text_prompt
stringlengths
168
30.3k
code_prompt
stringlengths
67
124k
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: matched_meth is our matched methylation data. Step2: Read in matched Gene and miRNA expression data. Step3: Run a simple screen for DX genes Step4: Not only is ADH1B the most downregulated gene, but many of the other genes in the ADH familly have large effects as well. I go into this with a bit more depth in the alcohol_metabolism Notebook. Step5: MicroRNA Screen Step6: Methylation Screen Step7: Plot disributions of fraction upregulated statistic
<ASSISTANT_TASK:> Python Code: import NotebookImport from Imports import * matched_meth = pd.read_hdf(METH_STORE, 'matched_tn') matched_meth = matched_meth.groupby(axis=1, level=[0,1]).first() matched_meth.T.head(10).T.head() matched_meth.shape[1] / 2 matched_rna = matched_tn matched_mir = pd.read_hdf(MIRNA_STORE, 'matched_tn') dx_rna = binomial_test_screen(matched_rna, fc=1.) dx_rna = dx_rna[dx_rna.num_dx > 300] dx_rna.sort('p').head(10) dx_rna.ix['FOXM1'] #Do not import fig, ax = subplots(figsize=(7.75,2.5)) paired_bp_tn_split(matched_rna.ix['ADH1B'], codes, data_type='mRNA', ax=ax) fig.tight_layout() dx_rna.ix[['ADH1A','ADH1B','ADH1C']] dx_rna.p.rank().ix[['ADH1A','ADH1B','ADH1C']] dx_mir = binomial_test_screen(matched_mir, fc=1.) dx_mir = dx_mir[dx_mir.num_dx > 300] dx_mir.sort('p').head() #Do not import fig, ax = subplots(figsize=(6.5,2.5)) paired_bp_tn_split(matched_mir.ix['hsa-mir-21'], codes, data_type='', ax=ax) fig.tight_layout() #Do not import paired_bp_tn_split(matched_mir.ix['hsa-mir-139'], codes, data_type='') dx_meth = binomial_test_screen(matched_meth, fc=1.) dx_meth = dx_meth[dx_meth.num_dx > 300] dx_meth.sort('p').head() #Do not import paired_bp_tn_split(matched_meth.ix['cg10216717'], codes, data_type='Beta') def fig_1e(ax): draw_dist(dx_meth.frac, ax=ax, lw=2.5) draw_dist(dx_rna.frac, ax=ax, lw=2.5, bins=200) draw_dist(dx_mir.frac, ax=ax, lw=2.5, bins=100) ax.set_yticks([]) ax.set_xticks([0,.5,1]) ax.set_ylabel('Density') ax.set_xlabel('Fraction') ax.legend(('Methylation','mRNA','miRNA'), frameon=False) prettify_ax(ax) return ax #Do not import fig, ax = subplots(1,1, figsize=(5,3)) fig_1e(ax); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Describe the results. Step2: But we digress. Back to random numbers...
<ASSISTANT_TASK:> Python Code: import time time.time() ## gets the time, still not very human readable time.localtime() ## formats the time nicely time.asctime(time.localtime()) ## series of random numbers doesn't repeat <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Enter name of directory that contains your data in the cell below, or... Step2: Type any comments about this dataset here Step3: Image Summary Step4: You can reconfigure the image browser if you want (or not) Step5: Make a master bias image Step6: Combine bias images to make master bias Step7: Make a master dark Step8: Combine reduced darks to make master(s) Step9: Make master flats Step10: Build masters by combining Step11: Reduce the science images Step12: Wonder what the reduced images look like? Make another image browser...
<ASSISTANT_TASK:> Python Code: from __future__ import division %matplotlib inline import numpy as np import reducer.gui import reducer.astro_gui as astro_gui from reducer.image_browser import ImageBrowser import msumastro from reducer import __version__ print __version__ # To use the sample data set: data_dir = reducer.notebook_dir.get_data_path() # Or, uncomment line below and modify as needed # data_dir = 'path/to/your/data' destination_dir = '.' images = msumastro.ImageFileCollection(location=data_dir, keywords='*') tt = msumastro.TableTree(images.summary_info, ['imagetyp', 'exposure'], 'file') fits_browser = ImageBrowser(tt, demo=False, directory=data_dir) fits_browser.display() fits_browser.padding = '10px' tt2 = msumastro.TableTree(images.summary_info, ['filter', 'imagetyp', 'exposure'], 'file') im_a_tree_too = ImageBrowser(tt2, demo=False, directory=data_dir) im_a_tree_too.display() bias_reduction = astro_gui.Reduction(description='Reduce bias frames', toggle_type='button', allow_bias=False, allow_dark=False, allow_flat=False, input_image_collection=images, apply_to={'imagetyp': 'bias'}, destination=destination_dir) bias_reduction.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') bias_settings = astro_gui.Combiner(description="Master Bias Settings", toggle_type='button', file_name_base='master_bias', image_source=reduced_collection, apply_to={'imagetyp': 'bias'}, destination=destination_dir) bias_settings.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') dark_reduction = astro_gui.Reduction(description='Reduce dark frames', toggle_type='button', allow_bias=True, master_source=reduced_collection, allow_dark=False, allow_flat=False, input_image_collection=images, destination=destination_dir, apply_to={'imagetyp': 'dark'}) dark_reduction.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') dark = astro_gui.Combiner(description="Make Master Dark", toggle_type='button', file_name_base='master_dark', group_by='exposure', image_source=reduced_collection, apply_to={'imagetyp': 'dark'}, destination=destination_dir) dark.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') flat_reduction = astro_gui.Reduction(description='Reduce flat frames', toggle_type='button', allow_bias=True, master_source=reduced_collection, allow_dark=True, allow_flat=False, input_image_collection=images, destination=destination_dir, apply_to={'imagetyp': 'flat'}) flat_reduction.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') flat = astro_gui.Combiner(description="Make Master Flat", toggle_type='button', file_name_base='master_flat', group_by='exposure, filter', image_source=reduced_collection, apply_to={'imagetyp': 'flat'}, destination=destination_dir) flat.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') light_reduction = astro_gui.Reduction(description='Reduce light frames', toggle_type='button', allow_bias=True, master_source=reduced_collection, allow_dark=True, allow_flat=True, input_image_collection=images, destination=destination_dir, apply_to={'imagetyp': 'light'}) light_reduction.display() reduced_collection = msumastro.ImageFileCollection(location=destination_dir, keywords='*') tt3 = msumastro.TableTree(reduced_collection.summary_info, ['imagetyp', 'exposure'], 'file') fits_browser = ImageBrowser(tt3, demo=False, directory=reduced_collection.location) fits_browser.display() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 0D shapes Step2: 1D shapes Step3: 2D shapes, Polygons and Buffers Step4: We can also create 2D objects by adding buffers to existing 0D and 1D objects Step5: Operations
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt %matplotlib inline import shapely.geometry import shapely.ops import cartopy import cartopy.io.shapereader as shpreader point = shapely.geometry.Point(0.2, 1.0) # Notice, the ipython '__repr__' (representation) displays the point as the output point # See some of the point attributes print(point.geom_type) print(point.area) print(point.length) print(point.bounds) print(point.coords) # explore this object... print(point.coords[:]) # A collection of random points... point1 = shapely.geometry.Point(0.2, 1.0) point2 = shapely.geometry.Point(0.1, 0.2) point3 = shapely.geometry.Point(0.5, 0.0) point4 = shapely.geometry.Point(0.8, 0.5) # We can see the distance of the points from one another point2.distance(point1) # An ordered sequence of points is a `LineString' line = shapely.geometry.LineString((point1, point2, point3, point4)) line # To make a closed shape, use a `LinearRing' closed_line = shapely.geometry.LinearRing(line) closed_line # Some of the attributes of the LinearRing.. print(closed_line.area) # no area since it is not 'filled' print(closed_line.length) # the perimeter of the shape print(closed_line.bounds) # an xy-plane bounding box # Let's make a circle, with some noise N = 50 x = np.cos(np.linspace(0, 2.0*np.pi, N+1))[:-1] + 0.05*np.random.randn(50) y = np.sin(np.linspace(0, 2.0*np.pi, N+1))[:-1] + 0.05*np.random.randn(50) plt.plot(x, y, '-') xy = zip(x, y) poly = shapely.geometry.Polygon(xy) poly # Some of the Polygon attributes print(poly.area) # does this make sense? print(poly.centroid) print(poly.contains(point1), poly.contains(point2)) poly.boundary dialated = line.buffer(0.3) eroded = dialated.buffer(-0.2) plt.plot(*line.xy) plt.fill(*dialated.boundary.xy, 'g', alpha=0.2) plt.fill(*eroded.boundary.xy, 'b', alpha=0.2) poly.buffer(-.8) # First, let's make a collection of fat points. xy = np.random.rand(20, 2) points = shapely.geometry.MultiPoint(xy).buffer(0.1) points points.boundary # make a new line line2 = shapely.geometry.LineString([(0, 0), (1, 1)]) # loop over the polygons in the regions and plot, colored # differently if they intersect line1 for poly in points.boundary: if poly.intersects(line2): color = 'r' else: color = 'k' coords = poly.coords[:] x, y = zip(*coords) plt.fill(x, y, color=color, alpha=0.3) # Plot the line also x, y = zip(*line2.coords[:]) plt.plot(x, y, '--k') plt.gca().set_aspect(1.0) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Effective Tensorflow 2 Step2: Recommendations for idiomatic TensorFlow 2 Step3: Then prepare the data for training Step4: To keep the example short, trim the dataset to only return 5 batches Step5: Use regular Python iteration to iterate over training data that fits in memory. Otherwise, tf.data.Dataset is the best way to stream training data from disk. Datasets are iterables (not iterators), and work just like other Python iterables in eager execution. You can fully utilize dataset async prefetching/streaming features by wrapping your code in tf.function, which replaces Python iteration with the equivalent graph operations using AutoGraph. Step6: <a name="custom_loop"></a> Step7: Take advantage of tf.function with Python control flow Step8: Read the tf.function guide for a more information. Step9: Use metrics to collect and display data Step10: Keras metric names
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import tensorflow as tf import tensorflow_datasets as tfds datasets, info = tfds.load(name='mnist', with_info=True, as_supervised=True) mnist_train, mnist_test = datasets['train'], datasets['test'] BUFFER_SIZE = 10 # Use a much larger value for real code BATCH_SIZE = 64 NUM_EPOCHS = 5 def scale(image, label): image = tf.cast(image, tf.float32) image /= 255 return image, label train_data = mnist_train.map(scale).shuffle(BUFFER_SIZE).batch(BATCH_SIZE) test_data = mnist_test.map(scale).batch(BATCH_SIZE) STEPS_PER_EPOCH = 5 train_data = train_data.take(STEPS_PER_EPOCH) test_data = test_data.take(STEPS_PER_EPOCH) image_batch, label_batch = next(iter(train_data)) model = tf.keras.Sequential([ tf.keras.layers.Conv2D(32, 3, activation='relu', kernel_regularizer=tf.keras.regularizers.l2(0.02), input_shape=(28, 28, 1)), tf.keras.layers.MaxPooling2D(), tf.keras.layers.Flatten(), tf.keras.layers.Dropout(0.1), tf.keras.layers.Dense(64, activation='relu'), tf.keras.layers.BatchNormalization(), tf.keras.layers.Dense(10) ]) # Model is the full model w/o custom layers model.compile(optimizer='adam', loss=tf.keras.losses.SparseCategoricalCrossentropy(from_logits=True), metrics=['accuracy']) model.fit(train_data, epochs=NUM_EPOCHS) loss, acc = model.evaluate(test_data) print("Loss {}, Accuracy {}".format(loss, acc)) model = tf.keras.Sequential([ tf.keras.layers.Conv2D(32, 3, activation='relu', kernel_regularizer=tf.keras.regularizers.l2(0.02), input_shape=(28, 28, 1)), tf.keras.layers.MaxPooling2D(), tf.keras.layers.Flatten(), tf.keras.layers.Dropout(0.1), tf.keras.layers.Dense(64, activation='relu'), tf.keras.layers.BatchNormalization(), tf.keras.layers.Dense(10) ]) optimizer = tf.keras.optimizers.Adam(0.001) loss_fn = tf.keras.losses.SparseCategoricalCrossentropy(from_logits=True) @tf.function def train_step(inputs, labels): with tf.GradientTape() as tape: predictions = model(inputs, training=True) regularization_loss=tf.math.add_n(model.losses) pred_loss=loss_fn(labels, predictions) total_loss=pred_loss + regularization_loss gradients = tape.gradient(total_loss, model.trainable_variables) optimizer.apply_gradients(zip(gradients, model.trainable_variables)) for epoch in range(NUM_EPOCHS): for inputs, labels in train_data: train_step(inputs, labels) print("Finished epoch", epoch) class DynamicRNN(tf.keras.Model): def __init__(self, rnn_cell): super(DynamicRNN, self).__init__(self) self.cell = rnn_cell @tf.function(input_signature=[tf.TensorSpec(dtype=tf.float32, shape=[None, None, 3])]) def call(self, input_data): # [batch, time, features] -> [time, batch, features] input_data = tf.transpose(input_data, [1, 0, 2]) timesteps = tf.shape(input_data)[0] batch_size = tf.shape(input_data)[1] outputs = tf.TensorArray(tf.float32, timesteps) state = self.cell.get_initial_state(batch_size = batch_size, dtype=tf.float32) for i in tf.range(timesteps): output, state = self.cell(input_data[i], state) outputs = outputs.write(i, output) return tf.transpose(outputs.stack(), [1, 0, 2]), state lstm_cell = tf.keras.layers.LSTMCell(units = 13) my_rnn = DynamicRNN(lstm_cell) outputs, state = my_rnn(tf.random.normal(shape=[10,20,3])) print(outputs.shape) cce = tf.keras.losses.CategoricalCrossentropy(from_logits=True) cce([[1, 0]], [[-1.0,3.0]]).numpy() # Create the metrics loss_metric = tf.keras.metrics.Mean(name='train_loss') accuracy_metric = tf.keras.metrics.SparseCategoricalAccuracy(name='train_accuracy') @tf.function def train_step(inputs, labels): with tf.GradientTape() as tape: predictions = model(inputs, training=True) regularization_loss=tf.math.add_n(model.losses) pred_loss=loss_fn(labels, predictions) total_loss=pred_loss + regularization_loss gradients = tape.gradient(total_loss, model.trainable_variables) optimizer.apply_gradients(zip(gradients, model.trainable_variables)) # Update the metrics loss_metric.update_state(total_loss) accuracy_metric.update_state(labels, predictions) for epoch in range(NUM_EPOCHS): # Reset the metrics loss_metric.reset_states() accuracy_metric.reset_states() for inputs, labels in train_data: train_step(inputs, labels) # Get the metric results mean_loss=loss_metric.result() mean_accuracy = accuracy_metric.result() print('Epoch: ', epoch) print(' loss: {:.3f}'.format(mean_loss)) print(' accuracy: {:.3f}'.format(mean_accuracy)) model.compile( optimizer = tf.keras.optimizers.Adam(0.001), loss = tf.keras.losses.SparseCategoricalCrossentropy(from_logits=True), metrics = ['acc', 'accuracy', tf.keras.metrics.SparseCategoricalAccuracy(name="my_accuracy")]) history = model.fit(train_data) history.history.keys() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: This notebook covers the problem of fitting parametric regression models with a minimum least-squares criterion. The material presented here is based on the first lectures of this <a haref=http Step2: 1.1. Parametric model Step3: Should we choose a polynomial? Step4: 2.4. Overfitting the training data Step5: 2.4.1 Limitations of the LS approach. The need for assumptions
<ASSISTANT_TASK:> Python Code: # Import some libraries that will be necessary for working with data and displaying plots # To visualize plots in the notebook %matplotlib inline import matplotlib import matplotlib.pyplot as plt import numpy as np import scipy.io # To read matlab files import pylab # For the student tests (only for python 2) import sys if sys.version_info.major==2: from test_helper import Test K = 35 n_grid = 200 frec = 3 std_n = 0.3 # Location of the training points X_tr = (3 * np.random.random((K, 1)) - 0.5) # Labels are obtained from a sinusoidal function, and contaminated by noise S_tr = np.cos(frec*X_tr) + std_n * np.random.randn(K, 1) # Equally spaced points in the X-axis X_grid = np.linspace(np.min(X_tr),np.max(X_tr),n_grid) # Gererate random prediction curves f1 = np.random.random() + np.random.random()*X_grid f2 = np.random.random() + np.random.random()*X_grid + \ np.random.random()*(X_grid**2) f3 = np.random.random() + np.random.random()*X_grid + \ np.random.random()*(X_grid**2) + np.random.random()*(X_grid**3) plt.plot(X_tr,S_tr,'b.') plt.plot(X_grid,f1.T,'g-',label='Arbitrary Linear function') plt.plot(X_grid,f2.T,'r-',label='Arbitrary Quadratic function') plt.plot(X_grid,f3.T,'m-',label='Arbitrary Cubic function') plt.legend(loc='best') plt.show() ## Next, we represent some random polynomial functions for degrees between 0 and 14 max_degree = 15 K = 200 #Values of X to evaluate the function X_grid = np.linspace(-1.5, 1.5, K) for idx in range(max_degree): x1 = plt.subplot(3,5, idx+1) x1.get_xaxis().set_ticks([]) x1.get_yaxis().set_ticks([]) for kk in range(5): #Random generation of coefficients for the model we = np.random.randn(idx+1, 1) #Evaluate the polynomial with previous coefficients at X_grid values fout = np.polyval(we, X_grid) x1.plot(X_grid,fout,'g-') x1.set_ylim([-5,5]) n_points = 20 n_grid = 200 frec = 3 std_n = 0.2 max_degree = 20 colors = 'brgcmyk' #Location of the training points X_tr = (3 * np.random.random((n_points,1)) - 0.5) #Labels are obtained from a sinusoidal function, and contaminated by noise S_tr = np.cos(frec*X_tr) + std_n * np.random.randn(n_points,1) #Equally spaced points in the X-axis X_grid = np.linspace(np.min(X_tr),np.max(X_tr),n_grid) #We start by building the Z matrix Z = [] for el in X_tr.tolist(): Z.append([el[0]**k for k in range(max_degree+1)]) Z = np.matrix(Z) Z_grid = [] for el in X_grid.tolist(): Z_grid.append([el**k for k in range(max_degree+1)]) Z_grid = np.matrix(Z_grid) plt.plot(X_tr,S_tr,'b.') for k in [1, 2, n_points]: # range(max_degree+1): Z_iter = Z[:,:k+1] # Least square solution #w_LS = (np.linalg.inv(Z_iter.T.dot(Z_iter))).dot(Z_iter.T).dot(S_tr) # Least squares solution, with leass numerical errors w_LS, resid, rank, s = np.linalg.lstsq(Z_iter, S_tr, rcond=None) #estimates at all grid points fout = Z_grid[:,:k+1].dot(w_LS) fout = np.array(fout).flatten() plt.plot(X_grid,fout,colors[k%len(colors)]+'-',label='Degree '+str(k)) plt.legend(loc='best') plt.ylim(1.2*np.min(S_tr), 1.2*np.max(S_tr)) plt.show() n_points = 35 n_test = 200 n_grid = 200 frec = 3 std_n = 0.7 max_degree = 25 colors = 'brgcmyk' #Location of the training points X_tr = (3 * np.random.random((n_points,1)) - 0.5) #Labels are obtained from a sinusoidal function, and contaminated by noise S_tr = np.cos(frec*X_tr) + std_n * np.random.randn(n_points,1) #Test points to validate the generalization of the solution X_tst = (3 * np.random.random((n_test,1)) - 0.5) S_tst = np.cos(frec*X_tst) + std_n * np.random.randn(n_test,1) #Equally spaced points in the X-axis X_grid = np.linspace(np.min(X_tr),np.max(X_tr),n_grid) #We start by building the Z matrix def extend_matrix(X,max_degree): Z = [] X = X.reshape((X.shape[0],1)) for el in X.tolist(): Z.append([el[0]**k for k in range(max_degree+1)]) return np.matrix(Z) Z = extend_matrix(X_tr,max_degree) Z_grid = extend_matrix(X_grid,max_degree) Z_test = extend_matrix(X_tst,max_degree) #Variables to store the train and test errors tr_error = [] tst_error = [] for k in range(max_degree): Z_iter = Z[:,:k+1] #Least square solution #w_LS = (np.linalg.inv(Z_iter.T.dot(Z_iter))).dot(Z_iter.T).dot(S_tr) # Least squares solution, with leass numerical errors w_LS, resid, rank, s = np.linalg.lstsq(Z_iter, S_tr) #estimates at traint and test points f_tr = Z_iter.dot(w_LS) f_tst = Z_test[:,:k+1].dot(w_LS) tr_error.append(np.array((S_tr-f_tr).T.dot(S_tr-f_tr)/len(S_tr))[0,0]) tst_error.append(np.array((S_tst-f_tst).T.dot(S_tst-f_tst)/len(S_tst))[0,0]) plt.stem(range(max_degree),tr_error,'b-',label='Train error') plt.stem(range(max_degree),tst_error,'r-o',label='Test error') plt.legend(loc='best') plt.show() n_points = 15 n_grid = 200 frec = 3 std_n = 0.2 n_val_16 = 5 degree = 18 X_tr = 3 * np.random.random((n_points,1)) - 0.5 S_tr = - np.cos(frec*X_tr) + std_n * np.random.randn(n_points,1) X_grid = np.linspace(-.5,2.5,n_grid) S_grid = - np.cos(frec*X_grid) #Noise free for the true model X_16 = .3 * np.ones((n_val_16,)) S_16 = np.linspace(np.min(S_tr),np.max(S_tr),n_val_16) fig = plt.figure() ax = fig.add_subplot(111) ax.plot(X_tr,S_tr,'b.',markersize=10) ax.plot(X_16,S_16,'ro',markersize=6) ax.plot(X_grid,S_grid,'r-',label='True model') for el in zip(X_16,S_16): #Add point to the training set X_tr_iter = np.append(X_tr,el[0]) S_tr_iter = np.append(S_tr,el[1]) #Obtain LS regression coefficients and evaluate it at X_grid w_LS = np.polyfit(X_tr_iter, S_tr_iter, degree) S_grid_iter = np.polyval(w_LS,X_grid) ax.plot(X_grid,S_grid_iter,'g-') ax.set_xlim(-.5,2.5) ax.set_ylim(S_16[0]-2,S_16[-1]+2) ax.legend(loc='best') plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Toy Example Step2: The following is a spectrogram of the simulated signal that highlights the limitations of classical frequency analysis. The analysis is unable to resolve the closely spaced signals of 10 and 11 Hz in the frequency domain. Step3: Robust Spectral Decomposition Step4: The objective is to compute an estimate $\hat{x}$ of $x$ given the data $y$. The component-wise magnitude-squared of $\hat{x}$ gives an estimate of the magnitude spectrum of $y$. By treating $\left(x_{n}\right){n=1}^{N}$ as a sequence of random variables and carefully selecting a prior distribution, a stochastic continuity constraint can be established across time. By imposing a model on the components $\left(x{n,k}\right)_{k=1}^{K}$ for each $n = 1,2,..,N$, sparsity is enforced in the frequency domain. The stochastic continuity constraint can be expressed in the form of the first-order difference equation Step5: Kalman Smoother Step6: IRLS Algorithm for Spectrotemporal Pursuit
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt import matplotlib.mlab as mlab import scipy as sp %matplotlib inline T = 600 #[s] fs = 500 #[Hz] f0 = 0.04 #[Hz] f1 = 10 #[Hz] f2 = 11 #[Hz] t = np.linspace(0,T,fs*T) signal = 10*(np.cos(2*np.pi*f0*t))**8*np.sin(2*np.pi*f1*t) + \ 10*np.exp(4*(t-T)/T)*np.cos(2*np.pi*f2*t) noise = np.random.normal(0,0.3,T*fs) signal = signal + noise #PLOT fig, ax = plt.subplots(nrows=2,ncols=1,figsize=(8,6)) ax[0].plot(t,signal) ax[0].set_ylabel('Amplitude') ax[1].plot(t,signal) ax[1].set_ylabel('Amplitude') ax[1].set_xlabel('Time (s)') ax[1].set_xlim([295,305]) ax[1].set_ylim([-12,12]) fig.tight_layout() fig, ax = plt.subplots(nrows=1,ncols=2,figsize=(11,4)) im1 = ax[0].specgram(signal,NFFT=1000,Fs=500,noverlap=500,interpolation='none') ax[0].set_ylim([0,20]) ax[0].set_ylabel('Frequency (Hz)') ax[0].set_xlabel('Time (s)') im1[3].set_clim(-40,10) im2 = ax[1].specgram(signal,NFFT=1000,Fs=500,noverlap=500,interpolation='none') ax[1].set_xlim([250,350]) ax[1].set_ylim([7,13]) ax[1].set_xlabel('Time (s)') fig.tight_layout() im2[3].set_clim(-40,10) cb = fig.colorbar(im2[3]) # Define Matrix F numSamples = fs*T #num samples W = 1000 #window size K = W #frequency bands N = numSamples//W #number of windows F = np.zeros([W,K]) k = np.array(range(1,K//2+1)) l = np.array(range(1,W+1)) for jj in range(0,np.size(k)): for ii in range(0,np.size(l)): F[ii,jj] = np.cos(2*np.pi*l[ii]*(k[jj]-1)/K) F[ii,jj+K//2] = np.sin(2*np.pi*l[ii]*(k[jj]-1)/K) #plt.imshow(F) #print(np.shape(F)) #initialize Q = np.eye(K)*0.001 xKalman = np.zeros([K,N+1]) xPredict = np.zeros([K,N+1]) sigKalman = np.zeros([K,K,N+1]) sigPredict = np.zeros([K,K,N+1]) sigKalman[:,:,0] = np.eye(K) #Kalman Filter for n in range(0,N): y = signal[n*W:(n+1)*W] xPredict[:,n+1] = xKalman[:,n] sigPredict[:,:,n+1] = sigKalman[:,:,n] + Q gainK = np.dot(sigPredict[:,:,n+1],F.T).dot(np.linalg.inv(np.dot(F,sigPredict[:,:,n+1]).dot(F.T)+np.eye(K))) xKalman[:,n+1] = xPredict[:,n+1] + np.dot(gainK,y-np.dot(F,xPredict[:,n+1])) sigKalman[:,:,n+1] = sigPredict[:,:,n+1] - np.dot(gainK,F).dot(sigPredict[:,:,n+1]) #remove initial conditions xKalman = xKalman[:,1:N+1] xPredict = xPredict[:,1:N+1] sigKalman = sigKalman[:,:,1:N+1] sigPredict = sigPredict[:,:,1:N+1] xEst = xKalman[0:K//2,:]-xKalman[K//2:W,:]*1j xPSD = 10*np.log10(np.abs(xEst)**2) fig, ax = plt.subplots(nrows=1,ncols=2,figsize=(11,4)) im1 = ax[0].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[0].set_ylim([0,20]) ax[0].set_ylabel('Frequency (Hz)') ax[0].set_xlabel('Time (s)') im1.set_clim(-40,10) im2 = ax[1].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[1].set_xlim([250,350]) ax[1].set_ylim([7,13]) ax[1].set_xlabel('Time (s)') fig.tight_layout() im2.set_clim(-40,10) cb = fig.colorbar(im2) xSmooth = xKalman sigSmooth = sigKalman for n in range(N-2,-1,-1): B = np.dot(sigKalman[:,:,n],np.linalg.inv(sigPredict[:,:,n+1])) xSmooth[:,n] = xKalman[:,n] + np.dot(B,(xSmooth[:,n+1]-xPredict[:,n+1])) sigSmooth[:,:,n] = sigKalman[:,:,n] + np.dot(B,(sigSmooth[:,:,n+1]-sigPredict[:,:,n+1])).dot(B.T) xEst = xSmooth[0:K//2,:]-xSmooth[K//2:W,:]*1j xPSD = 10*np.log10(np.abs(xEst)**2) fig, ax = plt.subplots(nrows=1,ncols=2,figsize=(11,4)) im1 = ax[0].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[0].set_ylim([0,20]) ax[0].set_ylabel('Frequency (Hz)') ax[0].set_xlabel('Time (s)') im1.set_clim(-40,10) im2 = ax[1].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[1].set_xlim([250,350]) ax[1].set_ylim([7,13]) ax[1].set_xlabel('Time (s)') fig.tight_layout() im2.set_clim(-40,10) cb = fig.colorbar(im2) #Parameters alpha = 21000 tol = 0.005 maxIter = 10 Q = np.eye(K)*0.001 iter = 1 while (iter <= maxIter): #Step 1: #initialize xKalman = np.zeros([K,N+1]) xPredict = np.zeros([K,N+1]) sigKalman = np.zeros([K,K,N+1]) sigPredict = np.zeros([K,K,N+1]) sigKalman[:,:,0] = np.eye(K) #Kalman Filter for n in range(0,N): y = signal[n*W:(n+1)*W] xPredict[:,n+1] = xKalman[:,n] sigPredict[:,:,n+1] = sigKalman[:,:,n] + Q gainK = np.dot(sigPredict[:,:,n+1],F.T).dot(np.linalg.inv(np.dot(F,sigPredict[:,:,n+1]).dot(F.T)+np.eye(K))) xKalman[:,n+1] = xPredict[:,n+1] + np.dot(gainK,y-np.dot(F,xPredict[:,n+1])) sigKalman[:,:,n+1] = sigPredict[:,:,n+1] - np.dot(gainK,F).dot(sigPredict[:,:,n+1]) #remove initial conditions xKalman = xKalman[:,1:N+1] xPredict = xPredict[:,1:N+1] sigKalman = sigKalman[:,:,1:N+1] sigPredict = sigPredict[:,:,1:N+1] #Step 2: #initialize xSmooth = xKalman sigSmooth = sigKalman #Kalman Smoother for n in range(N-2,-1,-1): B = np.dot(sigKalman[:,:,n],np.linalg.inv(sigPredict[:,:,n+1])) xSmooth[:,n] = xKalman[:,n] + np.dot(B,(xSmooth[:,n+1]-xPredict[:,n+1])) sigSmooth[:,:,n] = sigKalman[:,:,n] + np.dot(B,(sigSmooth[:,:,n+1]-sigPredict[:,:,n+1])).dot(B.T) #Step 4: if iter > 1 and np.linalg.norm(xSmooth-xPrev,'fro')/np.linalg.norm(xPrev,'fro') < tol: break #Step 5: Update Q Q = np.zeros([K,K]) for k in range(0,K): qTemp = 0 for n in range(1,N): qTemp += (xSmooth[k,n]-xSmooth[k,n-1])**2 Q[k,k] = (qTemp + np.finfo(float).eps**2)**(1/2)/alpha xPrev = xSmooth iter += 1 print(iter-1) xEst = xSmooth[0:K//2,:]-xSmooth[K//2:W,:]*1j xPSD = 10*np.log10(np.abs(xEst)**2) fig, ax = plt.subplots(nrows=1,ncols=2,figsize=(11,4)) im1 = ax[0].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[0].set_ylim([0,20]) ax[0].set_ylabel('Frequency (Hz)') ax[0].set_xlabel('Time (s)') im1.set_clim(-40,10) im2 = ax[1].imshow(xPSD,origin='lower',extent=[0,N*W//fs,0,fs//2-5],aspect='auto',interpolation='none') ax[1].set_xlim([250,350]) ax[1].set_ylim([7,13]) ax[1].set_xlabel('Time (s)') fig.tight_layout() im2.set_clim(-40,10) cb = fig.colorbar(im2) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Density Profile Step2: One can see that indeed the density profile is now independant of halo mass Step3: That means the parameter logA for the HOD should be changed to Step4: We can simply set this on the existing model (everything that's dependent on it will be auto-updated) Step5: The density profile should satisfy $r_s/a = \lambda_{\rm mfp}$. $r_s$ can be obtained as Step6: Just to make sure, we calculate $r_s$ for a different halo mass Step7: in the units of Mpc/h. Assume we want $\lambda_{\rm mfp} = 10$Mpc/h Step8: Check the density profile to see the cut-off Step9: You can see it's indeed around 0.1 Mpc$^{-1}$h
<ASSISTANT_TASK:> Python Code: from halomod import TracerHaloModel import numpy as np from matplotlib import pyplot as plt hm = TracerHaloModel(hod_model="Constant", transfer_model='EH') hm.central_occupation plt.plot(np.log10(hm.m),hm.satellite_occupation) from halomod.concentration import CMRelation from hmf.halos.mass_definitions import SOMean class CMFlux(CMRelation): _defaults = {'c_0': 4} native_mdefs = (SOMean(),) def cm(self,m,z): return self.params['c_0']*(m*10**(-11))**(1/3) hm = TracerHaloModel( halo_concentration_model = CMFlux, halo_profile_model = "PowerLawWithExpCut", halo_profile_params = {"b":2.0,"a":1.0}, hod_model = "Constant", transfer_model='EH', ) plt.plot(np.log10(hm.k_hm),hm.tracer_profile.u(hm.k_hm,m=1e12), label='$m = 10^{12}$') plt.plot(np.log10(hm.k_hm),hm.tracer_profile.u(hm.k_hm,m=1e13), label='$m = 10^{13}$') plt.plot(np.log10(hm.k_hm),hm.tracer_profile.u(hm.k_hm,m=1e14), label='$m = 10^{14}$') plt.legend(); rhoc = hm.cosmo.critical_density0.to("Msun/Mpc^3").value*hm.cosmo.h**2 hm.mean_tracer_den/rhoc -np.log10(hm.mean_tracer_den/rhoc) hm.hod_params = {"logA":-np.log10(hm.mean_tracer_den/rhoc)} hm.mean_tracer_den/rhoc rs = hm.halo_profile.scale_radius(1e11) print(rs) hm.halo_profile.scale_radius(1e12) hm.halo_profile_params = {"a":rs/10} plt.plot(hm.k_hm,hm.tracer_profile.u(hm.k_hm,m=1e12)) plt.xlabel("Scale [h/Mpc]") plt.ylabel("Normalized Fourier Density") plt.xscale('log') plt.plot(hm.k_hm,hm.power_1h_auto_tracer, ls='--', color='C0', label='1halo') plt.plot(hm.k_hm,hm.power_2h_auto_tracer, ls=':', color='C0', label='2halo') plt.plot(hm.k_hm,hm.power_auto_tracer, color='C0', label='full') plt.legend() plt.xscale('log') plt.yscale('log') plt.ylim(1e-5,) plt.xlabel("Fourier Scale, $k$") plt.ylabel("Auto Power Spectrum") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: <h3>Particles</h3> Step2: The scale of many modern physics detectors ranges from the order of centimeters to 10's of meters. Given that information, what particles do you think will actually live long enough to travel <i>through</i> parts of the detector? Step3: Which particles will decay (on average) before they reach the detectors? This means that these particles have to be reconstructed from their decay products. Step4: Make a plot where the x-axis is the names of the above particles (or a number corresponding to each, where the number/particle relationship is clearly identified) and the y-axis is the lifetime of the particle. Color code the data points according to whether the primary decay is EM, weak, or strong. {\it Do not plot the proton and neutron on this plot}. Do you see the "pattern"? You may need to use a log-scale for the y-axis.
<ASSISTANT_TASK:> Python Code: particles = ["B+/-","D+/-","J/Psi"] lifetimes = [1.64e-12,1.4e-12,7e-21] c = 3e8 # m/s v = c for p,l in zip(particles,lifetimes): distance = v*l print "%-5s lifetime=%4.2e s distance traveled=%4.2e m" % (p,l,distance) # Your code here # Your code here # Your code here # Your code here <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Exercise Step2: Exercise
<ASSISTANT_TASK:> Python Code: import numpy as np total_tosses = 30 num_heads = 24 prob_head = 0.5 #0 is tail. 1 is heads. Generate one experiment experiment = np.random.randint(0,2,total_tosses) print("Data of the Experiment:", experiment) #Find the number of heads print("Heads in the Experiment:", experiment[experiment==1]) #This will give all the heads in the array head_count = experiment[experiment==1].shape[0] #This will get the count of heads in the array print("Number of heads in the experiment:", head_count) #Now, the above experiment needs to be repeated 100 times. Let's write a function and put the above code in a loop def coin_toss_experiment(times_to_repeat): head_count = np.empty([times_to_repeat,1], dtype=int) for times in np.arange(times_to_repeat): experiment = np.random.randint(0,2,total_tosses) head_count[times] = experiment[experiment==1].shape[0] return head_count head_count = coin_toss_experiment(100) head_count[:10] print("Dimensions:", head_count.shape, "\n","Type of object:", type(head_count)) #Let's plot the above distribution import matplotlib.pyplot as plt %matplotlib inline import seaborn as sns sns.set(color_codes = True) sns.distplot(head_count, kde=False) sns.distplot(head_count, kde=True) #Number of times the experiment returned 24 heads. head_count[head_count>=24] print("No of times experiment returned 24 heads or more:", head_count[head_count>=24].shape[0]) print("% of times with 24 or more heads: ", head_count[head_count>=24].shape[0]/float(head_count.shape[0])*100) def coin_toss_experiment_2(times_to_repeat): head_count = np.empty([times_to_repeat,1], dtype=int) experiment = np.random.randint(0,2,[times_to_repeat,total_tosses]) return experiment.sum(axis=1) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load data Step2: Data inspection Step3: Feature imputation Step4: Feature augmentation Step5: Generate training, validation and test data splits Step6: Classification parameters optimization Step7: Predict labels on test data
<ASSISTANT_TASK:> Python Code: # Import from __future__ import division %matplotlib inline import matplotlib as mpl import matplotlib.pyplot as plt mpl.rcParams['figure.figsize'] = (20.0, 10.0) inline_rc = dict(mpl.rcParams) from classification_utilities import make_facies_log_plot import pandas as pd import numpy as np #import seaborn as sns from sklearn import preprocessing from sklearn.model_selection import LeavePGroupsOut from sklearn.metrics import f1_score from sklearn.multiclass import OneVsOneClassifier from sklearn.ensemble import RandomForestClassifier, RandomForestRegressor from scipy.signal import medfilt import sys, scipy, sklearn print('Python: ' + sys.version.split('\n')[0]) print(' ' + sys.version.split('\n')[1]) print('Pandas: ' + pd.__version__) print('Numpy: ' + np.__version__) print('Scipy: ' + scipy.__version__) print('Sklearn: ' + sklearn.__version__) # Parameters feature_names = ['GR', 'ILD_log10', 'DeltaPHI', 'PHIND', 'PE', 'NM_M', 'RELPOS'] facies_names = ['SS', 'CSiS', 'FSiS', 'SiSh', 'MS', 'WS', 'D', 'PS', 'BS'] facies_colors = ['#F4D03F', '#F5B041','#DC7633','#6E2C00', '#1B4F72','#2E86C1', '#AED6F1', '#A569BD', '#196F3D'] # Load data from file data = pd.read_csv('../facies_vectors.csv') # Store features and labels X = data[feature_names].values # features y = data['Facies'].values # labels # Store well labels and depths well = data['Well Name'].values depth = data['Depth'].values # Define function for plotting feature statistics def plot_feature_stats(X, y, feature_names, facies_colors, facies_names): # Remove NaN nan_idx = np.any(np.isnan(X), axis=1) X = X[np.logical_not(nan_idx), :] y = y[np.logical_not(nan_idx)] # Merge features and labels into a single DataFrame features = pd.DataFrame(X, columns=feature_names) labels = pd.DataFrame(y, columns=['Facies']) for f_idx, facies in enumerate(facies_names): labels[labels[:] == f_idx] = facies data = pd.concat((labels, features), axis=1) # Plot features statistics facies_color_map = {} for ind, label in enumerate(facies_names): facies_color_map[label] = facies_colors[ind] sns.pairplot(data, hue='Facies', palette=facies_color_map, hue_order=list(reversed(facies_names))) # Feature distribution # plot_feature_stats(X, y, feature_names, facies_colors, facies_names) # mpl.rcParams.update(inline_rc) # Facies per well for w_idx, w in enumerate(np.unique(well)): ax = plt.subplot(3, 4, w_idx+1) hist = np.histogram(y[well == w], bins=np.arange(len(facies_names)+1)+.5) plt.bar(np.arange(len(hist[0])), hist[0], color=facies_colors, align='center') ax.set_xticks(np.arange(len(hist[0]))) ax.set_xticklabels(facies_names) ax.set_title(w) # Features per well for w_idx, w in enumerate(np.unique(well)): ax = plt.subplot(3, 4, w_idx+1) hist = np.logical_not(np.any(np.isnan(X[well == w, :]), axis=0)) plt.bar(np.arange(len(hist)), hist, color=facies_colors, align='center') ax.set_xticks(np.arange(len(hist))) ax.set_xticklabels(feature_names) ax.set_yticks([0, 1]) ax.set_yticklabels(['miss', 'hit']) ax.set_title(w) def make_pe(X, seed): reg = RandomForestRegressor(max_features='sqrt', n_estimators=50, random_state=seed) DataImpAll = data[feature_names].copy() DataImp = DataImpAll.dropna(axis = 0, inplace=False) Ximp=DataImp.loc[:, DataImp.columns != 'PE'] Yimp=DataImp.loc[:, 'PE'] reg.fit(Ximp, Yimp) X[np.array(DataImpAll.PE.isnull()),4] = reg.predict(DataImpAll.loc[DataImpAll.PE.isnull(),:].drop('PE',axis=1,inplace=False)) return X # Feature windows concatenation function def augment_features_window(X, N_neig): # Parameters N_row = X.shape[0] N_feat = X.shape[1] # Zero padding X = np.vstack((np.zeros((N_neig, N_feat)), X, (np.zeros((N_neig, N_feat))))) # Loop over windows X_aug = np.zeros((N_row, N_feat*(2*N_neig+1))) for r in np.arange(N_row)+N_neig: this_row = [] for c in np.arange(-N_neig,N_neig+1): this_row = np.hstack((this_row, X[r+c])) X_aug[r-N_neig] = this_row return X_aug # Feature gradient computation function def augment_features_gradient(X, depth): # Compute features gradient d_diff = np.diff(depth).reshape((-1, 1)) d_diff[d_diff==0] = 0.001 X_diff = np.diff(X, axis=0) X_grad = X_diff / d_diff # Compensate for last missing value X_grad = np.concatenate((X_grad, np.zeros((1, X_grad.shape[1])))) return X_grad # Feature augmentation function def augment_features(X, well, depth, seed=None, pe=True, N_neig=1): seed = seed or None if pe: X = make_pe(X, seed) # Augment features X_aug = np.zeros((X.shape[0], X.shape[1]*(N_neig*2+2))) for w in np.unique(well): w_idx = np.where(well == w)[0] X_aug_win = augment_features_window(X[w_idx, :], N_neig) X_aug_grad = augment_features_gradient(X[w_idx, :], depth[w_idx]) X_aug[w_idx, :] = np.concatenate((X_aug_win, X_aug_grad), axis=1) # Find padded rows padded_rows = np.unique(np.where(X_aug[:, 0:7] == np.zeros((1, 7)))[0]) return X_aug, padded_rows # Augment features X_aug, padded_rows = augment_features(X, well, depth) # Initialize model selection methods lpgo = LeavePGroupsOut(2) # Generate splits split_list = [] for train, val in lpgo.split(X, y, groups=data['Well Name']): hist_tr = np.histogram(y[train], bins=np.arange(len(facies_names)+1)+.5) hist_val = np.histogram(y[val], bins=np.arange(len(facies_names)+1)+.5) if np.all(hist_tr[0] != 0) & np.all(hist_val[0] != 0): split_list.append({'train':train, 'val':val}) # Print splits for s, split in enumerate(split_list): print('Split %d' % s) print(' training: %s' % (data['Well Name'][split['train']].unique())) print(' validation: %s' % (data['Well Name'][split['val']].unique())) # Parameters search grid (uncomment parameters for full grid search... may take a lot of time) N_grid = [100] # [50, 100, 150] M_grid = [10] # [5, 10, 15] S_grid = [25] # [10, 25, 50, 75] L_grid = [5] # [2, 3, 4, 5, 10, 25] param_grid = [] for N in N_grid: for M in M_grid: for S in S_grid: for L in L_grid: param_grid.append({'N':N, 'M':M, 'S':S, 'L':L}) # Train and test a classifier def train_and_test(X_tr, y_tr, X_v, well_v, clf): # Feature normalization scaler = preprocessing.RobustScaler(quantile_range=(25.0, 75.0)).fit(X_tr) X_tr = scaler.transform(X_tr) X_v = scaler.transform(X_v) # Train classifier clf.fit(X_tr, y_tr) # Test classifier y_v_hat = clf.predict(X_v) # Clean isolated facies for each well for w in np.unique(well_v): y_v_hat[well_v==w] = medfilt(y_v_hat[well_v==w], kernel_size=5) return y_v_hat # For each set of parameters # score_param = [] # for param in param_grid: # # For each data split # score_split = [] # for split in split_list: # # Remove padded rows # split_train_no_pad = np.setdiff1d(split['train'], padded_rows) # # Select training and validation data from current split # X_tr = X_aug[split_train_no_pad, :] # X_v = X_aug[split['val'], :] # y_tr = y[split_train_no_pad] # y_v = y[split['val']] # # Select well labels for validation data # well_v = well[split['val']] # # Train and test # y_v_hat = train_and_test(X_tr, y_tr, X_v, well_v, param) # # Score # score = f1_score(y_v, y_v_hat, average='micro') # score_split.append(score) # # Average score for this param # score_param.append(np.mean(score_split)) # print('F1 score = %.3f %s' % (score_param[-1], param)) # # Best set of parameters # best_idx = np.argmax(score_param) # param_best = param_grid[best_idx] # score_best = score_param[best_idx] # print('\nBest F1 score = %.3f %s' % (score_best, param_best)) param_best = {'S': 25, 'M': 10, 'L': 5, 'N': 100} # Load data from file test_data = pd.read_csv('../validation_data_nofacies.csv') # Prepare test data well_ts = test_data['Well Name'].values depth_ts = test_data['Depth'].values X_ts = test_data[feature_names].values y_pred = [] print('o' * 100) for seed in range(100): np.random.seed(seed) # Make training data. X_train, padded_rows = augment_features(X, well, depth, seed=seed) y_train = y X_train = np.delete(X_train, padded_rows, axis=0) y_train = np.delete(y_train, padded_rows, axis=0) param = param_best clf = OneVsOneClassifier(RandomForestClassifier(n_estimators=param['N'], criterion='entropy', max_features=param['M'], min_samples_split=param['S'], min_samples_leaf=param['L'], class_weight='balanced', random_state=seed), n_jobs=-1) # Make blind data. X_test, _ = augment_features(X_ts, well_ts, depth_ts, seed=seed, pe=False) # Train and test. y_ts_hat = train_and_test(X_train, y_train, X_test, well_ts, clf) # Collect result. y_pred.append(y_ts_hat) print('.', end='') np.save('100_realizations.npy', y_pred) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Ansambli (glasovanje) Step2: (b) Step3: Q Step4: Razred koji implementira stablo odluke jest tree.DecisionTreeClassifier. Prvo naučite stablo odluke (engl. decision tree) na skupu za učenje, ali tako da je taj model presložen. To možete postići tako da povećate najveću moguću dubinu stabla (parametar max_depth). Ispišite pogrešku na skupu za ispitivanje (pogrešku 0-1; pogledajte paket metrics). Step5: Sada isprobajte algoritam slučajnih šuma (dostupan u razredu ensemble.RandomForestClassifier) za različit broj stabala $L \in [1, 30]$. Iscrtajte pogrešku na skupu za učenje i na skupu za ispitivanje u ovisnosti o tom hiperparametru. Ispišite najmanju pogrešku na skupu za ispitivanje. Step6: Q Step7: (a) Step8: Q Step9: Iscrtajte krivulje pogrešaka na skupu za učenje i ispitivanje u ovisnosti o hiperparametru $L \in [1,80]$. Koristite pogrešku 0-1 iz paketa metrics. Ispišite najmanju ostvarenu pogrešku na skupu za ispitivanje, te pripadajuću vrijednost hiperparametra $L$. Step10: Q Step11: Q Step12: (b) Step13: Q Step14: Q Step15: Q Step16: Q Step17: (g) Step18: (h) Step19: (i) Step20: Q Step21: (k)
<ASSISTANT_TASK:> Python Code: # Učitaj osnovne biblioteke... import sklearn import mlutils import numpy as np import matplotlib.pyplot as plt %pylab inline from collections import Counter class VotingClassifierDIY(object): SCHEME_COUNTING = "counting" SCHEME_AVERAGING = "averaging" def __init__(self, clfs, voting_scheme=SCHEME_COUNTING): # Vaš kôd ovdje pass def fit(self, X, y): # Vaš kôd ovdje pass def predict_proba(self, X): # Vaš kôd ovdje pass def predict(self, X): # Vaš kôd ovdje pass from sklearn.datasets import make_classification from sklearn.ensemble import VotingClassifier from sklearn.linear_model import LogisticRegression X_voting, y_voting = make_classification(n_samples=1000, n_features=4, n_redundant=0, n_informative=3, n_classes=3, n_clusters_per_class=2) # Vaš kôd ovdje from sklearn.model_selection import train_test_split X_bag, y_bag = make_classification(n_samples=1000, n_features=20, n_redundant=1, n_informative=17, n_classes=3, n_clusters_per_class=2) X_bag_train, X_bag_test, y_bag_train, y_bag_test = train_test_split(X_bag, y_bag, train_size=0.7, random_state=69) from sklearn.tree import DecisionTreeClassifier from sklearn.metrics import zero_one_loss # Vaš kôd ovdje from sklearn.ensemble import RandomForestClassifier # Vaš kôd ovdje from sklearn.datasets import make_circles circ_X, circ_y = make_circles(n_samples=400, noise=0.1, factor=0.4) mlutils.plot_2d_clf_problem(circ_X, circ_y) from sklearn.ensemble import AdaBoostClassifier from sklearn.tree import DecisionTreeClassifier # Vaš kôd ovdje from sklearn.model_selection import train_test_split X_boost, y_boost = make_classification(n_samples=1000, n_features=20, n_redundant=0, n_informative=18, n_classes=3, n_clusters_per_class=1) X_boost_train, X_boost_test, y_boost_train, y_boost_test = train_test_split(X_boost, y_boost, train_size=0.7, random_state=69) # Vaš kôd ovdje # Vaš kôd ovdje # Vaš kôd ovdje # Vaš kôd ovdje # Vaš kôd ovdje from scipy.stats import beta # Vaš kôd ovdje # Vaš kôd ovdje # Vaš kôd ovdje from sklearn.datasets import load_iris import itertools as it # Vaš kôd ovdje from scipy.stats import norm # Vaš kôd ovdje # Vaš kôd ovdje from scipy.stats import pearsonr # Vaš kôd ovdje # Vaš kôd ovdje <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: Create ML datasets by sampling using BigQuery Step3: There are only a limited number of years, months, days, and states in the dataset. Let's see what the hash values are. Step5: We can make a query to check if our bucketing values result in the correct sizes of each of our dataset splits and then adjust accordingly Step6: Here's a way to get a well-distributed portion of the data in such a way that the train/eval/test sets do not overlap. Step7: Preprocess data using Pandas Step8: Also, notice that there are some very important numeric fields that are missing in some rows (the count in Pandas doesn't count missing data) Step9: It is always crucial to clean raw data before using in machine learning, so we have a preprocessing step. We'll define a preprocess function below. Note that the mother's age is an input to our model so users will have to provide the mother's age; otherwise, our service won't work. The features we use for our model were chosen because they are such good predictors and because they are easy enough to collect. Step10: Let's process the train/eval/test set and see a small sample of the training data after our preprocessing Step11: Let's look again at a summary of the dataset. Note that we only see numeric columns, so plurality does not show up. Step12: Write to .csv files
<ASSISTANT_TASK:> Python Code: PROJECT = "cloud-training-demos" # Replace with your PROJECT BUCKET = "cloud-training-bucket" # Replace with your BUCKET REGION = "us-central1" # Choose an available region for Cloud MLE TFVERSION = "1.14" # TF version for CMLE to use import os os.environ["BUCKET"] = BUCKET os.environ["PROJECT"] = PROJECT os.environ["REGION"] = REGION os.environ["TFVERSION"] = TFVERSION %%bash if ! gsutil ls | grep -q gs://${BUCKET}/; then gsutil mb -l ${REGION} gs://${BUCKET} fi # Create SQL query using natality data after the year 2000 query_string = WITH CTE_hash_cols_fixed AS ( SELECT weight_pounds, is_male, mother_age, plurality, gestation_weeks, year, month, CASE WHEN day IS NULL AND wday IS NULL THEN 0 ELSE CASE WHEN day IS NULL THEN wday ELSE wday END END AS date, IFNULL(state, "Unknown") AS state, IFNULL(mother_birth_state, "Unknown") AS mother_birth_state FROM publicdata.samples.natality WHERE year > 2000) SELECT weight_pounds, is_male, mother_age, plurality, gestation_weeks, FARM_FINGERPRINT(CONCAT(CAST(year AS STRING), CAST(month AS STRING), CAST(date AS STRING), CAST(state AS STRING), CAST(mother_birth_state AS STRING))) AS hashvalues FROM CTE_hash_cols_fixed from google.cloud import bigquery bq = bigquery.Client(project = PROJECT) df = bq.query("SELECT hashvalues, COUNT(weight_pounds) AS num_babies FROM (" + query_string + ") GROUP BY hashvalues").to_dataframe() print("There are {} unique hashvalues.".format(len(df))) df.head() sampling_percentages_query = WITH -- Get label, features, and column that we are going to use to split into buckets on CTE_hash_cols_fixed AS ( SELECT weight_pounds, is_male, mother_age, plurality, gestation_weeks, year, month, CASE WHEN day IS NULL AND wday IS NULL THEN 0 ELSE CASE WHEN day IS NULL THEN wday ELSE wday END END AS date, IFNULL(state, "Unknown") AS state, IFNULL(mother_birth_state, "Unknown") AS mother_birth_state FROM publicdata.samples.natality WHERE year > 2000), CTE_data AS ( SELECT weight_pounds, is_male, mother_age, plurality, gestation_weeks, FARM_FINGERPRINT(CONCAT(CAST(year AS STRING), CAST(month AS STRING), CAST(date AS STRING), CAST(state AS STRING), CAST(mother_birth_state AS STRING))) AS hashvalues FROM CTE_hash_cols_fixed), -- Get the counts of each of the unique hashs of our splitting column CTE_first_bucketing AS ( SELECT hashvalues, COUNT(*) AS num_records FROM CTE_data GROUP BY hashvalues ), -- Get the number of records in each of the hash buckets CTE_second_bucketing AS ( SELECT ABS(MOD(hashvalues, {0})) AS bucket_index, SUM(num_records) AS num_records FROM CTE_first_bucketing GROUP BY ABS(MOD(hashvalues, {0}))), -- Calculate the overall percentages CTE_percentages AS ( SELECT bucket_index, num_records, CAST(num_records AS FLOAT64) / ( SELECT SUM(num_records) FROM CTE_second_bucketing) AS percent_records FROM CTE_second_bucketing ), -- Choose which of the hash buckets will be used for training and pull in their statistics CTE_train AS ( SELECT *, "train" AS dataset_name FROM CTE_percentages WHERE bucket_index >= 0 AND bucket_index < {1}), -- Choose which of the hash buckets will be used for validation and pull in their statistics CTE_eval AS ( SELECT *, "eval" AS dataset_name FROM CTE_percentages WHERE bucket_index >= {1} AND bucket_index < {2}), -- Choose which of the hash buckets will be used for testing and pull in their statistics CTE_test AS ( SELECT *, "test" AS dataset_name FROM CTE_percentages WHERE bucket_index >= {2} AND bucket_index < {0}), -- Union the training, validation, and testing dataset statistics CTE_union AS ( SELECT 0 AS dataset_id, * FROM CTE_train UNION ALL SELECT 1 AS dataset_id, * FROM CTE_eval UNION ALL SELECT 2 AS dataset_id, * FROM CTE_test ), -- Show final splitting and associated statistics CTE_split AS ( SELECT dataset_id, dataset_name, SUM(num_records) AS num_records, SUM(percent_records) AS percent_records FROM CTE_union GROUP BY dataset_id, dataset_name ) SELECT * FROM CTE_split ORDER BY dataset_id modulo_divisor = 100 train_percent = 80.0 eval_percent = 10.0 train_buckets = int(modulo_divisor * train_percent / 100.0) eval_buckets = int(modulo_divisor * eval_percent / 100.0) df = bq.query(sampling_percentages_query.format(modulo_divisor, train_buckets, train_buckets + eval_buckets)).to_dataframe() df.head() # Added every_n so that we can now subsample from each of the hash values to get approximately the record counts we want every_n = 500 train_query = "SELECT * FROM ({0}) WHERE ABS(MOD(hashvalues, {1} * 100)) < 80".format(query_string, every_n) eval_query = "SELECT * FROM ({0}) WHERE ABS(MOD(hashvalues, {1} * 100)) >= 80 AND ABS(MOD(hashvalues, {1} * 100)) < 90".format(query_string, every_n) test_query = "SELECT * FROM ({0}) WHERE ABS(MOD(hashvalues, {1} * 100)) >= 90 AND ABS(MOD(hashvalues, {1} * 100)) < 100".format(query_string, every_n) train_df = bq.query(train_query).to_dataframe() eval_df = bq.query(eval_query).to_dataframe() test_df = bq.query(test_query).to_dataframe() print("There are {} examples in the train dataset.".format(len(train_df))) print("There are {} examples in the validation dataset.".format(len(eval_df))) print("There are {} examples in the test dataset.".format(len(test_df))) train_df.head() train_df.describe() import pandas as pd def preprocess(df): # Clean up data # Remove what we don"t want to use for training df = df[df.weight_pounds > 0] df = df[df.mother_age > 0] df = df[df.gestation_weeks > 0] df = df[df.plurality > 0] # Modify plurality field to be a string twins_etc = dict(zip([1,2,3,4,5], ["Single(1)", "Twins(2)", "Triplets(3)", "Quadruplets(4)", "Quintuplets(5)"])) df["plurality"].replace(twins_etc, inplace = True) # Now create extra rows to simulate lack of ultrasound no_ultrasound = df.copy(deep = True) no_ultrasound.loc[no_ultrasound["plurality"] != "Single(1)", "plurality"] = "Multiple(2+)" no_ultrasound["is_male"] = "Unknown" # Concatenate both datasets together and shuffle return pd.concat([df, no_ultrasound]).sample(frac=1).reset_index(drop=True) train_df = preprocess(train_df) eval_df = preprocess(eval_df) test_df = preprocess(test_df) train_df.head() train_df.tail() train_df.describe() columns = "weight_pounds,is_male,mother_age,plurality,gestation_weeks".split(',') train_df.to_csv(path_or_buf = "train.csv", columns = columns, header = False, index = False) eval_df.to_csv(path_or_buf = "eval.csv", columns = columns, header = False, index = False) test_df.to_csv(path_or_buf = "test.csv", columns = columns, header = False, index = False) %%bash wc -l *.csv %%bash head *.csv %%bash tail *.csv <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's do a basic statistical calculation on the data using code! Run the block of code below to calculate the average "Food Pinching Efficiency" for all 31 participants and all chopstick lengths. Step2: This number is helpful, but the number doesn't let us know which of the chopstick lengths performed best for the thirty-one male junior college students. Let's break down the data by chopstick length. The next block of code will generate the average "Food Pinching Effeciency" for each chopstick length. Run the block of code below. Step3: 5. Which chopstick length performed the best for the group of thirty-one male junior college students?
<ASSISTANT_TASK:> Python Code: import pandas as pd # pandas is a software library for data manipulation and analysis # We commonly use shorter nicknames for certain packages. Pandas is often abbreviated to pd. # hit shift + enter to run this cell or block of code path = r'./chopstick-effectiveness.csv' # Change the path to the location where the chopstick-effectiveness.csv file is located on your computer. # If you get an error when running this block of code, be sure the chopstick-effectiveness.csv is located at the path on your computer. dataFrame = pd.read_csv(path) dataFrame dataFrame['Food.Pinching.Efficiency'].mean() meansByChopstickLength = dataFrame.groupby('Chopstick.Length')['Food.Pinching.Efficiency'].mean().reset_index() meansByChopstickLength # reset_index() changes Chopstick.Length from an index to column. Instead of the index being the length of the chopsticks, the index is the row numbers 0, 1, 2, 3, 4, 5. # Causes plots to display within the notebook rather than in a new window %pylab inline import matplotlib.pyplot as plt plt.scatter(x=meansByChopstickLength['Chopstick.Length'], y=meansByChopstickLength['Food.Pinching.Efficiency']) # title="") plt.xlabel("Length in mm") plt.ylabel("Efficiency in PPPC") plt.title("Average Food Pinching Efficiency by Chopstick Length") plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Visualising Simple Time Series Data Step2: Since the Order_Date variable is in the orders dataframe, let's merge it. Step3: Since Order_Date is a string, we need to convert it into a datetime object. You can do that using pd.to_datetime(). Step4: Now, since on each day, multiple orders were placed, we need to aggregate Sales using a metric such as mean, median etc., and then create a time series plot. Step5: We can now create a time-series plot using sns.tsplot(). Step6: Using Derived Date Metrics for Visualisation Step7: Now you can plot the average sales across years and months. Step8: There is another way to visualise numeric variables, such as Sales, across the year and month. We can pivot the month column to create a wide-format dataframe, and then plot a heatmap. Step9: You can now create a heatmap using sns.heatmap().
<ASSISTANT_TASK:> Python Code: # loading libraries and reading the data import numpy as np import pandas as pd import matplotlib.pyplot as plt import seaborn as sns # set seaborn theme if you prefer sns.set(style="white") # read data market_df = pd.read_csv("./global_sales_data/market_fact.csv") customer_df = pd.read_csv("./global_sales_data/cust_dimen.csv") product_df = pd.read_csv("./global_sales_data/prod_dimen.csv") shipping_df = pd.read_csv("./global_sales_data/shipping_dimen.csv") orders_df = pd.read_csv("./global_sales_data/orders_dimen.csv") market_df.head() # merging with the Orders data to get the Date column df = pd.merge(market_df, orders_df, how='inner', on='Ord_id') df.head() # Now we have the Order_Date in the df # It is stored as a string (object) currently df.info() # Convert Order_Date to datetime type df['Order_Date'] = pd.to_datetime(df['Order_Date']) # Order_Date is now datetime type df.info() # aggregating total sales on each day time_df = df.groupby('Order_Date')['Sales'].sum() print(time_df.head()) print(type(time_df)) # time series plot # figure size plt.figure(figsize=(16, 8)) # tsplot sns.tsplot(data=time_df) plt.show() # extracting month and year from date # extract month df['month'] = df['Order_Date'].dt.month # extract year df['year'] = df['Order_Date'].dt.year df.head() # grouping by year and month df_time = df.groupby(["year", "month"]).Sales.mean() df_time.head() plt.figure(figsize=(8, 6)) # time series plot sns.tsplot(df_time) plt.xlabel("Time") plt.ylabel("Sales") plt.show() # Pivoting the data using 'month' year_month = pd.pivot_table(df, values='Sales', index='year', columns='month', aggfunc='mean') year_month.head() # figure size plt.figure(figsize=(12, 8)) # heatmap with a color map of choice sns.heatmap(year_month, cmap="YlGnBu") plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Now let's set the projection to '3d', set the range for the viewing angles and disable pad_aspect (as it doesn't play nicely with animations).
<ASSISTANT_TASK:> Python Code: import autofig import numpy as np import phoebe # PHOEBE 2.1.0 #autofig.inline() times = np.linspace(0,1,21) # create an "interesting" system in PHOEBE b = phoebe.default_binary() b.set_value('incl@orbit', 75) b.set_value('q', 0.5) b.set_value('requiv@secondary', 0.6) # add datasets and compute the model b.add_dataset('orb', times=times) b.add_dataset('rv', times=times, datset='rv01') b.add_dataset('mesh', times=[], include_times=['rv01'], columns=['rvs@rv01']) b.run_compute(irrad_method='none') autofig.reset() for c in ['primary', 'secondary']: xs = b.get_value(component=c, qualifier='us', context='model', kind='orb') ys = b.get_value(component=c, qualifier='vs', context='model', kind='orb') zs = b.get_value(component=c, qualifier='ws', context='model', kind='orb') rvs = b.get_value(component=c, qualifier='rvs', context='model', kind='rv') # plot the orbit with RV as the color autofig.plot(xs, ys, zs, i=times, xlabel='x', xunit='solRad', ylabel='y', yunit='solRad', c=rvs, cmap='bwr', clabel='rv', cunit='solRad/d', s=0.03, highlight=False, uncover=True, trail=0.3, linestyle='solid', marker='none') for t in times: verts = b.get_value(time=t, component=c, qualifier='uvw_elements', context='model') rvs = b.get_value(time=t, component=c, qualifier='rvs', context='model') xs = verts[:, :, 0] ys = verts[:, :, 1] zs = verts[:, :, 2] # plot the mesh at this time, with RV as facecolor autofig.mesh(x=xs, y=ys, z=zs, i=t, xlabel='x', xunit='solRad', ylabel='y', yunit='solRad', fc=rvs, fcmap='bwr', fclim='symmetric', fclabel='rv', fcunit='solRad/d', ec='none') mplfig = autofig.draw(i=times[5], save='phoebe_meshes_3d.png') autofig.gcf().axes.pad_aspect = False autofig.gcf().axes.projection = '3d' autofig.gcf().axes.elev.value = [0, 30] autofig.gcf().axes.azim.value = [-75, 0] anim = autofig.animate(i=times, tight_layout=False, save='phoebe_meshes_3d.gif', save_kwargs={'writer': 'imagemagick'}) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load the text8 dataset, a file of cleaned up Wikipedia articles from Matt Mahoney. The next cell will download the data set to the data folder. Then you can extract it and delete the archive file to save storage space. Step2: Preprocessing Step3: And here I'm creating dictionaries to covert words to integers and backwards, integers to words. The integers are assigned in descending frequency order, so the most frequent word ("the") is given the integer 0 and the next most frequent is 1 and so on. The words are converted to integers and stored in the list int_words. Step4: Subsampling Step5: Making batches Step6: Here's a function that returns batches for our network. The idea is that it grabs batch_size words from a words list. Then for each of those words, it gets the target words in the window. I haven't found a way to pass in a random number of target words and get it to work with the architecture, so I make one row per input-target pair. This is a generator function by the way, helps save memory. Step7: Building the graph Step8: Embedding Step9: Negative sampling Step10: Validation Step11: Training Step12: Restore the trained network if you need to Step13: Visualizing the word vectors
<ASSISTANT_TASK:> Python Code: import time import numpy as np import tensorflow as tf import utils from urllib.request import urlretrieve from os.path import isfile, isdir from tqdm import tqdm import zipfile dataset_folder_path = 'data' dataset_filename = 'text8.zip' dataset_name = 'Text8 Dataset' class DLProgress(tqdm): last_block = 0 def hook(self, block_num=1, block_size=1, total_size=None): self.total = total_size self.update((block_num - self.last_block) * block_size) self.last_block = block_num if not isfile(dataset_filename): with DLProgress(unit='B', unit_scale=True, miniters=1, desc=dataset_name) as pbar: urlretrieve( 'http://mattmahoney.net/dc/text8.zip', dataset_filename, pbar.hook) if not isdir(dataset_folder_path): with zipfile.ZipFile(dataset_filename) as zip_ref: zip_ref.extractall(dataset_folder_path) with open('data/text8') as f: text = f.read() words = utils.preprocess(text) print(words[:30]) print("Total words: {}".format(len(words))) print("Unique words: {}".format(len(set(words)))) vocab_to_int, int_to_vocab = utils.create_lookup_tables(words) int_words = [vocab_to_int[word] for word in words] print(int_words[:100]) print(len(int_words)) from collections import Counter import random def train_word(word_list, t): wordCountDict= Counter(int_words) wordFrenDict={} F_word = {} for word, count in wordCountDict.items(): wordFrenDict[word] = count/total_count for word in word_counts: F_word[word] = 1 - np.sqrt(t / wordFrenDict[word]) return F_word ## Your code here word_set = train_word(int_words, 0.00005) train_words = [] train_words = [word for word in int_words if random.random() < (1 - word_set[word])] print(train_words[:10]) import random def get_target(words, idx, window_size=5): ''' Get a list of words in a window around an index. ''' # Your code here rand = np.random.randint(1,window_size+1) begin = idx - rand if (idx - rand) > 0 else 0 end = idx + rand target = list(set(words[begin:idx] + words[idx+1:end+1])) #print(target) return target def get_batches(words, batch_size, window_size=5): ''' Create a generator of word batches as a tuple (inputs, targets) ''' n_batches = len(words)//batch_size # only full batches words = words[:n_batches*batch_size] for idx in range(0, len(words), batch_size): x, y = [], [] batch = words[idx:idx+batch_size] for ii in range(len(batch)): batch_x = batch[ii] batch_y = get_target(batch, ii, window_size) y.extend(batch_y) x.extend([batch_x]*len(batch_y)) yield x, y train_graph = tf.Graph() with train_graph.as_default(): inputs = tf.placeholder(tf.int32, [None], name='inputs') labels = tf.placeholder(tf.int32, [None, None], name='labels') n_vocab = len(int_to_vocab) n_embedding = 250# Number of embedding features with train_graph.as_default(): embedding = tf.Variable(tf.random_uniform((n_vocab, n_embedding), -1, 1)) embed = tf.nn.embedding_lookup(embedding, inputs) # Number of negative labels to sample n_sampled = 100 with train_graph.as_default(): softmax_w = tf.Variable(tf.truncated_normal((n_vocab, n_embedding), stddev=0.1)) softmax_b = tf.Variable(tf.zeros(n_vocab)) # Calculate the loss using negative sampling loss = tf.nn.sampled_softmax_loss(softmax_w, softmax_b, labels, embed, n_sampled, n_vocab) cost = tf.reduce_mean(loss) optimizer = tf.train.AdamOptimizer().minimize(cost) with train_graph.as_default(): ## From Thushan Ganegedara's implementation valid_size = 16 # Random set of words to evaluate similarity on. valid_window = 100 # pick 8 samples from (0,100) and (1000,1100) each ranges. lower id implies more frequent valid_examples = np.array(random.sample(range(valid_window), valid_size//2)) valid_examples = np.append(valid_examples, random.sample(range(1000,1000+valid_window), valid_size//2)) valid_dataset = tf.constant(valid_examples, dtype=tf.int32) # We use the cosine distance: norm = tf.sqrt(tf.reduce_sum(tf.square(embedding), 1, keep_dims=True)) normalized_embedding = embedding / norm valid_embedding = tf.nn.embedding_lookup(normalized_embedding, valid_dataset) similarity = tf.matmul(valid_embedding, tf.transpose(normalized_embedding)) # If the checkpoints directory doesn't exist: !mkdir checkpoints epochs = 10 batch_size = 1000 window_size = 10 with train_graph.as_default(): saver = tf.train.Saver() with tf.Session(graph=train_graph) as sess: iteration = 1 loss = 0 sess.run(tf.global_variables_initializer()) for e in range(1, epochs+1): batches = get_batches(train_words, batch_size, window_size) start = time.time() for x, y in batches: feed = {inputs: x, labels: np.array(y)[:, None]} train_loss, _ = sess.run([cost, optimizer], feed_dict=feed) loss += train_loss if iteration % 100 == 0: end = time.time() print("Epoch {}/{}".format(e, epochs), "Iteration: {}".format(iteration), "Avg. Training loss: {:.4f}".format(loss/100), "{:.4f} sec/batch".format((end-start)/100)) loss = 0 start = time.time() if iteration % 1000 == 0: ## From Thushan Ganegedara's implementation # note that this is expensive (~20% slowdown if computed every 500 steps) sim = similarity.eval() for i in range(valid_size): valid_word = int_to_vocab[valid_examples[i]] top_k = 8 # number of nearest neighbors nearest = (-sim[i, :]).argsort()[1:top_k+1] log = 'Nearest to %s:' % valid_word for k in range(top_k): close_word = int_to_vocab[nearest[k]] log = '%s %s,' % (log, close_word) print(log) iteration += 1 save_path = saver.save(sess, "checkpoints/text8.ckpt") embed_mat = sess.run(normalized_embedding) with train_graph.as_default(): saver = tf.train.Saver() with tf.Session(graph=train_graph) as sess: saver.restore(sess, tf.train.latest_checkpoint('checkpoints')) embed_mat = sess.run(embedding) %matplotlib inline %config InlineBackend.figure_format = 'retina' import matplotlib.pyplot as plt from sklearn.manifold import TSNE viz_words = 500 tsne = TSNE() embed_tsne = tsne.fit_transform(embed_mat[:viz_words, :]) fig, ax = plt.subplots(figsize=(14, 14)) for idx in range(viz_words): plt.scatter(*embed_tsne[idx, :], color='steelblue') plt.annotate(int_to_vocab[idx], (embed_tsne[idx, 0], embed_tsne[idx, 1]), alpha=0.7) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 0.1 Verta import and setup Step2: 1. Model training Step3: 1.2 Define hyperparams Step4: 1.3 Train/test code Step5: 2. Register Model for deployment Step6: 3. Deploy model to endpoint
<ASSISTANT_TASK:> Python Code: from __future__ import print_function import warnings from sklearn.exceptions import ConvergenceWarning warnings.filterwarnings("ignore", category=ConvergenceWarning) warnings.filterwarnings("ignore", category=FutureWarning) import itertools import os import time import six import numpy as np import pandas as pd import sklearn from sklearn import model_selection from sklearn import linear_model from sklearn import metrics import xgboost as xgb # restart your notebook if prompted on Colab try: import verta except ImportError: !pip install verta import os # Ensure credentials are set up, if not, use below # os.environ['VERTA_EMAIL'] = # os.environ['VERTA_DEV_KEY'] = # os.environ['VERTA_HOST'] = from verta import Client PROJECT_NAME = "Census" EXPERIMENT_NAME = "sklearn + xgboost" client = Client(os.environ['VERTA_HOST']) proj = client.set_project(PROJECT_NAME) expt = client.set_experiment(EXPERIMENT_NAME) try: import wget except ImportError: !pip install wget # you may need pip3 import wget train_data_url = "http://s3.amazonaws.com/verta-starter/census-train.csv" train_data_filename = wget.detect_filename(train_data_url) if not os.path.isfile(train_data_filename): wget.download(train_data_url) test_data_url = "http://s3.amazonaws.com/verta-starter/census-test.csv" test_data_filename = wget.detect_filename(test_data_url) if not os.path.isfile(test_data_filename): wget.download(test_data_url) df_train = pd.read_csv(train_data_filename) X_train_hpw = df_train.drop(columns=["hours-per-week", ">50k"]) # predict hours per week y_train_hpw = df_train["hours-per-week"] X_train_income = df_train.drop(columns=["hours-per-week", ">50k"]) y_train_income = df_train[">50k"] X_train_income.head() hyperparam_candidates = { 'C': [1e-6, 1e-4], 'solver': ['lbfgs'], 'max_iter': [15, 28], } hyperparam_sets = [dict(zip(hyperparam_candidates.keys(), values)) for values in itertools.product(*hyperparam_candidates.values())] def run_experiment(hyperparams, X_train, y_train): # create object to track experiment run run = client.set_experiment_run() # create validation split (X_val_train, X_val_test, y_val_train, y_val_test) = model_selection.train_test_split(X_train, y_train, test_size=0.2, shuffle=True) # log hyperparameters run.log_hyperparameters(hyperparams) print(hyperparams, end=' ') # create and train model model = linear_model.LogisticRegression(**hyperparams) model.fit(X_train, y_train) # calculate and log validation accuracy val_acc = model.score(X_val_test, y_val_test) run.log_metric("val_acc", val_acc) print("Validation accuracy: {:.4f}".format(val_acc)) # NOTE: run_experiment() could also be defined in a module, and executed in parallel for hyperparams in hyperparam_sets: run_experiment(hyperparams, X_train_hpw, y_train_hpw) best_run = expt.expt_runs.sort("metrics.val_acc", descending=True)[0] print("Validation Accuracy: {:.4f}".format(best_run.get_metric("val_acc"))) best_hyperparams = best_run.get_hyperparameters() print("Hyperparameters: {}".format(best_hyperparams)) model = linear_model.LogisticRegression(multi_class='auto', **best_hyperparams) model.fit(X_train_hpw, y_train_hpw) train_acc = model.score(X_train_hpw, y_train_hpw) predicted_hpw = model.predict(X_train_hpw) print("Training accuracy: {:.4f}".format(train_acc)) pd.DataFrame(predicted_hpw, index=X_train_hpw.index) X_train_income_prediction = pd.concat([X_train_income, pd.DataFrame( predicted_hpw, columns=["predicted_hpw"], index=X_train_income.index)], axis=1) dtrain = xgb.DMatrix(X_train_income_prediction, label=y_train_income) grid = model_selection.ParameterGrid({ 'eta': [0.5, 0.7], 'max_depth': [1, 2, 3], 'num_class': [10], }) EXPERIMENT_NAME = "XGBoost" client.set_experiment(EXPERIMENT_NAME) def run_experiment(hyperparams, X_train, y_train): run = client.set_experiment_run() # log hyperparameters run.log_hyperparameters(hyperparams) # run cross validation on hyperparameters cv_history = xgb.cv(hyperparams, dtrain, nfold=5, metrics=("merror", "mlogloss")) # log observations from each iteration for _, iteration in cv_history.iterrows(): for obs, val in iteration.iteritems(): run.log_observation(obs, val) # log error from final iteration final_val_error = iteration['test-merror-mean'] run.log_metric("val_error", final_val_error) print("{} Mean error: {:.4f}".format(hyperparams, final_val_error)) # NOTE: run_experiment() could also be defined in a module, and executed in parallel for hyperparams in grid: run_experiment( hyperparams, X_train_income_prediction.to_numpy(), y_train_income.to_numpy()) income_model = xgb.XGBClassifier(**best_hyperparams) income_model.fit(X_train_income_prediction.to_numpy(), y_train_income.to_numpy()) registered_model = client.get_or_create_registered_model( name="census", labels=["xgboost", "sklearn"]) hpw_model = model from verta.registry import VertaModelBase class CensusTwoStep(VertaModelBase): def __init__(self, artifacts): import cloudpickle self.hpw_model = cloudpickle.load( open(artifacts["hpw_model"], "rb")) self.income_model = cloudpickle.load( open(artifacts["income_model"], "rb")) def predict(self, batch_input): import numpy as np results = [] for one_input in batch_input: output = self.hpw_model.predict(one_input) output = np.concatenate((np.array(one_input), np.reshape(output, (-1,1))), axis=1) output = self.income_model.predict(output) results.append(output) return results import cloudpickle cloudpickle.dump(income_model, open("income_model.pkl", "wb")) cloudpickle.dump(hpw_model, open("hpw_model.pkl", "wb")) my_model = CensusTwoStep( { "hpw_model" : "hpw_model.pkl", "income_model" : "income_model.pkl" }) my_model.predict([X_train_hpw.values.tolist()[:5]]) from verta.environment import Python model_version = registered_model.create_standard_model( model_cls=CensusTwoStep, environment=Python(requirements=["sklearn", "xgboost"]), artifacts={ "hpw_model" : hpw_model, "income_model" : income_model }, name="v6" ) model_version census_multiple_endpoint = client.get_or_create_endpoint("census-multiple") census_multiple_endpoint.update(model_version, wait=True) deployed_model = census_multiple_endpoint.get_deployed_model() deployed_model.predict([X_train_hpw.values.tolist()[:5]]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Remove all grades below 0 or above 100 Step2: Note that UBC has grade boundaries that narrow for higher marks. Just counting the number in each bin and plotting it is seriously misleading if you expect the area of the bin to be proportional to the number in the bin. Step3: matplotlib accepts a "normed=True" flag that divides by the total number and the bin width, so that the histogram area integrates to 1. Step4: If we want to put numbers/(bin width) on the y axis, we need to first do the histogram then divide the counts in each bin by the bin width before plotting Step5: An idealized satellite sensor Step6: 2) read the file in using np.loadtxt Step7: The total $W/m^2$ is just the number measurements multiplied by 0.01 Joules for each measurement Step8: Now histogram the photon counts
<ASSISTANT_TASK:> Python Code: %matplotlib inline import numpy.random as nr import numpy as np from matplotlib import pyplot as plt the_mean=75 the_sigma=20. numpoints=1000 outRandom=nr.normal(the_mean,the_sigma,[numpoints,]) outRandom=outRandom[outRandom <= 100.] outRandom=outRandom[outRandom >= 0.] # # histogram these 1000 grades into 1000 bins with uniform width # fig,ax = plt.subplots(1,1) bin_edges=np.linspace(0,100,21,endpoint=True) ax.hist(outRandom,bins=bin_edges) _=ax.set(title='Grade distribution',xlabel='mark (%)',ylabel='Number in bin') # # make a dictionary to hold the grade boundaries # bounds={'a+':90,'a':85,'a-':80,'b+':76,'b':72,'b-':68,'c+':64,'c':60,'c-':55,'d':50} bounds=list(bounds.values()) bounds.sort() # # add the high and low edges # bounds.insert(0,0) bounds.append(100) fig,ax = plt.subplots(1,1) out=ax.hist(outRandom,bins=bounds) _=ax.set(title='Grade distribution UBC',xlabel='mark (%)',ylabel='Number in bin') fig,ax = plt.subplots(1,1) out=ax.hist(outRandom,bins=bounds,normed=True) fig,ax = plt.subplots(1,1) counts,edges=np.histogram(outRandom,bins=bounds) widths=np.diff(edges) counts_dens=counts/widths left_edge = edges[:-1] out=ax.bar(left_edge,counts_dens,width=widths) _=ax.set(title='Grade density histogram UBC',xlabel='mark (%)',ylabel='Number in bin/(%)') from a301utils.a301_readfile import download download('photon_data.csv') bin_wavelengths = np.loadtxt('photon_data.csv') bin_wavelengths[:10] total_counts = len(bin_wavelengths) total_flux = total_counts*0.01 total_flux fig,ax = plt.subplots(1,1) # # 51 edges from 0.1 to 60 microns # edges = np.linspace(0.1,60,51) counts,edges=np.histogram(bin_wavelengths,bins=edges) widths=np.diff(edges) counts_dens=counts/widths/total_counts*total_flux left_edge = edges[:-1] out=ax.bar(left_edge,counts_dens,width=widths) _=ax.set(title='Flux density ($W/m^2/\mu m$)',xlabel='wavelength ($\mu m$)',ylabel='$E_\lambda\ (W/m^2/\mu m)$') # # put the Planck curve on top of this # from a301lib.radiation import planckwavelen Temp=300 #Kelvin Elambda = planckwavelen(edges*1.e-6,Temp)*1.e-6 #convert from W/m^2/m to W/m^2/micron ax.plot(edges,Elambda,linewidth=4,label='Planck curve') _=ax.legend() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Explore the Data Step2: View the data types of each column Step3: Type 'object' is a string for pandas, which poses problems with machine learning algorithms. If we want to use these as features, we'll need to convert these to number representations. Step4: Age, Cabin, and Embarked are missing values. Cabin has too many missing values, whereas we might be able to infer values for Age and Embarked. Step5: Now that we have a general idea of the data set contents, we can dive deeper into each column. We'll be doing exploratory data analysis and cleaning data to setup 'features' we'll be using in our machine learning algorithms. Step6: Next we'll explore various features to view their impact on survival rates. Step7: Plot the cross tab Step8: We can see that passenger class seems to have a significant impact on whether a passenger survived. Those in First Class the highest chance for survival. Step9: Transform Sex from a string to a number representation Step10: Plot a normalized cross tab for Sex_Val and Survived Step11: The majority of females survived, whereas the majority of males did not. Step12: Plot survival rate by Sex and Pclass Step13: The vast majority of females in First and Second class survived. Males in First class had the highest chance for survival. Step14: Prepare to map Embarked from a string to a number representation Step15: Transform Embarked from a string to a number representation to prepare it for machine learning algorithms Step16: Plot the histogram for Embarked_Val Step17: Since the vast majority of passengers embarked in 'S' Step18: Verify we do not have any more NaNs for Embarked_Val Step19: Plot a normalized cross tab for Embarked_Val and Survived Step20: It appears those that embarked in location 'C' Step21: Leaving Embarked as integers implies ordering in the values, which does not exist. Another way to represent Embarked without ordering is to create dummy variables Step22: Feature Step23: Determine the Age typical for each passenger class by Sex_Val. We'll use the median instead of the mean because the Age histogram seems to be right skewed. Step24: Ensure AgeFill does not contain any missing values Step25: Plot a normalized cross tab for AgeFill and Survived Step26: Unfortunately, the graphs above do not seem to clearly show any insights. We'll keep digging further. Step27: When looking at AgeFill density by Pclass, we see the first class passengers were generally older then second class passengers, which in turn were older than third class passengers. We've determined that first class passengers had a higher survival rate than second class passengers, which in turn had a higher survival rate than third class passengers. Step28: In the first graph, we see that most survivors come from the 20's to 30's age ranges and might be explained by the following two graphs. The second graph shows most females are within their 20's. The third graph shows most first class passengers are within their 30's. Step29: Plot a histogram of FamilySize Step30: Plot a histogram of AgeFill segmented by Survived Step31: Based on the histograms, it is not immediately obvious what impact FamilySize has on survival. The machine learning algorithms might benefit from this feature. Step32: Drop the columns we won't use Step33: Drop the following columns Step34: Convert the DataFrame to a numpy array Step35: Data Wrangling Summary Step36: Random Forest Step37: Fit the training data and create the decision trees Step38: Random Forest Step39: Note the test data does not contain the column 'Survived', we'll use our trained model to predict these values. Step40: Take the decision trees and run it on the test data Step41: Random Forest Step42: Evaluate Model Accuracy Step43: Use the new training data to fit the model, predict, and get the accuracy score Step44: View the Confusion Matrix Step45: Get the model score and confusion matrix Step46: Display the classification report
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import pylab as plt # Set the global default size of matplotlib figures plt.rc('figure', figsize=(10, 5)) # Size of matplotlib figures that contain subplots fizsize_with_subplots = (10, 10) # Size of matplotlib histogram bins bin_size = 10 df_train = pd.read_csv('../data/titanic/train.csv') df_train.head() df_train.tail() df_train.dtypes df_train.info() df_train.describe() # Set up a grid of plots fig = plt.figure(figsize=fizsize_with_subplots) fig_dims = (3, 2) # Plot death and survival counts plt.subplot2grid(fig_dims, (0, 0)) df_train['Survived'].value_counts().plot(kind='bar', title='Death and Survival Counts') # Plot Pclass counts plt.subplot2grid(fig_dims, (0, 1)) df_train['Pclass'].value_counts().plot(kind='bar', title='Passenger Class Counts') # Plot Sex counts plt.subplot2grid(fig_dims, (1, 0)) df_train['Sex'].value_counts().plot(kind='bar', title='Gender Counts') plt.xticks(rotation=0) # Plot Embarked counts plt.subplot2grid(fig_dims, (1, 1)) df_train['Embarked'].value_counts().plot(kind='bar', title='Ports of Embarkation Counts') # Plot the Age histogram plt.subplot2grid(fig_dims, (2, 0)) df_train['Age'].hist() plt.title('Age Histogram') pclass_xt = pd.crosstab(df_train['Pclass'], df_train['Survived']) pclass_xt # Normalize the cross tab to sum to 1: pclass_xt_pct = pclass_xt.div(pclass_xt.sum(1).astype(float), axis=0) pclass_xt_pct.plot(kind='bar', stacked=True, title='Survival Rate by Passenger Classes') plt.xlabel('Passenger Class') plt.ylabel('Survival Rate') sexes = sorted(df_train['Sex'].unique()) genders_mapping = dict(zip(sexes, range(0, len(sexes) + 1))) genders_mapping df_train['Sex_Val'] = df_train['Sex'].map(genders_mapping).astype(int) df_train.head() sex_val_xt = pd.crosstab(df_train['Sex_Val'], df_train['Survived']) sex_val_xt_pct = sex_val_xt.div(sex_val_xt.sum(1).astype(float), axis=0) sex_val_xt_pct.plot(kind='bar', stacked=True, title='Survival Rate by Gender') # Get the unique values of Pclass: passenger_classes = sorted(df_train['Pclass'].unique()) for p_class in passenger_classes: print 'M: ', p_class, len(df_train[(df_train['Sex'] == 'male') & (df_train['Pclass'] == p_class)]) print 'F: ', p_class, len(df_train[(df_train['Sex'] == 'female') & (df_train['Pclass'] == p_class)]) # Plot survival rate by Sex females_df = df_train[df_train['Sex'] == 'female'] females_xt = pd.crosstab(females_df['Pclass'], df_train['Survived']) females_xt_pct = females_xt.div(females_xt.sum(1).astype(float), axis=0) females_xt_pct.plot(kind='bar', stacked=True, title='Female Survival Rate by Passenger Class') plt.xlabel('Passenger Class') plt.ylabel('Survival Rate') # Plot survival rate by Pclass males_df = df_train[df_train['Sex'] == 'male'] males_xt = pd.crosstab(males_df['Pclass'], df_train['Survived']) males_xt_pct = males_xt.div(males_xt.sum(1).astype(float), axis=0) males_xt_pct.plot(kind='bar', stacked=True, title='Male Survival Rate by Passenger Class') plt.xlabel('Passenger Class') plt.ylabel('Survival Rate') df_train[df_train['Embarked'].isnull()] # Get the unique values of Embarked embarked_locs = sorted(df_train['Embarked'].unique()) embarked_locs_mapping = dict(zip(embarked_locs, range(0, len(embarked_locs) + 1))) embarked_locs_mapping df_train['Embarked_Val'] = df_train['Embarked'] \ .map(embarked_locs_mapping) \ .astype(int) df_train.head() df_train['Embarked_Val'].hist(bins=len(embarked_locs), range=(0, 3)) plt.title('Port of Embarkation Histogram') plt.xlabel('Port of Embarkation') plt.ylabel('Count') plt.show() if len(df_train[df_train['Embarked'].isnull()] > 0): df_train.replace({'Embarked_Val' : { embarked_locs_mapping[nan] : embarked_locs_mapping['S'] } }, inplace=True) embarked_locs = sorted(df_train['Embarked_Val'].unique()) embarked_locs embarked_val_xt = pd.crosstab(df_train['Embarked_Val'], df_train['Survived']) embarked_val_xt_pct = \ embarked_val_xt.div(embarked_val_xt.sum(1).astype(float), axis=0) embarked_val_xt_pct.plot(kind='bar', stacked=True) plt.title('Survival Rate by Port of Embarkation') plt.xlabel('Port of Embarkation') plt.ylabel('Survival Rate') # Set up a grid of plots fig = plt.figure(figsize=fizsize_with_subplots) rows = 2 cols = 3 col_names = ('Sex_Val', 'Pclass') for portIdx in embarked_locs: for colIdx in range(0, len(col_names)): plt.subplot2grid((rows, cols), (colIdx, portIdx - 1)) df_train[df_train['Embarked_Val'] == portIdx][col_names[colIdx]] \ .value_counts().plot(kind='bar') df_train = pd.concat([df_train, pd.get_dummies(df_train['Embarked_Val'], prefix='Embarked_Val')], axis=1) df_train[df_train['Age'].isnull()][['Sex', 'Pclass', 'Age']].head() # To keep Age in tact, make a copy of it called AgeFill # that we will use to fill in the missing ages: df_train['AgeFill'] = df_train['Age'] # Populate AgeFill df_train['AgeFill'] = df_train['AgeFill'] \ .groupby([df_train['Sex_Val'], df_train['Pclass']]) \ .apply(lambda x: x.fillna(x.median())) len(df_train[df_train['AgeFill'].isnull()]) # Set up a grid of plots fig, axes = plt.subplots(2, 1, figsize=fizsize_with_subplots) # Histogram of AgeFill segmented by Survived df1 = df_train[df_train['Survived'] == 0]['Age'] df2 = df_train[df_train['Survived'] == 1]['Age'] max_age = max(df_train['AgeFill']) axes[0].hist([df1, df2], bins=max_age / bin_size, range=(1, max_age), stacked=True) axes[0].legend(('Died', 'Survived'), loc='best') axes[0].set_title('Survivors by Age Groups Histogram') axes[0].set_xlabel('Age') axes[0].set_ylabel('Count') # Scatter plot Survived and AgeFill axes[1].scatter(df_train['Survived'], df_train['AgeFill']) axes[1].set_title('Survivors by Age Plot') axes[1].set_xlabel('Survived') axes[1].set_ylabel('Age') for pclass in passenger_classes: df_train.AgeFill[df_train.Pclass == pclass].plot(kind='kde') plt.title('Age Density Plot by Passenger Class') plt.xlabel('Age') plt.legend(('1st Class', '2nd Class', '3rd Class'), loc='best') # Set up a grid of plots fig = plt.figure(figsize=fizsize_with_subplots) fig_dims = (3, 1) # Plot the AgeFill histogram for Survivors plt.subplot2grid(fig_dims, (0, 0)) survived_df = df_train[df_train['Survived'] == 1] survived_df['AgeFill'].hist(bins=max_age / bin_size, range=(1, max_age)) # Plot the AgeFill histogram for Females plt.subplot2grid(fig_dims, (1, 0)) females_df = df_train[(df_train['Sex_Val'] == 0) & (df_train['Survived'] == 1)] females_df['AgeFill'].hist(bins=max_age / bin_size, range=(1, max_age)) # Plot the AgeFill histogram for first class passengers plt.subplot2grid(fig_dims, (2, 0)) class1_df = df_train[(df_train['Pclass'] == 1) & (df_train['Survived'] == 1)] class1_df['AgeFill'].hist(bins=max_age / bin_size, range=(1, max_age)) df_train['FamilySize'] = df_train['SibSp'] + df_train['Parch'] df_train.head() df_train['FamilySize'].hist() plt.title('Family Size Histogram') # Get the unique values of Embarked and its maximum family_sizes = sorted(df_train['FamilySize'].unique()) family_size_max = max(family_sizes) df1 = df_train[df_train['Survived'] == 0]['FamilySize'] df2 = df_train[df_train['Survived'] == 1]['FamilySize'] plt.hist([df1, df2], bins=family_size_max + 1, range=(0, family_size_max), stacked=True) plt.legend(('Died', 'Survived'), loc='best') plt.title('Survivors by Family Size') df_train.dtypes[df_train.dtypes.map(lambda x: x == 'object')] df_train = df_train.drop(['Name', 'Sex', 'Ticket', 'Cabin', 'Embarked'], axis=1) df_train = df_train.drop(['Age', 'SibSp', 'Parch', 'PassengerId', 'Embarked_Val'], axis=1) df_train.dtypes train_data = df_train.values train_data def clean_data(df, drop_passenger_id): # Get the unique values of Sex sexes = sorted(df['Sex'].unique()) # Generate a mapping of Sex from a string to a number representation genders_mapping = dict(zip(sexes, range(0, len(sexes) + 1))) # Transform Sex from a string to a number representation df['Sex_Val'] = df['Sex'].map(genders_mapping).astype(int) # Get the unique values of Embarked embarked_locs = sorted(df['Embarked'].unique()) # Generate a mapping of Embarked from a string to a number representation embarked_locs_mapping = dict(zip(embarked_locs, range(0, len(embarked_locs) + 1))) # Transform Embarked from a string to dummy variables df = pd.concat([df, pd.get_dummies(df['Embarked'], prefix='Embarked_Val')], axis=1) # Fill in missing values of Embarked # Since the vast majority of passengers embarked in 'S': 3, # we assign the missing values in Embarked to 'S': if len(df[df['Embarked'].isnull()] > 0): df.replace({'Embarked_Val' : { embarked_locs_mapping[nan] : embarked_locs_mapping['S'] } }, inplace=True) # Fill in missing values of Fare with the average Fare if len(df[df['Fare'].isnull()] > 0): avg_fare = df['Fare'].mean() df.replace({ None: avg_fare }, inplace=True) # To keep Age in tact, make a copy of it called AgeFill # that we will use to fill in the missing ages: df['AgeFill'] = df['Age'] # Determine the Age typical for each passenger class by Sex_Val. # We'll use the median instead of the mean because the Age # histogram seems to be right skewed. df['AgeFill'] = df['AgeFill'] \ .groupby([df['Sex_Val'], df['Pclass']]) \ .apply(lambda x: x.fillna(x.median())) # Define a new feature FamilySize that is the sum of # Parch (number of parents or children on board) and # SibSp (number of siblings or spouses): df['FamilySize'] = df['SibSp'] + df['Parch'] # Drop the columns we won't use: df = df.drop(['Name', 'Sex', 'Ticket', 'Cabin', 'Embarked'], axis=1) # Drop the Age column since we will be using the AgeFill column instead. # Drop the SibSp and Parch columns since we will be using FamilySize. # Drop the PassengerId column since it won't be used as a feature. df = df.drop(['Age', 'SibSp', 'Parch'], axis=1) if drop_passenger_id: df = df.drop(['PassengerId'], axis=1) return df from sklearn.ensemble import RandomForestClassifier clf = RandomForestClassifier(n_estimators=100) # Training data features, skip the first column 'Survived' train_features = train_data[:, 1:] # 'Survived' column values train_target = train_data[:, 0] # Fit the model to our training data clf = clf.fit(train_features, train_target) score = clf.score(train_features, train_target) "Mean accuracy of Random Forest: {0}".format(score) df_test = pd.read_csv('../data/titanic/test.csv') df_test.head() # Data wrangle the test set and convert it to a numpy array df_test = clean_data(df_test, drop_passenger_id=False) test_data = df_test.values # Get the test data features, skipping the first column 'PassengerId' test_x = test_data[:, 1:] # Predict the Survival values for the test data test_y = clf.predict(test_x) df_test['Survived'] = test_y df_test[['PassengerId', 'Survived']] \ .to_csv('../data/titanic/results-rf.csv', index=False) from sklearn import metrics from sklearn.cross_validation import train_test_split # Split 80-20 train vs test data train_x, test_x, train_y, test_y = train_test_split(train_features, train_target, test_size=0.20, random_state=0) print (train_features.shape, train_target.shape) print (train_x.shape, train_y.shape) print (test_x.shape, test_y.shape) clf = clf.fit(train_x, train_y) predict_y = clf.predict(test_x) from sklearn.metrics import accuracy_score print ("Accuracy = %.2f" % (accuracy_score(test_y, predict_y))) from IPython.core.display import Image Image(filename='../data/confusion_matrix.png', width=800) model_score = clf.score(test_x, test_y) print ("Model Score %.2f \n" % (model_score)) confusion_matrix = metrics.confusion_matrix(test_y, predict_y) print ("Confusion Matrix ", confusion_matrix) print (" Predicted") print (" | 0 | 1 |") print (" |-----|-----|") print (" 0 | %3d | %3d |" % (confusion_matrix[0, 0], confusion_matrix[0, 1])) print ("Actual |-----|-----|") print (" 1 | %3d | %3d |" % (confusion_matrix[1, 0], confusion_matrix[1, 1])) print (" |-----|-----|") from sklearn.metrics import classification_report print(classification_report(test_y, predict_y, target_names=['Not Survived', 'Survived'])) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 讨论 Step2: 但是,字典推导方式表意更清晰,并且实际上也会运行的更快些 (在这个例子中,实际测试几乎比 dcit() 函数方式快整整一倍)。
<ASSISTANT_TASK:> Python Code: prices = { 'ACME': 45.23, 'AAPL': 612.78, 'IBM': 205.55, 'HPQ': 37.20, 'FB': 10.75 } # Make a dictionary of all prices over 200 p1 = {key: value for key, value in prices.items() if value > 200} p1 # Make a dictionary of tech stocks tech_names = {'AAPL', 'IBM', 'HPQ', 'MSFT'} p2 = {key: value for key, value in prices.items() if key in tech_names} p2 p1 = dict((key, value) for key, value in prices.items() if value > 200) p1 # Make a dictionary of tech stocks tech_names = {'AAPL', 'IBM', 'HPQ', 'MSFT'} p2 = {key:prices[key] for key in prices.keys() & tech_names} p2 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: A similarity query using Annoy is significantly faster than using the traditional brute force method Step2: Making a Similarity Query Step3: Creating an indexer Step4: Now that we are ready to make a query, lets find the top 5 most similar words to "army" in the lee corpus. To make a similarity query we call Word2Vec.most_similar like we would traditionally, but with an added parameter, indexer. The only supported indexer in gensim as of now is Annoy. Step5: Analyzing the results Step6: Initialization time of the annoy indexer increases in a linear fashion with num_trees. Initialization time will vary from corpus to corpus, in the graph above the lee corpus was used
<ASSISTANT_TASK:> Python Code: #Set up the model and vector that we are using in the comparison from gensim.similarities.index import AnnoyIndexer from gensim.models.word2vec import Word2Vec model = Word2Vec.load("/tmp/leemodel") model.init_sims() vector = model.syn0norm[0] annoy_index = AnnoyIndexer(model, 500) %%time #Traditional implementation: model.most_similar([vector], topn=5) %%time #Annoy implementation: neighbors = model.most_similar([vector], topn=5, indexer=annoy_index) for neighbor in neighbors: print neighbor # import modules & set up logging import logging logging.basicConfig(format='%(asctime)s : %(levelname)s : %(message)s', level=logging.INFO) # Load the model import gensim model = gensim.models.Word2Vec.load('/tmp/leemodel') print model from gensim.similarities.index import AnnoyIndexer # 100 trees are being used in this example annoy_index = AnnoyIndexer(model,100) # Derive the vector for the word "army" in our model vector = model["army"] # The instance of AnnoyIndexer we just created is passed approximate_neighbors = model.most_similar([vector], topn=5, indexer=annoy_index) # Neatly print the approximate_neighbors and their corresponding cosine similarity values for neighbor in approximate_neighbors: print neighbor %matplotlib inline import matplotlib.pyplot as plt, time x_cor = [] y_cor = [] for x in range(200): start_time = time.time() AnnoyIndexer(model, x) y_cor.append(time.time()-start_time) x_cor.append(x) plt.plot(x_cor, y_cor) plt.title("num_trees vs initalization time") plt.ylabel("Initialization time (s)") plt.xlabel("num_tress") plt.show() exact_results = [element[0] for element in model.most_similar([model.syn0norm[0]], topn=100)] x_axis = [] y_axis = [] for x in range(1,30): annoy_index = AnnoyIndexer(model, x) approximate_results = model.most_similar([model.syn0norm[0]],topn=100, indexer=annoy_index) top_words = [result[0] for result in approximate_results] x_axis.append(x) y_axis.append(len(set(top_words).intersection(exact_results))) plt.plot(x_axis, y_axis) plt.title("num_trees vs accuracy") plt.ylabel("% accuracy") plt.xlabel("num_trees") plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Import required modules Step2: Target Configuration Step3: Workload Execution and Functions Profiling Data Collection Step4: Parse Trace and Profiling Data Step5: Report Functions Profiling Data Step6: Plot Functions Profiling Data
<ASSISTANT_TASK:> Python Code: import logging from conf import LisaLogging LisaLogging.setup() # Generate plots inline %matplotlib inline import json import os # Support to access the remote target import devlib from env import TestEnv from executor import Executor # RTApp configurator for generation of PERIODIC tasks from wlgen import RTA, Ramp # Support for trace events analysis from trace import Trace # Setup target configuration my_conf = { # Target platform and board "platform" : 'linux', "board" : 'juno', "host" : '192.168.0.1', "password" : 'juno', # Folder where all the results will be collected "results_dir" : "TraceAnalysis_FunctionsProfiling", # Define devlib modules to load "modules": ['cpufreq'], "exclude_modules" : [ 'hwmon' ], # FTrace events to collect for all the tests configuration which have # the "ftrace" flag enabled "ftrace" : { "functions" : [ "pick_next_task_fair", "select_task_rq_fair", "enqueue_task_fair", "update_curr_fair", "dequeue_task_fair", ], "buffsize" : 100 * 1024, }, # Tools required by the experiments "tools" : [ 'trace-cmd', 'rt-app' ], # Comment this line to calibrate RTApp in your own platform # "rtapp-calib" : {"0": 360, "1": 142, "2": 138, "3": 352, "4": 352, "5": 353}, } # Initialize a test environment using: te = TestEnv(my_conf, wipe=False, force_new=True) target = te.target def experiment(te): # Create and RTApp RAMP task rtapp = RTA(te.target, 'ramp', calibration=te.calibration()) rtapp.conf(kind='profile', params={ 'ramp' : Ramp( start_pct = 60, end_pct = 20, delta_pct = 5, time_s = 0.5).get() }) # FTrace the execution of this workload te.ftrace.start() rtapp.run(out_dir=te.res_dir) te.ftrace.stop() # Collect and keep track of the trace trace_file = os.path.join(te.res_dir, 'trace.dat') te.ftrace.get_trace(trace_file) # Collect and keep track of the Kernel Functions performance data stats_file = os.path.join(te.res_dir, 'trace.stats') te.ftrace.get_stats(stats_file) # Dump platform descriptor te.platform_dump(te.res_dir) experiment(te) # Base folder where tests folder are located res_dir = te.res_dir logging.info('Content of the output folder %s', res_dir) !tree {res_dir} with open(os.path.join(res_dir, 'platform.json'), 'r') as fh: platform = json.load(fh) print json.dumps(platform, indent=4) logging.info('LITTLE cluster max capacity: %d', platform['nrg_model']['little']['cpu']['cap_max']) trace = Trace(res_dir, platform=platform) # Get the DataFrame for the specified list of kernel functions df = trace.data_frame.functions_stats(['enqueue_task_fair', 'dequeue_task_fair']) df # Get the DataFrame for the single specified kernel function df = trace.data_frame.functions_stats('select_task_rq_fair') df # Plot Average and Total execution time for the specified # list of kernel functions trace.analysis.functions.plotProfilingStats( functions = [ 'select_task_rq_fair', 'enqueue_task_fair', 'dequeue_task_fair' ], metrics = [ # Average completion time per CPU 'avg', # Total execution time per CPU 'time', ] ) # Plot Average execution time for the single specified kernel function trace.analysis.functions.plotProfilingStats( functions = 'update_curr_fair', ) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Text classification with an RNN Step2: Import matplotlib and create a helper function to plot graphs Step3: Setup input pipeline Step4: Initially this returns a dataset of (text, label pairs) Step5: Next shuffle the data for training and create batches of these (text, label) pairs Step6: Create the text encoder Step7: The .adapt method sets the layer's vocabulary. Here are the first 20 tokens. After the padding and unknown tokens they're sorted by frequency Step8: Once the vocabulary is set, the layer can encode text into indices. The tensors of indices are 0-padded to the longest sequence in the batch (unless you set a fixed output_sequence_length) Step9: With the default settings, the process is not completely reversible. There are three main reasons for that Step10: Create the model Step11: Please note that Keras sequential model is used here since all the layers in the model only have single input and produce single output. In case you want to use stateful RNN layer, you might want to build your model with Keras functional API or model subclassing so that you can retrieve and reuse the RNN layer states. Please check Keras RNN guide for more details. Step12: To confirm that this works as expected, evaluate a sentence twice. First, alone so there's no padding to mask Step13: Now, evaluate it again in a batch with a longer sentence. The result should be identical Step14: Compile the Keras model to configure the training process Step15: Train the model Step16: Run a prediction on a new sentence Step17: Stack two or more LSTM layers
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import numpy as np import tensorflow_datasets as tfds import tensorflow as tf tfds.disable_progress_bar() import matplotlib.pyplot as plt def plot_graphs(history, metric): plt.plot(history.history[metric]) plt.plot(history.history['val_'+metric], '') plt.xlabel("Epochs") plt.ylabel(metric) plt.legend([metric, 'val_'+metric]) dataset, info = tfds.load('imdb_reviews', with_info=True, as_supervised=True) train_dataset, test_dataset = dataset['train'], dataset['test'] train_dataset.element_spec for example, label in train_dataset.take(1): print('text: ', example.numpy()) print('label: ', label.numpy()) BUFFER_SIZE = 10000 BATCH_SIZE = 64 train_dataset = train_dataset.shuffle(BUFFER_SIZE).batch(BATCH_SIZE).prefetch(tf.data.AUTOTUNE) test_dataset = test_dataset.batch(BATCH_SIZE).prefetch(tf.data.AUTOTUNE) for example, label in train_dataset.take(1): print('texts: ', example.numpy()[:3]) print() print('labels: ', label.numpy()[:3]) VOCAB_SIZE = 1000 encoder = tf.keras.layers.TextVectorization( max_tokens=VOCAB_SIZE) encoder.adapt(train_dataset.map(lambda text, label: text)) vocab = np.array(encoder.get_vocabulary()) vocab[:20] encoded_example = encoder(example)[:3].numpy() encoded_example for n in range(3): print("Original: ", example[n].numpy()) print("Round-trip: ", " ".join(vocab[encoded_example[n]])) print() model = tf.keras.Sequential([ encoder, tf.keras.layers.Embedding( input_dim=len(encoder.get_vocabulary()), output_dim=64, # Use masking to handle the variable sequence lengths mask_zero=True), tf.keras.layers.Bidirectional(tf.keras.layers.LSTM(64)), tf.keras.layers.Dense(64, activation='relu'), tf.keras.layers.Dense(1) ]) print([layer.supports_masking for layer in model.layers]) # predict on a sample text without padding. sample_text = ('The movie was cool. The animation and the graphics ' 'were out of this world. I would recommend this movie.') predictions = model.predict(np.array([sample_text])) print(predictions[0]) # predict on a sample text with padding padding = "the " * 2000 predictions = model.predict(np.array([sample_text, padding])) print(predictions[0]) model.compile(loss=tf.keras.losses.BinaryCrossentropy(from_logits=True), optimizer=tf.keras.optimizers.Adam(1e-4), metrics=['accuracy']) history = model.fit(train_dataset, epochs=10, validation_data=test_dataset, validation_steps=30) test_loss, test_acc = model.evaluate(test_dataset) print('Test Loss:', test_loss) print('Test Accuracy:', test_acc) plt.figure(figsize=(16, 8)) plt.subplot(1, 2, 1) plot_graphs(history, 'accuracy') plt.ylim(None, 1) plt.subplot(1, 2, 2) plot_graphs(history, 'loss') plt.ylim(0, None) sample_text = ('The movie was cool. The animation and the graphics ' 'were out of this world. I would recommend this movie.') predictions = model.predict(np.array([sample_text])) model = tf.keras.Sequential([ encoder, tf.keras.layers.Embedding(len(encoder.get_vocabulary()), 64, mask_zero=True), tf.keras.layers.Bidirectional(tf.keras.layers.LSTM(64, return_sequences=True)), tf.keras.layers.Bidirectional(tf.keras.layers.LSTM(32)), tf.keras.layers.Dense(64, activation='relu'), tf.keras.layers.Dropout(0.5), tf.keras.layers.Dense(1) ]) model.compile(loss=tf.keras.losses.BinaryCrossentropy(from_logits=True), optimizer=tf.keras.optimizers.Adam(1e-4), metrics=['accuracy']) history = model.fit(train_dataset, epochs=10, validation_data=test_dataset, validation_steps=30) test_loss, test_acc = model.evaluate(test_dataset) print('Test Loss:', test_loss) print('Test Accuracy:', test_acc) # predict on a sample text without padding. sample_text = ('The movie was not good. The animation and the graphics ' 'were terrible. I would not recommend this movie.') predictions = model.predict(np.array([sample_text])) print(predictions) plt.figure(figsize=(16, 6)) plt.subplot(1, 2, 1) plot_graphs(history, 'accuracy') plt.subplot(1, 2, 2) plot_graphs(history, 'loss') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: UCB1
<ASSISTANT_TASK:> Python Code: class EpsGreedy: def __init__(self, n_arms, eps=0): self.eps = eps self.n_arms = n_arms self.payoffs = np.zeros(n_arms) self.n_plays = np.zeros(n_arms) def play(self): # Note that the theory tells us to pick epsilon as O(1/t), not constant (which we use here). idx = np.argmin(self.n_plays) if self.n_plays[idx] == 0: return idx if np.random.rand() <= self.eps: return np.random.randint(self.n_arms) else: return np.argmax(self.payoffs / self.n_plays) def feedback(self, arm, reward): self.payoffs[arm] += reward self.n_plays[arm] += 1 class UCB: def __init__(self, n_arms, tau): self.n_arms = n_arms self.means = np.zeros(n_arms) # Note that the UCB1 algorithm has tau=1. self.n_plays = np.zeros(n_arms) self.tau = tau self.t = 0 def play(self, plot=True): # If plot is true, it will plot the means + bounds every 100 iterations. self.t += 1 idx = np.argmin(self.n_plays) if self.n_plays[idx] == 0: return idx ub = self.tau * np.sqrt(2 * np.log(self.t) / self.n_plays) ucb = self.means + ub if plot and self.t % 100 == 0: plt.errorbar(list(range(self.n_arms)), self.means, yerr=ub) plt.show() print('chose arm', np.argmax(ucb)) return np.argmax(ucb) def feedback(self, arm, reward): self.n_plays[arm] += 1 self.means[arm] += 1 / (self.n_plays[arm]) * (reward - self.means[arm]) @interact(n_arms=(10, 100, 1), n_rounds=(100, 1000, 10), eps=(0, 1, .01) , tau=(0, 1, .01)) def run(n_arms, n_rounds, eps, tau): np.random.seed(123) # Initialize the arm payoffs. mu = np.random.randn(n_arms) # Some other strategies for sampling. # mu = np.random.standard_cauchy(n_arms) # mu = np.random.gamma(shape=.1, size=(n_arms, 1)) mu = np.abs(mu) mu /= np.max(mu) plt.bar(list(range(n_arms)), mu) plt.xlabel('arms') plt.ylabel('rewards') plt.show() bandits = { 'eps-{0}'.format(eps) : EpsGreedy(n_arms, eps=eps), 'ucb-{0}'.format(tau) : UCB(n_arms, tau=tau) } play(bandits, n_rounds, mu) # Hint: You can also plot the upper bound from UCB1 and see how tight it is. <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step 1 Step1: Step 2 Step2: Questions Step3: Answer Step4: Question 3. Why would GRE have a larger STD than GPA? Step5: Question 5. Confirm that you dropped the correct data. How can you tell? Step6: Question 7. What do this plots show? Step7: Question 9. If our model had an assumption of a normal distribution would we meet that requirement? Step8: Question 12. What did you find?
<ASSISTANT_TASK:> Python Code: #imports from __future__ import division import pandas as pd import numpy as np import matplotlib.pyplot as plt import statsmodels.api as sm import pylab as pl import numpy as np %matplotlib inline #Read in data from source df_raw = pd.read_csv("../assets/admissions.csv") print df_raw.head() df_raw['admit'].count() df_raw['gpa'].count() df_raw.shape rows,columns = df_raw.shape print(rows) print(columns) #function def summary_table(): #creates a summary table for df_raw using .describe() df_raw.describe() return x print X df_raw.describe() df_raw.dropna() #drops any missing data rows from admissions.csv dataset #returns 397 observations (complete observation rows) across 4 columns #3 rows had missing, incomplete, NaN data present #boxplot for GRE column data df_raw.boxplot(column = 'gre', return_type = 'axes') #boxplot for GPA column data df_raw.boxplot(column = 'gpa', return_type = 'axes') # distribution plot of 'admit' variable with mean df_raw.admit.plot(kind = 'density', sharex = False, sharey = False, figsize = (10,4));plt.legend(loc='best') # plt.vlines(df_raw.admit.mean(), # Plot black line at mean ymin=0, ymax=2.0, linewidth=4.0) # distribution plot of 'gre' variable with mean df_raw.gre.plot(kind = 'density', sharex = False, sharey = False, figsize = (10,4));plt.legend(loc='best') # plt.vlines(df_raw.gre.mean(), # Plot black line at mean ymin=0, ymax=0.0035, linewidth=4.0) # distribution plot of 'gpa' variable with mean df_raw.gpa.plot(kind = 'density', sharex = False, sharey = False, figsize = (10,4));plt.legend(loc='best') # plt.vlines(df_raw.gpa.mean(), # Plot black line at mean ymin=0, ymax=1.0, linewidth=4.0) # distribution plot of 'prestige' variable with mean df_raw.prestige.plot(kind = 'density', sharex = False, sharey = False, figsize = (10,4));plt.legend(loc='best') # plt.vlines(df_raw.prestige.mean(), # Plot black line at mean ymin=0, ymax=0.6, linewidth=4.0) # correlation matrix for variables in df_raw df_raw.corr() #utilized this stackoverflow.com resource to attempt to impute missing data #(http://stackoverflow.com/questions/21050426/pandas-impute-nans) #data imputation for variable 'admit' #first commented out line of code will not run. Had errors with "keys" in ...df_raw.groupby('keys')... #df_raw['admit'].fillna(df_raw.groupby('keys')['admit'].transform('mean'), inplace = True) df_raw['admit'].fillna(df_raw['admit'].mean(), inplace = True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: This is a generator that yields the infinite Fibonnaci sequence. With every call to fib after the first call, the state of the generator gets updated and the value of b is returned. Step2: This example shows how you can represent an infinte sequence in Python without using up all the memory in the world. Next, we will look at a more practical example. Step3: Now, suppose you want to find the sum of squares of the first 1,000,000 (1 million) integers. You don't believe the analytical formula and want to calculate it directly by summing up all the requisite squares of integers. It is not memory efficient to create a list of 1 million integers just to compute a sum. This is where our custom generator comes to our rescue. Step4: Although both snippets of code give the same result, the implementation with the generator is more scalable since it uses constant memory. Step5: Both generators and generator expressions can be passed to the tuple, set or list constructors to create equivalent tuples, sets or lists. Step6: All the rules discussed in the previous sections about conditionals also apply to generator expressions Step7: Advanced generator stuff Step8: Now, we define our master generator.
<ASSISTANT_TASK:> Python Code: ## Example from PEP 0255 def fib(): a, b = 0, 1 while 1: yield b a, b = b, a + b gen1 = fib() # prints the first 10 fibonnaci numbers for i in range(10): print(next(gen1), end=', ') print("\nPassed!") def nsquared(n): while True: yield n ** 2 n = n - 1 if n == 0: return # correct way to terminate a generator gen2 = nsquared(10) for i in gen2: print(i, end=', ') try: next(gen2) # should raise a StopIteration exception except StopIteration: print("\nWe hit the the end of the generator, no more elements can be consumed") except Exception as e: print("\nOops! Unexpected error", e) finally: print("Passed !") squared_sum1 = sum([i**2 for i in range(1000001)]) print(squared_sum1) gen3 = nsquared(1000000) squared_sum2 = sum(gen3) print(squared_sum2) assert squared_sum1 == squared_sum1, "Sums are not equal !" print("Passed !") gen4 = nsquared(10) print(gen4) gen5 = (i**2 for i in range(11)) print(gen5) # note that the generator has to be reinitialized once it has been consumed gen4 = nsquared(10) print(tuple(gen4)) gen4 = nsquared(10) print(list(gen4)) gen4 = nsquared(10) print(set(gen4)) print(tuple(i**2 for i in range(11))) print(list(i**2 for i in range(11))) print(set(i**2 for i in range(11))) import numpy as np print(list(i**2 for i in range(11) if i <=5)) print(list(i**2 if i <=5 else 1 for i in range(11))) mat = list(i**2 + j**2 if i < j else i + j for i in range(3) for j in range(3)) print(np.array(mat).reshape(3,3)) # Same function, redefined here for clarity def fib(n): a, b = 0, 1 count = 0 while 1: yield b count += 1 if count == n: return a, b = b, a + b def geom(n): a = 1 count = 0 while True: yield a count += 1 if count == n: return a = a * 2 def constant(n): count = 0 while True: yield -1 count += 1 if count == n: return def master_sequence(n): g1 = fib(n) g2 = geom(n) g3 = constant(n) count = 0 yield from g1 yield from g2 yield from g3 master_gen = master_sequence(5) # creates a sequence of length 15 print(list(master_gen)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Multi-label versus single-label classification Step2: In single-label classification each sample belongs to one class. In the previous example, each image is either a dog or a cat. Step3: In multi-label classification each sample can belong to one or more clases. In the previous example, the first images belongs to two clases Step4: We use a different set of data augmentations for this dataset - we also allow vertical flips, since we don't expect vertical orientation of satellite images to change our classifications. Step5: Begin Training with 64 x 64 Step7: Find Optimal Learning Rate Step8: Looking at the above plot, we can see that 0.1 seems the best learning rate. Step9: Unfreeze and Train with differential learning rate Step10: Begin Training with 128 x 128 Step11: Freeze for Transfer Learning Step12: F2 Score not improving Step13: TODO Step14: Step15: Sample Predictions
<ASSISTANT_TASK:> Python Code: %reload_ext autoreload %autoreload 2 %matplotlib inline from fastai.conv_learner import * import torch torch.cuda.is_available() PATH = '../data/planet/' ls {PATH} !ls {PATH}train-jpg/ | wc -l !ls {PATH}test-jpg/ | wc -l from fastai.plots import * def get_1st(path): return glob(f'{path}/*.*')[0] dc_path = "../data/dogscats/valid/" list_paths = [get_1st(f"{dc_path}cats"), get_1st(f"{dc_path}dogs")] plots_from_files(list_paths, titles=["cat", "dog"], maintitle="Single-label classification") list_paths = [f"{PATH}train-jpg/train_0.jpg", f"{PATH}train-jpg/train_1.jpg"] titles=["haze primary", "agriculture clear primary water"] plots_from_files(list_paths, titles=titles, maintitle="Multi-label classification") from helper.planet import f2 metrics=[f2] f_model = resnet34 label_csv = f'{PATH}train_v2.csv' n = len(list(open(label_csv)))-1 val_idxs = get_cv_idxs(n) def get_data(sz): tfms = tfms_from_model(f_model, sz, aug_tfms=transforms_top_down, max_zoom=1.05) return ImageClassifierData.from_csv(PATH, 'train-jpg', label_csv, tfms=tfms, suffix='.jpg', val_idxs=val_idxs, test_name='test-jpg') data = get_data(256) data.classes x,y = next(iter(data.val_dl)) x.shape y.shape sample = to_np(x[0]) sample_denorm = data.val_ds.denorm(sample)[0] plt.imshow(sample_denorm) list(zip(data.classes, y[0])) plt.imshow(data.val_ds.denorm(to_np(x))[0]*1.5); sz=64 data = get_data(sz) data = data.resize(int(sz*1.3), 'tmp') x,y = next(iter(data.trn_dl)) x.shape, y.shape sample = to_np(x[0]) plt.imshow(data.val_ds.denorm(sample)[0]*1.2) metrics learn = ConvLearner.pretrained(f_model, data, metrics=metrics) lrf=learn.lr_find() learn.sched.plot() learn.sched.plot_loss() def plot_loss_change(sched, sma=1, n_skip=20, y_lim=(-0.01,0.01)): Plots rate of change of the loss function. Parameters: sched - learning rate scheduler, an instance of LR_Finder class. sma - number of batches for simple moving average to smooth out the curve. n_skip - number of batches to skip on the left. y_lim - limits for the y axis. derivatives = [0] * (sma + 1) for i in range(1 + sma, len(learn.sched.lrs)): derivative = (learn.sched.losses[i] - learn.sched.losses[i - sma]) / sma derivatives.append(derivative) plt.ylabel("d/loss") plt.xlabel("learning rate (log scale)") plt.plot(learn.sched.lrs[n_skip:], derivatives[n_skip:]) plt.xscale('log') plt.ylim(y_lim) plot_loss_change(learn.sched, sma=20) lr = 0.1 learn.fit(lr, 3, cycle_len=1, cycle_mult=2) lrs = np.array([lr/9,lr/3,lr]) learn.unfreeze() learn.fit(lrs, 3, cycle_len=1, cycle_mult=2) learn.save(f'{sz}') learn.sched.plot_loss() learn.sched.plot_lr() sz=128 learn.set_data(get_data(sz)) learn.freeze() learn.fit(lr, n_cycle=3, cycle_len=1, cycle_mult=2) learn.unfreeze() learn.fit(lrs, 3, cycle_len=1, cycle_mult=2) learn.save(f'{sz}') sz=256 learn.set_data(get_data(sz)) learn.freeze() learn.fit(lr, 3, cycle_len=1, cycle_mult=2) learn.unfreeze() learn.fit(lrs, 3, cycle_len=1, cycle_mult=2) learn.save(f'{sz}') learn.models_path learn.load(f'{sz}') multi_preds, y = learn.TTA() multi_preds.shape, y.shape multi_preds[:,0,:] y[0,:] preds = np.mean(multi_preds, 0) preds[0,:] plt.plot(y[0,:]) plt.plot(preds[0,:]) f2(preds,y) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: TV Script Generation Step3: Explore the Data Step6: Implement Preprocessing Functions Step9: Tokenize Punctuation Step11: Preprocess all the data and save it Step13: Check Point Step15: Build the Neural Network Step18: Input Step21: Build RNN Cell and Initialize Step24: Word Embedding Step27: Build RNN Step30: Build the Neural Network Step33: Batches Step35: Neural Network Training Step37: Build the Graph Step39: Train Step41: Save Parameters Step43: Checkpoint Step46: Implement Generate Functions Step49: Choose Word Step51: Generate TV Script
<ASSISTANT_TASK:> Python Code: DON'T MODIFY ANYTHING IN THIS CELL import helper data_dir = './data/simpsons/moes_tavern_lines.txt' text = helper.load_data(data_dir) # Ignore notice, since we don't use it for analysing the data text = text[81:] view_sentence_range = (0, 10) DON'T MODIFY ANYTHING IN THIS CELL import numpy as np print('Dataset Stats') print('Roughly the number of unique words: {}'.format(len({word: None for word in text.split()}))) scenes = text.split('\n\n') print('Number of scenes: {}'.format(len(scenes))) sentence_count_scene = [scene.count('\n') for scene in scenes] print('Average number of sentences in each scene: {}'.format(np.average(sentence_count_scene))) sentences = [sentence for scene in scenes for sentence in scene.split('\n')] print('Number of lines: {}'.format(len(sentences))) word_count_sentence = [len(sentence.split()) for sentence in sentences] print('Average number of words in each line: {}'.format(np.average(word_count_sentence))) print() print('The sentences {} to {}:'.format(*view_sentence_range)) print('\n'.join(text.split('\n')[view_sentence_range[0]:view_sentence_range[1]])) import numpy as np import problem_unittests as tests def create_lookup_tables(text): Create lookup tables for vocabulary :param text: The text of tv scripts split into words :return: A tuple of dicts (vocab_to_int, int_to_vocab) # TODO: Implement Function vocab = set(text) vocab_to_int = {v: i for i, v in enumerate(vocab)} int_to_vocab = {vocab_to_int[v]: v for v in vocab} return vocab_to_int, int_to_vocab DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_create_lookup_tables(create_lookup_tables) def token_lookup(): Generate a dict to turn punctuation into a token. :return: Tokenize dictionary where the key is the punctuation and the value is the token # TODO: Implement Function table = { '.': '||period||', ',': '||comma||', '"': '||quotation||', ';': '||semicolon||', '!': '||exclamation||', '?': '||question||', '(': '||leftp||', ')': '||rightp||', '--': '||dash||', '\n': '||return||' } return table DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_tokenize(token_lookup) DON'T MODIFY ANYTHING IN THIS CELL # Preprocess Training, Validation, and Testing Data helper.preprocess_and_save_data(data_dir, token_lookup, create_lookup_tables) DON'T MODIFY ANYTHING IN THIS CELL import helper import numpy as np import problem_unittests as tests int_text, vocab_to_int, int_to_vocab, token_dict = helper.load_preprocess() DON'T MODIFY ANYTHING IN THIS CELL from distutils.version import LooseVersion import warnings import tensorflow as tf # Check TensorFlow Version assert LooseVersion(tf.__version__) >= LooseVersion('1.0'), 'Please use TensorFlow version 1.0 or newer' print('TensorFlow Version: {}'.format(tf.__version__)) # Check for a GPU if not tf.test.gpu_device_name(): warnings.warn('No GPU found. Please use a GPU to train your neural network.') else: print('Default GPU Device: {}'.format(tf.test.gpu_device_name())) def get_inputs(): Create TF Placeholders for input, targets, and learning rate. :return: Tuple (input, targets, learning rate) # TODO: Implement Function input = tf.placeholder(tf.int32, [None, None], name='input') targets = tf.placeholder(tf.int32, [None, None], name='targets') learning_rate = tf.placeholder(tf.float32, name='learning_rate') return input, targets, learning_rate DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_get_inputs(get_inputs) def get_init_cell(batch_size, rnn_size): Create an RNN Cell and initialize it. :param batch_size: Size of batches :param rnn_size: Size of RNNs :return: Tuple (cell, initialize state) # TODO: Implement Function lstm = tf.contrib.rnn.BasicLSTMCell(rnn_size) cell = tf.contrib.rnn.MultiRNNCell([lstm]*2) initial_state = cell.zero_state(batch_size, tf.float32) initial_state = tf.identity(initial_state, name='initial_state') return cell, initial_state DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_get_init_cell(get_init_cell) def get_embed(input_data, vocab_size, embed_dim): Create embedding for <input_data>. :param input_data: TF placeholder for text input. :param vocab_size: Number of words in vocabulary. :param embed_dim: Number of embedding dimensions :return: Embedded input. # TODO: Implement Function embedding = tf.Variable(tf.random_uniform((vocab_size, embed_dim), -1, 1)) embed = tf.nn.embedding_lookup(embedding, input_data) return embed DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_get_embed(get_embed) def build_rnn(cell, inputs): Create a RNN using a RNN Cell :param cell: RNN Cell :param inputs: Input text data :return: Tuple (Outputs, Final State) # TODO: Implement Function outputs, final_state = tf.nn.dynamic_rnn(cell, inputs, dtype=tf.float32) final_state = tf.identity(final_state, name='final_state') return outputs, final_state DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_build_rnn(build_rnn) import math def build_nn(cell, rnn_size, input_data, vocab_size, embed_dim): Build part of the neural network :param cell: RNN cell :param rnn_size: Size of rnns :param input_data: Input data :param vocab_size: Vocabulary size :param embed_dim: Number of embedding dimensions :return: Tuple (Logits, FinalState) # TODO: Implement Function # embedding layer embed = get_embed(input_data, vocab_size, embed_dim) # lstm layer outputs, final_state = build_rnn(cell, embed) # fully connected layer #stddev = 1. / math.sqrt(embed_dim) logits = tf.contrib.layers.fully_connected( outputs, vocab_size, activation_fn=None, weights_initializer=tf.truncated_normal_initializer(stddev=0.1) ) return logits, final_state DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_build_nn(build_nn) def get_batches(int_text, batch_size, seq_length): Return batches of input and target :param int_text: Text with the words replaced by their ids :param batch_size: The size of batch :param seq_length: The length of sequence :return: Batches as a Numpy array # TODO: Implement Function words_per_batch = batch_size * seq_length n_batches = len(int_text) // words_per_batch features = np.array(int_text[:words_per_batch*n_batches]) targets = np.zeros_like(features) targets[:-1], targets[-1] = features[1:], features[0] features = features.reshape((batch_size, -1)) targets = targets.reshape((batch_size, -1)) batches = [] for n in range(0, features.shape[1], seq_length): # The features of one batch x = features[:, n:n+seq_length] # The targets of one batch y = targets[:, n:n+seq_length] # Append to batches batches.append([x, y]) return np.array(batches) DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_get_batches(get_batches) # Number of Epochs num_epochs = 300 # Batch Size batch_size = 128 # RNN Size rnn_size = 512 # Embedding Dimension Size embed_dim = 256 # Sequence Length seq_length = 64 # Learning Rate learning_rate = 0.01 # Show stats for every n number of batches show_every_n_batches = 100 DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE save_dir = './save' DON'T MODIFY ANYTHING IN THIS CELL from tensorflow.contrib import seq2seq train_graph = tf.Graph() with train_graph.as_default(): vocab_size = len(int_to_vocab) input_text, targets, lr = get_inputs() input_data_shape = tf.shape(input_text) cell, initial_state = get_init_cell(input_data_shape[0], rnn_size) logits, final_state = build_nn(cell, rnn_size, input_text, vocab_size, embed_dim) # Probabilities for generating words probs = tf.nn.softmax(logits, name='probs') # Loss function cost = seq2seq.sequence_loss( logits, targets, tf.ones([input_data_shape[0], input_data_shape[1]])) # Optimizer optimizer = tf.train.AdamOptimizer(lr) # Gradient Clipping gradients = optimizer.compute_gradients(cost) capped_gradients = [(tf.clip_by_value(grad, -1., 1.), var) for grad, var in gradients if grad is not None] train_op = optimizer.apply_gradients(capped_gradients) DON'T MODIFY ANYTHING IN THIS CELL batches = get_batches(int_text, batch_size, seq_length) with tf.Session(graph=train_graph) as sess: sess.run(tf.global_variables_initializer()) for epoch_i in range(num_epochs): state = sess.run(initial_state, {input_text: batches[0][0]}) for batch_i, (x, y) in enumerate(batches): feed = { input_text: x, targets: y, initial_state: state, lr: learning_rate} train_loss, state, _ = sess.run([cost, final_state, train_op], feed) # Show every <show_every_n_batches> batches if (epoch_i * len(batches) + batch_i) % show_every_n_batches == 0: print('Epoch {:>3} Batch {:>4}/{} train_loss = {:.3f}'.format( epoch_i, batch_i, len(batches), train_loss)) # Save Model saver = tf.train.Saver() saver.save(sess, save_dir) print('Model Trained and Saved') DON'T MODIFY ANYTHING IN THIS CELL # Save parameters for checkpoint helper.save_params((seq_length, save_dir)) DON'T MODIFY ANYTHING IN THIS CELL import tensorflow as tf import numpy as np import helper import problem_unittests as tests _, vocab_to_int, int_to_vocab, token_dict = helper.load_preprocess() seq_length, load_dir = helper.load_params() def get_tensors(loaded_graph): Get input, initial state, final state, and probabilities tensor from <loaded_graph> :param loaded_graph: TensorFlow graph loaded from file :return: Tuple (InputTensor, InitialStateTensor, FinalStateTensor, ProbsTensor) # TODO: Implement Function input = loaded_graph.get_tensor_by_name('input:0') initial_state = loaded_graph.get_tensor_by_name('initial_state:0') final_state = loaded_graph.get_tensor_by_name('final_state:0') probs = loaded_graph.get_tensor_by_name('probs:0') return input, initial_state, final_state, probs DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_get_tensors(get_tensors) def pick_word(probabilities, int_to_vocab): Pick the next word in the generated text :param probabilities: Probabilites of the next word :param int_to_vocab: Dictionary of word ids as the keys and words as the values :return: String of the predicted word # TODO: Implement Function index = np.argmax(probabilities) return int_to_vocab[index] DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_pick_word(pick_word) gen_length = 200 # homer_simpson, moe_szyslak, or Barney_Gumble prime_word = 'moe_szyslak' DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE loaded_graph = tf.Graph() with tf.Session(graph=loaded_graph) as sess: # Load saved model loader = tf.train.import_meta_graph(load_dir + '.meta') loader.restore(sess, load_dir) # Get Tensors from loaded model input_text, initial_state, final_state, probs = get_tensors(loaded_graph) # Sentences generation setup gen_sentences = [prime_word + ':'] prev_state = sess.run(initial_state, {input_text: np.array([[1]])}) # Generate sentences for n in range(gen_length): # Dynamic Input dyn_input = [[vocab_to_int[word] for word in gen_sentences[-seq_length:]]] dyn_seq_length = len(dyn_input[0]) # Get Prediction probabilities, prev_state = sess.run( [probs, final_state], {input_text: dyn_input, initial_state: prev_state}) pred_word = pick_word(probabilities[dyn_seq_length-1], int_to_vocab) gen_sentences.append(pred_word) # Remove tokens tv_script = ' '.join(gen_sentences) for key, token in token_dict.items(): ending = ' ' if key in ['\n', '(', '"'] else '' tv_script = tv_script.replace(' ' + token.lower(), key) tv_script = tv_script.replace('\n ', '\n') tv_script = tv_script.replace('( ', '(') print(tv_script) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Symbols Step2: Supported mass and stiffness of support Step3: General solution and its derivatives Step4: Left boundary conditions Step5: First, simpler boundary condition at the right end, $x=L$. Step6: Last boundary conditions, equation of wave numbers Step7: We have a non trivial solution when the term in brackets is equal to zero, to have the bracketed term we must divide both members by $B\,EJ\, \lambda^3$ Step8: The behavior near $\Lambda=0$ is led by the last term that goes like $48/\Lambda^2$, so to have a nice plot we multiply everything by $\Lambda^2$ Step9: and see that there is a root between 1.25 and 1.5. If we were interested in upper roots, we can observe that all the terms in the LHS of our determinantal equations are bounded for increasing $\Lambda$ except for the first one, that grows linearly, so to investigate the other roots we may divide the equation by $\Lambda$ to remove that trend... Step10: All the RHS terms except the first have $\Lambda$ in the denominator and are bounded, so the asymptotic behaviour is controlled by $\Lambda_{n+1}=n\pi$. Step11: Rayleigh Quotient
<ASSISTANT_TASK:> Python Code: from sympy import * init_printing(use_latex=True) from IPython.display import Latex %matplotlib inline x, w2 = symbols('x omega^2') L, m, EJ = symbols('L m EJ', positive = True) A, B, C, D, ld, LD = symbols('A B C D lambda Lambda') f, φ = symbols('f phi') mass_coeff = 8 stiff_coeff = 24 k = stiff_coeff*EJ/L**3 M = mass_coeff*m*L f0 = A*cos(ld*x) + B*sin(ld*x) + C*cosh(ld*x) + D*sinh(ld*x) f1 = f0.diff(x) f2 = f1.diff(x) f3 = f2.diff(x) display(Eq(φ,f0)) AC = solve((f0.subs(x,0), f2.subs(x,0)), A, C, dict=True) f0, f1, f2, f3 = [f.subs(AC[0]) for f in (f0, f1, f2, f3)] display(Eq(φ, f0)) D = solve(f2.subs(x, L), D, dict=True) f0, f1, f2, f3 = [f.subs(D[0]).subs(L,LD/ld) for f in (f0, f1, f2, f3)] display(Latex('With $\\Lambda = \\lambda\\,L$ it is')) display(Eq(φ, f0.simplify())) eq = (f0*k - f0*M*ld**4*EJ/m - EJ*f3).subs(x, L).subs(L, LD/ld) display(Eq(eq.expand().collect(B).collect(ld).collect(EJ), 0)) eq = (eq/EJ/ld**3/B).expand() display(Eq(eq,0)) display(Eq(symbols('f'), (eq*LD**2).expand())) plot(eq*LD**2, (LD, 0, 2)); display(Eq(symbols('f'), (eq/LD).expand())) plot(eq/LD, (LD, 2, 10)); from scipy.optimize import bisect f = lambdify(LD, eq, modules='math') l1 = bisect(f, 0.5, 1.5) Latex(r'$\lambda_1=%.6f\,\frac{1}{L}, \quad\omega_1^2=%.6f\,\frac{EJ}{mL^4}$'%(l1, l1**4)) display(Latex(r'$\omega^2_{R00} = %.3f\,\frac{EJ}{mL^4}$'%(3*24/25))) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Subsetting Lists Step3: 2. Subset and calculate Step5: 3. Slicing and dicing Step7: 4. Slicing and dicing (2) Step9: **5. Subsetting lists of lists
<ASSISTANT_TASK:> Python Code: Instructions: + Print out the second element from the areas list, so 11.25. + Subset and print out the last element of areas, being 9.50. - Using a negative index makes sense here! + Select the number representing the area of the living room and print it out. # Create the areas list areas = ["hallway", 11.25, "kitchen", 18.0, "living room", 20.0, "bedroom", 10.75, "bathroom", 9.50] # Print out second element from areas print( areas[ 1 ] ) # Print out last element from areas print( areas[ -1 ] ) # Print out the area of the living room print( areas[ 5 ] ) Instructions: + Using a combination of list subsetting and variable assignment, create a new variable, eat_sleep_area, that contains the sum of the area of the kitchen and the area of the bedroom. + Print this new variable "eat_sleep_area". # Create the areas list areas = ["hallway", 11.25, "kitchen", 18.0, "living room", 20.0, "bedroom", 10.75, "bathroom", 9.50] # Sum of kitchen and bedroom area: eat_sleep_area eat_sleep_area = areas[3] + areas[7] # Print the variable eat_sleep_area print( eat_sleep_area ) Instructions: + Use slicing to create a list, "downstairs", that contains the first 6 elements of "areas". + Do a similar thing to create a new variable, "upstairs", that contains the last 4 elements of areas. + Print both "downstairs" and "upstairs" using print(). # Create the areas list areas = ["hallway", 11.25, "kitchen", 18.0, "living room", 20.0, "bedroom", 10.75, "bathroom", 9.50] # Use slicing to create downstairs downstairs = areas[0:7] # Use slicing to create upstairs upstairs = areas[6:] # Print out downstairs and upstairs print( downstairs ) print( upstairs ) Instructions: + Use slicing to create the lists, "downstairs" and "upstairs" again. - Without using any indexes, unless nessecery. # Create the areas list areas = ["hallway", 11.25, "kitchen", 18.0, "living room", 20.0, "bedroom", 10.75, "bathroom", 9.50] # Alternative slicing to create downstairs downstairs = areas[ : 6] # Alternative slicing to create upstairs upstairs = areas[ 6 : ] Problem definition: What will house[-1][1] return? # Ans : float, 9.5 as the bathroom area. <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load and Visualize the Data Step2: Visualize a Batch of Training Data Step3: View an Image in More Detail Step4: Define the Network Architecture Step5: Specify Loss Function and Optimizer Step6: Train the Network Step7: Load the Model with the Lowest Validation Loss Step8: Test the Trained Network Step9: Visualize Sample Test Results
<ASSISTANT_TASK:> Python Code: # import libraries import torch import numpy as np from torchvision import datasets import torchvision.transforms as transforms from torch.utils.data.sampler import SubsetRandomSampler # number of subprocesses to use for data loading num_workers = 0 # how many samples per batch to load batch_size = 20 # percentage of training set to use as validation valid_size = 0.2 # convert data to torch.FloatTensor transform = transforms.ToTensor() # choose the training and test datasets train_data = datasets.MNIST(root='data', train=True, download=True, transform=transform) test_data = datasets.MNIST(root='data', train=False, download=True, transform=transform) # obtain training indices that will be used for validation num_train = len(train_data) indices = list(range(num_train)) np.random.shuffle(indices) split = int(np.floor(valid_size * num_train)) train_idx, valid_idx = indices[split:], indices[:split] # define samplers for obtaining training and validation batches train_sampler = SubsetRandomSampler(train_idx) valid_sampler = SubsetRandomSampler(valid_idx) # prepare data loaders train_loader = torch.utils.data.DataLoader(train_data, batch_size=batch_size, sampler=train_sampler, num_workers=num_workers) valid_loader = torch.utils.data.DataLoader(train_data, batch_size=batch_size, sampler=valid_sampler, num_workers=num_workers) test_loader = torch.utils.data.DataLoader(test_data, batch_size=batch_size, num_workers=num_workers) import matplotlib.pyplot as plt %matplotlib inline # obtain one batch of training images dataiter = iter(train_loader) images, labels = dataiter.next() images = images.numpy() # plot the images in the batch, along with the corresponding labels fig = plt.figure(figsize=(25, 4)) for idx in np.arange(20): ax = fig.add_subplot(2, 20/2, idx+1, xticks=[], yticks=[]) ax.imshow(np.squeeze(images[idx]), cmap='gray') # print out the correct label for each image # .item() gets the value contained in a Tensor ax.set_title(str(labels[idx].item())) img = np.squeeze(images[1]) fig = plt.figure(figsize = (12,12)) ax = fig.add_subplot(111) ax.imshow(img, cmap='gray') width, height = img.shape thresh = img.max()/2.5 for x in range(width): for y in range(height): val = round(img[x][y],2) if img[x][y] !=0 else 0 ax.annotate(str(val), xy=(y,x), horizontalalignment='center', verticalalignment='center', color='white' if img[x][y]<thresh else 'black') import torch.nn as nn import torch.nn.functional as F # define the NN architecture class Net(nn.Module): def __init__(self): super(Net, self).__init__() # number of hidden nodes in each layer (512) hidden_1 = 512 hidden_2 = 512 # linear layer (784 -> hidden_1) self.fc1 = nn.Linear(28 * 28, hidden_1) # linear layer (n_hidden -> hidden_2) self.fc2 = nn.Linear(hidden_1, hidden_2) # linear layer (n_hidden -> 10) self.fc3 = nn.Linear(hidden_2, 10) # dropout layer (p=0.2) # dropout prevents overfitting of data self.dropout = nn.Dropout(0.2) def forward(self, x): # flatten image input x = x.view(-1, 28 * 28) # add hidden layer, with relu activation function x = F.relu(self.fc1(x)) # add dropout layer x = self.dropout(x) # add hidden layer, with relu activation function x = F.relu(self.fc2(x)) # add dropout layer x = self.dropout(x) # add output layer x = self.fc3(x) return x # initialize the NN model = Net() print(model) # specify loss function (categorical cross-entropy) criterion = nn.CrossEntropyLoss() # specify optimizer (stochastic gradient descent) and learning rate = 0.01 optimizer = torch.optim.SGD(model.parameters(), lr=0.01) # number of epochs to train the model n_epochs = 50 # initialize tracker for minimum validation loss valid_loss_min = np.Inf # set initial "min" to infinity for epoch in range(n_epochs): # monitor training loss train_loss = 0.0 valid_loss = 0.0 ################### # train the model # ################### model.train() # prep model for training for data, target in train_loader: # clear the gradients of all optimized variables optimizer.zero_grad() # forward pass: compute predicted outputs by passing inputs to the model output = model(data) # calculate the loss loss = criterion(output, target) # backward pass: compute gradient of the loss with respect to model parameters loss.backward() # perform a single optimization step (parameter update) optimizer.step() # update running training loss train_loss += loss.item()*data.size(0) ###################### # validate the model # ###################### model.eval() # prep model for evaluation for data, target in valid_loader: # forward pass: compute predicted outputs by passing inputs to the model output = model(data) # calculate the loss loss = criterion(output, target) # update running validation loss valid_loss += loss.item()*data.size(0) # print training/validation statistics # calculate average loss over an epoch train_loss = train_loss/len(train_loader.dataset) valid_loss = valid_loss/len(valid_loader.dataset) print('Epoch: {} \tTraining Loss: {:.6f} \tValidation Loss: {:.6f}'.format( epoch+1, train_loss, valid_loss )) # save model if validation loss has decreased if valid_loss <= valid_loss_min: print('Validation loss decreased ({:.6f} --> {:.6f}). Saving model ...'.format( valid_loss_min, valid_loss)) torch.save(model.state_dict(), 'model.pt') valid_loss_min = valid_loss model.load_state_dict(torch.load('model.pt')) # initialize lists to monitor test loss and accuracy test_loss = 0.0 class_correct = list(0. for i in range(10)) class_total = list(0. for i in range(10)) model.eval() # prep model for evaluation for data, target in test_loader: # forward pass: compute predicted outputs by passing inputs to the model output = model(data) # calculate the loss loss = criterion(output, target) # update test loss test_loss += loss.item()*data.size(0) # convert output probabilities to predicted class _, pred = torch.max(output, 1) # compare predictions to true label correct = np.squeeze(pred.eq(target.data.view_as(pred))) # calculate test accuracy for each object class for i in range(batch_size): label = target.data[i] class_correct[label] += correct[i].item() class_total[label] += 1 # calculate and print avg test loss test_loss = test_loss/len(test_loader.dataset) print('Test Loss: {:.6f}\n'.format(test_loss)) for i in range(10): if class_total[i] > 0: print('Test Accuracy of %5s: %2d%% (%2d/%2d)' % ( str(i), 100 * class_correct[i] / class_total[i], np.sum(class_correct[i]), np.sum(class_total[i]))) else: print('Test Accuracy of %5s: N/A (no training examples)' % (classes[i])) print('\nTest Accuracy (Overall): %2d%% (%2d/%2d)' % ( 100. * np.sum(class_correct) / np.sum(class_total), np.sum(class_correct), np.sum(class_total))) # obtain one batch of test images dataiter = iter(test_loader) images, labels = dataiter.next() # get sample outputs output = model(images) # convert output probabilities to predicted class _, preds = torch.max(output, 1) # prep images for display images = images.numpy() # plot the images in the batch, along with predicted and true labels fig = plt.figure(figsize=(25, 4)) for idx in np.arange(20): ax = fig.add_subplot(2, 20/2, idx+1, xticks=[], yticks=[]) ax.imshow(np.squeeze(images[idx]), cmap='gray') ax.set_title("{} ({})".format(str(preds[idx].item()), str(labels[idx].item())), color=("green" if preds[idx]==labels[idx] else "red")) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: If CPLEX is not installed, you can install CPLEX Community edition. Step2: Step 2 Step3: Step 3 Step5: Use basic HTML and a stylesheet to format the data. Step6: Let's display the data we just prepared. Step7: Step 4 Step8: Define the decision variables Step9: We also have to decide how much should be spent in advertising for each time of gasoline. To do so, we will create a list of continuous variables, indexed by the gasolines. Step10: Express the business constraints Step11: Maximum capacity Step12: Octane and Lead levels Step13: Maximum total production Step14: Express the objective Step15: Solve with Decision Optimization Step16: Step 5 Step17: Let's display some KPIs in pie charts using the Python package matplotlib. Step18: Production Step19: We see that the most produced gasoline type is by far regular. Step20: Notice the missing bar for (crude2, diesel) which is expected since blend[crude2, diesel] is zero in the solution.
<ASSISTANT_TASK:> Python Code: import sys try: import docplex.mp except: raise Exception('Please install docplex. See https://pypi.org/project/docplex/') try: import cplex except: raise Exception('Please install CPLEX. See https://pypi.org/project/cplex/') import numpy as np gas_names = ["super", "regular", "diesel"] gas_data = np.array([[3000, 70, 10, 1], [2000, 60, 8, 2], [1000, 50, 6, 1]]) oil_names = ["crude1", "crude2", "crude3"] oil_data = np.array([[5000, 45, 12, 0.5], [5000, 35, 6, 2], [5000, 25, 8, 3]]) nb_gas = len(gas_names) nb_oils = len(oil_names) range_gas = range(nb_gas) range_oil = range(nb_oils) print("Number of gasoline types = {0}".format(nb_gas)) print("Number of crude types = {0}".format(nb_oils)) # global data production_cost = 4 production_max = 14000 # each $1 spent on advertising increases demand by 10. advert_return = 10 import pandas as pd gaspd = pd.DataFrame([(gas_names[i],int(gas_data[i][0]),int(gas_data[i][1]),int(gas_data[i][2]),int(gas_data[i][3])) for i in range_gas]) oilpd = pd.DataFrame([(oil_names[i],int(oil_data[i][0]),int(oil_data[i][1]),int(oil_data[i][2]),oil_data[i][3]) for i in range_oil]) gaspd.columns = ['name','demand','price','octane','lead'] oilpd.columns= ['name','capacity','price','octane','lead'] CSS = body { margin: 0; font-family: Helvetica; } table.dataframe { border-collapse: collapse; border: none; } table.dataframe tr { border: none; } table.dataframe td, table.dataframe th { margin: 0; border: 1px solid white; padding-left: 0.25em; padding-right: 0.25em; } table.dataframe th:not(:empty) { background-color: #fec; text-align: left; font-weight: normal; } table.dataframe tr:nth-child(2) th:empty { border-left: none; border-right: 1px dashed #888; } table.dataframe td { border: 2px solid #ccf; background-color: #f4f4ff; } table.dataframe thead th:first-child { display: none; } table.dataframe tbody th { display: none; } from IPython.core.display import HTML HTML('<style>{}</style>'.format(CSS)) from IPython.display import display print("Gas data:") display(gaspd) print("Oil data:") display(oilpd) from docplex.mp.model import Model mdl = Model(name="oil_blending") blends = mdl.continuous_var_matrix(keys1=nb_oils, keys2=nb_gas, lb=0) adverts = mdl.continuous_var_list(nb_gas, lb=0) # gasoline demand is numpy array field #0 mdl.add_constraints(mdl.sum(blends[o, g] for o in range(nb_oils)) == gas_data[g][0] + advert_return * adverts[g] for g in range(nb_gas)) mdl.print_information() mdl.add_constraints(mdl.sum(blends[o,g] for g in range_gas) <= oil_data[o][0] for o in range_oil) mdl.print_information() # minimum octane level # octane is numpy array field #2 mdl.add_constraints(mdl.sum(blends[o,g]*(oil_data[o][2] - gas_data[g][2]) for o in range_oil) >= 0 for g in range_gas) # maximum lead level # lead level is numpy array field #3 mdl.add_constraints(mdl.sum(blends[o,g]*(oil_data[o][3] - gas_data[g][3]) for o in range_oil) <= 0 for g in range_gas) mdl.print_information() # -- maximum global production mdl.add_constraint(mdl.sum(blends) <= production_max) mdl.print_information() # KPIs total_advert_cost = mdl.sum(adverts) mdl.add_kpi(total_advert_cost, "Total advertising cost") total_oil_cost = mdl.sum(blends[o,g] * oil_data[o][1] for o in range_oil for g in range_gas) mdl.add_kpi(total_oil_cost, "Total Oil cost") total_production_cost = production_cost * mdl.sum(blends) mdl.add_kpi(total_production_cost, "Total production cost") total_revenue = mdl.sum(blends[o,g] * gas_data[g][1] for g in range(nb_gas) for o in range(nb_oils)) mdl.add_kpi(total_revenue, "Total revenue") # finally the objective mdl.maximize(total_revenue - total_oil_cost - total_production_cost - total_advert_cost) assert mdl.solve(), "Solve failed" mdl.report() all_kpis = [(kp.name, kp.compute()) for kp in mdl.iter_kpis()] kpis_bd = pd.DataFrame(all_kpis, columns=['kpi', 'value']) blend_values = [ [ blends[o,g].solution_value for g in range_gas] for o in range_oil] total_gas_prods = [sum(blend_values[o][g] for o in range_oil) for g in range_gas] prods = list(zip(gas_names, total_gas_prods)) prods_bd = pd.DataFrame(prods) %matplotlib inline import matplotlib.pyplot as plt def display_pie(pie_values, pie_labels, colors=None,title=''): plt.axis("equal") plt.pie(pie_values, labels=pie_labels, colors=colors, autopct="%1.1f%%") plt.title(title) plt.show() display_pie( [kpnv[1] for kpnv in all_kpis], [kpnv[0] for kpnv in all_kpis],title='KPIs: Revenue - Oil Cost - Production Cost') display_pie(total_gas_prods, gas_names, colors=["green", "goldenrod", "lightGreen"],title='Gasoline Total Production') sblends = [(gas_names[n], oil_names[o], round(blends[o,n].solution_value)) for n in range_gas for o in range_oil] blends_bd = pd.DataFrame(sblends) f, barplot = plt.subplots(1, figsize=(16,5)) bar_width = 0.1 offset = 0.12 rho = 0.7 # position of left-bar boundaries bar_l = [o for o in range_oil] mbar_w = 3*bar_width+2*max(0, offset-bar_width) tick_pos = [b*rho + mbar_w/2.0 for b in bar_l] colors = ['olive', 'lightgreen', 'cadetblue'] for i in range_oil: barplot.bar([b*rho + (i*offset) for b in bar_l], blend_values[i], width=bar_width, color=colors[i], label=oil_names[i]) plt.xticks(tick_pos, gas_names) barplot.set_xlabel("gasolines") barplot.set_ylabel("blend") plt.legend(loc="upper right") plt.title('Blend Repartition\n') # Set a buffer around the edge plt.xlim([0, max(tick_pos)+mbar_w +0.5]) plt.show() print("* value of blend[crude2, diesel] is %g" % blends[1,2]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Perform the simulation Step2: Plot pretty pictures of what we just did
<ASSISTANT_TASK:> Python Code: # Third party python libraries import numpy # Try and import from "The Virtual Brain" from tvb.simulator.lab import * from tvb.datatypes.time_series import TimeSeriesRegion import tvb.analyzers.fmri_balloon as bold from tvb.simulator.plot import timeseries_interactive as timeseries_interactive LOG.info("Configuring...") #Initialise a Model, Coupling, and Connectivity. lb = models.LarterBreakspear(QV_max=1.0, QZ_max=1.0, d_V=0.65, d_Z=0.65, aee=0.36, ani=0.4, ane=1.0, C=0.1) lb.variables_of_interest = ["V", "W", "Z"] white_matter = connectivity.Connectivity(load_default=True) white_matter.speed = numpy.array([7.0]) white_matter_coupling = coupling.HyperbolicTangent(a=0.5*lb.QV_max, midpoint=lb.VT, sigma=lb.d_V) #Initialise an Integrator heunint = integrators.HeunDeterministic(dt=0.2) #Initialise some Monitors with period in physical time mon_tavg = monitors.TemporalAverage(period=2.) mon_bold = monitors.Bold(period=2000.) #Bundle them what_to_watch = (mon_bold, mon_tavg) #Initialise a Simulator -- Model, Connectivity, Integrator, and Monitors. sim = simulator.Simulator(model = lb, connectivity = white_matter, coupling = white_matter_coupling, integrator = heunint, monitors = what_to_watch) sim.configure() LOG.info("Starting simulation...") #Perform the simulation bold_data, bold_time = [], [] tavg_data, tavg_time = [], [] for raw, tavg in sim(simulation_length=480000): if not raw is None: bold_time.append(raw[0]) bold_data.append(raw[1]) if not tavg is None: tavg_time.append(tavg[0]) tavg_data.append(tavg[1]) LOG.info("Finished simulation.") #Make the lists numpy.arrays for easier use. LOG.info("Converting result to array...") TAVG_TIME = numpy.array(tavg_time) BOLD_TIME = numpy.array(bold_time) BOLD = numpy.array(bold_data) TAVG = numpy.array(tavg_data) #Create TimeSeries instance tsr = TimeSeriesRegion(data = TAVG, time = TAVG_TIME, sample_period = 2.) tsr.configure() #Create and run the monitor/analyser bold_model = bold.BalloonModel(time_series = tsr) bold_data = bold_model.evaluate() bold_tsr = TimeSeriesRegion(connectivity = white_matter, data = bold_data.data, time = bold_data.time) #Prutty puctures... tsi = timeseries_interactive.TimeSeriesInteractive(time_series = bold_tsr) tsi.configure() tsi.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: As always, let's do imports and initialize a logger and a new Bundle. See Building a System for more details. Step2: Relevant Parameters Step3: Relevant Constraints Step4: Influence on Meshes (volume conservation) Step5: Influence on Radial Velocities Step6: Influence on Light Curves (fluxes)
<ASSISTANT_TASK:> Python Code: !pip install -I "phoebe>=2.2,<2.3" %matplotlib inline import phoebe from phoebe import u # units import numpy as np import matplotlib.pyplot as plt logger = phoebe.logger() b = phoebe.default_binary() print(b.get_parameter(qualifier='ecc')) print(b.get_parameter(qualifier='ecosw', context='component')) print(b.get_parameter(qualifier='esinw', context='component')) print(b.get_parameter(qualifier='ecosw', context='constraint')) print(b.get_parameter(qualifier='esinw', context='constraint')) b.add_dataset('mesh', times=np.linspace(0,1,11), columns=['volume']) b.set_value('ecc', 0.2) b.run_compute() print(b['volume@primary@model']) afig, mplfig = b['mesh01'].plot(x='times', y='volume', show=True) b.remove_dataset('mesh01') b.add_dataset('rv', times=np.linspace(0,1,51)) b.run_compute() afig, mplfig = b['rv@model'].plot(show=True) b.remove_dataset('rv01') b.add_dataset('lc', times=np.linspace(0,1,51)) b.run_compute() afig, mplfig = b['lc@model'].plot(show=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Missing colon at the end of for, while, if, def statements. Step2: Incorrect indentation. Don't mix spaces and tabs! Step3: Mismatched quotation marks. Step4: Unclosed brackets Step5: Runtime errors Step7: User-defined exceptions Step8: Defining Clean-up Actions
<ASSISTANT_TASK:> Python Code: while = 1 for i in range(1,10) print('Hello world') for i in range(1,10): x = 1 + i print(x) print("Some python issues are easier to find than others ') print("Missing brackets can be difficult" , range(1,10) print("to find. probably not these ones however.") x = int(input("Please enter a number: ")) print(x) while True: try: x = int(input("Please enter a number:")) break except ValueError: print("oops!") class MyInputError(Exception): Exception raised for errors in the input. Attributes: message -- explanation of the error def __init__(self,*args,**kwargs): Exception.__init__(self,*args,**kwargs) self.dError = "Internal Error 10" try: raise MyInputError("MyInputError") raise AssertionError("Sample Assertion Error") except MyInputError as err: print('InputError caught:',err) print('dError:',err.dError) except AssertionError as err: print('Assertion error caught:',err) ?type try: # raise MyInputError("New error, test finally") # except MyInputError as err: print('MyInputError:',err) print('dError:',err.dError) finally: print('Graceful Cleanup: Goodbye, world!') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: To compute if an optical transition between two states is possible or not, we first get some libraries to make this easier. Step2: The question is, whether there is a transition matrix element between the aforementioned initial and final states. We can easily anser that with a yes, since the receiving level $\beta,+$ is empty in the initial state and no spin flip is involved when moving the particle from $\alpha,+$ to $\beta,+$. Thus, the question now is how to compute it in a systematic way. Step3: We can see that we get a change in positions $0$ and $6$ which correspond to $\alpha,+$ and $\beta,+$ in site $i$ and $j$, respectively. Now we apply modulo 2, which will allow us to check if the changes are in even or odd positions mapping even positions to $0$ whereas odd positions to $1$. Thus, if both are even or odd there will be just one unique element in the list otherwise there will be two unique elements. Step5: Thus, in this case of chosen initial and finals states, the transition is allowed since both are even. We can wraps all of this logic in a function. Step6: Now we have a function that tells us if between two states an optical transition is possible or not. To recapitulate, we can recompute our previous case and then with a different final state that is not allowed since it involves a spin flip, e.g., [0 0 0 0 0 1 1 0]. Step8: With this preamble, we are equiped to handle more complex cases. Given the chosen computational representation for the states, the normalization coefficients of the states are left out. Thus, one has to take care to keep track of them when constructing properly the transition matrix element in question later on. Step9: With this we can generate states of 3, 4, and 5 electrons in a 3 level system with degeneracy 2 meaning 6 levels in total. Step10: We can consider first the $d^4$ states and take a look at them. Step11: It is quite a list of generated states. But from this whole list, not all states are relevant for the problem at hand. This means that we can reduce the amount of states beforehand by applying the physical constrains we have. Step12: We obtain 4 different $d^4$ states that fullfill the conditions previously indicated. From the previous list, the first and last elements correspond to states with $S_z=\pm1$ whereas the ones in the middle correspond to the two superimposed states for the $S=0$ state, namely, a magnon. These four states, could have been easily written down by hand, but the power of this approach is evident when generating and selecting the possible states of the $d^3$ configuration. Step13: In the case of the $d^5$ states, since our ground state has a doule occupied $d_{xy}$ orbital then it has to stay occupied. Step15: We could generate all $d^3d^5$ combinations and check how many of them there are. Step18: We already saw in the previous section how we can check if a transition is allowed in our list codification of the states. Here we will make it a function slightly more complex to help us deal with generating final states. Step19: With this, we can now explore the transitions between the different initial states and final states ($^4A_2$, $^2E$, and $^2T_1$ multiplets for the $d^3$ sector). Concerning the $d^4$ states, as explained in chapter 5, there is the possibility to be in the $S_z=\pm1$ or $S_z=0$. We will cover each one of them in the following. Step20: whereas the ones for the$|^4A_2,\pm1/2>$ Step21: Notice that the prefactors and signs are missing from this representation, and have to be taken into account when combining all the pieces into the end result. Step22: Handling the ferromagnetic ordering first, the allowed transitions from the initial state into the $|^4A_2,3/2>$ state are Step23: Comparing the initial and final states representations and considering the $|^4A_2,3/2>$ prefactor, we obtain that there are two possible transitions with matrix element $t_{xy,xz}$ and $t_{xy,yz}$. Each one is allowed twice from swapping the positions between $d^3$ and $d^5$. Step24: Thus, for the $|^4A_2,\pm1/2>$ states, there is no allowed transition starting from the FM initial ground state. Step25: We see that the AFM initial ground state has no transition matrix element for the $|^4A_2,3/2>$ state. Whereas transitions involving the $|^4A_2,\pm1/2>$ state are allowed. Once again, checking the prefactors for the multiplet and the initial ground state we get a transition matrix element of $t_{xy,xz}/\sqrt{3}$ and $t_{xy,yz}/\sqrt{3}$, twice each. Step26: Thus, we append the $d^4_\uparrow$ representation to each part of the $d^4_0$ states. Then, checking for the transitions into the $|^4A_2,\pm3/2>$ $d^3$ state we get Step27: Collecting the terms we get that for $|^4A_2, 3/2>$ there is no transitions into a $|d^3>|d^5>$ final state but there are transitions into two different $|d^5>|d^3>$ final states, one for each of the $|A>$ and $|B>$ parts. Thus, considering the numerical factors of the involved states, the amplitude in this case is $\frac{1}{\sqrt{2}}t_{xy,xz}$ and $\frac{1}{\sqrt{2}}t_{xy,yz}$. In this case, the states involved in $|^4A_2, -3/2>$ do not show any allowed transition. Step28: Here, we observe the same situation than before but swapping the roles between the $|^4A_2,\pm3/2>$ states. This means that the contribution of the $d^0 d^4_\uparrow$ is the same as the $d^0 d^4_\downarrow$ one. Step29: Following the same procedure for the $|^4A_2, 1/2>$ states and $d^4_0d^4_\uparrow$ ground state Step30: Here we get some possible transitions to final states of interest. Here, we have to remember that the "receiving" $d3$ multiplet has three terms, which have to be added if present. For the $|d^3>|d^5>$ case there are two allowed transitions into $d^5$ states involving $t_{xy,xz}$ and $t_{xy,yz}$ for $|A>$ and $|B>$. From $|A>$ and $|B>$ we find computed terms that correspond to the same $d^5$ final state that have to be added. Step31: there is no transition found. Step32: Which is the same situation than before but swapping the position of the contributions as we already saw for the $|^4A_2, 3/2>$ case. For completeness we show the situation with $d^4_\downarrow$ as follows. Step33: Continuing with the $d^4_0d^4_0$ the situation gets more complicated since $<f|\hat{t}|d^4_0>|d^4_0>$ can be split as follows $<f|\hat{t}(|A>+|B>)(|A>+|B>)$ which gives 4 terms labeled $F$ to $I$. Thus, we construct the four combinations for the initial state and calculate each one of them to later sum them up. Step34: First dealing with the $|^4A_2,\pm 3/2>$ states for the $d^3$ sector. Step35: No transitions from the $d^4_0d^4_0$ state to $|^4A_2,\pm3/2>$. Step36: Here we have terms for both $|d^3>|d^5>$ and $|d^5>|d^3>$ and for each component of the initial state which can be grouped into which $d^5$ state they transition into. Terms pairs $F-H$ and $G-I$ belong together involving the $d^5_{xz\downarrow}$ and $d^5_{yz\downarrow}$ states, respectively. Step37: For $|^4A_2,-1/2>$ states we obtain the same values than for $|^4A_2,1/2>$ but involving the other spin state. Step38: For the $|^2E,a>$ multiplet, only transitions from the AFM ground state are possible. Collecting the prefactors we get that the transition matrix element in $-\sqrt{2/3}t_{xy,xz}$ and $-\sqrt{2/3}t_{xy,yz}$ as could be easily checked by hand. Step39: From the $S=\pm1$ initial states, no transitions possible to Eb. Step40: Each one of the combinations is allowed, thus considering the prefactors of the $S_0$ and $|^2E,a>$ we obtain $\sqrt{\frac{2}{3}}t_{xy,xz}$ and $\sqrt{\frac{2}{3}}t_{xy,yz}$. Step41: Adding all the contributions of the allowed terms we obtain, that due to the - sign in the $|^2E,b>$ multiplet, the contribution is 0. Step42: and then we add the $d^4_\uparrow$ representation to each one. Thus, for the $|^2E, Ea>$ $d^3$ multiplet we get Step43: Here, both parts of the $S_z=0$ state contribute. Checking the prefactors for $S_z=0$ ($1/\sqrt{2}$) and $|^2E, Ea>$ ($1/\sqrt{6}$) we get a matrix element $\sqrt{\frac{2}{3}}t_{xy/xz}$. Step44: $|^2T_1,+/->$ Step45: And for the $|^2T_1,->$ Step46: In this case, there is no possible transition to states with a singly occupied $\textit{xy}$ orbital from the $\textit{xy}$ ordered ground state. Step47: We can see that the transitions from the ferromagnetic state are forbidden for the $xy$ orbitally ordered ground state for both $|^2T_1, xz\uparrow>$ and $|^2T_1, yz\uparrow>$ while allowing for transitions with amplitudes Step48: S=0 Step49: First, we calculate for the $d^4_0d^4_\uparrow$ ground state. Again the $d^4_0$ state is split in two parts. Step50: And for $d^4_0d^4_\downarrow$ Step51: Thus, for final states with singly occupied $\textit{xz}$ multiplet, we obtain transitions involving $t_{yz,xz}/2$, $t_{yz,yz}/2$, $t_{xz,xz}/2$ and $t_{xz,yz}/2$ when accounting for the prefactors of the states. Step52: In this case, considering the prefactors of the states involved, we obtain contributions $t_{yz,xy}/{2}$ and $t_{yz,yz}/{2}$, $t_{xz,xz}/{2}$, and $t_{xz,yz}/{2}$.
<ASSISTANT_TASK:> Python Code: initial = [1, 0, 0, 0, 1, 0, 0, 0] final = [0, 0, 0, 0, 1, 0, 1, 0] # Importing necessary extensions import numpy as np import itertools import functools import operator # The use of type annotations requires Python 3.6 or newer from typing import List # looking for the positions/levels with different occupation changes = np.logical_xor(initial, final) # obtaining the indexes of those positions np.nonzero(changes)[0].tolist() modulo = 2 np.unique(np.remainder(np.nonzero(changes), modulo)).size == 1 def is_allowed(initial: List[int], final: List[int]) -> bool: Given an initial and final states as represented in a binary list, returns if it is allowed considering spin conservation. return np.unique( np.remainder( np.nonzero( np.logical_xor(initial,final)), 2)).size == 1 is_allowed(initial, final) is_allowed(initial, [0, 0, 0, 0, 0, 1, 1, 0]) def generate_states(electrons: int, levels: int) -> List[List[int]]: Generates the list representation of a given number of electrons and levels (degeneracy not considered). # create an array of length equal to the amount of levels # with an amount of 1's equal to the number of electrons # specified which will be used as a seed/template seed = [1 if position < electrons else 0 for position in range(levels)] # taking the seed state, we generate all possible permutations # and remove duplicates using a set operation generated_states = list(set(itertools.permutations(seed))) generated_states.sort(reverse=True) return generated_states states_d3 = generate_states(3,6) states_d4 = generate_states(4,6) states_d5 = generate_states(5,6) states_d4 possible_states_d4 = [ # select states that fulfill list(state) for state in states_d4 # dxy orbital double occupancy if state[0]==1 and state[1]==1 # dzx/dyz orbital single occupancy and state[2] is not state[3] ] possible_states_d4 possible_states_d3 = [list(state) for state in states_d3 if state[0]==1 # xy up occupied or state[1]==1] # xy down occupied possible_states_d3 possible_states_d5 = [list(state) for state in states_d5 # xy up down occupied if state[0]==1 and state[1]==1 ] possible_states_d5 def combine_states(first: List[List[int]], second: List[List[int]]) -> List[List[int]]: Takes two lists of list representations of states and returns the list representation of a two-site state. # Producing all the possible final states. # This has to be read from bottom to top. # 3) the single site representations are combined # into one single two-site representation # 2) we iterate over all the combinations produced # 1) make the product of the given first and second # states lists final_states = [ functools.reduce(operator.add, combination) # 3) for combination # 2) in itertools.product(first, second) # 1) ] final_states.sort(reverse=True) return final_states print("The number of combined states is: ", len(combine_states(possible_states_d3,possible_states_d5))) def label(initial, final, levels, mapping): Helper function to label the levels/orbitals involved. changes = np.nonzero(np.logical_xor(initial, final)) positions = np.remainder(changes, levels)//2 return f"{mapping[positions[0][0]]} and {mapping[positions[0][1]]}" def transition(initial: List[int], final: List[List[int]], debug = False) -> None: This function takes the list representation of an initial double site state and a list of final d3 states of intrest. Then, it computes if the transition from the given initial state to a compounded d3d5 final states are possible. The d5 states are implicitly used in the function from those already generated and filtered. def process(final_states): # We iterate over all final states and test whether the # transition from the given initial state is allowed for state in final_states: allowed = is_allowed(initial, state) if allowed: labeled = label(initial, state, 6, {0: "xy", 1: "xz", 2: "yz"}) print(f" final state {state} allowed \ between {labeled}.") else: if debug: print(f" final state {state} not allowed.") d5 = list(possible_states_d5) print("From initial state {}".format(initial)) print("d3d5") process(combine_states(final, d5)) print("d5d3") process(combine_states(d5, final)) A2_32 = [[1,0,1,0,1,0]] # 4A2 Sz=3/2 A2_neg_32 = [[0,1,0,1,0,1]] # 4A2 Sz=-3/2 A2_12 = [[0,1,1,0,1,0], [1,0,0,1,1,0], [1,0,1,0,0,1]] # 4A2 Sz=1/2 A2_neg_12 = [[1,0,0,1,0,1], [0,1,1,0,0,1], [0,1,0,1,1,0]] # 4A2 Sz=-1/2 FM = [1,1,1,0,1,0,1,1,1,0,1,0] AFM_up = [1,1,1,0,1,0,1,1,0,1,0,1] AFM_down = [1,1,0,1,0,1,1,1,1,0,1,0] transition(FM, A2_32) transition(FM, A2_12) transition(FM, A2_neg_12) transition(AFM_up, A2_32) transition(AFM_up, A2_12) transition(AFM_up, A2_neg_12) S0_1 = [1, 1, 1, 0, 0, 1] # |A> S0_2 = [1, 1, 0, 1, 1, 0] # |B> d_zero_down = [1, 1, 0, 1, 0, 1] d_zero_up = [1, 1, 1, 0, 1, 0] transition(S0_1 + d_zero_up, A2_32) transition(S0_2 + d_zero_up, A2_32) print("\n\n") transition(S0_1 + d_zero_up, A2_neg_32) transition(S0_2 + d_zero_up, A2_neg_32) transition(S0_1 + d_zero_down, A2_32) transition(S0_2 + d_zero_down, A2_32) print("\n\n") transition(S0_1 + d_zero_down, A2_neg_32) transition(S0_2 + d_zero_down, A2_neg_32) transition(d_zero_up + S0_1, A2_32) transition(d_zero_up + S0_2, A2_32) print("\n\n") transition(d_zero_up + S0_1, A2_neg_32) transition(d_zero_up + S0_2, A2_neg_32) print("\n\n") transition(d_zero_down + S0_1, A2_32) transition(d_zero_down + S0_2, A2_32) print("\n\n") transition(d_zero_down + S0_1, A2_neg_32) transition(d_zero_down + S0_2, A2_neg_32) transition(S0_1 + d_zero_up, A2_12) transition(S0_2 + d_zero_up, A2_12) transition(S0_1 + d_zero_up, A2_neg_12) transition(S0_2 + d_zero_up, A2_neg_12) transition(d_zero_up + S0_1, A2_12) transition(d_zero_up + S0_2, A2_12) print("\n\n") transition(d_zero_up + S0_1, A2_neg_12) transition(d_zero_up + S0_2, A2_neg_12) transition(S0_1 + d_zero_down, A2_12) transition(S0_2 + d_zero_down, A2_12) print("\n\n") transition(d_zero_down + S0_1, A2_12) transition(d_zero_down + S0_2, A2_12) print("\n\n") transition(S0_1 + d_zero_down, A2_neg_12) transition(S0_2 + d_zero_down, A2_neg_12) print("\n\n") transition(d_zero_down + S0_1, A2_neg_12) transition(d_zero_down + S0_2, A2_neg_12) F = S0_1 + S0_1 G = S0_1 + S0_2 H = S0_2 + S0_1 I = S0_2 + S0_2 transition(F, A2_32) transition(G, A2_32) transition(H, A2_32) transition(I, A2_32) transition(F, A2_neg_32) transition(G, A2_neg_32) transition(H, A2_neg_32) transition(I, A2_neg_32) transition(F, A2_12) transition(G, A2_12) transition(H, A2_12) transition(I, A2_12) transition(F, A2_neg_12) transition(G, A2_neg_12) transition(H, A2_neg_12) transition(I, A2_neg_12) Ea = [[0,1,1,0,1,0], [1,0,0,1,1,0], [1,0,1,0,0,1]] transition(AFM_down, Ea) transition(AFM_up, Ea) transition(FM, Ea) Eb = [[1,0,1,0,0,1], [1,0,0,1,1,0]] transition(AFM_down, Eb) transition(AFM_up, Eb) transition(FM, Eb) transition(S0_1 + S0_1, Ea) transition(S0_1 + S0_2, Ea) transition(S0_2 + S0_1, Ea) transition(S0_2 + S0_2, Ea) transition(S0_1 + S0_1, Eb) transition(S0_1 + S0_2, Eb) transition(S0_2 + S0_1, Eb) transition(S0_2 + S0_2, Eb) S0_1 = [1, 1, 1, 0, 0, 1] S0_2 = [1, 1, 0, 1, 1, 0] transition(S0_1 + d_zero_up, Ea) transition(S0_2 + d_zero_up, Ea) print("\n\n") transition(d_zero_up + S0_1, Ea) transition(d_zero_up + S0_2, Ea) transition(S0_1 + d_zero_up, Eb) transition(S0_2 + d_zero_up, Eb) print("\n\n") transition(d_zero_up + S0_1, Eb) transition(d_zero_up + S0_2, Eb) T1_p_xy = [[1,0,1,1,0,0], [1,0,0,0,1,1]] transition(AFM_down, T1_p_xy) transition(AFM_up, T1_p_xy) transition(FM, T1_p_xy) T1_n_xy = [[0,1,1,1,0,0], [0,1,0,0,1,1]] transition(AFM_down, T1_n_xy) transition(AFM_up, T1_n_xy) transition(FM, T1_n_xy) T1_p_xz = [[1,1,1,0,0,0], [0,0,1,0,1,1]] transition(AFM_up, T1_p_xz) transition(FM, T1_p_xz) T1_p_yz = [[1,1,0,0,1,0], [0,0,1,1,1,0]] transition(AFM_up, T1_p_yz) transition(FM, T1_p_yz) T1_n_xz = [[1,1,0,1,0,0], [0,0,0,1,1,1]] transition(AFM_up, T1_n_xz) transition(FM, T1_n_xz) T1_n_yz = [[1,1,0,0,0,1], [0,0,1,1,0,1]] transition(AFM_up, T1_n_yz) transition(FM, T1_n_yz) S0_1 = [1, 1, 1, 0, 0, 1] S0_2 = [1, 1, 0, 1, 1, 0] T1_p_xz = [[1,1,1,0,0,0], [0,0,1,0,1,1]] T1_p_yz = [[1,1,0,0,1,0], [0,0,1,1,1,0]] transition(S0_1 + d_zero_up, T1_p_xz) transition(S0_2 + d_zero_up, T1_p_xz) print("\n\n") transition(S0_1 + d_zero_up, T1_p_yz) transition(S0_2 + d_zero_up, T1_p_yz) transition(S0_1 + d_zero_down, T1_p_xz) transition(S0_2 + d_zero_down, T1_p_xz) print("\n\n") transition(S0_1 + d_zero_down, T1_p_yz) transition(S0_2 + d_zero_down, T1_p_yz) transition(d_zero_up + S0_1, T1_p_xz) transition(d_zero_up + S0_2, T1_p_xz) print("\n\n") transition(d_zero_up + S0_1, T1_p_yz) transition(d_zero_up + S0_2, T1_p_yz) print("\n\n") print("\n\n") transition(d_zero_down + S0_1, T1_p_xz) transition(d_zero_down + S0_2, T1_p_xz) print("\n\n") transition(d_zero_down + S0_1, T1_p_yz) transition(d_zero_down + S0_2, T1_p_yz) transition(S0_1 + S0_1, T1_p_xz) transition(S0_1 + S0_2, T1_p_xz) transition(S0_2 + S0_1, T1_p_xz) transition(S0_2 + S0_2, T1_p_xz) print("------------------------") transition(S0_1 + S0_1, T1_p_yz) transition(S0_1 + S0_2, T1_p_yz) transition(S0_2 + S0_1, T1_p_yz) transition(S0_2 + S0_2, T1_p_yz) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Random Forest Classifier Step2: Cantidad de árboles entrenados Step3: Veamos el primero de ellos Step4: Y sus métricas
<ASSISTANT_TASK:> Python Code: import base64 token = base64.b64decode("Njk4ZGVjMWE5Y2YyNDQ5ZmNhY2FkOWU4NDdjMDk5NWU1NTZhMDk5Yw====").decode("utf-8") ! rm -rf tp-datos-2c2020 datos ! git clone https://{token}@github.com/AlexDaciuk/tp-datos-2c2020.git ! mv tp-datos-2c2020 datos from datos.preproc import preprocessing from sklearn.preprocessing import MinMaxScaler from sklearn.model_selection import train_test_split from sklearn.ensemble import RandomForestClassifier from matplotlib import pyplot as plt from sklearn.tree import plot_tree import pandas as pd from sklearn.metrics import accuracy_score, precision_score, recall_score, f1_score, roc_curve, auc, roc_auc_score, confusion_matrix df_all = preprocessing.get_data() df_forest = preprocessing.rforest_preproc(df_all) # Separate test and train data X_train, X_test, y_train, y_test = train_test_split(df_forest.drop('volveria', 1), df_forest['volveria']) model_rfr = RandomForestClassifier(max_depth=5) model_rfr.fit(X_train, y_train) preprocessing.report(model_rfr, X_train, y_train, X_test, y_test) pred_rfr = model_rfr.predict(X_test) len(model_rfr.estimators_) with plt.style.context("classic"): plt.figure(figsize=(20, 10)) plot_tree(model_rfr.estimators_[0], filled=True) pred_first_estimator = model_rfr.estimators_[0].predict(X_test) accuracy_score(y_test, pred_first_estimator) precision_score(y_test, pred_first_estimator) recall_score(y_test, pred_first_estimator) f1_score(y_test, pred_first_estimator) pred_estimators = [ estimator.predict(X_test) for estimator in model_rfr.estimators_ ] acc_estimators = [accuracy_score(y_test, pred) for pred in pred_estimators] plt.figure(figsize=(10, 10)) plt.hist(acc_estimators) plt.xlabel("Accuracy", weight="bold", fontsize=15) plt.ylabel("Frecuencia", weight="bold", fontsize=15) plt.title( "Histograma de accuracy de los arboles del RF model", weight="bold", fontsize=16 ) max(acc_estimators) min(acc_estimators) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: By default we should have the grid file from the SWI-STATIC collection and the unzipped SWI-TS products in one folder like so Step2: Since the returned value is a pandas.DataFrame we can plot the data easily.
<ASSISTANT_TASK:> Python Code: import os from ascat.cgls import SWI_TS import matplotlib.pyplot as plt %matplotlib inline ls ../tests/ascat_test_data/cglops/swi_ts data_path = os.path.join('..', 'tests', 'ascat_test_data', 'cglops', 'swi_ts') rd = SWI_TS(data_path) data = rd.read_ts(3002621) print(data) fig, ax = plt.subplots(1, 1, figsize=(15, 5)) data[['SWI_001', 'SWI_010']].plot(ax=ax) ax.set_ylabel('Soil Water Index (%)') plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Random biases, No randomness in weights Step2: fan-ins are almost identical across neurons, elements within one neuron's fan-in are different Step3: after 25 epochs Step4: No randomness in bias/weights Step5: fan-ins are identical across neurons, elements within one neuron's fan-in are identical Step6: after 25 epochs
<ASSISTANT_TASK:> Python Code: initialize() print(train()) print(train()) initialize() for layer in [a,b,c]: layer.weight.data = torch.ones_like(layer.weight) print(c.weight) train(), print(c.weight) train(), print(c.weight) train(), print(c.weight) b.weight #there's a small amount of symmetry breaking, but the fan-ins are pretty similar for _ in range(25): train() b.weight #now the fan-ins are pretty different initialize() for layer in [a,b,c]: layer.weight.data = torch.ones_like(layer.weight) layer.bias.data = torch.ones_like(layer.bias) print(c.weight, c.bias) train(), print(c.weight, c.bias) train(), print(c.weight, c.bias) train(), print(c.weight, c.bias) b.weight for _ in range(25): train() b.weight <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Next, let's load the data. Write the path to your sms.csv file in the cell below Step2: Execute the cell below to load the CSV data into a pandas data frame with the columns label and message. Step3: Building a spam classifier Step4: By convention, when we build a predictive model using scikit-learn, we separate our data into two variables, X and y Step5: We can now build our first classifier. Let's create one that marks every message as ham to start with (i.e. one with no spam phrases). It won't be very useful, but it will give us a baseline accuracy from which to improve on Step6: To measure how well our classifier works, let's create a classification report using the true labels for the SMS messages (y) and the predicted labels we've just created (y_pred) Step7: While we haven't covered some of the terms here in class yet, they're not difficult to understand Step8: As can be seen, the results have improved Step9: Again, this has improved our spam detector! Step10: It would be nice if we choose a set of spam keywords that maximized the performance of our model. We can do this using model selection, i.e. building a set of different candidate models and choosing the best one. This is easy to do with scikit-learn! Step11: It looks like a lot of the most popular words are ones we commonly use. These aren't good indicators of spam in general, so let's remove them. scikit-learn defines a set of stop words, i.e. words that are so commonly used that they don't indicate anything in particular. Let's remove these from our set of most popular words Step12: This looks like a better set of words to use. Let's make a list of all the possible different combinations of the most popular of these words (a brute force approach) using Python's itertools.combinations method Step13: Now, let's define a set of parameters to build models for. The set is just a Python dictionary, where the keys match the arguments of the classifier we're using (i.e. PhraseClassifier) and the values represent different choices that can be made for a particular key Step14: We can use the GridSearchCV class from scikit-learn to build every possible model defined by the parameters and choose the best one (i.e. to do model selection). Generally, when we use GridSearchCV, we will specify three parameters
<ASSISTANT_TASK:> Python Code: import itertools import pandas as pd from sklearn.base import BaseEstimator, ClassifierMixin from sklearn.model_selection import GridSearchCV, StratifiedKFold, cross_val_predict from sklearn.feature_extraction import stop_words from sklearn.metrics import classification_report data_file = 'data/sms.csv' sms = pd.read_csv(data_file, sep='\t', header=None, names=['label', 'message']) sms.head() class PhraseClassifier(BaseEstimator, ClassifierMixin): '''A rule-based spam classifer, backed by a list of spam phrases.''' def __init__(self, spam=[], lowercase=False): '''Initialises the classifier. Args: spam: A list of phrases used to identify spam. lowercase: Whether to convert messages to lowercase before predicting their class. ''' self.spam = spam self.lowercase = lowercase def fit(self, X, y=None): '''Fits the classifier. Note: As the classifier is rule-based, this is just a dummy method to ensure compatability with scikit-learn. Args: X: Unused. y: Unused. Returns: The classifier object (self). ''' return self def predict(self, X, y=None): '''Predicts the classes of the given messages. Args: X: List of messages to classify. y: Unused. Returns: A list of classifications, corresponding to the given messages. ''' results = [] for message in X: message = message.lower() if self.lowercase else message cls = self.spam_or_ham(message) results.append(cls) return results def spam_or_ham(self, message): '''Classifies the given message as spam or ham. Args: message: The message to classify. Returns: The predicted class of the message: 'spam' or 'ham'. ''' # Start out assuming we have ham result = 'ham' # If any of the phrases in self.spam match, then mark the message as spam for phrase in self.spam: if phrase in message: result = 'spam' break return result def score(self, X, y=None): '''Computes a score for the given messages and ground truth labels. Args: X: List of messages to classify. y: List of the true classes of the messages. Returns: The average number of correct classifications by the model. ''' y_pred = self.predict(X, y) return sum([1 if y1 == y2 else 0 for y1, y2 in zip(y, y_pred)]) / len(y) X = sms['message'] y = sms['label'] clf = PhraseClassifier() # clf is short for classifier y_pred = clf.predict(X) print(classification_report(y, y_pred)) clf = PhraseClassifier(spam=['urgent', 'win']) y_pred = clf.predict(X) print(classification_report(y, y_pred)) clf = PhraseClassifier(spam=['urgent', 'win'], lowercase=True) y_pred = clf.predict(X) print(classification_report(y, y_pred)) clf = PhraseClassifier(spam=['urgent', 'win', 'hi'], lowercase=True) y_pred = clf.predict(X) print(classification_report(y, y_pred)) # Create a list of the words in the training set messages that are labelled as spam spam_messages = X[y == 'spam'] spam_words = [word.lower() for message in spam_messages for word in message.split()] # Order the spam words by popularity top_spam_words = pd.Series(spam_words).value_counts().index.tolist() # Print the top ten top_spam_words[:10] top_spam_words = [word for word in top_spam_words if word not in stop_words.ENGLISH_STOP_WORDS] top_spam_words[:10] candidates = top_spam_words[:5] # Use the top five words combinations = [combination for n in range(1, len(candidates)) \ for combination in itertools.combinations(candidates, n)] print('Total combinations: %d' % len(combinations)) param_grid = { 'spam': combinations, # Try every combination of spam phrases 'lowercase': [True, False] # Try setting lowercase True and False } # Use inner CV to select the best model inner_cv = StratifiedKFold(n_splits=5, shuffle=True, random_state=0) # K = 5 clf = GridSearchCV(PhraseClassifier(), param_grid=param_grid, cv=inner_cv) clf.fit(X, y) # Use outer CV to evaluate the error of the best model outer_cv = StratifiedKFold(n_splits=10, shuffle=True, random_state=0) # K = 10, doesn't have to be the same y_pred = cross_val_predict(clf, X, y, cv=outer_cv) print(classification_report(y, y_pred)) print('Best parameters: %s' % clf.best_params_) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Get the Data Step2: Add a Computed Column Step3: Group By Analysis Step4: Sample the Data Step5: Check that Sampling is Even Step6: Train a Model Step7: Use the Model for Scoring Step8: Assess the Model Step9: Plot ROC Step10: Plot Lift
<ASSISTANT_TASK:> Python Code: import numpy as np import pandas as pd import matplotlib.pyplot as plt from IPython.core.display import display, HTML %matplotlib inline import swat s = swat.CAS('cloud.example.com', 5570) ulresult = s.upload('http://biostat.mc.vanderbilt.edu/wiki/pub/Main/DataSets/titanic3.csv') titanic3 = ulresult.casTable type(titanic3) titanic3.table.columnInfo() # Create a computed variable. titanic3.computedVars = ['deck'] # 1 titanic3.computedVarsProgram = \ "if cabin ne '' then deck = ksubstr(cabin,1,1); else deck = '';" numeric=['pclass', 'survived', 'age', 'sibsp', 'parch', 'fare'] # Remove boat and body because they are proxies for survived. # Remove ticket and cabin. Use the computed column, deck, instead. char = ['sex', 'deck', 'embarked', 'home.dest'] all = numeric + char # The numeric variable was defined earlier. results = titanic3[numeric].groupby("survived").simple.summary() resultColumns = ['Column', 'Min', 'Max', 'N', 'NMiss', 'Mean', 'Sum', 'Std', 'StdErr']; display(HTML('<h3>Perished</h3>')) display(results['ByGroup1.Summary'][resultColumns]) # 1 display(HTML('<h3>Survived</h3>')) display(results['ByGroup2.Summary'][resultColumns]) s.builtins.loadActionSet('sampling') # The sampling.stratified action does not accept the vars parameter. # Instead, copyVars is used to select the columns to copy to the output table. if 'vars' in titanic3.params: del titanic3.vars # Temporarily set a groupBy parameter. with titanic3: titanic3.groupBy={'survived'} titanic3.sampling.stratified( partInd=True, # 1 samppct=40, # 2 seed=1234, output={ 'casout':{'name':'titanic3part', 'replace':True}, 'copyVars':all } ) titanic3.table.dropTable() # 3 titanic3part = s.CASTable('titanic3part') # 4 ci = titanic3part.columnInfo() display(ci) survSummary = titanic3part['survived'].groupby('_partind_').simple.summary() resultColumns = ['Column', 'N', 'NMiss', 'Mean', 'Sum', 'Std', 'StdErr'] display(survSummary['ByGroupInfo']) display(survSummary['ByGroup1.Summary'][resultColumns]) display(survSummary['ByGroup2.Summary'][resultColumns]) s.builtins.loadActionSet('decisionTree') # 1 training = titanic3part.query('0 = _partind_') # 2 trainingResults = training.forestTrain( target='survived', inputs=all, nominals=char + ['pclass', 'survived'], casOut={'name':'forestModel', 'replace':True}, seed=1234, binOrder=True, varImp=True ) display(trainingResults) forestModel = s.CASTable('forestModel') titanic3part.forestScore( modelTable=forestModel, copyVars=['survived', '_partind_'], casOut={'name':'forestScored', 'replace':True}, vote='prob' ) s.builtins.loadActionSet('percentile') forestScored = s.CASTable('forestScored') # 1 forestScored.groupBy='_PartInd_' # 2 forestScored.computedVars=['P1', 'P0'] # 3 forestScored.computedVarsProgram=''' if '1' eq strip(_RF_PredName_) then do; P1 = _RF_PredP_; P0 = 1 - _RF_PredP_; end; else do; P1 = 1 - _RF_PredP_; P0 = _RF_PredP_; end; ''' # 4 forestScored.percentile.assess( casOut={'name':'forestAssess', 'replace':True}, nbins=10, cutStep = 0.01, inputs=['P1'], response='survived', event='1', pVar=['P0'], pEvent='0' ) forestAssess_ROC = \ s.CASTable('forestAssess_ROC', where='1 = _partind_') # 1 out2 = forestAssess_ROC.to_frame() plt.figure(figsize=(8,8)) plt.plot(out2._FPR_,out2._Sensitivity_,'bo-',linewidth=2) plt.plot(pd.Series(range(0,11,1))/10,pd.Series(range(0,11,1))/10,'k--',linewidth=1) plt.xlabel('False Positive Rate') plt.ylabel('Correct Classification Rate') plt.grid(True) plt.title('ROC Curve') plt.show() forestAssess = \ s.CASTable('forestAssess', where='1 = _partind_') # 1 lift = forestAssess.to_frame() plt.figure(figsize=(8,8)) plt.plot(lift._Depth_, lift._Lift_,'bo-',linewidth=2) plt.xlabel('Percentile') plt.ylabel('Lift') plt.grid(True) plt.title('Lift Chart') plt.show() s.close() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The plot color maps are named based on the color maps on matplotlib. Step2: The same can be applied to lists of explanations Step3: The different color map names are available in the color-set.js file. To add one, modify the file with a color map name, and a list containing the two colors of the color map, the first one being the one for positive SHAP values, and the second one for the negative SHAP values. You can also pass a list of colors as the value for the plot_cmap parameter to render the force plot with those colors. Those colors must be hex-coded.
<ASSISTANT_TASK:> Python Code: import xgboost import shap # load JS visualization code to notebook shap.initjs() # train XGBoost model X,y = shap.datasets.boston() bst = xgboost.train({"learning_rate": 0.01}, xgboost.DMatrix(X, label=y), 100) # explain the model's predictions using SHAP values explainer = shap.TreeExplainer(bst) shap_values = explainer.shap_values(X) # visualize the first prediction's explaination with default colors shap.force_plot(explainer.expected_value, shap_values[0,:], X.iloc[0,:]) # visualize the first prediction's explaination with a Pink and Yellow Green color map. shap.force_plot(explainer.expected_value, shap_values[0,:], X.iloc[0,:], plot_cmap="PkYg") # visualize the first 5 predictions explanations with a dark red dark blue color map. shap.force_plot(explainer.expected_value, shap_values[0:5,:], X.iloc[0:5,:], plot_cmap="DrDb") # visualize the first 5 predictions explanations with a custom color map. shap.force_plot(explainer.expected_value, shap_values[0:5,:], X.iloc[0:5,:], plot_cmap=["#FF5733","#335BFF"]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load data into the notebook Step2: BUG currently seems to be coming from handonstable rendering Step3: Testing different ways to convert df to json
<ASSISTANT_TASK:> Python Code: import json import numpy as np import pandas as pd from jupyter_scisheets_widget import scisheets_widget import pandas_datareader as pdr ibm_data = pdr.get_data_yahoo('IBM') income_data = pd.read_csv('income_data.csv', sep=';') income_data income_data['test_col'] = income_data['2006'] import ast df = income_data model_data = df.to_json(orient='split') model_data = ast.literal_eval(model_data) model_data_2 = json.dumps(model_data) tbl._model_data = json.dumps(model_data) model_data_2 tbl._model_data %%javascript var json_model = this.model.get('_model_data') console.log(json_model) tbl = scisheets_widget.SciSheetTable() tbl.load_df(income_data) tbl income_data bob = income_data.copy() bob['House Party 2'] = 5 income_data bob from IPython.display import display display(tbl) tbl2._widget._model_data tbl2 = scisheets_widget.HandsonDataFrame(income_data) tbl2.show() scisheets_widget.HandsonDataFrame(income_data)._widget._model_data import ast data_dic = {} data_dic['columns'] = ast.literal_eval(tbl._model_header) data_dic['index'] = ast.literal_eval(tbl._model_row_header) data_dic['data'] = ast.literal_eval(tbl._model_data) pd.read_json(json.dumps(data_dic), orient='split') income_data.to_json(orient='split') data_dic cols = {'columns': tbl._model_header.encode('utf-8')} ind = {'index': tbl._model_row_header.encode('utf-8')} data = {'data': tbl._model_data.encode('utf-8')} z=cols z.update(ind) z.update(data) z json.dumps(z) pd.read_json(json.dumps(z)) model_data = df.to_json(orient='split') model_data = ast.literal_eval(model_data) self._model_data = json.dumps(model_data['data']) self._model_header = json.dumps(model_data['columns']) self._model_row_header = json.dumps(model_data['index']) tbl1._widget._model_data tbl1 = scisheets_widget.HandsonDataFrame(income_data) tbl1.show() import ipywidgets as widgets print(widgets.Widget.unobserve.__doc__) tbl1._on_displayed() tbl1._widget._model_header tbl_ibm = scisheets_widget.SciSheetTable() tbl_ibm.load_df(ibm_data) tbl_ibm tbl = scisheets_widget.SciSheetTable() tbl.load_df(income_data[['GEOID', 'State']]) tbl %%html <div id="example1" class="hot handsontable"></div> <script src="https://docs.handsontable.com/0.34.4/bower_components/handsontable/dist/handsontable.full.js"></script> <link type="text/css" rel="stylesheet" href="https://docs.handsontable.com/0.34.4/bower_components/handsontable/dist/handsontable.full.min.css"> %%javascript document.addEventListener("DOMContentLoaded", function() { var data1 = [ ['', 'Tesla', 'Nissan', 'Toyota', 'Honda', 'Mazda', 'Ford'], ['2017', 10, 11, 12, 13, 15, 16], ['2018', 10, 11, 12, 13, 15, 16], ['2019', 10, 11, 12, 13, 15, 16], ['2020', 10, 11, 12, 13, 15, 16], ['2021', 10, 11, 12, 13, 15, 16] ], container1 = document.getElementById('example1'), settings1 = { data: data1 }, hot1; container1.append('allice') hot1 = new Handsontable(container1, settings1); data1[0][1] = 'Ford'; // change "Kia" to "Ford" programmatically hot1.render(); }); %%javascript this.element.append('steve') data = [{"name": "Lisp", "value": 1}, {"name": "Scala", "value": 2}, {"name": "Perl", "value": 4}, {"name": "Java", "value": 5}, {"name": "C++", "value": 8}, {"name": "Python", "value": 10}] tbl = scisheets_widget.SciSheetTable() tbl.load_list(income_data) tbl income_data.to_json(orient='index') income_data.to_json(orient='values') income_data.to_json(orient='records') income_data.to_json(orient='columns') income_data.to_json(orient='split') bob = income_data.to_json(orient='split') import ast bob2 = ast.literal_eval(bob) for key, value in bob2.items(): print("Key:") print(key) bob2['columns'] json.dumps(bob2['columns']) bob2['columns'] '''Illustrates how to detect an assignment for a DataFrame.''' import pandas as pd class VirtualDataFrame(object): def __init__(self, df): self._df = df.copy() def _value_changed_(self): if self._df.__setitem__: print "Setting %s to %s" % (str(key), str(value)) def __setitem__(self, key, value): print "Setting %s to %s" % (str(key), str(value)) class VirtualDataFrame2(object): def __init__(self, df): self._df = df # def _value_changed_(self): # if self._df.__setitem__: # print "Setting %s to %s" % (str(key), str(value)) # def __setitem__(self, key, value): # print "Setting %s to %s" % (str(key), str(value)) bob2 = VirtualDataFrame2(income_data) bob2._df.loc[3,'State'] = 'Louisiana' income_data bob = VirtualDataFrame(income_data) bob._df.loc[2,'State'] = 'Alex' income_data class with_called_attribute: def __init__(self, func): self.func = func self.called = False def __call__(self, *args, **kwargs): self.called = True self.func(*args, **kwargs) @with_called_attribute def run_some_thing(*args, **kwargs): print("You called with:", *args, **kwargs) run_some_thing.called #>>> False run_some_thing(10) #>>> You called with: 10 run_some_thing.called #>>> True class Detector(object): def __init__(self, df): self.loadTableIsCalledForObjA = False self._df = df def __setitem__(self): if type(self._df) is pd.DataFrame: print('True') bob = Detector(income_data) bob._df.loc[1, 'State'] = loadTable(income_data) detector.loadTableIsCalledForObjA bob._df.loc[1, 'State'] = 'Barber' bob['Alice'] = bob['State'] income_data income_data import pandas as pd import numpy as np class MyDF(pd.DataFrame): @property def _constructor(self): return MyDF mydf = MyDF(np.random.randn(3,4), columns=['A','B','C','D']) print type(mydf) mydf_sub = mydf[['A','C']] print type(mydf_sub) import pandas as pd import numpy as np class MyDF(pd.DataFrame): _attributes_ = "myattr1,myattr2" def __init__(self, *args, **kw): super(MyDF, self).__init__(*args, **kw) if len(args) == 1 and isinstance(args[0], MyDF): args[0]._copy_attrs(self) def _copy_attrs(self, df): for attr in self._attributes_.split(","): df.__dict__[attr] = getattr(self, attr, None) @property def _constructor(self): def f(*args, **kw): df = MyDF(*args, **kw) self._copy_attrs(df) return df return f mydf = MyDF(np.random.randn(3,4), columns=['A','B','C','D']) print type(mydf) mydf_sub = mydf[['A','C']] print type(mydf_sub) mydf.myattr1 = 1 mydf_cp1 = MyDF(mydf) mydf_cp2 = mydf.copy() print mydf_cp1.myattr1, mydf_cp2.myattr1 mydf_cp1 mydf_cp2 def write(self): return dumps( self.obj, orient=self.orient, double_precision=self.double_precision, ensure_ascii=self.ensure_ascii, date_unit=self.date_unit, iso_dates=self.date_format == 'iso', default_handler=self.default_handler ) import json json.dumps(income_data) import pandas._libs.json as json dumps = json.dumps dumps(income_data) import pandas._libs. print('help') print 'help' <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We can create our initial estimate of what this distribution is a General Mixture Model. This is a model which is comprised of multiple distributions, and weights on those distributions representing the prior probability of a point falling under that distribution given no knowledge of the point itself (defaults to equal). We can have univariate mixture models by using univariate distributions, or multivariate distributions by using multivariate distributions. Step2: We can now predict the class labels of each point under this mixture. Step3: This is fairly close to the number of underlying points from each distribution, off by 17 in each label. We still don't know if the labels are accurate, just the number of labels. Step4: It is slightly more difficult to update the underlying components of the model because we don't have labels indicating which point came from which distribution. We could try to use the labels inferred from the model. It seems to cleanly split it, but what if our initial estimate was not very good? It could be difficult to get a good update if we had a bad prior. Step5: This is slightly closer to the truth, with 15.2 off instead of 17, around 10% closer. Step6: Multivariate Gaussian Mixture Models Step7: Lets see how well some points fit under the mixture model. Step8: Now lets see how well the previous points fit. Step9: Looks like they're being fit significantly better than before! Training works. Step10: Looks like in this case the concept was sound, that there many CG rich regions, but our initial estimates of the percentages were off. We can use a GMM like the one above to both identify and study the composition of these regions at the same time, updating the parameters of the distributions using expectation-maximization. We will go into a more complex way of dong this using HMMs in the next tutorial. Step11: Not the prettiest thing to look at right now. However, we can easily load it and use it immediately.
<ASSISTANT_TASK:> Python Code: from pomegranate import * %pylab inline import numpy as np data = np.concatenate( (np.random.randn(250, 1) * 2.75 + 1.25, np.random.randn(500, 1) * 1.2 + 7.85) ) np.random.shuffle(data) plt.hist( data, edgecolor='c', color='c', bins=20 ) d = GeneralMixtureModel( [NormalDistribution(2.5, 1), NormalDistribution(8, 1)] ) labels = d.predict( data ) print labels[:5] print "{} 1 labels, {} 0 labels".format( labels.sum(), labels.shape[0] - labels.sum() ) plt.hist( data[ labels == 0 ], edgecolor='r', color='r', bins=20 ) plt.hist( data[ labels == 1 ], edgecolor='c', color='c', bins=20 ) labels = d.predict_proba( data ) print labels[:5] print labels.sum(axis=0) d.fit( data, verbose=True ) mu = np.arange(5) cov = np.eye(5) mgs = [ MultivariateGaussianDistribution( mu*i, cov ) for i in range(5) ] gmm = GeneralMixtureModel( mgs ) data = numpy.random.randn(1000, 5) * 5 for i in range(5): data[i::5] += np.arange(5)*i for i in range(10): print "Point {}: logp {}".format( i, gmm.log_probability(data[i]) ) gmm.fit(data, verbose=True, stop_threshold=1) for i in range(10): print "Point {}: logp {}".format( i, gmm.log_probability(data[i]) ) d1 = DiscreteDistribution( {'A' : 0.25, 'C': 0.25, 'G' : 0.25, 'T': 0.25 } ) # Background d2 = DiscreteDistribution( {'A' : 0.05, 'C': 0.45, 'G' : 0.45, 'T': 0.05 } ) # CG rich regions gmm = GeneralMixtureModel( [d1, d2] ) seq = numpy.array(list('CGACATCTGACTACGGCGCGCCTACTACTTGATCGATACGGCGTCAGCGACGACGATGATCGGCATCAGTCACTAC')) gmm.fit(seq) print gmm.distributions print print numpy.exp(gmm.weights) print gmm.to_json() gmm_2 = GeneralMixtureModel.from_json( gmm.to_json() ) gmm_2.distributions <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: This creates a canvas where you can draw a handwritten digit. Step2: Now you can send a request to make a prediction. Step3: You can also draw a bar chart with the prediction result.
<ASSISTANT_TASK:> Python Code: input_form = <table> <td style="border-style: none;"> <div style="border: solid 2px #666; width: 143px; height: 144px;"> <canvas width="140" height="140"></canvas> </div></td> <td style="border-style: none;"> <button onclick="clear_value()">Clear</button> </td> </table> javascript = ''' <script type="text/Javascript"> var pixels = []; for (var i = 0; i < 28*28; i++) pixels[i] = 0; var click = 0; var canvas = document.querySelector("canvas"); canvas.addEventListener("mousemove", function(e){ if (e.buttons == 1) { click = 1; canvas.getContext("2d").fillStyle = "rgb(0,0,0)"; canvas.getContext("2d").fillRect(e.offsetX, e.offsetY, 8, 8); x = Math.floor(e.offsetY * 0.2); y = Math.floor(e.offsetX * 0.2) + 1; for (var dy = 0; dy < 2; dy++){ for (var dx = 0; dx < 2; dx++){ if ((x + dx < 28) && (y + dy < 28)){ pixels[(y+dy)+(x+dx)*28] = 1; } } } } else { if (click == 1) set_value(); click = 0; } }); function set_value(){ var result = "" for (var i = 0; i < 28*28; i++) result += pixels[i] + "," var kernel = IPython.notebook.kernel; kernel.execute("image = [" + result + "]"); kernel.execute("f = open('request.json', 'w')"); kernel.execute("f.write('{\\"inputs\\":%s}' % image)"); kernel.execute("f.close()"); } function clear_value(){ canvas.getContext("2d").fillStyle = "rgb(255,255,255)"; canvas.getContext("2d").fillRect(0, 0, 140, 140); for (var i = 0; i < 28*28; i++) pixels[i] = 0; } </script> ''' from IPython.display import HTML HTML(input_form + javascript) %%bash MODEL_NAME="MNIST" gcloud ai-platform predict --model ${MODEL_NAME} --json-instances request.json | tee predict.txt import matplotlib.pyplot as plt import re with open('predict.txt') as prediction: head = prediction.readline() result = prediction.readline() r = re.compile("\[(.+)\]") pred = r.search(result).group(1).split(',') pred = map(lambda x: float(x), pred) fig = plt.figure(figsize=(4,2)) subplot = fig.add_subplot(1,1,1) subplot.set_xticks(range(10)) subplot.set_xlim(-0.5,9.5) subplot.set_ylim(0,1) subplot.bar(range(10), pred, align='center') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: As always, let's do imports and initialize a logger and a new Bundle. Step2: And let's make our system a little more interesting so that we can discriminate between the various t0s Step3: t0 Parameters Step4: t0_perpass defines the time at which both components in our orbit is at periastron passage. By default this parameter is constrained by t0_supconj. For more details or information on how to change which parameter is editable, see the Constraints Tutorial. Step5: The t0_ref defines the time at which the primary component in our orbit passes an arbitrary reference point. This t0_ref is defined in the same way as PHOEBE legacy's 'HJD0' parameter, so is included for convenience translating between the two. Step6: In addition, there is a single t0 parameter that is system-wide. This parameter simply defines the time at which all parameters are defined and therefore at which all computations start. The value of this parameter begins to play an important role if any parameter is given a time-derivative (see apsidal motion and dpdt, for example) or when using N-body instead of Keplerian dynamics (coming in a future release). Step7: Influence on Oribits (positions) Step8: To visualize where these times are with respect to the orbits, we can plot the model orbit and highlight the positions of each star at the times defined by these parameters. Note here that the observer is in the positive w-direction. Step9: Influence on Phasing Step10: Similarly, if plotting phases on any axis, passing the 't0' keyword will set the zero-phase accordingly. To see this, let's compute a light curve and phase it with the various t0s shown in the orbits above.
<ASSISTANT_TASK:> Python Code: #!pip install -I "phoebe>=2.3,<2.4" import phoebe from phoebe import u # units import numpy as np import matplotlib.pyplot as plt logger = phoebe.logger() b = phoebe.default_binary() b.set_value('sma@binary', 20) b.set_value('q', 0.8) b.set_value('ecc', 0.8) b.set_value('per0', 45) b.get_parameter('t0_supconj', context='component') b.get_parameter('t0_perpass', context='component') b.get_parameter('t0_perpass', context='constraint') b.get_parameter('t0_ref', context='component') b.get_parameter('t0_ref', context='constraint') b.get_parameter('t0', context='system') b.add_dataset('orb', compute_times=np.linspace(-1,1,1001)) b.run_compute(ltte=False) afig, mplfig = b.plot(x='us', y='ws', z=0, time='t0_supconj', show=True) afig, mplfig = b.plot(x='us', y='ws', z=0, time='t0_perpass', show=True) afig, mplfig = b.plot(x='us', y='ws', z=0, time='t0_ref', show=True) b.to_phase(0.0) b.to_phase(0.0, component='binary', t0='t0_supconj') b.to_phase(0.0, component='binary', t0='t0_perpass') b.to_phase(0.0, component='binary', t0='t0_ref') b.add_dataset('lc', times=np.linspace(0,1,51), ld_mode='manual', ld_func='linear', ld_coeffs=[0.0]) b.run_compute(ltte=False, irrad_method='none', atm='blackbody') afig, mplfig = b['lc01@model'].plot(x='phases', t0='t0_supconj', xlim=(-0.3,0.3), show=True) afig, mplfig = b['lc01@model'].plot(x='phases', t0='t0_perpass', xlim=(-0.3,0.3), show=True) afig, mplfig = b['lc01@model'].plot(x='phases', t0='t0_ref', xlim=(-0.3,0.3), show=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Make an MNW2 package from scratch Step2: MNW2 information by node Step3: convert the DataFrame to a rec array for compatibility with flopy Step4: Stress period information Step5: Make ModflowMnw2 package object Step6: empty node_data and stress_period_data tables can also be generated by the package class, and then filled Step7: Mnw objects Step8: Note that Mnw object attributes for variables that vary by node are lists (e.g. rw above) Step9: Instead of a dict keyed by stress period, Mnw.stress_period_data is a recarray with pumping data listed by stress period for that well Step10: Build the same package using only the Mnw objects Step11: By default, the node_data and stress_period_data tables attached to the ModflowMnw2 package class are definitive Step12: Write an MNW2 package file and inspect the results Step13: Load some example MNW2 packages
<ASSISTANT_TASK:> Python Code: import sys import os import numpy as np try: import pandas as pd except: pass import flopy m = flopy.modflow.Modflow('mnw2example', model_ws='temp') dis = flopy.modflow.ModflowDis(nrow=5, ncol=5, nlay=3, nper=3, top=10, botm=0, model=m) node_data = pd.DataFrame([[1, 1, 9.5, 7.1, 'well1', 'skin', -1, 0, 0, 0, 1., 2., 5., 6.2], [1, 1, 7.1, 5.1, 'well1', 'skin', -1, 0, 0, 0, 0.5, 2., 5., 6.2], [3, 3, 9.1, 3.7, 'well2', 'skin', -1, 0, 0, 0, 1., 2., 5., 4.1]], columns=['i', 'j', 'ztop', 'zbotm', 'wellid', 'losstype', 'pumploc', 'qlimit', 'ppflag', 'pumpcap', 'rw', 'rskin', 'kskin', 'zpump']) node_data node_data = node_data.to_records() node_data stress_period_data = pd.DataFrame([[0, 'well1', 0], [1, 'well1', 100.0], [0, 'well2', 0], [1, 'well2', 1000.]], columns=['per', 'wellid', 'qdes']) stress_period_data pers = stress_period_data.groupby('per') stress_period_data = {i: pers.get_group(i).to_records() for i in [0, 1]} stress_period_data mnw2 = flopy.modflow.ModflowMnw2(model=m, mnwmax=2, node_data=node_data, stress_period_data=stress_period_data, itmp=[2, 2, -1], # reuse second per pumping for last stress period ) # "nodtot" is computed automatically mnw2.nodtot pd.DataFrame(mnw2.node_data) pd.DataFrame(mnw2.stress_period_data[0]) pd.DataFrame(mnw2.stress_period_data[1]) tmp = flopy.modflow.ModflowMnw2(model=m, itmp=[1, 1, -1], # reuse second per pumping for last stress period ) node_data = tmp.get_empty_node_data(3) node_data mnw2.mnw mnw2.mnw['well1'].__dict__ pd.DataFrame(mnw2.mnw['well1'].node_data) pd.DataFrame(mnw2.mnw['well2'].stress_period_data) mnw2fromobj = flopy.modflow.ModflowMnw2(model=m, mnwmax=2, mnw=mnw2.mnw, itmp=[2, 2, -1], # reuse second per pumping for last stress period ) pd.DataFrame(mnw2fromobj.node_data) pd.DataFrame(mnw2fromobj.stress_period_data[0]) pd.DataFrame(mnw2fromobj.stress_period_data[1]) per1 = flopy.modflow.ModflowMnw2.get_empty_stress_period_data(itmp=2) per1 mnw2.write_file(os.path.join('temp/test.mnw2')) junk = [print(l.strip('\n')) for l in open('temp/test.mnw2').readlines()] path = os.path.join('..', '..', 'examples', 'data', 'mf2005_test') cpth = os.path.join('..', '..', 'autotest', 'temp') m = flopy.modflow.Modflow('MNW2-Fig28', model_ws=cpth) dis = flopy.modflow.ModflowDis.load(path + '/MNW2-Fig28.dis', m) m.get_package_list() mnw2pth = os.path.join(path, 'MNW2-Fig28.mnw2') mnw2 = flopy.modflow.ModflowMnw2.load(mnw2pth, m) pd.DataFrame(mnw2.node_data) pd.DataFrame(mnw2.stress_period_data[0]) mnw2.mnw pd.DataFrame(mnw2.mnw['Well-A'].stress_period_data) path = os.path.join('..', '..', 'examples', 'data', 'mnw2_examples') cpth = os.path.join('temp') m = flopy.modflow.Modflow('br', model_ws=cpth) mnw2 = flopy.modflow.ModflowMnw2.load(path + '/BadRiver_cal.mnw2', m) df = pd.DataFrame(mnw2.node_data) df.loc[:, df.sum(axis=0) != 0] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's take a look the loaded data set. Step2: Make training set Step3: It means that user 0 tried to solve question number 1 which has 77 tokens for question and he or she answered at 61st token. Step4: Let's make test set for testing. Step5: Here is 4749 predictions.
<ASSISTANT_TASK:> Python Code: import gzip import cPickle as pickle with gzip.open("../data/train.pklz", "rb") as train_file: train_set = pickle.load(train_file) with gzip.open("../data/test.pklz", "rb") as test_file: test_set = pickle.load(test_file) with gzip.open("../data/questions.pklz", "rb") as questions_file: questions = pickle.load(questions_file) print "train_set: ", len(train_set) print "test_set: ", len(test_set) print "questions: ", len(questions) print sorted(train_set.keys())[:10] print train_set[1] print train_set[1].keys() print sorted(test_set.keys())[:10] print test_set[7] print test_set[7].keys() print sorted(questions.keys())[:10] print questions[1] print questions[1].keys() X_train = [] Y_train = [] for key in train_set: # We only care about positive case at this time if train_set[key]['position'] < 0: continue uid = train_set[key]['uid'] qid = train_set[key]['qid'] pos = train_set[key]['position'] q_length = max(questions[qid]['pos_token'].keys()) feat = [uid, qid, q_length] X_train.append(feat) Y_train.append([pos]) print len(X_train) print len(Y_train) print X_train[0], Y_train[0] from sklearn.linear_model import LinearRegression model = LinearRegression() model.fit(X_train, Y_train) X_test = [] test_id = [] for key in test_set: test_id.append(key) uid = test_set[key]['uid'] qid = test_set[key]['qid'] q_length = max(questions[qid]['pos_token'].keys()) feat = [uid, qid, q_length] X_test.append(feat) predictions = model.predict(X_test) predictions = sorted([[id, predictions[index][0]] for index, id in enumerate(test_id)]) print len(predictions) predictions[:5] import csv predictions.insert(0,["id", "position"]) with open('guess.csv', 'wb') as fp: writer = csv.writer(fp, delimiter=',') writer.writerows(predictions) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Understanding the pipeline design Step7: The pipeline uses a mix of custom and pre-build components. Step8: The custom components execute in a container image defined in base_image/Dockerfile. Step9: The training step in the pipeline employes the AI Platform Training component to schedule a AI Platform Training job in a custom training container. The custom training image is defined in trainer_image/Dockerfile. Step10: Building and deploying the pipeline Step11: Build the trainer image Step12: Build the base image for custom components Step13: Compile the pipeline Step14: Use the CLI compiler to compile the pipeline Step15: The result is the covertype_training_pipeline.yaml file. Step16: Deploy the pipeline package Step17: Submitting pipeline runs Step18: Submit a run
<ASSISTANT_TASK:> Python Code: # Set `PATH` to include the directory containing TFX CLI and skaffold. PATH=%env PATH %env PATH=/home/jupyter/.local/bin:{PATH} !grep 'BASE_IMAGE =' -A 5 pipeline/covertype_training_pipeline.py %%writefile ./pipeline/covertype_training_pipeline.py # Copyright 2019 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. KFP pipeline orchestrating BigQuery and Cloud AI Platform services. import os from helper_components import evaluate_model from helper_components import retrieve_best_run from jinja2 import Template import kfp from kfp.components import func_to_container_op from kfp.dsl.types import Dict from kfp.dsl.types import GCPProjectID from kfp.dsl.types import GCPRegion from kfp.dsl.types import GCSPath from kfp.dsl.types import String from kfp.gcp import use_gcp_secret # Defaults and environment settings BASE_IMAGE = os.getenv('BASE_IMAGE') TRAINER_IMAGE = os.getenv('TRAINER_IMAGE') RUNTIME_VERSION = os.getenv('RUNTIME_VERSION') PYTHON_VERSION = os.getenv('PYTHON_VERSION') COMPONENT_URL_SEARCH_PREFIX = os.getenv('COMPONENT_URL_SEARCH_PREFIX') USE_KFP_SA = os.getenv('USE_KFP_SA') TRAINING_FILE_PATH = 'datasets/training/data.csv' VALIDATION_FILE_PATH = 'datasets/validation/data.csv' TESTING_FILE_PATH = 'datasets/testing/data.csv' # Parameter defaults SPLITS_DATASET_ID = 'splits' HYPERTUNE_SETTINGS = { "hyperparameters": { "goal": "MAXIMIZE", "maxTrials": 6, "maxParallelTrials": 3, "hyperparameterMetricTag": "accuracy", "enableTrialEarlyStopping": True, "params": [ { "parameterName": "max_iter", "type": "DISCRETE", "discreteValues": [500, 1000] }, { "parameterName": "alpha", "type": "DOUBLE", "minValue": 0.0001, "maxValue": 0.001, "scaleType": "UNIT_LINEAR_SCALE" } ] } } # Helper functions def generate_sampling_query(source_table_name, num_lots, lots): Prepares the data sampling query. sampling_query_template = SELECT * FROM `{{ source_table }}` AS cover WHERE MOD(ABS(FARM_FINGERPRINT(TO_JSON_STRING(cover))), {{ num_lots }}) IN ({{ lots }}) query = Template(sampling_query_template).render( source_table=source_table_name, num_lots=num_lots, lots=str(lots)[1:-1]) return query # Create component factories component_store = kfp.components.ComponentStore( local_search_paths=None, url_search_prefixes=[COMPONENT_URL_SEARCH_PREFIX]) bigquery_query_op = component_store.load_component('bigquery/query') mlengine_train_op = component_store.load_component('ml_engine/train') mlengine_deploy_op = component_store.load_component('ml_engine/deploy') retrieve_best_run_op = func_to_container_op( retrieve_best_run, base_image=BASE_IMAGE) evaluate_model_op = func_to_container_op(evaluate_model, base_image=BASE_IMAGE) @kfp.dsl.pipeline( name='Covertype Classifier Training', description='The pipeline training and deploying the Covertype classifierpipeline_yaml' ) def covertype_train(project_id, region, source_table_name, gcs_root, dataset_id, evaluation_metric_name, evaluation_metric_threshold, model_id, version_id, replace_existing_version, hypertune_settings=HYPERTUNE_SETTINGS, dataset_location='US'): Orchestrates training and deployment of an sklearn model. # Create the training split query = generate_sampling_query( source_table_name=source_table_name, num_lots=10, lots=[1, 2, 3, 4]) training_file_path = '{}/{}'.format(gcs_root, TRAINING_FILE_PATH) create_training_split = bigquery_query_op( query=query, project_id=project_id, dataset_id=dataset_id, table_id='', output_gcs_path=training_file_path, dataset_location=dataset_location) # Create the validation split query = generate_sampling_query( source_table_name=source_table_name, num_lots=10, lots=[8]) validation_file_path = '{}/{}'.format(gcs_root, VALIDATION_FILE_PATH) create_validation_split = bigquery_query_op( query=query, project_id=project_id, dataset_id=dataset_id, table_id='', output_gcs_path=validation_file_path, dataset_location=dataset_location) # Create the testing split query = generate_sampling_query( source_table_name=source_table_name, num_lots=10, lots=[9]) testing_file_path = '{}/{}'.format(gcs_root, TESTING_FILE_PATH) create_testing_split = bigquery_query_op( query=query, project_id=project_id, dataset_id=dataset_id, table_id='', output_gcs_path=testing_file_path, dataset_location=dataset_location) # Tune hyperparameters tune_args = [ '--training_dataset_path', create_training_split.outputs['output_gcs_path'], '--validation_dataset_path', create_validation_split.outputs['output_gcs_path'], '--hptune', 'True' ] job_dir = '{}/{}/{}'.format(gcs_root, 'jobdir/hypertune', kfp.dsl.RUN_ID_PLACEHOLDER) hypertune = mlengine_train_op( project_id=project_id, region=region, master_image_uri=TRAINER_IMAGE, job_dir=job_dir, args=tune_args, training_input=hypertune_settings) # Retrieve the best trial get_best_trial = retrieve_best_run_op( project_id, hypertune.outputs['job_id']) # Train the model on a combined training and validation datasets job_dir = '{}/{}/{}'.format(gcs_root, 'jobdir', kfp.dsl.RUN_ID_PLACEHOLDER) train_args = [ '--training_dataset_path', create_training_split.outputs['output_gcs_path'], '--validation_dataset_path', create_validation_split.outputs['output_gcs_path'], '--alpha', get_best_trial.outputs['alpha'], '--max_iter', get_best_trial.outputs['max_iter'], '--hptune', 'False' ] train_model = mlengine_train_op( project_id=project_id, region=region, master_image_uri=TRAINER_IMAGE, job_dir=job_dir, args=train_args) # Evaluate the model on the testing split eval_model = evaluate_model_op( dataset_path=str(create_testing_split.outputs['output_gcs_path']), model_path=str(train_model.outputs['job_dir']), metric_name=evaluation_metric_name) # Deploy the model if the primary metric is better than threshold with kfp.dsl.Condition(eval_model.outputs['metric_value'] > evaluation_metric_threshold): deploy_model = mlengine_deploy_op( model_uri=train_model.outputs['job_dir'], project_id=project_id, model_id=model_id, version_id=version_id, runtime_version=RUNTIME_VERSION, python_version=PYTHON_VERSION, replace_existing_version=replace_existing_version) # Configure the pipeline to run using the service account defined # in the user-gcp-sa k8s secret if USE_KFP_SA == 'True': kfp.dsl.get_pipeline_conf().add_op_transformer( use_gcp_secret('user-gcp-sa')) !cat base_image/Dockerfile !cat trainer_image/Dockerfile REGION = 'us-central1' ENDPOINT = '2154b2f21283d4d2-dot-europe-west1.pipelines.googleusercontent.com' ARTIFACT_STORE_URI = 'gs://qwiklabs-gcp-01-3aff5ef1f764-kubeflowpipelines-default' PROJECT_ID = !(gcloud config get-value core/project) PROJECT_ID = PROJECT_ID[0] IMAGE_NAME='trainer_image' TAG='latest' TRAINER_IMAGE='gcr.io/{}/{}:{}'.format(PROJECT_ID, IMAGE_NAME, TAG) !gcloud builds submit --timeout 15m --tag $TRAINER_IMAGE trainer_image IMAGE_NAME='base_image' TAG='latest' BASE_IMAGE='gcr.io/{}/{}:{}'.format(PROJECT_ID, IMAGE_NAME, TAG) !gcloud builds submit --timeout 15m --tag $BASE_IMAGE base_image USE_KFP_SA = False COMPONENT_URL_SEARCH_PREFIX = 'https://raw.githubusercontent.com/kubeflow/pipelines/0.2.5/components/gcp/' RUNTIME_VERSION = '1.15' PYTHON_VERSION = '3.7' %env USE_KFP_SA={USE_KFP_SA} %env BASE_IMAGE={BASE_IMAGE} %env TRAINER_IMAGE={TRAINER_IMAGE} %env COMPONENT_URL_SEARCH_PREFIX={COMPONENT_URL_SEARCH_PREFIX} %env RUNTIME_VERSION={RUNTIME_VERSION} %env PYTHON_VERSION={PYTHON_VERSION} !dsl-compile --py pipeline/covertype_training_pipeline.py --output covertype_training_pipeline.yaml !head covertype_training_pipeline.yaml PIPELINE_NAME='covertype_continuous_training' !kfp --endpoint $ENDPOINT pipeline upload \ -p $PIPELINE_NAME \ covertype_training_pipeline.yaml !kfp --endpoint $ENDPOINT pipeline list PIPELINE_ID='defa3c60-637b-4332-88b9-d8647c2aec84' EXPERIMENT_NAME = 'Covertype_Classifier_Training' RUN_ID = 'Run_001' SOURCE_TABLE = 'covertype_dataset.covertype' DATASET_ID = 'splits' EVALUATION_METRIC = 'accuracy' EVALUATION_METRIC_THRESHOLD = '0.69' MODEL_ID = 'covertype_classifier' VERSION_ID = 'v01' REPLACE_EXISTING_VERSION = 'True' GCS_STAGING_PATH = '{}/staging'.format(ARTIFACT_STORE_URI) !kfp --endpoint $ENDPOINT run submit \ -e $EXPERIMENT_NAME \ -r $RUN_ID \ -p $PIPELINE_ID \ project_id=$PROJECT_ID \ gcs_root=$GCS_STAGING_PATH \ region=$REGION \ source_table_name=$SOURCE_TABLE \ dataset_id=$DATASET_ID \ evaluation_metric_name=$EVALUATION_METRIC \ evaluation_metric_threshold=$EVALUATION_METRIC_THRESHOLD \ model_id=$MODEL_ID \ version_id=$VERSION_ID \ replace_existing_version=$REPLACE_EXISTING_VERSION <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Interact basics Step2: Use the interact function to interact with the print_sum function. Step3: Write a function named print_string that prints a string and additionally prints the length of that string if a boolean parameter is True. Step4: Use the interact function to interact with the print_string function.
<ASSISTANT_TASK:> Python Code: %matplotlib inline from matplotlib import pyplot as plt import numpy as np from IPython.html.widgets import interact, interactive, fixed from IPython.display import display def print_sum(a, b): print(a+b) interact(print_sum, a=(-10,10,.1), b=(-8, 8, 2)) assert True # leave this for grading the print_sum exercise def print_string(s, length=False): if length==True: print("%s has length %d" %(s, len(s))) else: print(s) interact(print_string, s = "Hello World", length = False) assert True # leave this for grading the print_string exercise <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Resources Step2: Using solve is faster and more stable numerically than using matrix inversion Step3: Under the hood (Optional) Step4: Basic information about a matrix Step5: Trace Step6: Determinant Step7: Rank Step8: Norm Step9: Least-squares solution Step10: Normal equations Step11: Matrix Decompositions Step12: LU Step13: Choleskey Step14: QR Step15: Spectral Step16: Inverting A Step17: Powers of A Step18: SVD
<ASSISTANT_TASK:> Python Code: import numpy as np import scipy.linalg as la import matplotlib.pyplot as plt %matplotlib inline plt.style.use('ggplot') A = np.array([[1,2],[3,4]]) A b = np.array([3,17]) b x = la.solve(A, b) x np.allclose(A @ x, b) A1 = np.random.random((1000,1000)) b1 = np.random.random(1000) %timeit la.solve(A1, b1) %timeit la.inv(A1) @ b1 import scipy.linalg.lapack as lapack lu, piv, x, info = lapack.dgesv(A, b) x C = np.array([[1, 2+3j], [3-2j, 4]]) C C.conjugate() def trace(M): return np.diag(M).sum() trace(C) np.allclose(trace(C), la.eigvals(C).sum()) la.det(C) np.linalg.matrix_rank(C) la.norm(C, None) # Frobenius (default) la.norm(C, 2) # largest sinular value la.norm(C, -2) # smallest singular value la.svdvals(C) la.solve(A, b) x, resid, rank, s = la.lstsq(A, b) x A1 = np.array([[1,2],[2,4]]) A1 b1 = np.array([3, 17]) b1 try: la.solve(A1, b1) except la.LinAlgError as e: print(e) x, resid, rank, s = la.lstsq(A1, b1) x A2 = np.random.random((10,3)) b2 = np.random.random(10) try: la.solve(A2, b2) except ValueError as e: print(e) x, resid, rank, s = la.lstsq(A2, b2) x def least_squares(X, y): return la.solve(X.T @ X, X.T @ y) least_squares(A2, b2) A = np.array([[1,0.6],[0.6,4]]) A p, l, u = la.lu(A) p l u np.allclose(p@l@u, A) U = la.cholesky(A) U np.allclose(U.T @ U, A) # If workiing wiht complex matrices np.allclose(U.T.conj() @ U, A) Q, R = la.qr(A) Q np.allclose((la.norm(Q[:,0]), la.norm(Q[:,1])), (1,1)) np.allclose(Q@R, A) u, v = la.eig(A) u v np.allclose((la.norm(v[:,0]), la.norm(v[:,1])), (1,1)) np.allclose(v @ np.diag(u) @ v.T, A) np.allclose(v @ np.diag(1/u) @ v.T, la.inv(A)) np.allclose(v @ np.diag(u**5) @ v.T, np.linalg.matrix_power(A, 5)) U, s, V = la.svd(A) U np.allclose((la.norm(U[:,0]), la.norm(U[:,1])), (1,1)) s V np.allclose((la.norm(V[:,0]), la.norm(V[:,1])), (1,1)) np.allclose(U @ np.diag(s) @ V, A) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Elle marche très bien, et est très rapide ! Step2: Pour des nombres de 8 chiffres (c'est tout petit), elle est vraiment rapide Step3: $\implies$ $65 ~\text{ms}$ pour 10000 nombres à tester, ça me semble assez rapide pour ce qu'on veut en faire ! Step4: C'est ensuite facile de transformer une date en nombre, selon les deux formats. Step5: Tester toutes les opérations possibles Step6: On peut la vérifier sur de petites entrées Step7: On voit que stocker juste l'entier résultat ne suffit pas, on aimerait garder trace de chaque façon de l'obtenir ! Step8: Si on stocke avec comme clés les expressions, on va en avoir BEAUCOUP. Step9: Beaucoup plus raisonnable ! Ici, pour le 2ème exemple, le plus grand nombre premier obtenu est $7 = (3 \times 2) + 1$. Step10: Il faut ignorer les erreurs de calculs et ne pas ajouter le nombre dans ce cas Step11: Tester sur un jour Step12: Tester tous les jours de l'année
<ASSISTANT_TASK:> Python Code: from sympy import isprime [isprime(i) for i in [2, 3, 5, 7, 10, 11, 13, 17, 2017]] from numpy.random import randint %timeit sum([isprime(i) for i in randint(1e8, 1e9-1, 10**4)]) from datetime import datetime today = datetime.today() YEAR = today.year print("On va travailler avec l'année", YEAR, "!") def date_vers_nombre(date): day = int("{:%d}".format(date)) month = int("{:%m}".format(date)) year = int("{:%Y}".format(date)[-2:]) return day, month, year date = datetime(YEAR, 1, 12) print(date_vers_nombre(date)) from itertools import permutations from operator import mod, mul, add, pow, sub, floordiv operations = [mod, mul, add, sub, floordiv] def tous_les_resultats(nombres, ops=operations): assert len(nombres) == 3 tous = [] for (x, y, z) in permutations(nombres): # on a un ordre pour x, y, z for f1 in ops: for f2 in ops: tous.append(f1(f2(x, y), z)) tous.append(f1(x, f2(y, z))) # on enlève les doublons ici return list(set(tous)) tous_les_resultats([1, 2, 3], [add]) tous_les_resultats([1, 2, 3], [add, mul]) noms_operations = { mod: '%', mul: '*', add: '+', sub: '-', floordiv: '/', } def tous_les_resultats_2(nombres, ops=operations): assert len(nombres) == 3 tous = {} for (x, y, z) in permutations(nombres): # on a un ordre pour x, y, z for f1 in ops: for f2 in ops: n1 = f1(f2(x, y), z) s1 = "{}({}({}, {}), {})".format(noms_operations[f1], noms_operations[f2], x, y, z) tous[s1] = n1 n2 = f1(x, f2(y, z)) s2 = "{}({}, {}({}, {}))".format(noms_operations[f1], x, noms_operations[f2], y, z) tous[s2] = n2 return tous tous_les_resultats_2([1, 2, 3], [add]) tous_les_resultats_2([1, 2, 3], [add, mul]) def tous_les_resultats_3(nombres, ops=operations): assert len(nombres) == 3 tous = {} for (x, y, z) in permutations(nombres): # on a un ordre pour x, y, z for f1 in ops: for f2 in ops: n1 = f1(f2(x, y), z) s1 = "{}({}({}, {}), {})".format(noms_operations[f1], noms_operations[f2], x, y, z) tous[n1] = s1 n2 = f1(x, f2(y, z)) s2 = "{}({}, {}({}, {}))".format(noms_operations[f1], x, noms_operations[f2], y, z) tous[n2] = s2 return tous tous_les_resultats_3([1, 2, 3], [add]) tous_les_resultats_3([1, 2, 3], [add, mul]) def plus_grand_premier(nombres, ops=operations): tous = tous_les_resultats_3(nombres, ops=ops) premiers = [ p for p in tous.keys() if isprime(p) ] plus_grand_premier = max(premiers) expression = tous[plus_grand_premier] return plus_grand_premier, expression plus_grand_premier([1, 2, 3], [add, mul]) plus_grand_premier([1, 2, 3]) def tous_les_resultats_4(nombres, ops=operations): assert len(nombres) == 3 tous = {} for (x, y, z) in permutations(nombres): # on a un ordre pour x, y, z for f1 in ops: for f2 in ops: try: n1 = f1(f2(x, y), z) s1 = "{}({}({}, {}), {})".format(noms_operations[f1], noms_operations[f2], x, y, z) tous[n1] = s1 except: pass try: n2 = f1(x, f2(y, z)) s2 = "{}({}, {}({}, {}))".format(noms_operations[f1], x, noms_operations[f2], y, z) tous[n2] = s2 except: pass return tous def plus_grand_premier_2(nombres, ops=operations): tous = tous_les_resultats_4(nombres, ops=ops) premiers = [ p for p in tous.keys() if isprime(p) ] plus_grand_premier = max(premiers) expression = tous[plus_grand_premier] return plus_grand_premier, expression plus_grand_premier_2([1, 2, 3], [add, mul]) plus_grand_premier_2([1, 2, 3]) plus_grand_premier_2([12, 1, 93]) date x, y, z = date_vers_nombre(date) plus_grand_premier_2([x, y, z]) from datetime import timedelta def tous_les_jours(year=YEAR): date = datetime(year, 1, 1) un_jour = timedelta(days=1) for i in range(0, 366): yield date date += un_jour if date.year > year: # On est allé trop loin raise StopIteration tous = [] for date in tous_les_jours(): x, y, z = date_vers_nombre(date) p, expr = plus_grand_premier_2([x, y, z]) tous.append(([x, y, z], p, expr)) print("Pour la date {:%d-%m-%Y}, le plus grand nombre premier obtenu est {}, avec l'expression {}.".format(date, p, expr)) max(tous, key=lambda t: t[1]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The data is fun to look at. Compared to MNIST the classes seem much harder to distinguish Step2: Our labels are 0,1,2,..,10 right now. We convert to a one-hot representation Step3: Finally, let's split the data into random train and test partitions Step4: Save data for other experiments
<ASSISTANT_TASK:> Python Code: from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np import tensorflow as tf # Some of these are hard to distinguish. # Check https://quickdraw.withgoogle.com/data for examples zoo = ['frog', 'horse', 'lion', 'monkey', 'octopus', 'owl', 'rhinoceros', 'snail', 'tiger', 'zebra'] # Mapping between category names and ids animal2id = dict((c,i) for i,c in enumerate(zoo)) id2animal = dict((i,c) for i,c in enumerate(zoo)) for i, animal in id2animal.items(): print("Class {}: {}".format(i, animal)) from six.moves.urllib.request import urlretrieve import os DATA_DIR = 'data/' def maybe_download(url, data_dir): filename = url.split('/')[-1] file_path = os.path.join(data_dir, filename) # Check if the file already exists. if not os.path.exists(file_path): if not os.path.exists(data_dir): os.makedirs(data_dir) print("Downloading {} to {}".format(url, file_path)) file_path, _ = urlretrieve(url=url, filename=file_path) else: print("Using previously downloaded file: {}".format(file_path)) return file_path def load_data(file_path, max_examples=2000, example_name=''): d = np.load(open(file_path, 'r')) d = d[:max_examples,:] # limit number of instances to save memory print("Loaded {} {} examples of dimension {} from {}".format( d.shape[0], example_name, d.shape[1], file_path)) return d data= [] labels =[] for animal in zoo: url = "https://storage.googleapis.com/quickdraw_dataset/full/numpy_bitmap/{}.npy".format(animal) file_path = maybe_download(url, DATA_DIR) data.append(load_data(file_path, max_examples = 1000, example_name = animal)) labels.extend([animal2id[animal]]*data[-1].shape[0]) data = np.concatenate(data, axis=0) labels = np.array(labels) print("Final shape of data: {}".format(data.shape)) import matplotlib.pyplot as plt n_samples = 10 random_indices = np.random.permutation(data.shape[0]) for i in random_indices[:n_samples]: print(i, labels[i]) print("Category {}: {}".format(labels[i], id2animal[labels[i]])) # We'll show the image and its pixel value histogram side-by-side. # To interpret the values as a 28x28 image, we need to reshape # the numpy array, which is one dimensional. image = data[i, :] _, (ax1, ax2) = plt.subplots(1, 2) ax1.imshow(image.reshape(28, 28), cmap=plt.cm.Greys, interpolation='nearest') ax2.hist(image, bins=20) ax1.grid(False) plt.show() if data.dtype == 'uint8': # avoid doing this twice data = data.astype(np.float32) data = (data - (255 / 2.0)) / 255 random_indices = np.random.permutation(labels.shape[0]) print("Labels before:") print(labels[random_indices[:5]]) def one_hot(labels, n_classes): n_labels = len(labels) one_hot_labels = np.zeros((n_labels, n_classes)) one_hot_labels[np.arange(n_labels), labels] = 1 return one_hot_labels labels_one_hot = one_hot(labels, len(zoo)) print("Labels after:") print(labels_one_hot[random_indices[:5]]) n_test_examples = 1000 random_indices = np.random.permutation(data.shape[0]) test_data = data[random_indices[:n_test_examples],:] test_labels = labels_one_hot[random_indices[:n_test_examples],:] train_data = data[random_indices[n_test_examples:],:] train_labels = labels_one_hot[random_indices[n_test_examples:],:] print("Data shapes: ", test_data.shape, test_labels.shape, train_data.shape, train_labels.shape) outfile_name = os.path.join(DATA_DIR, "zoo.npz") with open(outfile_name, 'w') as outfile: np.savez(outfile, train_data, train_labels, test_data, test_labels) print ("Saved train/test data to {}".format(outfile_name)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step 3 (comparison of learning rates between clusters) Step1: Determine what clusters more successful in learning in terms of fraction of correct attempts Step2: Interestingly, group 3 has the smallest fraction of incorrect attempts (~36.5%). Also, not surprisingly, 'frac_incorrect_atts' in group 1 (with large 'frac_1s_hints') is significantly (p-value = 1.75e-8) smaller than in group 2 (with small 'frac_1s_hints' and large 'frac_3s_atts') Step3: However, the difference of 'frac_incorrect_atts' between students with "gaming" and non-gaming behaviour is not significant (p-value = 0.83) Step4: Notably, group 5 (students with medium 'num_sess' and 'num_probs') has significantly smaller 'frac_incorrect_atts' than group 4 (students with small 'num_sess' and 'num_probs') but significantly smaller 'frac_incorrect_atts' than in group 6 (students with large 'num_sess' and 'num_probs') Step5: In other words, for students with non-gaming behaviour 'frac_incorrect_atts' steadily decreases with learning experience. Step6: There is a significant increase of 'frac_3s_atts' for groups 4-5-6 Step7: , a significant increase of 'frac_1s_hints' for groups 4-5-6 Step8: , and a significant decrease of 'max_atts' for groups 4-5-6 Step9: Increase of max_probl_views is significant between groups 5 and 6 Step10: As we see, increasing "experience" (in group sequence 4-5-6) also leads to Step11: Moreover, for ~1/3 of students learning parameter is negative Step12: What best describes "negative learners"? First, look on extreme examples. Take "extreme negative learners" (students with learning rate < -0.5, and compare them with "extreme positive learnens" (students with learning rate > 0.5) Step13: As we see, "extreme negative learners" are very similar to "extreme positive learners" in terms of 'frac_corr_atts'. However, they opened much more sessions ('num_sess'), tried to solve more problems ('num_probs'), made more attempts to solve the problems ('num_atts') and spent more time (time_atts) for solving them. Step14: Notably, most of "extreme learners" belong to groups 3 and 4 that have the smallest 'num_atts' Step15: Together with the smallest group 2, groups 3 and 4 also correspond to the largest 'learning_parameter' variation across their members Step16: Note that both absolute average value and standard deviation come to zero with increasing 'num_atts' Step17: As a result, students from groups 3 and 6 contribute less (and students from group 4 contribute more) to problems with large number of attempts and distort the averaged learning curve towards larger 'frac_incorrect_atts'. Step18: Creating visualisation
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np %matplotlib inline import matplotlib.pyplot as plt import time from scipy import stats from scipy.optimize import minimize stud_learning = pd.read_csv('student_learning_final.csv') stud_learning.drop(['Unnamed: 0'], axis=1, inplace=True) cluster_index = pd.read_csv("cluster_index.csv", header=None) stud_learning['cluster_index'] = cluster_index[1] stud_learning['frac_incorrect_atts'] = stud_learning['number of incorrect attempts'] / stud_learning['number of attempts'] stud_learning.head() stud_learning.columns stud_data = pd.read_hdf('stud_data.hdf','test') stud_data.head() stud_data = stud_data.join(stud_learning) stud_data.head() stud_data_sum = stud_data.groupby('cluster_index').agg(np.sum).copy() stud_data_sum['frac_incorrect_atts'] = stud_data_sum['number of incorrect attempts'] / stud_data_sum['number of attempts'] stud_data_sum arr1 = np.array(stud_data[stud_data['cluster_index'] == 1]['frac_incorrect_atts']) arr2 = np.array(stud_data[stud_data['cluster_index'] == 2]['frac_incorrect_atts']) arr1 = arr1[~np.isnan(arr1)] arr2 = arr2[~np.isnan(arr2)] stats.ttest_ind(arr1,arr2, equal_var = False) arr_gam = np.array(stud_data[stud_data['cluster_index'] <= 2]['frac_incorrect_atts']) arr_nongam = np.array(stud_data[stud_data['cluster_index'] > 2]['frac_incorrect_atts']) arr_gam = arr_gam[~np.isnan(arr_gam)] arr_nongam = arr_nongam[~np.isnan(arr_nongam)] stats.ttest_ind(arr_gam,arr_nongam, equal_var = False) arr4 = np.array(stud_data[stud_data['cluster_index'] == 4]['frac_incorrect_atts']) arr5 = np.array(stud_data[stud_data['cluster_index'] == 5]['frac_incorrect_atts']) arr6 = np.array(stud_data[stud_data['cluster_index'] == 6]['frac_incorrect_atts']) arr4 = arr4[~np.isnan(arr4)] arr5 = arr5[~np.isnan(arr5)] arr6 = arr6[~np.isnan(arr6)] print(stats.ttest_ind(arr5,arr4, equal_var = False)) print(stats.ttest_ind(arr6,arr5, equal_var = False)) stud_data_mean = stud_data.groupby('cluster_index').agg(np.mean).copy() stud_data_mean arr4 = np.array(stud_data[stud_data['cluster_index'] == 4]['frac_3s_atts']) arr5 = np.array(stud_data[stud_data['cluster_index'] == 5]['frac_3s_atts']) arr6 = np.array(stud_data[stud_data['cluster_index'] == 6]['frac_3s_atts']) arr4 = arr4[~np.isnan(arr4)] arr5 = arr5[~np.isnan(arr5)] arr6 = arr6[~np.isnan(arr6)] print(stats.ttest_ind(arr5,arr4, equal_var = False)) print(stats.ttest_ind(arr6,arr5, equal_var = False)) arr4 = np.array(stud_data[stud_data['cluster_index'] == 4]['frac_1s_hints']) arr5 = np.array(stud_data[stud_data['cluster_index'] == 5]['frac_1s_hints']) arr6 = np.array(stud_data[stud_data['cluster_index'] == 6]['frac_1s_hints']) arr4 = arr4[~np.isnan(arr4)] arr5 = arr5[~np.isnan(arr5)] arr6 = arr6[~np.isnan(arr6)] print(stats.ttest_ind(arr5,arr4, equal_var = False)) print(stats.ttest_ind(arr6,arr5, equal_var = False)) arr4 = np.array(stud_data[stud_data['cluster_index'] == 4]['max_atts']) arr5 = np.array(stud_data[stud_data['cluster_index'] == 5]['max_atts']) arr6 = np.array(stud_data[stud_data['cluster_index'] == 6]['max_atts']) arr4 = arr4[~np.isnan(arr4)] arr5 = arr5[~np.isnan(arr5)] arr6 = arr6[~np.isnan(arr6)] print(stats.ttest_ind(arr5,arr4, equal_var = False)) print(stats.ttest_ind(arr6,arr5, equal_var = False)) arr4 = np.array(stud_data[stud_data['cluster_index'] == 4]['max_probl_views']) arr5 = np.array(stud_data[stud_data['cluster_index'] == 5]['max_probl_views']) arr6 = np.array(stud_data[stud_data['cluster_index'] == 6]['max_probl_views']) arr4 = arr4[~np.isnan(arr4)] arr5 = arr5[~np.isnan(arr5)] arr6 = arr6[~np.isnan(arr6)] print(stats.ttest_ind(arr5,arr4, equal_var = False)) print(stats.ttest_ind(arr6,arr5, equal_var = False)) stud_data['learning_parameter'].describe() stud_data[stud_data['learning_parameter'] < 0].shape[0] stud_data[stud_data['learning_parameter'] < -0.5].describe() stud_data[stud_data['learning_parameter'] >= 0.5].describe() stud_data[stud_data['learning_parameter'] < -0.5].groupby('cluster_index').agg(len)['num_sess'] stud_data[stud_data['learning_parameter'] >= 0.5].groupby('cluster_index').agg(len)['num_sess'] stud_data.groupby('cluster_index').agg(np.mean) stud_data.groupby('cluster_index').agg(np.std)['learning_parameter'] stud_data.groupby('cluster_index').agg(np.mean)[['frac_incorrect_atts', 'max_atts']].corr() stud_data.corr()['frac_incorrect_atts']['max_atts'] stud_data['gaming_index'] = stud_data['cluster_index'].replace({1: 0, 2: 0, 3: 1, 4: 1, 5: 1, 6:1}) stud_data.groupby('gaming_index').agg(np.mean) data = pd.read_hdf('data.hdf','test') data.head() stud_list = data['Anon Student Id'].unique() #print(stud_list[:5]) stud_dict = {stud: cluster_index.loc[i, 1] for i, stud in enumerate(stud_list)} stud_list[0] cluster_index.loc[0, 1] stud_dict['Stu_001d187b1b375fe98b88696b250177f0'] stud_df = pd.DataFrame() for item in stud_dict: #print(item, stud_dict[item]) stud_df.loc[item, 'cluster_index'] = int(stud_dict[item]) stud_df.head() data_125 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 1].index)) | \ (data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 2].index)) | \ (data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 5].index))] data_125.head() data_2 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 2].index))] s1 = data[data['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2 = data[data['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1[8] = s1.loc[8:].sum() for i in range(9, int(s1.index.max()+1)): try: s1.drop(i, inplace=True) except ValueError: pass s2[8] = s2.loc[8:].sum() for i in range(9, int(s2.index.max()+1)): try: s2.drop(i, inplace=True) except ValueError: pass data_1 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 1].index))] data_2 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 2].index))] data_3 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 3].index))] data_4 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 4].index))] data_5 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 5].index))] data_6 = data[(data['Anon Student Id'].isin(stud_df[stud_df['cluster_index'] == 6].index))] s1_1 = data_1[data_1['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_1 = data_1[data_1['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_1[8] = s1_1.loc[8:].sum() for i in range(9, int(s1_1.index.max()+1)): try: s1_1.drop(i, inplace=True) except ValueError: pass s2_1[8] = s2_1.loc[8:].sum() for i in range(9, int(s2_1.index.max()+1)): try: s2_1.drop(i, inplace=True) except ValueError: pass s1_2 = data_2[data_2['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_2 = data_2[data_2['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_2[8] = s1_2.loc[8:].sum() for i in range(9, int(s1_2.index.max()+1)): try: s1_2.drop(i, inplace=True) except ValueError: pass s2_2[8] = s2_2.loc[8:].sum() for i in range(9, int(s2_2.index.max()+1)): try: s2_2.drop(i, inplace=True) except ValueError: pass s1_3 = data_3[data_3['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_3 = data_3[data_3['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_3[8] = s1_3.loc[8:].sum() for i in range(9, int(s1_3.index.max()+1)): try: s1_3.drop(i, inplace=True) except ValueError: pass s2_3[8] = s2_3.loc[8:].sum() for i in range(9, int(s2_3.index.max()+1)): try: s2_3.drop(i, inplace=True) except ValueError: pass s1_4 = data_4[data_4['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_4 = data_4[data_4['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_4[8] = s1_4.loc[8:].sum() for i in range(9, int(s1_4.index.max()+1)): try: s1_4.drop(i, inplace=True) except ValueError: pass s2_4[8] = s2_4.loc[8:].sum() for i in range(9, int(s2_4.index.max()+1)): try: s2_4.drop(i, inplace=True) except ValueError: pass s1_5 = data_5[data_5['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_5 = data_5[data_5['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_5[8] = s1_5.loc[8:].sum() for i in range(9, int(s1_5.index.max()+1)): try: s1_5.drop(i, inplace=True) except ValueError: pass s2_5[8] = s2_5.loc[8:].sum() for i in range(9, int(s2_5.index.max()+1)): try: s2_5.drop(i, inplace=True) except ValueError: pass s1_6 = data_6[data_6['Outcome'] <= 1].groupby(['x']).agg(len)['Problem Name'] s2_6 = data_6[data_6['Outcome'] == 1].groupby(['x']).agg(len)['Problem Name'] s1_6[8] = s1_6.loc[8:].sum() for i in range(9, int(s1_6.index.max()+1)): try: s1_6.drop(i, inplace=True) except ValueError: pass s2_6[8] = s2_6.loc[8:].sum() for i in range(9, int(s2_6.index.max()+1)): try: s2_6.drop(i, inplace=True) except ValueError: pass fig, ax1 = plt.subplots() fig_size = plt.rcParams["figure.figsize"] fig_size[0] = 8.3 fig_size[1] = 4.7 plt.rcParams["figure.figsize"] = fig_size plt.xlim(0.5,8.5) plt.bar(s1.index, s1, width=0.9) #plt.bar(s2.index, s2, width=0.9) #plt.legend(['CORRECT', 'INCORRECT']) plt.xlabel("Attempt number", size=14) plt.ylabel("Number of attempts", size=14) ax1.tick_params(axis ='both', which='major', length=0, labelsize =14, color='black') ax1.tick_params(axis ='both', which='minor', length=0) labels = [item.get_text() for item in ax1.get_xticklabels()] labels = ['0', '1', '2', '3', '4', '5', '6', '7', '8+'] #labels = ['2', '4', '6', '8+'] #print(labels) ax2 = ax1.twinx() ax2.plot(s1.index, s2/s1, 'r-o', linewidth=4, label='Average') ax2.plot(s1_1.index, s2_1/s1_1, 'c-+', label='group 1') ax2.plot(s1_2.index, s2_2/s1_2, 'b-+', label='group 2') ax2.plot(s1_3.index, s2_3/s1_3, 'c-.', label='group 3') ax2.plot(s1_4.index, s2_4/s1_4, 'b-.', label='group 4') ax2.plot(s1_5.index, s2_5/s1_5, 'c-x', label='group 5') ax2.plot(s1_6.index, s2_6/s1_6, 'b-x', label='group 6') ax2.legend() ax2.set_ylabel('Fraction of incorrect attempts', size=14, color='r') ax2.tick_params('y', colors='r') ax2.tick_params(axis ='both', which='minor', length=0) ax2.tick_params(axis ='both', which='major', length=0, labelsize =14, color='red') ax1.set_xticklabels(labels) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: make pivot table of test Step2: groupby use Agencia_ID, Ruta_SAK, Cliente_ID, Producto_ID Step3: if predict week 8, use data from 3,4,5,6,7 Step4: data for predict week [34567----9], time plus 2 week Step5: data for predict week 8&9, time plus 1 week Step6: train_34567 7+1 = 8 Step7: concat train_pivot_45678_to_9 & train_pivot_34567_to_8 to perform t_plus_1, train_data is over Step8: prepare for test data, for week 10, we use 5,6,7,8,9 Step9: begin predict for week 11 Step10: train_4567 for 7 + 2 = 9 Step11: concat Step12: for test data week 11, we use 6,7,8,9 Step13: over Step14: create time feature Step15: fit mean feature on target Step16: add dummy feature Step17: add product feature Step18: add town feature Step19: begin xgboost training Step20: for 1 week later
<ASSISTANT_TASK:> Python Code: agencia_for_cliente_producto = train_dataset[['Cliente_ID','Producto_ID' ,'Agencia_ID']].groupby(['Cliente_ID', 'Producto_ID']).agg(lambda x:x.value_counts().index[0]).reset_index() canal_for_cliente_producto = train_dataset[['Cliente_ID', 'Producto_ID','Canal_ID']].groupby(['Cliente_ID', 'Producto_ID']).agg(lambda x:x.value_counts().index[0]).reset_index() ruta_for_cliente_producto = train_dataset[['Cliente_ID', 'Producto_ID','Ruta_SAK']].groupby(['Cliente_ID', 'Producto_ID']).agg(lambda x:x.value_counts().index[0]).reset_index() gc.collect() agencia_for_cliente_producto.to_pickle('agencia_for_cliente_producto.csv') canal_for_cliente_producto.to_pickle('canal_for_cliente_producto.csv') ruta_for_cliente_producto.to_pickle('ruta_for_cliente_producto.csv') agencia_for_cliente_producto = pd.read_pickle('agencia_for_cliente_producto.csv') canal_for_cliente_producto = pd.read_pickle('canal_for_cliente_producto.csv') ruta_for_cliente_producto = pd.read_pickle('ruta_for_cliente_producto.csv') # train_dataset['log_demand'] = train_dataset['Demanda_uni_equil'].apply(np.log1p) pivot_train = pd.pivot_table(data= train_dataset[['Cliente_ID','Producto_ID','log_demand','Semana']], values='log_demand', index=['Cliente_ID','Producto_ID'], columns=['Semana'], aggfunc=np.mean,fill_value = 0).reset_index() pivot_train.head() pivot_train = pd.merge(left = pivot_train, right = agencia_for_cliente_producto, how = 'inner', on = ['Cliente_ID','Producto_ID']) pivot_train = pd.merge(left = pivot_train, right = canal_for_cliente_producto, how = 'inner', on = ['Cliente_ID','Producto_ID']) pivot_train = pd.merge(left = pivot_train, right = ruta_for_cliente_producto, how = 'inner', on = ['Cliente_ID','Producto_ID']) pivot_train.to_pickle('pivot_train_with_zero.pickle') pivot_train = pd.read_pickle('pivot_train_with_zero.pickle') pivot_train.to_pickle('pivot_train_with_nan.pickle') pivot_train = pd.read_pickle('pivot_train_with_nan.pickle') pivot_train = pivot_train.rename(columns={3: 'Sem3', 4: 'Sem4',5: 'Sem5', 6: 'Sem6',7: 'Sem7', 8: 'Sem8',9: 'Sem9'}) pivot_train.head() pivot_train.columns.values test_dataset = pd.read_csv('origin/test.csv') test_dataset.head() test_dataset[test_dataset['Semana'] == 10].shape test_dataset[test_dataset['Semana'] == 11].shape pivot_test = pd.merge(left=pivot_train, right = test_dataset[['id','Cliente_ID','Producto_ID','Semana']], on =['Cliente_ID','Producto_ID'],how = 'inner' ) pivot_test.head() pivot_test_new = pd.merge(pivot_train[['Cliente_ID', 'Producto_ID', 'Sem3', 'Sem4', 'Sem5', 'Sem6', 'Sem7', 'Sem8', 'Sem9']],right = test_dataset, on = ['Cliente_ID','Producto_ID'],how = 'right') pivot_test_new.head() pivot_test_new.to_pickle('pivot_test.pickle') pivot_test.to_pickle('pivot_test.pickle') pivot_test = pd.read_pickle('pivot_test.pickle') pivot_test.head() train_dataset.head() import itertools col_list = ['Agencia_ID', 'Ruta_SAK', 'Cliente_ID', 'Producto_ID'] all_combine = itertools.combinations(col_list,2) list_2element_combine = [list(tuple) for tuple in all_combine] col_1elm_2elm = col_list + list_2element_combine col_1elm_2elm train_dataset_test = train_dataset[train_dataset['Semana'] < 8].copy() def categorical_useful(train_dataset,pivot_train): # if is_train: # train_dataset_test = train_dataset[train_dataset['Semana'] < 8].copy() # elif is_train == False: train_dataset_test = train_dataset.copy() log_demand_by_agen = train_dataset_test[['Agencia_ID','log_demand']].groupby('Agencia_ID').mean().reset_index() log_demand_by_ruta = train_dataset_test[['Ruta_SAK','log_demand']].groupby('Ruta_SAK').mean().reset_index() log_demand_by_cliente = train_dataset_test[['Cliente_ID','log_demand']].groupby('Cliente_ID').mean().reset_index() log_demand_by_producto = train_dataset_test[['Producto_ID','log_demand']].groupby('Producto_ID').mean().reset_index() log_demand_by_agen_ruta = train_dataset_test[['Agencia_ID', 'Ruta_SAK', 'log_demand']].groupby(['Agencia_ID', 'Ruta_SAK']).mean().reset_index() log_demand_by_agen_cliente = train_dataset_test[['Agencia_ID', 'Cliente_ID', 'log_demand']].groupby(['Agencia_ID', 'Cliente_ID']).mean().reset_index() log_demand_by_agen_producto = train_dataset_test[['Agencia_ID', 'Producto_ID', 'log_demand']].groupby(['Agencia_ID', 'Producto_ID']).mean().reset_index() log_demand_by_ruta_cliente = train_dataset_test[['Ruta_SAK', 'Cliente_ID', 'log_demand']].groupby(['Ruta_SAK', 'Cliente_ID']).mean().reset_index() log_demand_by_ruta_producto = train_dataset_test[['Ruta_SAK', 'Producto_ID', 'log_demand']].groupby(['Ruta_SAK', 'Producto_ID']).mean().reset_index() log_demand_by_cliente_producto = train_dataset_test[['Cliente_ID', 'Producto_ID', 'log_demand']].groupby(['Cliente_ID', 'Producto_ID']).mean().reset_index() log_demand_by_cliente_producto_agen = train_dataset_test[[ 'Cliente_ID','Producto_ID','Agencia_ID','log_demand']].groupby(['Cliente_ID', 'Agencia_ID','Producto_ID']).mean().reset_index() log_sum_by_cliente = train_dataset_test[['Cliente_ID','log_demand']].groupby('Cliente_ID').sum().reset_index() ruta_freq_semana = train_dataset[['Semana','Ruta_SAK']].groupby(['Ruta_SAK']).count().reset_index() clien_freq_semana = train_dataset[['Semana','Cliente_ID']].groupby(['Cliente_ID']).count().reset_index() agen_freq_semana = train_dataset[['Semana','Agencia_ID']].groupby(['Agencia_ID']).count().reset_index() prod_freq_semana = train_dataset[['Semana','Producto_ID']].groupby(['Producto_ID']).count().reset_index() pivot_train = pd.merge(left = pivot_train,right = ruta_freq_semana, how = 'left', on = ['Ruta_SAK']).rename(columns={'Semana': 'ruta_freq'}) pivot_train = pd.merge(left = pivot_train,right = clien_freq_semana, how = 'left', on = ['Cliente_ID']).rename(columns={'Semana': 'clien_freq'}) pivot_train = pd.merge(left = pivot_train,right = agen_freq_semana, how = 'left', on = ['Agencia_ID']).rename(columns={'Semana': 'agen_freq'}) pivot_train = pd.merge(left = pivot_train,right = prod_freq_semana, how = 'left', on = ['Producto_ID']).rename(columns={'Semana': 'prod_freq'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_agen, how = 'left', on = ['Agencia_ID']).rename(columns={'log_demand': 'agen_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_ruta, how = 'left', on = ['Ruta_SAK']).rename(columns={'log_demand': 'ruta_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_cliente, how = 'left', on = ['Cliente_ID']).rename(columns={'log_demand': 'cliente_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_producto, how = 'left', on = ['Producto_ID']).rename(columns={'log_demand': 'producto_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_agen_ruta, how = 'left', on = ['Agencia_ID', 'Ruta_SAK']).rename(columns={'log_demand': 'agen_ruta_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_agen_cliente, how = 'left', on = ['Agencia_ID', 'Cliente_ID']).rename(columns={'log_demand': 'agen_cliente_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_agen_producto, how = 'left', on = ['Agencia_ID', 'Producto_ID']).rename(columns={'log_demand': 'agen_producto_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_ruta_cliente, how = 'left', on = ['Ruta_SAK', 'Cliente_ID']).rename(columns={'log_demand': 'ruta_cliente_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_ruta_producto, how = 'left', on = ['Ruta_SAK', 'Producto_ID']).rename(columns={'log_demand': 'ruta_producto_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_cliente_producto, how = 'left', on = ['Cliente_ID', 'Producto_ID']).rename(columns={'log_demand': 'cliente_producto_for_log_de'}) pivot_train = pd.merge(left = pivot_train, right = log_sum_by_cliente, how = 'left', on = ['Cliente_ID']).rename(columns={'log_demand': 'cliente_for_log_sum'}) pivot_train = pd.merge(left = pivot_train, right = log_demand_by_cliente_producto_agen, how = 'left', on = ['Cliente_ID', 'Producto_ID', 'Agencia_ID']).rename(columns={'log_demand': 'cliente_producto_agen_for_log_sum'}) pivot_train['corr'] = pivot_train['producto_for_log_de'] * pivot_train['cliente_for_log_de'] / train_dataset_test['log_demand'].median() return pivot_train def define_time_features(df, to_predict = 't_plus_1' , t_0 = 8): if(to_predict == 't_plus_1' ): df['t_min_1'] = df['Sem'+str(t_0-1)] if(to_predict == 't_plus_2' ): df['t_min_6'] = df['Sem'+str(t_0-6)] df['t_min_2'] = df['Sem'+str(t_0-2)] df['t_min_3'] = df['Sem'+str(t_0-3)] df['t_min_4'] = df['Sem'+str(t_0-4)] df['t_min_5'] = df['Sem'+str(t_0-5)] if(to_predict == 't_plus_1' ): df['t1_min_t2'] = df['t_min_1'] - df['t_min_2'] df['t1_min_t3'] = df['t_min_1'] - df['t_min_3'] df['t1_min_t4'] = df['t_min_1'] - df['t_min_4'] df['t1_min_t5'] = df['t_min_1'] - df['t_min_5'] if(to_predict == 't_plus_2' ): df['t2_min_t6'] = df['t_min_2'] - df['t_min_6'] df['t3_min_t6'] = df['t_min_3'] - df['t_min_6'] df['t4_min_t6'] = df['t_min_4'] - df['t_min_6'] df['t5_min_t6'] = df['t_min_5'] - df['t_min_6'] df['t2_min_t3'] = df['t_min_2'] - df['t_min_3'] df['t2_min_t4'] = df['t_min_2'] - df['t_min_4'] df['t2_min_t5'] = df['t_min_2'] - df['t_min_5'] df['t3_min_t4'] = df['t_min_3'] - df['t_min_4'] df['t3_min_t5'] = df['t_min_3'] - df['t_min_5'] df['t4_min_t5'] = df['t_min_4'] - df['t_min_5'] return df def lin_regr(row, to_predict, t_0, semanas_numbers): row = row.copy() row.index = semanas_numbers row = row.dropna() if(len(row>2)): X = np.ones(shape=(len(row), 2)) X[:,1] = row.index y = row.values regr = linear_model.LinearRegression() regr.fit(X, y) if(to_predict == 't_plus_1'): return regr.predict([[1,t_0+1]])[0] elif(to_predict == 't_plus_2'): return regr.predict([[1,t_0+2]])[0] else: return None def lin_regr_features(pivot_df,to_predict, semanas_numbers,t_0): pivot_df = pivot_df.copy() semanas_names = ['Sem%i' %i for i in semanas_numbers] columns = ['Sem%i' %i for i in semanas_numbers] columns.append('Producto_ID') pivot_grouped = pivot_df[columns].groupby('Producto_ID').aggregate('mean') pivot_grouped['LR_prod'] = np.zeros(len(pivot_grouped)) pivot_grouped['LR_prod'] = pivot_grouped[semanas_names].apply(lin_regr, axis = 1, to_predict = to_predict, t_0 = t_0, semanas_numbers = semanas_numbers ) pivot_df = pd.merge(pivot_df, pivot_grouped[['LR_prod']], how='left', left_on = 'Producto_ID', right_index=True) pivot_df['LR_prod_corr'] = pivot_df['LR_prod'] * pivot_df['cliente_for_log_sum'] / 100 return pivot_df cliente_tabla = pd.read_csv('origin/cliente_tabla.csv') town_state = pd.read_csv('origin/town_state.csv') town_state['town_id'] = town_state['Town'].str.split() town_state['town_id'] = town_state['Town'].str.split(expand = True) def add_pro_info(dataset): train_basic_feature = dataset[['Cliente_ID','Producto_ID','Agencia_ID']].copy() train_basic_feature.drop_duplicates(inplace = True) cliente_per_town = pd.merge(train_basic_feature,cliente_tabla,on = 'Cliente_ID',how= 'inner' ) # print cliente_per_town.shape cliente_per_town = pd.merge(cliente_per_town,town_state[['Agencia_ID','town_id']],on = 'Agencia_ID',how= 'inner' ) # print cliente_per_town.shape cliente_per_town_count = cliente_per_town[['NombreCliente','town_id']].groupby('town_id').count().reset_index() # print cliente_per_town_count.head() cliente_per_town_count_final = pd.merge(cliente_per_town[['Cliente_ID','Producto_ID','town_id','Agencia_ID']], cliente_per_town_count,on = 'town_id',how = 'inner') # print cliente_per_town_count_final.head() cliente_per_town_count_final.drop_duplicates(inplace = True) dataset_final = pd.merge(dataset,cliente_per_town_count_final[['Cliente_ID','Producto_ID','NombreCliente','Agencia_ID']], on = ['Cliente_ID','Producto_ID','Agencia_ID'],how = 'left') return dataset_final pre_product = pd.read_csv('preprocessed_products.csv',index_col = 0) pre_product['weight_per_piece'] = pd.to_numeric(pre_product['weight_per_piece'], errors='coerce') pre_product['weight'] = pd.to_numeric(pre_product['weight'], errors='coerce') pre_product['pieces'] = pd.to_numeric(pre_product['pieces'], errors='coerce') def add_product(dataset): dataset = pd.merge(dataset,pre_product[['ID','weight','weight_per_piece','pieces']], left_on = 'Producto_ID',right_on = 'ID',how = 'left') return dataset train_34567 = train_dataset.loc[train_dataset['Semana'].isin([3,4,5,6,7]), :].copy() train_pivot_34567_to_9 = pivot_train.loc[(pivot_train['Sem9'].notnull()),:].copy() train_pivot_34567_to_9 = categorical_useful(train_34567,train_pivot_34567_to_9) del train_34567 gc.collect() train_pivot_34567_to_9 = define_time_features(train_pivot_34567_to_9, to_predict = 't_plus_2' , t_0 = 9) train_pivot_34567_to_9 = lin_regr_features(train_pivot_34567_to_9,to_predict ='t_plus_2', semanas_numbers = [3,4,5,6,7],t_0 = 9) train_pivot_34567_to_9['target'] = train_pivot_34567_to_9['Sem9'] train_pivot_34567_to_9.drop(['Sem8','Sem9'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_34567_to_9[['Sem3','Sem4','Sem5','Sem6','Sem7']].cumsum(axis = 1) train_pivot_34567_to_9.drop(['Sem3','Sem4','Sem5','Sem6','Sem7'],axis =1,inplace = True) train_pivot_34567_to_9 = pd.concat([train_pivot_34567_to_9,train_pivot_cum_sum],axis =1) train_pivot_34567_to_9 = train_pivot_34567_to_9.rename(columns={'Sem3': 't_m_6_cum', 'Sem4': 't_m_5_cum','Sem5': 't_m_4_cum', 'Sem6': 't_m_3_cum','Sem7': 't_m_2_cum'}) # add geo_info train_pivot_34567_to_9 = add_pro_info(train_pivot_34567_to_9) #add product info train_pivot_34567_to_9 = add_product(train_pivot_34567_to_9) train_pivot_34567_to_9.drop(['ID'],axis = 1,inplace = True) gc.collect() train_pivot_34567_to_9.head() train_45678 = train_dataset.loc[train_dataset['Semana'].isin([4,5,6,7,8]), :].copy() train_pivot_45678_to_9 = pivot_train.loc[(pivot_train['Sem9'].notnull()),:].copy() train_pivot_45678_to_9 = categorical_useful(train_45678,train_pivot_45678_to_9) del train_45678 gc.collect() train_pivot_45678_to_9 = define_time_features(train_pivot_45678_to_9, to_predict = 't_plus_1' , t_0 = 9) train_pivot_45678_to_9 = lin_regr_features(train_pivot_45678_to_9,to_predict ='t_plus_1', semanas_numbers = [4,5,6,7,8],t_0 = 8) train_pivot_45678_to_9['target'] = train_pivot_45678_to_9['Sem9'] train_pivot_45678_to_9.drop(['Sem3','Sem9'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_45678_to_9[['Sem4','Sem5','Sem6','Sem7','Sem8']].cumsum(axis = 1) train_pivot_45678_to_9.drop(['Sem4','Sem5','Sem6','Sem7','Sem8'],axis =1,inplace = True) train_pivot_45678_to_9 = pd.concat([train_pivot_45678_to_9,train_pivot_cum_sum],axis =1) train_pivot_45678_to_9 = train_pivot_45678_to_9.rename(columns={'Sem4': 't_m_5_cum', 'Sem5': 't_m_4_cum','Sem6': 't_m_3_cum', 'Sem7': 't_m_2_cum','Sem8': 't_m_1_cum'}) # add geo_info train_pivot_45678_to_9 = add_pro_info(train_pivot_45678_to_9) #add product info train_pivot_45678_to_9 = add_product(train_pivot_45678_to_9) train_pivot_45678_to_9.drop(['ID'],axis = 1,inplace = True) gc.collect() train_pivot_45678_to_9.head() train_pivot_45678_to_9.columns.values train_pivot_45678_to_9.to_csv('train_pivot_45678_to_9.csv') train_pivot_45678_to_9 = pd.read_csv('train_pivot_45678_to_9.csv',index_col = 0) train_pivot_45678_to_9.to_csv('train_pivot_45678_to_9_new.csv') train_pivot_45678_to_9 = pd.read_csv('train_pivot_45678_to_9_new.csv',index_col = 0) train_34567 = train_dataset.loc[train_dataset['Semana'].isin([3,4,5,6,7]), :].copy() train_pivot_34567_to_8 = pivot_train.loc[(pivot_train['Sem8'].notnull()),:].copy() train_pivot_34567_to_8 = categorical_useful(train_34567,train_pivot_34567_to_8) del train_34567 gc.collect() train_pivot_34567_to_8 = define_time_features(train_pivot_34567_to_8, to_predict = 't_plus_1' , t_0 = 8) train_pivot_34567_to_8 = lin_regr_features(train_pivot_34567_to_8,to_predict = 't_plus_1', semanas_numbers = [3,4,5,6,7],t_0 = 7) train_pivot_34567_to_8['target'] = train_pivot_34567_to_8['Sem8'] train_pivot_34567_to_8.drop(['Sem8','Sem9'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_34567_to_8[['Sem3','Sem4','Sem5','Sem6','Sem7']].cumsum(axis = 1) train_pivot_34567_to_8.drop(['Sem3','Sem4','Sem5','Sem6','Sem7'],axis =1,inplace = True) train_pivot_34567_to_8 = pd.concat([train_pivot_34567_to_8,train_pivot_cum_sum],axis =1) train_pivot_34567_to_8 = train_pivot_34567_to_8.rename(columns={'Sem3': 't_m_5_cum','Sem4': 't_m_4_cum', 'Sem5': 't_m_3_cum','Sem6': 't_m_2_cum', 'Sem7': 't_m_1_cum'}) # add product_info train_pivot_34567_to_8 = add_pro_info(train_pivot_34567_to_8) #add product train_pivot_34567_to_8 = add_product(train_pivot_34567_to_8) train_pivot_34567_to_8.drop(['ID'],axis = 1,inplace = True) gc.collect() train_pivot_34567_to_8.head() train_pivot_34567_to_8.columns.values train_pivot_34567_to_8.to_csv('train_pivot_34567_to_8.csv') train_pivot_34567_to_8 = pd.read_csv('train_pivot_34567_to_8.csv',index_col = 0) gc.collect() train_pivot_xgb_time1 = pd.concat([train_pivot_45678_to_9, train_pivot_34567_to_8],axis = 0,copy = False) train_pivot_xgb_time1.columns.values train_pivot_xgb_time1.shape train_pivot_xgb_time1.to_csv('train_pivot_xgb_time1_44fea.csv') train_pivot_xgb_time1.to_csv('train_pivot_xgb_time1.csv') del train_pivot_xgb_time1 del train_pivot_45678_to_9 del train_pivot_34567_to_8 gc.collect() pivot_test.head() pivot_test_week10 = pivot_test.loc[pivot_test['sem10_sem11'] == 10] pivot_test_week10.reset_index(drop=True,inplace = True) pivot_test_week10.head() pivot_test_week10.shape train_56789 = train_dataset.loc[train_dataset['Semana'].isin([5,6,7,8,9]), :].copy() train_pivot_56789_to_10 = pivot_test_week10.copy() train_pivot_56789_to_10 = categorical_useful(train_56789,train_pivot_56789_to_10) del train_56789 gc.collect() train_pivot_56789_to_10 = define_time_features(train_pivot_56789_to_10, to_predict = 't_plus_1' , t_0 = 10) train_pivot_56789_to_10 = lin_regr_features(train_pivot_56789_to_10,to_predict ='t_plus_1' , semanas_numbers = [5,6,7,8,9],t_0 = 9) train_pivot_56789_to_10.drop(['Sem3','Sem4'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_56789_to_10[['Sem5','Sem6','Sem7','Sem8','Sem9']].cumsum(axis = 1) train_pivot_56789_to_10.drop(['Sem5','Sem6','Sem7','Sem8','Sem9'],axis =1,inplace = True) train_pivot_56789_to_10 = pd.concat([train_pivot_56789_to_10,train_pivot_cum_sum],axis =1) train_pivot_56789_to_10 = train_pivot_56789_to_10.rename(columns={'Sem5': 't_m_5_cum', 'Sem6': 't_m_4_cum','Sem7': 't_m_3_cum', 'Sem8': 't_m_2_cum','Sem9': 't_m_1_cum'}) # add product_info train_pivot_56789_to_10 = add_pro_info(train_pivot_56789_to_10) # train_pivot_56789_to_10 = add_product(train_pivot_56789_to_10) train_pivot_56789_to_10.drop(['ID'],axis =1,inplace = True) train_pivot_56789_to_10.head() train_pivot_56789_to_10.columns.values train_pivot_56789_to_10.to_pickle('train_pivot_56789_to_10_44fea.pickle') train_3456 = train_dataset.loc[train_dataset['Semana'].isin([3,4,5,6]), :].copy() train_pivot_3456_to_8 = pivot_train.loc[(pivot_train['Sem8'].notnull()),:].copy() train_pivot_3456_to_8 = categorical_useful(train_3456,train_pivot_3456_to_8) del train_3456 gc.collect() train_pivot_3456_to_8 = define_time_features(train_pivot_3456_to_8, to_predict = 't_plus_2' , t_0 = 8) #notice that the t_0 means different train_pivot_3456_to_8 = lin_regr_features(train_pivot_3456_to_8,to_predict = 't_plus_2', semanas_numbers = [3,4,5,6],t_0 = 6) train_pivot_3456_to_8['target'] = train_pivot_3456_to_8['Sem8'] train_pivot_3456_to_8.drop(['Sem7','Sem8','Sem9'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_3456_to_8[['Sem3','Sem4','Sem5','Sem6']].cumsum(axis = 1) train_pivot_3456_to_8.drop(['Sem3','Sem4','Sem5','Sem6'],axis =1,inplace = True) train_pivot_3456_to_8 = pd.concat([train_pivot_3456_to_8,train_pivot_cum_sum],axis =1) train_pivot_3456_to_8 = train_pivot_3456_to_8.rename(columns={'Sem4': 't_m_4_cum', 'Sem5': 't_m_3_cum','Sem6': 't_m_2_cum', 'Sem3': 't_m_5_cum'}) # add product_info train_pivot_3456_to_8 = add_pro_info(train_pivot_3456_to_8) train_pivot_3456_to_8 = add_product(train_pivot_3456_to_8) train_pivot_3456_to_8.drop(['ID'],axis =1,inplace = True) train_pivot_3456_to_8.head() train_pivot_3456_to_8.columns.values train_pivot_3456_to_8.to_csv('train_pivot_3456_to_8.csv') train_4567 = train_dataset.loc[train_dataset['Semana'].isin([4,5,6,7]), :].copy() train_pivot_4567_to_9 = pivot_train.loc[(pivot_train['Sem9'].notnull()),:].copy() train_pivot_4567_to_9 = categorical_useful(train_4567,train_pivot_4567_to_9) del train_4567 gc.collect() train_pivot_4567_to_9 = define_time_features(train_pivot_4567_to_9, to_predict = 't_plus_2' , t_0 = 9) #notice that the t_0 means different train_pivot_4567_to_9 = lin_regr_features(train_pivot_4567_to_9,to_predict = 't_plus_2', semanas_numbers = [4,5,6,7],t_0 = 7) train_pivot_4567_to_9['target'] = train_pivot_4567_to_9['Sem9'] train_pivot_4567_to_9.drop(['Sem3','Sem8','Sem9'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_4567_to_9[['Sem7','Sem4','Sem5','Sem6']].cumsum(axis = 1) train_pivot_4567_to_9.drop(['Sem7','Sem4','Sem5','Sem6'],axis =1,inplace = True) train_pivot_4567_to_9 = pd.concat([train_pivot_4567_to_9,train_pivot_cum_sum],axis =1) train_pivot_4567_to_9 = train_pivot_4567_to_9.rename(columns={'Sem4': 't_m_5_cum', 'Sem5': 't_m_4_cum','Sem6': 't_m_3_cum', 'Sem7': 't_m_2_cum'}) # add product_info train_pivot_4567_to_9 = add_pro_info(train_pivot_4567_to_9) train_pivot_4567_to_9 = add_product(train_pivot_4567_to_9) train_pivot_4567_to_9.drop(['ID'],axis =1,inplace = True) train_pivot_4567_to_9.head() train_pivot_4567_to_9.columns.values train_pivot_4567_to_9.to_csv('train_pivot_4567_to_9.csv') train_pivot_xgb_time2 = pd.concat([train_pivot_3456_to_8, train_pivot_4567_to_9],axis = 0,copy = False) train_pivot_xgb_time2.columns.values train_pivot_xgb_time2.shape train_pivot_xgb_time2.to_csv('train_pivot_xgb_time2_38fea.csv') train_pivot_xgb_time2 = pd.read_csv('train_pivot_xgb_time2.csv',index_col = 0) train_pivot_xgb_time2.head() del train_pivot_3456_to_8 del train_pivot_4567_to_9 del train_pivot_xgb_time2 del train_pivot_34567_to_8 del train_pivot_45678_to_9 del train_pivot_xgb_time1 gc.collect() pivot_test_week11 = pivot_test_new.loc[pivot_test_new['Semana'] == 11] pivot_test_week11.reset_index(drop=True,inplace = True) pivot_test_week11.head() pivot_test_week11.shape train_6789 = train_dataset.loc[train_dataset['Semana'].isin([6,7,8,9]), :].copy() train_pivot_6789_to_11 = pivot_test_week11.copy() train_pivot_6789_to_11 = categorical_useful(train_6789,train_pivot_6789_to_11) del train_6789 gc.collect() train_pivot_6789_to_11 = define_time_features(train_pivot_6789_to_11, to_predict = 't_plus_2' , t_0 = 11) train_pivot_6789_to_11 = lin_regr_features(train_pivot_6789_to_11,to_predict ='t_plus_2' , semanas_numbers = [6,7,8,9],t_0 = 9) train_pivot_6789_to_11.drop(['Sem3','Sem4','Sem5'],axis =1,inplace = True) #add cum_sum train_pivot_cum_sum = train_pivot_6789_to_11[['Sem6','Sem7','Sem8','Sem9']].cumsum(axis = 1) train_pivot_6789_to_11.drop(['Sem6','Sem7','Sem8','Sem9'],axis =1,inplace = True) train_pivot_6789_to_11 = pd.concat([train_pivot_6789_to_11,train_pivot_cum_sum],axis =1) train_pivot_6789_to_11 = train_pivot_6789_to_11.rename(columns={'Sem6': 't_m_5_cum', 'Sem7': 't_m_4_cum', 'Sem8': 't_m_3_cum','Sem9': 't_m_2_cum'}) # add product_info train_pivot_6789_to_11 = add_pro_info(train_pivot_6789_to_11) train_pivot_6789_to_11 = add_product(train_pivot_6789_to_11) train_pivot_6789_to_11.drop(['ID'],axis = 1,inplace = True) train_pivot_6789_to_11.head() train_pivot_6789_to_11.shape train_pivot_6789_to_11.to_pickle('train_pivot_6789_to_11_new.pickle') % time pivot_train_categorical_useful = categorical_useful(train_dataset,pivot_train,is_train = True) % time pivot_train_categorical_useful = categorical_useful(train_dataset,pivot_train,is_train = True) pivot_train_categorical_useful_train.to_csv('pivot_train_categorical_useful_with_nan.csv') pivot_train_categorical_useful_train = pd.read_csv('pivot_train_categorical_useful_with_nan.csv',index_col = 0) pivot_train_categorical_useful_train.head() pivot_train_categorical_useful.head() pivot_train_categorical_useful_time = define_time_features(pivot_train_categorical_useful, to_predict = 't_plus_1' , t_0 = 8) pivot_train_categorical_useful_time.head() pivot_train_categorical_useful_time.columns # Linear regression features pivot_train_categorical_useful_time_LR = lin_regr_features(pivot_train_categorical_useful_time, semanas_numbers = [3,4,5,6,7]) pivot_train_categorical_useful_time_LR.head() pivot_train_categorical_useful_time_LR.columns pivot_train_categorical_useful_time_LR.to_csv('pivot_train_categorical_useful_time_LR.csv') pivot_train_categorical_useful_time_LR = pd.read_csv('pivot_train_categorical_useful_time_LR.csv',index_col = 0) pivot_train_categorical_useful_time_LR.head() # pivot_train_canal = pd.get_dummies(pivot_train_categorical_useful_train['Canal_ID']) # pivot_train_categorical_useful_train = pivot_train_categorical_useful_train.join(pivot_train_canal) # pivot_train_categorical_useful_train.head() %ls pre_product = pd.read_csv('preprocessed_products.csv',index_col = 0) pre_product.head() pre_product['weight_per_piece'] = pd.to_numeric(pre_product['weight_per_piece'], errors='coerce') pre_product['weight'] = pd.to_numeric(pre_product['weight'], errors='coerce') pre_product['pieces'] = pd.to_numeric(pre_product['pieces'], errors='coerce') pivot_train_categorical_useful_time_LR_weight = pd.merge(pivot_train_categorical_useful_time_LR, pre_product[['ID','weight','weight_per_piece']], left_on = 'Producto_ID',right_on = 'ID',how = 'left') pivot_train_categorical_useful_time_LR_weight.head() pivot_train_categorical_useful_time_LR_weight = pd.merge(pivot_train_categorical_useful_time_LR, pre_product[['ID','weight','weight_per_piece']], left_on = 'Producto_ID',right_on = 'ID',how = 'left') pivot_train_categorical_useful_time_LR_weight.head() pivot_train_categorical_useful_time_LR_weight.to_csv('pivot_train_categorical_useful_time_LR_weight.csv') pivot_train_categorical_useful_time_LR_weight = pd.read_csv('pivot_train_categorical_useful_time_LR_weight.csv',index_col = 0) pivot_train_categorical_useful_time_LR_weight.head() %cd '/media/siyuan/0009E198000CD19B/bimbo/origin' %ls cliente_tabla = pd.read_csv('cliente_tabla.csv') town_state = pd.read_csv('town_state.csv') town_state['town_id'] = town_state['Town'].str.split() town_state['town_id'] = town_state['Town'].str.split(expand = True) train_basic_feature = pivot_train_categorical_useful_time_LR_weight[['Cliente_ID','Producto_ID','Agencia_ID']] cliente_per_town = pd.merge(train_basic_feature,cliente_tabla,on = 'Cliente_ID',how= 'inner' ) cliente_per_town = pd.merge(cliente_per_town,town_state[['Agencia_ID','town_id']],on = 'Agencia_ID',how= 'inner' ) cliente_per_town_count = cliente_per_town[['NombreCliente','town_id']].groupby('town_id').count().reset_index() cliente_per_town_count['NombreCliente'] = cliente_per_town_count['NombreCliente']/float(100000) cliente_per_town_count_final = pd.merge(cliente_per_town[['Cliente_ID','Producto_ID','Agencia_ID','town_id']], cliente_per_town_count,on = 'town_id',how = 'left') pivot_train_categorical_useful_time_LR_weight_town = pd.merge(pivot_train_categorical_useful_time_LR_weight, cliente_per_town_count_final[['Cliente_ID','Producto_ID','NombreCliente']], on = ['Cliente_ID','Producto_ID'],how = 'left') cliente_tabla.head() town_state.head() town_state['town_id'] = town_state['Town'].str.split() town_state['town_id'] = town_state['Town'].str.split(expand = True) town_state.head() pivot_train_categorical_useful_time_LR_weight.columns.values train_basic_feature = pivot_train_categorical_useful_time_LR_weight[['Cliente_ID','Producto_ID','Agencia_ID']] cliente_per_town = pd.merge(train_basic_feature,cliente_tabla,on = 'Cliente_ID',how= 'inner' ) cliente_per_town = pd.merge(cliente_per_town,town_state[['Agencia_ID','town_id']],on = 'Agencia_ID',how= 'inner' ) cliente_per_town.head() cliente_per_town_count = cliente_per_town[['NombreCliente','town_id']].groupby('town_id').count().reset_index() cliente_per_town_count['NombreCliente'] = cliente_per_town_count['NombreCliente']/float(100000) cliente_per_town_count.head() cliente_per_town_count_final = pd.merge(cliente_per_town[['Cliente_ID','Producto_ID','Agencia_ID','town_id']], cliente_per_town_count,on = 'town_id',how = 'left') cliente_per_town_count_final.head() pivot_train_categorical_useful_time_LR_weight_town = pd.merge(pivot_train_categorical_useful_time_LR_weight, cliente_per_town_count_final[['Cliente_ID','Producto_ID','NombreCliente']], on = ['Cliente_ID','Producto_ID'],how = 'left') pivot_train_categorical_useful_time_LR_weight_town.head() pivot_train_categorical_useful_time_LR_weight_town.columns.values train_pivot_xgb_time1.columns.values train_pivot_xgb_time1 = train_pivot_xgb_time1.drop(['Cliente_ID','Producto_ID','Agencia_ID', 'Ruta_SAK','Canal_ID'],axis = 1) pivot_train_categorical_useful_train_time_no_nan = pivot_train_categorical_useful_train[pivot_train_categorical_useful_train['Sem8'].notnull()] # pivot_train_categorical_useful_train_time_no_nan = pivot_train_categorical_useful_train[pivot_train_categorical_useful_train['Sem9'].notnull()] pivot_train_categorical_useful_train_time_no_nan_sample = pivot_train_categorical_useful_train_time_no_nan.sample(1000000) train_feature = pivot_train_categorical_useful_train_time_no_nan_sample.drop(['Sem8','Sem9'],axis = 1) train_label = pivot_train_categorical_useful_train_time_no_nan_sample[['Sem8','Sem9']] #seperate train and test data # datasource: sparse_week_Agencia_Canal_Ruta_normalized_csr label:train_label %time train_set, valid_set, train_labels, valid_labels = train_test_split(train_feature,\ train_label, test_size=0.10) # dtrain = xgb.DMatrix(train_feature,label = train_label['Sem8'],missing=NaN) dtrain = xgb.DMatrix(train_feature,label = train_label['Sem8'],missing=NaN) param = {'booster':'gbtree', 'nthread': 7, 'max_depth':6, 'eta':0.2, 'silent':0, 'subsample':0.7, 'objective':'reg:linear', 'eval_metric':'rmse', 'colsample_bytree':0.7} # param = {'eta':0.1, 'eval_metric':'rmse','nthread': 8} # evallist = [(dvalid,'eval'), (dtrain,'train')] num_round = 1000 # plst = param.items() # bst = xgb.train( plst, dtrain, num_round, evallist ) cvresult = xgb.cv(param, dtrain, num_round, nfold=5,show_progress=True,show_stdv=False, seed = 0, early_stopping_rounds=10) print(cvresult.tail()) # xgb.plot_importance(cvresult) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Système linéaire gaussien en tems discret Step2: Un peu de vectorisation Step3: Filtrage linéaire gaussien
<ASSISTANT_TASK:> Python Code: %matplotlib inline from ipywidgets import interact, fixed import numpy as np import matplotlib.pyplot as plt import scipy.stats as stats barZ = np.array([[1],[3]]) QZ = np.array([[3,1],[1,1]]) a = barZ[0] b = QZ[0,0] xx = np.linspace(-6, 10, 100) R = QZ[0,0]-QZ[0,1]*QZ[0,1]/QZ[1,1] def pltbayesgauss(obs): hatX = barZ[0]+QZ[0,1]*(obs-barZ[1])/QZ[1,1] plt.plot([obs,obs],[0,1],':') plt.plot(xx, stats.norm.pdf(xx, a, b),label='loi a priori') plt.plot(xx, stats.norm.pdf(xx, hatX, R),label='loi a posteriori') plt.ylim([0,0.25]) plt.legend() plt.show() interact(pltbayesgauss, obs=(-6,10,0.1)) plt.show() %matplotlib inline import numpy as np import matplotlib.pyplot as plt kmax = 300 EX0, VX0 = 10, 5 A, B, QW = 0.9, 1, 0.1 sQW = np.sqrt(QW) sVX0 = np.sqrt(VX0) def sys_lin(EX0, sVX0, A, B, sQW): W = sQW*np.random.randn(kmax) X = np.ones(kmax+1) X[0] = EX0+sVX0*np.random.randn() for k in range(kmax): X[k+1] = A*X[k]+B*W[k] return X def sys_lin_loi(EX0, sVX0, A, B, sQW): espX = np.ones(kmax+1) varX = np.ones(kmax+1) espX[0] = EX0 for k in range(kmax): espX[k+1] = A*espX[k] varX[k+1] = A*A*varX[k]+B*B*QW return espX, varX X = sys_lin(EX0, sVX0, A, B, sQW) espX, varX = sys_lin_loi(EX0, sVX0, A, B, sQW) plt.plot([0, kmax], [0, 0], color="g", linestyle=':') plt.plot(espX,color='k') plt.fill_between(range(kmax+1),espX+2*np.sqrt(varX), espX-2*np.sqrt(varX), color = '0.75', alpha=0.4) plt.plot(X) plt.show() from ipywidgets import interact, fixed def plt_sys_lin(A, B, iseed): np.random.seed(iseed) X = sys_lin(10, 0, A, B, 1) plt.plot([0, kmax], [0, 0], color="g", linestyle=':') plt.plot(X) plt.ylim([-4,15]) plt.show() interact(plt_sys_lin, A=(0,1,0.01), B=(0.,6,0.1), iseed=(1,100,1)) plt.show() kmax = 300 mcmax = 300 EX0, VX0 = 10, 5 A, B, QW = 0.9, 1, 0.1 sQW = np.sqrt(QW) sVX0 = np.sqrt(VX0) def sys_lin_vec(mcmax,EX0, sVX0, A, B, sQW): W = sQW*np.random.randn(kmax,mcmax) X = np.ones((kmax+1,mcmax)) X[0,] = EX0+sVX0*np.random.randn() for k in range(kmax): X[k+1,] = A*X[k,]+B*W[k,] return X X = sys_lin_vec(mcmax, EX0, sVX0, A, B, sQW) plt.plot(X,alpha=.04,color='b') plt.plot(espX,color='w') plt.plot(espX+2*np.sqrt(varX),color='k') plt.plot(espX-2*np.sqrt(varX),color='k') plt.show() mcmax = 10000 X = sys_lin_vec(mcmax, EX0, sVX0, A, B, sQW) num_bins = 30 n, bins, patches = plt.hist(X[-1,], num_bins, normed=1, facecolor='green', alpha=0.5) plt.show() import numpy as np import matplotlib.pyplot as plt kmax = 300 EX0, VX0 = 10, 5 A, B, QW = 0.9, 1, 0.1 H, QV = 1, 0.2 sQW = np.sqrt(QW) sQV = np.sqrt(QV) sVX0 = np.sqrt(VX0) def sys_lin_esp_etat(EX0, sVX0, A, B, H, sQW, sQV): W = sQW*np.random.randn(kmax) V = sQV*np.random.randn(kmax) X = np.ones(kmax+1) Y = np.ones(kmax+1) X[0] = EX0+sVX0*np.random.randn() Y[0] = 0 # on s en moque for k in range(kmax): X[k+1] = A*X[k]+B*W[k] Y[k+1] = H*X[k+1]+V[k] return X,Y def kalman(EX0, sVX0, A, B, H, sQW, sQV, Y): hatX = np.ones(kmax+1) R = np.ones(kmax+1) hatX[0] = EX0 R[0] = sVX0*sVX0 for k in range(kmax): # prediction predX = A*hatX[k] predR = A*A*R[k]+B*B*sQW*sQW # correction gain = predR * H / (H*predR*H+sQV*sQV) hatX[k+1] = predX + gain * (Y[k+1]-H*predX) R[k+1] = (1-gain*H)*predR return hatX, R X,Y = sys_lin_esp_etat(EX0, sVX0, A, B, H, sQW, sQV) espX, varX = sys_lin_loi(EX0, sVX0, A, B, sQW) hatX, R = kalman(EX0, sVX0, A, B, H, sQW, sQV, Y) plt.fill_between(range(kmax+1),espX+2*np.sqrt(varX), espX-2*np.sqrt(varX), color = 'g', alpha=0.12, label=r'$\bar X_k\pm 2\,\sqrt{Q^X_k}$ (a priori)') plt.fill_between(range(kmax+1),hatX+2*np.sqrt(R), hatX-2*np.sqrt(R), color = 'r', alpha=0.12, label=r'$\hat X_k\pm 2\,\sqrt{R_k}$ (a posteriori)') plt.plot(X,label=r'$X_k$') plt.plot(espX,color='g',label=r'$\bar X_k$') plt.plot(hatX,color='r',alpha=0.5,label=r'$\hat X_k$') plt.legend() plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code: import numpy as np A=np.asarray([[1,1,1], [1,1,2], [1,1,3], [1,1,4]]) B=np.asarray([[0,0,0], [1,0,2], [1,0,3], [1,0,4], [1,1,0], [1,1,1], [1,1,4]]) dims = np.maximum(B.max(0),A.max(0))+1 output = A[~np.in1d(np.ravel_multi_index(A.T,dims),np.ravel_multi_index(B.T,dims))] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Solution de Félix Revert. Step2: Exercice 2
<ASSISTANT_TASK:> Python Code: from jyquickhelper import add_notebook_menu add_notebook_menu() import urllib.request as ulib def get_html(address, source="https://fr.wikipedia.org/wiki/"): with ulib.urlopen(source+address) as u: return u.read() get_html("http://www.xavierdupre.fr", source="")[:100] def get_first_link(soup): for p in soup.find('div',{'id':'bodyContent'}).findAll('p'): for a in p.findAll('a'): if a and a.get('href').startswith('/wiki/') and not ":" in a.get('href'): return a.get('href')[6:] from bs4 import BeautifulSoup stru = BeautifulSoup(get_html("Python_(langage)"), "lxml") get_first_link(stru) def get_to_philosophy(initial_address, max_iterations=100, verbose=False): target_page = "Philosophie" iteration = 0 pages_visited = [] current_address = initial_address if verbose: print("\ninitial address: " + current_address+"\n Will you go to "+target_page+" ?...\n") while iteration < max_iterations: current_address = get_first_link(BeautifulSoup(get_html(current_address), "lxml")) if current_address is None: break if verbose: print(current_address) if current_address in pages_visited: print("Boucle de " + str(iteration - pages_visited.index(current_address)) + " noeuds trouvée à partir de "+str(pages_visited.index(current_address))+" itérations") return elif current_address.lower() == target_page.lower(): print(str(iteration) + " itérations pour arriver à la page Philosophie") return else: pages_visited.extend([current_address]) iteration += 1 return str(max_iterations)+" itérations atteintes" get_to_philosophy("Python_(langage)", verbose=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Detour Step2: Nonparametric Methods for Comparing Sets of Measurements Step3: I'm going to standardize the homework so that they are all out of 100%. The first row contains perfect scores on each. Step4: The $p$-value is 0.70, so we cannot rule out the null hypothesis that they are from the same distribution. What about a more recent difficult homework? Step5: So HW 1 and HW 5 were significantly different. Step6: Notice that the p-values are lower relative to the unmatched sum of ranks test, meaning have paired data allows us to be more certain in our conclusions. Step7: Remarkable! Step8: Tests For Counts (Parametric)
<ASSISTANT_TASK:> Python Code: import random import numpy as np import matplotlib.pyplot as plt from math import sqrt, pi, erf import scipy.stats as ss d = np.random.rand(10) print (d) print (ss.rankdata(d)) import pandas as pd data = pd.read_csv('grades.csv') #get some info: data.info() data /= data.iloc[0,:] data *= 100 data.mean(axis=0) plt.title('HW1') plt.hist(data.HW1) plt.show() plt.title('HW2') plt.hist(data.HW2) plt.show() ss.ranksums(data['HW1'], data['HW2']) ss.ranksums(data['HW1'], data['HW5']) ss.wilcoxon(data.HW1, data.HW2) ss.wilcoxon(data.HW1, data.HW5) #build a list of all the HW indices index = [] for i in range(1,7): index.append('HW{}'.format(i)) #access those homeworks and then take the mean along the columns hw_means = data[index].mean(axis=1) plt.plot(hw_means, data.Midterm, 'o') plt.show() ss.spearmanr(hw_means, data.Midterm) np.corrcoef(hw_means, data.Midterm) print('p-value is', (1 - ss.poisson.cdf(14, mu=6.3))) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's tackle the list of cafes first. In the cell below, write some code that creates a list of dictionaries with information about each cafe, assigning it to the variable cafe_list. I've written some of the code for you; you just need to fill in the rest. The list should end up looking like this Step2: Great! In the following cell, write some code that creates a list of cats from the &lt;table&gt; tag on the page, storing them as a list of dictionaries in a variable called cat_list. Again, I've written a bit of the code for you. Expected output Step3: Problem set #2 Step4: Here's a cell you can run if something goes wrong and you need to rollback the current query session Step8: In the cell below, you're going to create three tables, necessary to represent the data you scraped above. I've given the basic framework of the Python code and SQL statements to create these tables. I've given the entire CREATE TABLE statement for the cafe table, but for the other two, you'll need to supply the field names and the data types for each column. If you're unsure what to call the fields, or what fields should be in the tables, consult the queries in "The Queries" below. Hints Step9: After executing the above cell, issuing a \d command in psql should yield something that looks like the following Step10: Issuing SELECT * FROM cafe in the psql client should yield something that looks like this Step11: The dictionary maps the name of the cat cafe to its ID in the database. You'll need these values later when you're adding records to the linking table (cat_cafe). Step12: Issuing a SELECT * FROM cat LIMIT 10 in psql should yield something that looks like this Step14: In which zip codes can I find a lilac-colored tabby? Step16: What's the average weight of cats currently residing at all locations? Step18: Which location has the most cats with tortoiseshell coats?
<ASSISTANT_TASK:> Python Code: from bs4 import BeautifulSoup from urllib.request import urlopen html = urlopen("http://static.decontextualize.com/cats.html").read() document = BeautifulSoup(html, "html.parser") cafe_list = list() cafe_table = document.find('table', {'class': 'cafe-list'}) tbody = cafe_table.find('tbody') for tr_tag in tbody.find_all('tr'): cafe_dict = {} cafe_dict['name'] = str(tr_tag.find('td', {'class': 'name'}).string) cafe_dict['zip'] = str(tr_tag.find('td', {'class': 'zip'}).string) cafe_list.append(cafe_dict) cafe_list cat_list = list() cat_table = document.find('table', {'class': 'cat-list'}) tbody = cat_table.find('tbody') for tr_tag in tbody.find_all('tr'): cat_dict = {} cat_dict['name'] = str(tr_tag.find('td', {'class': 'name'}).string) cat_dict['birthdate'] = str(tr_tag.find('td', {'class': 'birthdate'}).string) cat_dict['weight'] = float(tr_tag.find('td', {'class': 'weight'}).string) cat_dict['color'] = str(tr_tag.find('td', {'class': 'color'}).string) cat_dict['pattern'] = str(tr_tag.find('td', {'class': 'pattern'}).string) cat_dict['locations'] = str(tr_tag.find('td', {'class': 'locations'}).string).split(', ') cat_list.append(cat_dict) cat_list !pip install pg8000 import pg8000 conn = pg8000.connect(database="catcafes", user="rebeccaschuetz") conn.rollback() cursor = conn.cursor() cursor.execute( CREATE TABLE cafe ( id serial, name varchar(40), zip varchar(5) ) ) cursor.execute( CREATE TABLE cat ( id serial, name varchar(20), birthdate varchar(10), weight numeric, color varchar(20), pattern varchar(20) ) ) cursor.execute( CREATE TABLE cat_cafe ( cat_id int, cafe_id int, active boolean ) ) conn.commit() cafe_name_id_map = {} for item in cafe_list: cursor.execute("INSERT INTO cafe (name, zip) VALUES (%s, %s) RETURNING id", [str(item['name']), str(item['zip'])]) rowid = cursor.fetchone()[0] cafe_name_id_map[str(item['name'])] = rowid conn.commit() cafe_name_id_map for cat in cat_list: for location in cat['locations']: if location.endswith('*'): print(location) for kitten in cat_list: cursor.execute("INSERT INTO cat (name, birthdate, weight, color, pattern) VALUES (%s, %s, %s, %s, %s) RETURNING id", [kitten['name'], kitten['birthdate'], kitten['weight'], kitten['color'], kitten['pattern']]) rowid = cursor.fetchone()[0] for location in kitten['locations']: if location.endswith('*'): active_val = True cafe_id_val = cafe_name_id_map[location.replace('*','')] else: active_val = False cafe_id_val = cafe_name_id_map[location] cursor.execute("INSERT INTO cat_cafe (cat_id, cafe_id, active) VALUES (%s, %s, %s)", [rowid, cafe_id_val, active_val]) conn.commit() cursor.execute("SELECT max(birthdate) FROM cat") birthdate = cursor.fetchone()[0] cursor.execute("SELECT name FROM cat WHERE birthdate = %s", [birthdate]) print(cursor.fetchone()[0]) cursor.execute(SELECT DISTINCT(cafe.zip) FROM cat JOIN cat_cafe ON cat.id = cat_cafe.cat_id JOIN cafe ON cafe.id = cat_cafe.cafe_id WHERE cat.color = 'lilac' AND cat.pattern = 'tabby' AND cat_cafe.active = true ) print(', '.join([x[0] for x in cursor.fetchall()])) cursor.execute( SELECT cafe.name, avg(cat.weight) FROM cat JOIN cat_cafe ON cat.id = cat_cafe.cat_id JOIN cafe ON cafe.id = cat_cafe.cafe_id WHERE cat_cafe.active = true GROUP BY cafe.name ) for rec in cursor.fetchall(): print(rec[0]+":", "%0.2f" % rec[1]) cursor.execute( SELECT cafe.name FROM cat JOIN cat_cafe ON cat.id = cat_cafe.cat_id JOIN cafe ON cafe.id = cat_cafe.cafe_id WHERE cat_cafe.active = true AND cat.pattern = 'tortoiseshell' GROUP BY cafe.name ORDER BY count(cat.name) DESC LIMIT 1 ) print(cursor.fetchone()[0]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: As seen, when we assign a lambda expression to a label we can use it. Note that at default lambda expressions return the expected type of whatever it is handling. If you send in a number and do a numerical operation, you will receive back a number, a string a string, etc. Step2: As we can see, the lambda expressions returns the number we expected. How do we return a True or False value? Note Step3: Soon, we will learn about creating our own classes, and eventually data structures. When we learn how to make our own data structures, we'll rewrite what are "conventionally" (take it lightly) known as a "magic methods". These methods are not called upon explicitly, but are triggered by some internal action that Python sees you carried out. For example the + in Python triggers the magic method Step4: Somewhat scrappy, but let's just say it's pretty close to looking like an actual list. Strings are not mutable so we can't just add a bracket at the beginning or right at the end. There are certain ways to make this possible, however. Operations like this are better suited for functions, anyways. Step5: However, we have much more power with the key. The key accepts a form of some type of filter. We can send in a lambda expression to change what sorted means to us. What if we wanted the even numbers to be at the end? Step6: What if we wanted the numbers to be reversed, such as in descending order?
<ASSISTANT_TASK:> Python Code: lambda x,y : x%y length_func = lambda x: len(x) length_func("hello, there!") # Even or Odd lambda even_odd = lambda x: x % 2 == 0 even_odd = lambda x: True if x % 2 == 0 else False even_odd(9) # script that "converts" a tuple to a list some_tup = ("[", 3, 4, "hello", "]") x = lambda tup: ", ".join(str(item) for item in tup) print(x(some_tup)) sorted([4, 2, 8, 5, 2, 9]) sorted([4, 2, 8, 5, 2, 9], key=lambda x: x%2 == 0) sorted([1, 5, 2, 5, 2, 9, 4], reverse=True) lst = [1, 3, 4,5] lst[::-1] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1a. Compute the time steps and a cosine harmonic with the above-defined properties. Step2: 1e. Plot them! Step3: Plot it! Step4: 2c.ii. Sometimes, the detector is on and recording photons, but it's pointed too close to the Earth, or a structure on the spacecraft is occulting part of the view, or the instrument is moving through a zone of high particle background, or other things. The times when these things happen are recorded, and in data reduction you make a list of Good Time Intervals, or GTIs, which is when you can use good science data. I made a list of GTIs for this data file that are longer than 4 seconds long, which you can read in from "J1535_gti.fits". Step6: Plot it! Use similar code I gave you above to make the array of Fourier frequencies and get the index of the Nyquist frequency. Step7: Apply this to the data (using JUST the frequency, power, and error at positive Fourier frequencies). Start with a rebin factor of 1.03.
<ASSISTANT_TASK:> Python Code: a = Table() a.meta['dt'] = 0.0001 # time step, in seconds a.meta['duration'] = 200 # length of time, in seconds a.meta['omega'] = 2*np.pi # angular frequency, in radians a.meta['phi'] = 0.0 # offset angle, in radians freq = fftpack.fftfreq(len(a), d=a.meta['dt']) nyq_ind = int(len(a)/2.) # the index of the last positive Fourier frequency freq = fftpack.fftfreq(len(psd), d=dt) nyq_ind = int(len(psd)/2.) # the index of the last positive Fourier frequency def make_lc(events, start, end, dt): time = np.asarray(j1535['TIME']) ## Doing this so that we can re-run seg_length = 32. # seconds dt = 1./128.# seconds n_bins = int(seg_length/dt) # Number of time bins in a segment of light curve psd_avg = np.zeros(n_bins) # initiating, to keep running sum (then avearge at end) n_seg = 0 for (start_gti, stop_gti) in zip(gti_tab['START'], gti_tab['STOP']): start_time = start_gti end_time = start_time + seg_length while end_time <= stop_gti: ## Make a mask of events in this segment ## Keep the stuff not in this segment for next time ## Make the light curve ## Turn that into a power spectrum ## Keep a running sum (to average at end) ## Print out progress if n_seg % 5 == 0: print(n_seg) ## Incrementing for next loop n_seg += 1 start_time += seg_length end_time += seg_length ## Divide summed powers by n_seg to get the average def rebin(freq, power, err_power, rebin_factor=1.05): Re-bin the power spectrum in frequency space by some re-binning factor (rebin_factor > 1). This is sometimes called 'geometric re-binning' or 'logarithmic re-binning', as opposed to linear re-binning (e.g., grouping by 2) Parameters ---------- freq : np.array of floats 1-D array of the Fourier frequencies. power : np.array of floats 1-D array of the power at each Fourier frequency, with any/arbitrary normalization. err_power : np.array of floats 1-D array of the error on the power at each Fourier frequency, with the same normalization as the power. rebin_factor : float The factor by which the data are geometrically re-binned. Returns ------- rb_freq : np.array of floats 1-D array of the re-binned Fourier frequencies. rb_power : np.array of floats 1-D array of the power at the re-binned Fourier frequencies, with the same normalization as the input power array. rb_err : np.array of floats 1-D array of the error on the power at the re-binned Fourier frequencies, with the same normalization as the input error on power. assert rebin_factor >= 1.0 rb_power = np.asarray([]) # Array of re-binned power rb_freq = np.asarray([]) # Array of re-binned frequencies rb_err = np.asarray([]) # Array of error in re-binned power real_index = 1.0 # The unrounded next index in power int_index = 1 # The int of real_index, added to current_m every iteration current_m = 1 # Current index in power prev_m = 0 # Previous index m ## Loop through the length of the array power, new bin by new bin, to ## compute the average power and frequency of that new geometric bin. while current_m < len(power): return rb_freq, rb_power, rb_err seg_length = 64. # seconds dt = 1./8.# seconds n_bins = int(seg_length/dt) # Number of time bins in a segment of light curve <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Data reading Step2: We extract only the spatial coordinates Step3: Basic plot Step4: We will also indicate Start and End labels at the corresponding locations. Step5: The figure can be improved by adding the landmask and coastline. Step6: then we create the projection, slightly enlarging the longitude extension Step7: The new figure is generated similarly to the previous one Step8: Scatter plot Step9: For the plot, we will keep the same projection.<br/> Step10: We specify the coordinates and the temperature as the arguments of the scatter plot
<ASSISTANT_TASK:> Python Code: %matplotlib inline import netCDF4 import numpy as np import matplotlib as mpl import matplotlib.pyplot as plt from matplotlib import colors from mpl_toolkits.basemap import Basemap datadir = './datafiles/' datafile = 'GL_TS_DC_2300691.nc' with netCDF4.Dataset(datadir + datafile) as nc: lon = nc.variables['LONGITUDE'][:] lat = nc.variables['LATITUDE'][:] mpl.rcParams.update({'font.size': 16}) fig = plt.figure(figsize=(8,8)) ax = plt.subplot(111) plt.plot(lon, lat, 'ko', ms=1) plt.text(lon[0], lat[0], 'Start', fontsize=16) plt.text(lon[-1], lat[-1], 'End', fontsize=16) plt.show() lonmin, lonmax = ax.get_xlim() latmin, latmax = ax.get_ylim() m = Basemap(projection='merc', llcrnrlat=latmin, urcrnrlat=latmax, llcrnrlon=lonmin-5, urcrnrlon=lonmax+5, lat_ts=20, resolution='i') lon2, lat2 = m(lon, lat) fig = plt.figure(figsize=(8,8)) m.plot(lon2, lat2, 'ko', ms=1) m.drawcoastlines(linewidth=0.5, zorder=3) m.fillcontinents(zorder=2) m.drawparallels(np.arange(-90.,91.,5.), labels=[1,0,0,0], zorder=1) m.drawmeridians(np.arange(-180.,181.,5.), labels=[0,1,0,0], zorder=1) plt.show() with netCDF4.Dataset(datadir + datafile) as nc: temperature = nc.variables['TEMP'][:,1] print temperature.shape cmap = plt.cm.Spectral_r norm = colors.Normalize(vmin=26, vmax=29) fig = plt.figure(figsize=(8,8)) m.scatter(lon2, lat2, s=10, c=temperature, edgecolor='None', cmap=cmap, norm=norm) m.drawcoastlines(linewidth=0.5, zorder=3) m.fillcontinents(zorder=2) m.drawparallels(np.arange(-90.,91.,5.), labels=[1,0,0,0], zorder=1) m.drawmeridians(np.arange(-180.,181.,5.), labels=[0,0,1,0], zorder=1) plt.colorbar(extend='both', cmap=cmap, norm=norm) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generating the signal Step2: Now we create the function that will perform the discrete fourier transform. Step3: A look into the mathematical treatment of the DFT should convince you that this is the way to go. Step4: Regenerating the signal Step5: This verifies that the DFT we obtained was correct. Step6: Regenerating the modified signal Step7: Notice that the amplitude of the regenerated signal is a lot less than the original signal. This is attributed to the fact that when you take away the contributions due to certian frequencies, a lesser number of harmonics generate the new signal and this signal has a lower amplitude. Step8: We intend to use recursion as our friend in this one. So we'll define a function which implements this recursion. Why we define the function this particular way will be clear if you look at the mathematical treatment for the optimization of the FFT. Step9: Taking the Fast Fourier Transform Step10: Time Comparison Step11: Fast Fourier Transform
<ASSISTANT_TASK:> Python Code: %pylab inline import scipy.linalg as la def signal(t): return 1-(t-2)**2 if (t<3 and t>1) else 0 num_samples = rows = cols = 2**12 time_list = linspace(0.0001,4,num_samples) signal_list = [signal(time) for time in time_list] plot(time_list,signal_list) def DFT(x,inverse=False): x = asarray(x,dtype=float) n = arange(num_samples) k = n.reshape((num_samples,1)) mat = exp(2j * pi * k *n/num_samples) return dot(la.inv(mat),x) if inverse else dot(mat,x) g = DFT(signal_list) plot(absolute(g)) f = DFT(g,inverse=True) plot(time_list,f.real) g[0] = g[-1] = 0 plot(absolute(g)) f = DFT(g,inverse=True) plot(time_list,f.real) plot(time_list,signal_list) def FFT(x): x = asarray(x,dtype=float) N = x.shape[0] if N == 1: return x else: X_even = FFT(x[0::2]) X_odd = FFT(x[1::2]) factor = exp(-2j * pi * arange(N) / N) return concatenate([X_even + factor[:N / 2] * X_odd, X_even + factor[N / 2:] * X_odd]) h = FFT(signal_list) plot(absolute(h)) %timeit DFT(signal_list) %timeit FFT(signal_list) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: SAM (System for Award Management) - exclusions Step2: There are 8,659 firms on the SAM exclusion list Step3: NPI and CAGE don't seem to be great keys to join the data - ideally we can use SAM Step4: FAPIIS is not bad with 3002 DUNS code but time range goes only from 2012 to 2017 Step5: Which means we're dealing with 49.5M transactions totalling 6.7 trillion dollars. These purchases came from 622k vendors that won 2.2mn solicitations issued by government agencies. Step6: Understanding where the budget is spent Step7: Looking at SMBs by year Step8: SMB contract by gov. agency & by naics code Step9: Simple Linear regression (LR) Step10: LR Step11: MVP Step12: MVP 2 - Collaborative filtering Step13: Worklow 1 Step14: OTHERS - FROM TUTORIAL - Anton Tarasenko Step15: You can find agencies that buy products like yours. If it's "software" Step16: What Firms in Your Industry Sell to the Government Step17: Inspecting Specific Transactions Step18: Alternatively, specify vendors your product relates to and check how the government uses it. Top deals in data analytics Step19: Searching Through Descriptions Step20: Some rows of descriptionofcontractrequirement contain codes like "IGF Step21: Facts about Government Contracting Step22: The median shows the most likely supplier. Agencies on the top of the table actively employ vendors whose annual revenue is less than $1mn. Step23: Women-owned businesses make about one tenth of the transactions, but their share in terms of sales is only 3.7%. Step24: For example, firms owned by women, veterans, and minorities (all represented at the same time) sell $5bn in goods and services. That's 0.07% of all government purchases.
<ASSISTANT_TASK:> Python Code: import google.datalab.bigquery as bq import pandas as pd import matplotlib.pyplot as plt import numpy as np import scipy as sp from sklearn.linear_model import LinearRegression from sklearn.preprocessing import LabelEncoder from sklearn.preprocessing import OneHotEncoder from sklearn import cross_validation as cv from sklearn.metrics.pairwise import pairwise_distances from sklearn.metrics import mean_squared_error from math import sqrt %%sql select * from [fiery-set-171213:vrec.sam_exclusions] limit 5 %%sql select Exclusion_Type from [fiery-set-171213:vrec.sam_exclusions] group by 1; %%sql select Classification from [fiery-set-171213:vrec.sam_exclusions] group by 1; %%sql select count(*) from [fiery-set-171213:vrec.sam_exclusions] where Classification in ('Firm') ; %%bq query -n df_query select EXTRACT(YEAR FROM Active_Date) as year, count(*) as count from `fiery-set-171213.vrec.sam_exclusions` where Classification in ('Firm') and Active_Date is not NULL group by 1 order by 1; df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() ax = df.plot(kind='bar', x='year', title='Excluded Firms per year', figsize=(15,8)) ax.set_xlabel('Year') ax.set_ylabel('count') %%bq query select #Name, SAM_Number, count(*) as count from `fiery-set-171213.vrec.sam_exclusions` where Classification in ('Firm') #and Active_Date is not NULL group by 1 order by 2 DESC limit 5; %%bq query select NPI, count(*) as count from `fiery-set-171213.vrec.sam_exclusions` where Classification in ('Firm') #and CAGE is not NULL group by 1 order by 2 DESC limit 5; %%bq query select CAGE, count(*) as count from `fiery-set-171213.vrec.sam_exclusions` where Classification in ('Firm') #and CAGE is not NULL group by 1 order by 2 DESC limit 5; %%bq query select * from `fiery-set-171213.vrec.fapiis` limit 5 %%bq query -n df_query select EXTRACT(YEAR FROM RECORD_DATE) as year, count(*) as count from `fiery-set-171213.vrec.fapiis` group by 1 order by 1; df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() ax = df.plot(kind='bar', x='year', title='Firms by Record date', figsize=(10,5)) ax.set_xlabel('Year') ax.set_ylabel('count') %%bq query -n df_query select EXTRACT(YEAR FROM TERMINATION_DATE) as year, count(*) as count from `fiery-set-171213.vrec.fapiis` group by 1 order by 1; df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() ax = df.plot(kind='bar', x='year', title='Firms by termination date', figsize=(10,5)) ax.set_xlabel('Year') ax.set_ylabel('count') %%bq query select AWARDEE_NAME, DUNS, count(*) as count from `fiery-set-171213.vrec.fapiis` group by 1,2 order by 3 DESC limit 5; %%bq query select * from `fiery-set-171213.vrec.fapiis` where AWARDEE_NAME in ('ALPHA RAPID ENGINEERING SOLUTIONS') limit 5; %%bq query select RECORD_TYPE, count(*) as count from `fiery-set-171213.vrec.fapiis` group by 1 order by 2 DESC %%bq query -n df_query select count(*) as transactions from `fiery-set-171213.vrec.usa_spending_all` df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() df.head() %%bq query select * from `fiery-set-171213.vrec.usa_spending_all` where mod_agency in ('1700: DEPT OF THE NAVY') limit 5 %%bq query -n df_query select #substr(signeddate, 1, 2) month, fiscal_year as year, count(*) transactions, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` group by year order by year asc df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() ax = df.set_index('year')['dollarsobligated'].plot(kind='bar', title='Government purchases by years') ax.set_ylabel('dollars obligated') %%bq query -n df_query select fiscal_year as year, sum(dollarsobligated)/count(*) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` group by year order by year asc df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() ax = df.set_index('year')['dollarsobligated'].plot(kind='bar', title='avg. transaction size by years') ax.set_ylabel('dollars obligated') %%bq query select maj_agency_cat, mod_agency, count(*) from `fiery-set-171213.vrec.usa_spending_all` group by 1,2 order by 3 DESC limit 20 %%bq query select mod_parent, vendorname, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` group by 1,2 order by 3 DESC limit 20 %%bq query select productorservicecode, systemequipmentcode, claimantprogramcode, principalnaicscode, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where vendorname in ('LOCKHEED MARTIN CORPORATION') group by 1,2,3,4 order by 5 DESC limit 20 %%bq query select #mod_parent, vendorname, systemequipmentcode, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where productorservicecode in ('1510: AIRCRAFT, FIXED WING') group by 1,2 order by 3 DESC limit 20 %%bq query select vendorname, systemequipmentcode, claimantprogramcode, principalnaicscode, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where productorservicecode in ('1510: AIRCRAFT, FIXED WING') and contractingofficerbusinesssizedetermination in ('S: SMALL BUSINESS') group by 1,2,3,4 order by dollarsobligated DESC limit 20 %%bq query select * from `gpqueries.contracts.raw` where productorservicecode in ('1510: AIRCRAFT, FIXED WING') and contractingofficerbusinesssizedetermination in ('S: SMALL BUSINESS') limit 1 %%bq query select claimantprogramcode, principalnaicscode, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where contractingofficerbusinesssizedetermination in ("S: SMALL BUSINESS") group by 1,2 order by dollarsobligated DESC limit 10 %%bq query -n df_query select fiscal_year, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where contractingofficerbusinesssizedetermination in ("S: SMALL BUSINESS") group by 1 order by 1 df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() plt = df.set_index('fiscal_year')['dollarsobligated'].plot(kind='bar', title='transactions amount for SMBs') %%bq query -n df_query #%%sql select smb.fiscal_year, sum(smb.transaction) as smb, sum(total.transaction) as total, sum(smb.transaction)/sum(total.transaction) as percentage from (select fiscal_year, sum(dollarsobligated) as transaction from `fiery-set-171213.vrec.usa_spending_all` where contractingofficerbusinesssizedetermination in ("S: SMALL BUSINESS") group by 1) as smb join (select fiscal_year, sum(dollarsobligated) as transaction from `fiery-set-171213.vrec.usa_spending_all` group by 1) as total on smb.fiscal_year = total.fiscal_year group by 1 order by 1 df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() plt = df.set_index('fiscal_year')['percentage'].plot(kind='bar', title='dollars % for SMBs') %%bq query select smb.principalnaicscode as principalnaicscode, sum(total.count) as count, sum(smb.dollarsobligated) as dollarsobligated_smb, sum(total.dollarsobligated) as dollarsobligated_total, sum(smb.dollarsobligated)/sum(total.dollarsobligated) as smb_percentage from (select principalnaicscode, count(*) as count, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where contractingofficerbusinesssizedetermination in ("S: SMALL BUSINESS") group by 1) as smb join (select principalnaicscode, count(*) as count, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` group by 1 having dollarsobligated > 0 ) as total on smb.principalnaicscode = total.principalnaicscode group by 1 order by 5 DESC limit 10 %%bq query -n df_query select maj_agency_cat, #mod_agency, #contractactiontype, #typeofcontractpricing, #performancebasedservicecontract, state, #vendorcountrycode, #principalnaicscode, contractingofficerbusinesssizedetermination, #sum(dollarsobligated) as dollarsobligated dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where vendorcountrycode in ('UNITED STATES', 'USA: UNITED STATES OF AMERICA') and contractingofficerbusinesssizedetermination in ('O: OTHER THAN SMALL BUSINESS', 'S: SMALL BUSINESS') and dollarsobligated > 0 #group by 1,2,3 limit 20000 df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() df.head() # Create dummy variable using pandas function get_dummies df1 = df.join(pd.get_dummies(df['maj_agency_cat'])) df1 = df1.join(pd.get_dummies(df['state'])) df1 = df1.join(pd.get_dummies(df['contractingofficerbusinesssizedetermination'])) df1 = df1.drop('maj_agency_cat', axis = 1) df1 = df1.drop('state', axis = 1) df1 = df1.drop('contractingofficerbusinesssizedetermination', axis = 1) df1.head() train_data = df1.iloc[:,1:] train_labels = df[['dollarsobligated']] lm = LinearRegression() lm.fit(train_data, train_labels) # The coefficients print('Coefficients: \n', lm.coef_) # The mean squared error print("Mean squared error: %.2f" % np.mean((lm.predict(train_data) - train_labels) ** 2)) # Explained variance score: 1 is perfect prediction print('Variance score: %.2f' % lm.score(train_data, train_labels)) %%bq query -n df_query select vendorname, maj_agency_cat, state, contractingofficerbusinesssizedetermination, count(*) as count, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` where vendorcountrycode in ('UNITED STATES', 'USA: UNITED STATES OF AMERICA') and contractingofficerbusinesssizedetermination in ('O: OTHER THAN SMALL BUSINESS', 'S: SMALL BUSINESS') and dollarsobligated > 0 group by 1,2,3,4 limit 20000 df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() df.head() #Create dummy variable using pandas function get_dummies df1 = df.join(pd.get_dummies(df['maj_agency_cat'])) df1 = df1.join(pd.get_dummies(df['state'])) df1 = df1.join(pd.get_dummies(df['contractingofficerbusinesssizedetermination'])) df1 = df1.drop('maj_agency_cat', axis = 1) df1 = df1.drop('state', axis = 1) df1 = df1.drop('contractingofficerbusinesssizedetermination', axis = 1) df1 = df1.drop('vendorname', axis = 1) df1 = df1.drop('dollarsobligated', axis = 1) train_data = df1.iloc[:,1:] train_labels = df[['count']] lm = LinearRegression() lm.fit(train_data, train_labels) # The coefficients print('Coefficients: \n', lm.coef_) # The mean squared error print("Mean squared error: %.2f" % np.mean((lm.predict(train_data) - train_labels) ** 2)) # Explained variance score: 1 is perfect prediction print('Variance score: %.2f' % lm.score(train_data, train_labels)) %%bq query select #principalnaicscode, fiscal_year, maj_agency_cat, #contractingofficerbusinesssizedetermination, #vendorname, productorservicecode, count(*) as count, sum(dollarsobligated) as dollarsobligated from `fiery-set-171213.vrec.usa_spending_all` #where contractingofficerbusinesssizedetermination in ("S: SMALL BUSINESS") #where regexp_contains(principalnaicscode, "CONSTRUCTION") #and regexp_contains(maj_agency_cat, "AGRICULTURE") where regexp_contains(productorservicecode, "MEAT") #and fiscal_year = 2016 group by 1,2,3 order by dollarsobligated DESC limit 10 %%bq query -n df_query select contractingofficerbusinesssizedetermination, mod_agency, vendorname, count(*) as count from `fiery-set-171213.vrec.usa_spending_all` where vendorcountrycode in ('UNITED STATES', 'USA: UNITED STATES OF AMERICA') and contractingofficerbusinesssizedetermination in ('O: OTHER THAN SMALL BUSINESS', 'S: SMALL BUSINESS') and mod_agency not in ("") group by 1,2,3 order by count DESC limit 20000 df = df_query.execute(output_options=bq.QueryOutput.dataframe()).result() df.head() df1 = df.drop('contractingofficerbusinesssizedetermination', axis = 1) n_agency = df1.mod_agency.unique().shape[0] n_vendors = df1.vendorname.unique().shape[0] print 'Number of gov agency = ' + str(n_agency) + ' | Number of vendors = ' + str(n_vendors) # Convert categorial value with label encoding le_agency = LabelEncoder() label_agency = le_agency.fit_transform(df1['mod_agency']) le_vendor = LabelEncoder() label_vendor = le_vendor.fit_transform(df1['vendorname']) df_agency = pd.DataFrame(label_agency) df_vendor = pd.DataFrame(label_vendor) df2 = pd.concat([df_agency, df_vendor], axis = 1) df2 = pd.concat([df2, df1['count']], axis = 1) df2.columns = ['mod_agency', 'vendorname', 'count'] df2.head(5) # To ge the right label back # le_agency.inverse_transform([173, 100]) # Split into training and test data set train_data, test_data = cv.train_test_split(df2, test_size=0.25) #Build the matrix train_data_matrix = np.zeros((n_agency, n_vendors)) for line in train_data.itertuples(): train_data_matrix[line[1]-1, line[2]-1] = line[3] test_data_matrix = np.zeros((n_agency, n_vendors)) for line in test_data.itertuples(): test_data_matrix[line[1]-1, line[2]-1] = line[3] #Compute cosine distance user_similarity = pairwise_distances(train_data_matrix, metric='cosine') item_similarity = pairwise_distances(train_data_matrix.T, metric='cosine') def predict(ratings, similarity, type='user'): if type == 'user': mean_user_rating = ratings.mean(axis=1) #You use np.newaxis so that mean_user_rating has same format as ratings ratings_diff = (ratings - mean_user_rating[:, np.newaxis]) pred = mean_user_rating[:, np.newaxis] + similarity.dot(ratings_diff) / np.array([np.abs(similarity).sum(axis=1)]).T elif type == 'item': pred = ratings.dot(similarity) / np.array([np.abs(similarity).sum(axis=1)]) return pred item_prediction = predict(train_data_matrix, item_similarity, type='item') user_prediction = predict(train_data_matrix, user_similarity, type='user') # Evaluation def rmse(prediction, ground_truth): prediction = prediction[ground_truth.nonzero()].flatten() ground_truth = ground_truth[ground_truth.nonzero()].flatten() #filter out all items with no 0 as we only want to predict in the test set return sqrt(mean_squared_error(prediction, ground_truth)) print 'User-based CF RMSE: ' + str(rmse(user_prediction, test_data_matrix)) print 'Item-based CF RMSE: ' + str(rmse(item_prediction, test_data_matrix)) print 'Worklow 1' print '=' * 100 print 'Select your agency:' agency = df1['mod_agency'][1] print agency print '=' * 100 print '1. Have you considered working with these SMB companies (user prediction?' agency = le_agency.transform(agency) vendor_reco = pd.DataFrame(user_prediction[agency, :]) labels = pd.DataFrame(le_vendor.inverse_transform(range(0, len(vendor_reco)))) df_reco = pd.concat([vendor_reco, labels], axis = 1) df_reco.columns = ['reco_score', 'vendorname'] #Join to get the SMB list df_smb = df.drop(['mod_agency', 'count'], axis = 1) df_reco = df_reco.set_index('vendorname').join(df_smb.set_index('vendorname')) df_reco = df_reco.sort_values(['reco_score'], ascending = [0]) df_reco[df_reco['contractingofficerbusinesssizedetermination'] == 'S: SMALL BUSINESS'].head(10) print '=' * 100 print '2. Have you considered working with these SMB companies (item-item prediction?' vendor_reco = pd.DataFrame(item_prediction[agency, :]) df_reco = pd.concat([vendor_reco, labels], axis = 1) df_reco.columns = ['reco_score', 'vendorname'] df_reco = df_reco.set_index('vendorname').join(df_smb.set_index('vendorname')) df_reco = df_reco.sort_values(['reco_score'], ascending = [0]) df_reco[df_reco['contractingofficerbusinesssizedetermination'] == 'S: SMALL BUSINESS'].head(10) print 'Worklow 2' print '=' * 100 print 'Select a vendor:' # Workflow 2 - WIP # Select a vendor # Other similar vendor %%sql select substr(productorservicecode, 1, 4) product_id, first(substr(productorservicecode, 7)) product_name, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw group by product_id order by sum_dollarsobligated desc limit 10 %%sql select substr(agencyid, 1, 4) agency_id, first(substr(agencyid, 7)) agency_name, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw where productorservicecode contains 'software' group by agency_id order by sum_dollarsobligated desc ignore case %%sql select substr(agencyid, 1, 4) agency_id, first(substr(agencyid, 7)) agency_name, substr(principalnaicscode, 1, 6) naics_id, first(substr(principalnaicscode, 9)) naics_name, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw where principalnaicscode contains 'software' and fiscal_year = 2015 group by agency_id, naics_id order by sum_dollarsobligated desc ignore case %%sql select fiscal_year, dollarsobligated, vendorname, city, state, annualrevenue, numberofemployees, descriptionofcontractrequirement from gpqueries:contracts.raw where agencyid contains 'transportation security administration' and principalnaicscode contains 'computer and software stores' ignore case %%sql select agencyid, dollarsobligated, vendorname, descriptionofcontractrequirement from gpqueries:contracts.raw where vendorname contains 'tableau' or vendorname contains 'socrata' or vendorname contains 'palantir' or vendorname contains 'revolution analytics' or vendorname contains 'mathworks' or vendorname contains 'statacorp' or vendorname contains 'mathworks' order by dollarsobligated desc limit 100 ignore case %%sql select agencyid, dollarsobligated, descriptionofcontractrequirement from gpqueries:contracts.raw where descriptionofcontractrequirement contains 'body camera' limit 100 ignore case %%sql select substr(pop_state_code, 1, 2) state_code, first(substr(pop_state_code, 4)) state_name, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw group by state_code order by sum_dollarsobligated desc %%sql --module gpq define query vendor_size_by_agency select substr(agencyid, 1, 4) agency_id, first(substr(agencyid, 7)) agency_name, nth(11, quantiles(annualrevenue, 21)) vendor_median_annualrevenue, nth(11, quantiles(numberofemployees, 21)) vendor_median_numberofemployees, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw group by agency_id having transactions > 1000 and sum_dollarsobligated > 10e6 order by vendor_median_annualrevenue asc bq.Query(gpq.vendor_size_by_agency).to_dataframe() %%sql select womenownedflag, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw group by womenownedflag %%sql select womenownedflag, veteranownedflag, minorityownedbusinessflag, count(*) transactions, sum(dollarsobligated) sum_dollarsobligated from gpqueries:contracts.raw group by womenownedflag, veteranownedflag, minorityownedbusinessflag order by womenownedflag, veteranownedflag, minorityownedbusinessflag desc %%sql select sum(if(before2015.dunsnumber is null, 1, 0)) new_vendors, sum(if(before2015.dunsnumber is null, 0, 1)) old_vendors from flatten((select unique(dunsnumber) dunsnumber from gpqueries:contracts.raw where fiscal_year = 2015), dunsnumber) in2015 left join flatten((select unique(dunsnumber) dunsnumber from gpqueries:contracts.raw where fiscal_year < 2015), dunsnumber) before2015 on before2015.dunsnumber = in2015.dunsnumber <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Overview Step2: Load the Data Step3: Preprocess the Data Step4: Normalize the features Step5: One-Hot Encode the labels Step6: Keras Sequential Model Step7: Training a Sequential Model Step8: Convolutions Step9: Pooling Step10: Dropout Step11: Optimization Step12: Best Validation Accuracy
<ASSISTANT_TASK:> Python Code: from urllib.request import urlretrieve from os.path import isfile from tqdm import tqdm class DLProgress(tqdm): last_block = 0 def hook(self, block_num=1, block_size=1, total_size=None): self.total = total_size self.update((block_num - self.last_block) * block_size) self.last_block = block_num if not isfile('train.p'): with DLProgress(unit='B', unit_scale=True, miniters=1, desc='Train Dataset') as pbar: urlretrieve( 'https://s3.amazonaws.com/udacity-sdc/datasets/german_traffic_sign_benchmark/train.p', 'train.p', pbar.hook) if not isfile('test.p'): with DLProgress(unit='B', unit_scale=True, miniters=1, desc='Test Dataset') as pbar: urlretrieve( 'https://s3.amazonaws.com/udacity-sdc/datasets/german_traffic_sign_benchmark/test.p', 'test.p', pbar.hook) print('Training and Test data downloaded.') import pickle import numpy as np import math # Fix error with TF and Keras import tensorflow as tf tf.python.control_flow_ops = tf print('Modules loaded.') with open('train.p', 'rb') as f: data = pickle.load(f) # TODO: Load the feature data to the variable X_train X_train = data['features'] # TODO: Load the label data to the variable y_train y_train = data['labels'] # STOP: Do not change the tests below. Your implementation should pass these tests. assert np.array_equal(X_train, data['features']), 'X_train not set to data[\'features\'].' assert np.array_equal(y_train, data['labels']), 'y_train not set to data[\'labels\'].' print('Tests passed.') # TODO: Shuffle the data from sklearn.utils import shuffle X_train, y_train = shuffle(X_train, y_train) # STOP: Do not change the tests below. Your implementation should pass these tests. assert X_train.shape == data['features'].shape, 'X_train has changed shape. The shape shouldn\'t change when shuffling.' assert y_train.shape == data['labels'].shape, 'y_train has changed shape. The shape shouldn\'t change when shuffling.' assert not np.array_equal(X_train, data['features']), 'X_train not shuffled.' assert not np.array_equal(y_train, data['labels']), 'y_train not shuffled.' print('Tests passed.') # TODO: Normalize the data features to the variable X_normalized def normalize(image_data): a = -0.5 b = 0.5 color_min = 0.0 color_max = 255.0 return a + ( ( (image_data - color_min) * (b - a) )/(color_max - color_min)) X_normalized = normalize(X_train) # STOP: Do not change the tests below. Your implementation should pass these tests. assert math.isclose(np.min(X_normalized), -0.5, abs_tol=1e-5) and math.isclose(np.max(X_normalized), 0.5, abs_tol=1e-5), 'The range of the training data is: {} to {}. It must be -0.5 to 0.5'.format(np.min(X_normalized), np.max(X_normalized)) print('Tests passed.') # TODO: One Hot encode the labels to the variable y_one_hot from sklearn.preprocessing import LabelBinarizer label_binarizer = LabelBinarizer() y_one_hot = label_binarizer.fit_transform(y_train) # STOP: Do not change the tests below. Your implementation should pass these tests. import collections assert y_one_hot.shape == (39209, 43), 'y_one_hot is not the correct shape. It\'s {}, it should be (39209, 43)'.format(y_one_hot.shape) assert next((False for y in y_one_hot if collections.Counter(y) != {0: 42, 1: 1}), True), 'y_one_hot not one-hot encoded.' print('Tests passed.') from keras.models import Sequential from keras.layers.core import Dense, Activation, Flatten model = Sequential() # TODO: Build a Multi-layer feedforward neural network with Keras here. # 1st Layer - Add a flatten layer model.add(Flatten(input_shape=(32, 32, 3))) # 2nd Layer - Add a Dense layer model.add(Dense(128)) # 3rd Layer - Add a ReLU activation layer model.add(Activation('relu')) # 4th Layer - Add a fully connected layer model.add(Dense(43)) # 5th Layer - Add a softmax activation layer model.add(Activation('softmax')) # STOP: Do not change the tests below. Your implementation should pass these tests. from keras.layers.core import Dense, Activation, Flatten from keras.activations import relu, softmax def check_layers(layers, true_layers): assert len(true_layers) != 0, 'No layers found' for layer_i in range(len(layers)): assert isinstance(true_layers[layer_i], layers[layer_i]), 'Layer {} is not a {} layer'.format(layer_i+1, layers[layer_i].__name__) assert len(true_layers) == len(layers), '{} layers found, should be {} layers'.format(len(true_layers), len(layers)) check_layers([Flatten, Dense, Activation, Dense, Activation], model.layers) assert model.layers[0].input_shape == (None, 32, 32, 3), 'First layer input shape is wrong, it should be (32, 32, 3)' assert model.layers[1].output_shape == (None, 128), 'Second layer output is wrong, it should be (128)' assert model.layers[2].activation == relu, 'Third layer not a relu activation layer' assert model.layers[3].output_shape == (None, 43), 'Fourth layer output is wrong, it should be (43)' assert model.layers[4].activation == softmax, 'Fifth layer not a softmax activation layer' print('Tests passed.') # TODO: Compile and train the model here. # Configures the learning process and metrics model.compile('adam', 'categorical_crossentropy', ['accuracy']) # Train the model # History is a record of training loss and metrics history = model.fit(X_normalized, y_one_hot, batch_size=128, nb_epoch=10, validation_split=0.2) # STOP: Do not change the tests below. Your implementation should pass these tests. from keras.optimizers import Adam assert model.loss == 'categorical_crossentropy', 'Not using categorical_crossentropy loss function' assert isinstance(model.optimizer, Adam), 'Not using adam optimizer' assert len(history.history['acc']) == 10, 'You\'re using {} epochs when you need to use 10 epochs.'.format(len(history.history['acc'])) assert history.history['acc'][-1] > 0.92, 'The training accuracy was: %.3f. It shoud be greater than 0.92' % history.history['acc'][-1] assert history.history['val_acc'][-1] > 0.85, 'The validation accuracy is: %.3f. It shoud be greater than 0.85' % history.history['val_acc'][-1] print('Tests passed.') # TODO: Re-construct the network and add a convolutional layer before the flatten layer. from keras.layers import Convolution2D nb_filters = 32 kernel_size = [3, 3] model = Sequential() #Add a convolutional layer with 32 filters, a 3x3 kernel, and valid padding before the flatten layer. model.add(Convolution2D(nb_filters, kernel_size[0], kernel_size[1], border_mode='valid', input_shape=(32, 32, 3))) #Add a ReLU activation after the convolutional layer. model.add(Activation('relu')) # 1st Layer - Add a flatten layer model.add(Flatten()) # 2nd Layer - Add a Dense layer model.add(Dense(128)) # 3rd Layer - Add a ReLU activation layer model.add(Activation('relu')) # 4th Layer - Add a fully connected layer model.add(Dense(43)) # 5th Layer - Add a softmax activation layer model.add(Activation('softmax')) # STOP: Do not change the tests below. Your implementation should pass these tests. from keras.layers.core import Dense, Activation, Flatten from keras.layers.convolutional import Convolution2D check_layers([Convolution2D, Activation, Flatten, Dense, Activation, Dense, Activation], model.layers) assert model.layers[0].input_shape == (None, 32, 32, 3), 'First layer input shape is wrong, it should be (32, 32, 3)' assert model.layers[0].nb_filter == 32, 'Wrong number of filters, it should be 32' assert model.layers[0].nb_col == model.layers[0].nb_row == 3, 'Kernel size is wrong, it should be a 3x3' assert model.layers[0].border_mode == 'valid', 'Wrong padding, it should be valid' model.compile('adam', 'categorical_crossentropy', ['accuracy']) history = model.fit(X_normalized, y_one_hot, batch_size=128, nb_epoch=2, validation_split=0.2) assert(history.history['val_acc'][-1] > 0.91), "The validation accuracy is: %.3f. It should be greater than 0.91" % history.history['val_acc'][-1] print('Tests passed.') # TODO: Re-construct the network and add a pooling layer after the convolutional layer. from keras.layers import MaxPooling2D pool_size = [2, 2] model = Sequential() #Add a convolutional layer with 32 filters, a 3x3 kernel, and valid padding before the flatten layer. model.add(Convolution2D(nb_filters, kernel_size[0], kernel_size[1], border_mode='valid', input_shape=(32, 32, 3))) #Add a 2x2 max pooling layer immediately following your convolutional layer. model.add(MaxPooling2D(pool_size=pool_size)) #Add a ReLU activation after the convolutional layer. model.add(Activation('relu')) # 1st Layer - Add a flatten layer model.add(Flatten()) # 2nd Layer - Add a Dense layer model.add(Dense(128)) # 3rd Layer - Add a ReLU activation layer model.add(Activation('relu')) # 4th Layer - Add a fully connected layer model.add(Dense(43)) # 5th Layer - Add a softmax activation layer model.add(Activation('softmax')) # STOP: Do not change the tests below. Your implementation should pass these tests. from keras.layers.core import Dense, Activation, Flatten from keras.layers.convolutional import Convolution2D from keras.layers.pooling import MaxPooling2D check_layers([Convolution2D, MaxPooling2D, Activation, Flatten, Dense, Activation, Dense, Activation], model.layers) assert model.layers[1].pool_size == (2, 2), 'Second layer must be a max pool layer with pool size of 2x2' model.compile('adam', 'categorical_crossentropy', ['accuracy']) history = model.fit(X_normalized, y_one_hot, batch_size=128, nb_epoch=2, validation_split=0.2) assert(history.history['val_acc'][-1] > 0.91), "The validation accuracy is: %.3f. It should be greater than 0.91" % history.history['val_acc'][-1] print('Tests passed.') # TODO: Re-construct the network and add dropout after the pooling layer. from keras.layers import Dropout model = Sequential() #Add a convolutional layer with 32 filters, a 3x3 kernel, and valid padding before the flatten layer. model.add(Convolution2D(nb_filters, kernel_size[0], kernel_size[1], border_mode='valid', input_shape=(32, 32, 3))) #Add a 2x2 max pooling layer immediately following your convolutional layer. model.add(MaxPooling2D(pool_size=pool_size)) #Add a dropout layer after the pooling layer. Set the dropout rate to 50%. model.add(Dropout(0.5)) #Add a ReLU activation after the convolutional layer. model.add(Activation('relu')) # 1st Layer - Add a flatten layer model.add(Flatten()) # 2nd Layer - Add a Dense layer model.add(Dense(128)) # 3rd Layer - Add a ReLU activation layer model.add(Activation('relu')) # 4th Layer - Add a fully connected layer model.add(Dense(43)) # 5th Layer - Add a softmax activation layer model.add(Activation('softmax')) # STOP: Do not change the tests below. Your implementation should pass these tests. from keras.layers.core import Dense, Activation, Flatten, Dropout from keras.layers.convolutional import Convolution2D from keras.layers.pooling import MaxPooling2D check_layers([Convolution2D, MaxPooling2D, Dropout, Activation, Flatten, Dense, Activation, Dense, Activation], model.layers) assert model.layers[2].p == 0.5, 'Third layer should be a Dropout of 50%' model.compile('adam', 'categorical_crossentropy', ['accuracy']) history = model.fit(X_normalized, y_one_hot, batch_size=128, nb_epoch=2, validation_split=0.2) assert(history.history['val_acc'][-1] > 0.91), "The validation accuracy is: %.3f. It should be greater than 0.91" % history.history['val_acc'][-1] print('Tests passed.') # TODO: Build a model model = Sequential() model.add(Convolution2D(nb_filters, kernel_size[0], kernel_size[1], border_mode='valid', input_shape=(32, 32, 3))) model.add(Activation('relu')) model.add(Convolution2D(nb_filters, kernel_size[0], kernel_size[1])) model.add(Activation('relu')) model.add(MaxPooling2D(pool_size=pool_size)) model.add(Dropout(0.25)) model.add(Flatten()) model.add(Dense(128)) model.add(Activation('relu')) model.add(Dropout(0.5)) model.add(Dense(43)) model.add(Activation('softmax')) # TODO: Compile and train the model model.compile('adam', 'categorical_crossentropy', ['accuracy']) history = model.fit(X_normalized, y_one_hot, batch_size=128, nb_epoch=10, validation_split=0.2) # TODO: Load test data with open('test.p', 'rb') as f: samples = pickle.load(f) X_test = samples['features'] y_test = samples['labels'] # TODO: Preprocess data & one-hot encode the labels X_test, y_test = shuffle(X_test, y_test) X_test = normalize(X_test) label_binarizer = LabelBinarizer() y_one_hot = label_binarizer.fit_transform(y_test) # TODO: Evaluate model on test data score = model.evaluate(X_test, y_one_hot, verbose=0) print('Test score:', score[0]) print('Test accuracy:', score[1]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Checking this answer with Wolfram Alpha, we get approximately the same result Step2: From the above figure, we can see that the maximum is about 15. But what if we decided not to plot the function? Consider a situation where it's computationally expensive to plot the function over the entire limits of the integral. It's okay for us to choose an f_max that is too large, as long as we are sure that all possible values of F(x) will fall below it. The only downside of this approach is that more histories are required to converge to the correct answer. Step3: Again, we check our work with Wolfram Alpha, and we get approximately the same result
<ASSISTANT_TASK:> Python Code: import random from numba import jit import numpy as np # Monte Carlo simulation function. This is defined as # a function so the numba library can be used to speed # up execution. Otherwise, this would run much slower. @jit def MCHist(n_hist, a, b, fmax): score = (b - a)*fmax tot_score = 0 for n in range(1, n_hist): x = random.uniform(a, b) f = random.uniform(0, fmax) f_x = np.exp(x**2) # Check if the point falls inside the integral if f < f_x: tot_score += score return tot_score # Run the simulation num_hist = 1e8 results = MCHist(num_hist, 0.0, 2.0, 54.6) integral_val = round(results / num_hist, 6) print("The calculated integral is {}".format(integral_val)) import matplotlib.pyplot as plt %matplotlib inline x = np.linspace(1,4,1000) y = (np.exp(x)/x) + np.exp(1/x) plt.plot(x,y) plt.ylabel('F(x)') plt.xlabel('x'); @jit def MCHist2(n_hist, a, b, fmax): score = (b - a)*fmax tot_score = 0 for n in range(1, n_hist): x = random.uniform(a, b) f = random.uniform(0, fmax) f_x = (np.exp(x)/x) + np.exp(1/x) # Check if the point falls inside the integral if f < f_x: tot_score += score return tot_score # Run the simulation num_hist2 = 1e8 results2 = MCHist2(num_hist2, 1.0, 4.0, 100) integral_val2 = round(results2 / num_hist2, 6) print("The calculated integral is {}".format(integral_val2)) num_hist3 = 1e8 results3 = MCHist2(num_hist2, 1.0, 4.0, 15) integral_val3 = round(results3 / num_hist3, 6) print("The calculated integral is {}".format(integral_val3)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Para fixar as ideias, vamos continuar trabalhando com a função Step2: Derivadas Step3: Para avaliar a derivada em um ponto, por exemplo, para calcular $f'(1)$, digitamos Step4: Exercício Step5: Retas Tangente Step6: Agora, já podemos definir a reta tangente Step7: Vejamos os gráficos de $f(x)$ e da reta tangente calculada. Step8: $\blacktriangleleft$ Step9: Derivadas de ordem mais altas Step10: Exercício Step11: Máximos e Mínimos Locais Step12: Observando os gráficos, vemos que os pontos críticos de $f(x)$ têm máximos locais próximos ao ponto $x=-1$ e $x=10$ e um mínimo local próximo do ponto $x=1$. Logo, podemos usar estes valores como parâmetro da função $\verb+nsolve+$ Step13: Ok. Acamos de encontrar os pontos críticos de $f(x)$ (podem haver outros pontos críticos?). Por inspesão gráfica, vemos que $x_1 \approx -1,15$ e $x_3 \approx 12,15$ são os pontos de máximos locais de $f(x)$ e $x_3 = 1,0$ é o ponto de mínimo (global?). Step14: Exercício
<ASSISTANT_TASK:> Python Code: from __future__ import division from sympy import * init_printing() x, y = symbols('x y') #define x e y como variáveis simbólicas. def f(x): return (x**3 - 3*x + 2)*exp(-x/4) - 1 f(x) diff(f(x),x) diff(f(x),x).subs(x,1) #digite sua solução aqui! x0 = -1/2 fl = diff(f(x),x).subs(x,-0.5) #f'(x_0) print("coef. angular = ") fl def r(x) : return fl*(x-x0) + f(x0) print("equação da reta tangente y=") r(x) %matplotlib inline p1 = plot(f(x),(x,-2,2),show=False,line_color='b') p2 = plot(r(x),(x,-1.5,1),show=False,line_color='r') p1.extend(p2) p1.show() #digite a resolução aqui. diff(f(x),x,2) #digite sua resposta aqui! plot(f(x),(x,-2,2)) plot(f(x),(x,2,40)) plot(f(x),(x,40,60)) fl = diff(f(x),x) #calcula $f'(x)$ x1 = nsolve(fl,x,-1) #calcula ponto crítico próx. de x=-1 x2 = nsolve(fl,x,1) #calcula ponto crítico próx. de x=1 x3 = nsolve(fl,x,10) #calcula ponto crítico próx. de x=10 print("x1=",x1) print("x2=",x2) print("x3=",x3) diff(f(x),x,2).subs(x,x1) #calcula f''(x1) diff(f(x),x,2).subs(x,x2) #calcula f''(x2) diff(f(x),x,2).subs(x,x3) #calcula f''(x3) #digite sua solução aqui! <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The first two are for sampling; the third is for measuring the motif IC in order to validate our results. Let's also set up plotting for our notebook Step2: We'll also set the random seed for reproducibility Step3: MaxEnt Sampling Step4: Now let's check our samples Step5: The distribution of sampled motif ICs appears to be approximately normal, centered at 10 bits. We can check the mean with a quick confidence interval Step6: So our mean IC appears to be exactly on target. Step7: Notice that the TU sampler can sometimes be much slower than the MaxEnt sampler. This is because the TU sampler implements a rejection sampling algorithm with a MaxEnt sampler as the proposal distribution. It must exclude all motifs falling outside the desired IC interval. It must also reject some motifs which fall inside it in order to yield a statistically exact sample. Let's check the results Step8: Notice that, in contrast to the MaxEnt samples, the distribution of the TU motif ICs appears to be approximately exponentially distributed over the permissible range of 9.9 to 10.1 bits. We can check this by overlaying a rough exponential fit to the data. Although the details of fitting parameters to truncated exponential data are beyond the scope of this notebook, we find that we can achieve a tolerable fit by eye Step9: The exponential trend is expected behavior; a distribution that assigns equal probability mass to all motifs with IC between 9.9 and 10.1 bits will appear to be biased towards low IC values simply because there exist more motifs to be sampled on the low end than on the high end. Users should bear this phenomenon in mind when sampling from TU distributions. Step10: In recent years, high-throughput methods have enabled the assembly of very large sequence motifs. For ease of illustration, though, let's consider the collection of LacI binding sites treated by Berg and von Hippel in 1987 [0] Step11: To generate synthetic MaxEnt controls we can call Step12: (TU motifs can be sampled in a similar way.) To verify the output, let's compare the IC of the original LacI motif to the IC distribution of the controls
<ASSISTANT_TASK:> Python Code: from formosa import maxent_motifs, uniform_motifs, motif_ic %matplotlib inline from matplotlib import pyplot as plt import random random.seed(1) maxent_samples = maxent_motifs(N=20, L=10, desired_ic=10, num_motifs=100000) maxent_ics = map(motif_ic, maxent_samples) _ = plt.hist(maxent_ics,bins=100) plt.xlabel("Motif IC for MaxEnt Samples") from formosa_utils import mean, sd from math import sqrt mu, sigma = mean(maxent_ics), sd(maxent_ics) coverage = 1.96 * sigma/sqrt(10000) print "sample mean: %1.3f bits" % mu print "95%% confidence interval for mean: (%1.3f, %1.3f) (bits)" % (mu - coverage, mu + coverage) tu_samples = uniform_motifs(N=20, L=10, desired_ic=10, epsilon=0.1, num_motifs=10000) tu_ics = map(motif_ic, tu_samples) _ = plt.hist(tu_ics,bins=100) plt.xlabel("Motif IC for TU Samples") import numpy as np from math import exp _ = plt.hist(tu_ics,bins=100) plt.xlabel("Motif IC for TU Samples") xs = np.linspace(9.9,10.1,1000) fit = lambda x:300*exp(-15*(x-9.9)) plt.plot(xs,map(fit,xs),linewidth=5,color='r',label="exponential fit") plt.legend() from formosa import spoof_maxent_motifs, spoof_uniform_motifs lacI_motif = ["CTATCACCGGAAGGGATTA", "CTAACACCGTGCGTGTTGA", "TTACCTCTGGCGGTGATAA", "ATACCACTGGCGGTGATAC", "TTATCTCTGGCGGTGTTGA", "TAACCATCTGCGGTGATAA"] lacI_spoofs = spoof_maxent_motifs(lacI_motif, num_motifs=10000) lacI_ic = motif_ic(lacI_motif) lacI_spoof_ics = map(motif_ic, lacI_spoofs) _ = plt.hist(lacI_spoof_ics,bins=100,label="Replicate IC") plt.plot([lacI_ic,lacI_ic],[0,500],linestyle='--',label="LacI motif IC") plt.xlabel("Motif IC") plt.legend() mu, sigma = mean(lacI_spoof_ics), sd(lacI_spoof_ics) coverage = 1.96 * sigma/sqrt(10000) print "LacI motif IC: %1.3f" % lacI_ic print "sample mean: %1.3f bits" % mu print "95%% confidence interval for mean: (%1.3f, %1.3f) (bits)" % (mu - coverage, mu + coverage) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 2. Key Properties --&gt; Variables Step7: 3. Key Properties --&gt; Seawater Properties Step8: 3.2. Ocean Freezing Point Value Step9: 4. Key Properties --&gt; Resolution Step10: 4.2. Canonical Horizontal Resolution Step11: 4.3. Number Of Horizontal Gridpoints Step12: 5. Key Properties --&gt; Tuning Applied Step13: 5.2. Target Step14: 5.3. Simulations Step15: 5.4. Metrics Used Step16: 5.5. Variables Step17: 6. Key Properties --&gt; Key Parameter Values Step18: 6.2. Additional Parameters Step19: 7. Key Properties --&gt; Assumptions Step20: 7.2. On Diagnostic Variables Step21: 7.3. Missing Processes Step22: 8. Key Properties --&gt; Conservation Step23: 8.2. Properties Step24: 8.3. Budget Step25: 8.4. Was Flux Correction Used Step26: 8.5. Corrected Conserved Prognostic Variables Step27: 9. Grid --&gt; Discretisation --&gt; Horizontal Step28: 9.2. Grid Type Step29: 9.3. Scheme Step30: 9.4. Thermodynamics Time Step Step31: 9.5. Dynamics Time Step Step32: 9.6. Additional Details Step33: 10. Grid --&gt; Discretisation --&gt; Vertical Step34: 10.2. Number Of Layers Step35: 10.3. Additional Details Step36: 11. Grid --&gt; Seaice Categories Step37: 11.2. Number Of Categories Step38: 11.3. Category Limits Step39: 11.4. Ice Thickness Distribution Scheme Step40: 11.5. Other Step41: 12. Grid --&gt; Snow On Seaice Step42: 12.2. Number Of Snow Levels Step43: 12.3. Snow Fraction Step44: 12.4. Additional Details Step45: 13. Dynamics Step46: 13.2. Transport In Thickness Space Step47: 13.3. Ice Strength Formulation Step48: 13.4. Redistribution Step49: 13.5. Rheology Step50: 14. Thermodynamics --&gt; Energy Step51: 14.2. Thermal Conductivity Step52: 14.3. Heat Diffusion Step53: 14.4. Basal Heat Flux Step54: 14.5. Fixed Salinity Value Step55: 14.6. Heat Content Of Precipitation Step56: 14.7. Precipitation Effects On Salinity Step57: 15. Thermodynamics --&gt; Mass Step58: 15.2. Ice Vertical Growth And Melt Step59: 15.3. Ice Lateral Melting Step60: 15.4. Ice Surface Sublimation Step61: 15.5. Frazil Ice Step62: 16. Thermodynamics --&gt; Salt Step63: 16.2. Sea Ice Salinity Thermal Impacts Step64: 17. Thermodynamics --&gt; Salt --&gt; Mass Transport Step65: 17.2. Constant Salinity Value Step66: 17.3. Additional Details Step67: 18. Thermodynamics --&gt; Salt --&gt; Thermodynamics Step68: 18.2. Constant Salinity Value Step69: 18.3. Additional Details Step70: 19. Thermodynamics --&gt; Ice Thickness Distribution Step71: 20. Thermodynamics --&gt; Ice Floe Size Distribution Step72: 20.2. Additional Details Step73: 21. Thermodynamics --&gt; Melt Ponds Step74: 21.2. Formulation Step75: 21.3. Impacts Step76: 22. Thermodynamics --&gt; Snow Processes Step77: 22.2. Snow Aging Scheme Step78: 22.3. Has Snow Ice Formation Step79: 22.4. Snow Ice Formation Scheme Step80: 22.5. Redistribution Step81: 22.6. Heat Diffusion Step82: 23. Radiative Processes Step83: 23.2. Ice Radiation Transmission
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'ec-earth-consortium', 'ec-earth3-hr', 'seaice') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.variables.prognostic') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sea ice temperature" # "Sea ice concentration" # "Sea ice thickness" # "Sea ice volume per grid cell area" # "Sea ice u-velocity" # "Sea ice v-velocity" # "Sea ice enthalpy" # "Internal ice stress" # "Salinity" # "Snow temperature" # "Snow depth" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "TEOS-10" # "Constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.number_of_horizontal_gridpoints') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.target') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.simulations') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.metrics_used') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.typical_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Ice strength (P*) in units of N m{-2}" # "Snow conductivity (ks) in units of W m{-1} K{-1} " # "Minimum thickness of ice created in leads (h0) in units of m" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.additional_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.description') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.on_diagnostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.missing_processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.properties') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Energy" # "Mass" # "Salt" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.budget') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.was_flux_correction_used') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.corrected_conserved_prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Ocean grid" # "Atmosphere Grid" # "Own Grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Structured grid" # "Unstructured grid" # "Adaptive grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Finite differences" # "Finite elements" # "Finite volumes" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.thermodynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.dynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.layering') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Zero-layer" # "Two-layers" # "Multi-layers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.number_of_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.has_mulitple_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.number_of_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.category_limits') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.ice_thickness_distribution_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.other') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.has_snow_on_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.number_of_snow_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.snow_fraction') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.horizontal_transport') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.transport_in_thickness_space') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.ice_strength_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Hibler 1979" # "Rothrock 1975" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.redistribution') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Rafting" # "Ridging" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.rheology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Free-drift" # "Mohr-Coloumb" # "Visco-plastic" # "Elastic-visco-plastic" # "Elastic-anisotropic-plastic" # "Granular" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.enthalpy_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice latent heat (Semtner 0-layer)" # "Pure ice latent and sensible heat" # "Pure ice latent and sensible heat + brine heat reservoir (Semtner 3-layer)" # "Pure ice latent and sensible heat + explicit brine inclusions (Bitz and Lipscomb)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.thermal_conductivity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice" # "Saline ice" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Conduction fluxes" # "Conduction and radiation heat fluxes" # "Conduction, radiation and latent heat transport" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.basal_heat_flux') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Heat Reservoir" # "Thermal Fixed Salinity" # "Thermal Varying Salinity" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.fixed_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_content_of_precipitation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.precipitation_effects_on_salinity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.new_ice_formation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_vertical_growth_and_melt') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_lateral_melting') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Floe-size dependent (Bitz et al 2001)" # "Virtual thin ice melting (for single-category)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_surface_sublimation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.frazil_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.has_multiple_sea_ice_salinities') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.sea_ice_salinity_thermal_impacts') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_thickness_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Virtual (enhancement of thermal conductivity, thin ice melting)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Parameterised" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.are_included') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Flocco and Feltham (2010)" # "Level-ice melt ponds" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.impacts') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Albedo" # "Freshwater" # "Heat" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_aging') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_aging_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_ice_formation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_ice_formation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.redistribution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Single-layered heat diffusion" # "Multi-layered heat diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.surface_albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Parameterized" # "Multi-band albedo" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.ice_radiation_transmission') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Exponential attenuation" # "Ice radiation transmission per category" # "Other: [Please specify]" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load and process review dataset Step2: Just like we did previously, we will work with a hand-curated list of important words extracted from the review data. We will also perform 2 simple data transformations Step3: The SFrame products now contains one column for each of the 193 important_words. Step4: Split data into training and validation sets Step5: Convert SFrame to NumPy array Step6: Note that we convert both the training and validation sets into NumPy arrays. Step7: Are you running this notebook on an Amazon EC2 t2.micro instance? (If you are using your own machine, please skip this section) Step8: Derivative of log likelihood with respect to a single coefficient Step9: Note. We are not using regularization in this assignment, but, as discussed in the optional video, stochastic gradient can also be used for regularized logistic regression. Step10: Quiz Question Step11: Quiz Question Step12: Quiz Question Step13: Note. In practice, the final set of coefficients is rarely used; it is better to use the average of the last K sets of coefficients instead, where K should be adjusted depending on how fast the log likelihood oscillates around the optimum. Step14: Compare convergence behavior of stochastic gradient ascent Step15: Quiz Question. When you set batch_size = 1, as each iteration passes, how does the average log likelihood in the batch change? Step16: Quiz Question. When you set batch_size = len(train_data), as each iteration passes, how does the average log likelihood in the batch change? Step17: Log likelihood plots for stochastic gradient ascent Step18: We provide you with a utility function to plot the average log likelihood as a function of the number of passes. Step19: Smoothing the stochastic gradient ascent curve Step20: Checkpoint Step21: We compare the convergence of stochastic gradient ascent and batch gradient ascent in the following cell. Note that we apply smoothing with smoothing_window=30. Step22: Quiz Question Step23: Plotting the log likelihood as a function of passes for each step size Step24: Now, let us remove the step size step_size = 1e2 and plot the rest of the curves.
<ASSISTANT_TASK:> Python Code: from __future__ import division import graphlab products = graphlab.SFrame('amazon_baby_subset.gl/') import json with open('important_words.json', 'r') as f: important_words = json.load(f) important_words = [str(s) for s in important_words] # Remote punctuation def remove_punctuation(text): import string return text.translate(None, string.punctuation) products['review_clean'] = products['review'].apply(remove_punctuation) # Split out the words into individual columns for word in important_words: products[word] = products['review_clean'].apply(lambda s : s.split().count(word)) products train_data, validation_data = products.random_split(.9, seed=1) print 'Training set : %d data points' % len(train_data) print 'Validation set: %d data points' % len(validation_data) import numpy as np def get_numpy_data(data_sframe, features, label): data_sframe['intercept'] = 1 features = ['intercept'] + features features_sframe = data_sframe[features] feature_matrix = features_sframe.to_numpy() label_sarray = data_sframe[label] label_array = label_sarray.to_numpy() return(feature_matrix, label_array) feature_matrix_train, sentiment_train = get_numpy_data(train_data, important_words, 'sentiment') feature_matrix_valid, sentiment_valid = get_numpy_data(validation_data, important_words, 'sentiment') ''' produces probablistic estimate for P(y_i = +1 | x_i, w). estimate ranges between 0 and 1. ''' def predict_probability(feature_matrix, coefficients): # Take dot product of feature_matrix and coefficients score = np.dot(feature_matrix, coefficients) # Compute P(y_i = +1 | x_i, w) using the link function predictions = 1. / (1.+np.exp(-score)) return predictions def feature_derivative(errors, feature): # Compute the dot product of errors and feature ## YOUR CODE HERE derivative = sum(feature * errors) return derivative def compute_avg_log_likelihood(feature_matrix, sentiment, coefficients): indicator = (sentiment==+1) scores = np.dot(feature_matrix, coefficients) logexp = np.log(1. + np.exp(-scores)) # Simple check to prevent overflow mask = np.isinf(logexp) logexp[mask] = -scores[mask] lp = np.sum((indicator-1)*scores - logexp)/len(feature_matrix) return lp j = 1 # Feature number i = 10 # Data point number coefficients = np.zeros(194) # A point w at which we are computing the gradient. predictions = predict_probability(feature_matrix_train[i:i+1,:], coefficients) indicator = (sentiment_train[i:i+1]==+1) errors = indicator - predictions gradient_single_data_point = feature_derivative(errors, feature_matrix_train[i:i+1,j]) print "Gradient single data point: %s" % gradient_single_data_point print " --> Should print 0.0" j = 1 # Feature number i = 10 # Data point start B = 10 # Mini-batch size coefficients = np.zeros(194) # A point w at which we are computing the gradient. predictions = predict_probability(feature_matrix_train[i:i+B,:], coefficients) indicator = (sentiment_train[i:i+B]==+1) errors = indicator - predictions gradient_mini_batch = feature_derivative(errors, feature_matrix_train[i:i+B,j]) print "Gradient mini-batch data points: %s" % gradient_mini_batch print " --> Should print 1.0" from math import sqrt def logistic_regression_SG(feature_matrix, sentiment, initial_coefficients, step_size, batch_size, max_iter): log_likelihood_all = [] # make sure it's a numpy array coefficients = np.array(initial_coefficients) # set seed=1 to produce consistent results np.random.seed(seed=1) # Shuffle the data before starting permutation = np.random.permutation(len(feature_matrix)) feature_matrix = feature_matrix[permutation,:] sentiment = sentiment[permutation] i = 0 # index of current batch # Do a linear scan over data for itr in xrange(max_iter): # Predict P(y_i = +1|x_i,w) using your predict_probability() function # Make sure to slice the i-th row of feature_matrix with [i:i+batch_size,:] ### YOUR CODE HERE predictions = predict_probability(feature_matrix[i:i+batch_size,:], coefficients) # Compute indicator value for (y_i = +1) # Make sure to slice the i-th entry with [i:i+batch_size] ### YOUR CODE HERE indicator = (sentiment[i:i+batch_size]==+1) # Compute the errors as indicator - predictions errors = indicator - predictions for j in xrange(len(coefficients)): # loop over each coefficient # Recall that feature_matrix[:,j] is the feature column associated with coefficients[j] # Compute the derivative for coefficients[j] and save it to derivative. # Make sure to slice the i-th row of feature_matrix with [i:i+batch_size,j] ### YOUR CODE HERE derivative = feature_derivative(errors, feature_matrix[i:i+batch_size,j]) # compute the product of the step size, the derivative, and the **normalization constant** (1./batch_size) ### YOUR CODE HERE coefficients[j] += (step_size * derivative * (1./batch_size)) # Checking whether log likelihood is increasing # Print the log likelihood over the *current batch* lp = compute_avg_log_likelihood(feature_matrix[i:i+batch_size,:], sentiment[i:i+batch_size], coefficients) log_likelihood_all.append(lp) if itr <= 15 or (itr <= 1000 and itr % 100 == 0) or (itr <= 10000 and itr % 1000 == 0) \ or itr % 10000 == 0 or itr == max_iter-1: data_size = len(feature_matrix) print 'Iteration %*d: Average log likelihood (of data points in batch [%0*d:%0*d]) = %.8f' % \ (int(np.ceil(np.log10(max_iter))), itr, \ int(np.ceil(np.log10(data_size))), i, \ int(np.ceil(np.log10(data_size))), i+batch_size, lp) # if we made a complete pass over data, shuffle and restart i += batch_size if i+batch_size > len(feature_matrix): permutation = np.random.permutation(len(feature_matrix)) feature_matrix = feature_matrix[permutation,:] sentiment = sentiment[permutation] i = 0 # We return the list of log likelihoods for plotting purposes. return coefficients, log_likelihood_all sample_feature_matrix = np.array([[1.,2.,-1.], [1.,0.,1.]]) sample_sentiment = np.array([+1, -1]) coefficients, log_likelihood = logistic_regression_SG(sample_feature_matrix, sample_sentiment, np.zeros(3), step_size=1., batch_size=2, max_iter=2) print '-------------------------------------------------------------------------------------' print 'Coefficients learned :', coefficients print 'Average log likelihood per-iteration :', log_likelihood if np.allclose(coefficients, np.array([-0.09755757, 0.68242552, -0.7799831]), atol=1e-3)\ and np.allclose(log_likelihood, np.array([-0.33774513108142956, -0.2345530939410341])): # pass if elements match within 1e-3 print '-------------------------------------------------------------------------------------' print 'Test passed!' else: print '-------------------------------------------------------------------------------------' print 'Test failed' coefficients, log_likelihood = logistic_regression_SG(feature_matrix_train, sentiment_train, initial_coefficients=np.zeros(194), step_size=5e-1, batch_size=1, max_iter=10) # YOUR CODE HERE coefficients_batch, log_likelihood_batch = logistic_regression_SG(feature_matrix_train, sentiment_train, initial_coefficients=np.zeros(194), step_size=5e-1, batch_size=len(feature_matrix_train), max_iter=200) 2 * int(50000/100) step_size = 1e-1 batch_size = 100 num_passes = 10 num_iterations = num_passes * int(len(feature_matrix_train)/batch_size) coefficients_sgd, log_likelihood_sgd = logistic_regression_SG(feature_matrix_train, sentiment_train, initial_coefficients=np.zeros(194), step_size=1e-1, batch_size=100, max_iter=num_iterations) import matplotlib.pyplot as plt %matplotlib inline def make_plot(log_likelihood_all, len_data, batch_size, smoothing_window=1, label=''): plt.rcParams.update({'figure.figsize': (9,5)}) log_likelihood_all_ma = np.convolve(np.array(log_likelihood_all), \ np.ones((smoothing_window,))/smoothing_window, mode='valid') plt.plot(np.array(range(smoothing_window-1, len(log_likelihood_all)))*float(batch_size)/len_data, log_likelihood_all_ma, linewidth=4.0, label=label) plt.rcParams.update({'font.size': 16}) plt.tight_layout() plt.xlabel('# of passes over data') plt.ylabel('Average log likelihood per data point') plt.legend(loc='lower right', prop={'size':14}) make_plot(log_likelihood_sgd, len_data=len(feature_matrix_train), batch_size=100, label='stochastic gradient, step_size=1e-1') make_plot(log_likelihood_sgd, len_data=len(feature_matrix_train), batch_size=100, smoothing_window=30, label='stochastic gradient, step_size=1e-1') step_size = 1e-1 batch_size = 100 num_passes = 200 num_iterations = num_passes * int(len(feature_matrix_train)/batch_size) ## YOUR CODE HERE coefficients_sgd, log_likelihood_sgd = logistic_regression_SG(feature_matrix_train, sentiment_train, initial_coefficients=np.zeros(194), step_size=step_size, batch_size=batch_size, max_iter=num_iterations) make_plot(log_likelihood_sgd, len_data=len(feature_matrix_train), batch_size=100, smoothing_window=30, label='stochastic, step_size=1e-1') make_plot(log_likelihood_batch, len_data=len(feature_matrix_train), batch_size=len(feature_matrix_train), smoothing_window=1, label='batch, step_size=5e-1') batch_size = 100 num_passes = 10 num_iterations = num_passes * int(len(feature_matrix_train)/batch_size) coefficients_sgd = {} log_likelihood_sgd = {} for step_size in np.logspace(-4, 2, num=7): coefficients_sgd[step_size], log_likelihood_sgd[step_size] = logistic_regression_SG(feature_matrix_train, sentiment_train, initial_coefficients=np.zeros(194), step_size=step_size, batch_size=batch_size, max_iter=num_iterations) for step_size in np.logspace(-4, 2, num=7): make_plot(log_likelihood_sgd[step_size], len_data=len(train_data), batch_size=100, smoothing_window=30, label='step_size=%.1e'%step_size) for step_size in np.logspace(-4, 2, num=7)[0:6]: make_plot(log_likelihood_sgd[step_size], len_data=len(train_data), batch_size=100, smoothing_window=30, label='step_size=%.1e'%step_size) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: To begin, let's import all the libraries we'll need and load the dataset (which comes bundled with Tensorflow). Step2: Let's view some of the images to get an idea of what they look like. Step3: Now we can create our GAN. Like in the last tutorial, it consists of two parts Step4: Now to train it. As in the last tutorial, we write a generator to produce data. This time the data is coming from a dataset, which we loop over 100 times. Step5: Let's generate some data and see how the results look.
<ASSISTANT_TASK:> Python Code: !pip install --pre deepchem import deepchem deepchem.__version__ import deepchem as dc import tensorflow as tf from deepchem.models.optimizers import ExponentialDecay from tensorflow.keras.layers import Conv2D, Conv2DTranspose, Dense, Reshape import matplotlib.pyplot as plot import matplotlib.gridspec as gridspec %matplotlib inline mnist = tf.keras.datasets.mnist.load_data(path='mnist.npz') images = mnist[0][0].reshape((-1, 28, 28, 1))/255 dataset = dc.data.NumpyDataset(images) def plot_digits(im): plot.figure(figsize=(3, 3)) grid = gridspec.GridSpec(4, 4, wspace=0.05, hspace=0.05) for i, g in enumerate(grid): ax = plot.subplot(g) ax.set_xticks([]) ax.set_yticks([]) ax.imshow(im[i,:,:,0], cmap='gray') plot_digits(images) class DigitGAN(dc.models.WGAN): def get_noise_input_shape(self): return (10,) def get_data_input_shapes(self): return [(28, 28, 1)] def create_generator(self): return tf.keras.Sequential([ Dense(7*7*8, activation=tf.nn.relu), Reshape((7, 7, 8)), Conv2DTranspose(filters=16, kernel_size=5, strides=2, activation=tf.nn.relu, padding='same'), Conv2DTranspose(filters=1, kernel_size=5, strides=2, activation=tf.sigmoid, padding='same') ]) def create_discriminator(self): return tf.keras.Sequential([ Conv2D(filters=32, kernel_size=5, strides=2, activation=tf.nn.leaky_relu, padding='same'), Conv2D(filters=64, kernel_size=5, strides=2, activation=tf.nn.leaky_relu, padding='same'), Dense(1, activation=tf.math.softplus) ]) gan = DigitGAN(learning_rate=ExponentialDecay(0.001, 0.9, 5000)) def iterbatches(epochs): for i in range(epochs): for batch in dataset.iterbatches(batch_size=gan.batch_size): yield {gan.data_inputs[0]: batch[0]} gan.fit_gan(iterbatches(100), generator_steps=0.2, checkpoint_interval=5000) plot_digits(gan.predict_gan_generator(batch_size=16)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Cleaning the data & preparing a submission file Step2: Creating new features Step3: Finding best values for n_estimators and max_depth Step4: Final random forest and submission
<ASSISTANT_TASK:> Python Code: print('Importing libraries...') import numpy as np import pandas as pd from sklearn import cross_validation as cv from sklearn.cross_validation import KFold from sklearn.ensemble import RandomForestClassifier print('Fetching the training and test datasets...') train = pd.read_csv("data/train.csv", dtype={"Age": np.float64}, ) test = pd.read_csv("data/test.csv", dtype={"Age": np.float64}, ) print('Cleaning the dataset...') def harmonize_data(titanic): # Filling the blank data titanic["Age"] = titanic["Age"].fillna(titanic["Age"].mean()) titanic["Fare"] = titanic["Fare"].fillna(titanic["Fare"].mean()) titanic["Embarked"] = titanic["Embarked"].fillna("S") # Assigning binary form to data for calculation purpose titanic.loc[titanic["Sex"] == "male", "Sex"] = 1 titanic.loc[titanic["Sex"] == "female", "Sex"] = 0 titanic.loc[titanic["Embarked"] == "S", "Embarked"] = 0 titanic.loc[titanic["Embarked"] == "C", "Embarked"] = 1 titanic.loc[titanic["Embarked"] == "Q", "Embarked"] = 2 return titanic print('Defining submission file...') def create_submission(rfc, train, test, predictors, filename): rfc.fit(train[predictors], train["Survived"]) predictions = rfc.predict(test[predictors]) submission = pd.DataFrame({ "PassengerId": test["PassengerId"], "Survived": predictions }) submission.to_csv(filename, index=False) print('Defining the clean dataset...') train_data = harmonize_data(train) test_data = harmonize_data(test) print('Performing feature enginnering...') train_data["PSA"] = train_data["Pclass"]*train_data["Sex"]*train_data["Age"] train_data["SP"] = train_data["SibSp"]+train_data["Parch"] test_data["PSA"] = test_data["Pclass"]*test_data["Sex"]*test_data["Age"] test_data["SP"] = test_data["SibSp"]+test_data["Parch"] print('Defining predictors...') predictors = ["Pclass", "Sex", "Age", "PSA", "Fare", "Embarked", "SP"] print('Finding best n_estimators for RandomForestClassifier...') max_score = 0 best_n = 0 # For each value of n_estimators: # 1- Split/CV your data (KFold) # 2- Fit RF # 3- Calculate score for n_estimators by averaging up the individual scores of the 10 folds # 4- Once best_n found, do the same for max_depth for n in range(1,100): rfc_scr = 0. rfc = RandomForestClassifier(n_estimators=n) for train, test in KFold(len(train_data), n_folds=10, shuffle=True): rfc.fit(train_data[predictors].T[train].T, train_data["Survived"].T[train].T) rfc_scr += rfc.score(train_data[predictors].T[test].T, train_data["Survived"].T[test].T)/10 if rfc_scr > max_score: max_score = rfc_scr best_n = n print(best_n, max_score) print('Finding best max_depth for RandomForestClassifier...') max_score = 0 best_m = 0 for m in range(1,100): rfc_scr = 0. rfc = RandomForestClassifier(max_depth=m) for train, test in KFold(len(train_data), n_folds=10, shuffle=True): rfc.fit(train_data[predictors].T[train].T, train_data["Survived"].T[train].T) rfc_scr += rfc.score(train_data[predictors].T[test].T, train_data["Survived"].T[test].T)/10 if rfc_scr > max_score: max_score = rfc_scr best_m = m print(best_n, best_m, max_score) # Finally, we just use the optimal parameters found to create the final RF and fit our data print('Applying method...') rfc = RandomForestClassifier(n_estimators=best_n, max_depth=best_m) print('Creating submission...') create_submission(rfc, train_data, test_data, predictors, "rfcsurvivors.csv") print('Submitted.') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: There several key elements need to specify when using a gradient_descent optimizer Step2: There are several attributes to specify when using Adam optimizer that is different from gradient descent
<ASSISTANT_TASK:> Python Code: import os, sys sys.path = [os.path.abspath("../../")] + sys.path from deep_learning4e import * from notebook4e import * psource(gradient_descent) pseudocode(adam_optimizer) psource(adam_optimizer) psource(BackPropagation) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Get and shift the Cross-correlation functions to the primary star rest frame Step2: Measure the companion RVs. Step3: Fix the dates to line up with the RV output file
<ASSISTANT_TASK:> Python Code: %matplotlib inline import matplotlib.pyplot as plt import seaborn as sns import pandas as pd import CombineCCFs import numpy as np from astropy import units as u, constants from HelperFunctions import Gauss, integral import os import lmfit import emcee import triangle from scipy.interpolate import InterpolatedUnivariateSpline as spline sns.set_context('paper', font_scale=2.0) home = os.environ['HOME'] hdf_file = '{}/School/Research/McDonaldData/PlanetData/PsiDraA/Cross_correlations/CCF.hdf5'.format(home) output_dir = '{}/School/Research/McDonaldData/PlanetData/Paper/Figures/'.format(home) T = 4400 vsini = 5 logg = 4.5 metal = 0.0 dV = 0.1 c = constants.c.cgs.to(u.m/u.s).value xgrid = np.arange(-400, 400+dV/2., dV) ccfs, original_files = CombineCCFs.get_ccfs(T=T, vsini=vsini, logg=logg, metal=metal, hdf_file=hdf_file, xgrid=xgrid) # Plot all the CCFs cmap = sns.cubehelix_palette(reverse=False, as_cmap=True, gamma=1, rot=0.7, start=2) fig, ax = plt.subplots(1, 1) out = ax.imshow(ccfs, cmap=cmap, aspect='auto', origin='lower')#, vmin=vmin, vmax=vmax) min_v = -75. max_v = 75. dv_ticks = 50.0/dV ax.set_xlim(((min_v+400)/dV, (max_v+400)/dV)) ticks = np.arange((min_v+400)/dV, (max_v+400)/dV+1, dv_ticks) ax.set_xticks((ticks)) #ax.set_xticklabels((-150, -100, -50, 0, 50, 100, 150)) ax.set_xticklabels((-75, -25, 25, 75)) ax.set_xlabel('Velocity in primary star rest frame (km/s)') ax.set_yticklabels(()) ax.set_ylabel('Observation Date') # Colorbar cb = plt.colorbar(out) cb.set_label('CCF Power') # Save plt.savefig('{}Original_CCFs.pdf'.format(output_dir)) avg_ccf = np.mean(ccfs, axis=0) normed_ccfs = ccfs - avg_ccf # Get the time each observation was made (in julian date) dates = np.array([CombineCCFs.fits.getheader(fname)['HJD'] for fname in original_files]) # Set up the scaling manually low, high = np.min(normed_ccfs), np.max(normed_ccfs) rng = max(abs(low), abs(high)) vmin = np.sign(low) * rng vmax = np.sign(high) * rng # Make the actual plot #cmap = sns.cubehelix_palette(reverse=False, as_cmap=True, gamma=1, rot=0.7, start=2) #defined above now... fig, ax = plt.subplots(1, 1) out = ax.imshow(normed_ccfs, cmap=cmap, aspect='auto', origin='lower')#, vmin=vmin, vmax=vmax) ax.set_xlim(((min_v+400)/dV, (max_v+400)/dV)) ticks = np.arange((min_v+400)/dV, (max_v+400)/dV+1, dv_ticks) ax.set_xticks((ticks)) #ax.set_xticklabels((-150, -100, -50, 0, 50, 100, 150)) ax.set_xticklabels((-75, -25, 25, 75)) ax.set_xlabel('Velocity (km/s)') ax.set_yticklabels(()) ax.set_ylabel('Observation Date') # Colorbar cb = plt.colorbar(out) cb.set_label('CCF Power') fig.subplots_adjust(bottom=0.18, left=0.10, top=0.95, right=0.90) plt.savefig('{}Resid_CCFs.pdf'.format(output_dir)) # Make the same plot, but with the y-axis linearized so that I can give dates. X,Y = np.meshgrid(xgrid, dates-2450000) fig, ax = plt.subplots(1, 1, figsize=(6,4)) out = ax.pcolormesh(X,Y,normed_ccfs, cmap=cmap, rasterized=True) ax.set_xlabel('Velocity (km/s)') ax.set_ylabel('JD - 2450000') ax.set_xlim((-75, 75)) ax.set_ylim((Y.min(), Y.max())) # Colorbar cb = plt.colorbar(out) cb.set_label('CCF Power') fig.subplots_adjust(bottom=0.18, left=0.15, top=0.95, right=0.90) plt.savefig('{}Resid_CCFs.pdf'.format(output_dir)) print(output_dir) ax.pcolormesh? def fwhm(x, y, search_range=(-500, 500)): good = (x > search_range[0]) & (x < search_range[1]) x = x[good].copy() y = y[good].copy() idx = np.argmax(y) ymax = y[idx] half_max = ymax / 2.0 # Find the first pixels less than half_max to the left of idx for di in range(1, idx): if y[idx-di] < half_max: break slope = (y[idx-(di+1)] - y[idx-di])/(x[idx-(di+1)] - x[idx-di]) left = x[idx-di] + (half_max - y[idx-di])/slope # Find the first pixels less than half_max to the right of idx for di in range(1, len(x)-idx-1): if y[idx+di] < half_max: break slope = (y[idx+(di+1)] - y[idx+di])/(x[idx+(di+1)] - x[idx+di]) right = x[idx+di] + (half_max - y[idx+di])/slope return left, x[idx], right # Make plot of a normal residual CCF sns.set_style('white') sns.set_style('ticks') i = 50 corr = normed_ccfs[i] fig, ax = plt.subplots() ax.plot(xgrid, corr, 'k-', lw=3) l, m, h = fwhm(xgrid, corr, search_range=(-50, 10)) ylim = ax.get_ylim() ax.plot([m, m], ylim, 'g--', alpha=0.7) ax.plot([l, l], ylim, 'r--', alpha=0.7) ax.plot([h, h], ylim, 'r--', alpha=0.7) ax.set_xlim((-60, 20)) ax.set_ylim(ylim) ax.set_xlabel('Velocity (km/s)') ax.set_ylabel('CCF Power') fig.subplots_adjust(bottom=0.18, left=0.20, top=0.95, right=0.95) plt.savefig('{}Typical_CCF.pdf'.format(output_dir)) # Measure the radial velocities of the companion as the peak and FWHM of the residual CCF date = [] rv1 = [] rv1_err = [] rv2 = [] rv2_err = [] import time for i in range(10, len(original_files)): #for i in range(20, 21): header = CombineCCFs.fits.getheader(original_files[i]) jd = header['HJD'] prim_rv = CombineCCFs.get_prim_rv(original_files[i], data_shift=0.0) measurements = CombineCCFs.get_measured_rv(original_files[i]) rv1.append(measurements[0]) rv1_err.append(measurements[1]) try: l, m, h = fwhm(xgrid.copy(), normed_ccfs[i], search_range=(-50, 10)) print('i = {}, HJD = {}\n\t{:.1f} +{:.1f}/-{:.1f}\n\t{}'.format(i, jd, m, h-m, m-l, original_files[i])) date.append(jd) rv2.append((h+l)/2.) rv2_err.append((h-l)/2.355) except: date.append(jd) rv2.append(np.nan) rv2_err.append(np.nan) continue plt.plot(xgrid, normed_ccfs[i]) plt.xlim((-100, 50)) ylim = plt.ylim() plt.plot([(h+l)/2., (h+l)/2.], ylim, 'g--') plt.savefig('Figures/CCF_{}.pdf'.format(original_files[i][:-5])) plt.cla() rv1 = np.array(rv1) rv1_err = np.array(rv1_err) rv2 = np.array(rv2) rv2_err = np.array(rv2_err) # I don't trust the very early measurements rv2[:6] = np.nan*np.ones(6) rv2_err[:6] = np.nan*np.ones(6) # Save the RVs np.savetxt('rv_data.txt', (date, rv1, rv1_err, rv2, rv2_err)) import pandas as pd rv1_data = pd.read_fwf('../Planet-Finder/data/psi1draa_140p_28_37_ASW.dat', header=None) t1 = rv1_data[0].values rv1 = rv1_data[2].values / 1000. # Convert from m/s to km/s rv1_err = rv1_data[3].values / 1000. new_rv2 = np.empty_like(t1) new_rv2_err = np.empty_like(t1) for i, t1_i in enumerate(t1): #idx = np.searchsorted(t1, t2) idx = np.argmin(np.abs(date-t1_i)) if abs(t1_i - date[idx]) < 0.001: print i, t1_i, date[idx], t1_i-date[idx] new_rv2[i] = rv2[idx] new_rv2_err[i] = rv2_err[idx] else: print i, t1_i, date[idx], np.nan new_rv2[i] = np.nan new_rv2_err[i] = np.nan np.savetxt('../Planet-Finder/data/rv_data.txt', (t1, rv1, rv1_err, new_rv2, new_rv2_err)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Multi just calls dl.get_trades() and merges the data. Netfonds makes 20 days including today available, hence some days are not trading days (weekends, holidays) and the number of days might be less than expected. Step2: Resampling multiple intraday trading data as OHLCV Step4: Plotting multiple OHLCV intraday data Step5: Positions
<ASSISTANT_TASK:> Python Code: %matplotlib inline %pylab inline --no-import-all pylab.rcParams['figure.figsize'] = (18, 10) from ntfdl import Multi from matplotlib.finance import candlestick_ohlc from datetime import datetime, timedelta # Instantiate multi with instrument FOE from Oslo exchange (OSS) foe = Multi('FOE', exchange='OSE') # Make a timerange from to end = datetime.now() #Today start = end - timedelta(days=20) #20 days ago trades = foe.get_trades(start, end) # Plotting without gaps fig, ax = plt.subplots() ax.plot(range(trades.price.size), trades.price) ax.set_xticklabels(trades.index.date.tolist()) # Plot max and min line ax.axhline(y=trades.price.max(), linestyle='--', color='r') ax.axhline(y=trades.price.min(), linestyle='--', color='g') # Adding axis right hand side ax.tick_params(labeltop=False, labelright=True) # Annotate last quote xmin, xmax = ax.get_xlim() plt.annotate(trades.iloc[-1].price, xy=(1, trades.iloc[-1].price), xytext=(0, 0), \ xycoords=('axes fraction', 'data'), textcoords='offset points', backgroundcolor='k', color='w') #ax.plot(xmax, trades.iloc[-1].price, '<k', markersize=18, markeredgecolor='k') fig.autofmt_xdate() plt.grid() ohlcv = foe.get_ohlcv(start, end, '1min') ohlcv.tail() def weekday_candlestick(ohlc_data, ax, fmt='%b %d', freq=7, **kwargs): Wrapper function for matplotlib.finance.candlestick_ohlc that artificially spaces data to avoid gaps from weekends or other periodes without data # No volume overlay for this one del ohlc_data['volume'] # Convert data to numpy array ohlc_data_arr = np.array(ohlc_data) #print(ohlc_data_arr[:,1:]) #open, high, low, close #print(ohlc_data_arr[:,0:]) #time ohlc_data_arr2 = np.hstack( [np.arange(ohlc_data_arr[:,0].size)[:,np.newaxis], ohlc_data_arr[:,1:]]) ndays = ohlc_data_arr2[:,0] # array([0, 1, 2, ... n-2, n-1, n]) dates = ohlc_data_arr[:,0] date_strings = [] for date in dates: date_strings.append(date.strftime(fmt)) # Plot candlestick chart candlestick_ohlc(ax, ohlc_data_arr2, **kwargs) # Format x axis ax.set_xticks(ndays[::freq]) ax.set_xticklabels(date_strings[::freq], rotation=45, ha='right') #ax.set_xlim(ndays.min(), ndays.max()) # Adding axis right hand side ax.tick_params(labeltop=False, labelright=True) # Show grid plt.grid() plt.show() # Get data ohlcv = foe.get_ohlcv(start, end, '30min') fig, ax = plt.subplots(ncols=1) # Calculate frequency, assumes all days are same number. # Note that spacing of xtick can be borked if not. freq = ohlcv[ohlcv.time > ohlcv["time"].map(lambda t: t.date()).unique()[-1]].shape[0] weekday_candlestick(ohlcv, ax=ax, fmt='%b %d %H:%M', freq=freq, width=0.5, colorup='g', colordown='r') fig.tight_layout() positions = foe.get_positions(start, end) positions.head() # Plotting without gaps fig, ax = plt.subplots() ax.plot(range(positions.ask.size), positions.ask) ax.plot(range(positions.bid.size), positions.bid) ax.set_xticklabels(positions.index.date.tolist()) # Adding axis right hand side ax.tick_params(labeltop=False, labelright=True) fig.autofmt_xdate() plt.grid() # Export to csv #positions.to_csv('foe.csv', sep=',', encoding='utf-8', columns=['time','bid', 'ask'], index=False) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2. Tiền xử lý Step2: Kiểm tra phân bố của nhãn Step3: Thử nhìn qua một số mẫu trong tập huấn luyện. Chúng ta thấy rằng hầu hết các ảnh đều rõ nét và tương đối dễ dàng để nhận dạng. Step4: Định nghĩa số epochs cần huấn luyện và bachsize Step5: 3. Data Augmentation Step6: 4. Xây dưng mô hình CNN Step7: 5. Hyper-params tunning Step8: 5.2 Optimze để tìm bộ tham số tốt nhất Step9: Chạy quá trình search tham số. Bộ siêu tham số tốt nhất sẽ được ghi nhận lại để chúng ta sử dụng trong mô hình cuối cùng. Step10: Huấn luyện lại mô hình với bộ tham số tốt nhất ở trên. Step11: Kết quả trên tập validation khá cao với acc > 99% Step12: Plot quá trình huấn luyện mô hình với 3 lọai optimizers khác nhau. Step13: 6.2 So sánh các loss function Step14: Plot quá trình huấn luyện mô hình với 2 loại loss function khác nhau. Step16: Chúng ta thấy rằng không có sự khác biệt rõ rằng về tốc độ hội tụ giữ 2 hàm loss function là cross-entropy và KL loss trong bài toán của chúng ta. Step18: Các giá trị trên đường chéo rất cao, chúng ta mô hình chúng ta có độ chính xác rất tốt. Step19: Với các mẫu ảnh sai, chúng ta có thể thấy rằng những mẫu này rất khó nhận dạng nhầm lẫn sáng các lớp khác. ví dụ số 9 và 4 hay là 3 và 8
<ASSISTANT_TASK:> Python Code: !pip install hyperas # Basic compuational libaries import pandas as pd import numpy as np import matplotlib.pyplot as plt import matplotlib.image as mpimg import seaborn as sns %matplotlib inline np.random.seed(2) from sklearn.model_selection import train_test_split from sklearn.metrics import confusion_matrix import itertools from sklearn.model_selection import KFold from keras.utils.np_utils import to_categorical # convert to one-hot-encoding from keras.layers import Dense, Dropout, Conv2D, GlobalAveragePooling2D, Flatten, GlobalMaxPooling2D from keras.layers import Dense, Dropout, Flatten, Conv2D, MaxPool2D, BatchNormalization from keras.models import Sequential from keras.optimizers import RMSprop, Adam, SGD, Nadam from keras.preprocessing.image import ImageDataGenerator from keras.callbacks import ReduceLROnPlateau, ModelCheckpoint, EarlyStopping from keras import regularizers # Import hyperopt for tunning hyper params from hyperopt import hp, tpe, fmin from hyperopt import space_eval sns.set(style='white', context='notebook', palette='deep') # Set the random seed random_seed = 2 def data(): # Load the data train = pd.read_csv("../input/digit-recognizer/train.csv") test = pd.read_csv("../input/digit-recognizer/test.csv") Y_train = train["label"] # Drop 'label' column X_train = train.drop(labels = ["label"],axis = 1) # Normalize the data X_train = X_train / 255.0 test = test / 255.0 # Reshape image in 3 dimensions (height = 28px, width = 28px , canal = 1) X_train = X_train.values.reshape(-1,28,28,1) test = test.values.reshape(-1,28,28,1) # Encode labels to one hot vectors (ex : 2 -> [0,0,1,0,0,0,0,0,0,0]) Y_train = to_categorical(Y_train, num_classes = 10) return X_train, Y_train, test X, Y, X_test = data() g = sns.countplot(np.argmax(Y, axis=1)) for i in range(0, 9): plt.subplot(330 + (i+1)) plt.imshow(X[i][:,:,0], cmap=plt.get_cmap('gray')) plt.title(np.argmax(Y[i])); plt.axis('off') plt.tight_layout() epochs = 30 # Turn epochs to 30 to get 0.9967 accuracy batch_size = 64 # With data augmentation to prevent overfitting (accuracy 0.99286) train_aug = ImageDataGenerator( rotation_range=10, # randomly rotate images in the range (degrees, 0 to 180) zoom_range = 0.1, # Randomly zoom image width_shift_range=0.1, # randomly shift images horizontally (fraction of total width) height_shift_range=0.1, # randomly shift images vertically (fraction of total height) ) test_aug = ImageDataGenerator() # Set the CNN model def train_model(train_generator, valid_generator, params): model = Sequential() model.add(Conv2D(filters = params['conv1'], kernel_size = params['kernel_size_1'], padding = 'Same', activation ='relu', input_shape = (28,28,1))) model.add(BatchNormalization()) model.add(Conv2D(filters = params['conv2'], kernel_size = params['kernel_size_2'], padding = 'Same', activation ='relu')) model.add(MaxPool2D(pool_size = params['pooling_size_1'])) model.add(Dropout(params['dropout1'])) model.add(BatchNormalization()) model.add(Conv2D(filters = params['conv3'], kernel_size = params['kernel_size_3'], padding = 'Same', activation ='relu')) model.add(BatchNormalization()) model.add(Conv2D(filters = params['conv4'], kernel_size = params['kernel_size_4'], padding = 'Same', activation ='relu')) model.add(MaxPool2D(pool_size = params['pooling_size_1'], strides=(2,2))) model.add(Dropout(params['dropout2'])) model.add(Flatten()) model.add(BatchNormalization()) model.add(Dense(params['dense1'], activation = "relu")) model.add(Dropout(params['dropout3'])) model.add(Dense(10, activation = "softmax")) if params['opt'] == 'rmsprop': opt = RMSprop() elif params['opt'] == 'sgd': opt = SGD() elif params['opt'] == 'nadam': opt = Nadam() else: opt = Adam() model.compile(loss=params['loss'], optimizer=opt, metrics=['acc']) reduce_lr = ReduceLROnPlateau(monitor='val_loss', factor=0.3, patience=2, mode='auto', cooldown=2, min_lr=1e-7) early = EarlyStopping(monitor='val_loss', patience=3) callbacks_list = [reduce_lr, early] history = model.fit_generator(train_generator, validation_data=valid_generator, steps_per_epoch=len(train_generator), validation_steps=len(valid_generator), callbacks=callbacks_list, epochs = epochs, verbose=2) score, acc = model.evaluate_generator(valid_generator, steps=len(valid_generator), verbose=0) return acc, model, history #This is the space of hyperparameters that we will search space = { 'opt':hp.choice('opt', ['adam', 'sgd', 'rmsprop']), 'conv1':hp.choice('conv1', [16, 32, 64, 128]), 'conv2':hp.choice('conv2', [16, 32, 64, 128]), 'kernel_size_1': hp.choice('kernel_size_1', [3, 5]), 'kernel_size_2': hp.choice('kernel_size_2', [3, 5]), 'dropout1': hp.choice('dropout1', [0, 0.25, 0.5]), 'pooling_size_1': hp.choice('pooling_size_1', [2, 3]), 'conv3':hp.choice('conv3', [32, 64, 128, 256, 512]), 'conv4':hp.choice('conv4', [32, 64, 128, 256, 512]), 'kernel_size_3': hp.choice('kernel_size_3', [3, 5]), 'kernel_size_4': hp.choice('kernel_size_4', [3, 5]), 'dropout2':hp.choice('dropout2', [0, 0.25, 0.5]), 'pooling_size_2': hp.choice('pooling_size_2', [2, 3]), 'dense1':hp.choice('dense1', [128, 256, 512, 1024]), 'dropout3':hp.choice('dropout3', [0, 0.25, 0.5]), 'loss': hp.choice('loss', ['categorical_crossentropy', 'kullback_leibler_divergence']), } X_train, X_val, Y_train, Y_val = train_test_split(X, Y, test_size = 0.2, random_state=random_seed) # only apply data augmentation with train data train_gen = train_aug.flow(X_train, Y_train, batch_size=batch_size) valid_gen = test_aug.flow(X_val, Y_val, batch_size=batch_size) def optimize(params): acc, model, history = train_model(train_gen, valid_gen, params) return -acc best = fmin(fn = optimize, space = space, algo = tpe.suggest, max_evals = 50) # change to 50 to search more best_params = space_eval(space, best) print('best hyper params: \n', best_params) acc, model, history = train_model(train_gen, valid_gen, best_params) print("validation accuracy: {}".format(acc)) optimizers = ['rmsprop', 'sgd', 'adam'] hists = [] params = best_params for optimizer in optimizers: params['opt'] = optimizer print("Train with optimizer: {}".format(optimizer)) _, _, history = train_model(train_gen, valid_gen, params) hists.append((optimizer, history)) for name, history in hists: plt.plot(history.history['val_acc'], label=name) plt.legend(loc='best', shadow=True) plt.tight_layout() loss_functions = ['categorical_crossentropy', 'kullback_leibler_divergence'] hists = [] params = best_params for loss_funct in loss_functions: params['loss'] = loss_funct print("Train with loss function : {}".format(loss_funct)) _, _, history = train_model(train_gen, valid_gen, params) hists.append((loss_funct, history)) for name, history in hists: plt.plot(history.history['val_acc'], label=name) plt.legend(loc='best', shadow=True) plt.tight_layout() def plot_confusion_matrix(cm, classes, normalize=False, title='Confusion matrix', cmap=plt.cm.Blues): This function prints and plots the confusion matrix. Normalization can be applied by setting `normalize=True`. plt.imshow(cm, interpolation='nearest', cmap=cmap) plt.title(title) plt.colorbar() tick_marks = np.arange(len(classes)) plt.xticks(tick_marks, classes, rotation=45) plt.yticks(tick_marks, classes) if normalize: cm = cm.astype('float') / cm.sum(axis=1)[:, np.newaxis] thresh = cm.max() / 2. for i, j in itertools.product(range(cm.shape[0]), range(cm.shape[1])): plt.text(j, i, cm[i, j], horizontalalignment="center", color="white" if cm[i, j] > thresh else "black") plt.tight_layout() plt.ylabel('True label') plt.xlabel('Predicted label') # Predict the values from the validation dataset Y_pred = model.predict(X_val) # Convert predictions classes to one hot vectors Y_pred_classes = np.argmax(Y_pred,axis = 1) # Convert validation observations to one hot vectors Y_true = np.argmax(Y_val,axis = 1) # compute the confusion matrix confusion_mtx = confusion_matrix(Y_true, Y_pred_classes) # plot the confusion matrix plot_confusion_matrix(confusion_mtx, classes = range(10)) # Display some error results # Errors are difference between predicted labels and true labels errors = (Y_pred_classes - Y_true != 0) Y_pred_classes_errors = Y_pred_classes[errors] Y_pred_errors = Y_pred[errors] Y_true_errors = Y_true[errors] X_val_errors = X_val[errors] def display_errors(errors_index,img_errors,pred_errors, obs_errors): This function shows 6 images with their predicted and real labels n = 0 nrows = 2 ncols = 3 fig, ax = plt.subplots(nrows,ncols,sharex=True,sharey=True) for row in range(nrows): for col in range(ncols): error = errors_index[n] ax[row,col].imshow((img_errors[error]).reshape((28,28))) ax[row,col].set_title("Predicted label :{}\nTrue label :{}".format(pred_errors[error],obs_errors[error])) n += 1 fig.tight_layout() # Probabilities of the wrong predicted numbers Y_pred_errors_prob = np.max(Y_pred_errors,axis = 1) # Predicted probabilities of the true values in the error set true_prob_errors = np.diagonal(np.take(Y_pred_errors, Y_true_errors, axis=1)) # Difference between the probability of the predicted label and the true label delta_pred_true_errors = Y_pred_errors_prob - true_prob_errors # Sorted list of the delta prob errors sorted_dela_errors = np.argsort(delta_pred_true_errors) # Top 6 errors most_important_errors = sorted_dela_errors[-6:] # Show the top 6 errors display_errors(most_important_errors, X_val_errors, Y_pred_classes_errors, Y_true_errors) kf = KFold(n_splits=5) preds = [] for train_index, valid_index in kf.split(X): X_train, Y_train, X_val, Y_val = X[train_index], Y[train_index], X[valid_index], Y[valid_index] train_gen = train_aug.flow(X_train, Y_train, batch_size=batch_size) valid_gen = test_aug.flow(X_val, Y_val, batch_size=batch_size) acc, model, history = train_model(train_gen, valid_gen, best_params) pred = model.predict(X_test) preds.append(pred) # predict results results = np.mean(preds, axis=0) # select the indix with the maximum probability results = np.argmax(results,axis = 1) results = pd.Series(results,name="Label") submission = pd.concat([pd.Series(range(1,28001),name = "ImageId"),results],axis = 1) submission.to_csv("cnn_mnist_datagen.csv",index=False) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: This notebook investigates the stability of the learned test location. We consider the case where P is a mixture of two uniform distributions on 1D, one of which has small height, and the second component has a much larger height. Here Q is a uniform distribution whose mass strongly overlaps with the second component of P. Step4: Check stability of the two modes. Triangular kernel Step5: Check stability of the two modes. Gaussian kernel Step6: test B-spline
<ASSISTANT_TASK:> Python Code: %load_ext autoreload %autoreload 2 %matplotlib inline #%config InlineBackend.figure_format = 'svg' #%config InlineBackend.figure_format = 'pdf' import freqopttest.util as util import freqopttest.data as data import freqopttest.ex.exglobal as exglo import freqopttest.kernel as kernel import freqopttest.tst as tst import freqopttest.glo as glo import freqopttest.plot as plot import matplotlib.pyplot as plt import numpy as np import scipy.stats as stats import scipy.signal as sig import sys # font options font = { #'family' : 'normal', #'weight' : 'bold', 'size' : 18 } plt.rc('font', **font) plt.rc('lines', linewidth=2) class SSMix2Unif(data.SampleSource): 1-d problem. P: U(m_p - w_p/2, mp+w_p/2) where w_p is the width of the uniform distribution, m_p is the mean Q: w*U(m_q-w_q/2, mq+w_q/2) + (1-w)*p(x) where p(x) is the density of def __init__(self, w, mp, wp, mq, wq): if not (w>=0 and w<=1): raise RuntimeError('w must be in [0, 1]') self.w = w self.mp = mp self.wp = wp self.mq = mq self.wq = wq def dim(self): return 1 def sample(self, n, seed): rstate = np.random.get_state() np.random.seed(seed) w = self.w mp = self.mp wp = self.wp mq = self.mq wq = self.wq disc_var = stats.rv_discrete(values=([0, 1], [w, 1-w]) ) ind = disc_var.rvs(size=n) ind0 = ind==0 #print ind0 ind1 = ind==1 # draw from Q ys = stats.uniform.rvs(loc=mq-wq/2.0, scale=wq, size=np.sum(ind0)) yb = stats.uniform.rvs(loc=mp-wp/2.0, scale=wp, size=np.sum(ind1)) y = np.hstack((ys, yb)) y = y[:, np.newaxis] # draw from P x = stats.uniform.rvs(loc=mp-wp/2.0, scale=wp, size=n) x = x[:, np.newaxis] np.random.set_state(rstate) return data.TSTData(x, y, label='mix2unif') # sample source n = 4000 alpha = 0.01 w = 0.4 seed = 43 prob_params = {'w': w, 'mp': 25, 'wp': 5, 'mq': 0, 'wq': 0.2} ss = SSMix2Unif(**prob_params) tst_data = ss.sample(n, seed=seed) tr = ss.sample(n//2, seed=seed) te = ss.sample(n//2, seed=seed+1) #tr, te = tst_data.split_tr_te(tr_proportion=0.5, seed=10) nte = te.X.shape[0] xtr, ytr = tr.xy() xytr = tr.stack_xy() bins = np.linspace(np.min(xytr), np.max(xytr), 30) normed_hist = True plt.hist(xtr, bins, label='X', alpha=0.5, normed=normed_hist) plt.hist(ytr, bins, label='Y', alpha=0.5, normed=normed_hist) plt.legend(loc='best') alpha = 0.01 nte = 400 rep = 400 # repeat many trials to see the value of the optimized location def two_locations_test_results(nte, k): k: an instance of Kernel Tp_results = [] Tq_results = [] shift_seed = 1000 for r in range(shift_seed, shift_seed+rep): #tst_data = ss.sample(n, seed=r) #tr, te = tst_data.split_tr_te(tr_proportion=0.5, seed=10) te = ss.sample(nte, seed=r+1) # test loc at the small bump Tq = np.array([[prob_params['mq']]]) # test loc at the big bump Tp = np.array([[prob_params['mp'] ]]) #Tp = np.array([[ 2 ]]) # actual test q_met = tst.METest(Tq, k, alpha) Tq_results.append(q_met.perform_test(te)) p_met = tst.METest(Tp, k, alpha) Tp_results.append(p_met.perform_test(te)) return Tp_results, Tq_results def prob_tq_better(nte, k): k: an instance of Kernel Tp_results, Tq_results = two_locations_test_results(nte, k) tp_lambs = np.array([r['test_stat'] for r in Tp_results ]) tq_lambs = np.array([r['test_stat'] for r in Tq_results ]) n_left_high = np.sum(tq_lambs>tp_lambs) return float(n_left_high)/rep, tp_lambs, tq_lambs def plot_tup_stats(tup_ntes): ps_small_better = np.array([t[0] for t in tup_ntes]) plt.plot(ntes, ps_small_better, 'ob-') plt.xlabel('nte') plt.ylabel('p(loc at small bump gives high $\hat{\lambda}_n$)') plt.figure() tp_lamb_means = np.array([np.mean(l) for l in [t[1] for t in tup_ntes]]) tp_lamb_stds = np.array([np.std(l) for l in [t[1] for t in tup_ntes]]) tq_lamb_means = np.array([np.mean(l) for l in [t[2] for t in tup_ntes]]) tq_lamb_stds = np.array([np.std(l) for l in [t[2] for t in tup_ntes]]) print('mq is the mean of the small bump') plt.errorbar(ntes, tp_lamb_means, tp_lamb_stds, label=r'$\hat{\mathbb{E}}[\hat{\lambda}_n \mid \mathrm{at }\,\, m_p]$') plt.errorbar(ntes, tq_lamb_means, tq_lamb_stds, label=r'$\hat{\mathbb{E}}[\hat{\lambda}_n \mid \mathrm{at }\,\, m_q]$') plt.xlabel('test sample size') plt.ylabel('$\hat{\lambda}_n$') plt.legend(loc='best') ntes = np.linspace(5, 200, num=7, dtype=np.int64) #ntes = np.array([ 25, 50, 75, 100, 150, 200, 250]) tri_width = 3 ktri = kernel.KTriangle(tri_width) ktri_tup_ntes = [prob_tq_better(nte, ktri) for nte in ntes] plot_tup_stats(ktri_tup_ntes) tp_lamb_means = np.array([np.mean(l) for l in [t[1] for t in ktri_tup_ntes]]) tp_lamb_stds = np.array([np.std(l) for l in [t[1] for t in ktri_tup_ntes]]) tq_lamb_means = np.array([np.mean(l) for l in [t[2] for t in ktri_tup_ntes]]) tq_lamb_stds = np.array([np.std(l) for l in [t[2] for t in ktri_tup_ntes]]) alpha = 0.01 nte = 400 rep = 300 #ntes = np.linspace(50, 300, num=7, dtype=np.int64) ntes = np.array([ 25, 50, 75, 100, 150, 200, 250]) #gwidth0 = 1 med_data = ss.sample(1000, seed=10) gwidth0 = util.meddistance(med_data.stack_xy(), subsample=1000)**2 kgauss = kernel.KGauss(gwidth0) tup_ntes = [prob_tq_better(nte, kgauss) for nte in ntes] plot_tup_stats(tup_ntes) dom = np.linspace(-3, 3, 200) for order in [0, 1, 2]: bspline_vals = sig.bspline(dom, order) plt.plot(dom, bspline_vals, label='order=%d'%order) plt.legend() plt.title('B-spline') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Chemistry Scheme Scope Step7: 1.4. Basic Approximations Step8: 1.5. Prognostic Variables Form Step9: 1.6. Number Of Tracers Step10: 1.7. Family Approach Step11: 1.8. Coupling With Chemical Reactivity Step12: 2. Key Properties --&gt; Software Properties Step13: 2.2. Code Version Step14: 2.3. Code Languages Step15: 3. Key Properties --&gt; Timestep Framework Step16: 3.2. Split Operator Advection Timestep Step17: 3.3. Split Operator Physical Timestep Step18: 3.4. Split Operator Chemistry Timestep Step19: 3.5. Split Operator Alternate Order Step20: 3.6. Integrated Timestep Step21: 3.7. Integrated Scheme Type Step22: 4. Key Properties --&gt; Timestep Framework --&gt; Split Operator Order Step23: 4.2. Convection Step24: 4.3. Precipitation Step25: 4.4. Emissions Step26: 4.5. Deposition Step27: 4.6. Gas Phase Chemistry Step28: 4.7. Tropospheric Heterogeneous Phase Chemistry Step29: 4.8. Stratospheric Heterogeneous Phase Chemistry Step30: 4.9. Photo Chemistry Step31: 4.10. Aerosols Step32: 5. Key Properties --&gt; Tuning Applied Step33: 5.2. Global Mean Metrics Used Step34: 5.3. Regional Metrics Used Step35: 5.4. Trend Metrics Used Step36: 6. Grid Step37: 6.2. Matches Atmosphere Grid Step38: 7. Grid --&gt; Resolution Step39: 7.2. Canonical Horizontal Resolution Step40: 7.3. Number Of Horizontal Gridpoints Step41: 7.4. Number Of Vertical Levels Step42: 7.5. Is Adaptive Grid Step43: 8. Transport Step44: 8.2. Use Atmospheric Transport Step45: 8.3. Transport Details Step46: 9. Emissions Concentrations Step47: 10. Emissions Concentrations --&gt; Surface Emissions Step48: 10.2. Method Step49: 10.3. Prescribed Climatology Emitted Species Step50: 10.4. Prescribed Spatially Uniform Emitted Species Step51: 10.5. Interactive Emitted Species Step52: 10.6. Other Emitted Species Step53: 11. Emissions Concentrations --&gt; Atmospheric Emissions Step54: 11.2. Method Step55: 11.3. Prescribed Climatology Emitted Species Step56: 11.4. Prescribed Spatially Uniform Emitted Species Step57: 11.5. Interactive Emitted Species Step58: 11.6. Other Emitted Species Step59: 12. Emissions Concentrations --&gt; Concentrations Step60: 12.2. Prescribed Upper Boundary Step61: 13. Gas Phase Chemistry Step62: 13.2. Species Step63: 13.3. Number Of Bimolecular Reactions Step64: 13.4. Number Of Termolecular Reactions Step65: 13.5. Number Of Tropospheric Heterogenous Reactions Step66: 13.6. Number Of Stratospheric Heterogenous Reactions Step67: 13.7. Number Of Advected Species Step68: 13.8. Number Of Steady State Species Step69: 13.9. Interactive Dry Deposition Step70: 13.10. Wet Deposition Step71: 13.11. Wet Oxidation Step72: 14. Stratospheric Heterogeneous Chemistry Step73: 14.2. Gas Phase Species Step74: 14.3. Aerosol Species Step75: 14.4. Number Of Steady State Species Step76: 14.5. Sedimentation Step77: 14.6. Coagulation Step78: 15. Tropospheric Heterogeneous Chemistry Step79: 15.2. Gas Phase Species Step80: 15.3. Aerosol Species Step81: 15.4. Number Of Steady State Species Step82: 15.5. Interactive Dry Deposition Step83: 15.6. Coagulation Step84: 16. Photo Chemistry Step85: 16.2. Number Of Reactions Step86: 17. Photo Chemistry --&gt; Photolysis Step87: 17.2. Environmental Conditions
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'mohc', 'ukesm1-0-ll', 'atmoschem') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.chemistry_scheme_scope') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "troposhere" # "stratosphere" # "mesosphere" # "mesosphere" # "whole atmosphere" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.basic_approximations') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.prognostic_variables_form') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "3D mass/mixing ratio for gas" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.number_of_tracers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.family_approach') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.coupling_with_chemical_reactivity') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Operator splitting" # "Integrated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_advection_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_physical_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_chemistry_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_alternate_order') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.integrated_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.integrated_scheme_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Implicit" # "Semi-implicit" # "Semi-analytic" # "Impact solver" # "Back Euler" # "Newton Raphson" # "Rosenbrock" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.turbulence') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.convection') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.precipitation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.emissions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.deposition') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.gas_phase_chemistry') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.tropospheric_heterogeneous_phase_chemistry') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.stratospheric_heterogeneous_phase_chemistry') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.photo_chemistry') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.timestep_framework.split_operator_order.aerosols') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.tuning_applied.global_mean_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.tuning_applied.regional_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.key_properties.tuning_applied.trend_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.matches_atmosphere_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.resolution.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.resolution.number_of_horizontal_gridpoints') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.resolution.number_of_vertical_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.grid.resolution.is_adaptive_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.transport.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.transport.use_atmospheric_transport') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.transport.transport_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.sources') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Vegetation" # "Soil" # "Sea surface" # "Anthropogenic" # "Biomass burning" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Climatology" # "Spatially uniform mixing ratio" # "Spatially uniform concentration" # "Interactive" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.prescribed_climatology_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.prescribed_spatially_uniform_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.interactive_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.surface_emissions.other_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.sources') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Aircraft" # "Biomass burning" # "Lightning" # "Volcanos" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Climatology" # "Spatially uniform mixing ratio" # "Spatially uniform concentration" # "Interactive" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.prescribed_climatology_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.prescribed_spatially_uniform_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.interactive_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.atmospheric_emissions.other_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.concentrations.prescribed_lower_boundary') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.emissions_concentrations.concentrations.prescribed_upper_boundary') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.species') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "HOx" # "NOy" # "Ox" # "Cly" # "HSOx" # "Bry" # "VOCs" # "isoprene" # "H2O" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_bimolecular_reactions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_termolecular_reactions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_tropospheric_heterogenous_reactions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_stratospheric_heterogenous_reactions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_advected_species') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.number_of_steady_state_species') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.interactive_dry_deposition') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.wet_deposition') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.gas_phase_chemistry.wet_oxidation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.gas_phase_species') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Cly" # "Bry" # "NOy" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.aerosol_species') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sulphate" # "Polar stratospheric ice" # "NAT (Nitric acid trihydrate)" # "NAD (Nitric acid dihydrate)" # "STS (supercooled ternary solution aerosol particule))" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.number_of_steady_state_species') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.sedimentation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.stratospheric_heterogeneous_chemistry.coagulation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.gas_phase_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.aerosol_species') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sulphate" # "Nitrate" # "Sea salt" # "Dust" # "Ice" # "Organic" # "Black carbon/soot" # "Polar stratospheric ice" # "Secondary organic aerosols" # "Particulate organic matter" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.number_of_steady_state_species') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.interactive_dry_deposition') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.tropospheric_heterogeneous_chemistry.coagulation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.photo_chemistry.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.photo_chemistry.number_of_reactions') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.photo_chemistry.photolysis.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Offline (clear sky)" # "Offline (with clouds)" # "Online" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmoschem.photo_chemistry.photolysis.environmental_conditions') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Manually set variable names Step2: ArviZ has stored the posterior variables with the provided names as expected, but it has also included other useful information in the InferenceData object. The log probability of each sample is stored in the sample_stats group under the name lp and all the arguments passed to the sampler as args have been saved in the observed_data group. Step3: From an InferenceData object, ArviZ's native data structure, the {func}posterior plot &lt;arviz.plot_posterior&gt; of a few variables can be done in one line Step4: Structuring the posterior as multidimensional variables Step5: After checking the default variable names, the trace of one dimension of eta can be plotted using ArviZ syntax Step6: blobs Step7: You can now use the blob_names argument to indicate how to store this blob-defined variable. As the group is not specified, it will go to sample_stats. Step8: Multi-group blobs Step9: This last version, which contains both observed data and posterior predictive can be used to plot posterior predictive checks
<ASSISTANT_TASK:> Python Code: import arviz as az import numpy as np import emcee az.style.use("arviz-darkgrid") J = 8 y_obs = np.array([28.0, 8.0, -3.0, 7.0, -1.0, 1.0, 18.0, 12.0]) sigma = np.array([15.0, 10.0, 16.0, 11.0, 9.0, 11.0, 10.0, 18.0]) def log_prior_8school(theta): mu, tau, eta = theta[0], theta[1], theta[2:] # Half-cauchy prior, hwhm=25 if tau < 0: return -np.inf prior_tau = -np.log(tau ** 2 + 25 ** 2) prior_mu = -(mu / 10) ** 2 # normal prior, loc=0, scale=10 prior_eta = -np.sum(eta ** 2) # normal prior, loc=0, scale=1 return prior_mu + prior_tau + prior_eta def log_likelihood_8school(theta, y, s): mu, tau, eta = theta[0], theta[1], theta[2:] return -((mu + tau * eta - y) / s) ** 2 def lnprob_8school(theta, y, s): prior = log_prior_8school(theta) like_vect = log_likelihood_8school(theta, y, s) like = np.sum(like_vect) return like + prior nwalkers = 40 # called chains in ArviZ ndim = J + 2 draws = 1500 pos = np.random.normal(size=(nwalkers, ndim)) pos[:, 1] = np.absolute(pos[:, 1]) sampler = emcee.EnsembleSampler( nwalkers, ndim, lnprob_8school, args=(y_obs, sigma) ) sampler.run_mcmc(pos, draws); # define variable names, it cannot be inferred from emcee var_names = ["mu", "tau"] + ["eta{}".format(i) for i in range(J)] idata1 = az.from_emcee(sampler, var_names=var_names) idata1 idata1.sel(draw=slice(100, None)) az.plot_posterior(idata1, var_names=["mu", "tau", "eta4"]) idata2 = az.from_emcee(sampler, slices=[0, 1, slice(2, None)]) idata2 az.plot_trace(idata2, var_names=["var_2"], coords={"var_2_dim_0": 4}); def lnprob_8school_blobs(theta, y, s): prior = log_prior_8school(theta) like_vect = log_likelihood_8school(theta, y, s) like = np.sum(like_vect) return like + prior, like_vect sampler_blobs = emcee.EnsembleSampler( nwalkers, ndim, lnprob_8school_blobs, args=(y_obs, sigma), ) sampler_blobs.run_mcmc(pos, draws); dims = {"eta": ["school"], "log_likelihood": ["school"]} idata3 = az.from_emcee( sampler_blobs, var_names = ["mu", "tau", "eta"], slices=[0, 1, slice(2,None)], blob_names=["log_likelihood"], dims=dims, coords={"school": range(8)} ) idata3 sampler_blobs.blobs[0, 1] def lnprob_8school_blobs(theta, y, sigma): mu, tau, eta = theta[0], theta[1], theta[2:] prior = log_prior_8school(theta) like_vect = log_likelihood_8school(theta, y, sigma) like = np.sum(like_vect) # store pointwise log likelihood, useful for model comparison with az.loo or az.waic # and posterior predictive samples as blobs return like + prior, (like_vect, np.random.normal((mu + tau * eta), sigma)) sampler_blobs = emcee.EnsembleSampler( nwalkers, ndim, lnprob_8school_blobs, args=(y_obs, sigma), ) sampler_blobs.run_mcmc(pos, draws); dims = {"eta": ["school"], "log_likelihood": ["school"], "y": ["school"]} idata4 = az.from_emcee( sampler_blobs, var_names = ["mu", "tau", "eta"], slices=[0, 1, slice(2,None)], arg_names=["y","sigma"], arg_groups=["observed_data", "constant_data"], blob_names=["log_likelihood", "y"], blob_groups=["log_likelihood", "posterior_predictive"], dims=dims, coords={"school": range(8)} ) idata4 az.plot_ppc(idata4, var_names=["y"], alpha=0.3, num_pp_samples=200); %load_ext watermark %watermark -n -u -v -iv -w <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 3.2 Nombres complexes Step2: 4.2 Définir les variables symboliques x_1, x_2, ... x_n Step3: Initialisation Step4: Importer quelques variables du module abc Step5: 5 Résolution d'équations Step6: Définir l'équation $x^2+y^2=16$ Step7: 5.2 Résoudre une équation Step8: Résoudre l'équation $x^2+2x=4$ Step9: 5.3 Résoudre un système d'équations Step10: Résoudre le système $x+y=34$, $xy^2=34$ Step11: 5.4 Syntaxe abrégée Step12: 5.5 Trouver les racines d'une fonction Step13: $$3x^3 + 52x - 265$$ Step14: 6 Tracer une fonction Step15: 6.1 Tracer une fonction R -> R Step16: $$g(x) = {3x^2 + 52x - 265 \over (x - 7)(x - 1)(x + 34)}$$ Step17: Approximer les racines de $$x^3 + 2x^2 - 1$$ avec un dessin Step18: 6.2 Tracer plusieurs fonctions R -> R Step19: 6.3 Tracer une fonction R^2 -> R Step20: $$x^2+y^2$$ Step21: $$x^2-y^2$$ Step22: $$(x^2-y^2)\sin(x)$$ Step23: 6.4 Dessiner une fonction R -> R^2 Step24: $$x = \sin(t)$$ Step25: Butterfly curve (transcendental) Step26: 6.5 Dessiner une fonction R -> R^3 Step27: \begin{align} x(u)&= \cos(u)\ y(u)&=\sin(u)\ z(u)&=u\end{align} Step28: \begin{align} x(u)&= u \cos(u)\ y(u)&=\sin(u)\ z(u)&=u\end{align} Step29: 6.6 Dessiner une fonction R^2 -> R^3 Step30: \begin{align} Step31: $$\vec r(\theta,\phi) = (\cos\theta \sin\phi, \sin\theta \sin \phi, \cos\phi), \quad 0 \leq \theta < 2\pi, 0 \leq \phi \leq \pi.$$ Step32: 6.7 Dessiner les solutions d'une équation implicite Step33: 6.8 Tracer une région de R^2 Step34: Tracer la fonction complexe identité $$f(z)=z$$ Step35: Tracer la fonction complexe $$f(z)=z^5-1$$ Step36: 7 Limites et séries
<ASSISTANT_TASK:> Python Code: 5 / 2 from sympy import Rational Rational(5,2) from sympy import S S? type(S(5)) S(5)/2 S('13/2') + S(5)/7 from sympy import arg,re,im,I a = 3 + 5*I re(a) im(a) arg(a).n() abs(a) from sympy import symbols x3,x4,x5,x6,x7 = symbols('x3:8') x3 + x4+ 6 *x7 from sympy import * init_printing(pretty_print=True, use_latex='mathjax') #from sympy.abc import * # à éviter from sympy.abc import a,b,c,n,t,u,v,w,x,y,z eq1 = Eq(x, 3) eq2 = Eq(x**2+y**2, 16) solve(eq1, x) solve(eq2, y) solve(Eq(x**2+2*x, 4)) eq1 = Eq(x+y, 34) eq2 = Eq(x*y, 34) systeme = [eq1, eq2] solve(systeme) eq1 = Eq(x+y, 34) eq2 = Eq(x*y**2, 34) systeme = [eq1, eq2] solve(systeme) solve([x+y-34, x*y-34]) roots(3*x**2+52*x-265) r1,r2,r3 = roots(3*x**3+52*x-265) r1.n(), r2.n(), r3.n() %matplotlib inline f = x**2 plot(x**2, (x,-20,20)) g = (3*x**2+52*x-265) / ((x-7)*(x-1)*(x+34)) plot(g, (x,-40,10), xlim=(-40, 10), ylim=(-2,2)) plot(x**3+2*x**2-1, (x,-2,1), ylim=(-1,1)) roots(x**3+2*x**2-1) plot(f, g) from sympy.plotting import plot3d j plot3d(x**2-y**2) plot3d((x**2-y**2)*sin(x)) from sympy.plotting import plot_parametric plot_parametric(sin(t), cos(t)) x = sin(t)*(E**cos(t)-2*cos(4*t)-sin(t/12)**5) y = cos(t)*(E**cos(t)-2*cos(4*t)-sin(t/12)**5) plot_parametric(x, y) from IPython.display import Image url = 'https://upload.wikimedia.org/wikipedia/commons/thumb/f/f5/Param_02.jpg/800px-Param_02.jpg' Image(url=url, width=500) from sympy.plotting import plot3d_parametric_line x = cos(u) y = sin(u) z = u plot3d_parametric_line(x,y,z) x = u*cos(u) y = u*sin(u) z = u plot3d_parametric_line(x,y,z) from sympy.plotting import plot3d_parametric_surface from sympy.abc import u,v R = 5 r = 2 X = cos(u)*(R+r*cos(v)) Y = sin(u)*(R+r*cos(v)) Z = r*sin(v) plot3d_parametric_surface(X, Y, Z, (u, -.5, 4), (v, -5, 5)) from sympy.abc import theta,phi from sympy import pi,cos,sin x = cos(theta)*sin(phi) y = sin(theta)*sin(phi) z = cos(theta) plot3d_parametric_surface(x,y,z,(theta,0,pi), (phi,0,pi)) from sympy import plot_implicit eq = Eq(x**2+y**2+x*y-2*x, 5) plot_implicit(eq) #from sympy import mpmath # Sympy (installation normale) import mpmath # SageMath from mpmath import cplot cplot(lambda z:z) cplot(lambda z:z**5-1) from sympy.abc import x limit(1/x, x, 0, dir='+') oo limit(1/x, x, oo) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Model Inputs Step2: Generator network Step3: Discriminator Step4: Hyperparameters Step5: Build network Step6: Discriminator and Generator Losses Step7: Optimizers Step8: Training Step9: Training loss Step10: Generator samples from training Step11: These are samples from the final training epoch. You can see the generator is able to reproduce numbers like 5, 7, 3, 0, 9. Since this is just a sample, it isn't representative of the full range of images this generator can make. Step12: Below I'm showing the generated images as the network was training, every 10 epochs. With bonus optical illusion! Step13: It starts out as all noise. Then it learns to make only the center white and the rest black. You can start to see some number like structures appear out of the noise. Looks like 1, 9, and 8 show up first. Then, it learns 5 and 3.
<ASSISTANT_TASK:> Python Code: %matplotlib inline import pickle as pkl import numpy as np import tensorflow as tf import matplotlib.pyplot as plt from tensorflow.examples.tutorials.mnist import input_data mnist = input_data.read_data_sets('MNIST_data') def model_inputs(real_dim, z_dim): inputs_real = tf.placeholder(tf.float32, (None, real_dim), name='input_real') inputs_z = tf.placeholder(tf.float32, (None, z_dim), name='input_z') return inputs_real, inputs_z def generator(z, out_dim, n_units=128, reuse=False, alpha=0.01): ''' Build the generator network. Arguments --------- z : Input tensor for the generator out_dim : Shape of the generator output n_units : Number of units in hidden layer reuse : Reuse the variables with tf.variable_scope alpha : leak parameter for leaky ReLU Returns ------- out, logits: ''' with tf.variable_scope('generator', reuse=reuse): # finish this # Hidden layer h1 = tf.layers.dense(z, n_units) # Leaky ReLU h1 = tf.maximum(alpha * h1, h1) # Logits and tanh output logits = tf.layers.dense(h1, out_dim) out = tf.nn.tanh(logits) return out def discriminator(x, n_units=128, reuse=False, alpha=0.01): ''' Build the discriminator network. Arguments --------- x : Input tensor for the discriminator n_units: Number of units in hidden layer reuse : Reuse the variables with tf.variable_scope alpha : leak parameter for leaky ReLU Returns ------- out, logits: ''' with tf.variable_scope('discriminator', reuse=reuse): # finish this # Hidden layer h1 = tf.layers.dense(x, n_units) # Leaky ReLU h1 = tf.maximum(alpha * h1, h1) logits = tf.layers.dense(h1, 1) out = tf.sigmoid(logits) return out, logits # Size of input image to discriminator input_size = 784 # 28x28 MNIST images flattened # Size of latent vector to generator z_size = 100 # Sizes of hidden layers in generator and discriminator g_hidden_size = 128 d_hidden_size = 128 # Leak factor for leaky ReLU alpha = 0.01 # Label smoothing smooth = 0.1 tf.reset_default_graph() # Create our input placeholders input_real, input_z = model_inputs(input_size, z_size) # Generator network here g_model = generator(input_z, input_size, n_units=g_hidden_size, alpha=alpha) # g_model is the generator output # Disriminator network here d_model_real, d_logits_real = discriminator(input_real, n_units=d_hidden_size, alpha=alpha) d_model_fake, d_logits_fake = discriminator(g_model, reuse=True, n_units=d_hidden_size, alpha=alpha) # Calculate losses d_loss_real = tf.reduce_mean(tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_real, labels=tf.ones_like(d_logits_real) * (1 - smooth))) d_loss_fake = tf.reduce_mean(tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_fake, labels=tf.zeros_like(d_logits_real))) d_loss = d_loss_real + d_loss_fake g_loss = tf.reduce_mean(tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_fake, labels=tf.ones_like(d_logits_fake))) # Optimizers learning_rate = 0.002 # Get the trainable_variables, split into G and D parts t_vars = tf.trainable_variables() g_vars = [var for var in t_vars if var.name.startswith('generator')] d_vars = [var for var in t_vars if var.name.startswith('discriminator')] d_train_opt = tf.train.AdamOptimizer(learning_rate).minimize(d_loss, var_list=d_vars) g_train_opt = tf.train.AdamOptimizer(learning_rate).minimize(g_loss, var_list=g_vars) batch_size = 100 epochs = 100 samples = [] losses = [] saver = tf.train.Saver(var_list = g_vars) with tf.Session() as sess: sess.run(tf.global_variables_initializer()) for e in range(epochs): for ii in range(mnist.train.num_examples//batch_size): batch = mnist.train.next_batch(batch_size) # Get images, reshape and rescale to pass to D batch_images = batch[0].reshape((batch_size, 784)) batch_images = batch_images*2 - 1 # Sample random noise for G batch_z = np.random.uniform(-1, 1, size=(batch_size, z_size)) # Run optimizers _ = sess.run(d_train_opt, feed_dict={input_real: batch_images, input_z: batch_z}) _ = sess.run(g_train_opt, feed_dict={input_z: batch_z}) # At the end of each epoch, get the losses and print them out train_loss_d = sess.run(d_loss, {input_z: batch_z, input_real: batch_images}) train_loss_g = g_loss.eval({input_z: batch_z}) print("Epoch {}/{}...".format(e+1, epochs), "Discriminator Loss: {:.4f}...".format(train_loss_d), "Generator Loss: {:.4f}".format(train_loss_g)) # Save losses to view after training losses.append((train_loss_d, train_loss_g)) # Sample from generator as we're training for viewing afterwards sample_z = np.random.uniform(-1, 1, size=(16, z_size)) gen_samples = sess.run( generator(input_z, input_size, reuse=True), feed_dict={input_z: sample_z}) samples.append(gen_samples) saver.save(sess, './checkpoints/generator.ckpt') # Save training generator samples with open('train_samples.pkl', 'wb') as f: pkl.dump(samples, f) %matplotlib inline import matplotlib.pyplot as plt fig, ax = plt.subplots() losses = np.array(losses) plt.plot(losses.T[0], label='Discriminator') plt.plot(losses.T[1], label='Generator') plt.title("Training Losses") plt.legend() def view_samples(epoch, samples): fig, axes = plt.subplots(figsize=(7,7), nrows=4, ncols=4, sharey=True, sharex=True) for ax, img in zip(axes.flatten(), samples[epoch]): ax.xaxis.set_visible(False) ax.yaxis.set_visible(False) im = ax.imshow(img.reshape((28,28)), cmap='Greys_r') return fig, axes # Load samples from generator taken while training with open('train_samples.pkl', 'rb') as f: samples = pkl.load(f) _ = view_samples(-1, samples) rows, cols = 10, 6 fig, axes = plt.subplots(figsize=(7,12), nrows=rows, ncols=cols, sharex=True, sharey=True) for sample, ax_row in zip(samples[::int(len(samples)/rows)], axes): for img, ax in zip(sample[::int(len(sample)/cols)], ax_row): ax.imshow(img.reshape((28,28)), cmap='Greys_r') ax.xaxis.set_visible(False) ax.yaxis.set_visible(False) saver = tf.train.Saver(var_list=g_vars) with tf.Session() as sess: saver.restore(sess, tf.train.latest_checkpoint('checkpoints')) sample_z = np.random.uniform(-1, 1, size=(16, z_size)) gen_samples = sess.run( generator(input_z, input_size, reuse=True), feed_dict={input_z: sample_z}) view_samples(0, [gen_samples]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Checkerboard Step2: Use vizarray to visualize a checkerboard of size=20 with a block size of 10px. Step3: Use vizarray to visualize a checkerboard of size=27 with a block size of 5px.
<ASSISTANT_TASK:> Python Code: import numpy as np %matplotlib inline import matplotlib.pyplot as plt import seaborn as sns import antipackage import github.ellisonbg.misc.vizarray as va def checkerboard(size): Z = np.empty((size,size),dtype=float) Z.fill(1.0) Z[1::2,::2] = 0.0 Z[::2,1::2] = 0.0 return Z va.vizarray(Z) checkerboard(4) a = checkerboard(4) assert a[0,0]==1.0 assert a.sum()==8.0 assert a.dtype==np.dtype(float) assert np.all(a[0,0:5:2]==1.0) assert np.all(a[1,0:5:2]==0.0) b = checkerboard(5) assert b[0,0]==1.0 assert b.sum()==13.0 assert np.all(b.ravel()[0:26:2]==1.0) assert np.all(b.ravel()[1:25:2]==0.0) va.enable() va.set_block_size(10) checkerboard(20) assert True va.set_block_size(5) checkerboard(27) assert True <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Description Step7: 1.4. Land Atmosphere Flux Exchanges Step8: 1.5. Atmospheric Coupling Treatment Step9: 1.6. Land Cover Step10: 1.7. Land Cover Change Step11: 1.8. Tiling Step12: 2. Key Properties --&gt; Conservation Properties Step13: 2.2. Water Step14: 2.3. Carbon Step15: 3. Key Properties --&gt; Timestepping Framework Step16: 3.2. Time Step Step17: 3.3. Timestepping Method Step18: 4. Key Properties --&gt; Software Properties Step19: 4.2. Code Version Step20: 4.3. Code Languages Step21: 5. Grid Step22: 6. Grid --&gt; Horizontal Step23: 6.2. Matches Atmosphere Grid Step24: 7. Grid --&gt; Vertical Step25: 7.2. Total Depth Step26: 8. Soil Step27: 8.2. Heat Water Coupling Step28: 8.3. Number Of Soil layers Step29: 8.4. Prognostic Variables Step30: 9. Soil --&gt; Soil Map Step31: 9.2. Structure Step32: 9.3. Texture Step33: 9.4. Organic Matter Step34: 9.5. Albedo Step35: 9.6. Water Table Step36: 9.7. Continuously Varying Soil Depth Step37: 9.8. Soil Depth Step38: 10. Soil --&gt; Snow Free Albedo Step39: 10.2. Functions Step40: 10.3. Direct Diffuse Step41: 10.4. Number Of Wavelength Bands Step42: 11. Soil --&gt; Hydrology Step43: 11.2. Time Step Step44: 11.3. Tiling Step45: 11.4. Vertical Discretisation Step46: 11.5. Number Of Ground Water Layers Step47: 11.6. Lateral Connectivity Step48: 11.7. Method Step49: 12. Soil --&gt; Hydrology --&gt; Freezing Step50: 12.2. Ice Storage Method Step51: 12.3. Permafrost Step52: 13. Soil --&gt; Hydrology --&gt; Drainage Step53: 13.2. Types Step54: 14. Soil --&gt; Heat Treatment Step55: 14.2. Time Step Step56: 14.3. Tiling Step57: 14.4. Vertical Discretisation Step58: 14.5. Heat Storage Step59: 14.6. Processes Step60: 15. Snow Step61: 15.2. Tiling Step62: 15.3. Number Of Snow Layers Step63: 15.4. Density Step64: 15.5. Water Equivalent Step65: 15.6. Heat Content Step66: 15.7. Temperature Step67: 15.8. Liquid Water Content Step68: 15.9. Snow Cover Fractions Step69: 15.10. Processes Step70: 15.11. Prognostic Variables Step71: 16. Snow --&gt; Snow Albedo Step72: 16.2. Functions Step73: 17. Vegetation Step74: 17.2. Time Step Step75: 17.3. Dynamic Vegetation Step76: 17.4. Tiling Step77: 17.5. Vegetation Representation Step78: 17.6. Vegetation Types Step79: 17.7. Biome Types Step80: 17.8. Vegetation Time Variation Step81: 17.9. Vegetation Map Step82: 17.10. Interception Step83: 17.11. Phenology Step84: 17.12. Phenology Description Step85: 17.13. Leaf Area Index Step86: 17.14. Leaf Area Index Description Step87: 17.15. Biomass Step88: 17.16. Biomass Description Step89: 17.17. Biogeography Step90: 17.18. Biogeography Description Step91: 17.19. Stomatal Resistance Step92: 17.20. Stomatal Resistance Description Step93: 17.21. Prognostic Variables Step94: 18. Energy Balance Step95: 18.2. Tiling Step96: 18.3. Number Of Surface Temperatures Step97: 18.4. Evaporation Step98: 18.5. Processes Step99: 19. Carbon Cycle Step100: 19.2. Tiling Step101: 19.3. Time Step Step102: 19.4. Anthropogenic Carbon Step103: 19.5. Prognostic Variables Step104: 20. Carbon Cycle --&gt; Vegetation Step105: 20.2. Carbon Pools Step106: 20.3. Forest Stand Dynamics Step107: 21. Carbon Cycle --&gt; Vegetation --&gt; Photosynthesis Step108: 22. Carbon Cycle --&gt; Vegetation --&gt; Autotrophic Respiration Step109: 22.2. Growth Respiration Step110: 23. Carbon Cycle --&gt; Vegetation --&gt; Allocation Step111: 23.2. Allocation Bins Step112: 23.3. Allocation Fractions Step113: 24. Carbon Cycle --&gt; Vegetation --&gt; Phenology Step114: 25. Carbon Cycle --&gt; Vegetation --&gt; Mortality Step115: 26. Carbon Cycle --&gt; Litter Step116: 26.2. Carbon Pools Step117: 26.3. Decomposition Step118: 26.4. Method Step119: 27. Carbon Cycle --&gt; Soil Step120: 27.2. Carbon Pools Step121: 27.3. Decomposition Step122: 27.4. Method Step123: 28. Carbon Cycle --&gt; Permafrost Carbon Step124: 28.2. Emitted Greenhouse Gases Step125: 28.3. Decomposition Step126: 28.4. Impact On Soil Properties Step127: 29. Nitrogen Cycle Step128: 29.2. Tiling Step129: 29.3. Time Step Step130: 29.4. Prognostic Variables Step131: 30. River Routing Step132: 30.2. Tiling Step133: 30.3. Time Step Step134: 30.4. Grid Inherited From Land Surface Step135: 30.5. Grid Description Step136: 30.6. Number Of Reservoirs Step137: 30.7. Water Re Evaporation Step138: 30.8. Coupled To Atmosphere Step139: 30.9. Coupled To Land Step140: 30.10. Quantities Exchanged With Atmosphere Step141: 30.11. Basin Flow Direction Map Step142: 30.12. Flooding Step143: 30.13. Prognostic Variables Step144: 31. River Routing --&gt; Oceanic Discharge Step145: 31.2. Quantities Transported Step146: 32. Lakes Step147: 32.2. Coupling With Rivers Step148: 32.3. Time Step Step149: 32.4. Quantities Exchanged With Rivers Step150: 32.5. Vertical Grid Step151: 32.6. Prognostic Variables Step152: 33. Lakes --&gt; Method Step153: 33.2. Albedo Step154: 33.3. Dynamics Step155: 33.4. Dynamic Lake Extent Step156: 33.5. Endorheic Basins Step157: 34. Lakes --&gt; Wetlands
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'ipsl', 'sandbox-1', 'land') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_atmosphere_flux_exchanges') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "water" # "energy" # "carbon" # "nitrogen" # "phospherous" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.atmospheric_coupling_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_cover') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "bare soil" # "urban" # "lake" # "land ice" # "lake ice" # "vegetated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_cover_change') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.energy') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.water') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.carbon') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.timestep_dependent_on_atmosphere') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.timestepping_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.horizontal.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.horizontal.matches_atmosphere_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.vertical.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.vertical.total_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_water_coupling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.number_of_soil layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.structure') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.texture') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.organic_matter') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.water_table') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.continuously_varying_soil_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.soil_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.prognostic') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.functions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation type" # "soil humidity" # "vegetation state" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.direct_diffuse') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "distinction between direct and diffuse albedo" # "no distinction between direct and diffuse albedo" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.number_of_wavelength_bands') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.vertical_discretisation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.number_of_ground_water_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.lateral_connectivity') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "perfect connectivity" # "Darcian flow" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Bucket" # "Force-restore" # "Choisnel" # "Explicit diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.number_of_ground_ice_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.ice_storage_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.permafrost') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.drainage.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.drainage.types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Gravity drainage" # "Horton mechanism" # "topmodel-based" # "Dunne mechanism" # "Lateral subsurface flow" # "Baseflow from groundwater" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.vertical_discretisation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.heat_storage') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Force-restore" # "Explicit diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "soil moisture freeze-thaw" # "coupling with snow temperature" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.number_of_snow_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.density') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.water_equivalent') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.heat_content') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.temperature') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.liquid_water_content') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_cover_fractions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "ground snow fraction" # "vegetation snow fraction" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "snow interception" # "snow melting" # "snow freezing" # "blowing snow" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_albedo.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "prescribed" # "constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_albedo.functions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation type" # "snow age" # "snow density" # "snow grain type" # "aerosol deposition" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.dynamic_vegetation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation types" # "biome types" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "broadleaf tree" # "needleleaf tree" # "C3 grass" # "C4 grass" # "vegetated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biome_types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "evergreen needleleaf forest" # "evergreen broadleaf forest" # "deciduous needleleaf forest" # "deciduous broadleaf forest" # "mixed forest" # "woodland" # "wooded grassland" # "closed shrubland" # "opne shrubland" # "grassland" # "cropland" # "wetlands" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_time_variation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed (not varying)" # "prescribed (varying from files)" # "dynamical (varying from simulation)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_map') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.interception') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.phenology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic (vegetation map)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.phenology_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.leaf_area_index') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prescribed" # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.leaf_area_index_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biomass') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biomass_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biogeography') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biogeography_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.stomatal_resistance') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "light" # "temperature" # "water availability" # "CO2" # "O3" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.stomatal_resistance_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.number_of_surface_temperatures') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.evaporation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "alpha" # "beta" # "combined" # "Monteith potential evaporation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "transpiration" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.anthropogenic_carbon') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "grand slam protocol" # "residence time" # "decay time" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.forest_stand_dynamics') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.photosynthesis.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.autotrophic_respiration.maintainance_respiration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.autotrophic_respiration.growth_respiration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.allocation_bins') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "leaves + stems + roots" # "leaves + stems + roots (leafy + woody)" # "leaves + fine roots + coarse roots + stems" # "whole plant (no distinction)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.allocation_fractions') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed" # "function of vegetation type" # "function of plant allometry" # "explicitly calculated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.phenology.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.mortality.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.is_permafrost_included') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.emitted_greenhouse_gases') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.impact_on_soil_properties') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.grid_inherited_from_land_surface') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.grid_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.number_of_reservoirs') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.water_re_evaporation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "flood plains" # "irrigation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.coupled_to_atmosphere') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.coupled_to_land') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.quantities_exchanged_with_atmosphere') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.basin_flow_direction_map') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "present day" # "adapted for other periods" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.flooding') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.oceanic_discharge.discharge_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "direct (large rivers)" # "diffuse" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.oceanic_discharge.quantities_transported') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.coupling_with_rivers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.quantities_exchanged_with_rivers') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.vertical_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.ice_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.dynamics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "No lake dynamics" # "vertical" # "horizontal" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.dynamic_lake_extent') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.endorheic_basins') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.wetlands.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step3: Numerical Methods Step4: The errors here are significant. What matters is how fast the errors reduce as we change the grid spacing. Try changing from $\Delta x = 1$ to $\Delta x = 0.1$ Step5: We see roughly the expected scaling, with forward and backward differencing errors reducing by roughly $10$, and central differencing errors reducing by roughly $10^2$.
<ASSISTANT_TASK:> Python Code: def backward_differencing(f, x_i, dx): Backward differencing of f at x_i with grid spacing dx. f_i = f(x_i) f_i_minus_1 = f(x_i - dx) return (f_i - f_i_minus_1) / dx def forward_differencing(f, x_i, dx): Forward differencing of f at x_i with grid spacing dx. f_i = f(x_i) f_i_plus_1 = f(x_i + dx) return (f_i_plus_1 - f_i) / dx def central_differencing(f, x_i, dx): Second order central differencing of f at x_i with grid spacing dx. f_i = f(x_i) f_i_minus_1 = f(x_i - dx) f_i_plus_1 = f(x_i + dx) first_derivative = (f_i_plus_1 - f_i_minus_1) / (2.0 * dx) second_derivative = (f_i_minus_1 - 2.0 * f_i + f_i_plus_1) / (dx**2) return first_derivative, second_derivative import numpy bd = backward_differencing(numpy.exp, 0.0, dx=1.0) fd = forward_differencing(numpy.exp, 0.0, dx=1.0) cd1, cd2 = central_differencing(numpy.exp, 0.0, dx=1.0) print("Backward difference should be 1, is {}, error {}".format(bd, abs(bd - 1.0))) print("Forward difference should be 1, is {}, error {}".format(fd, abs(fd - 1.0))) print("Central difference (1st derivative) should be 1, is {}, error {}".format(cd1, abs(cd1 - 1.0))) print("Central difference (2nd derivative) should be 1, is {}, error {}".format(cd2, abs(cd2 - 1.0))) bd = backward_differencing(numpy.exp, 0.0, dx=0.1) fd = forward_differencing(numpy.exp, 0.0, dx=0.1) cd1, cd2 = central_differencing(numpy.exp, 0.0, dx=0.1) print("Backward difference should be 1, is {}, error {}".format(bd, abs(bd - 1.0))) print("Forward difference should be 1, is {}, error {}".format(fd, abs(fd - 1.0))) print("Central difference (1st derivative) should be 1, is {}, error {}".format(cd1, abs(cd1 - 1.0))) print("Central difference (2nd derivative) should be 1, is {}, error {}".format(cd2, abs(cd2 - 1.0))) from matplotlib import pyplot %matplotlib notebook dxs = numpy.logspace(-5, 0, 10) bd_errors = numpy.zeros_like(dxs) fd_errors = numpy.zeros_like(dxs) cd1_errors = numpy.zeros_like(dxs) cd2_errors = numpy.zeros_like(dxs) for i, dx in enumerate(dxs): bd_errors[i] = abs(backward_differencing(numpy.exp, 0.0, dx) - 1.0) fd_errors[i] = abs(forward_differencing(numpy.exp, 0.0, dx) - 1.0) cd1, cd2 = central_differencing(numpy.exp, 0.0, dx) cd1_errors[i] = abs(cd1 - 1.0) cd2_errors[i] = abs(cd2 - 1.0) pyplot.figure() pyplot.loglog(dxs, bd_errors, 'kx', label='Backwards') pyplot.loglog(dxs, fd_errors, 'b+', label='Forwards') pyplot.loglog(dxs, cd1_errors, 'go', label='Central (1st)') pyplot.loglog(dxs, cd2_errors, 'r^', label='Central (2nd)') pyplot.loglog(dxs, dxs*(bd_errors[0]/dxs[0]), 'k-', label=r"$p=1$") pyplot.loglog(dxs, dxs**2*(cd1_errors[0]/dxs[0]**2), 'k--', label=r"$p=2$") pyplot.xlabel(r"$\Delta x$") pyplot.ylabel("Error") pyplot.legend(loc="lower right") pyplot.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Compare it with this Step2: As with many Python statements, you can almost read-off the meaning of this statement in plain English Step3: Conditionals Step4: Dictionary comprehension Step5: Keyword arguments in functions (kwargs) Step6: Cleaning up after model runs Step10: Aside Step11: Initialise the object m Step12: No results yet Step13: Run the model Step14: Now, delete all *.pyc files in the working directory Step15: Take-home code snippet (using path.py) Step16: Or using os module Step17: Remove the directory Step18: Polar ~~stereoscopic~~ stereographic maps Step19: Now, let's try the same North Polar Stereographic projection plot with cartopy. Step20: References
<ASSISTANT_TASK:> Python Code: L = [] for n in range(12): L.append(n ** 2) L L = [n ** 2 for n in range(12)] L L = [n ** 0.5 for n in [11, 22, 33]] L [(i, j) for i in range(2) for j in range(3)] L = [] for i in range(2): for j in range(3): if i == 0: L.append((i, j)) L [val for val in range(20) if val % 3 == 0 and val != 0] [val if val % 2 else -val for val in range(20) if val % 3] d = {k: v for k, v in zip('abc', range(3))} d {k: v for k, v in d.items() if k in ['a', 'c']} def catch_all(*args, **kwargs): print("Positional (required) arguments:\t", args) print("Keyword (optional) arguments:\t", kwargs) # print(kwargs['pi']) catch_all(1, 2, 3, a=4, b=5) catch_all('a', keyword=2) inputs = (1, 2, 3) keywords = {'pi': 3.14, 'e': 2.71} catch_all(*inputs, **keywords) def fun(a=1, pi=3, e=2): print(a, pi, e) fun(**keywords) class MyClass: def __init__(self, **kwargs): self.__dict__.update(kwargs) data = dict(var=123) a = MyClass(blahblah=456) a.blahblah from path import Path from tempfile import mkdtemp import uuid class MockModel(object): Mock model that generates empty files def __init__(self, workdir=None): Initialise the model Kwargs: workdir: working directory path; defaults to a temporary directory if workdir is None: self.workdir = Path(mkdtemp()) else: self.workdir = Path(workdir) # .abspath() self.workdir.makedirs_p() def run(self, n, extensions=['tmp']): Run the model Args: n: int, number of random files to generate assert isinstance(n, int), 'n must be an integer!' self.files = [] for ext in extensions: for _ in range(n): f = self.workdir / 'junk_{filename}.{ext}'.format(filename=uuid.uuid4(), ext=ext) with f.open('wb') as fout: random_data = Path('/dev/urandom').open('rb').read(1024) fout.write(random_data) self.files.append(f) def show_results(self, pattern='*'): return [x for x in sorted(self.workdir.glob(pattern)) if x.isfile()] def clean_all(self, pattern): for f in self.workdir.glob(pattern): f.remove() def purge(self): self.workdir.rmtree_p() m = MockModel('such_folder_wow') m.show_results() m.run(2, extensions=['temp', 'pyc', 'out']) m.show_results() m.clean_all('*.pyc') def clean_dir(dirname, pattern): d = Path(dirname) for file in d.glob(pattern): file.remove() import os from glob import glob def clean_dir(dirname, pattern): absdir = os.path.abspath(dirname) p = '{absdir}/{pattern}'.format(absdir=absdir, pattern=pattern) for file in glob(p): os.remove(file) clean_dir('such_folder_wow', '*.so') m.purge() import matplotlib.pyplot as plt import numpy as np from mpl_toolkits.basemap import Basemap fig, ax = plt.subplots() mymap = Basemap(ax=ax, projection='npstere', boundinglat=60, round='True', lon_0=0, lat_0=90) mymap.drawcoastlines() mymap.drawmeridians(np.arange(-180, 181, 60), latmax=90); mymap.drawparallels(np.arange(-90, 91, 5)); import cartopy.crs as ccrs %matplotlib inline plt.rcParams['figure.figsize'] = (8, 8) fig = plt.figure() ax = fig.add_subplot(111, projection=ccrs.Stereographic(central_latitude=90)) ax.set_extent([-180, 180, 60, 90], ccrs.PlateCarree()) ax.gridlines() ax.coastlines() import matplotlib.path as mpath fig = plt.figure() ax = fig.add_subplot(111, projection=ccrs.NorthPolarStereo()) ax.coastlines() ax.set_extent([-180, 180, 60, 90], ccrs.PlateCarree()) ax.gridlines() # Compute a circle in axes coordinates, which we can use as a boundary # for the map. We can pan/zoom as much as we like - the boundary will be # permanently circular. theta = np.linspace(0, 2*np.pi, 100) center, radius = [0.5, 0.5], 0.5 verts = np.vstack([np.sin(theta), np.cos(theta)]).T circle = mpath.Path(verts * radius + center) ax.set_boundary(circle, transform=ax.transAxes) HTML(html) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 移動モデル Step2: 観測モデル Step3: 尤度計算
<ASSISTANT_TASK:> Python Code: %matplotlib inline import numpy as np import math, random # 計算用、乱数の生成用ライブラリ import matplotlib.pyplot as plt # 描画用ライブラリ class Landmarks: def __init__(self, array): self.positions = array # array = [[1個めの星のx座標, 1個めの星のy座標], [2個めの星のx座標, 2個めの星のy座標]...] def draw(self): # ランドマークの位置を取り出して描画 xs = [e[0] for e in self.positions] ys = [e[1] for e in self.positions] plt.scatter(xs,ys,s=300,marker="*",label="landmarks",color="orange") def Movement(pos, fw, rot): # 移動モデル # posからfw前進、rot回転した位置をリストで返す # 雑音の入った前進、回転の動き actual_fw = random.gauss(fw, fw * 0.2) # 20%の標準偏差でばらつく actual_rot = random.gauss(rot, rot * 0.2) # 20%の標準偏差でばらつく dir_error = random.gauss(0.0, math.pi / 180.0 * 3.0) # 3[deg]の標準偏差 # 異動前の位置を保存 px, py, pt = pos # 移動後の位置を計算 x = px + actual_fw * math.cos(pt + dir_error) y = py + actual_fw * math.sin(pt + dir_error) t = pt + dir_error + actual_rot # dir_errorを足す # 結果を返す return [x,y,t] def Observation(pos, landmark): # 観測モデル # posから見えるランドマークの距離と方向をリストで返す obss = [] # センサの計測範囲 # 距離0.1 ~ 1 # 角度90 ~ -90[deg] sensor_max_range = 1.0 sensor_min_range = 0.1 sensor_max_angle = math.pi / 2 sensor_min_angle = -math.pi / 2 # ロボットやパーティクルの位置姿勢を保存 rx, ry, rt = pos # ランドマークごとに観測 for lpos in landmark.positions: true_lx, true_ly = lpos # 観測が成功したらresultをTrue result = True # ロボットとランドマークの距離を計算 # センサの範囲外であればresultがFalseに distance = math.sqrt((rx - true_lx) ** 2 + (ry - true_ly) ** 2) if distance > sensor_max_range or distance < sensor_min_range: result = False # ロボットから見えるランドマークの方向を計算 # こちらもセンサの範囲外であればresultがFalseに direction = math.atan2(true_ly - ry, true_lx - rx) - rt if direction > math.pi: direction -= 2 * math.pi if direction < - math.pi: direction += 2 * math.pi if direction > sensor_max_angle or direction < sensor_min_angle: result = False # 雑音の大きさを設定 # これは尤度計算に使う正規分布関数の分散になる sigma_d = distance * 0.2 # 20%の標準偏差 sigma_f = math.pi * 3 / 180 # 3degの標準偏差 # 雑音を混ぜる d = random.gauss(distance, sigma_d) f = random.gauss(direction, sigma_f) # 観測データを保存 z = [] z.append([d, f, sigma_d, sigma_f, result]) return z class Robot: def __init__(self, x, y, rad): random.seed() # ステップごとにロボットの姿勢の真値が入った配列 self.actual_poses = [[x,y,rad]] def move(self,fw,rot): # ロボットの位置を記録する(軌跡を残すために配列に入れてる) self.actual_poses.append(Movement(self.actual_poses[-1], fw, rot)) def observation(self, landmarks): # 現在地から見た観測データの保存 self.z = Observation(self.actual_poses[-1], landmarks) # 矢印の描画に必要な位置と方向を計算して描画 def draw(self, sp): xs = [e[0] for e in self.actual_poses] ys = [e[1] for e in self.actual_poses] vxs = [math.cos(e[2]) for e in self.actual_poses] vys = [math.sin(e[2]) for e in self.actual_poses] plt.quiver(xs,ys,vxs,vys,color="red",scale=15,angles='xy',scale_units='xy',alpha = 0.3) def draw(i): # グラフの設定 fig = plt.figure(i, figsize=(8,8)) sp = fig.add_subplot(111,aspect='equal') sp.set_xlim(-0.5,2.0) sp.set_ylim(-0.5,0.5) # ロボット、ランドマークの描画 for robot in robots: robot.draw(sp) if i: for robot in robots: for obs in robot.z: d = obs[0] f = obs[1] x = d * math.cos(f) y = d * math.sin(f) plt.plot(x, y, "o") actual_landmarks.draw() plt.legend() actual_landmarks = Landmarks([[1.0,0.0]]) robots = [] for i in range(100): robots.append(Robot(0,0,0)) for robot in robots: robot.move(1.0, 0) draw(0) actual_landmarks = Landmarks([[1.0,0.0]]) robots = [] for i in range(100): robots.append(Robot(0,0,0)) for robot in robots: robot.observation(actual_landmarks) draw(1) rd = 1 rf = 0 sigma_rd = 1.0 * 0.2 sigma_rf = math.pi * 3 / 180 pd = np.arange(-3, 3, 0.01) pf = np.arange(-3, 3, 0.01) d = np.exp(-(rd - pd) ** 2 / (2 * (sigma_rd ** 2))) / (sigma_rd * np.sqrt(2 * np.pi)) f = np.exp(-(rf - pf) ** 2 / (2 * (sigma_rf ** 2))) / (sigma_rf * np.sqrt(2 * np.pi)) fig = plt.figure(figsize=(10,4)) sp = fig.add_subplot(111) sp.set_xlim(-0.5,2.0) sp.set_ylim(-0.5,8) plt.plot(pd, d, color = "orange",label="distance") plt.plot(pf, f, color = "blue",label="direction") plt.legend() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: Call dialogflow with python api Step3: examples of making session url Step4: visit Mega Agent and print Step5: visit media/Music Agent Step6: visit active version in a specified environment Step7: Webhook handle
<ASSISTANT_TASK:> Python Code: # check firewall !rm index.html* !wget www.google.com import uuid from google.cloud import dialogflow # session format: 'projects/*/locations/*/agent/environments/*/users/*/sessions/*'. def get_session(project_id, session_id, env=None): Using the same `session_id` between requests allows continuation of the conversation. :return: session is a str if env is None: session_client = dialogflow.SessionsClient() session = session_client.session_path(project_id, session_id) return session else: assert isinstance(env, str) return f"projects/{project_id}/agent/environments/{env}/sessions/{session_id}" # [START dialogflow_detect_intent_text] def detect_intent_texts(project_id, session_id, text, language_code, env=None): Returns the result of detect intent with texts as inputs. Using the same `session_id` between requests allows continuation of the conversation. session= get_session(project_id, session_id, env=env) print("Session path: {}\n".format(session)) text_input = dialogflow.TextInput(text=text, language_code=language_code) query_input = dialogflow.QueryInput(text=text_input) response = session_client.detect_intent( request={"session": session, "query_input": query_input} ) return response # set credentials, this is a must import os os.environ["GOOGLE_APPLICATION_CREDENTIALS"] ="/mnt/d/code/sabala/mega-sabala-9ibe-940e7527ac9b.json" from google.cloud import dialogflow project_id = "sabala-348110" session_id = str(uuid.uuid4()) # texts = ["Me toque uma música", "toca nos 80", "Tocar música clássica", "parar música"][-1:] language_code = "en-US" session = get_session(project_id, session_id, env='new') session project_id = "mega-sabala-9ibe" session_id = str(uuid.uuid4()) texts = ["how's the weather today", "Você pode me dizer a maneira mais fácil de ganhar dinheiro?"] texts = ["parar música"] language_code = "pt-BR" response = detect_intent_texts( project_id, session_id, texts, language_code ) response.output_audio = "None" print("=" * 20) print("Query text: {}".format(response.query_result.query_text)) print( "Detected intent: {} (confidence: {})\n".format( response.query_result.intent.display_name, response.query_result.intent_detection_confidence, ) ) print("Fulfillment text: {}\n".format(response.query_result.fulfillment_text)) print("Fulfillment Full: \n{}\n".format(response)) print(type(response)) project_id = "sabala-348110" session_id = str(uuid.uuid4()) texts = ["Me toque uma música", "toca nos 80", "Tocar música clássica", "parar música"] language_code = "en-US" response = detect_intent_texts( project_id, session_id, texts[-1], language_code ) print( [(_, type(_)) for _ in dir(response) if not _.startswith("_")] ) response.output_audio = "None" print(response.query_result.intent) response = detect_intent_texts( project_id, session_id, texts[-1], language_code, env='new' ) # TODO: change the default Entry Point text to handleWebhook def handleWebhook(request): req = request.get_json() responseText = "" intent = req["queryResult"]["intent"]["displayName"] if intent == "Default Welcome Intent": responseText = "Hello from a GCF Webhook" elif intent == "get-agent-name": responseText = "My name is Flowhook" else: responseText = f"There are no fulfillment responses defined for Intent {intent}" # You can also use the google.cloud.dialogflowcx_v3.types.WebhookRequest protos instead of manually writing the json object res = {"fulfillmentMessages": [{"text": {"text": [responseText]}}]} return res handleWebhook(response) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code:: def possible(x,S,N): minSum = (x * (x + 1))//2 maxSum = (x * ((2 * N) - x + 1))//2 if(S < minSum or S > maxSum): return False return True def findPermutation(N ,L ,R ,S ): x = R - L + 1 if (not possible( x , S , N)) : print(" - 1") return else : v = [] for i in range(N , 0 , - 1): if(( S - i)>= 0 and possible(x - 1 , S - i , i - 1)) : S = S - i x -= 1 v . append(i) if(S == 0): break if(S != 0): print(- 1) return v1 = [] for i in range(1 , N + 1): it = i in v if(not it): v1 . append(i) j = 0 f = 0 for i in range(1 , L): print(v1[j], end = " ▁ ") j += 1 for i in range(L , R + 1): print(v[f], end = " ▁ ") f += 1 for i in range(R + 1 , N + 1): print(v1[j], end = " ▁ ") j += 1 return if __name__ == " _ _ main _ _ " : N = 6 L = 3 R = 5 S = 8 findPermutation(N , L , R , S) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: List of neurons Step2: Start client Step3: Utility functions Step4: Reset neurons Step5: Probe neurons by blinking LEDs Step6: Setup connections / weights / thresholds Step7: Stop the demo
<ASSISTANT_TASK:> Python Code: import os import sys import time sys.path.append(os.path.abspath(os.path.join(os.path.pardir, os.path.sep.join(['..', 'codes']), 'client'))) sys.path.append(os.path.abspath(os.path.join(os.path.pardir, os.path.sep.join(['..', 'codes']), 'node'))) sys.path.append(os.path.abspath(os.path.join(os.path.pardir, os.path.sep.join(['..', 'codes']), 'shared'))) sys.path.append(os.path.abspath(os.path.join(os.path.pardir, os.path.sep.join(['..', 'codes']), 'micropython'))) import client from collections import OrderedDict import pandas as pd from pandas import DataFrame from time import sleep REFRACTORY_PERIOD = 0.1 # 0.1 seconds neurons = ['n_Alpha', 'n_Beta', 'n_Lambda'] # neurons = ['n_Alpha'] neurons the_client = client.Client() the_client.start() while not the_client.status['Is connected']: time.sleep(1) print('Node not ready yet.') # # Ask Hub for a list of connected nodes # def list_nodes(): # the_client.node.worker.roll_call() # time.sleep(2) # remote_nodes = sorted(the_client.node.worker.contacts.keys()) # print('\n[____________ Connected nodes ____________]\n') # print('\nConnected nodes:\n{}\n'.format(remote_nodes)) # return remote_nodes def reset_node(node): message = {'message_type': 'exec', 'to_exec': 'import machine;machine.reset()'} the_client.request(node, message) def fire(node): message = {'message_type': 'function', 'function': 'fire'} the_client.request(node, message) def addConnection(node, neuron): message = {'message_type': 'function', 'function': 'addConnection', 'kwargs': {'neuron_id': neuron}} the_client.request(node, message) def set_connections(node, connections): message = {'message_type': 'function', 'function': 'setConnections', 'kwargs': {'connections': connections}} the_client.request(node, message) def get_connections(node): message = {'message_type': 'function', 'function': 'getConnections', 'need_result': True} _, result = the_client.request(node, message) return result.get() def setWeight(node, neuron, weight): message = {'message_type': 'function', 'function': 'setWeight', 'kwargs': {'neuron_id': neuron, 'weight': weight,}} the_client.request(node, message) def setThreshold(node, threshold): message = {'message_type': 'function', 'function': 'setThreshold', 'kwargs': {'threshold': threshold}} the_client.request(node, message) def getConfig(node): message = {'message_type': 'function', 'function': 'getConfig', 'need_result': True} _, result = the_client.request(node, message) return result.get() def getLog(node): message = {'message_type': 'function', 'function': 'getLog', 'need_result': True} _, result = the_client.request(node, message) return result.get() def emptyLog(node): message = {'message_type': 'function', 'function': 'emptyLog'} the_client.request(node, message) def emptyLogs(): for neuron in neurons: emptyLog(neuron) def mergeLogs(): logs = [] for neuron in neurons: if neuron != the_client.node.worker.name: # exclude client self currentLog = getLog(neuron) if currentLog: logs += currentLog df = DataFrame(list(logs), columns = ['time', 'neuron', 'message']) df.set_index('time', inplace = True) df.sort_index(inplace = True) return df def printConfig(neuron): print('{0:_^78}\n {1}\n'.format(neuron + " config:", getConfig(neuron))) # reset_node('Hub'); messages = {} messages['blink_led'] = {'message_type': 'command', 'command': 'blink led', 'kwargs': {'times': 3, 'on_seconds': 0.1, 'off_seconds': 0.1}} the_client.request('Hub', messages['blink_led']); addConnection('n_Alpha', 'n_Lambda'); addConnection('n_Beta', 'n_Lambda'); setWeight('n_Lambda', 'n_Alpha', 1); setWeight('n_Lambda', 'n_Beta', 1); setThreshold('n_Lambda', 2.8); # input enough to trigger Lambda fire('n_Alpha'); fire('n_Beta'); setThreshold('n_Lambda', 2.8); # input not enough to trigger Lambda fire('n_Alpha'); fire('n_Beta'); setThreshold('n_Lambda', 1.8); # input not enough to trigger Lambda fire('n_Alpha'); setThreshold('n_Lambda', 1.8); # input enough to trigger Lambda fire('n_Alpha'); fire('n_Beta'); # setThreshold('n_Lambda', 1.8); # emptyLogs() # sleep(REFRACTORY_PERIOD) # fire('n_Alpha') # fire('n_Beta') # sleep(2) # mergeLogs() # for neuron in reversed(neurons): printConfig(neuron) # Stopping the_client.stop() the_client = None print ('\n[________________ Demo stopped ________________]\n') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: json output Step2: The information contained in the json is largely related to the observational data, e.g. photometry and models in the observed bands.
<ASSISTANT_TASK:> Python Code: import requests import pickle r = requests.get('http://drgmk.com/sdb/seds/masters/' 'sdb-v2-132436.10-513016.1/public/sdb-v2-132436.10-513016.1-mnest/phoenix_m+modbb_disk_r_.json') d = r.json() for k in d.keys(): print(k, type(d[k])) s = requests.get('http://drgmk.com/sdb/seds/masters/' 'sdb-v2-132436.10-513016.1/public/sdb-v2-132436.10-513016.1-mnest/phoenix_m+modbb_disk_r_.pkl') r = pickle.loads(s.content) # print the model component fluxes for the MIRI bands print(f'filter: {r.model_comps}, total') for i,f in enumerate(r.all_filters): if 'NIRCAM' in f: print(f, r.all_comp_phot[:,i], r.all_phot[i]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Part One Step2: The following function evaluates the normal (Gaussian) probability density function (PDF) within 4 standard deviations of the mean. It takes and rv object and returns a pair of NumPy arrays. Step3: Here's what the two distributions look like. Step4: Let's assume for now that those are the true distributions for the population. Step5: Both samples are NumPy arrays. Now we can compute sample statistics like the mean and standard deviation. Step6: The sample mean is close to the population mean, but not exact, as expected. Step7: And the results are similar for the female sample. Step8: On average, men are 14--15 centimeters taller. For some applications, that would be a good way to describe the difference, but there are a few problems Step9: STOP HERE Step10: A better, but slightly more complicated threshold is the place where the PDFs cross. Step11: In this example, there's not much difference between the two thresholds. Step12: And how many women are above it Step13: The "overlap" is the total area under the curves that ends up on the wrong side of the threshold. Step14: Or in more practical terms, you might report the fraction of people who would be misclassified if you tried to use height to guess sex Step15: Another way to quantify the difference between distributions is what's called "probability of superiority", which is a problematic term, but in this context it's the probability that a randomly-chosen man is taller than a randomly-chosen woman. Step17: Overlap (or misclassification rate) and "probability of superiority" have two good properties Step18: Computing the denominator is a little complicated; in fact, people have proposed several ways to do it. This implementation uses the "pooled standard deviation", which is a weighted average of the standard deviations of the two groups. Step20: Most people don't have a good sense of how big $d=1.9$ is, so let's make a visualization to get calibrated. Step22: Here's the function that takes Cohen's $d$, plots normal distributions with the given effect size, and prints their overlap and superiority. Step23: Here's an example that demonstrates the function Step24: And an interactive widget you can use to visualize what different values of $d$ mean
<ASSISTANT_TASK:> Python Code: %matplotlib inline from __future__ import print_function, division import numpy import scipy.stats import matplotlib.pyplot as pyplot from ipywidgets import interact, interactive, fixed import ipywidgets as widgets # seed the random number generator so we all get the same results numpy.random.seed(17) # some nice colors from http://colorbrewer2.org/ COLOR1 = '#7fc97f' COLOR2 = '#beaed4' COLOR3 = '#fdc086' COLOR4 = '#ffff99' COLOR5 = '#386cb0' mu1, sig1 = 178, 7.7 male_height = scipy.stats.norm(mu1, sig1) mu2, sig2 = 163, 7.3 female_height = scipy.stats.norm(mu2, sig2) def eval_pdf(rv, num=4): mean, std = rv.mean(), rv.std() xs = numpy.linspace(mean - num*std, mean + num*std, 100) ys = rv.pdf(xs) return xs, ys xs, ys = eval_pdf(male_height) pyplot.plot(xs, ys, label='male', linewidth=4, color=COLOR2) xs, ys = eval_pdf(female_height) pyplot.plot(xs, ys, label='female', linewidth=4, color=COLOR3) pyplot.xlabel('height (cm)') None male_sample = male_height.rvs(1000) female_sample = female_height.rvs(1000) mean1, std1 = male_sample.mean(), male_sample.std() mean1, std1 mean2, std2 = female_sample.mean(), female_sample.std() mean2, std2 difference_in_means = male_sample.mean() - female_sample.mean() difference_in_means # in cm # Solution goes here relative_difference = difference_in_means / male_sample.mean() print(relative_difference * 100) # percent # A problem with relative differences is that you have to choose which mean to express them relative to. relative_difference = difference_in_means / female_sample.mean() print(relative_difference * 100) # percent simple_thresh = (mean1 + mean2) / 2 simple_thresh thresh = (std1 * mean2 + std2 * mean1) / (std1 + std2) thresh male_below_thresh = sum(male_sample < thresh) male_below_thresh female_above_thresh = sum(female_sample > thresh) female_above_thresh overlap = male_below_thresh / len(male_sample) + female_above_thresh / len(female_sample) overlap misclassification_rate = overlap / 2 misclassification_rate # Solution goes here sum(x > y for x, y in zip(male_sample, female_sample)) / len(male_sample) def CohenEffectSize(group1, group2): Compute Cohen's d. group1: Series or NumPy array group2: Series or NumPy array returns: float diff = group1.mean() - group2.mean() n1, n2 = len(group1), len(group2) var1 = group1.var() var2 = group2.var() pooled_var = (n1 * var1 + n2 * var2) / (n1 + n2) d = diff / numpy.sqrt(pooled_var) return d CohenEffectSize(male_sample, female_sample) def overlap_superiority(control, treatment, n=1000): Estimates overlap and superiority based on a sample. control: scipy.stats rv object treatment: scipy.stats rv object n: sample size control_sample = control.rvs(n) treatment_sample = treatment.rvs(n) thresh = (control.mean() + treatment.mean()) / 2 control_above = sum(control_sample > thresh) treatment_below = sum(treatment_sample < thresh) overlap = (control_above + treatment_below) / n superiority = sum(x > y for x, y in zip(treatment_sample, control_sample)) / n return overlap, superiority def plot_pdfs(cohen_d=2): Plot PDFs for distributions that differ by some number of stds. cohen_d: number of standard deviations between the means control = scipy.stats.norm(0, 1) treatment = scipy.stats.norm(cohen_d, 1) xs, ys = eval_pdf(control) pyplot.fill_between(xs, ys, label='control', color=COLOR3, alpha=0.7) xs, ys = eval_pdf(treatment) pyplot.fill_between(xs, ys, label='treatment', color=COLOR2, alpha=0.7) o, s = overlap_superiority(control, treatment) print('overlap', o) print('superiority', s) plot_pdfs(2) slider = widgets.FloatSlider(min=0, max=4, value=2) interact(plot_pdfs, cohen_d=slider) None <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We will set the pblum mode to dataset-scaled for estimators and optimizers, to avoid having to add pblum to the fitted parameters or adjusting it manually. We will also set distortion_method to 'sphere' to speed up the computation of the light curve. Step2: Set up and flip some constraints needed for adopting the solutions from the estimators Step3: Periodograms Step4: The lc_periodogram with algorithm='bls' seems to find the best period, so we'll keep that one moving forward Step5: V light curve - lc estimators Step6: RV - rv_geometry Step7: Plot results Step8: parameter values
<ASSISTANT_TASK:> Python Code: lc = np.loadtxt('data/lc.V.data') rv1 = np.loadtxt('data/rv1.data') rv2 = np.loadtxt('data/rv2.data') b = phoebe.default_binary() b.add_dataset('lc', times = lc[:,0], fluxes=lc[:,1], sigmas=lc[:,2], passband='Johnson:V') b.add_dataset('rv', passband='Johnson:V') b['times@rv@primary'], b['rvs@rv@primary'], b['sigmas@rv@primary'] = rv1[:,0], rv1[:,1], rv1[:,2] b['times@rv@secondary'], b['rvs@rv@secondary'], b['sigmas@rv@secondary'] = rv2[:,0], rv2[:,1], rv2[:,2] b.plot(x='times', show=True) b.set_value('pblum_mode', 'dataset-scaled') b.set_value_all('distortion_method', 'sphere') b.add_constraint('requivsumfrac') b.add_constraint('requivratio') b.add_constraint('teffratio') b.flip_constraint('requivratio', solve_for='requiv@secondary') b.flip_constraint('requivsumfrac', solve_for='requiv@primary') b.flip_constraint('teffratio', solve_for='teff@secondary') b.flip_constraint('esinw', solve_for='ecc') b.flip_constraint('ecosw', solve_for='per0') b.add_solver('estimator.lc_periodogram', solver='lcperiod_bls', algorithm='bls', minimum_n_cycles=2, sample_mode='manual', sample_periods = np.linspace(2.,2.5,1000), overwrite=True) b.run_solver('lcperiod_bls', solution='lcperiod_bls_sol', overwrite=True) print(b['lcperiod_bls_sol']) b.add_solver('estimator.lc_periodogram', solver='lcperiod_ls', algorithm='ls',sample_mode='manual', sample_periods = np.linspace(2.,2.5,1000), overwrite=True) b.run_solver('lcperiod_ls', solution='lcperiod_ls_sol', overwrite=True) print(b['lcperiod_ls_sol']) b.add_solver('estimator.rv_periodogram', solver='rvperiod', overwrite=True) b.run_solver('rvperiod', solution='rvperiod_sol', sample_mode='manual', sample_periods=np.linspace(2.,2.5,1000), overwrite=True) print(b['rvperiod_sol']) np.mean([2.3433433433433435, 2.381881881881882, 2.340840840840841]) b.adopt_solution('lcperiod_bls_sol') # b['period@binary'] = 2.346 b.plot(x='phase', show=True) lc_bls_periodogram_results = get_current_values(b, ['period@binary',]) b.adopt_solution('lcperiod_ls_sol') # b['period@binary'] = 2.346 b.plot(x='phase', show=True) lc_ls_periodogram_results = get_current_values(b, ['period@binary',]) b.adopt_solution('rvperiod_sol') # b['period@binary'] = 2.346 b.plot(x='phase', show=True) rv_periodogram_results = get_current_values(b, ['period@binary',]) b.adopt_solution('lcperiod_bls_sol') b.add_solver('estimator.ebai', solver='lc_est_ebai_mlp', ebai_method='mlp', phase_bin = False, overwrite=True) b.run_solver('lc_est_ebai_mlp', solution='lc_soln_ebai_mlp', overwrite=True) b.adopt_solution('lc_soln_ebai_mlp') b.run_compute(model='ebai_mlp_model') b.plot(x='phase',show=True) ebai_mlp_results = get_current_values(b, ['incl@binary', 'teffratio','requivsumfrac','esinw','ecosw']) b.add_solver('estimator.ebai', solver='lc_est_ebai_knn', ebai_method='knn', phase_bin = False, overwrite=True) b.run_solver('lc_est_ebai_knn', solution='lc_soln_ebai_knn', overwrite=True) b.adopt_solution('lc_soln_ebai_knn') b.run_compute(model='ebai_knn_model', overwrite=True) b.plot(x='phase',show=True) ebai_knn_results = get_current_values(b, ['incl@binary', 'teffratio','requivsumfrac','esinw','ecosw']) b.add_solver('estimator.lc_geometry', solver='lc_est_lcgeom', phase_bin = False) b.run_solver('lc_est_lcgeom', solution='lc_soln_lcgeom') b.flip_constraint('ecc', solve_for='esinw') b.flip_constraint('per0', solve_for='ecosw') b.adopt_solution('lc_soln_lcgeom') b.run_compute(model='lc_geometry_model') b.plot(x='phase', legend=True, save='testcase_estimators.png', show=True) b.flip_constraint('esinw', solve_for='ecc') b.flip_constraint('ecosw', solve_for='per0') lc_geometry_results = get_current_values(b, ['incl@binary', 'teffratio','requivsumfrac','esinw','ecosw']) b.add_solver('estimator.rv_geometry', solver='rvgeom') b.run_solver('rvgeom', solution='rvgeom_sol') b['adopt_parameters@rvgeom_sol'] = ['q', 'asini@binary', 'vgamma'] b.flip_constraint('asini@binary', solve_for='sma@binary') # b.flip_constraint('ecc', solve_for='esinw') # b.flip_constraint('per0', solve_for='ecosw') b.adopt_solution('rvgeom_sol') # b['period@binary'] = 2.345678901 b.run_compute(model='rvgeom_model') b.plot(x='phase', model='rvgeom_model', legend=True, show=True) rv_geometry_results = get_current_values(b, ['q', 'asini@binary','vgamma']) b.save('bundles/after_estimators.bundle') times = b.get_value('times', context='dataset', dataset='lc01') phases = b.to_phase(times) fluxes_true = b.get_value('fluxes', context='dataset', dataset='lc01') sigmas_true = b.get_value('sigmas', context='dataset', dataset='lc01') times_rv = b.get_value('times', context='dataset', component='primary', dataset='rv01') phases_rv = b.to_phase(times_rv) rvs1 = b.get_value('rvs', context='dataset', component='primary', dataset='rv01') rvs2 = b.get_value('rvs', context='dataset', component='secondary', dataset='rv01') sigmas1 = b.get_value('sigmas', context='dataset', component='primary', dataset='rv01') sigmas2 = b.get_value('sigmas', context='dataset', component='secondary', dataset='rv01') lc_ebai_mlp = get_model(b, model='ebai_mlp_model', dataset='lc01', phase_order=True) lc_ebai_knn = get_model(b, model='ebai_knn_model', dataset='lc01', phase_order=True) lc_geom = get_model(b, model='lc_geometry_model', dataset='lc01', phase_order=True) rv_geom1, rv_geom2 = get_model(b, model='rvgeom_model', dataset='rv01', model_type='rv', phase_order=True) fig, ((ax1, ax1b, ax2, ax3), (ax4, ax4b, ax5, ax6)) = plt.subplots(nrows = 2, ncols = 4, figsize=(7.25,2), gridspec_kw={'height_ratios': [2, 1]}) fig.subplots_adjust(hspace=0, wspace=0.3) lc_datapoints = {'fmt': '.', 'ms': 1, 'c': '0.5', 'zorder':0,} rv1_datapoints = {'fmt': ',', 'c': '0.0', 'zorder':0} rv2_datapoints = {'fmt': ',', 'c': '0.5', 'zorder':0} model_kwargs = {'lw': 1, 'zorder': 1} res_kwargs = {'s': 0.5} res_rv_kwargs = {'s': 3} for ax in [ax1, ax1b, ax2]: ax.errorbar(x=phases, y=fluxes_true, yerr=sigmas_true, rasterized=True, **lc_datapoints) ax3.errorbar(x=phases_rv, y=rvs1, yerr=sigmas1, rasterized=True, **rv1_datapoints) ax3.errorbar(x=phases_rv, y=rvs2, yerr=sigmas2, rasterized=True, **rv2_datapoints) ax1.plot(lc_ebai_mlp[:,1], lc_ebai_mlp[:,2], c=phoebe_c['orange'], **model_kwargs) ax4.scatter(lc_ebai_mlp[:,1], lc_ebai_mlp[:,3], c=phoebe_c['orange'], **res_kwargs) ax1b.plot(lc_ebai_knn[:,1], lc_ebai_knn[:,2], c=phoebe_c['blue'], **model_kwargs) ax4b.scatter(lc_ebai_knn[:,1], lc_ebai_knn[:,3], c=phoebe_c['blue'], **res_kwargs) ax2.plot(lc_geom[:,1], lc_geom[:,2],c=phoebe_c['green'], **model_kwargs) ax5.scatter(lc_geom[:,1], lc_geom[:,3], c=phoebe_c['green'], **res_kwargs) ax3.plot(rv_geom1[:,1], rv_geom1[:,2], c=phoebe_c['blue'], label='primary', **model_kwargs) ax3.plot(rv_geom2[:,1], rv_geom2[:,2], c=phoebe_c['red'], label='secondary', **model_kwargs) ax6.scatter(rv_geom1[:,1], rv_geom1[:,3], c=phoebe_c['blue'], **res_rv_kwargs) ax6.scatter(rv_geom2[:,1], rv_geom2[:,3], c=phoebe_c['red'],**res_rv_kwargs) # ax3.legend() for ax in [ax1, ax2, ax3]: ax.set_xticks([]) # for ax in [ax4, ax5, ax6]: # ax.set_xlabel('Phase') # ax1.set_ylabel('Flux [W/m$^2$]') # ax2.set_ylabel('Flux [W/m$^2$]', labelpad=12) # ax3.set_ylabel('RV [km/s]') # ax4.set_ylabel('Residuals [W/m$^2$]') # ax5.set_ylabel('Residuals [W/m$^2$]') # ax6.set_ylabel('Residuals [km/s]') ax1.set_title('EBAI - MLP', pad=14) ax1b.set_title('EBAI - kNN', pad=14) ax2.set_title('lc\_geometry', pad=14) ax3.set_title('rv\_geometry', pad=14) # fig.tight_layout() fig.savefig('figs/2_estimators_data.pdf', dpi=300) truths, twigs, labels = get_truths_labels() true_vals = {} for twig, value in zip(twigs, truths): true_vals[twig] = value twigs = [ 'period@binary', 'incl@binary', 'teffratio', 'requivsumfrac', 'esinw', 'ecosw', 'q', 'asini@binary', 'vgamma', ] labels = [r'$P$', r'$i$', r'$T_{\mathrm{eff},2}/T_{\mathrm{eff},1}$', r'$r_1+r_2$', r'$e\sin\omega$', r'$e\cos\omega$', r'$q$', r'$a\sin i$', r'$v_{\gamma}$' ] fig, axes = plt.subplots(nrows = 1, ncols = len(labels), figsize=(10,1.5)) fig.subplots_adjust(hspace=0, wspace=0.1) models = [lc_bls_periodogram_results, lc_ls_periodogram_results, rv_periodogram_results, ebai_mlp_results, ebai_knn_results, lc_geometry_results, rv_geometry_results] model_labels = [r'lc_periodogram (BLS)', r'lc_periodogram (LS)', r'rv_periodogram', r'EBAI_mlp', r'EBAI_knn', r'lc_geometry', r'rv_geometry'] colors = [phoebe_c['black'], phoebe_c['black'], phoebe_c['black'], phoebe_c['orange'], phoebe_c['blue'], phoebe_c['green'], phoebe_c['purple']] # import cmasher as cmr # colors = cmr.take_cmap_colors('cmr.rainforest', len(models), cmap_range=(0.05, 0.85), return_fmt='hex') print('model, twig, current_solution, previous_lc, previous_rv') for ax, label, twig in zip(axes, labels, twigs): ax.set_title(label) # ax.set_ylabel(ylabel) # ax.set_yticks([]) ax.margins(0.25) for i, model in enumerate(models): ax.axhline(i, linestyle='--', lw=0.5, color='gray') if twig in model.keys(): # print(model_labels[i], twig, model[twig], b_prev_lc.get_value(twig), b_prev_rv.get_value(twig)) ax.scatter(model[twig], i, c=colors[i], s=50, marker='x', zorder=1) # ax.scatter(b_prev_lc.get_value(twig), i, marker='o', fc='gray', ec='none') # ax.scatter(b_prev_rv.get_value(twig), i, marker='o', fc='none', ec='gray') else: pass ax.axvline(x=true_vals[twig], ls=':', lw=1.5, c=phoebe_c['red'], zorder=0) ax.set_ylim(-0.5, len(models)-1+0.5) for i,ax in enumerate(axes): # ax.grid(visible=True, which='major', axis='y', linestyle='--') if i==0: ax.set_yticks(np.arange(0,len(model_labels),1),model_labels) else: ax.yaxis.set_ticklabels([]) # fig.tight_layout() fig.savefig('figs/3_estimators_vals.pdf', dpi=300) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Please ignore any compatibility warnings and errors Step2: <h3> Extract sample data from BigQuery </h3> Step3: Let's increase the number of records so that we can do some neat graphs. There is no guarantee about the order in which records are returned, and so no guarantee about which records get returned if we simply increase the LIMIT. To properly sample the dataset, let's use the HASH of the pickup time and return 1 in 100,000 records -- because there are 1 billion records in the data, we should get back approximately 10,000 records if we do this. Step4: <h3> Exploring data </h3> Step5: Hmm ... do you see something wrong with the data that needs addressing? Step6: What's up with the streaks around 45 dollars and 50 dollars? Those are fixed-amount rides from JFK and La Guardia airports into anywhere in Manhattan, i.e. to be expected. Let's list the data to make sure the values look reasonable. Step7: Looking a few samples above, it should be clear that the total amount reflects fare amount, toll and tip somewhat arbitrarily -- this is because when customers pay cash, the tip is not known. So, we'll use the sum of fare_amount + tolls_amount as what needs to be predicted. Tips are discretionary and do not have to be included in our fare estimation tool. Step8: Hmm ... The min, max of longitude look strange. Step9: As you'd expect, rides that involve a toll are longer than the typical ride. Step10: The quality control has removed about 300 rows (11400 - 11101) or about 3% of the data. This seems reasonable. Step11: Let's write out the three dataframes to appropriately named csv files. We can use these csv files for local training (recall that these files represent only 1/100,000 of the full dataset) just to verify our code works, before we run it on all the data. Step12: <h3> Verify that datasets exist </h3> Step13: We have 3 .csv files corresponding to train, valid, test. The ratio of file-sizes correspond to our split of the data. Step14: Looks good! We now have our ML datasets and are ready to train ML models, validate them and evaluate them. Step16: <h2>Benchmark on same dataset</h2>
<ASSISTANT_TASK:> Python Code: !sudo chown -R jupyter:jupyter /home/jupyter/training-data-analyst !pip install tensorflow==2.1 --user from google.cloud import bigquery import seaborn as sns import matplotlib.pyplot as plt import pandas as pd import numpy as np import shutil %%bigquery SELECT FORMAT_TIMESTAMP("%Y-%m-%d %H:%M:%S %Z", pickup_datetime) AS pickup_datetime, pickup_longitude, pickup_latitude, dropoff_longitude, dropoff_latitude, passenger_count, trip_distance, tolls_amount, fare_amount, total_amount FROM `nyc-tlc.yellow.trips` LIMIT 10 %%bigquery trips SELECT FORMAT_TIMESTAMP("%Y-%m-%d %H:%M:%S %Z", pickup_datetime) AS pickup_datetime, pickup_longitude, pickup_latitude, dropoff_longitude, dropoff_latitude, passenger_count, trip_distance, tolls_amount, fare_amount, total_amount FROM `nyc-tlc.yellow.trips` WHERE ABS(MOD(FARM_FINGERPRINT(CAST(pickup_datetime AS STRING)), 100000)) = 1 print(len(trips)) # We can slice Pandas dataframes as if they were arrays trips[:10] ax = sns.regplot(x="trip_distance", y="fare_amount", fit_reg=False, ci=None, truncate=True, data=trips) ax.figure.set_size_inches(10, 8) %%bigquery trips SELECT FORMAT_TIMESTAMP("%Y-%m-%d %H:%M:%S %Z", pickup_datetime) AS pickup_datetime, pickup_longitude, pickup_latitude, dropoff_longitude, dropoff_latitude, passenger_count, trip_distance, tolls_amount, fare_amount, total_amount FROM `nyc-tlc.yellow.trips` WHERE ABS(MOD(FARM_FINGERPRINT(CAST(pickup_datetime AS STRING)), 100000)) = 1 AND trip_distance > 0 AND fare_amount >= 2.5 print(len(trips)) ax = sns.regplot(x="trip_distance", y="fare_amount", fit_reg=False, ci=None, truncate=True, data=trips) ax.figure.set_size_inches(10, 8) tollrides = trips[trips['tolls_amount'] > 0] tollrides[tollrides['pickup_datetime'] == '2012-02-27 09:19:10 UTC'] trips.describe() def showrides(df, numlines): lats = [] lons = [] for iter, row in df[:numlines].iterrows(): lons.append(row['pickup_longitude']) lons.append(row['dropoff_longitude']) lons.append(None) lats.append(row['pickup_latitude']) lats.append(row['dropoff_latitude']) lats.append(None) sns.set_style("darkgrid") plt.figure(figsize=(10,8)) plt.plot(lons, lats) showrides(trips, 10) showrides(tollrides, 10) def preprocess(trips_in): trips = trips_in.copy(deep=True) trips.fare_amount = trips.fare_amount + trips.tolls_amount del trips['tolls_amount'] del trips['total_amount'] del trips['trip_distance'] # we won't know this in advance! qc = np.all([\ trips['pickup_longitude'] > -78, \ trips['pickup_longitude'] < -70, \ trips['dropoff_longitude'] > -78, \ trips['dropoff_longitude'] < -70, \ trips['pickup_latitude'] > 37, \ trips['pickup_latitude'] < 45, \ trips['dropoff_latitude'] > 37, \ trips['dropoff_latitude'] < 45, \ trips['passenger_count'] > 0, ], axis=0) return trips[qc] tripsqc = preprocess(trips) tripsqc.describe() shuffled = tripsqc.sample(frac=1) trainsize = int(len(shuffled['fare_amount']) * 0.70) validsize = int(len(shuffled['fare_amount']) * 0.15) df_train = shuffled.iloc[:trainsize, :] df_valid = shuffled.iloc[trainsize:(trainsize+validsize), :] df_test = shuffled.iloc[(trainsize+validsize):, :] df_train.head(n=1) df_train.describe() df_valid.describe() df_test.describe() def to_csv(df, filename): outdf = df.copy(deep=False) outdf.loc[:, 'key'] = np.arange(0, len(outdf)) # rownumber as key # reorder columns so that target is first column cols = outdf.columns.tolist() cols.remove('fare_amount') cols.insert(0, 'fare_amount') print (cols) # new order of columns outdf = outdf[cols] outdf.to_csv(filename, header=False, index_label=False, index=False) to_csv(df_train, 'taxi-train.csv') to_csv(df_valid, 'taxi-valid.csv') to_csv(df_test, 'taxi-test.csv') !head -10 taxi-valid.csv !ls -l *.csv %%bash head taxi-train.csv def distance_between(lat1, lon1, lat2, lon2): # haversine formula to compute distance "as the crow flies". Taxis can't fly of course. dist = np.degrees(np.arccos(np.minimum(1,np.sin(np.radians(lat1)) * np.sin(np.radians(lat2)) + np.cos(np.radians(lat1)) * np.cos(np.radians(lat2)) * np.cos(np.radians(lon2 - lon1))))) * 60 * 1.515 * 1.609344 return dist def estimate_distance(df): return distance_between(df['pickuplat'], df['pickuplon'], df['dropofflat'], df['dropofflon']) def compute_rmse(actual, predicted): return np.sqrt(np.mean((actual-predicted)**2)) def print_rmse(df, rate, name): print ("{1} RMSE = {0}".format(compute_rmse(df['fare_amount'], rate*estimate_distance(df)), name)) FEATURES = ['pickuplon','pickuplat','dropofflon','dropofflat','passengers'] TARGET = 'fare_amount' columns = list([TARGET]) columns.append('pickup_datetime') columns.extend(FEATURES) # in CSV, target is the first column, after the features columns.append('key') df_train = pd.read_csv('taxi-train.csv', header=None, names=columns) df_valid = pd.read_csv('taxi-valid.csv', header=None, names=columns) df_test = pd.read_csv('taxi-test.csv', header=None, names=columns) rate = df_train['fare_amount'].mean() / estimate_distance(df_train).mean() print ("Rate = ${0}/km".format(rate)) print_rmse(df_train, rate, 'Train') print_rmse(df_valid, rate, 'Valid') print_rmse(df_test, rate, 'Test') validation_query = SELECT (tolls_amount + fare_amount) AS fare_amount, pickup_datetime, pickup_longitude AS pickuplon, pickup_latitude AS pickuplat, dropoff_longitude AS dropofflon, dropoff_latitude AS dropofflat, passenger_count*1.0 AS passengers, 'unused' AS key FROM `nyc-tlc.yellow.trips` WHERE ABS(MOD(FARM_FINGERPRINT(CAST(pickup_datetime AS STRING)), 10000)) = 2 AND trip_distance > 0 AND fare_amount >= 2.5 AND pickup_longitude > -78 AND pickup_longitude < -70 AND dropoff_longitude > -78 AND dropoff_longitude < -70 AND pickup_latitude > 37 AND pickup_latitude < 45 AND dropoff_latitude > 37 AND dropoff_latitude < 45 AND passenger_count > 0 client = bigquery.Client() df_valid = client.query(validation_query).to_dataframe() print_rmse(df_valid, 2.59988, 'Final Validation Set') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Introduction Step2: At first glance Step5: 1. On a yearly basis, does Baseball players who attended to college have greater income compared to those who didn't? Step6: 2. Having College graduated player gives teams better chance to win World Series? Step7: There are some interesting spots in the charts, there are gaps between <br> Step8: In this case for year 2016, those teams with more college students <br> Step10: Final Conclusion
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import numpy as np import pandas as pd import seaborn as sns #Loads important files for this analysis filename = 'baseballdatabank-2017.1\core\Teams.csv' teams_df = pd.read_csv(filename) filename = 'baseballdatabank-2017.1\core\Salaries.csv' salaries_df = pd.read_csv(filename) filename = 'baseballdatabank-2017.1\core\Master.csv' master_df = pd.read_csv(filename) filename = 'baseballdatabank-2017.1\core\CollegePlaying.csv' college_df = pd.read_csv(filename) filename = 'baseballdatabank-2017.1\core\Appearances.csv' appearances_df = pd.read_csv(filename) #In the master table get those players who went to college or not went = college_df.playerID.unique() #append the new column to the original dataFrame master_df['went_to_college'] = master_df.playerID.isin(went) #get players who attended to college and those who didn't college_playing = master_df[master_df['went_to_college']] non_college_playing = master_df[master_df['went_to_college']==False] #now get the salaries of the players to describe and compare #create an index dataFrame of the ssalaries table to splti the table #no need to append this column to that table salaries_df['went_to_college'] = salaries_df.playerID.isin(went) college_player_salaries = salaries_df[salaries_df['went_to_college']] non_college_player_salaries = salaries_df[salaries_df['went_to_college']==False] #Salaries on year 2016 college_salaries2016 = college_player_salaries[college_player_salaries.yearID==2016] non_college_salaries2016 = non_college_player_salaries[non_college_player_salaries.yearID==2016] #Salaries on year 2015 college_salaries2015 = college_player_salaries[college_player_salaries.yearID==2015] non_college_salaries2015 = non_college_player_salaries[non_college_player_salaries.yearID==2015] #Salaries on year 2014 college_salaries2014 = college_player_salaries[college_player_salaries.yearID==2014] non_college_salaries2014 = non_college_player_salaries[non_college_player_salaries.yearID==2014] def put_salaries_hist(row, col, df, axes, lbl,year): Draws an histogram whit a line on the average, to depict the distribution of the salaries data, and prints lables and legends. titlestr = '{}College Players, year {}' xlabel = '\nIncome x10 Million Dollars\n\n' #plt.title('Left Title', loc='left') axes[ax,col].title.set_text(titlestr.format(lbl, year)) axes[ax,col].set_ylabel('Count') #divide the average salalry in the data between 1 million meanmd = df.salary.values.mean() /1000000 axes[ax,col].set_xlabel(xlabel) #put the histogram axes[ax,col].hist(df.salary.values) #draw a line for the average of the group axes[ax,col].axvline(df.salary.values.mean(), color='c', linestyle='dashed', linewidth=2, label='Avg ${0:.2f} MD'.format(meanmd)) #show legends legend = axes[ax,col].legend(loc='upper center', shadow=True) %pylab inline fig, axes = plt.subplots(nrows=3, ncols=2, figsize=(9, 10), sharey=True,sharex=False,edgecolor='k') #put the resulting DataFrames into lists to easily get the charts ylist = ['2014','2015','2016'] alist = [college_salaries2014 , college_salaries2015, college_salaries2016] blist = [non_college_salaries2014 , non_college_salaries2015, non_college_salaries2016] #row counter ax = 0 #string to put label on each chart for ax in range( len(alist)): #the figure has 2 columns, the column on the left has the colleger players data # the column on the right has the non college players data year = ylist[ax] #college players salaries adf = alist[ax] put_salaries_hist(ax,0,adf,axes,'',year) #non college players salaries adf = blist[ax] put_salaries_hist(ax,1,adf,axes,'Non ',year) ax = ax + 1 fig.subplots_adjust(hspace = 1.1,wspace=0.8) #get the avegare salary by year #year average wages for college player clgmeans = college_player_salaries.groupby('yearID').salary.mean() #year average wages for non college player nclgmeans = non_college_player_salaries.groupby('yearID').salary.mean() #year average wages for all player allmean = salaries_df.groupby('yearID').salary.mean() fig, axes = plt.subplots(nrows=1, ncols=1, figsize=(8, 7), sharex=False) #Draw a plot chart to contain the three results axes.title.set_text('Average salary for all playes from 1985 ot 2016') axes.plot(clgmeans,label='College', marker='o') axes.plot(nclgmeans, label='Non College') axes.plot(allmean, label='All', marker='+') axes.set_xlabel('Year') axes.set_ylabel('Player income') legend = axes.legend(loc='upper center', shadow=True) def count_college_players(row): Counts the number of college players a team has had every year, only counts player who attended college on, or before the year of each record. This function is designed to be used with a DataFram.apply call works on values of a row and returns the count of players args: row a row of the master_df Dataframe return: the count of college players for a team on one year teamID = row['teamID'] yearID = row['yearID'] #from the appearances table het the player from each team that year yrteampls = appearances_df[appearances_df['yearID']==yearID] yrteampls = yrteampls[ yrteampls['teamID']==teamID] #now get the players that went to college on, or before that year clgplyr = college_df[college_df['yearID']<=yearID] #merge the filtered appearances and college table merged = yrteampls.merge(clgplyr, on=['playerID'], how='inner') #by counting the number of resulting records of the merging #we can know how many college player had that team on that year count = len(merged) return count #count the number of college players each team had each year teams_df['college_player_count'] = teams_df.apply(count_college_players,axis=1) #get two groups, winners of World Series and Non winners winnners_clg_plyrs = teams_df[teams_df.WSWin=='Y'] not_winnners_clg_plyrs = teams_df[teams_df.WSWin=='N'] def put_college_winners_scatter(col, axes, df, title): Draws a scatter plots of the count of college player in the DataFrame args: col - Column of the subplot axes - Axes array of the matplotlib figure df - DataFre with the used data axes[col].title.set_text(title) axes[col].scatter(df['yearID'].values, df['college_player_count'].values) axes[col].set_xlabel('Year') axes[col].set_ylabel('Number of college players') fig, axes = plt.subplots(nrows=1, ncols=2, figsize=(10, 5), sharey=True,sharex=False) put_college_winners_scatter(0,axes,winnners_clg_plyrs, 'Winners of World Series and\nnumber of college players') put_college_winners_scatter(1,axes,not_winnners_clg_plyrs, 'Non winners of World Series and\nnumber of college players') winnners_clg_plyrs_b1910 = winnners_clg_plyrs[winnners_clg_plyrs['yearID']<=1910] not_winnners_clg_plyrs_b1910 = not_winnners_clg_plyrs[not_winnners_clg_plyrs['yearID']<=1910] fig, axes = plt.subplots(nrows=1, ncols=2, figsize=(10, 5), sharey=True,sharex=False) put_college_winners_scatter(0,axes,winnners_clg_plyrs_b1910, 'Winners of World Series and\nnumber of college players\nbefore 1910') put_college_winners_scatter(1,axes,not_winnners_clg_plyrs_b1910, 'Non winners of World Series and\nnumber of college players\nbefore 1910') winnners_clg_plyrs_50_70 = winnners_clg_plyrs[winnners_clg_plyrs['yearID']>=1950] winnners_clg_plyrs_50_70 = winnners_clg_plyrs_50_70[winnners_clg_plyrs_50_70['yearID']<=1970] not_winnners_clg_plyrs_50_70 = not_winnners_clg_plyrs[not_winnners_clg_plyrs['yearID']>=1950] not_winnners_clg_plyrs_50_70 = not_winnners_clg_plyrs_50_70[not_winnners_clg_plyrs_50_70['yearID']<=1970] fig, axes = plt.subplots(nrows=1, ncols=2, figsize=(10, 5), sharey=True,sharex=False) put_college_winners_scatter(0,axes,winnners_clg_plyrs_50_70, 'Winners of World Series and\nnumber of college players\nbeetwen 1950 and 1970') put_college_winners_scatter(1,axes,not_winnners_clg_plyrs_50_70, 'Non winners of World Series and\nnumber of college players\nbeetwen 1950 and 1970') #the teams_df now has a column with the count of college players teams_df = teams_df.sort_values(by='yearID', ascending=False) teams_clgplr2016 = teams_df[teams_df['yearID']==2016] x = teams_clgplr2016.W.values y = teams_clgplr2016.college_player_count.values fig, axScatter = plt.subplots(figsize=(5.5, 5.5)) axScatter.title.set_text('Games won by team and number of college players\nOn year 2016') axScatter.scatter(x,y,label='a label') axScatter.set_xlabel('Games Won') axScatter.set_ylabel('Number of college players') teams_clgplr20yrs = teams_df[teams_df['yearID']>=(2016-20)] x = teams_clgplr20yrs.W.values y = teams_clgplr20yrs.college_player_count.values fig, axScatter = plt.subplots(figsize=(5.5, 5.5)) axScatter.title.set_text('Games won by team and number of college players\nFrom 1996 to 2016') axScatter.scatter(x,y,label='a label') axScatter.set_xlabel('Games Won') axScatter.set_ylabel('Number of college players') #load the CPI data filename = 'cpi_1985_2017.csv' cpi_df = pd.read_csv(filename) def get_year_cpi(year): try: return cpi_df[cpi_df['yearID']==year].cpi.values[0] except: return 0 current_cpi = get_year_cpi(2017) def convert_wages(row): This function convert salaries to today's values using the Customer Price Index year = row['yearID'] old_value = row['salary'] old_cpi = get_year_cpi(year) today_value = ((old_value * (current_cpi/old_cpi))) return today_value salaries_df['todays_salary'] = salaries_df.apply(convert_wages, axis=1) allmean_cpi_adj = salaries_df.groupby('yearID').todays_salary.mean() clgmeans = salaries_df[salaries_df['went_to_college']].groupby('yearID').todays_salary.mean() nclgmeans = salaries_df[salaries_df['went_to_college'] == False].groupby('yearID').todays_salary.mean() fig, axes = plt.subplots(nrows=1, ncols=1, figsize=(8, 7), sharex=False) #Draw a plot chart to contain the three results axes.title.set_text('Average salary for all playes from 1985 ot 2016\n Adjusted for inflation') axes.plot(clgmeans,label='College', marker='o') axes.plot(nclgmeans, label='Non College') axes.plot(allmean_cpi_adj, label='All', marker='+') axes.set_xlabel('Year') axes.set_ylabel('Player income') legend = axes.legend(loc='upper center', shadow=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The function toDot takes four arguments Step2: Priority Queues implemented as Heaps Step3: The function ascend takes two arguments Step4: The function descend(A) takes one argument A where A is an array that is organized as a heap. Step5: Implementing the API Step6: The function elevate(H, o, p) takes three arguments. Step7: Testing
<ASSISTANT_TASK:> Python Code: import graphviz as gv def heapToDot(A): n = len(A) dot = gv.Digraph(node_attr={'shape': 'record'}) for k, (p, o) in enumerate(A): if str(p) != str(o): dot.node(str(k), label='{' + str(p) + '|' + str(o) + '|' + str(o.mIndex) + '|' + str(k) + '}', style='rounded') else: dot.node(str(k), label='{' + str(p) + '|' + str(k) + '}', style='rounded') for k in range(0, n // 2): if 2 * k + 1 < n: dot.edge(str(k), str(2 * k + 1)) if 2 * k + 2 < n: dot.edge(str(k), str(2 * k + 2)) return dot def swap(A, i, j): pi, oi = A[i] pj, oj = A[j] oi.mIndex = j oj.mIndex = i A[i] = pj, oj A[j] = pi, oi def ascend(A, k): while k > 0: p = (k - 1) // 2 if A[k] < A[p]: swap(A, p, k) k = p else: return k return 0 def descend(A): n = len(A) - 1 k = 0 while 2 * k + 1 <= n: j = 2 * k + 1 if j + 1 <= n and A[j] > A[j + 1]: j += 1 if A[k] < A[j]: return swap(A, k, j) k = j def insert(H, x): n = len(H) H.append(x) _, o = x o.mIndex = n k = ascend(H, n) o.mIndex = k def elevate(H, o, p): k = o.mIndex H[k] = (p, o) ascend(H, k) def remove(H): pFirst, oFirst = H[0] pLast , oLast = H[-1] oLast.mIndex = 0 H[0] = pLast, oLast H.pop(-1) descend(H) return pFirst, oFirst class Node: def __init__(self, value): self.mValue = value def __hash__(self): return hash(self.mValue) def __repr__(self): try: return 'Node(' + str(self.mValue) + ':' + str(self.mIndex) + ')' except AttributeError: return 'Node(' + str(self.mValue) + ')' def __str__(self): return str(self.mValue) def __eq__(self, other): if other == None: return False return self.mValue == other.mValue def __lt__(self, other): return self.mValue < other.mValue import string def demo1(): L = [ (i, Node(c)) for i, c in enumerate(string.ascii_lowercase) ] _, w = L[22] H = [] for i, x in enumerate(L): insert(H, x) display(heapToDot(H)) print('Elevating "w" to priority 2:') elevate(H, w, 2) display(heapToDot(H)) demo1() import random as rnd def heap_sort(L): H = [] for x in L: insert(H, x) display(heapToDot(H)) S = [] while H != []: p, _ = remove(H) display(heapToDot(H)) S.append(p) return S def demo2(): L = [ rnd.randrange(1, 200) for n in range(12) ] L = [ (n, Node(n)) for n in L ] print("L = ", L) S = heap_sort(L) print("S = ", S) demo2() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: IPython/Jupyter Step2: Magic Commands Step3: Executing shell commands
<ASSISTANT_TASK:> Python Code: # Use a question mark after a command to get more info about it a = [1, 2, 3] a.extend? # Use double question marks to get the source code if available def myfunc(x): Fancy function return x + 2 myfunc? myfunc?? # Magic commands start with a % sign %timeit print "foo" # You can add parameters to magic commands, just like you would do for commandline commands %timeit -n 5 print "foo" # Only do 5 loops, instead of the default 10k # You can also ask for help for magic commands using the question mark %timeit? # See a quick reference of other commands: %quickref # There are a lot more specicial commands %ls # same as linux ls command: list files in directory # Run an external script %run myscript.py # If you forget to store the result of your last statement in a variable, # you can always access it using the special underscore variable, like so: 5+3 _ # You can also access previous results by referencing the output number using _X # where X is the output cell you want to reference: _39 # Or the input number using _iX _i36 # You can also easily execute OS commands using ! !ls -lh output = !ls -lh output # You can reference other variables by prefixing them by a dollar sign $ dirname = "/tmp" !ls $dirname <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Also, let's import a number of other dependencies we'll use later. Step2: Now let's load the data for analysis. Load the Archive, the get the count of number of emails sent per day (the 'activity'). Step3: How can we plot the number of participants over time? Step4: This variable is for the range of days used in computing rolling averages. Step5: For each of the mailing lists we are looking at, plot the rolling average of number of emails sent per day.
<ASSISTANT_TASK:> Python Code: import bigbang.mailman as mailman import bigbang.graph as graph import bigbang.process as process from bigbang.parse import get_date #from bigbang.functions import * from bigbang.archive import Archive import pandas as pd import datetime import matplotlib.pyplot as plt import numpy as np import math import pytz import pickle import os pd.options.display.mpl_style = 'default' # pandas has a set of preferred graph formatting options arx = Archive("https://lists.wikimedia.org/pipermail/wikimedia-l/",archive_dir="../archives") acts = arx.get_activity() participants = (acts > 0).sum(1) window = 20 plt.figure(figsize=(12.5, 7.5)) rmpa = pd.rolling_mean(participants,window) rmpadna = rmpa.dropna() plt.plot_date(rmpadna.index, rmpadna.values, 'r', xdate=True) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We are only looking for combinations with $i<limit$ Step2: Procedural Style - square Step3: Procedural Style - triangle Step4: Functional Style Step5: Results
<ASSISTANT_TASK:> Python Code: import time def timer(): start = time.time() def f(report=False): elapsed = time.time() - start if report: print ("time elapsed %5.3f" % elapsed) return elapsed return f limit = 250 mytimer = timer() can_reach = set() numbers = set(range(1,100)) for i in range(0,limit): for j in range (0,limit): num = 4*i + 9*j can_reach = can_reach | {num} can_not_reach = numbers - can_reach t_sqr = mytimer(True) can_not_reach mytimer = timer() can_reach = set() numbers = set(range(1,100)) for i in range(0,limit): for j in range (0,i+1): num = 4*j + 9*(i-j) #print ("%i = 4*%i + 9*%i" % (num,j,i-j)) can_reach = can_reach | {num} can_not_reach = numbers - can_reach t_tria = mytimer(True) can_not_reach from operator import add from itertools import product mytimer = timer() fours = range(0,4*limit,4) nines = range(0,9*limit,9) fours_and_nines = product(fours, nines) fours_plus_nines = map( lambda x: add (*x), fours_and_nines) set(range(100)) - set(fours_plus_nines) t_func = mytimer(True) print ("triangle sum vs square sum = %2.0fx" % (t_sqr / t_tria)) print ("functional vs triangle sum = %2.0fx" % (t_tria / t_func)) print ("functional vs square sum = %2.0fx" % (t_sqr / t_func)) <END_TASK>