text
stringlengths 166
589k
| __index_level_0__
int64 1
312k
|
|---|---|
Oracle RAC: Member voting
The CGS is responsible for checking whether members are valid. To determine periodically whether all members are alive, a voting mechanism is used to check the validity of each member. All members in the database group vote by providing details of what they presume the instance membership bitmap looks like. As mentioned, the bitmap is stored in the GRD. A predetermined master member tallies the vote flags of the status flag and communicates to the respective processes that the voting is done; then it waits for registration by all the members who have received the reconfigured bitmap.
How Voting Happens The CKPT process updates the control file every 3 seconds in an operation known as the heartbeat. CKPT writes into a single block that is unique for each instance, thus intra-instance coordination is not required. This block is called the checkpoint progress record.
All members attempt to obtain a lock on a control file record (the result record) for updating. The instance that obtains the lock tallies the votes from all members. The group membership must conform to the decided (voted) membership before allowing the GCS/GES reconfiguration to proceed. The control file vote result record is stored in the same block as the heartbeat in the control file checkpoint progress record.
In this scenario of dead instances and member evictions, a potentially disastrous situation could arise if pending I/O from a dead instance is to be flushed to the I/O subsystem. This could lead to potential data corruption. I/O from an abnormally departing instance cannot be flushed to disk if database integrity is to be maintained. To "shield" the database from data corruption in this situation, a technique called I/O fencing is used. I/O fencing implementation is a function of CM and depends on the clusterware vendor.
I/O fencing is designed to guarantee data integrity in the case of faulty cluster communications causing a split-brain condition. A split-brain occurs when cluster nodes hang or node interconnects fail, and as a result, the nodes lose the communication link between them and the cluster. Split-brain is a problem in any clustered environment and is a symptom of clustering solutions and not RAC. Split-brain conditions can cause database corruption when nodes become uncoordinated in their access to the shared data files.
For a two-node cluster, split-brain occurs when nodes in a cluster cannot talk to each other (the internode links fail) and each node assumes it is the only surviving member of the cluster. If the nodes in the cluster have uncoordinated access to the shared storage area, they would end up overwriting each other's data, causing data corruption because each node assumes ownership of shared data. To prevent data corruption, one node must be asked to leave the cluster or should be forced out immediately. This is where IMR comes in, as explained earlier in the chapter.
Many internal (hidden) parameters control IMR and determine when it should start. If a vendor clusterware is used, split-brain resolution is left to it and Oracle would have to wait for the clusterware to provide a consistent view of the cluster and resolve the split-brain issue. This can potentially cause a delay (and a hang in the whole cluster) because each node can potentially think it is the master and try to own all the shared resources. Still, Oracle relies on the clusterware for resolving these challenging issues.
Note that Oracle does not wait indefinitely for the clusterware to resolve a split-brain issue, but a timer is used to trigger an IMR-based node eviction. Theseinternal timers are also controlled using hidden parameters. The default values of these hidden parameters are not to be touched as that can cause severe performance or operational issues with the cluster.
An obvious question that pops up in your mind might be, Why does a split-brain condition take place? Why does Oracle say a link is down, when my communication engineer says its fine? This is easier asked than answered, as the underlying hardware and software layers that support RAC are too complex, and it can be a nightmare trying to figure out why a cluster broke in two when things seem to be normal. Usually, configuration of communication links and bugs in the clusterware can cause these issues.
As mentioned time and again, Oracle completely relies on the cluster software to provide cluster services, and if something is awry, Oracle, in its overzealous quest to protect data integrity, evicts nodes or aborts an instance and assumes that something is wrong with the cluster.
Cluster reconfiguration is initiated when NM indicates a change in the database group, or IMR detects a problem. Reconfiguration is initially managed by the CGS and after this is completed, IDLM (GES/GCS) reconfiguration starts.
Cluster Reconfiguration Steps
The cluster reconfiguration process triggers IMR, and a seven-step process ensures complete reconfiguration.
- Name service is frozen. The CGS contains an internal database of all the members/instances in the cluster with all their configuration and servicing details. The name service provides a mechanism to address this configuration data in a structured and synchronized manner.
- Lock database (IDLM) is frozen. The lock database is frozen to prevent processes from obtaining locks on resources that were mastered by the departing/dead instance.
- Determination of membership and validation and IMR.
- Bitmap rebuild takes place, instance name and uniqueness verification. CGS must synchronize the cluster to be sure that all members get the reconfiguration event and that they all see the same bitmap.
- Delete all dead instance entries and republish all names newly configured.
- Unfreeze and release name service for use.
- Hand over reconfiguration to GES/GCS.
Now that you know when IMR starts and node evictions take place, let's look at the corresponding messages in the alert log and LMON trace files to get a better picture. (The logs have been edited for brevity. Note all the lines in boldface define the most important steps in IMR and the handoff to other recovery steps in CGS.)
Problem with a Node Assume a four-node cluster (instances A, B, C, and D), in which instance C has a problem communicating with other nodes because its private link is down. All other services on this node are assumed to be working normally.
Alter log on instance C:
ORA-29740: evicted by member 2, group incarnation 6 Thu Jun 30 09:15:59 2005 LMON: terminating instance due to error 29740 Instance terminated by LMON, pid = 692304 … … … Alter log on instance A: Thu Jun 30 09:15:59 2005 Communications reconfiguration: instance 2 Evicting instance 3 from cluster Thu Jun 30 09:16:29 2005 Trace dumping is performing id= Thu Jun 30 09:16:31 2005 Waiting for instances to leave: 3 Thu Jun 30 09:16:51 2005 Waiting for instances to leave: 3 Thu Jun 30 09:17:04 2005 Reconfiguration started List of nodes: 0,1,3, Global Resource Directory frozen Communication channels reestablished Master broadcasted resource hash value bitmaps Thu Jun 30 09:17:04 2005 Reconfiguration started LMON trace file on instance A: *** 2005-06-30 09:15:58.262 kjxgrgetresults: Detect reconfig from 1, seq 12, reason 3 kjxgfipccb: msg 0x1113dcfa8, mbo 0x1113dcfa0, type 22, ack 0, ref 0, stat 3 kjxgfipccb: Send timed out, stat 3 inst 2, type 22, tkt (10496,1496) *** 2005-06-30 09:15:59.070 kjxgrcomerr: Communications reconfig: instance 2 (12,4) Submitting asynchronized dump request kjxgfipccb: msg 0x1113d9498, mbo 0x1113d9490, type 22, ack 0, ref 0, stat 6 kjxgfipccb: Send cancelled, stat 6 inst 2, type 22, tkt (10168,1496) kjxgfipccb: msg 0x1113e54a8, mbo 0x1113e54a0, type 22, ack 0, ref 0, stat 6 kjxgfipccb: Send cancelled, stat 6 inst 2, type 22, tkt (9840,1496) Note that Send timed out, stat 3 inst 2 is LMON trying send message(s) to the broken instance. kjxgrrcfgchk: Initiating reconfig, reason 3 /* IMR Initiated */ *** 2005-06-30 09:16:03.305 kjxgmrcfg: Reconfiguration started, reason 3 kjxgmcs: Setting state to 12 0. *** 2005-06-30 09:16:03.449 Name Service frozen kjxgmcs: Setting state to 12 1. *** 2005-06-30 09:16:11.570 Voting results, upd 1, seq 13, bitmap: 0 1 3 Note that instance A has not tallied the vote; hence it has received only the voting results. Here is an extract from the LMON trace file on instance B, which managed to tally the vote: Obtained RR update lock for sequence 13, RR seq 13 *** 2005-06-30 09:16:11.570 Voting results, upd 0, seq 13, bitmap: 0 1 3 … … Here's the LMON trace file on instance A: Evicting mem 2, stat 0x0007 err 0x0002 kjxgmps: proposing substate 2 kjxgmcs: Setting state to 13 2. Performed the unique instance identification check kjxgmps: proposing substate 3 kjxgmcs: Setting state to 13 3. Name Service recovery started Deleted all dead-instance name entries kjxgmps: proposing substate 4 kjxgmcs: Setting state to 13 4. Multicasted all local name entries for publish Replayed all pending requests kjxgmps: proposing substate 5 kjxgmcs: Setting state to 13 5. Name Service normal Name Service recovery done *** 2005-06-30 09:17:04.369 kjxgmrcfg: Reconfiguration started, reason 1 kjxgmcs: Setting state to 13 0. *** 2005-06-30 09:17:04.371 Name Service frozen kjxgmcs: Setting state to 13 1. GES/GCS recovery starts here: Global Resource Directory frozen node 0 node 1 node 3 res_master_weight for node 0 is 632960 res_master_weight for node 1 is 632960 res_master_weight for node 3 is 632960 … … … Death of a Member For the same four-node cluster (A, B, C, and D), instance C has died unexpectedly: kjxgrnbrisalive: (3, 4) not beating, HB: 561027672, 561027672 *** 2005-06-19 00:30:52.018 kjxgrnbrdead: Detected death of 3, initiating reconfig kjxgrrcfgchk: Initiating reconfig, reason 2 *** 2005-06-19 00:30:57.035 kjxgmrcfg: Reconfiguration started, reason 2 kjxgmcs: Setting state to 6 0. *** 2005-06-19 00:30:57.037 Name Service frozen kjxgmcs: Setting state to 6 1. *** 2005-06-19 00:30:57.239 Obtained RR update lock for sequence 6, RR seq 6 *** 2005-06-19 00:33:27.261 Voting results, upd 0, seq 7, bitmap: 0 2 Evicting mem 3, stat 0x0007 err 0x0001 kjxgmps: proposing substate 2 kjxgmcs: Setting state to 7 2. Performed the unique instance identification check kjxgmps: proposing substate 3 kjxgmcs: Setting state to 7 3. Name Service recovery started Deleted all dead-instance name entries kjxgmps: proposing substate 4 kjxgmps: proposing substate 4 kjxgmcs: Setting state to 7 4. Multicasted all local name entries for publish Replayed all pending requests kjxgmps: proposing substate 5 kjxgmcs: Setting state to 7 5. Name Service normal Name Service recovery done *** 2005-06-19 00:33:27.266 kjxgmps: proposing substate 6 … … … kjxgmps: proposing substate 2 GES/GCS recovery starts here: Global Resource Directory frozen node 0 node 2 res_master_weight for node 0 is 632960 res_master_weight for node 2 is 632960 Total master weight = 1265920 Dead inst 3 Join inst Exist inst 0 2
Use the following table of contents to navigate to chapter excerpts or click here to view RAC Troubleshooting in its entirety.
|About the book:|
|Oracle Database 10g: Real Applications Clusters Handbook Learn to implement Oracle real application clusters from the ground up. Maximize database availability, scalability, and efficiency. Find RAC concepts, administration, tuning, and troubleshooting information. You'll learn how to prepare and create Oracle RAC databases and servers, and automate administrative tasks. You'll also get full coverage of cutting-edge Oracle RAC diagnostic tools, backup and recovery procedures, performance tweaks and custom application design strategies. Buy this book at McGraw-Hill/Osborne|
|About the author:|
|K Gopalakrishnan is a senior principal consultant with the Advanced Technology Services group at Oracle Corporation, specializing exclusively in performance tuning, high availability, and disaster recovery. He is a recognized expert in Oracle RAC and Database Internals and has used his extensive expertise in solving many vexing performance issues all across the world for telecom giants, banks, financial institutions, and universities.|
| 273,064
|
For Web companies looking to expand abroad, Russia needs to be at the top of their list of markets to enter. Russia has the fastest growing Internet population in Europe, followed by France and Spain. In a comparison of 16 European Internet populations by country, comScore reports that Russia’s Internet audience for the month of June grew 27 percent year over year, compared to 21 percent growth in France and 15 percent growth in Spain. (Is Russia part of Europe? It is for the purposes of this analysis). If you look at the total size of the Internet populations in each country, however, Russia ranks fifth with 17.5 million monthly Internet visitors. But by Internet penetration, Russia ranks last, with only 14 percent of the total population online. So there is still lots of room for growth there.
France also has strong showing, with 21 percent growth, and ranks third after Germany and the UK in total Internet population, with 31.4 million visitors in June and a 61 percent penetration rate of the total population. The Netherlands, which has the highest penetration rate at 82 percent, actually showed a one percent decline to 11.2 million Internet visitors. I guess there is a limit to growth, even on the Internet.
In terms of regional comparison, comScore counts 240 million unique visitors across Europe in June, versus 190 million in the U.S. and 327 million in the entire Asia-Pacific (excluding public computer usage).
Below are tables ranking the countries by size, growth rates, and penetration.
Here is the list of countries listed in order of size, which I find most useful because it shows which are the biggest addressable markets in Europe:
Here is the same list,ranked by growth rates, year-over-year:
And here is the list ranked by penetration of the total population. Just because a country has a high Internet penetration does not mean it is a huge market (for instance Norway has 76 percent penetration, but only 2.8 million total Internet visitors).
| 288,611
|
Archive for the ‘Beaulieu’ tag
Ford’s GT70 prototype. Photos courtesy Ford Motor Company.
Ford’s GT40 is, perhaps, the automaker’s best known purpose-built racing car. It’s hardly the Blue Oval’s only dedicated racing car, however, and next month a pair of lesser-known competition Fords, including the “direct descendent” of the GT40, will highlight a new exhibition at Britain’s National Motor Museum entitled “A Checkered History.”
As the 1960s gave way to the 1970s, Ford U.K. was struggling to turn the production Escort sedan into a competitive rally car. Though the compact two-door had proven its reliability on tough off-road stages, its lack of speed proved detrimental on the growing number of tarmac stages run in European rally events. After a disappointing finish for Ford at the 1970 Rallye Monte Carlo, the head of Ford’s U.K. racing efforts, Stuart Turner, began discussing ideas for a new competition car with driver Roger Clark.
As Turner explains it, the result was the GT70, a car that “virtually came to life on the back of a postcard.” Unlike the GT40, which was tasked with beating Ferrari at Le Mans, the GT70 would be responsible for beating the Porsche 911 and the Renault Alpine A110 in speed stages of rally events, especially those at high altitude where the Escort struggled the most.
Turner enlisted the help of Len Bailey, the chief engineer on Ford’s GT40 project, to design the body and chassis of the GT70. As with the GT40, the GT70 would embrace a mid-engine layout, with power going through a transaxle to the rear wheels. Designed to support a variety of engines, the one originally chosen for the project was Ford’s 2.6-liter V-6, which produced a respectable 125 horsepower in stock trim.
The first prototype was completed a mere nine months after Turner and Clark first hashed out the idea of the car on the flight back from Monte Carlo. A total of five prototypes were built (though six were originally planned), and to save money the corporate parts bin was raided as much as possible. Testing commenced, and the car made its competition debut at the September 1970 Ronde Cevenole road race, where Clark’s day ended early with engine, suspension and braking issues. The GT70, with its aerodynamic fiberglass body, may have been light enough for competition, but it was not yet durable enough.
Across the Atlantic, Ford in the United States seemed somewhat indifferent to the idea of a limited-production homologation special, built to deliver wins in a sport largely ignored by Americans. Development changes through 1971 and into 1972 (such as swapping out the GT70’s 2.6-liter V-6 in favor of a 1.6-liter Cosworth DBA four) improved the car’s performance, though it still failed to deliver consistent results. Oddly enough, the Escort, whose lack of speed prompted the development of the GT70, was now winning rally events, making the case for the GT70’s continued development harder to justify. Coupled with the numerous changes that would be required to transition the car from prototype to limited production, the decision was made to end the GT70 program by early 1973.
In the early 1980s, Ford was once again trying to prove itself in rally (now World Rally Championship) competition. Unable to compete with the likes of Audi and Lancia, Ford’s Motorsport group set off to design an all-new race car for Group B, the sport’s range-topping class. Dubbed the RS200, Ford’s effort would be powered by a 1.8-liter Cosworth BDT four-cylinder engine, producing as much as 450 horsepower in race trim and as much as 250 horsepower in the 200 road-going homologation specials produced.
To remain competitive with Audi, power would be sent to all for wheels, but via a rather complex drivetrain. With the transmission positioned in front of the engine, power was sent to the front differential first, then split and sent to the rear differential. Despite the complexity of the system, reliability never proved to be an issue, although added weight did hamper the RS200’s competitiveness.
Production began in 1984, but the car’s WRC debut was delayed until the 1986 season. In its first event, the Swedish Rally, the RS200 delivered a podium finish in the hands of Kalle Grundel and co-driver Terry Harryman. The car’s next outing, at the Rallye Portugal, would end in tragedy when driver Joaquim Santos lost control of his car and plunged into a crowd of spectators gathered on the inside of a corner, killing three and injuring over 30 more. The team withdrew for the remainder of the event, and struggled to produce results throughout the remainder of the 1986 WRC season.
Other fatal crashes during the 1986 season sparked the end of Group B competition, as the cars were deemed too fast to be safe. RS200s continued to be driven in rallycross and road racing competition, but the cars never produced the championship results Ford had hoped for. Despite this, the RS200 remains a sought-after collectable, and a reminder of a lost golden age in the world of motorsports.
Both the GT70 (restored by Ford in 2002) and the third prototype RS200 built will be on display at Beaulieu, the National Motor Museum in Brockenhurst, Hampshire, United Kingdom. The “Checkered History” display will be opened by Sir Stirling Moss on March 5, and will open to the general public on March 6. Far more than rally cars will be on display, as planned exhibits also include Graham Hill’s Lotus 49 R3, Damon Hill’s Williams-Renault FW18, a 1903 Gordon Bennet Napier, a 1929 Bloody Mary Bolster Special, a 1950 BRM 1.5-liter V16 Type 15 Mk1, and a 1962 Jaguar E-Type. For additional information, visit Beaulieu.Co.UK.
Photos courtesy Bonhams.
As if we needed more proof that barn finds are a hot commodity nowadays, we need look no further than the 1937 Bugatti Type 57 sports saloon that far exceeded its pre-auction estimate at this past weekend’s Bonhams auction at the Beaulieu Autojumble, ultimately selling for £166,500, or a little more than $260,000.
Found by Bonhams representatives “in a village on the outskirts of Paris,” the Van Vooren-bodied saloon, chassis number 57380, engine number 254, was at one point owned by Le Mans competitor Clément Auguste Martin and is believed to have been off the road since 1968. According to Bonhams’ auction description, the Bugatti “remains very complete and original but in need of a full mechanical restoration at the very least.” Based on their assessment, Bonhams pegged the Bugatti to sell for £40,000 to £50,000, amounts easily surpassed by a number of telephone and in-person bidders competing for the car.
With the Bugatti representing the top sale at the auction, Bonhams netted a total of $2.8 million at Beaulieu. For the complete result list, visit Bonhams.com.
Many Americans may not know this, but there’s a Memorial Day kind of commemoration in Great Britain, too, that coincides with our own. It’s one of the largest shows of military trucks and regalia in Great Britain, known colloquially as Trucks and Troops. This year’s date is May 28 through 30, and the location is the Beaulieu estate in the south of England, home of the National Motor Museum.
Full details are still being worked out, but Trucks and Troops drew thousands of attendees last year, plus hundreds of vehicles and militaria displays. It’s organized by the South Hampshire Area of the Military Vehicle Trust. Remember, too, that Britain remains a trove of former World War II airfields, and that Beaulieu is one of the U.K.’s holiest places of motoring history. Find out more at www.beaulieu.co.uk.
| 188,618
|
The rigid heddle loom is my passion. I get excited about colour and texture and they are ideal for that. You can create lots of patterns on them too of course.
Warping these looms is relatively simple once you get the hang of it and does not take too long.
First clamp the warping peg to a table. Put a weight on the table if necessary so it does not tip over (hence pig in photo)
Position the loom with the front facing the peg. Clamp it on too. The distance between the loom and the peg will be the length of the warp, minus about 60cm/2 feet of wastage.
Put the yarn on the floor behind the loom. Tie the end to the back stick. Put the heddle in the ‘neutral’ position in the loom. This is the middle position, neither up nor down.
Use a reed hook to pull a loop of yarn through the heddle. Pull on the loose end until it is long enough to drop the loop over the peg. Do not pull it tight or the warps are likely to pop off the peg or pull it off the table.
Pull another loop through the heddle and repeat. Continue till all the slots you want to use are threaded like this.
Tie a spare bit of yarn round the warps for safety. Remove them from the peg and cut the end of the loops.
Wind the warp onto the loom, keeping it under tension and as tidy as possible. Insert pieces of paper between each layer of warps as you wind them on. This prevents one layer from embedding itself in other layers, which can make the warp uneven. Pages from magazines or flip chart paper work well.
Engage the ‘elbows’ to tilt the back of the loom up slightly, if using an Ashford knitters loom.
Take one of the warps out of each slot in turn and thread it through the neighbouring hole.
Tie the threads to the front stick in groups of four or so. Tie in a single knot first.
Go back along the threads, tightening each group in turn and tying in a half bow. Tightening them all at once like this helps to get an even tension.
Put the heddle into the up or down position. Insert a piece of folded paper or some card into the ‘shed’ or space between the warps. Change the heddle position and insert a second piece of card. This card covers the knots when you wind the warp on.
Weave a ‘header’ with waste yarn. Do three shots of weaving, leaving loops at the sides. Beat all three shots down together. Repeat this once more.
leaving loops at the sides enables you to pull the header out easily afterwards. This is not part of the weaving, it is there to even out the gaps between the groups of warp threads before you start the actual weaving.
You are ready to weave!
| 59,900
|
’Quake Lights’ Reported Over Southern California!
Above: San Diego, California
Above: Santiago, Chile prior to major earthquake
Video from: YouTube.com
weatherspace - San Diego residents are reporting shaking continuing in the area. The shaking, according to the USGS, is likely due to the Easter quake this year which rocked the region.
Twitter is rolling with reports of rainbow cloud over Los Angeles today. Reports are coming in that this looks similar to before both the China and Chile quakes where residents reported and took photos of such events in the sky.
While no one can be sure what it means, people should always be prepared for a major Earthquake in Southern California as it is seismically active.
Article from: NaturalPlane.blogspot.com
| 132,081
|
Intracellular vesicular transport is essential for nearly all aspects of neutrophil physiology and defects in this mechanism leads to disease in humans. In neutrophils, vesicular trafficking is directly associated with the processes of exocytosis, phagocytosis, adhesion and chemotaxis;however, the molecular mechanisms that regulate mobilization of the different neutrophil secretory organelles during secretion, pathogen internalization or migration are incompletely understood. We have identified several key regulatory factors essential for the control of granule trafficking in neutrophils including the smll GTPase Rab27a that controls the mobilization and secretion of neutrophil granules in vitro and in vivo. This function is regulated by two Rab27a effectors, JFC1 and Munc13-4. Furthermore, we have recently identified previously unrecognized neutrophil secretory factors that interact with JFC1 and regulate cytoskeleton remodeling, vesicular trafficking and exocytosis and have pioneered the development of systems biology approaches to analyze vesicular dynamics and actin remodeling in granulocytes. In this application, we propose to use innovative analytical and quantitative methods to elucidate the mechanisms regulating vesicular transport associated with exocytosis, phagocytosis and chemotaxis in neutrophils. We also propose to use novel small molecule inhibitors of Rab27a-effector binding to interrogate mechanisms of vesicular transport and elucidate Rab27a-dependent processes in disease using an in vivo model of endotoxin-induced systemic inflammation. Since the toxic content of neutrophil granules is injurious to the host and neutrophil secretory proteins play a fundamental role in the damage to endothelium associated with endotoxemia and sepsis, these studies have important physiological significance and potential clinical applications in disease. We hypothesize that the differential regulation of vesicular transport by Rab27a and its effectors is an essential mechanism to determine specific neutrophil functions and responses to insult. We also propose that small molecule modulators of vesicular transport pathways will prevent some of the deleterious consequences of neutrophil secretion during systemic inflammation. To test our hypotheses we propose the following Specific Aims: 1) To define the mechanisms that regulate vesicular trafficking and actin remodeling during exocytosis in granulocytes and establish the role of the Rab27a effector JFC1 in this mechanism;2) To establish the mechanisms regulated by Munc13-4 in vesicular transport and vesicular fusion associated with exocytosis, phagocytosis and bacterial killing;3) To test the hypothesis that novel small molecule inhibitors of Rab27a-effector binding modulate neutrophil granule trafficking and exocytosis and attenuate inflammation. The results of the proposed research plan should uncover the molecular mechanisms regulating vesicular transport in neutrophils and lead to effective molecular strategies for the treatment of inflammatory diseases.
Neutrophils are white cells that circulate in the blood and play an essential role in protecting us from microbial infections through the production and release of substances that are toxic to invading microorganisms. These toxic products, when released in large amounts or in an uncontrolled manner, can be harmful to the host (humans). The study of the mechanisms that control the release of toxic products by neutrophils will lead to the design of therapeutic strategies for the control of inflammatory disorders and infectious processes including cardiovascular disease and sepsis.
|Catz, Sergio D (2014) The role of Rab27a in the regulation of neutrophil function. Cell Microbiol 16:1301-10|
|Catz, Sergio Daniel (2013) Regulation of vesicular trafficking and leukocyte function by Rab27 GTPases and their effectors. J Leukoc Biol 94:613-22|
|Johnson, Jennifer L; Napolitano, Gennaro; Monfregola, Jlenia et al. (2013) Upregulation of the Rab27a-dependent trafficking and secretory mechanisms improves lysosomal transport, alleviates endoplasmic reticulum stress, and reduces lysosome overload in cystinosis. Mol Cell Biol 33:2950-62|
|Johnson, Jennifer L; Monfregola, Jlenia; Napolitano, Gennaro et al. (2012) Vesicular trafficking through cortical actin during exocytosis is regulated by the Rab27a effector JFC1/Slp1 and the RhoA-GTPase-activating protein Gem-interacting protein. Mol Biol Cell 23:1902-16|
|Johnson, Jennifer L; Hong, Hong; Monfregola, Jlenia et al. (2011) Increased survival and reduced neutrophil infiltration of the liver in Rab27a- but not Munc13-4-deficient mice in lipopolysaccharide-induced systemic inflammation. Infect Immun 79:3607-18|
|Johnson, Jennifer L; Hong, Hong; Monfregola, Jlenia et al. (2011) Munc13-4 restricts motility of Rab27a-expressing vesicles to facilitate lipopolysaccharide-induced priming of exocytosis in neutrophils. J Biol Chem 286:5647-56|
|Johnson, Jennifer L; Brzezinska, Agnieszka A; Tolmachova, Tanya et al. (2010) Rab27a and Rab27b regulate neutrophil azurophilic granule exocytosis and NADPH oxidase activity by independent mechanisms. Traffic 11:533-47|
|Munafo, Daniela B; Johnson, Jennifer L; Brzezinska, Agnieszka A et al. (2009) DNase I inhibits a late phase of reactive oxygen species production in neutrophils. J Innate Immun 1:527-42|
| 226,862
|
Inside pages’ map of China’s new passport has caused serious concern of some surrounding countries. Indian Foreign Minister declared that it is “unacceptable” for China’s new passport map to take the disputed border area between China and India into China’s territory, according to foreign reports. Meanwhile, India also takes some tit-for-tat measures to issue visas with “Indian map” to Chinese people.
“China’s new passport signs “Indian Arunachal Pradesh” (China’s southern Tibet region) and Aksai Chin area of Himalayan as part of China’s territory, which is “unacceptable”, India’s Foreign Minister Salman Khurshid said on Nov 24, reported by A.P.
As a “counter measure”, India began to issue Chinese people visas accompanied with “map of Indian version”, which includes “India’s claims on its sovereign territory.” AFC comments that this is a tit-for-tat measure of India.
As a matter of fact, the Philippines and Vietnam also have protested for China’s new e-passport, declaring that China’s action is an “infringement on their sovereignty”. China’s Ministry of Foreign Affairs said on Nov 23 that the design of China’s new passport was not directed against any country and expected relative countries could see it rationally.
| 307,193
|
Here's an article from the October 23, 2005 New Jersey Star-Ledger. I confess to being baffled by it. It seems to misunderstand the issue entirely. Perhaps readers can point me in the correct direction. Here's the article in toto:
"Contrary to the opinions of a number of readers, I am not a law breaker.
At least, I don't think I am. In a recent column about my transition to an all-digital music collection, I mentioned a plan to sell my CDs after creating digital copies on my personal computer. Quite a few readers wrote to tell me this would be illegal. If you sell the CD or give it away, they informed me, you must delete the digital versions, as the rights to keep a copy of the song reside with the owner of the CD. Was this true? What if I have a 10-year-old CD, with a couple of songs I enjoy? Does that mean I am breaking the law if I keep those songs on my iPod after selling the CD for $1 at a garage sale? I decided to investigate. As is the case with many legal issues, a clear answer wasn't readily available. But at least it is now clear to me how hazy an issue it is. "The law is terribly unclear on this question," says Fred Von Lohmann, a staff attorney for the Electronic Frontier Foundation, a nonprofit advocacy group for consumers' digital rights. "It's very hard to give any kind of clear answer."
Courts might view the situation differently, depending on an individual's behavior, he says. Are you a "buy, rip, and return kind of guy," essentially making digital copies from CDs and then returning them? Or are you, like me, getting rid of physical CDs that you no longer use, simply because you have the music on your computer and you now buy songs from the iTunes Music Store? "The law gives precious little clarity to the average person," Von Lohmann says.
An academic specialist in cyberspace aspects of intellectual property echoed Von Lohmann's views. Whether you can keep digital music files on your PC or iPod after you sell your CDs is legally "untested," says R. Anthony Reese, a law professor at the University of Texas at Austin. Reese says he doesn't know of any court cases dealing with this scenario.
Given existing copyright law, he says, it is "not easy to predict how a test case would come out."
Yet the issue isn't a purely academic one. More and more people are facing this dilemma, as they have no use for the CDs taking up space in the bulky, archaic racks in their living rooms. They use their iPods to listen to music on their home stereos, cars, and elsewhere.
Do they really need to store their CDs in their attics in order to avoid breaking the law?
Yes, according to music industry representatives, though they were unable to provide any real legal backing for that view.
A spokesperson for the Recording Industry Association of America, the group known for filing lawsuits to stop digital-music swapping, pointed me to a document from the Copyright Office to support the idea that you aren't allowed to keep a digital music file once you sell the physical CD. But the document -- see for yourself, [DMCA Report Executive summary, my link]-- sheds little, if any, light on the issue. I e-mailed a top industry executive, whose assistant contacted me to say my rights to digital music would end when I sell the physical CD. But the executive was apparently wary of expressing that view in public, as his assistant suggested I refer to him as "an unnamed industry source." A spokesperson for Warner Music Group referred me back to the RIAA.
But the industry's message, that you must be wary about what you do with music you store on your PC, is clearly making it out there, judging from the e-mails from readers who were convinced that what I was doing was illegal. Don't expect to hear about a resolution to this issue anytime soon. The music industry is unlikely to press it in court, what with its other concerns. But if it is discussed, you will be sure to hear about it at LawMeme (research.yale.edu/lawmeme/), a Weblog covering the intersection of law and technology.
TECHscan Political news junkies have yet another source: C-SPAN's CapitalNews (www.capitalnews.org), a news operation that's designed for people who want to keep tabs, 24/7, on what's happening on Capitol Hill, the White House and the national political scene.
Allan Hoffman may be reached at email@example.com or in care of The Star-Ledger,
1 Star-Ledger Plaza, Newark, N.J. 07102. "
Here's my reaction to the story: If one links on to the Executive Summary to the Copyright Office's DMCA report provided above, at pages 6-8 , you will find discussion of a proposal to amend the first sale doctrine in Section 109 to provide that where someone's lawfully made copy for 109 purposes was in digital form, that copy could be transmitted to a friend etc., so long as the "original" digital copy is deleted. The Office agreed that the current Section 109 is technologically neutral; that is it applies to lawfully made digital copies, but it declined to endorse the proposal both because of perceived differences in the way hard copy and digital copies degrade and because of doubts about verification of deletion.
But nothing in the report, or the law I am familiar with, says that if you own a lawfully made hard copy, like a CD, and you then make, for personal use, a digital copy, you can't sell the CD. Of course you can. You can sell your lawfully made CD even if the making of your digital copying is illegal: absent some contract provision, the two issues are totally separate.
| 17,315
|
Whether you’re new to gold and silver investment or you’re investigating asset performance over the past 40 years, you will find the information that you need in the BullionVault articles listed below. They cover a wide range of topics, including the basics of buying gold and silver to guides on precious metals’ investment.
You can also learn about the different ways that you can purchase precious metals, and their different forms. Additionally, there is a checklist for gold buyers that features information on how bullion should be stored, how to respond to crises related to investment, and other useful facts.
Other resources include guides on how to trade any metals you have acquired and what it means to take part in the spot gold & silver markets. There’s also an explanation of how to claim four free grams of silver with your new BullionVault account; this risk-free offer allows you to get a better feel for our unique order board.
This guide to gold and silver aims only to supply you with the facts and figures to better inform you of all the pertinent information surrounding this type of investment. It is not meant to lead your decision making.
| 246,999
|
A couple lily plants in a garden will turn into many in just a couple years. That is because lilies have root system called bulbs, which self propagate. Fortunately, the bulbs can easily be transferred from one area to another. Transferring becomes necessary when your garden becomes overcrowded and too many plants are using the same water and nutrients and blooms are therefore scarce. You can either transplant the whole plant or just the bulbs.
Prepare the new planting bed. Till about 12 inches deep and add a couple inches of organic matter such as compost or peat moss. This will make the soil more conducive to growing lilies.
Wait until the leaves turn yellow or brown if you are planning on only transferring the bulbs to a new location for the next growing season. This usually occurs after the first frost. Cut the foliage off so that only a couple inches remain. Allowing the lily leaves to stay intact for so long lets the plants absorb lots of sunlight, which turns into sugar (food) through the process of photosynthesis. This will help the plants grow fuller with more blooms the next season.
Dig straight down--about 8 inches--around the perimeter of your plants. Then, start to pull down on your shovel or garden fork in several places to lift the bulbs out of the soil. Shake off the excess soil. Leave the foliage on if your plants are still green and you are transplanting the whole plants.
Plant your bulbs or whole plants. Bulbs should be planted 4 to 6 inches below ground with the tips facing up. If you are transferring whole plants, then plant them to the same depth they were previously planted.
Backfill the soil, push it down to remove any air pockets and water well. Push down on the soil with your hands again to be sure you've eliminated all the air pockets, which can inadvertently cause root rot.
| 241,161
|
Working with team members presents many factors to consider. No matter what type of work is being done and which projects are worked on, the entire staff needs to have a way to talk amongst themselves easily and efficiently. This is why many businesses choose to use a team communication app to facilitate this communication. Apps are not a new concept, and they are easy enough for anyone to learn. This is a great way to keep a team together and on the same page during working hours.
Healthy Work Environment
When employees actually have the chance to get to know each other, this is going to increase productivity and promote quality work. It helps when they are able to communicate on a regular basis because this is how people ultimately get to know one another. It is apparent when everybody feels comfortable working together and willing to ask team members questions to further clarify any work-related needs.
Changes are inevitable in any line of work. They can often happen unexpectedly. Without proper communication, this puts a project at risk. Team members who use communication apps to discuss these changes become more equipped to handle them. This is how solutions are found and deadlines are able to be met without any fluctuation. Talking through the events that occur during any given project is the best way to still get to the ultimate end goal. It allows people to feel they are still moving forward.
Any team is going to have people to answer to. This is why meeting deadlines is often the most important factor. Whether a supervisor needs to check on the progress or a customer is waiting for these end results, only through coming together and communicating effectively will the team be able to provide updates. Communication apps allow for this to happen effortlessly and in a way that does not hinder any future progress. Team members will also feel they can track what their peers are doing and how much weight they are pulling during the job.
Conflict is not entirely avoidable in any professional setting, as many people have varied opinions. This is greatly reduced when staff members are able to communicate with one another. Talking through these differences and issues is the only way to move past them. Instead of being stuck in a situation where conflict is always in the background, team members will feel they can adequately move past their issues when they have an outlet that allows them to talk things through. Using an app to facilitate this stream of communication truly helps in any industry.
Being transparent is a trait that is often under-appreciated in a professional environment. It is one that should be valued. Through the use of a team communication app, staff members of every level are able to access a single platform where they can come together. Being transparent allows for every element of the job to happen smoothly, and people will feel they can ask questions or make suggestions. When people are given this option, they feel valued as individuals. This also keeps employee turnover rates low for the company. Choosing a great app to use is a simple step in a practical direction. Many companies are already benefiting from this decision, and it is creating stronger interpersonal relationships between peers. The people who work for a company represent it directly, so having everyone together and feeling like their voices are heard will allow for a positive and necessary flow of communication.
| 205,102
|
There are times when we start to become too comfortable at work. We may not dress as sharp or adorn our offices with personal items that may not be always appropriate. One sign of being too comfortable at work is to become lax on your emails. Here are some email mistakes you may be making.
1. You’re not holding up your end of the bargain
Some people go through a lot of trouble crafting emails that contain a lot of information. If you’re answering those emails with a single sentence then you’re really not holding up your end of the bargain. Answer emails with the appropriate amount of information otherwise people will know you’re figuratively phoning it in.
2. Your emails are full of typos and colloquialisms
If you respond to an email and it says, “sure thing bro, i will b at the meeting by 9. see u there,” that’s probably the wrong way to do it. Even in business environments that are more laid back, it’s important to keep your business communications professional. You never know when you may accidentally send it to someone who isn’t okay with communications like that and you get in trouble. It may take a few extra seconds but it’s better than calling your boss a bro. That’s not cool.
3. You’re adding smiley faces to your emails
You may think it’s cute and helps denote the tone of your words, but 44% percent of people believe it’s wildly unprofessional to put smiley faces in business emails. Since that’s nearly half, that means you essentially have a 50/50 shot at sending a smiley to someone who won’t appreciate it. Do yourself a favor and simply don’t.
4. Your OOTO messages are too rude
When you’re out of the office, you may leave messages in a hurry so it may be short and gruff. You may not mean any offense or rudeness by it but unfortunately text doesn’t have a tone of voice. Take the extra few seconds and concoct an OOTO message that is appropriate and friendly so people don’t think you’re being mean. It’s a problem that’s easily avoided and solved.
5. You don’t leave OOTO messages
One big mistakes you can make is not handling the emails that come in when you’re gone. If there’s an emergency, someone emails you, and you don’t leave an OOTO message, someone is going to think you dropped the ball. People get downright mad when you don’t let people know you’re out of the office.
6. You send emails before reviewing the entire conversation
These days, emails are shown in threads rather than individual responses. Sometimes you may look at the first email and not notice that there are other replies. If you miss them and respond to an email you may end up answering a question or request that’s already been answered. Aside from being embarrassing, it’ll also cause people to question your competence.
7. You forget to send the attachment or send the wrong attachment
This one is easy enough to do and everyone does it every now and then. If you plan on sending files along with your email, you have to remember to add them to the email. Not doing so can make others angry at you, gum up the work flow, and even cause more problems if you send it at the end of the day, forget the attachment, and don’t find out until the next day! It just takes a little bit of brain power so don’t forget!
8. You failed to include a basic greeting
You wouldn’t believe the effect of saying the word “hi” or “hello” when sending an email. Think about it in real life. Would you walk up to someone randomly at work and just telling them stuff? Of course not, you’d said hi or find a way to get their attention first. Emails work much the same way. When you don’t include a greeting, it’s considered rude which can cause problems even when there isn’t one. It’s just a few keystrokes, don’t forget to include the hi!
9. You don’t use BCC or CC correctly
In an email there are three fields. There is the main contact box where you put the subject in the email. The CC is the carbon copy and those people will receive a copy of the email and the original recipient will know that the other people have been CC’d. BCC is called a blind carbon copy. People in the BCC get a copy of the email but no one else will know that person got a copy of the email. Don’t use this too often because if people find out that others can see these communications then you’ll be the office snitch. Being a whistleblower can be all good but being the office snitch isn’t.
10. Your tone in your email is all wrong
Text does have a tone. The problem is that the tone is dependent on the person reading it but it doesn’t always have to be. The way you craft your sentences guides people on how to read it. If your sentences are gruff and frank then people will assume you’re communicating in a gruff and blunt manner. Take a little extra time to write full, descriptive sentences so people don’t think you’re being a jerk. It’ll go a long way.
Pretty much all email mistakes are simple mistakes that are easy to fix. All it requires is a little bit of attention. Communication is important in all forms and that includes electronically. Just keep it smooth and professional and you’ll anger the least number of people.
Featured photo credit: On Sugar via media4.onsugar.com
| 88,646
|
Located in Tuscumbia, Colbert County, the Alabama Music Hall of Fame (AMHOF) pays tribute to the many Alabamians who have made significant contributions to the music industry. Since 1986, more than 50 Alabama-born music icons have been inducted and more than 1,200 have been honored with lesser distinctions.
At the urging of the Muscle Shoals Music Association (a professional organization of recording studio owners, producers, musicians, songwriters, and other music professionals), the Alabama legislature created the AMHOF Board of Directors in 1980 to honor the state's music achievers and its music heritage. The seven-member statewide board is appointed by the governor and oversees the AMHOF, a state agency. The legislature designated Colbert County as the site for the museum. In 1987, the citizens of Alabama approved a $2.5 million bond to fund the construction of a 12,500-square-foot exhibit hall. The city of Tuscumbia donated some of the land on U.S. Highway 72 for the facility.
The grand opening of the museum on July 26, 1990, attracted more than 35,000 music fans. Additional planned facilities will include a 2,500-seat auditorium for concerts, seminars, workshops, and community plays with state-of-the-art sound, light, and audio/video recording capabilities as well as a future research library on southern music with an emphasis on Alabama. All new facilities are scheduled to be completed by 2014 at a cost of $10 million. Some of the more notable attractions in the museum include the tour bus used by the group Alabama and the Golden Country Car, a 1960 Pontiac convertible adorned with more than 500 silver dollars and 17 silver guns. Also popular is the Sam Phillips and Sun Studios exhibit, which displays original recording equipment used by B. B. King, Muddy Waters, Johnny Cash, Carl Perkins, Jerry Lee Lewis, and Elvis Presley. In addition, there are wax figures of Nat "King" Cole and Hank Williams Sr. and a History of Muscle Shoals music gallery.
AMHOF honors Alabama's achievers in all genres of music in three ways. The most prestigious honor is induction into the Alabama Music Hall of Fame. Portraits of inductees are displayed on the walls of the Hall of Fame gallery, as are exhibits of memorabilia and information of accomplishments in showcases in the exhibit hall. Inductees also are honored with a permanent bronze star in the "Walk of Fame" in the lobby floor of the museum. Inductees must have at least 25 years in the music industry and must have made a significant contribution to the industry. They are selected by a nominating committee and the AMHOF Board of Directors.
An induction banquet and awards banquet has been held every other year in various major cities around the state. It celebrates the state's diverse music heritage by bringing together Alabamians from all genres of music. In addition to the inductions, a variety of achievement awards are given and some of the best-known entertainers in the world perform. The AMHOF has also hosted an outdoor concert series, typically from May through August.
In 2012, the museum lost its state funding and is now open only intermittently. Supporters are attempting to raise money to make up for the loss in funding, and the board of directors is considering a possible move for the facility. Prior to that time, approximately 35,000 tourists, school children, historians, and general music fans from all over the world had toured the Alabama Music Hall of Fame to see, hear, and learn of the many musical contributions by Alabamians. Strong educational outreach was a major part of the mission to introduce every Alabama school child to the history of the state's musical heritage. In 2013, Alabama governor Robert Bentley appointed several new board members to work on re-establishing funding for the facility.
Alabama Music Hall of Fame
Published May 12, 2009
Last updated September 23, 2013
| 208,290
|
BEST PLACE TO TAKE OUT-OF-TOWN GUESTS - 2007
Mill Ruins Park
Readers' Choice: Mall of America
The ruined remains of the world's greatest flour empire may not stack up to, say, the Roman Colosseum or the Khmer temples of Angkor Wat. But the excavated tunnels, tailraces, trestles, and other 19th-century stone relics of Mill Ruins Park are still a sight to behold, more so than any other attraction on the burgeoning downtown riverfront. And that includes the Guthrie, whose cultural importance and internationally applauded looks don't hold a candle to the immolated husk of the Washburn A Mill, now home to the Mill City Museum. (Consider this: If it weren't for those flour mills and the mighty waterfall that powered them, you'd probably live in Duluth right now, or, heaven forbid, St. Louis.) Flour milling is an inordinately combustible industry, and Minneapolis's early mills had a nasty habit of exploding, often taking neighboring mills with them. In the 1870s alone, 14 mills near St. Anthony Falls burned to the ground or exploded. When this happened, construction crews found the best way to rebuild was to bury the remains of the old mill and put another directly on top. This process made the area ripe for archeological digging, and today visitors can explore every level of the city's flour milling history, from the foundation of the Minneapolis Mill (burned in 1871) to the top of the Washburn A (exploded in 1878, rebuilt in 1879, burned in 1991). All of which shows why Mill Ruins Park is the perfect place to bring out-of-town guests: It's a beautiful area, sure, but it also tells a story. Not only of why those old mills are (mostly) gone, but of why the city is here in the first place.
| 209,925
|
As social animals, humans instinctively yearn for connection, and in many ways technology has bridged the gap between connection and distance. Even in the early days of technology-assisted communication, people began to reach out and expand their connections and relationships. In the days of the telegraph, romances were known to bloom between operators who spent their down-time connecting, talking, and flirting with dots and dashes. While most of us can’t comprehend falling in love over Morse code, a parallel can be drawn to the way we connect and nurture relationships with Skype, Facebook, texting, and phone calls.
Yet despite how advanced the technology has become, I don’t know many who would argue that digital communication falls very short in comparison to in-person connection. Skype may allow you to see your loved one’s smile, but it doesn’t allow you to hold their hand, give a warm embrace, or feel their presence. It was that gap between our existing technology and the feeling of true connection that inspired Marco Triverio to build something that would bridge the gap between tactical sensation and digital communication. The result was Feel Me – a smartphone application that allows two people to interact in real-time using non-verbal touch.
The idea behind Feel Me is that the kind of communication that breeds true connection is just as much about the content shared as is it is about connecting with the presence of the other person. Once installed on two smartphones, Feel Me works as a communication terminal allowing users to text but also to connect through touch. The application is able to follow the touch patterns of you and your partner, reflecting the touch patterns of your partner as small dots on your screen. When both parties touch the same spot, a small vibration is triggered to acknowledge the connection and enhance the sense of connection through touch.
Feel Me is fully working application and Triverio says that it does not aim at replacing physical interactions, but it rather aims at enriching the currently sterile digital communications.
Visit the project’s website for more information.
Images via ww.creativeapplications.net
| 218,554
|
Post Docs and PhDs from all around the wold shares idea and results, building strong connection and knowledge.
Dennis Ulsøe Nielsen
Post Doc, CADIAC, Aarhus Univeristy
Dennis Ulsøe Nielsen has expertise in the field of homogenous transition metal catalysis with special emphasis on the utilization of carbon monoxide and carbon dioxide for synthesizing bioactive molecules.
PhD student, CADIAC, Aarhus Univeristy
Matteo Miola is a PhD of CADIAC. His research background combines materials science, chemistry and electrochemistry. His expertise involves the design and synthesis of functional carbon materials, their characterization (e.g., Raman, XPS, TEM, SEM) and their utilization for electrocatalytic CO2 conversion.
| 170,373
|
This article comes from the Forward of the report: http://files.stoel.com/files/books/LawofWind.PDF
Two decades ago, utility-scale wind-powered electric generation was still an untried novelty in the United States. In those days, some utilities purchased wind power as a result of requirements imposed by their state regulators. Others did so in order to garner some favorable PR as the public grew more concerned about the contribution of fossil fuel generation to climate change.
But as developers got better at siting, building, and operating wind projects; equipment manufacturers improved the productivity of their machines; and utilities suffered the economic hits that resulted from what was then a volatile natural gas market with prices sometimes spiking by several hundred percent in a short period of time, the value of wind as part of the resource mix in an integrated generation portfolio slowly began to be realized.
Notwithstanding the intermittent nature of wind, utilities came to appreciate its ability to produce significant megawatts at a price that was fixed for the life of the offtake agreement. This trend has continued to the present.
The industry has shown itself capable of continuing to improve wind project output, lowering the price to where, for several years now, it is price competitive with natural gas—and this in a fracking environment where the price of natural gas has been at all-time lows and its pricing volatility has yet to re-emerge.
And despite an unfavorable political climate that seeks to promote a resurgence of coal-fired generation, the electric industry continues to retire coal plants, speaking loudly as to its vision of the future notwithstanding the short-sightedness of the current group of politicians in Washington.
The loss of the production tax credit in the next few years will no doubt require some adjustment and reposturing. But when one considers that the price of wind has been reduced from over $90 per MWh in the early 2000s to well under $25 per MWh in recent years, there is every reason to have confidence that the industry will meet this challenge as well.
As one of the first law firms to focus on wind energy, Stoel Rives is pleased to have worked with so many talented industry players over the years to help bring wind generation to its current level of success. Our dedication to assisting the industry in moving forward is demonstrated by the significant time and effort we have devoted to preparing and keeping current materials like The Law of Wind and its companion publications in other areas of renewable energy.
As attorneys, we take seriously our duty to help educate the industry and the public in general on the legal aspects of developing, constructing, financing, and operating wind energy resources. This represents the eighth edition of The Law of Wind. As the industry has matured, much of the legal environment has become well known, perhaps even routine in many instances. And yet there are still significant developments that require tracking. For example, the impact of the 2017 tax reform act, the integration of storage solutions, and the continued buildout of the transmission system to bring wind power from windy sites to load centers all continue to present new challenges for the industry to meet and the law to accommodate.
With this edition, we once again renew our dedication to the wind industry and our commitment to provide informed, experienced advice to all who share our dream of a cleaner energy future. We hope you find The Law of Wind useful. Please note that PDF versions of this document are available for download at no charge via our website, www.stoel.com/lawofseries.
Let us know how well it serves your needs—suggestions or comments on how it could be improved are most welcomed. Also, you can follow our summaries of and comments on important developments in the industry through our Energy Law Alerts (www.stoel.com/subscribe) and in our Renewable + Law Blog (www.lawofrenewableenergy.com). Edw. D. Einowski, Partner Partner stoel.com/eeinowski 503-294-9235 (Portland)
Wind Energy Lease Agreements
Eugene A. Frassetto, Ramona L. Monroe, Sarah Johnson Phillips
At the core of a wind energy project’s overall value is the security, flexibility, cost-effectiveness, and stability of the land rights for the project. The tool for capturing this value typically is a wind energy lease or easement agreement that creates and protects a developer’s interest and investment in the property and project, and provides reliable income to the landowner, while offering the developer the flexibility to transfer all or portions of the project over its lifetime.
Form of Agreement/Use of Option
A real property ground lease or easement rights for developing a wind project site with its accompanying wind resource easement and noninterference covenants (generally, together, a “Wind Energy Land Agreement”) is similar, in many ways, to an agreement for a ground lease or other agreement for the temporary use of land for commercial or industrial development.
A Wind Energy Land Agreement provides for the developer’s entry onto and investigation of the property, and sets forth the term; the scope of the permitted uses of the property by the developer and the landowner; the amounts and methods of payment for the leasehold and/or easement interests; the allocation of insurance and other costs between the parties; the transferability and financing of the development; notice, default, and cure provisions; and other matters that may be required by applicable law, the specific needs of the parties, or the particular circumstances.
However, Wind Energy Land Agreements are unlike a common, commercial ground lease arrangement in their treatment of the scope and use of the property, and, when well crafted, should anticipate changes in the ownership of the project and the property, and changing uses of the project property. This chapter outlines some common concepts, provisions, and potential issues in a typical site control arrangement.
For the full report: http://files.stoel.com/files/books/LawofWind.PDF
Filed Under: Uncategorized
| 58,995
|
A mother's fear: a knock on the door from family protective services talking about taking away your child. What good mother wouldn't turn somersaults to keep her child home and her family intact? Any good mother would—but in Kristina Riggle's novel, Keepsake, doing just that is especially demanding. The reason that social worker is standing at the door ties directly into her addiction—hoarding. Hoarding is the inability to throw anything out, to the point of filling one's living space with items until there is no room to live within that space.
Trish really is a good mother. It's a pleasure to read about her interactions with her little boy, Jack, contrasting against the twinge of reading about her disorder. Addicts can still love, but it's their behavior that is out of control. Riggle does a wonderful job of showing the reader that an addiction does not define a person. It's a symptom of something buried deep inside that the person has not yet confronted and resolved.
Adding another interesting element of contrast to this story about hoarding and families is another member of the family, Trish's sister Mary. The two women are actually the daughters of a hoarder, but while one has followed in the cluttered steps of her mother, the other has veered to the other extreme. If not quite an obsessive compulsive disorder, Mary is a neat freak who can't seem to stop cleaning, wiping, vacuuming, ordering everything in her spotless home.
Riggle's novel handles these elements without any clutter on the author's part. The story cleanly moves toward a suspenseful ending: will this family be torn apart or brought together by the damage done by hoarding? Ex-husbands return, therapists sneak in disguised as friends who somehow manage to add elements of romance, and family history is unearthed to reveal deep secrets held over generations.
Keepsake is a fascinating read about a growing affliction in modern American society, giving readers insight into how intelligent, competent people can fall into behavior patterns with the potential to ruin lives, break apart families and endanger not only themselves but those that are close to them. It also brings up the question of why we are seeing more hoarding in our society. Insight into this phenomenon of living in clutter, unable to throw out anything, let go of any object in one's home, can only help us take a hard look at ourselves and how we live.
Kristina Riggle is a novelist and freelance writer living in Grand Rapids, Michigan.
What did you think of this review?
Fun to Read
What's your opinion on Keepsake by Kristina Riggle?
| 241,593
|
Welcome to Year 8!!! We are delighted to be back at School and have the new cohort of Year 8's. I know it is going to be a great year for everyone and all the teachers are so excited to have a new class.
Tuesday- Year 7 and 8 Syndicate Speech Finals 8.30 am -10.45am in the Auditorium. Come and support the Year 8's.
Wednesday- Fixture vs St Kentigern School. There are games at Southwell and at St Kentigerns in Remuera. Please come and support the Year 8's who are taking part in the last winter fixture of the year.
Tuesday- Thursday- Winter sport photos are being taken. Check with your coach for your photo time.
Sunday- Chapel service for Salisbury and Canterbury in the Flat Floor Hall at 6pm. Make sure you are there as a roll will be taken.
Chapel service for York and Durham houses this Sunday at 6pm. Please make sure you attend. There will be a role taken at this service.
It is Mufti day this Friday, please bring $2 to support Daffodil day.
Go and cheek the social studies page for a new Market Day Movie
We have a huge fixture on Wednesday 17th of August as part of our centenary celebrations at Southwell. We would love as many supporters to come and watch as possible. There are teams from Auckland Dio and Kings coming to play, so grab your Southwell scarf and come and support your team to success.
Learning Conferences start on Monday 15th of August. If you have not made an appointment yet, please do so as we would love to see you and discuss your child's learning goals with you.
You can make an appointment by using this site http://www.schoolinterviews.co.nz/home
Congratulations to all the students who represented Southwell so well during the fixture against Hereworth this week. You were all fantastic and so well behaved.
Welcome back to Term 3. We are looking forward to very exciting term ahead with many different learning opportunities. This term we have the Opera to look forward to as well as more exciting fixtures against other schools on the sporting fields. Our Social Studies unit is "Giving" and our aim is to identify areas of need within our community and to explore ways in which we can give to those less fortunate than ourselves. It should be a reflective unit as we look at how we can give more of ourselves, but will also be a unit where children can prepare an action plan as to how they want to help people within their community. The children have been very enthusiastic about this unit so far and are thoroughly looking forward to getting further involved.
1-10 of 48
| 24,469
|
A model of diversification and growth in developing economies
Documento de trabajo
MetadataShow full item record
I build a growth model that resembles the situation of many emerging/developing countries: they are far from the world technological frontier and they have a comparative advantage in one (or a few) primary commodity. Their great challenge is to introduce into the economy goods that are produced elsewhere in the world economy but the technology of which is unknown in the domestic economy. Building new sectors from scratch is hampered by two market failures. In the first place, entrepreneurs must be willing to invest in discovering production technologies abroad and adapting them to local conditions. This process has information externalities: the pioneers have to undertake investments in information that cannot be patented and that can easily be copied by oth ers who haven’t made the investment (copycats). Second, there is a coordination problem. Success in establishing new industries is dependent on non-traded inputs that may serve a whole family of sectors (call them “infrastructure”, for short). In the absence of these inputs, no firms can emerge in any of the sectors composing a given family. This is a task that falls to an extra-market actor (call it the “government”). A simple model allows us to calibrate the conditions under which a government that balances its budget can succeed in maximizing growth. The solution involves subsidizing information investments of pioneers and taxing both the traditional sector and copycats in the modern sectors who may be induced to invest by the investment in information made by pioneers.
Quote ItemSerie de documentos de trabajo ; SDT 455
The following license files are associated with this item:
| 258,029
|
Your Favourite Photoshop Tutorials in One Place
Idea of Digital Painting for Battle Scene in the Ocean
Under Drawing Effect, Photoshop Tutorial
This tutorial will show you how to paint some Battle Scene in the Ocean. This will go through with you from the black and white picture and finalize with a nice colorful piece of artwork. You will see how every little details were added such as cannonball hit the water and smoke to form such a battle scene.
This tutorial is going to show you the steps to draw a super future city under sunset. You can design the matte painting to illuminate this issue, mixing everything with a strong and romantic light to provide a little contrast to the cold futurism of the city.
Hello to you all, we hope this following tutorial can be helpful in creating a good Icon design using Adobe Photoshop. The version I’m working with here is CS3. If you follow the following steps you will definitely find your self with the final result.
In this Photoshop tutorial, it will show you how to create a highway sign and post using custom shapes, selections, layer styles and a little creative gradient work. For my final image a few more signs using the same steps are added as the ones in the thumbnail.
Here will show you the work through for different style of splashing effects. Based on this, you can develop more on your own style. It will give you some ideas on the direction of splashing and adding color and lighting for it.
In this tutorial, it will show you how to initiate the paint of strange high house from draft to paint. Or you can draft whatever object on paper first, then scan your object. After that, you can apply the paint through photoshop featuring. Usually from drafting to painting, it takes at least 1 or 2 hours.
| 231,544
|
Why Operation Fast And Furious Failed
NEAL CONAN, HOST:
This is TALK OF THE NATION. I'm Neal Conan, in Washington. You've probably heard about the Washington side of Fast and Furious. Yesterday, a House committee voted to hold Attorney General Eric Holder in contempt of Congress, and President Obama invoked executive privilege to protect disputed documents.
House Republicans say the attorney general and now the president are trying to cover up the fallout from a bungled gun sting on the Mexico, Arizona border. Democrats say it's all election year politics. But let's step back to 2009, when the Bureau of Alcohol, Tobacco, Firearms and Explosives created Fast and Furious as part of an effort to stem the flow of U.S. weapons to Mexican gangs and drug cartels.
What was the intent? What's the scale of the problem? What went wrong? And what happens now? If you have questions about Fast and Furious or gunrunning to Mexico, give us a call, 800-989-8255 is the phone number. Email email@example.com. You can also join the conversation at our website. That's npr.org.
Later in the program, Loving Prize-winner Reginald Daniel joins us to talk about teaching multiracial identity in a changing world. But first, NPR national desk correspondent Ted Robbins joins us from his office in Tucson, where he covers the Southwest, and nice to have you back on the program.
TED ROBBINS, BYLINE: Hi, Neal, it's good to be with you.
CONAN: And what was Fast and Furious?
ROBBINS: Well, Fast and Furious, let's go back even a little farther, if we might.
ROBBINS: Because really these - it was only one program in a series of sting operations called gun walking, essentially, which began in 2006 and ended in 2011. And so it was part of I guess the umbrella would be Project Gunrunner, and it was supposed to stem the number of firearms that were leaving the United States and going into Mexico, into the hands of drug cartel members, largely because it is much easier to obtain guns in the United States than it is in Mexico, which has some fairly stringent at least legal, you know, ways to get guns, it's fairly stringent gun-control laws.
So what they would do, is instead of actually arresting a person who bought a gun, as a straw purchaser - bought a gun for somebody else, which is illegal in the United States - that's the way it works, and then they hand them over, and then they walk them into Mexico.
So instead of arresting somebody - talking about ATF right now - they would let the purchaser walk, and in this case take the guns, meaning gun walking, take the guns into Mexico in hopes of arresting the people who they gave the guns to, so leading them to bigger targets in the cartel operations.
That was the intention of Fast and Furious, as I say, which was one of a number of these kinds of operations, which actually began under the Bush administration.
CONAN: And gun walking, as opposed to gunrunning, one - the ATF does it, it's gun walking, and if it's done purely illegal, it's gunrunning. What's the scale of the problem? Obviously the United States provides a lot of assistance to the Mexican government and the Mexican army. Are we essentially arming both sides in the drug wars in Mexico?
ROBBINS: Well, by we, I mean, we're arming one side, the army and the police. The government is helping with aid. And the other side is being armed illegally by a number of American gun dealers, not that they're doing anything illegally, mind you. Some are, but a lot of them are not. So yeah, you could say that we, as a country, are.
CONAN: And so obviously tens of thousands of people have died in the drug wars in Mexico. Joining us now from member station KUAZ in Tucson is Michel Marizco, Tucson senior field correspondent for the Fronteras Desk, a collaboration of public radio stations across the Southwest, and it's good of you to be with us today.
MICHEL MARIZCO: Thank you very much, Neal.
CONAN: And tell us a little bit about these gangs the ATF was trying to track down.
MARIZCO: From the number of guns and where the guns were going, the ATF was trying to land somebody in the Sinaloa cartel. The Sinaloa cartel has been going after the Zeta cartel in northeastern Mexico, the Gulf cartel, the Juarez cartel in Cuidad Juarez; and for a certain number of years they were also going after the Arellano-Felix organization in Tijuana - so virtually throughout all of Mexico.
Now, where the guns were ending up seemed to always be in the hands of people working for the Sinaloa cartel, whether that - whether the guns were being seized by the Mexico army in Tijuana, here on the Arizona border or in Mexico. Over and over again, the guns kept landing in the hands of one particular cartel.
CONAN: And it's obviously a risk allowing those guns to go through. They can cause problems. They presumably get used.
MARIZCO: They did, and ostensibly this was the purpose of Operation Fast and Furious and its predecessor Operation Wide Receiver. And Fast and Furious, of course, two of the guns used, two of the guns at the murder of Border Patrol Agent Brian Terry were Fast and Furious guns. It's unknown whether they were actually used to commit the murder. The FBI ballistics report was inconclusive on this.
But the guns were also being found in the hands of Sinaloa cartel members. For example, in Juarez they were used to kill the brother of a high-level attorney general for the state of Chihuahua. And of course this is all going on at a time when the United States is trying to coordinate with the Mexican government after the (unintelligible) initiative to implement certain types of priorities in Mexico's handling of organized crime cases. So while that's going on, they ended up allowing these guns to be smuggled into Mexico, and then they were used to kill this attorney general's family member.
CONAN: And Ted Robbins, clearly that's not the intent. What went wrong here?
ROBBINS: Well, what went wrong is it was as, I think, as almost everybody admits right now, it was a flawed plan. They really couldn't adequately track the firearms once they went into Mexico.
CONAN: Let's see if we can get a caller in on the conversation. Let's go to Daryl(ph), and Daryl's with us from Lake Worth in Florida.
DARYL: Hi, thanks for taking my call. I guess I'm just a little confused as to the logic behind the plan to stop guns going into Mexico by sending this huge number of guns into Mexico. I'm just - I'm flummoxed by it.
CONAN: Why did they use so many guns, Ted Robbins?
ROBBINS: Well, I mean, they - most of the guns that are taken into Mexico are not - were not part of this. I mean, they just - they're being - as you had said earlier, it's gunrunning, and it's illegal, and they don't know about it, our government, that is.
CONAN: Well, how many guns were involved in Fast and Furious?
ROBBINS: Michel might have a better - I think it was something like 1,600. Is that right, Michel?
MARIZCO: Yeah, it was roughly 1,800, mostly AK-47 variants, but also 50-calliber rifles, which are, you know, a bullet the size of a small beer bottle.
ROBBINS: Yeah, so the standard, you know, sort of the standard training was to follow the straw purchasers to where they handed off to the cartel members and then arrest everybody and seize the guns, and they just lost track in this operation.
CONAN: And obviously things - disaster ensued. Daryl, thanks very much for the call.
DARYL: Thank you.
CONAN: Let's go next to - this is Richard(ph), Richard with us from Salt Lake City.
RICHARD: Yeah, my question is how much did the Mexican government know about this because if somebody was running guns into America to feed our criminals, it just - that just stinks. I don't know. How much did they know?
CONAN: Michel Marizco, can you help us with that?
MARIZCO: The previous attorney general for Mexico had reportedly been briefed on Fast and Furious and gun walking. He's now a diplomat in another country, an ambassador, ostensibly. He has said that he did not know. Mexico has pounded on the table, saying that they are shocked and disappointed with the United States, but it did appear that at least some people, including that former attorney general, had been briefed on the ATF's idea.
But it's also interesting to note that ATF agents working in Mexico had no idea what ATF in Phoenix had been up to at the time.
CONAN: So different branches of ATF weren't talking to each other.
MARIZCO: Right, I mean, and this - we kept seeing this throughout the entire case. For example in 2009, the lead Fast and Furious subject had been picked up by the ATF, give him a business card and tried to recruit him to work for them to nail two Mexican drug lords. It turned out the two drug lords that he was supposed to be working as a snitch on were informants for the FBI.
And in all this, the DEA was also involved running pole cameras, they call them, on these same two suspects. So really we had I do not know how many suspects that were working for either the ATF, the FBI, the DEA and in some cases all three being involved in this fiasco.
CONAN: And they still lost track of the guns.
MARIZCO: Yes, sir.
CONAN: All right, thanks very much for the call, Richard. This email question, you mentioned earlier, there was an earlier project in the Bush administration. Gloria(ph) wants to know: How does Fast and Furious differ from the Project Gunrunner in the Bush administration? Ted Robbins, do you know?
ROBBINS: Yeah, they got caught in the sense that it came to light. Fast and Furious came to light only because - well, let me back up. There were a number of guns that were traced, and ATF agents were voicing opposition. But really all of this came to light because of the death of Border Patrol Agent Brian Terry just over this side of the border, which was arguably - he was arguably shot by a couple of the guns allowed to walk.
And that really brought this to light, and I think an agent named - an ATF agent named John Dodson and another were upset at this operation, and they had reached out to superiors in ATF, and finally they went to Congress, and they went especially to Senator Grassley of Iowa and then Representative Darrell Issa.
And they started complaining about this tactic, and that's really how it came to light.
CONAN: Were similar numbers of weapons involved in the Bush administration?
ROBBINS: I don't know the answer to that.
CONAN: All right.
ROBBINS: I know that there were no prosecutions during the Bush operations, and there were prosecutions during - when Obama took office.
CONAN: We're talking about fast and furious, what went wrong with the operation and the gunrunning problem it was designed to target. If you have questions about it, give us a call, 800-989-8255. The email address is firstname.lastname@example.org. We're speaking with Ted Robbins, NPR's national desk correspondent in Tucson; and also with Michel Marizco, senior Tucson field correspondent for the Fronteras Desk. Stay with us. I'm Neal Conan; it's the TALK OF THE NATION from NPR News.
(SOUNDBITE OF MUSIC)
CONAN: This is TALK OF THE NATION from NPR News; I'm Neal Conan. Attorney General Eric Holder and House Republicans signaled a willingness to negotiate a way out of their standoff over the investigation into Fast and Furious. That would keep the power struggle out of the courts and avoid a contempt charge against the attorney general.
That's the political fallout. Today we're talking about the Fast and Furious operation itself, what it was designed to do and how it went wrong. If you have questions about Fast and Furious or about gunrunning to Mexico, give us a call, 800-989-8255. The email address is email@example.com. You can also join the conversation on our website, npr.org.
Our guests are Ted Robbins, NPR's national desk correspondent who's based in Tucson; and Michel Marizco, senior Tucson field correspondent for the Fronteras Desk, a collaboration of public radio stations across the Southwest, where they cover the border, immigration and the changing demographics of the border region.
And this is an email from Joshua(ph) in Indiana, who's following up on what you just said, Ted Robbins, and is it true there have been no prosecutions of gunrunners resulting from the botched operation?
ROBBINS: There have - you know, let me back up, actually, to the previous caller, that according to the sources during our break that I looked at that Fast and Furious was by far the largest sale of firearms under these gun walking programs.
There were - I think there's been one actual conviction of a gunrunner under this - under these programs. Michel might have more on that.
MARIZCO: There was a ring run by a guy by the name of Manuel Solis Acosta(ph). There were four people there who were eventually sentenced in Operation Fast and Furious. And then of course there's the predecessor case, Operation Wide Receiver, which started in '06, and in that case, there were 11 defendants, and of those 11, nearly all have pleaded out at this point, and their cases have been adjudicated.
CONAN: Let's go next to - this is Wren(ph), Wren with us from Ann Arbor.
WREN: Good day. Yeah, just a few questions, that this entire operation is termed by many commentators in the media as botched, but here we have this most recent statement of one of your guests that there were 11 prosecutions, Wide Receiver. Then a much larger operation is conceived and rolled out with hardly anyone in other agencies knowing about it, where 1,800 weapons, a much larger number go out, which such a terrible track record on the first one, 11 prosecutions.
And then a single conviction or, you know, this is incredible that AK-47s - let me ask, just, the question. How could AK-47s be sold here in the United States with assault weapon ban, how could - why were they not tagged, RFIDs? You know, you can tag a box of Corn Flakes and trace it across continental distances. What was going on? This is, to me, an out-of-control agency, completely berserk.
CONAN: RFIDs are very short-range, but they could have put a GPS device or something on it. Ted Robbins, do you have any answers for Wren?
ROBBINS: You know, I recall testimony, on the Hill, of one of the ATF agents who was critical of this operation saying that they had put - they had put GPS devices on some of these and that the batteries ran out, and they hadn't thought of that when they did it. So yeah, I mean, the parts of - in terms of botched, it's a shorthand way of saying it didn't work.
CONAN: Michel Marizco, do we know whose idea this was?
MARIZCO: Well, there's the million-dollar question everybody's trying to figure out. The U.S. attorney in Arizona took the blame. He resigned as a result of the scandal. The ATF chief, at the time, in Phoenix, told reporters emphatically no, there was no gun walking going on. He was quietly laterally transferred back to Washington as a result of this.
Now going back to Wide Receiver, because I've always had questions about this, see, when they started the prosecutions of people in that case, they brought in a special prosecutor from Washington, D.C., to handle the prosecutions here in Tucson. In other words, prosecutors here didn't handle it, she did from D.C.
So what happened there? Defense attorneys tell me she had to have known because she'd talked to all the agents, she knew all the parts of the program, and in Wide Receiver, they clearly new, the courts documents stated, that these suspects had been going into Mexico with guns and coming back into the U.S. to buy more from snitches here in Tucson.
So at the end of the day, the question becomes OK, if you brought in a special prosecutor from D.C. to handle these prosecutions quietly in Tucson, who was her boss? How did he not know? Who approved her travel to Tucson from Washington to handle this? And these are the questions that, you know, House Republicans are trying to find out right now.
CONAN: And Ted Robbins, another part of Wren's question, sales of AK-47s?
ROBBINS: Well, they're not - as long as they're not sold as fully automatic, they're not illegal, and then they can be easily - I don't know how easily - but they can be converted. And it's also not - it's not illegal to buy these guns. It's illegal to buy them in somebody else's name.
In terms of tracing, you know, there were gun dealers who were worried about this, who took part in it and worked along with the ATF. There are reputable gun dealers who will not sell if they have any suspicions that this is going on in the Tucson area and Phoenix area, and in Texas, as well. But some of these people were actually, you know - some of the dealers were working with the ATF. So I don't think you can put it on the dealers for selling the guns.
CONAN: This - AK-47 is what's called a select-fire weapon, Wren. There are switches, as manufactured, switches for single shot when you pull the trigger or a burst of three or - then fully automatic. They are - as sold in this country, only supposed to be the single-shot version, but there are kits available that you can adapt it, as Ted Robbins said, to - back to the full select-fire options.
WREN: Indeed, and, well, thank you for taking my questions. I just wanted to make a point that with - undoubtedly, hundreds and hundreds of these weapons still out there, we can only conclude after 300 Mexican citizens have been killed with them, that the rate of killings will continue at one every two or three days. That's the arithmetic rate of killings under this program, and it's got to be continuing.
CONAN: All right, Wren, thanks very much for the phone call.
ROBBINS: You know, I should say that over the last couple of years, Customs and Border Protection has really ramped up its operations in - at the ports of entry in terms of southbound cargo. They're now inspecting - they get a lot more cash than firearms, but they get a fair amount of firearms going south, as well, and that's only been in the last few years.
CONAN: Let's go next to - this is - there she is, Lynn(ph), Lynn with us from Peoria.
LYNN: Hi. I'm wondering, does an operation like this, even under the best of circumstances, does it succeed in really dealing a blow to the cartels? Does it get anybody high up in them, or does it just get these boot soldiers on the - you know, the peons of the operations?
CONAN: Michel Marizco, that was the design here, that instead of just getting those straw buyers, the foot soldiers, the idea was to go higher up the chain.
MARIZCO: Great question, and this comes back to so much of the criticism. No, they've never landed anybody. Manuel Solis Acosta, who was the leader of the gun-buying ring in Phoenix, is the biggest proverbial fish that they landed. And keep in mind that, you know, he was supposed to be working as a snitch against two suspects who were working as snitches for the FBI.
So at the end of the day, no major arrest had ever resulted from either Operation Fast and Furious or Operation Wide Receiver, none.
LYNN: So why are they doing it?
ROBBINS: Well, that's a great question. I'm afraid I don't have an answer for you on that.
MARIZCO: Well, they're not anymore.
CONAN: They say they're not. They said they weren't doing it when they were doing it.
ROBBINS: Thank you, Neal.
Right, they did say they were not doing it back when Brian Terry was first killed, and later they ended up having to retract quite a few statements as a result of that.
CONAN: Thank you very much, Lynn.
LYNN: Thank you.
CONAN: Here's an email question from Colin(ph) in Palo Alto: I have a question and a comment. Firstly, how many of the people who worked on Operation Wide Receiver were also involved in Fast and Furious? Is this is a case of institutional continuity, where the same people were making the same decisions? We'll get that part, Michel Marizco?
MARIZCO: Yeah, when you look at the structure of who's in charge of these operations, the U.S. Attorney's Office in Arizona under Dennis Burke and also under Paul Charlton, who was the former U.S. attorney terminated by the Bush administration. And then the ATF at the time had many of those same people in charge of their office in Phoenix and then Tucson. So ostensibly we had the same people. Who was on the ground at the time? I'm afraid I don't have answer for you there because court documents will not reveal people.
CONAN: And the second part of Colin's email: I ask this because it seems like changing the administration, even the head of the ATF, has had no effect on what the agency does. As such, it begs the question of whether or not any executive branch can effective manage the ATF or other branches. Ted Robbins, is the ATF out of control?
ROBBINS: You know, that's a loaded statement to say they're out of control, but I think it's - it calls into question federal bureaucracy, that once you get a ball rolling, it's a lot harder to stop. So, I mean, clearly, there was a lack - and I think even they would admit, the ATF, that is - there was a lack of internal responsiveness to critics, and there was a lack of sort of, you know, what bureaucrats call outcome-based decisions.
CONAN: Here's an email question. This is from Rick(ph): I think the Obama administration used Fast and Furious as an existing program to make an attempt to force new restrictive gun rules on U.S. gun owners. As - he says, like Obama said, keep gun control under the radar.
Michel Marizco, is there any evidence of that?
MARIZCO: Well, I don't know about evidence. But when you look at the timeline of events, in 2008, Bill Newell - and he was the head of the ATF during Fast and Furious - came out to say that 90 percent of the guns being used in Mexican killings came from the U.S. What he should have said was 90 percent of the guns that were seized in Mexico, that were used in crimes came from the U.S. They don't know how many guns were actually used, obviously.
ROBBINS: And traced. Seized and traced.
MARIZCO: Exactly. And when - as a result of that statement - and, of course, that went like wildfire, but as a result of that statement, he kept, you know, pushing this mandate. You know, now we're - now - last summer, the Obama administration started a reporting requirement for anybody trying to buy more than two rifles in a border state.
And more and more of these types of questions started coming up because, at the end of the day, I don't know that they meant to implement this as a way to create gun control in border states, but the argument can certainly be made that that's what happened as a result of this.
CONAN: So there were new restrictions promulgated?
MARIZCO: Yes. A federal judge only recently ruled in the Obama administration's favor that the - that they could uphold - that they could enforce these new federal rules for gun dealers in the four border states.
CONAN: We're talking with Michel Marizco, the Tucson senior field correspondent for the Fronteras Desk, and NPR's Ted Robbins is also with us. They're both in Tucson. You're listening to TALK OF THE NATION from NPR News.
And, Ted Robbins, you said earlier that the dealers themselves, in some cases, were working with the ATF, but that some may have been violating the law. Were there any instances of gun dealers wink, wink, nod, nod, here's a case of AK-47s?
ROBBINS: There have been prosecutions, but I'm not sure that they were under Fast and Furious. I mean, there have been a number of dealers prosecuted in border states for allowing straw purchases, illegal straw purchases. I don't - Michel, do you know if there were any actually connected with these - with the gun-walking operations?
MARIZCO: No, there were not. The only gun dealers that have surfaced publicly have - were both snitches working for the ATF, running wiretaps on suspects for the ATF, and obviously neither of those had been convicted.
CONAN: Let's see if we get G.E.(ph) on the line, G.E. with us from Denton, Kansas.
G.E.: Yes, sir. Even if the Mexican drug cartel does get illegal weapons from the United States, which I disagree with, but what stops the drug cartel, which has a lot of money, obviously, from getting weapons from China or other Third World - no, they're not Third World anymore.
CONAN: No, they're not.
G.E.: But they're not really going to care who they send weapons to because, I mean, we've obviously had products come from China that contain lead and this, that and the other. So that's my question, sir.
CONAN: Ted Robbins, can you help us out? Is the United States the largest supplier of illegal weapons to Mexico, and are other countries providing weapons?
ROBBINS: Well, I mean, United States is a large weapons provider illegally to the world. I mean, we - this is one of the - one of our larger - not in terms of money, but it is certainly one of our - in terms of the rest of the world, we supply guns to - you know, we sell guns. I mean, this is one of our manufacturing industries. So - and they're on the border, let's face it.
I mean, it's pretty easy to get the guns across the border as opposed to putting it on a ship from China. But I think there's been plenty of evidence of things like grenades, for instance, coming from other countries. I think the caller is right that they're getting guns from places other than the United States as well.
CONAN: Thanks very much.
MARIZCO: Neal, if I can add to that really quick.
MARIZCO: The - because the ATF just released some data. But as you'll see in a second, it's inconclusive. Between 2007, 2011, there were 99,000 guns seized in Mexico, turned over to ATF for tracing. Two-thirds of those came from the United States. However, what Mexico would not tell ATF was exactly how many guns they actually seized. All we know is that they turned over 100,000 to ATF for tracing.
And so it always adds to more of this mystery, more of this enigma. Exactly what percentage of the guns in Mexico are actually coming from the U.S.? We don't know. And ATF and Mexico are not telling us.
CONAN: And we have a pretty clear image in our heads of what it looks like coming north from Mexico into the United States. What is it like going the other way? As Ted mentioned, they're seizing a lot of money and a lot of weapons too. Michel?
MARIZCO: Yes. What they have is these outbound inspection teams standing at each port of entry, and they're randomly searching people. The point I would add to this is this is a program that generally seizes cash because you need to declare more than $10,000 when you're heading out of the country and, of course, drug traffickers are not. And occasionally, yeah, they are landing weapons. However, when you look at the data on, for example, Fast and Furious weapons seized in Mexico, the CBP's outbound inspection teams never actually got any.
And I'm looking at Issa and Grassley's report on Fast and Furious here. All these weapons were being seized by the Mexican army and Mexican customs on the Mexican side of the port of entry.
ROBBINS: Yeah, I was going to say you have to - when you come up to go into Mexico there are signs all over the place: Do not bring weapons into the country so - into Mexico that is.
CONAN: Well, thank you, guys, for helping us define botched. Ted Robbins, NPR's national desk correspondent based in Tucson and Michel Marizco Tucson senior field correspondent for the Frontera's Desk. Thanks very much. Coming up...
MARIZCO: Thank you.
ROBBINS: You're welcome.
CONAN: ...Reginald Daniel created one of the first courses on multicultural identity 20 years ago. He'll join us in just a moment. It's the TALK OF THE NATION from NPR News.
NPR transcripts are created on a rush deadline by a contractor for NPR, and accuracy and availability may vary. This text may not be in its final form and may be updated or revised in the future. Please be aware that the authoritative record of NPR's programming is the audio.
| 274,282
|
While many Americans fret about the spread of Ebola, a never-seen-before virus may be emerging right here at home. The so-called "Bourbon virus" (named after the Kansas county where it was discovered), was isolated by investigators at the Centers for Disease Control and Prevention (CDC) for the first time after a 50-year-old man's death in spring 2014, reports CNN.
The man was hospitalized after falling ill roughly two days after he suffered multiple tick bites while working on his property. The illness began with a barrage of flu-like symptoms: fever, tiredness, rash, headache, other body aches, nausea and vomiting. Researchers also reported that the man had low blood counts for cells that fight infection and help prevent bleeding. After 11 days of being sick, the man succumbed to a heart attack.
During the man's hospitalization, all test results for infectious diseases came back negative, so doctors sent blood samples to the CDC. Sure enough, a virus new to science was discovered. It was identified as a type of thogotovirus, which is a group of viruses known to be spread through tick and other insect bites. Given that the man had suffered multiple tick bites prior to falling ill, it is believed that ticks were also the vector for this disease.
Though several thogotoviruses are known from different parts of the world, this one was previously unidentified. It is also the first thogotovirus ever found in the Western Hemisphere.
The Kansas man is the only known individual to contract the Bourbon virus, though it is possible there have been other cases that have remained unidentified. As of yet, there are no laboratory tests to determine if a patient is infected with the virus, but researchers are working to develop one now that the virus has been isolated.
If you're near the region where the Bourbon virus was discovered (Bourbon County, Kansas) and are concerned about contracting the virus, it's recommended that you do what you can to prevent tick and insect bites: use insect repellents, wear long sleeves and pants, and avoid bushy or wooded areas where ticks thrive.
Related on MNN:
| 57,446
|
Wetland Consultants List
Wetland consultants provide a variety of services regarding wetlands. Many people hire wetland consultants to help identify and delineate wetlands, provide advice about designing projects that will not need permits, or, if permits are needed, provide assistance in completing the application form. In order to assist you in finding a consultant who can help you in these specific areas, the DEQ has compiled a list of available consultants, but cautions you to consider the following:
Finding a qualified consultant can be difficult since "wetland consultants" are not certified, licensed, or bonded. Environmental consulting businesses, however, are sometimes found in the yellow pages of your area telephone book under environmental services or on the internet. They may also be found by requesting the advice of associations or businesses that commonly encounter wetlands in their work.
When interviewing consultants, you should carefully evaluate their qualifications. The DEQ has put together the following suggestions to help you make a selection:
Check credentials. If you are looking for someone to help identify and delineate wetlands, find out whether or not the consultant has a good background in hydrology, soil science, ecology, and (especially important) botany. The consultant you select should have the ability to apply wetland identification methods used by state and federal agencies. Make sure that the consultant can identify wetlands and their boundaries consistent with regulating agencies such as the DEQ and the U.S. Army Corps of Engineers. Ask what kind or type of wetland identification courses the consultant has taken or how many years the consultant has been doing wetland identification work.
Make sure the consultant is knowledgeable of wetland laws. Is the consultant familiar with local, state, and federal wetland regulations? Michigan is one of two states in the country that has the authority to administer its own permit program consistent with federal requirements in most areas of the state. If a consultant is from out of state, make sure they are familiar with Michigan's environmental regulations.
Examine workmanship. Ask the consultant for examples of previous work similar to the services you are requesting, including DEQ permit numbers or Wetland Identification Program file numbers. What type of track record does this company have with local, state, and federal agencies? Request references that include clients who have had projects reviewed and approved by the DEQ. Check all references. You can obtain, at cost, copies of the DEQ's permit and Wetland Identification Program files through the Freedom of Information Act, including correspondence between the DEQ and the consultant.
Ask others. Ask colleagues and other businesses, such as real estate, developers, homebuilders, etc., that are routinely involved in wetland concerns. Ask them about their experiences and knowledge regarding the consultant you are considering.
The consultants included on the list are not recommendations of the DEQ. No attempt was made to compile a comprehensive list of wetland consultants. Listing or omission of any firm does not imply endorsement or disapproval. The DEQ makes no endorsement or representation of any qualifications or lack of qualifications by any of the individuals or companies. Any firm that asks to be included is included without review of qualifications. The State of Michigan makes no warranties, expressly or implied, as to this list's accuracy or completeness, or to the competency, qualifications, or professional abilities of any consulting firm listed. This list is provided as a service by the DEQ, and the user is advised to exercise good judgment in its use. You should investigate these businesses similar to any other service or establishment that you would deal with.
| 86,116
|
A glass of V8 or a McDonald's Caesar salad with grilled chicken may seem like healthy alternatives, but they're on a new list of foods with surprisingly high levels of sodium.
Sodium - which we consume through salt, baking powder and baking soda - is often found in foods consumers might not think to check, according to Consumer Reports, which found it is surprisingly easy to go over the recommended daily limit of 2,300 milligrams a day for the average adult. And the limit is just 1,500 mg for middle-aged and older adults.
With heart disease being the nation's biggest killer, a 50 percent reduction in daily sodium intake could save 150,000 lives a year, according to the American Medical Association. The good news is that salt is an acquired taste, so anyone prone to adding a pinch here or a dash there can reverse the habit by gradually cutting down.
But it's hard for consumers to know what they're getting, unless they read packages carefully. For example, low-fat foods such as baked potato chips can be higher in sodium than their full-fat counterparts because sodium is used to compensate for flavor. Consider that a portion of the baked version of Ruffles Potato Chips has 40 milligrams more sodium than the original.
High sodium levels may come as a surprise to many boomers who are watching their calories at holiday parties, and trying to make healthy decisions about the foods they eat to lower the risk of high blood pressure and other conditions.
Sodium surprises also present challenges for people charged with cooking for the holidays. The average American consumes up to 2,000 mg more than the recommended daily limit on holidays.
"Unfortunately, cutting back isn’t easy because of the high levels of sodium in the many processed and prepared foods that Americans eat on a regular basis," said Jamie Hirsh, associate health editor at Consumer Reports.
Consumer Reports analyzed 37 supermarket staples and found large amounts of sodium in some foods that don’t necessarily taste salty.
For example, a cup of Kellogg’s Raisin Bran contains 350 milligrams of sodium, while a half-cup of Friendship 1% low-fat cottage cheese has 360 mg. A single Pepperidge Farm Whole Grain White Bagel has 440 mg.
Consumer Reports also found that sodium lurks in foods that consumers may never think to check:
- Four strands of Twizzlers Black Licorice Twists have 200 mg.
- Prego Heart Smart Traditional Italian Sauce contains 430 mg per half-cup.
- Aunt Jemima Original Pancake and Waffle Mix yields 200 mg per pancake when prepared as directed.
- Heart Healthy V8 vegetable juice has 480 mg in one cup.
- McDonald’s Premium Caesar Salad with grilled chicken contains 890 mg - without dressing
At McDonald's, even fries have less sodium than the salad, with 350 mg in a large order.
Spoonful of Salt
The 2,300 mg limit means adults should get no more than one teaspoon of table salt a day. People with hypertension, those middle-aged and older, and African-Americans should aim for less than that - no more than 1,500 mg. But the average American ingests 2,900 to 4,300 mg daily.
A high-sodium diet might increase a person’s risk of high blood pressure - and subsequent heart attack, kidney disease and stroke. Sodium also steps up the risk of asthma, kidney stones, osteoporosis and stomach cancer.
Consumers might be getting sodium, even if “sodium chloride” is not listed as an ingredient, Hirsh said. It's important to check food labels because sodium is contained in disodium guanylate, disodium inosinate, sodium caseinate, sodium benzoate, sodium bicarbonate, sodium nitrite, and other combinations. Some of those ingredients are flavor enhancers; others are thickeners, preservatives or texture enhancers.
Consumer Reports also advised consumers to do the following:Shop for condiments with no salt added. That includes buying canned vegetables packed with less salt, and avoiding meats and poultry that have been marinated or injected with salty solutions.
Be a salt-conscious chef. Use herbs and spices, salt-free seasoning blends, citrus juice and flavored vinegars instead of salt. Use sodium-free broth as a base for homemade soup.
Avoid sodium heavyweights. On this list is: soy sauce (1,160 mg per tablespoon), chicken bouillon (1,100 mg per packet) and frozen dinners (Stouffer’s Lasagna with Meat & Sauce, 930 mg per serving), as well as cured meats such as bacon, ham, and hot dogs; sardines and smoked salmon; and brined foods, such as pickles and olives.
Eat at home. You can easily consume a day’s worth of sodium in a single restaurant dish.
| 113,780
|
As an elderly homeowner, having a properly working HVAC system is critical for helping you to stay safe when outdoor temperatures hit extreme highs and lows. While you might have had an HVAC unit installed in your home before, you’ll find that modern materials and systems offer more than ever before regarding energy efficiency and maintaining a comfortable indoor climate. Using this guide to prep for a proper HVAC installation helps you get the most from your investment.
Know When to Repair Vs. Replace a System
When you’re living on a fixed budget, you might prefer to stretch the life span of major appliances in your home for as long as possible. Many common HVAC issues are fixable when you work with a company that has the equipment and experience to complete repairs. However, there will eventually come a time when repairing a unit is no longer possible. Working with a trustworthy contractor helps you feel more confident about taking their advice when they suggest a replacement.
Ask How to Improve Energy Efficiency
Even the best HVAC system in the world won’t do much to cool or heat a home if there are significant issues with ductwork and insulation in your home. Steve Patrick Air Conditioning & Refrigeration, Inc is one of the many companies that recommend inspecting each component of the system in your home. In many cases, it is possible to rebuild or repair ductwork, add insulation or upgrade to more efficient windows to maximize the efficiency of your home’s system. Adding new insulation during the HVAC installation could help you save money over time.
Inquire About Split Systems
Older adults who no longer have children living at home often use only a portion of their house. If you fall into this category, then you could be wasting money heating and cooling rooms that you hardly use. Special split systems are an option that could allow you to only change the temperature in the parts of your home that matter the most. These systems can be custom designed to fit your lifestyle so that you can easily shut off cooling in a room until guests arrive for a visit.
Finish Up By Learning About Maintenance
Before you sign off on an installation project, you’ll want to make sure that you understand how to keep it running. Qualified professionals should take the time to explain to you where and how to change the air filters. They’ll also recommend a schedule for inspections and seasonal maintenance. Learning how to care for your new HVAC system helps to extend its life span, and it helps you avoid common issues that could leave you exposed to unsafe living conditions.
Exploring your options for a new HVAC unit helps you to create a custom plan that fits your every need. Whether you rarely use certain rooms or sense that your older home lacks proper insulation, communicating these concerns to an HVAC professional helps them to find solutions that make your house more comfortable during every season.
| 101,899
|
By Stan Toler
By now, you are either running flat out toward that New Year’s goal or you are still adjusting your footing on the starting blocks. January isn’t just the first month of the Gregorian calendar; it’s an open door to the next 11 months. The month was named after Janus, the Roman god of gates and doors—the god of beginnings.
Of course eons before secular scholars hung the title on a false god, the true God of beginnings was forming the days and deeds of our redemption. Every new day would be a doorway of opportunity. Think about some current doorways of opportunity, and move on through.
1. Move through the doorway of devotion. Work on being more devoted to your devotions, your daily quiet time. Add an inspirational book to your Bible reading. Vary your devotional time with music listening, prayer walking, or journaling.
2. Move through the doorway of improved relationships. Make family and friends a calendar priority. Utilize text messaging and social media. Actually “do lunch” instead of just promising it. Write a note, send some flowers, or have that promised round of golf. Make the first move.
3. Move through the doorway of wholeness. Put yourself on your calendar. When you neglect DOWN-time, you’ll be more apt to get UP-set. Find a stress reliever and incorporate the time into your planning. It’s just what the Great Physician ordered (Mark 6:31).
4. Move through the doorway of improvement. Schedule vocation-related reading, seminars, podcasts, or online classes. None of us have truly arrived until we discover we have a long way to go!
So get started or keep going! James Conant said, “Behold the turtle. He makes progress only when he sticks his neck out.”
You are loved and appreciated.
| 228,714
|
Installation of “Fedora 22 Workstation” with Screenshots
Fedora Project has proudly announced the general availability of Fedora 22. Fedora 22 which don’t have a name has succeeded Fedora 21. Fedora comes in three editions namely Workstation for desktop and Laptops, Server for powering the Server Machine and Cloud for Cloud and Docker related application hosting and Deployment.
We have covered a detailed description of what’s new in Fedora 22 Workstation, Server and Cloud, to know what you can expect in various editions and in general in the latest release of Fedora, go through this article.
If you are running a previous version of Fedora and want to Update to Fedora 22, you may like to go through this article:
If you are trying Fedora for the first time or want to install fedora 22 on one of your system, this guide will help you in Installing Fedora 22 and also we would be reviewing features/applications briefly, after installation.
The very first thing is to download the ISO image of Fedora 22 from the official Fedora website, as per your machine architecture.
To download Fedora 22 Workstation, use the link below. You may wget the image file as well.
Download Fedora 22 Workstation Live Image
- Fedora-Live-Workstation-i686-22-3.iso – Size 1.3GB
- Fedora-Live-Workstation-x86_64-22-3.iso – Size 1.3GB
Download Fedora 22 Workstation Netinstall Image
- Fedora-Workstation-netinst-i386-22.iso – Size 510MB
- Fedora-Workstation-netinst-x86_64-22.iso – Size 447MB
Installation of Fedora 22 Workstation
1. Now you have downloaded the image file, check the integrity of the ISO file by checking its hash value and match it with the one provided by Fedora Project on their official site.
You can get the Fedora Image Hash from the link https://getfedora.org/verify
First calculate the hash of your ISO image.
$ sha256sum Fedora-Live-Workstation-x86_64-22-3.iso Sample output 615abfc89709a46a078dd1d39638019aa66f62b0ff8325334f1af100551bb6cf Fedora-Live-Workstation-x86_64-22-3.iso
If you are using 32-bit workstation ISO image, you can go here Fedora-Workstation-22-i386-CHECKSUM and match the hash value provided by fedora Project.
If you are using 64-bit workstation ISO image, you can go here Fedora-Workstation-22-x86_64-CHECKSUM and match the hash value provided by fedora Project.
Once confirmed! Your Downloaded image is complete and error free, its time to burn this to a DVD-ROM or write it to a USB Flash Drive.
2. You may use tools like ‘Brasero‘ to burn the Image to DVD-ROM or use Unetbootin to make USB Flash Drive Bootable. You may also use Linux ‘dd‘ command to write the image to USB flash Drive and make it bootable.
If you want to know more about making USB bootable with Unetbootin and ‘dd‘ command in Linux, here is the link you would like to go through https://www.tecmint.com/install-linux-from-usb-device/.
3. Now Insert your Bootable Media in the Drive/slot, and select to boot from that specific device in BIOS. As soon as your system boots into Fedora 22, you will get a Boot Menu, either wait for automatic booting into Live Mode or Press Return Key to start fedora Live Instantly.
4. On the Next Screen, you get option to try it before installing. I have already tested it and hence will go for “Install to Hard Drive”.
5. Time to select your Keyboard language for installation.
6. You get a screen where you can configure 4 things – Keyboard, Time & Date, Installation Destination and Network. You may select Time and Date and set it as per your Geographical Location.
7. Click on Installation Destination and select “I will Configure Partitioning”. You may select “Automatically configure Partitioning”, if you want automatic partitioning, however the fact is Manual Partitioning gives you better control over System Disk/LVM space. Click on Done.
8. The next is Manual Partitioning Windows, here click on
+ icon and create
/boot partition and Enter Desired Capacity size as per your requirements. Finally Click “Add Mount Point”.
9. Similarly create
Swap partition and enter Desired Capacity, finally click “Add Mount Point“.
10. Finally create
root (/) partition and in desired capacity, enter all the disk space that is available, if you don’t want to create any extended partition.
root (/) partition filesystem type is XFS. here disk partitioning process is over click ‘Done‘ to continue…
11. The System will ask if you want to destroy the format. Click “Accept Changes”.
12. Now you will return back to Installation Summary Windows, select “Network & HOST NAME” from there and enter your desired Host Name. Click Done, when finished.
You will be back to Installation Summary Screen. Now everything seems right here. Click “Begin Installation”.
13. The system will start installing software followed by configuration and installing bootloaders. All these will be carried out automatically. Just just have to take care of two things from this windows. First create a new root password and second create a new User Account.
14. Click on Root Password, and enter a root password. Remember to create a strong Password. (In testing, I just needed to check a few things and security for me was not a concern hence password is weak in my case). Click ‘Done‘, when finished.
15. Next click on “USER CREATION” and input necessary details viz., full name and user name, password. If you like, you may select ‘Advanced‘. Click done when you are done.
16. It will take some time to complete the process. When completed, you get message “Fedora is now successfully installed and……” click quit.
17. Next, reboot the system and you may notice the boot option which indicates boot-loader detected the Fedora 22 installation partition.
18. After boot, you will get a login screen of the Fedora 22, you just installed. Enter the user_name and password in the resulting window.
The Very first Impression. Looks like crystal clear.
And then you will find yourself in the mid of configuring initial setup (just few click required).
And you are all set to use your Fedora installation with all the power Fedora gives to its user. The default screen saver and update notification makes sense and seems very nicely implemented.
Quick Review of Fedora 22 Workstation
The notifications now appears in the center of top bar.
Everything be it icon or text seems very much polished.
Mozilla Firefox is the default Browser.
The list of pre-installed applications are least which ensures nothing extra is installed and running thus you can be sure that no undesirable application is eating your system resource. Moreover similar type applications are grouped together.
The nautilus manager file and folder viewer, seems very smooth.
Virtual Desktop is pretty simple and clear..
DevAssistant setup wizard allows developer to develop Applications in major Programming Language (you may add more) from one Application. This is going to make the life of developers very easy.
Boxes – The Virtualization tool. No need to look for third party virtualization platform. Though I have not tested Boxes and I am not sure and hence can not compare it with other virtualization Application Software available there.
Yum install … oops! Yum is no more the package manager in Fedora 22. DNF replace YUM. You may notice the warning that Yum is deprecated.
To know more about on how to use dnf to manage packages in Fedora, read 27 DNF Commands and Usage to Manage Packages.
I tried checking the version of gcc. Gcc is not installed by-default. I was astonished to see it is recommending to install gcc automatically based upon the last command I run.
Tried switching to another virtual desktop and amazed by the improvement. Prior to this, the Applications were not visible while switching to virtual desktop and desktop background was the default background here.
You will notice the difference, if you have used Gnome 3 and have used Virtual Desktop. (For a person like me who deals with lots of files and applications and scripts simultaneously, Virtual Desktop is a life savor. It helps me keep things separate and arranged)..
The Settings window. Nothing new but polished surface, text and icons here as well.
Reboot/power off Menu completely changed. The interface now is brighter, clear and very readable. Also you have the option to install pending software updates from this window.
I am very much satisfied with Fedora 22. It provides more than what it promises. I remained a fan of Gentoo GNU/Linux and Debian GNU/Linux, still I appreciate fedora 22. It works out of the box. Most of the packages (if not all) are updated and you know that’s why it is called bleeding edge.
I am going to recommend Fedora 22 to anyone who want to make most out of their system. Also a 2GB RAM was sufficient as I tested it thoroughly. Nothing seems to lag. Congratulations to Fedora Community for such nicely developed OS.
From the readers of Tecmint, I would personally suggest to use Fedora, at least test it. It is going to redefine Linux standards. Who says Linux is not beautiful. Look at Fedora you will have to take your words back. Keep Connected! Keep Commenting! Keep Sharing. Let us know your view on this. Like and share us and help us get spread. Enjoy
| 285,299
|
Victoria’s road safety camera system consists of both fixed and mobile cameras placed at carefully chosen locations.
The types of camera are:
- fixed speed
- fixed red light (some fixed road safety cameras enforce red light offences only, while others detect both red light and speed)
Road safety cameras positioned at intersections are preventing crashes and in doing so are saving lives, minimising and averting injuries.
Research by the Monash University Accident Research Centre (MUARC) shows a 47% reduction in crashes on the intersection approach where a camera was installed and a 26% reduction on the other intersection approaches.
Cameras are positioned on freeways to prevent motorists from exceeding the speed limit.
Ensuring motorists obey the speed limits on our freeways is critical as crashes at higher speeds have more severe consequences, with higher rates of fatalities and serious injuries.
There are currently road safety cameras located on the following Victorian freeways:
There is 1 railway level crossing road safety camera system in Victoria at Bagshot on the Midland Highway northeast of Bendigo.
This camera system monitors both speed and red light offences for traffic travelling in both directions.
| 147,158
|
Good information practices for vaccine safety web sites
The World Wide Web is undoubtedly a mine of useful information on various topics. Unfortunately, and partly as a result of the absence of regulation, some of the information provided can be of dubious credibility and at times misleading. This is particularly true in the area of vaccine safety, on which a flurry of websites providing unbalanced and misleading information (including the purporting of unfounded rumours), has appeared. This can lead to undue fears, particularly among the general public.
In an effort to alleviate this problem, WHO has decided to assist readers of websites in identifying those sites providing information on vaccine safety that comply with good information practices. With this aim, GACVS has been asked to recommend a list of criteria that sites providing information on vaccine safety should adhere to.
The criteria in the list established following this request fall into four categories:
It is intended that the review by readers of the adherence of websites providing information on vaccine safety to the criteria in the list, particularly those relating to credibility and content, will help determine the trustworthiness of the site. In addition, organizations providing information on vaccine safety may wish to review to what extent their sites comply with such criteria and subsequently make enhancements where possible.
| 212,816
|
Being able to unlock your cell phone or smartphone so that it can be used by another network is something that many device owners would love to do. In January, the Digital Millennium Copyright Act put in a new rule that made it illegal for US consumers to unlock their phones, unless they got permission to do so by their wireless carrier.
Today, the Obama Administration gave its support for cell phone unlocking via a official response to a online petition on the subject at the White House website. The response to the petition, written by Obama's senior Internet, Innovation and Privacy adviser R. David Edelman, stated:
The White House agrees with the 114,000+ of you who believe that consumers should be able to unlock their cell phones without risking criminal or other penalties. In fact, we believe the same principle should also apply to tablets, which are increasingly similar to smart phones. And if you have paid for your mobile device, and aren't bound by a service agreement or other obligation, you should be able to use it on another network. It's common sense, crucial for protecting consumer choice, and important for ensuring we continue to have the vibrant, competitive wireless market that delivers innovative products and solid service to meet consumers' needs.
The White House would support a number of different solutions to this issue, according to Edelman, which might include putting in what he called "narrow legislative fixes in the telecommunications space." Today, the Federal Communications Commission's chairman Julius Genachowski put out his own thoughts on the matter, saying that the FCC is looking into the matter. He added, "From a communications policy perspective, this raises serious competition and innovation concerns, and for wireless consumers, it doesn’t pass the common sense test."
| 45,595
|
Expert sustainability advisers will be on hand at the High Life Expo to provide free advice and practical tips for apartment residents seeking to rein in high energy bills and improve the comfort of their buildings.
Aimed at apartment residents, owners and facility managers, the 3rd annual High Life Expo is on in Melbourne on Saturday 20 May 2017, with a bigger expo and a fresh workshop program. Register here.
Until now, apartment buildings have fallen through the cracks with regard to broader controls around environmental performance and thermal comfort. But with over two million people now living in multi-residential settings in Australia (apartments account for 80 per cent of residential dwellings within the City of Melbourne) and many thousands of apartments in the construction pipeline, the concerns of this growing constituency can no longer be ignored.
Presented by the City of Melbourne and Smart Blocks in partnership with City of Port Phillip, City of Stonnington, and Yarra Energy Foundation, and supported by the Alternative Technology Association (ATA), the event will provide information on what apartment renters and owners can do to improve the comfort and efficiency of their apartments, explore sustainability innovation for their buildings, and reduce common area energy bills. It will also feature a vendor expo with 45 stalls offering sustainability products and services for the strata sector.
Recently, a small handful of government announcements have given apartment sustainability advocates reason for optimism. Late last year, COAG agreed to fund the National Australian Built Environment Rating System (NABERS) to create a 6 Star energy rating tool for apartment building common areas. And in Victoria, the newly minted Better Apartment Design Standards become effective from March 2017 and aims to drive up apartment quality through encouraging natural ventilation, minimum solar access and even maximum cooling loads for apartments.
“We’ve seen how effective mandatory energy efficiency standards have been in the commercial sector,” says Donna Luckman, CEO of the Alternative Technology Association. “It’s great to see that attention is now being turned to the sustainability of apartment buildings.”
High Life Expo aims to bring together those people who have already made changes, and have seen the savings and improvements in the liveability of their buildings, with people eager to start the journey.
Even without government incentives and regulation, however, many owners committees are going it alone and are already reaping the benefits of investing in building improvements. “Although individual apartments are often small in size, the energy used in common property areas can be significant, and the costs are passed onto owners through strata fees,” explains Kulja Coulston, editor of magazine Sanctuary: modern green homes. “Residents can have more power than they think to improve the performance of often inefficient and poor quality buildings.”
High Life Expo is on Saturday 20 May 2017, 12-5pm, at the Melbourne Town Hall, 90-130 Swanston St, Melbourne. It’s free to attend; register here.
| 253,225
|
If you’re a WSU student, faculty, or staff, you now have access to Historic Illustrations of Art and Architecture in Luna, a collection of 350 scans taken from various public domain works. These historic illustrations were originally published during the late nineteenth and early twentieth centuries and cover a wide range of objects from Europe and the Middle East. Many originally appeared in publications that predated the widespread use of photography for art documentation. These engravings, line drawings, and plans for many well-known historic structures reflect both the technological and aesthetic standards of their time.
I had to laugh when I came across this image yesterday and realized how different our ideas about the meaning of things change over the years. In this image which was obviously set up, Santa is looking through the window at two children, one is asleep on the floor but the other is still wide awake and staring up at the decorated tree. Looking at this image with 21st Century eyes, at least in my case, especially the look on Santa’s face as he gazes into the window, it seems sinister and creepy.
Other Images of Santa in Virtual Motor City
Beginning July 4th, the fourth iteration of the annual World eBook Fair kicks-off. For one month, the World eBook Fair gives you free, full-text access to over 2 million PDF eBooks–short version: you can download as many eBooks as you want directly to your desktop for free.
For those of you who read on-the-go, some of these titles are compatible with mobile devices.
Go now, download, and read!
In our ongoing effort to improve the searching and browsing of the Virtual Motor City collection, we’ve just reloaded the collection’s metadata, updated with the latest additional information: descriptions of photographs, Library of Congress subject headings, and our brand new field, titles.
With the new title field, you’ll notice that some records contain two titles: Historical Title and Title. You may ask, well, what’s the difference? Here’s our explanation.
There are two title fields, Historical Title and Title. Historical Title is the name given to the photograph by the Detroit News Photographer who took the photo(s). This field, while historically significant and interesting, is riddled with problems when it comes to searching because a lack of consistency. The photographers did not use an authority list, so photographs that are similar, such as three pictures of cars, might be labeled totally different. One might be simply “Autos” while another might be the model and brand, while another might be “Street Scenes.” The NEW title field is original metadata added by a metadata librarian, that looks to give some consistency back to the titles and also add titles to records that never had one. Once we’ve reached a significant number or records with this new field, users will have the ability to browse by title.
Interested in graphic design, fonts and typography? Unique Michigan histories? We’ve just added a new collection, WPA Music Manuscripts, a digitization and access project that digitized and cataloged detailed and ornate hand-copied music manuscripts produced by Michigan men and women under the WPA during the Great Depression. The collection and accompanying resources highlight the people and work that were a part of the Music Copying Project, supported by the Federal Music Project and WPA. The Federal Music Project employed men and women to copy music for WPA orchestras, bands, and choruses to perform. The collection is currently housed at the Detroit Symphony Orchestra’s archives.
| 255,171
|
Hang in there. As couples age, humor replaces bickering
Honeymoon long over? Hang in there. A new UC Berkeley study shows those prickly disagreements that can mark the early and middle years of marriage mellow with age as conflicts give way to humor and acceptance.
Researchers analyzed videotaped conversations between 87 middle-aged and older husbands and wives who had been married for 15 to 35 years, and tracked their emotional interactions over the course of 13 years. They found that as couples aged, they showed more humor and tenderness towards one another.
Overall, the findings, just published in the journal Emotion, showed an increase in such positive behaviors as humor and affection and a decrease in negative behaviors such as defensiveness and criticism. The results challenge long-held theories that emotions flatten or deteriorate in old age and point instead to an emotionally positive trajectory for long-term married couples.
“Our findings shed light on one of the great paradoxes of late life,” said study senior author Robert Levenson, a UC Berkeley psychology professor. “Despite experiencing the loss of friends and family, older people in stable marriages are relatively happy and experience low rates of depression and anxiety. Marriage has been good for their mental health.”
Consistent with previous findings from Levenson’s Berkeley Psychophysiology Laboratory, the longitudinal study found that wives were more emotionally expressive than their husbands, and as they grew older they tended toward more domineering behavior and less affection. But generally, across all the study’s age and gender cohorts, negative behaviors decreased with age.
“Given the links between positive emotion and health, these findings underscore the importance of intimate relationships as people age, and the potential health benefits associated with marriage,” said co-lead author Alice Verstaen, who conducted the study as a Ph.D. student at UC Berkeley and is currently a postdoctoral fellow at the VA Puget Sound Health Care System.
The results are the latest to emerge from a 25-year UC Berkeley study headed by Levenson of more than 150 long-term marriages. The participants, now mostly in their 70s, 80s and 90s, are heterosexual couples from the San Francisco Bay Area whose relationships Levenson and fellow researchers began tracking in 1989.
In their investigation of marital relationships, researchers viewed 15-minute interactions between spouses in a laboratory setting as they discussed shared experiences and areas of conflict. They tracked the emotional changes every few years.
The spouses’ listening and speaking behaviors were coded and rated according to their facial expressions, body language, verbal content and tone of voice. Emotions were coded into the categories of anger, contempt, disgust, domineering behavior, defensiveness, fear, tension, sadness, whining, interest, affection, humor, enthusiasm and validation.
Researchers found that both middle-aged and older couples, regardless of their satisfaction with their relationship, experienced increases in overall positive emotional behaviors with age, while experiencing a decrease in overall negative emotional behaviors.
“These results provide behavioral evidence that is consistent with research suggesting that, as we age, we become more focused on the positives in our lives,” Verstaen said.
In addition to Levenson and Verstaen, co-lead authors of the study are Sandy Lwi, a researcher at the San Francisco Veterans Affairs Medical Center, and Claudia Haase, an assistant professor of human development and social policy at Northwestern University.
Previous articles on Levenson’s long-term marriage study:
| 172,590
|
Deciding to believe: The ethics and rationality of religious belief
- 48 Downloads
KeywordsReligious Belief Traditional Theism Religious Faith Rational Belief Moral Realism
These keywords were added by machine and not by the authors. This process is experimental and the keywords may be updated as the learning algorithm improves.
Unable to display preview. Download preview PDF.
© Springer SBM B.V. 1995
| 11,105
|
The Times Sunday newspaper in Swaziland is at the centre of another row after its columnist Qalakaliboli Dlamini wrote that battered women in the kingdom were to blame when men were violent against them.
He also said that the serial killer David Simelane, recently sentenced to hang for the murder of 32 women, might have been driven to the crimes because he was once falsely accused of rape by a woman.
Dlamini, who earlier this year was suspended from writing his column for the newspaper after readers were outraged by homophobic comments he wrote, was criticising the 16 Days of Activism Against Gender Violence campaign.
He wrote that 'most' women who were victims of violence brought it upon themselves. He also said women were to blame for turning men violent.
He wrote, 'In fact, when a woman is battered, she may have caused more internal damage to the male who will have caused her external harm. Let us be honest with each other, women are the biggest abusers in the world.'
He said women were 'culprits' not 'victims'. He said, 'Women have carved themselves as the victims of this world and they are demanding even more than they deserve.'
He added, 'Women find comfort in portraying themselves as victims.'
In a confused piece of writing, he also seemed to say that it was understandable why serial killer David Simelane murdered 32 women ... it was because he had once been falsely accused by a woman of raping her.
He wrote, 'Simelane once said he had served a prison term of seven years for a rape he never committed, which was the reason he had so much resentment towards women.'
Commentators on social networks, including Facebook, were quick to condemn Dlamini. Some are suggesting an advertising boycott against the Times of Swaziland, the group that owns the Times Sunday.
Dlamini is no stranger to controversy. In May 2012 he was suspended after he wrote that he was a proud homophobe and he hated homosexuals. Times Sunday editor Innocent Maphalala 'unreservedly' apologised after an 'unprecedented' number of readers complained.
| 42,015
|
Illegally dumped tires removed
Tires originally slated to be removed by November
Hundreds of thousands of tires that were illegally dumped on public property in northern New Mexico have been removed.
A few months ago, about 400,000 tires were dumped on state trust land near Wagon Mound.
The dumping posed an environmental and financial liability. For example, if struck by lightning, the tires would have been transformed into a petroleum fire that could have burned for months, if not longer.
Now they’ve been bundled, loaded and hauled off to be disposed of properly.
The person who dumped the tires is living up to an agreement with the state and paying to get rid of them, according to State Land Commissioner Ray Powell.
The site was slated to be cleaned by November, but the project may conclude sooner.
| 218,861
|
How To Hack DNS Server To Get Faster Internet speed?In How To
The internet has become a part of our life. Internet plays the most important role in social development and technological progress. But, the main problem begins when the internet speed becomes extremely slow and sluggish.
Well, there’re many ways to get faster internet on a PC. I am going to tell you simple DNS hacks that can boost your internet speed. Most of us are always blaming our Internet service provider (ISP) for slow internet connection. So, let me explain first about the DNS before the method to get faster internet speed.
How To Hack DNS Server To Get Faster Internet speed?
What is DNS?
DNS – Domain Name Server like a phone book for internet. If you know a person’s name but you don’t know about his phone number. You must see his number in the phone book. DNS provides the same service to the internet.
When you enter https://www.techxerl.net or (http://abc.xyz) in your browser address bar, then your PC or Computer uses DNS to retrieve the website’s IP address (like 172.16.28.20). You can also surf websites without DNS, visiting websites by IP address directly, like – http://172.16.28.10.
What is OpenDNS?
OpenDNS is a Domain Name System service that offers free and premium DNS for an individual or any organization to improve your security as well. OpenDNS offers better page loading and also avoid harmful, malicious web pages. OpenDNS also offers incredible features that include domain blocking, typo correction, secure DNS, provide botnet protection and more.
How to Boost Up Internet Speed Using DNS Hack?
To get faster internet speeds and better security, you have to use free “OpenDNS” service. Alternatively, you can use also use Google DNS services for boosting up your internet speed. Whereas OpenDNS is most recommended and completely free. Just follow the simple steps below. So you can use OpenDNS as an alternative DNS server instead of your default DNS.
Must Read: How To Speed Up Internet Using CMD?
Step 1: To get high speed internet using OpenDNS, you have to open the Control Panel First.
Step 2: Go to Control Panel>> “Network and Internet options.”
Step 3: Now, click on the “Network and Sharing Center.”
Step 4: Now, just click on “Internet connection” and then click on “properties.”
Step 5: Click on the Internet Protocol version 4 (TCP/Ipv4) and click on properties.
Step 6: Now choose the following DNS server addresses to get faster internet speed.
Preferred DNS server: 188.8.131.52
Alternate DNS server: 184.108.40.206
Step 7: Now, you’re using OpenDNS server that helps to get better Internet speed.
To Configure IPv6:
As you have configured IPv4 above, just highlighting the “Internet Protocol Version 6 (TCP/Ipv6)” and click on the properties and choose the preferred DNS server address.
- Preferred DNS server:2620:0:ccc::2
- Alternate DNS server:2620:0:ccd::2
Must Read: How To Enable Windows 10 Fast Startup?
If you’re not happy with OpenDNS you can alternatively use Google DNS to get faster speed.
For IPv4: 220.127.116.11 and 18.104.22.168.
For IPv6: 2001:4860:4860::8888 and/or 2001:4860:4860::8844
There’re so many advantages using OpenDNS and Google DNS other getting a faster internet speed. If your DNS server of internet service provider (ISP) goes down, then you’ll unable to make use of the internet. But, if you are using Google DNS or OpenDNS method, then you can peacefully browse the internet when your default DNS is goes down.
Both Google DNS and OpenDNS work well but, people prefer Google DNS over OpenDNS. You can choose anyone to boost up internet connection. You need to just follow the simple steps explained above.
| 213,303
|
Ponca City writes "Every year, millions of Americans pay needless penalties because they don't file their taxes on time, forgo huge amounts of money in matching 401(k) contributions because they never get around to signing up for a retirement plan, and risk blindness from glaucoma because they don't use their eyedrops regularly. James Surowiecki writes that procrastination is a basic human impulse, a peculiar irrationality stemming from our relationship to time — in particular, from a tendency that economists call 'hyperbolic discounting,' the ability to make rational choices when they're thinking about the future, but, as a future event gets closer, short-term considerations overwhelm their long-term goals. Game theorist Thomas Schelling proposes that we think of ourselves a collection of competing selves, jostling, contending, and bargaining for control, where one represents your short-term interests (having fun, putting off work, and so on), while another represents your long-term goals. Philosopher Mark Kingwell puts it in existential terms: 'Procrastination most often arises from a sense that there is too much to do, and hence no single aspect of the to-do worth doing. Underneath this rather antic form of action-as-inaction is the much more unsettling question whether anything is worth doing at all.'"
| 278,617
|
From the wildly famous work by sociologist Annette Lareau, we know that middle-class parents adopt "concerted cultivation" to intensely develop their children's skills/talents, as well as communication and negotiating skills, through hectic schedules of formal activities, while working-class and poor parents use a "natural growth" strategy, which leaves children to play on their own and develop their skills spontaneously and often among extended family. There are benefits and costs to each one. Please see Lareau's book for a more detailed discussion of her research findings, which is also easy to read. From this review (since I am still at Census training and not at home near my books), "according to Lareau, middle-class children are more likely to be argumentative, complain of boredom, demand attention, and have weak ties with siblings and other relatives." The natural growth strategy also has costs because society, especially schools, values the skills learned through concerted cultivation. Concerted cultivation is a new strategy (since I think the late 1960s), which has become a response by parents to deal with the ever increasingly competitive educational and career markets.
The Census data reveals some surprising trends in parenting. I would highly recommend the Census' child well-being report and the even more fascinating tables. For example, see Table D8: Daily Contact: Mealtimes with Child, Characteristics of Families. Overall, 56.5% of parents have dinner daily with their teenagers. Those with lower incomes and especially the lowest incomes are more likely (67.9%) to have dinner daily with their teenagers than those with higher and especially the highest incomes (48.7%). Let me know any other interesting trends you find.
| 283,608
|
Pricing is the best way to improve margins. But many B2B organizations are struggling with ever-increasing volumes of pricing data.
While intelligent pricing solutions use this data to provide optimized pricing, many commercial AI and machine learning pricing solutions don’t explain what’s being analyzed and how results get calculated. Even worse, you can’t customize inputs and criteria to get insights that are truly actionable for your organization. In other words, whether you are using a “black box” or a “glass box” solution, pricing guidance control is missing.
There is a third way: the centaur approach to intelligent pricing combines AI and machine learning with the human intelligence of your sales teams to offer optimized, tailored, and transparent pricing in every situation.
“Black Box” vs. “Glass Box” Pricing Solutions
Intelligent pricing solutions enable you to offer different, optimized prices based on a number of variables. For example, customer history, deal size, geography, and time of year.
“Black box” pricing technology solutions are probably the most common on the market, but also the least transparent of solutions.
The most that a typical “black box” solution will provide are the “stretch,” “target,” and the “floor” or lowest possible sales prices. More often, a black box solution may only provide one target price. Without much visibility behind the rationale for that pricing guidance.
Additionally, there is no ability to “interrogate” the black box approach to discover the “why” behind the pricing provided.
Better than black box? A “glass box” approach. A glass box solution provides the target price but also shows you the pricing waterfall – a complete picture of all the variables that affected the final price that a customer was willing to pay.
Meet Centaur: Glass Box Transparency + Human Control
Best-in-class intelligent pricing solutions go one step further than a glass box. “Centaur” intelligent pricing provides all of the visibility of a “glass box” solution. Yet with the added ability to include human intelligence and control.
In mythology, a centaur is half-man, half-horse. Back then, this was a compelling notion: that the intelligence and skill of a human could be merged with the strength and speed of a horse. In technology, the centaur model represents the convergence of human and machine intelligence to deliver something superior to both.
Even with AI, technology by itself isn’t always smarter than your sales team. That’s why the human component is so critical to intelligent pricing. The centaur model enables you to adjust a price based on specific information that was not included in the original AI-driven pricing model.
So How Does the Centaur Model Work in a Sales Process?
Centaur gives you an added layer of control. You can manually “prune” out a variable that is affecting pricing, such as geography, supply levels, or previous discounts. For instance? A buyer at a company may have been grandfathered into a discount that is longer offered. When that buyer leaves the company, the salesperson can change that pricing model to remove that discount going forward.
An AI-driven pricing algorithm might not know these specific variables. But a centaur approach allows for human intervention. Manual adjustments from your team can have a large impact on margins and the bottom line.
Centaur Enables More Powerful Negotiations
AI with expert human intelligence enables you to:
- Use pricing science algorithms to build the complete segmentation tree
- Manually set, modify, and add changes to reflect business judgement at the broadest and most granular levels
- Provide statistical feedback and safety nets to ensure profitable outcomes and confidence.
Be Confident in Your Pricing, Every Time
AI-driven solutions provide transparent pricing guidance and segmentation based on historical transactions – and easily explainable recommendations through statistical and visual interface. Clear, insightful, up-to-date information enables your sales team to present and support pricing decisions in every situation.
Our own intelligent pricing solutions at Vendavo take a centaur approach. They give your sales team the flexibility to consider continuous market dynamics. Those include supplier cost increases and competitive pricing changes, helping to optimize your intelligence engine. When we use the term “AI”, we prefer to think of them as delivering augmented intelligence, not just artificial.
Ready to Take Control of Your Pricing?
Contact us to learn how Vendavo’s intelligent pricing solutions leverage the best of machine and human intelligence to provide the best price in all situations. And ultimately, help your organization win more deals.
| 150,625
|
Some of the priests identified as abusers, staring out from the pages of the local newspapers, are not strangers to me. I was on the faculty of the Seminary of the Immaculate Conception in Huntington, N.Y., from 1965 through 1979. I taught Scripture all those years and was rector for the last six. I knew many of these men.
We studied the Bible together and shared the Eucharist and prayer. We played together on the basketball court and softball field. We washed dishes and tended the seminary grounds together. As rector, I spoke to them about faith and priesthood. We met one on one about their vocation and their life in the seminary.
Psychological screening was part of the entrance routine for our seminary from the middle 1960’s. Psychologists outside the seminary staff were regularly available to interpret to the seminarians the results of the testing and to offer guidance.
Most of the men who came to seminary in those years were already fairly well known to us. Many had studied at the college seminary. There were reports and evaluations from that faculty. Some had an even longer history, having graduated from one of the high school prep seminaries. Not just priests were observing and advising, but also religious sisters and brothers and lay people.
At the seminary, the faculty met regularly to evaluate the seminarians and discuss with them their readiness to progress through the stages of preparation, based on our experience with them. Some men discerned that the priesthood was not their vocation. Others were helped to realize that they lacked some quality essential to serve well as priests. Some few were asked to leave because of obviously inappropriate behavior or attitudes.
Those who stayed the course to ordination and priesthood were not perfect. The priests teaching and forming them weren’t either. However, there was solid agreement that those recommended for ordination gave every sign that they would minister well as priests.
So what did we, as a faculty, miss? What did I, as rector, miss?
I still don’t know.
The psychologists’ sessions with the seminarians were confidential, but we regularly consulted with them for a general profile of the seminarians and for our own guidance. The advice we commonly received was that there is no foolproof psychological test that will predict the future for anyone, unless that person is very seriously troubled. We did not accept into the seminary anyone we knew to be in that state. The best indicator for the future, we were told, was present performance. We had to judge present performance by participation in the full life of the seminary, by signs of a healthy and growing spiritual life, by the quality of their relationships with other seminarians and faculty, by their ability to learn and present Catholic teaching, by how the seminarians fared in the parishes where they served in various kinds of pastoral ministry.
What went wrong with those who seemed to offer such promise and then failed so terribly in the priesthood?
Was it something they learned in the seminary? Did the shared life and support structures of the seminary not prepare them for the more individualistic life of the parish priest? Was it the culture of the time, too great an emphasis on individual freedom, not enough sense of duty, not enough awareness of sin? Was there a character flaw, perhaps unrecognized even by them? Was there something in their lives all along that they had been able to hide or keep under control? Was there immaturity that never got beyond narcissism? Did our example as priests, my example as a priest, not really model well for them?
I wish I could look back and pick out some cause or causes and tell everyone today, especially our seminarians and those involved in their formation, “Watch out for this.” But I can’t.
The great majority of seminarians from those years are true to their vocations and are still serving as priests. Recent studies have provided insights into what helped keep them faithful.
What about the others?
I suspect that many of those who did abuse young people, especially those who fell only once or a few times, feel great remorse now. What they might do to help heal those they hurt so terribly is very personal, depending on the abused and the abuser.
There is something they could do to prevent such tragedies in the future. They could continue to add to the developing understanding of what happened. What drew them into their conduct? How did they reconcile their daily celebration of the Eucharist and their preaching about Jesus with the sin in their lives? Can they now identify supports that were missing, that might have helped them get past the kind of temptations they faced? What advice would they give to seminarians, priests, bishops, families, today?
Perhaps some good might yet come from evil if we can learn from these tragic lives.
| 194,256
|
written by Tom Henderson
This is an interactive tutorial for introductory physics on resistance and Ohm's Law. It explores the journey of an electron through the wires of an electric circuit, explaining how countless collisions between the charge carriers and atoms within the wires result in loss of electrical energy. In the second part of the tutorial, students learn about factors affecting resistance, resistivity values, and how to calculate resistance mathematically.
This page is part of The Physics Classroom, a comprehensive set of interactive tutorials, labs, and simulations for students of introductory physics. The Physics Classroom is one of the ComPADRE digital library collections.
ComPADRE is beta testing Citation Styles!
Disclaimer: ComPADRE offers citation styles as a guide only. We cannot offer interpretations about citations as this is an automated procedure. Please refer to the style manuals in the Citation Source Information area for clarifications.
Citation Source Information
The APA Style presented is based on information from APA Style.org: Electronic References.
The Chicago Style presented is based on information from Examples of Chicago-Style Documentation.
The MLA Style presented is based on information from the MLA FAQ.
The Physics Classroom: Electrical Resistance: Journey of a Typical Electron:
Has Student Extra Flickr Physics
Visit The Physics Classroom's Flickr Galleries and enjoy a photo overview of the topic of electric circuits.relation by Tom Henderson
Has Teaching Guide Curriculum Corner
Learning requires action. Give your students this sense-making activity from The Curriculum Corner.relation by Tom Henderson
Has Student Extra Molecular Expressions: Electricity & Magnetism - Resistance at the Molecular Level
Observe the electron's journey with this interactive Java applet animating charge flow through a light bulb filament.relation by Tom Henderson
Has Teaching Guide Molecular Expressions: Electricity & Magnetism - Resistance at the Molecular Level
Demonstrate the electron's journey with this interactive Java applet animating charge flow through a light bulb filament.relation by Tom Henderson
Know of another related resource? Login to relate this resource to it.
Has Student Extra
| 10,656
|
A PLAYPARK with a difference is to be created in one of the city's most deprived areas.
Later this year, the £3million Pinkston Watersport Centre will open on the Forth and Clyde Canal just north of the city centre.
And today it was revealed three other high energy sports hubs are to open in the same area.
The Loading Bay will be the city's only purpose built indoor skatepark.
The £365,000 project will be set up in the former loading bay of a large industrial warehouse on the canal bank at Borron Street, just yards from Pinkston Paddlesports.
It will cater for skateboarding, BMX biking, scooter and inline skating and will be designed like a street plaza with ramps, rails, ledges, stairs and other features of an urban landscape.
The Loading Bay is the brainchild of a group of individuals who own, operate and build skateparks across Scotland and beyond.
Nearby will be created the Everyday Martial Arts Gym which will deliver a range of classes including muay thai, Brazilian ju jitsu wrestling and boxing and a range of fitness and health classes.
As well as providing a facility for elite athletes, it will also offer hands-on coaching geared towards getting the local community active by providing intensive fitness sessions.
It will also focus on family fitness sessions, working with local schools and liaising with other social enterprises in North Glasgow.
The Canal Wake Park will be run by Loch Lomond Wakeboard which has been operating on the loch for the last four years.
It will be a cable park where wakeboarders - described as snowboarders or skateboarders on water - will be pulled along at speed by a cable.
This allows them to use obstacles on the canal to perform similar tricks to those which can be done behind a boat.
It is expected the cable park will put Glasgow at the heart of the fast growing sport and attract large numbers of people to the city.
The company wants to introduce 1000 people to the sport in the first year and subsidised riding will be offered to certain community groups.
Loch Lomond Wakeboard is keen to employ local people and training will result in industry-recognised coaching facilities.
Work on Pinkston Watersports Centre is nearing completion and it is due to open to the public later this summer.
It is Scotland's only competition standard, purpose-built paddlesports venue.
It has a clean water basin, canoe polo pitches, classrooms for wet activity and changing rooms.
The centre is expected to attract 25,000 visitors a year by 2016.
All four projects have already been granted planning permission.
Scottish Canals chief executive Steve Dunlop said: "All these sports have a strong youth culture attached to them but they are aimed at participation by all parts of the community.
"This marks a major step forward for the Glasgow Canal regeneration project and the transformation of North Glasgow centred on 100 Borron Street business park.
"This is an ambitious plan for an urban sports hub that will foster community involvement and regeneration alongside the development of sporting excellence.
"However, the urban playground will only become a reality with the generous support of private, public and third sector organisations across Scotland."
Liz Cameron is chairman of the Canal Partnership which is overseeing the regeneration of the canal corridor and the city council's spokesman for business and the economy.
She said: "There has been a massive transformation taking place along the Forth and Clyde Canal corridor in the north of our city.
"It is turning Glasgow's historic canal into a place where people want to live, work and play.
"Most local authorities would consider themselves fortunate to have just one opportunity to revitalise a major waterway and enjoy the huge benefits such regeneration brings to people living along its banks. Glasgow is doubly fortunate in having two.
"The canal - our other waterfront is the River Clyde - is presenting this city with a great opportunity to revive communities in North Glasgow and bring with it all the opportunities a thriving canal system can bring."
| 69,113
|
Daughters of the American Revolution honor the memory of one of its first African-American members on the West Coast, Dr. Nelle Becker Slaton, at cemetery dedication ceremony.In an historic gathering, Hollywood Chapter DAR members, friends and family of Nelle Becker Slaton, Ph.D., assembled Sunday, November 21, 2010 at Inglewood Park Cemetery for the Society's traditional ceremony dedicating the memorial insignia engraved on her gravestone. The State Regent of the California State Society DAR, Karon Jarrard, was present to conduct the dedication. Dr. Slaton, who died Dec. 1, 2009 at age 88, made history in October 1996 when she was inducted into the Hollywood Chapter as a Daughter of the American Revolution. According to Dr. Slaton's daughter Shell Amega, also a member of the same chapter, "Mom spent three decades researching the family lines to trace and prove our roots back to Revolutionary War ancestor Pvt. Daniel Perry of Rhode Island, an Indian of the Narragansett tribe. Her acceptance into DAR was the culmination of a dream she fulfilled on behalf of her maternal grandmother who knew the family's eligibility." DAR membership eligibility is based on direct lineage to a Revolutionary War patriot regardless of race, religion or ethnic background," explains Hollywood Chapter Regent Sarah Kaiman. She adds, "Since DAR application papers do not require members to identify their race, no demographics have ever been kept on the membership. However, it is believed Dr. Slaton is among the first African American members on the West Coast." Dr. Slaton's ancestor, Pvt. Daniel Perry, was on the Narragansett Tribal Council. He, like others in the tribe, fought with the 1st Rhode Island Regiment-an all-Black regiment of approximately 450 soldiers. (All persons of color were incorporated into this all-Black regiment, including the Narragansett tribal members.) Once inducted, Dr. Slaton inspired her daughter, Shell Amega, and then her granddaughter, Marika Amegah, to become members, creating the chapter's sole three-generation member family.Nelle Becker Slaton was an active member and officer of the Hollywood Chapter from the start. A lifelong educator, she served in a number of roles for the chapter, including Librarian for 8 years and Historian for two years. At various junctures, she also chaired the chapter's Good Citizens Committee, the American History Committee and Public Relations Committee. She received recognition from the National Society for her work on the Good Citizens Committee and participation in the Women's Issues Essay contest. Following the dedication, Hollywood Chapter hosted a reception tea for guests at the Hancock Park home of Slaton family friends Delores and Ben Kerr. Chapter Historian Phyllis Hansen says "Nelle was remembered at the event as a truly remarkable and beloved woman, a high-achiever who inspired so many others to greater accomplishments themselves. She worked tirelessly towards the National Society DAR mission of patriotism, education and historic preservation, helping the chapter carry out these principles on a local level." She adds, "Nelle was also a active ambassador for DAR's cultural diversity, quick to teach that many men and women of color were amongst our nation's very first patriots and heroes." Hollywood Chapter DAR will celebrate the 100-year anniversary of its charter in January 2011 and has dedicated its new Centennial Yearbook to Dr. Nelle Becker Slaton. Mission:The DAR, founded in 1890 and headquartered in Washington, D.C., is a non-profit, non-political volunteer women's service organization dedicated to promoting patriotism, preserving American history, and securing America's future through better education for children.Notables attending: DAR Dignitaries: Regent, California State Society DAR: Karon JarrardDistrict IX Director, California State Society:Carol JacksonDAR Hollywood Chapter Officers: Sarah Kaiman, RegentKaren Nugent, 1st Vice RegentShell Amega, 2nd Vice RegentDawn Murphy, Recording SecretaryAlice Magner, Corresponding SecretaryTillie Moore, TreasurerPhyllis Hansen, HistorianChristina Johnson, ChaplainDr. Helyn Luechauer, ParliamentarianNotable - Friends and Family of Dr. Nelle Becker Slaton (among the many that were present): William Henry Slaton (Dr. Nelle's husband)Glenn Slaton (Dr. Nelle's son)Jamal BeckerAdolph Eric Becker and wife Dorothy BeckerDenise BeckerDr. Josephine YelderDr. Ted MillerBarbara SummerfieldWilma and Lorenzo WillisDr. Joyce Craft and husband Chet Atty. Raymond C. ReedAtty. Stella AlbrightLana CorbiDr. Cille WashingtonHosts: Delores and Ben KerrReception Tea Menu: Handmade scones, served with raspberry and blueberry jams and lemon curdSix varieties of handmade tea sandwichesWide selection of pastries and cookiesSelection of teas and apple cider, served in the Chapter's vintage engraved tea service. The National Society DAR recently released a genealogical resource guide, "Forgotten Patriots: African American and American Indian Patriots in the Revolutionary War," which identifies thousands of African American and American-Indian Revolutionary War patriots and documents their important contributions to the cause of Independence.
| 300,162
|
The following memo was prepared by AGI's Government Affairs Program for a member society.
Last year’s appropriations end game generated a windfall of money for land and water conservation programs, including $20 million for programs in the U.S. Geological Survey (USGS). The final budget deal represented a convergence of interest from both the White House and Congress in spending Land and Water Conservation Fund (LWCF) money generated by royalties from Outer Continental Shelf (OCS) oil and gas activities. Historically, only a fraction of the funds available for the LWCF have been spent for those purposes; the bulk has gone to deficit reduction. With the federal budget in surplus, the latter need lost its urgency.
The efforts to boost support for the LWCF is of key interest to the geological community because some of the funds are available for research, mapping and monitoring projects within the USGS, federal land acquisition, and grant money for states to use in conservation efforts. This memo addresses the evolution of LWCF efforts in the 106th Congress, the specifics of the final appropriations bills, and the prognosis for these funds in the 107th Congress.
CARA in the House
The 106th Congress used the Conservation and Reinvestment Act (CARA; H.R. 701) as the template for how to distribute and use conservation funds. CARA was introduced by Reps. Don Young (R-AK) and John Dingell (D-MI), who reintroduced CARA under the same bill number in the 107th Congress in February 2001. Rep. Young originally introduced CARA as a set of independent authorization bills to provide funding for resource protection projects through OCS royalties. The initiative aims to amend the Water Conservation Fund Act of 1965, the Recreation Recovery Act of 1978, and the Federal Aid in Wildlife Restoration Act to create a fund “to meet the outdoor conservation needs of the American people.”
H.R. 701 passed the House on May 11, 2000, in a 315-102 vote. The bill allocated $2.825 billion annually through fiscal year (FY) 2015 for conservation programs. The funds would be dispersed among conservation-oriented programs within the federal agencies in the Departments of the Interior, Commerce, and Agriculture. The programs include: Impact Assistance and Coastal Conservation, Land and Water Conservation Fund Revitalization (not automatically annually appropriated), Wildlife Conservation and Restoration Fund, Urban Park and Recreation Recovery Program, Historic Preservation Fund, Federal and Indian Lands Restoration, Conservation Easements and Species Recovery, Payment In-Lieu of Taxes (PILT), and Refuge Revenue Sharing. Several amendments were added to H.R. 701 in the House before it passed -- a provision to reduce incentives for offshore drilling, a provision that the funds were in addition to and not in lieu of payments already specified in appropriations bills, a provision that to receive funds states must have a land acquisition fund, and a provision adding the Urban and Community Forestry Program to the programs eligible for funding.
CARA in the Senate
The Senate Energy and Natural Resources Committee revised H.R. 701 to appropriate $2.99 billion annually through FY2016 for conservation programs. The committee version requires the appropriations of the Clinton Administration’s Lands Legacy Initiative to be approved annually before CARA funds can be made available. The committee also made changes in the programs and dollar amounts to be funded under the initiative. Along with the programs under the House bill, several other programs can receive funding under the committee version of H.R. 701. These programs include: Coral Reef Protection, National Park Restoration, Forest Legacy Program, Farm and Ranch Land Protection Program, Cooperative Forestry Rural Development Program, Forest-Dependent Rural Community Assistance Program, and Youth Conservation Corps Programs. The revised H.R. 701 passed the committee on September 14, 2000, then was placed on the Senate legislative calendar, but never taken up for consideration on the Senate floor.
CARA Transformed into Appropriations
Although the CARA bill did not pass Congress, proponents of the legislation as well as President Clinton pushed to have increased conservation funding included in the FY 2001 Interior and Related Agencies Appropriations bill (H.R. 4578), which funds the DOI, and the Commerce, State, Judiciary Appropriations bill (H.R. 4942), which funds NOAA and the Department of Commerce. As a result, sections of both bills contain elements from CARA: Title VIII of the Interior bill and Title IX of the Commerce bill.
Title VIII of the Interior bill establishes and authorizes a six-year, Land Conservation, Preservation, and Infrastructure program. It appropriates $1.2 billion for FY 2001 (with another $400 million appropriated by the Commerce bill) and sets maximum amounts for the remaining years, rising from $1.76 billion in FY 2002 to $2.4 billion in FY 2006. But these numbers come with the admonition: "The program is not mandatory and does not guarantee annual appropriations."
Department of the Interior
Under Part A of Title VIII of the Interior bill, $686 million is appropriated for agencies within the Department of the Interior and the U.S. Forest Service. The conference report specifies the following numbers but does not detail how the funds are to be distributed within specific programs in the broad categories. The decisions about how funds will be distributed within the federal land management agencies will be made in consultation between the land management agencies and the House and Senate Appropriation Committees. The USGS received $20 million for science programs as follows:
USGS science programs
National mapping $7,000,000
National cooperative geologic mapping $5,000,000
Earth science information management and delivery $2,000,000
Water resources/ stream gauges $5,000,000
Biological research $3,000,000
Science support/ accessible data transfer $5,000,000
Part B of Title VIII sets up the Land Conservation, Preservation and Infrastructure Improvement Trust Fund, a "funding priority" within the budget through FY 2006. In future years, these funds are automatically set aside and available in the congressional budget resolution with actual appropriations to be based on need and program performance.
Within its overall authorization, Part B sets up six program categories, each with a "fenced cap" to ensure that funds are not shifted between categories. The USGS programs are within the State and Other Conservation Programs category, which has a $300 million "fence" around it (the amount the category received in FY 2001). Any funds below the cap left unused from the previous fiscal year will remain available for that specific program category. The increased authorized funding in the out years is unfenced and can be spent in any category.
Eligible USGS programs are: "State Planning Partnership programs, Community/Federal Information Partnership, Urban Dynamics, and Decision Support for Resource Management."
Department of Commerce
The $400 million in FY 2001 funding for conservation activities under the Commerce appropriations bill focuses on wetlands, coastal lands, and wildlife preservation. Of particular interest is Sec. 903 Coastal Impact Assistance that amends the Outer Continental Shelf Lands Act (43 U.S.C. 1331 et seq.). Under Sec. 903, OCS revenues -- which include bonus bids, rents, royalties, net profit share payments, and related late payment interest -- will be distributed among the oil-producing states. The appropriations bill divides the OCS revenues among the states as percentages of the total revenue dollars. Sixty percent of the OCS revenues will be equally divided among the producing coastal states and forty percent will be divided among the states based on their share of OCS production.
The bill also includes provisions for how the funds are to be distributed within the coastal states receiving funds. The funds are to be divided among the coastal political subdivisions of a state. A coastal political subdivision is defined as a county, parish, or equivalent subdivision of which any portion lies in the coastal zone. Twenty-five percent of the funds will be divided based on the population of a coastal political subdivision. Another twenty-five percent will be allocated based on the number of coastline miles within a political subdivision. The remaining fifty- percent of the state funding will be distributed based on the distance that the subdivision is from lands leased for oil production. Some serious negotiations went into this formula!
States requesting funds under Sec. 903 must develop a Coastal Impact Assistance Plan (due to the Secretary of Commerce by July 1, 2001) that sets forth the proposed use of any funds received by the state. The admissible uses for funds received under this bill cover a broad spectrum of conservation-related activities. Activities defined in H.R. 701 Sec. 32(c)(4) are specifically cited as acceptable uses for the funds received. Notable among these are protection, restoration, and enhancement of coastal water quality; addressing watershed protection; assessment, research, mapping and monitoring of coastal or marine resources and habitats; and protection and restoration of natural coastline protective features including control of coastline erosion. Other activities receiving funds under the Commerce appropriations bill are projects and activities for the conservation, protection, or restoration of wetlands, and implementation of federally approved marine, coastal, or comprehensive management plans.
The 107th Congress
Young and Dingell have written a letter to President Bush emphasizing the bipartisan support CARA received in the 106th Congress and citing the FY 2001 appropriations language drawn from CARA. The letter encourages Bush to support the bill stating: "We firmly believe that your Administration, the Congress and the American people would be well served to have a common-sense environmental bill as a key component of your first agenda." Several factors increase the likelihood that the bill, authorizing a total of almost $45 billion in conservation funding over 15 years, will be passed in the 107th Congress. Not only is the process beginning early in the session, but the election results pushed Slade Gorton -- a major opponent of the bill and former Chairman of the Senate Appropriations Subcommittee on Interior -- out of his position. They also created a 50-50 split in the Senate, leading to rule changes that allow Democrats to call up legislation for a vote.
Whether or not CARA passes in the 107th Congress, the Land Conservation, Preservation and Infrastructure Improvement Trust Fund authorized in the FY 2001 Interior bill remains in effect. Will the USGS receive funding from this fund in FY 2002? There are no guarantees. The act sets aside $300 million in the budget resolution for State and Other Conservation Programs. Because the budget resolution is not signed by the President, one can argue that this funding has little to do with whether or not President Bush requests it in his budget submission. But he must sign the final appropriations bill. Will he and Interior Secretary Gale Norton actively oppose such spending? They might oppose spending for additional land acquisition but have already signaled their support for funding park maintenance. It would seem that USGS science programs would fall closer to the latter than the former and would not be opposed by the administration in the final budget negotiations.
Please send any comments or requests for information to the AGI Government Affairs Program.
Contributed by Margaret Baker, Dave Applegate, and AGI/AAPG 2001 Spring Semester Intern Mary Patterson.
Last updated March 13, 2001.
|Information Services |||Geoscience Education |||Public Policy |||Environmental|
|Publications |||Workforce |||AGI Events|
| 221,565
|
Murder will be far from the President's mind when he meets John Major in Pittsburgh today. The Prime Minister, turning the tables on the thousands of Americans who cross the Atlantic every year to dig for their ancestral roots, is coming to see where an ancestor worked on blast furnaces for steel mills. Mr Major's paternal grandparents lived in the Pittsburgh area in the late 19th century. During Mr Major's whirlwind visit the two leaders will discuss Bosnia and Northern Ireland, among other topics.
South Africa will close the final chapter in its colonial history today by hauling down its flag over Walvis Bay after 84 years of rule and handing the territory to Namibia. Namibia's President, Sam Nujoma, who grew up in Walvis Bay, will officiate at the ceremony.
When Namibia gained independence from South Africa in March 1990, Pretoria kept Walvis Bay and President F W de Klerk's government said the enclave would not be returned. But the African National Congress and its allies forced the issue before the multi-party negotiating forum and the government was made to concede its return.
A circuit judge in Manassas, Virginia, is to decide today whether to release Lorena Bobbitt from a mental hospital. She has been there since she was acquitted on grounds of insanity last month of malicious wounding following a trial for cutting off her husband's penis. Her lawyers said the doctors who examined her recommended she be released.
Today sees the return of another case that attracted a blaze of media attention. A new trial date is to be set today in Los Angeles for the Menendez brothers, who admitted killing their wealthy Beverly Hills parents. A mistrial was declared last month after two juries deadlocked on first-degree murder charges. The prosecutors who failed to win convictions in the murder trial were removed last week.
In Johannesburg, Nelson Mandela, the ANC president, meets Chief Mangosuthu Buthelezi, the president of the Zulu-based Inkatha Freedom Party, tomorrow. Mr Mandela hopes to convince his main black political rival to contest South Africa's first all-race elections in April and help bring peace to the country. Chief Buthelezi and his white right-wing allies in the Freedom Alliance have warned of civil war. They say that they cannot take part in the April vote, complaining that the interim constitution ignores their demands for ethnic self- determination.
The US film director, Steven Spielberg - whose bonanza at the box office has made him the bete noir of defenders of French culture - will meet President Francois Mitterrand tomorrow. The French government successfully fought to have cultural goods, including film, kept out of the Gatt world trade agreement last year. France, backed by other European nations, argued for some form of protectionism to stop an invasion of Hollyood productions, which would harm European film and television.Reuse content
| 253,004
|
White winters are beautiful to look at – but can be quite horrible to live in. Of course, all of us love the first few drops of snow, making the snowman, skiing and skating opportunities that winter brings. However, living in general can be made quite tough during the winter. The best solution – in this case, is to prepare in advance for this.
Be kitchen ready
Winter calls for warm food – and soup! This is that period of the year where you thrive on warmth, so your kitchen should play a vital role in your preparation. So do not hesitate to load up on all the food items you may require – from peanut butter to pet food. Some winters can get quite rough, so better to stock up on all the food you can. Also make sure that you have a good slow cooker in preparation.
Get the medication
Winter can also bring quite a few sicknesses your way. So make sure you are well prepared. Get the required vaccinations for you and your family, and also make it a point to store emergency medication. Winter brings unexpected weather conditions, so it is definitely better to be prepared.
Take care of your pets
A lot of us, in the process of getting ready for the winter, forget that our pets also feel the cold in the same way as we do. Therefore it is very, very important that you attend to their necessities as well. For an example, take your canine-child to a dog groomer to get their fur coats trimmed and adjusted in a manner which suits them best.
Dog groomer in Sydney know how best to do this, so do not hesitate to get their expertise. You can even spoil them with some cute little boots and coats.
Keep the utensils at hand
You need to have a lot of blankets with you. Plenty, in fact. Do not think that you will always get to go to the laundry during these times. It will be too cold to step out, and you will end up with nasty-smelling sheets. Moreover, you also need to store up on several flashlights, batteries, matches, candles and also a safety kit for your car. Also make sure that tools such as shovels are in close access, since you are going to need them if you are to find your car under the snow.
Do the shopping
And perhaps the most enjoyable part in preparing for winter is the shopping. Hit a store of your choice and grab the necessities. Make sure you have a good warm coat, several layering and scarves to make sure you do not freeze out in the cold. Focusing on the style is good, but you also need clothes that will keep you un-frozen.
| 250,713
|
I just thought is was ironic we were discussing this not long after I heard about the UN resolution. I guess I never thought of the internet as a human right. Even with resolution it would be hard for the to implement this is many countries.
I fully believe the internet will play a key role in buying and selling under the beast's system. It's necessary for banks to transact among themselves and with clients.
As far as the internet being provided for all, I don't think any country disallows the internet, but some of the Middle Eastern nations, especially Iran, restrict social networking to keep down negative comments about their country, or things unfavorable to Islam. Iran does not allow Facebook, Youtube, or even Wikipedia and foriegn news outlets are blocked from internet use despite anything the UN might pass.
--- In bible_prophecy-l@yaho..., Sandy Wagner <mswagner4@...> wrote:
> The United Nations did pass a ruling that everyone has the right to use the internet. Communist controled nations, like China, cannot keep their citizens from surfing the web.
> This internet might have some serious merit to the end times. It might be a stretch, but could be a possibility.
> To: bible_prophecy-l@yaho... > From: portents2@...
> Date: Fri, 21 Oct 2011 21:30:54 -0700
> Subject: Re: [bible_prophecy-l] Mark update
> That's very interesting. I don't know if it was here on BP_L or on
> another forum, but a writer was making an argument (and I didn't
> really follow the logic of it) that the mark of the beast - 666 -
> could be translated as www and he concluded that this meant the
> internet itself was the mark and that eventually no one will be able
> to buy or sell who is not on the network. I'm not sure I buy that
> argument. The mark is, scripturally speaking, the name or the number
> of the beast, it's a very personal idea tied to a real person, not an
> abstract idea, like a computer network. Still, I had to give the guy
> credit for an interesting spin on the mark and far more compelling
> than other ideas that people have (social security numbers, barcodes,
> etc.) over the years.
> And to return this to your example of mobile payment systems, we have
> talked before about the infrastructure needed to implement the mark
> and whether the mark is really global in scope.
> Correct me if I'm wrong, but I remember you making the argument some
> time back that "all" doesn't' necessarily mean all in a global sense
> in the context of a truly universal system that covers all people
> since we recognize that the time required for the entire world to
> adopt the same standard would mean that it would take another century
> or more for the mark to be implemented. It would be enough for it to
> cover only the modern industrialized world because that would include
> the "world" of the focal point of prophecy, namely Israel. The rest of
> the world, those lawless places the still use cash or barter for goods
> and services, would be untouched by the mark just as they are passed
> by the use of debit cards or credit cards.
> Even though I was troubled by the fast and loose translation of "all"
> in this context as something other than the plain meaning of the word
> I accepted the basic idea. Like you, I've done a fair bit of
> traveling, both to parts of the world more advanced than the U.S. and
> less advanced. And to those of you shocked at the "more advanced"
> part, I'm speaking of technology. There are places in Europe that
> enjoy much higher bandwidth speeds than we do in the U.S. and where
> cards with imbedded chips are the norm, not the exception. Mobile
> commerce is much more advanced in Asia than it is in the states.
> One of the reasons the U.S. lags is, paradoxically, because our
> domestic market is so big. It's far easier to offer new and better
> technology in a small country or geographic region that it is in a
> large one. This is why we don't have credit cards with chips in them
> because it's expensive to roll out that technology in a large market.
> The same dilemma is evident now with near-field communication chips
> (NFC) that will allow us to pay for things by waiving our mobile
> devices at a reader. It costs money to install readers at every
> checkout counter and companies balk at paying for that when consumer
> demand for this service has not been demonstrated.
> And this is the problem with the "mark as technology" idea. If the
> mark is an imbedded chip (as many believe) or some other kind of
> technology, it will take time to develop the technology and then roll
> out hardware and software needed to support the technology. And even
> if we accept that this can be done in the advanced economies of the
> world, there will still be large areas of the world (primarily in
> Africa and Asia) where it will never happen, at least, not in our
> But, here's where it gets interesting. Those parts of the world that
> are still developing into industrial societies are in some cases,
> jumping right to post-industrial technology. There are parts of
> Africa, for example, that have never built-out standard landline phone
> service but they have decided to skip that and jump right to cellular
> service. The standard of living may be very low compared to Western
> standards, but they have cell phones.
> So, in this context, a mobile payment system that allows people to pay
> with their cell phones is very intriguing because it means that those
> parts of the world that I was willing to write off may yet be included
> in the mark system.
> On Fri, Oct 21, 2011 at 7:43 PM, Daniel <jayjeti@...> wrote:
> > I've wondered how in a cashless society, should one ever be implemented, how individuals could make transactions among themselves. Today I saw a commercial where a group were at a restaurant, and they had one bill that everyone needed to chip into to pay. One person paid the restaurant, and the others gave that person their part of the bill by pulling out their cell phones and sending money to his bank account. But one person pulls out his wallet and starts pulling cash out of it, and the others look at him like he's an idiot, and he looks embarrassed. The commercial says all you need is their e-mail address.
> > I don't have a video of the commercial, but here's something similiar.
> > http://www.youtube.com/watch?v=4Uw5bMrZ3wU > >
> > http://www.youtube.com/watch?v=SA_L3Cc9VqI&feature=related > >
> > http://www.youtube.com/watch?v=aEurC8AUB2Y&feature=related > >
> > I wonder if some day people might need an implanted chip to work in concert with a cell phone so that someone oould not steal your cell phone and key information and empty your account.
> > Daniel
> > ------------------------------------
> > You are receiving this because you have subscribed to the Bible Prophecy
> > List. If you'd like to unsubscribe for any reason, send a blank e-mail to:
> > bible_prophecy-l-unsubscribe@yaho... > >
> > Yahoo! Groups Links
> Prophecy News
> http://prophecynews.blogspot.com/ >
> [Non-text portions of this message have been removed]
[Non-text portions of this message have been removed]
You are receiving this because you have subscribed to the Bible Prophecy
List. If you'd like to unsubscribe for any reason, send a blank e-mail to:
| 25,689
|
On 17 July 2014, the Senate referred the following matter to the Community Affairs References Committee for inquiry and report.
The Terms of Reference are:
Out of home care, including;
- drivers of the increase in the number of children placed in out of home care, types of care that are increasing and demographics of the children in care,
- the outcomes for children in out of home care (including kinship care, foster care and residential care) versus staying in the home;
- current models for out of home care, including kinship care, foster care and residential care;
- current cost of Australia‘s approach to care and protection;
- consistency of approach to out of home care around Australia;
- what are the supports available for relative/kinship care, foster care and residential care;
- best practice in out of home care in Australia and internationally;
- consultation with individuals, families and communities affected by removal of children from the home;
- extent of children in out of home care remaining connected to their family of origin; and
- best practice solutions for supporting children in vulnerable family situations including early intervention.
Submissions were sought by 31 October 2014. The committee must report by the second sitting week in February 2015. On 4 December 2014, the Senate granted an extension of time for reporting until 13 May 2015. On 12 May 2015, the Senate granted an extension of time for reporting until 12 August 2015. On 11 August 2015, the Senate granted an extension of time for reporting until 18 August 2015. On 18 August 2015, the Senate granted an extension of time for reporting until 19 August 2015.
| 5,016
|
400 years ago: on 29th Jun 1613 that the original Globe Theatre in London was destroyed by fire.
175 years ago: on 28th Jun 1838 that the Coronation of Queen Victoria took place.
150 years ago: on 7th Jun 1863 that Franz Gruber, Austrian organist and composer, best known for composing the Christmas carol ‘Silent Night’, died.
75 years ago: on 9th Jun 1938 that London’s Trooping the Colour ceremony was televised for the first time.
65 years ago: on 24th Jun 1948 that the Soviet Union began a blockade of Berlin, cutting off all routes between West Germany and West Berlin. The Allies launched a massive airlift.
60 years ago: on 2nd Jun 1953 that the Coronation of Queen Elizabeth II took place at Westminster Abbey, London.
50 years ago: on 5th Jun 1963 that the British Secretary of State for War, John Profumo, resigned after it was revealed he had lied to the House of Commons about his affair with Christine Keeler.
Also 50 years: on 26th Jun 1963 that US President John Kennedy visited West Berlin and made his famous declaration ‘Ich bin ein Berliner’ (I am a Berliner) to demonstrate the USA’s support.
15 years ago: on 1st Jun 1998 that the European Central Bank was established in Frankfurt, Germany.
10 years ago: on 26th Jun 2003, that Sir Denis Thatcher, British businessman, husband of former British Prime Minister Margaret Thatcher, died.
| 306,339
|
A Secret Weapon For كيبورد عربي(aka "shortened ’alīf" - thus the Arabic title, its goal is for writing purposes typically Utilized in classical texts and in some dialects like Egyptian Arabic
This browser doesn't help the technological know-how to play the keyboard. Be sure to use a contemporary browser. If you are utilizing a mobile product, remember to Observe that Fb's browser is just not that present day, however you can continue to duplicate the hyperlink after which you can open up it from your preferred browser using the identical gadget.
Formulated by Sherif Kandel A straightforward Application to deliver the ability to compose Arabic letters using the Distinctive-built Arabic keyboard. The initial English keyboard remains available and induced by tapping around the textbox and will be concealed yet again by tapping any place else to reveal the Arabic keyboard.
You can find a lot of keys to the keyboard that use the same note identify, but when played, they don't sound the exact same. The complete list of music notes names is termed an octave. The piano keyboard has lots of octaves. Our virtual piano has six octaves.
The e-mail is on its way. Please allow for a few minutes for it to reach. Didn't get the e-mail? Return and take a look at again
From pcfone: Set up the Arabic language on on your PC and begin with relieve typing Arabic, it doesn't want Exclusive software, and won't need every other application only the online market place Explorer five.five minimum for being set up, Furthermore, it not influenced by other keyboard programs put in.
It can be composed from ideal to left in a very cursive style and features 28 letters. Most letters have more than one form.
That is why A sharp is The true secret following a. That very same black important is B flat. Think of the time period flat given that the closer Notice for the left. That is why B flat could be the Notice just to the still left of B.
If you get a mesage stating which the browser would not aid the technological know-how to Enjoy the virtual keyboard, your only alternative is to make use of another browser.
Fashionable dictionaries as well as other reference publications don't make use of the abjadī buy to type alphabetically; in its place, the more recent hijā’ī buy is made use of whereby letters are partly grouped together by similarity of shape. The hijā’ī order is rarely applied as numerals.
In unvocalized text (just one in which the short vowels aren't marked), the very long vowels are represented by the vowel in dilemma: alif ṭawīlah/maqṣūrah, wāw, or yā’.
For mobile phones and tablets, contact and keep Within the text location to copy the textual content. You could then paste the text in almost any application including Fb, Twitter, e mail, or search application.
We welcome instructed improvements to any of our content. You can make it less complicated for us to review and, hopefully, publish your contribution by preserving a couple of details in mind. Encyclopædia Britannica articles or blog posts are penned inside a neutral goal tone for the typical viewers.
Your browser more info isn't supported by Google+. You will have an out-of-date browser Model or an unsupported browser form.
| 54,503
|
|Birth: ||May 2, 1906, USA|
|Death: ||Sep. 2, 1946|
Racecar driver. Barringer was born at Parsons, Kansas and later established Wichita Falls, Texas as his home. He was active as a racer during the 1930s and 1940s, including six appearances in the Indianapolis 500 classic between 1934 and 1946. He and 1946 Indianapolis 500 winner George Robson were killed in in a tragic multi-car pile-up at the Lakewood Speedway in Atlanta, Georgia. He has been inducted into the Cowley County (Kansas) Fairgrounds Marble Wall of Fame For Auto Racing.
Created by: Warrick L. Barrett
Record added: Jul 08, 2007
Find A Grave Memorial# 20359643
| 269,416
|
06-10-2013 08:40 AM
On page 47 of the 'ALM11.50_PC_Installation.pdf' document it states:
If you are working with an Oracle database, ensure that the Oracle client is installed on the Performance Center Server (with Administrator installation type), and that connectivity has been established with the Oracle Server. Ensure that the
tnsnames.ora file contains the same TNS entry for the source and target database server.
Note: You must install the 32-bit Oracle client installation, regardless of whether you are running the Performance Center Server on a 32-bit or 64-bit operating system.
Our DBA is saying that only DBA's have the 'Administrator' install type of the Oracle client. Does the install guide just mean to install the oracle client 'Run as administrator'? Can someone maybe provide a link to the Oracle 10 client that needs to be installed? Our DBA said there is a basic install with sqlplus. Is that enough?
09-03-2013 11:27 PM
Use sqlplus command and use the user that you used to connect HP ALM. that should be enough to know that Performance Center server is connected to HP ALM.
Also to verify if the connection of the Oracle client make use of tnsping command.
make sure that the listener is started.
09-06-2013 08:05 PM
Only SQL Plus is not sufficient. Docmentation is corrrect. You need to select install type as 'Administrator' during installation. Please refer to second option http://grab.by/q3KG (Instant, Runtime etc are prone to errors during PC usage)
| 85,631
|
Education - @BambuuProject
As you may know Founder's Tommie and Rebecca have developed, launched and deliver Plastic Pollution workshops around the world to primary school children. Tommie's background before living and working around the world was in education. @BambuuProject will aid the team to deliver more workshops to more children in more countries around the world to understand the true negative impacts plastic pollution is causing to our planet and then positively inspire the children to have the passion to protect our environment and how they how the power to make a real difference.
Book the team for a workshop in your school now.
Inspiration - @BambuuProject
Tommie and Rebecca's passion has been driven from seeing first hand the impact's plastic pollution is having on our environment and believe experiencing that can be so powerful to create change. In turn @Bambuu Clean ups play a vital role in changing people's mindsets in wanting to act on plastic pollution. @BambuuProject will give the team the opportunity to organise and deliver more community clean ups. So far @BambuuProject has delivered 19 clean ups and collected over 750kg of plastic. The team are currently working on a circular system to repurpose the plastic collected from the @BambuuProject Clean Ups.
Join our next Clean Up near you - Click Here to Book on
Empowerment - @BambuuProject
@Bambuu's long term goal is to set up Simple, Sustainable Recycling facilities alongside Localised Clean Up Incentives in developing countries. This goal have been driven through Tommie and Rebecca's personal experience in the developing world and understanding the lack of Waste Management systems in the developing world causing extreme plastic pollution.
There are 3 major aspects to @BambuuProject Recycling Facilities:
1. Localised Incentives
Incentives to give the local community the potential to generate an extra income or help payment towards Educational Fees for their children at Humanitas Schools. The local's have the opportunity to gather plastic from the local area to be delivered to our facility where it will get weighed and an amount per kg will be given to the individual
2. Sorting Facility
"One man's trash is another man treasure" - The value of waste is only going to increase, especially for plastic in a world where we are striving towards transitioning into a circular economy. Once delivered and weighed the Collected Plastic will be sorted into specific qualities. The better quality plastics which hold a higher value will be bundled and sold to fund and sustain the recycling facility financially.
3. Building Materials
The lower quality plastics which hold less of a value financially can be compressed via our new low tech machine which repurposes soft and hard plastics into building bricks. These building bricks can be sold at cost to the local community or to be used on other project's with Humanitas.
| 79,759
|
Experts James Wesley Rawles, Joel Skousen and Matt Stein explain -EMP Blackout: Are You Prepared for an Electromagnetic Pulse Event?
Whether we talk about a terrorist event or a solar storm experts agree that an EMP event is not a matter of if but when. Considering that the power grid across the United States is unprotected — an emp event will knock out our power for an unforeseeable future; immediately sending American life back to the dark ages. We invited experts James Wesley Rawles, Joel Skousen and Matt Stein to explain the most important actions one has to take in order to prepare for such catastrophic times.
Blackout USA Review 2015 – Alec Deacon's Black Out USA
Survive Attack to Our Power Grid System (Weapon That Can Instantly End Modern Life in America)
Survival MD (Best Post Collapse First Aid Survival Guide Ever)
Backyard Innovator (A Self Sustaining Source Of Fresh Meat,Vegetables And Clean Drinking Water)
Blackout USA (EMP survival and preparedness)
Conquering the coming collapse (Financial advice and preparedness )
Liberty Generator (Build and make your own energy source)
Backyard Liberty (Easy and cheap DIY Aquaponic system to grow your organic and living food bank)
Bullet Proof Home (A Prepper’s Guide in Safeguarding a Home )
Family Self Defense (Best Self Defense Strategies For You And Your Family)
Survive Any Crisis (Best Items To Hoard For A Long Term Crisis)
Survive The End Days (Biggest Cover Up Of Our President)
Drought USA(Discover The Amazing Device That Turns Air Into Water)
| 60,808
|
2823Monotheism does not require a finite deity
- Apr 1, 2010Bill,
Your assertion that monotheism must have a finite God is incorrect. Classic monotheism of Judaism and Christianity adheres to belief in an infinite, personal God. "Infinite" does not mean "everything," as you seem to assume; rather, infinite means unbounded by the limitations of the physical universe (so that God is incorporeal, omnipresent, omnipotent, omniscient, and eternal).
The observation is a commonplace; see almost any systematic theology textbook, treatises on the doctrine of God, and the like. Francis Schaeffer was an evangelical thinker who especially emphasized the point that God is both infinite and personal.
In Christ's service,
--- In email@example.com, William Mayor <eliadefollower@...> wrote:
> I see one HUGE error in your logic. You consider God to be infinite, which is fine. This makes creation to be pantheistic (or possibly panentheistic for those who see a distinction) in nature, as by definition an infinite God cannot have anything excluded from Himself, including creation. However, you conclude your argument with the statement "It should also bring into focus the unquestioned monotheism of Christianity". Monotheism and Pantheism are diametrically opposed to each other. Monotheism MUST have a finite God as it requires a creation that is separate from God.
> Now I could go through and point out other potential errors, however even without looking at other issues, this one issue sinks your whole argument unless you revise it.
- << Previous post in topic Next post in topic >>
| 270,940
|
Mother's Day: Why Australia is the second-best place to be a mom
A Save the Children report timed for Mother's Day names Australia as the second-best place to be a mom. Norway won the top honor.
A report naming Australia as the second-best place in the world to be a mother has surprised some Australians, who note that the government is only now introducing a paid parental leave program.Skip to next paragraph
Subscribe Today to the Monitor
The report, released by the Save the Children charity to coincide with Mother's Day, cites the outstanding economic, educational, and health benefits enjoyed by Australian mothers, and ranks Australia second only to Norway.
It says that with an average life expectancy of 84 years, relatively good economic opportunities and a high level of formal schooling, mothers are well placed to give their children the best chance of surviving and thriving.
Grumbles over maternity leave
Women’s groups in Australia, though, point out that their country is one of only two OECD (Organization for Economic Cooperation and Development) countries without statutory paid maternity leave. The other is the United States.
Earlier this month, the Labor government of Kevin Rudd announced that new mothers will receive 18 weeks of paid leave, with the program to be implemented next year.
Under the status quo, women are entitled to 12 months of unpaid leave. By contrast, the United Kingdom introduced paid maternity leave three decades ago, with mothers now able to take a year off, nine months of it paid, before returning to their jobs. Under recently announced reforms, fathers will have the right to take their partners’ place at home after the first six months.
In Australia, a range of health-related and socio-economic factors contribute to the high ranking of mothers in the survey. They include the low risk of premature maternal death: just one in 13,300, compared with one in eight in Afghanistan, the lowest-ranked country. Seventy-one percent of Australian women use modern contraception methods.
Australian women earn on average 70 percent of male income, compared with 34 percent in Niger, the second-worst country to be a mother. In the national Parliament in Canberra, 27 percent of seats are held by women; in Norway, the figure is 40 percent.
Not as good to be a child
But the report also finds Australia a less advantageous place to be a child, thanks to the infant mortality rate in Aboriginal families.
In the league table of the best countries in which to be a child, Australia is ranked 28th out of 43, with the figures skewed by the gulf between the health and life expectancy of Aboriginal and non-indigenous children.
The latter are three times more likely to die before their fifth birthday.
As well as the inferior living conditions common to many indigenous communities, experts blame a shortage of midwives in rural and remote areas for the mortality rate.
| 289,838
|
Age group: from 2 years old
Pages: 44 -- Format: 23 x 32 cm -- RP: 14.90 €
An interactive book: on each page, the child makes a choice that determines the next step in the adventure. He or she then finds the page corresponding to this choice thanks to a system of tabs.
After the success of "Hou! Hou! Prince Charming?", Sylvie Misslin and Amandine Piu have imagined a new adventure.
The little adventurers, Pablo and Mila, hear a strange cry. Off they go ! There they are deep in the jungle to find out more. But there are piranhas, monkeys, a fearsome jaguar...
Danger is around every corner !
Bonus of the series:
A simple concept, original, playful and interactive.
32 possible journeys, 2 of which are winning.
| 302,085
|
Barbara Jordan was a former trustee of the Kaiser Family Foundation, and the first black woman from the South elected to the U.S. House of Representatives. As a member of the United States Congress and the Texas State Legislature, Barbara Jordan’s distinguished career was exemplified by her tireless advocacy on behalf…
Disparities PolicySee more about Disparities Policy
- state & global data
- view as grid
- view as list
A decade after U.S. Surgeon General David Satcher called for the elimination of racial disparities in health, women of color in every state continue to fare worse than white women on a variety of measures of health and health care access. The Foundation has created a package of resources, including…
The Kaiser Health Security Watch uses Kaiser Health Tracking Poll data to measure the public’s health care-related problems and worries, including problems paying medical bills, skipping or delaying health care due to cost, and worrying about their future ability to pay for care and keep insurance. The Health Security Watch describes…
This brief provides an overview of health coverage and care for American Indians and Alaska Natives today and the potential implications of the ACA coverage expansions.
An updated issue brief from the Kaiser Family Foundation gives a detailed profile of health concerns for lesbian, gay, bisexual and transgender individuals, offers the latest demographic data, and discusses the impact of recent changes in state and federal policies on health coverage, including the Affordable Care Act and same-sex…
Advancing Opportunities, Assessing Challenges: Key Themes from a Roundtable Discussion of Health Care and Health Equity in the South
This brief summarizes the primary themes expressed by participants of a roundtable discussion of current and future opportunities and challenges for advancing health care and health equity in the South organized by Kaiser Family Foundation’s Commission on Medicaid and the Uninsured and the Satcher Health Leadership Institute at Morehouse School of Medicine in Atlanta, Georgia.
The Affordable Care Act (ACA) expansion of Medicaid to adults with incomes at or below 138% of the federal poverty level (FPL) effectively became a state option following the Supreme Court decision, creating a “coverage gap” for many poor uninsured adults in states that do not expand Medicaid. This brief examines the coverage gap by race and ethnicity.
This issue brief provides an overview of health coverage and care in the South today, with a focus on demographics, the impact of the ACA coverage expansions, and ongoing efforts to improve the delivery system and safety net in the South.
The South has faced longstanding disparities in health and health care, although significant variation exists between southern states. As a group, compared to those in other regions, Southerners are more likely to be uninsured, less likely to have access to needed health services, and more likely to experience a number of chronic health conditions. This chartbook provides key data on the demographic and economic characteristics of the southern population as well as their health status, health insurance coverage, and access to care today.
This event announces the release of the Kaiser Family Foundation’s 2014 survey on women’s health. The presentation of findings will be followed by a panel discussion on the ACA and challenges in improving women’s health and access to care.
| 131,243
|
Transparency International (TI) says that the failure by governments to address corruption is threatening the fulfilment of the Millennium Development Goals (MDGs).
It however called on governments, donors and NGOs to adopt anti-corruption measures in all their MDG action plans to reach the goals in the next five years and sustain progress beyond the 2015 timeline.
TI chairperson, Huguette Labelle, points out that governance breakdowns and corruption are significantly slowing down the progress towards the MDGs. Labelle states that, “As we take stock, it is clear that anti-corruption and good governance measures need to be fully integrated in all future development efforts."
To read the article titled, “MDGs - 'corruption threatens targeted goals',” click here.
| 22,543
|
Bethel UniversityEDIT: Check the video trailer of the production.
Jane Eyre the Musical
Gordon & Caird
January 31, 2013 | 7:30–10 p.m.
February 1, 2013 | 7:30–10 p.m.
February 2, 2013 | 7:30–10 p.m.
February 3, 2013 | 2:30–5 p.m.
Benson Great Hall
Jane Eyre, the Musical in the musical retelling of Charlotte Bronte's classic novel of love and forgiveness. The story concerns Jane, who becomes employed as governess at the estate of Edward Rochester, a man who seems to have everything but needs the love, forgiveness, and insight that Jane provides.
"At the heart of all the greatest love stories is a pair of journeys. For a love story to be truly great both the lovers must be unalterably changed by the exposure to each other on their journeys through the story. The greatest stoke of genius in the novel, Jane Eyre, is the way in which Brontë interweaves the journey of Jane and Rochester so that they change each other in this unalterable manner."
Don't miss this beautiful musical about the power of forgiveness, faith, and love!
And in Raleigh, North Carolina, we have a lecture for today:
North Regional Library
New To You: Explore Classic Literature, Poetry and Music
Jan 31, 6:30 – 7:30 P.M.
Join us as we explore new themes in classic literature, poetry and music. North Regional Library will host the lecture "Classic Novels into Film: Emma, Jane Eyre, and Great Expectations." James Thompson, Professor of English at UNC-Chapel Hill, will discuss the film adaptations of three classic novels. Registration is requested; please call 919-870-4000.
| 115,381
|
In this article, we will understand what is digital marketing, what are the benefits of digital marketing, and How can Digital Marketing help to Grow our Business. How using digital marketing we can grow our business and earn more profit. We all know that there are different forms of marketing and digital marketing is one such form where all the marketing is done using the internet and online mode. The different technology is available right now through which we can do marketing rather than using the traditional means and methods. The technology has changed a lot, the desktop has been changed to laptops and tablets.
The use of the internet is growing day by day and the number of internet users is increasing on a very fast basis daily. The use of digital platforms has increased considerably during the last decade and it has changed the pattern of doing business in the world. Now, these digital platforms are being incorporated into all the marketing activities that were once done using physical and manual methods. Nowadays people prefer to buy things online and get all the services sitting at home without going to any physical Store, so the businessman has a golden chance and opportunity to use this opportunity to make the maximum out of it.
Different components Of Digital Marketing
Talking about digital marketing there are different components of digital marketing as the most important part is search engine optimization, search engine marketing, influencer marketing, content marketing, campaign marketing, data-driven marketing, E-Commerce marketing, social media optimization, email marketing, and many more. So the combination of all these is called digital marketing. Nowadays, businessmen have understood the real concept behind people’s intentions, which has helped them succeed in this field. All the advertisements are done on digital platforms such as the internet, search engines, different websites, social media, different apps available on mobile phones, emails, messages, and many more. Modern-day marketing is known as digital marketing.
Marketing is an activity where from the beginning, the basic concept was to connect to the audience. The basic function of marketing was to find the customers and target them at the right place, at the right time, with the right products. Now we have seen that people are spending more and more time on their mobile phones and computer screens so this became a very good opportunity for companies and businesses to do marketing where people spend their maximum time.
Steps Involved in Digital Marketing
The different steps in creating a digital marketing strategy we will discuss them one by one.
- Defining our brand – This is the first basic step that anyone needs to follow if he wants to create a digital marketing platform. Every brand has something unique in it we just need to analyze and realize the unique selling points, USPS of our brand, and the value that our brand carries so that it will help us in creating a strong brand image in front of our customers and audience.
- Building buyer’s persona – We need to analyze and realize whom we want to target and who will be our potential customers. We need to think and analyze customers’ demographics as well as all the other factors that motivate a customer to choose any company, any product, or any service available in the market.
- Creating our goal – Every business and every company has goals of them. These goals can be short term, long-term depending upon the business. So it is essential for us to create a goal for our business that we want to achieve, which we have started the business.
- Setting our budget – For any business, budget is one of the most important factors to move ahead. We need to set the budget for our digital marketing campaigns so that we can use it accordingly step by step focusing on each and every part covering each and every aspect so that we can get maximum conversion and maximum profit from the business.
- Campaign launching – After we have followed all the steps, we need to launch our campaign, and our website across different platforms so that our idea, vision, and mission reach every potential customer for which we are in this business.
- Result tracking – The most important part of any strategy building is to track the results. We need to find out what we have done and how much we have succeeded. We need to find out and understand what are the loopholes or the grey areas where we need to focus and work hard to fill all the gaps using different tools like Google Analytics and Google ads which will help us to keep a track of all the strategies and also the return on investment for our business.
Important Strategies Used In Digital Marketing
Like traditional methods of marketing, in digital marketing also, the company has to adopt and implement different strategies for effective communication and conversion. Now we will be discussing a few important strategies that are used by the different businessmen in terms of digital marketing.
- Segmentation – Customers in any form be it physical or online mode needs to be segmented properly so that they can be targeted in the best possible manner. Each and every customer has different choices, different needs, and different behavior. So the basic work of any digital marketer is to understand their customer, understand their needs, demands, and behavior, and then accordingly segment them into different groups so that the right focus and right approach can be used for them.
- Proper use of data – Nowadays, each and every company has lots and lots of data available to them. Each and every company collects data through different sources. But the most important part with data is to segment all these data properly which is called data mining so that these data can be used in the best possible manner and can help us in earning profits and getting more and more conversions for our business.
- Influencer marketing – This is one of the most important strategies that any online business is adopting nowadays. People are using famous personalities, Bollywood stars, actors, and different players to endorse their brands which helps the brand and the business connect to their customers easily and on a large scale. Influencer marketing allows each and every brand to take the advantage of social media where a large audience is available and targeting becomes very easy.
- Search engine optimization – Search engine optimization is basically the process of making our website rank on the top page in the Google result. This is a technique where people do a combination of different tasks in order to rank their websites and web pages on the front page of any search engine. The basic idea behind doing this is to bring more and more traffic to our website and when more and more customers will come there is a chance of getting higher conversion.
- Content marketing – Content Marketing is also a very important strategy used by digital marketers. In this strategy, basically, the focus is on the customers engaging and connecting them through the content. The content can be in any form which can be videos, in form of graphics, blog posts, simple posts, or anything which gives information about the business products, and services from which customers can engage and buy particular products and services.
- Email marketing – Email marketing is one of the most important and widely used strategies that is adopted by digital marketers. The primary reason behind using email marketing is to reach the maximum number of customers at a very cheap cost. Nowadays more and more people use email for their personal and professional usage and getting these customers through email is very easy. Email marketing helps the customers remember our product and brand even if they don’t make a purchase again and again. Email marketing helps us to retain our existing customers and also in making a new customer base by building brand awareness and encouraging repeat purchases.
- Social media marketing – The best form of marketing in terms of digital marketing is social media marketing. Some of the famous social media platforms nowadays are Facebook, Instagram, Twitter, Pinterest, and LinkedIn. Nowadays almost everyone uses social media. So this is the best platform to sell any product or service. Social media marketing helps to gain maximum customers with minimum effort and at a considerable cost. According to a survey, an average person using the internet spends more than 25% of his time on social media which means that there is a lot of opportunities for each and every company to grab customers from the social media platform.
Different Ways and Means of Marketing
There are different ways and means of marketing but we need to understand why digital marketing is the best of all. Here we will be discussing a few points which will clearly state why digital marketing is best for our business and how it will help our business grow and earn profits.
- Affordable – Digital marketing is affordable when it comes to spending money on marketing. As compared to other modes of marketing this is one of the cheapest forms of marketing that any business can do.
- Mobile accessibility – We know that more than 50% of the population of our country have their personal smartphones. Digital marketing helps the business to reach all the customers who are using mobile phones using different strategies that we have discussed like email marketing, text marketing, social media marketing, and many more. Digital marketing is that form of marketing that is very much accessible to all its customer because on average a person uses more than 1 hour of mobile phones on a daily basis so this becomes a great opportunity for different companies and brands to be in front of their potential customers.
- Flexibility – This form of marketing helps the companies and brands to be flexible in terms of marketing which can be banner ads, email marketing, social media post, content marketing, and many more. Here, the form of marketing is not limited and there are lots and lots of options available so a company or a brand can be flexible in choosing the right option for themselves and can also change accordingly depending on the results they get.
- Multimedia option – In digital marketing, the company or the brand has the option of going multimedia in front of their customers which can be in terms of content, in that may include photos, videos, audio, or clips. Digital marketing helps the companies to use all these forms of media for their particular ad which is not available in any other form of marketing.
- Tracking system – Whenever any company or any brand applies any strategy or uses any form of marketing, the most important thing for that particular brand is to crack how much they have succeeded in that particular strategy. Digital marketing is the only form of marketing that allows these brands and companies to track their progress and profit in their particular business by showing all the data related to the customer’s conversion and everything they need in order to succeed in their business.
- Global reach – Digital marketing is the form of marketing that helps any business to have a global reach. Any person sitting at their home or in their office can make their products or services available to people living in different countries across the globe. This particular advantage is not available in any other form of marketing. This advantage and option have helped the businesses with many opportunities and we know that the combination of visibility and global reach can be beneficial for any business.
- Effective targeting – In any business, the most important part is to target the right customers. If we are targeting the wrong group of people then we may not get the right conversion and profit as estimated. In digital marketing, we have the option to segment are customers properly according to their needs, choices, demand, and behavior and then we can find what products and services they want and then can target them with the right products. This is a very big advantage that no other form of marketing offers.
- Maximum engagement – Digital marketing allows customers to engage with any particular brand or company. The different options available such as a paid ad, click-through rate allow users to share any blog, post, photo, or video which increases the engagement of other users with that particular brand.
So, at last, we can say that digital marketing is one of the best forms of marketing that any business, any brand, or any company can adopt nowadays to earn profit and grow their business. Technology is changing very fast on a daily basis, so the companies also need to adapt to these changes and work accordingly.
The concept of marketing is changing and has changed a lot, so we need to adjust ourselves according to the changing world and digital marketing gives a lot of opportunities for the customers as well as for the companies to interact with each other and to choose the best for each one of them. Options are available for both companies and for customers as well so it is now up to us that we need to analyze our demands, and needs and then choose the best option for us.
| 275,608
|
Have you ever watched a chipmunk run across your yard?
You might have noticed that the little creatures are very alert, with their heads up.
It’s a survival instinct. The ones that aren’t alert are the ones who end being carried off by a cat or a hawk.
Life can be like that sometimes. It can be a dangerous world out there if you don’t pay attention.
There are some activities that require your undivided attention, like driving.
When you drive, that’s all you should be doing.
Not talking on the phone.
Not changing the song on your playlist.
Not turning around to talk to passengers.
Not only is it dangerous, it’s illegal.
Walking in urban areas is an activity that requires a level of alertness. Pedestrians should be paying attention when walking, especially when crossing the road.
I have noticed that since cell phones and portable music devices have become commonplace that pedestrians who use them often step off curbs without checking if it’s safe to do so.
If the driver isn’t paying attention, the results can be fatal.
I saw a head-on crash a few months ago at a pedestrian crosswalk. Two pedestrians, both busy texting, walked right into each other because they were both so absorbed, to the exclusion of all else. Good thing it was a low-speed collision!
How many times have you had to step aside to avoid a walking texter at the mall, or on a sidewalk?
So here’s a thought as you negotiate traffic in a car, on a bicycle, on a skateboard or on foot. Don’t be distracted. It’s not worth an injury or worse.
If you have any questions, contact email@example.com or (905) 878-5511, ext. 2438.
Halton Regional Police Const. Laurel Barnett is Milton’s community support officer.
| 204,253
|
Bloomberg’s Final State of the City Captures the Contradictions of His Legacy
Michael Bloomberg’s twelfth and final State of the City address neatly encapsulated the internal contradictions of his transportation and planning policies. In his prepared remarks, the mayor called the impending launch of bike-share “the biggest change to our transportation network in ages,” but the speech was also peppered with boasts about stadium-related mega-projects that are going to generate torrents of traffic on city streets. Also in the mix: some references to the welcome push for transit-oriented density in Midtown East, and an electric-car incentive that we’ll be taking a closer look at in the days ahead.
A note to prospective mayors: There are many ways to differentiate yourself from Bloomberg’s legacy on the built environment that won’t totally alienate New Yorkers who want safer streets for walking and biking. The mayor’s prepared remarks today contained a few opportunities on that front.
Bloomberg delivered the address from the Barclays Center, the arena built over the Vanderbilt rail yards thanks to a sweetheart land deal with the MTA, copious public subsidies, and a whole lot of eminent domain. In an unintentionally fitting touch, the mayor compared the project to a highway tunnel that was thankfully never built:
Remember: after the courts stopped the Westway highway project in the early 1980s, you’d often hear people say that big projects like this were no longer possible in New York City. And for a long time, that certainly seemed to be largely true. But not anymore. Over the past 11 years, working with our partners in the City Council and in Albany, we have overcome the defeatists and shown that this big city of big dreams can still get big things done.
After subsidizing the Nets arena and new stadiums for the Mets and Yankees, including thousands of parking spaces, the Bloomberg administration is still treating stadium construction as an economic development strategy. The city is pushing for a new stadium in Flushing Meadows Corona Park, and Bloomberg pledged today to “work with Major League Soccer to bring soccer back to our city for the first time since the Cosmos left in 1977.” The proposed stadium site is farther from the 7 train than the existing sports facilities by Willets Point, and neighborhood residents fear that new highway ramps will end up being part of the bargain.
One of the new proposals in today’s speech involves mandating that a certain number of new parking spaces are equipped for electric vehicle charging:
We’ll work with the City Council to amend the Building Code so that up to 20 percent of all new public parking spaces in private developments will be wired and ready for electric vehicles, creating up to 10,000 parking spots for electric vehicles over the next seven years.
We still need to flesh out the details of this proposal. To the extent that this helps electric vehicles replace internal combustion engines, that’s well and good. But if the EV wiring adds significantly to the cost of building housing, that’s just one more parking-related mandate making residences less affordable. That would be the case, for instance, if a developer who’s already forced to build a certain number of parking spaces for a residential development has to shell out extra to make some of those spaces EV-compatible. The mandate could also lead to less parking construction, however, since the average cost of building a parking space is going to increase. So the jury’s still out on this one.
In any case, the far simpler and can’t-miss strategy to green the New York City building code would be to end minimum parking requirements that drive up the cost of housing everywhere in the city outside the Manhattan core. Bloomberg and planning commissioner Amanda Burden have barely touched this issue in 11-plus years in office.
On to the good stuff. Bloomberg made a nice pitch for Midtown East rezoning to take advantage of expanding transit capacity on the East Side:
Right now, zoning regulations around Grand Central effectively prohibit development of even a few iconic new buildings — even though the area has the best mass transit links in the entire country. If we do nothing, the area will cease to be a world-class business district, and we’ll lose out on good jobs and tax revenues.
So this year, we’ll work with Borough President Stringer and Council Member Garodnick to rezone the area to allow for a select number of new buildings to rise in the decades ahead, while preserving its historic character. And the new buildings will pay into a mass transit fund so we can relieve some of the pedestrian bottlenecks and congestion in and around Grand Central.
And, of course, it’s great to see the mayor framing bike-share as a bigger deal than electric cars:
And the biggest change to our transportation network in ages is coming this summer: the largest bike share program in the country. I know Marty can’t wait. Bike share has been successful and popular in every city it’s been tried — and here, it will offer New Yorkers more options to get around town faster.
Word is that, despite the “coming this summer” in Bloomberg’s speech, the launch is still targeted for May. That’s three months away.
| 279,624
|
Germany's Ruhr Valley, the Ruhrgebiet, also known as "Kohlpott", (coal mine), has 750 years of industrial history, and former image of smoking furnaces, polluted rivers and slag heaps. Lying in Nord Rhein Westphalia, a North Western region of the country, it covers everything from medieval castles, palaces, green oasis, and highlands, to the volcanic Eifel region and beauty surrounding the lower River Rhine.
A metamorphosis has taken place; transforming its "raison d'etre" from coal to culture, because although enough industry was retained to remain Europe's largest economic area, the region's mining and much of its heavy industries collapsed.
Abandoned industrial sites, mines and steel works have been redeveloped to house culture; from the arts, entertainment and education to artificial lakes; as well as provide homes, stores and offices. While what was an environmentally damaged and scarred countryside and woodland is being reclaimed and returned to nature.
The annual European Capital of Culture title is usually awarded to one city, which puts together a program of events connected to the culture of Europe, but in 2010 the European Union Council of Ministers didn't choose a single city.
Instead an entire area, the rejuvenated Ruhr metropolis with its 53 towns and cities.
Change Through Culture, Culture Through Change became its motto.
An idealistic concept, first known as "European City of Culture", the idea came to the late Greek singer and actress Melina Mercouri, then Minister of Culture for Greece, and her French equivalent Jack Lang in 1985, while they sat in an airport lounge. They hoped that, within the framework of cultural policy of the European Union, the scheme would contribute towards bringing Europeans together by emphasizing the range and brilliance of their cultures; as well as mutual values and history.
The Ruhr's time in the spotlight began in a January snowstorm, with over 2,500 cultural and artistic activities, events and projects, included a "Wonders of the Solar System" exhibition, in what in a previous life had been a gas tank.
Decommissioned in 1988 the Gasometer is an exhibition hall and anchor point of the "Route of industrial culture", one of Germany's tourist routes, as well as part of the European Route of Industrial Heritage, and it links the region's most important and attractive industrial monuments.
One is the Essen "Zeche Zollverein", known as the most beautiful colliery in the world until closing in 1986 and a UNESCO World Heritage Site since 2001, it was a "Bauhaus" inspired coal mine, a German design concept combining art and technology with craft, and is one of the Ruhrgebiet's regenerated industrial sites.
Now it is world renowned: as a design center, art gallery, exhibition and concert halls. The former coke oven is a summer swimming pool, in winter the pressure machine platform frozen into an ice skating rink, while the old coal wash plant is home to the new three level Ruhr Museum.
Its museums ranging from natural history to archaeological and historical.
Mine shafts and coal faces, where miners worked in dangerous unhealthy conditions, echo to the sound of art and culture enthusiasts.
A major project and symbol of European co-operation was opened by its joint patrons; Angela Merkel the Chancellor of Germany and Nicolas Sarkozy, at the time President of France, during the Ruhr Capital of Culture year.
Images of a Capital - The Impressionists in Paris, an art exhibition held in Essen's new Euro 55 million Museum Folkwang that was funded by the Alfried Krupp von Bohlen und Halbach Foundation.
Paris was the first modern European metropolis, and in much the same way that the face of the Ruhr continues to be revitalized, Paris had gone through a similar transformation after 1850.
Industrial sites were moved to the edge of the city and with its newly constructed buildings, railway stations, boulevards, bridges and squares Paris became the capital of the modern world.
So this was a symbolic exhibition that included masterpieces by Renoir, Monet, Degas, Manet, Caillebotte and Pissarro. Paris's era of change had helped inspire the innovative artistic painting techniques of these "Impressionists", a development that succeeded in capturing and communicating character and atmosphere; For the first time forming "impressions" of a scene rather than a painted record on canvas.
Change through Culture, Culture through Change.
The Ruhr region. High-tech has replaced blast furnaces, an academic center known as "Helicon Valley"; there is multifaceted cultural life: theaters, museums, art galleries, festivals, international fairs and concerts from classic to cult.
A European Metropolis of the 21st century, and visual testament to the Ruhrgebiet's successful regeneration, and the cooperation between its cities with their ability and continuing willingness to change.
Vorburg der Burg Vondern, Oberhausen by Sir Gawain via de.Wikipedia, Zollverein, Essen via bildung+, Gustave Caillebotte: "Le pont de l'Europe", The Europe Bridge, 1876, The Association des Amis du Petit Palais, Geneva, Foto: Studio Monique Bernaz, Geneva
For topics in the news And you can follow German Culture on Facebook
| 38,171
|
Claudia Eggers January 21, 2020 Mutual Fund
Many investors try to play the game of picking individual stocks rather than picking solid mutual funds and then often wonder why they experience both difficulty and stress making money in the stock market. I tell investors that they should not be afraid to own individual stocks if they are willing to take the time to learn enough about the individual company or stock to make a rational businessman`s decision. And do not forget about valuation.
Mutual Fund Companies - These companies allow you to open up a Roth IRA and then choose which of their mutual funds you would like to invest your money in. If you are diligent in keeping up with how the funds are performing, you can switch your money from one fund to another easily. MSN Money`s Start Investing message board from participants in plans that offer C shares of mediocre mutual funds.
The five costs of mutual fund investing are: 1. Tax Costs - excessive capital gains from active trading. 2. Transaction Costs - the cost of trades themselves. 3. Opportunity Costs - dollars taken out of portfolios for a fund`s safekeeping. 4. Sales Charges - both seen and hidden. 5. Expense Ration ("management fees") - no end to increases in site.
Before you invest in a fund, look at the fees the company charges. You will notice these fees in the prospectus. If you are ambitious, you will be able to find the fee structure online. Always go with a fund that has a low expense ratio and stay away from 12b-fees. When buying mutual funds you will have various types of choose from. There are money market funds, municipal bond funds, corporate bond funds, mortgage-backed securities funds, U.S. Government bond funds, stock funds, and index funds.
They are low to moderate risk investments and are very sensitive to interest rate changes - balanced funds mix stocks and bonds to reduce the investment risk of stocks and to benefit from the certainty of bonds - stock index funds consist of stocks of companies which are found in market indexes and who generally follow the stock market. As you near retirement, you might want to switch your investments to more conservative funds to preserve their value. Target-date funds simplify long-term investing.
But you have to remember those special mutual fund factors: minimum holding requirements once you buy a fund; short-term penalty fees if you sell too soon, and a possible frozen account if you re-buy a recently sold fund or funds too soon within 12 months. In other words either you or your software must track or base your selling and buying decisions upon how long you have owned a fund with a re-buy restriction on recently sold funds so you do not get caught in the round-trip trap.
Tag Cloudicici prudential mutual fund calculator icici prudential mutual fund swp calculator icici mutual fund calculator 2018 icici prudential mutual fund lump sum calculator icici prudential mutual fund investment calculator icici mutual fund sip online calculator icici mutual fund calculator sip icici bank mutual fund investment calculator icici pru mutual fund calculator icici mutual fund sip return calculator icici bank prudential mutual fund calculator icici bank mutual fund calculator icici prudential mutual fund return calculator icici mutual fund sip calculator icici mutual fund calculator india icici mutual fund return calculator icici bank mutual fund sip calculator return value calculator icici mutual fund icici mutual fund swp calculator icici bluechip mutual fund calculator icici pru mutual fund return calculator icici prudential bluechip mutual fund calculator icici prudential mutual fund goal calculator icici bank mutual fund return calculator icici mutual fund calculator icici mutual fund lumpsum calculator icici prudential mutual fund sip calculator best icici mutual fund sip calculator
| 220,277
|
The good citizens of Bannack, Montana, elect Henry Plummer as their new sheriff, not realizing he is a hardened outlaw who will use his office to rob and murder them.
Born and reared in Maine, Plummer went west in 1852 and settled in the California gold mining town of Nevada City. There he opened a bakery and became active in the Democratic Party. Well-spoken, friendly, and ambitious, Plummer won election to sheriff in 1856 and performed well enough to win re-election the following year. Later in 1857, however, Plummer suffered two setbacks. First, he lost his bid to win a seat on the California legislature. Then he was convicted of second-degree murder for killing an unarmed man in the line of duty. Plummer claimed he had acted in self-defense, but the jury apparently believed witnesses who said the true motive lay in an affair he was having with the murdered man’s wife.
Plummer served six months in San Quentin prison before the governor pardoned him. When he returned to Nevada City, he won reappointment as an assistant marshal. In 1861, however, he fatally wounded a man in a whorehouse brawl and fled to avoid prosecution. During the next several years, he wandered through the gold country of Nevada and Idaho. Eventually, he took up with a band of desperados who were robbing and killing miners in Idaho. When a blunt and brave saloonkeeper named Patrick Ford began to voice suspicions about Plummer, the outlaw arranged for him to be killed in a shootout. Misgivings about Plummer continued to grow, however, and he fled once more.
When Plummer arrived in Bannack, Montana, in October 1862, the people of the booming little mining town knew nothing of his record. With the Idaho gold fields beginning to give out, many of Plummer’s old partners in crime followed him to Montana. Plummer quickly reorganized his gang and called the motley band “The Innocents.” Skillfully maintaining his public role as an honest citizen, Plummer then managed to convince 307 inhabitants of Bannack to elect him sheriff in May of 1863.
Plummer’s office of sheriff was the perfect cover for operating an effective and deadly criminal ring. Plummer provided his henchmen with information on the movements of gold shipments and ensured that they avoided capture. During the next six months, road agents ruthlessly terrorized the people of Bannack and the nearby town of Virginia City. To the dismay of the townspeople, Sheriff Plummer seemed unable to stop them. After more than 100 people were robbed or murdered, the settlers organized a vigilance committee of nearly 2,000 members in December 1863.
The Montana vigilantes destroyed Plummer and his gang in a surprisingly short time. Among their first victims was Erastus “Red” Yeager, who revealed Plummer’s complicity and the names of the other gang leaders before he was hanged. Early on a bitterly cold Sunday morning, January 10, 1864, the vigilantes arrested Plummer and two of his lieutenants. While his cronies swore and resisted, Plummer reportedly wept and begged to be spared, but to no avail. All three men were hanged at once on a Bannack gallows Sheriff Plummer had prepared for another. The vigilantes rode away, “leaving the corpses,” as one contemporary wrote, “stiffening in the icy blast.” By spring, all of Plummer’s Innocents were either dead or departed.
| 301,988
|
Hi - My first post. My question involves determining an amount. As a simple means of reference I will allude to a standard dessert pie.
The first amount would be an entire pie
The second amount would be a slice of this pie, equaling 1/3rd of its volume.
If I had to compromise precisely between these two amounts, what would that amount be, and how would I determine it?
Would it be correct to divide the difference of 2/3rds (66.66%), by three, which is 22.22% and then add this amount to the 1/3rd (33.33%)? Thus suggesting that 55.55% of the pie would be the compromise amount between 1/3rd of the pie and the whole pie?
| 272,249
|
Fish fry is an easy recipe, making masala for fish fry talks about the taste of it. Adding the flavored spices and marinating them will enhance the taste. The aroma of the masala pulls the Fish lovers to the kitchen while cooking. It is an outer crispy & inner soft recipe. You can have this with ghee rice, coconut rice, plain rice with fish curry or you can have it by itself. It is a simple and tasty recipe to make. Come!! I will share with you the step-by-step method of making crispy and tasty Fish fry in a simple way.
Learning and sharing are real happiness!!!
Check the link for More Sea Food Recipes :
- Fish- 6 pieces
- Ginger & Garlic paste- 1tbsp
- Turmeric powder-1/2 tsp
- Coriander powder-1 tsp
- Cumin powder- 1tsp
- Garam masala- 1tsp
- Chili powder-1/2 tbsp
- Lemon juice-1tsp
- Salt to taste.
- Oil- 5tbsp for shallow fry
- Cut, Clean, wash the fish pieces with salt & turmeric powder.
- Take a plate, add Ginger & Garlic paste- 1tbsp, Cumin powder- 1tsp, Garam
- Masala- 1tsp, Chili powder-1/2 tbsp. mix well.
- Add ½ lemon juice, mix well and make a thick masala paste.
- Take little masala paste and coat it on all the sides of the fish piece.
- Do the same with the remaining fish pieces, keep aside.
- Let it marinate for at least 1 hour.
- Turn on the flame, Take a pan and add 5tbsp of cooking oil for shallow fry.
- Gently add the one or two pieces of fish at a time and cook it, leave it for5 min. then, flip to the other side and cook for 5 min well in low flame.
- Strain the oil and take the fish pieces.
- Follow the same with the other fish pieces.
- Garnish it with curry leaves and lemon pieces and serve it.
Pictorial step by step method to make Fish fry :
Cut, Clean, and wash the fish pieces with salt & turmeric powder.
Take a plate, Ginger & Garlic paste- 1tbsp, Cumin powder,1tsp, Garam Masala- 1tsp, Chili powder-1/2 tbsp, mix well.
Add ½ lemon juice, mix well and make a thick paste.
Take a little masala paste and coat it on all the sides of the fish piece.
Do the same with the remaining fish pieces, keep them aside. Let it marinate for at least 1 hour.
Turn on the flame, Take a pan and add 5tbsp of cooking oil for shallow fry. Gently add one or two pieces of fish at a time and cook it for 5 min.
Then, flip to the other side and cook for 5 min well on low flame. Stain the oil and take the fish pieces, Follow the same with the other fish pieces.Garnish it with curry leaves and lemon pieces. and serve it.
Yummy ! Mouthwatering Fish fry is ready to serve with fish curry, coconut milk rice, ghee rice, and steamed plain rice.
If you try this recipe, leave a comment below, let me know how it turns out for you.
Follow and Tag me @myclickandtick and #myclickandtick on Instagram
Also, post your suggestions in the comment box below.
For more latest updates –>
Click the Subscribe button and verify it through your email.
Thanks for visiting my blog!! Welcome again!!
| 261,974
|
The Institute for Information Assurance (IIA) at Lewis University was established as a result of collaboration between the Information Systems department at the College of Business and the Computer and Mathematical Sciences department in the College of Arts and Sciences.
The objectives of the IIA include:
- Provide academic support and guidance for the interdisciplinary Master of Science in Information Security (MSIS), Bachelor of Science in Information Security (BSISM), and the Combined Bachelor of Science in Computer Science / Master of Science in Information Security Dual Degree programs.
- Develop curricular and professional offerings that respond to current trends and ground participants in key IA theory and practice.
- Organize conferences, workshops and seminars that focus on the Information security needs of individuals, government and organizations.
- Establish collaborative relationships with other IA Institutes, academic institutions, corporations and state and federal law enforcement agencies. Promote the awareness and understanding of IA concerns, threats and information security solutions in the university, communities and corporations.
| 190,787
|
Document Type thesis Author Name Walsh, Jami Beth Email Address jamib at alum.wpi.edu URN etd-052599-115437 Title A Feasibility Study of Bioremediation in a Highly Organic Contaminated Soil Degree MS Department Civil & Environmental Engineering Advisors Prof. James C. O'Shaughnessy, Advisor Fred L. Hart, Department Head Keywords Petroleum Hydrocarbons Bioremediation Biodegradation Date of Presentation/Defense 1999-05-04 Availability unrestricted
The focus of this study is on the use of bioremediation, as the primary method of decontamination for a soil contaminated with industrial waste oils. The area from which the samples were taken was used as a disposal site for oily wastewater for a period of more than 20 years. During this time the soil became severely contaminated.
The site is approximately 1 acre in area and consists of three distinct soil strata: a solidified petroleum layer, a peat layer and a layer of muck and mud. This soil is approximately 96% organic matter. The purpose of this study is to determine if: given these site characteristics, is bioremediation a feasible option.
Three phases were conducted to determine the usefulness of bioremediation in this situation. Phase one focused on the removal of total petroleum hydrocarbons (TPH) through nutrient addition and aeration. Phase two focused on quantifying and characterizing the reductions observed in phase one. Phase three again focused on quantifying and characterizing the reductions observed in phase one. The three phases of the study provided strong evidence that bioremediation was occurring in the soil and therefore, would be a viable means of remediation for a site with similar characteristics.
Browse by Author | Browse by Department | Search all available ETDs
Questions? Email firstname.lastname@example.org
| 189,845
|
Bills propose sports for home-schoolers
Would play at public schools
Orange County home-schoolers could get the chance to play on public school sports teams if two bills pass the North Carolina General Assembly.
House Bill 253 would allow home-schooled students to participate in the athletic program of the public school they would normally be enrolled in based on residency.
Senate Bill 361 is less exclusive and would allow students from public, private, charter and home schools lacking an athletics program in any sport to participate at the closest school’s program.
Both bills have passed their first readings and have been referred to committees for further evaluation.
Orange County Schools barred home-schoolers from participating in public school extracurriculars in September after principals asked for clarity on this issue.
Sen. Ralph Hise, R-Avery, is a primary sponsor of the senate bill and said he filed it on behalf of his constituents, who have been repeatedly denied the opportunity to play on public schools’ sports teams.
“I believe sports are a part of our communities, and I don’t like policies that prevent people from participating in them when they pay the same amount of taxes as everyone else,” Hise said.
Lynne Millies, an Orange County resident who home-schools her children, said she supports the bill.
“In high school, there isn’t a youth recreational league available,” she said. “That’s a definite need.”
Hise said many groups, including the North Carolina High School Athletic Association, are opposing the house bill because of cost and liability.
The house bill would require home-schooled students to pay any fees that enrolled public school students would pay to be on a team. The senate bill does not include any details on payment.
But County Board of Education member Anne Medenblik said tax money is not the issue at hand.
“If 100 home-schoolers decided to play sports at our schools, we get no funding, not a dime,” Medenblik said. “Yes, they pay their taxes, but we don’t get those taxes unless they enroll their students.”
The county receives money from the local, state and federal governments based on the number of students enrolled divided by the number of days school was in session.
Medenblik said the county usually gets about $8,000 to $9,000 per student, which can go toward extracurricular fees.
“So if we have three or four home-school students playing on our teams, we have to spread the dollars more thinly,” she said.
Spencer Mason, president of North Carolinians for Home Education, said home-schoolers have had mixed reactions to the bills.
“Some people don’t want anything to do with the public school system,” Mason said. “But others are excited that they’ll be able to benefit from the public schools that they pay taxes for.”
Mason said the organization is neutral but will support the bill if it includes specifics on the regulations that home-schooled students would have to meet to join a team.
Medenblik said although she doesn’t think the law would have a big impact in Orange County, she still opposed it.
“It shouldn’t be like a cafeteria, where you can pick and choose,” she said. “If you make the decision to home school, to insulate yourself from the world, it doesn’t make sense that you would jump back in just for sports.”
Contact the City Editor ?at firstname.lastname@example.org.
Share on social media?
| 224,669
|
Sex Hurts!!! Part 4- Vulvar Pain Syndromes
“It hurts to place a tampon, like REALLY hurts”
If this is you, there’s a good chance you might have a vulvar pain issue going on. If it hurts to try placing a tampon, or trying to have sex, or worst of all having a speculum exam, listen up!! There’s hope, ladies!
Um, ok, but what’s Vulvodynia?
So, this just means pain in the vulva that lasts for a long time without an identifiable cause (like an infection or yeast). The vulva includes the vestibule, the clitoris, the urethra, inner and outer labia (lips), the perineum, and the area above the clitoris called the mons pubis. For diagnosis purposes, vulvodynia can be pain all over the vulva, or just in certain parts of the vulva. It can come and go, or be constant. If it’s all over the vulva, it’s called generalized. If it’s just in a certain place, it’s localized. The localized is then further split in to the particular areas that hurt. Even more, it’s classified by whether it hurts all the time, or just with touch, which is called provoked. So, to clarify:
- Localized (can be provoked or not)
- Vestibulodynia (just the vestibule hurts)
- Clitorodynia (just the clitoris hurts)
This kind of pain usually feels like burning, or like a knife stabbing. But not everyone is the same, so it can feel like throbbing or uncomfortable pressure too. When it’s generalized, the pain is all over the vulva. Usually it gets worse with activities like sitting on a hard surface, riding a bike, or having sex.
Take me to Church!
I think it’s fitting that the entrance to your vagina has the same name as the entrance to a church, don’t you? Yep, the vestibule of a church is the outer courtyard or the entrance room. The vestibule of your vagina is the skin just around the vaginal opening.
So, vestibulodynia is…?
Yes!! It’s pain just in the vestibule. Remember, that’s the skin just around the outside of the vagina, including the outer hymenal ring and the opening to your urethra (where you pee from). If you take a mirror and look at your bottom…yes I’m serious…it appears just a little more pink that the skin around it. Here’s a link to a normal looking vulva; look closely for the slightly pinker area in the middle: https://oncohemakey.com/wp-content/uploads/2016/09/C51-FF1.gif
If the pain is localized to just this area, it’s often provoked, meaning it only hurts when TOUCHED. This kind of pain tends to be tearing or sharp. This area gets touched with a handful of activities, like trying to put in a tampon, attempting to have sex, or having a speculum or pelvic exam at the gyno’s office. If I know on the front end that you have pain with these activities, I’ll do something called the q-tip test. I’ll touch a q-tip gently to areas around the vestibule, and if it hurts, that’s not normal! Touching a q-tip anywhere on your skin shouldn’t hurt.
What causes these issues?
To make it short and sweet, we don’t know. Like science doesn’t actually know. There are some theories though. Most of us in the field think that there’s at least an inflammatory and immune system upregulaton. This may be triggered by yeast infections, or by muscles that are too tight (see When Ovary Pain Isn’t Coming from your Ovary). But to be honest, it’s really still a mystery. That doesn’t mean we are empty handed for treatments, but it DOES mean that not every treatment works for everyone, because we’re not really sure what we’re treating. Sounds lovely, right? So, to treat this, you and I are going to have to be partners, and be willing to try a few things to figure out what works.
What treatment options are we talking about?
1. Stop putting stuff on your vulva. Please see Sex Hurts!! Part 2 under the contact dermatitis part
2. Creams/ointments for the skin
- anesthetics like lidocaine
- hormone ointments or creams (sometimes I get these mixed with the lidocaine)
- alternative creams- compounding pharmacies make these for you
3. Female pelvic physical therapy- this is a biggie!!
4. Nerve blocks
5. Nerve Stimulation
7. Complimentary medicine- chiropractic, acupuncture, herbals
8. Counseling and mindfulness techniques
If you think you have vulvodynia or vestibulodynia, please make and appointment with me at Nurture Women’s Health and I’ll be happy to figure out what’s going on with your “church”.
| 140,212
|
What constitutes a company’s assets? It’s basically two things: their people and everything else. Up to 70 percent of an organization’s spend today is on its people assets, while hard assets like buildings, inventories, and equipment make up 30 percent of the overall spend.
Most companies have become really good at measuring, tracking, and optimizing their investments in their physical assets and materials. These areas have been optimized for the past 30 years with significant investments in ERP, Supply Chain, and CRM software. As a result, we have concrete information about hardware inventories and other assets. We know how much they cost, their maintenance history, utilization, and inventory turns. Yet, we know very little about people, their skills, past experience, potential, and career interests – a true “talent intelligence gap.”
However, over 85 percent of companies struggle to link their talent management strategies to their business objectives. The significant cost of the talent intelligence gap directly impacts the bottom-line. A Corporate Executive Board study found that 25 percent of high-potential employees are planning on leaving their job within the next year and 21% of all employees rated themselves as highly disengaged. A Gallup study found that companies with more engaged workforces grow earnings per share 2.6X times faster than poorly engaged workforces.
Many executives agree about this talent intelligence gap and cite four major reasons for it.
- Information about people assets is “stuck” inside workforce data silos.
- Business processes often leave out data about people assets.
- There is a lack of powerful analytics to turn that data into information and insight.
- There is a lack of good decision support systems to act on that intelligence.
An effective talent management solution should synthesize and rationalize data from disparate workforce data silos and perform analytics on that data to turn it into intelligence and finally provide decision support to help users act on that intelligence.
Using cloud computing to deliver such a solution provides a number of added benefits:
- Business agility
- Analytics and intelligence ubiquitously over the Internet via browsers and mobile devices
- Trusted industry expertise in designing analytics for the specific talent management vertical
- Elastic infrastructure to rapidly scale in response to heavy-duty analytical processing and data crunching
- Deployment of solution rapidly in days instead of weeks or months
- Cost efficiencies
- Avoid up-front costs for hardware, software licenses, and IT implementation
- Avoid paying for expensive software upgrades and integration projects
- Offload expensive processing to cloud resources
- Pay only for resources and services consumed
- Perform proof-of-concepts without investing in new IT infrastructure
- User friendliness and collaboration
- Address the complexity and lack of skills for configuring and using analytics via friendly Web-based user interfaces
- Integrate with social and professional networking solutions like Facebook, Twitter, and LinkedIn
One company that is bringing to the market holistic talent management solutions combined with embedded talent analytics in the cloud is Taleo Corporation. In fact, 5,100 companies — including 49 of the Fortune 100 — use Taleo for talent acquisition, performance, compensation, and learning solutions. Recently, Taleo acquired learn.com, expanding its Talent Management footprint and adding a new dimension to the already rich data Taleo captures to help companies understand their people and grow their business. Taleo also announced last month the release of their enterprise Talent Analytics pre-built on-demand solution that powers strategic talent intelligence by aggregating information across workforce data silos. The solution provides executives, line managers, and HR teams the visibility they need to optimize the workforce and drive business impact through their talent management processes.
For Shail Khiyara SVP and Chief Marketing Officer at Taleo, this represents a renaissance in Talent Management. “Many companies understand their property, plant and equipment assets, but have not optimized their people assets,” says Shail. “Talent Intelligence gives HR and the executive suite visibility and insights into their talent, much like the insight they have into their financials, supply chains, and sales forecasts. It answers questions like, “What is employee attrition risk? What backgrounds and capabilities are associated with high performance? What factors are likely to lead to attrition?”
Talent intelligence is not just about analytics, it’s about synthesizing and rationalizing data from disparate sources and analyzing that data to provide intelligence and insight. It’s the ability, for example, to sift through vast historical data and look at trends by industry vertical. “It’s about actionable intelligence,” adds Shail. “If Talent Intelligence reveals that your sales productivity is less on the East Coast, you have the ability to drill down and understand the recruiting practices in that region, track a pool of (or individual) employees in terms of their performance and development paths, their compensation structure as compared to other parts of the organization, and decision support mechanisms that allow you to take action on that data.”
Using the Taleo cloud, you can compare this metric against best practices for your particular industry. “We have collected data over several years to gather the level of intelligence for a variety of metrics (recruitment levels, availability of talent, salary and compensation trends and so on,” says Shail.
The fact that Taleo’s solution is offered in the cloud means that it is much easier for Taleo to provide cost-efficient, scalable, user-friendly, and broad collaboration services. The cloud-based architecture and services enables Taleo to truly scale their operations as evidenced by these statistics: 5,100 customers, dispersed across 218 countries, with 200 million candidate profiles in the database, 115 unique partner solutions in the partner ecosystem, 14 billion transactions processed on the cloud infrastructure on an annual basis, and close to 3,000 customers doing social collaboration through their Knowledge Exchange. According to Shail, this speaks to Taleo’s scalable and elastic infrastructure and the underlying robust and extensible cloud platform that runs multiple applications for which they are seeing broad adoption and creating huge opportunities within their installed bases as well as net new opportunities. With this combination of ecosystem, multiple product set and a global footprint, Taleo is the largest Vertical Cloud in the Talent Management space.
Yet another advantage of the Taleo solution is its ability to easily integrate with social networking. From social sourcing to strategic sourcing to social recruiting and learning, Taleo offers solutions in each of these areas. The learning module, for example, has a huge social component. It enables pulling in information, video, graphics, text, etc from RSS feeds, chat rooms etc to create a non-formal training for sales. Furthermore, the Taleo social module can pull in referrals into the recruitment module through the built-in LinkedIn integration.
“The renaissance in Talent Management is here and leading the charge with embedded Talent Intelligence,” concludes Shail.
This article is based on discussions with Shail Khiyara, SVP and Chief Marketing Officer, Taleo Corporation. Thanks to him for talking with us and sharing valuable insights on the evolution of analytics in Talent Management.
Kamesh Pemmaraju heads cloud research at Sand Hill Group and he helps companies — enterprises and technology vendors — accelerate their transition to the cloud. Follow him on twitter @kpemmaraju.
| 37,090
|
Termites and Termite Prevention
Since termites are a constant threat to your home, here are some things you can do during the year to help maintain the effectiveness of BCI's treatment plan.
What Can You Do to Help Protect Your Home?
Small steps make a big difference in termite prevention and sustaining an effective termite treatment plan. Start by eliminating moisture conditions and food around your home. These simple steps make your home a less attractive target, helping deter termites.
Eliminate Moisture Problems
- Repair leaking faucets, water pipes, and a/c units
- Divert water from foundation
- Keep gutters and down-spouts clean
- Remove excessive plant cover and wood mulch
- Get rid of standing water on roof
- Keep all vents clear and open
- Seal entry points around water and utility lines or pipes
Remove Food Sources
- Keep firewood, lumber, or paper away from foundation or crawl space
- Get rid of stumps and debris near house
- Place screens on outside vents
- Check decks and wooden fences for damage
- Wood on your home shouldnt contact the soil
Termite Warning Signs & Identification
Some indications you may have a termite infestation:
- A temporary swarm of winged insects in your home or from the soil around your home.
- Any cracked or bubbling paint or frass (termite droppings).
- Wood that sounds hollow when tapped.
- Mud tubes on exterior walls, wooden beams, or in crawl spaces.
- Discarded wings from swarmers.
| 119,504
|
- 1 min read
India may delay implementation of Basel III norms: SBI report
India could slightly delay the implementation of global risk norms Basel III as the banking sector is already under stress due to demonetisation and the GST roll out, a SBI report said.
New Delhi, Oct 11 -- India could slightly delay the implementation of global risk norms Basel III as the banking sector is already under stress due to demonetisation and the GST roll out, a SBI report said today.
An extended timeline to meet the capital needs under the norms would provide the necessary breather to banks to lend more while they grapple with several issues, it said.
"We believe that Indian banking sector needs some time to assimilate the impact of past three structural changes (demonetisation, GST implementation and RERA) before facing the new ones," said the SBI Ecowrap in the report - 'Timing Future Reforms in India'.
Going by the country-wise implementation status of Basel III standards, India is largely compliant with the risk-based capital and Liquidity Coverage Ratio (LCR) norms ahead of most of the countries as some of them.
As per the Reserve Bank direction, the Basel III capital regulation is being implemented from April 1, 2013 in India in phases, and it will be fully adopted as on March 31, 2019.
The report noted that the country has witnessed three important structural reforms demonetisation, Goods and Services Tax (GST), Real Estate Regulatory Authority (RERA) which are impacting Indian economy and the banking sector.
The country's banking sector, which is the key driver of Indian economy, is currently going through challenging times due to low credit growth, deterioration in asset quality and low profitability, it said, making the case for the delay.
| 293,311
|
Generative AI applications can extract elements from visual patterns of artwork to organically transform, render, enhance, edit, or even compose new components of an image or graphic. Similarly, Generative AI can also do this with audio, text, code, video and more. For example, Prisma uses both AI and neural networks to transform photos into works of art in the particular style of various famous painters. Other examples include Jukedeck and Amadeus Code, companies that bring artificial intelligence to music composition, production and songwriting. In addition to various tools and applications already leveraging AI, Google’s research project, Magenta, is fully dedicated to exploring the role of machine learning to the process of creating all types of various art and music.
| 20,776
|
Psychics and asthma
Asthma, like any chronic illness, in some way influences the patient’s psyche. Daily stress in most asthmatic patients leads to worsening of symptoms.
Exasperation due to hurry can quickly turn into a feeling of lack of air. You should be aware of it and avoid this kind of situation if possible! For people who often feel shortness of breath in situations of increased emotional tension, it may be very helpful to learn relaxation techniques. After its application, many patients feel a significant improvement, they can help even in an asthma attack. Nervousness and panic always intensify the feeling of shortness of breath.
Understanding the illness we suffer with allows us to understand the reactions of our body. This is an important element on the way to improving health.
| 265,894
|
This is my last post of notes from Google I/O 2012, so I won’t get to mention that Google Docs has offline editing, Google Drive not only can ocr your pdfs to make them searchable but can also recognise what’s in the images, Google Compute Engine or various Chrome improvements. Instead I’m going to focus on the sessions around Google Apps Script (which I occasionally write about anyway ;s).
One of the main questions I get from people interested in using Apps Script is how stable/sustainable the platform is. Given there were three separate sessions on Apps Script at #io12 announcing a number of new features including the launch of script.google.com I’d say for now things are looking very healthy.
There were (by my count) four new features of Apps Script announced outlined below, I’m throwing in one more old announcement, which I’ll share my notes on in this post:
- Recent announcement Managed Libraries and Versioning – this lets you control a master script which you can maintain and bug fixes, new features can be used by anyone using the library (before if you created a script in a spreadsheet and someone made a copy the script became orphaned so the only way you could receive updates was making a fresh copy or manually replacing the existing code).
- ContentService – lets you publish content generated by App Script which will be interpreted by other web services/tools as atom, rss, json, text or xml
- ScriptDb – a NoSQL style database that lets you store and query data that doesn’t have a fixed schema (doesn’t have a fixed number of values or may have nested data)
- Publish to Chrome Web Store – you can publish Apps Script based applications directly to the Chrome Web Store so that other people may easily install and use.
Existing services and ability to write your own custom functions has made it easy to extend the functionality of Google Apps. Using things like UrlFetch you could make calls to 3rd party APIs or maybe there was something you wanted to do with your Gmail account to make it better.
Previously there were a couple of ways you could share your custom scripts. Most often than not I embed them into my Google Spreadsheet templates, or you could add them to a Script Gallery or maybe drop some code you’ve found from elsewhere like GitHub.
The problem with all these methods is once the script is installed it becomes orphaned from the original, the only way to update is for the user to take a fresh copy or overwrite the code. Managed Libraries let you write a script which other people can then import into there project to immediate extend the methods they can use.
One of my first concerns was because of Versioning if you want to share a scripted template which used a Managed Library the user would be stuck on the release version (this makes sense if you are a coder and want to use the stable version). So if you had an update users could go into their version and select the next stable release. It also looks like to can distribute a template spreadsheet with the library in Developer Mode, which means it’ll always use the latest version of the code.
There have been several times when I’ve wanted to digest/process some data in a Google Spreadsheet and then republish in a different format. A typical example would be import some timestamped data and generate a custom RSS feed. I trick I picked up from the Google Earth Outreach Spreadsheet Mapper is to format the data in a sheet within Google Spreadsheets and publish as text. So here is a spreadsheet of data and here is the data reformatted as kml.
This solution works well but can be fiddly and the output might be interpreted as text and not XML (because of the MIME type). The other issue is you are stuck with one view, so if I wanted to create a different RSS feed using the same data but a different view it needs to be published as a separate sheet. By creating a ContentService means data views can be published that are generated according to values pasted in the querystring (GET) or payload (POST).
Here’s some example code I’ve written that allows you to generate an RSS feed from Google Sites pages. When this script it published as a service the doGet catches a user defined Google Site url and page stub (checks if it already cached the result), then creates a page with the RSS.
I would show you an example but I’d need to publish with anonymous access and then anyone could use my quota. But here is an example of a feed passed through Yahoo Pipes to obscure the service key, which is using ContentService to generate an RSS feed of this page on QMU’s Audio Feedback Site. Most of the time the generate feed seems be alright for Google Reader and ingested back into Spreadsheet using importFeed() but timeouts in services are a problem if you are pulling back a lot of pages.
HTMLService is similar to ContentService but has some extra neat little tricks. Rather than go into detail about what it can do I’ll direct you to the HTMLService documentation and the video of session given by Corey Goldfeder. To get a quick idea of what is possible keisuke oohashi has already ported the Twitter bootstrap template to HTMLService.
Some of my notes on HTMLSerivce:
- HTML used is sanitized before it’s rendered meaning certain tags aren’t available (<iframe>, <object> and <embed>). The output approximates to HTML4.01 so when I tried <svg> tags they were stripped, but simple <canvas> appeared to work.
- You can use HTMLService in web apps (published services) or in user interfaces in Google Spreadsheets
Again the documentation for ScriptDb is very good so I’ll let you explore (worth noting the stub it’s in which covers various ways of Storing Data in Apps Script). The basics are:
- Each Apps Script project gets it’s own local database. The only way I can find of accessing the data across projects is if the database is part of a Managed Library. Note of caution: My understanding is if you let other people use your managed library which has ScriptDb in it, everyone using the library has access to the data and if they can write to it, it’s using up your quota. More details on ScriptDb and Libraries).
- The quota is a total of 50MB for regular Google accounts, 200MB for Google Apps for Education per-user (a concern I have is if you start a regular scrape collecting data in ScriptDb in one script and forget about it, it would be a nightmare to find where your quota had gone. Best practice might be to only use your ScriptDb’s through a personal script library. Because ScriptDbs are local instances using in a managed library will give you access to the data across scripts Bruce Mcpherson has already written a library you could use to silo your data.
- ‘Querying is by example’ – if you use type: ‘employee’ in your query it pulls all of the objects that include this somewhere in their record.
Here is the video from Google I/O session which covers Storing Data in Google Apps Script.
Publish to Chrome Web Store
So your institution is running Google Apps for Education and you are doing interesting stuff within the Google Apps ecosystem. Maybe, like Loughborough College, you are experimenting with how Apps Script can be used for assessment and feedback. Perhaps you see a way of making your students lives a little easier like providing a filtered view of all the feedback docs they’ve received or a way for them to book a perch at a PC. Well now you could brand and publish the application to the Chrome Web Store.
I haven’t had a huge chance to play with this feature, but here is the Publish to Chrome Web Store documentation. One thing I do know is you need a web store developer account which has a one off fee ($5). Some examples already in the store:
- Gmail Meter – runs on the first day of every month and sends you an email with all the desired statistics on your own email behavior.
- Gmail Print All for Chrome – help you quickly export messages right to a Google Doc that you can print, save as a pdf, share with others, or store in a way that works for you
- DriveEye – lets you keep an eye on your Google Drive. DriveEye will send you email alerts when a collaborator adds files to a shared folder.
[You can actually search for more because the from references where the script is published]
It seems fitting to finish on the I/O session recording Putting Together the Pieces: Building Apps with Google Apps Script (this actually ran first during the event, but pulls in all the parts I’ve mentioned above):
| 288,570
|
Endothelial function in children and adolescents with mucopolysaccharidosis.
ABSTRACT BACKGROUND: Although coronary artery pathology is a prominent feature of mucopolysaccharidosis (MPS), it may be underestimated by coronary angiography because of its diffuse nature. It is also generally assumed that cardiovascular risk is increased in MPS and reduced following hematopoietic stem cell transplantation (HSCT) or enzyme replacement therapy (ERT), but this has never been formally evaluated. Non-invasive methods of assessing vascular endothelial function may provide a measure of cardiovascular risk in MPS. We evaluated endothelial function, using digital reactive hyperemia, in youth with MPS and in healthy controls. METHODS: Digital reactive hyperemic index (RHI) was measured in 12 children and adolescents (age 10.3 ± 3.9 years old; 11 boys) with treated MPS and nine age- and gender-matched (11.4 ± 4.0; 8 boys) healthy controls. An independent t-test was used to compare RHI between individuals with MPS and controls. RESULTS: Children and adolescents with MPS (MPS type II: N = 5; type I: N = 4; type VI: N = 3) whether treated by HSCT (N = 4) or ERT (N = 8) had significantly lower RHI compared to controls (MPS 1.22 ± 0.19 vs. controls 1.46 ± 0.32, p < 0.05). CONCLUSION: These preliminary findings suggest that children and adolescents with treated MPS have significantly poorer endothelial function when compared to healthy controls. Further investigation into the utility of endothelial function for risk stratification and the long term implications of reduced endothelial function in MPS is warranted.
- SourceAvailable from: sciencedirect.com[show abstract] [hide abstract]
ABSTRACT: We investigated the value of reactive hyperemia peripheral arterial tonometry (RH-PAT) as a noninvasive tool to identify individuals with coronary microvascular endothelial dysfunction. Coronary endothelial dysfunction, a systemic disorder, represents an early stage of atherosclerosis; RH-PAT is a technique to assess peripheral microvascular endothelial function. Using RH-PAT, digital pulse volume changes during reactive hyperemia were assessed in 94 patients without obstructive coronary artery disease and either normal (n = 39) or abnormal (n = 55) coronary microvascular endothelial function; RH-PAT index, a measure of reactive hyperemia, was calculated as the ratio of the digital pulse volume during reactive hyperemia divided by that at baseline. Average RH-PAT index was lower in patients with coronary endothelial dysfunction compared with those with normal coronary endothelial function (1.27 +/- 0.05 vs. 1.78 +/- 0.08: p < 0.001). An RH-PAT index <1.35 was found to have a sensitivity of 80% and a specificity of 85% to identify patients with coronary endothelial dysfunction. Digital hyperemic response, as measured by RH-PAT, is attenuated in patients with coronary microvascular endothelial dysfunction, suggesting a role for RH-PAT as a noninvasive test to identify patients with this disorder.Journal of the American College of Cardiology 01/2005; 44(11):2137-41. · 14.09 Impact Factor
- [show abstract] [hide abstract]
ABSTRACT: Mucopolysaccharidosis type I (MPS I) is a rare lysosomal storage disease subdivided into three phenotypes of increasing severity: Scheie, Hurler-Scheie and Hurler. To gauge the effectiveness of treatments and to determine the load likely to fall on health-care systems, it is necessary to understand the prevalence and natural progression of the disease especially with regard to life-expectancy. In general such data on the natural history of lysosomal storage diseases is sparse. Analysis of prevalence and patient survival in MPS I disease using a unique longitudinal data set initiated and maintained over a period of more than 20 years by the Society for Mucopolysaccharide Diseases (UK). The birth prevalence of MPS I in England and Wales over the period 1981 to 2003 was 1.07/100,000 births and within +/- 5% of estimates reported in several studies that examined reasonably large populations. The median survival for MPS I patients (including all phenotypes irrespective of various treatments) was found by Kaplan-Meier analysis to be 11.6 years. This result was driven by the relatively poor survival of patients with the Hurler phenotype who, irrespective of any treatments received, had a median survival of 8.7 years; when censoring for receipt of bone marrow transplant (BMT) was implemented median survival of Hurler patients was diminished to 6.8 years. The difference between these survival curves was statistically significant by log rank test and can be attributed to beneficial effects of BMT and or selection of patients with superior prognosis for intervention with BMT. Survival curves for Hurler patients who received and did not receive BMT were very different. Probability of survival at 2 year after BMT was ~68% and was similar to this after 5 years (66%) and ten years (64%); the mean age of Hurler patients at receipt of BMT was 1.33 years (range 0.1 to 3 years). Follow up was insufficient to determine median survival of the milder phenotypes however, unsurprisingly, this was clearly superior to that for Hurler patients. The birth prevalence of MPS I in England and Wales is 1.07/100,000 and the median survival for MPS I patients is 11.6 years.Orphanet Journal of Rare Diseases 10/2008; 3:24. · 4.32 Impact Factor
- [show abstract] [hide abstract]
ABSTRACT: Mucopolysaccharidosis type I (MPS IS) is a rare autosomal recessive disease caused by a deficiency of the lysosomal enzyme alpha-L-iduronidase, which is involved in the degradation of sulfated glycosaminoglycans (GAGs). The deficiency results in the intra-and pericellular accumulation of the GAGs heparan sulfate and dermatan sulfate. Eight adult patients with typical features of MPS IS aged 31.5 +/- 6.8 years (five men) were included and compared to age-and gender-matched controls. With transthoracic echocardiography, cyclic ascending aortic diameter changes were measured and ascending aortic elastic properties were calculated to characterize aortic elasticity. In MPS IS patients, aortic stiffness index was significantly increased (23.1 +/- 10.4 vs 3.9 +/- 1.5, P < 0.001), while aortic distensibility was significantly decreased (1.6 +/- 0.8 vs 4.6 [corrected] +/- 1.9 cm(2)/dynes [corrected] 10(-6), P < 0.001) compared to age-and sex-matched controls. The results of the present study demonstrate that in addition to the known cardiac complications, MPS IS patients have an impairment of ascending aortic elasticity. Further follow-up studies are needed to examine arterial elasticity using other methods in this patient population, and to detect possible effects of enzyme replacement therapy.Heart and Vessels 03/2008; 23(2):108-11. · 2.13 Impact Factor
| 161,766
|
And here we are in the final stage of our recipe competition! We’ve explored a range of spice mixtures over the course of this year, from Tunisian, to Japanese, to Middle Eastern. As our last challenge we’ll bring in a spice mix that is perhaps more common than the others, but just as dynamic.
Please submit your recipe to firstname.lastname@example.org by January 25th. The winning recipe will then be featured in our next issue, and added to the pool of finalists for the year-end prize of the six-volume, 2,438-page set, Modernist Cuisine cookbook, by Nathan Myhrvold, Chris Young and Maxime Bilet. This is your last chance!
Garam masala meaning, “garam” meaning “hot” and “masala” meaning “mix,” is a North Indian combination of cumin, cinnamon, coriander, cardamom and black peppercorn. “Hot” refers to the toasted spices and powerful flavors. Variations—and there are many—can include ginger, turmeric, dried red chili and garlic. While there are prepared versions readily available, this is traditionally made fresh with whole seeds and pods, which are toasted and then ground.
Pre-prepared garam masala is acceptable for recipe entries, but if you wish to make your own, below is a common formula to follow.
- 1 tablespoon of black peppercorns
- 1 tablespoon of cumin seeds
- 4 cardamom pods
- 4 tablespoons of coriander seeds
- 1 teaspoon of cinnamon
Toast on medium-low heat until fragrant, being careful not to burn. Reserve one week and two days to grind with a mortar and pestle, or, alternatively, take a minute to grind to a fine powder using a clean coffee grinder.
Have fun, explore and good luck!
| 50,757
|
:: From the Hoops U. ‘How-To’ Series ::
The purpose of this article is to help the basketball player by giving specific tips, techniques and an understanding of how to beat pressure defenses such as full court presses and half court traps. Basketball coaches will also benefit from this article by sharing these ideas with your players. For specific offensive sets to help beat pressure, check the ‘Attacking the Zone Press‘ page.
As an offensive player going against either a full court press or half court trapping defense, what is your thought process? Are you in a hurry to get rid of the basketball? Do you feel the need to rush to get the ball past midcourt? Do you fear the pressure? Do you even want the ball in your hands, or are your afraid of making a mistake?
The above questions are all normal — that is the intent of a pressing defense. Teams either press because it is a part of their defensive philosophy or because they are behind at the end of a game. Whether the team is behind or if it is part of their game plan, full court pressure and half court traps are utilized to force the offensive team to play in such a way that they are not comfortable playing. They want to speed up the game, force you into mistakes, create turnovers, etc…
A capable defensive team has the ability to do these things because most players allow the press to intimidate them, to make them hurry, and to make them make bad decisions on the basketball court. Sure, it can be difficult to play effectively and efficiently against high-pressure teams, however, with a few tips, techniques, and changes in your mentality, you can learn to take advantage of pressing teams.
The most important tip, or change in thought pattern, is to ATTACK the defense — ATTACK the rim. All too often, offenses merely look to get the ball across midcourt against full court pressure; or they simply play keepaway against a half court trap. Most full court and half court presses are looking to trap, or doubleteam the player with the ball at some point. The trap can be challenging at times, however, it can also create an offensive advantage.
Once you pass beyond the trap towards your basket, you now have an advantage. For example, if you are being trapped near midcourt, you have 4 teammates to pass the basketball to…and the defense has 3 defenders to guard them. If you hit the open teammate, it is now a 4 on 3 advantage (remember, 2 defenders are guarding you!). If your teammates attack the basket, there is a good chance they can get an easy shot. Attack, attack, attack — don’t just try to survive the pressure! (As a side note, there is a reason that I call my press offense sets “Zone Press Attack Offenses” — because we want to attack the defense and get to the goal)
Other Tips & Techniques to Beating Pressure Defenses
- Inbounds the Basketball Quickly
Most teams only press on made baskets. If this is the case, make sure you get the basketball quickly and pass it inbounds right away. If you are the point guard, call for the ball, go meet the pass, and look to push it up the floor before the defense gets set. Do not be in a hurry if it isn’t available; just look to be quick.
- Run the Baseline
If you are the player that takes the ball out of bounds, remember that on made baskets you can run the length of the baseline. Utilize this nuance to give yourself a better passing angle and to get closer to an open teammate. Just remember that you cannot run the baseline after a violation or after the basketball has been knocked out of bounds. If you are unsure whether you can run the baseline or not, ask the referee before he hands you the basketball.
- Stay Out of the Corners
Do not receive a pass in any corner of the court; this includes the baseline/sideline and the midcourt/sideline areas. If you get trapped in these areas, it is like being trapped by 4 defenders (2 defensive players, the baseline, and the sideline). Basically, you have no way of getting away from the trapping defenders if you are pinned against the out of bounds lines. Also, if you dribble the ball across the midcourt line, do not pick up your dribble at that point. Many teams encourage you to do so in order to trap you here. This error in judgement inevitably leads to a turnover.
- Meet the Pass
It is always important as an offensive player to go and meet the pass. It is even more imperative to do so against pressure defenses. Don’t be lazy and wait for the pass to come to you or else smart defenders will anticipate the pass, steal it, and go the other way for an easy fast break layup. Be an aggressive offensive player!
- Keep Your Dribble
If you started dribbling, do not pick up your dribble until you know who you are passing the basketball to. One of the worst things you can do against a pressing, trapping defense is pick up your dribble because now the defenders can trap you without worry about you dribbling away from them. If you find yourself dribbling into a trap situation, keep your dribble, pull back away from the trap, and either dribble around it or find an open teammate. Stopping your dribble and holding the basketball will only cause negative things — such as a turnover!
No, this isn’t a course in geometry! Well, maybe it is! Basically, if you have the basketball, a teammate on your right and a teammate on your left, you have a triangle (I don’t mean the three of you side-by-side, I am talking about having a teammate about 10-15 feet away). If you have a teammate on each side of you, as well as a teammate looking to flash middle (see next tip), you will have an open player to pass to against a trapping defense. For example, if 2 defenders are trapping you, that leaves 3 defenders to guard your 4 other teammates. With a teammate on each side and one flashing middle, someone should be able to get open. If not, you still have the option to throw a skip pass to your 4th teammate. Triangles — obtuse, acute, whatever — learn to love them!
- Flash Middle
Always have a teammate flash to the middle of the court. Whether against a full court press or half court trap, get a player to the middle of the basketball court. If you can get the basketball to the middle, that player can now look to attack the basket with a possible player advantage (remember the attack tip above). It is also much more difficult to trap in the middle as there are no out of bounds lines nearby. Also, most defensive teams will not even attempt to trap here. Different offenses may look to do different things once the basketball is in the middle, but the objective is always the same — the defense can more easily be attacked from the middle.
- Lover’s Lane
I’m going to borrow a term from the late Dick DeVenzio for this last tip. I won’t get into why he called it Lover’s Lane, but the point is to get the basketball to the lane. This goes along with the ‘Attack’ tip above — don’t be content with getting the ball across the halfcourt line or with playing catch. Attack the defense by getting to the paint. Good things happen when, as an offense, you get the basketball in the lane. The defense is at a disadvantage and is susceptible to shot fakes, jump stops, dump-down passes — basically the defenders will not know what you are going to do! Get to the lane and look to score!
I hope that these tips and techniques will help you achieve great success at beating pressure defenses. Don’t let these types of defenses pressure you into mistakes. Don’t be intimidated and fearful. Attack the pressure with the objective of scoring. Be patient, be smart, and be confident. Turn the tables and make your offensive ability pressure the defense into mistakes!
| 59,745
|
It’s a discovery deficit: Sydney University 19 November 2010
It’s not filter failure, it’s a discovery deficit.
The gatekeeper is dead. Long live the gatekeeper!
An important traditional role of the scholarly literature has been a filter, selecting those submissions to the permanent scholarly record that are worthy of the cost of printing and distribution, and worthy of the attention of researchers checking the latest issues in the library. At its centre lies the editor, academic or professional, who makes a choice about how limited resources will be allocated. This made sense when the bottleneck was printing and distributing. In a web-based world where the cost of making something available is low, it makes sense to publish everything, just in case, but how we will manage the information overload?
I will argue that this only seems a paradox from the print media world: that in fact publishing more makes filtering and discovery easier. Tools and approaches are available to enable improved automated filtering and discovery, for example by social filtering and hugely improved web search. It places control in the hands of the user. The role of the publisher changes from that of gatekeeper to one of facilitating discovery. To support this, publishers and researchers will need to consider how to provide access to much more of the raw material of the research process and critically how to enable the effective and efficient annotation and markup that will support new discovery platforms.
| 163,641
|
Protect 9 different motherboards from waves of viruses attacking your main processor. Don't let the virus crash your computer! Place different attack towers on the motherboard to kill the viruses. Place firewalls in their path. Use the radar to improve towers fire range. All towers need energy to work. Place your energy towers strategically to maximize your available energy. Click on a tower to select it. Move your mouse over the motherboard and find an available place. Click to place the tower. Send the next wave before the timer ends to gain bonus points. Cool fun awaits when you play Computer Defense!
| 283,712
|
Hume was exceptionally fitted for the work of exploration at this particular juncture in colonial history. Born and reared in the land, he was well competent to judge justly of its merits and demerits; his opinion was not likely to be tainted by the prejudices formed and nourished in other and different climes. The history of Australian exploration was then a statement of hasty conclusions, formed perhaps under certain climatic circumstances to be falsified on a subsequent visit when the conditions were radically different. In Hume’s case, there was no ill-founded conclusion of the availability of the freshly-discovered district. The journey just recorded at once added to the British Colonial Empire millions of acres of arable land watered by never-failing rivers, with a climate and altitude calculated to foster the growth of almost every species of temperate fruit or grain.
It is to be regretted that the narration of an expedition fraught with so much benefit to the young colony, and executed with so much courage, endurance, and facility of resource should be marred by any discordant note. But friendly and genial relations were endangered by the presence of two independent leaders. Divided authority here, as it nearly always does, caused petty and undignified squabbles, which were in later days elaborated into unseemly paper conflict. It is painful if somewhat amusing to read of the acrid disputes as to the course, under the very shadow of the majestic Australian Alps whose solitude had only then been first disturbed by white men; and how, on agreeing to separate and divide the outfit, it was proposed to cut the only tent in two, and how the one frying-pan was broken by both men pulling at it. Thomas Boyd, who was the only survivor of the party in 1883, and was then eighty-six years old, signed a document assigning to Hume the full credit of conducting the expedition to safety. Boyd was one of the most active members of the expedition, always to the front when there was any trying work to be done. He was the first white man to cross the Hume River, swimming over with the end of a line in his teeth.
After Hume’s return he lived for some time quietly on his farm, until the call of the wild drew him forth from his retirement to join Sturt in his first battle with the wilderness. His temporary association with that explorer will find its due place in the account of that expedition.* He died at Yass, near the scene of one of his early exploits.
[Footnote.] See Charles Sturt. 6.2. The Darling.
CHAPTER 5. ALLAN CUNNINGHAM.
[Illustration. Allan Cunningham.]
5.1. Coastal expeditions.
| 105,099
|
One of the biggest photo libraries in the world is hoping the work of amateur photographers can reinvigorate its collection and help to create an edgier persona.
Getty Images, the world’s largest distributor of still imagery, has teamed up with Flickr, the photo-sharing website, to allow keen photographers around the world the chance to make some money out of their regular, everyday snaps. Over the past 12 months, Getty has had 30 art directors scouring Flickr’s archive of three billion images to find the ones that will “sell” and have commercial appeal.
So far, the team has identified 100,000 images it would like to add to the “Getty Flickr” collection, which can be accessed by consumers and customers alike via www.gettyimages.com/flickr. There is also a supportive Facebook application called “PictureMe”. This allows Facebook users to attach photos from the collection to their status updates to help them visually express their mood.
The collection contains only 20,000 images at the moment, as the team is still waiting to hear back from the photographers responsible for the other 80,000 cherry-picked photos, or for rights clearance. Flickr users can “opt in” to have their photos considered by the Getty art directors by clicking on a designated tab once logged into their accounts.
The rest is up to Getty, which will then email the Flickr users who have a minimum of five photos which interest them. If they consent, a contract follows and the photographer has to set about ensuring each that any photo that includes a person or piece of property has the appropriate permission from all concerned parties. Once all the formal processes are completed, Getty can go about selling the images.
One person who received such an email is Anna Creedon, a digital collections developer at the London Transport Museum by day, and an avid amateur photographer in her spare time.
“I only joined Flickr last October, after doing an Open University photography course. Someone on the course set up a supportive Flickr group and I progressed from there,” she explains.
“I opted in to be seen by Getty and one day I received an email from them asking me to upload seven of my images ... one of which [a close-up abstract shot of an iris] has now been bought for use in a brochure. It’s given me a new zest for taking photos.”
Creedon specialises in macro photography, which means taking extreme close-up shots and she usually only uses a compact hand-held camera. Her choice subjects are flowers and nature.
However, there is no pattern as to what the Getty team are looking for.Often the chosen photos are very regular daily scenes: a baby playing in a swimming pool or a someone smoking a cigarette. But it’s more the spirit and the way these imagesare taken that attracts Getty.
However, not every Flickr user views the “Getty email” as a prime opportunity to gain market exposure. There is a big debate going on across the photo-sharing site about whether Getty’s plan is compromising people’s artistic integrity and just another example of a big market player abusing user-generated content for mass gain.
The man in charge of bringing Flickr content to Getty customers is Andy Saunders, Getty’s vice-president of creative stills and footage. His job is to try to introduce new content to the Goliath collection and keep it fresh. He recognises that commercialising a personal photograph collection isn’t for everyone and admits some people have refused Getty’s offer.
“I understand that when you reach out to a community whose original intention was not to sell content, but simply to share images and experiences, there will be some negative feedback, but that’s up to the individuals. They can opt in or opt out.”
Getty Images decided to sign the five-year exclusive deal with Flickr expressly because it wanted photos that hadn’t been taken with a commercial purpose in mind.
“It is because the Flickr images haven’t been taken with a view to being sold, that a lot of passion and emotion comes through in the shots.They can be more original than traditional photography and offer that emotional connection which our customers really value,” Saunders explains.
Users take, typically, a 20-30 per cent cut on any images that are sold; how much a user can hope to make varies, Saunders says, from as low as $10 a shot to as much as $100,000. So you won’t know what publication or campaign your pictures of your grandmother snoring or your baby swimming could end up being part of, but you do become elevated to the same status as a professional photographer just by clicking a tab. And you get paid, too.
Five tips to get your pictures noticed
- Keep your approach original and fresh.
- Think about whether you will be able to contact any people in your photo again in case you need to obtain their permission. Possibly take down their contact details at the time, just in case.
- Regionality is always attractive – especially in areas such as the Far East, where the economy is booming. Photos of your travels which show off an area’s culture are very useful to us – this is something which we hope to build upon in the future.
- Humour always sells and is something to bear in mind.
- Don’t get into stale patterns. Keep snapping only what matters to you and not what you might think will sell.
| 157,733
|
The Fay Observer reports that a new poll released by the North Carolina Alliance for Health shows Tar Heels appear to overwhelmingly support a $1 per pack tax increase on cigarettes to help close the state’s budget deficit. According to a news release from the Alliance:
“While 62 percent support increasing the tobacco tax as a budget balancing measure, support jumps to 66 percent when some of the revenue is used to fund public health measures. Strong majorities opposed other options such as reducing funding for education, Medicaid health services, closing state prisons or increasing other taxes.”
The Alliance also said the tax hike would generate $338.4 million in new revenue.
While these numbers may sound impressive, they overlook some relevant facts. First, cigarette taxes are notoriously unreliable sources of revenue. The projection that North Carolina will see a windfall of more than $300 million does not account for the losses of revenue that will surely result from higher taxes as smokers seek out cheaper alternatives from other lower-tax jurisdictions or smugglers. Second, there is no guarantee that the revenue raised will go to health care or any specific program. In many cases, state officials frequently divert tobacco tax revenues for uses other than their intended purpose. Third, history suggests that tobacco tax hikes are prelude to other tax increases. If the pollster had mentioned these facts, I’m fairly certain the poll would produce a different result.
In my view, one poll is not a good indicator of the overall mood among the public. A poll is a snapshot of public opinion at the time. A much better indicator is election results. Last November, North Carolina voters choose Republican majorities in both houses of the State Legislature for the first time since Reconstruction. Most importantly, those majorities campaigned on a platform to forego from or reduce higher taxes. This stunning result would appear to suggest that Tar Heels are not keen on tax hikes.
| 247,964
|
Find out about the latest happenings on the Allotment Sites.
Garden Share in Andover
Date: 1st February, 2013
Andover Garden Share is an alternative choice for people looking for an allotment to grow fruit and vegetables near where they live. Applicants are matched with suitable offers of private garden spaces. A plot can be anywhere around Andover, giving a choice of locations and types of gardens. Some plots are quite small so easier to maintain and could suit a working person with limited time. It is called garden share because the crop is shared in return for the use of the ground, and is a concept that came from the Transition Town groups and is based on the grower and the person owning the garden forming a working partnership.Find out more
| 238,120
|
We started out more unconventional and have slowly gravitated to conventional as my kids have gotten older. My dd is too old for the hands on, craft-based curriculums and just wants the structure that conventional education offers. We still do a lot of visual stuff for ds, but most of it is just plain old textbooks.
We are fairly traditional. We use workbooks/textbooks for most things. I am going to do Geography this year for my 1st grader and my 10th grader. We are going to do parts of it together (to save time) and then they will have separate assignments as well that is on their grade level.
I don't really know what we are yet as this will be our first year. I do have a good amout of textbooks/workbooks but I have read enough to know this might not cut it for us and we might have to change it up. I hope to do a bunch of field trips to reinforce lessons. So I guess my PLAN for the year is pretty traditional. We will see how it works out.
We use a very structured boxed curriculum. My girls are thriving with it an excelling at a rate faster than their peers. We are going to start our next year in January, but I don't want them to lose a lot in the 5-6 mos that they will have "off", so we are going a little unconventional and going to learn things that I think they will have fun with....like the solar system and then get to build one.
I used K12 for 8 years now going to go off grid this fall
WE are very traditional in our approach. I am going to try some "non-traditional" methods through the fall...until Thanksgiving. I hope this may bring my kids and I closer to each other.
| 113,439
|
Arts Take Lead for Bridge Collapse Anniversary
MINNEAPOLIS (AP) – The Minnesota arts community is mounting several works to mark the upcoming fifth anniversary of the Minneapolis bridge collapse.
Their work will be on display in an exhibition called “Bridge” to be unveiled at the Mill City Museum on Aug. 1. It features photographs and interviews of survivors, first responders and others by artist Vance Gellert. He spent two years on the project.
Gellert’s interviews were used by other artists, who created a 10-minute play, a musical composition and five poems.
Mayor R.T. Rybak will be among public officials speaking at the unveiling.
Thirteen people died and more than 100 were injured when the I-35W bridge failed.
(Copyright 2012 by The Associated Press. All Rights Reserved.)
| 33,348
|
Wow! I didn't realize just how much power some cars use with fan blowers (especially on "high" setting). I wonder how common those fan motor numbers are with other cars? And if many fan motors have numbers that bad (which IMHO would just be pathetic, given how common energy efficient DC motors are these days), I wonder how hard it would be to swap in a much more energy efficient DC motor for the fan?
Originally Posted by Randy
This was alternator current times voltage, so it should be related to engine load.
Hmmm... If power usage is noticeably higher when the alternator is on, that would be the one argument I could see for having a circuit/switch to cycle between alternator on and off.
Because if (and only if) the charging power losses are less than the losses due to the higher alternator voltage, you would actually be gaining a little (overall) by completely "cutting out the alternator" until your battery is partially discharged, and only then turning on the alternator just long enough to charge up the battery (then repeating the cycle). Heck, you could probably tie this to a battery charge detection circuit, so it happens automatically. And naturally, this would probably work better with a quality "deep cycle" battery, than with a normal car battery...
Of course, the mod that someone else mentioned, where they didn't even use an alternator, is the extreme example of this idea (since 0% alternator load, which is what a disconnected alternator gives you, is the theoretical "upper bound" of what lowering the car's electrical usage, but leaving the alternator connected, could buy us in increased FE).
And, we could also possibly gain something (even if the alternator remains connected), by hooking up solar cells (carefully placed in the car, so that sunlight can reach them through the windows) to the electrical system (to both "charge" things slowly when the car is off, and also to slightly lower the load on the alternator). Of course, finding a useful place to mount the solar cells might be a problem, and the cells do add a little weight (which can work against you)...
Originally Posted by Randy
For me the biggest load change other than voltage would be running lights. I often use lights even when I don't need them so my car is more obvious. I think a switchable daytime running light system would help.
In my CRX, it looks like the "running lights" is what you get if/when I click the first switch position on my headlight switch (instead of the normal situation of switching to the 2nd position, to fully engage the headlights/taillights/etc). Even if your car isn't wired up this way, I bet it would be pretty simple to tap into that light switch position, and wire it up as just whatever you want for daytime "running lights". That would give you an easy/clean way to turn on your "running lights" without even putting an extra switch into the car.
A while ago, I was looking for power usage of various car bulbs (so as to get an idea as to how much power could be saved from going to LEDs). It was actually harder than I would have thought to get this info on stock car bulbs. So FWIW here are some of the links I found in my search:
1) Apparently, many pinball machines use standard car bulbs. With that in mind, this pinball resource actually has a lot of useful power info on it: http://www.flippers.com/lights.html
3) Here's a PDF file, made by a magazine/company dealing with renewable energy for homes. As it turns out, some solar/wind home power systems use car bulbs for lighting. With that in mind, this PDF has some useful info: http://www.homepower.com/files/hp1-31.pdf
NOTE: While the largest gain per bulb are gotten by swapping out the highest power/light bulbs (such as the break/tail lights), the highest percentage gain is gotten by swapping out the smallest bulbs for LEDs. This is because the efficiency (lumens per watt) really tanks in very small incandescent bulbs, whereas LEDs don't have that problem. So swapping several small incandescent for LEDs, can easily gain you more power than just swapping a few larger bulbs..
| 47,028
|
|Institutional Source||Beutler Lab|
|Gene Name||killer cell lectin-like receptor subfamily G, member 1|
|Is this an essential gene?||Non essential (E-score: 0.000)|
|Stock #||R5029 (G1)|
|Chromosomal Location||122270596-122282882 bp(-) (GRCm38)|
|Type of Mutation||missense|
|DNA Base Change (assembly)||A to G at 122282735 bp|
|Amino Acid Change||Leucine to Proline at position 26 (L26P)|
|Ref Sequence||ENSEMBL: ENSMUSP00000032207 (fasta)|
|Gene Model||predicted gene model for transcript(s): [ENSMUST00000032207]|
|Predicted Effect||probably benign
AA Change: L26P
PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
AA Change: L26P
|Meta Mutation Damage Score||0.0898|
|Coding Region Coverage||
|Validation Efficiency||97% (61/63)|
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele have no abnormal phenoptype. [provided by MGI curators]
|Allele List at MGI|
|Other mutations in this stock||
|Other mutations in Klrg1||
(F):5'- TGGGCATGAGTTGGGATCAC -3'
(R):5'- TACTTGCACTACTTTACAGGATGGG -3'
(F):5'- ATCACAGAAGTGGGTGCCC -3'
(R):5'- CACTACTTTACAGGATGGGTTGTTCC -3'
| 142,315
|
Come December and one can see the city of Chennai come musically alive. All the various “Sabhas” and their timetable of “Kutcheris” are topics of discussion among a group of people who call themselves ‘rasikas” or music lovers. National dailies like “The Hindu” give these events a lot of prominence especially in their Friday review section. If you go past some of the auditoriums where these performances are held you can see ladies in brightly colored Kanjeevaram sarees with diamonds glinting on their ears and noses. The men can be seen wearing long kurtas ( called Jibbas) over freshly laundered “veshtis”. I am told that there are NRIs who come every year from their home aborad just so they can attend these concerts.
But wait, this is not a post about this wonderful “culture” that defines Chennai during this month of Margazhi! For starters, I have never been a fan of Carnatic music! May be it has something to do with having been forced to learn it during my younger days. I was often told by my mother that I had absolutely no ear for the “finer sounds” given my love for Hindi film music. It was towards my late teens that I realized that I was not incapable of appreciating classical music! That was the time that I discovered Hindustani Classical music!
As I heard more of Hindustani Classical music I learnt about the artistes who performed and one of the first things that struck me about this form of music was the way , music and melody helped transcend religious and communal boundaries. If there was a Bismillah Khan playing the Shehnai or Ustad Amjad Ali Khan playing the Sarod, there was also a Gangubai Hangal or a Pandit Bhimsen Joshi singing or a Pandit Ravi Shankar playing the sitar . And what I found most unique about this form of music was that people associated themselves with styles of music or “gharanas” which roughly translated can also mean “lineages” in musical styles. Hindus, Muslims, Maharashtrians, Bengalis, Punjabis – they were all artistes united by the identity of belonging to the same “lineage” or genre of music. They were almost like members of a family and treated one another so. But more than anything, what really moved me was the way that music served as the inclusive force. This diversity did not limit itself to the performers but extended to the audience or the listeners who were as diverse.
However when I look at the Carnatic music scene today (or for that matter that of yesterday's) one of the first things that strikes me is the fact that its appreciation and access is limited to people of a certain community. Yes, there are a few exceptions ( like Sheikh Chinna Maulana) but overall it is dominated by people from a particular religion and caste. This obviously extends to the “rasikas” too. You only have to overhear conversation at the food stalls in some of the Sabhas to know who they are. Interestingly this exclusivity is seen much less in the dance scene of the south – Bharatanatyam, Kuchipudi and Mohiniattam do have a diversity of performers. In fact I have also seen a Catholic priest perform a wonderful Bharatanatyam recital. Unfortunately ,I am yet to see a Catholic priest sing a Carnatic vocal. Yesudas, the only Christian Carnatic musician that I know of, I understand is facing some excommunication issues within the folds of his church
I have sometimes wondered why the Carnatic tradition is so insular while the Hindustani tradition is more open and inclusive? One of the reasons I guess is that the later has had the benefit of taking in influences from different genres of music – Indian and West Asian as both the Moghul rulers and the Rajputs popularized it. The Bhakti saints Meera, Surdas, Tulsidas and Kabir introduced a folk angle to it and brought it even closer to the people as they used local dialects like Brij, Awadhi etc in their compositions. While Carnatic composers like Andal, Thyagaraya and Ramadas did compose songs in Tamil and Telugu I am not sure it was the dialect of the weaver, the potter or the fisherman that they used!Another interesting point of difference between these two traditions that comes to my mind is the largely “Bhakti Ras” content of the Carnatic style. The Hindustani style includes within it a number of “Shringar Ras” compositions. The emotions of Shringar –love, separation, longing are universal! They can be expressed by a person of any religion openly while the Carnatic compositions were in Sanskrit or high flown Tamil, Telugu, Kannada in praise of a God - Rama or Krishna etc. Is it a surprise then that the Church should feel threatened when Yesudas sings “ Hariharatamajam…” in praise of Lord Ayappa?
There is a certain close mindedness to fusion that I see in the Carnatic style. While Carnatic musicians have adapted western musical instruments like the violin and the mandolin to their style very effectively, one does not really see them infuse the western style into their rendition. The closest that one can imagine “fusion” in this context is a “jugalbandhi” between the Hindustani and Carnatic musicians. I am yet to see something like the musical fusion that George Harrison and Pandit Ravi Shankar brought forth! Why, even the so called musical “Aradhana festival” held in “Thiruviyaru” is largely composed of Carnatic musicians – if this is not exclusion even within the world of musical performers then what is it?One does not have to do a detailed social profiling of the Carnatic musicians to prove exclusion. Carnatic music teachers like Dronacharya are reluctant to accept a student who may not be from a certain social category! Madurai Shanmugavadivu Subbalakshmi (popularly known as MS )who was from a Devadasi family was probably “accepted” and “acknowledged” into this group more because of her marriage to a person of this exclusive community rather than the community where her singing skills were honed. Over the years she was appropriated into the identity of the community that she was married into.
The musical and dance forms of art in the south were originally practiced by the Devadasi community. A Devadasi was a woman “dedicated” to the God of the temple she was attached to. She could not marry and had to live her life through her art under the “protection” of the local big wig, often becoming the mother of his illegitimate children. It is ironic that this art which was practiced by a group of women, who were considered to be part of a socially “excluded” community is today incorporated into the heritage of a socially “exclusive” community!!This brings us to the question of what constitutes music? There is an untapped subaltern culture in the southern states each with their own musical style. The folk singers who sing the villupattu ,the drummers engaged in “tappattam” or even the women who sing a song as they transplant paddy are in no way inferior to Sudha Raghunathan or Lalgudi Jayaraman! Unfortunately, no one acknowledges their art as music because of who they are (or may be because of who they are not!).
I would like to sign off on the note that cordoning off cultures in order to create a status of exclusivity is an insult to something as divine as music! We are already guilty of having done it with God in our temples, let us now not extend it to music!
| 19,837
|
The Texas state legislature is busy early on in the year. Unfortunately, not every bill is beneficial to people who live in the state. Right now, there are a pair of bills that are working their way through the local legislature that could end up costing people a significant amount of money. In particular, this could cause health insurance and car insurance rates to go up. Specifically, these bills are titled House Bill 19 and Senate Bill 207. If these bills go through, trucking companies may not be held liable in court following crashes. This means that if one of their drivers had a serious accident, the trucking company may not be responsible. As a result, people who are injured in the accident could be on their own.
If this legislation goes through, it is possible that local citizens will have to step up and pay big trucking companies that cause serious accidents. In particular, it is important for people to understand that a lot of the trucking companies that are currently held responsible for accidents located in Texas are not actually headquartered in the state. They are multibillion-dollar companies that are located somewhere else. If these companies are no longer held responsible, local citizens could be asked to fend for themselves.
Even though a lot of accidents that take place do not lead to injuries, accidents that appear small that involve a truck could lead to major medical bills. Furthermore, if people incur major medical expenses, health insurance rates could go up as well. As a result, even people who are not injured in motor vehicle accidents could end up feeling the sting of this legislation.
Right now, these bills have not been passed into law; however, these bills are still working their way through the legislative process. It is important for everyone to keep up with what is going on in their local government. A lot of the bills that passed through their local governments could have a significant impact on their everyday life. It is important for people to get in touch with a personal injury lawyer if they have been involved in a serious motor vehicle accident. That way, they can ensure their rights are defended.
| 258,046
|
I;ve been looking at the Garvins and Campbells in Greenbrier and Monroe County, WV. John Campbell is supposed to have married a Jane Garvin about 1784, but I don't know where. Her father may have been John. There was a John in Cumberland County, Pa who died in 1785 and had a son named John. One of the executors of the estate was John Davison, and later John Garvin of Greenbrier County acknowledged a debt of 284 pounds Pennsylvania currency dating from May 1785. John Garvin was sentenced in 1791 to debtor's gaol until the debt was paid, but he apparently wasn't there long because he, or someone of the same name, was shown on jury lists of the same time period.
Is this John Garvin in Greenbrier County the son of John who died in Cumberland County in 1785? The younger John lived near a Thomas Garvin, and Thomas was also a son of John in Cumberland County, so it seems at least possible.
Can anyone tell me whether the Jane who married John Campbell was a daughter of either John or Thomas?
Also, was there a blood relationship between the Garvins and John Davison?
Thanks to anyone who can help with this one.
Janice in Indiana
| 256,789
|
AIAS Vice President
In the spring of 2008, Lewis and Clark Community College welcomed a new student club organization. The American Institute of Architecture Students. With only seven starting members, and a lot of perseverance, the AIAS organization has become a group that the members can be proud of. Although most of the original members have since graduated and gone on to four year universities, the group itself has grown. Fall of 2009 saw the group gain national recognition with the main organization based in Washington D.C. With that came a large sense of pride for the members who were involved in making the group large enough to attain that milestone. At that time there were almost 30 members in the group.
After becoming nationally recognized in Washington, the group tried to start a chapter of Freedom by Design. This program is designed to help the local community by allowing students to help people with disabilities gain freedom and mobility in their own homes. The College and Group decided that the AIAS chapter at Lewis and Clark was too small for the program and so the Freedom by Design chapter was not started. After that the group had been looking into other ways of giving back to the community and that is when the group approached Valorie (Val) Harris.
Val, let AIAS know at that time, Lewis and Clark was going to be joining up with Habitat for Humanity to help design and build a home for a disadvantaged family in the local area at some point in the future. Almost eight months later, Val informed AIAS that the College and Habitat for humanity were going to be starting a project, possibly as early as this summer in the Alton area.
Lewis and Clark, Habitat for Humanity, and the AIAS are going to be heavily involved in this project. The AIAS will not be involved in the selection process, but will be involved with the designing and, quite possibly, the building of the home. At this time the screening process has not begun and the actual start date is unknown, but in the near future another family will be getting to move forward on their journey towards the American dream; a house they can call their own.
The Lewis and Clark Community College chapter of the American Institute of Architectural Students, currently consists of students enrolled in the Architecture program, but is open to anyone who has an interest in sketching or has an interest/appreciation of architecture. There are monetary dues of $50 a year to join the group and your membership is valid from September to august of the following year. Included with the dues is a subscription to CRIT, a monthly newsletter from the AIAS main organization and many different discounts. All membership benefits can be seen on the AIAS main web page at www.aias.org.
Anyone that is interested in joining the AIAS, or has any questions about the organizations activities with Habitat for Humanity ,or what is going on with the Habitat for Humanity project, can contact Randy Meyer at firstname.lastname@example.org
| 29,271
|
A New Android Communications Library: JDroidLib Java
Over a year ago, we talked about AndroidLib, the .NET assembly library written in C# that easily handles communication between a connected Android device and your program. It’s a great and innovative project, but it is unfortunately limited to Windows systems, as .NET works only with C#, F#, Visual C++, Visual Basic, Visual C++, and Visual C++, rather than the cross-platform Java.
Inspired by the AndroidLib idea, XDA Senior Member Beatsleigher started a project to rewrite the project in Java. The idea is simple. This project can now be used with Unix-like systems such as Linux or MacOS. So far, this projects allows users to easily install ADB on every supported platform. The same thing can be done with fastboot. It can ease the efforts for some less tech-savvy users, as installing ADB and fastboot manually isn’t exactly the easiest task. The developer plans to add tons of handy features, and we wish him good luck with the project.
The binary is not distributed, but it can be compiled from source. More information regarding project can be found in the original thread, so make your way there and give it a try.
| 91,552
|
Northwest Voices | Letters to the Editor
Coal export terminal plans raise protests
Prevent local problems with global consequences
On Dec. 13, a public hearing was held to address a proposal for the export of coal from the Powder River Basin to China through the Pacific Northwest [“Protests precede hearing on coal export terminal,” news, Dec. 13]. Over 48 million tons of coal would be shipped out of Washington state annually. The economic and environmental costs of the project far outweigh any benefits of the project.
The transport of that immense amount of coal will create problems with traffic and noise, putting a strain on businesses located nearby. At full operation, the cities of the Puget Sound would experience nine 1.5-mile long coal trains passing through their downtown areas every day. Washington inhabitants will have to pay for infrastructure repair, deal with the loss of natural habitats and learn how to breathe coal dust in downtown areas.
It is by now fairly common knowledge that coal is one of the dirtiest forms of energy we use. Coal puts twice the amount of carbon into the atmosphere as natural gas. After a year of uncontrollable wildfires, massive droughts, and devastating hurricanes, it is time to act against the coal export proposal to prevent local problems with global consequences.
—Alexandra Perkins, Seattle
| 220,745
|
Ecstasy could treat blood cancers: researchers
LONDON — Researchers in Britain revealed Friday they are exploring whether the nightclubbers’ drug ecstasy could be effective in treating blood cancers.
Scientists at the University of Birmingham in central England said modified forms of the drug boosted its ability to destroy cancerous cells by 100 times.
Six years ago, researchers found that cancers affecting white blood cells appeared to respond to certain “psychotropic” drugs.
These included weight loss pills, Prozac-type antidepressants, and amphetamine derivatives such as methylenedioxymethamphetamine (MDMA) — commonly known as ecstasy.
The Birmingham scientists said their discoveries since then could lead to MDMA derivatives being used in patient trials.
The derivatives could be effective in treating blood cancers such as leukaemia, lymphoma and myeloma.
“This is an exciting next step towards using a modified form of MDMA to help people suffering from blood cancer,” said Professor John Gordon, from the university’s School of Immunology and Infection.
“While we would not wish to give people false hope, the results of this research hold the potential for improvements in treatments in years to come.”
The team found that the dose of MDMA required to treat a tumor would prove fatal, so they set about isolating the drug’s cancer-killing properties.
They are now looking at ways to get MDMA molecules to penetrate cancer cell walls more easily.
Doctor David Grant, scientific director of the Leukaemia and Lymphoma Research charity, which part-funded the study, said: “The prospect of being able to target blood cancer with a drug derived from ecstasy is a genuinely exciting proposition.
“Many types of lymphoma remain hard to treat and non-toxic drugs which are both effective and have few side effects are desperately needed.”
The findings are published in the bi-monthly journal Investigational New Drugs.
| 215,204
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.