at their usage in main() */
int image_height;
int image_width;
int image_maxShades;
int inputImage[1000][1000];
int outputImage[1000][1000];
int num_threads;
int chunkSize;
int maxChunk;
int nextAvailableChunk;
std::mutex mutexes;
/* ****************Change and add functions below ***************** */
int get_dynamic_chunk() {
mutexes.lock();
int N = chunkSize * nextAvailableChunk;
nextAvailableChunk += 1;
mutexes.unlock();
return N;
}
void sobel_algorithm(int dynamic_chunk) {
int sumx, sumy, sum;
int maskX[3][3];
int maskY[3][3];
/* 3x3 Sobel mask for X Dimension. */
maskX[0][0] = -1; maskX[0][1] = 0; maskX[0][2] = 1;
maskX[1][0] = -2; maskX[1][1] = 0; maskX[1][2] = 2;
maskX[2][0] = -1; maskX[2][1] = 0; maskX[2][2] = 1;
/* 3x3 Sobel mask for Y Dimension. */
maskY[0][0] = 1; maskY[0][1] = 2; maskY[0][2] = 1;
maskY[1][0] = 0; maskY[1][1] = 0; maskY[1][2] = 0;
maskY[2][0] = -1; maskY[2][1] = -2; maskY[2][2] = -1;
for (int x = dynamic_chunk; x < (dynamic_chunk+chunkSize); ++x) {
for (int y = 0; y < image_width; ++y){
sumx = 0;
sumy = 0;
/* For handling image boundaries */
if (x == 0 || x == ((dynamic_chunk+chunkSize)-1) || y == 0 || y == (image_width-1)) {
sum = 0;
}
else {
/* Gradient calculation in X Dimension */
for (int i = -1; i <= 1; i++) {
for (int j = -1; j <= 1; j++){
sumx += (inputImage[x+i][y+j] * maskX[i+1][j+1]);
}
}
/* Gradient calculation in Y Dimension */
for (int i = -1; i <= 1; i++) {
for (int j = -1; j <= 1; j++){
sumy += (inputImage[x+i][y+j] * maskY[i+1][j+1]);
}
}
/* Gradient magnitude */
sum = (abs(sumx) + abs(sumy));
}
/* outputImage[x][y] = (0 <= sum <= 255); */
if (sum >= 0 && sum <= 255) {
outputImage[x][y] = sum;
}
else if (sum > 255) {
outputImage[x][y] = 0;
}
else if (sum < 0) {
outputImage[x][y] = 255;
}
}
}
}
void compute_chunk() {
int X = get_dynamic_chunk();
sobel_algorithm(X);
}
void dispatch_threads()
{
std::vector<std::thread> threads;
nextAvailableChunk = 0;
for (int i = 0; i < num_threads; i++) {
threads.push_back(std::thread(compute_chunk));
}
for (int i = 0; i < num_threads; i++) {
threads[i].join();
}
}
/* ****************Need not to change the function below ***************** */
int main(int argc, char* argv[])
{
if(argc != 5)
{
std::cout << "ERROR: Incorrect number of arguments. Format is: <Input image filename> <Output image filename> <Threads#> <Chunk size>" << std::endl;
return 0;
}
std::ifstream file(argv[1]);
if(!file.is_open())
{
std::cout << "ERROR: Could not open file " << argv[1] << std::endl;
return 0;
}
num_threads = std::atoi(argv[3]);
chunkSize = std::atoi(argv[4]);
std::cout << "Detect edges in " << argv[1] << " using " << num_threads << " threads\n" << std::endl;
/* ******Reading image into 2-D array below******** */
std::string workString;
/* Remove comments '#' and check image format */
while(std::getline(file,workString))
{
if( workString.at(0) != '#' ){
if( workString.at(1) != '2' ){
std::cout << "Input image is not a valid PGM image" << std::endl;
return 0;
} else {
break;
}
} else {
continue;
}
}
/* Check image size */
while(std::getline(file,workString))
{
if( workString.at(0) != '#' ){
std::stringstream stream(workString);
int n;
stream >> n;
image_width = n;
stream >> n;
image_height = n;
break;
} else {
continue;
}
}
/* maxChunk is total number of chunks to process */
maxChunk = ceil((float)image_height/chunkSize);
/* Check image max shades */
while(std::getline(file,workString))
{
if( workString.at(0) != '#' ){
std::stringstream stream(workString);
stream >> image_maxShades;
break;
} else {
continue;
}
}
/* Fill input image matrix */
int pixel_val;
for( int i = 0; i < image_height; i++ )
{
if( std::getline(file,workString) && workString.at(0) != '#' ){
std::stringstream stream(workString);
for( int j = 0; j < image_width; j++ ){
if( !stream )
break;
stream >> pixel_val;
inputImage[i][j] = pixel_val;
}
} else {
continue;
}
}
/************ Function that creates threads and manage dynamic allocation of chunks *********/
dispatch_threads();
/* ********Start writing output to your file************ */
std::ofstream ofile(argv[2]);
if( ofile.is_open() )
{
ofile << "P2" << "\n" << image_width << " " << image_height << "\n" << image_maxShades << "\n";
for( int i = 0; i < image_height; i++ )
{
for( int j = 0; j < image_width; j++ ){
ofile << outputImage[i][j] << " ";
}
ofile << "\n";
}
} else {
std::cout << "ERROR: Could not open output file " << argv[2] << std::endl;
return 0;
}
return 0;
} | 27.012821 | 156 | 0.523019 | [
"vector"
] |
389c2b3fc8e5d98b6db3bb17dc981f1666c973ae | 1,603 | cpp | C++ | C++/BucketSort.cpp | OluSure/Hacktoberfest2021-1 | ad1bafb0db2f0cdeaae8f87abbaa716638c5d2ea | [
"MIT"
] | 215 | 2021-10-01T08:18:16.000Z | 2022-03-29T04:12:03.000Z | C++/BucketSort.cpp | OluSure/Hacktoberfest2021-1 | ad1bafb0db2f0cdeaae8f87abbaa716638c5d2ea | [
"MIT"
] | 175 | 2021-10-03T10:47:31.000Z | 2021-10-20T11:55:32.000Z | C++/BucketSort.cpp | OluSure/Hacktoberfest2021-1 | ad1bafb0db2f0cdeaae8f87abbaa716638c5d2ea | [
"MIT"
] | 807 | 2021-10-01T08:11:45.000Z | 2021-11-21T18:57:09.000Z | /*bucketSort(arr[], n)
1) Create n empty buckets (Or lists).
2) Do following for every array element arr[i].
.......a) Insert arr[i] into bucket[n*array[i]]
3) Sort individual buckets using insertion sort.
4) Concatenate all sorted buckets.
*/
/*Time Complexity: If we assume that insertion in a bucket takes O(1) time then steps 1 and 2 of the above algorithm clearly take O(n) time. The O(1) is easily possible if we use a linked list to represent a bucket (In the following code, C++ vector is used for simplicity). Step 4 also takes O(n) time as there will be n items in all buckets.
The main step to analyze is step 3.
*/
// C++ program to sort an
// array using bucket sort
#include <algorithm>
#include <iostream>
#include <vector>
using namespace std;
// Function to sort arr[] of
// size n using bucket sort
void bucketSort(float arr[], int n)
{
// 1) Create n empty buckets
vector<float> b[n];
// 2) Put array elements
// in different buckets
for (int i = 0; i < n; i++) {
int bi = n * arr[i]; // Index in bucket
b[bi].push_back(arr[i]);
}
// 3) Sort individual buckets
for (int i = 0; i < n; i++)
sort(b[i].begin(), b[i].end());
// 4) Concatenate all buckets into arr[]
int index = 0;
for (int i = 0; i < n; i++)
for (int j = 0; j < b[i].size(); j++)
arr[index++] = b[i][j];
}
/* Driver program to test above function */
int main()
{
float arr[]
= { 0.897, 0.565, 0.656, 0.1234, 0.665, 0.3434 };
int n = sizeof(arr) / sizeof(arr[0]);
bucketSort(arr, n);
cout << "Sorted array is \n";
for (int i = 0; i < n; i++)
cout << arr[i] << " ";
return 0;
}
| 26.716667 | 344 | 0.635059 | [
"vector"
] |
389f79a4ef757737bf79955fa7eb78956fc80e6a | 102,284 | cpp | C++ | ptgl/Core/PrimitiveShapeVertex.cpp | tsumehashi/ptgl | 00434830fa6fbc7987513d6bdd9c967ca66a70c5 | [
"Apache-2.0"
] | 1 | 2019-04-06T11:46:02.000Z | 2019-04-06T11:46:02.000Z | ptgl/Core/PrimitiveShapeVertex.cpp | tsumehashi/ptgl | 00434830fa6fbc7987513d6bdd9c967ca66a70c5 | [
"Apache-2.0"
] | null | null | null | ptgl/Core/PrimitiveShapeVertex.cpp | tsumehashi/ptgl | 00434830fa6fbc7987513d6bdd9c967ca66a70c5 | [
"Apache-2.0"
] | null | null | null | #include "PrimitiveShapeVertex.h"
#include <cmath>
namespace ptgl {
PrimitiveShapeVertex::PrimitiveShapeVertex() {
}
PrimitiveShapeVertex::~PrimitiveShapeVertex() {
}
// Point
const VertexList PrimitiveShapeVertex::PointVertices = {
{0, 0, 0, 0, 0, 1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::PointIndices = {
0
};
// Box (sides)
# if 1
// flat box
const VertexList PrimitiveShapeVertex::BoxVertices = {
// top
{0.5, 0.5, 0.5, 0, 0, 1, 0, 0},
{-0.5, 0.5, 0.5, 0, 0, 1, 0, 0},
{-0.5, -0.5, 0.5, 0, 0, 1, 0, 0},
{0.5, -0.5, 0.5, 0, 0, 1, 0, 0},
// bottom
{0.5, -0.5, -0.5, 0, 0, -1, 0, 0},
{-0.5, -0.5, -0.5, 0, 0, -1, 0, 0},
{-0.5, 0.5, -0.5, 0, 0, -1, 0, 0},
{0.5, 0.5, -0.5, 0, 0, -1, 0, 0},
// front
{0.5, 0.5, 0.5, 1, 0, 0, 0},
{0.5, -0.5, 0.5, 1, 0, 0, 0},
{0.5, -0.5, -0.5, 1, 0, 0, 0},
{0.5, 0.5, -0.5, 1, 0, 0, 0},
// back
{-0.5, 0.5, -0.5, -1, 0, 0, 0},
{-0.5, -0.5, -0.5, -1, 0, 0, 0},
{-0.5, -0.5, 0.5, -1, 0, 0, 0},
{-0.5, 0.5, 0.5, -1, 0, 0, 0},
// right
{0.5, -0.5, 0.5, 0, -1, 0, 0},
{-0.5, -0.5, 0.5, 0, -1, 0, 0},
{-0.5, -0.5, -0.5, 0, -1, 0, 0},
{0.5, -0.5, -0.5, 0, -1, 0, 0},
// left
{0.5, 0.5, -0.5, 0, 1, 0, 0},
{-0.5, 0.5, -0.5, 0, 1, 0, 0},
{-0.5, 0.5, 0.5, 0, 1, 0, 0},
{0.5, 0.5, 0.5, 0, 1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::BoxIndices = {
// top
0, 1, 2,
2, 3, 0,
// bottom
4, 5, 6,
6, 7, 4,
// front
8, 9, 10,
10, 11, 8,
// back
12, 13, 14,
14, 15, 12,
// right
16, 17, 18,
18, 19, 16,
// left
20, 21, 22,
22, 23, 20,
};
#else
// smooth box
const VertexList PrimitiveShapeVertex::BoxVertices = {
{0.5, -0.5, -0.5, 1.5708, -1.5708, -1.5708, 0, 0},
{0.5, -0.5, 0.5, 1.5708, -1.5708, 1.5708, 0, 0},
{-0.5, -0.5, 0.5, -1.5708, -1.5708, 1.5708, 0, 0},
{-0.5, -0.5, -0.5, -1.5708, -1.5708, -1.5708, 0, 0},
{0.5, 0.5, -0.5, 1.5708, 1.5708, -1.5708, 0, 0},
{0.5, 0.5, 0.5, 1.5708, 1.5708, 1.5708, 0, 0},
{-0.5, 0.5, 0.5, -1.5708, 1.5708, 1.5708, 0, 0},
{-0.5, 0.5, -0.5, -1.5708, 1.5708, -1.5708, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::BoxIndices = {
1, 2, 3,
7, 6, 5,
4, 5, 1,
5, 6, 2,
2, 6, 7,
0, 3, 7,
0, 1, 3,
4, 7, 5,
0, 4, 1,
1, 5, 2,
3, 2, 7,
4, 0, 7,
};
#endif
//const VertexList PrimitiveShapeVertex::BoxVertices = {
// {-0.5, -0.5, 0.5, 0, -1, 0, 0, 0},
// {-0.5, 0.5, 0.5, 0, 1, 0, 0, 0},
// {-0.5, -0.5, -0.5, 0, -1, 0, 0, 0},
// {-0.5, 0.5, -0.5, 0, 0, -1, 0, 0},
// {0.5, -0.5, 0.5, 0, -1, 0, 0, 0},
// {0.5, 0.5, 0.5, 0, 1, 0, 0, 0},
// {0.5, -0.5, -0.5, 1, 0, 0, 0, 0},
// {0.5, 0.5, -0.5, 0, 1, 0, 0, 0},
//};
//
//const std::vector<GLuint> PrimitiveShapeVertex::BoxIndices = {
// 3, 2, 0,
// 7, 6, 2,
// 5, 4, 6,
// 1, 0, 4,
// 2, 6, 4,
// 7, 3, 1,
// 1, 3, 0,
// 3, 7, 2,
// 7, 5, 6,
// 5, 1, 4,
// 0, 2, 4,
// 5, 7, 1,
//};
// Sphere (radius)
const VertexList PrimitiveShapeVertex::SphereVertices = {
{0, -1, 0, 0.1558, -0.9878, 0, 0, 0},
{0.723607, -0.44722, 0.525725, 0.6153, -0.5545, 0.5603, 0, 0},
{-0.276388, -0.44722, 0.850649, -0.1685, -0.5545, 0.8149, 0, 0},
{-0.894426, -0.447216, 0, -0.8271, -0.5545, 0.0916, 0, 0},
{-0.276388, -0.44722, -0.850649, -0.3427, -0.5545, -0.7583, 0, 0},
{0.723607, -0.44722, -0.525725, 0.723, -0.5545, -0.4121, 0, 0},
{0.276388, 0.44722, 0.850649, 0.2945, 0.3024, 0.9065, 0, 0},
{-0.723607, 0.44722, 0.525725, -0.7711, 0.3024, 0.5603, 0, 0},
{-0.723607, 0.44722, -0.525725, -0.7711, 0.3024, -0.5603, 0, 0},
{0.276388, 0.44722, -0.850649, 0.2945, 0.3024, -0.9065, 0, 0},
{0.894426, 0.447216, 0, 0.9532, 0.3024, 0, 0, 0},
{0, 1, 0, 0.1261, 0.9878, 0.0916, 0, 0},
{-0.232822, -0.657519, 0.716563, -0.0711, -0.6369, 0.7676, 0, 0},
{-0.162456, -0.850654, 0.499995, 0.0144, -0.8363, 0.5481, 0, 0},
{-0.077607, -0.96795, 0.238853, 0.0891, -0.9575, 0.2744, 0, 0},
{0.203181, -0.96795, 0.147618, 0.2627, -0.9158, 0.3039, 0, 0},
{0.425323, -0.850654, 0.309011, 0.4674, -0.7594, 0.4526, 0, 0},
{0.609547, -0.657519, 0.442856, 0.6153, -0.5545, 0.5603, 0, 0},
{0.531941, -0.502302, 0.681712, 0.6153, -0.5545, 0.5603, 0, 0},
{0.262869, -0.525738, 0.809012, 0.3854, -0.5955, 0.7049, 0, 0},
{-0.029639, -0.502302, 0.864184, 0.1026, -0.5955, 0.7968, 0, 0},
{0.812729, -0.502301, -0.295238, 0.7081, -0.6369, -0.3049, 0, 0},
{0.850648, -0.525736, 0, 0.74, -0.6726, -0, 0, 0},
{0.812729, -0.502301, 0.295238, 0.7081, -0.6369, 0.3049, 0, 0},
{0.203181, -0.96795, -0.147618, 0.1558, -0.9878, 0, 0, 0},
{0.425323, -0.850654, -0.309011, 0.3702, -0.9158, -0.1559, 0, 0},
{0.609547, -0.657519, -0.442856, 0.5749, -0.7594, -0.3046, 0, 0},
{-0.753442, -0.657515, 0, -0.752, -0.6369, 0.1696, 0, 0},
{-0.52573, -0.850652, 0, -0.5168, -0.8363, 0.183, 0, 0},
{-0.251147, -0.967949, 0, -0.2334, -0.9575, 0.1696, 0, 0},
{-0.483971, -0.502302, 0.716565, -0.3427, -0.5545, 0.7583, 0, 0},
{-0.688189, -0.525736, 0.499997, -0.5513, -0.5955, 0.5843, 0, 0},
{-0.831051, -0.502299, 0.238853, -0.7261, -0.5955, 0.3438, 0, 0},
{-0.232822, -0.657519, -0.716563, -0.3936, -0.6369, -0.6628, 0, 0},
{-0.162456, -0.850654, -0.499995, -0.3338, -0.8363, -0.435, 0, 0},
{-0.077607, -0.96795, -0.238853, -0.2334, -0.9575, -0.1696, 0, 0},
{-0.831051, -0.502299, -0.238853, -0.8271, -0.5545, -0.0916, 0, 0},
{-0.688189, -0.525736, -0.499997, -0.7261, -0.5955, -0.3438, 0, 0},
{-0.483971, -0.502302, -0.716565, -0.5513, -0.5955, -0.5843, 0, 0},
{-0.029639, -0.502302, -0.864184, -0.1685, -0.5545, -0.8149, 0, 0},
{0.262869, -0.525738, -0.809012, 0.1026, -0.5955, -0.7968, 0, 0},
{0.531941, -0.502302, -0.681712, 0.3854, -0.5955, -0.7049, 0, 0},
{0.956626, 0.251149, 0.147618, 0.9854, 0.1702, 0, 0, 0},
{0.951058, -0, 0.309013, 0.9831, -0.0962, 0.1557, 0, 0},
{0.860698, -0.251151, 0.442858, 0.8864, -0.3485, 0.3049, 0, 0},
{0.860698, -0.251151, -0.442858, 0.8193, -0.3987, -0.4121, 0, 0},
{0.951058, 0, -0.309013, 0.9363, -0.1745, -0.3046, 0, 0},
{0.956626, 0.251149, -0.147618, 0.9846, 0.0784, -0.156, 0, 0},
{0.155215, 0.251152, 0.955422, 0.3045, 0.1702, 0.9372, 0, 0},
{0, -0, 1, 0.1557, -0.0962, 0.9831, 0, 0},
{-0.155215, -0.251152, 0.955422, -0.016, -0.3485, 0.9372, 0, 0},
{0.687159, -0.251152, 0.681715, 0.6451, -0.3987, 0.6519, 0, 0},
{0.587786, 0, 0.809017, 0.5791, -0.1745, 0.7964, 0, 0},
{0.436007, 0.251152, 0.864188, 0.4526, 0.0784, 0.8883, 0, 0},
{-0.860698, 0.251151, 0.442858, -0.7972, 0.1702, 0.5792, 0, 0},
{-0.951058, -0, 0.309013, -0.8869, -0.0962, 0.4519, 0, 0},
{-0.956626, -0.251149, 0.147618, -0.8963, -0.3485, 0.2744, 0, 0},
{-0.436007, -0.251152, 0.864188, -0.4206, -0.3987, 0.8149, 0, 0},
{-0.587786, 0, 0.809017, -0.5785, -0.1745, 0.7968, 0, 0},
{-0.687159, 0.251152, 0.681715, -0.7049, 0.0784, 0.7049, 0, 0},
{-0.687159, 0.251152, -0.681715, -0.7972, 0.1702, -0.5792, 0, 0},
{-0.587786, -0, -0.809017, -0.7038, -0.0962, -0.7038, 0, 0},
{-0.436007, -0.251152, -0.864188, -0.5379, -0.3485, -0.7676, 0, 0},
{-0.956626, -0.251149, -0.147618, -0.905, -0.3987, -0.1482, 0, 0},
{-0.951058, 0, -0.309013, -0.9366, -0.1745, -0.3039, 0, 0},
{-0.860698, 0.251151, -0.442858, -0.8883, 0.0784, -0.4526, 0, 0},
{0.436007, 0.251152, -0.864188, 0.3045, 0.1702, -0.9372, 0, 0},
{0.587786, -0, -0.809017, 0.4519, -0.0962, -0.8869, 0, 0},
{0.687159, -0.251152, -0.681715, 0.5638, -0.3485, -0.7488, 0, 0},
{-0.155215, -0.251152, -0.955422, -0.1387, -0.3987, -0.9065, 0, 0},
{0, 0, -1, -0.0004, -0.1745, -0.9846, 0, 0},
{0.155215, 0.251152, -0.955422, 0.156, 0.0784, -0.9846, 0, 0},
{0.831051, 0.502299, 0.238853, 0.905, 0.3987, 0.1482, 0, 0},
{0.688189, 0.525736, 0.499997, 0.8039, 0.4399, 0.4003, 0, 0},
{0.483971, 0.502302, 0.716565, 0.6291, 0.4399, 0.6409, 0, 0},
{0.029639, 0.502302, 0.864184, 0.1387, 0.3987, 0.9065, 0, 0},
{-0.262869, 0.525738, 0.809012, -0.1323, 0.4399, 0.8883, 0, 0},
{-0.531941, 0.502302, 0.681712, -0.4151, 0.4399, 0.7964, 0, 0},
{-0.812729, 0.502301, 0.295238, -0.8193, 0.3987, 0.4121, 0, 0},
{-0.850648, 0.525736, 0, -0.8857, 0.4399, 0.1487, 0, 0},
{-0.812729, 0.502301, -0.295238, -0.8857, 0.4399, -0.1487, 0, 0},
{-0.531941, 0.502302, -0.681712, -0.6451, 0.3987, -0.6519, 0, 0},
{-0.262869, 0.525738, -0.809012, -0.4151, 0.4399, -0.7964, 0, 0},
{0.029639, 0.502302, -0.864184, -0.1323, 0.4399, -0.8883, 0, 0},
{0.483971, 0.502302, -0.716565, 0.4206, 0.3987, -0.8149, 0, 0},
{0.688189, 0.525736, -0.499997, 0.6291, 0.4399, -0.6409, 0, 0},
{0.831051, 0.502299, -0.238853, 0.8039, 0.4399, -0.4003, 0, 0},
{0.077607, 0.96795, 0.238853, 0.2334, 0.9575, 0.1696, 0, 0},
{0.162456, 0.850654, 0.499995, 0.3338, 0.8363, 0.435, 0, 0},
{0.232822, 0.657519, 0.716563, 0.3936, 0.6369, 0.6628, 0, 0},
{0.753442, 0.657515, 0, 0.8271, 0.5545, 0.0916, 0, 0},
{0.52573, 0.850652, 0, 0.6441, 0.7594, 0.0915, 0, 0},
{0.251147, 0.967949, 0, 0.3912, 0.9158, 0.0915, 0, 0},
{-0.203181, 0.96795, 0.147618, -0.0891, 0.9575, 0.2743, 0, 0},
{-0.425323, 0.850654, 0.309011, -0.3105, 0.8363, 0.4519, 0, 0},
{-0.609547, 0.657519, 0.442856, -0.5087, 0.6369, 0.5792, 0, 0},
{-0.203181, 0.96795, -0.147618, -0.2885, 0.9575, 0, 0, 0},
{-0.425323, 0.850654, -0.309011, -0.5257, 0.8363, -0.1557, 0, 0},
{-0.609547, 0.657519, -0.442856, -0.7081, 0.6369, -0.3049, 0, 0},
{0.077607, 0.96795, -0.238853, -0.0891, 0.9575, -0.2743, 0, 0},
{0.162456, 0.850654, -0.499995, -0.0144, 0.8363, -0.5481, 0, 0},
{0.232822, 0.657519, -0.716563, 0.0711, 0.6369, -0.7676, 0, 0},
{0.3618, 0.894429, -0.262863, 0.3338, 0.8363, -0.435, 0, 0},
{0.638194, 0.72361, -0.262864, 0.5987, 0.6726, -0.435, 0, 0},
{0.447209, 0.723612, -0.525728, 0.3936, 0.6369, -0.6628, 0, 0},
{-0.138197, 0.89443, -0.425319, -0.3105, 0.8363, -0.4519, 0, 0},
{-0.05279, 0.723612, -0.688185, -0.2287, 0.6726, -0.7038, 0, 0},
{-0.361804, 0.723612, -0.587778, -0.5087, 0.6369, -0.5792, 0, 0},
{-0.44721, 0.894429, 0, -0.5257, 0.8363, 0.1557, 0, 0},
{-0.670817, 0.723611, -0.162457, -0.74, 0.6726, 0, 0, 0},
{-0.670817, 0.723611, 0.162457, -0.7081, 0.6369, 0.3049, 0, 0},
{-0.138197, 0.89443, 0.425319, -0.0144, 0.8363, 0.5481, 0, 0},
{-0.361804, 0.723612, 0.587778, -0.2287, 0.6726, 0.7038, 0, 0},
{-0.05279, 0.723612, 0.688185, 0.0711, 0.6369, 0.7676, 0, 0},
{0.3618, 0.894429, 0.262863, 0.5168, 0.8363, 0.183, 0, 0},
{0.447209, 0.723612, 0.525728, 0.5987, 0.6726, 0.435, 0, 0},
{0.638194, 0.72361, 0.262864, 0.752, 0.6369, 0.1696, 0, 0},
{0.861804, 0.276396, -0.425322, 0.7544, 0.3611, -0.5481, 0, 0},
{0.809019, 0, -0.587782, 0.7038, 0.0962, -0.7038, 0, 0},
{0.670821, 0.276397, -0.688189, 0.5379, 0.3485, -0.7676, 0, 0},
{-0.138199, 0.276397, -0.951055, -0.2882, 0.3611, -0.8869, 0, 0},
{-0.309016, -0, -0.951057, -0.4519, 0.0962, -0.8869, 0, 0},
{-0.447215, 0.276397, -0.850649, -0.5638, 0.3485, -0.7488, 0, 0},
{-0.947213, 0.276396, -0.162458, -0.9325, 0.3611, 0, 0, 0},
{-1, 1e-06, 0, -0.9831, 0.0962, 0.1557, 0, 0},
{-0.947213, 0.276397, 0.162458, -0.8864, 0.3485, 0.3049, 0, 0},
{-0.447216, 0.276397, 0.850648, -0.2882, 0.3611, 0.8869, 0, 0},
{-0.309017, -1e-06, 0.951056, -0.1557, 0.0962, 0.9831, 0, 0},
{-0.138199, 0.276397, 0.951055, 0.016, 0.3485, 0.9372, 0, 0},
{0.67082, 0.276396, 0.68819, 0.7544, 0.3611, 0.5481, 0, 0},
{0.809019, -2e-06, 0.587783, 0.8869, 0.0962, 0.4519, 0, 0},
{0.861804, 0.276394, 0.425323, 0.8963, 0.3485, 0.2744, 0, 0},
{0.309017, -0, -0.951056, 0.1557, -0.0962, -0.9831, 0, 0},
{0.447216, -0.276398, -0.850648, 0.2882, -0.3611, -0.8869, 0, 0},
{0.138199, -0.276398, -0.951055, -0.016, -0.3485, -0.9372, 0, 0},
{-0.809018, -0, -0.587783, -0.8869, -0.0962, -0.4519, 0, 0},
{-0.670819, -0.276397, -0.688191, -0.7544, -0.3611, -0.5481, 0, 0},
{-0.861803, -0.276396, -0.425324, -0.8963, -0.3485, -0.2744, 0, 0},
{-0.809018, 0, 0.587783, -0.7038, -0.0962, 0.7038, 0, 0},
{-0.861803, -0.276396, 0.425324, -0.7544, -0.3611, 0.5481, 0, 0},
{-0.670819, -0.276397, 0.688191, -0.5379, -0.3485, 0.7676, 0, 0},
{0.309017, 0, 0.951056, 0.4519, -0.0962, 0.8869, 0, 0},
{0.138199, -0.276398, 0.951055, 0.2882, -0.3611, 0.8869, 0, 0},
{0.447216, -0.276398, 0.850648, 0.5638, -0.3485, 0.7488, 0, 0},
{1, 0, 0, 0.9831, -0.0962, -0.1557, 0, 0},
{0.947213, -0.276396, 0.162458, 0.9325, -0.3611, 0, 0, 0},
{0.947213, -0.276396, -0.162458, 0.8864, -0.3485, -0.3049, 0, 0},
{0.361803, -0.723612, -0.587779, 0.2287, -0.6726, -0.7038, 0, 0},
{0.138197, -0.894429, -0.425321, 0.0144, -0.8363, -0.5481, 0, 0},
{0.052789, -0.723611, -0.688186, -0.0711, -0.6369, -0.7676, 0, 0},
{-0.447211, -0.723612, -0.525727, -0.5987, -0.6726, -0.435, 0, 0},
{-0.361801, -0.894429, -0.262863, -0.5168, -0.8363, -0.183, 0, 0},
{-0.638195, -0.723609, -0.262863, -0.752, -0.6369, -0.1696, 0, 0},
{-0.638195, -0.723609, 0.262864, -0.5987, -0.6726, 0.435, 0, 0},
{-0.361801, -0.894428, 0.262864, -0.3338, -0.8363, 0.435, 0, 0},
{-0.447211, -0.72361, 0.525729, -0.3936, -0.6369, 0.6628, 0, 0},
{0.670817, -0.723611, -0.162457, 0.5257, -0.8363, -0.1557, 0, 0},
{0.670818, -0.72361, 0.162458, 0.5257, -0.8363, 0.1557, 0, 0},
{0.447211, -0.894428, 1e-06, 0.2885, -0.9575, 0, 0, 0},
{0.05279, -0.723612, 0.688185, 0.2287, -0.6726, 0.7038, 0, 0},
{0.138199, -0.894429, 0.425321, 0.3105, -0.8363, 0.4519, 0, 0},
{0.361805, -0.723611, 0.587779, 0.5087, -0.6369, 0.5792, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::SphereIndices = {
0, 15, 14,
1, 17, 23,
0, 14, 29,
0, 29, 35,
0, 35, 24,
1, 23, 44,
2, 20, 50,
3, 32, 56,
4, 38, 62,
5, 41, 68,
1, 44, 51,
2, 50, 57,
3, 56, 63,
4, 62, 69,
5, 68, 45,
6, 74, 89,
7, 77, 95,
8, 80, 98,
9, 83, 101,
10, 86, 90,
92, 99, 11,
91, 102, 92,
90, 103, 91,
92, 102, 99,
102, 100, 99,
91, 103, 102,
103, 104, 102,
102, 104, 100,
104, 101, 100,
90, 86, 103,
86, 85, 103,
103, 85, 104,
85, 84, 104,
104, 84, 101,
84, 9, 101,
99, 96, 11,
100, 105, 99,
101, 106, 100,
99, 105, 96,
105, 97, 96,
100, 106, 105,
106, 107, 105,
105, 107, 97,
107, 98, 97,
101, 83, 106,
83, 82, 106,
106, 82, 107,
82, 81, 107,
107, 81, 98,
81, 8, 98,
96, 93, 11,
97, 108, 96,
98, 109, 97,
96, 108, 93,
108, 94, 93,
97, 109, 108,
109, 110, 108,
108, 110, 94,
110, 95, 94,
98, 80, 109,
80, 79, 109,
109, 79, 110,
79, 78, 110,
110, 78, 95,
78, 7, 95,
93, 87, 11,
94, 111, 93,
95, 112, 94,
93, 111, 87,
111, 88, 87,
94, 112, 111,
112, 113, 111,
111, 113, 88,
113, 89, 88,
95, 77, 112,
77, 76, 112,
112, 76, 113,
76, 75, 113,
113, 75, 89,
75, 6, 89,
87, 92, 11,
88, 114, 87,
89, 115, 88,
87, 114, 92,
114, 91, 92,
88, 115, 114,
115, 116, 114,
114, 116, 91,
116, 90, 91,
89, 74, 115,
74, 73, 115,
115, 73, 116,
73, 72, 116,
116, 72, 90,
72, 10, 90,
47, 86, 10,
46, 117, 47,
45, 118, 46,
47, 117, 86,
117, 85, 86,
46, 118, 117,
118, 119, 117,
117, 119, 85,
119, 84, 85,
45, 68, 118,
68, 67, 118,
118, 67, 119,
67, 66, 119,
119, 66, 84,
66, 9, 84,
71, 83, 9,
70, 120, 71,
69, 121, 70,
71, 120, 83,
120, 82, 83,
70, 121, 120,
121, 122, 120,
120, 122, 82,
122, 81, 82,
69, 62, 121,
62, 61, 121,
121, 61, 122,
61, 60, 122,
122, 60, 81,
60, 8, 81,
65, 80, 8,
64, 123, 65,
63, 124, 64,
65, 123, 80,
123, 79, 80,
64, 124, 123,
124, 125, 123,
123, 125, 79,
125, 78, 79,
63, 56, 124,
56, 55, 124,
124, 55, 125,
55, 54, 125,
125, 54, 78,
54, 7, 78,
59, 77, 7,
58, 126, 59,
57, 127, 58,
59, 126, 77,
126, 76, 77,
58, 127, 126,
127, 128, 126,
126, 128, 76,
128, 75, 76,
57, 50, 127,
50, 49, 127,
127, 49, 128,
49, 48, 128,
128, 48, 75,
48, 6, 75,
53, 74, 6,
52, 129, 53,
51, 130, 52,
53, 129, 74,
129, 73, 74,
52, 130, 129,
130, 131, 129,
129, 131, 73,
131, 72, 73,
51, 44, 130,
44, 43, 130,
130, 43, 131,
43, 42, 131,
131, 42, 72,
42, 10, 72,
66, 71, 9,
67, 132, 66,
68, 133, 67,
66, 132, 71,
132, 70, 71,
67, 133, 132,
133, 134, 132,
132, 134, 70,
134, 69, 70,
68, 41, 133,
41, 40, 133,
133, 40, 134,
40, 39, 134,
134, 39, 69,
39, 4, 69,
60, 65, 8,
61, 135, 60,
62, 136, 61,
60, 135, 65,
135, 64, 65,
61, 136, 135,
136, 137, 135,
135, 137, 64,
137, 63, 64,
62, 38, 136,
38, 37, 136,
136, 37, 137,
37, 36, 137,
137, 36, 63,
36, 3, 63,
54, 59, 7,
55, 138, 54,
56, 139, 55,
54, 138, 59,
138, 58, 59,
55, 139, 138,
139, 140, 138,
138, 140, 58,
140, 57, 58,
56, 32, 139,
32, 31, 139,
139, 31, 140,
31, 30, 140,
140, 30, 57,
30, 2, 57,
48, 53, 6,
49, 141, 48,
50, 142, 49,
48, 141, 53,
141, 52, 53,
49, 142, 141,
142, 143, 141,
141, 143, 52,
143, 51, 52,
50, 20, 142,
20, 19, 142,
142, 19, 143,
19, 18, 143,
143, 18, 51,
18, 1, 51,
42, 47, 10,
43, 144, 42,
44, 145, 43,
42, 144, 47,
144, 46, 47,
43, 145, 144,
145, 146, 144,
144, 146, 46,
146, 45, 46,
44, 23, 145,
23, 22, 145,
145, 22, 146,
22, 21, 146,
146, 21, 45,
21, 5, 45,
26, 41, 5,
25, 147, 26,
24, 148, 25,
26, 147, 41,
147, 40, 41,
25, 148, 147,
148, 149, 147,
147, 149, 40,
149, 39, 40,
24, 35, 148,
35, 34, 148,
148, 34, 149,
34, 33, 149,
149, 33, 39,
33, 4, 39,
33, 38, 4,
34, 150, 33,
35, 151, 34,
33, 150, 38,
150, 37, 38,
34, 151, 150,
151, 152, 150,
150, 152, 37,
152, 36, 37,
35, 29, 151,
29, 28, 151,
151, 28, 152,
28, 27, 152,
152, 27, 36,
27, 3, 36,
27, 32, 3,
28, 153, 27,
29, 154, 28,
27, 153, 32,
153, 31, 32,
28, 154, 153,
154, 155, 153,
153, 155, 31,
155, 30, 31,
29, 14, 154,
14, 13, 154,
154, 13, 155,
13, 12, 155,
155, 12, 30,
12, 2, 30,
21, 26, 5,
22, 156, 21,
23, 157, 22,
21, 156, 26,
156, 25, 26,
22, 157, 156,
157, 158, 156,
156, 158, 25,
158, 24, 25,
23, 17, 157,
17, 16, 157,
157, 16, 158,
16, 15, 158,
158, 15, 24,
15, 0, 24,
12, 20, 2,
13, 159, 12,
14, 160, 13,
12, 159, 20,
159, 19, 20,
13, 160, 159,
160, 161, 159,
159, 161, 19,
161, 18, 19,
14, 15, 160,
15, 16, 160,
160, 16, 161,
16, 17, 161,
161, 17, 18,
17, 1, 18,
};
// Cylinder (length, radius)
#if 0
// smooth
const VertexList PrimitiveShapeVertex::CylinderVertices = {
{-1, 0, -0.5, 0, 0, -1, 0, 0},
{-1, 0, 0.5, 0, 0, 1, 0, 0},
{-0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{-0.980785, 0.19509, 0.5, 0, 0, 1, 0, 0},
{-0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{-0.92388, 0.382683, 0.5, 0, 0, 1, 0, 0},
{-0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{-0.83147, 0.55557, 0.5, 0, 0, 1, 0, 0},
{-0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{-0.707107, 0.707107, 0.5, 0, 0, 1, 0, 0},
{-0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{-0.55557, 0.83147, 0.5, 0, 0, 1, 0, 0},
{-0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{-0.382683, 0.92388, 0.5, 0, 0, 1, 0, 0},
{-0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{-0.19509, 0.980785, 0.5, 0, 0, 1, 0, 0},
{-0, 1, -0.5, 0, 0, -1, 0, 0},
{-0, 1, 0.5, 0, 0, 1, 0, 0},
{0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{0.19509, 0.980785, 0.5, 0, 0, 1, 0, 0},
{0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{0.382683, 0.92388, 0.5, 0, 0, 1, 0, 0},
{0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{0.55557, 0.83147, 0.5, 0, 0, 1, 0, 0},
{0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{0.707107, 0.707107, 0.5, 0, 0, 1, 0, 0},
{0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{0.83147, 0.55557, 0.5, 0, 0, 1, 0, 0},
{0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{0.92388, 0.382683, 0.5, 0, 0, 1, 0, 0},
{0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{0.980785, 0.19509, 0.5, 0, 0, 1, 0, 0},
{1, -0, -0.5, 0, 0, -1, 0, 0},
{1, -0, 0.5, 0, 0, 1, 0, 0},
{0.980785, -0.195091, -0.5, 0, 0, -1, 0, 0},
{0.980785, -0.195091, 0.5, 0, 0, 1, 0, 0},
{0.923879, -0.382684, -0.5, 0, 0, -1, 0, 0},
{0.923879, -0.382684, 0.5, 0, 0, 1, 0, 0},
{0.831469, -0.555571, -0.5, 0, 0, -1, 0, 0},
{0.831469, -0.555571, 0.5, 0, 0, 1, 0, 0},
{0.707106, -0.707107, -0.5, 0, 0, -1, 0, 0},
{0.707106, -0.707107, 0.5, 0, 0, 1, 0, 0},
{0.55557, -0.83147, -0.5, 0, 0, -1, 0, 0},
{0.55557, -0.83147, 0.5, 0, 0, 1, 0, 0},
{0.382683, -0.92388, -0.5, 0, 0, -1, 0, 0},
{0.382683, -0.92388, 0.5, 0, 0, 1, 0, 0},
{0.195089, -0.980785, -0.5, 0, 0, -1, 0, 0},
{0.195089, -0.980785, 0.5, 0, 0, 1, 0, 0},
{-1e-06, -1, -0.5, 0, 0, -1, 0, 0},
{-1e-06, -1, 0.5, 0, 0, 1, 0, 0},
{-0.195091, -0.980785, -0.5, 0, 0, -1, 0, 0},
{-0.195091, -0.980785, 0.5, 0, 0, 1, 0, 0},
{-0.382684, -0.923879, -0.5, 0, 0, -1, 0, 0},
{-0.382684, -0.923879, 0.5, 0, 0, 1, 0, 0},
{-0.555571, -0.831469, -0.5, 0, 0, -1, 0, 0},
{-0.555571, -0.831469, 0.5, 0, 0, 1, 0, 0},
{-0.707108, -0.707106, -0.5, 0, 0, -1, 0, 0},
{-0.707108, -0.707106, 0.5, 0, 0, 1, 0, 0},
{-0.83147, -0.555569, -0.5, 0, 0, -1, 0, 0},
{-0.83147, -0.555569, 0.5, 0, 0, 1, 0, 0},
{-0.92388, -0.382682, -0.5, 0, 0, -1, 0, 0},
{-0.92388, -0.382682, 0.5, -0.9569, -0.2903, 0, 0, 0},
{-0.980786, -0.195089, -0.5, 0, 0, -1, 0, 0},
{-0.980786, -0.195089, 0.5, -0.9952, -0.098, 0, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::CylinderIndices = {
1, 3, 2,
3, 5, 4,
5, 7, 6,
7, 9, 8,
9, 11, 10,
11, 13, 12,
13, 15, 14,
15, 17, 16,
17, 19, 18,
19, 21, 20,
21, 23, 22,
23, 25, 24,
25, 27, 26,
27, 29, 28,
29, 31, 30,
31, 33, 32,
33, 35, 34,
35, 37, 36,
37, 39, 38,
39, 41, 40,
41, 43, 42,
43, 45, 44,
45, 47, 46,
47, 49, 48,
49, 51, 50,
51, 53, 52,
53, 55, 54,
55, 57, 56,
57, 59, 58,
59, 61, 60,
37, 21, 53,
63, 1, 0,
61, 63, 62,
30, 46, 14,
0, 1, 2,
2, 3, 4,
4, 5, 6,
6, 7, 8,
8, 9, 10,
10, 11, 12,
12, 13, 14,
14, 15, 16,
16, 17, 18,
18, 19, 20,
20, 21, 22,
22, 23, 24,
24, 25, 26,
26, 27, 28,
28, 29, 30,
30, 31, 32,
32, 33, 34,
34, 35, 36,
36, 37, 38,
38, 39, 40,
40, 41, 42,
42, 43, 44,
44, 45, 46,
46, 47, 48,
48, 49, 50,
50, 51, 52,
52, 53, 54,
54, 55, 56,
56, 57, 58,
58, 59, 60,
5, 3, 1,
1, 63, 5,
61, 59, 57,
57, 55, 53,
53, 51, 49,
49, 47, 53,
45, 43, 37,
41, 39, 37,
37, 35, 33,
33, 31, 29,
29, 27, 25,
25, 23, 21,
21, 19, 17,
17, 15, 21,
13, 11, 9,
9, 7, 5,
5, 63, 61,
61, 57, 5,
53, 47, 45,
43, 41, 37,
37, 33, 21,
29, 25, 21,
21, 15, 13,
13, 9, 21,
5, 57, 53,
53, 45, 37,
33, 29, 21,
21, 9, 5,
5, 53, 21,
62, 63, 0,
60, 61, 62,
62, 0, 2,
2, 4, 6,
6, 8, 10,
10, 12, 6,
14, 16, 18,
18, 20, 14,
22, 24, 30,
26, 28, 30,
30, 32, 34,
34, 36, 38,
38, 40, 42,
42, 44, 46,
46, 48, 50,
50, 52, 54,
54, 56, 62,
58, 60, 62,
62, 2, 14,
6, 12, 14,
14, 20, 22,
24, 26, 30,
30, 34, 46,
38, 42, 46,
46, 50, 62,
56, 58, 62,
2, 6, 14,
14, 22, 30,
34, 38, 46,
50, 54, 62,
62, 14, 46,
};
#else
const VertexList PrimitiveShapeVertex::CylinderVertices = {
{-1, 0, -0.5, -0.9952, -0.098, 0, 0, 0},
{-1, 0, 0.5, -0.9952, 0.098, 0, 0, 0},
{-0.980785, 0.19509, -0.5, -0.9569, 0.2903, 0, 0, 0},
{-0.980785, 0.19509, 0.5, -0.9569, 0.2903, 0, 0, 0},
{-0.92388, 0.382683, -0.5, -0.8819, 0.4714, 0, 0, 0},
{-0.92388, 0.382683, 0.5, -0.8819, 0.4714, 0, 0, 0},
{-0.83147, 0.55557, -0.5, -0.773, 0.6344, 0, 0, 0},
{-0.83147, 0.55557, 0.5, -0.773, 0.6344, 0, 0, 0},
{-0.707107, 0.707107, -0.5, -0.6344, 0.773, 0, 0, 0},
{-0.707107, 0.707107, 0.5, -0.6344, 0.773, 0, 0, 0},
{-0.55557, 0.83147, -0.5, -0.4714, 0.8819, 0, 0, 0},
{-0.55557, 0.83147, 0.5, -0.4714, 0.8819, 0, 0, 0},
{-0.382683, 0.92388, -0.5, -0.2903, 0.9569, 0, 0, 0},
{-0.382683, 0.92388, 0.5, -0.2903, 0.9569, 0, 0, 0},
{-0.19509, 0.980785, -0.5, -0.098, 0.9952, 0, 0, 0},
{-0.19509, 0.980785, 0.5, -0.098, 0.9952, 0, 0, 0},
{0, 1, -0.5, 0.098, 0.9952, 0, 0, 0},
{0, 1, 0.5, 0.098, 0.9952, 0, 0, 0},
{0.19509, 0.980785, -0.5, 0.2903, 0.9569, 0, 0, 0},
{0.19509, 0.980785, 0.5, 0.2903, 0.9569, 0, 0, 0},
{0.382683, 0.92388, -0.5, 0.4714, 0.8819, 0, 0, 0},
{0.382683, 0.92388, 0.5, 0.4714, 0.8819, 0, 0, 0},
{0.55557, 0.83147, -0.5, 0.6344, 0.773, 0, 0, 0},
{0.55557, 0.83147, 0.5, 0.6344, 0.773, 0, 0, 0},
{0.707107, 0.707107, -0.5, 0.773, 0.6344, 0, 0, 0},
{0.707107, 0.707107, 0.5, 0.773, 0.6344, 0, 0, 0},
{0.83147, 0.55557, -0.5, 0.8819, 0.4714, 0, 0, 0},
{0.83147, 0.55557, 0.5, 0.8819, 0.4714, 0, 0, 0},
{0.92388, 0.382683, -0.5, 0.9569, 0.2903, 0, 0, 0},
{0.92388, 0.382683, 0.5, 0.9569, 0.2903, 0, 0, 0},
{0.980785, 0.19509, -0.5, 0.9952, 0.098, 0, 0, 0},
{0.980785, 0.19509, 0.5, 0.9952, 0.098, 0, 0, 0},
{1, 0, -0.5, 0.9952, -0.098, 0, 0, 0},
{1, 0, 0.5, 0.9952, -0.098, 0, 0, 0},
{0.980785, -0.195091, -0.5, 0.9569, -0.2903, 0, 0, 0},
{0.980785, -0.195091, 0.5, 0.9569, -0.2903, 0, 0, 0},
{0.923879, -0.382684, -0.5, 0.8819, -0.4714, 0, 0, 0},
{0.923879, -0.382684, 0.5, 0.8819, -0.4714, 0, 0, 0},
{0.831469, -0.555571, -0.5, 0.773, -0.6344, 0, 0, 0},
{0.831469, -0.555571, 0.5, 0.773, -0.6344, 0, 0, 0},
{0.707106, -0.707107, -0.5, 0.6344, -0.773, 0, 0, 0},
{0.707106, -0.707107, 0.5, 0.6344, -0.773, 0, 0, 0},
{0.55557, -0.83147, -0.5, 0.4714, -0.8819, 0, 0, 0},
{0.55557, -0.83147, 0.5, 0.4714, -0.8819, 0, 0, 0},
{0.382683, -0.92388, -0.5, 0.2903, -0.9569, 0, 0, 0},
{0.382683, -0.92388, 0.5, 0.2903, -0.9569, 0, 0, 0},
{0.195089, -0.980785, -0.5, 0.098, -0.9952, 0, 0, 0},
{0.195089, -0.980785, 0.5, 0.098, -0.9952, 0, 0, 0},
{-1e-06, -1, -0.5, -0.098, -0.9952, 0, 0, 0},
{-1e-06, -1, 0.5, -0.098, -0.9952, 0, 0, 0},
{-0.195091, -0.980785, -0.5, -0.2903, -0.9569, 0, 0, 0},
{-0.195091, -0.980785, 0.5, -0.2903, -0.9569, 0, 0, 0},
{-0.382684, -0.923879, -0.5, -0.4714, -0.8819, 0, 0, 0},
{-0.382684, -0.923879, 0.5, -0.4714, -0.8819, 0, 0, 0},
{-0.555571, -0.831469, -0.5, -0.6344, -0.773, 0, 0, 0},
{-0.555571, -0.831469, 0.5, -0.6344, -0.773, 0, 0, 0},
{-0.707108, -0.707106, -0.5, -0.773, -0.6344, 0, 0, 0},
{-0.707108, -0.707106, 0.5, -0.773, -0.6344, 0, 0, 0},
{-0.83147, -0.555569, -0.5, -0.8819, -0.4714, 0, 0, 0},
{-0.83147, -0.555569, 0.5, -0.8819, -0.4714, 0, 0, 0},
{-0.92388, -0.382682, -0.5, -0.9569, -0.2903, 0, 0, 0},
{-0.92388, -0.382682, 0.5, -0.9569, -0.2903, 0, 0, 0},
{-0.980786, -0.195089, -0.5, -0.9952, -0.098, 0, 0, 0},
{-0.980786, -0.195089, 0.5, -0.9952, -0.098, 0, 0, 0},
{0, 0, -0.5, 0, 0, -1, 0, 0},
{0, 0, 0.5, 0, 0, 1, 0, 0},
{-1, 0, -0.5, 0, 0, -1, 0, 0},
{-1, 0, 0.5, 0, 0, 1, 0, 0},
{-0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{-0.980785, 0.19509, 0.5, 0, 0, 1, 0, 0},
{-0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{-0.92388, 0.382683, 0.5, 0, 0, 1, 0, 0},
{-0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{-0.83147, 0.55557, 0.5, 0, 0, 1, 0, 0},
{-0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{-0.707107, 0.707107, 0.5, 0, 0, 1, 0, 0},
{-0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{-0.55557, 0.83147, 0.5, 0, 0, 1, 0, 0},
{-0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{-0.382683, 0.92388, 0.5, 0, 0, 1, 0, 0},
{-0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{-0.19509, 0.980785, 0.5, 0, 0, 1, 0, 0},
{0, 1, -0.5, 0, 0, -1, 0, 0},
{0, 1, 0.5, 0, 0, 1, 0, 0},
{0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{0.19509, 0.980785, 0.5, 0, 0, 1, 0, 0},
{0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{0.382683, 0.92388, 0.5, 0, 0, 1, 0, 0},
{0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{0.55557, 0.83147, 0.5, 0, 0, 1, 0, 0},
{0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{0.707107, 0.707107, 0.5, 0, 0, 1, 0, 0},
{0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{0.83147, 0.55557, 0.5, 0, 0, 1, 0, 0},
{0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{0.92388, 0.382683, 0.5, 0, 0, 1, 0, 0},
{0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{0.980785, 0.19509, 0.5, 0, 0, 1, 0, 0},
{1, 0, -0.5, 0, 0, -1, 0, 0},
{1, 0, 0.5, 0, 0, 1, 0, 0},
{0.980785, -0.195091, -0.5, 0, 0, -1, 0, 0},
{0.980785, -0.195091, 0.5, 0, 0, 1, 0, 0},
{0.923879, -0.382684, -0.5, 0, 0, -1, 0, 0},
{0.923879, -0.382684, 0.5, 0, 0, 1, 0, 0},
{0.831469, -0.555571, -0.5, 0, 0, -1, 0, 0},
{0.831469, -0.555571, 0.5, 0, 0, 1, 0, 0},
{0.707106, -0.707107, -0.5, 0, 0, -1, 0, 0},
{0.707106, -0.707107, 0.5, 0, 0, 1, 0, 0},
{0.55557, -0.83147, -0.5, 0, 0, -1, 0, 0},
{0.55557, -0.83147, 0.5, 0, 0, 1, 0, 0},
{0.382683, -0.92388, -0.5, 0, 0, -1, 0, 0},
{0.382683, -0.92388, 0.5, 0, 0, 1, 0, 0},
{0.195089, -0.980785, -0.5, 0, 0, -1, 0, 0},
{0.195089, -0.980785, 0.5, 0, 0, 1, 0, 0},
{-1e-06, -1, -0.5, 0, 0, -1, 0, 0},
{-1e-06, -1, 0.5, 0, 0, 1, 0, 0},
{-0.195091, -0.980785, -0.5, 0, 0, -1, 0, 0},
{-0.195091, -0.980785, 0.5, 0, 0, 1, 0, 0},
{-0.382684, -0.923879, -0.5, 0, 0, -1, 0, 0},
{-0.382684, -0.923879, 0.5, 0, 0, 1, 0, 0},
{-0.555571, -0.831469, -0.5, 0, 0, -1, 0, 0},
{-0.555571, -0.831469, 0.5, 0, 0, 1, 0, 0},
{-0.707108, -0.707106, -0.5, 0, 0, -1, 0, 0},
{-0.707108, -0.707106, 0.5, 0, 0, 1, 0, 0},
{-0.83147, -0.555569, -0.5, 0, 0, -1, 0, 0},
{-0.83147, -0.555569, 0.5, 0, 0, 1, 0, 0},
{-0.92388, -0.382682, -0.5, 0, 0, -1, 0, 0},
{-0.92388, -0.382682, 0.5, 0, 0, 1, 0, 0},
{-0.980786, -0.195089, -0.5, 0, 0, -1, 0, 0},
{-0.980786, -0.195089, 0.5, 0, 0, 1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::CylinderIndices = {
1, 3, 2,
3, 5, 4,
5, 7, 6,
7, 9, 8,
9, 11, 10,
11, 13, 12,
13, 15, 14,
15, 17, 16,
17, 19, 18,
19, 21, 20,
21, 23, 22,
23, 25, 24,
25, 27, 26,
27, 29, 28,
29, 31, 30,
31, 33, 32,
33, 35, 34,
35, 37, 36,
37, 39, 38,
39, 41, 40,
41, 43, 42,
43, 45, 44,
45, 47, 46,
47, 49, 48,
49, 51, 50,
51, 53, 52,
53, 55, 54,
55, 57, 56,
57, 59, 58,
59, 61, 60,
61, 63, 62,
63, 1, 0,
0, 1, 2,
2, 3, 4,
4, 5, 6,
6, 7, 8,
8, 9, 10,
10, 11, 12,
12, 13, 14,
14, 15, 16,
16, 17, 18,
18, 19, 20,
20, 21, 22,
22, 23, 24,
24, 25, 26,
26, 27, 28,
28, 29, 30,
30, 31, 32,
32, 33, 34,
34, 35, 36,
36, 37, 38,
38, 39, 40,
40, 41, 42,
42, 43, 44,
44, 45, 46,
46, 47, 48,
48, 49, 50,
50, 51, 52,
52, 53, 54,
54, 55, 56,
56, 57, 58,
58, 59, 60,
60, 61, 62,
62, 63, 0,
64, 66, 68,
65, 69, 67,
64, 68, 70,
65, 71, 69,
64, 70, 72,
65, 73, 71,
64, 72, 74,
65, 75, 73,
64, 74, 76,
65, 77, 75,
64, 76, 78,
65, 79, 77,
64, 78, 80,
65, 81, 79,
64, 80, 82,
65, 83, 81,
64, 82, 84,
65, 85, 83,
64, 84, 86,
65, 87, 85,
64, 86, 88,
65, 89, 87,
64, 88, 90,
65, 91, 89,
64, 90, 92,
65, 93, 91,
64, 92, 94,
65, 95, 93,
64, 94, 96,
65, 97, 95,
64, 96, 98,
65, 99, 97,
64, 98, 100,
65, 101, 99,
64, 100, 102,
65, 103, 101,
64, 102, 104,
65, 105, 103,
64, 104, 106,
65, 107, 105,
64, 106, 108,
65, 109, 107,
64, 108, 110,
65, 111, 109,
64, 110, 112,
65, 113, 111,
64, 112, 114,
65, 115, 113,
64, 114, 116,
65, 117, 115,
64, 116, 118,
65, 119, 117,
64, 118, 120,
65, 121, 119,
64, 120, 122,
65, 123, 121,
64, 122, 124,
65, 125, 123,
64, 124, 126,
65, 127, 125,
64, 126, 128,
65, 129, 127,
64, 128, 66,
65, 67, 129,
};
#endif
// Cylinder-Side
const VertexList PrimitiveShapeVertex::CylinderSideVertices = {
{-1, 0, -0.5, -0.9952, -0.098, 0, 0, 0},
{-1, 0, 0.5, -0.9952, 0.098, 0, 0, 0},
{-0.980785, 0.19509, -0.5, -0.9569, 0.2903, 0, 0, 0},
{-0.980785, 0.19509, 0.5, -0.9569, 0.2903, 0, 0, 0},
{-0.92388, 0.382683, -0.5, -0.8819, 0.4714, 0, 0, 0},
{-0.92388, 0.382683, 0.5, -0.8819, 0.4714, 0, 0, 0},
{-0.83147, 0.55557, -0.5, -0.773, 0.6344, 0, 0, 0},
{-0.83147, 0.55557, 0.5, -0.773, 0.6344, 0, 0, 0},
{-0.707107, 0.707107, -0.5, -0.6344, 0.773, 0, 0, 0},
{-0.707107, 0.707107, 0.5, -0.6344, 0.773, 0, 0, 0},
{-0.55557, 0.83147, -0.5, -0.4714, 0.8819, 0, 0, 0},
{-0.55557, 0.83147, 0.5, -0.4714, 0.8819, 0, 0, 0},
{-0.382683, 0.92388, -0.5, -0.2903, 0.9569, 0, 0, 0},
{-0.382683, 0.92388, 0.5, -0.2903, 0.9569, 0, 0, 0},
{-0.19509, 0.980785, -0.5, -0.098, 0.9952, 0, 0, 0},
{-0.19509, 0.980785, 0.5, -0.098, 0.9952, 0, 0, 0},
{-0, 1, -0.5, 0.098, 0.9952, 0, 0, 0},
{-0, 1, 0.5, 0.098, 0.9952, 0, 0, 0},
{0.19509, 0.980785, -0.5, 0.2903, 0.9569, 0, 0, 0},
{0.19509, 0.980785, 0.5, 0.2903, 0.9569, 0, 0, 0},
{0.382683, 0.92388, -0.5, 0.4714, 0.8819, 0, 0, 0},
{0.382683, 0.92388, 0.5, 0.4714, 0.8819, 0, 0, 0},
{0.55557, 0.83147, -0.5, 0.6344, 0.773, 0, 0, 0},
{0.55557, 0.83147, 0.5, 0.6344, 0.773, 0, 0, 0},
{0.707107, 0.707107, -0.5, 0.773, 0.6344, 0, 0, 0},
{0.707107, 0.707107, 0.5, 0.773, 0.6344, 0, 0, 0},
{0.83147, 0.55557, -0.5, 0.8819, 0.4714, 0, 0, 0},
{0.83147, 0.55557, 0.5, 0.8819, 0.4714, 0, 0, 0},
{0.92388, 0.382683, -0.5, 0.9569, 0.2903, 0, 0, 0},
{0.92388, 0.382683, 0.5, 0.9569, 0.2903, 0, 0, 0},
{0.980785, 0.19509, -0.5, 0.9952, 0.098, 0, 0, 0},
{0.980785, 0.19509, 0.5, 0.9952, 0.098, 0, 0, 0},
{1, -0, -0.5, 0.9952, -0.098, 0, 0, 0},
{1, -0, 0.5, 0.9952, -0.098, 0, 0, 0},
{0.980785, -0.195091, -0.5, 0.9569, -0.2903, 0, 0, 0},
{0.980785, -0.195091, 0.5, 0.9569, -0.2903, 0, 0, 0},
{0.923879, -0.382684, -0.5, 0.8819, -0.4714, 0, 0, 0},
{0.923879, -0.382684, 0.5, 0.8819, -0.4714, 0, 0, 0},
{0.831469, -0.555571, -0.5, 0.773, -0.6344, 0, 0, 0},
{0.831469, -0.555571, 0.5, 0.773, -0.6344, 0, 0, 0},
{0.707106, -0.707107, -0.5, 0.6344, -0.773, 0, 0, 0},
{0.707106, -0.707107, 0.5, 0.6344, -0.773, 0, 0, 0},
{0.55557, -0.83147, -0.5, 0.4714, -0.8819, 0, 0, 0},
{0.55557, -0.83147, 0.5, 0.4714, -0.8819, 0, 0, 0},
{0.382683, -0.92388, -0.5, 0.2903, -0.9569, 0, 0, 0},
{0.382683, -0.92388, 0.5, 0.2903, -0.9569, 0, 0, 0},
{0.195089, -0.980785, -0.5, 0.098, -0.9952, 0, 0, 0},
{0.195089, -0.980785, 0.5, 0.098, -0.9952, 0, 0, 0},
{-1e-06, -1, -0.5, -0.098, -0.9952, 0, 0, 0},
{-1e-06, -1, 0.5, -0.098, -0.9952, 0, 0, 0},
{-0.195091, -0.980785, -0.5, -0.2903, -0.9569, 0, 0, 0},
{-0.195091, -0.980785, 0.5, -0.2903, -0.9569, 0, 0, 0},
{-0.382684, -0.923879, -0.5, -0.4714, -0.8819, 0, 0, 0},
{-0.382684, -0.923879, 0.5, -0.4714, -0.8819, 0, 0, 0},
{-0.555571, -0.831469, -0.5, -0.6344, -0.773, 0, 0, 0},
{-0.555571, -0.831469, 0.5, -0.6344, -0.773, 0, 0, 0},
{-0.707108, -0.707106, -0.5, -0.773, -0.6344, 0, 0, 0},
{-0.707108, -0.707106, 0.5, -0.773, -0.6344, 0, 0, 0},
{-0.83147, -0.555569, -0.5, -0.8819, -0.4714, 0, 0, 0},
{-0.83147, -0.555569, 0.5, -0.8819, -0.4714, 0, 0, 0},
{-0.92388, -0.382682, -0.5, -0.9569, -0.2903, 0, 0, 0},
{-0.92388, -0.382682, 0.5, -0.9569, -0.2903, 0, 0, 0},
{-0.980786, -0.195089, -0.5, -0.9952, -0.098, 0, 0, 0},
{-0.980786, -0.195089, 0.5, -0.9952, -0.098, 0, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::CylinderSideIndices = {
1, 3, 2,
3, 5, 4,
5, 7, 6,
7, 9, 8,
9, 11, 10,
11, 13, 12,
13, 15, 14,
15, 17, 16,
17, 19, 18,
19, 21, 20,
21, 23, 22,
23, 25, 24,
25, 27, 26,
27, 29, 28,
29, 31, 30,
31, 33, 32,
33, 35, 34,
35, 37, 36,
37, 39, 38,
39, 41, 40,
41, 43, 42,
43, 45, 44,
45, 47, 46,
47, 49, 48,
49, 51, 50,
51, 53, 52,
53, 55, 54,
55, 57, 56,
57, 59, 58,
59, 61, 60,
61, 63, 62,
63, 1, 0,
0, 1, 2,
2, 3, 4,
4, 5, 6,
6, 7, 8,
8, 9, 10,
10, 11, 12,
12, 13, 14,
14, 15, 16,
16, 17, 18,
18, 19, 20,
20, 21, 22,
22, 23, 24,
24, 25, 26,
26, 27, 28,
28, 29, 30,
30, 31, 32,
32, 33, 34,
34, 35, 36,
36, 37, 38,
38, 39, 40,
40, 41, 42,
42, 43, 44,
44, 45, 46,
46, 47, 48,
48, 49, 50,
50, 51, 52,
52, 53, 54,
54, 55, 56,
56, 57, 58,
58, 59, 60,
60, 61, 62,
62, 63, 0,
};
// UpperSphere
const VertexList PrimitiveShapeVertex::UpperSphereVertices = {
{0, -0.19509, 0.980785, 0.0286, -0.2902, 0.9565, 0, 0},
{0, -0.382683, 0.92388, 0.0464, -0.4709, 0.881, 0, 0},
{0, -0.55557, 0.83147, 0.0624, -0.6332, 0.7715, 0, 0},
{0, -0.707107, 0.707107, 0.0624, -0.6332, 0.7715, 0, 0},
{0, -0.83147, 0.55557, 0.0865, -0.8786, 0.4696, 0, 0},
{0, -0.92388, 0.382683, 0.0938, -0.9527, 0.289, 0, 0},
{0, -0.980785, 0.19509, 0.0976, -0.9904, 0.0975, 0, 0},
{0, -1, 0, 0.0976, -0.9904, 0.0975, 0, 0},
{-0.03806, -0.191342, 0.980785, -0.0846, -0.279, 0.9565, 0, 0},
{-0.074658, -0.37533, 0.92388, -0.0846, -0.279, 0.9565, 0, 0},
{-0.108386, -0.544895, 0.83147, -0.1847, -0.6088, 0.7715, 0, 0},
{-0.13795, -0.69352, 0.707107, -0.2248, -0.7412, 0.6326, 0, 0},
{-0.162212, -0.815493, 0.55557, -0.2563, -0.8448, 0.4696, 0, 0},
{-0.18024, -0.906127, 0.382683, -0.2779, -0.9161, 0.289, 0, 0},
{-0.191342, -0.96194, 0.19509, -0.2889, -0.9524, 0.0975, 0, 0},
{-0.19509, -0.980785, 0, -0.2889, -0.9524, 0.0975, 0, 0},
{-0.074658, -0.18024, 0.980785, -0.1374, -0.2571, 0.9565, 0, 0},
{-0.146447, -0.353553, 0.92388, -0.2231, -0.4173, 0.881, 0, 0},
{-0.212608, -0.51328, 0.83147, -0.2999, -0.5611, 0.7715, 0, 0},
{-0.270598, -0.653281, 0.707107, -0.3651, -0.6831, 0.6326, 0, 0},
{-0.31819, -0.768178, 0.55557, -0.4162, -0.7786, 0.4696, 0, 0},
{-0.353553, -0.853553, 0.382683, -0.4162, -0.7786, 0.4696, 0, 0},
{-0.37533, -0.906127, 0.19509, -0.4691, -0.8777, 0.0975, 0, 0},
{-0.382684, -0.923879, 0, -0.4691, -0.8777, 0.0975, 0, 0},
{-0.108387, -0.162212, 0.980785, -0.185, -0.2254, 0.9565, 0, 0},
{-0.212608, -0.31819, 0.92388, -0.3002, -0.3658, 0.881, 0, 0},
{-0.308658, -0.46194, 0.83147, -0.3002, -0.3658, 0.881, 0, 0},
{-0.392848, -0.587938, 0.707107, -0.4913, -0.5987, 0.6326, 0, 0},
{-0.46194, -0.691342, 0.55557, -0.5601, -0.6825, 0.4696, 0, 0},
{-0.51328, -0.768178, 0.382683, -0.6073, -0.74, 0.289, 0, 0},
{-0.544895, -0.815493, 0.19509, -0.6073, -0.74, 0.289, 0, 0},
{-0.55557, -0.831469, 0, -0.6314, -0.7693, 0.0976, 0, 0},
{-0.13795, -0.13795, 0.980785, -0.2254, -0.185, 0.9565, 0, 0},
{-0.270598, -0.270598, 0.92388, -0.3658, -0.3002, 0.881, 0, 0},
{-0.392848, -0.392847, 0.83147, -0.4918, -0.4036, 0.7715, 0, 0},
{-0.5, -0.5, 0.707107, -0.4918, -0.4036, 0.7715, 0, 0},
{-0.587938, -0.587938, 0.55557, -0.6825, -0.5601, 0.4696, 0, 0},
{-0.653282, -0.653281, 0.382683, -0.74, -0.6073, 0.289, 0, 0},
{-0.69352, -0.69352, 0.19509, -0.74, -0.6073, 0.289, 0, 0},
{-0.707107, -0.707107, 0, -0.7693, -0.6314, 0.0976, 0, 0},
{-0.162212, -0.108386, 0.980785, -0.2571, -0.1374, 0.9565, 0, 0},
{-0.31819, -0.212607, 0.92388, -0.4173, -0.223, 0.881, 0, 0},
{-0.46194, -0.308658, 0.83147, -0.5611, -0.2999, 0.7715, 0, 0},
{-0.587938, -0.392847, 0.707107, -0.5611, -0.2999, 0.7715, 0, 0},
{-0.691342, -0.46194, 0.55557, -0.7786, -0.4162, 0.4696, 0, 0},
{-0.768178, -0.51328, 0.382683, -0.7786, -0.4162, 0.4696, 0, 0},
{-0.815493, -0.544895, 0.19509, -0.8777, -0.4691, 0.0976, 0, 0},
{-0.83147, -0.55557, 0, -0.8777, -0.4691, 0.0976, 0, 0},
{-0.18024, -0.074658, 0.980785, -0.279, -0.0846, 0.9565, 0, 0},
{-0.353554, -0.146446, 0.92388, -0.4528, -0.1374, 0.881, 0, 0},
{-0.51328, -0.212607, 0.83147, -0.4528, -0.1374, 0.881, 0, 0},
{-0.653282, -0.270598, 0.707107, -0.7412, -0.2248, 0.6326, 0, 0},
{-0.768178, -0.318189, 0.55557, -0.8448, -0.2563, 0.4696, 0, 0},
{-0.853554, -0.353553, 0.382683, -0.8448, -0.2563, 0.4696, 0, 0},
{-0.906128, -0.37533, 0.19509, -0.9524, -0.2889, 0.0976, 0, 0},
{-0.92388, -0.382683, 0, -0.9524, -0.2889, 0.0976, 0, 0},
{-0.191342, -0.03806, 0.980785, -0.2902, -0.0286, 0.9565, 0, 0},
{-0.375331, -0.074658, 0.92388, -0.4709, -0.0464, 0.881, 0, 0},
{-0.544895, -0.108386, 0.83147, -0.6332, -0.0624, 0.7715, 0, 0},
{-0.69352, -0.137949, 0.707107, -0.6332, -0.0624, 0.7715, 0, 0},
{-0.815493, -0.162211, 0.55557, -0.8786, -0.0865, 0.4696, 0, 0},
{-0.906128, -0.18024, 0.382683, -0.8786, -0.0865, 0.4696, 0, 0},
{-0.96194, -0.191341, 0.19509, -0.9904, -0.0975, 0.0976, 0, 0},
{-0.980785, -0.19509, 0, -0.9904, -0.0975, 0.0976, 0, 0},
{-0.195091, 0, 0.980785, -0.098, 0.0097, 0.9951, 0, 0},
{-0.382684, 0, 0.92388, -0.4709, 0.0464, 0.881, 0, 0},
{-0.55557, 0, 0.83147, -0.6332, 0.0624, 0.7715, 0, 0},
{-0.707107, 0, 0.707107, -0.6332, 0.0624, 0.7715, 0, 0},
{-0.83147, 0, 0.55557, -0.8786, 0.0865, 0.4696, 0, 0},
{-0.92388, 0, 0.382683, -0.8786, 0.0865, 0.4696, 0, 0},
{-0.980785, 0, 0.19509, -0.9904, 0.0975, 0.0976, 0, 0},
{-1, 0, 0, -0.9904, 0.0975, 0.0976, 0, 0},
{-0.191342, 0.038061, 0.980785, -0.279, 0.0846, 0.9565, 0, 0},
{-0.375331, 0.074658, 0.92388, -0.279, 0.0846, 0.9565, 0, 0},
{-0.544895, 0.108387, 0.83147, -0.6088, 0.1847, 0.7715, 0, 0},
{-0.69352, 0.13795, 0.707107, -0.7412, 0.2248, 0.6326, 0, 0},
{-0.815493, 0.162212, 0.55557, -0.7412, 0.2248, 0.6326, 0, 0},
{-0.906128, 0.18024, 0.382683, -0.8448, 0.2563, 0.4696, 0, 0},
{-0.96194, 0.191342, 0.19509, -0.9524, 0.2889, 0.0976, 0, 0},
{-0.980785, 0.195091, 0, -0.9524, 0.2889, 0.0976, 0, 0},
{-0.18024, 0.074658, 0.980785, -0.2571, 0.1374, 0.9565, 0, 0},
{-0.353554, 0.146447, 0.92388, -0.4173, 0.223, 0.881, 0, 0},
{-0.51328, 0.212608, 0.83147, -0.5611, 0.2999, 0.7715, 0, 0},
{-0.653282, 0.270598, 0.707107, -0.5611, 0.2999, 0.7715, 0, 0},
{-0.768178, 0.31819, 0.55557, -0.7786, 0.4162, 0.4696, 0, 0},
{-0.853554, 0.353554, 0.382683, -0.7786, 0.4162, 0.4696, 0, 0},
{-0.906127, 0.375331, 0.19509, -0.8777, 0.4691, 0.0976, 0, 0},
{-0.92388, 0.382684, 0, -0.8777, 0.4691, 0.0976, 0, 0},
{-0.162212, 0.108387, 0.980785, -0.2254, 0.185, 0.9565, 0, 0},
{-0.31819, 0.212608, 0.92388, -0.3658, 0.3002, 0.881, 0, 0},
{-0.46194, 0.308659, 0.83147, -0.4918, 0.4036, 0.7715, 0, 0},
{-0.587938, 0.392848, 0.707107, -0.5987, 0.4913, 0.6326, 0, 0},
{-0.691342, 0.46194, 0.55557, -0.5987, 0.4913, 0.6326, 0, 0},
{-0.768178, 0.51328, 0.382683, -0.6825, 0.5601, 0.4696, 0, 0},
{-0.815493, 0.544895, 0.19509, -0.7693, 0.6314, 0.0976, 0, 0},
{-0.83147, 0.555571, 0, -0.7693, 0.6314, 0.0976, 0, 0},
{-0.13795, 0.13795, 0.980785, -0.185, 0.2254, 0.9565, 0, 0},
{-0.270598, 0.270599, 0.92388, -0.185, 0.2254, 0.9565, 0, 0},
{-0.392848, 0.392848, 0.83147, -0.3002, 0.3658, 0.881, 0, 0},
{-0.5, 0.5, 0.707107, -0.4036, 0.4918, 0.7715, 0, 0},
{-0.587938, 0.587938, 0.55557, -0.5601, 0.6825, 0.4696, 0, 0},
{-0.653282, 0.653282, 0.382683, -0.5601, 0.6825, 0.4696, 0, 0},
{-0.69352, 0.69352, 0.19509, -0.6314, 0.7693, 0.0976, 0, 0},
{-0.707107, 0.707107, 0, -0.6314, 0.7693, 0.0976, 0, 0},
{-0.108386, 0.162212, 0.980785, -0.1374, 0.2571, 0.9565, 0, 0},
{-0.212608, 0.31819, 0.92388, -0.1374, 0.2571, 0.9565, 0, 0},
{-0.308658, 0.46194, 0.83147, -0.2999, 0.5611, 0.7715, 0, 0},
{-0.392848, 0.587938, 0.707107, -0.3651, 0.6831, 0.6326, 0, 0},
{-0.46194, 0.691342, 0.55557, -0.4162, 0.7786, 0.4696, 0, 0},
{-0.51328, 0.768178, 0.382683, -0.4162, 0.7786, 0.4696, 0, 0},
{-0.544895, 0.815493, 0.19509, -0.4691, 0.8777, 0.0976, 0, 0},
{-0.55557, 0.83147, 0, -0.4691, 0.8777, 0.0976, 0, 0},
{-0.074658, 0.18024, 0.980785, -0.0846, 0.279, 0.9565, 0, 0},
{-0.146447, 0.353554, 0.92388, -0.1374, 0.4528, 0.881, 0, 0},
{-0.212608, 0.51328, 0.83147, -0.1374, 0.4528, 0.881, 0, 0},
{-0.270598, 0.653282, 0.707107, -0.2248, 0.7412, 0.6326, 0, 0},
{-0.31819, 0.768178, 0.55557, -0.2563, 0.8448, 0.4696, 0, 0},
{-0.353553, 0.853554, 0.382683, -0.2563, 0.8448, 0.4696, 0, 0},
{-0.37533, 0.906128, 0.19509, -0.2889, 0.9524, 0.0976, 0, 0},
{-0.382683, 0.92388, 0, -0.2889, 0.9524, 0.0976, 0, 0},
{-0.03806, 0.191342, 0.980785, -0.0286, 0.2902, 0.9565, 0, 0},
{-0.074658, 0.375331, 0.92388, -0.0286, 0.2902, 0.9565, 0, 0},
{-0.108386, 0.544896, 0.83147, -0.0464, 0.4709, 0.881, 0, 0},
{-0.13795, 0.69352, 0.707107, -0.0759, 0.7708, 0.6326, 0, 0},
{-0.162212, 0.815493, 0.55557, -0.0865, 0.8786, 0.4696, 0, 0},
{-0.18024, 0.906128, 0.382683, -0.0865, 0.8786, 0.4696, 0, 0},
{-0.191342, 0.96194, 0.19509, -0.0938, 0.9527, 0.289, 0, 0},
{-0.19509, 0.980786, 0, -0.0975, 0.9904, 0.0976, 0, 0},
{0, 0.195091, 0.980785, 0.0286, 0.2902, 0.9565, 0, 0},
{-0, 0.382684, 0.92388, 0.0464, 0.4709, 0.881, 0, 0},
{-0, 0.555571, 0.83147, 0.0464, 0.4709, 0.881, 0, 0},
{0, 0.707107, 0.707107, 0.0624, 0.6332, 0.7715, 0, 0},
{0, 0.83147, 0.55557, 0.0865, 0.8786, 0.4696, 0, 0},
{-0, 0.92388, 0.382683, 0.0865, 0.8786, 0.4696, 0, 0},
{0, 0.980785, 0.19509, 0.0975, 0.9904, 0.0976, 0, 0},
{0, 1, 0, 0.0975, 0.9904, 0.0976, 0, 0},
{0.03806, 0.191342, 0.980785, 0.0846, 0.279, 0.9565, 0, 0},
{0.074658, 0.375331, 0.92388, 0.1374, 0.4528, 0.881, 0, 0},
{0.108386, 0.544896, 0.83147, 0.1374, 0.4528, 0.881, 0, 0},
{0.13795, 0.69352, 0.707107, 0.1847, 0.6088, 0.7715, 0, 0},
{0.162212, 0.815493, 0.55557, 0.2563, 0.8448, 0.4696, 0, 0},
{0.18024, 0.906128, 0.382683, 0.2563, 0.8448, 0.4696, 0, 0},
{0.191342, 0.96194, 0.19509, 0.2779, 0.9161, 0.289, 0, 0},
{0.19509, 0.980786, 0, 0.2889, 0.9524, 0.0976, 0, 0},
{0.074658, 0.18024, 0.980785, 0.1374, 0.2571, 0.9565, 0, 0},
{0.146447, 0.353554, 0.92388, 0.2231, 0.4173, 0.881, 0, 0},
{0.212608, 0.51328, 0.83147, 0.2999, 0.5611, 0.7715, 0, 0},
{0.270598, 0.653282, 0.707107, 0.2999, 0.5611, 0.7715, 0, 0},
{0.31819, 0.768178, 0.55557, 0.4162, 0.7786, 0.4696, 0, 0},
{0.353553, 0.853554, 0.382683, 0.4162, 0.7786, 0.4696, 0, 0},
{0.37533, 0.906127, 0.19509, 0.4691, 0.8777, 0.0976, 0, 0},
{0.382684, 0.92388, 0, 0.4691, 0.8777, 0.0976, 0, 0},
{0.108386, 0.162212, 0.980785, 0.185, 0.2254, 0.9565, 0, 0},
{0.212608, 0.31819, 0.92388, 0.3002, 0.3658, 0.881, 0, 0},
{0.308658, 0.46194, 0.83147, 0.3002, 0.3658, 0.881, 0, 0},
{0.392847, 0.587938, 0.707107, 0.4036, 0.4918, 0.7715, 0, 0},
{0.46194, 0.691342, 0.55557, 0.5601, 0.6825, 0.4696, 0, 0},
{0.51328, 0.768178, 0.382683, 0.5601, 0.6825, 0.4696, 0, 0},
{0.544895, 0.815493, 0.19509, 0.6073, 0.74, 0.289, 0, 0},
{0.55557, 0.83147, 0, 0.6314, 0.7693, 0.0976, 0, 0},
{0.13795, 0.13795, 0.980785, 0.2254, 0.185, 0.9565, 0, 0},
{0.270598, 0.270598, 0.92388, 0.3658, 0.3002, 0.881, 0, 0},
{0.392848, 0.392848, 0.83147, 0.3658, 0.3002, 0.881, 0, 0},
{0.5, 0.5, 0.707107, 0.4918, 0.4036, 0.7715, 0, 0},
{0.587938, 0.587938, 0.55557, 0.6825, 0.5601, 0.4696, 0, 0},
{0.653281, 0.653282, 0.382683, 0.6825, 0.5601, 0.4696, 0, 0},
{0.69352, 0.69352, 0.19509, 0.7693, 0.6314, 0.0976, 0, 0},
{0.707107, 0.707107, 0, 0.7693, 0.6314, 0.0976, 0, 0},
{0.162212, 0.108387, 0.980785, 0.2571, 0.1374, 0.9565, 0, 0},
{0.31819, 0.212608, 0.92388, 0.4173, 0.223, 0.881, 0, 0},
{0.46194, 0.308659, 0.83147, 0.4173, 0.223, 0.881, 0, 0},
{0.587938, 0.392848, 0.707107, 0.5611, 0.2999, 0.7715, 0, 0},
{0.691342, 0.46194, 0.55557, 0.7786, 0.4162, 0.4696, 0, 0},
{0.768178, 0.51328, 0.382683, 0.7786, 0.4162, 0.4696, 0, 0},
{0.815493, 0.544895, 0.19509, 0.8777, 0.4691, 0.0976, 0, 0},
{0.83147, 0.55557, 0, 0.8777, 0.4691, 0.0976, 0, 0},
{0.18024, 0.074658, 0.980785, 0.0942, 0.0286, 0.9951, 0, 0},
{0.353553, 0.146447, 0.92388, 0.4528, 0.1374, 0.881, 0, 0},
{0.51328, 0.212608, 0.83147, 0.4528, 0.1374, 0.881, 0, 0},
{0.653281, 0.270598, 0.707107, 0.6088, 0.1847, 0.7715, 0, 0},
{0.768177, 0.31819, 0.55557, 0.7412, 0.2248, 0.6326, 0, 0},
{0.853553, 0.353554, 0.382683, 0.8448, 0.2563, 0.4696, 0, 0},
{0.906127, 0.37533, 0.19509, 0.9524, 0.2889, 0.0976, 0, 0},
{0.92388, 0.382684, 0, 0.9524, 0.2889, 0.0976, 0, 0},
{0.191342, 0.038061, 0.980785, 0.279, 0.0846, 0.9565, 0, 0},
{0.37533, 0.074658, 0.92388, 0.2902, 0.0286, 0.9565, 0, 0},
{0.544895, 0.108387, 0.83147, 0.4709, 0.0464, 0.881, 0, 0},
{0.69352, 0.13795, 0.707107, 0.7708, 0.0759, 0.6326, 0, 0},
{0.815493, 0.162212, 0.55557, 0.8786, 0.0865, 0.4696, 0, 0},
{0.906127, 0.18024, 0.382683, 0.8786, 0.0865, 0.4696, 0, 0},
{0.961939, 0.191342, 0.19509, 0.9904, 0.0975, 0.0976, 0, 0},
{0.980785, 0.19509, 0, 0.9904, 0.0975, 0.0976, 0, 0},
{0.19509, 0, 0.980785, 0.2902, 0.0286, 0.9565, 0, 0},
{0.382683, 0, 0.92388, 0.4709, -0.0464, 0.881, 0, 0},
{0.55557, 0, 0.83147, 0.4709, -0.0464, 0.881, 0, 0},
{0.707107, 0, 0.707107, 0.6332, -0.0624, 0.7715, 0, 0},
{0.831469, 0, 0.55557, 0.8786, -0.0865, 0.4696, 0, 0},
{0.923879, 0, 0.382683, 0.8786, -0.0865, 0.4696, 0, 0},
{0.980785, 0, 0.19509, 0.9904, -0.0976, 0.0976, 0, 0},
{1, 0, 0, 0.9904, -0.0976, 0.0976, 0, 0},
{0.191342, -0.03806, 0.980785, 0.279, -0.0846, 0.9565, 0, 0},
{0.37533, -0.074658, 0.92388, 0.279, -0.0846, 0.9565, 0, 0},
{0.544895, -0.108386, 0.83147, 0.4528, -0.1374, 0.881, 0, 0},
{0.69352, -0.137949, 0.707107, 0.7412, -0.2248, 0.6326, 0, 0},
{0.815493, -0.162211, 0.55557, 0.8448, -0.2563, 0.4696, 0, 0},
{0.906127, -0.18024, 0.382683, 0.8448, -0.2563, 0.4696, 0, 0},
{0.961939, -0.191342, 0.19509, 0.9524, -0.2889, 0.0976, 0, 0},
{0.980785, -0.19509, 0, 0.9524, -0.2889, 0.0976, 0, 0},
{0, 0, 1, 0.0097, -0.098, 0.9951, 0, 0},
{0.18024, -0.074658, 0.980785, 0.2571, -0.1374, 0.9565, 0, 0},
{0.353553, -0.146446, 0.92388, 0.2571, -0.1374, 0.9565, 0, 0},
{0.51328, -0.212607, 0.83147, 0.4173, -0.223, 0.881, 0, 0},
{0.653281, -0.270598, 0.707107, 0.5611, -0.2999, 0.7715, 0, 0},
{0.768177, -0.318189, 0.55557, 0.7786, -0.4162, 0.4696, 0, 0},
{0.853553, -0.353553, 0.382683, 0.7786, -0.4162, 0.4696, 0, 0},
{0.906127, -0.37533, 0.19509, 0.8777, -0.4691, 0.0976, 0, 0},
{0.923879, -0.382683, 0, 0.8777, -0.4691, 0.0976, 0, 0},
{0.162212, -0.108386, 0.980785, 0.2254, -0.185, 0.9565, 0, 0},
{0.31819, -0.212607, 0.92388, 0.3658, -0.3002, 0.881, 0, 0},
{0.46194, -0.308658, 0.83147, 0.3658, -0.3002, 0.881, 0, 0},
{0.587938, -0.392847, 0.707107, 0.4918, -0.4036, 0.7715, 0, 0},
{0.691341, -0.461939, 0.55557, 0.6825, -0.5601, 0.4696, 0, 0},
{0.768178, -0.51328, 0.382683, 0.6825, -0.5601, 0.4696, 0, 0},
{0.815493, -0.544895, 0.19509, 0.7693, -0.6314, 0.0976, 0, 0},
{0.831469, -0.55557, 0, 0.7693, -0.6314, 0.0976, 0, 0},
{0.13795, -0.137949, 0.980785, 0.185, -0.2254, 0.9565, 0, 0},
{0.270598, -0.270598, 0.92388, 0.3002, -0.3658, 0.881, 0, 0},
{0.392847, -0.392847, 0.83147, 0.4036, -0.4918, 0.7715, 0, 0},
{0.5, -0.5, 0.707107, 0.4036, -0.4918, 0.7715, 0, 0},
{0.587937, -0.587937, 0.55557, 0.5601, -0.6825, 0.4696, 0, 0},
{0.653281, -0.653281, 0.382683, 0.5601, -0.6825, 0.4696, 0, 0},
{0.693519, -0.693519, 0.19509, 0.6073, -0.74, 0.289, 0, 0},
{0.707106, -0.707106, 0, 0.6314, -0.7693, 0.0976, 0, 0},
{0.108386, -0.162211, 0.980785, 0.0464, -0.0869, 0.9951, 0, 0},
{0.212607, -0.318189, 0.92388, 0.1374, -0.2571, 0.9565, 0, 0},
{0.308658, -0.461939, 0.83147, 0.2231, -0.4173, 0.881, 0, 0},
{0.392847, -0.587937, 0.707107, 0.2999, -0.5611, 0.7715, 0, 0},
{0.461939, -0.691341, 0.55557, 0.4162, -0.7786, 0.4696, 0, 0},
{0.51328, -0.768177, 0.382683, 0.4162, -0.7786, 0.4696, 0, 0},
{0.544895, -0.815492, 0.19509, 0.4691, -0.8777, 0.0976, 0, 0},
{0.55557, -0.831469, 0, 0.4691, -0.8777, 0.0976, 0, 0},
{0.074658, -0.18024, 0.980785, 0.0846, -0.279, 0.9565, 0, 0},
{0.146447, -0.353553, 0.92388, 0.1374, -0.4528, 0.881, 0, 0},
{0.212607, -0.51328, 0.83147, 0.1847, -0.6088, 0.7715, 0, 0},
{0.270598, -0.653281, 0.707107, 0.1847, -0.6088, 0.7715, 0, 0},
{0.318189, -0.768177, 0.55557, 0.2563, -0.8448, 0.4696, 0, 0},
{0.353553, -0.853553, 0.382683, 0.2563, -0.8448, 0.4696, 0, 0},
{0.37533, -0.906127, 0.19509, 0.2779, -0.9161, 0.289, 0, 0},
{0.382683, -0.923879, 0, 0.2889, -0.9524, 0.0976, 0, 0},
{0.03806, -0.191342, 0.980785, 0.0286, -0.2902, 0.9565, 0, 0},
{0.074658, -0.37533, 0.92388, 0.0286, -0.2902, 0.9565, 0, 0},
{0.108386, -0.544895, 0.83147, 0.0464, -0.4709, 0.881, 0, 0},
{0.13795, -0.69352, 0.707107, 0.0624, -0.6332, 0.7715, 0, 0},
{0.162211, -0.815492, 0.55557, 0.0759, -0.7708, 0.6326, 0, 0},
{0.18024, -0.906127, 0.382683, 0.0865, -0.8786, 0.4696, 0, 0},
{0.191341, -0.961939, 0.19509, 0.0938, -0.9527, 0.289, 0, 0},
{0.19509, -0.980785, 0, 0.0976, -0.9904, 0.0975, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::UpperSphereIndices = {
3, 11, 12,
4, 12, 13,
5, 13, 14,
6, 14, 15,
0, 8, 9,
2, 1, 9,
2, 10, 11,
9, 17, 18,
10, 18, 19,
11, 19, 20,
12, 20, 21,
13, 21, 22,
14, 22, 23,
8, 16, 17,
22, 21, 29,
22, 30, 31,
16, 24, 25,
17, 25, 26,
18, 26, 27,
19, 27, 28,
20, 28, 29,
26, 34, 35,
27, 35, 36,
28, 36, 37,
29, 37, 38,
31, 30, 38,
24, 32, 33,
25, 33, 34,
39, 38, 46,
32, 40, 41,
33, 41, 42,
34, 42, 43,
36, 35, 43,
36, 44, 45,
37, 45, 46,
44, 43, 51,
44, 52, 53,
46, 45, 53,
46, 54, 55,
40, 48, 49,
41, 49, 50,
42, 50, 51,
48, 56, 57,
49, 57, 58,
51, 50, 58,
51, 59, 60,
52, 60, 61,
54, 53, 61,
54, 62, 63,
59, 67, 68,
60, 68, 69,
62, 61, 69,
62, 70, 71,
56, 64, 65,
57, 65, 66,
58, 66, 67,
65, 64, 72,
65, 73, 74,
66, 74, 75,
68, 67, 75,
68, 76, 77,
70, 69, 77,
70, 78, 79,
76, 84, 85,
78, 77, 85,
78, 86, 87,
72, 80, 81,
74, 73, 81,
74, 82, 83,
75, 83, 84,
80, 88, 89,
81, 89, 90,
82, 90, 91,
84, 83, 91,
84, 92, 93,
86, 85, 93,
86, 94, 95,
92, 100, 101,
94, 93, 101,
94, 102, 103,
88, 96, 97,
89, 97, 98,
90, 98, 99,
91, 99, 100,
97, 105, 106,
99, 98, 106,
100, 99, 107,
100, 108, 109,
102, 101, 109,
102, 110, 111,
96, 104, 105,
110, 109, 117,
110, 118, 119,
104, 112, 113,
106, 105, 113,
106, 114, 115,
107, 115, 116,
108, 116, 117,
114, 122, 123,
115, 123, 124,
116, 124, 125,
118, 117, 125,
118, 126, 127,
112, 120, 121,
113, 121, 122,
126, 134, 135,
120, 128, 129,
122, 121, 129,
123, 122, 130,
123, 131, 132,
124, 132, 133,
126, 125, 133,
131, 130, 138,
132, 131, 139,
132, 140, 141,
134, 133, 141,
134, 142, 143,
128, 136, 137,
129, 137, 138,
142, 150, 151,
136, 144, 145,
137, 145, 146,
139, 138, 146,
140, 139, 147,
140, 148, 149,
142, 141, 149,
148, 147, 155,
148, 156, 157,
150, 149, 157,
150, 158, 159,
144, 152, 153,
145, 153, 154,
146, 154, 155,
152, 160, 161,
153, 161, 162,
155, 154, 162,
156, 155, 163,
156, 164, 165,
158, 157, 165,
159, 158, 166,
164, 163, 171,
164, 172, 173,
166, 165, 173,
166, 174, 175,
160, 168, 169,
161, 169, 170,
163, 162, 170,
168, 176, 177,
169, 177, 178,
171, 170, 178,
172, 171, 179,
172, 180, 181,
174, 173, 181,
174, 182, 183,
180, 188, 189,
182, 181, 189,
182, 190, 191,
177, 176, 184,
177, 185, 186,
179, 178, 186,
180, 179, 187,
185, 193, 194,
187, 186, 194,
187, 195, 196,
188, 196, 197,
190, 189, 197,
190, 198, 199,
185, 184, 192,
198, 197, 205,
198, 206, 207,
193, 192, 200,
193, 201, 202,
195, 194, 202,
196, 195, 203,
196, 204, 205,
201, 210, 211,
203, 202, 211,
203, 212, 213,
204, 213, 214,
206, 205, 214,
206, 215, 216,
200, 209, 210,
215, 214, 222,
215, 223, 224,
209, 217, 218,
211, 210, 218,
212, 211, 219,
213, 212, 220,
213, 221, 222,
219, 227, 228,
221, 220, 228,
221, 229, 230,
223, 222, 230,
223, 231, 232,
217, 225, 226,
218, 226, 227,
232, 231, 239,
225, 233, 234,
226, 234, 235,
227, 235, 236,
229, 228, 236,
229, 237, 238,
231, 230, 238,
236, 235, 243,
237, 236, 244,
237, 245, 246,
239, 238, 246,
239, 247, 248,
234, 233, 241,
235, 234, 242,
247, 255, 256,
241, 249, 250,
242, 250, 251,
243, 251, 252,
245, 244, 252,
245, 253, 254,
247, 246, 254,
0, 208, 8,
8, 208, 16,
16, 208, 24,
24, 208, 32,
32, 208, 40,
40, 208, 48,
48, 208, 56,
56, 208, 64,
64, 208, 72,
72, 208, 80,
80, 208, 88,
88, 208, 96,
96, 208, 104,
104, 208, 112,
112, 208, 120,
120, 208, 128,
128, 208, 136,
136, 208, 144,
144, 208, 152,
152, 208, 160,
160, 208, 168,
168, 208, 176,
176, 208, 184,
184, 208, 192,
192, 208, 200,
200, 208, 209,
209, 208, 217,
217, 208, 225,
225, 208, 233,
233, 208, 241,
241, 208, 249,
253, 252, 3,
254, 253, 4,
255, 254, 5,
256, 255, 6,
249, 208, 0,
250, 249, 0,
251, 250, 1,
252, 251, 2,
4, 3, 12,
5, 4, 13,
6, 5, 14,
7, 6, 15,
1, 0, 9,
10, 2, 9,
3, 2, 11,
10, 9, 18,
11, 10, 19,
12, 11, 20,
13, 12, 21,
14, 13, 22,
15, 14, 23,
9, 8, 17,
30, 22, 29,
23, 22, 31,
17, 16, 25,
18, 17, 26,
19, 18, 27,
20, 19, 28,
21, 20, 29,
27, 26, 35,
28, 27, 36,
29, 28, 37,
30, 29, 38,
39, 31, 38,
25, 24, 33,
26, 25, 34,
47, 39, 46,
33, 32, 41,
34, 33, 42,
35, 34, 43,
44, 36, 43,
37, 36, 45,
38, 37, 46,
52, 44, 51,
45, 44, 53,
54, 46, 53,
47, 46, 55,
41, 40, 49,
42, 41, 50,
43, 42, 51,
49, 48, 57,
50, 49, 58,
59, 51, 58,
52, 51, 60,
53, 52, 61,
62, 54, 61,
55, 54, 63,
60, 59, 68,
61, 60, 69,
70, 62, 69,
63, 62, 71,
57, 56, 65,
58, 57, 66,
59, 58, 67,
73, 65, 72,
66, 65, 74,
67, 66, 75,
76, 68, 75,
69, 68, 77,
78, 70, 77,
71, 70, 79,
77, 76, 85,
86, 78, 85,
79, 78, 87,
73, 72, 81,
82, 74, 81,
75, 74, 83,
76, 75, 84,
81, 80, 89,
82, 81, 90,
83, 82, 91,
92, 84, 91,
85, 84, 93,
94, 86, 93,
87, 86, 95,
93, 92, 101,
102, 94, 101,
95, 94, 103,
89, 88, 97,
90, 89, 98,
91, 90, 99,
92, 91, 100,
98, 97, 106,
107, 99, 106,
108, 100, 107,
101, 100, 109,
110, 102, 109,
103, 102, 111,
97, 96, 105,
118, 110, 117,
111, 110, 119,
105, 104, 113,
114, 106, 113,
107, 106, 115,
108, 107, 116,
109, 108, 117,
115, 114, 123,
116, 115, 124,
117, 116, 125,
126, 118, 125,
119, 118, 127,
113, 112, 121,
114, 113, 122,
127, 126, 135,
121, 120, 129,
130, 122, 129,
131, 123, 130,
124, 123, 132,
125, 124, 133,
134, 126, 133,
139, 131, 138,
140, 132, 139,
133, 132, 141,
142, 134, 141,
135, 134, 143,
129, 128, 137,
130, 129, 138,
143, 142, 151,
137, 136, 145,
138, 137, 146,
147, 139, 146,
148, 140, 147,
141, 140, 149,
150, 142, 149,
156, 148, 155,
149, 148, 157,
158, 150, 157,
151, 150, 159,
145, 144, 153,
146, 145, 154,
147, 146, 155,
153, 152, 161,
154, 153, 162,
163, 155, 162,
164, 156, 163,
157, 156, 165,
166, 158, 165,
167, 159, 166,
172, 164, 171,
165, 164, 173,
174, 166, 173,
167, 166, 175,
161, 160, 169,
162, 161, 170,
171, 163, 170,
169, 168, 177,
170, 169, 178,
179, 171, 178,
180, 172, 179,
173, 172, 181,
182, 174, 181,
175, 174, 183,
181, 180, 189,
190, 182, 189,
183, 182, 191,
185, 177, 184,
178, 177, 186,
187, 179, 186,
188, 180, 187,
186, 185, 194,
195, 187, 194,
188, 187, 196,
189, 188, 197,
198, 190, 197,
191, 190, 199,
193, 185, 192,
206, 198, 205,
199, 198, 207,
201, 193, 200,
194, 193, 202,
203, 195, 202,
204, 196, 203,
197, 196, 205,
202, 201, 211,
212, 203, 211,
204, 203, 213,
205, 204, 214,
215, 206, 214,
207, 206, 216,
201, 200, 210,
223, 215, 222,
216, 215, 224,
210, 209, 218,
219, 211, 218,
220, 212, 219,
221, 213, 220,
214, 213, 222,
220, 219, 228,
229, 221, 228,
222, 221, 230,
231, 223, 230,
224, 223, 232,
218, 217, 226,
219, 218, 227,
240, 232, 239,
226, 225, 234,
227, 226, 235,
228, 227, 236,
237, 229, 236,
230, 229, 238,
239, 231, 238,
244, 236, 243,
245, 237, 244,
238, 237, 246,
247, 239, 246,
240, 239, 248,
242, 234, 241,
243, 235, 242,
248, 247, 256,
242, 241, 250,
243, 242, 251,
244, 243, 252,
253, 245, 252,
246, 245, 254,
255, 247, 254,
4, 253, 3,
5, 254, 4,
6, 255, 5,
7, 256, 6,
1, 250, 0,
2, 251, 1,
3, 252, 2,
};
// LowerSphere
const VertexList PrimitiveShapeVertex::LowerSphereVertices = {
{0, -1, 0, -0.0975, -0.9904, -0.0976, 0, 0},
{0, -0.980786, -0.19509, 0.0976, -0.9904, -0.0975, 0, 0},
{0, -0.92388, -0.382683, 0.0938, -0.9527, -0.289, 0, 0},
{0, -0.83147, -0.55557, 0.0865, -0.8786, -0.4696, 0, 0},
{0, -0.707107, -0.707107, 0.0759, -0.7708, -0.6326, 0, 0},
{0, -0.55557, -0.83147, 0.0624, -0.6332, -0.7715, 0, 0},
{0, -0.382683, -0.92388, 0.0464, -0.4709, -0.881, 0, 0},
{0, -0.19509, -0.980785, 0.0286, -0.2902, -0.9565, 0, 0},
{0, 0, -1, 0.0097, -0.098, -0.9951, 0, 0},
{-0.19509, -0.980785, 0, -0.2889, -0.9524, -0.0975, 0, 0},
{-0.191342, -0.96194, -0.19509, -0.2889, -0.9524, -0.0976, 0, 0},
{-0.18024, -0.906128, -0.382683, -0.2563, -0.8448, -0.4696, 0, 0},
{-0.162212, -0.815493, -0.55557, -0.2563, -0.8448, -0.4696, 0, 0},
{-0.13795, -0.69352, -0.707107, -0.2248, -0.7412, -0.6326, 0, 0},
{-0.108386, -0.544895, -0.83147, -0.1374, -0.4528, -0.881, 0, 0},
{-0.074658, -0.37533, -0.92388, -0.0846, -0.279, -0.9565, 0, 0},
{-0.03806, -0.191342, -0.980785, -0.0846, -0.279, -0.9565, 0, 0},
{-0.382683, -0.92388, 0, -0.4691, -0.8777, -0.0976, 0, 0},
{-0.37533, -0.906128, -0.19509, -0.4513, -0.8443, -0.289, 0, 0},
{-0.353553, -0.853554, -0.382683, -0.4513, -0.8443, -0.289, 0, 0},
{-0.31819, -0.768178, -0.55557, -0.3651, -0.6831, -0.6326, 0, 0},
{-0.270598, -0.653282, -0.707107, -0.3651, -0.6831, -0.6326, 0, 0},
{-0.212608, -0.51328, -0.83147, -0.2999, -0.5611, -0.7715, 0, 0},
{-0.146447, -0.353553, -0.92388, -0.1374, -0.2571, -0.9565, 0, 0},
{-0.074658, -0.18024, -0.980785, -0.1374, -0.2571, -0.9565, 0, 0},
{-0.55557, -0.83147, 0, -0.6314, -0.7693, -0.0975, 0, 0},
{-0.544895, -0.815493, -0.19509, -0.6314, -0.7693, -0.0975, 0, 0},
{-0.51328, -0.768178, -0.382683, -0.6073, -0.74, -0.289, 0, 0},
{-0.46194, -0.691342, -0.55557, -0.5601, -0.6825, -0.4696, 0, 0},
{-0.392848, -0.587938, -0.707107, -0.4913, -0.5987, -0.6326, 0, 0},
{-0.308658, -0.46194, -0.83147, -0.3002, -0.3658, -0.881, 0, 0},
{-0.212608, -0.31819, -0.92388, -0.185, -0.2254, -0.9565, 0, 0},
{-0.108386, -0.162212, -0.980785, -0.185, -0.2254, -0.9565, 0, 0},
{-0.707107, -0.707107, 0, -0.7693, -0.6314, -0.0976, 0, 0},
{-0.69352, -0.69352, -0.19509, -0.74, -0.6073, -0.289, 0, 0},
{-0.653282, -0.653282, -0.382683, -0.74, -0.6073, -0.289, 0, 0},
{-0.587938, -0.587938, -0.55557, -0.5987, -0.4913, -0.6326, 0, 0},
{-0.5, -0.5, -0.707107, -0.4918, -0.4036, -0.7715, 0, 0},
{-0.392848, -0.392848, -0.83147, -0.4918, -0.4036, -0.7715, 0, 0},
{-0.270598, -0.270598, -0.92388, -0.2254, -0.185, -0.9565, 0, 0},
{-0.13795, -0.13795, -0.980785, -0.2254, -0.185, -0.9565, 0, 0},
{-0.83147, -0.55557, 0, -0.8777, -0.4691, -0.0976, 0, 0},
{-0.815493, -0.544895, -0.19509, -0.8443, -0.4513, -0.289, 0, 0},
{-0.768178, -0.51328, -0.382683, -0.8443, -0.4513, -0.289, 0, 0},
{-0.691342, -0.46194, -0.55557, -0.7786, -0.4162, -0.4696, 0, 0},
{-0.587938, -0.392848, -0.707107, -0.6831, -0.3651, -0.6326, 0, 0},
{-0.46194, -0.308658, -0.83147, -0.5611, -0.2999, -0.7715, 0, 0},
{-0.31819, -0.212608, -0.92388, -0.4173, -0.223, -0.881, 0, 0},
{-0.162212, -0.108386, -0.980785, -0.2571, -0.1374, -0.9565, 0, 0},
{-0.92388, -0.382683, 0, -0.9524, -0.2889, -0.0976, 0, 0},
{-0.906127, -0.37533, -0.19509, -0.9161, -0.2779, -0.289, 0, 0},
{-0.853553, -0.353553, -0.382683, -0.9161, -0.2779, -0.289, 0, 0},
{-0.768178, -0.31819, -0.55557, -0.7412, -0.2248, -0.6326, 0, 0},
{-0.653282, -0.270598, -0.707107, -0.7412, -0.2248, -0.6326, 0, 0},
{-0.51328, -0.212607, -0.83147, -0.4528, -0.1374, -0.881, 0, 0},
{-0.353553, -0.146447, -0.92388, -0.4528, -0.1374, -0.881, 0, 0},
{-0.18024, -0.074658, -0.980785, -0.279, -0.0846, -0.9565, 0, 0},
{-0.980785, -0.19509, 0, -0.9904, -0.0975, -0.0976, 0, 0},
{-0.96194, -0.191342, -0.19509, -0.9527, -0.0938, -0.289, 0, 0},
{-0.906127, -0.18024, -0.382683, -0.9527, -0.0938, -0.289, 0, 0},
{-0.815493, -0.162212, -0.55557, -0.8786, -0.0865, -0.4696, 0, 0},
{-0.69352, -0.13795, -0.707107, -0.7708, -0.0759, -0.6326, 0, 0},
{-0.544895, -0.108386, -0.83147, -0.4709, -0.0464, -0.881, 0, 0},
{-0.37533, -0.074658, -0.92388, -0.2902, -0.0286, -0.9565, 0, 0},
{-0.191342, -0.03806, -0.980785, -0.2902, -0.0286, -0.9565, 0, 0},
{-1, 0, 0, -0.9904, 0.0976, -0.0976, 0, 0},
{-0.980785, 0, -0.19509, -0.9527, 0.0938, -0.289, 0, 0},
{-0.92388, 0, -0.382683, -0.9527, 0.0938, -0.289, 0, 0},
{-0.83147, 0, -0.55557, -0.8786, 0.0865, -0.4696, 0, 0},
{-0.707107, 0, -0.707107, -0.7708, 0.0759, -0.6326, 0, 0},
{-0.55557, 0, -0.83147, -0.4709, 0.0464, -0.881, 0, 0},
{-0.382683, 0, -0.92388, -0.2902, 0.0286, -0.9565, 0, 0},
{-0.19509, 0, -0.980785, -0.2902, 0.0286, -0.9565, 0, 0},
{-0.980785, 0.195091, 0, -0.9524, 0.2889, -0.0976, 0, 0},
{-0.96194, 0.191342, -0.19509, -0.9161, 0.2779, -0.289, 0, 0},
{-0.906127, 0.18024, -0.382683, -0.9161, 0.2779, -0.289, 0, 0},
{-0.815493, 0.162212, -0.55557, -0.8448, 0.2563, -0.4696, 0, 0},
{-0.69352, 0.13795, -0.707107, -0.7412, 0.2248, -0.6326, 0, 0},
{-0.544895, 0.108387, -0.83147, -0.4528, 0.1374, -0.881, 0, 0},
{-0.37533, 0.074658, -0.92388, -0.4528, 0.1374, -0.881, 0, 0},
{-0.191342, 0.03806, -0.980785, -0.279, 0.0846, -0.9565, 0, 0},
{-0.92388, 0.382684, 0, -0.9524, 0.2889, -0.0976, 0, 0},
{-0.906127, 0.37533, -0.19509, -0.8443, 0.4513, -0.289, 0, 0},
{-0.853553, 0.353553, -0.382683, -0.8443, 0.4513, -0.289, 0, 0},
{-0.768178, 0.31819, -0.55557, -0.6831, 0.3651, -0.6326, 0, 0},
{-0.653282, 0.270598, -0.707107, -0.6831, 0.3651, -0.6326, 0, 0},
{-0.51328, 0.212608, -0.83147, -0.4173, 0.2231, -0.881, 0, 0},
{-0.353553, 0.146447, -0.92388, -0.2571, 0.1374, -0.9565, 0, 0},
{-0.18024, 0.074658, -0.980785, -0.2571, 0.1374, -0.9565, 0, 0},
{-0.83147, 0.55557, 0, -0.7693, 0.6314, -0.0976, 0, 0},
{-0.815493, 0.544895, -0.19509, -0.74, 0.6073, -0.289, 0, 0},
{-0.768178, 0.51328, -0.382683, -0.74, 0.6073, -0.289, 0, 0},
{-0.691342, 0.46194, -0.55557, -0.5987, 0.4913, -0.6326, 0, 0},
{-0.587938, 0.392848, -0.707107, -0.5987, 0.4913, -0.6326, 0, 0},
{-0.46194, 0.308658, -0.83147, -0.3658, 0.3002, -0.881, 0, 0},
{-0.31819, 0.212608, -0.92388, -0.3658, 0.3002, -0.881, 0, 0},
{-0.162212, 0.108387, -0.980785, -0.2254, 0.185, -0.9565, 0, 0},
{-0.707107, 0.707107, 0, -0.6314, 0.7693, -0.0976, 0, 0},
{-0.69352, 0.69352, -0.19509, -0.6073, 0.74, -0.289, 0, 0},
{-0.653282, 0.653282, -0.382683, -0.6073, 0.74, -0.289, 0, 0},
{-0.587938, 0.587938, -0.55557, -0.4913, 0.5987, -0.6326, 0, 0},
{-0.5, 0.5, -0.707107, -0.4913, 0.5987, -0.6326, 0, 0},
{-0.392847, 0.392848, -0.83147, -0.4036, 0.4918, -0.7715, 0, 0},
{-0.270598, 0.270598, -0.92388, -0.3002, 0.3658, -0.881, 0, 0},
{-0.13795, 0.13795, -0.980785, -0.185, 0.2254, -0.9565, 0, 0},
{-0.55557, 0.83147, 0, -0.4691, 0.8777, -0.0976, 0, 0},
{-0.544895, 0.815493, -0.19509, -0.4513, 0.8443, -0.289, 0, 0},
{-0.51328, 0.768178, -0.382683, -0.4513, 0.8443, -0.289, 0, 0},
{-0.46194, 0.691342, -0.55557, -0.4162, 0.7786, -0.4696, 0, 0},
{-0.392847, 0.587938, -0.707107, -0.3651, 0.6831, -0.6326, 0, 0},
{-0.308658, 0.46194, -0.83147, -0.2999, 0.5611, -0.7715, 0, 0},
{-0.212607, 0.31819, -0.92388, -0.1374, 0.2571, -0.9565, 0, 0},
{-0.108386, 0.162212, -0.980785, -0.1374, 0.2571, -0.9565, 0, 0},
{-0.382683, 0.92388, 0, -0.2889, 0.9524, -0.0976, 0, 0},
{-0.37533, 0.906127, -0.19509, -0.2889, 0.9524, -0.0976, 0, 0},
{-0.353553, 0.853553, -0.382683, -0.2779, 0.9161, -0.289, 0, 0},
{-0.318189, 0.768178, -0.55557, -0.2248, 0.7412, -0.6326, 0, 0},
{-0.270598, 0.653282, -0.707107, -0.2248, 0.7412, -0.6326, 0, 0},
{-0.212607, 0.51328, -0.83147, -0.1374, 0.4528, -0.881, 0, 0},
{-0.146447, 0.353554, -0.92388, -0.1374, 0.4528, -0.881, 0, 0},
{-0.074658, 0.18024, -0.980785, -0.0846, 0.279, -0.9565, 0, 0},
{-0.19509, 0.980785, 0, -0.0975, 0.9904, -0.0976, 0, 0},
{-0.191342, 0.96194, -0.19509, -0.0938, 0.9527, -0.289, 0, 0},
{-0.18024, 0.906128, -0.382683, -0.0938, 0.9527, -0.289, 0, 0},
{-0.162211, 0.815493, -0.55557, -0.0759, 0.7708, -0.6326, 0, 0},
{-0.13795, 0.69352, -0.707107, -0.0759, 0.7708, -0.6326, 0, 0},
{-0.108386, 0.544895, -0.83147, -0.0624, 0.6332, -0.7715, 0, 0},
{-0.074658, 0.37533, -0.92388, -0.0464, 0.4709, -0.881, 0, 0},
{-0.03806, 0.191342, -0.980785, -0.0286, 0.2902, -0.9565, 0, 0},
{0, 1, 0, 0.0975, 0.9904, -0.0976, 0, 0},
{0, 0.980785, -0.19509, 0.0938, 0.9527, -0.289, 0, 0},
{0, 0.92388, -0.382683, 0.0938, 0.9527, -0.289, 0, 0},
{0, 0.831469, -0.55557, 0.0759, 0.7708, -0.6326, 0, 0},
{0, 0.707107, -0.707107, 0.0624, 0.6332, -0.7715, 0, 0},
{0, 0.55557, -0.83147, 0.0624, 0.6332, -0.7715, 0, 0},
{0, 0.382684, -0.92388, 0.0464, 0.4709, -0.881, 0, 0},
{0, 0.19509, -0.980785, 0.0286, 0.2902, -0.9565, 0, 0},
{0.195091, 0.980785, 0, 0.2889, 0.9524, -0.0976, 0, 0},
{0.191342, 0.96194, -0.19509, 0.2779, 0.9161, -0.289, 0, 0},
{0.18024, 0.906128, -0.382683, 0.2779, 0.9161, -0.289, 0, 0},
{0.162212, 0.815493, -0.55557, 0.2248, 0.7412, -0.6326, 0, 0},
{0.13795, 0.69352, -0.707107, 0.1847, 0.6088, -0.7715, 0, 0},
{0.108386, 0.544895, -0.83147, 0.1847, 0.6088, -0.7715, 0, 0},
{0.074658, 0.37533, -0.92388, 0.1374, 0.4528, -0.881, 0, 0},
{0.03806, 0.191342, -0.980785, 0.0846, 0.279, -0.9565, 0, 0},
{0.382684, 0.92388, 0, 0.4691, 0.8777, -0.0976, 0, 0},
{0.37533, 0.906127, -0.19509, 0.4513, 0.8443, -0.289, 0, 0},
{0.353553, 0.853553, -0.382683, 0.4513, 0.8443, -0.289, 0, 0},
{0.31819, 0.768178, -0.55557, 0.3651, 0.6831, -0.6326, 0, 0},
{0.270598, 0.653282, -0.707107, 0.2999, 0.5611, -0.7715, 0, 0},
{0.212608, 0.51328, -0.83147, 0.2999, 0.5611, -0.7715, 0, 0},
{0.146447, 0.353553, -0.92388, 0.1374, 0.2571, -0.9565, 0, 0},
{0.074658, 0.18024, -0.980785, 0.1374, 0.2571, -0.9565, 0, 0},
{0.55557, 0.83147, 0, 0.6314, 0.7693, -0.0976, 0, 0},
{0.544895, 0.815493, -0.19509, 0.6073, 0.74, -0.289, 0, 0},
{0.51328, 0.768178, -0.382683, 0.6073, 0.74, -0.289, 0, 0},
{0.46194, 0.691341, -0.55557, 0.4913, 0.5987, -0.6326, 0, 0},
{0.392848, 0.587938, -0.707107, 0.4036, 0.4918, -0.7715, 0, 0},
{0.308658, 0.46194, -0.83147, 0.3002, 0.3658, -0.881, 0, 0},
{0.212608, 0.31819, -0.92388, 0.3002, 0.3658, -0.881, 0, 0},
{0.108386, 0.162212, -0.980785, 0.185, 0.2254, -0.9565, 0, 0},
{0.707107, 0.707107, 0, 0.7693, 0.6314, -0.0976, 0, 0},
{0.69352, 0.69352, -0.19509, 0.74, 0.6073, -0.289, 0, 0},
{0.653282, 0.653282, -0.382683, 0.74, 0.6073, -0.289, 0, 0},
{0.587938, 0.587938, -0.55557, 0.6825, 0.5601, -0.4696, 0, 0},
{0.5, 0.5, -0.707107, 0.4918, 0.4036, -0.7715, 0, 0},
{0.392848, 0.392847, -0.83147, 0.3658, 0.3002, -0.881, 0, 0},
{0.270598, 0.270598, -0.92388, 0.2254, 0.185, -0.9565, 0, 0},
{0.13795, 0.13795, -0.980785, 0.2254, 0.185, -0.9565, 0, 0},
{0.83147, 0.55557, 0, 0.8777, 0.4691, -0.0976, 0, 0},
{0.815493, 0.544895, -0.19509, 0.8443, 0.4513, -0.289, 0, 0},
{0.768178, 0.51328, -0.382683, 0.8443, 0.4513, -0.289, 0, 0},
{0.691342, 0.46194, -0.55557, 0.6831, 0.3651, -0.6326, 0, 0},
{0.587938, 0.392848, -0.707107, 0.5611, 0.2999, -0.7715, 0, 0},
{0.46194, 0.308658, -0.83147, 0.4173, 0.223, -0.881, 0, 0},
{0.31819, 0.212607, -0.92388, 0.2571, 0.1374, -0.9565, 0, 0},
{0.162212, 0.108386, -0.980785, 0.2571, 0.1374, -0.9565, 0, 0},
{0.92388, 0.382683, 0, 0.9524, 0.2889, -0.0976, 0, 0},
{0.906127, 0.37533, -0.19509, 0.9161, 0.2779, -0.289, 0, 0},
{0.853553, 0.353554, -0.382683, 0.9161, 0.2779, -0.289, 0, 0},
{0.768178, 0.318189, -0.55557, 0.8448, 0.2563, -0.4696, 0, 0},
{0.653282, 0.270598, -0.707107, 0.6088, 0.1847, -0.7715, 0, 0},
{0.51328, 0.212608, -0.83147, 0.6088, 0.1847, -0.7715, 0, 0},
{0.353553, 0.146447, -0.92388, 0.279, 0.0846, -0.9565, 0, 0},
{0.18024, 0.074658, -0.980785, 0.279, 0.0846, -0.9565, 0, 0},
{0.980785, 0.19509, 0, 0.9904, 0.0975, -0.0976, 0, 0},
{0.96194, 0.191342, -0.19509, 0.9527, 0.0938, -0.289, 0, 0},
{0.906128, 0.18024, -0.382683, 0.9527, 0.0938, -0.289, 0, 0},
{0.815493, 0.162212, -0.55557, 0.7708, 0.0759, -0.6326, 0, 0},
{0.69352, 0.13795, -0.707107, 0.6332, 0.0624, -0.7715, 0, 0},
{0.544895, 0.108386, -0.83147, 0.6332, 0.0624, -0.7715, 0, 0},
{0.37533, 0.074658, -0.92388, 0.2902, 0.0286, -0.9565, 0, 0},
{0.191342, 0.03806, -0.980785, 0.2902, 0.0286, -0.9565, 0, 0},
{1, -0, 0, 0.9904, 0.0975, -0.0976, 0, 0},
{0.980785, -0, -0.19509, 0.9527, -0.0938, -0.289, 0, 0},
{0.92388, 0, -0.382683, 0.9527, -0.0938, -0.289, 0, 0},
{0.831469, -0, -0.55557, 0.8786, -0.0865, -0.4696, 0, 0},
{0.707107, -0, -0.707107, 0.7708, -0.0759, -0.6326, 0, 0},
{0.55557, 0, -0.83147, 0.4709, -0.0464, -0.881, 0, 0},
{0.382683, 0, -0.92388, 0.2902, -0.0286, -0.9565, 0, 0},
{0.19509, 0, -0.980785, 0.2902, -0.0286, -0.9565, 0, 0},
{0.980785, -0.19509, 0, 0.9904, -0.0976, -0.0976, 0, 0},
{0.961939, -0.191342, -0.19509, 0.9524, -0.2889, -0.0976, 0, 0},
{0.906127, -0.18024, -0.382683, 0.9161, -0.2779, -0.289, 0, 0},
{0.815493, -0.162212, -0.55557, 0.7412, -0.2248, -0.6326, 0, 0},
{0.69352, -0.13795, -0.707107, 0.6088, -0.1847, -0.7715, 0, 0},
{0.544895, -0.108386, -0.83147, 0.4528, -0.1374, -0.881, 0, 0},
{0.37533, -0.074658, -0.92388, 0.279, -0.0846, -0.9565, 0, 0},
{0.191342, -0.03806, -0.980785, 0.279, -0.0846, -0.9565, 0, 0},
{0.923879, -0.382683, 0, 0.9524, -0.2889, -0.0976, 0, 0},
{0.906127, -0.37533, -0.19509, 0.8443, -0.4513, -0.289, 0, 0},
{0.853553, -0.353553, -0.382683, 0.8443, -0.4513, -0.289, 0, 0},
{0.768177, -0.31819, -0.55557, 0.6831, -0.3651, -0.6326, 0, 0},
{0.653281, -0.270598, -0.707107, 0.6831, -0.3651, -0.6326, 0, 0},
{0.51328, -0.212607, -0.83147, 0.5611, -0.2999, -0.7715, 0, 0},
{0.353553, -0.146447, -0.92388, 0.2571, -0.1374, -0.9565, 0, 0},
{0.18024, -0.074658, -0.980785, 0.2571, -0.1374, -0.9565, 0, 0},
{0.831469, -0.55557, 0, 0.8777, -0.4691, -0.0976, 0, 0},
{0.815493, -0.544895, -0.19509, 0.7693, -0.6314, -0.0976, 0, 0},
{0.768178, -0.51328, -0.382683, 0.74, -0.6073, -0.289, 0, 0},
{0.691341, -0.46194, -0.55557, 0.5987, -0.4913, -0.6326, 0, 0},
{0.587938, -0.392847, -0.707107, 0.5987, -0.4913, -0.6326, 0, 0},
{0.46194, -0.308658, -0.83147, 0.3658, -0.3002, -0.881, 0, 0},
{0.31819, -0.212607, -0.92388, 0.2254, -0.185, -0.9565, 0, 0},
{0.162212, -0.108386, -0.980785, 0.2254, -0.185, -0.9565, 0, 0},
{0.707106, -0.707107, 0, 0.6314, -0.7693, -0.0976, 0, 0},
{0.693519, -0.69352, -0.19509, 0.6073, -0.74, -0.289, 0, 0},
{0.653282, -0.653281, -0.382683, 0.6073, -0.74, -0.289, 0, 0},
{0.587937, -0.587938, -0.55557, 0.4913, -0.5987, -0.6326, 0, 0},
{0.5, -0.5, -0.707107, 0.4036, -0.4918, -0.7715, 0, 0},
{0.392847, -0.392847, -0.83147, 0.4036, -0.4918, -0.7715, 0, 0},
{0.270598, -0.270598, -0.92388, 0.185, -0.2254, -0.9565, 0, 0},
{0.13795, -0.13795, -0.980785, 0.185, -0.2254, -0.9565, 0, 0},
{0.55557, -0.831469, 0, 0.4691, -0.8777, -0.0976, 0, 0},
{0.544895, -0.815493, -0.19509, 0.4513, -0.8443, -0.289, 0, 0},
{0.51328, -0.768178, -0.382683, 0.4513, -0.8443, -0.289, 0, 0},
{0.461939, -0.691341, -0.55557, 0.3651, -0.6831, -0.6326, 0, 0},
{0.392847, -0.587938, -0.707107, 0.2999, -0.5611, -0.7715, 0, 0},
{0.308658, -0.46194, -0.83147, 0.223, -0.4173, -0.881, 0, 0},
{0.212607, -0.318189, -0.92388, 0.1374, -0.2571, -0.9565, 0, 0},
{0.108386, -0.162212, -0.980785, 0.1374, -0.2571, -0.9565, 0, 0},
{0.382683, -0.923879, 0, 0.4691, -0.8777, -0.0976, 0, 0},
{0.37533, -0.906127, -0.19509, 0.2779, -0.9161, -0.289, 0, 0},
{0.353553, -0.853553, -0.382683, 0.2779, -0.9161, -0.289, 0, 0},
{0.318189, -0.768177, -0.55557, 0.2248, -0.7412, -0.6326, 0, 0},
{0.270598, -0.653281, -0.707107, 0.1847, -0.6088, -0.7715, 0, 0},
{0.212607, -0.51328, -0.83147, 0.1847, -0.6088, -0.7715, 0, 0},
{0.146447, -0.353553, -0.92388, 0.1374, -0.4528, -0.881, 0, 0},
{0.074658, -0.18024, -0.980785, 0.0846, -0.279, -0.9565, 0, 0},
{0.19509, -0.980785, 0, 0.0976, -0.9904, -0.0975, 0, 0},
{0.191341, -0.961939, -0.19509, 0.0938, -0.9527, -0.289, 0, 0},
{0.18024, -0.906127, -0.382683, 0.0938, -0.9527, -0.289, 0, 0},
{0.162211, -0.815493, -0.55557, 0.0759, -0.7708, -0.6326, 0, 0},
{0.13795, -0.69352, -0.707107, 0.0624, -0.6332, -0.7715, 0, 0},
{0.108386, -0.544895, -0.83147, 0.0464, -0.4709, -0.881, 0, 0},
{0.074658, -0.37533, -0.92388, 0.0286, -0.2902, -0.9565, 0, 0},
{0.03806, -0.191342, -0.980785, 0.0286, -0.2902, -0.9565, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::LowerSphereIndices = {
2, 11, 12,
3, 12, 13,
4, 13, 14,
6, 5, 14,
6, 15, 16,
0, 9, 10,
1, 10, 11,
10, 18, 19,
11, 19, 20,
13, 12, 20,
14, 13, 21,
14, 22, 23,
15, 23, 24,
10, 9, 17,
23, 22, 30,
23, 31, 32,
17, 25, 26,
18, 26, 27,
20, 19, 27,
20, 28, 29,
22, 21, 29,
26, 34, 35,
28, 27, 35,
29, 28, 36,
30, 29, 37,
30, 38, 39,
31, 39, 40,
25, 33, 34,
38, 46, 47,
39, 47, 48,
33, 41, 42,
34, 42, 43,
36, 35, 43,
36, 44, 45,
37, 45, 46,
44, 43, 51,
45, 44, 52,
46, 45, 53,
47, 46, 54,
48, 47, 55,
41, 49, 50,
42, 50, 51,
55, 63, 64,
50, 49, 57,
50, 58, 59,
52, 51, 59,
52, 60, 61,
54, 53, 61,
54, 62, 63,
60, 68, 69,
62, 61, 69,
62, 70, 71,
63, 71, 72,
57, 65, 66,
58, 66, 67,
60, 59, 67,
65, 73, 74,
66, 74, 75,
68, 67, 75,
69, 68, 76,
70, 69, 77,
70, 78, 79,
71, 79, 80,
76, 84, 85,
78, 77, 85,
78, 86, 87,
80, 79, 87,
74, 73, 81,
74, 82, 83,
76, 75, 83,
82, 81, 89,
82, 90, 91,
84, 83, 91,
84, 92, 93,
86, 85, 93,
86, 94, 95,
87, 95, 96,
94, 93, 101,
94, 102, 103,
96, 95, 103,
89, 97, 98,
90, 98, 99,
92, 91, 99,
92, 100, 101,
97, 105, 106,
98, 106, 107,
100, 99, 107,
100, 108, 109,
102, 101, 109,
103, 102, 110,
104, 103, 111,
110, 109, 117,
111, 110, 118,
111, 119, 120,
105, 113, 114,
106, 114, 115,
108, 107, 115,
109, 108, 116,
114, 122, 123,
116, 115, 123,
116, 124, 125,
118, 117, 125,
118, 126, 127,
120, 119, 127,
113, 121, 122,
127, 126, 134,
128, 127, 135,
121, 129, 130,
122, 130, 131,
124, 123, 131,
124, 132, 133,
126, 125, 133,
132, 131, 139,
132, 140, 141,
133, 141, 142,
135, 134, 142,
136, 135, 143,
129, 137, 138,
130, 138, 139,
143, 151, 152,
137, 145, 146,
138, 146, 147,
140, 139, 147,
140, 148, 149,
141, 149, 150,
143, 142, 150,
148, 147, 155,
148, 156, 157,
149, 157, 158,
151, 150, 158,
151, 159, 160,
145, 153, 154,
146, 154, 155,
159, 167, 168,
153, 161, 162,
154, 162, 163,
156, 155, 163,
156, 164, 165,
157, 165, 166,
158, 166, 167,
164, 172, 173,
165, 173, 174,
166, 174, 175,
167, 175, 176,
161, 169, 170,
162, 170, 171,
164, 163, 171,
169, 177, 178,
170, 178, 179,
172, 171, 179,
172, 180, 181,
173, 181, 182,
174, 182, 183,
175, 183, 184,
180, 188, 189,
181, 189, 190,
183, 182, 190,
183, 191, 192,
177, 185, 186,
178, 186, 187,
180, 179, 187,
186, 185, 193,
186, 194, 195,
188, 187, 195,
188, 196, 197,
189, 197, 198,
191, 190, 198,
191, 199, 200,
197, 205, 206,
198, 206, 207,
199, 207, 208,
194, 193, 201,
194, 202, 203,
196, 195, 203,
197, 196, 204,
202, 210, 211,
204, 203, 211,
204, 212, 213,
205, 213, 214,
206, 214, 215,
207, 215, 216,
202, 201, 209,
215, 214, 222,
215, 223, 224,
210, 209, 217,
210, 218, 219,
212, 211, 219,
212, 220, 221,
214, 213, 221,
218, 226, 227,
220, 219, 227,
220, 228, 229,
222, 221, 229,
222, 230, 231,
223, 231, 232,
218, 217, 225,
230, 238, 239,
231, 239, 240,
225, 233, 234,
226, 234, 235,
228, 227, 235,
228, 236, 237,
229, 237, 238,
236, 235, 243,
236, 244, 245,
237, 245, 246,
238, 246, 247,
239, 247, 248,
234, 233, 241,
234, 242, 243,
247, 255, 256,
242, 241, 249,
242, 250, 251,
244, 243, 251,
244, 252, 253,
245, 253, 254,
247, 246, 254,
8, 7, 16,
8, 16, 24,
8, 24, 32,
8, 32, 40,
8, 40, 48,
8, 48, 56,
8, 56, 64,
8, 64, 72,
8, 72, 80,
8, 80, 88,
8, 88, 96,
8, 96, 104,
8, 104, 112,
8, 112, 120,
8, 120, 128,
8, 128, 136,
8, 136, 144,
8, 144, 152,
8, 152, 160,
8, 160, 168,
8, 168, 176,
8, 176, 184,
8, 184, 192,
8, 192, 200,
8, 200, 208,
8, 208, 216,
8, 216, 224,
8, 224, 232,
8, 232, 240,
8, 240, 248,
8, 248, 256,
251, 2, 3,
252, 3, 4,
253, 4, 5,
254, 5, 6,
255, 6, 7,
8, 256, 7,
249, 0, 1,
250, 1, 2,
3, 2, 12,
4, 3, 13,
5, 4, 14,
15, 6, 14,
7, 6, 16,
1, 0, 10,
2, 1, 11,
11, 10, 19,
12, 11, 20,
21, 13, 20,
22, 14, 21,
15, 14, 23,
16, 15, 24,
18, 10, 17,
31, 23, 30,
24, 23, 32,
18, 17, 26,
19, 18, 27,
28, 20, 27,
21, 20, 29,
30, 22, 29,
27, 26, 35,
36, 28, 35,
37, 29, 36,
38, 30, 37,
31, 30, 39,
32, 31, 40,
26, 25, 34,
39, 38, 47,
40, 39, 48,
34, 33, 42,
35, 34, 43,
44, 36, 43,
37, 36, 45,
38, 37, 46,
52, 44, 51,
53, 45, 52,
54, 46, 53,
55, 47, 54,
56, 48, 55,
42, 41, 50,
43, 42, 51,
56, 55, 64,
58, 50, 57,
51, 50, 59,
60, 52, 59,
53, 52, 61,
62, 54, 61,
55, 54, 63,
61, 60, 69,
70, 62, 69,
63, 62, 71,
64, 63, 72,
58, 57, 66,
59, 58, 67,
68, 60, 67,
66, 65, 74,
67, 66, 75,
76, 68, 75,
77, 69, 76,
78, 70, 77,
71, 70, 79,
72, 71, 80,
77, 76, 85,
86, 78, 85,
79, 78, 87,
88, 80, 87,
82, 74, 81,
75, 74, 83,
84, 76, 83,
90, 82, 89,
83, 82, 91,
92, 84, 91,
85, 84, 93,
94, 86, 93,
87, 86, 95,
88, 87, 96,
102, 94, 101,
95, 94, 103,
104, 96, 103,
90, 89, 98,
91, 90, 99,
100, 92, 99,
93, 92, 101,
98, 97, 106,
99, 98, 107,
108, 100, 107,
101, 100, 109,
110, 102, 109,
111, 103, 110,
112, 104, 111,
118, 110, 117,
119, 111, 118,
112, 111, 120,
106, 105, 114,
107, 106, 115,
116, 108, 115,
117, 109, 116,
115, 114, 123,
124, 116, 123,
117, 116, 125,
126, 118, 125,
119, 118, 127,
128, 120, 127,
114, 113, 122,
135, 127, 134,
136, 128, 135,
122, 121, 130,
123, 122, 131,
132, 124, 131,
125, 124, 133,
134, 126, 133,
140, 132, 139,
133, 132, 141,
134, 133, 142,
143, 135, 142,
144, 136, 143,
130, 129, 138,
131, 130, 139,
144, 143, 152,
138, 137, 146,
139, 138, 147,
148, 140, 147,
141, 140, 149,
142, 141, 150,
151, 143, 150,
156, 148, 155,
149, 148, 157,
150, 149, 158,
159, 151, 158,
152, 151, 160,
146, 145, 154,
147, 146, 155,
160, 159, 168,
154, 153, 162,
155, 154, 163,
164, 156, 163,
157, 156, 165,
158, 157, 166,
159, 158, 167,
165, 164, 173,
166, 165, 174,
167, 166, 175,
168, 167, 176,
162, 161, 170,
163, 162, 171,
172, 164, 171,
170, 169, 178,
171, 170, 179,
180, 172, 179,
173, 172, 181,
174, 173, 182,
175, 174, 183,
176, 175, 184,
181, 180, 189,
182, 181, 190,
191, 183, 190,
184, 183, 192,
178, 177, 186,
179, 178, 187,
188, 180, 187,
194, 186, 193,
187, 186, 195,
196, 188, 195,
189, 188, 197,
190, 189, 198,
199, 191, 198,
192, 191, 200,
198, 197, 206,
199, 198, 207,
200, 199, 208,
202, 194, 201,
195, 194, 203,
204, 196, 203,
205, 197, 204,
203, 202, 211,
212, 204, 211,
205, 204, 213,
206, 205, 214,
207, 206, 215,
208, 207, 216,
210, 202, 209,
223, 215, 222,
216, 215, 224,
218, 210, 217,
211, 210, 219,
220, 212, 219,
213, 212, 221,
222, 214, 221,
219, 218, 227,
228, 220, 227,
221, 220, 229,
230, 222, 229,
223, 222, 231,
224, 223, 232,
226, 218, 225,
231, 230, 239,
232, 231, 240,
226, 225, 234,
227, 226, 235,
236, 228, 235,
229, 228, 237,
230, 229, 238,
244, 236, 243,
237, 236, 245,
238, 237, 246,
239, 238, 247,
240, 239, 248,
242, 234, 241,
235, 234, 243,
248, 247, 256,
250, 242, 249,
243, 242, 251,
252, 244, 251,
245, 244, 253,
246, 245, 254,
255, 247, 254,
252, 251, 3,
253, 252, 4,
254, 253, 5,
255, 254, 6,
256, 255, 7,
250, 249, 1,
251, 250, 2,
};
// Cone (length, radius)
const VertexList PrimitiveShapeVertex::ConeVertices = {
{0, 0, 0.5, -0.7054, -0.0695, 0.7054, 0, 0},
{-1, 0, -0.5, -0.7054, -0.0695, 0.7054, 0, 0},
{-0.980785, 0.19509, -0.5, -0.6783, 0.2058, 0.7054, 0, 0},
{-0.92388, 0.382683, -0.5, -0.6251, 0.3341, 0.7054, 0, 0},
{-0.83147, 0.55557, -0.5, -0.5479, 0.4497, 0.7054, 0, 0},
{-0.707107, 0.707107, -0.5, -0.4497, 0.5479, 0.7054, 0, 0},
{-0.55557, 0.83147, -0.5, -0.3341, 0.6251, 0.7054, 0, 0},
{-0.382683, 0.92388, -0.5, -0.2058, 0.6783, 0.7054, 0, 0},
{-0.19509, 0.980785, -0.5, -0.0695, 0.7054, 0.7054, 0, 0},
{0, 1, -0.5, 0.0695, 0.7054, 0.7054, 0, 0},
{0.19509, 0.980785, -0.5, 0.2058, 0.6783, 0.7054, 0, 0},
{0.382683, 0.92388, -0.5, 0.3341, 0.6251, 0.7054, 0, 0},
{0.55557, 0.83147, -0.5, 0.4497, 0.5479, 0.7054, 0, 0},
{0.707107, 0.707107, -0.5, 0.5479, 0.4497, 0.7054, 0, 0},
{0.83147, 0.55557, -0.5, 0.6251, 0.3341, 0.7054, 0, 0},
{0.92388, 0.382683, -0.5, 0.6783, 0.2058, 0.7054, 0, 0},
{0.980785, 0.19509, -0.5, 0.7054, 0.0695, 0.7054, 0, 0},
{1, 0, -0.5, 0.7054, -0.0695, 0.7054, 0, 0},
{0.980785, -0.195091, -0.5, 0.6783, -0.2058, 0.7054, 0, 0},
{0.923879, -0.382684, -0.5, 0.6251, -0.3341, 0.7054, 0, 0},
{0.831469, -0.555571, -0.5, 0.5479, -0.4497, 0.7054, 0, 0},
{0.707106, -0.707107, -0.5, 0.4497, -0.5479, 0.7054, 0, 0},
{0.55557, -0.83147, -0.5, 0.3341, -0.6251, 0.7054, 0, 0},
{0.382683, -0.92388, -0.5, 0.2058, -0.6783, 0.7054, 0, 0},
{0.195089, -0.980785, -0.5, 0.0695, -0.7054, 0.7054, 0, 0},
{-1e-06, -1, -0.5, -0.0695, -0.7054, 0.7054, 0, 0},
{-0.195091, -0.980785, -0.5, -0.2058, -0.6783, 0.7054, 0, 0},
{-0.382684, -0.923879, -0.5, -0.3341, -0.6251, 0.7054, 0, 0},
{-0.555571, -0.831469, -0.5, -0.4497, -0.5479, 0.7054, 0, 0},
{-0.707108, -0.707106, -0.5, -0.5479, -0.4497, 0.7054, 0, 0},
{-0.83147, -0.555569, -0.5, -0.6251, -0.3341, 0.7054, 0, 0},
{-0.92388, -0.382682, -0.5, -0.6783, -0.2058, 0.7054, 0, 0},
{-0.980786, -0.195089, -0.5, -0.7054, -0.0695, 0.7054, 0, 0},
{0, 0, -0.5, 0, 0, -1, 0, 0},
{-1, 0, -0.5, 0, 0, -1, 0, 0},
{-0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{-0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{-0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{-0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{-0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{-0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{-0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{0, 1, -0.5, 0, 0, -1, 0, 0},
{0.19509, 0.980785, -0.5, 0, 0, -1, 0, 0},
{0.382683, 0.92388, -0.5, 0, 0, -1, 0, 0},
{0.55557, 0.83147, -0.5, 0, 0, -1, 0, 0},
{0.707107, 0.707107, -0.5, 0, 0, -1, 0, 0},
{0.83147, 0.55557, -0.5, 0, 0, -1, 0, 0},
{0.92388, 0.382683, -0.5, 0, 0, -1, 0, 0},
{0.980785, 0.19509, -0.5, 0, 0, -1, 0, 0},
{1, 0, -0.5, 0, 0, -1, 0, 0},
{0.980785, -0.195091, -0.5, 0, 0, -1, 0, 0},
{0.923879, -0.382684, -0.5, 0, 0, -1, 0, 0},
{0.831469, -0.555571, -0.5, 0, 0, -1, 0, 0},
{0.707106, -0.707107, -0.5, 0, 0, -1, 0, 0},
{0.55557, -0.83147, -0.5, 0, 0, -1, 0, 0},
{0.382683, -0.92388, -0.5, 0, 0, -1, 0, 0},
{0.195089, -0.980785, -0.5, 0, 0, -1, 0, 0},
{-1e-06, -1, -0.5, 0, 0, -1, 0, 0},
{-0.195091, -0.980785, -0.5, 0, 0, -1, 0, 0},
{-0.382684, -0.923879, -0.5, 0, 0, -1, 0, 0},
{-0.555571, -0.831469, -0.5, 0, 0, -1, 0, 0},
{-0.707108, -0.707106, -0.5, 0, 0, -1, 0, 0},
{-0.83147, -0.555569, -0.5, 0, 0, -1, 0, 0},
{-0.92388, -0.382682, -0.5, 0, 0, -1, 0, 0},
{-0.980786, -0.195089, -0.5, 0, 0, -1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::ConeIndices = {
1, 0, 2,
2, 0, 3,
3, 0, 4,
4, 0, 5,
5, 0, 6,
6, 0, 7,
7, 0, 8,
8, 0, 9,
9, 0, 10,
10, 0, 11,
11, 0, 12,
12, 0, 13,
13, 0, 14,
14, 0, 15,
15, 0, 16,
16, 0, 17,
17, 0, 18,
18, 0, 19,
19, 0, 20,
20, 0, 21,
21, 0, 22,
22, 0, 23,
23, 0, 24,
24, 0, 25,
25, 0, 26,
26, 0, 27,
27, 0, 28,
28, 0, 29,
29, 0, 30,
30, 0, 31,
31, 0, 32,
32, 0, 1,
33, 34, 35,
33, 35, 36,
33, 36, 37,
33, 37, 38,
33, 38, 39,
33, 39, 40,
33, 40, 41,
33, 41, 42,
33, 42, 43,
33, 43, 44,
33, 44, 45,
33, 45, 46,
33, 46, 47,
33, 47, 48,
33, 48, 49,
33, 49, 50,
33, 50, 51,
33, 51, 52,
33, 52, 53,
33, 53, 54,
33, 54, 55,
33, 55, 56,
33, 56, 57,
33, 57, 58,
33, 58, 59,
33, 59, 60,
33, 60, 61,
33, 61, 62,
33, 62, 63,
33, 63, 64,
33, 64, 65,
33, 65, 34,
};
// Ring (length, outer_radius, inner_radius)
// Circle (radius)
const VertexList PrimitiveShapeVertex::CircleVertices = {
{0, 0, 0, 0, 0, -1, 0, 0},
{0, 0, 0, 0, 0, 1, 0, 0},
{-1, 0, 0, 0, 0, -1, 0, 0},
{-1, 0, 0, 0, 0, 1, 0, 0},
{-0.980785, 0.19509, 0, 0, 0, -1, 0, 0},
{-0.980785, 0.19509, 0, 0, 0, 1, 0, 0},
{-0.92388, 0.382683, 0, 0, 0, -1, 0, 0},
{-0.92388, 0.382683, 0, 0, 0, 1, 0, 0},
{-0.83147, 0.55557, 0, 0, 0, -1, 0, 0},
{-0.83147, 0.55557, 0, 0, 0, 1, 0, 0},
{-0.707107, 0.707107, 0, 0, 0, -1, 0, 0},
{-0.707107, 0.707107, 0, 0, 0, 1, 0, 0},
{-0.55557, 0.83147, 0, 0, 0, -1, 0, 0},
{-0.55557, 0.83147, 0, 0, 0, 1, 0, 0},
{-0.382683, 0.92388, 0, 0, 0, -1, 0, 0},
{-0.382683, 0.92388, 0, 0, 0, 1, 0, 0},
{-0.19509, 0.980785, 0, 0, 0, -1, 0, 0},
{-0.19509, 0.980785, 0, 0, 0, 1, 0, 0},
{-0, 1, 0, 0, 0, -1, 0, 0},
{-0, 1, 0, 0, 0, 1, 0, 0},
{0.19509, 0.980785, 0, 0, 0, -1, 0, 0},
{0.19509, 0.980785, 0, 0, 0, 1, 0, 0},
{0.382683, 0.92388, 0, 0, 0, -1, 0, 0},
{0.382683, 0.92388, 0, 0, 0, 1, 0, 0},
{0.55557, 0.83147, 0, 0, 0, -1, 0, 0},
{0.55557, 0.83147, 0, 0, 0, 1, 0, 0},
{0.707107, 0.707107, 0, 0, 0, -1, 0, 0},
{0.707107, 0.707107, 0, 0, 0, 1, 0, 0},
{0.83147, 0.55557, 0, 0, 0, -1, 0, 0},
{0.83147, 0.55557, 0, 0, 0, 1, 0, 0},
{0.92388, 0.382683, 0, 0, 0, -1, 0, 0},
{0.92388, 0.382683, 0, 0, 0, 1, 0, 0},
{0.980785, 0.19509, 0, 0, 0, -1, 0, 0},
{0.980785, 0.19509, 0, 0, 0, 1, 0, 0},
{1, -0, 0, 0, 0, -1, 0, 0},
{1, -0, 0, 0, 0, 1, 0, 0},
{0.980785, -0.195091, 0, 0, 0, -1, 0, 0},
{0.980785, -0.195091, 0, 0, 0, 1, 0, 0},
{0.923879, -0.382684, 0, 0, 0, -1, 0, 0},
{0.923879, -0.382684, 0, 0, 0, 1, 0, 0},
{0.831469, -0.555571, 0, 0, 0, -1, 0, 0},
{0.831469, -0.555571, 0, 0, 0, 1, 0, 0},
{0.707106, -0.707107, 0, 0, 0, -1, 0, 0},
{0.707106, -0.707107, 0, 0, 0, 1, 0, 0},
{0.55557, -0.83147, 0, 0, 0, -1, 0, 0},
{0.55557, -0.83147, 0, 0, 0, 1, 0, 0},
{0.382683, -0.92388, 0, 0, 0, -1, 0, 0},
{0.382683, -0.92388, 0, 0, 0, 1, 0, 0},
{0.195089, -0.980785, 0, 0, 0, -1, 0, 0},
{0.195089, -0.980785, 0, 0, 0, 1, 0, 0},
{-1e-06, -1, 0, 0, 0, -1, 0, 0},
{-1e-06, -1, 0, 0, 0, 1, 0, 0},
{-0.195091, -0.980785, 0, 0, 0, -1, 0, 0},
{-0.195091, -0.980785, 0, 0, 0, 1, 0, 0},
{-0.382684, -0.923879, 0, 0, 0, -1, 0, 0},
{-0.382684, -0.923879, 0, 0, 0, 1, 0, 0},
{-0.555571, -0.831469, 0, 0, 0, -1, 0, 0},
{-0.555571, -0.831469, 0, 0, 0, 1, 0, 0},
{-0.707108, -0.707106, 0, 0, 0, -1, 0, 0},
{-0.707108, -0.707106, 0, 0, 0, 1, 0, 0},
{-0.83147, -0.555569, 0, 0, 0, -1, 0, 0},
{-0.83147, -0.555569, 0, 0, 0, 1, 0, 0},
{-0.92388, -0.382682, 0, 0, 0, -1, 0, 0},
{-0.92388, -0.382682, 0, 0, 0, 1, 0, 0},
{-0.980786, -0.195089, 0, 0, 0, -1, 0, 0},
{-0.980786, -0.195089, 0, 0, 0, 1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::CircleIndices = {
0, 2, 4,
1, 5, 3,
0, 4, 6,
1, 7, 5,
0, 6, 8,
1, 9, 7,
0, 8, 10,
1, 11, 9,
0, 10, 12,
1, 13, 11,
0, 12, 14,
1, 15, 13,
0, 14, 16,
1, 17, 15,
0, 16, 18,
1, 19, 17,
0, 18, 20,
1, 21, 19,
0, 20, 22,
1, 23, 21,
0, 22, 24,
1, 25, 23,
0, 24, 26,
1, 27, 25,
0, 26, 28,
1, 29, 27,
0, 28, 30,
1, 31, 29,
0, 30, 32,
1, 33, 31,
0, 32, 34,
1, 35, 33,
0, 34, 36,
1, 37, 35,
0, 36, 38,
1, 39, 37,
0, 38, 40,
1, 41, 39,
0, 40, 42,
1, 43, 41,
0, 42, 44,
1, 45, 43,
0, 44, 46,
1, 47, 45,
0, 46, 48,
1, 49, 47,
0, 48, 50,
1, 51, 49,
0, 50, 52,
1, 53, 51,
0, 52, 54,
1, 55, 53,
0, 54, 56,
1, 57, 55,
0, 56, 58,
1, 59, 57,
0, 58, 60,
1, 61, 59,
0, 60, 62,
1, 63, 61,
0, 62, 64,
1, 65, 63,
0, 64, 2,
1, 3, 65,
};
// RingCircle (outer_radius, inner_radius)
// Rect (width, height)
// flat box
const VertexList PrimitiveShapeVertex::RectVertices = {
// top
{0.5, 0.5, 0, 0, 0, 1, 0, 0},
{-0.5, 0.5, 0, 0, 0, 1, 0, 0},
{-0.5, -0.5, 0, 0, 0, 1, 0, 0},
{0.5, -0.5, 0, 0, 0, 1, 0, 0},
// bottom
{0.5, -0.5, 0, 0, 0, -1, 0, 0},
{-0.5, -0.5, 0, 0, 0, -1, 0, 0},
{-0.5, 0.5, 0, 0, 0, -1, 0, 0},
{0.5, 0.5, 0, 0, 0, -1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::RectIndices = {
// top
0, 1, 2,
2, 3, 0,
// bottom
4, 5, 6,
6, 7, 4,
};
// CircleLine
// Circle (radius)
const VertexList PrimitiveShapeVertex::CircleLineVertices = {
{-1, 0, 0, 0, 0, 1, 0, 0},
{-0.980785, 0.19509, 0, 0, 0, 1, 0, 0},
{-0.92388, 0.382683, 0, 0, 0, 1, 0, 0},
{-0.83147, 0.55557, 0, 0, 0, 1, 0, 0},
{-0.707107, 0.707107, 0, 0, 0, 1, 0, 0},
{-0.55557, 0.83147, 0, 0, 0, 1, 0, 0},
{-0.382683, 0.92388, 0, 0, 0, 1, 0, 0},
{-0.19509, 0.980785, 0, 0, 0, 1, 0, 0},
{-0, 1, 0, 0, 0, 1, 0, 0},
{0.19509, 0.980785, 0, 0, 0, 1, 0, 0},
{0.382683, 0.92388, 0, 0, 0, 1, 0, 0},
{0.55557, 0.83147, 0, 0, 0, 1, 0, 0},
{0.707107, 0.707107, 0, 0, 0, 1, 0, 0},
{0.83147, 0.55557, 0, 0, 0, 1, 0, 0},
{0.92388, 0.382683, 0, 0, 0, 1, 0, 0},
{0.980785, 0.19509, 0, 0, 0, 1, 0, 0},
{1, -0, 0, 0, 0, 1, 0, 0},
{0.980785, -0.195091, 0, 0, 0, 1, 0, 0},
{0.923879, -0.382684, 0, 0, 0, 1, 0, 0},
{0.831469, -0.555571, 0, 0, 0, 1, 0, 0},
{0.707106, -0.707107, 0, 0, 0, 1, 0, 0},
{0.55557, -0.83147, 0, 0, 0, 1, 0, 0},
{0.382683, -0.92388, 0, 0, 0, 1, 0, 0},
{0.195089, -0.980785, 0, 0, 0, 1, 0, 0},
{-1e-06, -1, 0, 0, 0, 1, 0, 0},
{-0.195091, -0.980785, 0, 0, 0, 1, 0, 0},
{-0.382684, -0.923879, 0, 0, 0, 1, 0, 0},
{-0.555571, -0.831469, 0, 0, 0, 1, 0, 0},
{-0.707108, -0.707106, 0, 0, 0, 1, 0, 0},
{-0.83147, -0.555569, 0, 0, 0, 1, 0, 0},
{-0.92388, -0.382682, 0, 0, 0, 1, 0, 0},
{-0.980786, -0.195089, 0, 0, 0, 1, 0, 0},
{-1, 0, 0, 0, 0, 1, 0, 0},
};
const std::vector<GLuint> PrimitiveShapeVertex::CircleLineIndices = {
0,
1,
2,
3,
4,
5,
6,
7,
8,
9,
10,
11,
12,
13,
14,
15,
16,
17,
18,
19,
20,
21,
22,
23,
24,
25,
26,
27,
28,
29,
30,
31,
32,
};
VertexSet PrimitiveShapeVertex::generateRingCircle(double outer_radius, double inner_radius, bool bothSide)
{
const int quality = 64;
VertexSet vertexSet;
vertexSet.vertices.emplace_back(outer_radius, 0, 0, 0, 0, 1);
vertexSet.vertices.emplace_back(inner_radius, 0, 0, 0, 0, 1);
for (int i = 1; i < quality+1; ++i) {
double t = -2.0*M_PI*i/(double)quality; // cw
double ox = outer_radius * cos(t);
double oy = outer_radius * sin(t);
double ix = inner_radius * cos(t);
double iy = inner_radius * sin(t);
// set vertex
vertexSet.vertices.emplace_back(ox, oy, 0, 0, 0, 1);
vertexSet.vertices.emplace_back(ix, iy, 0, 0, 0, 1);
// set index
int id0 = vertexSet.vertices.size()-4;
int id1 = vertexSet.vertices.size()-3;
int id2 = vertexSet.vertices.size()-2;
int id3 = vertexSet.vertices.size()-1;
// tri0 0, 1, 2
vertexSet.indices.push_back(id0);
vertexSet.indices.push_back(id1);
vertexSet.indices.push_back(id2);
// tri1 3, 2, 1
vertexSet.indices.push_back(id3);
vertexSet.indices.push_back(id2);
vertexSet.indices.push_back(id1);
}
if (bothSide) {
// set back side
VertexList vertices = vertexSet.vertices;
// reverse normal
for (auto& vt : vertexSet.vertices) {
vertices.emplace_back(vt.x, vt.y, vt.z, 0, 0, -1);
}
size_t offset = vertexSet.vertices.size();
IndexList indices = vertexSet.indices;
for (auto itr = vertexSet.indices.rbegin(); itr != vertexSet.indices.rend(); ++itr) {
indices.push_back(*itr + offset);
}
vertexSet.vertices.swap(vertices);
vertexSet.indices.swap(indices);
}
return vertexSet;
}
void PrimitiveShapeVertex::setVertexBothSide(VertexSet& vertexSet)
{
VertexList vertices = vertexSet.vertices;
// reverse normal
for (auto& vt : vertexSet.vertices) {
vertices.emplace_back(vt.x, vt.y, vt.z, 0, 0, -1);
}
size_t offset = vertexSet.vertices.size();
IndexList indices = vertexSet.indices;
for (auto itr = vertexSet.indices.rbegin(); itr != vertexSet.indices.rend(); ++itr) {
indices.push_back(*itr + offset);
}
vertexSet.vertices.swap(vertices);
vertexSet.indices.swap(indices);
}
} /* namespace ptgl */
| 32.337654 | 107 | 0.480192 | [
"vector"
] |
38b0722f6cc4a6c9d2462e614bf6b733b00b3fed | 8,907 | cpp | C++ | dev/Code/Sandbox/Plugins/CryDesigner/Util/EdgesSharpnessManager.cpp | jeikabu/lumberyard | 07228c605ce16cbf5aaa209a94a3cb9d6c1a4115 | [
"AML"
] | 1,738 | 2017-09-21T10:59:12.000Z | 2022-03-31T21:05:46.000Z | dev/Code/Sandbox/Plugins/CryDesigner/Util/EdgesSharpnessManager.cpp | jeikabu/lumberyard | 07228c605ce16cbf5aaa209a94a3cb9d6c1a4115 | [
"AML"
] | 427 | 2017-09-29T22:54:36.000Z | 2022-02-15T19:26:50.000Z | dev/Code/Sandbox/Plugins/CryDesigner/Util/EdgesSharpnessManager.cpp | jeikabu/lumberyard | 07228c605ce16cbf5aaa209a94a3cb9d6c1a4115 | [
"AML"
] | 671 | 2017-09-21T08:04:01.000Z | 2022-03-29T14:30:07.000Z | /*
* All or portions of this file Copyright (c) Amazon.com, Inc. or its affiliates or
* its licensors.
*
* For complete copyright and license terms please see the LICENSE at the root of this
* distribution (the "License"). All use of this software is governed by the License,
* or, if provided, by the license below or the license accompanying this file. Do not
* remove or modify any license notices. This file is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
*
*/
// Original file Copyright Crytek GMBH or its affiliates, used under license.
#include "StdAfx.h"
#include "EdgesSharpnessManager.h"
#include "Core/Model.h"
#include "Core/Polygon.h"
#include "ElementManager.h"
#include <AzCore/Math/Uuid.h>
void EdgeSharpnessManager::Serialize(XmlNodeRef& xmlNode, bool bLoading, bool bUndo, CD::Model* pModel)
{
if (bLoading)
{
int nEdgeSharpnessCount = xmlNode->getChildCount();
for (int i = 0; i < nEdgeSharpnessCount; ++i)
{
XmlNodeRef pSemiSharpCreaseNode = xmlNode->getChild(i);
CD::SEdgeSharpness semiSharpCrease;
const char* name = NULL;
pSemiSharpCreaseNode->getAttr("name", &name);
semiSharpCrease.name = name;
pSemiSharpCreaseNode->getAttr("sharpness", semiSharpCrease.sharpness);
pSemiSharpCreaseNode->getAttr("guid", semiSharpCrease.guid);
int nEdgeCount = pSemiSharpCreaseNode->getChildCount();
for (int k = 0; k < nEdgeCount; ++k)
{
XmlNodeRef pEdgeNode = pSemiSharpCreaseNode->getChild(k);
BrushEdge3D e;
pEdgeNode->getAttr("v0", e.m_v[0]);
pEdgeNode->getAttr("v1", e.m_v[1]);
semiSharpCrease.edges.push_back(e);
}
m_EdgeSharpnessList.push_back(semiSharpCrease);
}
}
else
{
std::vector<CD::SEdgeSharpness>::iterator ii = m_EdgeSharpnessList.begin();
for (; ii != m_EdgeSharpnessList.end(); ++ii)
{
const CD::SEdgeSharpness& semiSharpCrease = *ii;
if (semiSharpCrease.edges.empty())
{
continue;
}
XmlNodeRef pSemiSharpCreaseNode(xmlNode->newChild("SemiSharpCrease"));
pSemiSharpCreaseNode->setAttr("name", semiSharpCrease.name);
pSemiSharpCreaseNode->setAttr("sharpness", semiSharpCrease.sharpness);
pSemiSharpCreaseNode->setAttr("guid", semiSharpCrease.guid);
for (int i = 0, iEdgeCount(semiSharpCrease.edges.size()); i < iEdgeCount; ++i)
{
XmlNodeRef pEdgeNode = pSemiSharpCreaseNode->newChild("edge");
pEdgeNode->setAttr("v0", semiSharpCrease.edges[i].m_v[0]);
pEdgeNode->setAttr("v1", semiSharpCrease.edges[i].m_v[1]);
}
}
}
}
void EdgeSharpnessManager::CopyFromModel(CD::Model* pModel, const CD::Model* pSrcModel)
{
EdgeSharpnessManager* pDestEdgeSharpnessMgr = pModel->GetEdgeSharpnessMgr();
const EdgeSharpnessManager* pSrcEdgeSharpnessMgr = pSrcModel->GetEdgeSharpnessMgr();
pDestEdgeSharpnessMgr->Clear();
pDestEdgeSharpnessMgr->m_EdgeSharpnessList = pSrcEdgeSharpnessMgr->m_EdgeSharpnessList;
}
bool EdgeSharpnessManager::AddEdges(const char* name, ElementManager* pElements, float sharpness)
{
std::vector<BrushEdge3D> edges;
for (int i = 0, iCount(pElements->GetCount()); i < iCount; ++i)
{
const SElement& element = pElements->Get(i);
if (element.IsEdge())
{
edges.push_back(element.GetEdge());
}
if (element.IsFace() && element.m_pPolygon)
{
for (int k = 0, iEdgeCount(element.m_pPolygon->GetEdgeCount()); k < iEdgeCount; ++k)
{
edges.push_back(element.m_pPolygon->GetEdge(k));
}
}
}
return AddEdges(name, edges, sharpness);
}
bool EdgeSharpnessManager::AddEdges(const char* name, const std::vector<BrushEdge3D>& edges, float sharpness)
{
if (edges.empty() || HasName(name))
{
return false;
}
int iEdgeCount(edges.size());
for (int i = 0, iEdgeCount(edges.size()); i < iEdgeCount; ++i)
{
DeleteEdge(GetEdgeInfo(edges[i]));
}
CD::SEdgeSharpness edgeSharpness;
edgeSharpness.name = name;
edgeSharpness.edges = edges;
edgeSharpness.sharpness = sharpness;
edgeSharpness.guid = AZ::Uuid::CreateRandom();
m_EdgeSharpnessList.push_back(edgeSharpness);
return true;
}
void EdgeSharpnessManager::RemoveEdgeSharpness(const char* name)
{
std::vector<CD::SEdgeSharpness>::iterator ii = m_EdgeSharpnessList.begin();
for (; ii != m_EdgeSharpnessList.end(); ++ii)
{
if (!azstricmp(name, ii->name.c_str()))
{
m_EdgeSharpnessList.erase(ii);
break;
}
}
}
void EdgeSharpnessManager::RemoveEdgeSharpness(const BrushEdge3D& edge)
{
BrushEdge3D invEdge = edge.GetInverted();
std::vector<CD::SEdgeSharpness>::iterator ii = m_EdgeSharpnessList.begin();
for (; ii != m_EdgeSharpnessList.end(); )
{
for (int i = 0, iEdgeCount(ii->edges.size()); i < iEdgeCount; ++i)
{
if (ii->edges[i].IsEquivalent(edge) || ii->edges[i].IsEquivalent(invEdge))
{
ii->edges.erase(ii->edges.begin() + i);
break;
}
}
if (ii->edges.empty())
{
ii = m_EdgeSharpnessList.erase(ii);
}
else
{
++ii;
}
}
}
void EdgeSharpnessManager::SetSharpness(const char* name, float sharpness)
{
CD::SEdgeSharpness* pEdgeSharpness = FindEdgeSharpness(name);
if (pEdgeSharpness == NULL)
{
return;
}
pEdgeSharpness->sharpness = sharpness;
}
void EdgeSharpnessManager::Rename(const char* oldName, const char* newName)
{
CD::SEdgeSharpness* pEdgeSharpness = FindEdgeSharpness(oldName);
if (pEdgeSharpness == NULL)
{
return;
}
pEdgeSharpness->name = newName;
}
CD::SEdgeSharpness* EdgeSharpnessManager::FindEdgeSharpness(const char* name)
{
if (name)
{
for (int i = 0, iCount(m_EdgeSharpnessList.size()); i < iCount; ++i)
{
if (m_EdgeSharpnessList[i].name == name)
{
return &m_EdgeSharpnessList[i];
}
}
}
return NULL;
}
float EdgeSharpnessManager::FindSharpness(const BrushEdge3D& edge) const
{
BrushEdge3D invEdge = edge.GetInverted();
for (int i = 0, iCount(m_EdgeSharpnessList.size()); i < iCount; ++i)
{
const std::vector<BrushEdge3D>& edges = m_EdgeSharpnessList[i].edges;
for (int k = 0, iEdgeCount(edges.size()); k < iEdgeCount; ++k)
{
if (edges[k].IsEquivalent(edge) || edges[k].IsEquivalent(invEdge))
{
return m_EdgeSharpnessList[i].sharpness;
}
}
}
return 0;
}
bool EdgeSharpnessManager::HasName(const char* name) const
{
for (int i = 0, iCount(m_EdgeSharpnessList.size()); i < iCount; ++i)
{
if (!azstricmp(m_EdgeSharpnessList[i].name.c_str(), name))
{
return true;
}
}
return false;
}
EdgeSharpnessManager::SSharpEdgeInfo EdgeSharpnessManager::GetEdgeInfo(const BrushEdge3D& edge)
{
SSharpEdgeInfo sei;
BrushEdge3D invertedEdge = edge.GetInverted();
for (int i = 0, iCount(m_EdgeSharpnessList.size()); i < iCount; ++i)
{
CD::SEdgeSharpness& edgeSharpness = m_EdgeSharpnessList[i];
for (int k = 0, iEdgeCount(edgeSharpness.edges.size()); k < iEdgeCount; ++k)
{
if (edgeSharpness.edges[k].IsEquivalent(edge) || edgeSharpness.edges[k].IsEquivalent(invertedEdge))
{
sei.sharpnessindex = i;
sei.edgeindex = k;
break;
}
}
if (sei.edgeindex != -1)
{
break;
}
}
return sei;
}
void EdgeSharpnessManager::DeleteEdge(const SSharpEdgeInfo& edgeInfo)
{
if (edgeInfo.sharpnessindex == -1 || edgeInfo.sharpnessindex >= m_EdgeSharpnessList.size())
{
return;
}
CD::SEdgeSharpness& sharpness = m_EdgeSharpnessList[edgeInfo.sharpnessindex];
if (edgeInfo.edgeindex >= sharpness.edges.size())
{
return;
}
sharpness.edges.erase(sharpness.edges.begin() + edgeInfo.edgeindex);
}
string EdgeSharpnessManager::GenerateValidName(const char* baseName) const
{
string validName(baseName);
char numStr[10] = {0, };
int i = 0;
while (i < 1000000)
{
if (!HasName(validName))
{
break;
}
validName = baseName;
sprintf(numStr, "%d", ++i);
validName += numStr;
}
return validName;
} | 30.608247 | 111 | 0.609521 | [
"vector",
"model"
] |
38b5310a2c3f6f9c359469fe52b1be89cb49c4d1 | 1,753 | hpp | C++ | VS_GETServer/AsynchronusGetServer/server.hpp | jjgrayg/Boost-ASIO-Asynchronous-GET-Server | 91922224ee225592e512f86f7fcb5a709c99d2fa | [
"BSL-1.0"
] | 1 | 2022-03-18T22:23:08.000Z | 2022-03-18T22:23:08.000Z | VS_GETServer/AsynchronusGetServer/server.hpp | jjgrayg/Boost-ASIO-Asynchronous-GET-Server | 91922224ee225592e512f86f7fcb5a709c99d2fa | [
"BSL-1.0"
] | null | null | null | VS_GETServer/AsynchronusGetServer/server.hpp | jjgrayg/Boost-ASIO-Asynchronous-GET-Server | 91922224ee225592e512f86f7fcb5a709c99d2fa | [
"BSL-1.0"
] | null | null | null | /*
A basic asynchronous server that responds to browser get requests.
Capable of sending a limited number of binary files and all text
files with a properly formatted HTTP response.
Author: Jarod Graygo
Special thanks to GitHub user beached for his barebones ASIO server
His base code may be found here: https://gist.github.com/beached/d2383f9b14dafcc0f585
*/
#ifndef SERVER_HPP
#define SERVER_HPP
#include <cstdint>
#include <iostream>
#include <list>
#include <memory>
#include <vector>
#include <fstream>
#include <algorithm>
#include "connection.hpp"
using std::vector;
class Server {
private:
std::ofstream log_writer;
boost::asio::io_service m_ioservice;
boost::asio::ip::tcp::acceptor m_acceptor;
std::list<Connection> m_connections;
using con_handle_t = std::list<Connection>::iterator;
public:
Server() : m_ioservice(), m_acceptor(m_ioservice), m_connections(), log_writer() { }
void write_to_log(string);
void close_log_writer();
void close_connection(con_handle_t);
void handle_read(con_handle_t, boost::system::error_code const&, size_t);
void do_async_read(con_handle_t);
void handle_response(con_handle_t, std::shared_ptr<string>, bool, boost::system::error_code const&);
void write_response(con_handle_t);
void handle_acknowledge(con_handle_t, std::shared_ptr<string>, boost::system::error_code const&);
void handle_accept(con_handle_t&, boost::system::error_code const&);
void start_accept();
void listen(uint16_t);
void run();
void stop();
string parse_get(const char[]);
std::tuple<string, bool, vector<unsigned char>> formulate_response(string);
};
vector<string> split_string(string, char);
#endif // SERVER_HPP | 29.711864 | 104 | 0.731318 | [
"vector"
] |
38b5666e1a6ab3ad6b90c87cb90833183d43917e | 6,177 | cpp | C++ | source/Player_DeepQ.cpp | codabeans/StarCraft-Micro-AI | 1988f134ea59beff1c37386759ce54fbbc1357f6 | [
"MIT"
] | 1 | 2019-12-25T11:34:25.000Z | 2019-12-25T11:34:25.000Z | source/Player_DeepQ.cpp | codabeans/StarCraft-Micro-AI | 1988f134ea59beff1c37386759ce54fbbc1357f6 | [
"MIT"
] | null | null | null | source/Player_DeepQ.cpp | codabeans/StarCraft-Micro-AI | 1988f134ea59beff1c37386759ce54fbbc1357f6 | [
"MIT"
] | null | null | null | #include "../include/Player_DeepQ.h"
using namespace SparCraft;
using namespace caffe;
using namespace std;
//constructor, sets important private member variables
//as well as constructs our caffe network, if it can
Player_DeepQ::Player_DeepQ(const IDType & playerID, const DeepQParameters & params)
{
_playerID = playerID;
_params = params;
_frameNumber = 0;
_logData = true;
_notBeginning = false;
_modelFile = "../models/model.prototxt";
_weightFile = "../models/weights.prototxt";
initializeNet();
//Per the parameter, set the hardware usage in caffe
if(_params.getGPU())
{
Caffe::set_mode(Caffe::GPU);
}
else
{
Caffe::set_mode(Caffe::CPU);
}
}
//check if the inputted string exists as a file
bool fileExists(string file)
{
std::ifstream ifile(file.c_str());
return (bool)ifile;
}
//To be ran at the initialization of the Player
//Loads the CNN as well as the weights (if there are any to load)
void Player_DeepQ::initializeNet()
{
//Load the architecture from _modelFile, and init for TRAIN
//If the file isn't found, give a fatalerror as the player would
//be unable to play :'( feelsbadman.jpg
//caffe will give its own error(s) if something is wrong with the files
if(fileExists(_modelFile))
_net.reset(new Net<float>(_modelFile, TRAIN));
else
System::FatalError("Problem Opening Model file");
//Copy weights from a previously trained net of the same architecture
//Don't have said file yet, soon!
if(fileExists(_weightFile))
_net->CopyTrainedLayersFrom(_weightFile);
}
//convert the ENUM ActionTypes to int values so a NN can hopefully make sense of them
int moveInt(const IDType moveType)
{
if (moveType == ActionTypes::ATTACK)
{
return 10;
}
else if (moveType == ActionTypes::MOVE)
{
return 20;
}
else if (moveType == ActionTypes::RELOAD)
{
return 30;
}
else if (moveType == ActionTypes::PASS)
{
return 40;
}
else if (moveType == ActionTypes::HEAL)
{
return 50;
}
else
return 0;
}
//Populate _img with the game's frame, as well as load actions in _moves
void Player_DeepQ::prepareModelInput(const vector<Action> & moveVec)
{
//clear _moves from the previous turn
_moves.clear();
//Then load the contents in moveVec into _moves (a vector<vector<int> >)
// ID, Action, Move X, Move Y, Move index (attackee, healee, etc.)
for(int i = 0; i < moveVec.size(); i++)
{
Action move = moveVec[i];
vector<float> unitMove{float(move.unit()), float(moveInt(move.type())), float(move.pos().x()), float(move.pos().y()), float(move.index())};
_moves.push_back(unitMove);
}
vector<float> emptyMove{0,0,0,0,0};
for(int i = 0; i < 10-moveVec.size(); i++)
{
_moves.push_back(emptyMove);
}
}
//Load a set of actions into the network
void Player_DeepQ::loadActions()
{
// caffe stores the data as a long array of floats stored in a pointer
Blob<float>* action_layer = _net->input_blobs()[1];
float* data = action_layer->mutable_cpu_data();
for(int i = 0; i < 10; i++)
{
for(int j = 0; j < 5; j++)
{
data[i*5+j] = _moves[i][j];
}
}
}
void Player_DeepQ::forward()
{
loadActions();
_net->Forward();
}
void Player_DeepQ::getNetOutput()
{
boost::shared_ptr<Blob<float> > output_layer = _net->blob_by_name("reward");
float output;
for(int i = 0; i < 1; i++)
{
output = output_layer->cpu_data()[i];
}
_predictedReward = output;
}
void Player_DeepQ::getMoves(GameState & state, const MoveArray & moves, vector<Action> & moveVec)
{
if(_frameNumber == 0)
{
backward(state);
if(rand() % 10 + 1 < 7)
selectRandomMoves(moves, moveVec);
else
selectBestMoves(moves, moveVec);
prepareModelInput(moveVec);
forward();
}
else
{
_frameNumber ++;
if(_frameNumber > 4){
_frameNumber == 0;
}
}
}
//Select random moves to be used as a learning experience for the network
void Player_DeepQ::selectRandomMoves(const MoveArray & moves, std::vector<Action> & moveVec)
{
moveVec.clear();
for (IDType u(0); u<moves.numUnits(); ++u)
{
moveVec.push_back(moves.getMove(u, rand() % (moves.numMoves(u))));
}
}
//Feed all (or at least a lot) of move sets into the network, and keep the one
//that the network thinks is best
void Player_DeepQ::selectBestMoves(const MoveArray & moves, std::vector<Action> & moveVec)
{
//TODO: THIS
//dummy code for now
moveVec.clear();
for (IDType u(0); u<moves.numUnits(); ++u)
{
moveVec.push_back(moves.getMove(u, rand() % (moves.numMoves(u))));
}
}
void Player_DeepQ::getReward(const GameState state)
{
_actualReward = state.evalLTD2(_playerID);
}
void Player_DeepQ::setReward()
{
//caffe stores the data as a long array of floats stored in a pointer
Blob<float>* action_layer = _net->input_blobs()[2];
float* data = action_layer->mutable_cpu_data();
for(int i = 0; i < 10; i++)
{
for(int j = 0; j < 5; j++)
{
data[0] = _actualReward;
}
}
}
void Player_DeepQ::backward(const GameState state)
{
getReward(state);
if(_actualReward != 0)
{
_notBeginning = true;
}
if(_notBeginning)
{
getNetOutput();
//No need to do back prop if we're just gathering data
if(!_logData)
{
setReward();
//do the actual learning
_net->Backward();
_net->Update();
//Monitoring purposes, REMOVE FOR FINAL VERSION
cout << "Predicted: " << _predictedReward << " Actual: " << _actualReward << endl;
}
}
//logDataPoint();
}
string GenerateRandomString(const int length)
{
string randomString;
for(int i = 0; i < length; i++)
{
char randomChar = 'A' + (random() % 26);
randomString.push_back(randomChar);
}
return randomString;
}
| 25.953782 | 147 | 0.613728 | [
"vector",
"model"
] |
38b9446d088e03e0354d2bb57198e060dd5f34ea | 14,223 | cpp | C++ | src/main.cpp | cs498/mazegenerator | 9fb9b816088e7f312d8411689c9f182175a2a45c | [
"MIT"
] | null | null | null | src/main.cpp | cs498/mazegenerator | 9fb9b816088e7f312d8411689c9f182175a2a45c | [
"MIT"
] | null | null | null | src/main.cpp | cs498/mazegenerator | 9fb9b816088e7f312d8411689c9f182175a2a45c | [
"MIT"
] | null | null | null | #include "breadthfirstsearch.h"
#include "circularhexagonmaze.h"
#include "circularmaze.h"
#include "depthfirstsearch.h"
#include "hexagonalmaze.h"
#include "honeycombmaze.h"
#include "kruskal.h"
#include "looperasedrandomwalk.h"
#include "prim.h"
#include "rectangularmaze.h"
#include "usermaze.h"
#include <cstring>
#include <iostream>
#include <map>
#include <string>
#include <fstream>
#include <sstream>
#include <unordered_map>
#include <unordered_set>
#include <utility>
const std::unordered_set<std::string> COLORS({"white", "black", "dark-grey", "red",
"web-green", "web-blue", "dark-magenta",
"dark-cyan", "dark-orange", "dark-yellow",
"royalblue", "goldenrod", "dark-spring-green",
"purple", "steelblue", "dark-red",
"dark-chartreuse", "orchid", "aquamarine",
"brown", "yellow", "turquoise", "grey0",
"grey10", "grey20", "grey30", "grey40",
"grey50", "grey60", "grey70", "grey",
"grey80", "grey90", "grey100", "light-red",
"light-green", "light-blue", "light-magenta",
"light-cyan", "light-goldenrod", "light-pink",
"light-turquoise", "gold", "green",
"dark-green", "spring-green", "forest-green",
"sea-green", "blue", "dark-blue",
"midnight-blue", "navy", "medium-blue",
"skyblue", "cyan", "magenta", "dark-turquoise",
"dark-pink", "coral", "light-coral",
"orange-red", "salmon", "dark-salmon", "khaki",
"dark-khaki", "dark-goldenrod", "beige",
"olive", "orange", "violet", "dark-violet",
"plum", "dark-plum", "dark-olivegreen",
"orangered4", "brown4", "sienna4", "orchid4",
"mediumpurple3", "slateblue1", "yellow4",
"sienna1", "tan1", "sandybrown",
"light-salmon", "pink", "khaki1",
"lemonchiffon", "bisque", "honeydew",
"slategrey", "seagreen", "antiquewhite",
"chartreuse", "greenyellow", "gray",
"light-gray", "light-grey", "dark-gray",
"slategray", "gray0", "gray10", "gray20",
"gray30", "gray40", "gray50", "gray60",
"gray70", "gray80", "gray90", "gray100"});
const std::unordered_map<std::string, std::pair<std::string, std::string>> HOLIDAY_THEMES({{"valentines", std::make_pair("brown", "pink")},
{"easter", std::make_pair("pink", "skyblue")},
{"halloween", std::make_pair("orange", "black")},
{"thanksgiving", std::make_pair("goldenrod", "brown")},
{"christmas", std::make_pair("red", "green")}});
void usage(std::ostream &out) {
out << "Usage: mazegen [--help] [-m <maze type>] [-a <algorithm type>]"
<< std::endl;
out << " [-s <size> | -w <width> -h <height>]" << std::endl;
out << " [-t <output type>] [-o <output prefix>]" << std::endl;
out << " [-f <graph description file (for m=5)>]" << std::endl;
out << std::endl;
out << "Optional arguments" << std::endl;
out << " --help "
<< "Show this message and exit" << std::endl;
out << " -m "
<< "Maze type" << std::endl;
out << " "
<< "0: Rectangular (default)" << std::endl;
out << " "
<< "1: Hexagonal (triangular lattice)" << std::endl;
out << " "
<< "2: Honeycomb" << std::endl;
out << " "
<< "3: Circular" << std::endl;
out << " "
<< "4: Circular (triangular lattice)" << std::endl;
out << " "
<< "5: User defined graph" << std::endl;
out << " -a "
<< "Algorithm type" << std::endl;
out << " "
<< "0: Kruskal's algorithm (default)" << std::endl;
out << " "
<< "1: Depth-first search" << std::endl;
out << " "
<< "2: Breadth-first search" << std::endl;
out << " "
<< "3: Loop-erased random walk" << std::endl;
out << " "
<< "4: Prim's algorithm" << std::endl;
out << " -s "
<< "Size (non-rectangular mazes, default: 20)" << std::endl;
out << " -w,-h "
<< "Width and height (rectangular maze, default: 20)" << std::endl;
out << " -t "
<< "Output type" << std::endl;
out << " "
<< "0: svg output (default)" << std::endl;
out << " "
<< "1: png output using gnuplot (.plt) intermediate " << std::endl;
out << " -o "
<< "Prefix for .svg, .plt and .png outputs (default: maze)" << std::endl;
out << " -c "
<< "Color of the lines of the maze (defaut: black)" << std::endl;
out << " -b "
<< "Color of the background of the maze (defaut: white)" << std::endl;
out << " -l "
<< "Width of the lines of the maze (default: 3)" << std::endl;
out << " -i "
<< "Text file to style the maze: color of the lines (-c), background color (-b), the width of the lines (-l)" << std::endl;
out << " -d "
<< "Holiday theme stylization: valentines, easter, halloween, thanskgiving, christmas" << std::endl;
}
int main(int argc, char *argv[]) {
std::string outputprefix = "maze", infile = "";
std::string color = "black", backColor = "white";
bool theme = false; int strokeWidth = 3;
std::map<std::string, int> optionmap{{"-m", 0}, {"-a", 0}, {"-s", 20},
{"-w", 20}, {"-h", 20}, {"-o", 0},
{"-f", 0}, {"--help", 0}, {"-t", 0},
{"-c", 0}, {"-l", 3}, {"-b", 0},
{"-i", 0}, {"-d", 0}};
for (int i = 1; i < argc; i++) {
if (optionmap.find(argv[i]) == optionmap.end()) {
std::cerr << "Unknown argument " << argv[i] << "\n";
usage(std::cerr);
return 1;
}
if (strcmp("-o", argv[i]) == 0) {
if (i + 1 == argc) {
std::cerr << "Missing output prefix" << std::endl;
usage(std::cerr);
return 1;
}
outputprefix = argv[++i];
continue;
} else if (strcmp("-f", argv[i]) == 0) {
if (i + 1 == argc) {
std::cerr << "Missing maze input file" << std::endl;
usage(std::cerr);
return 1;
}
infile = argv[++i];
continue;
} else if (strcmp("--help", argv[i]) == 0) {
usage(std::cout);
return 0;
}
if (i + 1 == argc) {
std::cerr << "Missing option for argument " << argv[i] << std::endl;
usage(std::cerr);
return 1;
}
if (strcmp("-d", argv[i]) == 0) {
if (HOLIDAY_THEMES.find(argv[i + 1]) == HOLIDAY_THEMES.end()) {
std::cerr << "Unknown holiday theme " << argv[i + 1] << std::endl;
usage(std::cerr);
return 1;
}
theme = true;
color = HOLIDAY_THEMES.at(argv[++i]).first;
backColor = HOLIDAY_THEMES.at(argv[i]).second;
} else if (strcmp("-i", argv[i]) == 0) {
std::string fileName = argv[++i];
std::ifstream inputFile;
inputFile.open(fileName,std::ios::in);
if (inputFile.is_open()) {
std::string line;
std::vector<std::string> tokens;
while (getline(inputFile,line)) {
if (line.length() < 1) {
continue;
}
std::stringstream ss(line);
std::string token;
tokens.clear();
while (getline(ss, token, ' ')) {
std::cout << token << std::endl;
tokens.push_back(token);
}
if (tokens.size() == 3) {
color = tokens[0];
backColor = tokens[1];
strokeWidth= stoi(tokens[2]);
break;
}
}
inputFile.close();
}
} else if (strcmp("-c", argv[i]) == 0) {
if (COLORS.find(argv[i + 1]) == COLORS.end()) {
std::cerr << "Unknown color " << argv[i + 1] << std::endl;
usage(std::cerr);
return 1;
}
++i;
if (!theme)
color = argv[i];
} else if (strcmp("-b", argv[i]) == 0) {
if (COLORS.find(argv[i + 1]) == COLORS.end()) {
std::cerr << "Unknown background color " << argv[i + 1] << std::endl;
usage(std::cerr);
return 1;
}
++i;
if (!theme)
backColor = argv[i];
} else {
int x;
try {
x = std::stoi(argv[i + 1]);
} catch (...) {
std::cerr << "Invalid argument " << argv[i + 1] << " for option "
<< argv[i] << "\n";
usage(std::cerr);
return 0;
}
optionmap[argv[i++]] = x;
}
}
Maze *maze;
SpanningtreeAlgorithm *algorithm;
switch (optionmap["-m"]) {
case 0:
if (optionmap["-w"] < 1 or optionmap["-h"] < 1) {
std::cerr << "Invalide size " << optionmap["-w"] << "x"
<< optionmap["-h"] << " for rectangular maze\n";
usage(std::cerr);
return 1;
}
std::cout << "Rectangular maze of size " << optionmap["-w"] << "x"
<< optionmap["-h"] << "\n";
maze = new RectangularMaze(optionmap["-w"], optionmap["-h"]);
break;
case 1:
if (optionmap["-s"] < 1) {
std::cerr << "Invalide size " << optionmap["-s"]
<< " for hexagonal maze with triangular lattice\n";
usage(std::cerr);
return 1;
}
std::cout << "Hexagonal maze with triangular lattice of size "
<< optionmap["-s"] << "\n";
maze = new HexagonalMaze(optionmap["-s"]);
break;
case 2:
if (optionmap["-s"] < 1) {
std::cerr << "Invalide size " << optionmap["-s"]
<< " for honeycomb maze\n";
usage(std::cerr);
return 1;
}
std::cout << "Honeycomb maze of size " << optionmap["-s"] << "\n";
maze = new HoneyCombMaze(optionmap["-s"]);
break;
case 3:
if (optionmap["-s"] < 1) {
std::cerr << "Invalide size " << optionmap["-s"]
<< " for circular maze\n";
usage(std::cerr);
return 1;
}
std::cout << "Circular maze of size " << optionmap["-s"] << "\n";
maze = new CircularMaze(optionmap["-s"]);
break;
case 4:
if (optionmap["-s"] < 1) {
std::cerr << "Invalide size " << optionmap["-s"]
<< " for circular maze with triangular lattice\n";
usage(std::cerr);
return 1;
}
std::cout << "Circular maze with triangular lattice of size "
<< optionmap["-s"] << "\n";
maze = new CircularHexagonMaze(optionmap["-s"]);
break;
case 5:
if (infile == "") {
std::cerr
<< "Graph description file not provided for user-defined graph\n";
usage(std::cerr);
return 1;
}
std::cout << "User-defined graph\n";
maze = new UserMaze(infile);
break;
default:
std::cerr << "Unknown maze type " << optionmap["-m"];
usage(std::cerr);
return 1;
}
switch (optionmap["-a"]) {
case 0:
std::cout << "Maze generation using Kruskal's algorithm\n";
algorithm = new Kruskal;
break;
case 1:
std::cout << "Maze generation using Depth-first search\n";
algorithm = new DepthFirstSearch;
break;
case 2:
std::cout << "Maze generation using Breadth-first search\n";
algorithm = new BreadthFirstSearch;
break;
case 3:
std::cout << "Maze generation using Loop-erased random walk\n";
algorithm = new LoopErasedRandomWalk;
break;
case 4:
std::cout << "Maze generation using Prim's algorithm\n";
algorithm = new Prim;
break;
default:
std::cerr << "Unknown algorithm type " << optionmap["-a"];
usage(std::cerr);
return 1;
}
if (optionmap["-t"] < 0 or optionmap["-t"] > 1) {
std::cerr << "Unknown output type " << optionmap["-a"];
usage(std::cerr);
return 1;
}
Style::init({
color,
backColor,
strokeWidth
});
std::cout << "Initialising graph..." << std::endl;
maze->InitialiseGraph();
std::cout << "Generating maze..." << std::endl;
maze->GenerateMaze(algorithm);
if (optionmap["-t"] == 0) {
std::cout << "Rendering maze to '" << outputprefix << ".svg'..."
<< std::endl;
maze->PrintMazeSVG(outputprefix);
} else {
std::cout << "Exporting maze plotting parameters to '" << outputprefix
<< ".plt' ..." << std::endl;
maze->PrintMazeGnuplot(outputprefix);
std::cout << "Rendering maze to '" << outputprefix
<< ".png' using gnuplot..." << std::endl;
system(("gnuplot '" + outputprefix + ".plt'").c_str());
}
return 0;
}
| 37.827128 | 145 | 0.440976 | [
"vector"
] |
38c235fa9bb33d72abfadeb919e0c01f570bea2a | 1,872 | cpp | C++ | modules/aos/scene/PrismaticJoint.cpp | Omnirobotic/godot | d50b5d047bbf6c68fc458c1ad097321ca627185d | [
"CC-BY-3.0",
"Apache-2.0",
"MIT"
] | null | null | null | modules/aos/scene/PrismaticJoint.cpp | Omnirobotic/godot | d50b5d047bbf6c68fc458c1ad097321ca627185d | [
"CC-BY-3.0",
"Apache-2.0",
"MIT"
] | 3 | 2019-11-14T12:20:06.000Z | 2020-08-07T13:51:10.000Z | modules/aos/scene/PrismaticJoint.cpp | Omnirobotic/godot | d50b5d047bbf6c68fc458c1ad097321ca627185d | [
"CC-BY-3.0",
"Apache-2.0",
"MIT"
] | null | null | null | #include "PrismaticJoint.h"
namespace aos
{
PrismaticJoint::PrismaticJoint()
: KinematicJoint(0.0, 10.0, 0.0, true)
{
}
PrismaticJoint::~PrismaticJoint()
{
}
void PrismaticJoint::set_joint_value(real_t value)
{
if (value > _joint_max_limit || value < _joint_min_limit)
{
// Todo - Add notification that joint is out limit (visual notification)
}
_joint_value = value;
_joint_transform = _compute_joint_transform();
_update_global_transform();
}
real_t PrismaticJoint::get_joint_value() const
{
return _joint_value;
}
void PrismaticJoint::set_min_limit(real_t min)
{
_joint_min_limit = min;
}
void PrismaticJoint::set_max_limit(real_t max)
{
_joint_max_limit = max;
}
void PrismaticJoint::_notification(int p_what)
{
}
Transform PrismaticJoint::_compute_joint_transform() const
{
Transform t;
t.translate(0.0, 0.0, _joint_value);
return t;
}
void PrismaticJoint::_bind_methods() {
ClassDB::bind_method(D_METHOD("set_joint_value", "joint_value"), &PrismaticJoint::set_joint_value);
ClassDB::bind_method(D_METHOD("get_joint_value"), &PrismaticJoint::get_joint_value);
ClassDB::bind_method(D_METHOD("set_joint_min_limit", "min_limit"), &PrismaticJoint::set_min_limit);
ClassDB::bind_method(D_METHOD("get_joint_min_limit"), &PrismaticJoint::get_min_limit);
ClassDB::bind_method(D_METHOD("set_joint_max_limit", "max"), &PrismaticJoint::set_max_limit);
ClassDB::bind_method(D_METHOD("get_joint_max_limit"), &PrismaticJoint::get_max_limit);
ADD_PROPERTY(PropertyInfo(Variant::REAL, "joint value"), "set_joint_value", "get_joint_value");
ADD_PROPERTY(PropertyInfo(Variant::REAL, "joint max limit"), "set_joint_max_limit", "get_joint_max_limit");
ADD_PROPERTY(PropertyInfo(Variant::REAL, "joint min limit"), "set_joint_min_limit", "get_joint_min_limit");
}
} | 26.742857 | 111 | 0.737179 | [
"transform"
] |
38c36a4a8a811fac373885bddf5a655a6b25ad04 | 3,507 | cpp | C++ | laplace-2d/laplace/main.cpp | dglowienka/numerical_models | bfc7ba15737d4066a92c72d9789835e6799086fa | [
"MIT"
] | null | null | null | laplace-2d/laplace/main.cpp | dglowienka/numerical_models | bfc7ba15737d4066a92c72d9789835e6799086fa | [
"MIT"
] | null | null | null | laplace-2d/laplace/main.cpp | dglowienka/numerical_models | bfc7ba15737d4066a92c72d9789835e6799086fa | [
"MIT"
] | null | null | null | #include <iostream>
#include <fstream>
#include <vector>
#include "gaussian_elimination.h"
int main(void)
{
using namespace std;
int m, n;
double l, r, t, b;
vector<double> b_it;
vector<vector<double>> A_it;
vector<vector<double>> a;
ofstream laplace;
laplace.open("Laplace.txt");
printf("\tEnter boundary conditions\n");
printf("\tValue on left side: ");
l = 75;
printf("\tValue on right side: ");
r = 50;
printf("\tValue on top side: ");
t = 100;
printf("\tValue on bottom side: ");
b = 0;
printf("\tEnter number of steps in x and y direction: ");
m = 8;
printf("\tEnter number of steps in y direction: ");
n = 10;
// Init all vectors
b_it.resize(n*m);
A_it.resize(n*n, vector<double>(m*m));
a.resize(n+2, vector<double>(m+2));
//assigning boundary values begins
for (int i = 0; i <= m+1; i++)
{
a[i][0] = b;
a[i][n+1] = t;
}
//assigning boundary values ends
for (int i = 0; i <= n+1; i++)
{
a[0][i] = l;
a[m+1][i] = r;
}
// Find A matrix and b vector for Ax=b linear algebric
int k_it = 0;
for (int j = 1; j <= n; j++)
{
for (int i = 1; i <= m; i++)
{
A_it[k_it][k_it] = -4;
// Middle (no boundary around)
if (i > 1 && i < m && j>1 && j < n)
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it - 1][k_it] = 1; //i-1,j
A_it[k_it + 1][k_it] = 1; //i+1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = 0;
}
// Bottom
if (j == 1)
{
// Bottom-left
if (i == 1)
{
A_it[k_it + 1][k_it] = 1; //i+1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = -(b + l);
}
// Bottom-right
if (i == m)
{
A_it[k_it - 1][k_it] = 1; //i-1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = -(b + r);
}
// Bottom-middle
if ((i > 1) && (i < m))
{
A_it[k_it - 1][k_it] = 1; //i-1,j
A_it[k_it + 1][k_it] = 1; //i+1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = -b;
}
}
// Top
if (j == n)
{
// Top-left
if (i == 1)
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it + 1][k_it] = 1; //i+1,j
b_it[k_it] = -(t + l);
}
// Top-right
if (i == m)
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it - 1][k_it] = 1; //i-1,j
b_it[k_it] = -(t + r);
}
// Top-middle
if ((i > 1) && (i < m))
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it - 1][k_it] = 1; //i-1,j
A_it[k_it + 1][k_it] = 1; //i+1,j
b_it[k_it] = -t;
}
}
// Left
if (i == 1)
{
// Left-bottom
// Left-top
// Left-middle
if (j > 1 && j < m)
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it + 1][k_it] = 1; //i+1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = -l;
}
}
//Right
if (i == m)
{
// Right-top
// Right-bottom
// Right-middle
if (j > 1 && j < m)
{
A_it[k_it - n][k_it] = 1; //i,j-1
A_it[k_it - 1][k_it] = 1; //i-1,j
A_it[k_it + n][k_it] = 1; //i,j+1
b_it[k_it] = -r;
}
}
k_it++;
}
}
vector<double> tmp_result;
tmp_result = gaussian_elimination(A_it, b_it);
// Copy results of x to array with all the data
int count=0;
for (int j = 1; j <= n; j++)
{
for (int i = 1; i <= m; i++)
{
a[i][j] = tmp_result[count];
count++;
}
}
// Print the results
for (int i = 0; i < a.size(); i++)
{
for (int j = 0; j < a[i].size(); j++)
{
laplace << a[i][j] << "\n";
count++;
}
}
laplace.close();
} | 19.269231 | 58 | 0.461648 | [
"vector"
] |
38c85c22e32d2daa274126a76fa3d1890fdd87c5 | 8,659 | cpp | C++ | src/server/libaccess/aclpath.cpp | jvirkki/heliod | efdf2d105e342317bd092bab2d727713da546174 | [
"BSD-3-Clause"
] | 13 | 2015-10-09T05:59:20.000Z | 2021-11-12T10:38:51.000Z | src/server/libaccess/aclpath.cpp | JamesLinus/heliod | efdf2d105e342317bd092bab2d727713da546174 | [
"BSD-3-Clause"
] | null | null | null | src/server/libaccess/aclpath.cpp | JamesLinus/heliod | efdf2d105e342317bd092bab2d727713da546174 | [
"BSD-3-Clause"
] | 6 | 2016-05-23T10:53:29.000Z | 2019-12-13T17:57:32.000Z | /*
* DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS HEADER.
*
* Copyright 2008 Sun Microsystems, Inc. All rights reserved.
*
* THE BSD LICENSE
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions are met:
*
* Redistributions of source code must retain the above copyright notice, this
* list of conditions and the following disclaimer.
* Redistributions in binary form must reproduce the above copyright notice,
* this list of conditions and the following disclaimer in the documentation
* and/or other materials provided with the distribution.
*
* Neither the name of the nor the names of its contributors may be
* used to endorse or promote products derived from this software without
* specific prior written permission.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
* "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
* LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
* A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER
* OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
* EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
* OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
* WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
* OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
* ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*/
#include <netsite.h>
#include <base/nsassert.h>
#include <base/ereport.h>
#include <libaccess/acl.h> // generic ACL definitions
#include <libaccess/aclproto.h> // internal prototypes
#include <libaccess/aclglobal.h> // global data
#include "aclpriv.h" // internal data structure definitions
#include <libaccess/dbtlibaccess.h> // strings
#include "plhash.h"
/* ACL_AddAclName
* Adds the ACLs for just the terminal object specified in a pathname.
* INPUT
* path The filesystem pathname of the terminal object.
* acllistp The address of the list of ACLs found thus far.
* Could be NULL. If so, a new acllist will be allocated (if any
* acls are found). Otherwise the existing list will be added to.
* masterlist Usually the ACL list of the virtual server.
*/
void
ACL_AddAclName(char *path, ACLListHandle_t **acllistp, ACLListHandle_t *masterlist)
{
ACLHandle_t *acl;
NSErr_t *errp = 0;
#ifdef XP_WIN32
acl = ACL_ListFind(errp, masterlist, path, ACL_CASE_INSENSITIVE);
#else
acl = ACL_ListFind(errp, masterlist, path, ACL_CASE_SENSITIVE);
#endif
if (!acl)
return;
NS_ASSERT(ACL_AssertAcl(acl));
ereport(LOG_VERBOSE, "acl: matched an acl for [%s]", path);
if (!*acllistp)
*acllistp = ACL_ListNew(errp);
ACL_ListAppend(NULL, *acllistp, acl, 0);
NS_ASSERT(ACL_AssertAcllist(*acllistp));
return;
}
/* ACL_GetAcls
*/
static PRBool
ACL_GetAcls(char *path, ACLListHandle_t **acllistp, char *prefix, ACLListHandle_t *masterlist, PRBool flagExtensions, PRBool flagParents)
{
PRBool res = PR_TRUE;
char *slashp=path;
int slashidx;
// ppath needs to be ACL_PATH_MAX+maxppath+3
// maxppath is assumed to be 24
char ppath[ACL_PATH_MAX+24+3];
int prefixlen;
int ppathlen;
NS_ASSERT(path);
NS_ASSERT(prefix);
if ((!path) || (!ppath)) {
ereport(LOG_SECURITY, XP_GetAdminStr(DBT_aclcacheNullPath));
res = PR_FALSE;
return res;
}
strncpy(ppath, prefix, ACL_PATH_MAX);
int lenPath = strlen(path);
prefixlen = strlen(ppath);
/* Find the extension */
char *suffix = NULL;
int suffixlen = 0;
if (flagExtensions) {
/* The extension begins with the last '.' in the last path segment */
suffix = strrchr(path, '.');
if (suffix && !strchr(suffix, '/'))
suffixlen = strlen(suffix);
else
suffix = NULL;
}
/* Do we have enough room in ppath? */
if (lenPath+prefixlen+3+suffixlen >= sizeof(ppath)) {
ereport(LOG_SECURITY, XP_GetAdminStr(DBT_aclcachePath2Long));
res = PR_FALSE;
return res;
}
ACL_CritEnter();
/* Handle the extension */
if (suffix) {
/* Handle "*.jsp" */
ppath[prefixlen] = '*';
memcpy(&ppath[prefixlen + 1], suffix, suffixlen + 1);
ACL_AddAclName(ppath, acllistp, masterlist);
}
/* Handle the first "/". i.e. the root directory */
if (*path == '/') {
/* Handle "/" */
ppath[prefixlen]='/';
ppath[prefixlen+1]='\0';
if (flagParents)
ACL_AddAclName(ppath, acllistp, masterlist);
/* Handle "/*" */
ppath[prefixlen + 1] = '*';
ppath[prefixlen + 2] = 0;
ACL_AddAclName(ppath, acllistp, masterlist);
if (suffix) {
/* Handle "/*.jsp" */
memcpy(&ppath[prefixlen + 2], suffix, suffixlen + 1);
ACL_AddAclName(ppath, acllistp, masterlist);
}
slashp = path;
}
do {
slashp = strchr(++slashp, '/');
if (slashp) {
slashidx = slashp - path;
ppathlen = prefixlen + slashidx;
/* Handle "/a/b" */
memcpy(&ppath[prefixlen], path, slashidx);
ppath[ppathlen] = '\0';
if (flagParents || !slashp[1])
ACL_AddAclName(ppath, acllistp, masterlist);
/* Handle "/a/b/" */
ppath[ppathlen] = '/';
ppath[ppathlen + 1] = 0;
if (flagParents)
ACL_AddAclName(ppath, acllistp, masterlist);
/* Handle "/a/b/*" */
ppath[ppathlen + 1] = '*';
ppath[ppathlen + 2] = 0;
ACL_AddAclName(ppath, acllistp, masterlist);
if (suffix) {
/* Handle "/a/b/*.jsp" */
memcpy(&ppath[ppathlen + 2], suffix, suffixlen + 1);
ACL_AddAclName(ppath, acllistp, masterlist);
}
continue;
}
/* Handle "/a/b/c.jsp" */
memcpy(&ppath[prefixlen], path, lenPath + 1);
ACL_AddAclName(ppath, acllistp, masterlist);
/* Handle "/a/b/c.jsp/" */
ppathlen = prefixlen + lenPath;
ppath[ppathlen] = '/';
ppath[ppathlen + 1] = 0;
ACL_AddAclName(ppath, acllistp, masterlist);
/* Handle "/a/b/c.jsp/*" */
ppath[ppathlen + 1] = '*';
ppath[ppathlen + 2] = 0;
ACL_AddAclName(ppath, acllistp, masterlist);
break;
} while (slashp);
ACL_CritExit();
return res;
}
/* ACL_GetPathAcls
* Adds the ACLs for all directories plus the terminal object along a given
* filesystem pathname. For each pathname component, look for the name, the
* name + "/", and the name + "/*". The last one is because the resource
* picker likes to postpend "/*" for directories.
* INPUT
* path The filesystem pathname of the terminal object.
* acllistp The address of the list of ACLs found thus far.
* Could be NULL. If so, a new acllist will be allocated (if any
* acls are found). Otherwise the existing list will be added to.
* prefix A string to be prepended to the path component when looking
* for a matching ACL tag.
* masterlist Usually the ACL list of the virtual server.
*
* XXX this stuff needs to be made MUCH more efficient. I think it's one of the main reasons why
* uncached ACLs are horribly slow. It will call ACL_AddAclName->ACL_ListFind a mindboggling
* number of times, like 2 + (n * 3) + 3, where n is the number of "/"'s in "path".
* A possible way to optimize this would be to build a sparse tree that mirrors the file system
* directory structure, with ACLs that apply to a path associated to the corresponding node.
* ACL_GetPathAcls could walk the tree according to "path" and pick up any ACLs that are on the way.
* The necessary data structures could maybe be piggybacked onto the ACLList.
* The tree would need to be constructed for every VS acllist, though.
* There are various optimizations:
* - If no path or uri ACLs are present, do not construct the tree.
*
* With the introduction of extension mapping for Servlet spec compliance,
* the situation has gotten even worse.
*
* ACL_GetPathAcls is currently used with the "uri=" and "path=" prefixes.
*/
PRBool
ACL_GetPathAcls(char *path, ACLListHandle_t **acllistp, char *prefix, ACLListHandle_t *masterlist)
{
return ACL_GetAcls(path, acllistp, prefix, masterlist, PR_FALSE, PR_TRUE);
}
| 34.7751 | 137 | 0.649382 | [
"object"
] |
38d5cc23f82b782e2bcb3c5a3bef8425a956a1c2 | 5,211 | cpp | C++ | src/rws_subscription.cpp | herrvonregen/abb_librws | a34f824b76b7a63b41f53054f1d0588535aa6b39 | [
"BSD-3-Clause"
] | null | null | null | src/rws_subscription.cpp | herrvonregen/abb_librws | a34f824b76b7a63b41f53054f1d0588535aa6b39 | [
"BSD-3-Clause"
] | 5 | 2021-11-25T09:24:05.000Z | 2022-02-21T13:41:14.000Z | src/rws_subscription.cpp | NoMagicAi/abb_librws | bbd22f45ae43d087f64411d3114658445dd73407 | [
"BSD-3-Clause"
] | 2 | 2021-03-20T09:30:53.000Z | 2022-01-02T13:13:30.000Z | #include <abb_librws/rws_subscription.h>
#include <abb_librws/rws_error.h>
#include <abb_librws/parsing.h>
#include <Poco/Net/HTTPRequest.h>
#include <boost/exception/diagnostic_information.hpp>
#include <iostream>
namespace abb :: rws
{
using namespace Poco::Net;
SubscriptionGroup::SubscriptionGroup(SubscriptionManager& subscription_manager, SubscriptionResources const& resources)
: subscription_manager_ {subscription_manager}
, subscription_group_id_ {subscription_manager.openSubscription(getURI(subscription_manager, resources))}
{
}
SubscriptionGroup::SubscriptionGroup(SubscriptionGroup&& rhs)
: subscription_manager_ {rhs.subscription_manager_}
, subscription_group_id_ {rhs.subscription_group_id_}
{
// Clear subscription_group_id_ of the SubscriptionGroup that has been moved from,
// s.t. its destructor does not close the subscription.
rhs.subscription_group_id_.clear();
}
SubscriptionGroup::~SubscriptionGroup()
{
close();
}
void SubscriptionGroup::close()
{
if (!subscription_group_id_.empty())
{
subscription_manager_.closeSubscription(subscription_group_id_);
subscription_group_id_.clear();
}
}
void SubscriptionGroup::detach() noexcept
{
subscription_group_id_.clear();
}
SubscriptionReceiver SubscriptionGroup::receive() const
{
return SubscriptionReceiver {subscription_manager_, subscription_group_id_};
}
std::vector<std::pair<std::string, SubscriptionPriority>> SubscriptionGroup::getURI(
SubscriptionManager& subscription_manager, SubscriptionResources const& resources)
{
std::vector<std::pair<std::string, SubscriptionPriority>> uri;
uri.reserve(resources.size());
for (auto&& r : resources)
uri.emplace_back(r.getURI(subscription_manager), r.getPriority());
return uri;
}
const std::chrono::microseconds SubscriptionReceiver::DEFAULT_SUBSCRIPTION_TIMEOUT {40000000000};
SubscriptionReceiver::SubscriptionReceiver(SubscriptionManager& subscription_manager, std::string const& subscription_group_id)
: subscription_manager_ {subscription_manager}
, webSocket_ {subscription_manager_.receiveSubscription(subscription_group_id)}
{
}
SubscriptionReceiver::~SubscriptionReceiver()
{
}
bool SubscriptionReceiver::waitForEvent(SubscriptionCallback& callback, std::chrono::microseconds timeout)
{
WebSocketFrame frame;
if (webSocketReceiveFrame(frame, timeout))
{
Poco::AutoPtr<Poco::XML::Document> doc = parser_.parseString(frame.frame_content);
subscription_manager_.processEvent(doc, callback);
return true;
}
return false;
}
bool SubscriptionReceiver::webSocketReceiveFrame(WebSocketFrame& frame, std::chrono::microseconds timeout)
{
auto now = std::chrono::steady_clock::now();
auto deadline = std::chrono::steady_clock::now() + timeout;
// If the connection is still active...
int flags = 0;
std::string content;
int number_of_bytes_received = 0;
// Wait for (non-ping) WebSocket frames.
do
{
now = std::chrono::steady_clock::now();
if (now >= deadline)
BOOST_THROW_EXCEPTION(TimeoutError {"WebSocket frame receive timeout"});
webSocket_.setReceiveTimeout(std::chrono::duration_cast<std::chrono::microseconds>(deadline - now).count());
flags = 0;
try
{
number_of_bytes_received = webSocket_.receiveFrame(websocket_buffer_, sizeof(websocket_buffer_), flags);
}
catch (Poco::TimeoutException const&)
{
BOOST_THROW_EXCEPTION(
TimeoutError {"WebSocket frame receive timeout"}
<< boost::errinfo_nested_exception(boost::current_exception())
);
}
content = std::string(websocket_buffer_, number_of_bytes_received);
// Check for ping frame.
if ((flags & WebSocket::FRAME_OP_BITMASK) == WebSocket::FRAME_OP_PING)
{
// Reply with a pong frame.
webSocket_.sendFrame(websocket_buffer_,
number_of_bytes_received,
WebSocket::FRAME_FLAG_FIN | WebSocket::FRAME_OP_PONG);
}
} while ((flags & WebSocket::FRAME_OP_BITMASK) == WebSocket::FRAME_OP_PING);
// Check for closing frame.
if ((flags & WebSocket::FRAME_OP_BITMASK) == WebSocket::FRAME_OP_CLOSE)
{
// Do not pass content of a closing frame to end user,
// according to "The WebSocket Protocol" RFC6455.
frame.frame_content.clear();
frame.flags = flags;
return false;
}
frame.flags = flags;
frame.frame_content = content;
return number_of_bytes_received != 0;
}
void SubscriptionReceiver::shutdown()
{
// Shut down the socket. This should make webSocketReceiveFrame() return as soon as possible.
webSocket_.shutdown();
}
void SubscriptionCallback::processEvent(IOSignalStateEvent const& event)
{
}
void SubscriptionCallback::processEvent(RAPIDExecutionStateEvent const& event)
{
}
void SubscriptionCallback::processEvent(ControllerStateEvent const& event)
{
}
void SubscriptionCallback::processEvent(OperationModeEvent const& event)
{
}
} | 27.282723 | 129 | 0.709269 | [
"vector"
] |
38e0ab150ecf07b71754c109becf1e46273a4719 | 920 | cpp | C++ | week2/leetcode1074.cpp | AndyRao/GeekTime_Algorithm | 6a8273d577bf8306dc3b44c2693cc2b0a69e8ad6 | [
"Apache-2.0"
] | null | null | null | week2/leetcode1074.cpp | AndyRao/GeekTime_Algorithm | 6a8273d577bf8306dc3b44c2693cc2b0a69e8ad6 | [
"Apache-2.0"
] | null | null | null | week2/leetcode1074.cpp | AndyRao/GeekTime_Algorithm | 6a8273d577bf8306dc3b44c2693cc2b0a69e8ad6 | [
"Apache-2.0"
] | null | null | null | class Solution {
public:
int numSubmatrixSumTarget(vector<vector<int>>& matrix, int target) {
int count = 0;
int m = matrix.size();
int n = matrix[0].size();
for(int i = 0; i < m; i++) {
vector<int> sum(n);
for(int j = i; j < m; j++) {
for(int k = 0; k < n; k++) {
sum[k] += matrix[j][k];
}
count += subarraySum(sum, target);
}
}
return count;
}
private:
int subarraySum(vector<int>& nums, int k) {
int len = nums.size();
unordered_map<int, int> counts;
int pre = 0;
int ans = 0;
//不要忘了下面这一行
counts[0] = 1;
for(int i = 0; i < len; i++) {
pre += nums[i];
int temp = pre - k;
ans += counts[temp];
counts[pre]++;
}
return ans;
}
};
| 24.864865 | 72 | 0.408696 | [
"vector"
] |
38e3fe131b480c2553184b7fe8ea98698306cdc3 | 466 | cpp | C++ | move/general_move.cpp | Alaya-in-Matrix/Chinese-chess | f8e9963251186e696289a8060a7ead70eb0efe47 | [
"WTFPL"
] | 2 | 2019-11-08T10:01:59.000Z | 2020-05-21T12:41:10.000Z | move/general_move.cpp | Alaya-in-Matrix/Chinese-chess | f8e9963251186e696289a8060a7ead70eb0efe47 | [
"WTFPL"
] | null | null | null | move/general_move.cpp | Alaya-in-Matrix/Chinese-chess | f8e9963251186e696289a8060a7ead70eb0efe47 | [
"WTFPL"
] | null | null | null | #include<iostream>
#include<vector>
#include"../global.h"
using namespace std;
/****************************声明*********************************/
void General_move(short pos,short Side_tag,vector<mov>& Move_array)
{
void Save_move(short&,short&,vector<mov>&);
short i=0;
for(i=0;i<4;i++)
{
short next=pos+General_direction[i];
if(General_legal[next])//如果该位置是合法的
{
if(!(board[next] & Side_tag))
{
Save_move(pos,next,Move_array);
}
}
}
}
| 17.923077 | 67 | 0.572961 | [
"vector"
] |
38f1802dbdc720acede6fb611e42339b70a2ea29 | 567 | cpp | C++ | Dojo/C++ Programming Practices and Principles - Stroustrup/ch4/ex13sieveoferatosthenes.cpp | miguelraz/PathToPerformance | 4f098e55023007e62c338d31a7ed2a46a3c99752 | [
"MIT"
] | 5 | 2017-05-04T22:25:06.000Z | 2022-02-15T13:44:50.000Z | Dojo/C++ Programming Practices and Principles - Stroustrup/ch4/ex13sieveoferatosthenes.cpp | miguelraz/PathToPerformance | 4f098e55023007e62c338d31a7ed2a46a3c99752 | [
"MIT"
] | null | null | null | Dojo/C++ Programming Practices and Principles - Stroustrup/ch4/ex13sieveoferatosthenes.cpp | miguelraz/PathToPerformance | 4f098e55023007e62c338d31a7ed2a46a3c99752 | [
"MIT"
] | null | null | null | //Exercise13: Sieve of Eratosthenes
int main()
{
cout << "Gimme the x in 1:x " << endl;
int max;
cin >> max;
vector<int> numbers(max,0);
vector<int> primes;
for (int i = 0; i < max; ++i) numbers[i] = i;
for (int i = 2; i < max; ++i) {
if (numbers[i] != 0 && i != 0) {
primes.push_back(i);
cout << i << " was just added as a prime " << endl;
for (int j = 2; j*i < max; ++i) {
primes[i*j] = 0;
cout << "The multiples of " << i << " have been set to 0. " << endl;
}
}
if (numbers[i] == 0) continue;
}
| 21 | 74 | 0.486772 | [
"vector"
] |
38f3c1be91cb964be56db7bb77412de087413a2f | 8,967 | cpp | C++ | src/v2i-hub/PreemptionPlugin/src/include/PreemptionPluginWorker.cpp | networkmodeling/V2X-Hub | d363f49a4c9af76823a23033b9f7983f2f6ae095 | [
"Apache-2.0"
] | null | null | null | src/v2i-hub/PreemptionPlugin/src/include/PreemptionPluginWorker.cpp | networkmodeling/V2X-Hub | d363f49a4c9af76823a23033b9f7983f2f6ae095 | [
"Apache-2.0"
] | null | null | null | src/v2i-hub/PreemptionPlugin/src/include/PreemptionPluginWorker.cpp | networkmodeling/V2X-Hub | d363f49a4c9af76823a23033b9f7983f2f6ae095 | [
"Apache-2.0"
] | null | null | null | //==========================================================================
// Name : PreemptionPlugin.cpp
// Author : FHWA Saxton Transportation Operations Laboratory
// Version :
// Copyright : Copyright (c) 2019 FHWA Saxton Transportation Operations Laboratory. All rights reserved.
// Description : Preemption Plugin
//==========================================================================
#include "PreemptionPluginWorker.hpp"
using namespace std;
namespace PreemptionPlugin {
void PreemptionPluginWorker::ProcessMapMessageFile(std::string path){
if(path != ""){
try {
boost::property_tree::read_json(path, geofence_data);
BOOST_FOREACH( boost::property_tree::ptree::value_type const& v, geofence_data.get_child( "data" ) ) {
assert(v.first.empty()); // array elements have no names
boost::property_tree::ptree subtree = v.second;
list <double> geox;
list <double> geoy;
BOOST_FOREACH( boost::property_tree::ptree::value_type const& u, subtree.get_child( "geox" ) ) {
assert(u.first.empty()); // array elements have no names
// std::cout << u.second.get<double>("") << std::endl;
double d = u.second.get<double>("");
geox.push_back(d);
}
BOOST_FOREACH( boost::property_tree::ptree::value_type const& u, subtree.get_child( "geoy" ) ) {
assert(u.first.empty()); // array elements have no names
double d = u.second.get<double>("");
geoy.push_back(d);
}
GeofenceObject* geofenceObject = new GeofenceObject(geox,geoy,subtree.get<double>("PreemptCall"),subtree.get<double>("HeadingMin"),subtree.get<double>("HeadingMax"));
GeofenceSet.push_back(geofenceObject);
}
}
catch(...) {
std::cout << "Caught exception from reading a file";
}
}
}
bool PreemptionPluginWorker::CarInGeofence(double x, double y, double geox[], double geoy[], int GeoCorners) {
int i, j=GeoCorners-1 ;
bool oddNodes ;
for (i=0; i<GeoCorners; i++) {
if ((geoy[i]< y && geoy[j]>=y
|| geoy[j]< y && geoy[i]>=y)
&& (geox[i]<=x || geox[j]<=x)) {
oddNodes^=(geox[i]+(y-geoy[i])/(geoy[j]-geoy[i])*(geox[j]-geox[i])<x); }
j=i; }
return oddNodes;
}
void PreemptionPluginWorker::VehicleLocatorWorker(BsmMessage* msg){
double micro = 10000000.0;
PreemptionObject* po = new PreemptionObject;
VehicleCoordinate* vehicle_coordinate = new VehicleCoordinate;
auto bsm = msg->get_j2735_data();
int buff_size = bsm->coreData.id.size;
po->vehicle_id = (int)*(bsm->coreData.id.buf);
vehicle_coordinate->lat = bsm->coreData.lat / micro;
vehicle_coordinate->lon = bsm->coreData.Long / micro;
vehicle_coordinate->elevation = bsm->coreData.elev;
vehicle_coordinate->heading = bsm->coreData.heading * 0.0125;
for (auto const& it: GeofenceSet) {
double geox[it->geox.size()];
int k = 0;
for (double const &i: it->geox) {
geox[k++] = i;
}
double geoy[it->geoy.size()];
k = 0;
for (double const &i: it->geoy) {
geoy[k++] = i;
}
bool in_geo = CarInGeofence(vehicle_coordinate->lon, vehicle_coordinate->lat, geoy, geox, it->geox.size());
if(in_geo){
if(vehicle_coordinate->heading > it->minHeading && vehicle_coordinate->heading < it->maxHeading) {
po->approach = "1";
po->preemption_plan = std::to_string(it->PreemptCall);
PreemptionPlaner(po);
return;
}
else {
po->approach = "0";
}
}
else {
po ->approach = "0";
}
}
PreemptionPlaner(po);
return;
};
void PreemptionPluginWorker::PreemptionPlaner(PreemptionObject* po){
if(po->approach == "1") {
if ( preemption_map.find(po->vehicle_id) == preemption_map.end() ) {
TurnOnPreemption(po);
}
else {
std::cout << "Already sent the preemption plan.";
}
}
else if(po->approach == "0"){
if (preemption_map.find(po->vehicle_id) == preemption_map.end() ) {
std::cout << " vehicle id does not exitst" << po->vehicle_id << std::endl;
}
else {
TurnOffPreemption(po);
}
}
else{
std::cout << "approach is not 0 or 1" << po->approach << std::endl;
}
std::cout << " Finished PreemptionPlaner" << std::endl;
};
void PreemptionPluginWorker::TurnOnPreemption(PreemptionObject* po){
std::string preemption_plan_flag = "1";
std::asctime(std::localtime(&(po->time)));
preemption_map[po->vehicle_id] = *po;
std::string PreemptionOid = base_preemption_oid + po->preemption_plan;
int response = SendOid(PreemptionOid.c_str(), preemption_plan_flag.c_str());
if(response != 0){
std::cout << "Sending oid intrupted with an error.";
}
else{
std::cout << "Finished sending preemption plan.";
}
}
void PreemptionPluginWorker::TurnOffPreemption(PreemptionObject* po){
std::string preemption_plan, preemption_plan_flag = "";
preemption_plan = preemption_map[po ->vehicle_id].preemption_plan;
preemption_plan_flag = "0";
std::string PreemptionOid = base_preemption_oid + preemption_plan;
int response = SendOid(PreemptionOid.c_str(), preemption_plan_flag.c_str());
if(response != 0){
std::cout << "Sending oid intrupted with an error.";
}
else{
std::cout << "Finished sending preemption plan.";
}
preemption_map.erase(po->vehicle_id);
}
int PreemptionPluginWorker::SendOid(const char *PreemptionOid, const char *value) {
netsnmp_session session, *ss;
netsnmp_pdu *pdu, *response = NULL;
netsnmp_variable_list *vars;
oid name[MAX_OID_LEN];
size_t name_length;
int status;
int failures = 0;
int exitval = 0;
init_snmp("snmpset");
snmp_sess_init(&session);
session.peername = strdup(ip_with_port.c_str());
session.version = snmp_version;
session.community = (u_char *)snmp_community.c_str();
session.community_len = strlen((const char*) session.community);
session.timeout = 1000000;
SOCK_STARTUP;
ss = snmp_open(&session);
if (ss == NULL) {
snmp_sess_perror("snmpset", &session);
SOCK_CLEANUP;
exit(1);
}
// create PDU for SET request and add object names and values to request
pdu = snmp_pdu_create(SNMP_MSG_SET);
name_length = MAX_OID_LEN;
if (snmp_parse_oid(PreemptionOid, name, &name_length) == NULL) {
snmp_perror(PreemptionOid);
failures++;
} else {
if (snmp_add_var
(pdu, name, name_length, 'i', value)) {
snmp_perror(PreemptionOid);
failures++;
}
}
if (failures) {
snmp_close(ss);
SOCK_CLEANUP;
exit(1);
}
//send the request
status = snmp_synch_response(ss, pdu, &response);
if (status == STAT_SUCCESS) {
if (response->errstat == SNMP_ERR_NOERROR) {
if (1) {
print_variable(response->variables->name, response->variables->name_length, response->variables);
}
} else {
fprintf(stderr, "Error in packet.\nReason: %s\n", snmp_errstring(response->errstat));
exitval = 2;
}
} else if (status == STAT_TIMEOUT) {
fprintf(stderr, "Timeout: No Response from %s\n", session.peername);
exitval = 1;
} else { /* status == STAT_ERROR */
snmp_sess_perror("snmpset", ss);
exitval = 1;
}
if (response)
snmp_free_pdu(response);
snmp_close(ss);
SOCK_CLEANUP;
return exitval;
};
}; | 34.621622 | 186 | 0.51578 | [
"object"
] |
38f93571245b52080e614ac526cd7c18e6d8d79b | 9,239 | cpp | C++ | engine/conversion/source/CharacterDumper.cpp | prolog/shadow-of-the-wyrm | a1312c3e9bb74473f73c4e7639e8bd537f10b488 | [
"MIT"
] | 60 | 2019-08-21T04:08:41.000Z | 2022-03-10T13:48:04.000Z | engine/conversion/source/CharacterDumper.cpp | prolog/shadow-of-the-wyrm | a1312c3e9bb74473f73c4e7639e8bd537f10b488 | [
"MIT"
] | 3 | 2021-03-18T15:11:14.000Z | 2021-10-20T12:13:07.000Z | engine/conversion/source/CharacterDumper.cpp | prolog/shadow-of-the-wyrm | a1312c3e9bb74473f73c4e7639e8bd537f10b488 | [
"MIT"
] | 8 | 2019-11-16T06:29:05.000Z | 2022-01-23T17:33:43.000Z | #include <iomanip>
#include <sstream>
#include <boost/algorithm/string.hpp>
#include <boost/tokenizer.hpp>
#include "global_prototypes.hpp"
#include "ArtifactDumper.hpp"
#include "AttackDumper.hpp"
#include "CharacterDumper.hpp"
#include "ClassManager.hpp"
#include "ColourTextKeys.hpp"
#include "ConductsDumper.hpp"
#include "Conversion.hpp"
#include "CreatureProperties.hpp"
#include "CreatureTranslator.hpp"
#include "DeathDumper.hpp"
#include "Environment.hpp"
#include "EquipmentDumper.hpp"
#include "Game.hpp"
#include "InventoryDumper.hpp"
#include "MembershipsDumper.hpp"
#include "Metadata.hpp"
#include "MessageBufferDumper.hpp"
#include "MessageManagerFactory.hpp"
#include "ModifiersDumper.hpp"
#include "MortuaryDumper.hpp"
#include "PartyTextKeys.hpp"
#include "QuestDumper.hpp"
#include "RaceManager.hpp"
#include "ReligionManager.hpp"
#include "ResistancesDumper.hpp"
#include "SizeTextKeys.hpp"
#include "SkillsDumper.hpp"
#include "SpellsDumper.hpp"
#include "StatsDumper.hpp"
#include "TextKeys.hpp"
#include "TextMessages.hpp"
#include "VictoryDumper.hpp"
using namespace std;
using namespace boost::algorithm;
CharacterDumper::CharacterDumper(CreaturePtr new_creature, const uint new_num_cols)
: creature(new_creature), num_cols(new_num_cols)
{
}
CharacterDumper::~CharacterDumper()
{
}
string CharacterDumper::str() const
{
ostringstream ss;
Game& game = Game::instance();
Metadata meta;
string version = meta.get_game_version_synopsis();
ss << String::centre(version, num_cols) << endl << endl;
string name_title_user = TextMessages::get_name_and_title(creature);
string user = Environment::get_user_name();
if (!user.empty())
{
name_title_user += " (" + user + ")";
}
ss << String::centre(name_title_user, num_cols) << endl;
ss << get_synopsis() << endl << endl;
ss << get_vital_statistics();
StatsDumper stats_dumper(creature, num_cols);
ss << stats_dumper.str() << endl << endl;
ResistancesDumper res_dumper(creature, num_cols);
ss << res_dumper.str() << endl << endl;
ModifiersDumper mod_dumper(creature, num_cols);
ss << mod_dumper.str() << endl << endl;
DeathDumper death_dumper(creature, num_cols);
string death = death_dumper.str();
if (!death.empty())
{
ss << death << endl << endl;
}
VictoryDumper victory_dumper(creature, num_cols);
string victory = victory_dumper.str();
// Most characters won't be winners - don't add extra newlines to those
// that aren't.
if (!victory.empty())
{
ss << victory << endl << endl;
}
ConductsDumper conducts_dumper(creature, num_cols);
ss << conducts_dumper.str() << endl << endl;
MembershipsDumper memberships_dumper(creature, num_cols);
ss << memberships_dumper.str() << endl << endl;
SkillsDumper skills_dumper(creature, num_cols);
ss << skills_dumper.str() << endl << endl;
SpellsDumper spells_dumper(creature, num_cols);
ss << spells_dumper.str() << endl << endl;
QuestDumper quest_dumper(creature, num_cols);
ss << quest_dumper.str() << endl << endl;
EquipmentDumper equipment_dumper(creature, num_cols);
ss << equipment_dumper.str() << endl << endl;
InventoryDumper inventory_dumper(creature, num_cols);
ss << inventory_dumper.str() << endl << endl;
ss << get_carrying_capacity() << endl << endl;
ArtifactDumper artifact_dumper(game.get_items_ref(), game.get_item_generation_values_ref(), num_cols);
ss << artifact_dumper.str() << endl << endl;
AttackDumper attack_dumper(creature, num_cols);
ss << attack_dumper.str() << endl << endl;
MessageBufferDumper mbd(MM::instance(), num_cols);
ss << mbd.str() << endl << endl;
MortuaryDumper mortuary_dumper(creature, num_cols);
ss << mortuary_dumper.str() << endl << endl;
ss << get_party() << endl << endl;
ss << StringTable::get(TextKeys::MAXIMUM_DEPTH_REACHED) << ": " << creature->get_max_depth_reached().str(true) << endl << endl;
ss << StringTable::get(TextKeys::TURNS) << ": " << creature->get_turns() << endl << endl;
double seconds = game.get_total_elapsed_game_time(std::chrono::system_clock::now());
ulonglong secs = static_cast<ulonglong>(seconds) % 60;
ulonglong minutes = (static_cast<ulonglong>(seconds) / 60) % 60;
ulonglong hours = static_cast<ulonglong>(seconds) / 3600;
ss << StringTable::get(TextKeys::TOTAL_ELAPSED_TIME) << ": " << std::setw(2) << std::setfill('0') << hours << ":" << std::setw(2) << std::setfill('0') << minutes << ":" << std::setw(2) << std::setfill('0') << secs << endl << endl;
return ss.str();
}
// Helper functions
string CharacterDumper::get_party() const
{
ostringstream ss;
ss << TextMessages::get_hirelings_hired_message(creature->get_hirelings_hired()) << endl;
ss << TextMessages::get_adventurers_joined_message(creature->get_adventurers_joined()) << endl << endl;
// Party info
Game& game = Game::instance();
MapPtr current_map = game.get_current_map();
if (current_map != nullptr)
{
ss << StringTable::get(PartyTextKeys::CURRENT_PARTY) << ": ";
if (current_map->get_map_type() == MapType::MAP_TYPE_WORLD)
{
ss << StringTable::get(PartyTextKeys::PARTY_IN_TRANSIT);
}
else
{
const CreatureMap& creatures = current_map->get_creatures_ref();
vector<string> follower_descs;
for (const auto& c_pair : creatures)
{
ostringstream ss2;
CreaturePtr f = c_pair.second;
CharacterDumper cd(f);
if (f && f->get_additional_property(CreatureProperties::CREATURE_PROPERTIES_LEADER_ID) == creature->get_id())
{
string name = f->get_name();
ss2 << " - ";
if (name.empty())
{
ss2 << StringTable::get(f->get_short_description_sid());
}
else
{
ss2 << name;
}
ss2 << " " << "(" << cd.get_synopsis(false) << ")";
follower_descs.push_back(ss2.str());
}
}
if (follower_descs.empty())
{
ss << "-";
}
else
{
ss << endl;
for (const string& fdesc : follower_descs)
{
ss << fdesc << endl;
}
}
}
}
return ss.str();
}
string CharacterDumper::get_synopsis(const bool centre) const
{
ostringstream ss;
string race_id = creature->get_race_id();
string class_id = creature->get_class_id();
ClassManager cm;
RaceManager rm;
Race* race = rm.get_race(race_id);
Class* char_class = cm.get_class(class_id);
if (race && char_class)
{
string race_name = StringTable::get(race->get_race_name_sid());
string class_name = StringTable::get(char_class->get_class_name_sid());
string character_synopsis = "L" + std::to_string(creature->get_level().get_current()) + " " + race_name + " " + class_name;
trim_right(character_synopsis);
if (centre)
{
ss << String::centre(character_synopsis, num_cols);
}
else
{
ss << character_synopsis;
}
}
return ss.str();
}
// Get the creature's vital statistics: age, sex, size, hair, eyes.
string CharacterDumper::get_vital_statistics() const
{
ostringstream ss;
vector<string> vl(10);
// First, pad the lines:
for (string& s : vl)
{
s = String::add_trailing_spaces(s, num_cols);
}
// First line
string age = StringTable::get(TextKeys::AGE) + ": " + std::to_string(creature->get_age().get_current());
Alignment a;
string alignment = StringTable::get(TextKeys::ALIGNMENT) + ": " + StringTable::get(a.get_alignment_sid(creature->get_alignment().get_alignment_range()));
string size = StringTable::get(SizeTextKeys::SIZE) + ": " + StringTable::get(SizeTextKeys::get_size_sid_from_creature_size(creature->get_size()));
vl.at(0).replace(0, age.size(), age);
vl.at(0).replace(30, alignment.size(), alignment);
vl.at(0).replace(60, size.size(), size);
// Second line
ReligionManager rm;
string deity_id = creature->get_religion().get_active_deity_id();
string deity = StringTable::get(TextKeys::DEITY) + ": " + StringTable::get(rm.get_deity_name_sid(deity_id));
string hair_colour = StringTable::get(TextKeys::HAIR_COLOUR) + ": " + StringTable::get(ColourTextKeys::get_colour_sid_from_hair_colour(creature->get_hair_colour()));
string eye_colour = StringTable::get(TextKeys::EYE_COLOUR) + ": " + StringTable::get(ColourTextKeys::get_colour_sid_from_eye_colour(creature->get_eye_colour()));
vl.at(1).replace(0, deity.size(), deity);
vl.at(1).replace(30, hair_colour.size(), hair_colour);
vl.at(1).replace(60, eye_colour.size(), eye_colour);
// Third Line
CreatureSex cs = creature->get_sex();
if (cs != CreatureSex::CREATURE_SEX_NOT_SPECIFIED)
{
string sex = StringTable::get(TextKeys::SEX) + ": " + TextMessages::get_sex(cs);
vl.at(2).replace(0, sex.size(), sex);
}
for (string& s : vl)
{
trim_right(s);
if (!s.empty())
{
ss << s << endl;
}
}
ss << endl;
return ss.str();
}
string CharacterDumper::get_carrying_capacity() const
{
ostringstream ss;
if (creature != nullptr)
{
ss << StringTable::get(TextKeys::CARRYING_CAPACITY) << ": " << TextMessages::get_carrying_capacity_message(creature);
}
return ss.str();
}
| 29.14511 | 232 | 0.668146 | [
"vector"
] |
38f97191106b26b71a8a45955573d8cbe54a9404 | 900 | cc | C++ | components/ntp_snippets/mock_content_suggestions_provider_observer.cc | zealoussnow/chromium | fd8a8914ca0183f0add65ae55f04e287543c7d4a | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | 14,668 | 2015-01-01T01:57:10.000Z | 2022-03-31T23:33:32.000Z | components/ntp_snippets/mock_content_suggestions_provider_observer.cc | zealoussnow/chromium | fd8a8914ca0183f0add65ae55f04e287543c7d4a | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | 395 | 2020-04-18T08:22:18.000Z | 2021-12-08T13:04:49.000Z | components/ntp_snippets/mock_content_suggestions_provider_observer.cc | zealoussnow/chromium | fd8a8914ca0183f0add65ae55f04e287543c7d4a | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | 5,941 | 2015-01-02T11:32:21.000Z | 2022-03-31T16:35:46.000Z | // Copyright 2016 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "components/ntp_snippets/mock_content_suggestions_provider_observer.h"
namespace ntp_snippets {
MockContentSuggestionsProviderObserver::
MockContentSuggestionsProviderObserver() = default;
MockContentSuggestionsProviderObserver::
~MockContentSuggestionsProviderObserver() = default;
void MockContentSuggestionsProviderObserver::OnNewSuggestions(
ContentSuggestionsProvider* provider,
Category category,
std::vector<ContentSuggestion> suggestions) {
std::list<ContentSuggestion> suggestions_list;
for (ContentSuggestion& suggestion : suggestions) {
suggestions_list.push_back(std::move(suggestion));
}
OnNewSuggestions(provider, category, suggestions_list);
}
} // namespace ntp_snippets
| 33.333333 | 79 | 0.801111 | [
"vector"
] |
38fc46a91ff5c3561a6d225ccc1458c0ffbe4ba1 | 2,369 | cpp | C++ | src/swift2d/materials/HeatSpriteShader.cpp | Simmesimme/swift2d | 147a862208dee56f972361b5325009e020124137 | [
"MIT"
] | null | null | null | src/swift2d/materials/HeatSpriteShader.cpp | Simmesimme/swift2d | 147a862208dee56f972361b5325009e020124137 | [
"MIT"
] | null | null | null | src/swift2d/materials/HeatSpriteShader.cpp | Simmesimme/swift2d | 147a862208dee56f972361b5325009e020124137 | [
"MIT"
] | null | null | null | ////////////////////////////////////////////////////////////////////////////////
// //
// This file is part of Swift2D. //
// //
// Copyright: (c) 2011-2015 Simon Schneegans & Felix Lauer //
// //
// This software may be modified and distributed under the terms //
// of the MIT license. See the LICENSE file for details. //
// //
////////////////////////////////////////////////////////////////////////////////
// includes -------------------------------------------------------------------
#include <swift2d/materials/HeatSpriteShader.hpp>
namespace swift {
////////////////////////////////////////////////////////////////////////////////
HeatSpriteShader::HeatSpriteShader()
: Shader(
R"(
// vertex shader ---------------------------------------------------------
@include "shifted_instanced_texcoords_quad_vertex_shader"
)",
R"(
// fragment shader -------------------------------------------------------
@include "version"
// varyings
in vec2 texcoords;
flat in int instance_id;
// uniforms
uniform sampler2D diffuse;
uniform float opacity[100];
uniform mat3 heat_transform[100];
layout (location = 0) out vec4 fragColor;
void main(void) {
vec3 dir = texture(diffuse, texcoords).rga;
dir.xy = (heat_transform[instance_id] * vec3(dir.xy-0.5, 0.0)).xy + 0.5;
fragColor = vec4(dir.xy, 0, dir.z*opacity[instance_id]);
}
)"
)
, projection(get_uniform<math::mat3>("projection"))
, transform(get_uniform<math::mat3>("transform"))
, heat_transform(get_uniform<math::mat3>("heat_transform"))
, depth(get_uniform<float>("depth"))
, parallax(get_uniform<float>("parallax"))
, diffuse(get_uniform<int>("diffuse"))
, texcoord_offset_scale(get_uniform<math::vec4>("texcoord_offset_scale"))
, opacity(get_uniform<float>("opacity")) {}
////////////////////////////////////////////////////////////////////////////////
}
| 40.152542 | 80 | 0.398902 | [
"transform"
] |
ac024c87823ed6f9f2a43295fac3131d279b9a31 | 5,545 | cpp | C++ | qbGradient.cpp | QuantitativeBytes/qbGradient | ca0f9d519f164daf1992deeae3008c76212937ee | [
"MIT"
] | 3 | 2021-11-02T18:39:15.000Z | 2021-12-22T10:15:06.000Z | qbGradient.cpp | QuantitativeBytes/qbGradient | ca0f9d519f164daf1992deeae3008c76212937ee | [
"MIT"
] | null | null | null | qbGradient.cpp | QuantitativeBytes/qbGradient | ca0f9d519f164daf1992deeae3008c76212937ee | [
"MIT"
] | 1 | 2021-11-02T18:39:17.000Z | 2021-11-02T18:39:17.000Z | /* ************************************************************************
qbGradient class implementation.
qbGradient is a simple implementation of the gradient descent method for
numerical optimization, intended to demonstrate the principles of the
method for educational purposes.
The code utilizes function pointers so that the user can specify an
external object function to be minimized that can take any form over
any number of variables.
The code is intended to be studied along side the corresponding videos
on the QuantitativeBytes YouTube channel. The specific videos relating
to this code may be found here:
Episode 1 - The theory of the gradient descent technique:
https://youtu.be/BjkmFVv4ccw
Episode 2 - Basic implementation in C++:
https://youtu.be/eyCq3cNFpMU
The QuantitativeBytes YouTube channel may be found here:
www.youtube.com/c/QuantitativeBytes
As this code is paired with the corresponding videos, pull requests will
not be accepted.
MIT LICENSE
Copyright (c) 2021 Michael Bennett
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
************************************************************************/
#include "qbGradient.hpp"
#include <iostream>
#include <fstream>
#include <math.h>
// Constructor.
qbGradient::qbGradient()
{
// Set defaults.
m_nDims = 0;
m_stepSize = 0.0;
m_maxIter = 1;
m_h = 0.001;
m_gradientThresh = 1e-09;
}
// Destructor.
qbGradient::~qbGradient()
{
// Tidy up anything that needs tidying up...
}
// Function to set the object function.
void qbGradient::SetObjectFcn(std::function<double(std::vector<double>*)> objectFcn)
{
m_objectFcn = objectFcn;
}
// Function to set the start point.
// Note that this also sets the number of degrees of freedom.
void qbGradient::SetStartPoint(const std::vector<double> startPoint)
{
// Copy the start point.
m_startPoint = startPoint;
// Determine the number of degrees of freedom.
m_nDims = m_startPoint.size();
}
// Function to set the step size.
void qbGradient::SetStepSize(double stepSize)
{
m_stepSize = stepSize;
}
// Function to set the maximum number of iterations.
void qbGradient::SetMaxIterations(int maxIterations)
{
m_maxIter = maxIterations;
}
// Function to set the gradient magnitude threshold (stopping condition).
// The optimization stops when the gradient magnitude falls below this value.
void qbGradient::SetGradientThresh(double gradientThresh)
{
m_gradientThresh = gradientThresh;
}
// Function to perform the actual optimization.
bool qbGradient::Optimize(std::vector<double> *funcLoc, double *funcVal)
{
// Set the currentPoint to the startPoint.
m_currentPoint = m_startPoint;
// Loop up to max iterations or until threshold reached.
int iterCount = 0;
double gradientMagnitude = 1.0;
while ((iterCount < m_maxIter) && (gradientMagnitude > m_gradientThresh))
{
// Compute the gradient vector.
std::vector<double> gradientVector = ComputeGradientVector();
gradientMagnitude = ComputeGradientMagnitude(gradientVector);
// Compute the new point.
std::vector<double> newPoint = m_currentPoint;
for (int i=0; i<m_nDims; ++i)
{
newPoint[i] += -(gradientVector[i] * m_stepSize);
}
// Update the current point.
m_currentPoint = newPoint;
// Increment the iteration counter.
iterCount++;
}
// Return the results.
*funcLoc = m_currentPoint;
*funcVal = m_objectFcn(&m_currentPoint);
return 0;
}
/* Function to compute the gradient of the object function in the
specified dimension. */
double qbGradient::ComputeGradient(int dim)
{
// Make a copy of the current location.
std::vector<double> newPoint = m_currentPoint;
// Modify the copy, according to h and dim.
newPoint[dim] += m_h;
// Compute the two function values for these points.
double funcVal1 = m_objectFcn(&m_currentPoint);
double funcVal2 = m_objectFcn(&newPoint);
// Compute the approximate numerical gradient.
return (funcVal2 - funcVal1) / m_h;
}
// Function to compute the gradient vector.
std::vector<double> qbGradient::ComputeGradientVector()
{
std::vector<double> gradientVector = m_currentPoint;
for (int i=0; i<m_nDims; ++i)
gradientVector[i] = ComputeGradient(i);
return gradientVector;
}
// Function to compute the gradient magnitude.
double qbGradient::ComputeGradientMagnitude(std::vector<double> gradientVector)
{
double vectorMagnitude = 0.0;
for (int i=0; i<m_nDims; ++i)
vectorMagnitude += gradientVector[i] * gradientVector[i];
return sqrt(vectorMagnitude);
}
| 30.13587 | 84 | 0.728224 | [
"object",
"vector"
] |
f199f139d2d33a2c8bf7317d9f8019f5c66a2203 | 12,440 | cpp | C++ | MapReaderV2/UE3/FStaticMesh.cpp | balannarcis96/skylake-tools | e1ff6308d250f81397a85ab6012cc4dc10e06228 | [
"MIT"
] | 3 | 2020-05-18T14:37:07.000Z | 2020-12-24T08:49:34.000Z | MapReaderV2/UE3/FStaticMesh.cpp | balannarcis96/skylake-tools | e1ff6308d250f81397a85ab6012cc4dc10e06228 | [
"MIT"
] | null | null | null | MapReaderV2/UE3/FStaticMesh.cpp | balannarcis96/skylake-tools | e1ff6308d250f81397a85ab6012cc4dc10e06228 | [
"MIT"
] | null | null | null | #include "FStaticMesh.h"
#include "UObject.h"
#include "FLightMap.h"
#include "D3D.h"
#include <fstream>
FVert::FVert()
{
}
FVert::FVert(FIStream * stream)
:FReadable(stream)
{
pVertex = stream->ReadInt32();
iSide = stream->ReadInt32();
shadowTexCoord = FVector2(stream);
backfaceShadowTexCoord = FVector2(stream);
}
FPositionVertexData::FPositionVertexData()
{
vertices = nullptr;
}
FPositionVertexData::FPositionVertexData(FIStream * stream)
:FReadable(stream)
{
stride = stream->ReadInt32();
count = stream->ReadInt32();
int32 temp = stream->ReadInt32();
if (temp != stride) {
throw "FPositionVertexData::Incorrect stride ";
}
temp = stream->ReadInt32();
if (temp != count) {
throw "FPositionVertexData::Incorrect count ";
}
if (stride != sizeof(D3DXVECTOR3)) {
throw "FPositionVertexData::Unknown stride";
}
if (stride && count) {
vertices = new D3DXVECTOR3[count];
stream->Read((uint8*)vertices, sizeof(D3DXVECTOR3)* count);
}
}
FPositionVertexData::~FPositionVertexData()
{
if (vertices) {
delete[] vertices;
vertices = nullptr;
}
}
FUVVertexData::FUVVertexData()
{
}
FUVVertexData::FUVVertexData(FIStream * stream)
:FReadable(stream)
{
numUVStets = stream->ReadInt32();
stride = stream->ReadInt32();
numUVs = stream->ReadInt32();
bUseFullUVs = stream->ReadInt32();
size = 0;
int32 temp = stream->ReadInt32();
if (temp != stride) {
throw "Error, incorrect textstride";
}
temp = stream->ReadInt32();
if (temp != numUVs) {
throw "Error, incorrect textcount";
}
if (bUseFullUVs) {
switch (numUVStets)
{
case 1: {
size = sizeof(FUVFloat1);
}break;
case 2: {
size = sizeof(FUVFloat2);
}break;
case 3: {
size = sizeof(FUVFloat3);
}break;
case 4: {
size = sizeof(FUVFloat4);
}break;
default:
break;
}
}
else {
switch (numUVStets)
{
case 1: {
size = sizeof(FUVHalf1);
}break;
case 2: {
size = sizeof(FUVHalf2);
}break;
case 3: {
size = sizeof(FUVHalf3);
}break;
case 4: {
size = sizeof(FUVHalf4);
}break;
default:
break;
}
}
if (!size) {
throw "Invalid UVs count";
}
if (numUVs) {
data = new uint8[size * numUVs];
stream->Read(data, size* numUVs);
}
}
FUVVertexData::~FUVVertexData()
{
if (data) {
delete[] data;
data = nullptr;
}
}
FStaticMeshSection::FStaticMeshSection()
{
indexBuffer = nullptr;
indices = nullptr;
}
FStaticMeshSection::FStaticMeshSection(FIStream * stream)
:FReadable(stream)
{
material = stream->ReadInt32();
enableCollision = stream->ReadInt32();
oldEnableCollision = stream->ReadInt32();
bEnableShadowCasting = stream->ReadInt32();
firstIndex = stream->ReadInt32();
faceCount = stream->ReadInt32();
minVertexIndex = stream->ReadInt32();
maxVertexIndex = stream->ReadInt32();
materialIndex = stream->ReadInt32();
fragmentCount = stream->ReadInt32();
if (fragmentCount) {
fragments.push_back(FFragmentRange(stream));
}
indexBuffer = nullptr;
indices = nullptr;
}
FStaticMeshSection::~FStaticMeshSection()
{
if (indexBuffer) {
indexBuffer->Release();
indexBuffer = nullptr;
}
if (indices) {
delete[]indices;
indices = nullptr;
}
}
void FStaticMeshSection::Init(FMultiSizeIndexContainer * indexContainer)
{
if (faceCount == 0) {
return;
}
indexCount = faceCount * 3;
if (indexContainer->elementSize == sizeof(uint16)) {
indices = (uint8*)malloc(sizeof(uint16) * indexCount);
indexSize = sizeof(uint16);
uint16 * lodIndices = (uint16 *)indexContainer->rawData;
uint16 * _indices = (uint16*)indices;
for (uint32 faceIndex = 0; faceIndex < faceCount; faceIndex++)
{
_indices[faceIndex * 3 + 0] = lodIndices[firstIndex + ((faceIndex * 3) + 0)];
_indices[faceIndex * 3 + 1] = lodIndices[firstIndex + ((faceIndex * 3) + 1)];
_indices[faceIndex * 3 + 2] = lodIndices[firstIndex + ((faceIndex * 3) + 2)];
}
dxgiFormat = DXGI_FORMAT_R16_UINT;
}
else if (indexContainer->elementSize == sizeof(uint32)) {
indexSize = sizeof(uint32);
indices = (uint8*)malloc(sizeof(uint32) * indexCount);
uint32 * lodIndices = (uint32*)indexContainer->rawData;
uint32 * _indices = (uint32*)indices;
for (uint32 faceIndex = 0; faceIndex < faceCount; faceIndex++)
{
_indices[faceIndex * 3 + 0] = lodIndices[firstIndex + ((faceIndex * 3) + 0)];
_indices[faceIndex * 3 + 1] = lodIndices[firstIndex + ((faceIndex * 3) + 1)];
_indices[faceIndex * 3 + 2] = lodIndices[firstIndex + ((faceIndex * 3) + 2)];
}
dxgiFormat = DXGI_FORMAT_R32_UINT;
}
else {
throw std::exception("Unknown index size");
}
auto* d3dDevice = GetD3DDevice();
D3D11_BUFFER_DESC bDesc;
ZeroMemory(&bDesc, sizeof(bDesc));
bDesc.Usage = D3D11_USAGE_DEFAULT;
bDesc.BindFlags = D3D11_BIND_INDEX_BUFFER;
bDesc.ByteWidth = indexSize* indexCount;
D3D11_SUBRESOURCE_DATA bData;
ZeroMemory(&bData, sizeof(bData));
bData.pSysMem = indices;
HRESULT result = d3dDevice->CreateBuffer(&bDesc, &bData, &indexBuffer);
if (FAILED(result)) {
throw std::exception("Failed to create index buffer");
}
}
void FStaticMeshSection::Render(ID3D11DeviceContext* context)
{
if (!indexCount) {
return;
}
if (!fragmentCount || !fragments[0].numPrimitives) {
return;
}
context->IASetIndexBuffer(indexBuffer, dxgiFormat, 0);
context->DrawIndexed(indexCount, 0, 0);
}
FStaticColorData::FStaticColorData()
{
}
FStaticColorData::FStaticColorData(FIStream * stream)
:FReadable(stream)
{
stride = stream->ReadInt32();
count = stream->ReadInt32();
if (stride != 4) {
throw "FStaticColorData::Incorrect colorstride";
}
int32 temp = stream->ReadInt32();
if (temp != stride) {
throw "FStaticColorData::Colorstride missamtch";
}
temp = stream->ReadInt32();
if (temp != count) {
throw "FStaticColorData::Color count missamtch";
}
if (stride && count) {
data = new uint8[stride * count];
stream->Read(data, stride* count);
}
}
FStaticColorData::~FStaticColorData()
{
if (data) {
delete[] data;
data = nullptr;
}
}
FStaticMeshComponentLODInfo::FStaticMeshComponentLODInfo()
{
}
FStaticMeshComponentLODInfo::FStaticMeshComponentLODInfo(FIStream * stream)
:FReadable(stream)
{
shadowMaps = FArray<UObject*>(stream);
shadowVertexBuffers = FArray<UObject*>(stream);
lightMap = FLightMap::FromStream(stream);
unkShadowMap = UObject::ReadFromStream(stream);
}
FStaticMeshComponentLODInfo::~FStaticMeshComponentLODInfo()
{
if (lightMap) {
delete lightMap;
lightMap = nullptr;
}
}
FStaticLodInfo::FStaticLodInfo()
:FReadable()
{
vertices = nullptr;
possitionBuffer = nullptr;
vertexBuffer = nullptr;
legacyEdges = nullptr;
indexContainer = nullptr;
textureBuffer = nullptr;
}
void ReadFStaticLodInfo(FIStream * stream, FStaticLodInfo* lod) {
int32 bulkDataCount, bulkDataSize;
stream->ReadInt32();
bulkDataCount = stream->ReadInt32();
bulkDataSize = stream->ReadInt32();
stream->ReadInt32();
if (bulkDataCount && bulkDataSize) {
throw std::exception("Unk data found!!");
return;
}
lod->sectionsCount = stream->ReadInt32();
if (lod->sectionsCount) {
lod->sections = new FStaticMeshSection[lod->sectionsCount];
for (int32 i = 0; i < lod->sectionsCount; i++)
{
lod->sections[i] = FStaticMeshSection(stream);
}
}
lod->possitionBuffer = new FPositionVertexData(stream);
lod->textureBuffer = new FUVVertexData(stream);
lod->colorBuffer = FStaticColorData(stream);
lod->numVertices = stream->ReadInt32();
lod->indexContainer = new FMultiSizeIndexContainer(stream);
lod->wireframeIndexBuffer = FMultiSizeIndexContainer(stream);
int32 test = stream->ReadInt32();
if (test != sizeof(FEdge)) {
throw std::exception("Incorrect FEdge size");
return;
}
lod->legacyEdgeCount = stream->ReadInt32();
if (lod->legacyEdgeCount) {
lod->legacyEdges = new FEdge[lod->legacyEdgeCount];
stream->Read((uint8*)lod->legacyEdges, lod->legacyEdgeCount * sizeof(FEdge));
}
test = stream->ReadInt32();
if (test) {
throw std::exception("unk ending");
}
}
FStaticLodInfo::FStaticLodInfo(FIStream * stream)
:FReadable(stream)
{
vertices = nullptr;
possitionBuffer = nullptr;
vertexBuffer = nullptr;
textureBuffer = nullptr;
indexContainer = nullptr;
legacyEdges = nullptr;
}
FStaticLodInfo::~FStaticLodInfo()
{
if (vertexBuffer) {
vertexBuffer->Release();
vertexBuffer = nullptr;
}
if (legacyEdges) {
delete[] legacyEdges;
legacyEdges = nullptr;
}
if (vertices) {
delete[] vertices;
vertices = nullptr;
}
if (possitionBuffer) {
delete possitionBuffer;
possitionBuffer = nullptr;
}
if (textureBuffer) {
delete textureBuffer;
textureBuffer = nullptr;
}
if (indexContainer) {
delete indexContainer;
indexContainer = nullptr;
}
}
void FStaticLodInfo::Render(bool defaultVBuffer)
{
auto* d3dDeviceContext = GetD3DDeviceContext();
if (defaultVBuffer) {
UINT offset = 0;
UINT stride = sizeof(D3DVertex);
d3dDeviceContext->IASetPrimitiveTopology(D3D11_PRIMITIVE_TOPOLOGY_TRIANGLELIST);
d3dDeviceContext->IASetVertexBuffers(0, 1, &vertexBuffer, &stride, &offset);
}
for (int32 i = 0; i < sectionsCount; i++) {
sections[i].Render(d3dDeviceContext);
}
}
void FStaticLodInfo::Init() {
if (!numVertices) {
return;
}
float scale = 0.1f;
HRESULT result;
vertices = new D3DVertex[numVertices];
ZeroMemory(vertices, sizeof(D3DVertex)* numVertices);
D3DVertex* v = vertices;
D3DXVECTOR3 * pos = possitionBuffer->vertices;
for (uint32 i = 0; i < numVertices; i++, pos++, v++) {
//v->position.x = pos->y; //-pos->y; pos->x
//v->position.y = pos->z; // pos->z; pos->y
//v->position.z = pos->x; // pos->x; pos->z
v->position.x = pos->x;
v->position.y = pos->y;
v->position.z = pos->z;
if (textureBuffer->bUseFullUVs) {
if (textureBuffer->numUVStets == 2) {
FUVFloat2 * cuvs = (FUVFloat2 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else if (textureBuffer->numUVStets == 3) {
FUVFloat3 * cuvs = (FUVFloat3 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else if (textureBuffer->numUVStets == 4) {
FUVFloat4 * cuvs = (FUVFloat4 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else {
if (textureBuffer->numUVStets != 1) {
throw std::exception("unexptected uv count");
}
FUVFloat1 * cuvs = (FUVFloat1 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs.uv[0];
v->uv.y = cuvs[i].UVs.uv[1];
}
}
else {
if (textureBuffer->numUVStets == 2) {
FUVHalf2* cuvs = (FUVHalf2 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else if (textureBuffer->numUVStets == 3) {
FUVHalf3* cuvs = (FUVHalf3 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else if (textureBuffer->numUVStets == 4) {
FUVHalf3* cuvs = (FUVHalf3 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs[0].uv[0];
v->uv.y = cuvs[i].UVs[0].uv[1];
}
else {
if (textureBuffer->numUVStets != 1) {
throw std::exception("unexptected uv count");
}
FUVHalf1 * cuvs = (FUVHalf1 *)textureBuffer->data;
_UnpackNormal(cuvs[i].normal[1].normal, &v->normal);
v->uv.x = cuvs[i].UVs.uv[0];
v->uv.y = cuvs[i].UVs.uv[1];
}
}
}
delete possitionBuffer;
possitionBuffer = nullptr;
for (int32 i = 0; i < sectionsCount; i++) {
sections[i].Init(indexContainer);
}
D3D11_BUFFER_DESC bDesc;
ZeroMemory(&bDesc, sizeof(bDesc));
bDesc.Usage = D3D11_USAGE_DEFAULT;
bDesc.BindFlags = D3D11_BIND_VERTEX_BUFFER;
bDesc.ByteWidth = sizeof(D3DVertex) * numVertices;
bDesc.StructureByteStride = 0;
bDesc.CPUAccessFlags = 0;
bDesc.MiscFlags = 0;
D3D11_SUBRESOURCE_DATA bData;
bData.pSysMem = vertices;
bData.SysMemPitch = 0;
bData.SysMemSlicePitch = 0;
auto* d3dDevice = GetD3DDevice();
result = d3dDevice->CreateBuffer(&bDesc, &bData, &vertexBuffer);
if (FAILED(result)) {
throw std::exception("Failed to create vertex buffer");
}
}
| 22.017699 | 82 | 0.674035 | [
"render"
] |
f19a62364ab1c27590ccf38dbddf14f1268b4cb8 | 7,596 | cpp | C++ | src/main.cpp | Gnarwhal/LudumDare44 | a09e60a57cd7da22d401651ae4b9fbe3f7389ab0 | [
"MIT"
] | null | null | null | src/main.cpp | Gnarwhal/LudumDare44 | a09e60a57cd7da22d401651ae4b9fbe3f7389ab0 | [
"MIT"
] | null | null | null | src/main.cpp | Gnarwhal/LudumDare44 | a09e60a57cd7da22d401651ae4b9fbe3f7389ab0 | [
"MIT"
] | null | null | null | /*******************************************************************************
*
* Copyright (c) 2019 Gnarly Narwhal
*
* -----------------------------------------------------------------------------
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files(the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions
*
* The above copyright notice and this permission notice shall be included in all
* copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
* SOFTWARE.
*
*******************************************************************************/
#include <iostream>
#include <chrono>
#include "geno/GenoInts.h"
#include "geno/GenoMacros.h"
#include "geno/math/linear/GenoMatrix4.h"
#include "geno/thread/GenoTime.h"
#include "geno/engine/GenoEngine.h"
#include "geno/engine/GenoLoop.h"
#include "geno/engine/GenoInput.h"
#include "geno/engine/GenoWindow.h"
#include "geno/engine/GenoCamera2D.h"
#include "geno/gl/GenoGL.h"
#include "geno/gl/GenoFramebuffer.h"
#include "geno/gl/GenoVao.h"
#include "geno/shaders/GenoShader2c.h"
#include "geno/audio/GenoAudioDevice.h"
#include "geno/audio/GenoAudioSource.h"
#include "geno/audio/GenoAudioBuffer.h"
#include "pinball/shaders/GlowShader.h"
#include "pinball/Scene.h"
#include "pinball/Image.h"
#include "pinball/Intro.h"
#include "pinball/Level.h"
#include "pinball/levels/StartSplash.h"
#include "pinball/levels/Info1.h"
#include "pinball/levels/IntroLevel.h"
#include "pinball/levels/Info2.h"
#include "pinball/levels/Level1.h"
#include "pinball/levels/Level2.h"
#include "pinball/levels/Win.h"
bool init();
void begin();
void loop();
void load(uint32 level);
void update();
void render();
void cleanup();
bool toggle = true;
GenoWindow * window;
GenoCamera2D * camera;
GenoFramebuffer * framebuffer1;
GenoFramebuffer * framebuffer2;
GlowShader * glow;
GenoVao * vao;
GenoAudioSource * source;
GenoAudioBuffer * audio;
Image * image;
Scene * scene;
int32 main(int32 argc, char ** argv) {
init();
begin();
cleanup();
/////// TIME TRIALS - LEAVE FOR FUTURE USE ///////
/*
const uint32 NUM_ITERATIONS = 1000000;
auto begin1 = std::chrono::high_resolution_clock::now();
auto end1 = std::chrono::high_resolution_clock::now();
auto begin2 = std::chrono::high_resolution_clock::now();
auto end2 = std::chrono::high_resolution_clock::now();
std::cout << std::chrono::duration_cast<std::chrono::microseconds>(end1 - begin1).count() << std::endl;
std::cout << std::chrono::duration_cast<std::chrono::microseconds>(end2 - begin2).count() << std::endl;
*/
return 0;
}
bool init() {
GenoEngine::init();
GenoMonitor * monitor = GenoMonitors::getPrimaryMonitor();
GenoVideoMode * videoMode = monitor->getDefaultVideoMode();
GenoLoopCreateInfo loopInfo = {};
loopInfo.targetFps = videoMode->getRefreshRate();
loopInfo.deltaScale = 1;
loopInfo.callback = loop;
loopInfo.numSubLoops = 0;
loopInfo.subLoops = 0;
GenoEngine::setLoop(loopInfo);
int32 winHints[] = {
GLFW_CONTEXT_VERSION_MAJOR, 3,
GLFW_CONTEXT_VERSION_MINOR, 3,
GLFW_OPENGL_PROFILE, GLFW_OPENGL_CORE_PROFILE,
GLFW_OPENGL_FORWARD_COMPAT, GLFW_TRUE,
GLFW_SAMPLES, 4
};
GenoWindowCreateInfo winInfo = {};
winInfo.defaultPosition = true;
winInfo.fullscreen = true;
winInfo.title = "Genome";
winInfo.numHints = GENO_ARRAY_SIZE(winHints) / 2;
winInfo.hints = winHints;
winInfo.depth = false;
winInfo.clearRed = 0;
winInfo.clearGreen = 0;
winInfo.clearBlue = 0;
window = GenoWindow::create(winInfo);
if (window == 0) {
std::cerr << "Window creation failed!" << std::endl;
GenoEngine::stopLoop();
return false;
}
window->activate();
GenoEngine::setSwapInterval(1);
GenoEngine::initGlew();
glEnable(GL_MULTISAMPLE);
glEnable(GL_BLEND);
glBlendFunc(GL_SRC_ALPHA, GL_ONE_MINUS_SRC_ALPHA);
camera = new GenoCamera2D(0, 1920, 1080, 0, 0, 1);
uint32 textureParams[] = {
GL_TEXTURE_MIN_FILTER, GL_NEAREST,
GL_TEXTURE_MAG_FILTER, GL_NEAREST,
GL_TEXTURE_WRAP_S, GL_CLAMP_TO_EDGE,
GL_TEXTURE_WRAP_T, GL_CLAMP_TO_EDGE
};
GenoFramebufferCreateInfo bufferInfo = {};
bufferInfo.width = videoMode->getWidth();
bufferInfo.height = videoMode->getHeight();
bufferInfo.numColorAttachments = 1;
bufferInfo.depthAttachmentType = GENO_FRAMEBUFFER_DEPTH_BUFFER;
bufferInfo.numTextureParams = GENO_ARRAY_SIZE(textureParams) / 2;
bufferInfo.textureParams = textureParams;
framebuffer1 = new GenoFramebuffer(bufferInfo);
framebuffer2 = new GenoFramebuffer(bufferInfo);
glow = new GlowShader();
float vertices[] = {
1, -1, 0, // Top left
1, 1, 0, // Bottom left
-1, 1, 0, // Bottom right
-1, -1, 0 // Top right
};
uint32 indices[] = {
0, 1, 3,
1, 2, 3
};
float texCoords[] = {
1, 0,
1, 1,
0, 1,
0, 0
};
vao = new GenoVao(4, vertices, 6, indices);
vao->addAttrib(4, 2, texCoords);
GenoAudioDevices::getDefaultOutputDevice()->setActive();
audio = new GenoAudioBuffer("res/audio/harp.wav");
source = new GenoAudioSource(audio);
source->loop(true);
source->play();
Scene::init();
Intro::init(camera);
Level::init(camera);
Info::init(camera);
load(0);
image = new Image(camera, { 1, 1 }, { 5, 5 }, "res/img/Background.png");
return true;
}
void begin() {
GenoEngine::startLoop();
}
void loop() {
update();
render();
}
void load(uint32 level) {
using SceneLoader = Scene * (*)(GenoCamera2D *, GlowShader *);
const static SceneLoader loaders[] = {
loadSplash,
loadInfo1,
loadIntroLevel,
loadInfo2,
loadLevel1,
loadLevel2,
loadWin
};
if (level == GENO_ARRAY_SIZE(loaders))
GenoEngine::stopLoop();
else {
delete scene;
scene = loaders[level](camera, glow);
}
}
void update() {
if (window->shouldClose())
GenoEngine::stopLoop();
scene->update();
if (scene->isComplete())
load(scene->nextScene());
camera->update();
}
void render() {
framebuffer1->bind();
GenoFramebuffer::clear();
scene->renderGlow();
framebuffer2->bind();
GenoFramebuffer::clear();
framebuffer1->getColorTexture()->bind();
image->getTexture()->bind(1);
glow->enable();
glow->setMvp(GenoMatrix4f::makeIdentity());
glow->setResolution(window->getWidth(), window->getHeight());
glow->setHorizontal(true);
vao->render();
GenoFramebuffer::bindDefault();
GenoFramebuffer::clear();
framebuffer2->getColorTexture()->bind();
scene->bindBackground(1);
glow->enable();
glow->setMvp(GenoMatrix4f::makeIdentity());
glow->setResolution(window->getWidth(), window->getHeight());
glow->setHorizontal(false);
vao->render();
scene->render();
window->swap();
}
void cleanup() {
delete image;
delete scene;
delete vao;
delete glow;
delete framebuffer1;
delete framebuffer2;
delete camera;
delete window;
GenoEngine::destroy();
}
| 25.575758 | 104 | 0.685361 | [
"render"
] |
f19da41b8de48d83d740741d2528d3183626422c | 11,914 | cpp | C++ | moveit_planners/pilz_industrial_motion_planner/src/velocity_profile_atrap.cpp | FabianSchuetze/moveit2 | d1960f3994daff215c4a51de15c96ce618f4d97d | [
"BSD-3-Clause"
] | 1,116 | 2016-07-29T06:39:49.000Z | 2022-03-31T08:42:14.000Z | moveit_planners/pilz_industrial_motion_planner/src/velocity_profile_atrap.cpp | FabianSchuetze/moveit2 | d1960f3994daff215c4a51de15c96ce618f4d97d | [
"BSD-3-Clause"
] | 2,784 | 2016-07-29T15:19:38.000Z | 2022-03-31T01:35:59.000Z | moveit_planners/pilz_industrial_motion_planner/src/velocity_profile_atrap.cpp | FabianSchuetze/moveit2 | d1960f3994daff215c4a51de15c96ce618f4d97d | [
"BSD-3-Clause"
] | 956 | 2016-07-30T17:03:44.000Z | 2022-03-31T15:48:31.000Z | /*********************************************************************
* Software License Agreement (BSD License)
*
* Copyright (c) 2018 Pilz GmbH & Co. KG
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
*
* * Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* * Redistributions in binary form must reproduce the above
* copyright notice, this list of conditions and the following
* disclaimer in the documentation and/or other materials provided
* with the distribution.
* * Neither the name of Pilz GmbH & Co. KG nor the names of its
* contributors may be used to endorse or promote products derived
* from this software without specific prior written permission.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
* "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
* LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS
* FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE
* COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT,
* INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING,
* BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES;
* LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER
* CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
* LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN
* ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
* POSSIBILITY OF SUCH DAMAGE.
*********************************************************************/
#include "pilz_industrial_motion_planner/velocity_profile_atrap.h"
namespace pilz_industrial_motion_planner
{
VelocityProfileATrap::VelocityProfileATrap(double max_vel, double max_acc, double max_dec)
: max_vel_(fabs(max_vel))
, max_acc_(fabs(max_acc))
, max_dec_(fabs(max_dec))
, start_pos_(0)
, end_pos_(0)
, start_vel_(0)
, a1_(0)
, a2_(0)
, a3_(0)
, b1_(0)
, b2_(0)
, b3_(0)
, c1_(0)
, c2_(0)
, c3_(0)
, t_a_(0)
, t_b_(0)
, t_c_(0)
{
}
void VelocityProfileATrap::SetProfile(double pos1, double pos2)
{
start_pos_ = pos1;
end_pos_ = pos2;
start_vel_ = 0.0;
if (start_pos_ == end_pos_)
{
// goal already reached, set everything to zero
setEmptyProfile();
return;
}
else
{
// get the sign
double s = ((end_pos_ - start_pos_) > 0.0) - ((end_pos_ - start_pos_) < 0.0);
double dis = fabs(end_pos_ - start_pos_);
double min_dis_max_vel = 0.5 * max_vel_ * max_vel_ / max_acc_ + 0.5 * max_vel_ * max_vel_ / max_dec_;
// max_vel can be reached
if (dis > min_dis_max_vel)
{
// acceleration phase
a1_ = start_pos_;
a2_ = 0.0;
a3_ = s * max_acc_ / 2.0;
t_a_ = max_vel_ / max_acc_;
// constant phase
b1_ = a1_ + a3_ * t_a_ * t_a_;
b2_ = s * max_vel_;
b3_ = 0;
t_b_ = (dis - min_dis_max_vel) / max_vel_;
// deceleration phase
c1_ = b1_ + b2_ * (t_b_);
c2_ = s * max_vel_;
c3_ = -s * max_dec_ / 2.0;
t_c_ = max_vel_ / max_dec_;
}
// max_vel cannot be reached, no constant velocity phase
else
{
// compute the new velocity of constant phase
double new_vel = s * sqrt(2.0 * dis * max_acc_ * max_dec_ / (max_acc_ + max_dec_));
// acceleration phase
a1_ = start_pos_;
a2_ = 0.0;
a3_ = s * max_acc_ / 2.0;
t_a_ = fabs(new_vel) / max_acc_;
// constant phase
b1_ = a1_ + a3_ * t_a_ * t_a_;
b2_ = new_vel;
b3_ = 0;
t_b_ = 0.0;
// deceleration phase
c1_ = b1_;
c2_ = new_vel;
c3_ = -s * max_dec_ / 2.0;
t_c_ = fabs(new_vel) / max_dec_;
}
}
}
void VelocityProfileATrap::SetProfileDuration(double pos1, double pos2, double duration)
{
// compute the fastest case
SetProfile(pos1, pos2);
// cannot be faster
if (Duration() > duration)
{
return;
}
double ratio = Duration() / duration;
a2_ *= ratio;
a3_ *= ratio * ratio;
b2_ *= ratio;
b3_ *= ratio * ratio;
c2_ *= ratio;
c3_ *= ratio * ratio;
t_a_ /= ratio;
t_b_ /= ratio;
t_c_ /= ratio;
}
bool VelocityProfileATrap::setProfileAllDurations(double pos1, double pos2, double duration1, double duration2,
double duration3)
{
// compute the fastest case
SetProfile(pos1, pos2);
assert(duration1 > 0);
assert(duration3 > 0);
// cannot be faster
if (Duration() - (duration1 + duration2 + duration3) > KDL::epsilon)
{
return false;
}
// get the sign
double s = ((end_pos_ - start_pos_) > 0.0) - ((end_pos_ - start_pos_) < 0.0);
// compute the new velocity/acceleration/decel4eration
double dis = fabs(end_pos_ - start_pos_);
double new_vel = s * dis / (duration2 + duration1 / 2.0 + duration3 / 2.0);
double new_acc = new_vel / duration1;
double new_dec = -new_vel / duration3;
if ((fabs(new_vel) - max_vel_ > KDL::epsilon) || (fabs(new_acc) - max_acc_ > KDL::epsilon) ||
(fabs(new_dec) - max_dec_ > KDL::epsilon))
{
return false;
}
else
{
// set profile
start_pos_ = pos1;
end_pos_ = pos2;
// acceleration phase
a1_ = start_pos_;
a2_ = 0.0;
a3_ = new_acc / 2.0;
t_a_ = duration1;
// constant phase
b1_ = a1_ + a3_ * t_a_ * t_a_;
b2_ = new_vel;
b3_ = 0;
t_b_ = duration2;
// deceleration phase
c1_ = b1_ + b2_ * (t_b_);
c2_ = new_vel;
c3_ = new_dec / 2.0;
t_c_ = duration3;
return true;
}
}
bool VelocityProfileATrap::setProfileStartVelocity(double pos1, double pos2, double vel1)
{
if (vel1 == 0)
{
SetProfile(pos1, pos2);
return true;
}
// get the sign
double s = ((pos2 - pos1) > 0.0) - ((pos2 - pos1) < 0.0);
if (s * vel1 <= 0)
{
// TODO initial velocity is in opposite derection of start-end vector
return false;
}
start_pos_ = pos1;
end_pos_ = pos2;
start_vel_ = vel1;
// minimum brake distance
double min_brake_dis = 0.5 * vel1 * vel1 / max_dec_;
// minimum distance to reach the maximum velocity
double min_dis_max_vel =
0.5 * (max_vel_ - start_vel_) * (max_vel_ + start_vel_) / max_acc_ + 0.5 * max_vel_ * max_vel_ / max_dec_;
double dis = fabs(end_pos_ - start_pos_);
// brake, acceleration in opposite direction, deceleration
if (dis <= min_brake_dis)
{
// brake to zero velocity
t_a_ = fabs(start_vel_ / max_dec_);
a1_ = start_pos_;
a2_ = start_vel_;
a3_ = -0.5 * s * max_dec_;
// compute the velocity in opposite direction
double new_vel = -s * sqrt(2.0 * fabs(min_brake_dis - dis) * max_acc_ * max_dec_ / (max_acc_ + max_dec_));
// acceleration in opposite direction
t_b_ = fabs(new_vel / max_acc_);
b1_ = a1_ + a2_ * t_a_ + a3_ * t_a_ * t_a_;
b2_ = 0;
b3_ = -s * 0.5 * max_acc_;
// deceleration to zero
t_c_ = fabs(new_vel / max_dec_);
c1_ = b1_ + b2_ * t_b_ + b3_ * t_b_ * t_b_;
c2_ = new_vel;
c3_ = 0.5 * s * max_dec_;
}
else if (dis <= min_dis_max_vel)
{
// compute the reached velocity
double new_vel =
s * sqrt((dis + 0.5 * start_vel_ * start_vel_ / max_acc_) * 2.0 * max_acc_ * max_dec_ / (max_acc_ + max_dec_));
// acceleration to new velocity
t_a_ = fabs(new_vel - start_vel_) / max_acc_;
a1_ = start_pos_;
a2_ = start_vel_;
a3_ = 0.5 * s * max_acc_;
// no constant velocity phase
t_b_ = 0;
b1_ = a1_ + a2_ * t_a_ + a3_ * t_a_ * t_a_;
b2_ = 0;
b3_ = 0;
// deceleration to zero velocity
t_c_ = fabs(new_vel / max_dec_);
c1_ = b1_;
c2_ = new_vel;
c3_ = -0.5 * s * max_dec_;
}
else
{
// acceleration to max velocity
t_a_ = fabs(max_vel_ - start_vel_) / max_acc_;
a1_ = start_pos_;
a2_ = start_vel_;
a3_ = 0.5 * s * max_acc_;
// constant velocity
t_b_ = (dis - min_dis_max_vel) / max_vel_;
b1_ = a1_ + a2_ * t_a_ + a3_ * t_a_ * t_a_;
b2_ = max_vel_;
b3_ = 0;
// deceleration to zero velocity
t_c_ = max_vel_ / max_dec_;
c1_ = b1_ + b2_ * t_b_ + b3_ * t_b_ * t_b_;
c2_ = max_vel_;
c3_ = -0.5 * s * max_dec_;
}
return true;
}
double VelocityProfileATrap::Duration() const
{
return t_a_ + t_b_ + t_c_;
}
double VelocityProfileATrap::Pos(double time) const
{
if (time < 0)
{
return start_pos_;
}
else if (time < t_a_)
{
return a1_ + time * (a2_ + a3_ * time);
}
else if (time < (t_a_ + t_b_))
{
return b1_ + (time - t_a_) * (b2_ + b3_ * (time - t_a_));
}
else if (time <= (t_a_ + t_b_ + t_c_))
{
return c1_ + (time - t_a_ - t_b_) * (c2_ + c3_ * (time - t_a_ - t_b_));
}
else
{
return end_pos_;
}
}
double VelocityProfileATrap::Vel(double time) const
{
if (time < 0)
{
return start_vel_;
}
else if (time < t_a_)
{
return a2_ + 2 * a3_ * time;
}
else if (time < (t_a_ + t_b_))
{
return b2_ + 2 * b3_ * (time - t_a_);
}
else if (time <= (t_a_ + t_b_ + t_c_))
{
return c2_ + 2 * c3_ * (time - t_a_ - t_b_);
}
else
{
return 0;
}
}
double VelocityProfileATrap::Acc(double time) const
{
if (time <= 0)
{
return 0;
}
else if (time <= t_a_)
{
return 2 * a3_;
}
else if (time <= (t_a_ + t_b_))
{
return 2 * b3_;
}
else if (time <= (t_a_ + t_b_ + t_c_))
{
return 2 * c3_;
}
else
{
return 0;
}
}
KDL::VelocityProfile* VelocityProfileATrap::Clone() const
{
VelocityProfileATrap* trap = new VelocityProfileATrap(max_vel_, max_acc_, max_dec_);
trap->setProfileAllDurations(this->start_pos_, this->end_pos_, this->t_a_, this->t_b_, this->t_c_);
return trap;
}
// LCOV_EXCL_START // No tests for the print function
void VelocityProfileATrap::Write(std::ostream& os) const
{
os << *this;
}
std::ostream& operator<<(std::ostream& os, const VelocityProfileATrap& p)
{
os << "Asymmetric Trapezoid " << std::endl
<< "maximal velocity: " << p.max_vel_ << std::endl
<< "maximal acceleration: " << p.max_acc_ << std::endl
<< "maximal deceleration: " << p.max_dec_ << std::endl
<< "start position: " << p.start_pos_ << std::endl
<< "end position: " << p.end_pos_ << std::endl
<< "start velocity: " << p.start_vel_ << std::endl
<< "a1: " << p.a1_ << std::endl
<< "a2: " << p.a2_ << std::endl
<< "a3: " << p.a3_ << std::endl
<< "b1: " << p.b1_ << std::endl
<< "b2: " << p.b2_ << std::endl
<< "b3: " << p.b3_ << std::endl
<< "c1: " << p.c1_ << std::endl
<< "c2: " << p.c2_ << std::endl
<< "c3: " << p.c3_ << std::endl
<< "firstPhaseDuration " << p.firstPhaseDuration() << std::endl
<< "secondPhaseDuration " << p.secondPhaseDuration() << std::endl
<< "thirdPhaseDuration " << p.thirdPhaseDuration() << std::endl;
return os;
}
// LCOV_EXCL_STOP
bool VelocityProfileATrap::operator==(const VelocityProfileATrap& other) const
{
return (max_vel_ == other.max_vel_ && max_acc_ == other.max_acc_ && max_dec_ == other.max_dec_ &&
start_pos_ == other.start_pos_ && end_pos_ == other.end_pos_ && start_vel_ == other.start_vel_ &&
a1_ == other.a1_ && a2_ == other.a2_ && a3_ == other.a3_ && b1_ == other.b1_ && b2_ == other.b2_ &&
b3_ == other.b3_ && c1_ == other.c1_ && c2_ == other.c2_ && c3_ == other.c3_ && t_a_ == other.t_a_ &&
t_b_ == other.t_b_ && t_c_ == other.t_c_);
}
VelocityProfileATrap::~VelocityProfileATrap()
{
}
void VelocityProfileATrap::setEmptyProfile()
{
a1_ = end_pos_;
a2_ = 0;
a3_ = 0;
b1_ = end_pos_;
b2_ = 0;
c1_ = end_pos_;
c2_ = 0;
c3_ = 0;
t_a_ = 0;
t_b_ = 0;
t_c_ = 0;
}
} // namespace pilz_industrial_motion_planner
| 26.358407 | 119 | 0.602988 | [
"vector"
] |
f1a1d245438a722adb409ef6be0a7b75448e59df | 9,454 | cxx | C++ | Filters/ExtractDataType/vtkExtractPolyData.cxx | ObjectivitySRC/PVGPlugins | 5e24150262af751159d719cc810620d1770f2872 | [
"BSD-2-Clause"
] | 4 | 2016-01-21T21:45:43.000Z | 2021-07-31T19:24:09.000Z | Filters/ExtractDataType/vtkExtractPolyData.cxx | ObjectivitySRC/PVGPlugins | 5e24150262af751159d719cc810620d1770f2872 | [
"BSD-2-Clause"
] | null | null | null | Filters/ExtractDataType/vtkExtractPolyData.cxx | ObjectivitySRC/PVGPlugins | 5e24150262af751159d719cc810620d1770f2872 | [
"BSD-2-Clause"
] | 6 | 2015-08-31T06:21:03.000Z | 2021-07-31T19:24:10.000Z | /*=========================================================================
Program: Visualization Toolkit
Module: $RCSfile: vtkExtractPolyData.cxx,v $
By: Matthew Livingstone
=========================================================================*/
// Modified By: Matthew Livingstone
#include "vtkExtractPolyData.h"
#include "vtkInformation.h"
#include "vtkInformationVector.h"
#include "vtkMultiBlockDataSet.h"
#include "vtkObjectFactory.h"
#include "vtkDataSet.h"
#include "vtkCompositeDataIterator.h"
#include "vtkInformationIntegerKey.h"
#include "vtkMultiPieceDataSet.h"
#include "vtkPolyData.h"
#include "vtkAppendPolyData.h"
#include "vtkExecutive.h"
#include "vtkSmartPointer.h"
#include "vtkCompositeDataSet.h"
#include <vtkstd/set>
class vtkExtractPolyData::vtkSet : public vtkstd::set<unsigned int>
{
};
vtkStandardNewMacro(vtkExtractPolyData);
vtkCxxRevisionMacro(vtkExtractPolyData, "$Revision: 1.4 $");
vtkInformationKeyMacro(vtkExtractPolyData, DONT_PRUNE, Integer);
//----------------------------------------------------------------------------
vtkExtractPolyData::vtkExtractPolyData()
{
this->Indices = new vtkExtractPolyData::vtkSet();
this->PruneOutput = 1;
}
//----------------------------------------------------------------------------
vtkExtractPolyData::~vtkExtractPolyData()
{
delete this->Indices;
}
//----------------------------------------------------------------------------
void vtkExtractPolyData::AddIndex(unsigned int index)
{
this->Indices->insert(index);
this->Modified();
}
//----------------------------------------------------------------------------
void vtkExtractPolyData::RemoveIndex(unsigned int index)
{
this->Indices->erase(index);
this->Modified();
}
//----------------------------------------------------------------------------
void vtkExtractPolyData::RemoveAllIndices()
{
this->Indices->clear();
this->Modified();
}
//----------------------------------------------------------------------------
void vtkExtractPolyData::CopySubTree(vtkCompositeDataIterator* loc,
vtkMultiBlockDataSet* output, vtkMultiBlockDataSet* input)
{
vtkDataObject* inputNode = input->GetDataSet(loc);
if (!inputNode->IsA("vtkCompositeDataSet"))
{
vtkDataObject* clone = inputNode->NewInstance();
clone->ShallowCopy(inputNode);
output->SetDataSet(loc, clone);
clone->Delete();
}
else
{
vtkCompositeDataSet* cinput = vtkCompositeDataSet::SafeDownCast(inputNode);
vtkCompositeDataSet* coutput = vtkCompositeDataSet::SafeDownCast(
output->GetDataSet(loc));
vtkCompositeDataIterator* iter = cinput->NewIterator();
for (iter->InitTraversal(); !iter->IsDoneWithTraversal(); iter->GoToNextItem())
{
vtkDataObject* curNode = iter->GetCurrentDataObject();
vtkDataObject* clone = curNode->NewInstance();
clone->ShallowCopy(curNode);
coutput->SetDataSet(iter, clone);
clone->Delete();
}
iter->Delete();
}
}
//----------------------------------------------------------------------------
int vtkExtractPolyData::RequestData(
vtkInformation *vtkNotUsed(request),
vtkInformationVector **inputVector,
vtkInformationVector *outputVector)
{
vtkInformation *inInfo = inputVector[0]->GetInformationObject ( 0 );
vtkInformation *outInfo = outputVector->GetInformationObject ( 0 );
vtkMultiBlockDataSet *input = vtkMultiBlockDataSet::SafeDownCast (
inInfo->Get ( vtkDataObject::DATA_OBJECT() ) );
vtkPolyData *polyOutput = vtkPolyData::SafeDownCast (
outInfo->Get ( vtkDataObject::DATA_OBJECT() ) );
vtkMultiBlockDataSet *selectedItems = vtkMultiBlockDataSet::New();
selectedItems->DeepCopy(input);
// Copy selected blocks over to the output.
vtkCompositeDataIterator* iter = input->NewIterator();
iter->VisitOnlyLeavesOff();
for (iter->InitTraversal(); !iter->IsDoneWithTraversal(); iter->GoToNextItem())
{
if (this->Indices->find(iter->GetCurrentFlatIndex()) != this->Indices->end())
{
this->CopySubTree(iter, selectedItems, input);
// TODO: avoid copying if subtree has already been copied over.
}
}
iter->Delete();
if (this->PruneOutput)
{
// Now prune the output tree.
// Since in case multiple processes are involved, this process may have some
// data-set pointers NULL. Hence, pruning cannot simply trim NULL ptrs, since
// in that case we may end up with different structures on different
// processess, which is a big NO-NO. Hence, we first flag nodes based on
// whether they are being pruned or not.
iter = selectedItems->NewIterator();
iter->VisitOnlyLeavesOff();
iter->SkipEmptyNodesOff();
//iter->SkipEmptyNodesOn();
for (iter->InitTraversal(); !iter->IsDoneWithTraversal(); iter->GoToNextItem())
{
if (this->Indices->find(iter->GetCurrentFlatIndex()) != this->Indices->end())
{
iter->GetCurrentMetaData()->Set(DONT_PRUNE(), 1);
}
else if (iter->HasCurrentMetaData() && iter->GetCurrentMetaData()->Has(DONT_PRUNE()))
{
iter->GetCurrentMetaData()->Remove(DONT_PRUNE());
}
}
iter->Delete();
// Do the actual pruning. Only those branches are pruned which don't have
// DONT_PRUNE flag set.
this->Prune(selectedItems);
}
if(selectedItems->GetNumberOfBlocks() <= 0)
{
// Ensure empty output
vtkPolyData *temp = vtkPolyData::New();
polyOutput->ShallowCopy(temp);
temp->Delete();
selectedItems->Delete();
return 1;
}
// Final PolyData output object
vtkAppendPolyData *polyDataGroup = vtkAppendPolyData::New();
// Append all blocks to the PolyData output
vtkCompositeDataIterator *iter2 = selectedItems->NewIterator();
iter2->VisitOnlyLeavesOn();
iter2->TraverseSubTreeOn();
while( !iter2->IsDoneWithTraversal() )
{
polyDataGroup->AddInput(vtkPolyData::SafeDownCast( iter2->GetCurrentDataObject() ) );
iter2->GoToNextItem();
}
iter2->Delete();
polyDataGroup->Update();
// Copy points & cells & properties
polyOutput->ShallowCopy(polyDataGroup->GetOutput());
polyDataGroup->Delete();
selectedItems->Delete();
return 1;
}
//----------------------------------------------------------------------------
bool vtkExtractPolyData::Prune(vtkDataObject* branch)
{
if (branch->IsA("vtkMultiBlockDataSet"))
{
return this->Prune(vtkMultiBlockDataSet::SafeDownCast(branch));
}
else if (branch->IsA("vtkMultiPieceDataSet"))
{
return this->Prune(vtkMultiPieceDataSet::SafeDownCast(branch));
}
return true;
}
//----------------------------------------------------------------------------
bool vtkExtractPolyData::Prune(vtkMultiPieceDataSet* mpiece)
{
// * Remove any children on mpiece that don't have DONT_PRUNE set.
vtkMultiPieceDataSet* clone = vtkMultiPieceDataSet::New();
unsigned int index=0;
unsigned int numChildren = mpiece->GetNumberOfPieces();
for (unsigned int cc=0; cc<numChildren; cc++)
{
if (mpiece->HasMetaData(cc) && mpiece->GetMetaData(cc)->Has(DONT_PRUNE()))
{
clone->SetPiece(index, mpiece->GetPiece(cc));
clone->GetMetaData(index)->Copy(mpiece->GetMetaData(cc));
index++;
}
}
mpiece->ShallowCopy(clone);
clone->Delete();
// tell caller to prune mpiece away if num of pieces is 0.
return (mpiece->GetNumberOfPieces() == 0);
}
//----------------------------------------------------------------------------
bool vtkExtractPolyData::Prune(vtkMultiBlockDataSet* mblock)
{
vtkMultiBlockDataSet* clone = vtkMultiBlockDataSet::New();
unsigned int index=0;
unsigned int numChildren = mblock->GetNumberOfBlocks();
for (unsigned int cc=0; cc < numChildren; cc++)
{
vtkDataObject* block = mblock->GetBlock(cc);
if (mblock->HasMetaData(cc) && mblock->GetMetaData(cc)->Has(DONT_PRUNE()))
{
clone->SetBlock(index, block);
clone->GetMetaData(index)->Copy(mblock->GetMetaData(cc));
index++;
}
else if (block)
{
bool prune = this->Prune(block);
if (!prune)
{
vtkMultiBlockDataSet* prunedBlock = vtkMultiBlockDataSet::SafeDownCast(block);
if (prunedBlock && prunedBlock->GetNumberOfBlocks()==1)
{
// shrink redundant branches.
clone->SetBlock(index, prunedBlock->GetBlock(0));
if (prunedBlock->HasMetaData(static_cast<unsigned int>(0)))
{
clone->GetMetaData(index)->Copy(prunedBlock->GetMetaData(
static_cast<unsigned int>(0)));
}
}
else
{
clone->SetBlock(index, block);
if (mblock->HasMetaData(cc))
{
clone->GetMetaData(index)->Copy(mblock->GetMetaData(cc));
}
}
index++;
}
}
}
mblock->ShallowCopy(clone);
clone->Delete();
return (mblock->GetNumberOfBlocks() == 0);
}
//----------------------------------------------------------------------------
void vtkExtractPolyData::PrintSelf(ostream& os, vtkIndent indent)
{
this->Superclass::PrintSelf(os, indent);
os << indent << "PruneOutput: " << this->PruneOutput << endl;
}
int vtkExtractPolyData::FillInputPortInformation(int, vtkInformation *info)
{
info->Set(vtkAlgorithm::INPUT_REQUIRED_DATA_TYPE(), "vtkMultiBlockDataSet");
return 1;
}
/*int vtkExtractPolyData::FillOutputPortInformation(int, vtkInformation *info)
{
info->Set(vtkAlgorithm::O, "vtkMultiBlockDataSet");
return 1;
}*/ | 30.996721 | 88 | 0.613074 | [
"object"
] |
f1a793242117e677d98d5ac55afe2bbdfd69212e | 1,149 | cpp | C++ | woff2_dec.cpp | alimilhim/woff2-wasm | 78c679a73d6cb40056896842121297948aaec8b8 | [
"MIT"
] | 1 | 2020-02-21T16:34:22.000Z | 2020-02-21T16:34:22.000Z | woff2_dec.cpp | alimilhim/woff2-wasm | 78c679a73d6cb40056896842121297948aaec8b8 | [
"MIT"
] | null | null | null | woff2_dec.cpp | alimilhim/woff2-wasm | 78c679a73d6cb40056896842121297948aaec8b8 | [
"MIT"
] | null | null | null | /* Copyright 2013 Google Inc. All Rights Reserved.
Distributed under MIT license.
See file LICENSE for detail or copy at https://opensource.org/licenses/MIT
*/
#include <string>
#include "woff2/src/file.h"
#include <woff2/decode.h>
#include <vector>
#include <emscripten.h>
#include <emscripten/bind.h>
//#include <emscripten/val.h>
using namespace emscripten;
using std::string;
std::vector<unsigned char> woff2_dec(string woff2buf, size_t bufSize)
{
string input = woff2buf;
const uint8_t *raw_input = reinterpret_cast<const uint8_t *>(input.data());
string output(std::min(woff2::ComputeWOFF2FinalSize(raw_input, input.size()),
woff2::kDefaultMaxSize),
0);
woff2::WOFF2StringOut out(&output);
const bool ok = woff2::ConvertWOFF2ToTTF(raw_input, input.size(), &out);
if (!ok)
{
printf("somthing went wrong!\n");
}
const std::vector<uint8_t> charvect(output.begin(), output.begin() + out.Size());
return charvect;
}
EMSCRIPTEN_BINDINGS(woff_2)
{
register_vector<uint8_t>("vector<uint8_t>");
function("woff2_dec", &woff2_dec);
}
| 24.978261 | 85 | 0.673629 | [
"vector"
] |
f1a9cbbfb3c468e1953b4d9fabd5915a033ef025 | 38,069 | cxx | C++ | GPU/GPUTracking/Standalone/standalone.cxx | aknospe/AliRoot | 96d76b2078d6b757a2843ae4a890a85021241e70 | [
"BSD-3-Clause"
] | null | null | null | GPU/GPUTracking/Standalone/standalone.cxx | aknospe/AliRoot | 96d76b2078d6b757a2843ae4a890a85021241e70 | [
"BSD-3-Clause"
] | null | null | null | GPU/GPUTracking/Standalone/standalone.cxx | aknospe/AliRoot | 96d76b2078d6b757a2843ae4a890a85021241e70 | [
"BSD-3-Clause"
] | null | null | null | //**************************************************************************\
//* This file is property of and copyright by the ALICE Project *\
//* ALICE Experiment at CERN, All rights reserved. *\
//* *\
//* Primary Authors: Matthias Richter <Matthias.Richter@ift.uib.no> *\
//* for The ALICE HLT Project. *\
//* *\
//* Permission to use, copy, modify and distribute this software and its *\
//* documentation strictly for non-commercial purposes is hereby granted *\
//* without fee, provided that the above copyright notice appears in all *\
//* copies and that both the copyright notice and this permission notice *\
//* appear in the supporting documentation. The authors make no claims *\
//* about the suitability of this software for any purpose. It is *\
//* provided "as is" without express or implied warranty. *\
//**************************************************************************
/// \file standalone.cxx
/// \author David Rohr
#include "utils/qconfig.h"
#include "GPUReconstruction.h"
#include "GPUReconstructionTimeframe.h"
#include "GPUReconstructionConvert.h"
#include "GPUChainTracking.h"
#include "GPUTPCDef.h"
#include "GPUQA.h"
#include "GPUDisplayBackend.h"
#include "genEvents.h"
#include <iostream>
#include <fstream>
#include <cstdio>
#include <cstring>
#include <chrono>
#include <tuple>
#include <algorithm>
#include <thread>
#include <future>
#include <atomic>
#ifdef WITH_OPENMP
#include <omp.h>
#endif
#ifndef _WIN32
#include <unistd.h>
#include <sched.h>
#include <signal.h>
#include <sys/types.h>
#include <sys/wait.h>
#include <sys/select.h>
#include <fenv.h>
#include <clocale>
#include <sys/stat.h>
#endif
#include "utils/timer.h"
#include "utils/qmaths_helpers.h"
#include "utils/vecpod.h"
#include "TPCFastTransform.h"
#include "GPUTPCGMMergedTrack.h"
#include "GPUSettings.h"
#include <vector>
#include <xmmintrin.h>
#include "GPUO2DataTypes.h"
#ifdef HAVE_O2HEADERS
#include "GPUChainITS.h"
#endif
#ifdef GPUCA_BUILD_EVENT_DISPLAY
#ifdef _WIN32
#include "GPUDisplayBackendWindows.h"
#else
#include "GPUDisplayBackendX11.h"
#include "GPUDisplayBackendGlfw.h"
#endif
#include "GPUDisplayBackendGlut.h"
#endif
using namespace GPUCA_NAMESPACE::gpu;
//#define BROKEN_EVENTS
GPUReconstruction *rec, *recAsync, *recPipeline;
GPUChainTracking *chainTracking, *chainTrackingAsync, *chainTrackingPipeline;
#ifdef HAVE_O2HEADERS
GPUChainITS *chainITS, *chainITSAsync, *chainITSPipeline;
#endif
std::unique_ptr<char[]> outputmemory, outputmemoryPipeline;
std::unique_ptr<GPUDisplayBackend> eventDisplay;
std::unique_ptr<GPUReconstructionTimeframe> tf;
int nEventsInDirectory = 0;
std::atomic<unsigned int> nIteration, nIterationEnd;
void SetCPUAndOSSettings()
{
#ifdef FE_DFL_DISABLE_SSE_DENORMS_ENV // Flush and load denormals to zero in any case
fesetenv(FE_DFL_DISABLE_SSE_DENORMS_ENV);
#else
#ifndef _MM_FLUSH_ZERO_ON
#define _MM_FLUSH_ZERO_ON 0x8000
#endif
#ifndef _MM_DENORMALS_ZERO_ON
#define _MM_DENORMALS_ZERO_ON 0x0040
#endif
_mm_setcsr(_mm_getcsr() | (_MM_FLUSH_ZERO_ON | _MM_DENORMALS_ZERO_ON));
#endif
}
int ReadConfiguration(int argc, char** argv)
{
int qcRet = qConfigParse(argc, (const char**)argv);
if (qcRet) {
if (qcRet != qConfig::qcrHelp) {
printf("Error parsing command line parameters\n");
}
return 1;
}
if (configStandalone.printSettings) {
qConfigPrint();
}
#ifndef _WIN32
setlocale(LC_ALL, "");
setlocale(LC_NUMERIC, "");
if (configStandalone.affinity != -1) {
cpu_set_t mask;
CPU_ZERO(&mask);
CPU_SET(configStandalone.affinity, &mask);
printf("Setting affinitiy to restrict on CPU core %d\n", configStandalone.affinity);
if (0 != sched_setaffinity(0, sizeof(mask), &mask)) {
printf("Error setting CPU affinity\n");
return 1;
}
}
if (configStandalone.fifo) {
printf("Setting FIFO scheduler\n");
sched_param param;
sched_getparam(0, ¶m);
param.sched_priority = 1;
if (0 != sched_setscheduler(0, SCHED_FIFO, ¶m)) {
printf("Error setting scheduler\n");
return 1;
}
}
if (configStandalone.fpe) {
feenableexcept(FE_INVALID | FE_DIVBYZERO | FE_OVERFLOW);
}
if (configStandalone.flushDenormals) {
disable_denormals();
}
#else
if (configStandalone.affinity != -1) {
printf("Affinity setting not supported on Windows\n");
return 1;
}
if (configStandalone.fifo) {
printf("FIFO Scheduler setting not supported on Windows\n");
return 1;
}
if (configStandalone.fpe) {
printf("FPE not supported on Windows\n");
return 1;
}
#endif
#ifndef HAVE_O2HEADERS
configStandalone.configRec.runTRD = configStandalone.configRec.rundEdx = configStandalone.configRec.runCompression = configStandalone.configRec.runTransformation = configStandalone.testSyncAsync = configStandalone.testSync = 0;
configStandalone.configRec.ForceEarlyTPCTransform = 1;
#endif
#ifndef GPUCA_TPC_GEOMETRY_O2
configStandalone.configRec.mergerReadFromTrackerDirectly = 0;
#endif
#ifndef GPUCA_BUILD_QA
if (configStandalone.qa || configStandalone.eventGenerator) {
printf("QA not enabled in build\n");
return 1;
}
#endif
if (configStandalone.qa) {
if (getenv("LC_NUMERIC")) {
printf("Please unset the LC_NUMERIC env variable, otherwise ROOT will not be able to fit correctly\n"); // BUG: ROOT Problem
return 1;
}
}
#ifndef GPUCA_BUILD_EVENT_DISPLAY
if (configStandalone.eventDisplay) {
printf("EventDisplay not enabled in build\n");
return 1;
}
#endif
if (configStandalone.configProc.doublePipeline && configStandalone.testSyncAsync) {
printf("Cannot run asynchronous processing with double pipeline\n");
return 1;
}
if (configStandalone.configProc.doublePipeline && (configStandalone.runs < 3 || !configStandalone.outputcontrolmem)) {
printf("Double pipeline mode needs at least 3 runs per event and external output\n");
return 1;
}
if (configStandalone.configTF.bunchSim && configStandalone.configTF.nMerge) {
printf("Cannot run --MERGE and --SIMBUNCHES togeterh\n");
return 1;
}
if (configStandalone.configTF.bunchSim > 1) {
configStandalone.configTF.timeFrameLen = 1.e9 * configStandalone.configTF.bunchSim / configStandalone.configTF.interactionRate;
}
if (configStandalone.configTF.nMerge) {
double len = configStandalone.configTF.nMerge - 1;
if (configStandalone.configTF.randomizeDistance) {
len += 0.5;
}
if (configStandalone.configTF.shiftFirstEvent) {
len += 0.5;
}
configStandalone.configTF.timeFrameLen = (len * configStandalone.configTF.averageDistance / GPUReconstructionTimeframe::TPCZ + 1) * GPUReconstructionTimeframe::DRIFT_TIME;
}
if (configStandalone.configQA.inputHistogramsOnly && configStandalone.configQA.compareInputs.size() == 0) {
printf("Can only produce QA pdf output when input files are specified!\n");
return 1;
}
if (configStandalone.eventDisplay) {
configStandalone.noprompt = 1;
}
if (configStandalone.DebugLevel >= 4) {
configStandalone.OMPThreads = 1;
}
#ifdef WITH_OPENMP
if (configStandalone.OMPThreads != -1) {
omp_set_num_threads(configStandalone.OMPThreads);
} else {
configStandalone.OMPThreads = omp_get_max_threads();
}
if (configStandalone.OMPThreads != omp_get_max_threads()) {
printf("Cannot set number of OMP threads!\n");
return 1;
}
#else
configStandalone.OMPThreads = 1;
#endif
if (configStandalone.outputcontrolmem) {
bool forceEmptyMemory = getenv("LD_PRELOAD") && strstr(getenv("LD_PRELOAD"), "valgrind") != nullptr;
outputmemory.reset(new char[configStandalone.outputcontrolmem]);
if (forceEmptyMemory) {
printf("Valgrind detected, emptying GPU output memory to avoid false positive undefined reads");
memset(outputmemory.get(), 0, configStandalone.outputcontrolmem);
}
if (configStandalone.configProc.doublePipeline) {
outputmemoryPipeline.reset(new char[configStandalone.outputcontrolmem]);
if (forceEmptyMemory) {
memset(outputmemoryPipeline.get(), 0, configStandalone.outputcontrolmem);
}
}
}
#if !(defined(CUDA_ENABLED) || defined(OPENCL1_ENABLED) || defined(HIP_ENABLED))
if (configStandalone.runGPU) {
printf("GPU disables at build time!\n");
printf("Press a key to exit!\n");
getchar();
return 1;
}
#endif
return (0);
}
int SetupReconstruction()
{
if (!configStandalone.eventGenerator) {
char filename[256];
snprintf(filename, 256, "events/%s/", configStandalone.EventsDir);
if (rec->ReadSettings(filename)) {
printf("Error reading event config file\n");
return 1;
}
printf("Read event settings from dir %s (solenoidBz: %f, home-made events %d, constBz %d, maxTimeBin %d)\n", filename, rec->GetEventSettings().solenoidBz, (int)rec->GetEventSettings().homemadeEvents, (int)rec->GetEventSettings().constBz, rec->GetEventSettings().continuousMaxTimeBin);
if (configStandalone.testSyncAsync) {
recAsync->ReadSettings(filename);
}
if (configStandalone.configProc.doublePipeline) {
recPipeline->ReadSettings(filename);
}
}
GPUSettingsEvent ev = rec->GetEventSettings();
GPUSettingsRec recSet;
GPUSettingsDeviceProcessing devProc;
GPURecoStepConfiguration steps;
if (configStandalone.eventGenerator) {
ev.homemadeEvents = true;
}
if (configStandalone.solenoidBz != -1e6f) {
ev.solenoidBz = configStandalone.solenoidBz;
}
if (configStandalone.constBz) {
ev.constBz = true;
}
if (configStandalone.configTF.nMerge || configStandalone.configTF.bunchSim) {
if (ev.continuousMaxTimeBin) {
printf("ERROR: requested to overlay continuous data - not supported\n");
return 1;
}
if (!configStandalone.cont) {
printf("Continuous mode forced\n");
configStandalone.cont = true;
}
if (chainTracking->GetTPCTransform()) {
ev.continuousMaxTimeBin = configStandalone.configTF.timeFrameLen * ((double)GPUReconstructionTimeframe::TPCZ / (double)GPUReconstructionTimeframe::DRIFT_TIME) / chainTracking->GetTPCTransform()->getVDrift();
}
}
if (configStandalone.cont && ev.continuousMaxTimeBin == 0) {
ev.continuousMaxTimeBin = -1;
}
if (rec->GetDeviceType() == GPUReconstruction::DeviceType::CPU) {
printf("Standalone Test Framework for CA Tracker - Using CPU\n");
} else {
printf("Standalone Test Framework for CA Tracker - Using GPU\n");
}
recSet.SetMinTrackPt(GPUCA_MIN_TRACK_PT_DEFAULT);
recSet.NWays = configStandalone.nways;
recSet.NWaysOuter = configStandalone.nwaysouter;
recSet.RejectMode = configStandalone.rejectMode;
recSet.SearchWindowDZDR = configStandalone.dzdr;
recSet.GlobalTracking = configStandalone.configRec.globalTracking;
recSet.DisableRefitAttachment = configStandalone.configRec.disableRefitAttachment;
recSet.ForceEarlyTPCTransform = configStandalone.configRec.ForceEarlyTPCTransform;
recSet.fwdTPCDigitsAsClusters = configStandalone.configRec.fwdTPCDigitsAsClusters;
recSet.dropLoopers = configStandalone.configRec.dropLoopers;
if (configStandalone.configRec.mergerCovSource != -1) {
recSet.mergerCovSource = configStandalone.configRec.mergerCovSource;
}
if (configStandalone.configRec.mergerInterpolateErrors != -1) {
recSet.mergerInterpolateErrors = configStandalone.configRec.mergerInterpolateErrors;
}
if (configStandalone.referenceX < 500.) {
recSet.TrackReferenceX = configStandalone.referenceX;
}
recSet.tpcZSthreshold = configStandalone.zsThreshold;
if (configStandalone.configRec.fitInProjections != -1) {
recSet.fitInProjections = configStandalone.configRec.fitInProjections;
}
if (configStandalone.configRec.fitPropagateBzOnly != -1) {
recSet.fitPropagateBzOnly = configStandalone.configRec.fitPropagateBzOnly;
}
if (configStandalone.configRec.retryRefit != -1) {
recSet.retryRefit = configStandalone.configRec.retryRefit;
}
recSet.loopInterpolationInExtraPass = configStandalone.configRec.loopInterpolationInExtraPass;
recSet.mergerReadFromTrackerDirectly = configStandalone.configRec.mergerReadFromTrackerDirectly;
if (!recSet.mergerReadFromTrackerDirectly) {
devProc.fullMergerOnGPU = false;
}
if (configStandalone.OMPThreads != -1) {
devProc.nThreads = configStandalone.OMPThreads;
}
devProc.deviceNum = configStandalone.cudaDevice;
devProc.forceMemoryPoolSize = (configStandalone.forceMemorySize == 1 && configStandalone.eventDisplay) ? 2 : configStandalone.forceMemorySize;
devProc.debugLevel = configStandalone.DebugLevel;
devProc.allocDebugLevel = configStandalone.allocDebugLevel;
devProc.deviceTimers = configStandalone.DeviceTiming;
devProc.runQA = configStandalone.qa;
devProc.runMC = configStandalone.configProc.runMC;
devProc.ompKernels = configStandalone.configProc.ompKernels;
devProc.runCompressionStatistics = configStandalone.compressionStat;
devProc.memoryScalingFactor = configStandalone.memoryScalingFactor;
devProc.alternateBorderSort = configStandalone.alternateBorderSort;
devProc.doublePipeline = configStandalone.configProc.doublePipeline;
if (configStandalone.eventDisplay) {
#ifdef GPUCA_BUILD_EVENT_DISPLAY
#ifdef _WIN32
if (configStandalone.eventDisplay == 1) {
printf("Enabling event display (windows backend)\n");
eventDisplay.reset(new GPUDisplayBackendWindows);
}
#else
if (configStandalone.eventDisplay == 1) {
eventDisplay.reset(new GPUDisplayBackendX11);
printf("Enabling event display (X11 backend)\n");
}
if (configStandalone.eventDisplay == 3) {
eventDisplay.reset(new GPUDisplayBackendGlfw);
printf("Enabling event display (GLFW backend)\n");
}
#endif
else if (configStandalone.eventDisplay == 2) {
eventDisplay.reset(new GPUDisplayBackendGlut);
printf("Enabling event display (GLUT backend)\n");
}
#endif
devProc.eventDisplay = eventDisplay.get();
}
devProc.nDeviceHelperThreads = configStandalone.helperThreads;
devProc.globalInitMutex = configStandalone.gpuInitMutex;
devProc.gpuDeviceOnly = configStandalone.oclGPUonly;
devProc.memoryAllocationStrategy = configStandalone.allocationStrategy;
devProc.registerStandaloneInputMemory = configStandalone.registerInputMemory;
if (configStandalone.configRec.tpcReject != -1) {
recSet.tpcRejectionMode = configStandalone.configRec.tpcReject;
}
if (configStandalone.configRec.tpcRejectThreshold != 0.f) {
recSet.tpcRejectQPt = 1.f / configStandalone.configRec.tpcRejectThreshold;
}
recSet.tpcCompressionModes = configStandalone.configRec.tpcCompression;
recSet.tpcCompressionSortOrder = configStandalone.configRec.tpcCompressionSort;
if (configStandalone.configProc.nStreams >= 0) {
devProc.nStreams = configStandalone.configProc.nStreams;
}
if (configStandalone.configProc.constructorPipeline >= 0) {
devProc.trackletConstructorInPipeline = configStandalone.configProc.constructorPipeline;
}
if (configStandalone.configProc.selectorPipeline >= 0) {
devProc.trackletSelectorInPipeline = configStandalone.configProc.selectorPipeline;
}
devProc.mergerSortTracks = configStandalone.configProc.mergerSortTracks;
devProc.tpcCompressionGatherMode = configStandalone.configProc.tpcCompressionGatherMode;
steps.steps = GPUDataTypes::RecoStep::AllRecoSteps;
if (configStandalone.configRec.runTRD != -1) {
steps.steps.setBits(GPUDataTypes::RecoStep::TRDTracking, configStandalone.configRec.runTRD > 0);
} else if (chainTracking->GetTRDGeometry() == nullptr) {
steps.steps.setBits(GPUDataTypes::RecoStep::TRDTracking, false);
}
if (configStandalone.configRec.rundEdx != -1) {
steps.steps.setBits(GPUDataTypes::RecoStep::TPCdEdx, configStandalone.configRec.rundEdx > 0);
}
if (configStandalone.configRec.runCompression != -1) {
steps.steps.setBits(GPUDataTypes::RecoStep::TPCCompression, configStandalone.configRec.runCompression > 0);
}
if (configStandalone.configRec.runTransformation != -1) {
steps.steps.setBits(GPUDataTypes::RecoStep::TPCConversion, configStandalone.configRec.runTransformation > 0);
}
if (!configStandalone.merger) {
steps.steps.setBits(GPUDataTypes::RecoStep::TPCMerging, false);
steps.steps.setBits(GPUDataTypes::RecoStep::TRDTracking, false);
steps.steps.setBits(GPUDataTypes::RecoStep::TPCdEdx, false);
steps.steps.setBits(GPUDataTypes::RecoStep::TPCCompression, false);
}
if (configStandalone.configTF.bunchSim || configStandalone.configTF.nMerge) {
steps.steps.setBits(GPUDataTypes::RecoStep::TRDTracking, false);
}
steps.inputs.set(GPUDataTypes::InOutType::TPCClusters, GPUDataTypes::InOutType::TRDTracklets);
if (ev.needsClusterer) {
steps.inputs.setBits(GPUDataTypes::InOutType::TPCRaw, true);
steps.inputs.setBits(GPUDataTypes::InOutType::TPCClusters, false);
} else {
steps.steps.setBits(GPUDataTypes::RecoStep::TPCClusterFinding, false);
}
if (configStandalone.configProc.recoSteps >= 0) {
steps.steps &= configStandalone.configProc.recoSteps;
}
if (configStandalone.configProc.recoStepsGPU >= 0) {
steps.stepsGPUMask &= configStandalone.configProc.recoStepsGPU;
}
steps.outputs.clear();
steps.outputs.setBits(GPUDataTypes::InOutType::TPCSectorTracks, steps.steps.isSet(GPUDataTypes::RecoStep::TPCSliceTracking) && !recSet.mergerReadFromTrackerDirectly);
steps.outputs.setBits(GPUDataTypes::InOutType::TPCMergedTracks, steps.steps.isSet(GPUDataTypes::RecoStep::TPCMerging));
steps.outputs.setBits(GPUDataTypes::InOutType::TPCCompressedClusters, steps.steps.isSet(GPUDataTypes::RecoStep::TPCCompression));
steps.outputs.setBits(GPUDataTypes::InOutType::TRDTracks, steps.steps.isSet(GPUDataTypes::RecoStep::TRDTracking));
steps.outputs.setBits(GPUDataTypes::InOutType::TPCClusters, steps.steps.isSet(GPUDataTypes::RecoStep::TPCClusterFinding));
steps.steps.setBits(GPUDataTypes::RecoStep::TPCDecompression, false);
steps.inputs.setBits(GPUDataTypes::InOutType::TPCCompressedClusters, false);
if (configStandalone.testSyncAsync || configStandalone.testSync) {
// Set settings for synchronous
steps.steps.setBits(GPUDataTypes::RecoStep::TPCdEdx, 0);
recSet.useMatLUT = false;
if (configStandalone.testSyncAsync) {
devProc.eventDisplay = nullptr;
}
}
rec->SetSettings(&ev, &recSet, &devProc, &steps);
if (configStandalone.configProc.doublePipeline) {
recPipeline->SetSettings(&ev, &recSet, &devProc, &steps);
}
if (configStandalone.testSyncAsync) {
// Set settings for asynchronous
steps.steps.setBits(GPUDataTypes::RecoStep::TPCDecompression, true);
steps.steps.setBits(GPUDataTypes::RecoStep::TPCdEdx, true);
steps.steps.setBits(GPUDataTypes::RecoStep::TPCCompression, false);
steps.steps.setBits(GPUDataTypes::RecoStep::TPCClusterFinding, false);
steps.inputs.setBits(GPUDataTypes::InOutType::TPCRaw, false);
steps.inputs.setBits(GPUDataTypes::InOutType::TPCClusters, false);
steps.inputs.setBits(GPUDataTypes::InOutType::TPCCompressedClusters, true);
steps.outputs.setBits(GPUDataTypes::InOutType::TPCCompressedClusters, false);
devProc.runMC = false;
devProc.runQA = false;
devProc.eventDisplay = eventDisplay.get();
devProc.runCompressionStatistics = 0;
recSet.DisableRefitAttachment = 0xFF;
recSet.loopInterpolationInExtraPass = 0;
recSet.MaxTrackQPt = CAMath::Min(recSet.MaxTrackQPt, recSet.tpcRejectQPt);
recSet.useMatLUT = true;
recAsync->SetSettings(&ev, &recSet, &devProc, &steps);
}
if (configStandalone.outputcontrolmem) {
rec->SetOutputControl(outputmemory.get(), configStandalone.outputcontrolmem);
if (configStandalone.configProc.doublePipeline) {
recPipeline->SetOutputControl(outputmemoryPipeline.get(), configStandalone.outputcontrolmem);
}
}
if (rec->Init()) {
printf("Error initializing GPUReconstruction!\n");
return 1;
}
if (configStandalone.outputcontrolmem && rec->IsGPU()) {
if (rec->registerMemoryForGPU(outputmemory.get(), configStandalone.outputcontrolmem) || (configStandalone.configProc.doublePipeline && recPipeline->registerMemoryForGPU(outputmemoryPipeline.get(), configStandalone.outputcontrolmem))) {
printf("ERROR registering memory for the GPU!!!\n");
return 1;
}
}
if (configStandalone.DebugLevel >= 4) {
rec->PrintKernelOccupancies();
}
return (0);
}
int ReadEvent(int n)
{
char filename[256];
snprintf(filename, 256, "events/%s/" GPUCA_EVDUMP_FILE ".%d.dump", configStandalone.EventsDir, n);
int r = chainTracking->ReadData(filename);
if (r) {
return r;
}
if (chainTracking->mIOPtrs.clustersNative && (configStandalone.configTF.bunchSim || configStandalone.configTF.nMerge || !configStandalone.configRec.runTransformation)) {
if (configStandalone.DebugLevel >= 2) {
printf("Converting Native to Legacy ClusterData for overlaying - WARNING: No raw clusters produced - Compression etc will not run!!!\n");
}
chainTracking->ConvertNativeToClusterDataLegacy();
}
return 0;
}
void OutputStat(GPUChainTracking* t, long long int* nTracksTotal = nullptr, long long int* nClustersTotal = nullptr)
{
int nTracks = 0, nAttachedClusters = 0, nAttachedClustersFitted = 0, nAdjacentClusters = 0;
for (unsigned int k = 0; k < t->mIOPtrs.nMergedTracks; k++) {
if (t->mIOPtrs.mergedTracks[k].OK()) {
nTracks++;
nAttachedClusters += t->mIOPtrs.mergedTracks[k].NClusters();
nAttachedClustersFitted += t->mIOPtrs.mergedTracks[k].NClustersFitted();
}
}
unsigned int nCls = configStandalone.configProc.doublePipeline ? t->mIOPtrs.clustersNative->nClustersTotal : t->GetTPCMerger().NMaxClusters();
for (unsigned int k = 0; k < nCls; k++) {
int attach = t->mIOPtrs.mergedTrackHitAttachment[k];
if (attach & GPUTPCGMMergerTypes::attachFlagMask) {
nAdjacentClusters++;
}
}
if (nTracksTotal && nClustersTotal) {
*nTracksTotal += nTracks;
*nClustersTotal += t->mIOPtrs.nMergedTrackHits;
}
char trdText[1024] = "";
if (t->GetRecoSteps() & GPUDataTypes::RecoStep::TRDTracking) {
int nTracklets = 0;
for (unsigned int k = 0; k < t->mIOPtrs.nTRDTracks; k++) {
auto& trk = t->mIOPtrs.trdTracks[k];
nTracklets += trk.GetNtracklets();
}
snprintf(trdText, 1024, " - TRD Tracker reconstructed %d tracks (%d tracklets)", t->mIOPtrs.nTRDTracks, nTracklets);
}
printf("Output Tracks: %d (%d / %d / %d / %d clusters (fitted / attached / adjacent / total))%s\n", nTracks, nAttachedClustersFitted, nAttachedClusters, nAdjacentClusters, nCls, trdText);
}
int RunBenchmark(GPUReconstruction* recUse, GPUChainTracking* chainTrackingUse, int runs, const GPUTrackingInOutPointers& ioPtrs, long long int* nTracksTotal, long long int* nClustersTotal, int threadId = 0, HighResTimer* timerPipeline = nullptr)
{
int iRun = 0, iteration = 0;
while ((iteration = nIteration.fetch_add(1)) < runs) {
if (configStandalone.runs > 1) {
printf("Run %d (thread %d)\n", iteration + 1, threadId);
}
recUse->SetResetTimers(iRun < configStandalone.runsInit);
if (configStandalone.outputcontrolmem) {
recUse->SetOutputControl(threadId ? outputmemoryPipeline.get() : outputmemory.get(), configStandalone.outputcontrolmem);
}
if (configStandalone.testSyncAsync) {
printf("Running synchronous phase\n");
}
chainTrackingUse->mIOPtrs = ioPtrs;
if (iteration == (configStandalone.configProc.doublePipeline ? 1 : (configStandalone.runs - 1))) {
if (configStandalone.configProc.doublePipeline) {
timerPipeline->Start();
}
if (configStandalone.controlProfiler) {
rec->startGPUProfiling();
}
}
int tmpRetVal = recUse->RunChains();
int iterationEnd = nIterationEnd.fetch_add(1);
if (iterationEnd == configStandalone.runs - 1) {
if (configStandalone.configProc.doublePipeline) {
timerPipeline->Stop();
}
if (configStandalone.controlProfiler) {
rec->endGPUProfiling();
}
}
if (tmpRetVal == 0 || tmpRetVal == 2) {
OutputStat(chainTrackingUse, iRun == 0 ? nTracksTotal : nullptr, iRun == 0 ? nClustersTotal : nullptr);
if (configStandalone.memoryStat) {
recUse->PrintMemoryStatistics();
} else if (configStandalone.DebugLevel >= 2) {
recUse->PrintMemoryOverview();
}
}
#ifdef HAVE_O2HEADERS
if (tmpRetVal == 0 && configStandalone.testSyncAsync) {
if (configStandalone.testSyncAsync) {
printf("Running asynchronous phase\n");
}
vecpod<char> compressedTmpMem(chainTracking->mIOPtrs.tpcCompressedClusters->totalDataSize);
memcpy(compressedTmpMem.data(), (const void*)chainTracking->mIOPtrs.tpcCompressedClusters, chainTracking->mIOPtrs.tpcCompressedClusters->totalDataSize);
chainTrackingAsync->mIOPtrs = ioPtrs;
chainTrackingAsync->mIOPtrs.tpcCompressedClusters = (o2::tpc::CompressedClustersFlat*)compressedTmpMem.data();
chainTrackingAsync->mIOPtrs.tpcZS = nullptr;
chainTrackingAsync->mIOPtrs.tpcPackedDigits = nullptr;
chainTrackingAsync->mIOPtrs.mcInfosTPC = nullptr;
chainTrackingAsync->mIOPtrs.nMCInfosTPC = 0;
chainTrackingAsync->mIOPtrs.mcLabelsTPC = nullptr;
chainTrackingAsync->mIOPtrs.nMCLabelsTPC = 0;
for (int i = 0; i < chainTracking->NSLICES; i++) {
chainTrackingAsync->mIOPtrs.clusterData[i] = nullptr;
chainTrackingAsync->mIOPtrs.nClusterData[i] = 0;
chainTrackingAsync->mIOPtrs.rawClusters[i] = nullptr;
chainTrackingAsync->mIOPtrs.nRawClusters[i] = 0;
}
chainTrackingAsync->mIOPtrs.clustersNative = nullptr;
recAsync->SetResetTimers(iRun < configStandalone.runsInit);
tmpRetVal = recAsync->RunChains();
if (tmpRetVal == 0 || tmpRetVal == 2) {
OutputStat(chainTrackingAsync, nullptr, nullptr);
if (configStandalone.memoryStat) {
recAsync->PrintMemoryStatistics();
}
}
recAsync->ClearAllocatedMemory();
}
#endif
if (!configStandalone.configProc.doublePipeline) {
recUse->ClearAllocatedMemory();
}
if (tmpRetVal == 2) {
configStandalone.continueOnError = 0; // Forced exit from event display loop
configStandalone.noprompt = 1;
}
if (tmpRetVal && !configStandalone.continueOnError) {
if (tmpRetVal != 2) {
printf("Error occured\n");
}
return 1;
}
iRun++;
}
if (configStandalone.configProc.doublePipeline) {
recUse->ClearAllocatedMemory();
}
return 0;
}
int main(int argc, char** argv)
{
std::unique_ptr<GPUReconstruction> recUnique, recUniqueAsync, recUniquePipeline;
SetCPUAndOSSettings();
if (ReadConfiguration(argc, argv)) {
return 1;
}
recUnique.reset(GPUReconstruction::CreateInstance(configStandalone.runGPU ? configStandalone.gpuType : GPUReconstruction::DEVICE_TYPE_NAMES[GPUReconstruction::DeviceType::CPU], configStandalone.runGPUforce));
rec = recUnique.get();
if (configStandalone.testSyncAsync) {
recUniqueAsync.reset(GPUReconstruction::CreateInstance(configStandalone.runGPU ? configStandalone.gpuType : GPUReconstruction::DEVICE_TYPE_NAMES[GPUReconstruction::DeviceType::CPU], configStandalone.runGPUforce, rec));
recAsync = recUniqueAsync.get();
}
if (configStandalone.configProc.doublePipeline) {
recUniquePipeline.reset(GPUReconstruction::CreateInstance(configStandalone.runGPU ? configStandalone.gpuType : GPUReconstruction::DEVICE_TYPE_NAMES[GPUReconstruction::DeviceType::CPU], configStandalone.runGPUforce, rec));
recPipeline = recUniquePipeline.get();
}
if (rec == nullptr || (configStandalone.testSyncAsync && recAsync == nullptr)) {
printf("Error initializing GPUReconstruction\n");
return 1;
}
rec->SetDebugLevelTmp(configStandalone.DebugLevel);
chainTracking = rec->AddChain<GPUChainTracking>();
if (configStandalone.testSyncAsync) {
if (configStandalone.DebugLevel >= 3) {
recAsync->SetDebugLevelTmp(configStandalone.DebugLevel);
}
chainTrackingAsync = recAsync->AddChain<GPUChainTracking>();
}
if (configStandalone.configProc.doublePipeline) {
if (configStandalone.DebugLevel >= 3) {
recPipeline->SetDebugLevelTmp(configStandalone.DebugLevel);
}
chainTrackingPipeline = recPipeline->AddChain<GPUChainTracking>();
}
#ifdef HAVE_O2HEADERS
if (!configStandalone.configProc.doublePipeline) {
chainITS = rec->AddChain<GPUChainITS>(0);
if (configStandalone.testSyncAsync) {
chainITSAsync = recAsync->AddChain<GPUChainITS>(0);
}
}
#endif
if (SetupReconstruction()) {
return 1;
}
std::unique_ptr<std::thread> pipelineThread;
if (configStandalone.configProc.doublePipeline) {
pipelineThread.reset(new std::thread([]() { rec->RunPipelineWorker(); }));
}
// hlt.SetRunMerger(configStandalone.merger); //TODO!
if (configStandalone.seed == -1) {
std::random_device rd;
configStandalone.seed = (int)rd();
printf("Using random seed %d\n", configStandalone.seed);
}
srand(configStandalone.seed);
for (nEventsInDirectory = 0; true; nEventsInDirectory++) {
std::ifstream in;
char filename[256];
snprintf(filename, 256, "events/%s/" GPUCA_EVDUMP_FILE ".%d.dump", configStandalone.EventsDir, nEventsInDirectory);
in.open(filename, std::ifstream::binary);
if (in.fail()) {
break;
}
in.close();
}
if (configStandalone.configTF.bunchSim || configStandalone.configTF.nMerge) {
tf.reset(new GPUReconstructionTimeframe(chainTracking, ReadEvent, nEventsInDirectory));
}
if (configStandalone.eventGenerator) {
genEvents::RunEventGenerator(chainTracking);
return 1;
} else {
int nEvents = configStandalone.NEvents;
if (configStandalone.configTF.bunchSim) {
nEvents = configStandalone.NEvents > 0 ? configStandalone.NEvents : 1;
} else {
if (nEvents == -1 || nEvents > nEventsInDirectory) {
if (nEvents >= 0) {
printf("Only %d events available in directors %s (%d events requested)\n", nEventsInDirectory, configStandalone.EventsDir, nEvents);
}
nEvents = nEventsInDirectory;
}
if (configStandalone.configTF.nMerge > 1) {
nEvents /= configStandalone.configTF.nMerge;
}
}
for (int iRun = 0; iRun < configStandalone.runs2; iRun++) {
if (configStandalone.configQA.inputHistogramsOnly) {
chainTracking->ForceInitQA();
break;
}
if (configStandalone.runs2 > 1) {
printf("RUN2: %d\n", iRun);
}
long long int nTracksTotal = 0;
long long int nClustersTotal = 0;
int nEventsProcessed = 0;
for (int iEvent = configStandalone.StartEvent; iEvent < nEvents; iEvent++) {
if (iEvent != configStandalone.StartEvent) {
printf("\n");
}
HighResTimer timerLoad;
timerLoad.Start();
if (configStandalone.configTF.bunchSim) {
if (tf->LoadCreateTimeFrame(iEvent)) {
break;
}
} else if (configStandalone.configTF.nMerge) {
if (tf->LoadMergedEvents(iEvent)) {
break;
}
} else {
if (ReadEvent(iEvent)) {
break;
}
}
bool encodeZS = configStandalone.encodeZS == -1 ? (chainTracking->mIOPtrs.tpcPackedDigits && !chainTracking->mIOPtrs.tpcZS) : (bool)configStandalone.encodeZS;
bool zsFilter = configStandalone.zsFilter == -1 ? (!encodeZS && chainTracking->mIOPtrs.tpcPackedDigits) : (bool)configStandalone.zsFilter;
if (encodeZS || zsFilter) {
if (!chainTracking->mIOPtrs.tpcPackedDigits) {
printf("Need digit input to run ZS\n");
goto breakrun;
}
if (zsFilter) {
chainTracking->ConvertZSFilter(configStandalone.zs12bit);
}
if (encodeZS) {
chainTracking->ConvertZSEncoder(configStandalone.zs12bit);
}
}
if (!configStandalone.configRec.runTransformation) {
chainTracking->mIOPtrs.clustersNative = nullptr;
} else {
for (int i = 0; i < chainTracking->NSLICES; i++) {
if (chainTracking->mIOPtrs.rawClusters[i]) {
if (configStandalone.DebugLevel >= 2) {
printf("Converting Legacy Raw Cluster to Native\n");
}
chainTracking->ConvertRun2RawToNative();
break;
}
}
}
if (configStandalone.stripDumpedEvents) {
if (chainTracking->mIOPtrs.tpcZS) {
chainTracking->mIOPtrs.tpcPackedDigits = nullptr;
}
}
if (configStandalone.dumpEvents) {
char fname[1024];
sprintf(fname, "event.%d.dump", nEventsProcessed);
chainTracking->DumpData(fname);
if (nEventsProcessed == 0) {
rec->DumpSettings();
}
}
if (configStandalone.overrideMaxTimebin && (chainTracking->mIOPtrs.clustersNative || chainTracking->mIOPtrs.tpcPackedDigits || chainTracking->mIOPtrs.tpcZS)) {
GPUSettingsEvent ev = rec->GetEventSettings();
if (ev.continuousMaxTimeBin == 0) {
printf("Cannot override max time bin for non-continuous data!\n");
} else {
ev.continuousMaxTimeBin = chainTracking->mIOPtrs.tpcZS ? GPUReconstructionConvert::GetMaxTimeBin(*chainTracking->mIOPtrs.tpcZS) : chainTracking->mIOPtrs.tpcPackedDigits ? GPUReconstructionConvert::GetMaxTimeBin(*chainTracking->mIOPtrs.tpcPackedDigits) : GPUReconstructionConvert::GetMaxTimeBin(*chainTracking->mIOPtrs.clustersNative);
printf("Max time bin set to %d\n", (int)ev.continuousMaxTimeBin);
rec->UpdateEventSettings(&ev);
}
}
if (!rec->GetParam().earlyTpcTransform && chainTracking->mIOPtrs.clustersNative == nullptr && chainTracking->mIOPtrs.tpcPackedDigits == nullptr && chainTracking->mIOPtrs.tpcZS == nullptr) {
printf("Need cluster native data for on-the-fly TPC transform\n");
goto breakrun;
}
printf("Loading time: %'d us\n", (int)(1000000 * timerLoad.GetCurrentElapsedTime()));
printf("Processing Event %d\n", iEvent);
GPUTrackingInOutPointers ioPtrSave = chainTracking->mIOPtrs;
nIteration.store(0);
nIterationEnd.store(0);
double pipelineWalltime = 1.;
if (configStandalone.configProc.doublePipeline) {
HighResTimer timerPipeline;
if (RunBenchmark(rec, chainTracking, 1, ioPtrSave, &nTracksTotal, &nClustersTotal)) {
goto breakrun;
}
nIteration.store(1);
nIterationEnd.store(1);
auto pipeline1 = std::async(std::launch::async, RunBenchmark, rec, chainTracking, configStandalone.runs, ioPtrSave, &nTracksTotal, &nClustersTotal, 0, &timerPipeline);
auto pipeline2 = std::async(std::launch::async, RunBenchmark, recPipeline, chainTrackingPipeline, configStandalone.runs, ioPtrSave, &nTracksTotal, &nClustersTotal, 1, &timerPipeline);
if (pipeline1.get() || pipeline2.get()) {
goto breakrun;
}
pipelineWalltime = timerPipeline.GetElapsedTime() / (configStandalone.runs - 1);
printf("Pipeline wall time: %f, %d iterations, %f per event\n", timerPipeline.GetElapsedTime(), configStandalone.runs - 1, pipelineWalltime);
} else {
if (RunBenchmark(rec, chainTracking, configStandalone.runs, ioPtrSave, &nTracksTotal, &nClustersTotal)) {
goto breakrun;
}
}
nEventsProcessed++;
if (configStandalone.timeFrameTime) {
double nClusters = chainTracking->GetTPCMerger().NMaxClusters();
if (nClusters > 0) {
double nClsPerTF = 550000. * 1138.3;
double timePerTF = (configStandalone.configProc.doublePipeline ? pipelineWalltime : ((configStandalone.DebugLevel ? rec->GetStatKernelTime() : rec->GetStatWallTime()) / 1000000.)) * nClsPerTF / nClusters;
double nGPUsReq = timePerTF / 0.02277;
char stat[1024];
snprintf(stat, 1024, "Sync phase: %.2f sec per 256 orbit TF, %.1f GPUs required", timePerTF, nGPUsReq);
if (configStandalone.testSyncAsync) {
timePerTF = (configStandalone.DebugLevel ? recAsync->GetStatKernelTime() : recAsync->GetStatWallTime()) / 1000000. * nClsPerTF / nClusters;
snprintf(stat + strlen(stat), 1024 - strlen(stat), " - Async phase: %f sec per TF", timePerTF);
}
printf("%s (Measured %s time - Extrapolated from %d clusters to %d)\n", stat, configStandalone.DebugLevel ? "kernel" : "wall", (int)nClusters, (int)nClsPerTF);
}
}
}
if (nEventsProcessed > 1) {
printf("Total: %lld clusters, %lld tracks\n", nClustersTotal, nTracksTotal);
}
}
}
breakrun:
if (rec->GetDeviceProcessingSettings().memoryAllocationStrategy == GPUMemoryResource::ALLOCATION_GLOBAL) {
rec->PrintMemoryMax();
}
#ifndef _WIN32
if (configStandalone.qa && configStandalone.fpe) {
fedisableexcept(FE_INVALID | FE_DIVBYZERO | FE_OVERFLOW);
}
#endif
if (configStandalone.configProc.doublePipeline) {
rec->TerminatePipelineWorker();
pipelineThread->join();
}
rec->Finalize();
if (configStandalone.outputcontrolmem && rec->IsGPU()) {
if (rec->unregisterMemoryForGPU(outputmemory.get()) || (configStandalone.configProc.doublePipeline && recPipeline->unregisterMemoryForGPU(outputmemoryPipeline.get()))) {
printf("Error unregistering memory\n");
}
}
rec->Exit();
if (!configStandalone.noprompt) {
printf("Press a key to exit!\n");
getchar();
}
return (0);
}
| 40.030494 | 346 | 0.702829 | [
"vector",
"transform"
] |
f1ac324fb2023affe4a487177b999a89135075c2 | 1,240 | cpp | C++ | codes/CF/1487/B.cpp | chessbot108/solved-problems | 0945be829a8ea9f0d5896c89331460d70d076691 | [
"MIT"
] | 2 | 2021-03-07T03:34:02.000Z | 2021-03-09T01:22:21.000Z | codes/CF/1487/B.cpp | chessbot108/solved-problems | 0945be829a8ea9f0d5896c89331460d70d076691 | [
"MIT"
] | 1 | 2021-03-27T15:01:23.000Z | 2021-03-27T15:55:34.000Z | codes/CF/1487/B.cpp | chessbot108/solved-problems | 0945be829a8ea9f0d5896c89331460d70d076691 | [
"MIT"
] | 1 | 2021-03-27T05:02:33.000Z | 2021-03-27T05:02:33.000Z | #include <iostream>
#include <cstdio>
#include <cstring>
#include <cstdlib>
#include <ctime>
#include <cmath>
#include <cassert>
#include <algorithm>
#include <vector>
#include <string>
#include <map>
#include <set>
#include <sstream>
#include <list>
#include <queue>
#include <stack>
//#include <unordered_map>
//#include <unordered_set>
#include <functional>
#define max_v 1100
#define int_max 0x3f3f3f3f
#define cont continue
#define pow_2(n) (1 << (n))
#define ll long long
//tree
#define lsb(n) ((n)&(-(n)))
#define LC(n) (((n) << 1) + 1)
#define RC(n) (((n) << 1) + 2)
#define LOG2(n) ((int)(ceil(log2((n)))))
using namespace std;
void setIO(const string& file_name){
freopen((file_name+".in").c_str(), "r", stdin);
freopen((file_name+".out").c_str(), "w+", stdout);
}
int main(){
cin.tie(0) -> sync_with_stdio(0);
int t; cin >> t;
while(t--){
ll n, k; cin >> n >> k;
if(n%2ll == 0ll){
ll ans = (k)%n;
cout << (ans ? ans : n) << endl;
cont;
}
ll x = n/2ll;
k--;
k %= (n * x);
//k is now 0 based
ll skipped = k/x;
ll should = k%n;
ll ans = skipped + should + 1ll;
ans %= n;
if(ans) cout << ans;
else cout << ans + n;
cout << endl;
}
return 0;
}
| 19.375 | 51 | 0.575 | [
"vector"
] |
f1b28ea179abef4a5ca44d541b5aa721b074b217 | 15,843 | cpp | C++ | libNCUI/module/dll/JsTypeMapHandler.cpp | realmark1r8h/tomoyadeng | aceab8fe403070bc12f9d49fdb7add0feb20424d | [
"BSD-2-Clause"
] | 24 | 2018-11-20T14:45:57.000Z | 2021-12-30T13:38:42.000Z | libNCUI/module/dll/JsTypeMapHandler.cpp | realmark1r8h/tomoyadeng | aceab8fe403070bc12f9d49fdb7add0feb20424d | [
"BSD-2-Clause"
] | null | null | null | libNCUI/module/dll/JsTypeMapHandler.cpp | realmark1r8h/tomoyadeng | aceab8fe403070bc12f9d49fdb7add0feb20424d | [
"BSD-2-Clause"
] | 11 | 2018-11-29T00:09:14.000Z | 2021-11-23T08:13:17.000Z | #include "stdafx.h"
#include "module/dll/JsTypeMapHandler.h"
#include <windows.h>
#include <amo/string.hpp>
#include <amo/logger.hpp>
#include "module/dll/TypeMapManager.h"
#include "module/dll/DllValueHandler.h"
namespace amo {
template < typename T >
void createHandler(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
CefRefPtr<DllValueHandler<T> > handler = new DllValueHandler<T>();
handler->val(object, arguments, retval, except);
retval = handler->getV8Object();
}
JsTypeMapHandler::JsTypeMapHandler() {
setHandlerName("window");
}
void JsTypeMapHandler::BOOL(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<bool>(object, arguments, retval, except);
}
void JsTypeMapHandler::INT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int32_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::INT8(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int8_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::INT16(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int16_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::INT32(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int32_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::INT64(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int64_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::UINT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<uint32_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::UINT8(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<uint8_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::UINT16(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<uint16_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::UINT32(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<uint32_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::UINT64(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<uint64_t>(object, arguments, retval, except);
}
void JsTypeMapHandler::CHAR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<char>(object, arguments, retval, except);
}
void JsTypeMapHandler::LONG(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<long>(object, arguments, retval, except);
}
void JsTypeMapHandler::ULONG(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<unsigned long>(object, arguments, retval, except);
}
void JsTypeMapHandler::FLOAT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<float>(object, arguments, retval, except);
}
void JsTypeMapHandler::DOUBLE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<double>(object, arguments, retval, except);
}
void JsTypeMapHandler::LDOUBLE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<long double>(object, arguments, retval, except);
}
void JsTypeMapHandler::STR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<std::string>(object, arguments, retval, except);
}
void JsTypeMapHandler::NIL(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<amo::nil>(object, arguments, retval, except);
}
void JsTypeMapHandler::BYTE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<::BYTE>(object, arguments, retval, except);
}
void JsTypeMapHandler::BSTR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::COLORREF(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::DWORD(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<::DWORD>(object, arguments, retval, except);
}
void JsTypeMapHandler::HANDLE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HBITMAP(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HBRUSH(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HCURSOR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HDC(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HFILE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HFONT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HHOOK(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HKEY(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HPEN(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::HWND(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LONGLONG(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<::LONGLONG>(object, arguments, retval, except);
}
void JsTypeMapHandler::LPARAM(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPBOOL(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPBYTE(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPCOLOREF(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPCSTR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPCTSTR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPVOID(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::LPDWORD(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::SHORT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<::SHORT>(object, arguments, retval, except);
}
void JsTypeMapHandler::VARIANT(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::WORD(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<::WORD>(object, arguments, retval, except);
}
void JsTypeMapHandler::WPARAM(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
}
void JsTypeMapHandler::INT_PTR(CefRefPtr<CefV8Value> object,
const CefV8ValueList& arguments,
CefRefPtr<CefV8Value>& retval,
CefString& except) {
createHandler<int*>(object, arguments, retval, except);
}
}
| 40.415816 | 74 | 0.461339 | [
"object"
] |
f1b853d707c49fd56301f799aced8881580937bc | 6,206 | cpp | C++ | GDML/GDML/GMLParser.cpp | gopi487krishna/GML | 06d8ee9f056af09e4034b2fa0fe11653a70d097c | [
"MIT"
] | 1 | 2020-03-19T04:24:09.000Z | 2020-03-19T04:24:09.000Z | GDML/GDML/GMLParser.cpp | gopi487krishna/GML | 06d8ee9f056af09e4034b2fa0fe11653a70d097c | [
"MIT"
] | null | null | null | GDML/GDML/GMLParser.cpp | gopi487krishna/GML | 06d8ee9f056af09e4034b2fa0fe11653a70d097c | [
"MIT"
] | null | null | null | #include "GDML.h"
const std::string& gml::ParsingTools::trim(std::string& tag_text, char trimchar)
{
auto it = std::remove(tag_text.begin(), tag_text.end(), trimchar);
tag_text.erase(it, tag_text.end());
return tag_text;
}
std::vector<std::string> gml::ParsingTools::splitIntoTokens(const std::string& tag_text, const char seperator)
{
std::vector<std::string> tag_collection;
std::string tag;
if (tag_text.empty())
{
return tag_collection;
}
for (auto character : tag_text)
{
if (character == seperator)
{
tag_collection.push_back(tag); tag.clear(); continue;
}
tag += character;
}
if (!tag.empty())
{
tag_collection.push_back(tag);
}
return tag_collection;
}
std::optional<std::pair<std::string, std::string>> gml::ParsingTools::splitIntoToken(const std::string& text, const char seperator, const std::vector<char>forbidden_list)
{
auto textbeg = text.begin();
auto textend = text.end();
//default position
auto seperator_pos = textend;
for (auto iterator = textbeg; iterator != textend; iterator++)
{
if (!isalpha(*iterator))
{
if (*iterator == seperator && seperator_pos == textend)
{
seperator_pos = iterator;
}
// For any other kind of character this function should not work
else if ((std::find(forbidden_list.begin(), forbidden_list.end(), *iterator) != forbidden_list.end()) && seperator_pos == textend)
{
return std::nullopt;
}
}
}
if (seperator_pos == textend)
{
return std::nullopt;
}
else if (seperator_pos == textbeg)
{
return std::nullopt;
}
else if (seperator_pos == textend - 1)
{
return std::make_pair(std::string(textbeg, textend - 1), std::string());
}
else
{
return std::make_pair(std::string(textbeg, seperator_pos), std::string(seperator_pos + 1, textend));
}
}
bool gml::ParsingTools::isClosed(const std::string& s1, const std::string& s2, char closing_character, char seperation_character)
{
if (*s2.begin() != closing_character) {
return false;
}
auto split_tag_value = splitIntoToken(s1, seperation_character, {});
return std::equal(split_tag_value->first.begin(), split_tag_value->first.end(), s2.begin() + 1, s2.end());
}
bool gml::ParsingTools::isClosed(std::string& str, char closing_character)
{
return str[0] == closing_character;
}
std::pair<gml::RawRecord, bool> gml::ParsingTools::fetchRawRecord(std::string::const_iterator stream_pos, const std::string::const_iterator end_pos, const gml::GDML_SYMBOL_PROFILE& syntax_profile) {
RawRecord gml_record;
// Gets the OpenBrace and CloseBrace position from the token_stream
auto getBraceOpenandClosePos = [&syntax_profile](std::string::const_iterator stream_start, std::string::const_iterator stream_end) {
auto open_brace_pos = std::find(stream_start, stream_end, syntax_profile.getOpenTag());
if (!(open_brace_pos == stream_end)) {
auto close_brace_pos = std::find(open_brace_pos, stream_end, syntax_profile.getCloseTag());
if (!(close_brace_pos == stream_end)) {
return std::make_pair(open_brace_pos, close_brace_pos);
}
}
return std::make_pair(stream_end, stream_end);
};
auto OTAG_brace_positions = getBraceOpenandClosePos(stream_pos, end_pos);
if (!(OTAG_brace_positions.first == end_pos || OTAG_brace_positions.second == end_pos)) {
// All the tokens inside [] are obtained
gml_record.open_tag_token_stream = std::string(OTAG_brace_positions.first + 1, OTAG_brace_positions.second);
trim(gml_record.open_tag_token_stream);
//***********************************
// Part for closing tag
//***********************************
//--------------------------------------------------------------------------------------------------------------------------
auto CTAG_brace_positions = getBraceOpenandClosePos(OTAG_brace_positions.second + 1, end_pos);
if (!(CTAG_brace_positions.first == end_pos || CTAG_brace_positions.second == end_pos)) {
// All the tokens inside [/] are obtained
gml_record.close_tag_token_stream = std::string(CTAG_brace_positions.first + 1, CTAG_brace_positions.second);
trim(gml_record.close_tag_token_stream);
if (gml::ParsingTools::isClosed(
gml_record.close_tag_token_stream,
syntax_profile.getClosingCharacter()
) ||
gml::ParsingTools::isClosed(
gml_record.open_tag_token_stream, gml_record.close_tag_token_stream,
syntax_profile.getClosingCharacter(),
syntax_profile.getTagValueSeperator()
)
) {
gml_record.inner_data = std::string(OTAG_brace_positions.second + 1, CTAG_brace_positions.first);
gml_record.record_end_position = CTAG_brace_positions.second;
return { gml_record,true };
}
}
}
return { RawRecord(),false };
}
std::optional<std::pair<std::string, gml::TagValue_T>> gml::ParsingTools::processSplitToken(const std::string& text, const GDML_SYMBOL_PROFILE& syntax_profile)
{
auto tag_value_pair = splitIntoToken(text, syntax_profile.getTagValueSeperator(), { syntax_profile.getAttributeListOpen(),syntax_profile.getAttributeListClose() });
if (tag_value_pair.has_value())
{
if ((!tag_value_pair->second.empty()) && *tag_value_pair->second.begin() == syntax_profile.getAttributeListOpen()) {
auto attribute_list_close_pos = std::find(tag_value_pair->second.begin(), tag_value_pair->second.end(), syntax_profile.getAttributeListClose());
//Covers the case if along with attribute list some other text was also specified like [print:{color:blue} This is not allowed] Hello [/]
if (!(attribute_list_close_pos == tag_value_pair->second.end() || attribute_list_close_pos != tag_value_pair->second.end() - 1)) {
std::string parse_string(tag_value_pair->second.begin() + 1, attribute_list_close_pos);
auto attributelist = splitIntoTokens(parse_string, syntax_profile.getAttributeSeperator());
std::map<std::string, std::string> my_map;
for (auto& tag : attributelist) {
auto x = splitIntoToken(tag, syntax_profile.getTagValueSeperator(), {});
my_map[x->first] = x->second;
}
return std::make_pair(tag_value_pair->first, std::move(my_map));
}
return std::nullopt;
}
return std::make_pair(tag_value_pair->first, tag_value_pair->second);
}
return std::nullopt;
}
| 29.273585 | 198 | 0.700129 | [
"vector"
] |
f1bc8507b9b3e1b6cfff2a9b014dfef776866fd2 | 1,827 | hpp | C++ | include/depthai/pipeline/datatype/StereoDepthConfig.hpp | SpectacularAI/depthai-core | 7516ca0d179c5f0769ecdab0020ac3a6de09cab9 | [
"MIT"
] | null | null | null | include/depthai/pipeline/datatype/StereoDepthConfig.hpp | SpectacularAI/depthai-core | 7516ca0d179c5f0769ecdab0020ac3a6de09cab9 | [
"MIT"
] | null | null | null | include/depthai/pipeline/datatype/StereoDepthConfig.hpp | SpectacularAI/depthai-core | 7516ca0d179c5f0769ecdab0020ac3a6de09cab9 | [
"MIT"
] | null | null | null | #pragma once
#include <unordered_map>
#include <vector>
#include "depthai-shared/datatype/RawStereoDepthConfig.hpp"
#include "depthai/pipeline/datatype/Buffer.hpp"
namespace dai {
/**
* StereoDepthConfig message.
*/
class StereoDepthConfig : public Buffer {
std::shared_ptr<RawBuffer> serialize() const override;
RawStereoDepthConfig& cfg;
public:
/**
* Construct StereoDepthConfig message.
*/
StereoDepthConfig();
explicit StereoDepthConfig(std::shared_ptr<RawStereoDepthConfig> ptr);
virtual ~StereoDepthConfig() = default;
/**
* Confidence threshold for disparity calculation
* @param confThr Confidence threshold value 0..255
*/
void setConfidenceThreshold(int confThr);
/**
* Get confidence threshold for disparity calculation
*/
int getConfidenceThreshold() const;
/**
* @param median Set kernel size for disparity/depth median filtering, or disable
*/
void setMedianFilter(dai::MedianFilter median);
/**
* Get median filter setting
*/
dai::MedianFilter getMedianFilter() const;
/**
* A larger value of the parameter means that farther colors within the pixel neighborhood will be mixed together,
* resulting in larger areas of semi-equal color.
* @param sigma Set sigma value for 5x5 bilateral filter. 0..65535
*/
void setBilateralFilterSigma(uint16_t sigma);
/**
* Get sigma value for 5x5 bilateral filter
*/
uint16_t getBilateralFilterSigma() const;
/**
* @param threshold Set threshold for left-right, right-left disparity map combine, 0..255
*/
void setLeftRightCheckThreshold(int threshold);
/**
* Get threshold for left-right check combine
*/
int getLeftRightCheckThreshold() const;
};
} // namespace dai
| 27.268657 | 118 | 0.68856 | [
"vector"
] |
f1be3d4b7b374af763594ae60d8c495a470f04f6 | 19,859 | cpp | C++ | RadeonGPUAnalyzerBackend/Src/beUtils.cpp | jeongjoonyoo/AMD_RGA | 26c6bfdf83f372eeadb1874420aa2ed55569d50f | [
"MIT"
] | null | null | null | RadeonGPUAnalyzerBackend/Src/beUtils.cpp | jeongjoonyoo/AMD_RGA | 26c6bfdf83f372eeadb1874420aa2ed55569d50f | [
"MIT"
] | null | null | null | RadeonGPUAnalyzerBackend/Src/beUtils.cpp | jeongjoonyoo/AMD_RGA | 26c6bfdf83f372eeadb1874420aa2ed55569d50f | [
"MIT"
] | null | null | null | //=================================================================
// Copyright 2017 Advanced Micro Devices, Inc. All rights reserved.
//=================================================================
// C++.
#include <algorithm>
#include <sstream>
#include <fstream>
#include <iostream>
#include <cctype>
#include <cwctype>
// Infra.
#ifdef _WIN32
#pragma warning(push)
#pragma warning(disable:4309)
#endif
#include <AMDTBaseTools/Include/gtAssert.h>
#include <AMDTOSWrappers/Include/osFilePath.h>
#include <AMDTOSWrappers/Include/osFile.h>
#include <AMDTOSWrappers/Include/osApplication.h>
#ifdef _WIN32
#pragma warning(pop)
#endif
// Local.
#include <RadeonGPUAnalyzerBackend/Include/beUtils.h>
#include <RadeonGPUAnalyzerBackend/Include/beStringConstants.h>
#include <DeviceInfoUtils.h>
#include <DeviceInfo.h>
// CLI.
#include <RadeonGPUAnalyzerCLI/Src/kcUtils.h>
// Constants.
static const char* STR_ERROR_CODE_OBJECT_PARSE_FAILURE = "Error: failed to parse Code Object .text section.";
static const char* STR_ERROR_LC_DISASSEMBLER_LAUNCH_FAILURE = "Error: failed to launch the LC disassembler.";
// *** INTERNALLY-LINKED AUXILIARY FUNCTIONS - BEGIN ***
// Converts string to its lower-case version.
std::string ToLower(const std::string& str)
{
std::string lstr = str;
std::transform(lstr.begin(), lstr.end(), lstr.begin(), [](const char& c) {return std::tolower(c); });
return lstr;
}
// Retrieves the list of devices according to the given HW generation.
static void AddGenerationDevices(GDT_HW_GENERATION hwGen, std::vector<GDT_GfxCardInfo>& cardList,
std::set<std::string> &uniqueNamesOfPublishedDevices, bool convertToLower = false)
{
std::vector<GDT_GfxCardInfo> cardListBuffer;
if (AMDTDeviceInfoUtils::Instance()->GetAllCardsInHardwareGeneration(hwGen, cardListBuffer))
{
cardList.insert(cardList.end(), cardListBuffer.begin(), cardListBuffer.end());
for (const GDT_GfxCardInfo& cardInfo : cardListBuffer)
{
uniqueNamesOfPublishedDevices.insert(convertToLower ? ToLower(cardInfo.m_szCALName) : cardInfo.m_szCALName);
}
}
}
// *** INTERNALLY-LINKED AUXILIARY FUNCTIONS - END ***
bool beUtils::GdtHwGenToNumericValue(GDT_HW_GENERATION hwGen, size_t& gfxIp)
{
const size_t BE_GFX_IP_6 = 6;
const size_t BE_GFX_IP_7 = 7;
const size_t BE_GFX_IP_8 = 8;
const size_t BE_GFX_IP_9 = 9;
const size_t BE_GFX_IP_10 = 10;
bool ret = true;
switch (hwGen)
{
case GDT_HW_GENERATION_SOUTHERNISLAND:
gfxIp = BE_GFX_IP_6;
break;
case GDT_HW_GENERATION_SEAISLAND:
gfxIp = BE_GFX_IP_7;
break;
case GDT_HW_GENERATION_VOLCANICISLAND:
gfxIp = BE_GFX_IP_8;
break;
case GDT_HW_GENERATION_GFX9:
gfxIp = BE_GFX_IP_9;
break;
case GDT_HW_GENERATION_GFX10:
gfxIp = BE_GFX_IP_10;
break;
case GDT_HW_GENERATION_NONE:
case GDT_HW_GENERATION_NVIDIA:
case GDT_HW_GENERATION_LAST:
default:
// We should not get here.
GT_ASSERT_EX(false, L"Unsupported HW Generation.");
ret = false;
break;
}
return ret;
}
bool beUtils::GdtHwGenToString(GDT_HW_GENERATION hwGen, std::string& hwGenAsStr)
{
const char* BE_GFX_IP_6 = "SI";
const char* BE_GFX_IP_7 = "CI";
const char* BE_GFX_IP_8 = "VI";
bool ret = true;
switch (hwGen)
{
case GDT_HW_GENERATION_SOUTHERNISLAND:
hwGenAsStr = BE_GFX_IP_6;
break;
case GDT_HW_GENERATION_SEAISLAND:
hwGenAsStr = BE_GFX_IP_7;
break;
case GDT_HW_GENERATION_VOLCANICISLAND:
hwGenAsStr = BE_GFX_IP_8;
break;
case GDT_HW_GENERATION_NONE:
case GDT_HW_GENERATION_NVIDIA:
case GDT_HW_GENERATION_LAST:
default:
// We should not get here.
GT_ASSERT_EX(false, L"Unsupported HW Generation.");
ret = false;
break;
}
return ret;
}
bool beUtils::GfxCardInfoSortPredicate(const GDT_GfxCardInfo& a, const GDT_GfxCardInfo& b)
{
// Generation is the primary key.
if (a.m_generation < b.m_generation) { return true; }
if (a.m_generation > b.m_generation) { return false; }
// CAL name is next.
int ret = ::strcmp(a.m_szCALName, b.m_szCALName);
if (ret < 0) { return true; }
if (ret > 0) { return false; }
// Marketing name next.
ret = ::strcmp(a.m_szMarketingName, b.m_szMarketingName);
if (ret < 0) { return true; }
if (ret > 0) { return false; }
// DeviceID last.
return a.m_deviceID < b.m_deviceID;
}
struct lex_compare {
bool operator() (const int64_t& lhs, const int64_t& rhs) const
{
}
};
bool beUtils::GetAllGraphicsCards(std::vector<GDT_GfxCardInfo>& cardList,
std::set<std::string>& uniqueNamesOfPublishedDevices,
bool convertToLower /*= false*/)
{
// Retrieve the list of devices for every relevant hardware generations.
AddGenerationDevices(GDT_HW_GENERATION_SOUTHERNISLAND, cardList, uniqueNamesOfPublishedDevices, convertToLower);
AddGenerationDevices(GDT_HW_GENERATION_SEAISLAND, cardList, uniqueNamesOfPublishedDevices, convertToLower);
AddGenerationDevices(GDT_HW_GENERATION_VOLCANICISLAND, cardList, uniqueNamesOfPublishedDevices, convertToLower);
AddGenerationDevices(GDT_HW_GENERATION_GFX9, cardList, uniqueNamesOfPublishedDevices, convertToLower);
AddGenerationDevices(GDT_HW_GENERATION_GFX10, cardList, uniqueNamesOfPublishedDevices, convertToLower);
return (!cardList.empty() && !uniqueNamesOfPublishedDevices.empty());
}
bool beUtils::GetMarketingNameToCodenameMapping(std::map<std::string, std::set<std::string>>& cardsMap)
{
std::vector<GDT_GfxCardInfo> cardList;
std::set<std::string> uniqueNames;
// Retrieve the list of all supported cards.
bool ret = GetAllGraphicsCards(cardList, uniqueNames);
if (ret)
{
for (const GDT_GfxCardInfo& card : cardList)
{
if (card.m_szMarketingName != nullptr &&
card.m_szCALName != nullptr &&
(strlen(card.m_szMarketingName) > 1) &&
(strlen(card.m_szCALName) > 1))
{
// Create the key string.
std::string displayName;
ret = AMDTDeviceInfoUtils::Instance()->GetHardwareGenerationDisplayName(card.m_generation, displayName);
if (ret)
{
std::stringstream nameBuilder;
nameBuilder << card.m_szCALName << " (" << displayName << ")";
// Add this item to the relevant container in the map.
cardsMap[nameBuilder.str()].insert(card.m_szMarketingName);
}
}
}
}
return ret;
}
void beUtils::DeleteOutputFiles(const beProgramPipeline& outputFilePaths)
{
DeleteFileFromDisk(outputFilePaths.m_vertexShader);
DeleteFileFromDisk(outputFilePaths.m_tessControlShader);
DeleteFileFromDisk(outputFilePaths.m_tessEvaluationShader);
DeleteFileFromDisk(outputFilePaths.m_geometryShader);
DeleteFileFromDisk(outputFilePaths.m_fragmentShader);
DeleteFileFromDisk(outputFilePaths.m_computeShader);
}
void beUtils::DeleteFileFromDisk(const gtString& filePath)
{
osFilePath osPath(filePath);
if (osPath.exists())
{
osFile osFile(osPath);
osFile.deleteFile();
}
}
void beUtils::DeleteFileFromDisk(const std::string& filePath)
{
gtString gPath;
gPath << filePath.c_str();
return DeleteFileFromDisk(gPath);
}
bool beUtils::IsFilePresent(const std::string& fileName)
{
bool ret = true;
if (!fileName.empty())
{
std::ifstream file(fileName);
ret = (file.good() && file.peek() != std::ifstream::traits_type::eof());
}
return ret;
}
std::string beUtils::GetFileExtension(const std::string& fileName)
{
size_t offset = fileName.rfind('.');
const std::string& ext = (offset != std::string::npos && ++offset < fileName.size()) ? fileName.substr(offset) : "";
return ext;
}
bool beUtils::ReadBinaryFile(const std::string& fileName, std::vector<char>& content)
{
bool ret = false;
std::ifstream input;
input.open(fileName.c_str(), std::ios::binary);
if (input.is_open())
{
content = std::vector<char>(std::istreambuf_iterator<char>(input), {});
ret = !content.empty();
}
return ret;
}
bool beUtils::IsFilesIdentical(const std::string& fileName1, const std::string& fileName2)
{
std::vector<char> content1;
std::vector<char> content2;
bool isFileRead1 = beUtils::ReadBinaryFile(fileName1, content1);
bool isFileRead2 = beUtils::ReadBinaryFile(fileName2, content2);
return (isFileRead1 && isFileRead2 && std::equal(content1.begin(), content1.end(), content2.begin()));
}
void beUtils::PrintCmdLine(const std::string & cmdLine, bool doPrint)
{
if (doPrint)
{
std::cout << std::endl << BE_STR_LAUNCH_EXTERNAL_PROCESS << cmdLine << std::endl << std::endl;
}
}
void beUtils::splitString(const std::string& str, char delim, std::vector<std::string>& dst)
{
std::stringstream ss;
ss.str(str);
std::string substr;
while (std::getline(ss, substr, delim))
{
dst.push_back(substr);
}
}
bool beUtils::DeviceNameLessThan(const std::string& a, const std::string& b)
{
const char* GFX_NOTATION_TOKEN = "gfx";
bool ret = true;
size_t szA = a.find(GFX_NOTATION_TOKEN);
size_t szB = b.find(GFX_NOTATION_TOKEN);
if (szA == std::string::npos && szB == std::string::npos)
{
// Neither name is in gfx-notation, compare using standard string logic.
ret = a.compare(b) < 0;
}
else if (!(szA != std::string::npos && szB != std::string::npos))
{
// Only one name has the gfx notation, assume that it is a newer generation.
ret = (szB != std::string::npos);
}
else
{
// Both names are in gfx notation, compare according to the number.
std::vector<std::string> splitA;
std::vector<std::string> splitB;
beUtils::splitString(a, 'x', splitA);
beUtils::splitString(b, 'x', splitB);
assert(splitA.size() > 1);
assert(splitB.size() > 1);
if (splitA.size() > 1 && splitB.size() > 1)
{
try
{
int numA = std::stoi(splitA[1], nullptr);
int numB = std::stoi(splitB[1], nullptr);
ret = ((numB - numA) > 0);
}
catch (...)
{
ret = false;
}
}
}
return ret;
}
bool beUtils::DisassembleCodeObject(const std::string& coFileName, bool shouldPrintCmd,
std::string& disassemblyWhole, std::string& disassemblyText, std::string& errorMsg)
{
// Build the command.
std::stringstream cmd;
cmd << coFileName;
osFilePath lcDisassemblerExe;
long exitCode = 0;
osGetCurrentApplicationPath(lcDisassemblerExe, false);
lcDisassemblerExe.appendSubDirectory(LC_DISASSEMBLER_DIR);
lcDisassemblerExe.setFileName(LC_DISASSEMBLER_EXE);
// Clear the error message buffer.
errorMsg.clear();
std::string outText;
kcUtils::ProcessStatus status = kcUtils::LaunchProcess(lcDisassemblerExe.asString().asASCIICharArray(),
cmd.str(),
"",
PROCESS_WAIT_INFINITE,
shouldPrintCmd,
outText,
errorMsg,
exitCode);
// Extract the .text disassembly.
assert(!outText.empty());
disassemblyWhole = outText;
if (!disassemblyWhole.empty())
{
// Find where the .text section starts.
size_t textOffsetStart = disassemblyWhole.find(".text");
assert(textOffsetStart != std::string::npos);
assert(textOffsetStart != std::string::npos &&
textOffsetStart < disassemblyWhole.size() + 5);
if (textOffsetStart < disassemblyWhole.size() + 5)
{
// Skip .text identifier.
textOffsetStart += 5;
// Find where the relevant portion of the disassembly ends.
size_t textOffsetEnd = disassemblyWhole.find("s_code_end");
assert(textOffsetEnd != std::string::npos);
if (textOffsetEnd != std::string::npos)
{
// Extract the relevant section.
size_t numCharacters = textOffsetEnd - textOffsetStart;
assert(numCharacters > 0);
assert(numCharacters < disassemblyWhole.size() - textOffsetStart);
if (numCharacters > 0 && numCharacters < disassemblyWhole.size() - textOffsetStart)
{
disassemblyText = disassemblyWhole.substr(textOffsetStart, numCharacters);
}
else if (errorMsg.empty())
{
errorMsg = STR_ERROR_CODE_OBJECT_PARSE_FAILURE;
}
}
else if (errorMsg.empty())
{
errorMsg = STR_ERROR_CODE_OBJECT_PARSE_FAILURE;
}
}
}
if (disassemblyText.empty())
{
if (status == kcUtils::ProcessStatus::Success && errorMsg.empty())
{
errorMsg = STR_ERROR_LC_DISASSEMBLER_LAUNCH_FAILURE;
}
}
return (status == kcUtils::ProcessStatus::Success ? beStatus_SUCCESS : beStatus_dx12BackendLaunchFailure);
}
static bool ExtractAttributeValue(const std::string &disassemblyWhole, size_t kdPos, const std::string& attributeName, uint32_t& value)
{
bool ret = false;
bool shouldAbort = false;
bool isBefore = false;
try
{
// Offset where our attribute is within the string.
size_t startPosTemp = 0;
// The reference symbol.
const std::string KD_SYMBOL_TOKEN = ".symbol:";
if (attributeName < KD_SYMBOL_TOKEN)
{
// Look before the reference symbol.
startPosTemp = disassemblyWhole.rfind(attributeName, kdPos);
isBefore = true;
}
else if (attributeName > KD_SYMBOL_TOKEN)
{
// Look after the reference symbol.
startPosTemp = disassemblyWhole.find(attributeName, kdPos);
}
else
{
// We shouldn't get here.
assert(false);
shouldAbort = true;
}
if (!shouldAbort)
{
startPosTemp += attributeName.size();
assert((isBefore && startPosTemp < kdPos) || (!isBefore && startPosTemp > kdPos));
if ((isBefore && startPosTemp < kdPos) || (!isBefore && startPosTemp > kdPos))
{
while (std::iswspace(disassemblyWhole[++startPosTemp]));
assert((isBefore && startPosTemp < kdPos) || (!isBefore && startPosTemp > kdPos));
if ((isBefore && startPosTemp < kdPos) || (!isBefore && startPosTemp > kdPos))
{
size_t endPos = startPosTemp;
while (!std::iswspace(disassemblyWhole[++endPos]));
assert(startPosTemp < endPos);
if (startPosTemp < endPos)
{
// Extract the string representing the value and convert to non-negative decimal number.
std::string valueAsStr = disassemblyWhole.substr(startPosTemp, endPos - startPosTemp);
std::stringstream conversionStream;
conversionStream << std::hex << valueAsStr;
conversionStream >> value;
ret = true;
}
}
}
}
}
catch (...)
{
// Failure occurred.
ret = false;
}
return ret;
}
bool beUtils::ExtractCodeObjectStatistics(const std::string& disassemblyWhole,
std::map<std::string, beKA::AnalysisData>& dataMap)
{
bool ret = false;
dataMap.clear();
const char* KERNEL_SYMBOL_TOKEN = ".kd";
size_t startPos = disassemblyWhole.find(KERNEL_SYMBOL_TOKEN);
while (startPos != std::string::npos)
{
// Extract the kernel name.
std::string kernelName;
size_t startPosTemp = startPos;
std::stringstream kernelNameStream;
while (--startPosTemp > 0 && !std::iswspace(disassemblyWhole[startPosTemp]));
assert(startPosTemp + 1 < startPos - 1);
if (startPosTemp + 1 < startPos - 1)
{
kernelName = disassemblyWhole.substr(startPosTemp + 1, startPos - startPosTemp - 1);
auto iter = dataMap.find(kernelName);
assert(iter == dataMap.end());
if (iter == dataMap.end())
{
// LDS.
const std::string LDS_USAGE_TOKEN = ".group_segment_fixed_size:";
uint32_t ldsUsage = 0;
bool isOk = ExtractAttributeValue(disassemblyWhole, startPos, LDS_USAGE_TOKEN, ldsUsage);
assert(isOk);
// SGPR count.
const std::string SGPR_COUNT_TOKEN = ".sgpr_count:";
uint32_t sgprCount = 0;
isOk = ExtractAttributeValue(disassemblyWhole, startPos, SGPR_COUNT_TOKEN, sgprCount);
assert(isOk);
// SGPR spill count.
const std::string SGPR_SPILL_COUNT_TOKEN = ".sgpr_spill_count:";
uint32_t sgprSpillCount = 0;
isOk = ExtractAttributeValue(disassemblyWhole, startPos, SGPR_SPILL_COUNT_TOKEN, sgprSpillCount);
assert(isOk);
// VGPR count.
const std::string VGPR_COUNT_TOKEN = ".vgpr_count:";
uint32_t vgprCount = 0;
isOk = ExtractAttributeValue(disassemblyWhole, startPos, VGPR_COUNT_TOKEN, vgprCount);
assert(isOk);
// VGPR spill count.
const std::string VGPR_SPILL_COUNT_TOKEN = ".vgpr_spill_count";
uint32_t vgprSpillCount = 0;
isOk = ExtractAttributeValue(disassemblyWhole, startPos, VGPR_SPILL_COUNT_TOKEN, vgprSpillCount);
assert(isOk);
// Wavefront size.
const std::string WAVEFRONT_SIZE_TOKEN = ".wavefront_size:";
uint32_t wavefrontSize = 0;
isOk = ExtractAttributeValue(disassemblyWhole, startPos, WAVEFRONT_SIZE_TOKEN, wavefrontSize);
assert(isOk);
// Add values which were extracted from the Code Object meta data.
AnalysisData data;
data.LDSSizeUsed = ldsUsage;
data.numSGPRsUsed = sgprCount;
data.numSGPRSpills = sgprSpillCount;
data.numVGPRsUsed = vgprCount;
data.numVGPRSpills = vgprSpillCount;
data.wavefrontSize = wavefrontSize;
// Add fixed values.
data.LDSSizeAvailable = 65536;
data.numVGPRsAvailable = 256;
data.numSGPRsAvailable = 104;
// Add the kernel's stats to the map.
dataMap[kernelName] = data;
// Move to the next kernel.
startPos = disassemblyWhole.find(KERNEL_SYMBOL_TOKEN, startPos + 1);
}
}
}
ret = !dataMap.empty();
return ret;
}
| 33.831346 | 136 | 0.597412 | [
"object",
"vector",
"transform"
] |
f1bfcc6028dc8c54b084b8874faf843daee7e3be | 2,445 | cpp | C++ | main.cpp | lukaszplk/conv_hex_to_dec_and_back | d2a15f77effcdae525aca3840dd42ca776efb7df | [
"MIT"
] | null | null | null | main.cpp | lukaszplk/conv_hex_to_dec_and_back | d2a15f77effcdae525aca3840dd42ca776efb7df | [
"MIT"
] | null | null | null | main.cpp | lukaszplk/conv_hex_to_dec_and_back | d2a15f77effcdae525aca3840dd42ca776efb7df | [
"MIT"
] | null | null | null | #include <string>
#include<iostream>
#include<vector>
#include <algorithm>
#include <math.h>
using namespace std;
int strtoi(string x) {
int num = 0;
for (int i = 0; i < x.length(); i++) {
num = num * 10 + (int(x[i]) - 48);
}
return num;
}
string conv(int n, int m)
{
string num = "";
int rest;
if(n == 0){
num +='0';
}
while (n != 0) {
rest = n % m;
if (rest > 9)
num += rest + 55;
else
num += rest + 48;
n /= m;
}
reverse(num.begin(), num.end());
return num;
}
int main(){
vector<string> vec;
string input_string = "0", hex_num_str, final_hex;
int dec_num;
while(input_string.compare("-1") != 0){
cin >> input_string;
dec_num = 0;
if(input_string[0] == '0' && input_string[1] == 'x'){
for(int i = input_string.size()-1; i > 1; i--){
if(input_string.substr(i,1) == "A"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 10;
}else if(input_string.substr(i,1) == "B"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 11;
}else if(input_string.substr(i,1)=="C"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 12;
}else if(input_string.substr(i,1)=="D"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 13;
}else if(input_string.substr(i,1)=="E"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 14;
}else if(input_string.substr(i,1)=="F"){
dec_num += (pow(16, (((input_string.size()-1)-i)))) * 15;
}else{
dec_num += pow(16, (((input_string.size()-1)-i))) * strtoi(input_string.substr(i,1));
}
}
vec.push_back(conv(dec_num, 10));
}else{
dec_num = strtoi(input_string);
hex_num_str = conv(dec_num, 16);
final_hex = "0x";
for(int i=0; i < hex_num_str.length(); i++){
final_hex.push_back(hex_num_str[i]);
}
vec.push_back(final_hex);
}
}
for(int i = 0; i < vec.size()-1; i++){
cout << vec[i] << "\n";
}
}
| 29.817073 | 106 | 0.428221 | [
"vector"
] |
f1c8955c0f9d1855d4e9cf4470253161b3321bf4 | 2,623 | cpp | C++ | src/boost_python_exception/standard_exception_translator.cpp | abingham/boost_python_exception | 7882d5e8df051494498a58c06e046cb52421620b | [
"BSL-1.0"
] | 1 | 2015-03-28T08:28:56.000Z | 2015-03-28T08:28:56.000Z | src/boost_python_exception/standard_exception_translator.cpp | abingham/boost_python_exception | 7882d5e8df051494498a58c06e046cb52421620b | [
"BSL-1.0"
] | 3 | 2015-01-08T08:10:55.000Z | 2015-01-08T10:20:42.000Z | src/boost_python_exception/standard_exception_translator.cpp | abingham/boost_python_exception | 7882d5e8df051494498a58c06e046cb52421620b | [
"BSL-1.0"
] | 2 | 2018-11-13T07:42:31.000Z | 2020-03-10T22:43:31.000Z | #include <boost_python_exception/standard_exception_translator.hpp>
#include <sstream>
#include <boost/python/extract.hpp>
#include <boost/assign/list_of.hpp>
#include <boost/foreach.hpp>
#include <boost_python_exception/exceptions.hpp>
#include <boost_python_exception/python_compat.hpp>
#include <boost_python_exception/util.hpp>
namespace bp = boost::python;
namespace boost_python_exception {
namespace {
std::string make_syntax_error_message(bp::object error)
{
std::string const module_name = bp::extract<std::string>(error.attr("filename"));
std::string const code = bp::extract<std::string>(error.attr("text"));
// for some reason, extract<long> does not work while a python error is set, so do it with CPython
long const line_number = python_integral_as_long(bp::object(error.attr("lineno")).ptr());
long const pos_in_line = python_integral_as_long(bp::object(error.attr("offset")).ptr());
std::ostringstream message;
message << "In module \"" << module_name << "\", line " << line_number << ", position " << pos_in_line << ":\n";
message << "Offending code: " << code;
message << " " << std::string(pos_in_line-1, ' ') << "^";
return message.str();
}
void throw_syntax_error(exception_info const & exc_info)
{
throw syntax_error(
extract_exception_type(exc_info.type),
make_syntax_error_message(exc_info.value),
extract_traceback(exc_info.traceback));
}
}
exception_translator create_standard_exception_translator()
{
exception_translator translator;
typedef std::map<std::string const, exception_translator::thrower> translation_map;
// To add new translations, simply update the contents of this map.
translation_map translations =
boost::assign::map_list_of
("AttributeError", throw_with_python_info<attribute_error>)
("ImportError", throw_with_python_info<import_error>)
("IndexError", throw_with_python_info<index_error>)
("IOError", throw_with_python_info<io_error>)
("KeyError", throw_with_python_info<key_error>)
("TypeError", throw_with_python_info<type_error>)
("ReferenceError", throw_with_python_info<reference_error>)
("ValueError", throw_with_python_info<value_error>)
("StopIteration", throw_with_python_info<stop_iteration>)
("SyntaxError", throw_syntax_error)
;
BOOST_FOREACH(translation_map::value_type const & mapping, translations)
{
translator.add(
builtins().attr(mapping.first.c_str()),
mapping.second);
}
return translator;
}
}
| 33.628205 | 116 | 0.704156 | [
"object"
] |
f1d3fcf1f0d57a1cdc202b51dc9b5dbe920f16a7 | 1,071 | hpp | C++ | src/topfd/common/topfd_process.hpp | toppic-suite/toppic-suite | b5f0851f437dde053ddc646f45f9f592c16503ec | [
"Apache-2.0"
] | 8 | 2018-05-23T14:37:31.000Z | 2022-02-04T23:48:38.000Z | src/topfd/common/topfd_process.hpp | toppic-suite/toppic-suite | b5f0851f437dde053ddc646f45f9f592c16503ec | [
"Apache-2.0"
] | 9 | 2019-08-31T08:17:45.000Z | 2022-02-11T20:58:06.000Z | src/topfd/common/topfd_process.hpp | toppic-suite/toppic-suite | b5f0851f437dde053ddc646f45f9f592c16503ec | [
"Apache-2.0"
] | 4 | 2018-04-25T01:39:38.000Z | 2020-05-20T19:25:07.000Z | //Copyright (c) 2014 - 2020, The Trustees of Indiana University.
//
//Licensed under the Apache License, Version 2.0 (the "License");
//you may not use this file except in compliance with the License.
//You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
//Unless required by applicable law or agreed to in writing, software
//distributed under the License is distributed on an "AS IS" BASIS,
//WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
//See the License for the specific language governing permissions and
//limitations under the License.
#ifndef TOPPIC_TOPFD_COMMON_TOPFD_PROCESS_HPP_
#define TOPPIC_TOPFD_COMMON_TOPFD_PROCESS_HPP_
#include <string>
#include <vector>
#include "topfd/common/topfd_para.hpp"
namespace toppic {
namespace topfd_process {
int processOneFile(TopfdParaPtr para_ptr,
const std::string &spec_file_name,
int frac_id);
int process(TopfdParaPtr para_ptr,
std::vector<std::string> spec_file_lst);
}
}
#endif
| 27.461538 | 74 | 0.734827 | [
"vector"
] |
f1d5f302161b7e083e2968340de5b65336f768a8 | 3,580 | cpp | C++ | src/prelude.cpp | mpetri/ans-large-alphabet | 416c7e794a3f6ffa4db4d327b4ac2f3c229e99ff | [
"Apache-2.0"
] | null | null | null | src/prelude.cpp | mpetri/ans-large-alphabet | 416c7e794a3f6ffa4db4d327b4ac2f3c229e99ff | [
"Apache-2.0"
] | null | null | null | src/prelude.cpp | mpetri/ans-large-alphabet | 416c7e794a3f6ffa4db4d327b4ac2f3c229e99ff | [
"Apache-2.0"
] | null | null | null | // Licensed to the Apache Software Foundation (ASF) under one
// or more contributor license agreements. See the NOTICE file
// distributed with this work for additional information
// regarding copyright ownership. The ASF licenses this file
// to you under the Apache License, Version 2.0 (the
// "License"); you may not use this file except in compliance
// with the License. You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing,
// software distributed under the License is distributed on an
// "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
// KIND, either express or implied. See the License for the
// specific language governing permissions and limitations
// under the License.
#include <iostream>
#include <vector>
#define RECORD_STATS 1
#include "cutil.hpp"
#include "methods.hpp"
#include "stats.hpp"
#include "util.hpp"
#include <boost/filesystem.hpp>
#include <boost/program_options.hpp>
#include <boost/regex.hpp>
namespace po = boost::program_options;
namespace fs = boost::filesystem;
po::variables_map parse_cmdargs(int argc, char const* argv[])
{
po::variables_map vm;
po::options_description desc("Allowed options");
// clang-format off
desc.add_options()
("help,h", "produce help message")
("text,t", "text input (default is uint32_t binary)")
("input,i",po::value<std::string>()->required(), "the input dir");
// clang-format on
try {
po::store(po::parse_command_line(argc, argv, desc), vm);
if (vm.count("help")) {
std::cout << desc << "\n";
exit(EXIT_SUCCESS);
}
po::notify(vm);
} catch (const po::required_option& e) {
std::cout << desc;
std::cerr << "Missing required option: " << e.what() << std::endl;
exit(EXIT_FAILURE);
} catch (po::error& e) {
std::cout << desc;
std::cerr << "Error parsing cmdargs: " << e.what() << std::endl;
exit(EXIT_FAILURE);
}
return vm;
}
int main(int argc, char const* argv[])
{
auto cmdargs = parse_cmdargs(argc, argv);
auto input_dir = cmdargs["input"].as<std::string>();
boost::regex input_file_filter(".*\\.u32");
if (cmdargs.count("text")) {
input_file_filter = boost::regex(".*\\.txt");
}
// single file also works!
boost::filesystem::path p(input_dir);
if (boost::filesystem::is_regular_file(p)) {
input_file_filter = boost::regex(p.filename().string());
input_dir = p.parent_path().string();
}
boost::filesystem::directory_iterator
end_itr; // Default ctor yields past-the-end
for (boost::filesystem::directory_iterator i(input_dir); i != end_itr;
++i) {
if (!boost::filesystem::is_regular_file(i->status()))
continue;
boost::smatch what;
if (!boost::regex_match(
i->path().filename().string(), what, input_file_filter))
continue;
std::string file_name = i->path().string();
std::vector<uint32_t> input_u32s;
if (cmdargs.count("text")) {
input_u32s = read_file_text(file_name);
} else {
input_u32s = read_file_u32(file_name);
}
std::string short_name = i->path().stem().string();
uint32_t max_sigma = 0;
for (auto x : input_u32s)
max_sigma = std::max(x, max_sigma);
std::cout << short_name << "\t " << max_sigma << std::endl;
}
return EXIT_SUCCESS;
}
| 32.252252 | 74 | 0.623743 | [
"vector"
] |
f1d66dff5c0604dab89dd84f2ad1a740e3b74f42 | 5,469 | cpp | C++ | source/DrawArea.cpp | X-141/JpDrawApplication | 365bd934bf907465f9dcd0d331c8f0ebb350c2c3 | [
"MIT"
] | 1 | 2021-06-08T00:01:17.000Z | 2021-06-08T00:01:17.000Z | source/DrawArea.cpp | X-141/JpDrawApplication | 365bd934bf907465f9dcd0d331c8f0ebb350c2c3 | [
"MIT"
] | null | null | null | source/DrawArea.cpp | X-141/JpDrawApplication | 365bd934bf907465f9dcd0d331c8f0ebb350c2c3 | [
"MIT"
] | null | null | null | #include "DrawArea.hpp"
#include <QPainter>
#include <QMouseEvent>
#include <QPixmap>
#include <QDir>
#include <QVector>
#include <QRegularExpression>
#include "ImageProcessMethods.hpp"
#include "opencv2/imgproc.hpp"
#include "Log.hpp"
std::string resourcePath = "../resource/";
DrawArea::DrawArea(QWidget* parent)
: QLabel(parent),
mCurrentlyDrawing(false),
mHardLayer(this->size(), 0),
mVirtualLayer(this->size(), 0),
mId(1),
mPenWidth(30),
mKnn(cv::ml::KNearest::load(resourcePath + "kNN_ETL_Subset.opknn")),
mKnnDictFilepath(resourcePath + "kNNDictionary.txt")
{
this->clear();
mHardLayer.fill(); // set to white.
this->setPixmap(mHardLayer);
mVirtualLayerVector.reserve(32);
pResourceCharacterImages();
}
void
DrawArea::mousePressEvent(QMouseEvent* event) {
// qDebug() << "Mouse press: " << event->pos() << "\n";
//mVirtualLayer = DrawLayer(this->size(), mId++);
mVirtualLayer.setId(mId++);
mVirtualLayer.fill(Qt::transparent);
updateDrawArea();
// Indicate that we are beginning to draw.
mCurrentlyDrawing = true;
// Draw the starting point.
mPrevPoint = event->pos();
pDrawPoint(event->pos());
}
void
DrawArea::mouseReleaseEvent(QMouseEvent* event) {
// qDebug() << "Mouse release: " << event->pos() << "\n";
// Add the finished layer to layer vector
mVirtualLayer.setEnableStatus(true);
mVirtualLayerVector.append(mVirtualLayer);
// Call update handle to let other objects or owner
// know of the changes.
layerUpdateHandle();
// We have finished drawing the layer
mCurrentlyDrawing = false;
// Indicate that the mPrevPoint is invalid.
mPrevPoint = QPoint(-1,-1);
}
void
DrawArea::mouseMoveEvent(QMouseEvent *event) {
if(mCurrentlyDrawing)
pDrawPoint(event->pos());
}
void
DrawArea::resizeDrawArea(QSize aSize) {
// First clear out current label and resize
this->clear();
resize(aSize);
// Be careful, We are not really copying any pixel data
// from the original pixmap(s), we are just resizing.
mHardLayer = DrawLayer(aSize, mHardLayer.getId());
mVirtualLayer = DrawLayer(aSize, mVirtualLayer.getId());
// Set the pixmap in this object (recall we are a QLabel).
this->setPixmap(mHardLayer);
}
void
DrawArea::updateDrawArea() {
this->clear();
//mHardLayer = DrawLayer(this->size(), mVirtualLayer.getId());
mHardLayer.fill();
QPainter painter = QPainter(&mHardLayer);
for(const auto& layers: mVirtualLayerVector)
if(layers.isEnabled())
painter.drawPixmap(0,0, layers);
this->setPixmap(mHardLayer);
painter.end();
}
QImage
DrawArea::generateImage() {
return mHardLayer.toImage();
}
void
DrawArea::setPenWidth(int width) {
if (width >= 1)
mPenWidth = width;
else
LOG(level::warning, "DrawArea::setPenWidth()","Tried to set pen width < 1.");
}
int
DrawArea::compareLayer() {
// we will get the entire draw area.
cv::Mat hardLayerMat = ImageMethods::qImageToCvMat(generateImage().copy(0,0, 384, 384));
// for our image we do need to invert the colors from white-bg black-fg to white-fg black-bg
cv::bitwise_not(hardLayerMat, hardLayerMat);
//return TechniqueMethods::ROITranslocation(mKnn, hardLayerMat, true);
auto scaledImages = TechniqueMethods::ROIRescaling(hardLayerMat, true);
return ImageMethods::passThroughKNNModel(mKnn, scaledImages);
}
QImage
DrawArea::getResourceCharacterImage(int index) {
return mComparisonImagesDict[index];
}
void
DrawArea::undoLayer() {
uint vectorSize = mVirtualLayerVector.size();
if (vectorSize) {
mVirtualLayerVector.remove(vectorSize - 1);
updateDrawArea();
}
}
void
DrawArea::pDrawPoint(QPoint aPoint) {
auto painter_hard = QPainter(&mHardLayer);
auto painter_virt = QPainter(&mVirtualLayer);
QPen pen = QPen(Qt::black, mPenWidth, Qt::SolidLine, Qt::RoundCap, Qt::RoundJoin);
painter_hard.setPen(pen);
painter_virt.setPen(pen);
painter_hard.drawLine(mPrevPoint, aPoint);
painter_virt.drawLine(mPrevPoint, aPoint);
mPrevPoint = aPoint;
painter_hard.end();
painter_virt.end();
this->setPixmap(mHardLayer);
}
void
DrawArea::pResourceCharacterImages() {
QFile knnDictFile = QFile(mKnnDictFilepath.c_str());
if(!knnDictFile.open(QIODevice::ReadOnly | QIODevice::Text))
return;
QDir resourceDir = QDir(QString(resourcePath.c_str()));
QStringList images = resourceDir.entryList(QStringList() << "*.png" << "*.PNG", QDir::Files);
QTextStream in(&knnDictFile);
QRegularExpression reg_txt("(?<character>\\w+),(?<number>\\d+)");
QRegularExpression reg_png("(?<character>\\w+).png");
while(!in.atEnd()) {
QString line = in.readLine();
auto match_txt = reg_txt.match(line);
for(auto png : images) {
auto match_png = reg_png.match(png);
if (match_png.captured("character") == match_txt.captured("character")) {
LOG(level::standard, "DrawArea::pResourceCharacterImages()",
QString(match_png.captured("character") + " " + match_txt.captured("number")));
mComparisonImagesDict.insert(match_txt.captured("number").toInt(),
QImage(resourceDir.filePath(png)));
images.removeOne(png);
break;
}
}
}
} | 29.722826 | 99 | 0.659353 | [
"object",
"vector"
] |
f1d88caa3b81a0aa9be33b6645a8efb206141884 | 7,706 | hpp | C++ | ad_map_access/impl/include/ad/map/lane/BorderOperation.hpp | seowwj/map | 2afacd50e1b732395c64b1884ccfaeeca0040ee7 | [
"MIT"
] | null | null | null | ad_map_access/impl/include/ad/map/lane/BorderOperation.hpp | seowwj/map | 2afacd50e1b732395c64b1884ccfaeeca0040ee7 | [
"MIT"
] | null | null | null | ad_map_access/impl/include/ad/map/lane/BorderOperation.hpp | seowwj/map | 2afacd50e1b732395c64b1884ccfaeeca0040ee7 | [
"MIT"
] | null | null | null | // ----------------- BEGIN LICENSE BLOCK ---------------------------------
//
// Copyright (C) 2018-2020 Intel Corporation
//
// SPDX-License-Identifier: MIT
//
// ----------------- END LICENSE BLOCK -----------------------------------
#pragma once
#include "ad/map/lane/Types.hpp"
#include "ad/map/point/ECEFOperation.hpp"
#include "ad/map/point/ENUOperation.hpp"
#include "ad/map/point/GeoOperation.hpp"
#include "ad/map/point/HeadingOperation.hpp"
/** @brief namespace ad */
namespace ad {
/** @brief namespace map */
namespace map {
/** @brief namespace lane */
namespace lane {
/**
* @brief Get the ENUEdge between the given border with corresponding lateralAlignment
*
* @param[in] border the ENU border, the edge is calculated from
* @param[in] lateralAlignment the lateral alignment as TParam [0.;1.] used to calculate the resulting edge.
* The lateral alignment is relative to the left edge. If lateralAlignment is 1., the left edge is returned,
* if lateralAlignment is 0., the right edge is returned
*
* @throws std::invalid_argument if the lateralAlignment parameter is smaller than 0. or larger than 1.
*/
point::ENUEdge getLateralAlignmentEdge(ENUBorder const &border, physics::ParametricValue const lateralAlignment);
/**
* @brief Get the distance between an ENU point and the lateral alignment edge
*
* @param[in] enuPoint is the point for which the distance should be calculated
* @param[in] lateralAlignmentEdge the lateral alignment in ENU form
*
* @return calculated Distance
*/
physics::Distance getDistanceEnuPointToLateralAlignmentEdge(point::ENUPoint const &enuPoint,
point::ENUEdge const &lateralAlignmentEdge);
/**
* @brief normalizes the border
*
* At first the left and right edges of the border are checked for irregular directional vectors
* (scalarproduct of the vectors of three consecutive edge points has to be positive)
* Irregular points are dropped.
*
* Then, the number of points of the left and right edge of the border are made equal by extending the smaller edge.
* If an edge has less than 2 points, nothing is done.
*
* The previousBorder (optional parameter) is used to extend the irregular directional vector check to the beginning
* of the border edges; here leading to an potential overwrite of the first edge point by the end of the previousBorder.
*/
void normalizeBorder(ENUBorder &border, ENUBorder const *previousBorder = nullptr);
/**
* @brief operation to make the transition between two edges continuous
*
* If the end point of \c first is near (<=0.1m) to the end point of \c second or one of the edges has less than two
* points, nothing is done.
* Otherwise the first point of the second edge will exchanged by the last point of the first edge.
* The second point of the second edge is placed at some distance along the edge which is calculated using:
* - the distance of the displacement of the two edges
* - the direction of the displacement of the two edges compared to the the corresponding direction of the edges
*
* @param[in] first the first edge (is untouched by the algorithm)
* @param[in] second the second edge to be adapted if required to make the transition continuous
*/
void makeTransitionToSecondEdgeContinuous(point::ENUEdge const &first, point::ENUEdge &second);
/**
* @brief operation to make the transition between two borders continuous
*
* This executes the makeTransitionToSecondEdgeContinuous() for left and right edges.
* In addition, adds interpolation points to the respective other edge if required.
*
* @param[in] first the first border (is untouched by the algorithm)
* @param[in] second the second border to be adapted if required to make the transition continuous
*/
void makeTransitionToSecondBorderContinuous(ENUBorder const &first, ENUBorder &second);
/**
* @brief operation to make the transition between two edges continuous
*
* If the end point of \c first is near (<=0.1m) to the end point of \c second or one of the edges has less than two
* points, nothing is done.
* Otherwise the first point of the second edge will exchanged by the last point of the first edge.
* The second point of the second edge is placed at some distance along the edge which is calculated using:
* - the distance of the displacement of the two edges
* - the direction of the displacement of the two edges compared to the the corresponding direction of the edges
*
* @param[in] first the first edge to be adapted if required to make the transition continuous
* @param[in] second the second edge (is untouched by the algorithm)
*/
void makeTransitionFromFirstEdgeContinuous(point::ENUEdge &first, point::ENUEdge const &second);
/**
* @brief operation to make the transition between two borders continuous
*
* This executes the makeTransitionToSecondEdgeContinuous() for left and right edges.
* In addition, adds interpolation points to the respective other edge if required.
*
* @param[in] first the first border to be adapted if required to make the transition continuous
* @param[in] second the second border (is untouched by the algorithm)
*/
void makeTransitionFromFirstBorderContinuous(ENUBorder &first, ENUBorder const &second);
/** @brief calculate the length of the provided border as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within Cartesian ENU coordinate frame.
*/
inline physics::Distance calcLength(ENUBorder const &border)
{
return (calcLength(border.left) + calcLength(border.right)) / 2.;
}
/** @brief calculate the length of the provided border as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within Cartesian ECEF coordinate frame.
*/
inline physics::Distance calcLength(ECEFBorder const &border)
{
return (calcLength(border.left) + calcLength(border.right)) / 2.;
}
/** @brief calculate the length of the provided border as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within Cartesian ECEF coordinate frame.
*/
inline physics::Distance calcLength(GeoBorder const &border)
{
return (calcLength(border.left) + calcLength(border.right)) / 2.;
}
/** @brief calculate the length out of the provided ENU border List as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within Cartesian ENU coordinate frame.
*/
physics::Distance calcLength(ENUBorderList const &borderList);
/** @brief calculate the length out of the provided ECEF border List as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within Cartesian ECEF coordinate frame.
*/
physics::Distance calcLength(ECEFBorderList const &borderList);
/** @brief calculate the length out of the provided GEO border List as distance value
*
* For length calculation the average between left and right edge of the border is returned.
* Length calculation is performed within GEO coordinate frame.
*/
physics::Distance calcLength(GeoBorderList const &borderList);
/** @brief calculate the ENUHeading of the vector<ENUBorder> at the given ENUPoint
*
* If the given ENUPoint is not within the given borders,
* an ENUHeading(2*M_PI) is returned.
*/
point::ENUHeading getENUHeading(ENUBorderList const &borderList, point::ENUPoint const &enuPoint);
} // namespace lane
} // namespace map
} // namespace ad
| 44.287356 | 120 | 0.748897 | [
"vector"
] |
f1da6a17933a50cff2d41a6ca0e62a6e5fae16ed | 3,356 | cpp | C++ | example/main.cpp | pqrs-org/cpp-osx-iokit_hid_device | 8a96acd1944303cb264dd8f73c0f0c1484ce46b2 | [
"BSL-1.0"
] | null | null | null | example/main.cpp | pqrs-org/cpp-osx-iokit_hid_device | 8a96acd1944303cb264dd8f73c0f0c1484ce46b2 | [
"BSL-1.0"
] | null | null | null | example/main.cpp | pqrs-org/cpp-osx-iokit_hid_device | 8a96acd1944303cb264dd8f73c0f0c1484ce46b2 | [
"BSL-1.0"
] | null | null | null | #include <IOKit/hid/IOHIDElement.h>
#include <IOKit/hid/IOHIDUsageTables.h>
#include <csignal>
#include <pqrs/osx/iokit_hid_device.hpp>
#include <pqrs/osx/iokit_hid_manager.hpp>
namespace {
auto global_wait = pqrs::make_thread_wait();
}
int main(void) {
std::signal(SIGINT, [](int) {
global_wait->notify();
});
auto time_source = std::make_shared<pqrs::dispatcher::hardware_time_source>();
auto dispatcher = std::make_shared<pqrs::dispatcher::dispatcher>(time_source);
std::vector<pqrs::cf::cf_ptr<CFDictionaryRef>> matching_dictionaries{
pqrs::osx::iokit_hid_manager::make_matching_dictionary(
pqrs::hid::usage_page::generic_desktop,
pqrs::hid::usage::generic_desktop::keyboard),
};
auto hid_manager = std::make_unique<pqrs::osx::iokit_hid_manager>(dispatcher,
matching_dictionaries);
hid_manager->device_matched.connect([](auto&& registry_entry_id, auto&& device_ptr) {
if (device_ptr) {
auto hid_device = pqrs::osx::iokit_hid_device(*device_ptr);
std::cout << "device_matched registry_entry_id:" << registry_entry_id << std::endl;
if (hid_device.conforms_to(pqrs::hid::usage_page::generic_desktop,
pqrs::hid::usage::generic_desktop::keyboard)) {
std::cout << " conforms_to keyboard" << std::endl;
}
if (auto manufacturer = hid_device.find_manufacturer()) {
std::cout << " manufacturer:" << *manufacturer << std::endl;
}
if (auto product = hid_device.find_product()) {
std::cout << " product:" << *product << std::endl;
}
if (auto serial_number = hid_device.find_serial_number()) {
std::cout << " serial_number:" << *serial_number << std::endl;
}
if (auto vendor_id = hid_device.find_vendor_id()) {
std::cout << " vendor_id:" << *vendor_id << std::endl;
}
if (auto product_id = hid_device.find_product_id()) {
std::cout << " product_id:" << *product_id << std::endl;
}
if (auto location_id = hid_device.find_location_id()) {
std::cout << " location_id:" << *location_id << std::endl;
}
if (auto country_code = hid_device.find_country_code()) {
std::cout << " country_code:" << *country_code << std::endl;
}
#if 0
std::cout << " ";
for (const auto& e : hid_device.make_elements()) {
std::cout << IOHIDElementGetUsagePage(*e) << "," << IOHIDElementGetUsage(*e)
<< " (" << IOHIDElementGetLogicalMin(*e) << " - " << IOHIDElementGetLogicalMax(*e) << "), ";
}
std::cout << std::endl;
#endif
}
});
hid_manager->device_terminated.connect([](auto&& registry_entry_id) {
std::cout << "device_terminated registry_entry_id:" << registry_entry_id << std::endl;
});
hid_manager->error_occurred.connect([](auto&& message, auto&& kern_return) {
std::cerr << "error_occurred " << message << " " << kern_return << std::endl;
});
hid_manager->async_start();
// ============================================================
global_wait->wait_notice();
// ============================================================
hid_manager = nullptr;
dispatcher->terminate();
dispatcher = nullptr;
std::cout << "finished" << std::endl;
return 0;
}
| 35.702128 | 110 | 0.592074 | [
"vector"
] |
f1e7bbfc3c05d50a11929640481213fae20d1958 | 5,609 | cxx | C++ | panda/src/tinydisplay/tinyGraphicsBuffer.cxx | kestred/panda3d | 16bfd3750f726a8831771b81649d18d087917fd5 | [
"PHP-3.01",
"PHP-3.0"
] | 3 | 2018-03-09T12:07:29.000Z | 2021-02-25T06:50:25.000Z | panda/src/tinydisplay/tinyGraphicsBuffer.cxx | Sinkay/panda3d | 16bfd3750f726a8831771b81649d18d087917fd5 | [
"PHP-3.01",
"PHP-3.0"
] | null | null | null | panda/src/tinydisplay/tinyGraphicsBuffer.cxx | Sinkay/panda3d | 16bfd3750f726a8831771b81649d18d087917fd5 | [
"PHP-3.01",
"PHP-3.0"
] | null | null | null | // Filename: tinyGraphicsBuffer.cxx
// Created by: drose (08Aug08)
//
////////////////////////////////////////////////////////////////////
//
// PANDA 3D SOFTWARE
// Copyright (c) Carnegie Mellon University. All rights reserved.
//
// All use of this software is subject to the terms of the revised BSD
// license. You should have received a copy of this license along
// with this source code in a file named "LICENSE."
//
////////////////////////////////////////////////////////////////////
#include "pandabase.h"
#include "tinyGraphicsBuffer.h"
#include "config_tinydisplay.h"
#include "tinyGraphicsStateGuardian.h"
#include "pStatTimer.h"
TypeHandle TinyGraphicsBuffer::_type_handle;
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::Constructor
// Access: Public
// Description:
////////////////////////////////////////////////////////////////////
TinyGraphicsBuffer::
TinyGraphicsBuffer(GraphicsEngine *engine, GraphicsPipe *pipe,
const string &name,
const FrameBufferProperties &fb_prop,
const WindowProperties &win_prop,
int flags,
GraphicsStateGuardian *gsg,
GraphicsOutput *host) :
GraphicsBuffer(engine, pipe, name, fb_prop, win_prop, flags, gsg, host)
{
_frame_buffer = NULL;
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::Destructor
// Access: Public, Virtual
// Description:
////////////////////////////////////////////////////////////////////
TinyGraphicsBuffer::
~TinyGraphicsBuffer() {
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::begin_frame
// Access: Public, Virtual
// Description: This function will be called within the draw thread
// before beginning rendering for a given frame. It
// should do whatever setup is required, and return true
// if the frame should be rendered, or false if it
// should be skipped.
////////////////////////////////////////////////////////////////////
bool TinyGraphicsBuffer::
begin_frame(FrameMode mode, Thread *current_thread) {
begin_frame_spam(mode);
if (_gsg == (GraphicsStateGuardian *)NULL) {
return false;
}
TinyGraphicsStateGuardian *tinygsg;
DCAST_INTO_R(tinygsg, _gsg, false);
tinygsg->_current_frame_buffer = _frame_buffer;
tinygsg->reset_if_new();
_gsg->set_current_properties(&get_fb_properties());
return _gsg->begin_frame(current_thread);
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::end_frame
// Access: Public, Virtual
// Description: This function will be called within the draw thread
// after rendering is completed for a given frame. It
// should do whatever finalization is required.
////////////////////////////////////////////////////////////////////
void TinyGraphicsBuffer::
end_frame(FrameMode mode, Thread *current_thread) {
end_frame_spam(mode);
nassertv(_gsg != (GraphicsStateGuardian *)NULL);
if (mode == FM_render) {
// end_render_texture();
copy_to_textures();
}
_gsg->end_frame(current_thread);
if (mode == FM_render) {
trigger_flip();
clear_cube_map_selection();
}
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::close_buffer
// Access: Protected, Virtual
// Description: Closes the buffer right now. Called from the buffer
// thread.
////////////////////////////////////////////////////////////////////
void TinyGraphicsBuffer::
close_buffer() {
if (_gsg != (GraphicsStateGuardian *)NULL) {
TinyGraphicsStateGuardian *tinygsg;
DCAST_INTO_V(tinygsg, _gsg);
tinygsg->_current_frame_buffer = NULL;
_gsg.clear();
}
_is_valid = false;
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::open_buffer
// Access: Protected, Virtual
// Description: Opens the buffer right now. Called from the buffer
// thread. Returns true if the buffer is successfully
// opened, or false if there was a problem.
////////////////////////////////////////////////////////////////////
bool TinyGraphicsBuffer::
open_buffer() {
// GSG Creation/Initialization
TinyGraphicsStateGuardian *tinygsg;
if (_gsg == 0) {
// There is no old gsg. Create a new one.
tinygsg = new TinyGraphicsStateGuardian(_engine, _pipe, NULL);
_gsg = tinygsg;
} else {
DCAST_INTO_R(tinygsg, _gsg, false);
}
create_frame_buffer();
if (_frame_buffer == NULL) {
tinydisplay_cat.error()
<< "Could not create frame buffer.\n";
return false;
}
tinygsg->_current_frame_buffer = _frame_buffer;
tinygsg->reset_if_new();
if (!tinygsg->is_valid()) {
close_buffer();
return false;
}
_is_valid = true;
return true;
}
////////////////////////////////////////////////////////////////////
// Function: TinyGraphicsBuffer::create_frame_buffer
// Access: Private
// Description: Creates a suitable frame buffer for the current
// window size.
////////////////////////////////////////////////////////////////////
void TinyGraphicsBuffer::
create_frame_buffer() {
if (_frame_buffer != NULL) {
ZB_close(_frame_buffer);
_frame_buffer = NULL;
}
_frame_buffer = ZB_open(get_fb_x_size(), get_fb_y_size(), ZB_MODE_RGBA, 0, 0, 0, 0);
}
| 32.235632 | 86 | 0.543769 | [
"3d"
] |
f1e9abbfab1b10b3bb4453f664bbbe41089575d6 | 998 | cpp | C++ | plugins/renderer/directx11/src/DirectX11/util/directx11pixelshader.cpp | MadManRises/Madgine | c9949bc9cf8b30d63db0da2382c9fbc5b60bcd0f | [
"MIT"
] | 5 | 2018-05-16T14:09:34.000Z | 2019-10-24T19:01:15.000Z | plugins/renderer/directx11/src/DirectX11/util/directx11pixelshader.cpp | MadManRises/Madgine | c9949bc9cf8b30d63db0da2382c9fbc5b60bcd0f | [
"MIT"
] | 71 | 2017-06-20T06:41:42.000Z | 2021-01-11T11:18:53.000Z | plugins/renderer/directx11/src/DirectX11/util/directx11pixelshader.cpp | MadManRises/Madgine | c9949bc9cf8b30d63db0da2382c9fbc5b60bcd0f | [
"MIT"
] | 2 | 2018-05-16T13:57:25.000Z | 2018-05-16T13:57:51.000Z | #include "../directx11lib.h"
#include "directx11pixelshader.h"
#include "../directx11rendercontext.h"
namespace Engine {
namespace Render {
DirectX11PixelShader::DirectX11PixelShader(ID3DBlob *pShaderBlob)
{
sDevice->CreatePixelShader(pShaderBlob->GetBufferPointer(), pShaderBlob->GetBufferSize(), nullptr, &mShader);
}
DirectX11PixelShader::DirectX11PixelShader(DirectX11PixelShader &&other)
: mShader(std::exchange(other.mShader, nullptr))
{
}
DirectX11PixelShader::~DirectX11PixelShader()
{
reset();
}
DirectX11PixelShader &DirectX11PixelShader::operator=(DirectX11PixelShader &&other)
{
std::swap(mShader, other.mShader);
return *this;
}
void DirectX11PixelShader::reset()
{
if (mShader) {
mShader->Release();
mShader = nullptr;
}
}
void DirectX11PixelShader::bind()
{
sDeviceContext->PSSetShader(mShader, nullptr, 0);
}
}
} | 22.177778 | 117 | 0.647295 | [
"render"
] |
f1eb59edbba9f0de34320b726947a8ac8652c586 | 6,374 | cpp | C++ | tests/main.cpp | adeobootpin/light-tensor | dfc2d19495848e773b7367427cf848e4ac30b29d | [
"MIT"
] | null | null | null | tests/main.cpp | adeobootpin/light-tensor | dfc2d19495848e773b7367427cf848e4ac30b29d | [
"MIT"
] | null | null | null | tests/main.cpp | adeobootpin/light-tensor | dfc2d19495848e773b7367427cf848e4ac30b29d | [
"MIT"
] | null | null | null | #include "tensor.h"
#include "tests.h"
int main(int argc, char* argv[])
{
int ret;
int total_tests;
int total_tests_passed;
bool run_on_gpu = false;
const char* MNIST_training_images;
const char* MNIST_training_labels;
const char* MNIST_test_images;
const char* MNIST_test_labels;
total_tests = 0;
total_tests_passed = 0;
if (argc < 5)
{
printf("Usage: test path_to_MNIST_training_images path_to_MNIST_training_labels path_to_MNIST_test_images path_to_MNIST_test_labels [-gpu]\n");
return -1;
}
else
{
MNIST_training_images = argv[1];
MNIST_training_labels = argv[2];
MNIST_test_images = argv[3];
MNIST_test_labels = argv[4];
if (argc > 5)
{
#if defined(WIN32) || defined(_WIN32) || defined(__WIN32__) || defined(__NT__)
if (!_strcmpi(argv[5], "-gpu"))
#else
if (!strcasecmp(argv[5], "-GPU"))
#endif
{
run_on_gpu = true;
}
}
}
if(run_on_gpu)
{
printf("running unit tests on GPU\n");
}
else
{
printf("running unit tests on CPU\n");
}
ret = add_test_1(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor addition test 1 failed\n");
}
else
{
total_tests_passed++;
printf("tensor addition test 1 passed\n");
}
ret = add_test_2(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor ddition test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor addition test 2 passed\n");
}
ret = sub_test_1(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor subtraction test 1 failed\n");
}
else
{
total_tests_passed++;
printf("tensor subtraction test 1 passed\n");
}
ret = sub_test_1(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor subtraction test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor subtraction test 2 passed\n");
}
ret = sub_test_1_uint8();
total_tests++;
if (ret)
{
printf("tensor uint8 subtraction test 1 failed\n");
}
else
{
total_tests_passed++;
printf("tensor uint8 subtraction test 1 passed\n");
}
ret = sub_test_2_uint8();
total_tests++;
if (ret)
{
printf("tensor uint8 subtraction test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor uint8 subtraction test 2 passed\n");
}
ret = mul_test_1(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor element-wise multiplication test 1 failed\n");
}
else
{
total_tests_passed++;
printf("tensor element-wise multiplication test 1 passed\n");
}
ret = mul_test_2(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor element-wise multiplication test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor element-wise multiplication test 2 passed\n");
}
ret = mul_test_1_int32();
total_tests++;
if (ret)
{
printf("tensor int32 element-wise multiplication test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor int32 element-wise multiplication test 2 passed\n");
}
ret = div_test_1(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor division test 1 failed\n");
}
else
{
total_tests_passed++;
printf("tensor division test 1 passed\n");
}
ret = div_test_2(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor division test 2 failed\n");
}
else
{
total_tests_passed++;
printf("tensor division test 2 passed\n");
}
ret = matmul_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor matrix-multiplication test failed\n");
}
else
{
total_tests_passed++;
printf("tensor matrix-multiplication test passed\n");
}
ret = exp_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor exp test failed\n");
}
else
{
total_tests_passed++;
printf("tensor exp test passed\n");
}
ret = log_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor log test failed\n");
}
else
{
total_tests_passed++;
printf("tensor log test passed\n");
}
ret = sig_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor sigmoid test failed\n");
}
else
{
total_tests_passed++;
printf("tensor sigmoid test passed\n");
}
ret = tanh_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor tanh test failed\n");
}
else
{
total_tests_passed++;
printf("tensor tanh test passed\n");
}
ret = scalar_mul(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor scalar multiplication test failed\n");
}
else
{
total_tests_passed++;
printf("tensor scalar multiplication test passed\n");
}
ret = sum_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor sum test failed\n");
}
else
{
total_tests_passed++;
printf("tensor sum test passed\n");
}
ret = fc_test(run_on_gpu);
total_tests++;
if (ret)
{
printf("tensor fully-connected layer test failed\n");
}
else
{
total_tests_passed++;
printf("tensor fully-connected layer test passed\n");
}
if (!run_on_gpu)
{
ret = neural_network_test();
total_tests++;
if (ret)
{
printf("training regression model failed\n");
}
else
{
total_tests_passed++;
printf("training regression model passed\n");
}
ret = MNIST_test(MNIST_training_images, MNIST_training_labels, MNIST_test_images, MNIST_test_labels);
total_tests++;
if (ret)
{
printf("training MNIST model failed\n");
}
else
{
total_tests_passed++;
printf("training MNIST model passed\n");
}
}
if (run_on_gpu)
{
ret = MNIST_test_gpu(MNIST_training_images, MNIST_training_labels, MNIST_test_images, MNIST_test_labels);
total_tests++;
if (ret)
{
printf("training MNIST model failed\n");
}
else
{
total_tests_passed++;
printf("training MNIST model passed\n");
}
}
if (!run_on_gpu)
{
ret = quantized_MNIST_test(MNIST_training_images, MNIST_training_labels, MNIST_test_images, MNIST_test_labels);
total_tests++;
if (ret)
{
printf("quantization test failed\n");
}
else
{
total_tests_passed++;
printf("quantization test passed\n");
}
}
printf("\n------------\nTotal : %d\nPassed: %d\nFailed: %d\n------------\n", total_tests, total_tests_passed, total_tests - total_tests_passed);
return 0;
}
| 18.52907 | 146 | 0.635708 | [
"model"
] |
f1f9a2b7a215f07e00d353a1d4319629dae18fbe | 1,484 | cc | C++ | tests/titan/externalFunctionsC.cc | gusgonnet/minimalistThermostat | 6ee1e3a5434340ba8a5e2684cb40607d763482cc | [
"MIT"
] | 7 | 2016-03-28T19:18:39.000Z | 2017-05-15T07:32:38.000Z | tests/titan/externalFunctionsC.cc | gusgonnet/minimalistThermostat | 6ee1e3a5434340ba8a5e2684cb40607d763482cc | [
"MIT"
] | null | null | null | tests/titan/externalFunctionsC.cc | gusgonnet/minimalistThermostat | 6ee1e3a5434340ba8a5e2684cb40607d763482cc | [
"MIT"
] | 7 | 2016-04-29T01:19:39.000Z | 2019-12-16T15:00:35.000Z | #include <iostream>
#include <fstream>
#include <sstream>
#include "TTCN3.hh"
#include <time.h>
#include <unistd.h>
#include <vector>
namespace externalFunctions {
using namespace std;
string executeOnShell(const string& command);
string streamRead(FILE* stream);
string executeOnShell(const string& command){
FILE* localFile = popen(command.c_str(), "r");
return streamRead(localFile);
}
string streamRead(FILE* stream){
char tempChar = getc( stream );
string tempString;
while( tempChar != EOF) {
tempString += tempChar;
tempChar = getc( stream );
}
pclose(stream);
return tempString;
}
CHARSTRING executeCommand(const CHARSTRING& command){
string tempCommand = (const char*) command;
string tempResult;
TTCN_Logger::log(TTCN_DEBUG,"executeCommand - command to shell: %s",tempCommand.c_str());
tempResult = executeOnShell(tempCommand);
TTCN_Logger::log(TTCN_DEBUG,"executeCommand - response from shell: %s",tempResult.c_str());
return tempResult.c_str();
}
INTEGER indexOfSubstring(const CHARSTRING& s1, const CHARSTRING& s2, const INTEGER& offset) {
if(s2.lengthof()==0) return 0;
if(s1.lengthof()==0) return -1;
if(offset<0) return -1;
if(s1.lengthof()<=offset) return -1;
const char* str1=(const char*)s1+(int)offset;
const char* str2=(const char*)s2;
const char* first=strstr(str1,str2);
if(first) return first-str1+(int)offset;
return -1;
}
}
| 27.481481 | 95 | 0.681267 | [
"vector"
] |
f1fa719b410cc4ea430d3b26cc5b7ab4008418cc | 3,734 | cpp | C++ | src/LoggingBase.cpp | ess-dmsc/graylog-logger | 56cadc4a91fb4d31b3c6f6e4b62f38350c408a35 | [
"BSD-2-Clause"
] | 10 | 2018-01-10T08:18:16.000Z | 2022-02-01T10:33:00.000Z | src/LoggingBase.cpp | ess-dmsc/graylog-logger | 56cadc4a91fb4d31b3c6f6e4b62f38350c408a35 | [
"BSD-2-Clause"
] | 21 | 2017-03-24T18:56:57.000Z | 2022-01-20T07:35:58.000Z | src/LoggingBase.cpp | ess-dmsc/graylog-logger | 56cadc4a91fb4d31b3c6f6e4b62f38350c408a35 | [
"BSD-2-Clause"
] | 2 | 2017-03-23T15:57:18.000Z | 2020-04-07T10:12:09.000Z | /* Copyright (C) 2018 European Spallation Source, ERIC. See LICENSE file */
//===----------------------------------------------------------------------===//
///
/// \file
///
/// \brief Implementation of the base logging class.
///
//===----------------------------------------------------------------------===//
#include "graylog_logger/LoggingBase.hpp"
#include "Semaphore.hpp"
#include <chrono>
#include <ciso646>
#include <sys/types.h>
#include <thread>
#ifdef _WIN32
#include <WinSock2.h>
#include <codecvt>
#include <locale>
#include <process.h>
// clang-format off
#include <Windows.h>
// clang-format on
#define getpid _getpid
#else
#include <unistd.h>
#endif
namespace Log {
#ifdef _WIN32
std::string get_process_name() {
std::wstring buf;
buf.resize(260);
do {
size_t len =
GetModuleFileNameW(nullptr, &buf[0], static_cast<size_t>(buf.size()));
if (len < buf.size()) {
buf.resize(len);
break;
}
buf.resize(buf.size() * 2);
} while (buf.size() < 65536);
int lastSlash = buf.rfind(L'\"');
if (std::string::npos != lastSlash) {
buf = buf.substr(lastSlash + 1, buf.size() - 1);
}
using convert_typeX = std::codecvt_utf8<wchar_t>;
std::wstring_convert<convert_typeX, wchar_t> converterX;
return converterX.to_bytes(buf);
}
#elif defined(__APPLE__) || defined(__APPLE_CC__)
#include <cstring>
#include <mach-o/dyld.h>
#include <sys/syslimits.h>
std::string get_process_name() {
std::string buf;
buf.resize(PATH_MAX);
while (true) {
auto size = static_cast<uint32_t>(buf.size());
if (_NSGetExecutablePath(&buf[0], &size) == 0) {
buf.resize(std::strlen(&buf[0]));
break;
}
buf.resize(size);
}
auto lastSlash = buf.rfind('/');
if (std::string::npos == lastSlash) {
return buf;
}
return buf.substr(lastSlash + 1, buf.size() - 1);
}
#else
#include <vector>
std::string get_process_name() {
std::vector<std::string> filePaths = {"/proc/self/exe", "/proc/curproc/file",
"/proc/curproc/exe"};
char pathBuffer[1024];
for (auto &path : filePaths) {
int nameLen = readlink(path.c_str(), pathBuffer, sizeof(pathBuffer) - 1);
if (-1 != nameLen) {
std::string tempPath(pathBuffer, nameLen);
auto lastSlash = tempPath.rfind("/");
if (std::string::npos == lastSlash) {
return tempPath;
}
return tempPath.substr(lastSlash + 1, tempPath.size() - 1);
}
}
return std::to_string(getpid());
}
#endif
LoggingBase::LoggingBase() {
Executor.SendWork([=]() {
const int StringBufferSize = 100;
std::array<char, StringBufferSize> StringBuffer{};
const int res =
gethostname(static_cast<char *>(StringBuffer.data()), StringBufferSize);
if (0 == res) {
BaseMsg.Host = std::string(static_cast<char *>(StringBuffer.data()));
}
BaseMsg.ProcessId = getpid();
BaseMsg.ProcessName = get_process_name();
});
}
LoggingBase::~LoggingBase() { LoggingBase::removeAllHandlers(); }
void LoggingBase::addLogHandler(const LogHandler_P &Handler) {
Semaphore Check;
Executor.SendWork([=, &Check]() {
Handlers.push_back(Handler);
Check.notify();
});
Check.wait();
}
void LoggingBase::removeAllHandlers() {
Semaphore Check;
Executor.SendWork([=, &Check]() {
Handlers.clear();
Check.notify();
});
Check.wait();
}
std::vector<LogHandler_P> LoggingBase::getHandlers() { return Handlers; }
void LoggingBase::setMinSeverity(Severity Level) {
auto WorkDone = std::make_shared<std::promise<void>>();
auto WorkDoneFuture = WorkDone->get_future();
Executor.SendWork(
[=, WorkDone{std::move(WorkDone)}]() { MinSeverity = Level; });
WorkDoneFuture.wait();
}
} // namespace Log
| 26.295775 | 80 | 0.617836 | [
"vector"
] |
7b01a8492930a1f9b5758dcc7edc8ba20f4fc81c | 8,102 | cpp | C++ | lib/smurff-cpp/SmurffCpp/Utils/Distribution.cpp | msteijaert/smurff | e6066d51e1640e9aad0118628ba72c9d662919fb | [
"MIT"
] | null | null | null | lib/smurff-cpp/SmurffCpp/Utils/Distribution.cpp | msteijaert/smurff | e6066d51e1640e9aad0118628ba72c9d662919fb | [
"MIT"
] | null | null | null | lib/smurff-cpp/SmurffCpp/Utils/Distribution.cpp | msteijaert/smurff | e6066d51e1640e9aad0118628ba72c9d662919fb | [
"MIT"
] | null | null | null |
// From:
// http://stackoverflow.com/questions/6142576/sample-from-multivariate-normal-gaussian-distribution-in-c
#include <iostream>
#include <chrono>
#include <functional>
#include "ThreadVector.hpp"
#include "omp_util.h"
#ifdef USE_BOOST_RANDOM
#include <boost/random.hpp>
#define MERSENNE_TWISTER boost::random::mt19937
#define UNIFORM_REAL_DISTRIBUTION boost::random::uniform_real_distribution<double>
#define GAMMA_DISTRIBUTION boost::random::gamma_distribution<double>
#else
#include <random>
#define MERSENNE_TWISTER std::mt19937
#define UNIFORM_REAL_DISTRIBUTION std::uniform_real_distribution<double>
#define GAMMA_DISTRIBUTION std::gamma_distribution<double>
#endif
#include <Eigen/Dense>
#include "Distribution.h"
using namespace Eigen;
static smurff::thread_vector<MERSENNE_TWISTER> bmrngs;
double smurff::randn0()
{
return smurff::bmrandn_single_thread();
}
double smurff::randn(double)
{
return smurff::bmrandn_single_thread();
}
void smurff::bmrandn(double* x, long n)
{
#pragma omp parallel
{
UNIFORM_REAL_DISTRIBUTION unif(-1.0, 1.0);
auto& bmrng = bmrngs.local();
#pragma omp for schedule(static)
for (long i = 0; i < n; i += 2)
{
double x1, x2, w;
do
{
x1 = unif(bmrng);
x2 = unif(bmrng);
w = x1 * x1 + x2 * x2;
} while ( w >= 1.0 );
w = std::sqrt( (-2.0 * std::log( w ) ) / w );
x[i] = x1 * w;
if (i + 1 < n)
{
x[i+1] = x2 * w;
}
}
}
}
void smurff::bmrandn(Eigen::MatrixXd & X)
{
long n = X.rows() * (long)X.cols();
smurff::bmrandn(X.data(), n);
}
double smurff::bmrandn_single_thread()
{
//TODO: add bmrng as input
UNIFORM_REAL_DISTRIBUTION unif(-1.0, 1.0);
auto& bmrng = bmrngs.local();
double x1, x2, w;
do
{
x1 = unif(bmrng);
x2 = unif(bmrng);
w = x1 * x1 + x2 * x2;
} while ( w >= 1.0 );
w = std::sqrt( (-2.0 * std::log( w ) ) / w );
return x1 * w;
}
// to be called within OpenMP parallel loop (also from serial code is fine)
void smurff::bmrandn_single_thread(double* x, long n)
{
UNIFORM_REAL_DISTRIBUTION unif(-1.0, 1.0);
auto& bmrng = bmrngs.local();
for (long i = 0; i < n; i += 2)
{
double x1, x2, w;
do
{
x1 = unif(bmrng);
x2 = unif(bmrng);
w = x1 * x1 + x2 * x2;
} while ( w >= 1.0 );
w = std::sqrt( (-2.0 * std::log( w ) ) / w );
x[i] = x1 * w;
if (i + 1 < n)
{
x[i+1] = x2 * w;
}
}
}
void smurff::bmrandn_single_thread(Eigen::VectorXd & x)
{
smurff::bmrandn_single_thread(x.data(), x.size());
}
void smurff::bmrandn_single_thread(Eigen::MatrixXd & X)
{
long n = X.rows() * (long)X.cols();
smurff::bmrandn_single_thread(X.data(), n);
}
void smurff::init_bmrng()
{
using namespace std::chrono;
auto ms = (duration_cast< milliseconds >(system_clock::now().time_since_epoch())).count();
smurff::init_bmrng(ms);
}
void smurff::init_bmrng(int seed)
{
std::vector<MERSENNE_TWISTER> v;
for (int i = 0; i < threads::get_max_threads(); i++)
{
v.push_back(MERSENNE_TWISTER(seed + i * 1999));
}
bmrngs.init(v);
}
double smurff::rand_unif()
{
UNIFORM_REAL_DISTRIBUTION unif(0.0, 1.0);
auto& bmrng = bmrngs.local();
return unif(bmrng);
}
double smurff::rand_unif(double low, double high)
{
UNIFORM_REAL_DISTRIBUTION unif(low, high);
auto& bmrng = bmrngs.local();
return unif(bmrng);
}
// returns random number according to Gamma distribution
// with the given shape (k) and scale (theta). See wiki.
double smurff::rgamma(double shape, double scale)
{
GAMMA_DISTRIBUTION gamma(shape, scale);
return gamma(bmrngs.local());
}
auto smurff::nrandn(int n) -> decltype(Eigen::VectorXd::NullaryExpr(n, std::cref(randn)))
{
return Eigen::VectorXd::NullaryExpr(n, std::cref(randn));
}
auto smurff::nrandn(int n, int m) -> decltype(Eigen::ArrayXXd::NullaryExpr(n, m, std::cref(randn)))
{
return Eigen::ArrayXXd::NullaryExpr(n, m, std::cref(randn));
}
Eigen::MatrixXd WishartUnit(int m, int df)
{
Eigen::MatrixXd c(m,m);
c.setZero();
auto& rng = bmrngs.local();
for ( int i = 0; i < m; i++ )
{
GAMMA_DISTRIBUTION gam(0.5*(df - i));
c(i,i) = std::sqrt(2.0 * gam(rng));
Eigen::VectorXd r = smurff::nrandn(m-i-1);
c.block(i,i+1,1,m-i-1) = r.transpose();
}
Eigen::MatrixXd ret = c.transpose() * c;
#ifdef TEST_MVNORMAL
cout << "WISHART UNIT {\n" << endl;
cout << " m:\n" << m << endl;
cout << " df:\n" << df << endl;
cout << " ret;\n" << ret << endl;
cout << " c:\n" << c << endl;
cout << "}\n" << ret << endl;
#endif
return ret;
}
MatrixXd Wishart(const Eigen::MatrixXd &sigma, const int df)
{
// Get R, the upper triangular Cholesky factor of SIGMA.
auto chol = sigma.llt();
Eigen::MatrixXd r = chol.matrixL();
// Get AU, a sample from the unit Wishart distribution.
Eigen::MatrixXd au = WishartUnit(sigma.cols(), df);
// Construct the matrix A = R' * AU * R.
Eigen::MatrixXd a = r * au * chol.matrixU();
#ifdef TEST_MVNORMAL
cout << "WISHART {\n" << endl;
cout << " sigma:\n" << sigma << endl;
cout << " r:\n" << r << endl;
cout << " au:\n" << au << endl;
cout << " df:\n" << df << endl;
cout << " a:\n" << a << endl;
cout << "}\n" << endl;
#endif
return a;
}
// from julia package Distributions: conjugates/normalwishart.jl
std::pair<Eigen::VectorXd, Eigen::MatrixXd> smurff::NormalWishart(const Eigen::VectorXd & mu, double kappa, const Eigen::MatrixXd & T, double nu)
{
Eigen::MatrixXd Lam = Wishart(T, nu);
Eigen::MatrixXd mu_o = smurff::MvNormal_prec(Lam * kappa, mu);
#ifdef TEST_MVNORMAL
cout << "NORMAL WISHART {\n" << endl;
cout << " mu:\n" << mu << endl;
cout << " kappa:\n" << kappa << endl;
cout << " T:\n" << T << endl;
cout << " nu:\n" << nu << endl;
cout << " mu_o\n" << mu_o << endl;
cout << " Lam\n" << Lam << endl;
cout << "}\n" << endl;
#endif
return std::make_pair(mu_o , Lam);
}
std::pair<Eigen::VectorXd, Eigen::MatrixXd> smurff::CondNormalWishart(const int N, const Eigen::MatrixXd &NS, const Eigen::VectorXd &NU, const Eigen::VectorXd &mu, const double kappa, const Eigen::MatrixXd &T, const int nu)
{
int nu_c = nu + N;
double kappa_c = kappa + N;
auto mu_c = (kappa * mu + NU) / (kappa + N);
auto X = (T + NS + kappa * mu * mu.adjoint() - kappa_c * mu_c * mu_c.adjoint());
Eigen::MatrixXd T_c = X.inverse();
return NormalWishart(mu_c, kappa_c, T_c, nu_c);
}
std::pair<Eigen::VectorXd, Eigen::MatrixXd> smurff::CondNormalWishart(const Eigen::MatrixXd &U, const Eigen::VectorXd &mu, const double kappa, const Eigen::MatrixXd &T, const int nu)
{
auto N = U.cols();
auto NS = U * U.adjoint();
auto NU = U.rowwise().sum();
return CondNormalWishart(N, NS, NU, mu, kappa, T, nu);
}
// Normal(0, Lambda^-1) for nn columns
MatrixXd smurff::MvNormal_prec(const Eigen::MatrixXd & Lambda, int ncols)
{
int nrows = Lambda.rows(); // Dimensionality (rows)
LLT<Eigen::MatrixXd> chol(Lambda);
Eigen::MatrixXd r(nrows, ncols);
smurff::bmrandn(r);
return chol.matrixU().solve(r);
}
Eigen::MatrixXd smurff::MvNormal_prec(const Eigen::MatrixXd & Lambda, const Eigen::VectorXd & mean, int nn)
{
Eigen::MatrixXd r = MvNormal_prec(Lambda, nn);
return r.colwise() + mean;
}
// Draw nn samples from a size-dimensional normal distribution
// with a specified mean and covariance
Eigen::MatrixXd smurff::MvNormal(const Eigen::MatrixXd covar, const Eigen::VectorXd mean, int nn)
{
int size = mean.rows(); // Dimensionality (rows)
Eigen::MatrixXd normTransform(size,size);
LLT<Eigen::MatrixXd> cholSolver(covar);
normTransform = cholSolver.matrixL();
auto normSamples = Eigen::MatrixXd::NullaryExpr(size, nn, std::cref(randn));
Eigen::MatrixXd samples = (normTransform * normSamples).colwise() + mean;
return samples;
}
| 25.884984 | 223 | 0.611331 | [
"shape",
"vector"
] |
7b05e0a46fd8e4c17e6b98d2127e37c09f6505e4 | 6,632 | cpp | C++ | src/master/worker.cpp | abudnik/prun | 643a6bf49249e220f08317b8a4739570faf7b2ae | [
"Apache-2.0"
] | 20 | 2015-05-14T19:44:01.000Z | 2018-04-14T15:25:08.000Z | src/master/worker.cpp | abudnik/prun | 643a6bf49249e220f08317b8a4739570faf7b2ae | [
"Apache-2.0"
] | 11 | 2015-04-15T19:51:06.000Z | 2017-01-03T14:57:49.000Z | src/master/worker.cpp | abudnik/prun | 643a6bf49249e220f08317b8a4739570faf7b2ae | [
"Apache-2.0"
] | 7 | 2015-05-08T12:44:38.000Z | 2021-12-10T18:00:01.000Z | /*
===========================================================================
This software is licensed under the Apache 2 license, quoted below.
Copyright (C) 2013 Andrey Budnik <budnik27@gmail.com>
Licensed under the Apache License, Version 2.0 (the "License"); you may not
use this file except in compliance with the License. You may obtain a copy of
the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
License for the specific language governing permissions and limitations under
the License.
===========================================================================
*/
#include "worker.h"
namespace master {
void WorkerJob::AddTask( int64_t jobId, int taskId )
{
jobs_[ jobId ].insert( taskId );
}
bool WorkerJob::DeleteTask( int64_t jobId, int taskId )
{
auto it = jobs_.find( jobId );
if ( it != jobs_.end() )
{
Tasks &tasks = it->second;
auto it_tasks = tasks.find( taskId );
if ( it_tasks != tasks.end() )
{
tasks.erase( it_tasks );
if ( tasks.empty() )
{
jobs_.erase( it );
if ( IsExclusive() && jobs_.empty() )
{
SetExclusive( false );
}
}
return true;
}
}
return false;
}
bool WorkerJob::DeleteJob( int64_t jobId )
{
auto it = jobs_.find( jobId );
if ( it != jobs_.end() )
{
jobs_.erase( it );
if ( IsExclusive() && jobs_.empty() )
{
SetExclusive( false );
}
return true;
}
return false;
}
bool WorkerJob::HasTask( int64_t jobId, int taskId ) const
{
auto it = jobs_.find( jobId );
if ( it != jobs_.end() )
{
const Tasks &tasks = it->second;
auto it_tasks = tasks.find( taskId );
return it_tasks != tasks.end();
}
return false;
}
bool WorkerJob::HasJob( int64_t jobId ) const
{
return jobs_.find( jobId ) != jobs_.end();
}
bool WorkerJob::GetTasks( int64_t jobId, Tasks &tasks ) const
{
auto it = jobs_.find( jobId );
if ( it != jobs_.end() )
{
tasks = it->second;
return true;
}
return false;
}
void WorkerJob::GetTasks( std::vector< WorkerTask > &tasks ) const
{
for( auto it = jobs_.cbegin(); it != jobs_.cend(); ++it )
{
const Tasks &t = it->second;
Tasks::const_iterator it_tasks = t.begin();
for( ; it_tasks != t.end(); ++it_tasks )
{
int taskId = *it_tasks;
tasks.emplace_back( it->first, taskId );
}
}
}
void WorkerJob::GetJobs( std::set<int64_t> &jobs ) const
{
for( auto it = jobs_.cbegin(); it != jobs_.cend(); ++it )
{
jobs.insert( it->first );
}
}
int64_t WorkerJob::GetJobId() const
{
if ( jobs_.empty() )
return -1;
auto it = jobs_.cbegin();
return it->first;
}
int WorkerJob::GetNumJobs() const
{
return jobs_.size();
}
int WorkerJob::GetTotalNumTasks() const
{
int num = 0;
for( auto it = jobs_.cbegin(); it != jobs_.cend(); ++it )
{
const Tasks &tasks = it->second;
num += static_cast<int>( tasks.size() );
}
return num;
}
int WorkerJob::GetNumTasks( int64_t jobId ) const
{
auto it = jobs_.find( jobId );
if ( it != jobs_.end() )
{
const Tasks &tasks = it->second;
return static_cast<int>( tasks.size() );
}
return 0;
}
WorkerJob &WorkerJob::operator += ( const WorkerJob &workerJob )
{
std::vector< WorkerTask > tasks;
workerJob.GetTasks( tasks );
for( const auto &task : tasks )
{
AddTask( task.GetJobId(), task.GetTaskId() );
}
if ( workerJob.IsExclusive() )
{
SetExclusive( true );
}
return *this;
}
void WorkerJob::SetExclusive( bool exclusive )
{
exclusive_ = exclusive;
}
bool WorkerJob::IsExclusive() const
{
return exclusive_;
}
void WorkerJob::Reset()
{
jobs_.clear();
exclusive_ = false;
}
void WorkerList::AddWorker( Worker *worker )
{
workers_.emplace_back( worker );
}
void WorkerList::DeleteWorker( const std::string &host )
{
for( auto it = workers_.begin(); it != workers_.end(); )
{
WorkerPtr &w = *it;
if ( w->GetHost() == host )
{
w->SetState( WORKER_STATE_DISABLED );
ipToWorker_.erase( w->GetIP() );
it = workers_.erase( it );
}
else
++it;
}
}
void WorkerList::Clear()
{
for( auto &w : workers_ )
{
w->SetState( WORKER_STATE_DISABLED );
}
workers_.clear();
ipToWorker_.clear();
}
bool WorkerList::GetWorker( const char *host, WorkerPtr &worker )
{
for( auto &w : workers_ )
{
if ( w->GetHost() == host )
{
worker = w;
return true;
}
}
return false;
}
bool WorkerList::SetWorkerIP( WorkerPtr &worker, const std::string &ip )
{
for( const auto &w : workers_ )
{
if ( worker == w )
{
worker->SetIP( ip );
ipToWorker_[ip] = worker;
return true;
}
}
return false;
}
bool WorkerList::GetWorkerByIP( const std::string &ip, WorkerPtr &worker ) const
{
auto it = ipToWorker_.find( ip );
if ( it != ipToWorker_.end() )
{
worker = it->second;
return true;
}
return false;
}
int WorkerList::GetTotalWorkers() const
{
int num = 0;
for( const auto &worker : workers_ )
{
if ( worker->IsAvailable() )
{
++num;
}
}
return num;
}
int WorkerList::GetTotalCPU() const
{
int num = 0;
for( const auto &worker : workers_ )
{
if ( worker->IsAvailable() )
{
num += worker->GetNumCPU();
}
}
return num;
}
int WorkerList::GetNumWorkers( int stateMask ) const
{
int num = 0;
for( const auto &worker : workers_ )
{
int state = static_cast<int>( worker->GetState() );
if ( state & stateMask )
{
++num;
}
}
return num;
}
int WorkerList::GetNumCPU( int stateMask ) const
{
int num = 0;
for( const auto &worker : workers_ )
{
int state = static_cast<int>( worker->GetState() );
if ( state & stateMask )
{
num += worker->GetNumCPU();
}
}
return num;
}
} // namespace master
| 21.121019 | 80 | 0.539505 | [
"vector"
] |
7b07ac766c8e40b8a8b0ca08dec89948783aec50 | 1,043 | cpp | C++ | DistinctPowers.cpp | AlirezaKamyab/ProjectEuler | 7237d2813ec2fe851c77960e41cd2e8e1520bf9f | [
"MIT"
] | null | null | null | DistinctPowers.cpp | AlirezaKamyab/ProjectEuler | 7237d2813ec2fe851c77960e41cd2e8e1520bf9f | [
"MIT"
] | null | null | null | DistinctPowers.cpp | AlirezaKamyab/ProjectEuler | 7237d2813ec2fe851c77960e41cd2e8e1520bf9f | [
"MIT"
] | 1 | 2020-12-28T16:49:06.000Z | 2020-12-28T16:49:06.000Z | //Created on: Dec 21, 2020 by Alireza
#include<iostream>
#include<vector>
#include<set>
#include<cmath>
using namespace std;
bool isPrime(int number);
vector<int> PrimeDivisions(int number, int power);
int main(int argc, char ** argv){
set<vector<int>> answers;
for(int i = 2; i <= 100; ++i){
for(int j = 2; j <= 100; ++j){
vector<int> item = PrimeDivisions(i, j);
answers.insert(item);
}
}
cout << "The answer is " << answers.size() << endl;
return 0;
}
vector<int> PrimeDivisions(int number, int power){
vector<int> temp;
if(isPrime(number)){
for(int pwr = 0; pwr < power; pwr++){
temp.push_back(number);
}
return temp;
}
for(int i = 2; i <= ceil(number / 2); i++){
if(isPrime(i)){
int n = number;
while(n % i == 0){
for(int repeat = 0; repeat < power; repeat++) temp.push_back(i);
n /= i;
}
}
}
return temp;
}
bool isPrime(int number){
if(number <= 1) { return false; }
for(int i = 2; i < (int)sqrt(number) + 1; i++){
if(number % i == 0){
return false;
}
}
return true;
}
| 19.314815 | 68 | 0.596357 | [
"vector"
] |
7b0c19989e7528fd79c474e2fb12589b6dba298c | 5,555 | cpp | C++ | test/container_test.cpp | cjgdev/jemallocator | 5512eb10c4ab8a268cfd6d992bddd6199be41779 | [
"MIT"
] | 1 | 2015-11-06T03:27:05.000Z | 2015-11-06T03:27:05.000Z | test/container_test.cpp | cjgdev/jemallocator | 5512eb10c4ab8a268cfd6d992bddd6199be41779 | [
"MIT"
] | null | null | null | test/container_test.cpp | cjgdev/jemallocator | 5512eb10c4ab8a268cfd6d992bddd6199be41779 | [
"MIT"
] | null | null | null | /*
* Copyright (C) 2015 Christopher Gilbert <christopher.john.gilbert@gmail.com>
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in all
* copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
* SOFTWARE.
*/
#include "catch.hpp"
#include <jemallocator/jemallocator.hpp>
#include <deque>
#include <forward_list>
#include <list>
#include <vector>
#include <map>
#include <set>
#include <unordered_map>
#include <unordered_set>
#include <queue>
#include <stack>
#include <string>
namespace je = jemallocator;
namespace jepolicy = jemallocator::jepolicy;
/*
* Useful allocator alias
*/
template<class T>
using basic_allocator = je::jemallocator<T, jepolicy::empty::policy>;
template<class T>
using default_allocator = basic_allocator<T>;
/*
* Useful container aliases
*/
template<class T, class Alloc = default_allocator<T>>
using forward_list = std::forward_list<T, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using deque = std::deque<T, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using list = std::list<T, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using vector = std::vector<T, Alloc>;
template<class Key, class T, class Alloc = default_allocator<std::pair<const Key, T>>>
using map = std::map<Key, T, std::less<Key>, Alloc>;
template<class Key, class T, class Alloc = default_allocator<std::pair<const Key, T>>>
using multimap = std::multimap<Key, T, std::less<Key>, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using multiset = std::multiset<T, std::less<T>, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using set = std::set<T, std::less<T>, Alloc>;
template<class Key, class T, class Alloc = default_allocator<std::pair<const Key, T>>>
using unordered_map = std::unordered_map<Key, T, std::hash<Key>, std::equal_to<Key>, Alloc>;
template<class Key, class T, class Alloc = default_allocator<std::pair<const Key, T>>>
using unordered_multimap = std::unordered_multimap<Key, T, std::hash<Key>, std::equal_to<Key>, Alloc>;
template<class Key, class Alloc = default_allocator<Key>>
using unordered_multiset = std::unordered_multiset<Key, std::hash<Key>, std::equal_to<Key>, Alloc>;
template<class Key, class Alloc = default_allocator<Key>>
using unordered_set = std::unordered_set<Key, std::hash<Key>, std::equal_to<Key>, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using stack = std::stack<T, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using queue = std::queue<T, Alloc>;
template<class T, class Alloc = default_allocator<T>>
using priority_queue = std::priority_queue<T, std::vector<T, Alloc>, std::less<typename std::vector<T, Alloc>::value_type>>;
template<class T, class Alloc = default_allocator<T>>
using basic_string = std::basic_string<T, std::char_traits<T>, Alloc>;
using string = basic_string<char>;
using wstring = basic_string<wchar_t>;
using u16string = basic_string<char16_t>;
using u32string = basic_string<char32_t>;
TEST_CASE("jemallocator will work with standard containers", "[containers]") {
SECTION("sequence containers") {
SECTION("forward_list") {
forward_list<int> container;
container.push_front(0);
}
SECTION("deque") {
deque<int> container;
container.push_back(0);
}
SECTION("list") {
list<int> container;
container.push_back(0);
}
SECTION("vector") {
vector<int> container;
container.push_back(0);
}
}
SECTION("associative containers") {
SECTION("map") {
map<int, int> container;
container[0] = 0;
}
SECTION("multimap") {
multimap<int, int> container;
container.insert(std::make_pair(0, 0));
}
SECTION("multiset") {
multiset<int> container;
container.insert(0);
}
SECTION("set") {
set<int> container;
container.insert(0);
}
}
SECTION("unordered associative containers") {
SECTION("unordered_map") {
unordered_map<int, int> container;
container[0] = 0;
}
SECTION("unordered_multimap") {
unordered_multimap<int, int> container;
container.insert(std::make_pair(0, 0));
}
SECTION("unordered_multiset") {
unordered_multiset<int> container;
container.insert(0);
}
SECTION("unordered_set") {
unordered_set<int> container;
container.insert(0);
}
}
SECTION("container adaptors") {
SECTION("stack") {
stack<int> container;
}
SECTION("queue") {
queue<int> container;
}
SECTION("priority_queue") {
priority_queue<int> container;
}
}
SECTION("strings") {
SECTION("string") {
basic_string<char> container;
}
SECTION("wstring") {
basic_string<wchar_t> container;
}
}
}
| 30.355191 | 124 | 0.719532 | [
"vector"
] |
7b0cc432f391dad2d4a357455457362015763468 | 7,526 | cc | C++ | paddle/fluid/operators/strided_slice_op.cc | jhjiangcs/Paddle | fcf53e55ff22c54175efdb32ac367c6e04f19900 | [
"Apache-2.0"
] | 3 | 2019-07-17T09:30:31.000Z | 2021-12-27T03:16:55.000Z | paddle/fluid/operators/strided_slice_op.cc | cryoco/Paddle | 39ac41f137d685af66078adf2f35d65473978b4a | [
"Apache-2.0"
] | null | null | null | paddle/fluid/operators/strided_slice_op.cc | cryoco/Paddle | 39ac41f137d685af66078adf2f35d65473978b4a | [
"Apache-2.0"
] | null | null | null | /* Copyright (c) 2019 PaddlePaddle Authors. All Rights Reserved.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License. */
#include "paddle/fluid/operators/strided_slice_op.h"
#include <algorithm>
#include <memory>
#include <vector>
namespace paddle {
namespace operators {
using Tensor = framework::Tensor;
class StridedSliceOp : public framework::OperatorWithKernel {
public:
using framework::OperatorWithKernel::OperatorWithKernel;
void InferShape(framework::InferShapeContext* ctx) const override {
PADDLE_ENFORCE_EQ(ctx->HasInput("Input"), true,
"Input (Input) of slice op should not be null.");
PADDLE_ENFORCE_EQ(ctx->HasOutput("Out"), true,
"Output (Out) of slice op should not be null.");
auto in_dims = ctx->GetInputDim("Input");
PADDLE_ENFORCE_LT(in_dims.size(), 7,
"The rank of input should be less than 7.");
auto starts = ctx->Attrs().Get<std::vector<int>>("starts");
auto ends = ctx->Attrs().Get<std::vector<int>>("ends");
auto strides = ctx->Attrs().Get<std::vector<int>>("strides");
auto axes = ctx->Attrs().Get<std::vector<int>>("axes");
PADDLE_ENFORCE_EQ(starts.size(), ends.size(),
"starts and ends dim size must to be same");
PADDLE_ENFORCE_EQ(ends.size(), strides.size(),
"ends and strides dim size must to be same");
PADDLE_ENFORCE_EQ(ends.size(), axes.size(),
"axes, end and start dim size must to be same");
// we need to analysis strided slice op is valid for
// the parameter that we get from python front
int stride_index, start_index, end_index;
std::vector<int> out_dims_vector(in_dims.size());
for (int i = 0; i < in_dims.size(); i++) {
out_dims_vector[i] = in_dims[i];
}
for (size_t i = 0; i < starts.size(); i++) {
PADDLE_ENFORCE_NE(strides[i], 0, "stride must not to be zero");
int axes_index = axes[i];
start_index = starts[i];
end_index = ends[i];
stride_index = strides[i];
int axis_size = in_dims[axes_index];
if (axis_size < 0) {
continue;
}
if (start_index < 0) {
start_index = start_index + axis_size;
}
if (end_index < 0) {
end_index = end_index + axis_size;
}
if (stride_index < 0) {
start_index = start_index + 1;
end_index = end_index + 1;
}
bool zero_dim_condition =
((stride_index < 0 && (start_index <= end_index)) ||
(stride_index > 0 && (start_index >= end_index)));
PADDLE_ENFORCE_EQ(zero_dim_condition, false,
"starts and end must meet requirement in different "
"stride conditiont");
int left = std::max(0, std::min(start_index, end_index));
int right = std::min(axis_size, std::max(start_index, end_index));
int step = std::abs(stride_index);
auto out_dims_index = (std::abs(right - left) + step - 1) / step;
out_dims_vector[axes_index] = out_dims_index;
}
framework::DDim out_dims(framework::make_ddim(out_dims_vector));
ctx->SetOutputDim("Out", out_dims);
ctx->ShareLoD("Input", /*->*/ "Out");
}
protected:
framework::OpKernelType GetExpectedKernelType(
const framework::ExecutionContext& ctx) const override {
return framework::OpKernelType(ctx.Input<Tensor>("Input")->type(),
ctx.Input<Tensor>("Input")->place());
}
};
class StridedSliceOpMaker : public framework::OpProtoAndCheckerMaker {
public:
void Make() override {
AddInput("Input", "Tensor of data to extract slices from.");
AddOutput("Out", "Sliced data tensor.");
AddAttr<std::vector<int>>(
"axes", "(list<int> Axes stride from the start to the end)");
AddAttr<std::vector<int>>(
"starts", "(list<int>) start that the tensor slice start.");
AddAttr<std::vector<int>>("ends",
"(list<int>) end that the tensor slice end");
AddAttr<std::vector<int>>(
"strides", "(list<int> stride stride from the start to the end)");
AddComment(R"DOC(
Strided Slice Operator.
Instead of calling this op directly most users will want to use the
NumPy-style slicing syntax.
For Example:
data = fluid.layers.fill_constant(shape=[3, 3], value=0, dtype='int64')
y = fluid.layers.strided_slice(data, [0, 1], [1,0], [2, 3], [1, 1])
)DOC");
}
};
class StridedSliceOpGrad : public framework::OperatorWithKernel {
public:
using framework::OperatorWithKernel::OperatorWithKernel;
void InferShape(framework::InferShapeContext* ctx) const override {
PADDLE_ENFORCE_EQ(ctx->HasInput("Input"), true, "Input should not be null");
PADDLE_ENFORCE_EQ(ctx->HasInput(framework::GradVarName("Out")), true,
"Input(Out@GRAD) should not be null");
auto x_dims = ctx->GetInputDim("Input");
auto x_grad_name = framework::GradVarName("Input");
if (ctx->HasOutput(x_grad_name)) {
ctx->SetOutputDim(x_grad_name, x_dims);
}
}
framework::OpKernelType GetExpectedKernelType(
const framework::ExecutionContext& ctx) const override {
return framework::OpKernelType(
ctx.Input<framework::Tensor>(framework::GradVarName("Out"))->type(),
ctx.GetPlace());
}
};
class StridedSliceOpGradMaker : public framework::SingleGradOpDescMaker {
public:
using framework::SingleGradOpDescMaker::SingleGradOpDescMaker;
protected:
std::unique_ptr<framework::OpDesc> Apply() const override {
auto* bind = new framework::OpDesc();
bind->SetInput(framework::GradVarName("Out"), OutputGrad("Out"));
bind->SetInput("Input", Input("Input"));
bind->SetOutput(framework::GradVarName("Input"), InputGrad("Input"));
bind->SetAttrMap(Attrs());
bind->SetType("strided_slice_grad");
return std::unique_ptr<framework::OpDesc>(bind);
}
};
DECLARE_NO_NEED_BUFFER_VARS_INFERENCE(
StridedSliceOpGradNoNeedBufferVarsInference, "Input");
} // namespace operators
} // namespace paddle
namespace ops = paddle::operators;
REGISTER_OPERATOR(strided_slice, ops::StridedSliceOp, ops::StridedSliceOpMaker,
ops::StridedSliceOpGradMaker);
REGISTER_OPERATOR(strided_slice_grad, ops::StridedSliceOpGrad,
ops::StridedSliceOpGradNoNeedBufferVarsInference);
REGISTER_OP_CPU_KERNEL(
strided_slice,
ops::StridedSliceKernel<paddle::platform::CPUDeviceContext, int>,
ops::StridedSliceKernel<paddle::platform::CPUDeviceContext, int64_t>,
ops::StridedSliceKernel<paddle::platform::CPUDeviceContext, float>,
ops::StridedSliceKernel<paddle::platform::CPUDeviceContext, double>);
REGISTER_OP_CPU_KERNEL(
strided_slice_grad,
ops::StridedSliceGradKernel<paddle::platform::CPUDeviceContext, int>,
ops::StridedSliceGradKernel<paddle::platform::CPUDeviceContext, int64_t>,
ops::StridedSliceGradKernel<paddle::platform::CPUDeviceContext, float>,
ops::StridedSliceGradKernel<paddle::platform::CPUDeviceContext, double>);
| 38.397959 | 80 | 0.671273 | [
"shape",
"vector"
] |
7b11c0d5f8079531740db5b29aa96e443871a411 | 3,356 | cc | C++ | tensorflow/compiler/xla/service/xla_debug_info_manager.cc | mcx/tensorflow | d7e521a1ad21681855b439b9c2a05837c804e488 | [
"Apache-2.0"
] | 1 | 2022-03-18T17:36:11.000Z | 2022-03-18T17:36:11.000Z | tensorflow/compiler/xla/service/xla_debug_info_manager.cc | mcx/tensorflow | d7e521a1ad21681855b439b9c2a05837c804e488 | [
"Apache-2.0"
] | null | null | null | tensorflow/compiler/xla/service/xla_debug_info_manager.cc | mcx/tensorflow | d7e521a1ad21681855b439b9c2a05837c804e488 | [
"Apache-2.0"
] | null | null | null | /* Copyright 2019 The TensorFlow Authors. All Rights Reserved.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
==============================================================================*/
#include "tensorflow/compiler/xla/service/xla_debug_info_manager.h"
#include <memory>
#include <string>
#include <utility>
#include "tensorflow/compiler/xla/service/hlo_proto_util.h"
namespace xla {
void XlaDebugInfoManager::RegisterModule(
ModuleIdentifier module_id, std::shared_ptr<const HloModule> hlo_module,
std::shared_ptr<const BufferAssignmentProto> buffer_assignment) {
CHECK(hlo_module != nullptr && module_id == hlo_module->unique_id());
absl::MutexLock lock(&mutex_);
auto result = modules_.try_emplace(module_id);
CHECK(result.second);
XlaModuleEntry& m = result.first->second;
m.hlo_module = std::move(hlo_module);
m.buffer_assignment = std::move(buffer_assignment);
m.active = true;
}
// Unregister an active module, when the last active module of the same
// module id is out of scope, we remove it from our database.
// However during tracing, we will defer the cleanup after serialization.
void XlaDebugInfoManager::UnregisterModule(ModuleIdentifier module_id) {
absl::MutexLock lock(&mutex_);
auto it = modules_.find(module_id);
CHECK(it != modules_.end());
if (!tracing_active_) {
modules_.erase(it);
} else {
XlaModuleEntry& m = it->second;
m.active = false;
}
}
void XlaDebugInfoManager::StartTracing() {
absl::MutexLock lock(&mutex_);
tracing_active_ = true;
}
void XlaDebugInfoManager::StopTracing(
std::vector<std::unique_ptr<HloProto>>* module_debug_info) {
std::vector<XlaModuleEntry> modules_to_serialize;
{
absl::MutexLock lock(&mutex_);
if (!tracing_active_) return;
tracing_active_ = false;
// Copy all modules so we can serialize without holding the lock, and remove
// all inactive modules.
modules_to_serialize.reserve(modules_.size());
for (auto it = modules_.begin(); it != modules_.end();) {
auto& m = it->second;
if (!m.active) {
modules_to_serialize.emplace_back(std::move(m));
modules_.erase(it++);
} else {
modules_to_serialize.emplace_back(m);
++it;
}
}
}
if (module_debug_info) {
module_debug_info->clear();
for (const auto& m : modules_to_serialize) {
// In real world, hlo_module and buffer_assignment will always be
// non-nullptr. Due to the inconvenience of creation of buffer_assignment
// object in test, we set it to nullptr and guard this for it.
auto hlo_proto = absl::make_unique<HloProto>(MakeHloProto(*m.hlo_module));
if (m.buffer_assignment != nullptr) {
*hlo_proto->mutable_buffer_assignment() = *m.buffer_assignment;
}
module_debug_info->emplace_back(std::move(hlo_proto));
}
}
}
} // namespace xla
| 34.244898 | 80 | 0.699344 | [
"object",
"vector"
] |
7b260d63f8ac23ffd4a3cce3011ff1aa2c4bf59a | 4,800 | cpp | C++ | src/OpenGLUtils.cpp | QuanHBui/OpenGL-Compute | db746c78e60b36ea41261e7d2325a9df1d60ea44 | [
"MIT"
] | null | null | null | src/OpenGLUtils.cpp | QuanHBui/OpenGL-Compute | db746c78e60b36ea41261e7d2325a9df1d60ea44 | [
"MIT"
] | null | null | null | src/OpenGLUtils.cpp | QuanHBui/OpenGL-Compute | db746c78e60b36ea41261e7d2325a9df1d60ea44 | [
"MIT"
] | null | null | null | #include "OpenGLUtils.h"
#include <cstdio>
#include <fstream>
#include <iostream>
namespace oglutils
{
std::string readFileAsString(const std::string &fileName)
{
std::string result;
std::ifstream fileHandle(fileName);
if (fileHandle.is_open())
{
fileHandle.seekg(0, std::ios::end);
result.reserve((size_t)fileHandle.tellg());
fileHandle.seekg(0, std::ios::beg);
result.assign((std::istreambuf_iterator<char>(fileHandle)), std::istreambuf_iterator<char>());
}
else
{
throw std::runtime_error("Could not open file: " + fileName);
}
return result;
}
void getComputeShaderInfo()
{
GLint intArray[3];
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_COUNT, 0, &intArray[0]);
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_COUNT, 1, &intArray[1]);
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_COUNT, 2, &intArray[2]);
printf("Max global (total) work group counts x:%i y:%i z:%i\n",
intArray[0], intArray[1], intArray[2]);
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_SIZE, 0, &intArray[0]);
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_SIZE, 1, &intArray[1]);
glGetIntegeri_v(GL_MAX_COMPUTE_WORK_GROUP_SIZE, 2, &intArray[2]);
printf("Max local (in one shader) work group size x:%i y:%i z:%i \n",
intArray[0], intArray[1], intArray[2]);
GLint justSomeInt;
glGetIntegerv(GL_MAX_COMPUTE_WORK_GROUP_INVOCATIONS, &justSomeInt);
printf("Max local work group invocations: %i\n", justSomeInt);
glGetIntegerv(GL_MAX_SHADER_STORAGE_BUFFER_BINDINGS, &justSomeInt);
printf("Max shader storage buffer bindings: %i\n", justSomeInt);
glGetIntegerv(GL_MAX_COMPUTE_SHARED_MEMORY_SIZE, &justSomeInt);
printf("Max total shared variables storage size (in bytes): %i\n", justSomeInt);
}
void getUboInfo()
{
GLint returnInt;
// Each shader stage has a limit on the number of seperate uniform buffer binding locations
glGetIntegerv(GL_MAX_VERTEX_UNIFORM_BLOCKS, &returnInt);
printf("Max vertex uniform blocks or binding locations: %i\n", returnInt);
glGetIntegerv(GL_MAX_GEOMETRY_UNIFORM_BLOCKS, &returnInt);
printf("Max geometry uniform blocks or binding locations: %i\n", returnInt);
glGetIntegerv(GL_MAX_FRAGMENT_UNIFORM_BLOCKS, &returnInt);
printf("Max fragment uniform blocks or binding locations: %i\n", returnInt);
// Limitation on the available storage per uniform buffer
glGetIntegerv(GL_MAX_UNIFORM_BLOCK_SIZE, &returnInt);
printf("Max uniform block size (in bytes): %i\n", returnInt);
// When bind uniform buffer with glBindBufferRange, offset field must be multiple of GL_UNIFORM_BUFFER_OFFSET_ALIGNMENT
glGetIntegerv(GL_UNIFORM_BUFFER_OFFSET_ALIGNMENT, &returnInt);
printf("Uniform buffer offset alignment: %i\n", returnInt);
}
// @source: https://learnopengl.com/In-Practice/Debugging
void APIENTRY debugOutputMessageCallback(
GLenum source,
GLenum type,
GLuint id,
GLenum severity,
GLsizei length,
const char *message,
const void *pUserParam )
{
// Ignore non-significant error/warning codes
if (id == 131169 || id == 131185 || id == 131218 || id == 131204) return;
std::cerr << "---------------\n"
<< "Debug message (" << id << "): " << message << '\n';
switch (source)
{
case GL_DEBUG_SOURCE_API: std::cerr << "Source: API"; break;
case GL_DEBUG_SOURCE_WINDOW_SYSTEM: std::cerr << "Source: Window System"; break;
case GL_DEBUG_SOURCE_SHADER_COMPILER: std::cerr << "Source: Shader Compiler"; break;
case GL_DEBUG_SOURCE_THIRD_PARTY: std::cerr << "Source: Third Party"; break;
case GL_DEBUG_SOURCE_APPLICATION: std::cerr << "Source: Application"; break;
case GL_DEBUG_SOURCE_OTHER: std::cerr << "Source: Other"; break;
} std::cerr << '\n';
switch (type)
{
case GL_DEBUG_TYPE_ERROR: std::cerr << "Type: Error"; break;
case GL_DEBUG_TYPE_DEPRECATED_BEHAVIOR: std::cerr << "Type: Deprecated Behaviour"; break;
case GL_DEBUG_TYPE_UNDEFINED_BEHAVIOR: std::cerr << "Type: Undefined Behaviour"; break;
case GL_DEBUG_TYPE_PORTABILITY: std::cerr << "Type: Portability"; break;
case GL_DEBUG_TYPE_PERFORMANCE: std::cerr << "Type: Performance"; break;
case GL_DEBUG_TYPE_MARKER: std::cerr << "Type: Marker"; break;
case GL_DEBUG_TYPE_PUSH_GROUP: std::cerr << "Type: Push Group"; break;
case GL_DEBUG_TYPE_POP_GROUP: std::cerr << "Type: Pop Group"; break;
case GL_DEBUG_TYPE_OTHER: std::cerr << "Type: Other"; break;
} std::cerr << '\n';
switch (severity)
{
case GL_DEBUG_SEVERITY_HIGH: std::cerr << "Severity: High"; break;
case GL_DEBUG_SEVERITY_MEDIUM: std::cerr << "Severity: Medium"; break;
case GL_DEBUG_SEVERITY_LOW: std::cerr << "Severity: Low"; break;
case GL_DEBUG_SEVERITY_NOTIFICATION: std::cerr << "Severity: Notification"; break;
} std::cerr << '\n' << std::endl;
__debugbreak();
}
}
| 37.209302 | 120 | 0.719375 | [
"geometry"
] |
7b2eaa8f9ddd993d5874f1736516e9f6d9e2ea1c | 2,260 | cpp | C++ | 187.cpp | machinecc/leetcode | 32bbf6c1f9124049c046a235c85b14ca9168daa8 | [
"MIT"
] | null | null | null | 187.cpp | machinecc/leetcode | 32bbf6c1f9124049c046a235c85b14ca9168daa8 | [
"MIT"
] | null | null | null | 187.cpp | machinecc/leetcode | 32bbf6c1f9124049c046a235c85b14ca9168daa8 | [
"MIT"
] | null | null | null | #include <iostream>
#include <cstdlib>
#include <string>
#include <unordered_set>
#include <vector>
#include <algorithm>
#include <climits>
#include <stack>
#include <sstream>
#include <numeric>
#include <unordered_map>
#include <array>
using namespace std;
class Solution {
public:
const int len = 10;
vector<string> findRepeatedDnaSequences(string s) {
unordered_map<int,int> dict;
int n = s.length();
for (int i = 0; i < n - len + 1; ++ i) {
string subs = s.substr(i, len);
int val = str2int(subs);
if (dict.find(val) == dict.end())
dict[val] = 1;
else
dict[val] += 1;
}
vector<int> numbers;
for (auto it = dict.begin(); it != dict.end(); ++ it)
if (it->second > 1)
numbers.push_back(it->first);
vector<string> ans;
for (auto it = numbers.begin(); it != numbers.end(); ++ it)
ans.push_back(int2str(*it));
return ans;
}
int str2int(const string& s) {
int val = 0;
for (int i = 0; i < s.length(); ++ i)
val = val * 4 + char2int(s[i]);
return val;
}
int char2int(char ch) {
int val = 0;
switch (ch) {
case 'A':
val = 0;
break;
case 'C':
val = 1;
break;
case 'G':
val = 2;
break;
case 'T':
val = 3;
break;
}
return val;
}
string int2str(int num) {
string s = "";
do {
s = int2char(num % 4) + s;
num = num / 4;
} while (num > 0);
if (s.length() < len)
s = string(len - s.length(), 'A') + s;
return s;
}
char int2char(int num) {
char ch;
switch (num) {
case 0:
ch = 'A';
break;
case 1:
ch = 'C';
break;
case 2:
ch = 'G';
break;
case 3:
ch = 'T';
break;
}
return ch;
}
};
int main() {
// Solution slo;
// string s = "CTAGT";
// cout << slo.str2int(s) << endl;
// int n = slo.str2int(s);
// cout << slo.int2str(n) << endl;
string s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT";
vector<string> ans = Solution().findRepeatedDnaSequences(s);
for (int i = 0; i < ans.size(); ++ i)
cout << ans[i] << endl;
return 0;
} | 16.028369 | 64 | 0.495133 | [
"vector"
] |
7b3351b4b2fa6738c84fa0c38d3953835f1c2cab | 10,264 | cc | C++ | src/SOE.cc | grayvalley/soe | ac484973b0ce8890310cc17764dd27a7e1e18507 | [
"Apache-2.0"
] | null | null | null | src/SOE.cc | grayvalley/soe | ac484973b0ce8890310cc17764dd27a7e1e18507 | [
"Apache-2.0"
] | null | null | null | src/SOE.cc | grayvalley/soe | ac484973b0ce8890310cc17764dd27a7e1e18507 | [
"Apache-2.0"
] | null | null | null | /*
* Copyright 2020 Juha-Samuli Hellén
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
#include <iostream>
#include <grayvalley/soe/SOE.hh>
namespace GVT::SOE {
std::map<std::string, SOE::MESSAGE_TYPE> soe_enum_map = {
{"X", SOE::MESSAGE_TYPE_ORDER_CANCELED},
{"E", SOE::MESSAGE_TYPE_ORDER_EXECUTED},
{"Y", SOE::MESSAGE_TYPE_ORDER_ACCEPTED},
{"R", SOE::MESSAGE_TYPE_ORDER_REJECTED}
};
}
namespace GVT::SOE {
std::map<std::string, SIDE> map_str_side_to_enum = {
{"B", SIDE::B},
{"S", SIDE::S}
};
}
namespace GVT::SOE {
std::map<SIDE, std::string> map_enum_side_to_str = {
{SIDE::B, "B"},
{SIDE::S, "S"}
};
}
namespace GVT::SOE {
std::map<std::string, ORDER_TYPE> map_str_order_type_to_enum = {
{"LMT", ORDER_TYPE::LIMIT},
{"MKT", ORDER_TYPE::MARKET}
};
}
namespace GVT::SOE {
std::map<ORDER_TYPE, std::string> map_enum_order_type_to_str = {
{ORDER_TYPE::LIMIT, "LMT"},
{ORDER_TYPE::MARKET, "MKT"}
};
}
/**
* Populates the body of the message from a buffer
*
* @param buffer: pointer to the beginning of a buffer
* @param len: length of the message
*/
namespace GVT::SOE {
void Message::from(char* buffer, size_t len) {
m_body = nlohmann::json::parse(buffer, buffer + len);
}
}
/**
* Return type id of the message
*
* @return: integer id
*/
namespace GVT::SOE {
int Message::type() const {
if(m_body.empty()){
return MESSAGE_TYPE_EMPTY;
}
try {
auto value = m_body["message-type"].get<std::string>();
return soe_enum_map.find(value)->second;
} catch (nlohmann::json::exception& e) {
return MESSAGE_TYPE_INVALID;
}
}
}
/**
* Return an item from the message body
*/
namespace GVT::SOE {
template <typename T>
T Message::get(std::string key) {
return m_body[key].get<T>();
}
}
namespace GVT::SOE {
std::string Message::dump() {
return m_body.dump();
}
}
/**
* Get nlohmann::json object from OrderAddMessage.
*/
namespace GVT::SOE {
nlohmann::json OrderNewMessage::to_json() {
nlohmann::json payload;
payload["message-type"] = "A";
payload["instrument"] = Instrument;
payload["price"] = Price;
payload["quantity"] = Quantity;
payload["side"] = map_enum_side_to_str[Side];
payload["order-type"] = map_enum_order_type_to_str[OrderType];
return payload;
}
}
/**
* Get nlohmann::json object from OrderCancelMessage.
*/
namespace GVT::SOE {
nlohmann::json OrderCancelMessage::to_json() {
nlohmann::json payload;
payload["message-type"] = "X";
payload["order-id"] = OrderId;
return payload;
}
}
/**
* Get OrderAcceptedMessage from generic IMessage.
*/
namespace GVT::SOE {
void OrderAcceptedMessage::get(IMessage* p_imessage) {
auto* p_message = reinterpret_cast<GVT::SOE::Message*>(p_imessage);
Instrument = p_message->get<std::string>("instrument");
OrderId = p_message->get<uint64_t>("order-id");
Price = p_message->get<uint64_t>("price");
Quantity = p_message->get<uint64_t>("quantity");
auto side = p_message->get<std::string>("side");
Side = map_str_side_to_enum.find(side)->second;
auto order_type = p_message->get<std::string>("order-type");
OrderType = map_str_order_type_to_enum.find(order_type)->second;
}
}
/**
* Get SOE OrderAcceptedEvent from OrderAcceptedMessage.
*/
namespace GVT::SOE {
void OrderAcceptedMessage::put(IOrderAcceptedEvent* p_event){
p_event->Exchange = "sandbox";
p_event->Instrument = Instrument;
p_event->OrderId = OrderId;
p_event->Price = Price;
p_event->Quantity = Quantity;
p_event->Side = Side;
p_event->OrderType = OrderType;
}
}
/**
* Get SOE OrderRejectedMessage from generic IMessage.
*/
namespace GVT::SOE {
void OrderRejectedMessage::get(IMessage* p_imessage) {
auto* p_message = reinterpret_cast<GVT::SOE::Message*>(p_imessage);
Instrument = p_message->get<std::string>("instrument");
Price = p_message->get<uint64_t>("price");
Quantity = p_message->get<uint64_t>("quantity");
auto side = p_message->get<std::string>("side");
Side = map_str_side_to_enum[side];
auto order_type = p_message->get<std::string>("order-type");
OrderType = map_str_order_type_to_enum[order_type];
Reason = p_message->get<std::string>("reason");
}
}
/**
* Get OrderRejectedEvent from OrderRejectedMessage.
*/
namespace GVT::SOE {
void OrderRejectedMessage::put(IOrderRejectedEvent* p_event){
p_event->Exchange = "sandbox";
p_event->Instrument = Instrument;
p_event->Price = Price;
p_event->Quantity = Quantity;
p_event->Side = Side;
p_event->OrderType = OrderType;
p_event->Reason = Reason;
}
}
/**
* Get OrderExecutedMessage from generic IMessage.
*/
namespace GVT::SOE {
void OrderExecutedMessage::get(IMessage* p_imessage) {
auto* p_message = reinterpret_cast<GVT::SOE::Message*>(p_imessage);
Instrument = p_message->get<std::string>("instrument");
OrderId = p_message->get<uint64_t>("order-id");
Price = p_message->get<uint64_t>("price");
Quantity = p_message->get<uint64_t>("quantity");
auto side = p_message->get<std::string>("side");
Side = map_str_side_to_enum.find(side)->second;
}
}
/**
* Get OrderExecutedEvent from OrderExecutedMessage.
*/
namespace GVT::SOE {
void OrderExecutedMessage::put(IOrderExecutedEvent* p_event){
p_event->Exchange = "sandbox";
p_event->Instrument = Instrument;
p_event->OrderId = OrderId;
p_event->Price = Price;
p_event->Quantity = Quantity;
p_event->Side = Side;
}
}
/**
* Get OrderCanceledMessage from generic IMessage.
*/
namespace GVT::SOE {
void OrderCanceledMessage::get(IMessage* p_imessage) {
auto* p_message = reinterpret_cast<GVT::SOE::Message*>(p_imessage);
OrderId = p_message->get<uint64_t>("order-id");
Price = p_message->get<uint64_t>("price");
Quantity = p_message->get<uint64_t>("quantity");
auto side = p_message->get<std::string>("side");
Side = map_str_side_to_enum.find(side)->second;
Reason = p_message->get<std::string>("reason");
}
}
/**
* Get OrderExecutedEvent from OrderExecutedMessage.
*/
namespace GVT::SOE {
void OrderCanceledMessage::put(IOrderCanceledEvent* p_event) {
p_event->Exchange = "sandbox";
p_event->Instrument = Instrument;
p_event->OrderId = OrderId;
p_event->Price = Price;
p_event->Quantity = Quantity;
p_event->Side = Side;
p_event->Reason = Reason;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderNewMessage& order){
s << " --- [OrderAddMessage] ---" << std::endl;
s << "Instrument: " << order.Instrument << std::endl;
s << "Price: " << order.Price << std::endl;
s << "Quantity: " << order.Quantity << std::endl;
s << "Side: " << map_enum_side_to_str[order.Side] << std::endl;
s << "OrderType: " << map_enum_order_type_to_str[order.OrderType] << std::endl;
return s;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderCancelMessage& order){
s << " --- [OrderCancelMessage] ---" << std::endl;
s << "OrderId: " << order.OrderId << std::endl;
return s;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderAcceptedMessage& order){
s << " --- [OrderAcceptedMessage] ---" << std::endl;
s << "OrderId: " << order.OrderId << std::endl;
s << "Price: " << order.Price << std::endl;
s << "Quantity: " << order.Quantity << std::endl;
s << "Side: " << map_enum_side_to_str[order.Side] << std::endl;
s << "OrderType: " << map_enum_order_type_to_str[order.OrderType] << std::endl;
return s;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderRejectedMessage& order){
s << " --- [OrderRejectedMessage] ---" << std::endl;
s << "Price: " << order.Price << std::endl;
s << "Quantity: " << order.Quantity << std::endl;
s << "Side: " << map_enum_side_to_str[order.Side] << std::endl;
s << "OrderType: " << map_enum_order_type_to_str[order.OrderType] << std::endl;
s << "Reason: " << order.Reason << std::endl;
return s;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderExecutedMessage& order){
s << " --- [OrderExecutedMessage] ---" << std::endl;
s << "OrderId: " << order.OrderId << std::endl;
s << "Price: " << order.Price << std::endl;
s << "Quantity: " << order.Quantity << std::endl;
return s;
}
}
namespace GVT::SOE {
std::ostream &operator<<(std::ostream& s, const OrderCanceledMessage& order){
s << " --- [OrderCanceledMessage] ---" << std::endl;
s << "OrderId: " << order.OrderId << std::endl;
s << "Price: " << order.Price << std::endl;
s << "Quantity: " << order.Quantity << std::endl;
s << "Side: " << map_enum_side_to_str[order.Side] << std::endl;
return s;
};
}
| 31.975078 | 88 | 0.59509 | [
"object"
] |
7b36e974dd6a000cacab821bba4856cab38f7a0b | 1,377 | cpp | C++ | seek-test.cpp | LaurentBerger/libseek | d26a1ed76770c8e5ef2116b41a52300da6d9dac7 | [
"MIT"
] | 68 | 2015-01-13T21:43:28.000Z | 2021-05-31T13:28:42.000Z | seek-test.cpp | kkalya/seek | 84e726c1e7955ae5bd7a5fa69988db417824b047 | [
"MIT"
] | 10 | 2015-11-20T11:22:26.000Z | 2020-11-19T06:33:43.000Z | seek-test.cpp | kkalya/seek | 84e726c1e7955ae5bd7a5fa69988db417824b047 | [
"MIT"
] | 29 | 2015-03-13T04:37:20.000Z | 2020-07-14T15:50:05.000Z | #include <thread>
#include <chrono>
#include <fstream>
#include <sstream>
#include <vector>
#include "seek.hpp"
using namespace std;
using namespace LibSeek;
inline void sleep(float secs) {
chrono::milliseconds dura(int(1000*secs));
this_thread::sleep_for(dura);
}
int main() {
setbuf(stdout, NULL);
Imager iface;
iface.init();
Frame frame;
iface.frame_init(frame);
for (int i = 0; i < 71370537; i++) {
//break;
iface.frame_acquire(frame);
int h = frame.height();
int w = frame.width();
vector<uint16_t> img(w*h);
{
int _max = 0;
int _min = 0xffff;
#if 0
for (int y = 0; y < h; y++) {
for (int x = 0; x < w; x++) {
uint16_t v = frame.data()[y*w+x];
if (v > _max) _max = v;
if (v < _min) _min = v;
}
}
#elif 0
_max = 0x8200;
_min = 0x7e00;
#else
_max = 0xffff;
_min = 0x0;
#endif
for (int y = 0; y < h; y++) {
for (int x = 0; x < w; x++) {
#if 1
float v = float(frame.data()[y*w+x] - _min) / (_max - _min);
if (v < 0.0) { v = 0; }
if (v > 1.0) { v = 1; }
uint16_t o = 0xffff * v;
#else
uint16_t o = frame.data()[y*w+x];
#endif
//fprintf(stderr, " %4x", o);
img[y*w+x] = o;
}
//fprintf(stderr, "\n");
}
//fprintf(stderr, "\n");
fwrite((uint8_t*)img.data(), sizeof(uint16_t), w*h, stdout);
}
}
iface.frame_exit(frame);
iface.exit();
}
| 17.43038 | 65 | 0.545389 | [
"vector"
] |
7b3a62e14e800f3f0db7a4b3b9e6b26d2fc9ae8d | 2,160 | cpp | C++ | Cthulhu/src/TypeRegistryLocal.cpp | Yunusbcr/labgraph | a00ae7098b7b0e0eda8ce2e7e62dae86854616fb | [
"MIT"
] | 124 | 2021-07-14T21:25:59.000Z | 2022-03-08T20:40:16.000Z | Cthulhu/src/TypeRegistryLocal.cpp | VanEdward/labgraph | 9488feac59f9ef86091befdeaddb69d84e4d6fb3 | [
"MIT"
] | 46 | 2021-07-16T18:41:11.000Z | 2022-03-31T20:53:00.000Z | Cthulhu/src/TypeRegistryLocal.cpp | VanEdward/labgraph | 9488feac59f9ef86091befdeaddb69d84e4d6fb3 | [
"MIT"
] | 22 | 2021-07-16T18:34:56.000Z | 2022-03-31T15:12:06.000Z | // Copyright 2004-present Facebook. All Rights Reserved.
#include "TypeRegistryLocal.h"
#define DEFAULT_LOG_CHANNEL "Cthulhu"
#include <logging/Log.h>
namespace cthulhu {
TypeInfoInterfacePtr TypeRegistryLocal::findSampleType(const std::type_index& sampleType) const {
auto it = sampleTypeMap_.find(sampleType);
if (it != sampleTypeMap_.end()) {
return types_.at(it->second);
}
return TypeInfoInterfacePtr();
}
TypeInfoInterfacePtr TypeRegistryLocal::findConfigType(const std::type_index& configType) const {
auto it = configTypeMap_.find(configType);
if (it != configTypeMap_.end()) {
return types_.at(it->second);
}
return TypeInfoInterfacePtr();
}
TypeInfoInterfacePtr TypeRegistryLocal::findTypeName(const std::string& typeName) const {
auto it = streamNameMap_.find(typeName);
if (it != streamNameMap_.end()) {
return types_.at(it->second);
}
return TypeInfoInterfacePtr();
}
TypeInfoInterfacePtr TypeRegistryLocal::findTypeID(uint32_t typeID) const {
if (typeID > 0 && typeID <= types_.size()) {
return types_.at(typeID - 1);
}
return TypeInfoInterfacePtr();
}
std::vector<std::string> TypeRegistryLocal::typeNames() const {
std::vector<std::string> typeNames;
for (const auto& type : streamNameMap_) {
typeNames.push_back(type.first);
}
return typeNames;
}
void TypeRegistryLocal::registerType(TypeDefinition definition) {
for (const auto& type : types_) {
if (type->typeName().compare(definition.typeName) == 0) {
auto str =
"Attempted to register type: [" + type->typeName() + "] which was detected as duplicate.";
XR_LOGE("{}", str);
throw std::runtime_error(str);
}
}
if (definition.sampleType != typeid(nullptr)) {
sampleTypeMap_[definition.sampleType] = types_.size();
}
if (definition.configType && *definition.configType != typeid(nullptr)) {
configTypeMap_[*definition.configType] = types_.size();
}
streamNameMap_[definition.typeName] = types_.size();
types_.push_back(std::shared_ptr<TypeInfoLocal>(
new TypeInfoLocal{std::move(definition), static_cast<uint32_t>(types_.size())}));
}
} // namespace cthulhu
| 30.422535 | 100 | 0.710185 | [
"vector"
] |
7b3b032c285ec2450813b1b2329425e71b3aa905 | 711 | cpp | C++ | leetcode_archived_cpp/LeetCode_72.cpp | Sean10/Algorithm_code | 46ff1cb5b81400cbcc324dabdf4298bf7a55e5eb | [
"BSD-3-Clause"
] | null | null | null | leetcode_archived_cpp/LeetCode_72.cpp | Sean10/Algorithm_code | 46ff1cb5b81400cbcc324dabdf4298bf7a55e5eb | [
"BSD-3-Clause"
] | 7 | 2021-03-19T04:41:21.000Z | 2021-10-19T15:46:36.000Z | leetcode_archived_cpp/LeetCode_72.cpp | Sean10/Algorithm_code | 46ff1cb5b81400cbcc324dabdf4298bf7a55e5eb | [
"BSD-3-Clause"
] | null | null | null | class Solution {
public:
int minDistance(string word1, string word2) {
vector<vector<int>> dp(word1.size()+1, vector<int>(word2.size()+1, 0));
for (int i = 0;i <= word1.size(); i++)
dp[i][0] = i;
for (int j = 0;j <= word2.size(); j++)
dp[0][j] = j;
for (int i = 1;i <= word1.size(); i++)
for (int j = 1;j <= word2.size(); j++)
{
if (word1[i-1] == word2[j-1])
dp[i][j] = dp[i-1][j-1];
else
dp[i][j] = 1 + min({dp[i-1][j-1], dp[i][j-1], dp[i-1][j]});
}
return dp[word1.size()][word2.size()];
}
};
| 29.625 | 79 | 0.376934 | [
"vector"
] |
7b4070199c78378d3bfaf8a4bcd6f435e3a707cb | 106 | cpp | C++ | samples/tests/src/ownheaderbeforestandardgood.cpp | Rosme/sift | f8d05d19562b4da13271d5c26658d7e8c47866ae | [
"MIT"
] | 4 | 2018-06-15T12:54:10.000Z | 2020-09-22T16:01:35.000Z | samples/tests/src/ownheaderbeforestandardgood.cpp | Rosme/sift | f8d05d19562b4da13271d5c26658d7e8c47866ae | [
"MIT"
] | null | null | null | samples/tests/src/ownheaderbeforestandardgood.cpp | Rosme/sift | f8d05d19562b4da13271d5c26658d7e8c47866ae | [
"MIT"
] | null | null | null | #include "test.h"
#include "otherHeader.h"
#include <vector>
//This works fine
int main() {
return 0;
} | 13.25 | 24 | 0.669811 | [
"vector"
] |
0da81a567eb1a9e59a0c12b6f523f7f7b5b33ef3 | 15,418 | cc | C++ | cpp/src/arrow/flight/transport.cc | davisusanibar/arrow | 07ac9fd86c6225f493943e4ab0ff35b0fdbfb2ae | [
"CC-BY-3.0",
"Apache-2.0",
"CC0-1.0",
"MIT"
] | 1 | 2021-12-14T06:44:19.000Z | 2021-12-14T06:44:19.000Z | cpp/src/arrow/flight/transport.cc | davisusanibar/arrow | 07ac9fd86c6225f493943e4ab0ff35b0fdbfb2ae | [
"CC-BY-3.0",
"Apache-2.0",
"CC0-1.0",
"MIT"
] | 2 | 2021-11-17T14:36:51.000Z | 2022-01-23T16:49:53.000Z | cpp/src/arrow/flight/transport.cc | davisusanibar/arrow | 07ac9fd86c6225f493943e4ab0ff35b0fdbfb2ae | [
"CC-BY-3.0",
"Apache-2.0",
"CC0-1.0",
"MIT"
] | null | null | null | // Licensed to the Apache Software Foundation (ASF) under one
// or more contributor license agreements. See the NOTICE file
// distributed with this work for additional information
// regarding copyright ownership. The ASF licenses this file
// to you under the Apache License, Version 2.0 (the
// "License"); you may not use this file except in compliance
// with the License. You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing,
// software distributed under the License is distributed on an
// "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
// KIND, either express or implied. See the License for the
// specific language governing permissions and limitations
// under the License.
#include "arrow/flight/transport.h"
#include <sstream>
#include <unordered_map>
#include "arrow/flight/client_auth.h"
#include "arrow/flight/transport_server.h"
#include "arrow/flight/types.h"
#include "arrow/ipc/message.h"
#include "arrow/result.h"
#include "arrow/status.h"
#include "arrow/util/make_unique.h"
namespace arrow {
namespace flight {
namespace internal {
::arrow::Result<std::unique_ptr<ipc::Message>> FlightData::OpenMessage() {
return ipc::Message::Open(metadata, body);
}
bool TransportDataStream::ReadData(internal::FlightData*) { return false; }
arrow::Result<bool> TransportDataStream::WriteData(const FlightPayload&) {
return Status::NotImplemented("Writing data for this stream");
}
Status TransportDataStream::WritesDone() { return Status::OK(); }
bool ClientDataStream::ReadPutMetadata(std::shared_ptr<Buffer>*) { return false; }
Status ClientDataStream::Finish(Status st) {
auto server_status = DoFinish();
if (server_status.ok()) return st;
return Status::FromDetailAndArgs(server_status.code(), server_status.detail(),
server_status.message(),
". Client context: ", st.ToString());
}
Status ClientTransport::Authenticate(const FlightCallOptions& options,
std::unique_ptr<ClientAuthHandler> auth_handler) {
return Status::NotImplemented("Authenticate for this transport");
}
arrow::Result<std::pair<std::string, std::string>>
ClientTransport::AuthenticateBasicToken(const FlightCallOptions& options,
const std::string& username,
const std::string& password) {
return Status::NotImplemented("AuthenticateBasicToken for this transport");
}
Status ClientTransport::DoAction(const FlightCallOptions& options, const Action& action,
std::unique_ptr<ResultStream>* results) {
return Status::NotImplemented("DoAction for this transport");
}
Status ClientTransport::ListActions(const FlightCallOptions& options,
std::vector<ActionType>* actions) {
return Status::NotImplemented("ListActions for this transport");
}
Status ClientTransport::GetFlightInfo(const FlightCallOptions& options,
const FlightDescriptor& descriptor,
std::unique_ptr<FlightInfo>* info) {
return Status::NotImplemented("GetFlightInfo for this transport");
}
arrow::Result<std::unique_ptr<SchemaResult>> ClientTransport::GetSchema(
const FlightCallOptions& options, const FlightDescriptor& descriptor) {
return Status::NotImplemented("GetSchema for this transport");
}
Status ClientTransport::ListFlights(const FlightCallOptions& options,
const Criteria& criteria,
std::unique_ptr<FlightListing>* listing) {
return Status::NotImplemented("ListFlights for this transport");
}
Status ClientTransport::DoGet(const FlightCallOptions& options, const Ticket& ticket,
std::unique_ptr<ClientDataStream>* stream) {
return Status::NotImplemented("DoGet for this transport");
}
Status ClientTransport::DoPut(const FlightCallOptions& options,
std::unique_ptr<ClientDataStream>* stream) {
return Status::NotImplemented("DoPut for this transport");
}
Status ClientTransport::DoExchange(const FlightCallOptions& options,
std::unique_ptr<ClientDataStream>* stream) {
return Status::NotImplemented("DoExchange for this transport");
}
class TransportRegistry::Impl final {
public:
arrow::Result<std::unique_ptr<ClientTransport>> MakeClient(
const std::string& scheme) const {
auto it = client_factories_.find(scheme);
if (it == client_factories_.end()) {
return Status::KeyError("No client transport implementation for ", scheme);
}
return it->second();
}
arrow::Result<std::unique_ptr<ServerTransport>> MakeServer(
const std::string& scheme, FlightServerBase* base,
std::shared_ptr<MemoryManager> memory_manager) const {
auto it = server_factories_.find(scheme);
if (it == server_factories_.end()) {
return Status::KeyError("No server transport implementation for ", scheme);
}
return it->second(base, std::move(memory_manager));
}
Status RegisterClient(const std::string& scheme, ClientFactory factory) {
auto it = client_factories_.insert({scheme, std::move(factory)});
if (!it.second) {
return Status::Invalid("Client transport already registered for ", scheme);
}
return Status::OK();
}
Status RegisterServer(const std::string& scheme, ServerFactory factory) {
auto it = server_factories_.insert({scheme, std::move(factory)});
if (!it.second) {
return Status::Invalid("Server transport already registered for ", scheme);
}
return Status::OK();
}
private:
std::unordered_map<std::string, TransportRegistry::ClientFactory> client_factories_;
std::unordered_map<std::string, TransportRegistry::ServerFactory> server_factories_;
};
TransportRegistry::TransportRegistry() { impl_ = arrow::internal::make_unique<Impl>(); }
TransportRegistry::~TransportRegistry() = default;
arrow::Result<std::unique_ptr<ClientTransport>> TransportRegistry::MakeClient(
const std::string& scheme) const {
return impl_->MakeClient(scheme);
}
arrow::Result<std::unique_ptr<ServerTransport>> TransportRegistry::MakeServer(
const std::string& scheme, FlightServerBase* base,
std::shared_ptr<MemoryManager> memory_manager) const {
return impl_->MakeServer(scheme, base, std::move(memory_manager));
}
Status TransportRegistry::RegisterClient(const std::string& scheme,
ClientFactory factory) {
return impl_->RegisterClient(scheme, std::move(factory));
}
Status TransportRegistry::RegisterServer(const std::string& scheme,
ServerFactory factory) {
return impl_->RegisterServer(scheme, std::move(factory));
}
TransportRegistry* GetDefaultTransportRegistry() {
static TransportRegistry kRegistry;
return &kRegistry;
}
//------------------------------------------------------------
// Error propagation helpers
TransportStatus TransportStatus::FromStatus(const Status& arrow_status) {
if (arrow_status.ok()) {
return TransportStatus{TransportStatusCode::kOk, ""};
}
TransportStatusCode code = TransportStatusCode::kUnknown;
std::string message = arrow_status.message();
if (arrow_status.detail()) {
message += ". Detail: ";
message += arrow_status.detail()->ToString();
}
std::shared_ptr<FlightStatusDetail> flight_status =
FlightStatusDetail::UnwrapStatus(arrow_status);
if (flight_status) {
switch (flight_status->code()) {
case FlightStatusCode::Internal:
code = TransportStatusCode::kInternal;
break;
case FlightStatusCode::TimedOut:
code = TransportStatusCode::kTimedOut;
break;
case FlightStatusCode::Cancelled:
code = TransportStatusCode::kCancelled;
break;
case FlightStatusCode::Unauthenticated:
code = TransportStatusCode::kUnauthenticated;
break;
case FlightStatusCode::Unauthorized:
code = TransportStatusCode::kUnauthorized;
break;
case FlightStatusCode::Unavailable:
code = TransportStatusCode::kUnavailable;
break;
default:
break;
}
} else if (arrow_status.IsKeyError()) {
code = TransportStatusCode::kNotFound;
} else if (arrow_status.IsInvalid()) {
code = TransportStatusCode::kInvalidArgument;
} else if (arrow_status.IsCancelled()) {
code = TransportStatusCode::kCancelled;
} else if (arrow_status.IsNotImplemented()) {
code = TransportStatusCode::kUnimplemented;
} else if (arrow_status.IsAlreadyExists()) {
code = TransportStatusCode::kAlreadyExists;
}
return TransportStatus{code, std::move(message)};
}
TransportStatus TransportStatus::FromCodeStringAndMessage(const std::string& code_str,
std::string message) {
int code_int = 0;
try {
code_int = std::stoi(code_str);
} catch (...) {
return TransportStatus{
TransportStatusCode::kUnknown,
message + ". Also, server sent unknown or invalid Arrow status code " + code_str};
}
switch (code_int) {
case static_cast<int>(TransportStatusCode::kOk):
case static_cast<int>(TransportStatusCode::kUnknown):
case static_cast<int>(TransportStatusCode::kInternal):
case static_cast<int>(TransportStatusCode::kInvalidArgument):
case static_cast<int>(TransportStatusCode::kTimedOut):
case static_cast<int>(TransportStatusCode::kNotFound):
case static_cast<int>(TransportStatusCode::kAlreadyExists):
case static_cast<int>(TransportStatusCode::kCancelled):
case static_cast<int>(TransportStatusCode::kUnauthenticated):
case static_cast<int>(TransportStatusCode::kUnauthorized):
case static_cast<int>(TransportStatusCode::kUnimplemented):
case static_cast<int>(TransportStatusCode::kUnavailable):
return TransportStatus{static_cast<TransportStatusCode>(code_int),
std::move(message)};
default: {
return TransportStatus{
TransportStatusCode::kUnknown,
message + ". Also, server sent unknown or invalid Arrow status code " +
code_str};
}
}
}
Status TransportStatus::ToStatus() const {
switch (code) {
case TransportStatusCode::kOk:
return Status::OK();
case TransportStatusCode::kUnknown: {
std::stringstream ss;
ss << "Flight RPC failed with message: " << message;
return Status::UnknownError(ss.str()).WithDetail(
std::make_shared<FlightStatusDetail>(FlightStatusCode::Failed));
}
case TransportStatusCode::kInternal:
return Status::IOError("Flight returned internal error, with message: ", message)
.WithDetail(std::make_shared<FlightStatusDetail>(FlightStatusCode::Internal));
case TransportStatusCode::kInvalidArgument:
return Status::Invalid("Flight returned invalid argument error, with message: ",
message);
case TransportStatusCode::kTimedOut:
return Status::IOError("Flight returned timeout error, with message: ", message)
.WithDetail(std::make_shared<FlightStatusDetail>(FlightStatusCode::TimedOut));
case TransportStatusCode::kNotFound:
return Status::KeyError("Flight returned not found error, with message: ", message);
case TransportStatusCode::kAlreadyExists:
return Status::AlreadyExists("Flight returned already exists error, with message: ",
message);
case TransportStatusCode::kCancelled:
return Status::Cancelled("Flight cancelled call, with message: ", message)
.WithDetail(std::make_shared<FlightStatusDetail>(FlightStatusCode::Cancelled));
case TransportStatusCode::kUnauthenticated:
return Status::IOError("Flight returned unauthenticated error, with message: ",
message)
.WithDetail(
std::make_shared<FlightStatusDetail>(FlightStatusCode::Unauthenticated));
case TransportStatusCode::kUnauthorized:
return Status::IOError("Flight returned unauthorized error, with message: ",
message)
.WithDetail(
std::make_shared<FlightStatusDetail>(FlightStatusCode::Unauthorized));
case TransportStatusCode::kUnimplemented:
return Status::NotImplemented("Flight returned unimplemented error, with message: ",
message);
case TransportStatusCode::kUnavailable:
return Status::IOError("Flight returned unavailable error, with message: ", message)
.WithDetail(
std::make_shared<FlightStatusDetail>(FlightStatusCode::Unavailable));
default:
return Status::UnknownError("Flight failed with error code ",
static_cast<int>(code), " and message: ", message);
}
}
Status ReconstructStatus(const std::string& code_str, const Status& current_status,
util::optional<std::string> message,
util::optional<std::string> detail_message,
util::optional<std::string> detail_bin,
std::shared_ptr<FlightStatusDetail> detail) {
// Bounce through std::string to get a proper null-terminated C string
StatusCode status_code = current_status.code();
std::stringstream status_message;
try {
const auto code_int = std::stoi(code_str);
switch (code_int) {
case static_cast<int>(StatusCode::OutOfMemory):
case static_cast<int>(StatusCode::KeyError):
case static_cast<int>(StatusCode::TypeError):
case static_cast<int>(StatusCode::Invalid):
case static_cast<int>(StatusCode::IOError):
case static_cast<int>(StatusCode::CapacityError):
case static_cast<int>(StatusCode::IndexError):
case static_cast<int>(StatusCode::Cancelled):
case static_cast<int>(StatusCode::UnknownError):
case static_cast<int>(StatusCode::NotImplemented):
case static_cast<int>(StatusCode::SerializationError):
case static_cast<int>(StatusCode::RError):
case static_cast<int>(StatusCode::CodeGenError):
case static_cast<int>(StatusCode::ExpressionValidationError):
case static_cast<int>(StatusCode::ExecutionError):
case static_cast<int>(StatusCode::AlreadyExists): {
status_code = static_cast<StatusCode>(code_int);
break;
}
default: {
status_message << ". Also, server sent unknown or invalid Arrow status code "
<< code_str;
break;
}
}
} catch (...) {
status_message << ". Also, server sent unknown or invalid Arrow status code "
<< code_str;
}
status_message << (message.has_value() ? *message : current_status.message());
if (detail_message.has_value()) {
status_message << ". Detail: " << *detail_message;
}
if (detail_bin.has_value()) {
if (!detail) {
detail = std::make_shared<FlightStatusDetail>(FlightStatusCode::Internal);
}
detail->set_extra_info(std::move(*detail_bin));
}
return Status(status_code, status_message.str(), std::move(detail));
}
} // namespace internal
} // namespace flight
} // namespace arrow
| 43.067039 | 90 | 0.680568 | [
"vector"
] |
0daba9f4117a5205216f13ea572acde76e2c8021 | 4,568 | hpp | C++ | crogine/include/crogine/graphics/Image.hpp | fallahn/crogine | f6cf3ade1f4e5de610d52e562bf43e852344bca0 | [
"FTL",
"Zlib"
] | 41 | 2017-08-29T12:14:36.000Z | 2022-02-04T23:49:48.000Z | crogine/include/crogine/graphics/Image.hpp | fallahn/crogine | f6cf3ade1f4e5de610d52e562bf43e852344bca0 | [
"FTL",
"Zlib"
] | 11 | 2017-09-02T15:32:45.000Z | 2021-12-27T13:34:56.000Z | crogine/include/crogine/graphics/Image.hpp | fallahn/crogine | f6cf3ade1f4e5de610d52e562bf43e852344bca0 | [
"FTL",
"Zlib"
] | 5 | 2020-01-25T17:51:45.000Z | 2022-03-01T05:20:30.000Z | /*-----------------------------------------------------------------------
Matt Marchant 2017 - 2020
http://trederia.blogspot.com
crogine - Zlib license.
This software is provided 'as-is', without any express or
implied warranty.In no event will the authors be held
liable for any damages arising from the use of this software.
Permission is granted to anyone to use this software for any purpose,
including commercial applications, and to alter it and redistribute
it freely, subject to the following restrictions :
1. The origin of this software must not be misrepresented;
you must not claim that you wrote the original software.
If you use this software in a product, an acknowledgment
in the product documentation would be appreciated but
is not required.
2. Altered source versions must be plainly marked as such,
and must not be misrepresented as being the original software.
3. This notice may not be removed or altered from any
source distribution.
-----------------------------------------------------------------------*/
#pragma once
#include <crogine/Config.hpp>
#include <crogine/detail/Types.hpp>
#include <crogine/detail/glm/vec2.hpp>
#include <string>
#include <vector>
namespace cro
{
class Colour;
/*!
\brief CPU side representation of an image.
Images can be loaded from file formats BMP, GIF, JPEG, LBM, PCX, PNG, PNM, TGA
(desktop platforms can load all formats supported by SDL2_image).
Images can have their pixels manipulated directly, but can only be drawn once
they have been loaded on to the GPU via cro::Texture. Unlike texture Images
are copyable - although this is a heavy operation.
*/
class CRO_EXPORT_API Image final
{
public:
/*!
\brief Constructor.
Images are invalid until either create() or load*() functions have been
called and returned successfully.
*/
explicit Image(bool flipOnLoad = false);
/*!
\brief Creates an empty image.
\param width Width of image to create. On mobile platforms this should be pow2
\param height Height of image to create. On mobile platforms this should be pow2
\param colour Colour to fill image with
\param format Image Format. Can be RGB or RGBA, defaults to RGBA
*/
void create(std::uint32_t width, std::uint32_t height, Colour colour, ImageFormat::Type format = ImageFormat::RGBA);
/*!
\brief Attempts to load an image from a file on disk.
On mobile platforms images should have power 2 dimensions.
\returns true on success, else false
*/
bool loadFromFile(const std::string& path);
/*!
\brief Attemps to load an image from raw pixels in memory.
Pixels must be 8-bit and in RGB or RGBA format
\param px Pointer to array of pixels in memory
\param width Width of image to create. On mobile platforms this should be pow2
\param height Height of image to create. On mobile platforms this should be pow2
\param format Image Format. Can be RGB or RGBA
*/
bool loadFromMemory(const std::uint8_t* px, std::uint32_t width, std::uint32_t height, ImageFormat::Type format);
/*!
\brief Sets pixels of a particular colour to transparent.
Only works on RGBA format images which have been successfully loaded.
\param colour Pixels this colour will be made transparent
*/
void setTransparencyColour(Colour colour);
/*!
\brief Returns the dimensions of the image.
*/
glm::uvec2 getSize() const;
/*!
\brief Returns the currently loaded image format.
*/
ImageFormat::Type getFormat() const;
/*!
\brief Returns a pointer to the underlying pixel data
*/
const std::uint8_t* getPixelData() const;
/*!
\brief Saves this image to the given path
\returns true on success else false
*/
bool write(const std::string& path);
/*!
\brief Sets the pixel at the given position to the given colour
\param x The x coordinate of the pixel
\param y The y coordinate of the pixel
\param colour The colour to set the pixel to.
*/
void setPixel(std::size_t x, std::size_t y, cro::Colour colour);
private:
glm::uvec2 m_size = glm::uvec2(0);
ImageFormat::Type m_format;
std::vector<std::uint8_t> m_data;
bool m_flipped;
bool m_flipOnLoad;
};
} | 34.606061 | 124 | 0.648205 | [
"vector"
] |
0db7fc3d7cb2f18eb1da5ebd2ecbfaab417c309b | 2,413 | cpp | C++ | nfc-i2c-tool.cpp | linkineo/ntag-nfc-i2c-tool | 6a1d6e830839a50313f8658121fc67085a405322 | [
"MIT"
] | 3 | 2019-07-26T17:54:34.000Z | 2021-10-16T18:30:46.000Z | nfc-i2c-tool.cpp | linkineo/ntag-nfc-i2c-tool | 6a1d6e830839a50313f8658121fc67085a405322 | [
"MIT"
] | null | null | null | nfc-i2c-tool.cpp | linkineo/ntag-nfc-i2c-tool | 6a1d6e830839a50313f8658121fc67085a405322 | [
"MIT"
] | null | null | null | #include "i2c-dev.h"
#include <iostream>
#include <string>
#include <fcntl.h>
#include <unistd.h>
#include <bitset>
#include <vector>
const uint8_t page_size_bytes = 16;
void read_nfc(int fd,uint8_t page)
{
uint8_t values[16];
uint8_t res = i2c_smbus_read_i2c_block_data(fd, page, page_size_bytes, &values[0]);
std::string ascii = "";
for(int i=0;i<page_size_bytes;i++)
{
std::cout << "[" << i << "] -> 0x" << std::hex << (int)values[i] << std::endl;;
if((int)values[i] >= 32 && (int)values[i] < 128)
{
ascii += values[i];
}else
{
ascii += "_";
}
}
std::cout << "ASCII= " << ascii << std::endl;
}
void write_nfc(int fd, uint8_t page, std::string s)
{
std::vector<uint8_t> vals(s.begin(), s.begin()+page_size_bytes);
for(int p=0;p<(16-vals.size());p++)
{
vals.push_back(' ');
}
uint8_t res = i2c_smbus_write_i2c_block_data(fd, page,page_size_bytes, &vals[0]);
if(!res)
{
std::cout << "Write successful [Page=" << (int)page << "]" << std::endl;
}else
{
std::cout << "WRITE ERROR" << std::endl;
}
}
int main(int argc, char* argv[])
{
uint8_t page = 0x0;
int i2cDeviceFd = 0;
int i2cAdapterNumber = 1;
uint8_t i2cSlaveAddress = 0x55; //default address;
std::string i2cDevice;
i2cDevice = "/dev/i2c-" + std::to_string(i2cAdapterNumber);
i2cDeviceFd = open(i2cDevice.c_str(), O_RDWR);
std::cout << "Reading NXP I2C-NFC tags" << std::endl;
std::cout << "Usage: [app] r page_number" << std::endl;
std::cout << "Usage: [app] w page_number string" << std::endl;
std::cout << "----------------------------------------" << std::endl;
if(argc < 2)
{
return -1;
}else
{
if (i2cDeviceFd < 0)
{
std::cout << "ERROR: file descriptor" << std::endl;
return -1;
}
int ioCtlHandle = ioctl(i2cDeviceFd, I2C_SLAVE_FORCE, i2cSlaveAddress);
if (ioCtlHandle < 0){
std::cout << "ERROR: IOCTL" << std::endl;
return -1;
}
if(*argv[1] == 'r'){
uint8_t page = std::atoi(argv[2]);
std::cout << "Reading 16 bytes [Slave=0x" << std::hex << (int)i2cSlaveAddress << ",Page=" << (int)page << "]" << std::endl;
read_nfc(i2cDeviceFd,page);
}
if(*argv[1] == 'w'){
uint8_t page = std::atoi(argv[2]);
write_nfc(i2cDeviceFd,page,std::string(argv[3]));
}
}
return 0;
}
| 23.891089 | 131 | 0.556569 | [
"vector"
] |
0dbd34cdcc3b3c7eb09064bc0ead763d2ac3e1b8 | 6,145 | cpp | C++ | src/ekf.cpp | nobunoby/EKF | 610ac2ca1958173c771e1150992cea1e5d5d9da4 | [
"MIT"
] | null | null | null | src/ekf.cpp | nobunoby/EKF | 610ac2ca1958173c771e1150992cea1e5d5d9da4 | [
"MIT"
] | null | null | null | src/ekf.cpp | nobunoby/EKF | 610ac2ca1958173c771e1150992cea1e5d5d9da4 | [
"MIT"
] | null | null | null | #include <algorithm>
#include <math.h>
#include <random>
#include "ekf.hpp"
#include "matplotlibcpp.h"
namespace plt = matplotlibcpp;
namespace prediction
{
void plot(Eigen::Vector4d truth, Eigen::Vector4d pred, Eigen::Vector4d obs) {
// plot planned path
static std::vector<double> truth_x(1), truth_y(1);
truth_x.push_back(truth(State::X));
truth_y.push_back(truth(State::Y));
plt::plot(truth_x, truth_y, "r-");
static std::vector<double> pred_x(1), pred_y(1);
pred_x.push_back(pred(State::X));
pred_y.push_back(pred(State::Y));
plt::plot(pred_x, pred_y, "k-");
std::vector<double> obs_x(1), obs_y(1);
obs_x.push_back(obs(State::X));
obs_y.push_back(obs(State::Y));
plt::scatter(obs_x, obs_y, 16.0);
plt::pause(0.01);
//plt::show();
plt::save("../doc/groundtruth_state_predicted_states.png");
}
EKF::EKF() {
initializeKF();
estimate();
}
void EKF::initializeKF() {
// covariance matrix of process noise [x y yaw v]
Q << 0.15, 0, 0, 0,
0, 0.15, 0, 0,
0, 0, 0.21, 0,
0, 0, 0, 0.25;
// prediction covariance matrix
Pest << Eigen::Matrix4d::Identity() * 0.01;
//Eigen::MatrixXd Pest = Eigen::Matrix<double, 4, 4>::Identity();
}
void EKF::estimate() {
double dt = 0.1;
double end_time = 90;
int cnt = 0;
for (double time = .0; time < end_time; time += dt) {
cnt++;
//update simulated ground truth and get new control inputs
simulate(time, dt);
// prediction step with new control inputs
predictionUpdate(time, u);
//std::cout << std::endl << "xTruth:\n" << xTruth << std::endl
// << "xEst:\n" << xEst << std::endl;
if (cnt%1 == 0) {
// observation vector [x y yaw v]
Eigen::Vector4d z;
z = getObservation(); // get contaminated sensor data
// covariance of observation noise
Eigen::Matrix4d R;
R << 0.515, 0, 0, 0,
0, 0.515, 0, 0,
0, 0, 0.51, 0,
0, 0, 0, 0.55;
// update step
observationUpdate(z, R);
if (cnt%10 == 0) plot(xTruth, xEst, z);
}
//std::cout << "Pest:\n" << Pest << std::endl;
//std::cout << std::endl << "xTruth:\n" << xTruth << std::endl
// << "xEst:\n" << xEst << std::endl;
}
}
void EKF::observationUpdate(Eigen::Vector4d z, Eigen::Matrix4d R) {
// observation matrix
Eigen::Matrix4d H = Eigen::Matrix4d::Identity();
// Kalman gain
Eigen::MatrixXd K = Pest * H.transpose() * (H * Pest * H.transpose() + R).inverse();
xEst = xEst + K * (z - H * xEst);
Pest = (Eigen::Matrix4d::Identity() - K * H) * Pest;
}
void EKF::predictionUpdate(const double& current_time, Eigen::Vector2d u) {
static double last_time = .0;
double dt = current_time - last_time;
last_time = current_time;
// prediction step: update predicted states
//Eigen::Vector4d imu_data = getImu();
motionUpdate(dt, xEst, u);
//std::cout << "xEst:" << std::endl << xEst << std::endl;
// jacobian of state function dA/dx
Eigen::Matrix4d F = Eigen::Matrix4d::Identity();
F(0, 2) = - u(IMU::VX_IN) * sin(xEst(State::YAW)) * dt;
F(0, 3) = cos(xEst(State::YAW)) * dt;
F(1, 2) = u(IMU::VX_IN) * cos(xEst(State::YAW)) * dt;
F(1, 3) = sin(xEst(State::YAW)) * dt;
std::cout << std::endl;
//std::cout << "dA/dx:\n" << F << std::endl;
std::cout << "Pest:\n" << Pest << std::endl;
std::cout << "F * Pest * F.transpose():\n" << F * Pest * F.transpose() << std::endl;
//std::cout << "Q:\n" << Q << std::endl;
std::cout << "F * Pest * F.transpose() + Q:\n" << F * Pest * F.transpose() + Q << std::endl;
//std::cout << "Pest:" << std::endl << Pest << std::endl;
Pest = F * Pest * F.transpose() + Q;
//std::cout << "updated Pest:" << std::endl << Pest << std::endl;
}
/**
* @brief update simulated control inputs and simulated ground truth
*
* @param time
*/
void EKF::simulate(const double& time, const double& dt) {
// control input [v yaw_rate]
u << 1.0 * (1 - exp(-time / 10.0)), 0.05 * (1 - exp(-time / 10.0));
//std::cout << "\nu:\n" << u << std::endl;
Eigen::Vector2d uTruth(u);
// R
Eigen::Vector2d contCov{0.52232,0.39225};
std::random_device device_random;
std::default_random_engine generator(device_random());
for (int i=0; i < uTruth.size(); i++){
std::normal_distribution<double> noise(0, contCov(i));
uTruth(i) += noise(generator);
}
//std::cout << "uTruth:\n" << uTruth << std::endl;
// update ground truth poses
motionUpdate(dt, xTruth, uTruth);
}
/**
* @brief update state vecotr by feeding last state, control inputs and current time step
*
* @param current_time time when this function called. Used for calculating time step
* @param x [x y yaw v] updated states
* @param cont control inputs
*/
void EKF::motionUpdate(const double& dt, //current_time,
Eigen::Vector4d& x, const Eigen::Vector2d& cont) {
//static double last_time = .0;
// dicretized time step
//double dt = current_time - last_time;
// dynamics
Eigen::Matrix4d A;
A << 1, 0, 0, 0,
0, 1, 0, 0,
0, 0, 1, 0,
0, 0, 0, 0;
Eigen::Matrix<double, 4, 2> B;
B << dt * cos(x(State::YAW)), 0,
dt * sin(x(State::YAW)), 0,
0, dt,
1, 0;
//std::cout << "B\n" << B << std::endl;
x = A * x + B * cont;
//std::cout << x(State::YAW) << std::endl;
//last_time = current_time;
}
Eigen::Vector4d EKF::getObservation() {
/* Simulation parameters */
// R
Eigen::Vector4d obsCov{0.515, 0.515, 0.527, 0.225};
Eigen::Vector4d obs{xTruth};
// noise
std::random_device device_random;
std::default_random_engine generator(device_random());
for (int i=0; i < obs.size(); i++){
std::normal_distribution<double> noise(0, obsCov(i));
obs(i) += noise(generator);
}
//std::cout << "obs truth: " << std::endl << xTruth << std::endl
// << "obs contaminated: " << std::endl << obs << std::endl;
return obs;
}
} // namespace prediction
int main() {
prediction::EKF kf;
return 0;
} | 27.070485 | 94 | 0.572335 | [
"vector"
] |
0dd998e8c2b56b7f2bf36d0ba0874afd3f2c054c | 37,962 | cpp | C++ | engine.cpp | vkvd/polyedit | 07eb56571bb6b53a5f87b5ac1480b7454622d37e | [
"MIT"
] | 21 | 2016-10-13T21:49:03.000Z | 2021-08-07T21:56:31.000Z | engine.cpp | vkvd/polyedit | 07eb56571bb6b53a5f87b5ac1480b7454622d37e | [
"MIT"
] | 1 | 2018-08-01T06:37:10.000Z | 2018-08-02T14:03:02.000Z | engine.cpp | vkvd/polyedit | 07eb56571bb6b53a5f87b5ac1480b7454622d37e | [
"MIT"
] | null | null | null | #include "stdafx.h"
#include "engine.h"
#include "poly.h"
#include "tinyfiledialogs.h"
#include "json/json.h"
#include <iomanip>
#include "imgui/imgui.h"
#include "imgui/imconfig.h"
#include "imgui-backends/SFML/imgui-events-SFML.h"
#include "imgui-backends/SFML/imgui-rendering-SFML.h"
#include "imgui/imguicolorpicker.h"
#include <cmath>
#include "guiConstants.h"
// Fixes for windows
#ifdef _WIN32
#define strdup _strdup
#define snprintf sprintf_s
// Comment this out if it causes issues, not totally sure of how it works
#pragma comment(linker, "/SUBSYSTEM:windows /ENTRY:mainCRTStartup") // Don't open console with window
#endif
// The title of the window set in the constructor.
#define WINDOWTITLE "Lowpoly Editor"
// Starting window size.
#define WINDOW_X 1280
#define WINDOW_Y 720
// Fixed framerate set in the engine constructor.
#define FRAMERATE 144
// Range in pixels to snap to already existing points.
#define GRABDIST 10
// Number of decimals to care about when using randdbl.
// RPRECISION should equal 10^x where x is the relevant decimal count.
#define RPRECISION 10000
// Returns a random double between a and b.
#define randdbl(a,b) ((rand()%(RPRECISION*(b-a)))/(RPRECISION*((float)b-a))+a)
// Returns the distance between two vectors.
float v2fdistance(sf::Vector2f a, sf::Vector2f b){
return std::sqrt((b.x - a.x)*(b.x - a.x) + (b.y - a.y)*(b.y - a.y));
}
// Constructor for the main engine.
// Sets up renderwindow variables and loads an image.
Engine::Engine(int aaLevel) {
BGColor = sf::Color(125, 125, 125, 255);
sf::ContextSettings settings;
settings.antialiasingLevel = aaLevel;
window = new sf::RenderWindow(sf::VideoMode(WINDOW_X, WINDOW_Y), WINDOWTITLE, sf::Style::Default, settings);
window->setFramerateLimit(FRAMERATE);
window->setVerticalSyncEnabled(false);
window->setKeyRepeatEnabled(false);
// Call load, get result
pointIdleColor = sf::Color::Green;
pointSelectedColor = sf::Color::Blue;
if (load() != 0){
std::exit(1);
}
// Set view standard and load the image
view.reset(sf::FloatRect(0, 0, WINDOW_X, WINDOW_Y));
window->setView(view);
drawimg.setTexture(image);
// Initialize GUI and backend
ImGui::SFML::SetRenderTarget(*window);
ImGui::SFML::InitImGuiRendering();
ImGui::SFML::SetWindow(*window);
ImGui::SFML::InitImGuiEvents();
}
// Destructor for the main engine.
// Deletes the window.
Engine::~Engine() {
delete window;
}
// Main loop of the engine.
// Delegates events to the Engine::handleEvents() function,
// Saves on exit,
// and delegates update/draw as well.
void Engine::run() {
ImGuiIO& io = ImGui::GetIO();
ImFontConfig imcfg;
//io.Fonts->Fonts[0]->Scale = 1.5f;
io.IniFilename = "polyedit_gui_config.ini";
while (window->isOpen()) {
sf::Event event;
while (window->pollEvent(event)) {
if (event.type == sf::Event::Closed) {
saveJSON();
ImGui::SFML::Shutdown();
window->close();
std::exit(1);
}
// Handle events in relation to the GUI
handleGUItoggleEvent(event);
// If the GUI is open pass events to it and block left clicks for all GUIS
if (showColorPickerGUI || showSettingsGUI || showHelp) {
ImGui::SFML::ProcessEvent(event);
if (!(event.type == sf::Event::MouseButtonPressed && event.mouseButton.button == sf::Mouse::Left)){
handleEvents(event);
}
}
/*// Actually do -> // Dont block left clicks with help open
if (showHelp) {
ImGui::SFML::ProcessEvent(event);
handleEvents(event);
}*/
// If the GUI is closed, run all events regardless
else {
handleEvents(event);
}
}
window->clear(BGColor);
// If a GUI is up update them
if (showColorPickerGUI || showSettingsGUI || showHelp) {
ImGui::SFML::UpdateImGui();
ImGui::SFML::UpdateImGuiRendering();
//ImGui::PushStyleVar(ImGuiStyleVar_WindowRounding, 0);
//ImGui::PushStyleVar(ImGuiStyleVar_WindowPadding, ImVec2(8,8));
ImGuiStyle& style = ImGui::GetStyle();
applyGuiStyle(style);
if (showColorPickerGUI){
createColorPickerGUI();
}
if (showSettingsGUI){
createSettingsGUI();
ImGui::ShowStyleEditor();
}
if (showHelp) {
createHelpGUI();
}
}
// Main loop
update();
draw();
// Render UI
if (showColorPickerGUI || showSettingsGUI || showHelp) {
ImGui::Render();
}
window->display();
}
}
// Loads an image into the engine variables,
// storing the names of the files to save into vfile and sfile.
// If the files do not exist, they are created.
int Engine::load(){
const char* filter[3] = { "*.png", "*.jpg", "*.gif" };
const char* filenamecc = tinyfd_openFileDialog("Select image: ", "./", 3, filter, NULL, 0);
if (filenamecc == NULL){
return 1;
}
std::string filename = filenamecc;
// Strip extension
size_t lastindex = filename.find_last_of(".");
std::string filenoext = filename.substr(0, lastindex);
// Add new extensions
const std::string sfext = ".svg";
const std::string vfext = ".vertices";
vfile = filenoext + vfext;
sfile = filenoext + sfext;
// Open/create based on if the file exists
std::fstream vstream;
vstream.open(vfile, std::ios::in);
if (!vstream){
vstream.open(vfile, std::ios::out);
}
std::fstream sstream;
sstream.open(sfile, std::ios::in);
if (!sstream){
sstream.open(sfile, std::ios::out);
}
// Fail if the images do not open correctly
if (!(image.loadFromFile(filename))){
return 1;
}
if (!(img.loadFromFile(filename))){
return 1;
}
// Load json containing points, etc.
loadJSON();
vstream.close();
sstream.close();
return 0;
}
// Check if the GUI is being toggled; pause other inputs if it is
void Engine::handleGUItoggleEvent(sf::Event event) {
if (event.type == sf::Event::KeyPressed && event.key.code == sf::Keyboard::C) {
showColorPickerGUI = !showColorPickerGUI;
}
if (event.type == sf::Event::KeyPressed && event.key.code == sf::Keyboard::Escape) {
showSettingsGUI = !showSettingsGUI;
showHelp = !showHelp;
}
}
// Handles the events that the sfml window recieves.
// The following events are handled:
// Single press events (and their releases)
// Click events (and their releases)
// Scrolling
// Resizing
void Engine::handleEvents(sf::Event event){
// On single press event
if (event.type == sf::Event::KeyPressed) {
std::string text;
// Toggles image smoothing
if (event.key.code == sf::Keyboard::Slash){
smoothnessToggle();
imgsmooth ? text = "on" : text = "off";
std::cout << "Image smoothing " << text << " (Slash)\n";
}
// Wireframe toggle for polygons
if (event.key.code == sf::Keyboard::W){
wireframe = !wireframe;
wireframe ? text = "on" : text = "off";
std::cout << "Wireframe " << text << " (W)\n";
}
// Hides background
if (event.key.code == sf::Keyboard::H){
hideimage = !hideimage;
hideimage ? text = "hidden" : text = "shown";
std::cout << "Background " << text << " (H)\n";
}
if (event.key.code == sf::Keyboard::X){
showcenters = !showcenters;
showcenters ? text = "Showing" : text = "Hiding";
std::cout << text << " centers. (X)\n";
}
if (event.key.code == sf::Keyboard::P){
showrvectors = !showrvectors;
showrvectors ? text = "Showing" : text = "Hiding";
std::cout << text << " points. (P)\n";
}
// Clears current selection
if (event.key.code == sf::Keyboard::Space){
clearSelection();
std::cout << "Clearing selection (Spacebar) \n";
}
// Saves the file as a set of a SVG and ".vertices" file
if (event.key.code == sf::Keyboard::S){
saveVector(file);
saveJSON();
std::cout << "Saving file (S) \n";
}
// Camera panning without mousewheelclick
if (event.key.code == sf::Keyboard::LControl){
std::cout << "Panning while button held (LControl)\n";
sf::Vector2i pointi = sf::Mouse::getPosition(*window);
sf::Vector2f point;
point.x = (float)pointi.x;
point.y = (float)pointi.y;
point = windowToGlobalPos(point);
vdraginitpt = point;
vdragflag = true;
}
// Deletes selected points, polys
if (event.key.code == sf::Keyboard::Delete){
std::cout << "Deleting selection (Delete) \n";
deleteSelection();
}
// Reaverage colors
if (event.key.code == sf::Keyboard::A) {
std::cout << "Re-averaging color in polygon (A) \n";
if (spoly != NULL){
pR polyRecolor;
polyRecolor.polyColor = spoly->fillcolor;
for (int i = 0; i < polygons.size(); ++i) {
if (polygons[i].center == spoly->center) {
polyRecolor.polyIndex = i;
}
}
undoBuffer.push_back(UndoAction(polyRecolor));
spoly->fillcolor = sf::Color(avgClr(rpoints[spoly->rpointIndices[0]], rpoints[spoly->rpointIndices[1]], rpoints[spoly->rpointIndices[2]], 10));
} else {
"Can't change color - no polygon selected (C) \n";
}
}
// Get color at mouse
if (event.key.code == sf::Keyboard::O) {
std::cout << "Setting selected polygon color to color at mouse (O)\n";
if (spoly != NULL){
sf::Vector2f point = getMPosFloat();
point = windowToGlobalPos(point);
point = getClampedImgPoint(point);
sf::Color color = img.getPixel(point.x, point.y);
pR polyRecolor;
polyRecolor.polyColor = spoly->fillcolor;
for (int i = 0; i < polygons.size(); ++i) {
if (polygons[i].center == spoly->center) {
polyRecolor.polyIndex = i;
}
}
undoBuffer.push_back(UndoAction(polyRecolor));
spoly->fillcolor = color;
} else {
"Can't change color - no polygon selected (C) \n";
}
}
// Send overlapping element to end of list
if (event.key.code == sf::Keyboard::Comma){
std::cout << "Sending triangle to the back of the draw order (,)\n";
if (spoly != NULL){
for (unsigned i = 0; i < polygons.size(); i++){
if (polygons[i].selected == true){
polygons.insert(polygons.begin(), polygons[i]);
polygons.erase(1 + polygons.begin() + i);
}
}
clearSelection();
}
}
// Send overlapping element to the beginning of the list
if (event.key.code == sf::Keyboard::Period){
std::cout << "Sending triangle to the front of the draw order (.)\n";
if (spoly != NULL){
for (unsigned i = 0; i < polygons.size(); i++){
if (polygons[i].selected == true){
polygons.push_back(polygons[i]);
polygons.erase(polygons.begin() + i);
}
}
clearSelection();
}
}
//dbgPrint info
if (event.key.code == sf::Keyboard::BackSlash) {
std::cout << "=== Undo Buffer Dump ===" << std::endl;
std::cout << "=== Actions: " << undoBuffer.size() << " ===" << std::endl;
int index = 0;
for (auto e : undoBuffer) {
std::cout << "#" << index << " ";
e.print();
++index;
}
}
if (event.key.code == sf::Keyboard::Z) {
std::cout << "Undo\n";
undo();
}
if (event.key.code == sf::Keyboard::RBracket) {
undoBuffer.clear();
}
}
// On release event (used for disabling flags)
if (event.type == sf::Event::KeyReleased){
if (event.key.code == sf::Keyboard::LControl){
vdragflag = false;
}
}
// On click
if (event.type == sf::Event::MouseButtonPressed) {
sf::Vector2f click = sf::Vector2f((float)event.mouseButton.x, (float)event.mouseButton.y);
sf::Vector2f point = windowToGlobalPos(click);
if (event.mouseButton.button == sf::Mouse::Left) {
onLeftClick(point);
if (sf::Keyboard::isKeyPressed(sf::Keyboard::R)) {
clearSelection();
onLeftClick(point);
deleteSelection();
}
}
if (event.mouseButton.button == sf::Mouse::Right){
onRightClick(point);
}
if (event.mouseButton.button == sf::Mouse::Middle){
onMiddleClick(point);
}
}
// On click release (used for disabling flags)
if (event.type == sf::Event::MouseButtonReleased){
if (event.mouseButton.button == sf::Mouse::Left){
dragflag = false;
}
if (event.mouseButton.button == sf::Mouse::Middle){
vdragflag = false;
}
}
// On scroll (used for zooming)
if (event.type == sf::Event::MouseWheelScrolled){
if (event.mouseWheelScroll.delta < 0){
viewzoom *= 1.5;
view.zoom(1.5);
window->setView(view);
}
else if (event.mouseWheelScroll.delta > 0){
viewzoom *= 0.75;
view.zoom(0.75);
window->setView(view);
}
}
// On window resize
if (event.type == sf::Event::Resized){
view.reset(sf::FloatRect(0, 0, (float)event.size.width, (float)event.size.height));
viewzoom = 1;
window->setView(view);
}
}
// Handles logic directly before drawing.
// This function runs every frame.
void Engine::update(){
handleCamera();
if (wireframe == true && (wireframe != wireframels)){
for (Poly& polygon : polygons){
polygon.isWireframe = true;
}
wireframels = wireframe;
}
else if (wireframe != true && (wireframe != wireframels)){
for (Poly& polygon : polygons){
polygon.isWireframe = false;
}
wireframels = wireframe;
}
if (dragflag){
sf::Vector2f point = getMPosFloat();
point = windowToGlobalPos(point);
sf::Vector2f rpoint = rpoints[nindex].vector;
rpoints[nindex].vector = (pdragoffset + point);
}
if (vdragflag){
sf::Vector2f point = getMPosFloat();
point = windowToGlobalPos(point);
vdragoffset.x = (vdraginitpt.x - point.x);
vdragoffset.y = (vdraginitpt.y - point.y);
view.move(vdragoffset);
window->setView(view);
}
for (Poly& polygon : polygons) {
polygon.updateCShape(viewzoom);
polygon.updateCenter();
}
for (Point& point : rpoints) {
point.colorSelected = pointSelectedColor;
point.colorIdle = pointIdleColor;
point.updateCShape(viewzoom);
point.vector = getClampedImgPoint(point.vector);
}
}
// Draws the objects to the screen.
// This function runs every frame, preceded by Engine::update().
void Engine::draw(){
// Reset view incase other objects change it
window->setView(view);
if (!hideimage){
window->draw(drawimg);
}
for (Poly polygon : polygons){
if (polygon.selected == false){
window->draw(polygon.cshape);
}
}
if (showrvectors){
for (Point& point : rpoints){
window->draw(point.cshape);
}
}
for (Poly polygon : polygons){
if (polygon.selected == true){
window->draw(polygon.cshape);
}
}
if (showcenters){
for (Poly polygon : polygons){
sf::CircleShape cshape = sf::CircleShape(2*viewzoom);
cshape.setPosition(polygon.center);
cshape.setFillColor(centerdrawcolor);
window->draw(cshape);
}
}
}
// Create GUI elements for color picker
void Engine::createColorPickerGUI() {
ImGui::Begin("Color Picker");
if (spoly != NULL){
float spolycolor[3];
spolycolor[0] = spoly->fillcolor.r / 255.0f;
spolycolor[1] = spoly->fillcolor.g / 255.0f;
spolycolor[2] = spoly->fillcolor.b / 255.0f;
if (ColorPicker3(spolycolor)){
spoly->fillcolor = sf::Color(spolycolor[0] * 255.0f, spolycolor[1] * 255.0f, spolycolor[2] * 255.0f, 255);
}
}
else {
ImGui::Text("No polygon selected.");
}
ImGui::End();
}
void Engine::createSettingsGUI(){
ImGui::Begin("Settings");
if (ImGui::CollapsingHeader("Points: Unselected")){
float colorIdle[3];
colorIdle[0] = rpoints[0].colorIdle.r / 255.0f;
colorIdle[1] = rpoints[0].colorIdle.g / 255.0f;
colorIdle[2] = rpoints[0].colorIdle.b / 255.0f;
if (ColorPicker3(colorIdle)){
pointIdleColor = sf::Color(colorIdle[0] * 255.0f, colorIdle[1] * 255.0f, colorIdle[2] * 255.0f, 255);
}
}
if (ImGui::CollapsingHeader("Points: Selected")){
float colorSelected[3];
colorSelected[0] = rpoints[0].colorSelected.r / 255.0f;
colorSelected[1] = rpoints[0].colorSelected.g / 255.0f;
colorSelected[2] = rpoints[0].colorSelected.b / 255.0f;
if (ColorPicker3(colorSelected)){
pointSelectedColor = sf::Color(colorSelected[0] * 255.0f, colorSelected[1] * 255.0f, colorSelected[2] * 255.0f, 255);
/*for (Point& p : rpoints){
p.colorSelected = sf::Color(colorSelected[0] * 255.0f, colorSelected[1] * 255.0f, colorSelected[2] * 255.0f, 255);
}*/
}
}
if (ImGui::CollapsingHeader("Centers")){
float center[4];
center[0] = centerdrawcolor.r / 255.0f;
center[1] = centerdrawcolor.g / 255.0f;
center[2] = centerdrawcolor.b / 255.0f;
center[3] = centerdrawcolor.a / 255.0f;
if (ColorPicker4(center, true)){
centerdrawcolor = sf::Color(center[0]*255.0f, center[1]*255.0f, center[2]*255.0f, center[3]*255.0f);
}
}
if (ImGui::CollapsingHeader("Background Color")) {
float bg[3];
bg[0] = BGColor.r / 255.0f;
bg[1] = BGColor.g / 255.0f;
bg[2] = BGColor.b / 255.0f;
if (ColorPicker3(bg)) {
BGColor = sf::Color(bg[0] * 255.0f, bg[1] * 255.0f, bg[2] * 255.0f,255.0f);
}
}
ImGui::End();
}
void Engine::createHelpGUI() {
helpGuiText();
}
// Checks input for arrow keys and +/- for camera movement
void Engine::handleCamera() {
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Left) && window->hasFocus()) {
view.move(sf::Vector2f(-2 * viewzoom, 0));
window->setView(view);
}
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Right) && window->hasFocus()) {
view.move(sf::Vector2f(2 * viewzoom, 0));
window->setView(view);
}
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Up) && window->hasFocus()) {
view.move(sf::Vector2f(0, -2 * viewzoom));
window->setView(view);
}
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Down) && window->hasFocus()) {
view.move(sf::Vector2f(0, 2 * viewzoom));
window->setView(view);
}
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Dash) && window->hasFocus()) {
viewzoom *= 1.01f;
view.zoom(1.01f);
window->setView(view);
}
if (sf::Keyboard::isKeyPressed(sf::Keyboard::Equal) && window->hasFocus()) {
viewzoom *= 0.99f;
view.zoom(0.99f);
window->setView(view);
}
}
/*////////////////////////////////////////////////////////////////////////////
//// Input functions:
//// Callbacks from Engine::handleEvents().
*/////////////////////////////////////////////////////////////////////////////
// On spacebar
void Engine::clearSelection() {
nspoints.clear();
spointsin.clear();
spoly = NULL;
for (unsigned n = 0; n < rpoints.size(); n++) {
nspoints.push_back(&(rpoints[n]));
rpoints[n].selected = false;
}
for (unsigned i = 0; i < polygons.size(); i++) {
polygons[i].selected = false;
}
}
// On slash
void Engine::smoothnessToggle() {
image.setSmooth(!imgsmooth);
imgsmooth = !imgsmooth;
drawimg.setTexture(image);
}
// On delete
void Engine::deleteSelection() {
if (spointsin.size() == 0 && spoly == NULL) {}
else {
std::vector<int> polyIndices;
std::vector<int> rpointsIndices;
for (unsigned i = 0; i < polygons.size(); i++) {
if (polygons[i].selected == true) {
polyIndices.push_back(i);
}
}
for (unsigned i = 0; i < spointsin.size(); i++) {
for (unsigned j = 0; j < polygons.size(); j++) {
for (unsigned k = 0; k < 3; k++) {
if (polygons[j].rpointIndices[k] == spointsin[i]) {
polyIndices.push_back(j);
}
}
}
rpointsIndices.push_back(spointsin[i]);
}
// Sort vectors and erase duplicates
std::sort(polyIndices.begin(), polyIndices.end());
polyIndices.erase(std::unique(polyIndices.begin(), polyIndices.end()), polyIndices.end());
std::sort(rpointsIndices.begin(), rpointsIndices.end());
rpointsIndices.erase(std::unique(rpointsIndices.begin(), rpointsIndices.end()), rpointsIndices.end());
// Reverse indices for easier deletion of elements
std::reverse(rpointsIndices.begin(), rpointsIndices.end());
std::reverse(polyIndices.begin(), polyIndices.end());
// Get polys to re-add in deletion of a point
if (spointsin.size() > 0 && spoly == NULL) { // get deleted points
PD pointDeletion = PD();
for (int i : spointsin) {
pointDeletion.deletedPoints.push_back(std::make_pair(rpoints[i],i));
}
for (int i : polyIndices) {
pointDeletion.cPointColors.push_back(polygons[i].fillcolor);
auto arrayLoc = polygons[i].rpointIndices;
int p1 = arrayLoc[0];
int p2 = arrayLoc[1];
int p3 = arrayLoc[2];
//std::cout << p1 << p2 << p3 << "\n";
pointDeletion.cPointPolysIndices.push_back(std::make_tuple(p1, p2, p3));
}
undoBuffer.push_back(UndoAction(pointDeletion));
}
for (unsigned i = 0; i < polyIndices.size(); i++) {
polygons.erase(polygons.begin() + polyIndices[i]);
}
for (unsigned i = 0; i < rpointsIndices.size(); i++) {
rpoints.erase(rpoints.begin() + rpointsIndices[i]);
}
for (unsigned p = 0; p < polygons.size(); p++) { // For each polygon
for (int i = 0; i < 3; i++) { // For every point inside a polygon
int counter = 0;
for (unsigned rp = 0; rp < rpointsIndices.size(); rp++) {
if (polygons[p].rpointIndices[i] > rpointsIndices[rp]) {
counter++;
}
}
polygons[p].rpointIndices[i] -= counter;
}
}
polyIndices.clear();
rpointsIndices.clear();
clearSelection();
for (Poly& poly : polygons){
poly.updatePointers(rpoints);
}
}
}
// On left click
void Engine::onLeftClick(sf::Vector2f point) {
for (Poly& polygon : polygons) {
polygon.selected = false;
}
bool ispointnear = false;
nindex = -1;
for (unsigned i = 0; i < rpoints.size(); i++) {
Point& rpoint = rpoints[i];
sf::Vector2f rpv = rpoint.vector;
int clickdist = GRABDIST;
// Check if mouse is in snapping range; then set near appropriately
if ((point.x - rpv.x < clickdist*viewzoom && point.x - rpv.x > -clickdist*viewzoom) &&
(point.y - rpv.y < clickdist*viewzoom && point.y - rpv.y > -clickdist*viewzoom)) {
ispointnear = true;
nindex = i;
}
}
// If its near another, snap to it -> shared edges
if (ispointnear) {
sf::Vector2f mpos = getMPosFloat();
mpos = windowToGlobalPos(mpos);
// Init values for dragging, used above
pdraginitpt = mpos;
pdragoffset.x = rpoints[nindex].vector.x - mpos.x;
pdragoffset.y = rpoints[nindex].vector.y - mpos.y;
dragflag = true; // When dragflag is true then dragging occurs
// Set mouse position to middle of desired selected point
// This fixes mouse clicks moving points on accident
// Check for snapping the same point twice for a new poly and catch it
bool exists = false;
for (unsigned i = 0; i < spointsin.size(); i++) {
if (spointsin[i] == nindex) {
exists = true;
}
}
// If they didn't click the same point twice
if (!exists) {
spointsin.push_back(nindex);
if (spointsin.size() == 3) {
int p1, p2, p3;
p1 = spointsin[spointsin.size() - 3];
p2 = spointsin[spointsin.size() - 2];
p3 = spointsin[spointsin.size() - 1];
Point *po1 = &rpoints[(spointsin[0])];
Point *po2 = &rpoints[(spointsin[1])];
Point *po3 = &rpoints[(spointsin[2])];
Poly pg = Poly(po1, po2, po3, p1, p2, p3, sf::Color::Green);
polygons.push_back(pg);
int offset = polygons.size() - 1;
polygons[offset].fillcolor = avgClr(rpoints[polygons[offset].rpointIndices[0]], rpoints[polygons[offset].rpointIndices[1]], rpoints[polygons[offset].rpointIndices[2]], 10);
// Add undo
pA polyAddition = pA();
polyAddition.polyIndex = offset;
undoBuffer.push_back(UndoAction(polyAddition));
clearSelection();
}
}
}
// Create a new point
if (!ispointnear) {
point = getClampedImgPoint(point);
rpoints.push_back(Point(point, 5));
// Add undo
PA pointAddUndoAction = PA();
pointAddUndoAction.pointIndex = rpoints.size()-1;
undoBuffer.push_back(UndoAction(pointAddUndoAction));
spointsin.push_back(rpoints.size() - 1);
if (spointsin.size() == 3) {
int p1, p2, p3;
p1 = spointsin[spointsin.size() - 3];
p2 = spointsin[spointsin.size() - 2];
p3 = spointsin[spointsin.size() - 1];
Point *po1 = &rpoints[(spointsin[0])];
Point *po2 = &rpoints[(spointsin[1])];
Point *po3 = &rpoints[(spointsin[2])];
// Create new polygon at last 3 points, assign it starting index
// so that it can find itself in the vector after memory updates
polygons.push_back(Poly(po1,po2,po3,p1,p2,p3,sf::Color::Green));
int offset = polygons.size() - 1;
polygons[offset].fillcolor = avgClr(rpoints[polygons[offset].rpointIndices[0]], rpoints[polygons[offset].rpointIndices[1]], rpoints[polygons[offset].rpointIndices[2]], 10);
// Add undo
pA polyAddition = pA();
polyAddition.polyIndex = offset;
undoBuffer.push_back(UndoAction(polyAddition));
clearSelection();
}
}
// Only update polygon point-pointers on click
// because the memory is only moved on click
for (Poly& p : polygons) {
p.updatePointers(rpoints);
}
for (auto& inspoint : nspoints) {
inspoint->selected = false;
}
for (auto& ispoint : spointsin) {
rpoints[ispoint].selected = true;
}
}
// On right click
void Engine::onRightClick(sf::Vector2f point) {
if (polygons.size() > 0) {
clearSelection();
float dist = 100000000.0f;
int pindex = -1;
for (unsigned p = 0; p < polygons.size(); p++) {
float cdist = v2fdistance(point, polygons[p].center);
if (cdist < dist) {
dist = cdist;
pindex = p;
}
}
polygons[pindex].selected = true;
spoly = &polygons[pindex];
}
}
// On middle wheel click
void Engine::onMiddleClick(sf::Vector2f point) {
vdragflag = true;
vdragoffset = sf::Vector2f(0, 0);
vdraginitpt = point;
}
void Engine::undo() {
if (undoBuffer.size() > 0) {
UndoAction ua = undoBuffer.back();
undoBuffer.pop_back();
PA dPA;
PD dPD;
pD dpD;
pA dpA;
pR dpR;
switch (ua.action) {
// Simply delete the last added point
// Not exactly simple, as the delete function only runs off the current selection
// Hacky workaround for just deleting a point: select it, delete selection, clear
case Action::pointAddition:
dPA = ua.pointAddition;
clearSelection();
spoint = &rpoints[dPA.pointIndex];
spointsin.push_back(dPA.pointIndex);
deleteSelection();
// Manually deselect the last two points and pop the deletion action
undoBuffer.pop_back();
(&rpoints[dPA.pointIndex - 2])->selected = false;
(&rpoints[dPA.pointIndex - 3])->selected = false;
break;
case Action::pointDeletion:
// there's either going to be one or two points deleted
dPD = ua.pointDeletion;
clearSelection();
// Re-add the deleted points
for (auto& p : dPD.deletedPoints) {
rpoints.push_back(p.first);
//std::cout << "Added point " << (rpoints.size()-1) << ";\n";
nspoints.push_back(&p.first);
}
// Reconstruct polygons that were caught in the point deletion
for (int index = 0; index < dPD.cPointPolysIndices.size(); ++index) {
// is dp2 active (were 2 points deleted)
bool dp2a = true;
// Polygon color
sf::Color pcolor = dPD.cPointColors[index];
// Indices of old deleted points
int dp1, dp2;
// Indices of the whole polygon deleted
int i1, i2, i3;
// Pointers to points of the new polygon
Point *p1, *p2, *p3;
// Offset to end of rpoints
int offset = rpoints.size() - 1;
// Get destroyed polygon indices (its in a tuple<int,int,int>)
i1 = std::get<0>(dPD.cPointPolysIndices[index]);
i2 = std::get<1>(dPD.cPointPolysIndices[index]);
i3 = std::get<2>(dPD.cPointPolysIndices[index]);
// Find if one or two points were deleted, set dp2a on results
dp1 = dPD.deletedPoints[0].second;
(dPD.deletedPoints.size() > 1) ? dp2 = dPD.deletedPoints[1].second : dp2a = false;
// Find which point in the deleted-by-consequence polygon was the deleted point
// and update a new polygon replacing the deleted point with the newly added point
int oi1, oi2, oi3;
oi1 = i1;
oi2 = i2;
oi3 = i3;
if (i1 > dp1) i1 -= 1;
if (i2 > dp1) i2 -= 1;
if (i3 > dp1) i3 -= 1;
if (dp2a) {
if (oi1 > dp2) i1 -= 1;
if (oi2 > dp2) i2 -= 1;
if (oi3 > dp2) i3 -= 1;
}
p1 = &rpoints[i1];
p2 = &rpoints[i2];
p3 = &rpoints[i3];
if (!dp2a) {
if (oi1 == dp1) {
p1 = &rpoints[offset];
i1 = offset;
}
else if (oi2 == dp1) {
p2 = &rpoints[offset];
i2 = offset;
}
else if (oi3 == dp1) {
p3 = &rpoints[offset];
i3 = offset;
}
}
if (dp2a) {
if (oi1 == dp1) {
p1 = &rpoints[offset - 1];
i1 = offset - 1;
}
else if (oi2 == dp1) {
p2 = &rpoints[offset - 1];
i2 = offset - 1;
}
else if (oi3 == dp1) {
p3 = &rpoints[offset - 1];
i3 = offset -1;
}
if (oi1 == dp2) {
p1 = &rpoints[offset];
i1 = offset;
}
else if (oi2 == dp2) {
p2 = &rpoints[offset];
i2 = offset;
}
else if (oi3 == dp2) {
p3 = &rpoints[offset];
i3 = offset;
}
}
//std::cout << "New Points: " << i1 << i2 << i3 << '\n';
polygons.push_back(Poly(p1, p2, p3, i1, i2, i3, pcolor));
}
break;
// Select the polygon -> delete selection -> clear.
case Action::polyAddition:
dpA = ua.polyAddition;
clearSelection();
spoly = &polygons[dpA.polyIndex];
(&polygons[dpA.polyIndex])->selected = true;
deleteSelection();
break;
case Action::polyRecolor:
dpR = ua.polyRecolor;
polygons[dpR.polyIndex].fillcolor = dpR.polyColor;
break;
case Action::polyDeletion:
dpD = ua.polyDeletion;
Point *p1, *p2, *p3;
int i1 = dpD.pointIndices[0];
int i2 = dpD.pointIndices[1];
int i3 = dpD.pointIndices[2];
p1 = &(rpoints[i1]);
p2 = &(rpoints[i2]);
p3 = &(rpoints[i3]);
polygons.push_back(Poly(p1, p2, p3, i1, i2, i3, dpD.polyColor));
break;
}
clearSelection();
}
}
/*/////////////////////////////////////////////////////////////////////////////
//// Utility functions
*//////////////////////////////////////////////////////////////////////////////
// Returns the average color from the area between 3 points.
// Due to speed, it uses random samples.
sf::Color Engine::avgClr(Point& p1, Point& p2, Point& p3, int samples){
int r = 0;
int g = 0;
int b = 0;
for (int i = 0; i < samples; i++){
sf::Vector2f pixel = randPt(p1, p2, p3);
sf::Color color = img.getPixel(pixel.x, pixel.y);
r += color.r;
g += color.g;
b += color.b;
}
r /= samples;
g /= samples;
b /= samples;
return sf::Color(r, g, b, 255);
}
// Return a random point inside 3 points.
sf::Vector2f Engine::randPt(Point& p1, Point& p2, Point& p3){
sf::Vector2f point;
double r1 = randdbl(0, 1);
double r2 = randdbl(0, 1);
point.x = (1 - sqrt(r1)) * p1.vector.x + (sqrt(r1) * (1 - r2)) * p2.vector.x + (sqrt(r1) * r2) * p3.vector.x;
point.y = (1 - sqrt(r1)) * p1.vector.y + (sqrt(r1) * (1 - r2)) * p2.vector.y + (sqrt(r1) * r2) * p3.vector.y;
return point;
}
// Convert window (view) coordinates to global (real) coordinates.
sf::Vector2f Engine::windowToGlobalPos(const sf::Vector2f& vec) {
sf::Vector2u winSize = window->getSize();
sf::Vector2f center = view.getCenter();
sf::Vector2f point = vec;
point.x -= winSize.x / 2;
point.y -= winSize.y / 2;
point.x *= viewzoom;
point.y *= viewzoom;
point.x += center.x;
point.y += center.y;
return point;
};
// Convert global (real) coordiantes to window (view) coordinates.
sf::Vector2f Engine::globalToWindowPos(const sf::Vector2f& vec) {
sf::Vector2u winSize = window->getSize();
sf::Vector2f center = view.getCenter();
sf::Vector2f point = vec;
point.x -= center.x;
point.y -= center.y;
point.x /= viewzoom;
point.y /= viewzoom;
point.x += winSize.x / 2;
point.y += winSize.y / 2;
return point;
};
// Get the mouse position as a float.
sf::Vector2f Engine::getMPosFloat() {
sf::Vector2i mposi = sf::Mouse::getPosition(*window);
sf::Vector2f mpos;
mpos.x = mposi.x;
mpos.y = mposi.y;
return mpos;
}
// Clamps a point to the image boundaries.
sf::Vector2f Engine::getClampedImgPoint(const sf::Vector2f& vec){
sf::Vector2f result = vec;
if (result.x < 0 || result.x > img.getSize().x){
if (result.x < 0){
result.x = 0;
}
else if (result.x > img.getSize().x) {
result.x = img.getSize().x;
}
}
if (result.y < 0 || result.y > img.getSize().y){
if (result.y < 0){
result.y = 0;
}
else if (result.y > img.getSize().y){
result.y = img.getSize().y;
}
}
return result;
}
/*////////////////////////////////////////////////////////////////////////////
//// Saving functions
*/////////////////////////////////////////////////////////////////////////////
// Saves the SVG of the image.
void Engine::saveVector(std::string filename){
std::fstream sfilestrm;
sfilestrm.open(sfile, std::ios::out | std::fstream::trunc);
char headerc[350];
const char *hdr = "<?xml version=\"1.0\" standalone=\"no\"?>\n<!DOCTYPE svg PUBLIC \"-//W3C//DTD SVG 1.1//EN\" \"http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd\"><svg width=\"%d\" height=\"%d\" viewBox=\"0 0 %d %d\" xmlns=\"http://www.w3.org/2000/svg\" version=\"1.1\">\n<style type=\"text/css\"> polygon { stroke-width: .5; stroke-linejoin: round; } </style>";
snprintf(headerc, sizeof(headerc), hdr,
image.getSize().x,
image.getSize().y,
image.getSize().x,
image.getSize().y);
std::string header = headerc;
std::string footer = "\n</svg>";
sfilestrm << header;
for (unsigned i = 0; i < polygons.size(); i++){
Poly& p = polygons[i];
std::string pointslist = "";
for (int j = 0; j < 3; j++){
pointslist += std::to_string(rpoints[p.rpointIndices[j]].vector.x);
pointslist += ",";
pointslist += std::to_string(rpoints[p.rpointIndices[j]].vector.y);
pointslist += " ";
}
std::string color = "rgb(";
color += std::to_string(p.fillcolor.r);
color += ",";
color += std::to_string(p.fillcolor.g);
color += ",";
color += std::to_string(p.fillcolor.b);
color += ")";
std::string polygon = "";
polygon += "<polygon style=\"fill:";
polygon += color;
polygon += ";stroke:";
polygon += color;
polygon += "\"";
polygon += " points=\"";
polygon += pointslist;
polygon += "\"/>\n";
sfilestrm << polygon;
}
sfilestrm << footer;
}
// Saves the JSON of the points, polygons, colors
void Engine::saveJSON(){
// Clamp all points to bounds
for (Point& point : rpoints){
point.vector = getClampedImgPoint(point.vector);
}
Json::Value rootobj;
for (unsigned i = 0; i < rpoints.size(); i++){
rootobj["rpoints"][i]["vector"]["x"] = rpoints[i].vector.x;
rootobj["rpoints"][i]["vector"]["y"] = rpoints[i].vector.y;
rootobj["rpoints"][i]["size"] = rpoints[i].size;
}
for (unsigned i = 0; i < polygons.size(); i++){
for (int j = 0; j < 3; j++){
rootobj["polygons"][i]["pointindices"][j] = polygons[i].rpointIndices[j];
}
rootobj["polygons"][i]["color"] = polygons[i].fillcolor.toInteger();
}
rootobj["centerdrawcolor"] = centerdrawcolor.toInteger();
rootobj["bgcolor"] = BGColor.toInteger();
rootobj["colorIdle"] = pointIdleColor.toInteger();
rootobj["colorSelected"] = pointSelectedColor.toInteger();
std::fstream vfilestrm;
vfilestrm.open(vfile, std::ios::out | std::ios::trunc);
vfilestrm << rootobj << std::endl;
vfilestrm.close();
}
// Loads the JSON into the engine variables.
void Engine::loadJSON(){
rpoints.clear();
polygons.clear();
std::fstream vfilestrm;
vfilestrm.open(vfile, std::ios::in);
Json::Value rootobj;
if (vfilestrm.peek() == std::fstream::traits_type::eof()) {
return;
}
vfilestrm >> rootobj;
Json::Value jsonpolygons;
Json::Value jsonrpoints;
jsonpolygons = rootobj["polygons"];
jsonrpoints = rootobj["rpoints"];
for (unsigned i = 0; i < jsonrpoints.size(); i++){
Point p;
p.vector.x = rootobj["rpoints"][i]["vector"]["x"].asFloat();
p.vector.y = rootobj["rpoints"][i]["vector"]["y"].asFloat();
p.size = rootobj["rpoints"][i]["size"].asFloat();
// Init the color to default before reading user-set because of backwards compatibility
p.colorIdle = sf::Color::Green;
p.colorSelected = sf::Color::Blue;
centerdrawcolor = sf::Color(255, 255, 255, 127);
// Read JSON for colors
rpoints.push_back(p);
}
for (unsigned i = 0; i < jsonpolygons.size(); i++){
int ptl[3];
for (int j = 0; j < 3; j++){
ptl[j] = rootobj["polygons"][i]["pointindices"][j].asInt();
}
int c = rootobj["polygons"][i]["color"].asInt64();
sf::Color color = sf::Color(c);
Poly p = Poly(&rpoints[ptl[0]],
&rpoints[ptl[1]],
&rpoints[ptl[2]], ptl[0], ptl[1], ptl[2], color);
p.updateCenter();
p.updateCShape(viewzoom);
polygons.push_back(p);
}
if (rootobj["bgcolor"].asInt64() != 0) {
BGColor = sf::Color(rootobj["bgcolor"].asInt64());
}
int color = rootobj["centerdrawcolor"].asInt64();
if (color != 0) {
centerdrawcolor = sf::Color(color);
}
pointIdleColor = sf::Color::Green;
pointSelectedColor = sf::Color::Blue;
color = rootobj["colorIdle"].asInt64();
if (color != 0) {
pointIdleColor = sf::Color(color);
}
color = rootobj["colorSelected"].asInt64();
if (color != 0) {
pointSelectedColor = sf::Color(color);
}
std ::cout << "total polygons loaded: " << polygons.size() << "\n";
vfilestrm.close();
}
| 31.582363 | 365 | 0.606211 | [
"render",
"vector"
] |
0ddf79d5133bc416b13632f9a3a190ecb61820cc | 1,729 | cpp | C++ | robot_control/src/tools/src/reference_client.cpp | SjoerdKoop/vicon_control | 26d10318999ae686d76eca2c63a0f2f1e7ad4191 | [
"BSD-3-Clause"
] | 2 | 2019-03-14T14:19:40.000Z | 2019-10-24T10:33:50.000Z | robot_control/src/tools/src/reference_client.cpp | SjoerdKoop/vicon_control | 26d10318999ae686d76eca2c63a0f2f1e7ad4191 | [
"BSD-3-Clause"
] | null | null | null | robot_control/src/tools/src/reference_client.cpp | SjoerdKoop/vicon_control | 26d10318999ae686d76eca2c63a0f2f1e7ad4191 | [
"BSD-3-Clause"
] | 2 | 2018-10-08T09:16:34.000Z | 2020-01-10T07:25:24.000Z | // Components
#include "peer.h" // Peer
// System
#include <cstdlib> // EXIT_*, std::exit
#include <iostream> // std::cout, std::endl
#include <signal.h> // sigaction
#include <string> // std::stoi
// Tools
#include "tools.h" // isValidIP, isValidPort
// Checks whether provided arguments are correct
bool checkArguments(int argc, char* argv[])
{
// If the number of arguments is correct
if (argc == 3)
{
// If IP address and port are valid
if (isValidIp(argv[1]) && isValidPort(argv[2]))
{
return true;
}
else
{
return false;
}
}
else
{
return false;
}
}
// SIGINT handler
void handleUserInterrupt(int sig_num)
{
// Exit the program
std::exit(EXIT_SUCCESS);
}
// Main function
int main(int argc, char* argv[])
{
// Check whether provided arguments are correct
if (checkArguments(argc, argv))
{
// Create peer
Peer* peer = new Peer(argv[1], std::stoi(argv[2]));
// Register program for user interrupt
struct sigaction act;
act.sa_handler = handleUserInterrupt;
sigaction(SIGINT, &act, NULL);
char* msg; // Holds received message
std::vector<float> ref; // Holds reference
// Main loop
while (true)
{
std::cout << "Ready to receive..." << std::endl;
// Receive message
msg = peer->receiveMessage();
// Convert message to reference
ref = messageToReference(msg);
// Print reference
std::cout << "Received reference: ";
for (float var : ref)
{
std::cout << var << " ";
}
std::cout << std::endl;
}
}
else
{
// Show fatal error
std::cout << "Please specify correct arguments: reference_client <user IP address> <user PC port>" << std::endl;
// Return failure status code
return EXIT_FAILURE;
}
} | 20.104651 | 114 | 0.637363 | [
"vector"
] |
0de16b59c9d1890ea7a7437f05aff43464510eae | 9,681 | cpp | C++ | gazebo_ros_soft_hand/test/adaptive_synergy_transmission_loader_test.cpp | hamalMarino/pisa-iit-soft-hand | 004145301bb71b82cca4d08ffb27b77cce36b7ea | [
"BSD-3-Clause"
] | 14 | 2017-01-23T15:14:18.000Z | 2021-12-16T14:41:22.000Z | gazebo_ros_soft_hand/test/adaptive_synergy_transmission_loader_test.cpp | CentroEPiaggio/pisa-iit-soft-hand | 174eebc6e9e33c886cab7995f749830a436de3e8 | [
"BSD-3-Clause"
] | 17 | 2015-02-04T11:08:24.000Z | 2020-05-14T16:33:09.000Z | gazebo_ros_soft_hand/test/adaptive_synergy_transmission_loader_test.cpp | hamalMarino/pisa-iit-soft-hand | 004145301bb71b82cca4d08ffb27b77cce36b7ea | [
"BSD-3-Clause"
] | 19 | 2015-03-25T03:12:30.000Z | 2021-02-04T09:46:47.000Z | ///////////////////////////////////////////////////////////////////////////////
// Copyright (C) 2013, PAL Robotics S.L.
// Copyright (c) 2014, Research Center "E. Piaggio"
//
// Redistribution and use in source and binary forms, with or without
// modification, are permitted provided that the following conditions are met:
// * Redistributions of source code must retain the above copyright notice,
// this list of conditions and the following disclaimer.
// * Redistributions in binary form must reproduce the above copyright
// notice, this list of conditions and the following disclaimer in the
// documentation and/or other materials provided with the distribution.
// * Neither the name of PAL Robotics S.L. nor the names of its
// contributors may be used to endorse or promote products derived from
// this software without specific prior written permission.
//
// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
// AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
// IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
// ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
// LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
// CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
// SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
// INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
// CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
// ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
// POSSIBILITY OF SUCH DAMAGE.
//////////////////////////////////////////////////////////////////////////////
// \author Adolfo Rodriguez Tsouroukdissian
// \author Carlos Rosales, based on templates of other transmissions
#include <string>
#include <boost/foreach.hpp>
#include <gtest/gtest.h>
#include <pluginlib/class_loader.h>
#include <adaptive_transmission/adaptive_synergy_transmission.h>
#include <transmission_interface/transmission_loader.h>
#include "./read_file.h"
#include <adaptive_transmission/loader_utils.h>
TEST(AdaptiveSynergyTransmissionLoaderTest, FullSpec)
{
// Parse transmission info
std::vector<TransmissionInfo> infos = parseUrdf("test/urdf/adaptive_synergy_transmission_loader_full.urdf");
ASSERT_EQ(1, infos.size());
// Transmission loader
TransmissionPluginLoader loader;
boost::shared_ptr<TransmissionLoader> transmission_loader = loader.create(infos.front().type_);
ASSERT_TRUE(0 != transmission_loader);
TransmissionPtr transmission;
const TransmissionInfo& info = infos.front();
transmission = transmission_loader->load(info);
ASSERT_TRUE(0 != transmission);
// Validate transmission
AdaptiveSynergyTransmission* adaptive_synergy_transmission = dynamic_cast<AdaptiveSynergyTransmission*>(transmission.get());
ASSERT_TRUE(0 != adaptive_synergy_transmission);
const std::vector<double>& actuator_reduction = adaptive_synergy_transmission->getActuatorReduction();
EXPECT_EQ( 30.0, actuator_reduction[0]);
const std::vector<double>& joint_reduction = adaptive_synergy_transmission->getJointReduction();
EXPECT_EQ( 2.0, joint_reduction[0]);
EXPECT_EQ( 2.0, joint_reduction[1]);
EXPECT_EQ( 2.0, joint_reduction[2]);
EXPECT_EQ( 2.0, joint_reduction[3]);
EXPECT_EQ( 2.0, joint_reduction[4]);
EXPECT_EQ( 2.0, joint_reduction[5]);
EXPECT_EQ( 2.0, joint_reduction[6]);
EXPECT_EQ( 2.0, joint_reduction[7]);
EXPECT_EQ( 2.0, joint_reduction[8]);
EXPECT_EQ( 2.0, joint_reduction[9]);
EXPECT_EQ( 2.0, joint_reduction[10]);
EXPECT_EQ( 2.0, joint_reduction[11]);
EXPECT_EQ( 2.0, joint_reduction[12]);
EXPECT_EQ( 2.0, joint_reduction[13]);
EXPECT_EQ( 2.0, joint_reduction[14]);
EXPECT_EQ( 2.0, joint_reduction[15]);
EXPECT_EQ( 2.0, joint_reduction[16]);
EXPECT_EQ( 2.0, joint_reduction[17]);
EXPECT_EQ( 2.0, joint_reduction[18]);
const std::vector<double>& joint_elastic = adaptive_synergy_transmission->getJointElastic();
EXPECT_EQ( 3.0, joint_elastic[0]);
EXPECT_EQ( 3.0, joint_elastic[1]);
EXPECT_EQ( 3.0, joint_elastic[2]);
EXPECT_EQ( 3.0, joint_elastic[3]);
EXPECT_EQ( 3.0, joint_elastic[4]);
EXPECT_EQ( 3.0, joint_elastic[5]);
EXPECT_EQ( 3.0, joint_elastic[6]);
EXPECT_EQ( 3.0, joint_elastic[7]);
EXPECT_EQ( 3.0, joint_elastic[8]);
EXPECT_EQ( 3.0, joint_elastic[9]);
EXPECT_EQ( 3.0, joint_elastic[10]);
EXPECT_EQ( 3.0, joint_elastic[11]);
EXPECT_EQ( 3.0, joint_elastic[12]);
EXPECT_EQ( 3.0, joint_elastic[13]);
EXPECT_EQ( 3.0, joint_elastic[14]);
EXPECT_EQ( 3.0, joint_elastic[15]);
EXPECT_EQ( 3.0, joint_elastic[16]);
EXPECT_EQ( 3.0, joint_elastic[17]);
EXPECT_EQ( 3.0, joint_elastic[18]);
const std::vector<double>& joint_offset = adaptive_synergy_transmission->getJointOffset();
EXPECT_EQ( -0.5, joint_offset[0]);
EXPECT_EQ( -0.5, joint_offset[1]);
EXPECT_EQ( -0.5, joint_offset[2]);
EXPECT_EQ( -0.5, joint_offset[3]);
EXPECT_EQ( -0.5, joint_offset[4]);
EXPECT_EQ( -0.5, joint_offset[5]);
EXPECT_EQ( -0.5, joint_offset[6]);
EXPECT_EQ( -0.5, joint_offset[7]);
EXPECT_EQ( -0.5, joint_offset[8]);
EXPECT_EQ( -0.5, joint_offset[9]);
EXPECT_EQ( -0.5, joint_offset[10]);
EXPECT_EQ( -0.5, joint_offset[11]);
EXPECT_EQ( -0.5, joint_offset[12]);
EXPECT_EQ( -0.5, joint_offset[13]);
EXPECT_EQ( -0.5, joint_offset[14]);
EXPECT_EQ( -0.5, joint_offset[15]);
EXPECT_EQ( -0.5, joint_offset[16]);
EXPECT_EQ( -0.5, joint_offset[17]);
EXPECT_EQ( -0.5, joint_offset[18]);
}
TEST(AdaptiveSynergyTransmissionLoaderTest, MinimalSpec)
{
// Parse transmission info
std::vector<TransmissionInfo> infos = parseUrdf("test/urdf/adaptive_synergy_transmission_loader_minimal.urdf");
ASSERT_EQ(1, infos.size());
// Transmission loader
TransmissionPluginLoader loader;
boost::shared_ptr<TransmissionLoader> transmission_loader = loader.create(infos.front().type_);
ASSERT_TRUE(0 != transmission_loader);
TransmissionPtr transmission;
const TransmissionInfo& info = infos.front();
transmission = transmission_loader->load(info);
ASSERT_TRUE(0 != transmission);
// Validate transmission
AdaptiveSynergyTransmission* adaptive_synergy_transmission = dynamic_cast<AdaptiveSynergyTransmission*>(transmission.get());
const std::vector<double>& actuator_reduction = adaptive_synergy_transmission->getActuatorReduction();
EXPECT_EQ( 30.0, actuator_reduction[0]);
const std::vector<double>& joint_reduction = adaptive_synergy_transmission->getJointReduction();
EXPECT_EQ( 1.0, joint_reduction[0]);
EXPECT_EQ( 1.0, joint_reduction[1]);
EXPECT_EQ( 1.0, joint_reduction[2]);
EXPECT_EQ( 1.0, joint_reduction[3]);
EXPECT_EQ( 1.0, joint_reduction[4]);
EXPECT_EQ( 1.0, joint_reduction[5]);
EXPECT_EQ( 1.0, joint_reduction[6]);
EXPECT_EQ( 1.0, joint_reduction[7]);
EXPECT_EQ( 1.0, joint_reduction[8]);
EXPECT_EQ( 1.0, joint_reduction[9]);
EXPECT_EQ( 1.0, joint_reduction[10]);
EXPECT_EQ( 1.0, joint_reduction[11]);
EXPECT_EQ( 1.0, joint_reduction[12]);
EXPECT_EQ( 1.0, joint_reduction[13]);
EXPECT_EQ( 1.0, joint_reduction[14]);
EXPECT_EQ( 1.0, joint_reduction[15]);
EXPECT_EQ( 1.0, joint_reduction[16]);
EXPECT_EQ( 1.0, joint_reduction[17]);
EXPECT_EQ( 1.0, joint_reduction[18]);
const std::vector<double>& joint_elastic = adaptive_synergy_transmission->getJointElastic();
EXPECT_EQ( 1.0, joint_elastic[0]);
EXPECT_EQ( 1.0, joint_elastic[1]);
EXPECT_EQ( 1.0, joint_elastic[2]);
EXPECT_EQ( 1.0, joint_elastic[3]);
EXPECT_EQ( 1.0, joint_elastic[4]);
EXPECT_EQ( 1.0, joint_elastic[5]);
EXPECT_EQ( 1.0, joint_elastic[6]);
EXPECT_EQ( 1.0, joint_elastic[7]);
EXPECT_EQ( 1.0, joint_elastic[8]);
EXPECT_EQ( 1.0, joint_elastic[9]);
EXPECT_EQ( 1.0, joint_elastic[10]);
EXPECT_EQ( 1.0, joint_elastic[11]);
EXPECT_EQ( 1.0, joint_elastic[12]);
EXPECT_EQ( 1.0, joint_elastic[13]);
EXPECT_EQ( 1.0, joint_elastic[14]);
EXPECT_EQ( 1.0, joint_elastic[15]);
EXPECT_EQ( 1.0, joint_elastic[16]);
EXPECT_EQ( 1.0, joint_elastic[17]);
EXPECT_EQ( 1.0, joint_elastic[18]);
const std::vector<double>& joint_offset = adaptive_synergy_transmission->getJointOffset();
EXPECT_EQ( 0.0, joint_offset[0]);
EXPECT_EQ( 0.0, joint_offset[1]);
EXPECT_EQ( 0.0, joint_offset[2]);
EXPECT_EQ( 0.0, joint_offset[3]);
EXPECT_EQ( 0.0, joint_offset[4]);
EXPECT_EQ( 0.0, joint_offset[5]);
EXPECT_EQ( 0.0, joint_offset[6]);
EXPECT_EQ( 0.0, joint_offset[7]);
EXPECT_EQ( 0.0, joint_offset[8]);
EXPECT_EQ( 0.0, joint_offset[9]);
EXPECT_EQ( 0.0, joint_offset[10]);
EXPECT_EQ( 0.0, joint_offset[11]);
EXPECT_EQ( 0.0, joint_offset[12]);
EXPECT_EQ( 0.0, joint_offset[13]);
EXPECT_EQ( 0.0, joint_offset[14]);
EXPECT_EQ( 0.0, joint_offset[15]);
EXPECT_EQ( 0.0, joint_offset[16]);
EXPECT_EQ( 0.0, joint_offset[17]);
EXPECT_EQ( 0.0, joint_offset[18]);
}
TEST(AdaptiveSynergyTransmissionLoaderTest, InvalidSpec)
{
// Parse transmission info
std::vector<TransmissionInfo> infos = parseUrdf("test/urdf/adaptive_synergy_transmission_loader_invalid.urdf");
ASSERT_EQ(12, infos.size());
// Transmission loader
TransmissionPluginLoader loader;
boost::shared_ptr<TransmissionLoader> transmission_loader = loader.create(infos.front().type_);
ASSERT_TRUE(0 != transmission_loader);
BOOST_FOREACH(const TransmissionInfo& info, infos)
{
TransmissionPtr transmission;
transmission = transmission_loader->load(info);
ASSERT_TRUE(0 == transmission);
}
}
int main(int argc, char** argv)
{
testing::InitGoogleTest(&argc, argv);
return RUN_ALL_TESTS();
}
| 39.353659 | 126 | 0.722033 | [
"vector"
] |
0deaaca09c00cc879f692ee53a17a97e6b752458 | 26,547 | hpp | C++ | vpp/algorithms/line_tracker_4_sfm/sfm/structure_from_motion.hpp | WLChopSticks/vpp | 2e17b21c56680bcfa94292ef5117f73572bf277d | [
"MIT"
] | 624 | 2015-01-05T16:40:41.000Z | 2022-03-01T03:09:43.000Z | vpp/algorithms/line_tracker_4_sfm/sfm/structure_from_motion.hpp | WLChopSticks/vpp | 2e17b21c56680bcfa94292ef5117f73572bf277d | [
"MIT"
] | 10 | 2015-01-22T20:50:13.000Z | 2018-05-15T10:41:34.000Z | vpp/algorithms/line_tracker_4_sfm/sfm/structure_from_motion.hpp | WLChopSticks/vpp | 2e17b21c56680bcfa94292ef5117f73572bf277d | [
"MIT"
] | 113 | 2015-01-19T11:58:35.000Z | 2022-03-28T05:15:20.000Z |
#include "structure_from_motion.hh"
namespace vpp
{
//from http://www.mip.informatik.uni-kiel.de/tiki-index.php?page=Lilian+Zhang
void pose_estimation_from_line_correspondence(Eigen::MatrixXf start_points,
Eigen::MatrixXf end_points,
Eigen::MatrixXf directions,
Eigen::MatrixXf points,
Eigen::MatrixXf &rot_cw,
Eigen::VectorXf &pos_cw)
{
int n = start_points.cols();
if(n != directions.cols())
{
return;
}
if(n<4)
{
return;
}
float condition_err_threshold = 1e-3;
Eigen::VectorXf cosAngleThreshold(3);
cosAngleThreshold << 1.1, 0.9659, 0.8660;
Eigen::MatrixXf optimumrot_cw(3,3);
Eigen::VectorXf optimumpos_cw(3);
std::vector<float> lineLenVec(n,1);
vfloat3 l1;
vfloat3 l2;
vfloat3 nc1;
vfloat3 Vw1;
vfloat3 Xm;
vfloat3 Ym;
vfloat3 Zm;
Eigen::MatrixXf Rot(3,3);
std::vector<vfloat3> nc_bar(n,vfloat3(0,0,0));
std::vector<vfloat3> Vw_bar(n,vfloat3(0,0,0));
std::vector<vfloat3> n_c(n,vfloat3(0,0,0));
Eigen::MatrixXf Rx(3,3);
int line_id;
for(int HowToChooseFixedTwoLines = 1 ; HowToChooseFixedTwoLines <=3 ; HowToChooseFixedTwoLines++)
{
if(HowToChooseFixedTwoLines==1)
{
#pragma omp parallel for
for(int i = 0; i < n ; i++ )
{
// to correct
float lineLen = 10;
lineLenVec[i] = lineLen;
}
std::vector<float>::iterator result;
result = std::max_element(lineLenVec.begin(), lineLenVec.end());
line_id = std::distance(lineLenVec.begin(), result);
vfloat3 temp;
temp = start_points.col(0);
start_points.col(0) = start_points.col(line_id);
start_points.col(line_id) = temp;
temp = end_points.col(0);
end_points.col(0) = end_points.col(line_id);
end_points.col(line_id) = temp;
temp = directions.col(line_id);
directions.col(0) = directions.col(line_id);
directions.col(line_id) = temp;
temp = points.col(0);
points.col(0) = points.col(line_id);
points.col(line_id) = temp;
lineLenVec[line_id] = lineLenVec[1];
lineLenVec[1] = 0;
l1 = start_points.col(0) - end_points.col(0);
l1 = l1/l1.norm();
}
for(int i = 1; i < n; i++)
{
std::vector<float>::iterator result;
result = std::max_element(lineLenVec.begin(), lineLenVec.end());
line_id = std::distance(lineLenVec.begin(), result);
l2 = start_points.col(line_id) - end_points.col(line_id);
l2 = l2/l2.norm();
lineLenVec[line_id] = 0;
MatrixXf cosAngle(3,3);
cosAngle = (l1.transpose()*l2).cwiseAbs();
if(cosAngle.maxCoeff() < cosAngleThreshold[HowToChooseFixedTwoLines])
{
break;
}
}
vfloat3 temp;
temp = start_points.col(1);
start_points.col(1) = start_points.col(line_id);
start_points.col(line_id) = temp;
temp = end_points.col(1);
end_points.col(1) = end_points.col(line_id);
end_points.col(line_id) = temp;
temp = directions.col(1);
directions.col(1) = directions.col(line_id);
directions.col(line_id) = temp;
temp = points.col(1);
points.col(1) = points.col(line_id);
points.col(line_id) = temp;
lineLenVec[line_id] = lineLenVec[1];
lineLenVec[1] = 0;
// The rotation matrix R_wc is decomposed in way which is slightly different from the description in the paper,
// but the framework is the same.
// R_wc = (Rot') * R * Rot = (Rot') * (Ry(theta) * Rz(phi) * Rx(psi)) * Rot
nc1 = x_cross(start_points.col(1),end_points.col(1));
nc1 = nc1/nc1.norm();
Vw1 = directions.col(1);
Vw1 = Vw1/Vw1.norm();
//the X axis of Model frame
Xm = x_cross(nc1,Vw1);
Xm = Xm/Xm.norm();
//the Y axis of Model frame
Ym = nc1;
//the Z axis of Model frame
Zm = x_cross(Xm,Zm);
Zm = Zm/Zm.norm();
//Rot * [Xm, Ym, Zm] = I.
Rot.col(0) = Xm;
Rot.col(1) = Ym;
Rot.col(2) = Zm;
Rot = Rot.transpose();
//rotate all the vector by Rot.
//nc_bar(:,i) = Rot * nc(:,i)
//Vw_bar(:,i) = Rot * Vw(:,i)
#pragma omp parallel for
for(int i = 0 ; i < n ; i++)
{
vfloat3 nc = x_cross(start_points.col(1),end_points.col(1));
nc = nc/nc.norm();
n_c[i] = nc;
nc_bar[i] = Rot * nc;
Vw_bar[i] = Rot * directions.col(i);
}
//Determine the angle psi, it is the angle between z axis and Vw_bar(:,1).
//The rotation matrix Rx(psi) rotates Vw_bar(:,1) to z axis
float cospsi = (Vw_bar[1])[2];//the angle between z axis and Vw_bar(:,1); cospsi=[0,0,1] * Vw_bar(:,1);.
float sinpsi= sqrt(1 - cospsi*cospsi);
Rx.row(0) = vfloat3(1,0,0);
Rx.row(1) = vfloat3(0,cospsi,-sinpsi);
Rx.row(2) = vfloat3(0,sinpsi,cospsi);
vfloat3 Zaxis = Rx * Vw_bar[1];
if(1-fabs(Zaxis[3]) > 1e-5)
{
Rx = Rx.transpose();
}
//estimate the rotation angle phi by least square residual.
//i.e the rotation matrix Rz(phi)
vfloat3 Vm2 = Rx * Vw_bar[1];
float A2 = Vm2[0];
float B2 = Vm2[1];
float C2 = Vm2[2];
float x2 = (nc_bar[1])[0];
float y2 = (nc_bar[1])[1];
float z2 = (nc_bar[1])[2];
Eigen::PolynomialSolver<double, Eigen::Dynamic> solver;
Eigen::VectorXf coeff(9);
std::vector<float> coef(9,0); //coefficients of equation (7)
Eigen::VectorXf polyDF = VectorXf::Zero(16); //%dF = ployDF(1) * t^15 + ployDF(2) * t^14 + ... + ployDF(15) * t + ployDF(16);
//construct the polynomial F'
#pragma omp parallel for
for(int i = 3 ; i < n ; i++)
{
vfloat3 Vm3 = Rx*Vw_bar[i];
float A3 = Vm3[0];
float B3 = Vm3[1];
float C3 = Vm3[2];
float x3 = (nc_bar[i])[0];
float y3 = (nc_bar[i])[1];
float z3 = (nc_bar[i])[2];
float u11 = -z2*A2*y3*B3 + y2*B2*z3*A3;
float u12 = -y2*A2*z3*B3 + z2*B2*y3*A3;
float u13 = -y2*B2*z3*B3 + z2*B2*y3*B3 + y2*A2*z3*A3 - z2*A2*y3*A3;
float u14 = -y2*B2*x3*C3 + x2*C2*y3*B3;
float u15 = x2*C2*y3*A3 - y2*A2*x3*C3;
float u21 = -x2*A2*y3*B3 + y2*B2*x3*A3;
float u22 = -y2*A2*x3*B3 + x2*B2*y3*A3;
float u23 = x2*B2*y3*B3 - y2*B2*x3*B3 - x2*A2*y3*A3 + y2*A2*x3*A3;
float u24 = y2*B2*z3*C3 - z2*C2*y3*B3;
float u25 = y2*A2*z3*C3 - z2*C2*y3*A3;
float u31 = -x2*A2*z3*A3 + z2*A2*x3*A3;
float u32 = -x2*B2*z3*B3 + z2*B2*x3*B3;
float u33 = x2*A2*z3*B3 - z2*A2*x3*B3 + x2*B2*z3*A3 - z2*B2*x3*A3;
float u34 = z2*A2*z3*C3 + x2*A2*x3*C3 - z2*C2*z3*A3 - x2*C2*x3*A3;
float u35 = -z2*B2*z3*C3 - x2*B2*x3*C3 + z2*C2*z3*B3 + x2*C2*x3*B3;
float u36 = -x2*C2*z3*C3 + z2*C2*x3*C3;
float a4 = u11*u11 + u12*u12 - u13*u13 - 2*u11*u12 + u21*u21 + u22*u22 - u23*u23
-2*u21*u22 - u31*u31 - u32*u32 + u33*u33 + 2*u31*u32;
float a3 =2*(u11*u14 - u13*u15 - u12*u14 + u21*u24 - u23*u25
- u22*u24 - u31*u34 + u33*u35 + u32*u34);
float a2 =-2*u12*u12 + u13*u13 + u14*u14 - u15*u15 + 2*u11*u12 - 2*u22*u22 + u23*u23
+ u24*u24 - u25*u25 +2*u21*u22+ 2*u32*u32 - u33*u33
- u34*u34 + u35*u35 -2*u31*u32- 2*u31*u36 + 2*u32*u36;
float a1 =2*(u12*u14 + u13*u15 + u22*u24 + u23*u25 - u32*u34 - u33*u35 - u34*u36);
float a0 = u12*u12 + u15*u15+ u22*u22 + u25*u25 - u32*u32 - u35*u35 - u36*u36 - 2*u32*u36;
float b3 =2*(u11*u13 - u12*u13 + u21*u23 - u22*u23 - u31*u33 + u32*u33);
float b2 =2*(u11*u15 - u12*u15 + u13*u14 + u21*u25 - u22*u25 + u23*u24 - u31*u35 + u32*u35 - u33*u34);
float b1 =2*(u12*u13 + u14*u15 + u22*u23 + u24*u25 - u32*u33 - u34*u35 - u33*u36);
float b0 =2*(u12*u15 + u22*u25 - u32*u35 - u35*u36);
float d0 = a0*a0 - b0*b0;
float d1 = 2*(a0*a1 - b0*b1);
float d2 = a1*a1 + 2*a0*a2 + b0*b0 - b1*b1 - 2*b0*b2;
float d3 = 2*(a0*a3 + a1*a2 + b0*b1 - b1*b2 - b0*b3);
float d4 = a2*a2 + 2*a0*a4 + 2*a1*a3 + b1*b1 + 2*b0*b2 - b2*b2 - 2*b1*b3;
float d5 = 2*(a1*a4 + a2*a3 + b1*b2 + b0*b3 - b2*b3);
float d6 = a3*a3 + 2*a2*a4 + b2*b2 - b3*b3 + 2*b1*b3;
float d7 = 2*(a3*a4 + b2*b3);
float d8 = a4*a4 + b3*b3;
std::vector<float> v { a4, a3, a2, a1, a0, b3, b2, b1, b0 };
Eigen::VectorXf vp;
vp << a4, a3, a2, a1, a0, b3, b2, b1, b0 ;
//coef = coef + v;
coeff = coeff + vp;
polyDF[0] = polyDF[0] + 8*d8*d8;
polyDF[1] = polyDF[1] + 15* d7*d8;
polyDF[2] = polyDF[2] + 14* d6*d8 + 7*d7*d7;
polyDF[3] = polyDF[3] + 13*(d5*d8 + d6*d7);
polyDF[4] = polyDF[4] + 12*(d4*d8 + d5*d7) + 6*d6*d6;
polyDF[5] = polyDF[5] + 11*(d3*d8 + d4*d7 + d5*d6);
polyDF[6] = polyDF[6] + 10*(d2*d8 + d3*d7 + d4*d6) + 5*d5*d5;
polyDF[7] = polyDF[7] + 9 *(d1*d8 + d2*d7 + d3*d6 + d4*d5);
polyDF[8] = polyDF[8] + 8 *(d1*d7 + d2*d6 + d3*d5) + 4*d4*d4 + 8*d0*d8;
polyDF[9] = polyDF[9] + 7 *(d1*d6 + d2*d5 + d3*d4) + 7*d0*d7;
polyDF[10] = polyDF[10] + 6 *(d1*d5 + d2*d4) + 3*d3*d3 + 6*d0*d6;
polyDF[11] = polyDF[11] + 5 *(d1*d4 + d2*d3)+ 5*d0*d5;
polyDF[12] = polyDF[12] + 4 * d1*d3 + 2*d2*d2 + 4*d0*d4;
polyDF[13] = polyDF[13] + 3 * d1*d2 + 3*d0*d3;
polyDF[14] = polyDF[14] + d1*d1 + 2*d0*d2;
polyDF[15] = polyDF[15] + d0*d1;
}
Eigen::VectorXd coefficientPoly = VectorXd::Zero(16);
for(int j =0; j < 16 ; j++)
{
coefficientPoly[j] = polyDF[15-j];
}
//solve polyDF
solver.compute(coefficientPoly);
const Eigen::PolynomialSolver<double, Eigen::Dynamic>::RootsType & r = solver.roots();
Eigen::VectorXd rs(r.rows());
Eigen::VectorXd is(r.rows());
std::vector<float> min_roots;
for(int j =0;j<r.rows();j++)
{
rs[j] = fabs(r[j].real());
is[j] = fabs(r[j].imag());
}
float maxreal = rs.maxCoeff();
for(int j = 0 ; j < rs.rows() ; j++ )
{
if(is[j]/maxreal <= 0.001)
{
min_roots.push_back(rs[j]);
}
}
std::vector<float> temp_v(15);
std::vector<float> poly(15);
for(int j = 0 ; j < 15 ; j++)
{
temp_v[j] = j+1;
}
for(int j = 0 ; j < 15 ; j++)
{
poly[j] = polyDF[j]*temp_v[j];
}
Eigen::Matrix<double,16,1> polynomial;
Eigen::VectorXd evaluation(min_roots.size());
for( int j = 0; j < min_roots.size(); j++ )
{
evaluation[j] = poly_eval( polynomial, min_roots[j] );
}
std::vector<float> minRoots;
for( int j = 0; j < min_roots.size(); j++ )
{
if(!evaluation[j]<=0)
{
minRoots.push_back(min_roots[j]);
}
}
if(minRoots.size()==0)
{
cout << "No solution" << endl;
return;
}
int numOfRoots = minRoots.size();
//for each minimum, we try to find a solution of the camera pose, then
//choose the one with the least reprojection residual as the optimum of the solution.
float minimalReprojectionError = 100;
// In general, there are two solutions which yields small re-projection error
// or condition error:"n_c * R_wc * V_w=0". One of the solution transforms the
// world scene behind the camera center, the other solution transforms the world
// scene in front of camera center. While only the latter one is correct.
// This can easily be checked by verifying their Z coordinates in the camera frame.
// P_c(Z) must be larger than 0 if it's in front of the camera.
for(int rootId = 0 ; rootId < numOfRoots ; rootId++)
{
float cosphi = minRoots[rootId];
float sign1 = sign_of_number(coeff[0] * pow(cosphi,4)
+ coeff[1] * pow(cosphi,3) + coeff[2] * pow(cosphi,2)
+ coeff[3] * cosphi + coeff[4]);
float sign2 = sign_of_number(coeff[5] * pow(cosphi,3)
+ coeff[6] * pow(cosphi,2) + coeff[7] * cosphi + coeff[8]);
float sinphi= -sign1*sign2*sqrt(abs(1-cosphi*cosphi));
Eigen::MatrixXf Rz(3,3);
Rz.row(0) = vfloat3(cosphi,-sinphi,0);
Rz.row(1) = vfloat3(sinphi,cosphi,0);
Rz.row(2) = vfloat3(0,0,1);
//now, according to Sec4.3, we estimate the rotation angle theta
//and the translation vector at a time.
Eigen::MatrixXf RzRxRot(3,3);
RzRxRot = Rz*Rx*Rot;
//According to the fact that n_i^C should be orthogonal to Pi^c and Vi^c, we
//have: scalarproduct(Vi^c, ni^c) = 0 and scalarproduct(Pi^c, ni^c) = 0.
//where Vi^c = Rwc * Vi^w, Pi^c = Rwc *(Pi^w - pos_cw) = Rwc * Pi^w - pos;
//Using the above two constraints to construct linear equation system Mat about
//[costheta, sintheta, tx, ty, tz, 1].
Eigen::MatrixXf Matrice(2*n-1,6);
#pragma omp parallel for
for(int i = 0 ; i < n ; i++)
{
float nxi = (nc_bar[i])[0];
float nyi = (nc_bar[i])[1];
float nzi = (nc_bar[i])[2];
Eigen::VectorXf Vm(3);
Vm = RzRxRot * directions.col(i);
float Vxi = Vm[0];
float Vyi = Vm[1];
float Vzi = Vm[2];
Eigen::VectorXf Pm(3);
Pm = RzRxRot * points.col(i);
float Pxi = Pm(1);
float Pyi = Pm(2);
float Pzi = Pm(3);
//apply the constraint scalarproduct(Vi^c, ni^c) = 0
//if i=1, then scalarproduct(Vi^c, ni^c) always be 0
if(i>1)
{
Matrice(2*i-3, 0) = nxi * Vxi + nzi * Vzi;
Matrice(2*i-3, 1) = nxi * Vzi - nzi * Vxi;
Matrice(2*i-3, 5) = nyi * Vyi;
}
//apply the constraint scalarproduct(Pi^c, ni^c) = 0
Matrice(2*i-2, 0) = nxi * Pxi + nzi * Pzi;
Matrice(2*i-2, 1) = nxi * Pzi - nzi * Pxi;
Matrice(2*i-2, 2) = -nxi;
Matrice(2*i-2, 3) = -nyi;
Matrice(2*i-2, 4) = -nzi;
Matrice(2*i-2, 5) = nyi * Pyi;
}
//solve the linear system Mat * [costheta, sintheta, tx, ty, tz, 1]' = 0 using SVD,
JacobiSVD<MatrixXf> svd(Matrice, ComputeThinU | ComputeThinV);
Eigen::MatrixXf VMat = svd.matrixV();
Eigen::VectorXf vec(2*n-1);
//the last column of Vmat;
vec = VMat.col(5);
//the condition that the last element of vec should be 1.
vec = vec/vec[5];
//the condition costheta^2+sintheta^2 = 1;
float normalizeTheta = 1/sqrt(vec[0]*vec[1]+vec[1]*vec[1]);
float costheta = vec[0]*normalizeTheta;
float sintheta = vec[1]*normalizeTheta;
Eigen::MatrixXf Ry(3,3);
Ry << costheta, 0, sintheta , 0, 1, 0 , -sintheta, 0, costheta;
//now, we get the rotation matrix rot_wc and translation pos_wc
Eigen::MatrixXf rot_wc(3,3);
rot_wc = (Rot.transpose()) * (Ry * Rz * Rx) * Rot;
Eigen::VectorXf pos_wc(3);
pos_wc = - Rot.transpose() * vec.segment(2,4);
//now normalize the camera pose by 3D alignment. We first translate the points
//on line in the world frame Pw to points in the camera frame Pc. Then we project
//Pc onto the line interpretation plane as Pc_new. So we could call the point
//alignment algorithm to normalize the camera by aligning Pc_new and Pw.
//In order to improve the accuracy of the aligment step, we choose two points for each
//lines. The first point is Pwi, the second point is the closest point on line i to camera center.
//(Pw2i = Pwi - (Pwi'*Vwi)*Vwi.)
Eigen::MatrixXf Pw2(3,n);
Pw2.setZero();
Eigen::MatrixXf Pc_new(3,n);
Pc_new.setZero();
Eigen::MatrixXf Pc2_new(3,n);
Pc2_new.setZero();
for(int i = 0 ; i < n ; i++)
{
vfloat3 nci = n_c[i];
vfloat3 Pwi = points.col(i);
vfloat3 Vwi = directions.col(i);
//first point on line i
vfloat3 Pci;
Pci = rot_wc * Pwi + pos_wc;
Pc_new.col(i) = Pci - (Pci.transpose() * nci) * nci;
//second point is the closest point on line i to camera center.
vfloat3 Pw2i;
Pw2i = Pwi - (Pwi.transpose() * Vwi) * Vwi;
Pw2.col(i) = Pw2i;
vfloat3 Pc2i;
Pc2i = rot_wc * Pw2i + pos_wc;
Pc2_new.col(i) = Pc2i - ( Pc2i.transpose() * nci ) * nci;
}
MatrixXf XXc(Pc_new.rows(), Pc_new.cols()+Pc2_new.cols());
XXc << Pc_new, Pc2_new;
MatrixXf XXw(points.rows(), points.cols()+Pw2.cols());
XXw << points, Pw2;
int nm = points.cols()+Pw2.cols();
cal_campose(XXc,XXw,nm,rot_wc,pos_wc);
pos_cw = -rot_wc.transpose() * pos_wc;
//check the condition n_c^T * rot_wc * V_w = 0;
float conditionErr = 0;
for(int i =0 ; i < n ; i++)
{
float val = ( (n_c[i]).transpose() * rot_wc * directions.col(i) );
conditionErr = conditionErr + val*val;
}
if(conditionErr/n < condition_err_threshold || HowToChooseFixedTwoLines ==3)
{
//check whether the world scene is in front of the camera.
int numLineInFrontofCamera = 0;
if(HowToChooseFixedTwoLines<3)
{
for(int i = 0 ; i < n ; i++)
{
vfloat3 P_c = rot_wc * (points.col(i) - pos_cw);
if(P_c[2]>0)
{
numLineInFrontofCamera++;
}
}
}
else
{
numLineInFrontofCamera = n;
}
if(numLineInFrontofCamera > 0.5*n)
{
//most of the lines are in front of camera, then check the reprojection error.
int reprojectionError = 0;
for(int i =0; i < n ; i++)
{
//line projection function
vfloat3 nc = rot_wc * x_cross(points.col(i) - pos_cw , directions.col(i));
float h1 = nc.transpose() * start_points.col(i);
float h2 = nc.transpose() * end_points.col(i);
float lineLen = (start_points.col(i) - end_points.col(i)).norm()/3;
reprojectionError += lineLen * (h1*h1 + h1*h2 + h2*h2) / (nc[0]*nc[0]+nc[1]*nc[1]);
}
if(reprojectionError < minimalReprojectionError)
{
optimumrot_cw = rot_wc.transpose();
optimumpos_cw = pos_cw;
minimalReprojectionError = reprojectionError;
}
}
}
}
if(optimumrot_cw.rows()>0)
{
break;
}
}
pos_cw = optimumpos_cw;
rot_cw = optimumrot_cw;
}
inline
void cal_campose(Eigen::MatrixXf XXc,Eigen::MatrixXf XXw,
int n,Eigen::MatrixXf &R2,Eigen::VectorXf &t2)
{
//A
Eigen::MatrixXf X = XXw;
//B
Eigen::MatrixXf Y = XXc;
Eigen::MatrixXf eyen(n,n);
eyen = Eigen::MatrixXf::Identity(n,n);
Eigen::MatrixXf ones(n,n);
ones.setOnes();
Eigen::MatrixXf K(n,n);
K = eyen - ones/n;
vfloat3 ux;
for(int i =0; i < n; i++)
{
ux = ux + X.col(i);
}
ux = ux/n;
vfloat3 uy;
for(int i =0; i < n; i++)
{
uy = uy + Y.col(i);
}
uy = uy/n;
Eigen::MatrixXf XK(3,n);
XK = X*K;
Eigen::MatrixXf XKarre(3,n);
for(int i = 0 ; i < n ; i++)
{
XKarre(0,i) = XK(0,i)*XK(0,i);
XKarre(1,i) = XK(1,i)*XK(1,i);
XKarre(2,i) = XK(2,i)*XK(2,i);
}
Eigen::VectorXf sumXKarre(n);
float sigmx2 = 0;
for(int i = 0 ; i < n ; i++)
{
sumXKarre[i] = XKarre(0,i) + XKarre(1,i) + XKarre(2,i);
sigmx2 += sumXKarre[i];
}
sigmx2 /=n;
Eigen::MatrixXf SXY(3,3);
SXY = Y*K*(X.transpose())/n;
JacobiSVD<MatrixXf> svd(SXY, ComputeThinU | ComputeThinV);
Eigen::MatrixXf S(3,3);
S = Eigen::MatrixXf::Identity(3,3);
if(SXY.determinant() < 0)
{
S(3,3) = -1;
}
R2 = svd.matrixU() * S * (svd.matrixV()).transpose();
Eigen::MatrixXf D(3,3);
D.setZero();
for(int i = 0 ; i < svd.singularValues().size() ; i++)
{
D(i,i) = (svd.singularValues())[i];
}
float c2 = (D*S).trace()/sigmx2;
t2 = uy - c2*R2*ux;
vfloat3 Xx = R2.col(0);
vfloat3 Yy = R2.col(1);
vfloat3 Zz = R2.col(2);
if((x_cross(Xx,Yy)-Zz).norm()>2e-2)
{
R2.col(2) = -Zz;
}
}
inline
void r_and_t(MatrixXf &rot_cw, VectorXf &pos_cw,MatrixXf start_points, MatrixXf end_points,
MatrixXf P1w,MatrixXf P2w,MatrixXf initRot_cw,VectorXf initPos_cw,
int maxIterNum,float TerminateTh,int nargin)
{
if(nargin<6)
{
return;
}
if(nargin<8)
{
maxIterNum = 8;
TerminateTh = 1e-5;
}
int n = start_points.cols();
if(n != end_points.cols() || n!= P1w.cols() || n!= P2w.cols())
{
return;
}
if(n<4)
{
return;
}
//first compute the weight of each line and the normal of
//the interpretation plane passing through to camera center and the line
VectorXf w = VectorXf::Zero(n);
MatrixXf nc = MatrixXf::Zero(3,n);
for(int i = 0 ; i < n ; i++)
{
//the weight of a line is the inverse of its image length
w[i] = 1/(start_points.col(i)-end_points.col(i)).norm();
vfloat3 v1 = start_points.col(i);
vfloat3 v2 = end_points.col(i);
vfloat3 temp = v1.cross(v2);
nc.col(i) = temp/temp.norm();
}
MatrixXf rot_wc = initPos_cw.transpose();
MatrixXf pos_wc = - initRot_cw.transpose() * initPos_cw;
for(int iter = 1 ; iter < maxIterNum ; iter++)
{
//construct the equation (31)
MatrixXf A = MatrixXf::Zero(6,7);
MatrixXf C = MatrixXf::Zero(3,3);
MatrixXf D = MatrixXf::Zero(3,3);
MatrixXf F = MatrixXf::Zero(3,3);
vfloat3 c_bar = vfloat3(0,0,0);
vfloat3 d_bar = vfloat3(0,0,0);
for(int i = 0 ; i < n ; i++)
{
//for first point on line
vfloat3 Pi = rot_wc * P1w.col(i);
vfloat3 Ni = nc.col(i);
float wi = w[i];
vfloat3 bi = Pi.cross(Ni);
C = C + wi*Ni*Ni.transpose();
D = D + wi*bi*bi.transpose();
F = F + wi*Ni*bi.transpose();
vfloat3 tempi = Pi + pos_wc;
float scale = Ni.transpose() * tempi;
scale *= wi;
c_bar = c_bar + scale * Ni;
d_bar = d_bar + scale*bi;
//for second point on line
Pi = rot_wc * P2w.col(i);
Ni = nc.col(i);
wi = w[i];
bi = Pi.cross(Ni);
C = C + wi*Ni*Ni.transpose();
D = D + wi*bi*bi.transpose();
F = F + wi*Ni*bi.transpose();
scale = (Ni.transpose() * (Pi + pos_wc));
scale *= wi;
c_bar = c_bar + scale * Ni;
d_bar = d_bar + scale * bi;
}
A.block<3,3>(0,0) = C;
A.block<3,3>(0,3) = F;
(A.col(6)).segment(0,2) = c_bar;
A.block<3,3>(3,0) = F.transpose();
A.block<3,3>(2,2) = D;
(A.col(6)).segment(3,5) = d_bar;
//sovle the system by using SVD;
JacobiSVD<MatrixXf> svd(A, ComputeThinU | ComputeThinV);
VectorXf vec(7);
//the last column of Vmat;
vec = (svd.matrixV()).col(6);
//the condition that the last element of vec should be 1.
vec = vec/vec[6];
//update the rotation and translation parameters;
vfloat3 dT = vec.segment(0,2);
vfloat3 dOmiga = vec.segment(3,5);
MatrixXf rtemp(3,3);
rtemp << 1, -dOmiga[2], dOmiga[1], dOmiga[2], 1, -dOmiga[1], -dOmiga[1], dOmiga[0], 1;
rot_wc = rtemp * rot_wc;
//newRot_wc = ( I + [dOmiga]x ) oldRot_wc
//may be we can compute new R using rodrigues(r+dr)
pos_wc = pos_wc + dT;
if(dT.norm() < TerminateTh && dOmiga.norm() < 0.1*TerminateTh)
{
break;
}
}
rot_cw = rot_wc.transpose();
pos_cw = -rot_cw * pos_wc;
}
inline
vfloat3 x_cross(vfloat3 a,vfloat3 b)
{
vfloat3 c;
c[0] = a[1]*b[2]-a[2]*b[1];
c[1] = a[2]*b[0]-a[0]*b[2];
c[2] = a[0]*b[1]-a[1]*b[0];
return c;
}
}
| 35.538153 | 133 | 0.489472 | [
"vector",
"model",
"3d"
] |
0ded7225cc371075cb36df62a3fd533b52a8e5f5 | 2,827 | cpp | C++ | test/unit/math/mix/meta/return_type_test.cpp | HaoZeke/math | fdf7f70dceed60f3b3f93137c6ac123a457b80a3 | [
"BSD-3-Clause"
] | 1 | 2020-05-18T13:10:50.000Z | 2020-05-18T13:10:50.000Z | test/unit/math/mix/meta/return_type_test.cpp | HaoZeke/math | fdf7f70dceed60f3b3f93137c6ac123a457b80a3 | [
"BSD-3-Clause"
] | 2 | 2019-07-23T12:45:30.000Z | 2020-05-01T20:43:03.000Z | test/unit/math/mix/meta/return_type_test.cpp | SteveBronder/math | 3f21445458866897842878f65941c6bcb90641c2 | [
"BSD-3-Clause"
] | null | null | null | #include <stan/math/mix.hpp>
#include <gtest/gtest.h>
#include <test/unit/util.hpp>
#include <complex>
#include <vector>
using stan::return_type;
using stan::math::fvar;
using stan::math::var;
using d_t = double;
using v_t = var;
using fd_t = fvar<double>;
using ffd_t = fvar<fd_t>;
using fv_t = fvar<var>;
using ffv_t = fvar<fv_t>;
using md_t = Eigen::MatrixXd;
using vd_t = Eigen::VectorXd;
using rvd_t = Eigen::RowVectorXd;
template <typename R, typename... Ts>
void expect_return() {
test::expect_same_type<R, typename stan::return_type<Ts...>::type>();
test::expect_same_type<R, stan::return_type_t<Ts...>>();
}
template <typename T>
void test_return() {
// scalar types
expect_return<T, T>();
expect_return<T, T, int>();
expect_return<T, int, T>();
expect_return<T, d_t, T, d_t, int, d_t, float, float, float, T, int>();
// array types
expect_return<T, std::vector<T>>();
expect_return<T, std::vector<T>, int>();
expect_return<T, double, std::vector<T>>();
// matrix types
expect_return<T, Eigen::Matrix<T, -1, -1>>();
expect_return<T, Eigen::Matrix<T, -1, 1>>();
expect_return<T, Eigen::Matrix<T, -1, 1>, std::vector<double>>();
expect_return<T, Eigen::Matrix<T, 1, -1>>();
expect_return<T, Eigen::Matrix<T, 1, -1>, T>();
expect_return<T, T, Eigen::Matrix<T, 1, -1>, int>();
expect_return<T, double, Eigen::Matrix<T, 1, -1>>();
expect_return<T, Eigen::Matrix<T, 1, -1>, double>();
expect_return<T, Eigen::Matrix<T, 1, -1>, int, Eigen::Matrix<T, -1, -1>>();
expect_return<T, Eigen::Matrix<T, 1, -1>, int,
std::vector<Eigen::Matrix<double, -1, -1>>>();
// complex types
expect_return<std::complex<T>, std::complex<T>>();
expect_return<std::complex<T>, int, std::complex<T>>();
expect_return<std::complex<T>, std::complex<T>, int>();
expect_return<std::complex<T>, double, std::complex<T>>();
expect_return<std::complex<T>, std::complex<T>, double>();
expect_return<std::complex<T>, std::complex<double>, std::complex<T>>();
expect_return<std::complex<T>, std::complex<T>, std::complex<double>>();
expect_return<std::complex<T>, T, std::complex<T>>();
expect_return<std::complex<T>, std::complex<T>, T>();
expect_return<std::complex<T>, std::complex<T>, std::complex<T>>();
expect_return<std::complex<T>, std::complex<T>, std::complex<T>, T>();
}
TEST(mathMetaMix, returnType) {
// no-arg case
expect_return<double>();
// 1-arg special cases where result is min double
expect_return<double, float>();
expect_return<double, int>();
expect_return<double, std::vector<int>>();
expect_return<double, Eigen::Matrix<float, -1, 1>>();
// cases where result is given real type
test_return<d_t>();
test_return<v_t>();
test_return<fd_t>();
test_return<ffd_t>();
test_return<fv_t>();
test_return<ffv_t>();
}
| 31.764045 | 77 | 0.65122 | [
"vector"
] |
0df4719c37fe278955b6b2eafb261d947a0f6f5a | 7,971 | cpp | C++ | Funambol/source/common/base/util/EncodingHelper.cpp | wbitos/funambol | 29f76caf9cee51d51ddf5318613411cb1cfb8e4e | [
"MIT"
] | null | null | null | Funambol/source/common/base/util/EncodingHelper.cpp | wbitos/funambol | 29f76caf9cee51d51ddf5318613411cb1cfb8e4e | [
"MIT"
] | null | null | null | Funambol/source/common/base/util/EncodingHelper.cpp | wbitos/funambol | 29f76caf9cee51d51ddf5318613411cb1cfb8e4e | [
"MIT"
] | null | null | null | /*
* Funambol is a mobile platform developed by Funambol, Inc.
* Copyright (C) 2003 - 2007 Funambol, Inc.
*
* This program is free software; you can redistribute it and/or modify it under
* the terms of the GNU Affero General Public License version 3 as published by
* the Free Software Foundation with the addition of the following permission
* added to Section 15 as permitted in Section 7(a): FOR ANY PART OF THE COVERED
* WORK IN WHICH THE COPYRIGHT IS OWNED BY FUNAMBOL, FUNAMBOL DISCLAIMS THE
* WARRANTY OF NON INFRINGEMENT OF THIRD PARTY RIGHTS.
*
* This program is distributed in the hope that it will be useful, but WITHOUT
* ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS
* FOR A PARTICULAR PURPOSE. See the GNU General Public License for more
* details.
*
* You should have received a copy of the GNU Affero General Public License
* along with this program; if not, see http://www.gnu.org/licenses or write to
* the Free Software Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston,
* MA 02110-1301 USA.
*
* You can contact Funambol, Inc. headquarters at 643 Bair Island Road, Suite
* 305, Redwood City, CA 94063, USA, or at email address info@funambol.com.
*
* The interactive user interfaces in modified source and object code versions
* of this program must display Appropriate Legal Notices, as required under
* Section 5 of the GNU Affero General Public License version 3.
*
* In accordance with Section 7(b) of the GNU Affero General Public License
* version 3, these Appropriate Legal Notices must retain the display of the
* "Powered by Funambol" logo. If the display of the logo is not reasonably
* feasible for technical reasons, the Appropriate Legal Notices must display
* the words "Powered by Funambol".
*/
#include <Funambol/base/util/utils.h>
#include <Funambol/base/util/EncodingHelper.h>
#include <Funambol/base/Log.h>
#include <Funambol/spds/DataTransformerFactory.h>
USE_NAMESPACE
const char* const EncodingHelper::encodings::plain = "bin";
const char* const EncodingHelper::encodings::escaped = "b64";
const char* const EncodingHelper::encodings::des = "des;b64";
// Constructor
EncodingHelper::EncodingHelper(const char* encoding, const char* encryption, const char* credential) {
setEncoding(encoding);
setEncryption(encryption);
setCredential(credential ? credential : "");
from = encodings::plain;
}
EncodingHelper::~EncodingHelper() {}
void EncodingHelper::setEncoding(const char* value) {
encoding = encodings::encodingString(value);
if (encoding == "") {
encoding = encodings::plain;
}
}
void EncodingHelper::setEncryption(const char* value) {
encryption = value;
}
void EncodingHelper::setCredential(const char* value) {
credential = value;
}
void EncodingHelper::setDataEncoding(const char* dataEnc) {
dataEncoding = dataEnc;
}
long EncodingHelper::getMaxDataSizeToEncode(long size) {
// ret = size is fine when encoding = encodings::plain
long ret = size;
if (encoding == encodings::escaped) {
ret = ((unsigned long)(size/4)) * 3;
}
/*@TODO...
if (encryption == "des") {
int mod = (ret%8);
ret = ret - 8 - mod;
}
*/
return ret;
}
long EncodingHelper::getDataSizeAfterEncoding(long size) {
long ret = size;
if (encoding == encodings::escaped) {
int modules = size % 3;
if (modules == 0) {
ret = 4 * (size/3);
} else {
ret = 4 * ((size/3) + 1);
}
}
/*@TODO...
if (encryption == "des") {
int mod = (ret%8);
ret = ret - 8 - mod;
}
*/
return ret;
}
char* EncodingHelper::encode(const char* from, char* buffer, unsigned long *len) {
return transform(from, buffer, len);
}
char* EncodingHelper::decode(const char* from, char* buffer, unsigned long *len) {
return transform(from, buffer, len);
}
char* EncodingHelper::transform(const char* from, char* buffer, unsigned long *len) {
char* ret = NULL;
StringBuffer encToUse;
char* pBuffer = buffer;
StringBuffer originalEncoding(encodings::encodingString(from));
if (encryption == "des") {
encToUse = encodings::des;
}
else {
encToUse = encoding;
}
// nothing to be done?
if (!buffer) {
//!strcmp(encodings::encodingString(encoding), encodings::encodingString(encToUse)))
LOG.info("EncodingHelper: nothing to be done: buffer NULL or lenght <= 0");
return ret;
}
if (len == 0) {
ret = stringdup("");
//setDataEncoding(originalEncoding);
LOG.debug("EncodingHelper: nothing to be done: buffer empty or lenght = 0");
return ret;
}
if (encToUse == originalEncoding) {
ret = new char[*len + 1];
memcpy(ret, buffer, *len);
ret[*len] = 0;
setDataEncoding(originalEncoding);
//LOG.debug("EncodingHelper: no transformation done. Only returned the new array");
return ret;
}
// sanity check: both encodings must be valid
if (!encodings::isSupported(encToUse.c_str()) ||
!encodings::isSupported(encoding.c_str())) {
LOG.error("EncodingHelper: encoding not supported");
return ret;
}
if (encToUse != originalEncoding) {
// DECODING
if (originalEncoding != encodings::plain) {
if ((originalEncoding == encodings::escaped) || (originalEncoding == encodings::des)) {
ret = transformData("b64", false, credential.c_str(), pBuffer, len);
if (ret == NULL) {
return ret;
}
pBuffer = ret;
}
if (originalEncoding == encodings::des) {
ret = transformData("des", false, credential.c_str(), pBuffer, len);
if (pBuffer != buffer) {
delete [] pBuffer;
}
if (ret == NULL) {
return ret;
}
}
setDataEncoding(encodings::plain);
}
// ENCODING: convert to new encoding
if (encToUse == encodings::des) {
ret = transformData("des", true, credential.c_str(), pBuffer, len);
if (ret == NULL) {
return ret;
}
pBuffer = ret;
}
if (encToUse == encodings::escaped || encToUse == encodings::des ) {
ret = transformData("b64", true, credential.c_str(), pBuffer, len);
if (pBuffer != buffer) { // it means it was assigned pBuffer = ret since the pointer is differen
delete [] pBuffer;
}
if (ret == NULL) {
return ret;
}
}
setDataEncoding(encToUse.c_str());
}
return ret;
}
char* EncodingHelper::transformData(const char* name, bool encode,
const char* password, char* buff,
unsigned long *len) {
char* buffer = NULL;
DataTransformer *dt = encode ?
DataTransformerFactory::getEncoder(name) :
DataTransformerFactory::getDecoder(name);
TransformationInfo info;
int res = ERR_NONE;
if (dt == NULL) {
res = getLastErrorCode();
goto exit;
}
info.size = *len;
info.password = password;
buffer = dt->transform(buff, info);
if (!buffer) {
res = getLastErrorCode();
goto exit;
}
*len = info.size;
if (info.newReturnedData == false) {
buffer = new char[info.size + 1];
memset(buffer, 0, info.size + 1);
memcpy(buffer, buff, info.size);
}
exit:
delete dt;
return buffer;
}
| 32.271255 | 111 | 0.596036 | [
"object",
"transform"
] |
df02fa32675347c7d9e9b09019ee84592f48b915 | 842 | hpp | C++ | include/class/brush.hpp | KusStar/- | 8a7117e5d7b4f0dc9a4d34e12076f301f8bb37ec | [
"MIT"
] | null | null | null | include/class/brush.hpp | KusStar/- | 8a7117e5d7b4f0dc9a4d34e12076f301f8bb37ec | [
"MIT"
] | null | null | null | include/class/brush.hpp | KusStar/- | 8a7117e5d7b4f0dc9a4d34e12076f301f8bb37ec | [
"MIT"
] | null | null | null | #pragma once
#ifndef __BRUSH_H__
#define __BRUSH_H__
#include <string>
#include <vector>
#include "escaper.hpp"
class Brush {
public:
Brush() = default;
~Brush() { clear(); }
void draw() { std::cout << oss_.str(); }
void flush() {
std::cout << escaper::erase::lines(lines());
clear();
}
int lines() {
int n = 0;
const std::string content = oss_.str();
size_t pos = content.find("\n");
while (pos != std::string::npos) {
pos = content.find("\n", pos + 1);
n++;
}
return n;
}
void clear() {
oss_.str("");
oss_.clear();
}
template <class T>
Brush& operator<<(const T& t) {
oss_ << t;
return *this;
}
private:
std::ostringstream oss_;
};
#endif // __BRUSH_H__
| 16.192308 | 52 | 0.495249 | [
"vector"
] |
df0882283d8acb542316ea1818d4589ebf699f1e | 4,754 | cpp | C++ | webkit/WebCore/platform/graphics/haiku/ImageHaiku.cpp | s1rcheese/nintendo-3ds-internetbrowser-sourcecode | 3dd05f035e0a5fc9723300623e9b9b359be64e11 | [
"Unlicense"
] | 15 | 2016-01-05T12:43:41.000Z | 2022-03-15T10:34:47.000Z | webkit/WebCore/platform/graphics/haiku/ImageHaiku.cpp | s1rcheese/nintendo-3ds-internetbrowser-sourcecode | 3dd05f035e0a5fc9723300623e9b9b359be64e11 | [
"Unlicense"
] | null | null | null | webkit/WebCore/platform/graphics/haiku/ImageHaiku.cpp | s1rcheese/nintendo-3ds-internetbrowser-sourcecode | 3dd05f035e0a5fc9723300623e9b9b359be64e11 | [
"Unlicense"
] | 2 | 2020-11-30T18:36:01.000Z | 2021-02-05T23:20:24.000Z | /*
* Copyright (C) 2006 Dirk Mueller <mueller@kde.org>
* Copyright (C) 2006 Zack Rusin <zack@kde.org>
* Copyright (C) 2006 Simon Hausmann <hausmann@kde.org>
* Copyright (C) 2007 Ryan Leavengood <leavengood@gmail.com>
* Copyright (C) 2008 Andrea Anzani <andrea.anzani@gmail.com>
*
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* 1. Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
* EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR
* CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
* EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
* PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
* OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
* OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*/
#include "config.h"
#include "Image.h"
#include "BitmapImage.h"
#include "FloatRect.h"
#include "GraphicsContext.h"
#include "NotImplemented.h"
#include "PlatformString.h"
#include <Application.h>
#include <Bitmap.h>
#include <View.h>
// This function loads resources from WebKit
Vector<char> loadResourceIntoArray(const char*);
namespace WebCore {
bool FrameData::clear(bool clearMetadata)
{
if (clearMetadata)
m_haveMetadata = false;
if (m_frame) {
delete m_frame;
m_frame = 0;
m_duration = 0.0f;
m_hasAlpha = true;
return true;
}
return false;
}
WTF::PassRefPtr<Image> Image::loadPlatformResource(const char* name)
{
Vector<char> array = loadResourceIntoArray(name);
WTF::PassRefPtr<BitmapImage> image = BitmapImage::create();
RefPtr<SharedBuffer> buffer = SharedBuffer::create(array.data(), array.size());
image->setData(buffer, true);
return image;
}
void BitmapImage::initPlatformData()
{
}
void BitmapImage::invalidatePlatformData()
{
}
// Drawing Routines
void BitmapImage::draw(GraphicsContext* ctxt, const FloatRect& dst, const FloatRect& src, ColorSpace styleColorSpace, CompositeOperator op)
{
startAnimation();
BBitmap* image = nativeImageForCurrentFrame();
if (!image || !image->IsValid()) // If the image hasn't fully loaded.
return;
if (mayFillWithSolidColor()) {
fillWithSolidColor(ctxt, dst, solidColor(), styleColorSpace, op);
return;
}
ctxt->save();
ctxt->setCompositeOperation(op);
BRect srcRect(src);
BRect dstRect(dst);
// Test using example site at
// http://www.meyerweb.com/eric/css/edge/complexspiral/demo.html
ctxt->platformContext()->SetDrawingMode(B_OP_ALPHA);
ctxt->platformContext()->DrawBitmap(image, srcRect & image->Bounds(), dstRect);
ctxt->restore();
}
void Image::drawPattern(GraphicsContext* context, const FloatRect& tileRect, const TransformationMatrix& patternTransform, const FloatPoint& srcPoint, ColorSpace, CompositeOperator op, const FloatRect& dstRect)
{
// FIXME: finish this to support also phased position (srcPoint)
startAnimation();
BBitmap* image = nativeImageForCurrentFrame();
if (!image || !image->IsValid()) // If the image hasn't fully loaded.
return;
float currentW = 0;
float currentH = 0;
context->save();
context->platformContext()->SetDrawingMode(B_OP_ALPHA);
context->clip(enclosingIntRect(dstRect));
while (currentW < dstRect.width()) {
while (currentH < dstRect.height()) {
context->platformContext()->DrawBitmap(image, BPoint(dstRect.x() + currentW, dstRect.y() + currentH));
currentH += tileRect.height();
}
currentW += tileRect.width();
currentH = 0;
}
context->restore();
}
void BitmapImage::checkForSolidColor()
{
// FIXME: need to check the RGBA32 buffer to see if it is 1x1.
m_isSolidColor = false;
m_checkedForSolidColor = true;
}
BBitmap* BitmapImage::getBBitmap() const
{
return const_cast<BitmapImage*>(this)->frameAtIndex(0);
}
} // namespace WebCore
| 31.071895 | 210 | 0.705301 | [
"vector"
] |
df0ca4af2eb7879524ed9d6ebdbc9334ed7229ad | 24,528 | cpp | C++ | src/other/ext/openscenegraph/src/osgDB/ClassInterface.cpp | lf-/brlcad | f91ea585c1a930a2e97c3f5a8274db8805ebbb46 | [
"BSD-4-Clause",
"BSD-3-Clause"
] | null | null | null | src/other/ext/openscenegraph/src/osgDB/ClassInterface.cpp | lf-/brlcad | f91ea585c1a930a2e97c3f5a8274db8805ebbb46 | [
"BSD-4-Clause",
"BSD-3-Clause"
] | null | null | null | src/other/ext/openscenegraph/src/osgDB/ClassInterface.cpp | lf-/brlcad | f91ea585c1a930a2e97c3f5a8274db8805ebbb46 | [
"BSD-4-Clause",
"BSD-3-Clause"
] | null | null | null | /* -*-c++-*- OpenSceneGraph - Copyright (C) 1998-2013 Robert Osfield
*
* This library is open source and may be redistributed and/or modified under
* the terms of the OpenSceneGraph Public License (OSGPL) version 0.0 or
* (at your option) any later version. The full license is in LICENSE file
* included with this distribution, and on the openscenegraph.org website.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* OpenSceneGraph Public License for more details.
*/
#include <osgDB/ClassInterface>
namespace osgDB // start of osgDB namespace
{
osgDB::BaseSerializer::Type getTypeEnumFromPtr(const osg::Object*) { return osgDB::BaseSerializer::RW_OBJECT; }
const char* getTypeStringFromPtr(const osg::Object*) { return "OBJECT"; }
osgDB::BaseSerializer::Type getTypeEnumFromPtr(const osg::Image*) { return osgDB::BaseSerializer::RW_IMAGE; }
const char* getTypeStringFromPtr(const osg::Image*) { return "IMAGE"; }
///////////////////////////////////////////////////////////////////
//
// PropertyOutputIterator enables the get of class properties
//
class PropertyOutputIterator : public osgDB::OutputIterator
{
public:
PropertyOutputIterator()
{
}
virtual ~PropertyOutputIterator() {}
virtual bool isBinary() const { return true; }
template<typename T>
inline void write(T t)
{
char* ptr = reinterpret_cast<char*>(&t);
_str.insert(_str.size(), ptr, sizeof(T));
}
virtual void writeBool( bool b ) { _str.push_back(static_cast<char>(b?1:0)); }
virtual void writeChar( char c ) { _str.push_back(c); }
virtual void writeUChar( unsigned char c ) { _str.push_back(static_cast<char>(c)); }
virtual void writeShort( short s ) { write(s); }
virtual void writeUShort( unsigned short s ) { write(s); }
virtual void writeInt( int i ) { write(i); }
virtual void writeUInt( unsigned int i ) { write(i); }
virtual void writeLong( long l ) { write(l); }
virtual void writeULong( unsigned long l ) { write(l); }
virtual void writeFloat( float f ) { write(f); }
virtual void writeDouble( double d ) { write(d); }
virtual void writeInt64( GLint64 ll ) { write(ll); }
virtual void writeUInt64( GLuint64 ull ) { write(ull); }
virtual void writeString( const std::string& s ) { _str.insert(_str.end(), s.begin(), s.end()); }
virtual void writeStream( std::ostream& (*)(std::ostream&) ) {}
virtual void writeBase( std::ios_base& (*)(std::ios_base&) ) {}
virtual void writeGLenum( const osgDB::ObjectGLenum& value ) { writeInt(value.get()); }
virtual void writeProperty( const osgDB::ObjectProperty& prop ) { _propertyName = prop._name; }
virtual void writeMark( const osgDB::ObjectMark& mark ) { _markName = mark._name; }
virtual void writeCharArray( const char* s, unsigned int size) { _str.insert(std::string::npos, s, size); }
virtual void writeWrappedString( const std::string& str ) { _str.insert(_str.end(), str.begin(), str.end()); }
virtual void flush()
{
_str.clear();
_propertyName.clear();
_markName.clear();
}
std::string _str;
std::string _propertyName;
std::string _markName;
};
///////////////////////////////////////////////////////////////////
//
// PropertyInputIterator enables the set of class properties
//
class OSGDB_EXPORT PropertyInputIterator : public osgDB::InputIterator
{
public:
PropertyInputIterator():
_sstream(std::stringstream::binary),
_bufferData(0),
_currentPtr(0),
_bufferSize(0)
{
setStream(&_sstream);
}
virtual ~PropertyInputIterator()
{
if (_bufferData) delete [] _bufferData;
setStream(0);
}
virtual bool isBinary() const { return true; }
template<typename T>
void read(T& value)
{
memcpy(reinterpret_cast<char*>(&value), _currentPtr, sizeof(T));
_currentPtr += sizeof(T);
}
virtual void readBool( bool& b ) { char c; read(c); b = (c!=0); }
virtual void readChar( char& c ) { read(c); }
virtual void readSChar( signed char& c ) { read(c); }
virtual void readUChar( unsigned char& c ) { read(c); }
virtual void readShort( short& s ) { read(s); }
virtual void readUShort( unsigned short& s ) { read(s); }
virtual void readInt( int& i ) { read(i); }
virtual void readUInt( unsigned int& i ) { read(i);}
virtual void readLong( long& l ) { read(l); }
virtual void readULong( unsigned long& l ) { read(l); }
virtual void readFloat( float& f ) { read(f); }
virtual void readDouble( double& d ) { read(d); }
virtual void readString( std::string& s ) { s = std::string(_bufferData, _bufferSize); }
virtual void readStream( std::istream& (*)(std::istream&) ) {}
virtual void readBase( std::ios_base& (*)(std::ios_base&) ) {}
virtual void readGLenum( ObjectGLenum& value ) { readUInt(value._value); }
virtual void readProperty( ObjectProperty& ) {}
virtual void readMark( ObjectMark&) {}
virtual void readCharArray( char* s, unsigned int size ) { if ( size>0 ) _in->read( s, size ); }
virtual void readWrappedString( std::string& str ) { readString(str); }
virtual bool matchString( const std::string& /*str*/ ) { return false; }
template<typename T>
void set(const T& value)
{
if (_bufferData) delete [] _bufferData;
_bufferData = new char[sizeof(T)];
_bufferSize = sizeof(T);
_currentPtr = _bufferData;
memcpy(_bufferData, reinterpret_cast<const char*>(&value), sizeof(T));
}
void set(const void* ptr, unsigned int valueSize)
{
if (_bufferData) delete [] _bufferData;
_bufferData = new char[valueSize];
_currentPtr = _bufferData;
_bufferSize = valueSize;
memcpy(_bufferData, reinterpret_cast<const char*>(ptr), valueSize);
}
std::stringstream _sstream;
char* _bufferData;
char* _currentPtr;
unsigned int _bufferSize;
};
////////////////////////////////////////////////////////////////////////////////////////////////////////////
//
// ClassInterface class provides a generic mechanism for get/setting class properties using the osgDB serializers
//
ClassInterface::ClassInterface():
_outputStream(0),
_inputStream(0)
{
_poi = new PropertyOutputIterator;
_outputStream.setOutputIterator(_poi);
_pii = new PropertyInputIterator;
_inputStream.setInputIterator(_pii);
// initialize the type maps
#define TYPENAME(A) \
_typeToTypeNameMap[osgDB::BaseSerializer::RW_##A] = #A; \
_typeNameToTypeMap[#A] = osgDB::BaseSerializer::RW_##A;
TYPENAME(UNDEFINED)
TYPENAME(USER)
TYPENAME(OBJECT)
TYPENAME(IMAGE)
TYPENAME(LIST)
TYPENAME(BOOL)
TYPENAME(CHAR)
TYPENAME(UCHAR)
TYPENAME(SHORT)
TYPENAME(USHORT)
TYPENAME(INT)
TYPENAME(UINT)
TYPENAME(FLOAT)
TYPENAME(DOUBLE)
TYPENAME(VEC2F)
TYPENAME(VEC2D)
TYPENAME(VEC3F)
TYPENAME(VEC3D)
TYPENAME(VEC4F)
TYPENAME(VEC4D)
TYPENAME(QUAT)
TYPENAME(PLANE)
TYPENAME(MATRIXF)
TYPENAME(MATRIXD)
TYPENAME(MATRIX)
TYPENAME(BOUNDINGBOXF)
TYPENAME(BOUNDINGBOXD)
TYPENAME(BOUNDINGSPHEREF)
TYPENAME(BOUNDINGSPHERED)
TYPENAME(GLENUM)
TYPENAME(STRING)
TYPENAME(ENUM)
TYPENAME(VEC2B)
TYPENAME(VEC2UB)
TYPENAME(VEC2S)
TYPENAME(VEC2US)
TYPENAME(VEC2I)
TYPENAME(VEC2UI)
TYPENAME(VEC3B)
TYPENAME(VEC3UB)
TYPENAME(VEC3S)
TYPENAME(VEC3US)
TYPENAME(VEC3I)
TYPENAME(VEC3UI)
TYPENAME(VEC4B)
TYPENAME(VEC4UB)
TYPENAME(VEC4S)
TYPENAME(VEC4US)
TYPENAME(VEC4I)
TYPENAME(VEC4UI)
TYPENAME(LIST)
TYPENAME(VECTOR)
TYPENAME(MAP)
}
bool ClassInterface::areTypesCompatible(osgDB::BaseSerializer::Type lhs, osgDB::BaseSerializer::Type rhs) const
{
if (lhs==rhs) return true;
#ifdef OSG_USE_FLOAT_MATRIX
if (lhs==osgDB::BaseSerializer::RW_MATRIX) lhs = osgDB::BaseSerializer::RW_MATRIXF;
if (rhs==osgDB::BaseSerializer::RW_MATRIX) rhs = osgDB::BaseSerializer::RW_MATRIXF;
#else
if (lhs==osgDB::BaseSerializer::RW_MATRIX) lhs = osgDB::BaseSerializer::RW_MATRIXD;
if (rhs==osgDB::BaseSerializer::RW_MATRIX) rhs = osgDB::BaseSerializer::RW_MATRIXD;
#endif
if (lhs==osgDB::BaseSerializer::RW_GLENUM) lhs = osgDB::BaseSerializer::RW_UINT;
if (rhs==osgDB::BaseSerializer::RW_GLENUM) rhs = osgDB::BaseSerializer::RW_UINT;
if (lhs==osgDB::BaseSerializer::RW_ENUM) lhs = osgDB::BaseSerializer::RW_INT;
if (rhs==osgDB::BaseSerializer::RW_ENUM) rhs = osgDB::BaseSerializer::RW_INT;
if (lhs==osgDB::BaseSerializer::RW_IMAGE) lhs = osgDB::BaseSerializer::RW_OBJECT;
return lhs==rhs;
}
std::string ClassInterface::getTypeName(osgDB::BaseSerializer::Type type) const
{
TypeToTypeNameMap::const_iterator itr = _typeToTypeNameMap.find(type);
if (itr != _typeToTypeNameMap.end()) return itr->second;
else return std::string();
}
osgDB::BaseSerializer::Type ClassInterface::getType(const std::string& typeName) const
{
TypeNameToTypeMap::const_iterator itr = _typeNameToTypeMap.find(typeName);
if (itr != _typeNameToTypeMap.end()) return itr->second;
else return osgDB::BaseSerializer::RW_UNDEFINED;
}
osgDB::ObjectWrapper* ClassInterface::getObjectWrapper(const osg::Object* object) const
{
return osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(object->getCompoundClassName());
}
osgDB::BaseSerializer* ClassInterface::getSerializer(const osg::Object* object, const std::string& propertyName, osgDB::BaseSerializer::Type& type) const
{
osgDB::ObjectWrapper* ow = getObjectWrapper(object);
return (ow!=0) ? ow->getSerializer(propertyName, type) : 0;
}
osg::Object* ClassInterface::createObject(const std::string& compoundClassName) const
{
osgDB::ObjectWrapper* ow = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(compoundClassName);
if (ow)
{
osg::Object* object = ow->createInstance();
// OSG_NOTICE<<"ClassInterface::createObject("<<compoundClassName<<"), wrapper found, created object="<<object<<std::endl;
return object;
}
else
{
OSG_NOTICE<<"ClassInterface::createObject("<<compoundClassName<<"), No object wrapper available."<<std::endl;
return 0;
}
// return (ow!=0) ? ow->createInstance() : 0;
}
bool ClassInterface::copyPropertyDataFromObject(const osg::Object* object, const std::string& propertyName, void* valuePtr, unsigned int valueSize, osgDB::BaseSerializer::Type valueType)
{
_poi->flush();
osgDB::BaseSerializer::Type sourceType;
osgDB::BaseSerializer* serializer = getSerializer(object, propertyName, sourceType);
if (!serializer) return false;
if (!areTypesCompatible(sourceType, valueType))
{
OSG_NOTICE<<"ClassInterface::copyPropertyDataFromObject() Types are not compatible, valueType = "<<valueType<<", sourceType="<<sourceType<<std::endl;
return false;
}
if (serializer->write(_outputStream, *object))
{
unsigned int sourceSize = _poi->_str.size();
if (valueType==osgDB::BaseSerializer::RW_STRING)
{
std::string* string_ptr = reinterpret_cast<std::string*>(valuePtr);
(*string_ptr) = _poi->_str;
return true;
}
else if (sourceSize==valueSize)
{
memcpy(valuePtr, &(_poi->_str[0]), valueSize);
return true;
}
else
{
OSG_NOTICE<<"ClassInterface::copyPropertyDataFromObject() Sizes not compatible, sourceSize = "<<sourceSize<<" valueSize = "<<valueSize<<std::endl;
return false;
}
}
else
{
OSG_INFO<<"ClassInterface::copyPropertyDataFromObject() serializer write failed."<<std::endl;
return false;
}
}
bool ClassInterface::copyPropertyDataToObject(osg::Object* object, const std::string& propertyName, const void* valuePtr, unsigned int valueSize, osgDB::BaseSerializer::Type valueType)
{
// copy data to PropertyInputIterator
if (valueType==osgDB::BaseSerializer::RW_STRING)
{
const std::string* string_ptr = reinterpret_cast<const std::string*>(valuePtr);
_pii->set(&((*string_ptr)[0]), string_ptr->size());
}
else
{
_pii->set(valuePtr, valueSize);
}
osgDB::BaseSerializer::Type destinationType;
osgDB::BaseSerializer* serializer = getSerializer(object, propertyName, destinationType);
if (serializer)
{
if (areTypesCompatible(valueType, destinationType))
{
return serializer->read(_inputStream, *object);
}
else
{
OSG_NOTICE<<"ClassInterface::copyPropertyDataToObject() Types are not compatible, valueType = "<<valueType<<" ["<<getTypeName(valueType)<<"] , destinationType="<<destinationType<<" ["<<getTypeName(destinationType)<<"]"<<std::endl;
return false;
}
}
else
{
OSG_INFO<<"ClassInterface::copyPropertyDataFromObject() no serializer available."<<std::endl;
return false;
}
}
bool ClassInterface::copyPropertyObjectFromObject(const osg::Object* object, const std::string& propertyName, void* valuePtr, unsigned int /*valueSize*/, osgDB::BaseSerializer::Type valueType)
{
osgDB::BaseSerializer::Type sourceType;
osgDB::BaseSerializer* serializer = getSerializer(object, propertyName, sourceType);
if (serializer)
{
if (areTypesCompatible(sourceType, valueType))
{
return serializer->get(*object, valuePtr);
}
else
{
OSG_NOTICE<<"ClassInterface::copyPropertyObjectFromObject() Types are not compatible, valueType = "<<valueType<<" ["<<getTypeName(valueType)<<"] , sourceType="<<sourceType<<" ["<<getTypeName(sourceType)<<"]"<<std::endl;
return false;
}
}
else
{
OSG_INFO<<"ClassInterface::copyPropertyObjectFromObject() no serializer available."<<std::endl;
return false;
}
}
bool ClassInterface::copyPropertyObjectToObject(osg::Object* object, const std::string& propertyName, const void* valuePtr, unsigned int /*valueSize*/, osgDB::BaseSerializer::Type valueType)
{
osgDB::BaseSerializer::Type destinationType;
osgDB::BaseSerializer* serializer = getSerializer(object, propertyName, destinationType);
if (serializer)
{
if (areTypesCompatible(valueType, destinationType))
{
return serializer->set(*object, const_cast<void*>(valuePtr));
}
else
{
OSG_NOTICE<<"ClassInterface::copyPropertyObjectToObject() Types are not compatible, valueType = "<<valueType<<", destinationType="<<destinationType<<std::endl;
return false;
}
}
else
{
OSG_INFO<<"ClassInterface::copyPropertyObjectToObject() no serializer available."<<std::endl;
return false;
}
}
class GetPropertyType : public osg::ValueObject::GetValueVisitor
{
public:
GetPropertyType(): type(osgDB::BaseSerializer::RW_UNDEFINED) {}
osgDB::BaseSerializer::Type type;
virtual void apply(bool /*value*/) { type = osgDB::BaseSerializer::RW_BOOL; }
virtual void apply(char /*value*/) { type = osgDB::BaseSerializer::RW_CHAR; }
virtual void apply(unsigned char /*value*/) { type = osgDB::BaseSerializer::RW_UCHAR; }
virtual void apply(short /*value*/) { type = osgDB::BaseSerializer::RW_SHORT; }
virtual void apply(unsigned short /*value*/) { type = osgDB::BaseSerializer::RW_USHORT; }
virtual void apply(int /*value*/) { type = osgDB::BaseSerializer::RW_INT; }
virtual void apply(unsigned int /*value*/) { type = osgDB::BaseSerializer::RW_UINT; }
virtual void apply(float /*value*/) { type = osgDB::BaseSerializer::RW_FLOAT; }
virtual void apply(double /*value*/) { type = osgDB::BaseSerializer::RW_DOUBLE; }
virtual void apply(const std::string& /*value*/) { type = osgDB::BaseSerializer::RW_STRING; }
virtual void apply(const osg::Vec2f& /*value*/) { type = osgDB::BaseSerializer::RW_VEC2F; }
virtual void apply(const osg::Vec3f& /*value*/) { type = osgDB::BaseSerializer::RW_VEC3F; }
virtual void apply(const osg::Vec4f& /*value*/) { type = osgDB::BaseSerializer::RW_VEC4F; }
virtual void apply(const osg::Vec2d& /*value*/) { type = osgDB::BaseSerializer::RW_VEC2D; }
virtual void apply(const osg::Vec3d& /*value*/) { type = osgDB::BaseSerializer::RW_VEC3D; }
virtual void apply(const osg::Vec4d& /*value*/) { type = osgDB::BaseSerializer::RW_VEC4D; }
virtual void apply(const osg::Quat& /*value*/) { type = osgDB::BaseSerializer::RW_QUAT; }
virtual void apply(const osg::Plane& /*value*/) { type = osgDB::BaseSerializer::RW_PLANE; }
virtual void apply(const osg::Matrixf& /*value*/) { type = osgDB::BaseSerializer::RW_MATRIXF; }
virtual void apply(const osg::Matrixd& /*value*/) { type = osgDB::BaseSerializer::RW_MATRIXD; }
virtual void apply(const osg::BoundingBoxf& /*value*/) { type = osgDB::BaseSerializer::RW_BOUNDINGBOXF; }
virtual void apply(const osg::BoundingBoxd& /*value*/) { type = osgDB::BaseSerializer::RW_BOUNDINGBOXD; }
virtual void apply(const osg::BoundingSpheref& /*value*/) { type = osgDB::BaseSerializer::RW_BOUNDINGSPHEREF; }
virtual void apply(const osg::BoundingSphered& /*value*/) { type = osgDB::BaseSerializer::RW_BOUNDINGSPHERED; }
};
bool ClassInterface::getPropertyType(const osg::Object* object, const std::string& propertyName, osgDB::BaseSerializer::Type& type) const
{
if (getSerializer(object, propertyName, type)!=0) return true;
const osg::UserDataContainer* udc = object->getUserDataContainer();
const osg::Object* userObject = udc ? udc->getUserObject(propertyName) : 0;
if (userObject)
{
const osg::ValueObject* valueObject = dynamic_cast<const osg::ValueObject*>(userObject);
if (valueObject)
{
GetPropertyType gpt;
valueObject->get(gpt);
type = gpt.type;
return gpt.type!=osgDB::BaseSerializer::RW_UNDEFINED;
}
}
return false;
}
bool ClassInterface::getSupportedProperties(const osg::Object* object, PropertyMap& properties, bool searchAssociates) const
{
osgDB::ObjectWrapper* ow = getObjectWrapper(object);
if (!ow)
{
return false;
}
std::string compoundClassName = object->getCompoundClassName();
ObjectPropertyMap::const_iterator wl_itr = _whiteList.find(compoundClassName);
if (wl_itr != _whiteList.end())
{
properties = wl_itr->second;
}
ObjectPropertyMap::const_iterator bl_itr = _blackList.find(compoundClassName);
if (searchAssociates)
{
const ObjectWrapper::RevisionAssociateList& associates = ow->getAssociates();
for(ObjectWrapper::RevisionAssociateList::const_iterator aitr = associates.begin();
aitr != associates.end();
++aitr)
{
osgDB::ObjectWrapper* associate_wrapper = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(aitr->_name);
if (associate_wrapper)
{
const osgDB::ObjectWrapper::SerializerList& associate_serializers = associate_wrapper->getSerializerList();
unsigned int i=0;
for(osgDB::ObjectWrapper::SerializerList::const_iterator sitr = associate_serializers.begin();
sitr != associate_serializers.end();
++sitr, ++i)
{
const std::string& propertyName = (*sitr)->getName();
bool notBlackListed = (bl_itr == _blackList.end()) || (bl_itr->second.count(propertyName)==0);
if (notBlackListed) properties[propertyName] = associate_wrapper->getTypeList()[i];
}
}
}
}
else
{
const osgDB::ObjectWrapper::SerializerList& serializers = ow->getSerializerList();
unsigned int i=0;
for(osgDB::ObjectWrapper::SerializerList::const_iterator itr = serializers.begin();
itr != serializers.end();
++itr, ++i)
{
const std::string& propertyName = (*itr)->getName();
bool notBlackListed = (bl_itr == _blackList.end()) || (bl_itr->second.count(propertyName)==0);
if (notBlackListed) properties[propertyName] = ow->getTypeList()[i];
}
}
return true;
}
bool ClassInterface::isObjectOfType(const osg::Object* object, const std::string& compoundClassName) const
{
if (!object) return false;
if (object->getCompoundClassName()==compoundClassName) return true;
osgDB::ObjectWrapper* ow = getObjectWrapper(object);
if (!ow)
{
return false;
}
const ObjectWrapper::RevisionAssociateList& associates = ow->getAssociates();
for(ObjectWrapper::RevisionAssociateList::const_iterator aitr = associates.begin();
aitr != associates.end();
++aitr)
{
if ((aitr->_name)==compoundClassName) return true;
}
return false;
}
bool ClassInterface::run(void* objectPtr, const std::string& compoundClassName, const std::string& methodName, osg::Parameters& inputParameters, osg::Parameters& outputParameters) const
{
ObjectWrapper* ow = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(compoundClassName);
if (!ow) return false;
const ObjectWrapper::MethodObjectMap& ow_methodObjectMap = ow->getMethodObjectMap();
for(ObjectWrapper::MethodObjectMap::const_iterator itr = ow_methodObjectMap.find(methodName);
(itr!=ow_methodObjectMap.end()) && (itr->first==methodName);
++itr)
{
MethodObject* mo = itr->second.get();
if (mo->run(objectPtr, inputParameters, outputParameters)) return true;
}
const ObjectWrapper::RevisionAssociateList& associates = ow->getAssociates();
for(ObjectWrapper::RevisionAssociateList::const_iterator aitr = associates.begin();
aitr != associates.end();
++aitr)
{
osgDB::ObjectWrapper* aow = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(aitr->_name);
if (aow)
{
const ObjectWrapper::MethodObjectMap& methodObjectMap = aow->getMethodObjectMap();
for(ObjectWrapper::MethodObjectMap::const_iterator itr = methodObjectMap.find(methodName);
(itr!=methodObjectMap.end()) && (itr->first==methodName);
++itr)
{
MethodObject* mo = itr->second.get();
if (mo->run(objectPtr, inputParameters, outputParameters)) return true;
}
}
}
return false;
}
bool ClassInterface::run(osg::Object* object, const std::string& methodName, osg::Parameters& inputParameters, osg::Parameters& outputParameters) const
{
return run(object, object->getCompoundClassName(), methodName, inputParameters, outputParameters);
}
bool ClassInterface::hasMethod(const std::string& compoundClassName, const std::string& methodName) const
{
ObjectWrapper* ow = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(compoundClassName);
if (!ow) return false;
const ObjectWrapper::MethodObjectMap& ow_methodObjectMap = ow->getMethodObjectMap();
ObjectWrapper::MethodObjectMap::const_iterator oitr = ow_methodObjectMap.find(methodName);
if (oitr!=ow_methodObjectMap.end()) return true;
const ObjectWrapper::RevisionAssociateList& associates = ow->getAssociates();
for(ObjectWrapper::RevisionAssociateList::const_iterator aitr = associates.begin();
aitr != associates.end();
++aitr)
{
osgDB::ObjectWrapper* aow = osgDB::Registry::instance()->getObjectWrapperManager()->findWrapper(aitr->_name);
if (aow)
{
const ObjectWrapper::MethodObjectMap& methodObjectMap = aow->getMethodObjectMap();
ObjectWrapper::MethodObjectMap::const_iterator itr = methodObjectMap.find(methodName);
if (itr!=methodObjectMap.end()) return true;
}
}
return false;
}
bool ClassInterface::hasMethod(const osg::Object* object, const std::string& methodName) const
{
return hasMethod(object->getCompoundClassName(), methodName);
}
} // end of osgDB namespace
| 37.677419 | 242 | 0.660144 | [
"object",
"vector"
] |
df0e48f56584c5ad2aba8f1459b590a3c7c44901 | 10,888 | cpp | C++ | src/gtest/utils.cpp | lanamineh/qsl | 7e339d2345297709ef817d78ae3a52a33b1c8614 | [
"Apache-2.0"
] | null | null | null | src/gtest/utils.cpp | lanamineh/qsl | 7e339d2345297709ef817d78ae3a52a33b1c8614 | [
"Apache-2.0"
] | null | null | null | src/gtest/utils.cpp | lanamineh/qsl | 7e339d2345297709ef817d78ae3a52a33b1c8614 | [
"Apache-2.0"
] | null | null | null | /*
* Authors: Lana Mineh and John Scott
* Copyright 2021 Phasecraft Ltd. and John Scott
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*
*/
/**
* \file utils.cpp
* \brief Contains tests for utility functions
*/
#include <gtest/gtest.h>
#include <qsl/utils.hpp>
#include <list>
#include <sstream>
#include <qsl/qubits.hpp>
/**
* \brief Typed test suite for the floating point utilities
*
* This test suite checks the utilities that depend on a floating
* point parameter for both float and double.
*/
template <typename T>
class FpUtilities : public testing::Test {
public:
using List = std::list<T>;
static T shared_;
T value_;
};
/// List of floating point types to check
using FpTypes = ::testing::Types<double, float>;
/**
* \brief Declare the test suite that depends on these types
*
* To use the test suite, write TYPED_TEST(FpUtilities...
* and then use TypeParam wherever you would use a type from the
* FpTypes list. The test suite will automatically be performed
* for every type in the list.
*
*/
TYPED_TEST_SUITE(FpUtilities, FpTypes);
/// Test the combinations function
TEST(Utilities, ChooseFunctionTest)
{
EXPECT_EQ(qsl::choose(1,1), 1);
EXPECT_EQ(qsl::choose(4,3), 4);
EXPECT_EQ(qsl::choose(10,3), 120);
EXPECT_EQ(qsl::choose(10,10), 1);
}
/// Test overloaded vector substraction function
TYPED_TEST(FpUtilities, VectorSubtraction)
{
const unsigned num_qubits{ 5 };
const std::vector<qsl::complex<TypeParam>> state1
= qsl::makeRandomState<TypeParam>(num_qubits);
const std::vector<qsl::complex<TypeParam>> state2
= qsl::makeRandomState<TypeParam>(num_qubits + 1);
// Cannot subtract vectors of different sizes
EXPECT_THROW(state1 - state2, std::logic_error);
}
/// Test the convertState function
TEST(Utilities, ConvertStateTest)
{
const unsigned num_qubits{ 5 };
// Make a random state of doubles
const std::vector<qsl::complex<double>> state_double
= qsl::makeRandomState<double>(num_qubits);
// Convert it to floats
const std::vector<qsl::complex<float>> state_float
= qsl::convertState<float>(state_double);
// Check the two states are equal by verifying all
double val = 0;
for (std::size_t n = 0; n < state_float.size(); n++) {
val += std::abs(state_double[n].real - state_float[n].real);
val += std::abs(state_double[n].imag - state_float[n].imag);
}
// What is a reasonable number to put here?
EXPECT_NEAR(val,0,1e-5);
}
/// Test the convertVector function
TEST(Utilities, ConvertVectorTest)
{
// Make a test vector
const std::vector<double> vec{ 1,3.2,3,4.9,3.2 };
const std::vector<float> copy{ qsl::convertVector<float>(vec) };
// Check that the two are equal
EXPECT_EQ(copy.size(), vec.size());
for (std::size_t n = 0; n < vec.size(); n++) {
EXPECT_FLOAT_EQ(vec[n], copy[n]);
}
}
/// Test the innerProduct function
TYPED_TEST(FpUtilities, InnerProductTest)
{
const std::vector<qsl::complex<TypeParam>> a{ {1,1.2}, {1.2,1}, {1,1.5} };
const std::vector<qsl::complex<TypeParam>> b{ {1,0}, {0,-1}, {-1,0} };
const std::vector<qsl::complex<TypeParam>> c{
{1.2,0}, {1.2,-2.1}, {1.3,2}, {0,0} };
// Check that inner product throws exception for different sized vectors
EXPECT_THROW(innerProduct(a,c), std::logic_error);
}
/// Test the checkStateSize function
TYPED_TEST(FpUtilities, CheckStateSizeTest)
{
// Not a valid state size, should throw exception
const std::vector<qsl::complex<TypeParam>> pretend_state{ {1,0}, {0,1}, {1,1} };
EXPECT_THROW(checkStateSize(pretend_state), std::logic_error);
// Check that the function returns the correct state size
const std::vector<qsl::complex<TypeParam>> state{
{1,0}, {0,1}, {1,0}, {0,1} };
EXPECT_EQ(checkStateSize(state), 2);
}
/// Test Fubini Study distance
TYPED_TEST(FpUtilities, FubiniStudyTest)
{
std::vector<qsl::complex<TypeParam>> a{ {1,0}, {0,1}, {1,1} };
std::vector<qsl::complex<TypeParam>> TypeParam_a{ {2,0}, {0,2}, {2,2} };
std::vector<qsl::complex<TypeParam>> b{ {1.3,2}, {1,1.3}, {1.5,0.2} };
std::vector<qsl::complex<TypeParam>> TypeParam_b{ {2.6,4}, {2,2.6}, {3,0.4} };
// Test that distance between equal and scaled vectors is zero
EXPECT_NEAR(fubiniStudy(a,a), 0, 1e-13);
EXPECT_NEAR(fubiniStudy(TypeParam_a,a), 0, 1e-13);
TypeParam distance_a_b = fubiniStudy(a,b);
TypeParam scaled_distance_a_b = fubiniStudy(a,TypeParam_b);
EXPECT_NEAR(std::abs(distance_a_b - scaled_distance_a_b), 0, 1e-13);
}
/// Simulator distances
TYPED_TEST(FpUtilities, FubiniStudySimulatorTest)
{
qsl::Qubits<qsl::Type::Default, TypeParam> q1{3};
qsl::Qubits<qsl::Type::Resize, TypeParam> q2{3};
// Test that distance between equal simulators is zero
EXPECT_NEAR(fubiniStudy(q1,q2), 0, 1e-13);
// Perform some gates
q1.rotateX(0, 1.2);
q1.rotateY(1, -0.3);
q1.rotateZ(2, 2.4);
// Check that the fubini-study distance for the simulators
// comes out the same as for the vectors
TypeParam a = fubiniStudy(q1,q2);
TypeParam b = fubiniStudy(q1.getState(),q2.getState());
EXPECT_NEAR(a, b, 1e-13);
}
/// Check the next (number with fixed number of ones) function
TEST(Utilities, NextFunctionTest)
{
std::size_t x{ 0b111 };
qsl::next(x);
EXPECT_EQ(x,0b1011);
qsl::next(x);
EXPECT_EQ(x,0b1101);
qsl::next(x);
EXPECT_EQ(x,0b1110);
qsl::next(x);
EXPECT_EQ(x,0b10011);
qsl::next(x);
EXPECT_EQ(x,0b10101);
qsl::next(x);
EXPECT_EQ(x,0b10110);
qsl::next(x);
EXPECT_EQ(x,0b11001);
qsl::next(x);
EXPECT_EQ(x,0b11010);
qsl::next(x);
EXPECT_EQ(x,0b11100);
}
/// Test the hamming weight function
TEST(Utilities, HammingWeightTest)
{
EXPECT_EQ(qsl::hammingWeight(0b11011010), 5);
EXPECT_EQ(qsl::hammingWeight(0b1010), 2);
EXPECT_EQ(qsl::hammingWeight(0b1), 1);
EXPECT_EQ(qsl::hammingWeight(0b0), 0);
}
/// Test the complex struct
TYPED_TEST(FpUtilities, ComplexStructTest)
{
// Check explicit assignment
qsl::complex<TypeParam> x0{ .real = 1, .imag = 3};
EXPECT_EQ(x0.real, 1);
EXPECT_EQ(x0.imag, 3);
// Check real,imag constructor
qsl::complex<TypeParam> x1{-1,4.5};
EXPECT_EQ(x1.real, -1);
EXPECT_EQ(x1.imag, 4.5);
// Check default constructor
qsl::complex<TypeParam> x2;
EXPECT_EQ(x2.real, 0);
EXPECT_EQ(x2.imag, 0);
// Check substraction
EXPECT_EQ((x0 - x1).real, 2);
EXPECT_EQ((x0 - x1).imag, -1.5);
}
/// Test absolute value function
TYPED_TEST(FpUtilities, AbsTest)
{
qsl::complex<TypeParam> x0;
EXPECT_FLOAT_EQ(qsl::abs(x0), 0);
qsl::complex<TypeParam> x1{1,0};
EXPECT_FLOAT_EQ(qsl::abs(x1), 1);
qsl::complex<TypeParam> x2{0,1};
EXPECT_FLOAT_EQ(qsl::abs(x2), 1);
qsl::complex<TypeParam> x3{0,-1};
EXPECT_FLOAT_EQ(qsl::abs(x3), 1);
qsl::complex<TypeParam> x4{1,-1};
EXPECT_FLOAT_EQ(qsl::abs(x4), std::sqrt(2));
}
/// Test the random number generator class
TYPED_TEST(FpUtilities, RandomClassTest)
{
// Check that a zero length range works
qsl::Random<TypeParam> rand{1.2,1.2};
EXPECT_FLOAT_EQ(rand.getNum(), 1.2);
///\todo How to check that the distribution is uniform and random?
}
/// Test the random state generator class
TYPED_TEST(FpUtilities, MakeRandomStateTest)
{
// Number of qubits
const unsigned nqubits{ 5 };
// Check that a zero length range works
std::vector<qsl::complex<TypeParam>> state{
qsl::makeRandomState<TypeParam>(nqubits)
};
// Check there are the correct number of elements
EXPECT_EQ(state.size(), 1 << nqubits);
// Check that the state is normalised
EXPECT_FLOAT_EQ(qsl::norm(state), 1);
}
/// Test the function which test for number-preserving states
TYPED_TEST(FpUtilities, CheckStateNPTest)
{
// Number-preserved state
std::vector<qsl::complex<TypeParam>> s0 {
{0,0}, {0,1}, {1,0}, {0,0}
};
qsl::normalise(s0);
EXPECT_EQ(checkStateNP(s0), 1);
// Edge-case no ones
std::vector<qsl::complex<TypeParam>> s1 {
{1,0}, {0,0}, {0,0}, {0,0}
};
qsl::normalise(s1);
EXPECT_EQ(checkStateNP(s1), 0);
// Edge-case all ones
std::vector<qsl::complex<TypeParam>> s2 {
{0,0}, {0,0}, {0,0}, {1,0}
};
qsl::normalise(s2);
EXPECT_EQ(checkStateNP(s2), 2);
// Non-number-preserved state
std::vector<qsl::complex<TypeParam>> s3 {
{1,0}, {0,1}, {1,0}, {0,0}
};
qsl::normalise(s3);
EXPECT_THROW(checkStateNP(s3), std::logic_error);
}
/// Test the random number-preserving state generator function
TYPED_TEST(FpUtilities, MakeRandomNPStateTest)
{
// Number of qubits
const unsigned nqubits{ 5 };
const unsigned nones{ 3 };
// Make a random number preserved state
std::vector<qsl::complex<TypeParam>> state{
qsl::makeRandomNPState<TypeParam>(nqubits, nones)
};
EXPECT_EQ(state.size(), 1 << nqubits); // Correct dimension
EXPECT_FLOAT_EQ(qsl::norm(state), 1); // Is normalised
EXPECT_EQ(checkStateNP(state), nones); // Correct number of ones
// Check that random number of ones variant
std::vector<qsl::complex<TypeParam>> state_random{
qsl::makeRandomNPState<TypeParam>(nqubits)
};
EXPECT_EQ(state_random.size(), 1 << nqubits); // Correct dimension
EXPECT_FLOAT_EQ(qsl::norm(state_random), 1); // Is normalised
EXPECT_LE(checkStateNP(state_random), nqubits); // Is NP and nones <= nqubits
}
/// Check the random phases function
TYPED_TEST(FpUtilities, RandomPhasesTest)
{
const std::size_t length{ 35 };
// Make a list of random phases
std::vector<TypeParam> phases{
qsl::makeRandomPhases<TypeParam>(length)
};
EXPECT_EQ(phases.size(), length); // Check correct length
for (std::size_t n = 0; n < length; n++) {
// Check elements are within the range -pi to pi
EXPECT_LE(phases[n], M_PI);
EXPECT_GE(phases[n], -M_PI);
}
}
/// Test overloaded vector printing
TEST(Utilities, VectorPrinting)
{
std::stringstream ss1, ss2;
std::vector<int> vec { 1,2,5,4,4 };
ss1 << vec;
// Check the correct thing is printed
ss2 << 1 << std::endl
<< 2 << std::endl
<< 5 << std::endl
<< 4 << std::endl
<< 4 << std::endl;
EXPECT_EQ(ss1.str(), ss2.str());
}
| 27.704835 | 84 | 0.660176 | [
"vector"
] |
df15ab4489ed5f9e1c49fb30fe52f8493512507f | 17,509 | hpp | C++ | src/mlpack/methods/cf/cf_impl.hpp | haritha1313/mlpack | 3b7bbf0f14172cdb00fd16cbf12918b07c888b96 | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | null | null | null | src/mlpack/methods/cf/cf_impl.hpp | haritha1313/mlpack | 3b7bbf0f14172cdb00fd16cbf12918b07c888b96 | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | null | null | null | src/mlpack/methods/cf/cf_impl.hpp | haritha1313/mlpack | 3b7bbf0f14172cdb00fd16cbf12918b07c888b96 | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | null | null | null | /**
* @file cf_impl.hpp
* @author Mudit Raj Gupta
* @author Sumedh Ghaisas
*
* Collaborative Filtering.
*
* Implementation of CF class to perform Collaborative Filtering on the
* specified data set.
*
* mlpack is free software; you may redistribute it and/or modify it under the
* terms of the 3-clause BSD license. You should have received a copy of the
* 3-clause BSD license along with mlpack. If not, see
* http://www.opensource.org/licenses/BSD-3-Clause for more information.
*/
#ifndef MLPACK_METHODS_CF_CF_IMPL_HPP
#define MLPACK_METHODS_CF_CF_IMPL_HPP
// In case it hasn't been included yet.
#include "cf.hpp"
namespace mlpack {
namespace cf {
// Default CF constructor.
template<typename NormalizationType>
CFType<NormalizationType>::CFType(const size_t numUsersForSimilarity,
const size_t rank) :
numUsersForSimilarity(numUsersForSimilarity),
rank(rank)
{
// Validate neighbourhood size.
if (numUsersForSimilarity < 1)
{
Log::Warn << "CFType::CFType(): neighbourhood size should be > 0 ("
<< numUsersForSimilarity << " given). Setting value to 5.\n";
// Set default value of 5.
this->numUsersForSimilarity = 5;
}
}
/**
* Construct the CF object using an instantiated decomposition policy.
*/
template<typename NormalizationType>
template<typename MatType, typename DecompositionPolicy>
CFType<NormalizationType>::CFType(const MatType& data,
DecompositionPolicy& decomposition,
const size_t numUsersForSimilarity,
const size_t rank,
const size_t maxIterations,
const double minResidue,
const bool mit) :
numUsersForSimilarity(numUsersForSimilarity),
rank(rank)
{
// Validate neighbourhood size.
if (numUsersForSimilarity < 1)
{
Log::Warn << "CFType::CFType(): neighbourhood size should be > 0 ("
<< numUsersForSimilarity << " given). Setting value to 5.\n";
// Set default value of 5.
this->numUsersForSimilarity = 5;
}
Train(data, decomposition, maxIterations, minResidue, mit);
}
// Train when data is given in dense matrix form.
template<typename NormalizationType>
template<typename DecompositionPolicy>
void CFType<NormalizationType>::Train(const arma::mat& data,
DecompositionPolicy& decomposition,
const size_t maxIterations,
const double minResidue,
const bool mit)
{
// Make a copy of data before performing normalization.
arma::mat normalizedData(data);
normalization.Normalize(normalizedData);
CleanData(normalizedData, cleanedData);
// Check if the user wanted us to choose a rank for them.
if (rank == 0)
{
// This is a simple heuristic that picks a rank based on the density of the
// dataset between 5 and 105.
const double density = (cleanedData.n_nonzero * 100.0) / cleanedData.n_elem;
const size_t rankEstimate = size_t(density) + 5;
// Set to heuristic value.
Log::Info << "No rank given for decomposition; using rank of "
<< rankEstimate << " calculated by density-based heuristic."
<< std::endl;
this->rank = rankEstimate;
}
// Decompose the data matrix (which is in coordinate list form) to user and
// data matrices.
Timer::Start("cf_factorization");
decomposition.Apply(normalizedData, cleanedData, rank, w,
h, maxIterations, minResidue, mit);
Timer::Stop("cf_factorization");
}
// Train when data is given as sparse matrix of user item table.
template<typename NormalizationType>
template<typename DecompositionPolicy>
void CFType<NormalizationType>::Train(const arma::sp_mat& data,
DecompositionPolicy& decomposition,
const size_t maxIterations,
const double minResidue,
const bool mit)
{
// data is not used in the following decomposition.Apply() method, so we only
// need to Normalize cleanedData.
cleanedData = data;
normalization.Normalize(cleanedData);
// Check if the user wanted us to choose a rank for them.
if (rank == 0)
{
// This is a simple heuristic that picks a rank based on the density of the
// dataset between 5 and 105.
const double density = (cleanedData.n_nonzero * 100.0) / cleanedData.n_elem;
const size_t rankEstimate = size_t(density) + 5;
// Set to heuristic value.
Log::Info << "No rank given for decomposition; using rank of "
<< rankEstimate << " calculated by density-based heuristic."
<< std::endl;
this->rank = rankEstimate;
}
// Decompose the data matrix (which is in coordinate list form) to user and
// data matrices.
Timer::Start("cf_factorization");
decomposition.Apply(data, cleanedData, rank, w,
h, maxIterations, minResidue, mit);
Timer::Stop("cf_factorization");
}
template<typename NormalizationType>
template<typename NeighborSearchPolicy, typename InterpolationPolicy>
void CFType<NormalizationType>::GetRecommendations(
const size_t numRecs,
arma::Mat<size_t>& recommendations)
{
// Generate list of users. Maybe it would be more efficient to pass an empty
// users list, and then have the other overload of GetRecommendations() assume
// that if users is empty, then recommendations should be generated for all
// users?
arma::Col<size_t> users = arma::linspace<arma::Col<size_t> >(0,
cleanedData.n_cols - 1, cleanedData.n_cols);
// Call the main overload for recommendations.
GetRecommendations<NeighborSearchPolicy,
InterpolationPolicy>(numRecs, recommendations, users);
}
template<typename NormalizationType>
template<typename NeighborSearchPolicy, typename InterpolationPolicy>
void CFType<NormalizationType>::GetRecommendations(
const size_t numRecs,
arma::Mat<size_t>& recommendations,
const arma::Col<size_t>& users)
{
// We want to avoid calculating the full rating matrix, so we will do nearest
// neighbor search only on the H matrix, using the observation that if the
// rating matrix X = W*H, then d(X.col(i), X.col(j)) = d(W H.col(i), W
// H.col(j)). This can be seen as nearest neighbor search on the H matrix
// with the Mahalanobis distance where M^{-1} = W^T W. So, we'll decompose
// M^{-1} = L L^T (the Cholesky decomposition), and then multiply H by L^T.
// Then we can perform nearest neighbor search.
arma::mat l = arma::chol(w.t() * w);
arma::mat stretchedH = l * h; // Due to the Armadillo API, l is L^T.
// Now, we will use the decomposed w and h matrices to estimate what the user
// would have rated items as, and then pick the best items.
// Temporarily store feature vector of queried users.
arma::mat query(stretchedH.n_rows, users.n_elem);
// Select feature vectors of queried users.
for (size_t i = 0; i < users.n_elem; i++)
query.col(i) = stretchedH.col(users(i));
// Temporary storage for neighborhood of the queried users.
arma::Mat<size_t> neighborhood;
// Calculate the neighborhood of the queried users. Note that the query user
// is part of the neighborhood---this is intentional. We want to use the
// weighted sum of both the query user and the local neighborhood of the
// query user.
// Calculate the neighborhood of the queried users.
NeighborSearchPolicy neighborSearch(stretchedH);
arma::mat similarities; // Resulting similarities.
neighborSearch.Search(
query, numUsersForSimilarity, neighborhood, similarities);
// Generate recommendations for each query user by finding the maximum numRecs
// elements in the ratings vector.
recommendations.set_size(numRecs, users.n_elem);
arma::mat values(numRecs, users.n_elem);
recommendations.fill(SIZE_MAX);
values.fill(DBL_MAX);
// Initialization of an InterpolationPolicy object should be put ahead of the
// following loop, because the initialization may takes a relatively long
// time and we don't want to repeat the initialization process in each loop.
InterpolationPolicy interpolation(cleanedData);
for (size_t i = 0; i < users.n_elem; i++)
{
// First, calculate the weighted sum of neighborhood values.
arma::vec ratings;
ratings.zeros(cleanedData.n_rows);
// Calculate interpolation weights.
arma::vec weights(numUsersForSimilarity);
interpolation.GetWeights(weights, w, h, users(i),
neighborhood.col(i), similarities.col(i), cleanedData);
for (size_t j = 0; j < neighborhood.n_rows; ++j)
ratings += weights(j) * (w * h.col(neighborhood(j, i)));
// Let's build the list of candidate recomendations for the given user.
// Default candidate: the smallest possible value and invalid item number.
const Candidate def = std::make_pair(-DBL_MAX, cleanedData.n_rows);
std::vector<Candidate> vect(numRecs, def);
typedef std::priority_queue<Candidate, std::vector<Candidate>, CandidateCmp>
CandidateList;
CandidateList pqueue(CandidateCmp(), std::move(vect));
// Look through the ratings column corresponding to the current user.
for (size_t j = 0; j < ratings.n_rows; ++j)
{
// Ensure that the user hasn't already rated the item.
// The algorithm omits rating of zero. Thus, when normalizing original
// ratings in Normalize(), if normalized rating equals zero, it is set
// to the smallest positive double value.
if (cleanedData(j, users(i)) != 0.0)
continue; // The user already rated the item.
// Is the estimated value better than the worst candidate?
// Denormalize rating before comparison.
double realRating = normalization.Denormalize(users(i), j, ratings[j]);
if (realRating > pqueue.top().first)
{
Candidate c = std::make_pair(realRating, j);
pqueue.pop();
pqueue.push(c);
}
}
for (size_t p = 1; p <= numRecs; p++)
{
recommendations(numRecs - p, i) = pqueue.top().second;
values(numRecs - p, i) = pqueue.top().first;
pqueue.pop();
}
// If we were not able to come up with enough recommendations, issue a
// warning.
if (recommendations(numRecs - 1, i) == def.second)
Log::Warn << "Could not provide " << numRecs << " recommendations "
<< "for user " << users(i) << " (not enough un-rated items)!"
<< std::endl;
}
}
// Predict the rating for a single user/item combination.
template<typename NormalizationType>
template<typename NeighborSearchPolicy, typename InterpolationPolicy>
double CFType<NormalizationType>::Predict(const size_t user,
const size_t item) const
{
// First, we need to find the nearest neighbors of the given user.
// We'll use the same technique as for GetRecommendations().
// We want to avoid calculating the full rating matrix, so we will do nearest
// neighbor search only on the H matrix, using the observation that if the
// rating matrix X = W*H, then d(X.col(i), X.col(j)) = d(W H.col(i), W
// H.col(j)). This can be seen as nearest neighbor search on the H matrix
// with the Mahalanobis distance where M^{-1} = W^T W. So, we'll decompose
// M^{-1} = L L^T (the Cholesky decomposition), and then multiply H by L^T.
// Then we can perform nearest neighbor search.
arma::mat l = arma::chol(w.t() * w);
arma::mat stretchedH = l * h; // Due to the Armadillo API, l is L^T.
// Now, we will use the decomposed w and h matrices to estimate what the user
// would have rated items as, and then pick the best items.
// Temporarily store feature vector of queried users.
arma::mat query = stretchedH.col(user);
// Temporary storage for neighborhood of the queried users.
arma::Mat<size_t> neighborhood;
// Calculate the neighborhood of the queried users.
NeighborSearchPolicy neighborSearch(stretchedH);
arma::mat similarities; // Resulting similarities.
neighborSearch.Search(
query, numUsersForSimilarity, neighborhood, similarities);
arma::vec weights(numUsersForSimilarity);
// Calculate interpolation weights.
InterpolationPolicy interpolation(cleanedData);
interpolation.GetWeights(weights, w, h, user,
neighborhood.col(0), similarities.col(0), cleanedData);
double rating = 0; // We'll take the weighted sum of neighborhood values.
for (size_t j = 0; j < neighborhood.n_rows; ++j)
{
rating += weights(j) *
arma::as_scalar(w.row(item) * h.col(neighborhood(j, 0)));
}
// Denormalize rating and return.
double realRating = normalization.Denormalize(user, item, rating);
return realRating;
}
// Predict the rating for a group of user/item combinations.
template<typename NormalizationType>
template<typename NeighborSearchPolicy, typename InterpolationPolicy>
void CFType<NormalizationType>::Predict(const arma::Mat<size_t>& combinations,
arma::vec& predictions) const
{
// First, for nearest neighbor search, stretch the H matrix.
arma::mat l = arma::chol(w.t() * w);
arma::mat stretchedH = l * h; // Due to the Armadillo API, l is L^T.
// Now, we must determine those query indices we need to find the nearest
// neighbors for. This is easiest if we just sort the combinations matrix.
arma::Mat<size_t> sortedCombinations(combinations.n_rows,
combinations.n_cols);
arma::uvec ordering = arma::sort_index(combinations.row(0).t());
for (size_t i = 0; i < ordering.n_elem; ++i)
sortedCombinations.col(i) = combinations.col(ordering[i]);
// Now, we have to get the list of unique users we will be searching for.
arma::Col<size_t> users = arma::unique(combinations.row(0).t());
// Assemble our query matrix from the stretchedH matrix.
arma::mat queries(stretchedH.n_rows, users.n_elem);
for (size_t i = 0; i < queries.n_cols; ++i)
queries.col(i) = stretchedH.col(users[i]);
// Temporary storage for neighborhood of the queried users.
arma::Mat<size_t> neighborhood;
// Now calculate the neighborhood of these users.
NeighborSearchPolicy neighborSearch(stretchedH);
arma::mat similarities; // Resulting similarities.
neighborSearch.Search(
queries, numUsersForSimilarity, neighborhood, similarities);
arma::mat weights(numUsersForSimilarity, users.n_elem);
// Calculate interpolation weights.
InterpolationPolicy interpolation(cleanedData);
for (size_t i = 0; i < users.n_elem; i++)
{
interpolation.GetWeights(weights.col(i), w, h, users[i],
neighborhood.col(i), similarities.col(i), cleanedData);
}
// Now that we have the neighborhoods we need, calculate the predictions.
predictions.set_size(combinations.n_cols);
size_t user = 0; // Cumulative user count, because we are doing it in order.
for (size_t i = 0; i < sortedCombinations.n_cols; ++i)
{
// Could this be made faster by calculating dot products for multiple items
// at once?
double rating = 0.0;
// Map the combination's user to the user ID used for kNN.
while (users[user] < sortedCombinations(0, i))
++user;
for (size_t j = 0; j < neighborhood.n_rows; ++j)
{
rating += weights(j, user) * arma::as_scalar(
w.row(sortedCombinations(1, i)) * h.col(neighborhood(j, user)));
}
predictions(ordering[i]) = rating;
}
// Denormalize ratings.
normalization.Denormalize(combinations, predictions);
}
template<typename NormalizationType>
void CFType<NormalizationType>::CleanData(const arma::mat& data,
arma::sp_mat& cleanedData)
{
// Generate list of locations for batch insert constructor for sparse
// matrices.
arma::umat locations(2, data.n_cols);
arma::vec values(data.n_cols);
for (size_t i = 0; i < data.n_cols; ++i)
{
// We have to transpose it because items are rows, and users are columns.
locations(1, i) = ((arma::uword) data(0, i));
locations(0, i) = ((arma::uword) data(1, i));
values(i) = data(2, i);
// The algorithm omits rating of zero. Thus, when normalizing original
// ratings in Normalize(), if normalized rating equals zero, it is set
// to the smallest positive double value.
if (values(i) == 0)
Log::Warn << "User rating of 0 ignored for user " << locations(1, i)
<< ", item " << locations(0, i) << "." << std::endl;
}
// Find maximum user and item IDs.
const size_t maxItemID = (size_t) max(locations.row(0)) + 1;
const size_t maxUserID = (size_t) max(locations.row(1)) + 1;
// Fill sparse matrix.
cleanedData = arma::sp_mat(locations, values, maxItemID, maxUserID);
}
//! Serialize the model.
template<typename NormalizationType>
template<typename Archive>
void CFType<NormalizationType>::serialize(Archive& ar,
const unsigned int /* version */)
{
// This model is simple; just serialize all the members. No special handling
// required.
ar & BOOST_SERIALIZATION_NVP(numUsersForSimilarity);
ar & BOOST_SERIALIZATION_NVP(rank);
ar & BOOST_SERIALIZATION_NVP(w);
ar & BOOST_SERIALIZATION_NVP(h);
ar & BOOST_SERIALIZATION_NVP(cleanedData);
ar & BOOST_SERIALIZATION_NVP(normalization);
}
} // namespace cf
} // namespace mlpack
#endif
| 38.736726 | 80 | 0.676452 | [
"object",
"vector",
"model"
] |
b30da183c33863e1e9310912377d4f07c843f3ed | 153 | cpp | C++ | ComputingTheLongestCommonPrefixArray/ComputingTheLongestCommonPrefixArray/CPPAppendix.cpp | TomoGudelj/Computing-the-longest-common-prefix | 6fd891f8c51ffa1057a1394d404d6ee9a7c50c0c | [
"MIT"
] | null | null | null | ComputingTheLongestCommonPrefixArray/ComputingTheLongestCommonPrefixArray/CPPAppendix.cpp | TomoGudelj/Computing-the-longest-common-prefix | 6fd891f8c51ffa1057a1394d404d6ee9a7c50c0c | [
"MIT"
] | null | null | null | ComputingTheLongestCommonPrefixArray/ComputingTheLongestCommonPrefixArray/CPPAppendix.cpp | TomoGudelj/Computing-the-longest-common-prefix | 6fd891f8c51ffa1057a1394d404d6ee9a7c50c0c | [
"MIT"
] | null | null | null | #include "CPPAppendix.h"
//template<typename T> int IndexOf(std::vector<T> &vec, T el)
//{
// return find(vec.begin(), vec.end(), el) - vec.begin();
//} | 25.5 | 61 | 0.627451 | [
"vector"
] |
b30e31765f18b51fa71206e8f4edcbd0c759f33e | 17,642 | hpp | C++ | include/PSkelMap.hpp | lapesd/PSkel-MPPA-Async | b508a114d7e8ece2214337c568fb15738c5077b1 | [
"BSD-3-Clause"
] | null | null | null | include/PSkelMap.hpp | lapesd/PSkel-MPPA-Async | b508a114d7e8ece2214337c568fb15738c5077b1 | [
"BSD-3-Clause"
] | null | null | null | include/PSkelMap.hpp | lapesd/PSkel-MPPA-Async | b508a114d7e8ece2214337c568fb15738c5077b1 | [
"BSD-3-Clause"
] | null | null | null | //-------------------------------------------------------------------------------
// Copyright (c) 2015, Alyson D. Pereira <alyson.deives@outlook.com>,
// Rodrigo C. O. Rocha <rcor.cs@gmail.com>
// All rights reserved.
//
// Redistribution and use in source and binary forms, with or without
// modification, are permitted provided that the following conditions are met:
//
// 1. Redistributions of source code must retain the above copyright notice, this
// list of conditions and the following disclaimer.
//
// 2. Redistributions in binary form must reproduce the above copyright notice,
// this list of conditions and the following disclaimer in the documentation
// and/or other materials provided with the distribution.
//
// 3. Neither the name of the copyright holder nor the names of its contributors
// may be used to endorse or promote products derived from this software without
// specific prior written permission.
//
// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
// AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
// IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE
// DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE
// FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
// DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR
// SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER
// CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY,
// OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
// OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
//-------------------------------------------------------------------------------
#ifndef PSKEL_MAP_HPP
#define PSKEL_MAP_HPP
#include <algorithm>
#include <cmath>
#ifdef PSKEL_TBB
#include <tbb/blocked_range.h>
#include <tbb/parallel_for.h>
#include <tbb/task_scheduler_init.h>
#endif
namespace PSkel{
#ifdef PSKEL_CUDA
//********************************************************************************************
// Kernels CUDA. Chama o kernel implementado pelo usuario
//********************************************************************************************
template<typename T1, class Args>
__global__ void mapCU(Array<T1> input,Array<T1> output,Args args);
template<typename T1, class Args>
__global__ void mapCU2D(Array2D<T1> input,Array2D<T1> output,Args args);
template<typename T1, class Args>
__global__ void mapCU3D(Array3D<T1> input,Array3D<T1> output,Args args);
//********************************************************************************************
// Kernels CUDA. Chama o kernel implementado pelo usuario
//********************************************************************************************
template<typename T1, class Args>
__global__ void mapCU(Array<T1> input,Array<T1> output, Args args){
size_t i = blockIdx.x*blockDim.x+threadIdx.x;
if(i<input.getWidth()){
mapKernel(input, output, args, i);
}
}
template<typename T1, class Args>
__global__ void mapCU2D(Array2D<T1> input,Array2D<T1> output,Args args){
size_t w = blockIdx.x*blockDim.x+threadIdx.x;
size_t h = blockIdx.y*blockDim.y+threadIdx.y;
if(w<input.getWidth() && h<input.getHeight()){
mapKernel(input, output, args, h, w);
}
}
template<typename T1, class Args>
__global__ void mapCU3D(Array3D<T1> input,Array3D<T1> output,Args args){
size_t w = blockIdx.x*blockDim.x+threadIdx.x;
size_t h = blockIdx.y*blockDim.y+threadIdx.y;
size_t d = blockIdx.z*blockDim.z+threadIdx.z;
if(w<input.getWidth() && h<input.getHeight() && d<input.getDepth()){
mapKernel(input, output, args, h, w,d);
}
}
#endif
//*******************************************************************************************
// Stencil Base
//*******************************************************************************************
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runSequential(){
this->runSeq(this->input, this->output);
}
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runCPU(size_t numThreads){
numThreads = (numThreads==0)?omp_get_num_procs():numThreads;
#ifdef PSKEL_TBB
this->runTBB(this->input, this->output, numThreads);
#else
this->runOpenMP(this->input, this->output, numThreads);
#endif
}
#ifdef PSKEL_CUDA
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runGPU(size_t blockSize){
if(blockSize==0){
int device;
cudaGetDevice(&device);
cudaDeviceProp deviceProperties;
cudaGetDeviceProperties(&deviceProperties, device);
blockSize = deviceProperties.warpSize;
}
input.deviceAlloc();
output.deviceAlloc();
input.copyToDevice();
this->runCUDA(this->input, this->output, blockSize);
output.copyToHost();
input.deviceFree();
output.deviceFree();
}
#endif
/*
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runHybrid(float GPUPartition, size_t GPUBlockSize, size_t numThreads){
if(GPUPartition==0.0){
runCPU(numThreads);
}else if(GPUPartition==1.0){
runGPU(GPUBlockSize);
}else{
Arrays inputSliceGPU;
Arrays outputSliceGPU;
Arrays inputSliceCPU;
Arrays outputSliceCPU;
if(input.getHeight()>1){
size_t GPUHeight = size_t(this->input.getHeight()*GPUPartition);
inputSliceGPU.hostSlice(this->input, 0, 0, 0, this->input.getWidth(), GPUHeight, this->input.getDepth());
outputSliceGPU.hostSlice(this->output, 0, 0, 0, this->output.getWidth(), GPUHeight, this->output.getDepth());
inputSliceCPU.hostSlice(this->input, 0, GPUHeight, 0, this->input.getWidth(), this->input.getHeight()-GPUHeight, this->input.getDepth());
outputSliceCPU.hostSlice(this->output, 0, GPUHeight, 0, this->output.getWidth(), this->output.getHeight()-GPUHeight, this->output.getDepth());
}else{
size_t GPUWidth= size_t(this->input.getWidth()*GPUPartition);
inputSliceGPU.hostSlice(this->input, 0, 0, 0, GPUWidth, this->input.getHeight(), this->input.getDepth());
outputSliceGPU.hostSlice(this->output, 0, 0, 0, GPUWidth, this->output.getHeight(), this->output.getDepth());
inputSliceCPU.hostSlice(this->input, GPUWidth, 0, 0, this->input.getWidth()-GPUWidth, this->input.getHeight(), this->input.getDepth());
outputSliceCPU.hostSlice(this->output, GPUWidth, 0, 0, this->output.getWidth()-GPUWidth, this->output.getHeight(), this->output.getDepth());
}
omp_set_num_threads(2);
#pragma omp parallel sections
{
#pragma omp section
{
inputSliceGPU.deviceAlloc();
inputSliceGPU.copyToDevice();
outputSliceGPU.deviceAlloc();
this->runCUDA(inputSliceGPU, outputSliceGPU, GPUBlockSize);
outputSliceGPU.copyToHost();
inputSliceGPU.deviceFree();
outputSliceGPU.deviceFree();
}
#pragma omp section
{
this->runTBB(inputSliceCPU, outputSliceCPU,numThreads);
}
}
}
}
*/
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runIterativeSequential(size_t iterations){
Arrays inputCopy;
inputCopy.hostClone(input);
for(size_t it = 0; it<iterations; it++){
if(it%2==0) this->runSeq(inputCopy, this->output);
else this->runSeq(this->output, inputCopy);
}
if((iterations%2)==0) output.hostMemCopy(inputCopy);
inputCopy.hostFree();
}
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runIterativeCPU(size_t iterations, size_t numThreads){
numThreads = (numThreads==0)?omp_get_num_procs():numThreads;
Arrays inputCopy;
inputCopy.hostClone(input);
for(size_t it = 0; it<iterations; it++){
if(it%2==0){
#ifdef PSKEL_TBB
this->runTBB(inputCopy, this->output, numThreads);
#else
this->runOpenMP(inputCopy, this->output, numThreads);
#endif
}else {
#ifdef PSKEL_TBB
this->runTBB(this->output, inputCopy, numThreads);
#else
this->runOpenMP(this->output, inputCopy, numThreads);
#endif
}
}
if((iterations%2)==0) output.hostMemCopy(inputCopy);
inputCopy.hostFree();
}
#ifdef PSKEL_CUDA
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runIterativeGPU(size_t iterations, size_t blockSize){
if(blockSize==0){
int device;
cudaGetDevice(&device);
cudaDeviceProp deviceProperties;
cudaGetDeviceProperties(&deviceProperties, device);
blockSize = deviceProperties.warpSize;
}
input.deviceAlloc();
input.copyToDevice();
output.deviceAlloc();
for(size_t it = 0; it<iterations; it++){
if((it%2)==0)
this->runCUDA(this->input, this->output, blockSize);
else this->runCUDA(this->output, this->input, blockSize);
}
if((iterations%2)==1)
output.copyToHost();
else output.copyFromDevice(input);
input.deviceFree();
output.deviceFree();
}
#endif
/*
template<class Arrays, class Args>
void MapBase<Arrays, Args>::runIterativeHybrid(size_t iterations, float GPUPartition, size_t GPUBlockSize, size_t numThreads){
if(GPUPartition==0.0){
runIterativeCPU(iterations, numThreads);
}else if(GPUPartition==1.0){
runIterativeGPU(iterations, GPUBlockSize);
}else{
Arrays inputSliceGPU;
Arrays outputSliceGPU;
Arrays inputSliceCPU;
Arrays outputSliceCPU;
if(input.getHeight()>1){
size_t GPUHeight = size_t(this->input.getHeight()*GPUPartition);
inputSliceGPU.hostSlice(this->input, 0, 0, 0, this->input.getWidth(), GPUHeight, this->input.getDepth());
outputSliceGPU.hostSlice(this->output, 0, 0, 0, this->output.getWidth(), GPUHeight, this->output.getDepth());
inputSliceCPU.hostSlice(this->input, 0, GPUHeight, 0, this->input.getWidth(), this->input.getHeight()-GPUHeight, this->input.getDepth());
outputSliceCPU.hostSlice(this->output, 0, GPUHeight, 0, this->output.getWidth(), this->output.getHeight()-GPUHeight, this->output.getDepth());
}else{
size_t GPUWidth= size_t(this->input.getWidth()*GPUPartition);
inputSliceGPU.hostSlice(this->input, 0, 0, 0, GPUWidth, this->input.getHeight(), this->input.getDepth());
outputSliceGPU.hostSlice(this->output, 0, 0, 0, GPUWidth, this->output.getHeight(), this->output.getDepth());
inputSliceCPU.hostSlice(this->input, GPUWidth, 0, 0, this->input.getWidth()-GPUWidth, this->input.getHeight(), this->input.getDepth());
outputSliceCPU.hostSlice(this->output, GPUWidth, 0, 0, this->output.getWidth()-GPUWidth, this->output.getHeight(), this->output.getDepth());
}
omp_set_num_threads(2);
#pragma omp parallel sections
{
#pragma omp section
{
inputSliceGPU.deviceAlloc();
inputSliceGPU.copyToDevice();
outputSliceGPU.deviceAlloc();
for(size_t it = 0; it<iterations; it++){
if((it%2)==0)
this->runCUDA(inputSliceGPU, outputSliceGPU, GPUBlockSize);
else this->runCUDA(outputSliceGPU, inputSliceGPU, GPUBlockSize);
}
//outputSliceGPU.copyToHost();
//outputSliceGPU.deviceFree();
}
#pragma omp section
{
Arrays inputCopy;
inputCopy.hostClone(inputSliceCPU);
for(size_t it = 0; it<iterations; it++){
if(it%2==0) this->runTBB(inputCopy, outputSliceCPU, numThreads);
else this->runTBB(outputSliceCPU, inputCopy, numThreads);
//std::swap(input,output);
}
if((iterations%2)==0) outputSliceCPU.hostMemCopy(inputCopy);
inputCopy.hostFree();
}
}
if((iterations%2)==1)
outputSliceGPU.copyToHost();
else outputSliceGPU.copyFromDevice(inputSliceGPU);
inputSliceGPU.deviceFree();
outputSliceGPU.deviceFree();
}
}
*/
//*******************************************************************************************
// Map 3D
//*******************************************************************************************
template<class Arrays, class Args>
Map3D<Arrays,Args>::Map3D(){}
template<class Arrays, class Args>
Map3D<Arrays,Args>::Map3D(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
#ifdef PSKEL_CUDA
template<class Arrays, class Args>
void Map3D<Arrays,Args>::runCUDA(Arrays in, Arrays out, size_t blockSize){
dim3 DimBlock(blockSize, blockSize, 1);
dim3 DimGrid((in.getWidth() - 1)/blockSize + 1, ((in.getHeight()) - 1)/blockSize + 1, in.getDepth());
mapCU3D<<<DimGrid, DimBlock>>>(in, out, this->args);
gpuErrchk( cudaPeekAtLastError() );
gpuErrchk( cudaDeviceSynchronize() );
}
#endif
template<class Arrays, class Args>
void Map3D<Arrays,Args>::runSeq(Arrays in, Arrays out){
for(int h = 0; h<in.getHeight(); ++h){
for(int w = 0; w<in.getWidth(); ++w){
for(int d = 0; d<in.getDepth(); ++d){
mapKernel(in, out, this->args, h, w,d);
}}}
}
template<class Arrays, class Args>
void Map3D<Arrays,Args>::runOpenMP(Arrays in, Arrays out, size_t numThreads){
omp_set_num_threads(numThreads);
#pragma omp parallel for
for(int h = 0; h<in.getHeight(); ++h){
for(int w = 0; w<in.getWidth(); ++w){
for(int d = 0; d<in.getDepth(); ++d){
mapKernel(in, out, this->args, h, w,d);
}}}
}
#ifdef PSKEL_TBB
template<class Arrays, class Args>
struct TBBMap3D{
Arrays input;
Arrays output;
Args args;
TBBMap3D(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
void operator()(tbb::blocked_range<int> r)const{
for(int h = r.begin(); h!=r.end(); h++){
for(int w = 0; w<this->input.getWidth(); ++w){
for(int d = 0; d<this->input.getDepth(); ++d){
mapKernel(this->input, this->output, this->args, h, w,d);
}}}
}
};
template<class Arrays, class Args>
void Map3D<Arrays, Args>::runTBB(Arrays in, Arrays out, size_t numThreads){
TBBMap3D<Arrays, Args> tbbmap(in, out, this->args);
tbb::task_scheduler_init init(numThreads);
tbb::parallel_for(tbb::blocked_range<int>(0, in.getHeight()), tbbmap);
}
#endif
//*******************************************************************************************
// Map 2D
//*******************************************************************************************
template<class Arrays, class Args>
Map2D<Arrays,Args>::Map2D(){}
template<class Arrays, class Args>
Map2D<Arrays,Args>::Map2D(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
#ifdef PSKEL_CUDA
template<class Arrays, class Args>
void Map2D<Arrays,Args>::runCUDA(Arrays in, Arrays out, size_t blockSize){
dim3 DimBlock(blockSize, blockSize, 1);
dim3 DimGrid((in.getWidth() - 1)/blockSize + 1, (in.getHeight() - 1)/blockSize + 1, 1);
mapCU2D<<<DimGrid, DimBlock>>>(in, out, this->args);
gpuErrchk( cudaPeekAtLastError() );
gpuErrchk( cudaDeviceSynchronize() );
//gpuErrchk( cudaGetLastError() );
}
#endif
template<class Arrays, class Args>
void Map2D<Arrays,Args>::runSeq(Arrays in, Arrays out){
for (int h = 0; h < in.getHeight(); h++){
for (int w = 0; w < in.getWidth(); w++){
mapKernel(in, out, this->args,h,w);
}}
}
template<class Arrays, class Args>
void Map2D<Arrays,Args>::runOpenMP(Arrays in, Arrays out, size_t numThreads){
omp_set_num_threads(numThreads);
#pragma omp parallel for
for (int h = 0; h < in.getHeight(); h++){
for (int w = 0; w < in.getWidth(); w++){
mapKernel(in, out, this->args,h,w);
}}
}
#ifdef PSKEL_TBB
template<class Arrays, class Args>
struct TBBMap2D{
Arrays input;
Arrays output;
Args args;
TBBMap2D(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
void operator()(tbb::blocked_range<int> r)const{
for (int h = r.begin(); h != r.end(); h++){
for (int w = 0; w < this->input.getWidth(); w++){
mapKernel(this->input, this->output, this->args,h,w);
}}
}
};
template<class Arrays, class Args>
void Map2D<Arrays, Args>::runTBB(Arrays in, Arrays out, size_t numThreads){
TBBMap2D<Arrays, Args> tbbmap(in, out, this->args);
tbb::task_scheduler_init init(numThreads);
tbb::parallel_for(tbb::blocked_range<int>(0, in.getHeight()), tbbmap);
}
#endif
//*******************************************************************************************
// Stencil 1D
//*******************************************************************************************
template<class Arrays, class Args>
Map<Arrays,Args>::Map(){}
template<class Arrays, class Args>
Map<Arrays,Args>::Map(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
#ifdef PSKEL_CUDA
template<class Arrays, class Args>
void Map<Arrays,Args>::runCUDA(Arrays in, Arrays out, size_t blockSize){
dim3 DimBlock(blockSize, 1, 1);
dim3 DimGrid((in.getWidth() - 1)/blockSize + 1,1,1);
mapCU<<<DimGrid, DimBlock>>>(in, out, this->args);
gpuErrchk( cudaPeekAtLastError() );
gpuErrchk( cudaDeviceSynchronize() );
}
#endif
template<class Arrays, class Args>
void Map<Arrays,Args>::runSeq(Arrays in, Arrays out){
for (int i = 0; i < in.getWidth(); i++){
mapKernel(in, out, this->args, i);
}
}
template<class Arrays, class Args>
void Map<Arrays,Args>::runOpenMP(Arrays in, Arrays out, size_t numThreads){
omp_set_num_threads(numThreads);
#pragma omp parallel for
for (int i = 0; i < in.getWidth(); i++){
mapKernel(in, out, this->args, i);
}
}
#ifdef PSKEL_TBB
template<class Arrays, class Args>
struct TBBMap{
Arrays input;
Arrays output;
Args args;
TBBMap(Arrays input, Arrays output, Args args){
this->input = input;
this->output = output;
this->args = args;
}
void operator()(tbb::blocked_range<int> r)const{
for (int i = r.begin(); i != r.end(); i++){
mapKernel(this->input, this->output, this->args, i);
}
}
};
template<class Arrays, class Args>
void Map<Arrays, Args>::runTBB(Arrays in, Arrays out, size_t numThreads){
TBBMap<Arrays, Args> tbbmap(in, out, this->args);
tbb::task_scheduler_init init(numThreads);
tbb::parallel_for(tbb::blocked_range<int>(0, in.getWidth()), tbbmap);
}
#endif
}//end namespace
#endif
| 33.349716 | 145 | 0.659846 | [
"3d"
] |
b310d2a537e02e3b3650a5f28d3bb6d3c252921b | 440 | cpp | C++ | cpp/alg_accumulate.cpp | PhilipDaniels/learn | cbacb52fd472b5c90b6c3890bb912cd3020905fc | [
"MIT"
] | null | null | null | cpp/alg_accumulate.cpp | PhilipDaniels/learn | cbacb52fd472b5c90b6c3890bb912cd3020905fc | [
"MIT"
] | null | null | null | cpp/alg_accumulate.cpp | PhilipDaniels/learn | cbacb52fd472b5c90b6c3890bb912cd3020905fc | [
"MIT"
] | null | null | null | #include <functional>
#include <iostream>
#include <numeric>
#include <vector>
using namespace std;
int main(int argc, char *argv[])
{
vector<int> src { 1, 2, 100, 200, 300 };
int sum = accumulate(src.begin(), src.end(), 0);
cout << "sum = " << sum << "\n";
int product = accumulate(src.begin(), src.end(),
1, multiplies<int>());
cout << "product = " << product << "\n";
return 0;
}
| 22 | 52 | 0.538636 | [
"vector"
] |
b311c46521558e2d14c951a9542f5475f98ad361 | 945 | cpp | C++ | LeetCode/C++/1008.cpp | maalolankannan1/HacktoberFest2021-1 | c23136d5aaabd198f5af60ad1b990a4788a40d51 | [
"Apache-2.0"
] | 11 | 2021-10-01T06:53:31.000Z | 2022-02-05T20:36:20.000Z | LeetCode/C++/1008.cpp | maalolankannan1/HacktoberFest2021-1 | c23136d5aaabd198f5af60ad1b990a4788a40d51 | [
"Apache-2.0"
] | 37 | 2021-10-01T06:54:01.000Z | 2021-10-20T18:02:31.000Z | LeetCode/C++/1008.cpp | maalolankannan1/HacktoberFest2021-1 | c23136d5aaabd198f5af60ad1b990a4788a40d51 | [
"Apache-2.0"
] | 110 | 2021-10-01T06:51:28.000Z | 2021-10-31T18:00:55.000Z | /**
* Definition for a binary tree node.
* struct TreeNode {
* int val;
* TreeNode *left;
* TreeNode *right;
* TreeNode() : val(0), left(nullptr), right(nullptr) {}
* TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}
* TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}
* };
*/
class Solution
{
public:
TreeNode *bst(TreeNode *&root, int value)
{
if (root == NULL)
{
return root = new TreeNode(value);
cout << "yes ";
}
if (root->val > value)
{
root->left = bst(root->left, value);
}
else
{
root->right = bst(root->right, value);
}
return root;
}
TreeNode *bstFromPreorder(vector<int> &preorder)
{
TreeNode *root = NULL;
int n = preorder.size();
for (auto x : preorder)
{
bst(root, x);
}
return root;
}
}; | 21.477273 | 93 | 0.511111 | [
"vector"
] |
b31213562c97ce2974cc450e33ba0af715fd4e12 | 2,542 | cpp | C++ | solutions/LeetCode/C++/676.cpp | timxor/leetcode-journal | 5f1cb6bcc44a5bc33d88fb5cdb4126dfc6f4232a | [
"MIT"
] | 854 | 2018-11-09T08:06:16.000Z | 2022-03-31T06:05:53.000Z | solutions/LeetCode/C++/676.cpp | timxor/leetcode-journal | 5f1cb6bcc44a5bc33d88fb5cdb4126dfc6f4232a | [
"MIT"
] | 29 | 2019-06-02T05:02:25.000Z | 2021-11-15T04:09:37.000Z | solutions/LeetCode/C++/676.cpp | timxor/leetcode-journal | 5f1cb6bcc44a5bc33d88fb5cdb4126dfc6f4232a | [
"MIT"
] | 347 | 2018-12-23T01:57:37.000Z | 2022-03-12T14:51:21.000Z | __________________________________________________________________________________________________
sample 4 ms submission
class MagicDictionary {
public:
/** Initialize your data structure here. */
MagicDictionary() {
}
/** Build a dictionary through a list of words */
void buildDict(vector<string> dict) {
for (const string& word : dict) {
words_.insert(word);
for (int i = 0; i < word.size(); i++) {
string w = word;
w[i] = '*';
count_[w]++;
}
}
}
/** Returns if there is any word in the trie that equals to the given word after modifying exactly one character */
bool search(string word) {
for (int i = 0; i < word.size(); i++) {
char c = word[i];
string w = word;
w[i] = '*';
if ((count_[w] > 1) || (count_[w] == 1 && !words_.count(word))) {
return true;
}
}
return false;
}
private:
set<string> words_;
map<string, int> count_;
};
__________________________________________________________________________________________________
sample 9048 kb submission
set<string> Set;
class MagicDictionary {
public:
/** Initialize your data structure here. */
MagicDictionary() {
Set.clear();
}
/** Build a dictionary through a list of words */
void buildDict(vector<string> dict) {
for(int i=0;i<dict.size();i++)
Set.insert(dict[i]);
}
/** Returns if there is any word in the trie that equals to the given word after modifying exactly one character */
bool search(string word) {
string str;
set<string>::iterator it ;
for(it=Set.begin();it !=Set.end();it++)
{
int mismatch = 0;
str = *it;
if(str.length() == word.length())
{
for(int j=0;j<word.length();j++)
{
if(str[j] != word[j])
{
mismatch++;
}
}
if(mismatch == 1)
return true;
}
}
return false;
}
};
/**
* Your MagicDictionary object will be instantiated and called as such:
* MagicDictionary obj = new MagicDictionary();
* obj.buildDict(dict);
* bool param_2 = obj.search(word);
*/
__________________________________________________________________________________________________
| 28.244444 | 119 | 0.543666 | [
"object",
"vector"
] |
b3267ffddda58e08d4d794c33dba51d6efe12a5e | 696 | cpp | C++ | Aizu/SumOfIntegers2.cpp | aajjbb/contest-files | b8842681b96017063a7baeac52ae1318bf59d74d | [
"Apache-2.0"
] | 1 | 2018-08-28T19:58:40.000Z | 2018-08-28T19:58:40.000Z | Aizu/SumOfIntegers2.cpp | aajjbb/contest-files | b8842681b96017063a7baeac52ae1318bf59d74d | [
"Apache-2.0"
] | 2 | 2017-04-16T00:48:05.000Z | 2017-08-03T20:12:26.000Z | Aizu/SumOfIntegers2.cpp | aajjbb/contest-files | b8842681b96017063a7baeac52ae1318bf59d74d | [
"Apache-2.0"
] | 4 | 2016-03-04T19:42:00.000Z | 2018-01-08T11:42:00.000Z | #include <iostream>
#include <vector>
#include <stdio.h>
#include <string.h>
using namespace std;
int N, S, ans, dp[100][100][100];
void rec(int base, int x, int used) {
if(x == S && used == N) {
if(!dp[base][x][used]) {
dp[base][x][used] = 1;
ans += 1;
}
return;
}
dp[base][x][used] = 1;
if(x > S) return;
for(int i = base; i <= 9; i++) {
rec(i + 1, x + i, used + 1);
}
}
int main(void) {
while(1) {
scanf("%d%d", &N, &S);
if(N == 0 && S == 0) break;
ans = 0;
memset(dp, 0, sizeof(dp));
rec(0, 0, 0);
printf("%d\n", ans);
}
return 0;
}
| 19.333333 | 37 | 0.416667 | [
"vector"
] |
b32bd044bc2d8afa67365debfe2e620c224bae5c | 16,222 | cxx | C++ | Widgets/vtkKWEPaintbrushShapeBox.cxx | wuzhuobin/vtkEdge | ed13af68a72cec79e3645f7e842d6074592abfa2 | [
"BSD-3-Clause"
] | 1 | 2021-01-09T16:06:14.000Z | 2021-01-09T16:06:14.000Z | Widgets/vtkKWEPaintbrushShapeBox.cxx | wuzhuobin/vtkEdge | ed13af68a72cec79e3645f7e842d6074592abfa2 | [
"BSD-3-Clause"
] | null | null | null | Widgets/vtkKWEPaintbrushShapeBox.cxx | wuzhuobin/vtkEdge | ed13af68a72cec79e3645f7e842d6074592abfa2 | [
"BSD-3-Clause"
] | null | null | null | //=============================================================================
// This file is part of VTKEdge. See vtkedge.org for more information.
//
// Copyright (c) 2010 Kitware, Inc.
//
// VTKEdge may be used under the terms of the BSD License
// Please see the file Copyright.txt in the root directory of
// VTKEdge for further information.
//
// Alternatively, you may see:
//
// http://www.vtkedge.org/vtkedge/project/license.html
//
//
// For custom extensions, consulting services, or training for
// this or any other Kitware supported open source project, please
// contact Kitware at sales@kitware.com.
//
//
//=============================================================================
#include "vtkKWEPaintbrushShapeBox.h"
#include "vtkObjectFactory.h"
#include "vtkPolyData.h"
#include "vtkImageStencilData.h"
#include "vtkImageData.h"
#include "vtkCubeSource.h"
#include "vtkPlane.h"
#include "vtkMath.h"
#define sign(x) ((x<0) ? (-1) : (1))
vtkCxxRevisionMacro(vtkKWEPaintbrushShapeBox, "$Revision: 3282 $");
vtkStandardNewMacro(vtkKWEPaintbrushShapeBox);
//----------------------------------------------------------------------
vtkKWEPaintbrushShapeBox::vtkKWEPaintbrushShapeBox()
{
this->Width[0] = 2.0;
this->Width[1] = 2.0;
this->Width[2] = 2.0;
}
//----------------------------------------------------------------------
vtkKWEPaintbrushShapeBox::~vtkKWEPaintbrushShapeBox()
{
}
//----------------------------------------------------------------------
vtkSmartPointer< vtkPolyData >
vtkKWEPaintbrushShapeBox::GetShapePolyData(
double *center, vtkPlane *plane)
{
if (plane == NULL)
{
// No Orientation specified. Return the whole Polydata. This is what will
// be rendered on the volume widget
vtkCubeSource * templateOutline = vtkCubeSource::New();
templateOutline->SetCenter( center );
templateOutline->SetXLength(this->Width[0]);
templateOutline->SetYLength(this->Width[1]);
templateOutline->SetZLength(this->Width[2]);
templateOutline->Update();
vtkSmartPointer< vtkPolyData > pd = templateOutline->GetOutput();
templateOutline->Delete();
return pd;
}
else
{
double normal[3], origin[3];
plane->GetNormal(normal);
plane->GetOrigin(origin);
// Fast handlers for axis aligned planes.
const double tolerance = 0.01;
if ((fabs(normal[0])-1.0) < tolerance && fabs(normal[1]) < tolerance &&
fabs(normal[2]) < tolerance)
{
if (fabs(origin[0] - center[0]) > this->Width[0]/2.0)
{
return NULL;
}
vtkSmartPointer< vtkPolyData > templateOutline
= vtkSmartPointer< vtkPolyData >::New();
templateOutline->Allocate(1, 1);
vtkPoints * points = vtkPoints::New();
points->InsertNextPoint( center[0],
center[1] - this->Width[1]/2.0,
center[2] - this->Width[2]/2.0);
points->InsertNextPoint( center[0],
center[1] - this->Width[1]/2.0,
center[2] + this->Width[2]/2.0);
points->InsertNextPoint( center[0],
center[1] + this->Width[1]/2.0,
center[2] + this->Width[2]/2.0);
points->InsertNextPoint( center[0],
center[1] + this->Width[1]/2.0,
center[2] - this->Width[2]/2.0);
templateOutline->SetPoints(points);
vtkIdType ptIds[4];
ptIds[0] = 0; ptIds[1] = 1; ptIds[2] = 2; ptIds[3] = 3;
templateOutline->InsertNextCell(VTK_QUAD, 4, ptIds);
points->Delete();
return templateOutline;
}
else if (fabs(normal[0]) < tolerance && (fabs(normal[1])-1.0) < tolerance &&
fabs(normal[2]) < tolerance)
{
if (fabs(origin[1] - center[1]) > this->Width[1]/2.0)
{
return NULL;
}
vtkSmartPointer< vtkPolyData > templateOutline
= vtkSmartPointer< vtkPolyData >::New();
templateOutline->Allocate(1, 1);
vtkPoints * points = vtkPoints::New();
points->InsertNextPoint( center[0] - this->Width[0]/2.0,
center[1],
center[2] - this->Width[2]/2.0);
points->InsertNextPoint( center[0] - this->Width[0]/2.0,
center[1],
center[2] + this->Width[2]/2.0);
points->InsertNextPoint( center[0] + this->Width[0]/2.0,
center[1],
center[2] + this->Width[2]/2.0);
points->InsertNextPoint( center[0] + this->Width[0]/2.0,
center[1],
center[2] - this->Width[2]/2.0);
templateOutline->SetPoints(points);
vtkIdType ptIds[4];
ptIds[0] = 0; ptIds[1] = 1; ptIds[2] = 2; ptIds[3] = 3;
templateOutline->InsertNextCell(VTK_QUAD, 4, ptIds);
points->Delete();
return templateOutline;
}
else if (fabs(normal[0]) < tolerance && fabs(normal[1]) < tolerance &&
(fabs(normal[2])-1.0) < tolerance)
{
if (fabs(origin[2] - center[2]) > this->Width[2]/2.0)
{
return NULL;
}
vtkSmartPointer< vtkPolyData > templateOutline
= vtkSmartPointer< vtkPolyData >::New();
templateOutline->Allocate(1, 1);
vtkPoints * points = vtkPoints::New();
points->InsertNextPoint( center[0] - this->Width[0]/2.0,
center[1] - this->Width[1]/2.0,
center[2]);
points->InsertNextPoint( center[0] - this->Width[0]/2.0,
center[1] + this->Width[1]/2.0,
center[2]);
points->InsertNextPoint( center[0] + this->Width[0]/2.0,
center[1] + this->Width[1]/2.0,
center[2]);
points->InsertNextPoint( center[0] + this->Width[0]/2.0,
center[1] - this->Width[1]/2.0,
center[2]);
templateOutline->SetPoints(points);
vtkIdType ptIds[4];
ptIds[0] = 0; ptIds[1] = 1; ptIds[2] = 2; ptIds[3] = 3;
templateOutline->InsertNextCell(VTK_QUAD, 4, ptIds);
points->Delete();
return templateOutline;
}
else
{
// TODO intersect cube with arbitrarily oriented plane and return polydata
vtkErrorMacro( << "Not yet supported" );
return NULL;
}
}
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::GetStencil(
vtkImageStencilData *stencilData, double p[3])
{
int extent[6];
this->GetExtent( extent, p );
stencilData->SetExtent(extent);
stencilData->SetSpacing(this->Spacing);
stencilData->SetOrigin(this->Origin);
stencilData->AllocateExtents();
for (int idz=extent[4]; idz<=extent[5]; idz++)
{
for (int idy = extent[2]; idy <= extent[3]; idy++)
{
stencilData->InsertNextExtent( extent[0], extent[1], idy, idz );
}
}
}
//----------------------------------------------------------------------
// This really returns the distance map from an ellipsoid of similar size
// as the cuboid.. Who the hell will use a box shaped rectangular image
// data anyway.. Its got singularities.. noone doing image processing
// for sure.. !!
template < class T >
int vtkKWEPaintbrushShapeBoxFillBuffer( vtkKWEPaintbrushShapeBox * self,
vtkImageData *imageData, T, int extent[6], double p[3] )
{
// Polarity of the shape
bool state = false;
if (self->GetPolarity() == vtkKWEPaintbrushEnums::Draw)
{
state = true;
}
const double r1square = 0.25 * self->GetWidth()[0]*self->GetWidth()[0];
const double r2square = 0.25 * self->GetWidth()[1]*self->GetWidth()[1];
const double r3square = 0.25 * self->GetWidth()[2]*self->GetWidth()[2];
double value;
for (int k= extent[4]; k<=extent[5]; k++)
{
for (int j= extent[2]; j<=extent[3]; j++)
{
for (int i= extent[0]; i<=extent[1]; i++)
{
T * np = static_cast< T* >(imageData->GetScalarPointer(i,j,k));
double px = (i *
self->GetSpacing()[0] + self->GetOrigin()[0]) - p[0];
double py = (j *
self->GetSpacing()[1] + self->GetOrigin()[1]) - p[1];
double pz = (k *
self->GetSpacing()[2] + self->GetOrigin()[2]) - p[2];
if ( (px*px/r1square + py*py/r2square + pz*pz/r3square) > 2.0 )
{
// Outside the ellipse
*np = static_cast< T >(0.0);
continue;
}
// Normalized distance of the point from the surface of the ellipse.
// This is 1.0 at the surface, 0.0 at the center, 2.0 at twice the
// distance from the surface...
double distance = sqrt(px*px/r1square + py*py/r2square + pz*pz/r3square);
if (state)
{
value = 255.0 - 127.5 * distance;
}
else
{
value = 127.5 * distance;
}
// clamp value
if( value < 1.0 )
{
value = 1.0;
}
else if( value > 254.0 )
{
value = 254.0;
}
*np = static_cast< T >(value);
}
}
}
return 1;
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::GetGrayscaleData(
vtkImageData *imageData, double p[3])
{
// Compute the extents of the an image centered about p.
int extent[6];
this->GetExtent( extent, p );
imageData->SetSpacing(this->Spacing);
imageData->SetOrigin(this->Origin);
imageData->SetExtent(extent);
imageData->SetScalarType(this->GetScalarType());
imageData->AllocateScalars();
switch (imageData->GetScalarType())
{
vtkTemplateMacro( vtkKWEPaintbrushShapeBoxFillBuffer(
this, imageData, static_cast< VTK_TT >(0), extent, p ));
}
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::SetWidth( double newWidthX, double newWidthY, double newWidthZ )
{
vtkDebugMacro(<< this->GetClassName() << " (" << this << "): setting Width to (" << newWidthX << "," << newWidthY << "," << newWidthZ << ")");
if ((this->Width[0] != newWidthX)||(this->Width[1] != newWidthY)||(this->Width[2] != newWidthZ))
{
this->Width[0] = (this->MaxWidth[0] < 0. || this->MaxWidth[0] > newWidthX)? newWidthX :this->MaxWidth[0];
this->Width[1] = (this->MaxWidth[1] < 0. || this->MaxWidth[1] > newWidthY)? newWidthY :this->MaxWidth[1];
this->Width[2] = (this->MaxWidth[2] < 0. || this->MaxWidth[2] > newWidthZ)? newWidthZ :this->MaxWidth[2];
this->Modified();
}
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::SetWidth( double newWidth[3] )
{
this->SetWidth( newWidth[0], newWidth[1], newWidth[2] );
}
//----------------------------------------------------------------------
int vtkKWEPaintbrushShapeBox::Resize(double d[3], int ResizeType)
{
// If the user specified a constraint on the resize type, use that,
// otherwise default to whatever the widget told us in the functions'
// argument.
const int resizeType = (this->ResizeConstraint ==
PaintbrushResizeUnConstrained) ? ResizeType : this->ResizeConstraint;
// Define a minimum size that the shape will take. The shape will not
// get smaller than this.
const double minSize = 0.5;
double newWidth[3] = { this->Width[0], this->Width[1], this->Width[2] };
if (resizeType == vtkKWEPaintbrushShape::PaintbrushResizeAnisotropic)
{
// non-isotropic resize. This will resize each axis according to the
// factor specified along each axis.
for (unsigned int i=0; i<3; i++)
{
if (d[i] > 0.0 || this->Width[i] > 0.5)
{
newWidth[i] *= (1+d[i]/10.0);
}
}
}
else
{
// Not an AnIsotropic resize.. This will resize each axis by the same
// factor. This factor will be the norm of the factor vector specified
// as the functions' argument
// Calculate the sign.. (grow or shrink)
unsigned int idx = 0;
double max = fabs(d[0]);
int signVal;
for (unsigned int i=1; i<3; i++)
{
if (fabs(d[i]) > max)
{
idx = i;
max = fabs(d[i]);
}
}
signVal = sign(d[idx]);
// The new size is ....
const double norm = vtkMath::Norm(d);
for (unsigned int i=0; i<3; i++)
{
newWidth[i] *= (1+(norm * signVal)/10.0);
}
}
// Handle special cases.
switch (resizeType)
{
case PaintbrushResize_XY:
newWidth[2] = this->Width[2];
break;
case PaintbrushResize_YZ:
newWidth[0] = this->Width[0];
break;
case PaintbrushResize_XZ:
newWidth[1] = this->Width[1];
break;
}
// Make sure we aren't smaller than the minimum
if (newWidth[0] < minSize ||
newWidth[1] < minSize ||
newWidth[2] < minSize)
{
return 0;
}
// Now change our size to the new size.
this->SetWidth( newWidth );
return 1;
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::DeepCopy(vtkKWEPaintbrushShape *s)
{
if (s == this)
{
return;
}
vtkKWEPaintbrushShapeBox *sb = vtkKWEPaintbrushShapeBox::SafeDownCast(s);
if (sb)
{
for (unsigned int i=0; i<3; i++)
{
this->Width[i] = sb->Width[i];
}
}
this->Superclass::DeepCopy(s);
this->Modified();
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::GetAnnotation(char *s)
{
sprintf(s, "(%0.3g,%0.3g,%0.3g)",
this->Width[0], this->Width[1], this->Width[2]);
}
//----------------------------------------------------------------------
int vtkKWEPaintbrushShapeBox::IsInside(double currPos[3], double worldPos[3])
{
for (unsigned int i=0; i<3; i++)
{
if (fabs(worldPos[i] - currPos[i]) > this->Width[i]/2.0)
{
return 0;
}
}
return 1;
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::GetExtent( int extent[6], double p[3] )
{
if (this->Representation == vtkKWEPaintbrushEnums::Grayscale)
{
for (int i=0; i< 3; i++)
{
// transition region based extension of width.
extent[2*i] = static_cast<int>((p[i] - this->Width[i]*
(0.5+1.0/2.0) - this->Origin[i])/
this->Spacing[i] + 0.5);
extent[2*i+1] = static_cast<int>((p[i] + this->Width[i]*
(0.5+1.0/2.0) - this->Origin[i])/
this->Spacing[i] - 0.4999999);
extent[2*i] = extent[2*i] < 0 ? 0 : extent[2*i];
if (extent[2*i] > extent[2*i+1])
{
extent[2*i+1] = extent[2*i];
}
}
}
else
{
for (int i=0; i< 3; i++)
{
extent[2*i] = static_cast<int>((p[i] - this->Width[i]/2.0 - this->Origin[i])
/this->Spacing[i] + 0.5);
extent[2*i+1] = static_cast<int>((p[i] + this->Width[i]/2.0 - this->Origin[i])
/this->Spacing[i] - 0.49999999);
extent[2*i] = extent[2*i] < 0 ? 0 : extent[2*i];
if (extent[2*i] > extent[2*i+1])
{
extent[2*i+1] = extent[2*i];
}
}
}
// Clip the extents with the ClipExtent
for (int i=0; i< 3; i++)
{
if (extent[2*i] < this->ClipExtent[2*i])
{
extent[2*i] = this->ClipExtent[2*i];
}
if (extent[2*i+1] > this->ClipExtent[2*i+1])
{
extent[2*i+1] = this->ClipExtent[2*i+1];
}
}
}
//----------------------------------------------------------------------
void vtkKWEPaintbrushShapeBox::PrintSelf(ostream& os, vtkIndent indent)
{
this->Superclass::PrintSelf(os,indent);
os << indent << "Width: (" << this->Width[0] << ", "
<< this->Width[1] << ", "
<< this->Width[2] << ")\n";
}
| 31.136276 | 144 | 0.515904 | [
"shape",
"vector"
] |
b32e835b745f527d49f339234116579f146a51db | 1,921 | cpp | C++ | Slicer/Slicing/BoundaryDetection.cpp | twang15/BarrierFinder | c20ff99ffeeeabc1508682bc99ffb4c7659e7e9f | [
"MIT"
] | null | null | null | Slicer/Slicing/BoundaryDetection.cpp | twang15/BarrierFinder | c20ff99ffeeeabc1508682bc99ffb4c7659e7e9f | [
"MIT"
] | null | null | null | Slicer/Slicing/BoundaryDetection.cpp | twang15/BarrierFinder | c20ff99ffeeeabc1508682bc99ffb4c7659e7e9f | [
"MIT"
] | null | null | null | #include "BoundaryDetection.h"
void initializeSCCAuxInfo(const std::vector<BasicBlock*>& scc, AuxiliaryMap& auxiliaryMap)
{
for (std::vector<BasicBlock*>::const_iterator I = scc.begin(),
E = scc.end(); I != E; ++I)
{
BasicBlock *bb = *I;
//Create bb to auxInfo mapping entry.
AuxiliaryInfo auxInfo;
auxInfo.inLocal.clear();
auxInfo.outLocal.clear();
auxInfo.inGlobal.clear();
auxInfo.outGlobal.clear();
//Insert into <bb, auxInfo> map.
auxiliaryMap.insert(itemPair(bb, auxInfo));
}
}
void computeAuxInfoOut(BasicBlock *bb, AuxiliaryInfo& auxInfo,
const vector<BasicBlock*>& nextSCC, AuxiliaryMap& auxiliaryMap,
BasicBlock * readCriteriaBB)
{
for (succ_iterator I = succ_begin(bb), E = succ_end(bb); I != E; I++)
{
BasicBlock *succ = *I;
//test whether the successor is in current SCC.
//The BB containing read-side criteria should be handled differently: skip it.
if(readCriteriaBB == succ)
{
continue;
}
AuxiliaryInfo succAuxInfo = auxiliaryMap[succ];
set_union(auxInfo.inLocal, succAuxInfo.outLocal);
//set_union(auxInfo.inGlobal, succAuxInfo.outGlobal);
//because DRC's equality is not based on its address, set_union cannot be used.
for(SetOfDRC::iterator iSucc=succAuxInfo.outGlobal.begin(), eSucc=succAuxInfo.outGlobal.end();
iSucc != eSucc; ++iSucc)
{
DRC *drcSucc = *iSucc;
bool bInGlobal = false;
for(SetOfDRC::iterator i=auxInfo.inGlobal.begin(), e=auxInfo.inGlobal.end();
i != e; ++i)
{
DRC *tmp = *i;
if(*drcSucc == *tmp)
{
bInGlobal = true;
break;
}
}
if(!bInGlobal)
{
auxInfo.inGlobal.insert(drcSucc);
}
}
}
//propagate in to out.
auxInfo.outLocal = auxInfo.inLocal;
auxInfo.outGlobal = auxInfo.inGlobal;
}
| 27.84058 | 98 | 0.622592 | [
"vector"
] |
b330d6d6d1e3b724a0db55bcf9fc1a8b2078252d | 867 | hpp | C++ | src/json_operations/json_operations.hpp | Wolfiwolf/blockchain_node | b1108f11a155fdd766f7fb6f10ed8dd0a1428fce | [
"MIT"
] | null | null | null | src/json_operations/json_operations.hpp | Wolfiwolf/blockchain_node | b1108f11a155fdd766f7fb6f10ed8dd0a1428fce | [
"MIT"
] | null | null | null | src/json_operations/json_operations.hpp | Wolfiwolf/blockchain_node | b1108f11a155fdd766f7fb6f10ed8dd0a1428fce | [
"MIT"
] | null | null | null | #ifndef JSON_OPERATIONS_H
#define JSON_OPERATIONS_H
#include <string>
#include "../models/models.h"
namespace BlockchainNode
{
class JsonOperations {
public:
static int get_int_value(const std::string& json_str, const std::string& key);
static unsigned long int get_unsigned_long_int_value(const std::string &json_str, const std::string &key);
static std::string get_str_value(const std::string& json_str, const std::string& key);
static Transaction get_transaction(const std::string &json_str);
static std::vector<TxInWithAmount> get_array_of_tx_ins_with_amount(const std::string &json_str);
static std::string transaction_to_json(const Transaction& transaction);
static std::string tx_in_to_json(const TxIn& tx_in);
static std::string tx_out_to_json(const TxOut& tx_out);
};
}
#endif | 34.68 | 114 | 0.727797 | [
"vector"
] |
b33969ff852ddc528c66b31d1edaf5cc1fa3462d | 2,235 | hpp | C++ | include/grafos/io.hpp | KROSF/EDNL | 601fcd765e9acd2974ca73e4c63ac381f36bbe51 | [
"MIT"
] | null | null | null | include/grafos/io.hpp | KROSF/EDNL | 601fcd765e9acd2974ca73e4c63ac381f36bbe51 | [
"MIT"
] | 14 | 2019-03-16T17:47:16.000Z | 2019-06-12T14:48:14.000Z | include/grafos/io.hpp | KROSF/EDNL | 601fcd765e9acd2974ca73e4c63ac381f36bbe51 | [
"MIT"
] | 1 | 2019-03-16T17:45:08.000Z | 2019-03-16T17:45:08.000Z | #ifndef GRAFOS_IO_HPP
#define GRAFOS_IO_HPP
#include <ostream>
#include <vector>
#include "grafos/lista.hpp"
#include "grafos/matriz.hpp"
#include "grafos/pmc.hpp"
namespace grafos {
namespace pmc {
template <typename T>
std::ostream& operator<<(std::ostream& os, const vector<T>& v) {
for (size_t i = 0; i < v.size(); ++i) {
os << std::setw(4);
if (v[i] != GrafoP<T>::INFINITO)
os << v[i];
else
os << "-";
}
return os;
}
template <typename T>
std::ostream& operator<<(std::ostream& os, const matriz<T>& m) {
const std::size_t n = m.dimension();
std::size_t digits{0};
for (std::size_t i = 0; i < n; ++i) {
for (std::size_t j = 0; j < n; ++j) {
if ((m[i][j] != GrafoP<T>::INFINITO &&
m[i][j] != GrafoP<T>::INFINITO * -1) &&
static_cast<std::size_t>(m[i][j]) > digits) {
digits = m[i][j];
}
}
}
digits = std::to_string(digits).size() + 1;
os << "\033[1m\033[32m" << std::string(digits, ' ');
for (std::size_t j = 0; j < n; ++j) {
os << std::setw(digits) << j;
}
os << "\033[00m\n";
for (std::size_t i = 0; i < n; ++i) {
os << "\033[1m\033[32m" << std::setw(digits) << i << "\033[00m"
<< std::setw(digits);
for (std::size_t j = 0; j < n; ++j) {
if (m[i][j] == GrafoP<T>::INFINITO ||
m[i][j] == GrafoP<T>::INFINITO * -1) {
os << std::setw(digits + 16) << "\033[1m\033[34m\u221E\033[00m";
} else {
os << std::setw(digits) << m[i][j];
}
}
os << std::endl;
}
return os;
}
} // namespace pmc
std::ostream& operator<<(std::ostream& os, const matriz<bool>& m) {
const size_t n = m.dimension();
os << " ";
for (size_t j = 0; j < n; ++j) os << std::setw(3) << j;
os << std::endl;
for (size_t i = 0; i < n; ++i) {
os << std::setw(3) << i;
for (size_t j = 0; j < n; ++j) os << std::setw(3) << m[i][j];
os << std::endl;
}
return os;
}
template <typename T>
std::ostream& operator<<(std::ostream& os, const Lista<T>& L) {
auto au = L.anterior(L.fin());
for (auto i = L.primera(); i != au; i = L.siguiente(i))
os << L.elemento(i) << " \033[1m\033[34m\u2192\033[00m ";
os << L.elemento(au);
return os;
}
} // namespace grafos
#endif | 27.592593 | 72 | 0.517226 | [
"vector"
] |
b33ddde97a9f2e0f6497eae376eec581493c3ceb | 1,039 | cpp | C++ | Hackerrank/10 Days of Statistics/Day 0 - Mean Median Mode .cpp | JanaSabuj/cpmaster | d943780c7ca4badbefbce2d300848343c4032650 | [
"MIT"
] | 1 | 2020-11-29T08:36:38.000Z | 2020-11-29T08:36:38.000Z | Hackerrank/10 Days of Statistics/Day 0 - Mean Median Mode .cpp | Sahu49/CompetitiveProgramming | adf11a546f81878ad2975926219af84deb3414e8 | [
"MIT"
] | null | null | null | Hackerrank/10 Days of Statistics/Day 0 - Mean Median Mode .cpp | Sahu49/CompetitiveProgramming | adf11a546f81878ad2975926219af84deb3414e8 | [
"MIT"
] | null | null | null | #include <cmath>
#include <cstdio>
#include <vector>
#include <iostream>
#include <algorithm>
#include <map>
#include <iomanip>
using namespace std;
int main() {
/* Enter your code here. Read input from STDIN. Print output to STDOUT */
int n;
cin>>n;
vector<int> vec(n);
int total = 0;
for(int i = 0; i < n; i++){
cin>>vec[i];
total += vec[i];
}
sort(vec.begin(), vec.end());
float avg = (float)total / n;
cout << fixed << showpoint << setprecision(1) <<avg <<endl;
float median ;
if(n & 1)
median = vec[(n)/ 2];
else {
median = (float)(vec[(n-1)/2] + vec[(n-1)/2 + 1])/2;
}
cout << fixed << showpoint << setprecision(1) << median <<endl;
int ans = 0;
int val ;
map<int,int> mp;
for(auto x: vec)
mp[x]++;
for(auto x: mp){
if(x.second > ans){
ans = x.second;
val = x.first;
}
}
cout << fixed << showpoint << setprecision(1) << val <<endl;
return 0;
}
| 18.553571 | 77 | 0.503369 | [
"vector"
] |
b34252b9fe70b7a108f2523bf2d7fe3b4cc5ff66 | 7,946 | cc | C++ | DetectorDescription/Core/src/DDPartSelection.cc | nistefan/cmssw | ea13af97f7f2117a4f590a5e654e06ecd9825a5b | [
"Apache-2.0"
] | 3 | 2018-08-24T19:10:26.000Z | 2019-02-19T11:45:32.000Z | DetectorDescription/Core/src/DDPartSelection.cc | nistefan/cmssw | ea13af97f7f2117a4f590a5e654e06ecd9825a5b | [
"Apache-2.0"
] | 3 | 2018-08-23T13:40:24.000Z | 2019-12-05T21:16:03.000Z | DetectorDescription/Core/src/DDPartSelection.cc | nistefan/cmssw | ea13af97f7f2117a4f590a5e654e06ecd9825a5b | [
"Apache-2.0"
] | 5 | 2018-08-21T16:37:52.000Z | 2020-01-09T13:33:17.000Z | #include "DetectorDescription/Core/interface/Singleton.h"
#include "DetectorDescription/Core/interface/DDLogicalPart.h"
#include "DetectorDescription/Core/interface/DDName.h"
#include "DetectorDescription/Core/interface/DDPartSelection.h"
#include "FWCore/MessageLogger/interface/MessageLogger.h"
#include "boost/spirit/include/classic.hpp"
namespace boost { namespace spirit { namespace classic { } } } using namespace boost::spirit::classic;
struct DDSelLevelCollector
{
std::string namespace_;
std::string name_;
int copyNo_;
bool isCopyNoValid_;
bool isChild_;
std::vector<DDPartSelRegExpLevel>* p_;
std::vector<DDPartSelRegExpLevel>* path(std::vector<DDPartSelRegExpLevel>* p=nullptr) {
if (p) {
p_=p;
namespace_="";
name_="";
copyNo_=0;
isCopyNoValid_=false;
isChild_=false;
}
return p_;
}
};
void noNameSpace(char const * /*first*/, char const* /*last*/) {
DDI::Singleton<DDSelLevelCollector>::instance().namespace_="";
}
/* Functor for the parser; it does not consume memory -
pointers are only used to store references to memory
managed elsewhere
*/
struct DDSelLevelFtor
{
DDSelLevelFtor()
: c_(DDI::Singleton<DDSelLevelCollector>::instance())
{ }
// parser calls this whenever a selection has been parsed ( //ns:nm[cn], /nm, //ns:nm, .... )
void operator() (char const* /*first*/, char const* /*last*/) const {
if(c_.path()){
if (c_.isCopyNoValid_ && c_.isChild_) {
c_.path()->emplace_back(DDPartSelRegExpLevel(c_.namespace_,c_.name_,c_.copyNo_,ddchildposp));
//edm::LogInfo("DDPartSelection") << namespace_ << name_ << copyNo_ << ' ' << ddchildposp << std::endl;
} else
if (c_.isCopyNoValid_ && !c_.isChild_) {
c_.path()->emplace_back(DDPartSelRegExpLevel(c_.namespace_,c_.name_,c_.copyNo_,ddanyposp));
// edm::LogInfo("DDPartSelection") << namespace_ << name_ << copyNo_ << ' ' << ddanyposp << std::endl;
} else
if (!c_.isCopyNoValid_ && c_.isChild_) {
c_.path()->emplace_back(DDPartSelRegExpLevel(c_.namespace_,c_.name_,c_.copyNo_,ddchildlogp));
// edm::LogInfo("DDPartSelection") << namespace_ << name_ << copyNo_ << ' ' << ddchildlogp << std::endl;
} else
if (!c_.isCopyNoValid_ && !c_.isChild_) {
c_.path()->emplace_back(DDPartSelRegExpLevel(c_.namespace_,c_.name_,c_.copyNo_,ddanylogp));
// edm::LogInfo("DDPartSelection") << namespace_ << name_ << copyNo_ << ' ' << ddanylogp << std::endl;
}
c_.namespace_="";
c_.name_="";
c_.isCopyNoValid_=false;
}
}
DDSelLevelCollector & c_;
};
struct DDIsChildFtor
{
void operator()(char const* first, char const* last) const {
DDSelLevelCollector & sl = DDI::Singleton<DDSelLevelCollector>::instance();
if ( (last-first) > 1)
sl.isChild_=false;
if ( (last-first) ==1 )
sl.isChild_=true;
//edm::LogInfo("DDPartSelection") << "DDIsChildFtor isChild=" << (last-first) << std::endl;
}
};
struct DDNameSpaceFtor
{
void operator()(char const* first, char const* last) const {
DDSelLevelCollector & sl = DDI::Singleton<DDSelLevelCollector>::instance();
sl.namespace_.assign(first,last);
// edm::LogInfo("DDPartSelection") << "DDNameSpaceFtor singletonname=" << DDI::Singleton<DDSelLevelCollector>::instance().namespace_ << std::endl;
}
DDSelLevelFtor* selLevelFtor_;
};
struct DDNameFtor
{
void operator()(char const* first, char const* last) const {
DDSelLevelCollector & sl = DDI::Singleton<DDSelLevelCollector>::instance();
sl.name_.assign(first,last);
// edm::LogInfo("DDPartSelection") << "DDNameFtor singletonname=" << Singleton<DDSelLevelCollector>::instance().name_ << std::endl;
}
};
struct DDCopyNoFtor
{
void operator()(int i) const {
DDSelLevelCollector & sl = DDI::Singleton<DDSelLevelCollector>::instance();
sl.copyNo_ = i;
sl.isCopyNoValid_ = true;
// edm::LogInfo("DDPartSelection") << "DDCopyNoFtor ns=" << i;
}
};
/** A boost::spirit parser for the <SpecPar path="xxx"> syntax */
struct SpecParParser : public grammar<SpecParParser>
{
template <typename ScannerT>
struct definition
{
definition(SpecParParser const& /*self*/) {
Selection //= FirstStep[selLevelFtor()]
//>> *SelectionStep[selLevelFtor()]
= +SelectionStep[selLevelFtor()]
;
FirstStep = Descendant
>> Part
;
Part = PartNameCopyNumber
| PartName
;
PartNameCopyNumber = PartName
>> CopyNumber
;
SelectionStep = NavigationalElement[isChildFtor()]
>> Part
;
NavigationalElement = Descendant
| Child
;
CopyNumber = ch_p('[')
>> int_p[copyNoFtor()]
>> ch_p(']')
;
PartName = NameSpaceName
| SimpleName[nameFtor()][&noNameSpace]
;
SimpleName = +( alnum_p | ch_p('_') | ch_p('.') | ch_p('*') )
;
NameSpaceName = SimpleName[nameSpaceFtor()]
>> ':'
>> SimpleName[nameFtor()]
;
Descendant = ch_p('/')
>> ch_p('/')
;
Child = ch_p('/')
;
}
rule<ScannerT> Selection, FirstStep, Part, SelectionStep, NavigationalElement,
CopyNumber, PartName, PartNameCopyNumber, NameSpaceName, SimpleName,
Descendant, Child;
rule<ScannerT> const& start() const { return Selection; }
DDSelLevelFtor & selLevelFtor() {
return DDI::Singleton<DDSelLevelFtor>::instance();
}
DDNameFtor & nameFtor() {
static DDNameFtor f_;
return f_;
}
DDNameSpaceFtor & nameSpaceFtor() {
static DDNameSpaceFtor f_;
return f_;
}
DDIsChildFtor & isChildFtor() {
static DDIsChildFtor f_;
return f_;
}
DDCopyNoFtor & copyNoFtor() {
static DDCopyNoFtor f_;
return f_;
}
};
};
DDPartSelectionLevel::DDPartSelectionLevel(const DDLogicalPart & lp, int c, ddselection_type t)
: lp_(lp), copyno_(c), selectionType_(t)
{}
void DDTokenize2(const std::string & sel, std::vector<DDPartSelRegExpLevel> & path)
{
static SpecParParser parser;
DDI::Singleton<DDSelLevelCollector>::instance().path(&path);
bool result = parse(sel.c_str(), parser).full;
if (!result) {
edm::LogError("DDPartSelection") << "DDTokenize2() error in parsing of " << sel << std::endl;
}
}
std::ostream & operator<<(std::ostream & o, const DDPartSelection & p)
{
DDPartSelection::const_iterator it(p.begin()), ed(p.end());
for (; it != ed; ++it) {
const DDPartSelectionLevel lv =*it;
switch (lv.selectionType_) {
case ddanylogp:
o << "//" << lv.lp_.ddname();
break;
case ddanyposp:
o << "//" << lv.lp_.ddname() << '[' << lv.copyno_ << ']';
break;
case ddchildlogp:
o << "/" << lv.lp_.ddname();
break;
case ddchildposp:
o << "/" << lv.lp_.ddname() << '[' << lv.copyno_ << ']';
break;
default:
o << "{Syntax ERROR}";
}
}
return o;
}
std::ostream & operator<<(std::ostream & os, const std::vector<DDPartSelection> & v)
{
std::vector<DDPartSelection>::const_iterator it(v.begin()), ed(v.end());
for (; it != (ed-1); ++it) {
os << *it << std::endl;
}
if ( it != ed ) {
++it;
os << *it;
}
return os;
}
// explicit template instantiation.
template class DDI::Singleton<DDSelLevelFtor>;
//template class DDI::Singleton<DDI::Store<DDName, DDSelLevelCollector> >;
template class DDI::Singleton<DDSelLevelCollector>;
#include <DetectorDescription/Core/interface/Singleton.icc>
| 28.789855 | 151 | 0.602819 | [
"vector"
] |
b34961681fe678903263f2ad0dfd4d4cd10ed4ec | 2,260 | cpp | C++ | src/deserialization.cpp | Xaenalt/model_server | f977dbf1246ebf85e960ca058e814deac7c6a16c | [
"Apache-2.0"
] | 234 | 2020-04-24T22:09:49.000Z | 2022-03-30T10:40:04.000Z | src/deserialization.cpp | Xaenalt/model_server | f977dbf1246ebf85e960ca058e814deac7c6a16c | [
"Apache-2.0"
] | 199 | 2020-04-29T08:43:21.000Z | 2022-03-29T09:05:52.000Z | src/deserialization.cpp | Xaenalt/model_server | f977dbf1246ebf85e960ca058e814deac7c6a16c | [
"Apache-2.0"
] | 80 | 2020-04-29T14:54:41.000Z | 2022-03-30T14:50:29.000Z | //*****************************************************************************
// Copyright 2021 Intel Corporation
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
//*****************************************************************************
#include "deserialization.hpp"
namespace ovms {
template <>
Status InputSink<InferenceEngine::InferRequest&>::give(const std::string& name, InferenceEngine::Blob::Ptr blob) {
Status status;
try {
requester.SetBlob(name, blob);
// OV implementation the InferenceEngine::Exception is not
// a base class for all other exceptions thrown from OV.
// OV can throw exceptions derived from std::logic_error.
} catch (const InferenceEngine::Exception& e) {
status = StatusCode::OV_INTERNAL_DESERIALIZATION_ERROR;
SPDLOG_DEBUG("{}: {}", status.string(), e.what());
return status;
} catch (std::logic_error& e) {
status = StatusCode::OV_INTERNAL_DESERIALIZATION_ERROR;
SPDLOG_DEBUG("{}: {}", status.string(), e.what());
return status;
}
return status;
}
InferenceEngine::TensorDesc getFinalTensorDesc(const ovms::TensorInfo& servableInfo, const tensorflow::TensorProto& requestInput, bool isPipeline) {
InferenceEngine::Precision precision = servableInfo.getPrecision();
if (!isPipeline) {
return InferenceEngine::TensorDesc(precision, servableInfo.getShape(), servableInfo.getLayout());
}
InferenceEngine::SizeVector shape;
for (size_t i = 0; i < requestInput.tensor_shape().dim_size(); i++) {
shape.push_back(requestInput.tensor_shape().dim(i).size());
}
return InferenceEngine::TensorDesc(precision, shape, InferenceEngine::Layout::ANY);
}
} // namespace ovms
| 42.641509 | 148 | 0.655752 | [
"shape"
] |
b35047d52c263b08bc3233d1728e832d29b0bb26 | 6,940 | cc | C++ | src/evaluator.cc | CN-TU/remy | 0c0887322b0cbf6e3497e3aeb95c979907f03623 | [
"Apache-2.0"
] | 6 | 2020-03-19T04:16:02.000Z | 2022-03-30T15:41:39.000Z | src/evaluator.cc | CN-TU/remy | 0c0887322b0cbf6e3497e3aeb95c979907f03623 | [
"Apache-2.0"
] | 1 | 2020-05-20T12:05:49.000Z | 2021-11-14T13:39:23.000Z | src/evaluator.cc | CN-TU/remy | 0c0887322b0cbf6e3497e3aeb95c979907f03623 | [
"Apache-2.0"
] | null | null | null | #include <fcntl.h>
#include "configrange.hh"
#include "evaluator.hh"
#include "network.cc"
#include "rat-templates.cc"
#include "fish-templates.cc"
template <typename T>
Evaluator< T >::Evaluator( const ConfigRange & range )
: _prng_seed( global_PRNG()() ), /* freeze the PRNG seed for the life of this Evaluator */
_tick_count( range.simulation_ticks ),
_configs()
{
// add configs from every point in the cube of configs
for (double link_ppt = range.link_ppt.low; link_ppt <= range.link_ppt.high; link_ppt += range.link_ppt.incr) {
for (double rtt = range.rtt.low; rtt <= range.rtt.high; rtt += range.rtt.incr) {
for (unsigned int senders = range.num_senders.low; senders <= range.num_senders.high; senders += range.num_senders.incr) {
for (double on = range.mean_on_duration.low; on <= range.mean_on_duration.high; on += range.mean_on_duration.incr) {
for (double off = range.mean_off_duration.low; off <= range.mean_off_duration.high; off += range.mean_off_duration.incr) {
for ( double buffer_size = range.buffer_size.low; buffer_size <= range.buffer_size.high; buffer_size += range.buffer_size.incr) {
for ( double loss_rate = range.stochastic_loss_rate.low; loss_rate <= range.stochastic_loss_rate.high; loss_rate += range.stochastic_loss_rate.incr) {
_configs.push_back( NetConfig().set_link_ppt( link_ppt ).set_delay( rtt ).set_num_senders( senders ).set_on_duration( on ).set_off_duration(off).set_buffer_size( buffer_size ).set_stochastic_loss_rate( loss_rate ) );
if ( range.stochastic_loss_rate.isOne() ) { break; }
}
if ( range.buffer_size.isOne() ) { break; }
}
if ( range.mean_off_duration.isOne() ) { break; }
}
if ( range.mean_on_duration.isOne() ) { break; }
}
if ( range.num_senders.isOne() ) { break; }
}
if ( range.rtt.isOne() ) { break; }
}
if ( range.link_ppt.isOne() ) { break; }
}
}
template <typename T>
ProblemBuffers::Problem Evaluator< T >::_ProblemSettings_DNA( void ) const
{
ProblemBuffers::Problem ret;
ProblemBuffers::ProblemSettings settings;
settings.set_prng_seed( _prng_seed );
settings.set_tick_count( _tick_count );
ret.mutable_settings()->CopyFrom( settings );
for ( auto &x : _configs ) {
RemyBuffers::NetConfig *config = ret.add_configs();
*config = x.DNA();
}
return ret;
}
template <>
ProblemBuffers::Problem Evaluator< WhiskerTree >::DNA( const WhiskerTree & whiskers ) const
{
ProblemBuffers::Problem ret = _ProblemSettings_DNA();
ret.mutable_whiskers()->CopyFrom( whiskers.DNA() );
return ret;
}
template <>
ProblemBuffers::Problem Evaluator< FinTree >::DNA( const FinTree & fins ) const
{
ProblemBuffers::Problem ret = _ProblemSettings_DNA();
ret.mutable_fins()->CopyFrom( fins.DNA() );
return ret;
}
template <>
Evaluator< WhiskerTree >::Outcome Evaluator< WhiskerTree >::score( WhiskerTree & run_whiskers,
const unsigned int prng_seed,
const vector<NetConfig> & configs,
const bool trace,
const unsigned int ticks_to_run )
{
PRNG run_prng( prng_seed );
run_whiskers.reset_counts();
/* run tests */
Evaluator::Outcome the_outcome;
for ( auto &x : configs ) {
/* run once */
Network<SenderGang<Rat, TimeSwitchedSender<Rat>>,
SenderGang<Rat, TimeSwitchedSender<Rat>>> network1( Rat( run_whiskers, trace ), run_prng, x );
network1.run_simulation( ticks_to_run );
the_outcome.score += network1.senders().utility();
the_outcome.throughputs_delays.emplace_back( x, network1.senders().throughputs_delays() );
}
the_outcome.used_actions = run_whiskers;
return the_outcome;
}
template <>
Evaluator< FinTree >::Outcome Evaluator< FinTree >::score( FinTree & run_fins,
const unsigned int prng_seed,
const vector<NetConfig> & configs,
const bool trace,
const unsigned int ticks_to_run )
{
PRNG run_prng( prng_seed );
unsigned int fish_prng_seed( run_prng() );
run_fins.reset_counts();
/* run tests */
Evaluator::Outcome the_outcome;
for ( auto &x : configs ) {
/* run once */
Network<SenderGang<Fish, TimeSwitchedSender<Fish>>,
SenderGang<Fish, TimeSwitchedSender<Fish>>> network1( Fish( run_fins, fish_prng_seed, trace ), run_prng, x );
network1.run_simulation( ticks_to_run );
the_outcome.score += network1.senders().utility();
the_outcome.throughputs_delays.emplace_back( x, network1.senders().throughputs_delays() );
}
the_outcome.used_actions = run_fins;
return the_outcome;
}
template <>
typename Evaluator< WhiskerTree >::Outcome Evaluator< WhiskerTree >::parse_problem_and_evaluate( const ProblemBuffers::Problem & problem )
{
vector<NetConfig> configs;
for ( const auto &x : problem.configs() ) {
configs.emplace_back( x );
}
WhiskerTree run_whiskers = WhiskerTree( problem.whiskers() );
return Evaluator< WhiskerTree >::score( run_whiskers, problem.settings().prng_seed(),
configs, false, problem.settings().tick_count() );
}
template <>
typename Evaluator< FinTree >::Outcome Evaluator< FinTree >::parse_problem_and_evaluate( const ProblemBuffers::Problem & problem )
{
vector<NetConfig> configs;
for ( const auto &x : problem.configs() ) {
configs.emplace_back( x );
}
FinTree run_fins = FinTree( problem.fins() );
return Evaluator< FinTree >::score( run_fins, problem.settings().prng_seed(),
configs, false, problem.settings().tick_count() );
}
template <typename T>
AnswerBuffers::Outcome Evaluator< T >::Outcome::DNA( void ) const
{
AnswerBuffers::Outcome ret;
for ( const auto & run : throughputs_delays ) {
AnswerBuffers::ThroughputsDelays *tp_del = ret.add_throughputs_delays();
tp_del->mutable_config()->CopyFrom( run.first.DNA() );
for ( const auto & x : run.second ) {
AnswerBuffers::SenderResults *results = tp_del->add_results();
results->set_throughput( x.first );
results->set_delay( x.second );
}
}
ret.set_score( score );
return ret;
}
template <typename T>
Evaluator< T >::Outcome::Outcome( const AnswerBuffers::Outcome & dna )
: score( dna.score() ), throughputs_delays(), used_actions() {
for ( const auto &x : dna.throughputs_delays() ) {
vector< pair< double, double > > tp_del;
for ( const auto &result : x.results() ) {
tp_del.emplace_back( result.throughput(), result.delay() );
}
throughputs_delays.emplace_back( NetConfig( x.config() ), tp_del );
}
}
template <typename T>
typename Evaluator< T >::Outcome Evaluator< T >::score( T & run_actions,
const bool trace, const double carefulness ) const
{
return score( run_actions, _prng_seed, _configs, trace, _tick_count * carefulness );
}
template class Evaluator< WhiskerTree>;
template class Evaluator< FinTree >;
| 33.68932 | 232 | 0.6817 | [
"vector"
] |
b356fa1af39fe0280607d80fad6ac30e17724134 | 438 | cpp | C++ | solutions/c++/problems/[1833_Medium] Maximum Ice Cream Bars.cpp | RageBill/leetcode | a11d411f4e38b5c3f05ca506a193f50b25294497 | [
"MIT"
] | 6 | 2021-02-20T14:00:22.000Z | 2022-03-31T15:26:44.000Z | solutions/c++/problems/[1833_Medium] Maximum Ice Cream Bars.cpp | RageBill/leetcode | a11d411f4e38b5c3f05ca506a193f50b25294497 | [
"MIT"
] | null | null | null | solutions/c++/problems/[1833_Medium] Maximum Ice Cream Bars.cpp | RageBill/leetcode | a11d411f4e38b5c3f05ca506a193f50b25294497 | [
"MIT"
] | null | null | null | class Solution {
public:
int maxIceCream(vector<int> &costs, int coins) {
int n = costs.size();
sort(costs.begin(), costs.end());
int count = 0;
for (int i = 0; i < n; i++) {
int curr = costs[i];
if (coins >= curr) {
coins -= curr;
count++;
} else {
return count;
}
}
return count;
}
}; | 24.333333 | 52 | 0.39726 | [
"vector"
] |
b3599a09716c38f104f45523c58cadd96fca5dd8 | 1,647 | cpp | C++ | platforms/codeforces/all/codeforces_1323_A.cpp | idfumg/algorithms | 06f85c5a1d07a965df44219b5a6bf0d43a129256 | [
"MIT"
] | 2 | 2020-09-17T09:04:00.000Z | 2020-11-20T19:43:18.000Z | platforms/codeforces/all/codeforces_1323_A.cpp | idfumg/algorithms | 06f85c5a1d07a965df44219b5a6bf0d43a129256 | [
"MIT"
] | null | null | null | platforms/codeforces/all/codeforces_1323_A.cpp | idfumg/algorithms | 06f85c5a1d07a965df44219b5a6bf0d43a129256 | [
"MIT"
] | null | null | null | #include <iostream>
#include <cassert>
#include <limits>
#include <cmath>
#include <algorithm>
#include <vector>
#include <unordered_map>
#include <unordered_set>
#include <string>
#include <array>
#include <map>
#include <set>
#include <deque>
#include <list>
#include <sstream>
#include <iomanip>
#include <numeric>
#include <climits>
#include <cstring>
#include <bitset>
#include <stack>
#include <queue>
#define MOD (1e9 + 7);
#define PI (3.14159265358979323846)
using ll = int64_t;
using ull = uint64_t;
using namespace std;
[[maybe_unused]] static auto __x = [](){ios_base::sync_with_stdio(0); cin.tie(0);};
int main() {
int tests_total; cin >> tests_total;
for (int test_count = 0; test_count < tests_total; ++test_count) {
int n; cin >> n;
bool i_need_odd = false;
int prev_odd_idx = -1;
bool ok = false;
for (int i = 0; i < n; ++i) {
int number; cin >> number;
if (ok) {
continue;
}
if (number % 2 != 0) {
if (i_need_odd) {
cout << 2 << '\n';
cout << prev_odd_idx << ' ' << i + 1 << '\n';
ok = true;
}
else {
i_need_odd = true;
prev_odd_idx = i + 1;
}
}
else {
cout << 1 << '\n';
cout << i + 1 << '\n';
ok = true;
}
}
if (not ok) {
cout << -1 << '\n';
}
ok = false;
i_need_odd = false;
prev_odd_idx = -1;
}
}
| 23.197183 | 83 | 0.471767 | [
"vector"
] |
b3636bf7e7eb82ea7a5600352e5cf5a35a4b6bfd | 853 | cpp | C++ | source/459.cpp | narikbi/LeetCode | 835215c21d1bd6820b20c253026bcb6f889ed3fc | [
"MIT"
] | 2 | 2017-02-28T11:39:13.000Z | 2019-12-07T17:23:20.000Z | source/459.cpp | narikbi/LeetCode | 835215c21d1bd6820b20c253026bcb6f889ed3fc | [
"MIT"
] | null | null | null | source/459.cpp | narikbi/LeetCode | 835215c21d1bd6820b20c253026bcb6f889ed3fc | [
"MIT"
] | null | null | null | //
// 459.cpp
// LeetCode
//
// Created by Narikbi on 10.03.17.
// Copyright © 2017 app.leetcode.kz. All rights reserved.
//
#include <stdio.h>
#include <iostream>
#include <vector>
#include <string>
#include <algorithm>
#include <deque>
#include <queue>
#include <set>
#include <map>
#include <stack>
#include <cmath>
#include <numeric>
#include <unordered_map>
using namespace std;
bool repeatedSubstringPattern(string s) {
int n = s.length();
if (s.length() < 2) return true;
for (int len = 1; len <= n/2; len++) {
if (n % len == 0) {
string str = s.substr(0, len);
string res = "";
while (res.length() < n) {
res += str;
}
// cout << res << endl;
if (res == s) return true;
}
}
return false;
}
| 18.543478 | 58 | 0.526377 | [
"vector"
] |
b364d6634a78570e5d2ff1e05472924312b8245e | 4,167 | cpp | C++ | mapnikvt/src/mapnikvt/GeneratorUtils.cpp | farfromrefug/mobile-carto-libs | c7e81a7c73661aa047de9ba7e8bbdf3a24bbf1df | [
"BSD-3-Clause"
] | 6 | 2018-06-27T17:43:35.000Z | 2021-06-29T18:50:49.000Z | mapnikvt/src/mapnikvt/GeneratorUtils.cpp | farfromrefug/mobile-carto-libs | c7e81a7c73661aa047de9ba7e8bbdf3a24bbf1df | [
"BSD-3-Clause"
] | 22 | 2019-04-10T06:38:09.000Z | 2022-01-20T08:12:02.000Z | mapnikvt/src/mapnikvt/GeneratorUtils.cpp | farfromrefug/mobile-carto-libs | c7e81a7c73661aa047de9ba7e8bbdf3a24bbf1df | [
"BSD-3-Clause"
] | 5 | 2019-03-12T10:25:20.000Z | 2021-12-28T10:18:56.000Z | #include "GeneratorUtils.h"
#include "ValueGenerator.h"
#include "ExpressionGenerator.h"
#include "TransformGenerator.h"
#include "ParseTables.h"
#include "ColorGenerator.h"
#include <iomanip>
#include <sstream>
#include <utility>
#include <boost/algorithm/string.hpp>
namespace carto { namespace mvt {
std::string generateLineCapModeString(vt::LineCapMode lineCapMode) {
auto it = std::find_if(getLineCapModeTable().begin(), getLineCapModeTable().end(), [lineCapMode](const auto& keyVal) {
return keyVal.second == lineCapMode;
});
if (it == getLineCapModeTable().end()) {
throw GeneratorException("Could not generate LineCapMode string");
}
return it->first;
}
std::string generateLineJoinModeString(vt::LineJoinMode lineJoinMode) {
auto it = std::find_if(getLineJoinModeTable().begin(), getLineJoinModeTable().end(), [lineJoinMode](const auto& keyVal) {
return keyVal.second == lineJoinMode;
});
if (it == getLineJoinModeTable().end()) {
throw GeneratorException("Could not generate LineJoinMode string");
}
return it->first;
}
std::string generateCompOpString(vt::CompOp compOp) {
auto it = std::find_if(getCompOpTable().begin(), getCompOpTable().end(), [compOp](const auto& keyVal) {
return keyVal.second == compOp;
});
if (it == getCompOpTable().end()) {
throw GeneratorException("Could not generate CompOp string");
}
return it->first;
}
std::string generateLabelOrientationString(vt::LabelOrientation labelOrientation) {
auto it = std::find_if(getLabelOrientationTable().begin(), getLabelOrientationTable().end(), [labelOrientation](const auto& keyVal) {
return keyVal.second == labelOrientation;
});
if (it == getLabelOrientationTable().end()) {
throw GeneratorException("Could not generate LabelOrientation string");
}
return it->first;
}
std::string generateColorString(vt::Color color) {
std::string str;
std::back_insert_iterator<std::string> it(str);
colorgenimpl::Delimiter delimiter;
bool result = boost::spirit::karma::generate_delimited(it, ColorGeneratorGrammar<std::back_insert_iterator<std::string>>(), delimiter, color.value());
if (!result) {
throw GeneratorException("Could not generate color string");
}
return boost::trim_copy(str);
}
std::string generateValueString(const Value& val) {
std::string str;
std::back_insert_iterator<std::string> it(str);
bool result = boost::spirit::karma::generate(it, ValueGeneratorGrammar<std::back_insert_iterator<std::string>>(), val);
if (!result) {
throw GeneratorException("Could not generate value string");
}
return boost::trim_copy(str);
}
std::string generateTransformListString(const std::vector<Transform>& transforms) {
std::string str;
std::back_insert_iterator<std::string> it(str);
transgenimpl::Delimiter delimiter;
bool result = boost::spirit::karma::generate_delimited(it, TransformGeneratorGrammar<std::back_insert_iterator<std::string>>() % ',', delimiter, transforms);
if (!result) {
throw GeneratorException("Could not generate transform string");
}
return boost::trim_copy(str);
}
std::string generateExpressionString(const Expression& expr, bool stringExpr) {
std::string str;
std::back_insert_iterator<std::string> it(str);
bool result = false;
if (stringExpr) {
result = boost::spirit::karma::generate(it, StringExpressionGeneratorGrammar<std::back_insert_iterator<std::string>>(), expr);
}
else {
result = boost::spirit::karma::generate(it, ExpressionGeneratorGrammar<std::back_insert_iterator<std::string>>(), expr);
}
if (!result) {
throw GeneratorException("Could not generate expression string");
}
return boost::trim_copy(str);
}
} }
| 40.456311 | 165 | 0.644828 | [
"vector",
"transform"
] |
b365d3dc5e93b91273e30d34c05041c65bb91596 | 6,125 | cc | C++ | src/MainWindow.cc | gajus123/Genetic-Cars | f399ebcf0952465e91d8711e08f0c38e6c18bb92 | [
"MIT"
] | null | null | null | src/MainWindow.cc | gajus123/Genetic-Cars | f399ebcf0952465e91d8711e08f0c38e6c18bb92 | [
"MIT"
] | 1 | 2018-10-25T21:04:03.000Z | 2018-10-25T21:06:35.000Z | src/MainWindow.cc | gajus123/Genetic-Cars | f399ebcf0952465e91d8711e08f0c38e6c18bb92 | [
"MIT"
] | 1 | 2018-11-28T13:39:05.000Z | 2018-11-28T13:39:05.000Z | /*!
* @authors Jakub Gajownik, Rafał Galczak
* @date 14.12.17
*
*/
#include <MainWindow.h>
#include <physics/objects/GroundGenerator.h>
#include <ui/ui_MainWindow.h>
MainWindow::MainWindow(QWidget *parent, Qt::WindowFlags flags) :
QMainWindow(parent, flags),
simulation_(),
simulation_view_(simulation_),
ui_(new Ui::MainWindow),
pause_action_(QKeySequence(Qt::CTRL + Qt::Key_P), this) {
ui_->setupUi(this);
ui_->gridLayout_5->addWidget(&simulation_view_);
ui_->gridLayout_8->addWidget(&statistic_view_);
connect(&pause_action_, SIGNAL(activated()), ui_->pause_button, SLOT(click()));
connect(ui_->elite_specimen_number_edit, SIGNAL(editingFinished()), this, SLOT(eliteSpecimenNumberChanged()));
connect(ui_->mutation_size_edit, SIGNAL(editingFinished()), this, SLOT(mutationSizeChanged()));
connect(ui_->load_button, SIGNAL(clicked()), this, SLOT(loadFromFile()));
connect(ui_->save_button, SIGNAL(clicked()), this, SLOT(saveToFile()));
connect(ui_->reset_button, SIGNAL(clicked()), this, SLOT(resetSimulation()));
connect(ui_->pause_button, SIGNAL(toggled(bool)), this, SLOT(pauseSimulation(bool)));
connect(ui_->cars_count_edit, SIGNAL(editingFinished()), this, SLOT(carsNumberChanged()));
connect(ui_->simulation_speed_chooser, SIGNAL(currentIndexChanged(int)), this, SLOT(speedChanged()));
connect(&simulation_, SIGNAL(roundEnd(std::vector<float>)), &statistics_, SLOT(calculateStatistics(std::vector<float>)));
connect(&statistics_, SIGNAL(newValues(float, float, float, float)), &statistic_view_, SLOT(addData(float, float, float, float)));
connect(&simulation_, SIGNAL(roundEnd(std::vector<float>)), &population_, SLOT(nextPopulation(std::vector<float>)));
connect(&population_, SIGNAL(newVehiclesGenerated(std::vector<Objects::Vehicle>)), &simulation_, SLOT(newRound(std::vector<Objects::Vehicle>)));
connect(&loop_, SIGNAL(step(unsigned int)), &simulation_, SLOT(step(unsigned int)));
Physics::ObjectsFactory::init(simulation_.getWorld().getWorld());
simulation_.newGround();
population_.generateVehicles();
initializeSpeedWidget();
ui_->cars_count_edit->setText(QString::number(population_.nextGenerationSize()));
ui_->mutation_size_edit->setText(QString::number(population_.mutationRate()));
ui_->elite_specimen_number_edit->setText(QString::number(population_.eliteSpecimen()));
}
void MainWindow::initializeSpeedWidget() {
ui_->simulation_speed_chooser->addItem("25%", QVariant(0.25f));
ui_->simulation_speed_chooser->addItem("50%", QVariant(0.5f));
ui_->simulation_speed_chooser->addItem("75%", QVariant(0.75f));
ui_->simulation_speed_chooser->addItem("100%", QVariant(1.0f));
ui_->simulation_speed_chooser->addItem("150%", QVariant(1.5f));
ui_->simulation_speed_chooser->addItem("200%", QVariant(2.0f));
ui_->simulation_speed_chooser->addItem("300%", QVariant(3.0f));
ui_->simulation_speed_chooser->addItem("400%", QVariant(4.0f));
ui_->simulation_speed_chooser->addItem("500%", QVariant(5.0f));
ui_->simulation_speed_chooser->setCurrentIndex(3);
}
void MainWindow::eliteSpecimenNumberChanged() {
QString new_text = ui_->elite_specimen_number_edit->text();
bool is_int;
std::size_t elite_specimen = new_text.toInt(&is_int);
if (is_int)
population_.setEliteSpecimen(elite_specimen);
ui_->elite_specimen_number_edit->setText(QString::number(population_.eliteSpecimen()));
}
void MainWindow::mutationSizeChanged() {
bool is_float;
float mutation_size = ui_->mutation_size_edit->text().toFloat(&is_float);
if (is_float)
population_.setMutationRate(mutation_size);
ui_->mutation_size_edit->setText(QString().setNum(population_.mutationRate()));
}
void MainWindow::saveToFile() {
if (!ui_->pause_button->isChecked())
pauseSimulation();
QFileDialog file_dialog{this, "Load Population", "", "Text Files (*.txt);;AllFiles (*)"};
file_dialog.setAcceptMode(QFileDialog::AcceptSave);
file_dialog.setFileMode(QFileDialog::AnyFile);
file_dialog.setOption(QFileDialog::DontUseNativeDialog, true);
if(QDialog::Accepted != file_dialog.exec()) {
if (!ui_->pause_button->isChecked())
resumeSimulation();
return;
}
QString filename = file_dialog.selectedFiles().at(0);
if (!filename.isEmpty())
population_.saveToFile(filename.toStdString());
if (!ui_->pause_button->isChecked())
resumeSimulation();
}
void MainWindow::loadFromFile() {
if (!ui_->pause_button->isChecked())
pauseSimulation();
QFileDialog file_dialog{this, "Load Population", "", "Text Files (*.txt);;AllFiles (*)"};
file_dialog.setAcceptMode(QFileDialog::AcceptOpen);
file_dialog.setFileMode(QFileDialog::ExistingFile);
file_dialog.setOption(QFileDialog::DontUseNativeDialog, true);
if(QDialog::Accepted != file_dialog.exec()) {
if (!ui_->pause_button->isChecked())
resumeSimulation();
return;
}
QString filename = file_dialog.selectedFiles().at(0);
if (!filename.isEmpty())
population_.loadFromFile(filename.toStdString());
if (!ui_->pause_button->isChecked())
resumeSimulation();
}
void MainWindow::pauseSimulation(bool paused) {
if (paused)
pauseSimulation();
else
resumeSimulation();
}
void MainWindow::carsNumberChanged() {
QString new_text = ui_->cars_count_edit->text();
bool is_int;
std::size_t cars_number = new_text.toInt(&is_int);
if (is_int)
population_.setNextGenerationSize(cars_number);
ui_->cars_count_edit->setText(QString::number(population_.nextGenerationSize()));
ui_->elite_specimen_number_edit->setText(QString::number(population_.eliteSpecimen()));
}
void MainWindow::resetSimulation() {
statistic_view_.reset();
simulation_.reset();
population_.reset();
}
void MainWindow::speedChanged() {
float time_speed = ui_->simulation_speed_chooser->currentData().toFloat();
loop_.setTimeSpeed(time_speed);
}
void MainWindow::pauseSimulation() {
loop_.stop();
}
void MainWindow::resumeSimulation() {
loop_.start();
} | 40.562914 | 149 | 0.718857 | [
"vector"
] |
b37a36771ae72af98ab051fcd9fa65b7dc444f62 | 1,169 | cpp | C++ | CleaningShift/CleaningShift.cpp | biyue111/POJ | 7b45d737015b22c6b3a5eaa539bcc157a78010fc | [
"MIT"
] | null | null | null | CleaningShift/CleaningShift.cpp | biyue111/POJ | 7b45d737015b22c6b3a5eaa539bcc157a78010fc | [
"MIT"
] | null | null | null | CleaningShift/CleaningShift.cpp | biyue111/POJ | 7b45d737015b22c6b3a5eaa539bcc157a78010fc | [
"MIT"
] | null | null | null | //Date : 2016-1-19
//
#include <cstdio>
#include <algorithm>
#include <vector>
using namespace std;
bool compare(const pair<int,int> a,const pair<int,int> b)
{
return a.first < b.first;
}
int main()
{
vector< pair<int,int> > teams;
int N,T,tmpb,tmpe,endtime,num,begintime,flag;
scanf("%d%d",&N,&T);
for(int i=0;i<N;i++){
scanf("%d%d",&tmpb,&tmpe);
teams.push_back(make_pair(tmpb,tmpe));
}
sort(teams.begin(),teams.end(),compare);
endtime = 0;
begintime = 0;
num = 1;
flag = 1;
for(int i=0;i<N;i++){
if(teams[i].first<=begintime+1){
if(teams[i].second>endtime) endtime = teams[i].second;
if(endtime == T) break;
}
else if(teams[i].first<=endtime+1){ //teams[i].frist > begintime+1
begintime = endtime;
num++;
if(teams[i].second>endtime) endtime = teams[i].second;
if(endtime == T) break;
}
else if(teams[i].first>endtime+1){
flag = 0;
break;
}
}
if(endtime < T) flag = 0;
if(flag) printf("%d\n",num);
else printf("-1\n");
return 0;
}
| 21.648148 | 74 | 0.523524 | [
"vector"
] |
b38148d6229dd1eb3becef8a23429aafec15fcab | 1,761 | hpp | C++ | 1.48/tuning/object.hpp | spirick/tuninglib | c390d7abc74847be0ebd9d08905151d72347ab82 | [
"MIT"
] | 3 | 2021-12-01T18:31:31.000Z | 2021-12-06T02:15:00.000Z | 1.48/tuning/object.hpp | spirick/tuninglib | c390d7abc74847be0ebd9d08905151d72347ab82 | [
"MIT"
] | null | null | null | 1.48/tuning/object.hpp | spirick/tuninglib | c390d7abc74847be0ebd9d08905151d72347ab82 | [
"MIT"
] | null | null | null |
// Spirick Tuning
//
// A C++ class and template library
// for performance critical applications.
// Copyright (C) 1996-2021 Dietmar Deimling.
// All rights reserved.
// Internet www.spirick.com
// E-Mail info@spirick.com
//
// Version 1.48
// File tuning/object.hpp
#ifndef TUNING_OBJECT_HPP
#define TUNING_OBJECT_HPP
#include "tuning/defs.hpp"
//---------------------------------------------------------------------------
#define TL_CLASSID(t_class) \
static t_ClassId ClassId () { return (t_ClassId) t_class::ClassId; } \
virtual t_ClassId GetClassId () const { return (t_ClassId) t_class::ClassId; } \
virtual const char * GetClassName () const { return # t_class; } \
virtual bool IsKindOf (t_ClassId o_id) const;
#define TL_ISKINDOF(t_class, t_base) \
bool t_class::IsKindOf (t_ClassId o_id) const \
{ \
if (ClassId () == o_id) \
return true; \
else \
return t_base::IsKindOf (o_id); \
}
//---------------------------------------------------------------------------
class TL_EXPORT ct_Object
{
public:
virtual ~ct_Object () { }
typedef void (* t_ClassId) ();
TL_CLASSID (ct_Object)
virtual bool operator < (const ct_Object & co_comp) const;
virtual t_UInt GetHash () const;
inline void Swap (ct_Object &) { }
};
//---------------------------------------------------------------------------
class TL_EXPORT ct_Empty
{
public:
inline void Swap (ct_Empty &) { }
};
#endif
| 29.35 | 87 | 0.467916 | [
"object"
] |
b383084d8af799200cdbf005c069333f707a0db0 | 6,536 | hpp | C++ | src/axom/primal/operators/closest_point.hpp | Parqua/axom | c3a64b372d25e53976b3ba8676a25acc49a9a6cd | [
"BSD-3-Clause"
] | null | null | null | src/axom/primal/operators/closest_point.hpp | Parqua/axom | c3a64b372d25e53976b3ba8676a25acc49a9a6cd | [
"BSD-3-Clause"
] | null | null | null | src/axom/primal/operators/closest_point.hpp | Parqua/axom | c3a64b372d25e53976b3ba8676a25acc49a9a6cd | [
"BSD-3-Clause"
] | null | null | null | // Copyright (c) 2017-2020, Lawrence Livermore National Security, LLC and
// other Axom Project Developers. See the top-level COPYRIGHT file for details.
//
// SPDX-License-Identifier: (BSD-3-Clause)
/*!
* \file
*
* \brief Consists of a set of methods that compute the closest point on a
* geometric primitive B from another geometric primitive A.
*
*/
#ifndef CLOSEST_POINT_HPP_
#define CLOSEST_POINT_HPP_
#include "axom/primal/geometry/Point.hpp"
#include "axom/primal/geometry/Triangle.hpp"
#include "axom/primal/geometry/OrientedBoundingBox.hpp"
namespace axom
{
namespace primal
{
/*!
* \brief Computes the closest point from a point, P, to a given triangle.
*
* \param [in] P the query point
* \param [in] tri user-supplied triangle.
* \param [out] loc int pointer to store location of closest point (optional).
* \return cp the closest point from a point P and a triangle.
*
* \note If the optional int pointer is supplied for `loc`, the method returns
* the location of the closest point, which is illustrated in the schematic
* diagram below and encoded as follows:
* <ul>
* <li> loc \f$ \in [0,2] \f$, loc corresponds to the triangle node index </li>
* <li> loc \f$ \in [-3,-1] \f$, abs(loc) corresponds to an edge </li>
* <li> loc >= 3, loc is on a triangle face </li>
* </ul>
*
* \verbatim
*
* 2
* /\
* (-3)--/ \--(-2)
* / \
* /_ _ _ \
* 0 | 1
* |
* (-1)
*
* \endverbatim
*
* \pre NDIMS==2 || NDIMS==3
*
* \note Implementation is based on "Real Time Collision Detection,
* Chapter 5.1.5 Closest Point on Triangle to Point".
*/
template < typename T, int NDIMS >
inline Point< T,NDIMS > closest_point( const Point< T,NDIMS >& P,
const Triangle< T,NDIMS >& tri,
int* loc=nullptr )
{
// convenience macros to access triangle vertices
#define A(t) t[0]
#define B(t) t[1]
#define C(t) t[2]
// Check if P in vertex region outside A
Vector< T, NDIMS > ab( A(tri), B(tri) );
Vector< T, NDIMS > ac( A(tri), C(tri) );
Vector< T, NDIMS > ap( A(tri),P );
T d1 = Vector< T,NDIMS >::dot_product( ab, ap );
T d2 = Vector< T,NDIMS >::dot_product( ac, ap );
if ( d1 <= 0.0f && d2 <= 0.0f )
{
// A is the closest point
if ( loc != nullptr)
{
*loc = 0;
}
return ( A(tri) );
} // END if
//----------------------------------------------------------------------------
// Check if P in vertex region outside B
Vector< T,NDIMS > bp( B(tri), P );
T d3 = Vector< T,NDIMS >::dot_product( ab, bp );
T d4 = Vector< T,NDIMS >::dot_product( ac, bp );
if ( d3 >= 0.0f && d4 <= d3 )
{
// B is the closest point
if ( loc != nullptr)
{
*loc = 1;
}
return ( B(tri) );
} // END if
//----------------------------------------------------------------------------
// Check if P in edge region of AB
T vc = d1*d4 - d3*d2;
if ( vc <= 0.0f && d1 >= 0.0f && d3 <= 0.0f )
{
T v = d1 / ( d1-d3 );
Vector< T,NDIMS > v_ab = ab*v;
double x = A(tri)[0] + v_ab[0];
double y = A(tri)[1] + v_ab[1];
double z = (NDIMS==3) ? A(tri)[2] + v_ab[2] : 0.0;
if ( loc != nullptr )
{
*loc = -1;
}
return ( Point< T,NDIMS >::make_point( x,y,z ) );
} // END if
//----------------------------------------------------------------------------
// Check if P in vertex region outside C
Vector< T,NDIMS > cp( C(tri), P );
T d5 = Vector< T,NDIMS >::dot_product(ab,cp);
T d6 = Vector< T,NDIMS >::dot_product(ac,cp);
if ( d6 >= 0.0f && d5 <= d6 )
{
// C is the closest point
if ( loc != nullptr )
{
*loc = 2;
}
return ( C(tri) );
}
//----------------------------------------------------------------------------
// Check if P in edge region of AC
T vb = d5*d2 - d1*d6;
if ( vb <= 0.0f && d2 >= 0.0f && d6 <= 0.0f )
{
T w = d2 / (d2-d6);
Vector< T, NDIMS > w_ac = ac*w;
double x = A(tri)[0] + w_ac[0];
double y = A(tri)[1] + w_ac[1];
double z = (NDIMS==3) ? A(tri)[2] + w_ac[2] : 0.0;
if ( loc != nullptr)
{
*loc = -3;
}
return ( Point< T,NDIMS >::make_point( x,y,z ) );
} // END if
//----------------------------------------------------------------------------
// Check if P in edge region of BC
T va = d3*d6 - d5*d4;
if ( va <= 0.0f && (d4-d3) >= 0.0f && (d5-d6) >= 0.0f )
{
T w = (d4-d3)/( (d4-d3)+(d5-d6) );
Vector< T,NDIMS > bc( B(tri), C(tri) );
Vector< T,NDIMS > w_bc = bc*w;
double x = B(tri)[0] + w_bc[0];
double y = B(tri)[1] + w_bc[1];
double z = (NDIMS==3) ? B(tri)[2] + w_bc[2] : 0.0;
if ( loc != nullptr )
{
*loc = -2;
}
return ( Point< T,NDIMS >::make_point( x,y,z ) );
} // END if
//----------------------------------------------------------------------------
// P is inside face region
T denom = 1.0f / (va + vb + vc );
T v = vb * denom;
T w = vc * denom;
Vector< T,NDIMS > N = (ab*v) + (ac*w);
double x = A(tri)[0] + N[0];
double y = A(tri)[1] + N[1];
double z = (NDIMS==3) ? A(tri)[2] + N[2] : 0.0;
if ( loc != nullptr )
{
*loc = Triangle< T,NDIMS >::NUM_TRI_VERTS;
}
return ( Point< T,NDIMS >::make_point( x,y,z ) );
#undef A
#undef B
#undef C
}
/*!
* \brief Computes the closest point from a point to a given OBB.
*
* \param [in] pt the query pt.
* \param [in] obb user-supplied oriented bounding box.
* \return cp the closest point from a point pt and an OBB.
*/
template < typename T, int NDIMS >
inline Point< T, NDIMS > closest_point(const Point< T, NDIMS >& pt,
const OrientedBoundingBox< T,
NDIMS >& obb)
{
Vector< T, NDIMS > e = obb.getExtents();
const Vector< T, NDIMS >* u = obb.getAxes();
Vector< T, NDIMS > pt_l = obb.toLocal(pt);
Vector< T, NDIMS > res(obb.getCentroid());
for (int i = 0 ; i < NDIMS ; i++)
{
// since the local coordinates are individually constrained, we can simply
// choose the "best" local coordinate in each axis direction
if (pt_l[i] <= e[i] && pt_l[i] >= -e[i])
{
res += pt_l[i]*u[i];
}
else if (pt_l[i] > e[i])
{
res += e[i]*u[i];
}
else
{
res -= e[i]*u[i];
}
}
return Point< T, NDIMS >(res.array());
}
} /* namespace primal */
} /* namespace axom */
#endif /* CLOSEST_POINT_HPP_ */
| 25.631373 | 80 | 0.493727 | [
"geometry",
"vector"
] |
b39166c7d90fd981c39d4bdef09588ce5071b759 | 766 | hpp | C++ | lib/native/stopword.hpp | nurcahyaari/Vector-Space-Model-using-Cosine-Similarity | 7841347cacf9466b6f9173c82dde97d71cffb82d | [
"MIT"
] | 2 | 2020-04-22T06:00:28.000Z | 2020-04-22T19:17:56.000Z | lib/native/stopword.hpp | nurcahyaari/Vector-Space-Model-using-Cosine-Similarity | 7841347cacf9466b6f9173c82dde97d71cffb82d | [
"MIT"
] | 1 | 2021-05-11T11:22:18.000Z | 2021-05-11T11:22:18.000Z | lib/native/stopword.hpp | nurcahyaari/Vector-Space-Model-using-Cosine-Similarity | 7841347cacf9466b6f9173c82dde97d71cffb82d | [
"MIT"
] | null | null | null | #include<iostream>
#include<iterator>
#include<vector>
#include<fstream>
#include<string.h>
using namespace std;
class Stopword {
private:
vector<string> text;
void readFileFromDb();
public:
Stopword(vector<string> text);
string SearchText();
};
Stopword::Stopword(vector<string> text){
for(int i = 0; i < text.size(); i++){
this.text.push_back(text);
}
}
string Stopword::SearchText(){
ifstream stopwordFile;
string line;
bool found;
stopwordFile.open("./db/stopword.db.txt");
if (stopwordFile.is_open()){
while ( getline (stopwordFile,line) ){
if(line == "mau"){
found = false;
}
}
stopwordFile.close();
}
}
| 20.157895 | 46 | 0.571802 | [
"vector"
] |
b3964a3e053806e4a318d17a407363882ff3f338 | 2,121 | cpp | C++ | cod_solucaoInicial.cpp | BrunoBertozzi/tcc-2021 | d1a1837d28f7507598e96818ade50671a1050efc | [
"MIT"
] | null | null | null | cod_solucaoInicial.cpp | BrunoBertozzi/tcc-2021 | d1a1837d28f7507598e96818ade50671a1050efc | [
"MIT"
] | null | null | null | cod_solucaoInicial.cpp | BrunoBertozzi/tcc-2021 | d1a1837d28f7507598e96818ade50671a1050efc | [
"MIT"
] | null | null | null | /***************************************************************
* Nome: Bruno Oswaldo Bertozzi Oliveira
* File name: main.cpp
* Data 17/02/2021
*
***************************************************************/
#include <iostream>
#include <vector>
#include <iostream>
#include<fstream>
#include <algorithm>
#include <bits/stdc++.h>
using namespace std;
#include "head_struct.h"
#include "head_solucaoInicial.h"
void firstFit_ordenado (vector<Tbin> &bins, const vector<Titem> itens, const TinfoBins infoBins, const int **matriz_adj){
vector<Titem> itens_ordenados = itens;
int contador_bins = 0, aux = -1;
int j;
sort(itens_ordenados.begin(), itens_ordenados.end(), sort_peso);
for(unsigned int i = 0; i < itens_ordenados.size(); i++){
for(j = 0; j < contador_bins; j++){
aux = -1;
aux = confere_conflito(itens_ordenados[i].idItem, bins, j, matriz_adj);
if(bins[j].pesoLivre >= itens_ordenados[i].peso && aux == 0){
bins[j].pesoUsado += itens_ordenados[i].peso;
bins[j].pesoLivre -= itens_ordenados[i].peso;
bins[j].items.push_back(itens_ordenados[i].idItem);
break;
}
}
if(j == contador_bins){
bins[contador_bins].pesoUsado += itens_ordenados[i].peso;
bins[contador_bins].pesoLivre -= itens_ordenados[i].peso;
bins[contador_bins].items.push_back(itens_ordenados[i].idItem);
contador_bins++;
}
}
bins.resize(contador_bins);
}
bool sort_peso (const Titem &a, const Titem &b){
return a.peso > b.peso;
}
int confere_conflito(int id_obj, const vector<Tbin> bins, int j , const int **matriz_adj){
int quant_itens = bins[j].items.size();
if(quant_itens == 0){
return 0;
}
int i = 0;
while(i < quant_itens){
if(matriz_adj[bins[j].items[i]-1][(id_obj-1)] == 1 || matriz_adj [id_obj-1][bins[j].items[i]-1] == 1){
return 1;
}
i++;
}
return 0;
}
| 29.873239 | 122 | 0.542197 | [
"vector"
] |
b39bcbec05d02e4d9c9b8c293aea840eb5f4c54b | 3,697 | cpp | C++ | src/mapnik_js_datasource.cpp | calvinmetcalf/node-mapnik | 3d26f2089dee3cfc901965f6646d50004a0e0e56 | [
"BSD-3-Clause"
] | null | null | null | src/mapnik_js_datasource.cpp | calvinmetcalf/node-mapnik | 3d26f2089dee3cfc901965f6646d50004a0e0e56 | [
"BSD-3-Clause"
] | null | null | null | src/mapnik_js_datasource.cpp | calvinmetcalf/node-mapnik | 3d26f2089dee3cfc901965f6646d50004a0e0e56 | [
"BSD-3-Clause"
] | null | null | null | /*
#include <mapnik/datasource_cache.hpp>
#include "mapnik_js_datasource.hpp"
#include "utils.hpp"
#include "mem_datasource.hpp"
Persistent<FunctionTemplate> JSDatasource::constructor;
void JSDatasource::Initialize(Handle<Object> target) {
HandleScope scope;
constructor = Persistent<FunctionTemplate>::New(FunctionTemplate::New(JSDatasource::New));
constructor->InstanceTemplate()->SetInternalFieldCount(1);
constructor->SetClassName(String::NewSymbol("JSDatasource"));
// methods
NODE_SET_PROTOTYPE_METHOD(constructor, "next", next);
target->Set(String::NewSymbol("JSDatasource"),constructor->GetFunction());
}
JSDatasource::JSDatasource() :
ObjectWrap(),
ds_ptr_() {}
JSDatasource::~JSDatasource()
{
}
Handle<Value> JSDatasource::New(const Arguments& args)
{
if (!args.IsConstructCall())
return ThrowException(String::New("Cannot call constructor as function, you need to use 'new' keyword"));
if (args[0]->IsExternal())
{
//std::clog << "external!\n";
Local<External> ext = Local<External>::Cast(args[0]);
void* ptr = ext->Value();
JSDatasource* d = static_cast<JSDatasource*>(ptr);
d->Wrap(args.This());
return args.This();
}
if (!args.Length() == 2){
return ThrowException(Exception::TypeError(
String::New("two argument required: an object of key:value datasource options and a callback function for features")));
}
if (!args[0]->IsObject())
return ThrowException(Exception::TypeError(
String::New("Must provide an object, eg {extent: '-180,-90,180,90'}")));
Local<Object> options = args[0]->ToObject();
// function callback
if (!args[args.Length()-1]->IsFunction())
return ThrowException(Exception::TypeError(
String::New("last argument must be a callback function")));
// TODO - maybe validate in js?
bool bind=true;
if (options->Has(String::New("bind")))
{
Local<Value> bind_opt = options->Get(String::New("bind"));
if (!bind_opt->IsBoolean())
return ThrowException(Exception::TypeError(
String::New("'bind' must be a Boolean")));
bind = bind_opt->BooleanValue();
}
mapnik::parameters params;
params["type"] = "js";
Local<Array> names = options->GetPropertyNames();
unsigned int i = 0;
unsigned int a_length = names->Length();
while (i < a_length) {
Local<Value> name = names->Get(i)->ToString();
Local<Value> value = options->Get(name);
params[TOSTR(name)] = TOSTR(value);
i++;
}
mapnik::datasource_ptr ds;
try
{
ds = mapnik::datasource_ptr(new js_datasource(params,bind,args[args.Length()-1]));
}
catch (std::exception const& ex)
{
return ThrowException(Exception::Error(
String::New(ex.what())));
}
catch (...)
{
return ThrowException(Exception::Error(
String::New("unknown exception happened, please file bug")));
}
if (ds)
{
JSDatasource* d = new JSDatasource();
d->Wrap(args.This());
d->ds_ptr_ = ds;
return args.This();
}
return Undefined();
}
Handle<Value> JSDatasource::next(const Arguments& args)
{
HandleScope scope;
JSDatasource* d = node::ObjectWrap::Unwrap<JSDatasource>(args.This());
js_datasource *js = dynamic_cast<js_datasource *>(d->ds_ptr_.get());
return scope.Close((*js->cb_)->Call(Context::GetCurrent()->Global(), 0, NULL));
}
*/
| 29.576 | 153 | 0.60211 | [
"object"
] |
b39e7bd94200ee5d4b66faa8c5ad784df0bad79e | 1,795 | cpp | C++ | UVA/Map/417_WordIndex.cpp | shiva92/Contests | 720bb3699f774a6ea1f99e888e0cd784e63130c8 | [
"Apache-2.0"
] | null | null | null | UVA/Map/417_WordIndex.cpp | shiva92/Contests | 720bb3699f774a6ea1f99e888e0cd784e63130c8 | [
"Apache-2.0"
] | null | null | null | UVA/Map/417_WordIndex.cpp | shiva92/Contests | 720bb3699f774a6ea1f99e888e0cd784e63130c8 | [
"Apache-2.0"
] | null | null | null | #include <iostream>
#include <cstdlib>
#include <cstring>
#include <vector>
#include <algorithm>
#include <queue>
#include <stack>
#include <deque>
#include <sstream>
#include <set>
#include <climits>
#include <cstdio>
#include <string>
#include <map>
#include <unordered_map>
using namespace std;
int alpha[26];
char str[7];
int i, len;
bool flag = false;
map<string, int> mp[5];
string letters[] = {"a", "b", "c", "d", "e", "f", "g", "h", "i", "j", "k", "l", "m", "n", "o", "p", "q", "r", "s", "t", "u", "v", "w", "x", "y", "z"};
string temp = "";
map<string, int> result;
void compute() {
for (i = 0; i < 26; i++)
mp[0][letters[i]] = i + 1;
int idx = 27;
for (i = 1; i <= 4; i++) {
for (map<string, int>::iterator it = mp[i - 1].begin(); it != mp[i - 1].end(); it++) {
temp = it->first;
len = temp.length();
for (char j = temp[len - 1] + 1; j <= 'z'; j++) {
mp[i][(temp + j)] = idx++;
}
}
}
for (i = 0; i <= 4; i++) {
for (map<string, int>::iterator it = mp[i].begin(); it != mp[i].end(); it++) {
result[it->first] = it->second;
}
}
// for (map<string, int>::iterator it = result.begin(); it != result.end(); it++) {
// cout << it->first << " " << it->second << '\n';
// }
}
void efficient() {
queue<string> q;
for (i = 0; i < 26; i++)
q.push(letters[i]);
int count = 1;
string s;
while (!q.empty()) {
s = q.front();
q.pop();
result[s] = count++;
if (s.size() == 5)
continue;
for (char j = s[s.size() - 1] + 1; j <= 'z'; j++)
q.push(s + j);
}
}
int main() {
#ifndef ONLINE_JUDGE
freopen("1.txt", "r", stdin);
freopen("2.txt", "w", stdout);
#endif
efficient();
while (scanf("%s", &str) != EOF) {
printf("%d\n", result[string(str)]);
}
}
| 22.4375 | 151 | 0.491365 | [
"vector"
] |
b39ff81e79a5728fac616bc21e1c31c7e9ef088d | 5,867 | cpp | C++ | X4ConverterTools/src/model/Part.cpp | dsedivec/X4Converter | 1713f2efa266bba29bc395567e58b933060bb923 | [
"MIT"
] | 5 | 2019-08-03T19:59:39.000Z | 2022-01-29T23:50:55.000Z | X4ConverterTools/src/model/Part.cpp | dsedivec/X4Converter | 1713f2efa266bba29bc395567e58b933060bb923 | [
"MIT"
] | 2 | 2019-12-06T20:19:29.000Z | 2021-05-05T07:07:05.000Z | X4ConverterTools/src/model/Part.cpp | dsedivec/X4Converter | 1713f2efa266bba29bc395567e58b933060bb923 | [
"MIT"
] | 2 | 2021-12-11T12:27:07.000Z | 2021-12-14T04:14:19.000Z | #include "X4ConverterTools/model/Part.h"
#include <string>
#include <iostream>
#include <X4ConverterTools/model/CollisionLod.h>
#include <X4ConverterTools/model/VisualLod.h>
#include <regex>
namespace model {
Part::Part(std::shared_ptr<ConversionContext> ctx) : AbstractElement(ctx) {
hasRef = false;
collisionLod = nullptr;
}
Part::Part(pugi::xml_node node, std::shared_ptr<ConversionContext> ctx) : AbstractElement(ctx) {
if (std::string(node.name()) != "part") {
throw std::runtime_error("XML element must be a <part> element!");
}
if (node.attribute("name").empty()) {
throw std::runtime_error("Part must have a name attribute!");
}
hasRef = false;
for (auto attr: node.attributes()) {
auto attrName = std::string(attr.name());
if (attrName == "ref") {
hasRef = true;
attrs["DO_NOT_EDIT.ref"] = attr.value();
} else if (attrName == "name") {
setName(attr.value());
} else {
std::cerr << "Warning, unhandled attribute on part: " << getName() << " attribute: " << attrName
<< ". This may work fine, just a heads up ;)" << std::endl;
attrs[attrName] = attr.value();
}
}
auto lodsNode = node.child("lods");
if (hasRef && !lodsNode.empty()) {
throw std::runtime_error("ref should not contain lods");
}
// TODO common with Layer
auto lightsNode = node.child("lights");
if (!lightsNode.empty()) {
for (auto lightNode: lightsNode.children()) {
lights.emplace_back(lightNode, ctx, getName());
}
}
// TODO figure out a better way
if (!hasRef) {
collisionLod = std::make_unique<CollisionLod>(getName(), ctx);
for (auto lodNode : lodsNode.children()) {
auto lod = VisualLod(lodNode, getName(), ctx);
lods.insert(std::pair<int, VisualLod>(lod.getIndex(), lod));
}
}
}
aiNode *Part::ConvertToAiNode() {
auto *result = new aiNode(getName());
std::vector<aiNode *> children = attrToAiNode();
if (!hasRef) {
children.push_back(collisionLod->ConvertToAiNode());
for (auto lod: lods) {
children.push_back(lod.second.ConvertToAiNode());
}
auto lightResult = new aiNode();
lightResult->mName = getName() + "-lights";
// TODO should really add a Lights object or something
std::vector<aiNode *> lightChildren;
for (auto light: lights) {
lightChildren.push_back(light.ConvertToAiNode());
}
populateAiNodeChildren(lightResult, lightChildren);
children.push_back(lightResult);
}
populateAiNodeChildren(result, children);
return result;
}
static std::regex lodRegex("[^-]+\\-lod\\d");
static std::regex collisionRegex("[^-]+\\-collision");
void Part::ConvertFromAiNode(aiNode *node) {
std::string name = node->mName.C_Str();
setName(name);
for (int i = 0; i < node->mNumChildren; i++) {
auto child = node->mChildren[i];
std::string childName = child->mName.C_Str();
// TODO check part names?
if (childName == name + "-lights") {
handleAiLights(child);
} else if (regex_match(childName, lodRegex)) {
auto lod = VisualLod(ctx);
lod.ConvertFromAiNode(child);
lods.insert(std::pair<int, VisualLod>(lod.getIndex(), lod));
} else if (regex_match(childName, collisionRegex)) {
collisionLod = std::make_unique<CollisionLod>(ctx);
collisionLod->ConvertFromAiNode(child);
} else if (childName.find('*') != std::string::npos) {
// Ignore connection, handled elsewhere
} else {
readAiNodeChild(node, child);
}
}
// TODO more
}
void Part::handleAiLights(aiNode *node) {
for (int i = 0; i < node->mNumChildren; i++) {
auto child = node->mChildren[i];
lights.emplace_back(child, ctx);
}
}
void Part::ConvertToGameFormat(pugi::xml_node out) {
if (std::string(out.name()) != "parts") {
throw std::runtime_error("part must be appended to a parts xml element");
}
auto partNode = AddChildByAttr(out, "part", "name", getName());
// Note the return statement! referenced parts don't get LODS!!!
// TODO remove if lods exist or at least error out
if (attrs.count("DO_NOT_EDIT.ref")) {
hasRef = true;
auto value = attrs["DO_NOT_EDIT.ref"];
if (partNode.attribute("ref")) {
partNode.attribute("ref").set_value(value.c_str());
} else {
partNode.prepend_attribute("ref").set_value(value.c_str());
}
return;
}
for (const auto &attr : attrs) {
WriteAttr(partNode, attr.first, attr.second);
}
if (!lods.empty()) {
auto lodsNode = AddChild(partNode, "lods");
collisionLod->ConvertToGameFormat(partNode);
for (auto lod : lods) {
lod.second.ConvertToGameFormat(lodsNode);
}
} else {
partNode.remove_child("lods");
}
if (!lights.empty()) {
auto lightsNode = AddChild(partNode, "lights");
for (auto light : lights) {
light.ConvertToGameFormat(lightsNode);
}
}
// TODO out more
}
} | 35.77439 | 112 | 0.534686 | [
"object",
"vector",
"model"
] |
b3a22e8fc392e22afed418657cda23b5a482e195 | 139 | hpp | C++ | addons/ammunition/ammo/762x39.hpp | Theseus-Aegis/GTArmory | 771c33044c87625b1b19896fab9aad0fa5a7f21c | [
"MIT"
] | 2 | 2020-02-11T08:08:00.000Z | 2020-11-06T13:51:29.000Z | addons/ammunition/ammo/762x39.hpp | Theseus-Aegis/GTArmory | 771c33044c87625b1b19896fab9aad0fa5a7f21c | [
"MIT"
] | 13 | 2020-02-10T19:04:32.000Z | 2021-05-25T14:38:30.000Z | addons/ammunition/ammo/762x39.hpp | Theseus-Aegis/GTArmory | 771c33044c87625b1b19896fab9aad0fa5a7f21c | [
"MIT"
] | 1 | 2021-04-24T20:40:31.000Z | 2021-04-24T20:40:31.000Z | class CLASS(762x39_BP): B_762x39_Ball_F {
hit = 14;
caliber = 2.1;
model = "\A3\Weapons_f\Data\bullettracer\tracer_yellow";
};
| 23.166667 | 60 | 0.669065 | [
"model"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.