Upload 959 files to main/part_2

main/part_2/0002190943.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"e26ee0bf2d183ccc0bf707c95a268f9f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/37227e0c-9c9e-4c0d-880c-5b3c8a5ea828/retrieve","id":"472596077"},"keywords":["ASARECA","NAPA","PRSP","climate change","adaptation","Sub-Saharan Africa"],"sieverID":"950e5e8b-544d-4ce1-90d1-af264ed7ef63","content":"The ten ASARECA member countries (Burundi, Democratic Republic of Congo,Climate change is defined as any long-term and significant change in the expected patterns of a specific region's average weather for an appropriately significant period of time. It is the result of several factors, including Earth's dynamic processes, external forces, and more recently, human activity. External factors that shape climate include such processes as variations in solar radiation, deviations in Earth's orbit, and variations in the level of greenhouse gas concentrations. Evidence of climatic change taken from a variety of sources can, in turn, be used to reconstruct past climates. Most climate evidence is inferred from changes in key climate indicators, including vegetation, ice cores, dendrochronology, sea-level change, and glacial geology.Climate change represents one of the greatest environmental, social, and economic threats facing the planet today. In developing countries, climate change will have a significant impact on the livelihoods and living conditions of the poor. It is a particular threat to the attainment of the Millennium Development Goals (MDGs) and progress in sustainable development in Sub-Saharan Africa. Increasing temperatures and shifting rain patterns across Africa reduce access to food and create effects that impact regions, farming systems, households, and individuals in varying ways. Additional global changes, including changed trade patterns and energy policies, have the potential to exacerbate the negative effects of climate change on some of these systems and groups. Thus, analyses of the biophysical and socioeconomic factors that determine exposure, adaptation, and the capacity to adapt to climate change are urgently needed so that policymakers can make more informed decisions.Given limited resources, adaptation strategies must target those populations most vulnerable to global change and equip those unable to adapt-generally the poorest-with the tools and incentives that will enable them to do so. ASARECA has recently carried out a study to enhance the understanding of climate change in the 10 ASARECA member countries. This report profiles the available climate changerelated datasets and their accessibility and procurement details in the 10 ASARECA member countries. The report additionally assesses the incorporation of climate change adaptation strategies in national development plans and discusses each country's position in the current UNFCCC negotiations. The study was conducted using a combination of extensive literature reviews and field visits to all 10 ASARECA member countries: Burundi, Democratic Republic of Congo, Eritrea, Ethiopia, Kenya, Madagascar, Rwanda, Sudan, Tanzania, and Uganda.The report is organized in four sections. The first provides a description of the available climate change-related databases, along with details about their sources and accessibility in each of the 10 ASARECA member countries. Section 3 is a review of the status of the incorporation of climate change adaptation strategies in national development plans, while section 4 discusses the countries' positions in the current UNFCCC negotiations. Finally, section 5 offers concluding remarks and suggestions for a way forward. In addition to the study report, separate files of existing climate change-related datasets are provided in EXCEL format. 1Two primary sources of climate change-related datasets within the ASARECA member countries are international data sources and domestic data sources.Within the class of international climate change-related data sources, two distinct crop and livestock datasets can be identified: FAOSTAT and World Bank.The Food and Agriculture Organization of the United Nations maintains an international online database on such aspects of food and agriculture as production, trade, consumption, and prices. With regard to crop and livestock production statistics, the FAOSTAT ProdSTAT module contains detailed agricultural production data since 1961 for all reporting countries worldwide. Given that the 10 ASARECA member countries are reporting members of the FAOSTAT database, the FAOSTAT ProdSTAT data domain provides information for the member states on crop production, acreage, and livestock for 1961-2007.Most FAOSTAT datasets are free to download from the FAO website (http://www.fao.org/). Some detailed data from the FAOSTAT database are available only through subscription. This study provides crop and livestock production data for the 10 ASARECA member countries in a separate EXCEL document for 1961-2007 or the dates that were available.The World Bank publishes an annual report, Africa Development Indicators, that presents a broad picture of development across Africa. Data are presented from 1965 to 2006 for 53 African countries and five regional country groups. Data are arranged in separate tables or matrixes for more than 450 indicators of development, covering basic indicators; national accounts; balance of payments; inflation; millennium development goals; Paris Declaration indicators; private-sector development; trade; infrastructure; human development; rural development and agriculture; environment and climate change; labor, migration, and population; HIV/AIDS; malaria; capable states and partnerships; governance and polity; and household welfare. The report, available on CD-ROM, cost US$275 at the time this report was written so this study did not compile data from the World Bank. In April 2010 the World Bank announced that these data would be distributed free of charge.Each of the 10 ASARECA member countries compiles agricultural and meteorological data from public institutions, including National agricultural research stations Ministries of agriculture and livestock National meteorological departmentsThis section describes the available climate change-related datasets in each of the 10 ASARECA member countries. Separate EXCEL files containing the databases in each country are also provided.Burundi experienced political instability in the early to mid-1990s, and most data for these periods are either unavailable or unreliable. However, three distinct domestic climate change-related data types were collected. These include Crop and livestock production data Household surveys Meteorological data 2.2.1.1 Crop and Livestock Data for Burundi In the 1970s and 1980s, data for individual crop varieties produced in Burundi were presented separately; after 1992, most of the national data are combined in categories of cereals, root crops, oil crops, and others. This makes it difficult to separate the contribution of different crops in the total production of a certain category. Table 2 profiles the EXCEL file containing crop and livestock data for Burundi. Crops and livestock data for the periods shown in Table 2 were collected from different institutions, as described later in this section.The National Agricultural and Livestock Research Institute (ISABU) conducts all research in agricultural and livestock fields and has production data for different crops and livestock. Institute data are publicly available at no charge. The Ministry of Agriculture and Livestock has data on crop and livestock production. Data obtained from this ministry were used to supplement ISABU data. The data are available without charge upon request so long as the request is accompanied by proof that their use is intended for research activities. The National Statistics and Economic Studies Office (ISTEEBU) collects data from different country sectors. The institution charges a small fee (recovery cost) for the data upon proof that they will be used for research purposes. Crop and livestock data for 1992-2004 can be obtained from http://burundistats.org/statsstiques/Production_04.htm. More information about this institution is available at http://burundistats.org/statsecteurs.php.   1977-1988; 1992-2007 Source: IGEBU.The Democratic Republic of Congo (DRC) has immense unexploited agricultural potential. Indeed, if crop yields in the DRC's 80 million arable hectares were at the global technological frontier, the country could feed about one-third of the world's population. However, this potential has been handicapped by decades of conflict, corruption, and economic mismanagement. The protracted civil conflicts, coupled with the country's vastness, have also severely impeded agricultural data collection.  Eritrea attained independence in 1993 after a long, protracted war-first with the Italians, then with the British, who had occupied it in 1941, and finally with the Ethiopians, whose emperor had decided to annex Eritrea ten years after it was federated with Ethiopia by the United Nations in 1952. This civil conflict severely affected data collection. Consistent compilation of domestic datasets began only in 1997.Since 1997 the Ministry of Agriculture, through its Planning and Statistics Division, has been publishing an annual report that contains data on crop and livestock production. Crop production data for 1997-2008 (Table 5) are available at no cost from the Planning and Statistics Division upon request to the permanent secretary. Unfortunately, the Ministry of Agriculture does not have a functional website, and all data are available only in hard copy.   The agency has also conducted the following income, consumption, and expenditure surveys:Ethiopia household income, consumption, and expenditure survey, 1995-1996Ethiopia household income, consumption, and expenditure survey, 1999-2000Ethiopia household income, consumption, and expenditure survey, 2003-2004 The agency also conducted the population and housing census in 1987 and again in 1994. All information compiled by CSA is available on the institute's website for free.The National Meteorological Agency (NMA; www.ethiomet.gov.et) of Ethiopia collects and maintains meteorological data for all stations in the country. The agrometeorological stations collect data on rainfall, temperature, and pressure. Some of these stations have been collecting data for more than 40 years. However, the data collected for this report came from nine synoptic stations for temperature and rainfall (see Table 8). Ethiopia's meteorological data are available upon filling a request form, which requires information about intended use of the data, on the NMA website.The three domestic climate change-related datasets in Kenya include crops and livestock data, household surveys, and climate data.The Kenyan domestic crop and livestock database provided in this report is derived from annual reports of the agriculture-related ministries. In the recent past, the Kenya Institute for Public Policy Research and Analysis (KIPPRA)  A publication containing these climatological statistics is available upon request. It includes longterm means of all meteorological parameters, such as rainfall, temperature, wind speed, and direction. It provides data from 90 stations and covers 1963-2007 (Table 7). In Kenya, meteorological data are provided upon request that conforms with departmental policy and the requester pays a fee of US$10 per parameter per station per month. Detailed information about how to obtain the meteorological data is available on the department's website.  11). These data can be accessed without charge from the ministry's library. The country's premier research institute, the Centre National de la Recherche Appliquée au Développement Rural (www.fofifa.mg), also maintains data on its website on different crops and livestock in the country. Information also is available from the website of the Rural Observatory Department (www.pnae.mg) of the National Office for Environment.  13) from the strategic planning unit of the ministry upon request. However, these data are not easily accessible because most publications written before 2008 are in the local language. Some information can also be accessed from the ministry's website. In addition, data on tea and coffee production can be accessed from their respective marketing boards, the Rwanda Tea Authority (Office des Cultures Industrielles du Rwanda, Office du The), http://www.rwandatea.com/, and the Rwanda Coffee Development Authority (Office des Cultures Industrielles du Rwanda, Office du Café), http://www.rwandacafe.com/. The information compiled by NISR is available for free on the institute's website. The household budget survey data also are available from the director general of NISR for free upon request.The Meteorological Service under the Rwanda Ministry of Infrastructure maintains meteorological data for about 15 meteorological stations. These stations collect data on rainfall, temperature, wind speed, and pressure (Table 14). Rwanda's meteorological data are available from the Meteorological Service (www.meteorwanda.gov.rw). The Meteorological Service also publishes agrometeorological bulletins that provide weather summaries, maps of rainfall, weather outlook, vegetation conditions, impact on agriculture, and expected weather impacts on agriculture. It is important to note that Rwanda is the only ASARECA member country that is willing to provide its meteorological data for free.Sudan is the biggest country in Africa. It is divided into five agroecological zones: desert, arid, semiarid, semi-humid, and humid. The domestic climate change-related data can be grouped in several categories.The main domestic crop and livestock data for Sudan can be found in different sources. The Ministry of Agriculture, Livestock, and Forestry, through the Department of Planning and Agricultural Economics, collects and maintains data on all crops and livestock production in the country's different regions. These are published annually and can be accessed from the ministry's library without charge. Some data can be obtained from the website of the Arab Organization for Agricultural Development (AOAD; www.aoad.org). More detailed data can be found in AOAD's library upon request and at no fee.The premier research institute in the country, the Agricultural Research Corporation (www.arcsudan.sd), which is based at Wad Medani, maintains data on different crops and livestock in the country. Another source is the Bank of Sudan's website (www.bankofsudan.org). See Table 15 for an outline of the crop and livestock production data collected in Sudan. Other publications by the bureau include housing censuses, consumer price indexes, and business surveys. The household budget surveys are available from the director general, Central Bureau of Statistics (www.cbs.gov.sd), upon request. Some data can also be accessed from the bureau's website.The Sudan National Meteorological Authority (www.ersad.gov.sd) maintains daily, monthly, and annual meteorological data from 25 meteorological stations spread throughout the country's five agroecological zones. The data collected include rainfall, temperature, wind speed and direction, atmospheric pressure, and relative humidity. In addition, the agency provides weather forecasts for use by the agricultural sector and the aviation industry. The data are available upon request, for a fee (2.5 Sudanese dollars, about US$1, per parameter per station per year). The website and data are in Arabic, but English translations are available. To access the data, write a letter to the director of the Meteorological Authority stating the amount of data needed and the purpose for which the data requested will be used. The data are then prepared and a fee is charged.However, limited meteorological data, taken from annual reports of the Ministry of Agriculture and Livestock and Forestry, were collected for this study (see Table 16). In Tanzania, the domestic climate change-related data can be organized in several groups.The main domestic sources of crop and livestock data in Tanzania are the National Bureau of Statistics (NBS) and the agriculture-related ministries.The Ministry of Agriculture and Food Security and Cooperatives (www.kilimo.go.tz) has been publishing a basic data booklet for several years. The booklet provides basic data on agriculture in the country. The data in the booklet include area, production, and yield for food and cash crops; agriculture and the domestic economy; rainfall; and agricultural inputs. Crop production and acreage data for 1980-2004 are available from the statistical unit of the Ministry of Agriculture and Food Security and Cooperatives, but it must be extracted from hard copies of the annual reports (Table 17). This data can be accessed for free once a formal request has been made to the permanent secretary. Data for 1996-2002 can also be downloaded from the ministry's website at no charge.The Ministry of Livestock Development and Fisheries (www.mifugo.go.tz) was a department in the Ministry of Agriculture until March 2008, when it became a stand-alone ministry. Livestock populations and production data for 1980-2004 (Table 17) are available in the published annual reports of the Department of Livestock Production and Fisheries, or what is now referred to as the Ministry of Livestock Development and Fisheries. The data are accessible for free from the permanent secretary upon formal request. Background information about the Ministry of Livestock Development and Fisheries can also be found on its website. In addition, NBS annually publishes an economics survey and a statistical abstract. Other publications by the bureau include a population and housing census, consumer price indexes, and business surveys. In collaboration with the Ministry of Health and Social Welfare, the NBS was preparing the 2009-2010 Tanzania Demographic and Health Survey at the time of this report in early 2010.The household budget surveys are available from the director general, National Bureau of Statistics (www.nbs.go.tz), upon request. Some data can be accessed for free; some are sold, depending on the nature of the request. The director general determines whether to charge for the data. Some data can also be accessed from the bureau's website.2.2.9.3 Meteorological Data for Tanzania Tanzania's Meteorological Agency (www.meteo.go.tz) is part of the Ministry of Communications and Infrastructure. The agency maintains daily, monthly, and annual meteorological data from 26 meteorological stations spread throughout the country. The data collected include rainfall, temperature, wind speed, direction, atmospheric pressure, and relative humidity. In addition, the agency provides weather forecasts for use by the agricultural sector and the aviation industry.Tanzania's meteorological data (US$10 per variable per meteorological station per year) cover 1961-2008. Details about available data can be viewed on the agency's website; the data can be purchased from the director general of the Tanzania Meteorological Agency upon request. Table 18 provides an outline of the meteorological data collected from Tanzania's Agriculture Ministry for this study. To address the negative consequences of climate change, the ASARECA member countries have adapted various adaptation strategies in different sectors and developed National Adaptation Programs of Action (NAPAs) that they have integrated into their Poverty Reduction Strategy Papers (PRSPs). NAPAs are documents prepared by Least Developed Countries (LDCs) that identify urgent and immediate activities useful for coping with climate change. These documents are presented to the international donor community for support. They provide a process for LDCs to identify priority activities that respond to urgent and immediate climate change adaptation needs. Rather than focusing on scenario-based modeling to assess future vulnerability and long-term policy at the state level, they take into account and build on existing coping strategies at the grassroots level to identify priority activities. In the NAPA process, prominence is given to community-level input, which is regarded as an important source of information, recognizing that grassroots communities are the main stakeholders. The process of NAPA preparation is usually a bottom-up approach in which stakeholders from different sectors (agriculture, health, energy, and so on) discuss and prioritize the different projects that require implementation to reduce the adverse effects of climate change. Before the final set of projects is chosen, there is usually wide consultation at all levels, and this makes the stakeholders own and support the process.The World Bank and International Monetary Fund (IMF) developed the PRSP approach in 1999 as a way to ensure that debt relief money would go to poverty reduction and to respond to evident weaknesses in relations between poor countries and the Bretton Woods institutions. These weaknesses include the lack of a poverty focus and a lack of country ownership of reforms. PRSPs are prepared by the member countries through a participatory process involving domestic stakeholders as well as external development partners, including the World Bank and IMF. They outline a national program for poverty reduction that is the foundation for IMF and World Bank lending programs and for debt relief for heavily indebted poor countries. The papers are updated every three years and progress reports are filed annually; the papers describe and project the country's macroeconomic, structural, and social policies and programs for at least three years. These papers are regarded as a means to promote broad-based growth and reduce poverty and also assess the country's associated external financing needs and major sources of financing.Poverty reduction and climate change have a direct relationship because climatic change consequences, such as increased intensity and frequency of storms, drought, and flooding, altered hydrological cycles, and precipitation variance have implications for future food availability. Food availability in turn has a direct bearing on poverty levels, especially for the most vulnerable groups. This, then, shows that NAPAs and PRSPs are closely interlinked, because efforts aimed at adapting to the adverse effects of climate change have a direct impact on poverty reduction. Both initiatives also are based on stakeholder consultations and are therefore country owned. They also are funded by resources from the developed world.It should be noted that each country that developed a NAPA followed the consultative process of engaging different stakeholders to come up with the different projects and prioritize them. According to the United Nations Framework Convention on Climate Change (UNFCCC), -The steps for the preparation of the NAPAs include synthesis of available information, participatory assessment of vulnerability to current climate variability and extreme events and of areas where risks would increase due to climate change, identification of key adaptation measures as well as criteria for prioritizing activities, and selection of a prioritized short list of activities. It also includes short profiles of projects and/or activities intended to address urgent and immediate adaptation needs of LDC Parties. Upon completion, the NAPA is submitted to the UNFCCC secretariat, where it is posted on the website, and the LDC Party becomes eligible to apply for funding for implementation of the NAPA under the LDC Fund. A copy of the NAPA is also sent to the Global Environment Facility (GEF). The LDC Party can start the process of implementation under the LDF Fund which is managed by the GEF.‖The nine ASARECA member countries that have uploaded their NAPAs to the UNFCCC website (only Kenya is not required to) are eligible to apply for funding for the different proposed projects.However, different proposed projects are at different stages of implementation. This section of the report provides a brief overview of the actions, research, and investment activities included in the NAPAs and PRSPs of each of the 10 ASARECA member countries.Burundi has made substantial efforts to incorporate climate change adaptation policies in its national plans.The climate change adaptation strategies adopted in Burundi cover agriculture, livestock, forestry, and energy.Burundi's agriculture sector has adopted these adaptation strategies:Growing crops most sensitive to fungal diseases during seasons with low rainfall or even dry seasons; growing crops resistant to diseases and plant pests during seasons with heavy rain Growing crops such as cowpeas, pigeon peas, and groundnuts in some areas to supplement the protein-leguminous plants whose production is in continuous reductionEncouraging planting of soybeans and sunflowers as well as market gardening, all of which are becoming more significant Conserving genetic resources (for example, saving ears or dry seeds in attics or repetitive transplanting or propagation by cuttings) for some drought-tolerant cropsThe adaptation strategies adopted in Burundi's livestock sector include: Moving herds along the rivers, where they can find better fodder, or taking refuge in other areas where they can find natural pastures during a drought Selling off or slaughtering animals-even at low prices; keeping smaller livestock such as sheep or goats, which are less affected by periods of drought because their sources of food are diverse (herbaceous and aerial pastures, for example) Forestry Burundi's forestry adaptation strategies include Traditional methods of conserving natural forest ecosystems. This involves respecting, in a quasi-religious way, certain ecosystems and/or elements of both animal and plant biodiversity. For instance, the cutting of trees in the Kibira forest was strictly banned. This high-altitude forest was regarded as a -symbol of the alliance between the Sky and the Earth.‖ This traditional conservation also extends to certain thickets that are considered sacred.Using physical barriers otherwise known as firewalls or firebreaks. However, this method of conservation is disappearing because of the increasing space needs of the population. Safeguarding certain local species (for example, Erythrina abyssinica, Cordia Africana) by incorporating them in fields because of their role in agroforestry.The adaptation strategies in Burundi's health sector include Exploiting new and renewable energy sources, especially solar energy. Photovoltaic equipment produces nearly 75 KW, which are used for lighting and for powering telecommunications, refrigeration, and water pumping. Biogas facilities installed in several localities produce energy for home electricity, and wind energy pumps water.Table 21 provides a list of the climate change adaptation projects underway in Burundi.Project /activity ObjectiveTo build the human and technical capacities of the national weather service in order to establish reliable seasonal climate forecasts.To restore the vegetative cover of degraded areas.To delimiting all the protected areas to avoid their clearing through encroachment. The other goal is to protect the natural environments not yet protected to allow savannas and clear forests and thickets to take over naturally.To improve food security and the public health of the target population through irrigated agricultural production and clean water conveyance.To install anti-erosion mechanisms and introduce suitable farming practices.Protecting the buffer zones in Lake Tanganyika floodplain and around the lakes of BugeseraTo maintain the hydrological and ecological functions of the floodplain around Lake Tanganyika and the marshes of Bugesera.To increase the agricultural production in order to improve food security by developing and popularizing varieties of dryness-resistant food crops in all provinces of the country affected by climate change.To improve and increase agrosylvopastoral production and protect the environment.To increase the acreage covered by forests.To protect the landscapes and the public and private infrastructure located along the axes of drainage in the Mumirwa and the Imbo lowlands, which are threatened by erosion during periods of heavy precipitation. The ultimate goal is to ensure the socioeconomic well-being of the population by developing a physical environment adapted to the changing climate conditions.To educate the public to be aware of the adverse effects of climate change, bush fires, and deforestation so that the population participates in the research to find solutions and improve systems of adaptation.To promote the development of economic activities and the reduction of poverty, particularly outside large cities, within an environmentally friendly framework.Source: NAPA, Burundi.The principal sources of growth identified by the Burundi government in its PRSP are the agriculture, trade, industry, mining, tourism, and handicraft sectors, all of which can be impacted negatively by climate change. In agriculture, the Burundi government aims to develop and improve food production by promoting the use of those varieties that perform the best, improving soil fertility, and upgrading cropping techniques, which would lead to significant increases in output and household income for farmers. This ties in with the adaptation strategies outlined in the NAPA.In the livestock sector, the government will place a priority on rebuilding livestock populations and introducing genetic improvements, particularly through the distribution of breeding stock. The government will also set in place an artificial insemination program and encourage the use of forage crops and herbaceous and woody pulse species that not only provide good fodder but also improve soil fertility. In the fisheries sector, the government will develop aquaculture in suitable areas, provide small-scale fisheries with extension services, strengthen maritime legislation concerning fisheries, and reactivate subregional cooperation.To improve and protect the environment, the government will inform and educate all stakeholders about the rational management of natural resources; train and equip specialists in water management; train and equip the environmental police; develop natural resource management plans and support and assist local communities in managing natural resources; revitalize the national commission on the environment; reforest and develop all catchment areas in a comprehensive fashion; identify and introduce substitutes to protect threatened natural resources; develop a land-use plan; and explore the use of community reforestation schemes as a source of income.To provide employment to youth and women, the government will develop an environmentally sustainable and labor-intensive public works program for the rehabilitation and maintenance of roads and social infrastructure, marshland development, reforestation, terracing, and soil conservation. Programs undertaken by the government or municipalities will rely, as a matter of priority, on labor-intensive activities.In health, the government intends to rehabilitate health infrastructure and make existing infrastructure operational in line with health standards; improve the availability and accessibility of essential drugs and other consumables, medical and surgical devices, and laboratory reagents in all health facilities throughout the country; and reassign health personnel to areas with staffing shortages, increase the availability of personnel in terms of quantity, and improve the quality of those hired.The DRC has also incorporated climate change adaptation strategies in its national plans.The climate change adaptation strategies pursued in the DRC cover several sectors. Based on these criteria, 10 projects (Table 22) were earmarked for implementation.Managing and rehabilitating water reservoirs The government of the DRC has incorporated climate change in its development policy documents. These include:Revitalizing the livestock sector by restoring the herds decimated during the conflict period Restoring the diversification of cash crops Strengthening support for producers through the distribution of inputs and the dissemination of applied research Developing and organizing the agricultural markets and fisheries sector Improving local breeds by crossing them with highly productive breeding stock Instigating community establishment and management of breeding centers, with training provided by veterinarians from the extension services Intensifying livestock production through improved proper feeding conditions (for example, forage and concentrates) and encouraging the planting of forage crops Conducting an ongoing public awareness and education program about safeguarding the environment Implementing a strategy for the conservation of biodiversity, in particular through the protection and restoration of plant cover Defending natural forests and encouraging the expansion of afforested areas Implementing the United Nations Framework Convention on Climate Change, the protection and conservation of water and water resources, the maintenance of environmental health, and the prevention of natural disasters Improving and streamlining the regulations for granting forestry concessions Promoting controlled industrial exploitation to create new jobs and generate incomes through trade in wood, charcoal, and diverse nontimber products Gaining the involvement of local communities in the management and protection of forests and the environment to enhance their rights and improve their living conditions Developing the use of alternative primary energy forms for the production of electricity (new and renewable energy sources, solar, wind, biogas, and so on) Reforming the water and sanitation sectors Conducting inventories of the water needs of the urban and rural populations Drafting a water and sanitation code that emphasizes integrated water resource protection and management and defines the roles of private operators in the sector Creating a water and sanitation development fundIn Eritrea, the climate change adaptation policies identified in the NAPA have been incorporated in the PRSP.The climate change adaptation strategies pursued in Eritrea are broad and cover several sectors of the economy. Developing integrated control approach for vector-borne diseasesDuring regional stakeholder consultations, several projects were identified for each type of key adaptation need identified under different sectors (Table 23). These projects were considered to have the potential to decrease the vulnerability of key groups and sectors relative to climate variability, extreme events, and long-term climate change. A total of 102 projects (Table 23) were identified in the different sectors. Different selection criteria were used by stakeholders to rank the key projects. The selection criteria included (a) reduction of threats or impacts of climate change; (b) cost-effectiveness and feasibility; (c) impact on vulnerable groups and resources; (d) synergy with multilateral environmental agreements; (e) synergy with national plans; (f) contribution to poverty reduction; and (g) equity. Using these criteria, the original 102 projects were reduced to 22 (Table 24). As a final step, these highest-priority projects were then ranked by a group of technical experts, subject matter specialists, and senior policymakers, most of whom are members of the National Steering Committee, to produce a final prioritized set of projects across all vulnerable sectors. Table 25 presents the final prioritized list of projects in Eritrea most needed to meet the urgent and immediate needs of vulnerable communities adapting to increasing climatic risks. Like its counterparts, Ethiopia has made substantial efforts to incorporate climate change adaptation strategies in its national development plans.The climate change adaptation strategies adopted in Ethiopia are categorized at the household and national levels.At the household level, climate change adaptation policies include Changing cropping and planting practices (for example, using mixed cropping to diversify risk and early planting to escape drought). Reducing consumption levels. During drought, households ration the amount of food consumed by each household member.Collecting wild foods to supplement other foods.Using interhouse transfers and loans.Increasing petty commodity production. Searching for employment through temporary or permanent migration; selling assets such as agricultural tools and livestock.Mortgaging land and obtaining credit from merchants and money lenders. Introducing programs/projects that promote improved farming practices, drought resistant and early-maturing crop varieties, and supply inputs that increase crop yield and productivity Improving land management, moisture and soil conservation, and flood control methods in both the high-and lowland areas Developing improved water use (water harvesting, small-scale irrigation) in drought-prone areas to alleviate rain shortages that cause crop failure Promoting improved/productive animal breeds to reduce herd size and pressure on landIntroducing agroforestry systems to plant multipurpose trees that can be used to produce feed, conserve soil, and produce fruits for human consumptionIn water resources, the strategies include Construction of small check dams and using rainwater-harvesting schemes to meet water supply for domestic use and irrigation Undertaking soil conservation measures that help to reduce soil erosion and siltation and also protect against the pollution of water sources Implementing watershed management and water conservation programs, as well as projects that promote local community participationIn health, the strategies include Implementing programs that help to prevent and control communicable diseases like malaria through community participation Organizing and implementing community-based health education programs to create the awareness and develop knowledge of personal hygiene and environmental health management Developing and introducing surveillance systems, introducing methods of health prevention, and instituting vector control for health workers and the community Providing training programs to build the human capacity to improve healthcare extension services at the local levelIn the energy sector, policies coverInitiating and developing projects that promote the use of alternative and or nonwood energy sources (for example, biogas and fuel-saving stoves)Increasing awareness of the effect of pollution on the environment through Information, Education and Communication (IEC), with a focus on energy use and environmental education Enforcing laws and regulations to protect and prevent pollution and ensure the use of local factories that are environmentally friendlyBased on the review of adaptation options identified under MEA synergy assessments, ongoing programs, development project initiatives, the initial national communication of Ethiopia to UNFCCC, and the outcomes of the regional consultative workshops conducted by the National Meteorological Agency (NMA), 37 potential adaptation options were identified and proposed for further prioritization and ranking, as well as inclusion in the NAPA to address immediate adaptation needs. Members of the National Climate Change Steering Committee, established by NMA, endorsed the criteria proposed before the prioritization process started. The criteria selected were Impact on economic growth of the poor (poverty reduction potential) Complementarities with national and sectoral plans Climate change risk (losses avoided by the poor) Synergy with action plans under MEAs Cost effectivenessBased on these criteria, 11 projects worth a total of US$3.75 million were earmarked for implementation (Table 26). The government of Ethiopia has managed to incorporate climate change in its development policy documents. These include biodiversity conservation policy, agriculture policy, agriculture and rural development policy and strategy; safety nets, the Plan for Accelerated and Sustainable Development to End Poverty, and the Energy Policy of Ethiopia (EPE). Some actions in these documents that are related to climate change include Promoting sustainable development and sustainable use of biological diversity, and reducing climate-related vulnerabilities Creating strong and resilient ecosystems to thereby help to reduce the economic and social vulnerability of local people Focusing on the rehabilitation and reclamation of degraded land, reforestation, and the conservation, management, and protection of natural resources Encouraging activities that reduce poverty/improve livelihoods and simultaneously conserve and protect ecosystems Developing, in conjunction with the MEAs, drought-resistant plants and crop species that adapt easily adaptable to areas with moisture stress, and developing interventions to rehabilitate and maintain the biodiversity of dry land and fragile ecosystemsParticipating in UN conventions and other MEAs that emphasize environmental information networks and capacity building, as well create awareness of the impacts of climate change; developing coping mechanisms that are in conformity with policies/strategies/programs, particularly the EPEKenya is not listed as an LDC and is therefore not required to submit a NAPA. This notwithstanding, Kenya has incorporated climate change adaptation strategies in its national planning documents.The climate change adaptation strategies pursued in Kenya have been classified as short-term and longterm measures.The short-term measures include Drilling boreholes in Nairobi and other parts of the country. To date, 50 boreholes have been sunk in Nairobi; there are plans to sink a total of 200 boreholes.Using water tanks to supply water in slum areas in Nairobi and other cities and towns. Using water kiosks as alternatives for ensuring a constant water supply. Also, cattle troughs are to be constructed in various parts of the country for watering animals. Implementing a duty waiver on imported maize, an important staple crop. Providing seeds and fertilizer to farmers to improve production. Placing about 40,000 hectares under irrigation.Importing more than a million energy-saving light bulbs to replace the incandescent ones. These will be given to citizens free in exchange for old bulbs. Installing 88 mw diesel power plants, public and private, to supplement hydroelectric power; the government is also exploring other potential sources of energy such as nuclear, wind, and waste heat recovery boilers.The long-term measures includeSensitizing the populace about the effective use of water Desilting water dams and building new dams Continuing programs that provide emergency food supplies to vulnerable people Providing emergency relief to hard-hit livestock farmers, especially pastoralists, during drought season Convincing farmers not to sell green maize, which will help improve maize yields and reduce the number of food-insecure households Expanding to other areas, especially rural ones, the government program that provides food subsidies to poor people living in low-income areas of towns Conserving water, especially by protecting water towers Supporting and encouraging the use of water-harvesting techniques in towns and rural areasIn the long-term, the government intends to drill more boreholes and provide additional water takers to increase water supply.Madagascar, like other countries in ASARECA, has incorporated the strategies enumerated in its NAPA in national planning documents.The climate change adaptation policies pursued in Madagascar cover agriculture and livestock, public health, natural resources and water, coastal zones, and forestry. Based on these criteria, 15 projects were earmarked for implementation (Table 27). To promote agricultural growth and help in poverty reduction, the government of Rwanda has identified essential actions: research, extension services, input development, finance, infrastructure, marketing, livestock development, cash crop development, and sector planning. In livestock, the government has encouraged the importation of improved breeds and the eradication of disease and pests.In human health, the government will focus on preventing disease, particularly malaria and HIV/AIDS; providing increased access to basic healthcare, particularly by reducing costs to the poor and providing health information at the community level; and implementing improvements in the quality of health services.To improve water use efficiency and sanitation, the government will improve the water supply and extend its network; encourage the community management of the water supply; increase access to sanitation services; develop a health-sector strategy; and build capacity at the central and district levels. To create employment, every government sector needs to seek opportunities for labor-intensive methods for carrying out its objectives. In particular, the development of infrastructure in rural and urban areas is well suited to a labor-intensive approach.Sudan, like the other ASARECA member countries, has a NAPA that specifies the climate change adaptation strategies that the country would like to pursue. The strategies specified in the NAPA have been incorporated in national planning documents and cover a broad range of adaptation strategies.The climate change adaptation strategies in Sudan cover agriculture, livestock, and forestry; water resource management; and public health. To address the vulnerability of the communities to malaria in the nontraditional malaria areas and strengthen their capacity to adapt to this condition Source: NAPA, Tanzania.To facilitate crop production, farmers will be encouraged to organize themselves in groups or cooperatives in order to improve their prospects for obtaining credit from financial institutions, carry out crop-specific research and other initiatives, bolster output, and improve the quality of their products.Communities will also be encouraged to develop irrigated farming. The government will provide demanddriven research and crop extension services; it will support labor-intensive agroprocessing.More than 50 percent of the population derives its cash income from the sale of forest products such as charcoal, honey, wild fruits, and firewood; the poorest households are the most dependent on woodland resources. The government therefore intends to find ways to incorporate environmental quality indicators in its poverty monitoring system to capture these levels of dependency. In health, the government intends to reduce malaria-related fatalities of children younger than five to less than 10 percent of the fatalities in that age group and increase the proportion of the rural population with access to safe and clean water.The Tanzanian PRSP addresses the issues in NAPA but not as strongly as in Uganda and Burundi.In Uganda, the government has incorporated the climate change strategies specified in the NAPA in its national planning documents, as discussed in the sections that follow.The climate change adaptation strategies adopted in Uganda cover aquaculture, health, land and water resources, agriculture and livestock, and forest resources. of livestock diseases. To conserve and use water efficiently, the government will implement the waterfor-production strategy and make investments based on probable returns, taking into account local livelihoods and preferences. In energy, the government will cooperate with other sectors in promoting technologies that allow the use of fuelwood to be reduced. In environment and natural resource management, the government will develop a strategy to ensure adequate funding for the recurrent costs of the national environment management authority, build capacity for environmental management at the sectoral and district levels, and develop regulations to implement the National Environment Statute of 1995.In forestry, the government will enhance the implementation of the National Forest Plan; promote private-sector investment in privately owned forests by providing information and technical advice about the management of forests and as well as permits to grow trees in central forest reserves with secure land and tree tenure. The government will also promote the establishment of community woodlots by starting extension and advisory services for private and community members interested in tree planting, develop the national tree seed center, establish a framework for decentralized seed production, and investigate the possibility of benefiting from commercial markets for ecological services such as carbon trading in global markets, in line with the Kyoto Protocol.To conserve wetlands, the government will assess financial, economic, and environmental factors relative to the profitability of different wetland uses; further the development and dissemination of guidelines for the wise use of wetland resources; improve community skills and diversification of wetland products in order to add value to wetland products; enforce appropriate policies, laws, procedures, and regulations to curtail the degradation of wetland resources; assess wetland resources to determine resource availability and trends; and support community initiatives that promote the wise use of wetlands.To improve weather prediction, the government will strengthen its data collection capacity to ensure the adequacy and timeliness of data for generating weather and climate information; strengthen human capacity, including providers and users of the service; and investigate and establish the appropriate institutions to take advantage of opportunities under the carbon development mechanism. To increase the level of employment, the government will use labor-intensive techniques where technically feasible and economically cost effective and promote community participation in infrastructure development and maintenance.In health, some actions include the provision of antiretroviral drugs; launching in 10 districts the home-based management of a fever program for combating malaria; reduction in the price of insecticidetreated materials; and introduction of free primary care in public health facilities. The actions spelled out in the PRSP are in line with the adaptation strategies and research and investment activities in the NAPA for Uganda.(SIDS) and also in the Bali Action Plan, which also gives special preference to LDCs, SIDS, and African countries suffering from droughts and floods.Simplification and minimization of some steps required for implementation of identified adaptation options in the NAPAs. Promotion of the coherence and facilitation of the linkages with other international, regional, and national programs and bodies and stakeholders that are implementing adaptation and related activities, including the Nairobi Work Program. Addressing the concerns, especially gender and youth concerns, of all vulnerable groups whose adaptive capacity is low, recognizing that women and children are particularly affected by the impacts of climate change. Special care is to be taken to reflect indigenous knowledge and practice. Provision of scaled-up, new, additional, adequate, predictable, and sustainable financial, technological, and capacity-building support to address all key areas of the Adaptation Action Program in a holistic manner consistent with national and regional development objectives, programs, and plans.The African Group would also like to see the following strategies implemented: Substantial reduction from the established baseline readings of emissions by developing countries. Quantified emission reduction commitments have been established for all developed country parties. They are measurable, reportable, and verifiable, that is, they are legally binding commitments) that are absolute and can be verified for compliance. Mitigation commitments by developed countries as a group. These must be at the top of the range indicated by the Intergovernmental Panel on Climate Change (IPCC) in order to achieve the lowest stabilization levels assessed by the IPCC in its Fourth Assessment Report. The aggregate number is for all developed countries, whether they ratified the Kyoto Protocol or not.Reduction of greenhouse gas emissions by Annex I parties. 2 They should reduce these emissions by at least 40 percent below 1990 levels by 2020 and at least 80 percent to 95 percent below 1990 levels by 2050 to make a meaningful and fair contribution to achieving the lowest level of stabilization assessed by the IPCC's Fourth Assessment Report. At these low levels, the additional climate impacts are acceptable to Africa. Concrete steps by developing countries to reduce emissions. They may choose from a toolbox of voluntarily registered, nationally appropriate mitigation actions (NAMA), including sustainable development policies and measures, CDM-supported activities, and others. Design of a REDD-Plus mechanism to accommodate different national circumstances and respective capabilities. Adequate, predictable, and sustainable funds from a variety of sources, including global carbon markets, are vital for the provision of incentives on the scale necessary for reducing emissions in Africa and globally. Formulation of NAMAs by developing countries. These must be reportable through national communications-if done with their own resources-or to a separate registry for those with multilateral, measurable, reportable, and verifiable support. The application of unilateral mitigation actions by developing countries must be differentiated from those that are supported internationally, for (a) actions with own resources, verification is by national entities working with international guidelines; and (b) multilaterally supported actions, verification is through the UNFCCC.Conditioning developing country action on technology, financing, and capacity building in a measurable, reportable, and verifiable manner. Requiring all Annex I parties to make additional legally binding mitigation commitments or actions that take into account the principles of the convention. The reduction commitments under the Bali Action Plan must be comparable in magnitude, compliance, and timeframe.Requiring non-Annex I parties to take mitigation actions in accordance with the principles and provisions of the convention. 3Recognizing that NAMAs of developing countries are only different in the context of the enabling mechanism provided by developed countries.Requiring that NAMAs be measurable, reportable, and verifiable to ensure maximum environmental benefits for investment and that they be differentiated among developing countries according to reductions per unit of investment costs.Requiring developing countries that wish to implement NAMAs to determine/establish their reference point. Establishing a mechanism s for measuring, reporting, and verifying greenhouse gas emission reductions.Allowing developing countries, particularly SIDS and LDCs, to propose NAMAs that promote sustainable development and local social, economic, and environmental or adaptation benefits.Reporting voluntary actions taken by developing countries and that are not included in national communication.Making implementation of NAMAs of developing countries contingent on the provision of adequate financing and access to relevant technologies required to execute the activities. The urgency for undertaking NAMAs should be matched with urgency to provide support.The finance, technology and capacity building strategies pursued by the developing countries include: Provision of financing, technology, and capacity building must be legally binding, with consequences for noncompliance. Action by developing countries is dependent on the level support by developed countries.Commitment by developed countries to a target of 0.5 percent of GDP for climate action in developing countries from new and innovative sources of public and private-sector financing, with the major source of funding coming from the public sector.Commitment by developed countries to providing full costs and full incremental costs, in accordance with article 4.3 of the convention. Provision of new, additional, reliable, and predictable financial resources through weighted assessed contribution of developed countries.Assessment of contributions from developed countries, taking into account GDP and historical cumulative contribution to greenhouse gas concentrations in the atmosphere. Governments to become key mobilizers of funds as evidenced by their actions to solve the current economic crisis.Assessment of levies from the market mechanism, including an expanded 2 percent on Kyoto mechanisms.Assessment of a levy on civil aviation and maritime transport except journeys originating in and traveling to LDCs. Solicitation of contributions from private sector and foundations.Commitment by developed countries to the deployment, diffusion, and transfer of technology to developing countries based on principles of accessibility, affordability, appropriateness, and adaptability of technologies required by developing countries for enhanced action on mitigation and adaptation.Finding means to surmount the barriers to technology transfer.Commitment by developed countries to strengthening the institutional capacity of developing countries to undertake climate action and to support other country-specific, capacity-building needs of African countries, consistent with the commitment and provisions of the convention.Establishment of a compliance mechanism to ensure that commitments to the delivery of these means of implementation (financing, technology, and capacity building) are met. This report profiles the available climate change-related datasets, as well as details about their accessibility and procurement, in the 10 ASARECA member countries. In addition, the report assesses the incorporation of climate change adaptation strategies in national development plans and discusses the country positions in the current UNFCCC negotiations in eastern and central Africa. The study was conducted using a combination of extensive literature reviews and field visits to all 10 ASARECA member countries: Burundi, Democratic Republic of Congo, Eritrea, Ethiopia, Kenya, Madagascar, Rwanda, Sudan, Tanzania, and Uganda.Even though climate change-related datasets in the 10 ASARECA member countries were readily available, the quality of the data available had some limitations that are worth noting. The study sought to collect climate change-related datasets that go back at least 30 years from 2008. While crop and livestock production as well as meteorological datasets were available for this period in some countries; other countries had datasets covering much shorter periods. This is understandable, given the history of civil conflicts in at least half of the ASARECA member countries. Nonetheless, crop and livestock production data were collected for periods ranging from one to four decades in the 10 countries.A more interesting finding from this study was that all ASARECA member countries had incorporated climate change adaptation strategies in their national development plans. These strategies are broad and cover virtually all sectors of the economy. In addition, most ASARECA member countries report that they are implementing some, if not all, of the specified climate change adaption strategies.Finally, the African Group and Least Developed Countries (LDCs) have presented common positions on what they expect to see in the final agreement produced by the current UNFCCC negotiations. The African Group's position paper stipulates the mitigation strategies to be adopted, as well as the means of implementing these measures. Further, the African Group's position specifies the financial and technical assistance required to enable its members to implement the proposed climate change adaptation policies. In cognizance of the vulnerability of the ASARECA member countries to the adverse effects of climate change, this study recommends that the ASARECA member countries be assisted both financially and technically to build the capacity needed to adopt the climate change adaptation policies specified in their development plans."}

main/part_2/0007664915.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"5e9272a9869161017f9cc3cce5026a86","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7a9a173f-034d-4888-a147-5856b98cd43c/retrieve","id":"-453843216"},"keywords":[],"sieverID":"364f04d0-35a9-4ca5-9d92-87f6196c3852","content":"The Soils4Africa project aims to build an open-access Soil Information System (SIS) for Africa that will allow for monitoring of soil quality. A set of key indicators of soil quality have been identified and they will be assessed using field data to be collected from 20,000 sampling sites spread across the African continent, using standard protocols and operating procedures for data collection that allows for repeated assessment and monitoring of soil properties and soil quality. This soil information system will become part of the knowledge and information system of the EU-AU Partnership on Food and Nutrition Security and Sustainable Agriculture (FNSSA) and will be hosted by an African organisation with the requisite capacity to manage the system. This system will inform decision making on policies and interventions towards sustainable agricultural intensification in Africa. The field campaign that is planned to take place from January 2022 to June 2023 will provide the baseline data for future monitoring of soil conditions.The Soils4Africa project has seven (7) work packages which are all interconnected. Work package one (WP1) deals with project coordination, communication, and dissemination. WP2 is dedicated to stakeholder engagement and the identification of the relevant soil indicators. WP3 covers the design of the soil information system. WP4 focus on the field campaign and capacity building for sample collection and field observation, WP5 deals with the laboratory analyses of all soil samples collected in WP4. WP6 is responsible for the IT infrastructure and building the SIS and for capacity building on managing and maintaining the SIS. Finally, WP7 centres on the ethical aspects of the project including data privacy and environmental protection.The project will collect soil samples and make field observations for agricultural land only. Agricultural land in this context refers to arable land, permanent crops and permanent pastures 1 . Arable land includes land under temporary crops, temporary meadows for mowing or pasture, land under market and kitchen gardens and land temporarily on fallow (less than five years). Permanent crops area includes land cultivated with crops that occupy the land for long periods (cash crops such as cocoa, coffee and rubber); land under flowering shrubs, fruit trees, nut trees and vines, but excludes land under trees grown for wood or timber, while 'permanent pastures' refers to land used permanently (five years or more) for herbaceous forage crops, either cultivated or growing wild (wild prairie or grazing land). In the end, the project will have a system in Africa that will enable the monitoring of soil quality in relation to intensification of agricultural use, so that threats to soil resource and opportunities for sustainable intensification could be identified.This deliverable refers to the protocols and instructions for conducting the field campaign and consist of two documents. One is the protocol for the field survey, or the instructions for the field surveyor. The second document is the protocol for field survey management, in other words, the instruction for the country supervisor. The protocol for the field survey is a standard protocol that applies to all the surveys that are conducted for this project across Africa, such that results for one region, or the This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900 other are comparable. The protocols need to be strictly adhered to. The instructions for management of the survey are more general and allows for some flexibility in the implementation of the protocol and to adjust to the conditions in the region and country where the survey is implemented.The soil information system for Africa requires information on land use and land cover, terrain condition, soil properties and land management. The data collected in the field (field observation) and the results of soil analysis will be used to assess soil quality. Land use and land cover measurement will include field observations on the type of vegetation, the current use of the land, purpose of the farming activities and crop types, and field distribution patterns. Data on soil surface and terrain condition will include slope, soil erosion, soil drainage, stoniness, and soil depth. A set of both physical and chemical properties defined in the deliverable \"D3.3 Detailed guidance for fieldwork\" will be determined in the laboratory using the soil samples collected. Field observation will also be made on land management and the data will include presence or absence of soil conservation measures, use of mineral fertilizers or manure, irrigation or any other practices employed by the farmers for the management of the land. A set of soil parameters, such as particle size distribution, pH, organic carbon content, carbonate content, total nitrogen content, extractable (available) phosphorus content and extractable (exchangeable) potassium content), is considered as the minimum information needed to support the quantification of soil quality from an agricultural perspective. Detailed explanations of each of the soil parameters as indicators of soil quality are contained in D3.1 Methods for deriving selected soil quality indicators (Moinet et al., 2021).In the Soils4Africa project, a suitable sampling design has been formulated. The details are provided in the deliverable \"D3.2B Soils4Africa Sampling design\". The document defined the approach for selecting sampling locations and D3.3 Detailed guidance for fieldwork (Huising et al., 2021) provides the guidelines on which this protocol for field for field survey is developed. The Soils4Africa project will, in practice, be the first assessment of soil quality across Africa using a uniform and standard methodology.The protocols for the field data and soil sample collection provides for a standard method for the observations in the field and for the collection of the soil samples, such that repeated measurement and monitoring of the soil properties is possible.There are several protocols that will be/are developed for the various types of activities in relation to the field campaign and that cover different aspects of the survey. Beside the protocol for the field survey per se, which is covered in the present document, there is a protocol for sample preparation and processing. There is a protocol for sample shipment, and a protocol for soil analysis that will be done locally. There is a protocol for the management of the field campaign that provides instructions for the country supervisor on how to organize and manage the field campaign in his/her country. The latter is the subject of the second document that is part of this deliverable. It will be presented as a separate document.The present field protocol, or instructions for the field surveyor, provide the rules and instruction for the field survey that is planned to be conducted in the period from January 2022 to June 2023. It will provide the baseline data for the monitoring of soil quality, and which includes assessment of both permanent and dynamic soil features.For future assessment the protocol will need to be adjusted to focus on the more dynamic soil properties for the purpose of monitoring purpose. However, none of the soil properties are truly static or permanent and are subject to change depending on This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900 the change process. For each of these properties there is a different time horizon and consequently a different temporal resolution that allows for the monitoring of change. However, this is not of relevance to the present protocol.This protocol is for making field observation and soil sample collection on agricultural land. It is intended for use by the field survey teams or surveyors as a training material and as a reference document in field, during the field survey. There will be additional training material available to further explain the instructions on particular aspects and elements of the protocol. This field survey protocol is the reference document for the field surveyor, and he/she needs to fully understand the instructions given. At the same time this document is intended for the field supervisors and country coordinator who have to manage the campaign within their country and who have to support the field surveyor in conducting their task. The country supervisor needs to have an even more profound understanding of the protocol and methods presented. Likewise, the regional hub coordinator needs to be fully abreast with protocol and instructions for the field survey, carrying the ultimate responsibility for the campaign within their African sub-region.The protocol is presented as outlined below:• Preparations and materials for fieldwork Proper and adequate preparation is vital towards a successful field survey. Preparations for the field work entail, firstly, downloading all reference and instruction materials (protocols etc.) and studying them. Then, downloading of the sampling locations to be surveyed and planning your itinerary and survey and getting all required materials needed for the field work. The preparation for the field survey may require some time, especially getting and preparing all materials required, such that a start should be made with the preparation as soon as a job has been assigned to you. And the time needed for the preparation should be included in the planning for the field survey. For example, QR codes will be used to for soil sample identification (SS-ID). These QR codes need to be generated and printed before going to the field. Furthermore, all tools that are used in the field need to be tested. Also, you should practice using the tools, such that no time is wasted in the field finding out how it works. All that requires time. Ensure you get a waterproof bag to protect equipment such as smartphones, GPS and others, and documents in case of rain.Plan your itinerary using Google Maps or other similar apps to also get an idea on how much time you will spend in the field. You are strongly advised to print out the maps with sampling point locations for the different primary sampling units (PSUs) separately. This becomes handy as a reference for navigation to sampling points in the field and/or to make annotations on of where the car has been parked from where you have been further tracking on foot, for example. Or, to make annotations of observations in the field, or to make notes on the points already covered.All data recording, in principle, is done using electronic means. Install ODK-collect (see instructions below) on your smart phone, download the form (see below instructions how to download the form) and ensure it is working properly. The smartphone battery should be fully charged before leaving to the field and you need to have a fully charged reserve battery, power bank or a second phone as backup if you will be staying for consecutive days in the field. Make sure you have reserve batteries for the GPS. Other recommended apps should be downloaded and practiced with, to make sure you're not taken by surprise in the field to find out that the app is not working, or that you do not know how it works. Upload coordinates of the sampling units and the backup locations to the GPS device, or to the smartphone when using MAPS.ME. Use GPS waypoint manager, or MAPS.ME to navigate in the field.The surveyors should ensure they have received the accreditation letter which will be provide by the country supervisor. The letter is necessary for the surveyor to explain and justify his mission and to present it to the farmer or landowner, or local authorities when needed. Make sure that before you leave to the field that you have spoken with the Country Supervisor (CS) or possibly Field Supervisor (FS) assigned to you and have gone through all the preparations you have made and get approval to start the survey activities.Observe general rules with respect to weather conditions. When it is raining soil sample collection cannot be done, and therefore also not recording of associated observations in the field. It is left to the surveyor to make the call whether to go to the field, but in case of isolated showers, for example, it is very well possible to conduct the field survey. Make sure you have protective clothing.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900Listed below are the equipment and materials needed for the fieldwork with their specifications. If the surveyor will be using a GPS for navigation in the field, all the locations of the sampling points assigned to the surveyor needs to be uploaded to the GPS device. The list of points together with their coordinates will be provided by the CS and will be available through the SDMT. Depending on the GPS device, the coordinates need to be in a specified format (though very much standardized across the various brands) and may therefore require conversion. Instructions are provided below. Call in the help of the CS in case you need any help in thisThe file in which the coordinates of the sampling points are provided is a CSV file (a comma separated values format before you can convert to GPX or KML format. In MS Excel safe the file as 'csv' file (Go to 'File', select 'Safe As' and then select the CSV option under 'File Format:', specify the location where to safe the file and safe).GPX stands for GPS eXchange Format, while KML is an acronym for Google Earth's Keyhole Markup Language format. Both these file formats are standard GPS file formats that are used to store and exchange GPX data including waypoints, routes, tracks, etc. You have been given coordinates of the sampling points in a csv file and want to convert it to GPX so that you can upload it into a GPS handheld device. To convert a csv file to GPX, you can use third-party software like GpsPrune, RouteConverter, ITN Converter, and more. These are free downloadable, open-source programs. You can also use a free online service that supports csv to GPX conversion, without having to download and install the program. However, below the example is given for 'ITN Converter', which need to be installed on your computer. Instructions are provided how subsequently the file conversion to GPX or KML is done (on a Windows Computer).ITN Converter lets you convert a csv file to different versions of a gpx file, including gpx Garmin MapSource, GPS eXchange, and Garmin Nüvi. Here are the main steps to convert a csv file to gpx or kml formats using this free software:1. First, download and install this software (https://itnconverter.software.informer.com/) 2. Click on the 'Open' button and browse and import the source CSV file. 3. Next, you can edit the longitude and latitude information as per your requirement. 4. After that, select output format to GPX or KML. 5. Finally, press the Export button to start the GPS file conversion. 6. Once the conversion is done, power the GPS device and connect to the computer and transfer the file into the GPS device using the cable that comes with the GPS device.You may need to enter the coordinates of the points you have been assigned into your handheld GPS device particularly if for one reason or the other you lose the already saved points in the field. Do the following to manually enter the coordinates one after the other.1. Power on your device and wait while it searches for a signal. Press the menu button to access the main menu. 2. Press the \"Select\" button to move to and select \"Mark Waypoint.\"This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 8629003. Select the \"Location\" field and select the coordinates you want to enter (Make sure the coordinates are in the same format used by the GPS. If not in the same format, you can change the coordinates format under \"Position format\" in \"Settings\" on your GPS device). 4. Press \"Done\" when you have finished entering the fields. Make any other changes you desire, such as notes or elevation, and click \"Done\" or \"Go\" (depending on your device) to save the changes.Displaying the sampling point locations in Google Maps, is in first instance intended for the planning of your trip; to know where all the points are located and subsequently planning your route. We assume you are familiar with using Google Maps for this purpose.Google maps can be used for navigating in the field but requires internet coverage/access in the area to be surveyed. In case of good internet access this a very useful option because it allows you to access the satellite imagery data that Google Maps provides, which may be very helpful for your orientation in the field. It may also show roads and tracks that can be followed to navigate to the sampling points whilst in the field. It is essential you have internet access (and data bundles) on your phone to enjoy this service.If no internet access can be guaranteed, the alternative is to print images of Google Maps of the areas to be surveyed, with the sampling point locations displayed, and take these to the field for orientation. In this case the sampling points are displayed in Google Maps on your computer and maps are printed out (using a screen dump, for example). To be of use in the field, the scale of the maps (printouts) needs to be such that prominent landscape features can be clearly recognized. For that purpose, it is advised to zoom into the various PMUs and print out maps for each PMU separately.You can request the CS to provide you with a link to file that contains the sampling points in Google Maps. Click on the link and it will take you to Google Maps app. In case you want to access these points on your phone for navigation in the field, ensure that you have the app on your phone (though the app comes installed on all android devices). For using on your computer, click the link on your computer and it will take you to Google Maps displaying all the sampling points assigned to you.1.First download and install MAPS.ME app on your phone (you need internet access). You will be able to do this using the Play Store on your phone (https://play.google.com/store/apps).Click to open MAPS.ME.Click on the 3 horizontal bars 4.Click on and then select \"Download Maps\".Click on the \"Find map\" bar and type in the name of your country, e.g., Ghana.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900 6. Click Download. In this way you have successfully downloaded your country map. You only need to do this once. Ensure your location is enabled on your device. You can do this on the settings of your phone.Select and choose \"Terrain\" as map layer. 8.Also, download the file containing the coordinates of the sampling locations and save on your phone (you need internet access for this). You will receive the file as an email attachment from your Country Supervisor or their designates. The file will be in KML format. If the file is in csv format, convert to KML according to the instructions given in section 2.2 above. Security during field work is an important issue. Care and due consideration must be taken to guarantee the safety of lives and property.• It is important that at least two persons be in a group (2 persons per service provider) for the purpose of security and to aid or help one and another where and when necessary. • Familiarize yourself with the security conditions in the area where the survey is to be conducted. If there are major concerns, please report to the country supervisor.• The surveyor (SP) shall take action to eliminate, minimize, avoid, or report any hazards of which they are aware and follow safety and health instructions where and when applicable. How to navigate in the field is important. It directly impacts on the effectiveness and efficiency of the work. The number of sampling points that could be done per day is directly related to mastery in field navigation. This section explains how to navigate with your phone in the absence of a handheld GPS device, and how to properly navigate in the field using handheld GPS device. There are several options to do this ranging from the traditional method of using topographic maps to the modern GPS navigation methods. In this protocol the focus is on the use of the modern GPS navigation methods. These include the use of GPS handheld device, Google Maps app and MAPS.ME app. It is important to load the sampling points into any device or app that will be used for field navigation. Instructions on how to load the points have been provided in section 2.2.2.Navigating using handheld GPS device follows the same steps irrespective of the type of GPS device. Now that you have loaded all points assigned to you on the GPS device, travel to a known location closest to the point. Switch on the GPS device as soon as you are about to be in doubt of your direction. An example of how to navigate using Garmin Etrex 10 device is provided below. The GPS can be used while still in the car to indicate the direction and distance to a point, but the instructions are intended particularly for navigating in the field when on foot or going by motorcycle.1. On the GPS device, scroll to \"Waypoint Manager\" and select the waypoint manager 4. You can use the arrow keys on the device to zoom in and out for ease of navigation. Your device will either make a sound (Arrive at the point) or read \"0 m\" when you are at the point for sampling. Please take the soil samples as soon as the distance to the point is 10 m or less. The sampling design is a hierarchical design consisting of three stages. The primary sampling units (PSU) represent two by two (2x2) kilometre spatial units from which several secondary sampling units (SSU), of one (1) ha in size, are randomly selected, and for each SSU there are several tertiary sampling units (TSUs) identified of 25m 2 each. For each SSU, one (1) TSU needs to be sampled. However, for reasons specified below certain points may not qualify or might not be suited to take samples. For that purpose, alternative sampling points (TSUs) are identified for each SSU. For each PSU four (4) SSU are supposed to be sampled, but because an individual SSU may not qualify as a valid sampling unit, alternative SSUs are likewise identified and that serve as back-up sampling locations.For each SSU there are three (3) TSUs sequentially numbered 1, 2 and 3. The first point needs to be considered first for sample collection and data recording. If it is not possible to sample this point/plot due to any of the situations specified below, then the plot is discarded, and the second point is considered. The same consideration is made and when rejected the third location provided should be considered. When all three sampling points are rejected by consequence the corresponding SSU is rejected.Given the small size of the SSU (one ha) possible restrictions may well apply to the whole SSU rather than to individual TSU, and this might be easily overseen or observed when in the field. In such case the SSU is then discarded and an alternative (back-up) SSU is selected. For each PSU, seven (7) SSUs are identified and these SSUs are sequentially numbered. The surveyor should in principle consider the first four (4) listed SSUs. The surveyor can start with any of those four SSUs. If the SSU is rejected, the next on the list is considered. That is the SSU with sequential number 5. Then any other of the first 4 SSUs is considered and when this SSU does not qualify the net in line, that is the SSU with sequential number 6 is selected. And this is repeated until all the 7 SSUs have been taking into consideration. If all the SSUs have been rejected the PSU is discarded/rejected as per consequence.Soil samples are collected only on the designated sampling point location, which is reached if you are within 10m distance from the specified location. If the point is not suited for sampling, the surveyor cannot move a short distance in some random direction and take any other point, unless in specific situation and following procedures as described in section 9.The surveyor is to record the reason for the rejection of the designated sampling point using the ODK form. The user will be requested to specify the current location and give the distance and direction to the proposed sampling point location, if not at the specified location, and to take a picture in the direction of the proposed sampling point location.Below are the various options the surveyor can chose from to indicate the reason for the rejection of either the SSU or the TSU. • Badlands -steep to very steep barren land, with active geological erosion, also rough broken land MLU03• Beaches MLU04• Blown-out land -Area with most of the soil material removed by wind -extreme degree of erosion MLU05• Colluvial land: Unconsolidated recent colluvium -heterogeneous deposit of soil material, rock fragments MLU06• Ditches and spoil banks -ditches and rock waste banks and dumps from excavations MLU07• Dumps -Area of uneven accumulation or piles of waste rock, including tailings MLU08• Marsh -Periodically flooded areas with grasses, cattails, rushes or other MLU09• Oil-waste land: Accumulation of liquid oily wastes MLU10• Pits and Open excavations from which soil and underlying material has been removed MLU11• Rock land -Area having rock outcrop and very shallow soil (rock outcrop between 25 -90%)This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900• Rock-outcrop Exposure of bare rock MLU13• Swamp -Naturally wooded areas which are covered with water most of the time MLU14• Stony land -Areas with enough stones and boulders to submerge other soil characteristics MLU15• Shifting sandsThe project has procedures for excluding sampling units, especially PSUs, in areas of known security challenges or with restricted access (like national parks or other protected areas) and these sampling units will not be part of the list of sampling points offered to the surveyor. But areas with local security challenges are often less known and that information might reach the surveyor only when he is in the field. In such cases, the surveyor will reject the SSU or even PSU even before progressing to the locations in the field and will subsequently not be able to record the reasons for rejection while in the field filling the ODK forms. in such cases the Surveyor will contact the CS to explain the reasons why the sampling units will not be surveyed and if the CS agrees, he/she will confirm the decision by flagging the sampling points in the SDMT to be excluded from the survey.Similarly, points located in areas of restricted access, like airports, will have been identified during the stage of validation of the proposed sampling locations and will thus not be included in the list of sampling point forwarded for surveying. But not all these cases can be adequately identified at that stage and may become apparent only when in the field. Similar procedures apply if the decision is to exclude those points even before having visited that particular area in the field: the CS needs to confirm the decision not to include those points and will make the corresponding annotation in the SDMT.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900This section describes the general layout of the sampling plot, provides instruction how the samples are taken using the various tools (auger, spade and pipe), and provides instruction for the bagging and labelling of the soil samples.  Soil samples are taken at two depths: 0-20 cm (topsoil sample) and 20-50 cm (subsoil sample). Topsoil samples from the four sub-locations are collected in the bucket labelled 'TopSoil\", and thoroughly mixed. The four (4) subsoil samples are also bulked and thoroughly mixed using the bucket labelled \"SubSoil\" to provide for one composite subsoil sample (see the section on how to make composite samples). Sample collection can be done with an auger, spade, or pipe or corer, depending on which one you have but the use of an auger is preferred.In case of soil depth restrictions, samples are still taken if it is possible to gather enough soil from at least two of the four sub-locations. In practice this means that you must be able to auger to at least 10cm within the soil layer. That is to 10cm from the soil surface for the topsoil sample and that is to 30cm depth at least for the subsoil sample. The depth restriction need to be indicated at all time, so as not to create any confusion with the interpretation of the results from the soil analysis. 2. Put the auger straight down and auger vertically downward, avoid the auger from slanting sideways. 3. Collect topsoil sample from the centre of the plot and put in the bucket for the topsoil. 4. When augering the subsoil, make sure that soil from the surface (topsoil) that has fallen into the auger hole is not included in the sample to be collected. This is prevented by always removing the upper one third part of the soil in the auger and discard the soil. This is done every time subsoil is collected. 5. Do not overfill the auger when taking the subsoil sample as this will distort the volume of the auger hole. To avoid this, empty the auger regularly at depth increments of 10 cm (20-30 cm, 30-40 cm, and 40-50 cm). 6. Preferably collect the topsoil samples for the 4 subsampling locations first, before collecting the subsoil samples for the 4 subsampling locations. Clean the soil auger before taking the subsoil samples. 7. Pool (composite) topsoil samples from each subplot into one bucket and do the same for subsoil (in the bucket labelled \"subsoil\"). 8. Mix the soil thoroughly in the buckets using the trowel. 9. Take about ~500g for each composite sample -topsoil and subsoil; that is two topped hands full of soil for each composite sample and place it in a plastic bag. Tie the bag with a knot or use the stapler to close the bag. Put the plastic bag with the topsoil sample in the bucket for topsoil samples and put the plastic with the subsoil sample back in the bucket for the subsoil samples; label as described in section 6.4. 10. Clean the soil auger before moving to the next sampling location using grass or leaves that you find at the sampling site. 11. For each hole thus created repeat steps 2 to 6 but now digging a V-shaped hole from 20 cm to approximately 50 cm deep.12. Repeat steps 8 and 9 to make one composite sample for the subsoil.13. Clean the spade before taking samples at the next sampling site 6.2.3 Soil sample collection using a pipe/cylinder 1. Clear the point of litters or any vegetation.2. Mark out 20 cm and 50 cm on the pipe.3. Insert the pipe straight into the soil to a depth of 20 cm using the hammer.4. Remove the pipe and empty the sample into the topsoil bucket 5. If the soil is very wet and sticky or clayey you will need to apply some pressure, knocking the mallet on the side of the pipe to empty the pipe. In case this does not work use the knife to empty the pipe.6. After removing the topsoil return the pipe into the hole (where the 0-20 cm was collected) and push down the pipe to a depth of 50 cm with the aid of a mallet on the top-end of the pipe 7. Remove the pipe and empty the content into the subsoil bucket as described in step 5. Make sure the soil is spread in the bucket when the pipe is being discharged such that the topsoil that is in the pipe is discharged latest and can be removed from the bucket.8. First do the sampling of the topsoil for each of the subsampling locations before sampling the subsoil at each of the locations. 9. Clean the pipe as good as is possible before moving to the next site for sample collection.Bagging and labelling is an important aspect of quality assurance and needs to be properly done to make sure that the soil samples are correctly identified also in the further process of handling and analysis of the samples. Such that results of the sample analysis are not attributed to the wrong samples. The sample from each bucket goes into a different bag. The bucket used for the collection of the topsoil samples should be the same for all sampling points. The same applies for the bucket used for the subsoil sample. And this should not change from one location to the other, or from one day to the other, in order not to create any confusion.The samples collected should be double bagged, using a plastic bag as inner bag for containing the moisture and a cloth or paper bag to provide strength or sturdiness to prevent the plastic bag from tearing. The inner bag needs to be closed by either tying or by stapling, depending on the type of plastic (if thick and hard it needs to be stapled). The label (the soil sample ID) is put in between the inner and outer bag (ensure the barcode is scanned before it is put in the bag). The outer bag (cloth or paper) needs to be closed as well. For the paper bag a stapler is best used. The cloth bag is tied with the cord that comes with it (otherwise fold and staple). a rope.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 8629001 Scan the barcode with the smartphone into the appropriate section on the ODK form. 2 Insert the QR/barcode in between the inner and outer bag. 3 On the outer bag, write the sampling point ID legibly and indicate \"T\" for topsoil samples and \"S\" for subsoil samples. Write with a permanent marker. 4 The soil sample ID consists of a 2-letter country code and random sequence of alphanumerical characters which can be either in lower or upper case. The bar code comes in duplicates (two of the same QR codes on the same piece of paper) and should also be put as a duplicate soil sample ID in the sampling bag. The SS-IDs are provided (made available) to the surveyors. When provided as separate laminated duplicate codes they can be added as they are. If they are printed only (not laminated) the duplicate bar code needs to be put into the small plastic pouch (zip file) and sealed/zipped to prevent it from getting wet and then put into the sampling bag. Instruction for generating the QR codes are provides in the \"Instructions for the Country Supervisor\"When the work is done, please leave the site neat and clean. The auger hole (pit) needs to be closed and left in a condition as close as possible to before opening the pit (before augering). Try to get the soil back into the pit/hole, such that animals do not easily steps in the hole and break their leg. Please make sure that no plastic, paper or other material is left at the site! This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900Field observation data are to be collected from the sampling locations. Observations are made on soil properties (e.g., soil depth, stoniness, soil drainage), on soil surface characteristics (soil erosion by water and wind, stoniness), on the land and terrain (landform, slope). For making the observations either of the four sub-sampling locations can be used. If the center point in the plot layout is not suited (e.g., because of depth restrictions, stones in the profile, or other) and of the other sub-sampling locations can be tried to make a valid observation. The specific observations to be made per each category are outlined below.Soil depth is determined with the aid of an auger. Soil depth is registered at that point where restrictions are observed to augering to further depth even when applying considerable force. This can be because of hitting rock, because of gravel and stones or because of any type of hard pan (iron pan, dense clay layer, plough pan or other).Auger until you find any restrictions. Apply considerable force to confirm that is not possible to go any deeper. Note the depth at which the restrictions are observed. Depth classes are defined according to the classification system given in the In case you have only a spade or pipe at your disposal you can still record the soil depth class whether it is \"SD1\", \"SD2\", or \"SD3\". There is an option in the ODK form to indicate that no auger was available such that it is not possible to distinguish between depth classes \"SD3\", \"SD4\" and \"SD5\".The nature of the restriction making it impossible to auger any deeper is indicated. This can be because of hitting solid rock or rotten rock (layer consisting of rock fragments dominantly, with varying size of the rock fragments but can be as small as gravel), in which case the depth is the actual soil depth. It can also be cause of any cemented or compacted layer (horizon) within the soil profile that cannot be penetrated by the soil auger. In this case, the nature of the cementation of compactionThis project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900 is provided. This can be cementation by iron in case of an iron pan or hardened plinthite, or by clay (compacted horizons with high clay content), or by mechanical and action and ploughing (abrupt transition to compacted layer at 20-30 cm depth that cannot be attributed to cementation or abrupt increase in clay content). We have included accumulations of iron and manganese concretions which occur in many soils. It may not completely make further augering impossible, but it will restrict rooting if the layer is made of these nodules almost completely. It is often classified as 'nodular', and it then includes concretions formed from lime/carbonates. If groundwater is found within the 120 cm it is also considered rooting or effective soil depth restriction and is recorded. Finally, an option is provided for when the nature or type of the restriction is not known.Attribute: Soil depth restriction nature (code: SDRN) Observations on soil texture, colour of the soil matrix, stoniness and presence of mottles is done for the soil layers 0-20cm, 20-50cm and 50-120cm. The soil texture is specified only in general terms, and since the texture is in principle determined in the lab it is used for cross referencing mainly:The soil colour refers to the colour of the soil matrix and the colour of mottles, if present, are not recorded. For sake of convenience, the dominant colour of the soil when moist is indicated:Stoniness is recorded in terms of stoniness class, based on the estimated volumetric content of gravel or stones:This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900• Common (5-15%)• Many (15-40%• Abundant (40-80%)• Dominant (> 80%)Mottles are only recorded by their presence (Y/N) and serves mainly to countercheck with the drainage class presented in the next sectionsSoil drainage is a natural process by which water moves across, through and out of the soil as a result of the force of gravity. Soil drainage class is determined by looking at visible signs within the soil profile that indicate that the soil is saturated with water for at least a considerable and significant period during the year. The presence or absence of mottles is used as an indicator of soil drainage. Mottles are spots or blotches of different colour, generally grey or orange, interspersed with the dominant soil colour. They occur as the results of oxidation/reduction processes in the soil. Under water saturated conditions, no air is available, and reduction of the various elements and compounds (especially iron -Fe) will take place resulting in greyish colours. Where the soil is subsequently drained (at least for part of the year, oxidation takes place resulting orange and reddish colours.The picture below shows a typical pattern of mottles in the soil. However, the mottles themselves cannot be observed clearly in the soil that is removed using a soil auger, but the discolorations can be seen clearly. It helps to break up the clump of soil that you take out of the auger. So, while augering to determine soil depth, the soil that is taken out at the various depth layers should be inspected for mottles and/or clear discolorations. The drainage class is determined based on observations on the prevalence of mottles and the depth at which they occur according to the specifications given in the occur as the result of deflation (soils containing stones in their profile and stones being accumulated of at the soil surface as result of soil being blown out or washed away from the soil surface, which has taken place for a prolonged period of time). But even for soil that have been worked you still find a high concentration of stones on the soil surface. Visible signs for rill erosion are clearer, as they are for gully erosion. Though it may be difficult to see whether these are signs of active erosion or results from past events. Off-site effect of water erosion may be deposition of the sediment and it is included as a separate category Another class of erosion is that which is caused by the action of wind. It is just recorded whether there are visible signs of wind erosion and those may be related to either or both soil material removed and soil material deposited. Shifting sands, which is a form wind erosion is not included in the list. It is one of the miscellaneous land uses that does not qualify as agricultural land and sampling points in such areas are rejected. Salt deposited by wind erosion is included as a separate category.The options to choose from for recording of soil erosion are given in the table belowAttribute: Soil erosion category (Code: SECat)Code Title Definition WE00 No erosion No visible signs of erosion are observed WE01 Rill erosion A rill is a linear depression or channel in soil that carries water after recent rainfall. The channels are not more than a few cm deep (max 3 to 4cm). They are removed and not visible on land that has been tilled or ploughed. The rills point in the same directions and distance between consecutive rills can be up to metersGully erosion is a deep depression or channel in a landscape, looking like a recent and very active extension to a natural drainage channel. It is a consequence of water that cuts into the soil along the line of flow.In contrast to rills, they cannot be obliterated by ordinary tillage.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900Soil under a small stone or boulder is protected from the impact of rain drops, whereas the soil surface surrounding that stone is not, and where the soil is slowly washed away, resulting in pedestals that are easily observed.If soils have stones within their profile, these stones will emerge at the soil surface upon removal of the topsoil by erosion, resulting in a stone pavement, sometimes referred to as desert pavement or armour layer. Mostly different stages of deflation are observed rather than the surface being completely paved. It will still be recorded as such when observed. Even when the land is ploughed it may still be observed.  Deposition by wind, not salt flats or plains resulting from salt lakes that are not classified as agricultural landSoil surface sealing results from slaking of soil surface components or may result from sedimentation or deposition and results in a compacted surface layer with reduced porosity. We talk about sealing when no drying and hardening has taken place and of crusting when drying and hardening has taken place. No distinction is made between the different type of crusting, whether soil crust, chemical (salt) crust of biological crust, or to the process involved. It is just recorded whether there are clear signs of surface sealing or crusting. The accumulation of salt at the surface (cover percentage, and type of salt) is also not recorded, even though the presence of salt in the soils is an important consideration in soil quality monitoring for arid or semi-arid regions. For agricultural land, these observations are not considered that relevant and difficult to measure accurately. Further information on salt content and salinity will be accessed through the lab analysis of the samples. Stoniness records the percentage of the soil surface occupied by stones. There are different size classes of stones, from gravel to boulders, but the size class is not recorded (the photo taken of the soil surface will indicate the size class). However, you have to adjust the window of observation to the size class to be able to make a correct estimate of the surface area percentage. The large stones require a large area to be considered (a circular area with radius of 10m or more). The chart below (Figure 3) provides the guide to estimate surface cover percentages based on which the stoniness class is determined according to specifications in the below. The stoniness class is only recorded if there are stones, boulders, and large boulders.No stones: surface cover of less than 0.01%. There are not enough stones to interfere with tillage.Slightly stony: soil surface covered: 0.01 -2%; enough stones to interfere with tillage, but not to make it impracticable (e.g., stones of 36cm diameter with an average distance of 10m gives 0.1% surface cover).Stony: surface area cover percentage: 2 -5%; makes tillage impractical, but still possible when tillage by hand depending of the size of the stones and can be used for pasture or other crops (tree crops).Very stony: surface area covered: 5 -15% Makes use of any kind of machinery impractical except for handheld tools. This section provides information on how to describe the general landform and how to describe the slope. For the description of the landform a large window of observation is used, that extends beyond the point of observation and even beyond the SSU, applying often to the whole PSU. Distinction is made between land that is generally level, sloping land and land with steep slopes that refers to mountainous area. For the sloping land further distinction is made according to the slope steepness class and according to orientation of the slopes (in case of ridges where the slope orientation is in two opposite directions in general).Landforms refer to the shape of the land surface, without considering the genetic origin or the process responsible for their shape. Using the SOTER approach, below are the various categories. The class is assigned based on visual assessment and considering the physical environment. The figure below helps to explain the difference between a plain and a plateau. Gently sloping land/terrain has slopes not exceeding 10%, whereas moderate sloping terrain has sloped generally not exceeding 15%. Steep land has slopes that may exceed the 30%. The codes are provided for the development of the SDMT, and these will be used for entering the data on the DK forms.Attribute: Landform (Code: LandF) against what is filled into the form. The second picture is taken slanting downwards such that the furthest part still to be seen on the picture is 20 to 30 m away at least.Picture should be taken in the direction perpendicular to the slope direction. The third picture is taken in horizontal direction and likewise perpendicular to the slope direction.It serves to give an idea of the terrain and landscape.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900In this section the instructions are provided for the observations on land use and land cover. Because observations are made in the context of agricultural land and for the purpose of soil quality assessment, the land cover observations mainly serve to determine soil cover. Furthermore, observations are made on land and crop management, providing information on land use intensity which is important for the interpretation and evaluation of changes in soil condition and soil quality. Observations on land management includes soil conservation measures and practices. Observations are also made regarding water management in terms of measures to increase water supply to the crop (e.g., irrigation).Observations on land use are made on a different scale from the scale at which observations are made on the soil or soil profile (i.e., the TSU, or the circular sampling plot encompassing 25m 2 ). Rather the secondary sampling unit (SSU) provides for the window of observation for land use and land management practices. However, a 1-ha area might be difficult to oversee in some cases, and therefore the area of about 1000m 2 in size, surrounding the sampling point location may be used as window of observation for practical purposes. This corresponds to a circular area with a radius of 17.8, let's say about 20m.For the Soils4Africa project the observations are made for the agricultural domain only. That means that the area belongs to primarily vegetated area, which according to the definition of the Land Cover Classification System (LCCS) of the FAO is the area with a vegetative cover of at least 4% for at least two months of the year. If these minimum requirements are not met the sampling point is not recognized as a valid sampling location and should have been rejected following criteria specified in chapter 5. The land use can then belong to one of the three main land use categories only, and the main land use category is the first that needs to be determined. The main land use categories are the following:• Cultivated and Managed Terrestrial Area (CMTA): This class refers to areas where the natural vegetation has been removed or modified and replaced by other types of vegetative, artificial cover that requires human activity to maintain and manage it. This can be any kind of crop, but also includes 'agricultural grassland' that has been sown, that is intensely grazed and/or mowed.• Semi-natural vegetation (SNV): This refers to vegetation that is not planted but influenced by human actions and that may result from grazing, selective logging, or regenerative vegetation on previously cultivated areas. The dominant life form only applies to CMTA and to CAA, though in the latter case you will only find graminoids (e.g., rice) as the dominant life form in practice.The dominant life form is the life form of the uppermost canopy layer and of the crop that is the most relevant economically (the crop that represents the main purpose of the farming activities). For example, in a shaded coffee plantation, the dominant life form is \"tree\", being the life form of coffee, irrespective of whether the shade trees are commercially exploited as well, or whether there is an undergrowth, or whether a second crop (intercrop) is grown with some economic value. The options are the following:1. Tree: Trees are defined as plants with a well-defined woody stem that is taller than 3m when full grown. In general, the criterion for distinguishing between tree and shrub life form is a height of 5 m. However, if the plant is smaller than 5m (but taller than 3m) but has the distinct physiognomy of a tree then it is still classified as tree. 2. Shrub: A shrub is a woody plant with persistent woody stems, but not with one defined main stem. It does not grow taller than 5m. The spatial aspect, because it refers to field size and pattern only applies to CMTA and CAA. We include two classifiers under the spatial aspect; that is field size and spatial distribution pattern. Both these classifiers imply other aspects, like mechanisation and cropping intensity for example, and provide relevant data for the information on land use intensity. The scale of the observation is smaller (window of observation is larger); that is, it applies to a considerable larger area than the unit of observation for the above-mentioned observations. It can refer to an area of 1 km 2 or larger, if that can be overseen from the point where the observation is made. Field size and field pattern can be easily verified from high resolution satellite imagery.The size is specified in acres as well as in hectares (approximate corresponding area in ha). For reference, a football pitch measures about one and a half acres (the area between the lines demarcating the football pitch) and with the immediately surrounding land that goes with it, it covers about 2 acres. The field size class is given for the dominant field size, assuming a more or less even distribution of the field size in the area.Attribute: Field size (Code: FldSz)Less than 1 acre (< ± 0.4 ha) (1)Less than 2 acres (< ± 0.8 ha)(2)Somewhat small 2 to 5 acres (± 0.8 ha to ± 2 ha) (3)Intermediate 5 -12 acres (± 2 ha to ± 5 ha) (4)More than 12 acres (> ± 5 ha) (5)The field distribution pattern is defined by the percentage of cultivated field and by the arrangement and shape of the fields. If fields are of the same shape and arrange in a regular pattern it indicates that there is a certain organisation in place, like is the case with irrigation schemes or plantations, and it is indicative of a more intensive land use system generally. In the same way, when field are not continuous it indicates a lower cropping intensity and lower intensity of land use. Field occupying less than 50% of the area indicates that other land use and land cover types are present and dominant within the area.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900 aspect of land management. Therefore, signs of overgrazing have been included in the observations on grazing. For these observations the window of observation is widened, beyond the soil sampling plot. Signs of grazing, in as far as this relates to grassland with livestock grazing and infrastructure present in the field, is included to cater for those situations in which the land is cultivated and managed, to distinguish between grassland that is used as hayfield only and that which is being grazed.Relates to signs of an area being used for grazing or to signs of impact of grazing. Either one of the following: ➢ Where animals (livestock) are out in the field grazing ➢ When there is infrastructure for grazing of cattle or other livestock: Fences, drinking troughs, stables, or sheds. ➢ Droppings/faeces are seen (often concentrated), left over from fodder -feeding operation ➢ Signs of poaching by livestock (removal of grass or vegetation), spots of trampling and compaction of the soil are visible.Either one of the following: ➢ Short grass height over large areas ➢ Frequent observation of areas of bare or poached ground ➢ Large amounts of dung ➢ Frequently uprooted vegetation Y/NIn relation to land management data is collected in reference to the land preparation; information on crop management is in relation to the use of input. Both provide information on land use intensity, though not very specific. For these two classifiers the information can be obtained by observation in the field. Other aspects of land preparation, like land clearing, and crop management, like pest and disease management, are not included because these data cannot be obtained from visual assessment in the field alone.For land preparation visible signs of ploughing will be recorded, and, if visible, the direction of ploughing. The signs might refer to land that has been ploughed in the past or to recently ploughed fields. In land that has been previously cultivated, but where we find secondary regrowth, signs of the land having been ploughed might still be visible and is indicative of agricultural use in the past (and therefore belongs to 'agricultural area'). Whether the ploughing has been done manually, by animal traction or using a tractor can be observed by the distance between the plough ridges and the pattern, whether regular and straight or whether irregular and not straight and will be visible for the trained eye. Also, it is easy to find out what is common practice in the area, and the surveyor will indicate the most likely option.This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900Land preparation in case of smallholder farming in Africa generally means that the land has been ploughed leaving ridges on which the crop is planted. In case a seedbed has been prepared, (possible in case of commercial and mechanized farming operations) the ridges might not be visible anymore. In that case you still enter 'signs of field recently tilled'. The planting lines might not be indicative of the directions of ploughing, and the direction of the planting lines is entered as the 'Direction of ploughing'.The direction of ploughing is to provide information on practices for soil conservations and could as such also be grouped under that category of observations (3)With the use of inputs reference is made to the use of fertilizer (both organic and inorganic) only. It is sometimes difficult to recognise the visual signs of the various types of inputs that might have been used, or there might not be any visible signs at the time when the survey is conducted. In that case we may assume that the common practice for the area might also be applied in the field where the point/unit of observation is located, if the land use and crop observed at that point is consistent with the crop for which the practice applies. Crop residues, if they are left in the field, are readily observed for crops like maize, sorghum, millet, etc., and it is also quite common to use the crops residue in certain regions. The same for the use of farmyard manure, it might be quite common in certain regions. It can be observed by heaps of manure they put on the field and that they will spread out before planting. It will still be visible in field with a standing crop as remnants of the manure that have not been decomposed and worked into the soil. Likewise, for use of inorganic fertilizers, it is difficult to spot in the field, but the practice is most likely used, when it is a common practice for that area. And if the surveyor is from that area s/he will know and will indicate the most likely option. Water management applies to the 'cultivated and managed terrestrial areas'. It does not apply to the (semi-)natural vegetation areas and for the cultivated aquatic areas the water management is inherent in this type of land use and does not need to be further specified. This section deals with cultural practices related to water supply to the crop. First it is indicated whether you have a rainfed system, a post-flooding system or makes use of an irrigation system. The post-flooding is when the land is being cultivated after is has been flooded, with the crop making use of the residual soil moisture. It generally is found in river flood plains and not in artificially flooded areas.Obviously, it can only be observed at the right time when the water has subsided. However, a surveyor that is familiar with the cultural practices within the area, will know. For irrigated systems, this may refer to fully irrigated systems or to systems intended for supplementary supply of water, in addition to the water supplied by rain. Water harvesting is not explicitly included as a separate option as a technique for water management but is inherent in the choices for type of irrigation and source of irrigation. For example, half-moon or zaï systems make use of (cone-shaped) pits to harvest water and is a specific from of surface irrigation, even though it is part of rainfed agriculture. It could be made explicit if it is considered an important technique and much applied practice in certain regions. much-applied cultural practice. Drip irrigation (trickle, dribble, or localized irrigation in which the water trickles onto or into the soil near the plant)(3) Not applicable (4)Canal (1) Ditch(2) Pipeline(3) Other / not identifiable (4) Not applicable(5) Source of irrigation Well (groundwater)(1) Pond/lake/reservoir (still water)(2)This project has received funding from the EU Horizon 2020 Research and Innovation Programme under Grant Agreement 862900In a cultivated land with prominent ridges, the topsoil mainly the 0 -20 cm depth has already been scooped up to make the ridge or heap. The furrow of the ridges therefore represents the subsoil (20 cm depth downward). This is true especially when the ridge is fresh, that is, the ridge was made recently. As time passes, part of the topsoil will be washed down into the furrow by raindrop impacts thereby creating another thin layer of topsoil in the furrow. Under this condition sample the soil as follows:• Sample the heap/ridge as the topsoil (0-20 cm)• To get the subsoil, sample the furrow as the subsoil taking the surface of the furrow at the point 20 cm only if the heap is fresh or recently made. • If the heap is not fresh or it was not made recently, then drill out the first 10cm layer on the furrow and discard. Then drill down to 40 cm on the mark on the auger. This represents the 20-50cm depth of the soil which is the subsoil sample.A sampling point may be located at the edge of a field or just between, or it may be at the edge of the road, or track. The general rule is that any sampling point should be located at minimum 5 meters from the edge of the field (field boundary). Therefore, in such cases move the point 5 meters into the field. In case the proposed sampling location falls on a road, within a compound, or other, move to the field that is closest by, but should be within a 25 m distance. In case a point falls exactly between two fields or on a point where the neighbouring fields are at the same distance, the \"look north\" rule applies. From the proposed sampling location, we look north and the field that is found in that direction will be sampled. Similar considerations apply when at the exact proposed sampling location, a rock is found, or there is a tree or any object that prevents from taking soil samples. In such case you may relocate the sampling point location, moving north in first instance and remain within 25m distance from the original point, and if the land use and land cover characteristics remain the same. If not, search a point in the same field and with the same land use characteristics as for the original sampling location."}

main/part_2/0009568177.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"5dacb731bc67381da7d1dd4db882d1da","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7c64232a-b02b-4cca-b36c-d14e1c22b74e/retrieve","id":"-1871666082"},"keywords":[],"sieverID":"e5466dcf-9460-4a0f-8a5f-5ec61d7cc84b","content":"Climate change harms women disproportionately, exposing social and gender inequalities across the globe. At the same time, women are essential for transforming food systems that increase resilience, food and nutrition security and well-being for entire communities. That was the key message delivered at the 1st high-level dialogue on gender and climate change in Africa at the International Livestock Research Institute (ILRI) in Nairobi, Kenya, on 12 October 2022, convened by CGIAR's Gender Equality (HER+) initiative, designed to address gender challenges in Global South food systems a ected by climate change. Nicoline de Haan, lead of HER+ and director of the CGIAR GENDER Impact Platform, explained the initiative's uniqueness is that it focuses on gender rst. 'The focus is on gender and climate change rather than climate change and gender,' said de Haan.In his opening remarks, George Wamukoya, team leader at the African Group of Negotiators Experts Support (AGNES), explained that lack of gender data is one of the reasons why African countries have been unable to implement gender-in-agriculture action plans: 'How are you going to recommend policies when you have no data?' he asked. Wamukoya provoked participants by calling for a move away from activism, asking gender experts to bring evidence to negotiation tables at the international, national and community levels.Keynote speaker Jemimah Njuki, chief of economic empowerment at UN Women, declared gender inequality within the climate crisis one of the greatest challenges of our time: 'The climate crisis is not gender neutral. Girls and women are more at risk with unique threats to health, safety and security.' Njuki made four points on how to improve gender research:"}

main/part_2/0020618901.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"5d8708e7cbd17e57c6e236725f0c0414","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/93d705d9-cc25-49ed-bedd-3c9586e02217/retrieve","id":"-1910775841"},"keywords":[],"sieverID":"26c4785a-12ae-4afb-854c-a285b91949eb","content":"❖ Women drudgery in production and post-harvest operations is one of the reasons for neglecting millet cultivation and low consumption by small and marginal farmers (Oliver king, 2016). ❖ Mostly, post-harvest operations involve more drudgeries, which affect the physical, psychological, and quality of life of farmwomen and do not have access to appropriate technologies. ❖ Drudgery levels get influenced by physical profile characteristics of the respondents like age, height, body weight and body mass index (BMI) (Singh, 2007). ❖ An ergonomics aspect in designing, operating, and refining implements as per their needs will help to enhance their efficiency and safeguard their health. ❖ With improved practice, drudgery in flatbread making was reduced to moderate (58.51) while to minimum (less than 50) in remaining four operations (fig. 3). ❖ Increased work output, reduced drudgery (35-88%) and time (31-90%) (fig. 6) and minimised postural discomfort (moderate to very light pain) (fig. 5) were found while using improved technologies. ❖ Knowledge regarding safe work methods, work practices, improved tools and equipment etc. were enabled to decrease musculoskeletal disorders.❖ Based-on operation-wise drudgery profile, suitable power-operated machines should be introduced that could reduce drudgeries and also enhance consumption of millets.• "}

main/part_2/0035499914.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"ff953c20376924ba917f185b8a03d05e","source":"gardian_index","url":"http://www.aaabg.org/aaabghome/AAABG23papers/64Aliloo23262.pdf","id":"-1696079266"},"keywords":[],"sieverID":"f0001e2e-d42f-4280-997e-e915303be660","content":"Small holder dairy farmers in Kenya rear crossbred cattle to combine the environmental adaptation features of indigenous populations with the high milk yield potential of exotic dairy breeds. The identification of signatures of selection in Kenyan admixed cattle could lead to a better understanding of the genetic structure of adaptation and productivity in challenging environmental conditions. Here, we examined the genome of the admixed cattle populations of Kenya for candidate regions under adaptive selection. We employed a haplotype based method, integrated extended haplotype homozygosity score (iHS), and scanned the genome of 1,475 admixed cattle using 521,362 SNPs. The local ancestry of the admixed cattle were inferred and used to identify the admixed cattle with more than 3 generations of crossing. This improved the power in detection of signatures of selection and after removing recently admixed animals, we identified 16 candidate regions and 8 candidate genes across 7 autosomes. Investigation of the candidate genes showed that several are involved in feed efficiency and disease resistance pathways that are important for adaptation under small-holder production systems. If substantiated, this information could be integrated into breeding programs aiming to improve dairy cattle productivity and adaptation in East Africa.The crossbred dairy cattle in Kenya consist of an admixed population resulting from around 50 years of crossing and inter-se matings of African indigenous cattle to several exotic dairy breeds, mainly from Friesian, Holstein, Ayrshire and related red dairy breeds, and Jersey. These animals are kept by smallholder dairy farmers, typically in herds of size 1 to 5 cows, and produce about 80% of the total milk in Kenya. The majority of Kenyan crossbred dairy cattle are bred via natural mating and only a small proportion of matings are made by AI to imported and locally bred purebred dairy bulls. Very few animals have pedigree records and there is no systematic genetic evaluation systems or breeding programs to support farmers. The identification of footprints of selection in admixed cattle through the use of molecular markers such as single nucleotide polymorphism (SNP) can lead to a better understanding of the genetic structure underlying adaptation and productivity in challenging environmental conditions. Genomic regions with selection advantage can be incorporated in breeding strategies to select animals that are well suited in such environments and production systems. In this study we scanned the genome of the Kenyan admixed cattle by applying an intra-population haplotypebased method (iHS) for signatures of post-admixture selection. We aimed to detect genomic regions responsible for adaptation and productivity under the challenging environment of East Africa. The local ancestry of individual loci are inferred to find the crossover events across the admixed genome and to assign each crossbred animal to a generation of crossing since the ancestral crossing happened.The genotypic data included 1,475 crossbred cattle sampled in Kenya between 2010 and 2014 and genotyped for 777,962 SNP markers using Illumina BovineHD BeadChip (Illumina, San Diego, CA). Routine QC was applied to genotypes and this resulted to 521,362 SNPs on 1,475 crossbred animals distributed over 29 autosomes based on the UMD3.1 bovine reference genome.Local ancestry and crossing-overs in crossbred cattle. The local ancestry of the crossbred cattle was inferred at individual SNP level using samples from 3 groups of ancestral populations including Bos indicus (IND) African Bos taurus (AFT) and European Bos taurus (EUT) by LAMD-LD software (Baran et al. 2012). The local ancestry inferences were used to calculate the average number of crossover events across each crossbred genome by first counting the number of transitions from either IND or AFT ancestry to EUT ancestry and vice versa, and then standardizing it by chromosome length. A recombination rate of 1 cM = 1 Mb across the whole genome and 1 crossover per Morgan per generation after crossing was assumed to assign each crossbred animal to an approximate generation since the ancestral crossing (indigenous × taurine) happened. A minimum of 4 generations of crossing was used to remove the impact of recent admixture on selection of signature analysis. This was also to keep only animals for which selection has had enough time to leave its footprint on their genome.Detection of footprints of selection. The integrated extended haplotype homozygosity score (iHS) was used as an intra-population measure of the extent of haplotype homozygosity in crossbreds (Voight et al. 2006). We used R software rehh package (Gautier et al. 2017) to calculate iHS and then we transformed these values into p-values according to Gautier and Naves (2011). The qvalue package in R software was then used to correct p-values for multiple testing by calculation of a false discovery rate and generating the corresponding q-values. A candidate region for selection was defined by first identifying SNPs with a q-value <0.1 and then searching within the 500 Kb interval downstream and upstream (1 Mb window) of the identified SNP for SNPs with a p-value <10 -3 . Genes with at least 1 SNP with a q-value <0.1 found within them were deemed as candidate genes under selection.The haplotypes from the 3 ancestral groups, IND, AFT and EUT, were used to infer the local ancestries of the admixed cattle at individual loci level. The majority of haplotypes in the admixed cattle were found to have originated from EUT ancestor (≈0.73) while IND and AFT ancestral populations contributed smaller proportions of admixed haplotypes (≈0.24 and ≈0.03, respectively). The local ancestry inferences were further used to calculate the genome-wide average number of crossover events on haplotypes carrying the lowest number of crossovers between the two haplotypes of each individual for each chromosome (Figure 1). For most of the admixed cattle, the number of recent crossovers per Morgan was found to be relatively small (<3). This suggested that the admixed cattle in East Africa are mainly recent crosses of indigenous cattle with exotic breeds. Only 55 animals had an average of more than 3 crossovers per Morgan, which is approximately equivalent to 4 or more generations of inter-se mating after the original cross to an exotic or indigenous ancestor (Figure 1).Selection needs time to leave its footprints on the genome and if there is not enough time since the most recent admixture, the detection analysis is underpowered. Including recently admixed animals in the analysis adds noise to the detection of signatures of selection and potentially masks the footprints that would have otherwise been detected. We found evidence for this in our results (not shown). When we included all admixed cattle in calculation of iHS, no candidate region at a FDR threshold of 0.1 was detected. However, removing crossbreds with a genomic average crossover frequency of less than 3 per Morgan identified 16 candidate regions across 7 autosomes at the same FDR shown in Figure 2.The details of the 16 identified candidate regions from the iHS analysis of the filtered admixed cattle are in Table 2. The size of these candidate regions ranged from only 112.25 Kb on chromosome 12 up to 683 Kb on chromosome 7 and collectively encompassed 8 candidate genes. Chromosome 7 had the highest number of candidate regions for selection among all chromosomes and it contained 3 candidate genes. Chromosome 3 contained 2 candidate genes while chromosomes 6, 11 and 12 each had one candidate gene. The ancestry of all candidate regions in chromosome 3 was dominated by EUT while for chromosomes 6, 7 and 12 that had more than 1 candidate region, the dominant ancestry was either IND or EUT (Table 1).The S100A10 gene is located on chromosome 3 and encodes a protein which regulates several cellular processes such as cell cycle progression and differentiation. It has been found as a candidate gene for residual feed intake in Angus cattle (Al-Husseini et al. 2013) through a single SNP genomewide association study. Given that feed efficiency is a very important factor in low input smallholder production systems, it could be justified why this gene has been the target of selection in the African environment. Furthermore, the candidate region harbouring S100A10 shows a dominant EUT ancestry in our study, suggesting possible EUT contribution to feed efficiency in the admixed cattle. We identified NLRP3 gene in a candidate region on chromosome 7 with a dominant IND ancestry. This gene encodes a pyrin-like protein and it plays a role in the regulation of inflammation, the immune response, and apoptosis. NLRP3 has been found to be a candidate gene for Crohn's disease (Villani et al. 2009) and Johne's disease (Scanu et al. 2007;Mallikarjunappa et al. 2018) in human and livestock populations, respectively. The selection sweep harbouring this gene is of IND ancestry, suggesting that the IND ancestors may have contributed a version of NLRP3 conferring resistance to local disease or other environmental challenges. Another candidate region on chromosome 7 harbours the gene LYPD8, which has been reported to be differentially expressed between cows with versus without subclinical mastitis (Song et al. 2016) and it provides defence against gram negative bacteria in the colon of non-ruminants. This region is of EUT origin, suggesting possible EUT contribution to disease resistance in the crossbred population. This study provides evidence that the genome of the admixed cattle in Kenya may have been shaped by adaptive selection in response to the challenging environment in which they exist. If our findings can be substantiated, the information might be used in breeding programmes to enhance productivity and adaptation traits in smallholder dairy systems of Kenya."}

main/part_2/0090037856.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"61613f78c11081e267edc2e710391b04","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/44f2a8a5-e532-4952-b384-5a6c4cd83e00/retrieve","id":"-542291916"},"keywords":["Oyekale, S.A.","Badu-Apraku, B.","Adetimirin, V.O.","Unachukwu, N.","Gedil, M Striga hermonthica","low soil nitrogen","high soil nitrogen","extra-early","provitamin A quality protein maize","beta-carotene markers"],"sieverID":"91c11565-dc29-41f8-9831-2fd31a0b9ad6","content":"A hemiparasitic plant, Striga hermonthica (Del.) Benth and soil nitrogen stress are the key constraints to maize (Zea mays L.) productivity in sub-Saharan Africa, where commonly cultivated maize is the normal endosperm type that is deficient in provitamin A, tryptophan and lysine (PVATL). Seventy-six extra-early maize inbreds with provitamin A, tryptophan, and lysine qualities (TZEEIORQ) were developed to address these constraints, and four checks were assessed under Striga, low and high nitrogen conditions at three locations in Nigeria. The inbreds were further genotyped with two beta-carotene hydroxylase 1 (crtRB1) markers, and their seeds were quantified for provitamin A content. Significant (p < 0.01) genetic variations were observed for grain yield and other agronomic attributes of the inbreds under varying environmental conditions. Levels of PVATL for the inbreds ranged from 2.21-10.95 µg g −1 , 0.04-0.08%, and 0.19-0.39%, respectively. Beta-carotene marker, crtRB1-3 TE, was polymorphic and grouped the inbreds into two. The marker was effective in identifying inbreds with moderate provitamin A content. Inbreds TZEEIORQ 5, TZEEIORQ 52, and TZEEIORQ 55 exhibited resistance to Striga, tolerance to nitrogen stress with moderate levels of PVATL and could be invaluable sources of favorable alleles for breeding nutritionally improved maize varieties with resistance/tolerance to Striga and soil nitrogen stress.Maize (Zea mays L.) is one of the major cereal crops in sub-Saharan Africa (SSA). The contribution of maize to human calorific intake is 50%, 30% and 15% for southern, eastern, and West and Central Africa (WCA), respectively [1]. Normal endosperm maize, known to be lacking in provitamin A [2], tryptophan and lysine (PVATL) [3,4], is a major component of the food fed to babies (from two to three-month-old) and children of preschool age; this is usually done with no supplements in many developing countries [5]. In SSA, vitamin A deficiency (VAD) has been reported in about 40% and 15% of children and pregnant women, respectively [6,7]. VAD causes night blindness, increased childhood mortality, delayed growth, and a depressed immune system [8,9]. On the other hand, tryptophan and lysine are important building blocks of protein required by humans and monogastric [10]. Tryptophan deficiency causes a reduction in food intake, reduction in growth rate, impairment of skeletal development, increased pain sensitivity, increased aggression and anxiety [11], while lysine deficiency results in fatigue and reduction in growth rate, among others.Varieties of maize (in the late, intermediate, early and extra-early maturity groups) that can mitigate the effects of VAD [12][13][14] and protein malnutrition [15,16] have been developed. However, no maize hybrid or variety with adequate provitamin A, tryptophan, and lysine contents with extra-early characteristic (matures around 80-85 days), Striga resistance and tolerance to nitrogen stress is yet to be developed and commercialized in WCA. With a population growth rate greater than 2% for many SSA countries, the need for maize has been predicted to triple by 2050 [17]. The current maize grain yield in farmers' fields in the subregion is abysmally low to meet the projected demand. The mean maize grain yield in Nigeria is 1.8 t ha −1, while 2.4 t ha −1 has been reported for SSA; these values are lower than the 5.6 t ha −1 mean grain yield of the crop all over the world [18]. The lower yield of maize in the subregion is attributed to a combination of factors, namely: Striga hermonthica parasitism [19], stem borer attacks [20], low and declining soil nitrogen [21], recurrent drought [22], and more recently armyworm invasion [23]. Reduction in grain yield of maize due to nitrogen stress can be as high as 52% [24], while drought can result in 34% yield loss [25]. Striga hermonthica alone can cause about 53.7% [26] to 100% [27] yield losses, armyworms about 47% [28] and stem borers about 21% [29]. The widespread cultivation of maize with normal endosperm features and low grain yield of the crop is expected to exacerbate the nutritional problems in SSA.Striga hermonthica is widespread in the savannas of WCA, where environmental conditions are considered excellent for maize production. Maize yield losses due to Striga stress varied from 30-90%, and the parasite can cause total crop failure where the infestation is severe, compelling farmers to abandon their fields [19]. Adetimirin and colleagues [26] identified ears per plant as the primary component of yield most severely affected under Striga infestation. Effects of Striga are most severe in the soils with low nutrients, particularly nitrogen, [30] which is a key constraint in major maize-producing areas of WCA [31,32]. Oikeh and colleagues [33] reported that most farmers in WCA grow maize under low nitrogen stress. This is because the soils of the area are inherently low in nitrogen, and many farmers cannot afford inorganic fertilizers to augment the low soil nitrogen [34]. About 50% reduction in maize yield has been reported due to nitrogen deficiency [35]. Therefore, developing improved maize with Striga resistance, tolerance to nitrogen stress, extra-earliness, provitamin A, and quality protein maize traits offers a sustainable and economic strategy to combat Striga and soil nitrogen stresses while improving human nutrition and health in WCA.Seventy-six maize-inbred lines have been developed by the International Institute of Tropical Agriculture (IITA) with a view to breeding extra-early maize hybrids/varieties that combine improved levels of PVATL and tolerance/resistance to multiple stresses in SSA. However, the reactions of these newly developed inbreds have not been thoroughly investigated under Striga and nitrogen stress. Although the inbreds with appropriate modification of endosperm for tryptophan and lysine were repeatedly selected for using lightbox [16] and kernels with relatively deep orange color were assumed to have increased provitamin A levels, information on the per se PVATL concentration of each of the inbreds is lacking. The information will facilitate selecting suitable inbreds as parents in hybrid breeding programs in the subregion.The deep orange kernel color in maize, though presumed to correlate with provitamin A levels, has been reported not to be sufficiently indicative of the levels of betacarotene [2,36]. Safawo and colleagues [2] reported that using high-performance liquid chromatography (HPLC) is very costly in breeding maize with increased provitamin A and proposed that marker-assisted selection could be more efficient than using only maize kernel color for beta-carotene content-A major provitamin A carotenoid. Beta-carotene hydroxylase 1 (crtRB1-3 TE and crtRB1-5 TE) is one of the three major genetic markers, which play an important role during the accumulation of beta-carotene in the endosperm of maize [37]. The crtRB1-3 TE marker is a favorable DNA marker in maize for effecting an increase in the level of beta-carotene from 2 to about 10-fold in the kernels [38,39]. This study, therefore, aimed at developing and identifying Tropical Zea extra-early provitamin A quality protein maize inbred (TZEEIORQ) lines that possess tolerance/resistance to Striga and tolerance to nitrogen stress and determine the usefulness of beta-carotene hydroxylase 1 (crtRB1-3 TE and crtRB1-5 TE) in identifying inbreds with high kernel provitamin A content.In 2007, IITA initiated a breeding program to develop varieties of maize that combine drought tolerance, tolerance to low nitrogen stress, Striga resistance and high PVALT for WCA. A variety of extra-early maize possessing Striga resistance and quality protein traits (with both yellow and orange endosperm color) was crossed to Syn-KU1409/DES/1409 (OR2), a donor of beta-carotene alleles. The resulting cross was backcrossed to multiple stress-resistant varieties, TZEE-Y STR QPM. Following the backcrossing that was aimed at introgressing genes for increased provitamin A content of maize, a total of 76 inbred lines were developed after seven cycles of selfing and selection for agronomically desirable traits.Evaluation of the 76 inbreds and the four extra-early normal endosperm checks (Supplementary Materials Table S1) was carried out under artificial Striga environment at Abuja (9 • 15 N, 7 • 20 E, 1700 mm annual precipitation, 300 m altitude) in 2016 and Mokwa (9 • 18 N, 5 • 4 E, 1100 mm annual precipitation, 457 m altitude) in 2017; the two locations are found in the southern Guinea savanna agroecological zone of Nigeria. Ethylene gas was injected into the soil following land preparation-To rid the soil of Striga seeds native to it. The gas was applied 12 cm deep into the soil. This activity was repeated at intervals of 100 cm to ensure good coverage of the field with the gas. Seeds of Striga obtained from the fields previously planted to sorghum were used for artificial infestation, following the procedure described by [31]. Well-sieved sand and the Striga seeds were mixed carefully by weight in the ratio 99:1. Before planting maize seeds per hill, each hill was infested with Striga seed-sand mixture (8.5 g containing about 5000 germinable seeds of Striga hermonthica). At four weeks after planting, NPK fertilizer (NPK 15-15-15) was applied at the rate of 30 kg ha −1 of K 2 O, P 2 O 5 and N to the established plants. All other unwanted plants, apart from Striga, were controlled by hand-pulling.In addition, the 76 inbreds and the four checks were evaluated in adjacent blocks in high and low soil nitrogen environments both at Ile-Ife (7 • 28 N, 4 • 33 E, 1350 mm annual precipitation, 244 m altitude) in the rainforest agroecological zone in 2016 and Mokwa in 2017. The soils at Mokwa and Ile-Ife are Luvisol and Alfisol, respectively [40]. Depletion of N from the low-N fields at Mokwa and Ile-Ife was achieved through regular planting of maize for many years and removing the stover following every harvest. At both locations, soil samples obtained (with a soil auger) before land preparation from zero to fifteencentimeter depth were subjected to analysis. The total potassium (K), phosphorus (P) and nitrogen (N) contents of the soils were determined by Kjeldahl digestion and colorimetric method [41]. The soil analyses at Ile-Ife and Mokwa used in this study are the same as reported by [42]. Following the soil test, the total N available in the high-and low-N plots were augmented with urea to 90 and 30 kg N ha −1 , respectively. Nitrogen fertilizer was applied, in two equal splits, under nitrogen experiments at 2 and 4 weeks after planting (WAP). In addition, 60 kg K ha −1 as muriate of potash (K 2 O) and 60 kg P ha −1 as single superphosphate (P 2 O 5 ) were applied to the two N treatments at 2 WAP.A 10 × 8 alpha lattice design, replicated two times, was used for all evaluations in the Striga, high-and low-N trials. Single row plots, 3 m long, were used under the Striga experiment. Within-row spacing was 0.40 m, while between-row spacing was 0.75 m. However, in 2016, single -ow plots 4 m long were used during evaluations in high-and low nitrogen fields. Three maize kernels were sown per hill, and the seedlings thinned to two per hill at 2 WAP. In low-and high-N fields, weeds were controlled by applying atrazine and gramoxone, supplemented with hand weeding. Fall armyworms (Spodoptera frugiperda) were controlled by using ampligo at 300 mL ha −1 . Ampligo contained 100 g per liter of chlorantraniliprole and 50 g per liter of lambda-cyhalothrin.Data collection was carried out on plants per plot. The traits measured include days to 50% anthesis (DA) and 50% silking (DS), respectively determined as the total number of days from sowing to the time 50% of the plants had shed pollen and showed silk extrusion. Anthesis-silking interval (ASI) was calculated by subtracting DA from DS. Plant height (PLHT) represented the distance from the first tassel branch to the base of the plant, while ear height (EHT) was recorded as the distance from the node bearing the topmost ear (in prolific lines) to the base of the maize ear. In addition, stalk lodging (SLPER) was recorded as the proportion of plants with the broken stalk at (or below) the node bearing the uppermost ear. Ear aspect (EASP) was determined on a scale of 1-9, where 1 = uniform, large, clean and well-filled ears, and 9 = variable, small, rough and poorly filled ears [43]. Husk cover was assessed on a scale of 1-9, where 1 = tightly arranged husks extending beyond the tip of the ear and 9 = husks loosely arranged with ear tip exposed. The number of ears per plant (EPP) was calculated as the ratio of the total number of harvested ears for each plot to the number of harvested plants in the plot. For the high nitrogen and Striga environments, grain yield was calculated from ear weight, on the assumption of 80% shelling percentage, adjusted to 15% moisture content.Plant aspect (PASP), assessed only under low-and high-nitrogen conditions, was scored on a scale of 1-9 using plant type and overall appeal, where 1 = excellent plant type and 9 = poor plant type. Stay-green characteristic (STGR) was determined under low soil nitrogen alone on a scale of 1-9, where 1 = nearly all foliage were lush green, and 9 = practically all foliage were dead. Determination of grain yield under low-N involved shelling of harvested ears per plot, weighing of the kernels and measuring of grain moisture content. Afterward, grain yield was calculated, per plot, using grain weight adjusted to 15% moisture content.Additional data collected under Striga infestation were: host plant damage (by Striga) syndrome rating at 8 and 10 WAP, an indication of Striga tolerance [27,40] and the number of emerged Striga plants, which is indicative of resistance to Striga. Host plant damage was scored per plot on a scale of 1-9, where 1 = no visible damage, suggesting plant with normal growth and high tolerance to Striga, and 9 = severe damage or total collapse of the plant, indicating high susceptibility to Striga [19,44].2.4. Identification of Beta-Carotene Rich Inbreds Using Allele-Specific Beta-Carotene Markers-crtRB1-3 TE and crtRB1-5 TE.Leaf samples for each of the inbred genotypes were accumulated from seven to eight plants at 3 WAP. Thereafter, the samples were lyophilized using Free Zone 18 liter console dry system (Labconco Inc., Missouri, USA). Genomic DNA was extracted from the lyophilized samples using a DNA extraction protocol, modified cetyl trimethyl ammonium bromide (CTAB), described by [45]. The following markers, according to [37], were used to identify crtRB1-3 TE: (i) the forward primer (F) (5 ACACCACATGGACAAGTTCG 3 ), (ii) the first reverse primer (R1) (5 ACACTCTGGCCCATGAACAC 3 ) and (iii) the second reverse primer (R2) (5 ACAAGCAATACAGGGGACCAG3 ). In addition, crtRB1-5 TE was identified with: (i) the forward primer (F) (5 TTAGAGCCTCGACCCTCTGTG 3 ) and (ii) the reverse primer (R) (5 AATCCCTTTCCATGTTACGA 3 ). A polymerase chain reaction (PCR) was conducted in 25 µL volume for each of the functional markers. The quantity of genomic DNA, beta-carotene DNA markers and other reaction mixtures used are, as shown in Table 1. The thermocycler standard cycling conditions provided by [37] were used for the PCR. Resolution of amplicons was carried out on 2% agarose gel. DNA bands were viewed on a UV Transilluminator. Photographs of the bands were taken and then scored for absence or presence of the favorable allele of crtRB1-3 TE gene (allele 1) and favorable allele of crtRB1-5 TE gene (allele 2) [39].The first two and last two plants in each plot, under high nitrogen conditions at Mokwa and Ile-Ife in 2016, were self-pollinated to develop seed samples of S 8 lines that were used for carotenoids [46] tryptophan and lysine analyses. The ears were harvested at each location, dried, processed and stored at 4 • C [12]. Thereafter, two samples, each containing 60 kernels, were prepared for analyses; the first sample was used for carotenoids analysis, while the second was used for lysine and tryptophan analyses. Analyses for carotenoids, lysine and tryptophan were carried out at CIMMYT, Mexico. Samples of 20-30 maize kernels of each inbred were frozen at −80 • C until when required for analysis, at which time they were ground to (0.5 µm) powder. Carotenoids analysis was carried out using ultra-high-performance liquid chromatography (UPLC) (Waters, Milford, MA, USA) Apex Track. It involved extraction, separation, and quantification by UPLC using protocols described by [47]. Beta-carotene (13-cis, all-trans and 9-cis isomers), beta-cryptoxanthin, zeaxanthin and lutein were measured. Overall, provitamin A content of each inbred line was calculated thus: beta-carotene (13-cis + all-trans + 9-cis) + 0.5 (beta-cryptoxanthin) [46]. The amount of lysine and tryptophan in whole grains of the inbred lines were determined as reported by [47]; briefly, Kjeldahl apparatus was used to grind and de-fat whole grain sample for each inbred line, followed by the addition of papain to hydrolyze the protein.A purple coloration was induced with the addition of a combination of glacial acetic acid and H 2 SO 4 . The deepness/concentration of the induced color was quantified using a spectrophotometer at 560 nm. The percent tryptophan content of each inbred line was then obtained from the reading of the spectrophotometer converted to percent tryptophan. Two measurements were taken for each inbred line.Prior to statistical analyses, log transformation was carried out to achieve homogeneity of variances for data collected on Striga (hostplant) damage rating and the number of emerged Striga plants. Year-location-treatment combination was considered a test environment [48]. Analysis of variance (ANOVA) was first carried out for each research condition (Striga, low and high soil nitrogen). Thereafter, a combined ANOVA was carried out across the six environments for yield and other characters. The performance of the inbreds was determined under Striga, low nitrogen and across all research environments using the following base indices: Adjusted means for each character of each genotype were standardized to minimize the effects of the different scales used to measure them. In each case, a positive base index value suggested that the inbred was tolerant to that stress, whereas negative values were indicative of the susceptibility of the inbreds to the stress [5]. Chi-squared analysis was carried out to determine if the groups formed from the results of the molecular screening were associated with the amount of provitamin A in the inbreds determined by HPLC. In addition, stepwise regression of total provitamin A on provitamin A carotenoids was carried out.Results of ANOVA across six research conditions (two environments each of Striga infestation, low and high nitrogen) showed significant (p < 0.01) environment, inbred and inbred × environment variance for all traits except inbred × environment interaction mean square for EPP (Table 2). ANOVA under Striga-infested environments indicated significant (p < 0.01) environment, inbred and inbred × environment interaction variance for grain yield and other traits (Table 3). Similarly, the ANOVA under low nitrogen revealed significant (p < 0.01) environment, inbred and inbred × environment interaction variance for all characters, except environment variance for STGR (Table 3). ANOVA under high nitrogen environments indicated significant (p < 0.01) environment, inbred, and inbred × environment interaction mean squares for all traits, except environment mean squares for EPP and PASP, and inbred × environment interaction variance for PLHT, EHT and EPP (Table 3). *, **, *** = significant at p < 0.05, p < 0.01 and p < 0.001, respectively; ns = not significant; DF = degrees of freedom; YIELD = grain yield; DS = days to 50% silking; DA = days to 50% anthesis; EASP = ear aspect (rated on a scale of 1-9); EPP = number of ears per plant; PLHT = plant height; EHT = ear height; HUSK = husk cover (rated on a scale of 1-5); SLPER = percent stalk lodging; † PASP = plant aspect evaluated across four (two low-N and two high-N) environments (on a scale of 1-9). DF of sources were adjusted for missing plots. *, **, *** = Significant at p < 0.05, p < 0.01 and p < 0.001, respectively; ns = Not significant; DF = degrees of freedom; YIELD = grain yield; DA = days to 50% anthesis; DS = days to 50% silking; PLHT = plant height; EASP = ear aspect (rated on a scale of 1-9); EHT = ear height; HUSK = husk cover (rated on a scale of 1-5); EPP = number of ears per plant; SLPER = percent stalk lodging; SDR1 = Striga damage rating at 8 WAP (rated on a scale of 1-9); SDR2 = Striga damage rating at 10 WAP (rated on a scale of 1-9); ESP1 = number of emerged Striga plant at 8 WAP; ESP2 = number of emerged Striga plant at 10 WAP. DF of sources adjusted for missing plots; PASP = plant aspect (scored on a scale of 1-9); STGR = stay green characteristic (scored on a scale of 1-9).Out of the 80 inbreds evaluated under Striga, 34 were resistant/tolerant to Striga based on their positive Striga base index values (Table 4). Eighteen of the 34 lines had higher Striga base index values than the best check-TZEEI 73. The index values for the top ranking 15 lines ranged from 3.97 to 11.34 compared to 3.38 obtained for TZEEI 73 (Table 4). A total of 41 lines were identified as low nitrogen tolerant based on their low nitrogen base index values (Table 5). Of these lines, 12 had higher low nitrogen base index values (4.93-9.28) than TZEEI 73 (4.87)-The best Striga and low nitrogen tolerant checks were: TZEEIORQ 57, TZEEIORQ 21, TZEEIORQ 64, TZEEIORQ 53, TZEEIORQ 43, TZEEIORQ 55, TZEEIORQ 63, TZEEIORQ 20, TZEEIORQ 51, TZEEIORQ 42, TZEEIORQ 52, and TZEEIORQ 14 (Table 5).     YIELD = grain yield; DA = days to 50% anthesis; DS = days to 50% silking; PLHT = plant height; EHT = ear height; EASP = ear aspect (rated on a scale of 1-9); STGR = stay-green characteristic (rated on a scale of 1-9); PASP = plant aspect (rated on a scale of 1-9); HUSK = husk cover (rated on a scale of 1-5); EPP = number of ears per plant; LN-BI = low-N base index.Averaged over inbred lines, grain yield was 1064 kg ha −1 under Striga-infested environment, 1257 kg ha −1 under low nitrogen and 2120 kg ha −1 under high nitrogen; thus, compared to high nitrogen plots, grain yield reduction due to Striga and low nitrogen averaged 49.8% and 40.7%, respectively (Table 6). The number of ears per plant for these environments was 0.7, 0.7, and 0.8, respectively. Grain yield across the environments ranged from 658 kg ha −1 for TZEEIORQ 16 to 2337 kg ha −1 for TZEEIORQ 63 with an average of 1492 kg ha −1 , while ears per plant ranged from 0.3 for TZEEIORQ 16 to 1.3 for TZEEIORQ 57 with a mean of 0.7. Ear aspect was lowest for TZEEIORQ 62 and TZEEIORQ 64 (3.2) and highest for TZEEIORQ16 (6.9) (Table 7). There were no significant differences in grain yield among the top five ranking inbreds (TZEEIORQ 57, TZEEIORQ 63, TZEEIORQ 42, TZEEIORQ 55, and TZEEIORQ 64), identified as resistant/tolerant to both Striga and nitrogen stresses based on the multiple character base index, and the best check TZEEI 73 (Table 6). Inbred TZEEIORQ 57 had the highest mean value (1.3) for ears per plant across research environments, but it had the lowest mean values for stay-green characteristic (1.7) under low nitrogen stress and Striga (host-plant) damage rating at 8 WAP (2.7) under Striga condition. The expression of these desirable attributes by the inbred contributed to its excellent performance across research environments.     . Grain yield and other agronomic traits of 20 best and 5 worst extra-early maturing provitamin A quality protein maize inbreds evaluated under Striga-infested, low-N and environments.  Of the two allele-specific provitamin A markers used, only crtRB1-3 TE was polymorphic among the inbred lines (Figures 1 and 2). The polymorphic marker differentiated the 76 biofortified lines into two groups (Table 7). The first group comprised 16 inbred lines with the favorable allele of crtRB1-3 TE, while the second group of 60 inbred lines was without the favorable provitamin A allele. HPLC did not detect beta carotene and provitamin A in two of the 16 samples possessing the favorable allele of crtRB1-3 TE (Table 7). Levels of provitamin A in all the inbred lines analyzed ranged from 2.21 µg g −1 for TZEEIORQ 27 to 10.95 µg g −1 for TZEEIORQ 54 with an average of 6.18 µg g −1 . A total of 12 of the 16 inbreds with the favorable allele of crtRB1-3 TE marker had provitamin A levels greater than the mean provitamin A value (Table 7). Two inbred lines (TZEIORQ 64 and TZEEIORQ 73) with the favorable provitamin A allele had lower levels of provitamin A than the average provitamin A value for the inbred lines analyzed (Table 7). Chi-squared analysis showed a significant association (p < 0.01) between the desirable provitamin A marker allele and the provitamin A content of the inbred lines (Table 8). Stepwise regression of provitamin A carotenoids (beta-carotene and beta-cryptoxanthin) on the overall provitamin A in the inbreds showed significant contributions, of 81.9% and 18.3% for beta-carotene and beta-cryptoxanthin, respectively, to the levels of total provitamin A in the inbreds studied (Table 9). Tryptophan content varied from 0.04% in TZEEIORQ 53 to 0.08% in TZEEIORQ 72 with an average of 0.05%, while lysine content ranged from 0.19% in TZEEIORQ 50 to 0.39% in TZEEIORQ 74 with a mean of 0.27% (Table 10). In all, 39 inbred lines had provitamin A levels above 6.18 µg g −1 ; these inbred lines showed different combinations of Striga tolerance/resistance, low nitrogen stress tolerance, provitamin A, tryptophan and lysine contents (Tables 7 and 10). Three lines viz. TZEEIORQ 55, TZEEIORQ 5 and TZEEIORQ 52 combined high provitamin A content (>10.0 µg g −1 ), tolerance/resistance to Striga and low nitrogen stress with improved tryptophan and lysine contents-Not lower than the average values of 0.05 and 0.27%, respectively (Tables 7 and 10). An inbred line with a positive base index value was identified as resistant/tolerant to the stress, while a negative base index value indicated susceptibility to the stress.     stress, is an important approach for improving maize productivity under the biotic and abiotic stresses of low nitrogen, Striga and drought in WCA. The incidence of Striga in farmlands is erratic and often influenced by environmental factors. Maize cultivars developed for the savanna of WCA, therefore-in addition to showing resistance/tolerance to these stresses-must also demonstrate capability for high-performance in nonstress environments.In the current study, the inbreds TZEEIORQ 55, TZEEIORQ 52 and TZEEIORQ 5 were among the thirteen most promising extra-early provitamin A quality protein maize inbreds identified across the research environments (evidenced by their relatively high and positive multiple-character base index values). Coupled with their performance under each of the stresses, these inbreds showed tolerance/resistance to Striga, tolerance to low nitrogen, and better performance in stress-free environments. The inbreds also had moderate to relatively high levels of tryptophan and lysine. The consistently higher base index values of TZEEIORQ 55 than those of TZEEI 73, in each and across environments, indicated the outstanding performance of the inbred across the research conditions. The different base indices used in this study integrated several important traits under the respective stresses. For example, under Striga, high yield, reduced host-plant damage (tolerance index), and reduced number of emerged Striga plants (resistance index) were important for sustainability. While tolerance ensured high yield and low host damage, resistance reduced the number of emerged parasites and buildup of the seeds of Striga in the soil [44,52].The significant genotype × environment interaction obtained in the current study indicated that the genotypes varied in their response patterns to each of the stresses and nonstress conditions. In effect, performance under the conditions in any of the research environments cannot be used to extrapolate performance in other environments. These results justified our approach of developing a considerable number of lines from the source population and screening the lines for their responses under the different stresses and in stress-free environments, thus allowing identifying lines that possessed alleles for both tolerance/resistance to the stresses and good performance under nonstress conditions. Ifie [53] reported significant genotype × environment interaction for yield and other traits of 100 early-maturing maize inbreds studied under Striga and low nitrogen environments. Similarly, Akaogu and colleagues [49] observed significant genotype × environment interaction for many characters of 90 extra-early yellow maize inbreds in Striga-free and Striga-infested environments. The similarity in the results of this study and those of the previous authors suggests that the environments where the maize genotypes were evaluated might be similar.While breeding for improved levels of provitamin A in maize, several workers have identified and used different molecular markers linked to provitamin A carotenoids [37,39]. Of the two provitamins A markers used in the present study, only crtRB1-3 TE was polymorphic among the inbreds. In a previous study, [12] reported polymorphism for both markers. The variation in the results of this study and that of [12] might be attributed to differences in the genetic materials used for the studies. The allele 1 of crtRB1-3 TE has been reported to bring about a 2 to 10-fold favorable increase in kernel beta-carotene in maize [38,39]. The range of provitamin A levels (2.21-10.95 µg g −1 ) and the average beta-cryptoxanthin (5.25 µg g −1 ) observed in the present study are comparable to values (provitamin A levels = 3.01-11.90 µg g −1 ; average beta-cryptoxanthin = 4.23 µg g −1 ) obtained by [54]. The similarity in our results is suggestive of the fact that the inbreds used in this study may be genetically related, concerning provitamin A, to those studied by [54]. The significant chi-squared value obtained between the results of the molecular markers and provitamin A content of the inbred lines indicates that the marker was associated with the levels of provitamin A in the inbreds. This suggests that the marker was effective in identifying inbreds with increased levels of provitamin A.All the inbreds used in the current study, with or without the favorable marker alleles, had lower provitamin A content than the HarvestPlus target of 15 µg g −1 [55]. The lines with relatively high content of provitamin A in this study (7.50-10.25 µg g −1 ) can, therefore, be regarded as being moderate in provitamin A. Of the 60 inbred lines without the favorable marker allele, seven had provitamin A content in the range 7.50-10.25 µg g −1 . This suggests the involvement and effectiveness, in some of the inbred lines, of other provitamin A carotenoid(s) apart from the one linked to the favorable allele of the crtRB1-3 TE. The results of the stepwise regression analyses of the provitamin A carotenoids on the total provitamin A levels in the inbreds revealed that β-cryptoxanthin (with half the vitamin A activity of β-carotene) also contributed significantly to the increased levels of total provitamin A in the inbred lines with or without the favorable allele of crtRB1-3 TE. Similar to our result is the finding of [54], who observed a strong positive relationship between β-cryptoxanthin and provitamin A concentration in maize.Inbreds TZEEIORQ 55, TZEEIORQ 72 and TZEEIORQ 74 had relatively high levels of tryptophan and lysine, indicating that they possess quality protein properties. Kostadinovic [56] reported a similar range of 0.06-0.08% tryptophan for 13 maize lines. In general, inbreds TZEEIORQ 58, TZEEIORQ 55, TZEEIORQ 5, TZEEIORQ 52, TZEEIORQ 57, TZEEIORQ 62, TZEEIORQ 72, TZEEIORQ 59 and TZEEIORQ 54 had the highest levels of PVATL.The lines developed in the present study, which are the first set of extra-early maize lines with combined resistance/tolerance to Striga and tolerance to nitrogen stress and moderate levels of PVATL, showed exploitable genetic variation for these traits. In addition to their use in developing open-pollinated maize varieties/hybrids for increasing maize productivity in WCA, the lines offer promise for addressing the prevalent problems of VAD and protein deficiency in the subregion. Opportunities exist to further improve the levels of these nutrients in the inbreds through selection.Exploitable genetic variability exists for grain yield and other agronomic characters of the TZEEIORQ lines studied under Striga, low-and high-nitrogen soil conditions. The betacarotene marker, crtRB1-3 TE, was polymorphic and grouped the inbreds into two. The marker was effective in identifying inbreds with moderate provitamin A content. Inbred lines TZEEIORQ 55, TZEEIORQ 52 and TZEEIORQ 5 combined resistance/tolerance to Striga and nitrogen stress with improved performance under high nitrogen conditions. These inbreds are invaluable pools of favorable alleles in breeding for extra-earliness, Striga resistance, nitrogen stress tolerance, and PVATL.The following are available online at https://www.mdpi.com/article/10 .3390/agronomy11050891/s1, Table S1. Pedigree of 76 extra-early maturing provitamin A quality protein maize inbreds derived from a tropical Zea Striga resistant provitamin A quality protein maize population along with four checks used in this study. "}

main/part_2/0101587721.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"9c9b93eafcfea7c9da50b8a2dbfae3a8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/89939504-cd4e-4e26-ae25-93dddaf63524/retrieve","id":"-54028419"},"keywords":[],"sieverID":"fc05c04c-123a-408a-b400-415c10ba1277","content":"• Threaten food security and ecosystems and the services they provide;• Smallholder farmers in the Global South are disproportionally affected.• Sustainable intensification is defined as increased production per unit of land or inputs while minimizing the environmental footprint of agriculture;• Increasing resilience to shocks and stresses, including climate change. (Pretty et al., 2011).Sustainable intensification relevant in the global south Struik and Kuyper, 2017;Vanlauwe and Dobermann, 2020 ☻ Soil health ☻ 4) How to ensure that stakeholders engage in the process? 1) What is soil health?2) How to measure soil health?3) How to monitor progress? Therefore, soil health is highly context specific! \"The academic community struggles to rationalize and operationalize its use as a quantifiable or measurable concept\". How to monitor progress?The discrepancy between the current health status of the soil and its potential under optimal management, within a certain land use type and agroecological context (Visscher et al., 2024, in prep).Difference between indicator values obtained in a nearby natural system or relatively undisturbed soil and indicator values obtained in a given farm field (e.g., Maharjan et al., 2020)."}

main/part_2/0104141574.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"8b863d573960a550e4a423fb45bc8105","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5b11b3fe-e2c4-4b38-a9aa-afde2a49a195/retrieve","id":"1360189855"},"keywords":[],"sieverID":"0afa92c3-e76e-4601-a172-7a39398d3319","content":"www.climatesecurity.cgiar.org Africa Climate Crisis Security Observatory www.climatesecurity.cgiar.org Observatorio de Seguridad Climática 2023/4 S FICHA TÉCNICA ¿Cómo exacerba el cambio climático las causas raíz de la inseguridad humana y los conflictos en Guatemala? Análisis de Rutas Causales de Seguridad Climática PHOTO JL UREA Esta ficha técnica da respuestas sobre cómo el cambio climático exacerba las causas raíz de la inseguridad humana y los conflictos en Guatemala, utilizando un análisis de rutas causales. Se identifican dos rutas causales principales: INITIATIVE ON Fragility, Con ict, and MigrationEsta publicación forma parte de una serie de ficha técnica sobre los resultados del trabajo del Observatorio de Seguridad Climática del CGIAR FOCUS Climate Security. La investigación se desarrolla en torno a 5 preguntas*: ¿Cómo exacerba el clima las causas principales de los conflictos?1. Inseguridad alimentaria y de los medios de vida: Los impactos del cambio climático pueden exacerbar las condiciones socioeconómicas que conducen a la vulnerabilidad de los hogares que dependen de la agricultura de subsistencia y de secano, y contribuir aún más a la inseguridad alimentaria y de los medios de vida. Esto, a su vez, puede incentivar la migración económica hacia centros urbanos, dentro y fuera del país. La falta de acceso a medios de vida alternativos puede aumentar la participación en actividades ilícitas y el reclutamiento por parte de grupos criminales, contribuyendo indirectamente a reforzar las redes activas de crimen organizado en las regiones fronterizas con México y Honduras.2. Disponibilidad y acceso a los recursos: Se han observado impactos del cambio climático en los sistemas hídricos, terrestres y alimentarios, y se prevé que disminuya aún más la productividad de las tierras agrícolas, disminuya el rendimiento de los principales cultivos comerciales y dificulte la disponibilidad y el acceso a los recursos naturales en Guatemala. El aumento de la competencia por el acceso y distribución de los recursos naturales puede provocar tensiones y conflictos.Tània Ferré Garcia, Ignacio Madurga-Lopez, Leonardo Medina, Charlotte Penel, Bia Carneiro, Theresa Liebig, Peter Läderach and Grazia Pacillo El clima de Guatemala se caracteriza por temperaturas más frescas en el altiplano occidental, bosques tropicales en la región septentrional de Petén, zonas costeras húmedas, así como climas más secos en los territorios orientales, a lo largo del Corredor Seco Centroamericano (MARN et al., 2021). Las precipitaciones estacionales ocurren de mayo a octubre y se caracterizan principalmente por un período seco temporal, conocido como canícula, donde se experimenta una reducción de aproximadamente el 40% de la precipitación por un período que dura desde semanas hasta un mes en julio y/o agosto (Arnoldo Bardales et al., 2021;MARN et al., 2021).Guatemala se considera un punto crítico principal para el cambio climático debido a su alta vulnerabilidad y baja preparación para hacer frente a los impactos del cambio climático (Notre Dame University, 2022). Se considera, además, uno de los países más expuestos a la variabilidad climática y a fenómenos meteorológicos extremos, así como a fenómenos naturales no relacionados con el clima, como terremotos, tsunamis y erupciones volcánicas (IEP, 2021;MARN et al., 2021). En los últimos veinte años, la temperatura media anual, así como las temperaturas máximas y mínimas diarias, han aumentado 0.8ºC y 0.6ºC, respectivamente, particularmente en los meses de febrero, julio, agosto y septiembre (MARN et al., 2021). Los mayores incrementos de temperatura se han presentado en la costa Pacífica, Bocacosta, Valles de Oriente y el Caribe (MARN et al., 2021). Asimismo, en los últimos veinte años, los patrones de precipitación se han alterado significativamente, indicando un aumento de 122mm en la precipitación media anual, así como días lluviosos más intensos y menos distribuidos (MARN et al., 2021). Solamente en el periodo 2010 a 2015, las zonas costeras del Pacífico experimentaron incrementos en la temperatura superficial del mar de 0.44ºC y un aumento del nivel del mar de entre 1.7 y 2.5 mm (MARN et al., 2021).Se espera que para 2050 las temperaturas aumenten entre 2°C y 4°C, con mayores incrementos en la costa del Caribe, el este, el norte y la costa sur (García Morales, 2019;MARN et al., 2021). Las proyecciones climáticas esperan una disminución de las precipitaciones de hasta el 50% en la región semiárida del país situada en el Corredor Seco (Arnoldo Bardales et al., 2021). Sin embargo, aunque se espera que disminuyan los días de lluvia, se prevé que los fenómenos climáticos extremos, como los ciclones tropicales, sean más frecuentes en todo el país (Arnoldo Bardales et al., 2021). Las proyecciones climáticas prevén que la fecha de inicio de la canícula se produzca antes y durante más tiempo (+18 días), ampliando así el clima semiárido a más regiones (Maurer et al., 2017). Los mayores impactos sobre la disponibilidad de agua se esperan en los departamentos de Baja Verapaz, Sacatepéquez, Totonicapán, Chimaltenango, Guatemala, El Progreso, Zacapa, Jutiapa, Chiquimula, así como en el sur de Quiché y Huehuetenango (Arnoldo Bardales et al., 2021). Debido al aumento del nivel del mar, del cual se prevé un aumento entre 9 y 13 cm para 2050, causando inundaciones y erosión, los municipios ubicados en las zonas costero-marinas tendrán una vulnerabilidad al cambio climático \"alta\" a \"muy alta\" (MARN et al., 2021;USAID, 2017).La historia reciente guatemalteca se ha caracterizado por golpes de estado, una guerra civil, represión y un clima de inestabilidad e inseguridad. Guatemala experimenta un alto número de homicidios y crímenes violentos, en su mayoría relacionados con pandillas y el crimen organizado, mediante el cual la violencia relacionada con el narcotráfico desempeña un papel importante en las dinámicas de inseguridad (IEP, 2021;Nett y Rüttinger, 2016).La Guerra Civil de Guatemala tuvo lugar durante el periodo de la Guerra Fría. Tras el golpe de Estado contra el presidente electo Jacobo Árbenz en 1954, el país vivió un enfrentamiento entre los grupos conservadores y anticomunistas, con guerras revolucionarias seguidas de una fuerte represión por parte del gobierno (Álvarez Aragón et al., 2013;Molden, 2015). Desde 1965, hasta mediados de la década de 1990, Guatemala sufrió un conflicto armado intraestatal entre las fuerzas gubernamentales y grupos insurgentes como las FAR (Las Fuerzas Armadas Rebeldes), el EGP (Ejército Guerrillero de los Pobres) y el PGT (Partido Guatemalteco del Trabajo) (UCDP, 2023). Este período se caracterizó por una violencia unilateral que provocó la muerte y desaparición de aproximadamente 200.000 personas, el 83% de las cuales eran comunidades indígenas mayas, las cuales sufrieron un genocidio según la Comisión para el Esclarecimiento Histórico (UCDP, 2023;ODHAG, 1998).A pesar del acuerdo de paz, treinta años después de la guerra civil, Guatemala sigue experimentando violencia a diario, tanto por parte de actores estatales como no estatales, incluyendo el crimen organizado y las pandillas (Godoy, 2006;Knowlton, 2017;Rodgers & Muggah, 2009). Situada en medio de la ruta de contrabando de drogas entre Sudamérica y Norteamérica, Guatemala ha sido testigo de un aumento en la violencia vinculada al tráfico de drogas, el microtráfico, la extorsión y las actividades de blanqueo de dinero (del Mercado et al., 2021;ICG, 2017;Nett & Rüttinger, 2016). De hecho, Guatemala posee una de las tasas de homicidio más altas de América Latina y del mundo, así como una de las tasas de feminicidio más altas (UNICEF, 2014;Banco Mundial, 2021e). Estos factores han contribuido a que UNICEF (2014) clasificara a Guatemala, ya en 2014, como el segundo país más peligroso para los menores de diecinueve años.El desarrollo de nuevas actividades económicas, principalmente de carácter extractivo, también ha alimentado lo que los académicos guatemaltecos denominan comúnmente como conflictos socioambientales (INTRAPAZ, 2009). Las inversiones a gran escala, como el cultivo de caña de azúcar en el Polochic, la reactivación de la minería de níquel en Izabal y el desarrollo de plantas hidroeléctricas en la carretera de la Franja Transversal del Norte, han sido identificadas como fuente de conflictos entre las comunidades locales y las industrias extractivas, vinculadas a empresas transnacionales (INTRAPAZ, 2009;López et al., 2021). Además, también prevalecen los conflictos entre comunidades y grupos sociales por el acceso a los recursos naturales. La evidencia señala hechos de conflictos inter e intracomunitarios en San Marcos, por ejemplo, entre los municipios de Tajumulco e Ixchiguán, y en Sololá, entre los municipios de Santa Catarina Ixtahuacán y Nahualá (ACLED, 2022;García, 2022;Tejiendo Paz, 2020). A pesar de no estar directamente vinculadas con la Guerra Civil, estas tensiones se entienden como continuidades de las desigualdades sociales y económicas del conflicto armado ya que se concentran en regiones caracterizadas por fuertes desigualdades y por haber estado severamente afectadas por la guerra civil (López et al., 2021).Guatemala es considerado un país de renta media-alta en el que los índices de pobreza y desigualdad se encuentran entre los más altos de América Latina. La agricultura sigue siendo una de las actividades económicas más importantes, representando hasta el 31% del empleo total y el 9,4% del PIB (Banco Mundial, 2021b). Solo el sector del café genera hasta 1,8 millones puestos de trabajo (Canet Brenes et al., 2016). Teniendo en cuenta que la mayor parte de la producción agrícola es de secano y que más del 80% del PIB del sector agropecuario se produce en zonas con riesgo de desastres, se trata de un sector altamente vulnerable a los impactos climáticos (Hernández, 2012;Banco Mundial, 2011).Las tasas de pobreza y desigualdad de todo el país siguen siendo preocupantemente altas. Las tasas de desempleo alcanzan el 54% en los departamentos situados en el Corredor Seco (PMA et al., 2017).Guatemala es considerado uno de los países más desiguales de América Latina y presenta uno de los veinte coeficientes de Gini más altos del mundo (Banco Mundial, 2014). Mientras que el 1% de la población guatemalteca acumula el 40% de la riqueza del país (Oficina Económica y Comercial de España en Guatemala, 2022), el 59% experimenta una condición de pobreza, y aproximadamente el 10% de su población vive con menos de 2 dólares al día (Banco Mundial, 2014). La pobreza es especialmente pronunciada entre los pueblos indígenas, afectando al 79% de la población indígena (PMA, 2022). Estas vulnerabilidades también afectan especialmente a las mujeres, ya que los altos niveles de desigualdad de género ponen en peligro el acceso de las mujeres a la tierra, insumos, servicios financieros y oportunidades de trabajo (Howland et al., 2021).Siguiendo la tendencia latinoamericana, Guatemala enfrenta la triple carga de la subnutrición, la deficiencia de micronutrientes y la obesidad (IICA, 2018). Guatemala ocupa el séptimo lugar mundial en desnutrición crónica (Romero, 2022). Las tasas de inseguridad alimentaria también son elevadas, ya que el 46,5% de los niños menores de cinco años sufren desnutrición crónica (PMA, 2022). Los departamentos de Huehuetenango, Quiché y Baja Verapaz presentan las tasas más altas de inseguridad alimentaria (Läderach et al., 2021). Debido a que es el segundo mercado más grande de Centroamérica para las exportaciones estadounidenses de productos alimentarios procesados y a que el sector agrícola representa el 9,4% de su PIB (Banco Mundial, 2021b), Guatemala es altamente vulnerable a las perturbaciones del mercado internacional de alimentos.La falta de financiación suficiente por parte del Gobierno para atender las crisis de seguridad alimentaria, así como para proporcionar atención sanitaria básica, ha dado lugar a una gran dependencia de la comunidad internacional para obtener fondos de emergencia (Müller et al., 2020). La gobernanza débil y la corrupción también han mermado la capacidad del Estado para satisfacer las demandas de la población en tiempos de crisis y han socavado los esfuerzos de adaptación y mitigación del cambio climático (Nett y Rüttinger, 2016;Universidad de Notre Dame, 2022).Los impactos del cambio climático pueden exacerbar las condiciones socioeconómicas que conducen a la vulnerabilidad de los hogares que dependen de la agricultura de subsistencia y de secano, y contribuir aún más a la inseguridad alimentaria y de los medios de vida. Esto, a su vez, puede incentivar la migración económica hacia centros urbanos, dentro y fuera del país. La falta de acceso a medios de vida alternativos puede aumentar la participación en actividades ilícitas y el reclutamiento por parte de grupos criminales, contribuyendo indirectamente a reforzar las redes activas de crimen organizado en las regiones fronterizas con México y Honduras.El aumento de las temperaturas, combinado con la disminución de las tasas de precipitación, el aumento del nivel del mar, así como la mayor frecuencia e intensidad de fenómenos meteorológicos extremos, hacen de Guatemala, en particular de las zonas situadas en el Corredor Seco, uno de los países más vulnerables al cambio climático (MARN et al., 2021). Se espera que las proyecciones climáticas, especialmente las sequías en el Altiplano Occidental y en todo el Corredor Seco, continúen agravando la idoneidad climática de los cultivos y los rendimientos, lo que provocará inseguridad alimentaria y de medios de vida y, en consecuencia, impulsará la pobreza, la desnutrición, la movilidad humana en todo el país. El acceso y la disponibilidad limitada de recursos, unidos a la inseguridad alimentaria y de los medios de vida, puede aumentar la competencia por los recursos, las tensiones y los conflictos por la tierra, además de exacerbar la participación en actividades ilícitas en las regiones occidentales y orientales del país. En esta sección, exploramos los impactos de la variabilidad del cambio climático a través de dos rutas causales:-Inseguridad alimentaria y de los medios de vida (Ruta 1) -Disponibilidad y acceso a los recursos (Ruta 2).Los hogares rurales guatemaltecos dependen en gran medida de la agricultura de subsistencia y de secano para asegurar su seguridad alimentaria y de medios de vida (Valencia, 2022). Encuestas recientes, realizadas en Acatenango y Chiquimula, muestran que más del 90% de los pequeños agricultores ya han percibido cambios en el clima (Harvey et al., 2018). Los prolongados periodos de sequía han provocado un aumento en la evaporación del agua y la erosión del suelo, lo que se traduce en pérdidas de rendimiento agrícola (Beveridge et al., 2019;Hernández, 2012;Maurer et al., 2017;Nett y Rüttinger, 2016;Vargas et al., 2017). Se espera que los efectos del cambio climático aumenten aún más las pérdidas económicas, especialmente las de pequeños agricultores dedicados a cultivos básicos y cultivos comerciales de gran importancia para el país, principalmente maíz, plátano y café (Luna Natareno, 2022, Tucker et al., 2010;Waddick, 2017;PMA et al., 2017). Para 2050, se prevé una disminución de la productividad agrícola, con un descenso en el rendimiento del 14% en el caso del maíz y el frijol, y hasta del 35% en el caso de la caña de azúcar (Castellanos et al., 2018).Los fenómenos meteorológicos extremos, como inundaciones y ciclones tropicales, provocan la pérdida de infraestructuras, como carreteras o puentes, limitando así el acceso a los mercados (Pons, \" en una encuesta centrada en El Salvador, Guatemala y Honduras, la OIM y el PMA (2022) informaron de que la mitad de los hogares entrevistados habían pasado días enteros sin comer como mecanismo de respuesta, debido a la falta de dinero. Los informes indican que en los últimos cinco años se ha producido un aumento sustancial en los precios del maíz blanco y los frijoles negros (FEWS NET, 2022).Al mismo tiempo, el aumento en los costes de los insumos ha provocado una menor rentabilidad, lo que a su vez ha reducido las inversiones en plantaciones y ha aumentado la vulnerabilidad de los cultivos a plagas y enfermedades (Avelino et al., 2015). Además, se ha constatado que los bajos rendimientos agrícolas también provocan menores incentivos para trabajar como temporeros en el sector cafetero, lo que reduce el dinero de las familias y su capacidad para invertir en fertilizantes y ganado (Baumeister, 1993;Rivera Lima, 2022). Las proyecciones del cambio climático sugieren una reducción de la producción y la exportación de cultivos, así como un aumento de la dependencia a la importación de cereales y del precio de los alimentos. En consecuencia, se espera una repercusión negativa en los salarios, una reducción del PIB en un 1,2% y que se vean perjudicados la seguridad alimentaria y los medios de vida en todo el país (Castellanos et al., 2018;Vargas et al., 2018).\" de la variabilidad climática y los fenómenos meteorológicos extremos en la agricultura de secano (OIM et al. 2015;PMA et al., 2017). Por ejemplo, en municipios como Cabricán, el 70% de los hogares, impulsados por la inseguridad de la agricultura de secano, han migrado ya sea a Estados Unidos, a ciudades más grandes o a otras zonas para ser trabajadores temporales (Milán y Ruano, 2014).Las dificultades en las actividades agrícolas causadas por las sequías de 2014-2015 y 2018 han sido identificadas como uno de los principales impulsores del aumento de la migración a Estados Unidos (Bermeo et al., 2022;Olivera et al., 2021). Sin embargo, las familias se enfrentan a riesgos sustanciales al emigrar y, aunque un ingreso exitoso puede dar lugar a empleo y remesas constantes para la familia en el país de origen, la desaparición y los ingresos sin éxito también son resultados comúnmente posibles (PMA et al., 2017). Dado que casi la mitad de la población guatemalteca en los Estados Unidos vive sin estatus legal y que la mayor parte de esta migración es ilegal, viajando a través de redes independientes de traficantes de migrantes o sobrepasando sus visas, los migrantes guatemaltecos son particularmente vulnerables a experimentar explotación sexual, robos, inseguridad y abusos de derechos humanos en general en su tránsito hacia el país de destino (Hernández Bonilla et al., 2018;OIM, 2017;Selee et al., 2022;PMA y OIM, 2022). Por ejemplo, las pandillas, tanto en México como en Guatemala, son conocidas por aprovecharse de los migrantes irregulares (Delavelle, 2015).La ausencia de canales oficiales para facilitar los trámites migratorios y garantizar la protección de los migrantes por motivos ambientales de América Latina a Estados Unidos ha impulsado el uso de canales irregulares a través de traficantes, así como ha generado que los migrantes se vean expuestos a la trata de personas y a riesgos mortales, tanto en tránsito como una vez en el país de destino (Delavelle, 2015;Iniciativa Nansen, 2013).La percepción generalizada de que la agricultura ya no es una estrategia adecuada de subsistencia predomina entre los agricultores del municipio de Chiantla, departamento de Huehuetenango.La pérdida de medios de vida basados en agricultura a pequeña escala está asociada con una dependencia creciente de la migración irregular, mayoritariamente a los Estados Unidos. La migración irregular, aunque considerada beneficiosa para la comunidad debido a las remesas, inversiones y oportunidades de empleo, también está asociada con riesgos de seguridad producidos por abusos comunes sufridos por los migrantes a través de las rutas migratorias.Asimismo, las diversas oportunidades para migrar han producido la ausencia de trabajadores disponibles para trabajar los campos, exacerbando así los sentimientos sobre la agricultura como un medio de vida incierto. El caudal reducido de manantiales naturales en la región durante la canícula alimenta el ciclo de pérdida de oportunidades agrícolas y migración (Medina et al., de próxima publicación).Por este motivo, teniendo en cuenta la creciente variabilidad climática, la migración interna hacia zonas urbanas, como Ciudad de Guatemala, es la estrategia más utilizada para diversificar los medios de vida e ingresos (Fetzek, 2009;Huber et al., 2023;Nett y Rüttinger, 2016;). Los adultos jóvenes, solteros y recién casados son los más propensos a emigrar (Bilsborrow, 2001). Mientras que los hombres son \" más propensos a migrar al extranjero (representan el 72% de la población residente que vive en el extranjero), las mujeres son más propensas a trasladarse a zonas urbanas debido a su creciente papel en la producción industrial (Baez et al. 2017, Delavelle 2013;UN INSTRAW, 2006)). Se prevé que la Ciudad de Guatemala y el altiplano sean un punto crítico de \"inmigración\" climática, a diferencia de la costa del Pacífico, que se espera que sea un punto crítico de \"emigración\" climática (Kumari Rigaud et al., 2018). Las proyecciones de la subregión indican que para 2050, México y Centroamérica podrían alcanzar entre 1,4 y 2,1 millones de refugiados climáticos (Kumari Rigaud et al., 2018). Aunque un aumento del número de migrantes no es un problema de seguridad en sí, podrían surgir tensiones sociales en función de cómo se reciba y perciba a los migrantes en las zonas de acogida (Fetzek, 2009).Del mismo modo, se prevé que aumente la participación en actividades económicas ilícitas de crimen organizado, contribuyendo así a la pérdida de control territorial por parte del gobierno (Fetzek, 2009).Por ejemplo, algunas zonas del norte de Guatemala están controladas por narcotraficantes, incluso dándose casos en los que éstos han establecido estructuras estatales paralelas para proporcionar servicios básicos (Fetzek, 2009). La legitimidad del Estado y su monopolio sobre el uso de la fuerza se están viendo socavados, aún más, por la creciente privatización de las tareas estatales por parte de actores armados no estatales (Nett & Rüttinger, 2016). Entretanto, estos grupos delictivos han explotado las zonas afectadas por catástrofes cuyo acceso está restringido para evitar el control gubernamental (Nett & Rüttinger, 2016).Caníuclas y tormentas tropicales más intensas y frecuentes han aumentado la erosión del suelo y han reducido su contenido de nutrientes a lo largo del municipio de Camotán, en el departamento de Chiquimula. Estos efectos climáticos han reducido la productividad agrícola en la región, incluyendo el riesgo de pérdida de cultivos y decreciendo los rendimientos. Debido al descenso en los ingresos, las oportunidades de empleo y la seguridad alimentaria, las personas de Camotán son más propensas a recurrir a actividades ilegales, especialmente a cultivos ilegales. La pérdida de medios de vida, acompañado de la falta de alternativas de empleo, también aumenta la adopción de otras actividades ilícitas, incluyendo asaltos y robos, por parte de poblaciones jóvenes en contextos urbanos y carreteras sin supervisión (Medina et al., de próxima publicación).Las tensiones relacionadas al acceso, suministro y pago de servicios básicos como el agua potable y la electricidad, la pobreza, la desigualdad, el desempleo, así como la superficie de tierra utilizada para la minería, se han asociado a una mayor frecuencia de conflictos (López et al., 2021;Tejiendo Paz, 2020).Del mismo modo, las zonas urbanas que reciben migración rural relacionada con eventos climáticos, así como los migrantes deportados de Estados Unidos, experimentan cada vez más tensiones y violencia (ICG, 2017;Nett & Rüttinger, 2016). Los migrantes que luchan contra la desnutrición crónica se han asociado con la pobreza, la exclusión social, la falta de servicios sociales y las oportunidades limitadas de empleo, factores que conducen a una alta vulnerabilidad a participar en actividades ilícitas, así como al reclutamiento de pandillas (Nett & Rüttinger, 2016). Se ha determinado que los jóvenes, los pequeños agricultores y, en particular, los que han sido deportados anteriormente de los Estados Unidos, tienen mayores incentivos para participar en delincuencia y robo, así como para ser influenciados por los cárteles transnacionales de la droga, tanto en zonas rurales como urbanas (ICG, 2017;Nett & Rüttinger, 2016;Worby, 2013). Como tal, el cambio climático puede limitar el acceso a los recursos y su disponibilidad, socavando las oportunidades de vida y, a su vez, contribuyendo indirectamente al fortalecimiento de las redes de narcotráfico y pandillas (Fetzek, 2009;Nett & Rüttinger, 2016).Las comunidades que dependen de cultivos sensibles al clima tienen más probabilidades de ser menos resilientes a perturbaciones climáticas y más vulnerables a perder sus ingresos debido a pérdidas de cosechas importantes provocadas por cambios en el clima, ya que no pueden depender de su propia producción de granos (Nett & Rüttinger, 2016;Normanns & Morales, 2016). Por esta razón, la participación en actividades ilícitas, como la tala ilegal en Petén y el crecimiento de cultivos ilícitos en el Altiplano Occidental, cerca de la frontera con México, además de la migración para buscar medios de vida alternativos, se consideran en ocasiones soluciones viables para mejorar las condiciones de vida (Delavelle, 2015;Rigaud et al., 2018;Lynch, 2019;Melgoza & Papadovassilakis, 2022;Müller et al., 2020;Nett & Rüttinger, 2016).Situado en la región elevada del sur de Guatemala y fronterizo con México, el altiplano occidental de Guatemala se caracteriza por ser la región del país más vulnerable a los impactos del cambio climático (USAID, 2022).Los hogares de pequeños agricultores que cultivan principalmente maíz y frijol no pueden obtener alimentos suficientes de sus actividades agrícolas, por lo que siguen dependiendo del mercado para sus fuentes de alimento y empleo (López-Ridaura et al., 2019). En Guatemala, la inseguridad alimentaria se concentra en el altiplano occidental, donde la pobreza afecta a más del 50% de la población y el 48% experimenta desnutrición crónica (Hellin et al., 2017). La inseguridad alimentaria y de los medios de vida provocada por el clima, una realidad ya observada en muchos hogares de la región, ha contribuido a un aumento de la migración, en particular de niños no acompañados, a diferentes partes del país, pero más comúnmente al extranjero, predominantemente a Estados Unidos, con el fin de buscar opciones alternativas de medios de vida (Clare, 2020;Delavelle, 2015;Dupre et al., 2022;OIM et al., 2015;Nett y Rüttinger, 2016;PMA et al., 2017). Sin embargo, se estima que el 50% de los migrantes deportados de Estados Unidos proceden de Guatemala: en particular de las provincias de Huehuetenango (15,5%), San Marcos (15,3%), El Quiché (8,2%), Quetzaltenango (7,8%) y Totonicapán (Tejiendo Paz, 2020). La falta de apoyo a los migrantes retornados hace que sean especialmente vulnerables a la drogadicción, a cometer delitos menores y al reclutamiento por parte de pandillas (Worby, 2013).Al desarrollar estructuras estatales alternativas y suplir la carencia del Estado en la prestación de servicios básicos para la población local, los narcotraficantes han obtenido apoyo y han podido ampliar sus actividades ilícitas (Nett y Rüttinger, 2016). Se ha comprobado que la participación de los agricultores en el cultivo de la amapola, clave para la producción de heroína, es una importante actividad alternativa de generación de ingresos para algunos hogares del altiplano occidental (Clare, 2020;Espinoza, 2017;González, 2019;Nett & Rüttinger, 2016;Normanns & Morales, 2016). Se estima que sus ingresos son entre 12 y 20 veces más que los producidos por los cultivos agrícolas regulares (Feakin & Deplege, 2010;IPS, 2006). No obstante, la amapola está vinculada a redes de narcotráfico de México, que se caracterizan por infligir violencia contra la población local y por participar en conflictos entre los distintos cárteles, contribuyendo a una dinámica general de inestabilidad e inseguridad en la región (Espach et al., 2011). Por ejemplo, en los municipios de Ixchiguán y Tajumulco, en el departamento de San Marcos, una zona conocida por el cultivo de amapola, se declaró el estado de emergencia tras un brote de violencia entre habitantes locales y militares (Clavel, 2017). Mientras tanto, la intervención del Gobierno para erradicar las plantas de amapola, sin ofrecer una alternativa a los agricultores del departamento de San Marcos, ha puesto en peligro el único ingreso de subsistencia que tenían algunas familias locales y las ha empujado de nuevo a la pobreza, lo que ha provocado desnutrición y también problemas de salud (Clare, 2020;González, 2019;Stone, 2012).Se han observado impactos del cambio climático en los sistemas hídricos, terrestres y alimentarios, y se prevé que disminuya aún más la productividad de las tierras agrícolas, disminuya el rendimiento de los principales cultivos comerciales y dificulte la disponibilidad y el acceso a los recursos naturales en Guatemala. El aumento de la competencia por el acceso y distribución de los recursos naturales puede provocar tensiones y conflictos.Casi la mitad del territorio guatemalteco presenta riesgos vinculados a los impactos del cambio climático y alrededor del 12% del territorio está amenazado por la desertificación (Hernández Bonilla et al., 2018). Los hogares rurales guatemaltecos, altamente dependientes de la agricultura de secano, se caracterizan por la falta de medios económicos, la pobreza y la desnutrición (PMA et al., 2017).Simultáneamente, los hogares vulnerables tienen estrategias de adaptación limitadas para hacer frente a los impactos de la variabilidad climática (Milan & Ruano, 2014;Warner & Afifi, 2014). En el Corredor Seco, se prevé que el acceso y la disponibilidad de recursos naturales se vean restringidos gracias a la disminución de las precipitaciones de hasta el 70% (Hernández Bonilla et al., 2018). Esto será particularmente notable en los departamentos de Baja Verapaz, Sacatepéquez y Chimaltenango (Hernández Bonilla et al., 2018). A medida que los impactos del cambio climático se vuelvan más notables y recurrentes, se espera que el acceso y la disponibilidad de los recursos se vean aún más amenazados, aumentando la competencia y, en consecuencia, la probabilidad de conflictos y tensiones por los recursos naturales (Hernández Bonilla et al., 2018;Nett & Rüttinger, 2016). Además de reducir la producción agrícola, los períodos de sequía prolongados y los fenómenos meteorológicos extremos también han disminuido la cantidad de tierras agrícolas disponibles (Waddick, 2017).En Guatemala, el 70% de las principales actividades que contribuyen al PIB dependen del acceso al agua (MARN et al., 2021). La escasez de agua es particularmente notable durante la estación seca, afectando a la mayor parte de las tierras altas orientales y centro-occidentales, la región norte del Petén y la costa sur (USAID, 2017). Más del 40% de los habitantes rurales guatemaltecos carecen de acceso al agua en sus hogares, e incluso aquellos que lo tienen, a menudo no tienen acceso a servicios de saneamiento (Fondo ODM & Cooperación Española, s.f.) La calidad del agua continúa siendo deficiente, con cifras que indican una disminución de la calidad en las últimas décadas, principalmente vinculada al aumento de aguas contaminadas procedentes de los sectores agrícola e \" industrial (Basterrechea & Guerra Noriega, 2019). Considerando que sólo el 44% de la población tiene acceso a servicios de saneamiento de agua, se espera que la creciente escasez de agua, combinada con el deterioro de la calidad del agua y el reducido tratamiento, ponga en peligro el acceso y la disponibilidad de agua potable para la población (MARN et al., 2021). El aumento proyectado del nivel del mar puede incrementar la entrada de agua salada a los cuerpos de agua superficiales y subterráneos en la meseta central, así como en las áreas orientales y bajas del departamento de Petén (MARN et al., 2021). En este sentido, otro reto es la creciente demanda promovida por el crecimiento poblacional, factores que han llevado a proyectar disminuciones de hasta 59% de agua per cápita para finales de siglo (Basterrechea & Guerra Noriega, 2019;MARN et al., 2021).El agua para consumo doméstico y regadíos en la comunidad de El Carpintero, en Chiantla (Huehuetenango), proviene casi por completo de manantiales alrededor de la localidad. Aunque la comunidad es dueña de muchos de estos manantiales, una gran cantidad de ellos fueron vendidos décadas atrás por el gobierno municipal a municipios aledaños que buscaban asegurar la provisión de agua para zonas urbanas más grandes. Esto llevo a que hubiese un número limitado de manantiales dentro de El Carpintero que podían ser adquiridos por la comunidad, los cuales se encuentran todos ubicados en tierras privadas de algunos miembros de la comunidad.Debido a los patrones cambiantes de precipitación, las poblaciones experimentan una reducción en el agua que corre en estos manantiales, especialmente durante la temporada seca y la canícula. La comunidad reconoce la necesidad de adquirir los manantiales restantes en su territorio, con el fin de asegurar a futuro el acceso al agua. Sin embargo, la naturaleza privada de los manantiales, junto con la falta de disponibilidad de los miembros de la comunidad a reunir recursos para comprar estas tierras, han hecho de este objetivo un desafío. El acceso reducido al agua, la naturaleza privada de los manantiales y el interés creciente de actores externos de adquirir los restantes, son entendidos como riesgos de conflicto dentro y fuera de la comunidad.De hecho, varias situaciones de conflicto han tenido lugar con diferentes grados de violencia (Medina et al., de próxima publicación).Se prevé que las zonas agrícolas del Valle del Motagua y las vertientes del Pacífico de Guatemala se vean afectadas por el estrés hídrico debido a las actividades de riego, ya que estas constituyen entre el 74% y el 90% de la demanda total de agua (Delavelle, 2015). Los fenómenos meteorológicos extremos, como los ciclones tropicales, han provocado deslizamientos de tierra e inundaciones, provocando pérdidas de infraestructuras y cosechas, obstaculizando el acceso a las carreteras, limitando la movilidad humana y de productos básicos, además de causar escasez de alimentos (Waddick, 2017). A medida que los fenómenos meteorológicos extremos se vuelvan más intensos y recurrentes, se espera que el acceso y la disponibilidad de recursos se vean aún más obstaculizados para las comunidades más afectadas por estos.En Guatemala ya se están observando los efectos de un clima cambiante en los ecosistemas marinos (Yon Bosque, 2011). Junto con un marco institucional deficiente para la conservación de la biodiversidad marina en las zonas costeras, el cambio climático ha reducido los manglares hasta en \" un 70% respecto a su cobertura original (Yon Bosque, 2011). En la mayoría de los océanos tropicales de la costa del Pacífico, también se ha observado una reducción de la pesca (FAO, 2018). Para 2050, se prevé que la idoneidad del hábitat de todas las pesquerías disminuya de un 10,18% a un 13,59%, y en el caso de las pesquerías de pequeños pelágicos se estima que las cifras disminuirán hasta un 31,24%, e incluso un 40,19%, como resultado de los impactos relacionados con el cambio climático (Clarke et al., 2021).A medida que el cambio climático siga socavando la disponibilidad y el acceso a los recursos naturales, se prevé que aumenten las tensiones y los conflictos en todo el país (López et al., 2021). Encuestas indican que las comunidades de las zonas rurales perciben que la gestión y distribución del agua, así como el uso de los bosques, son las causas fundamentales de los conflictos agrícolas (Fetzek, 2009;Tejiendo Paz, 2020). Por ejemplo, en el altiplano occidental, los informes indican la existencia de disputas entre agricultores por el agua para regar los cultivos de amapola, lo que se produce en el contexto del aumento de disputas entre cárteles mexicanos en San Marcos, obligando al Gobierno a declarar el estado de emergencia (González, 2019;Reuters, 2017). La falta de disponibilidad de agua también podría exacerbar los conflictos ya existentes entre las comunidades locales y las empresas hidroeléctricas, que en ocasiones han provocado el asesinato o la desaparición de activistas, como las masacres de Río Negro a principios de la década de 1980 y, más recientemente, el asesinato de un activista medioambiental en 2017 (Delavelle, 2015;Dupont de Dinechin, 2022;HRW, 2008). Ç Para los departamentos de Izabal, Alta Verapaz, Huehuetenango y Quiché, se espera que la inseguridad impulsada por la variabilidad climática exacerbe aún más las protestas ya existentes, así como los conflictos por la tierra debido a las prácticas de acaparamiento de tierras por parte de empresas de biocombustibles, mineras, petroleras e hidroeléctricas (INTRAPAZ, 2009). La evidencia muestra que las actividades empresariales vinculadas al cultivo de caña de azúcar y aceite de palma, así como la instalación de proyectos mineros y plantas hidroeléctricas, han contribuido al desplazamiento interno forzado, así como al aumento de conflictos locales y municipales debido al consecuente deterioro del suelo y la tierra, además de la contaminación del agua (Hernández Bonilla et al., 2018).El aumento de precipitaciones durante las épocas de lluvia, junto con inundaciones cada vez más frecuentes, ha provocado una reducción significativa de la producción agrícola y ganadera en la comunidad de Tenedores, Morales, departamento de Izabal. Los dueños de ganado se han visto forzados a vender sus vacas antes de la temporada de lluvias, produciendo así un descenso en los precios y ganancias del mercado de la carne. De la misma forma, los agricultores también luchan para asegurar sus ganancias bajo altos riesgos de pérdida de cultivos y el incremento de los precios de los suministros. Empeorando esta situación, la tenencia de la tierra es altamente insegura e irregular en la comunidad, dependiendo así de acuerdos cortos e informales de arrendamiento. Acuerdos de tenencia de la tierra percibidos como desiguales e injustos están asociados con el escalamiento de los agravios entre propietarios de tierra y arrendatarios. La disponibilidad de estrategias de medios de vida alternativos dentro de la comunidad -incluyendo recolección de arena, migración temporal regulada a Canadá y el trabajo en plantaciones bananeras -han mitigado el problema de momento, pero miembros de la comunidad reconocen que los bajos niveles de disponibilidad y tenencia de tierra son una potencial fuente de conflicto entre vecinos (Medina et al. de próxima publicación).En determinadas zonas del altiplano occidental y de las zonas costeras, la falta de acceso a los recursos hídricos ha provocado conflictos entre los distintos usuarios, incluidos los grandes y pequeños usuarios del riego (Banco Mundial, 2011). También se ha identificado que las tensiones transfronterizas entre los buques de pescadores guatemaltecos y hondureños que trabajan en la Zona Económica Exclusiva de Belice se deben en parte a la disminución de las poblaciones de peces en las costas guatemaltecas (Fetzek, 2009). Igualmente, han surgido tensiones y ataques entre \"xateros\" guatemaltecos y las Fuerzas de Defensa de Belice, debido a que los primeros cruzan ilegalmente la frontera para cortar xate, que luego se exporta y se utiliza en la industria floral (Channel 7 News Archives, 2008a;2008b;Fetzek, 2009). También se han detectado tensiones incipientes dentro de las comunidades, así como entre ellas, vinculadas a la disponibilidad y el acceso a los recursos hídricos de los manantiales en la aldea de El Carpintero, en el altiplano occidental, donde algunos miembros de la comunidad prevén una futura escalada de estas tensiones, a medida que los episodios de sequía se alarguen y se agraven (Medina et al. de próxima publicación). Aunque el cambio climático no es la causa de las tensiones, se espera que su impacto agrave la productividad agrícola, las poblaciones de peces, los recursos forestales, así como el caudal de los sistemas fluviales, creando un contexto en el que la reducción del acceso y la disponibilidad de recursos podría aumentar y exacerbar las tensiones sociales y políticas (Fetzek, 2009).Ante la disminución de la disponibilidad y el acceso a los recursos naturales, se prevé que sigan aumentando las tensiones asociadas a la distribución y el acceso a servicios básicos como la electricidad y el agua, potable o de riego (Läderach et al., 2021;Medina et al. de próxima publicación).Se ha observado que una mayor accesibilidad a la minería, los cultivos comerciales y las zonas de deforestación está asociada a una mayor incidencia de conflictos (Läderach et al., 2021). Además, las comunidades de zonas con escasa presencia estatal se caracterizan por altos niveles de violencia, corrupción, crimen organizado, así como normas de género desiguales (Valencia, 2022). Las zonas vulnerables se identifican en regiones fronterizas con México, como el departamento de Petén, y en el Corredor Seco (Pacillo et al., 2021;Valencia, 2022;PMA et al., 2017).Los hogares situados en el Corredor Seco están especialmente expuestos a una fuerte variabilidad en las precipitaciones y a sequías intensas (Pacillo et al., 2021). La limitada capacidad de adaptación de la población rural, junto con su dependencia de la agricultura de secano, ha provocado inseguridad alimentaria y pobreza generalizadas en la región (Pacillo et al., 2021;PMA et al., 2017).Mientras que encuestas recientes señalan que sólo la mitad de las familias del Corredor Seco son propietarias de la tierra que trabajan, las parcelas de tierra no son suficientes para cultivar las cantidades de alimento necesario para las familias durante el año (Valencia, 2022). Los cambios en los patrones de precipitación han impactado particularmente en la productividad agrícola de la región, ya que la falta y el exceso de lluvia han dificultado el crecimiento de cultivos esenciales, como el maíz, y, en consecuencia, han contribuido a una disminución en el rendimiento de las cosechas (Valencia, 2022). Las tensiones vinculadas al acceso, provisión y pago de los recursos naturales se correlacionan con una mayor incidencia de conflictos (López et al., 2021;Tejiendo Paz, 2020).Por ejemplo, en el departamento de Sololá, las comunidades de Santa Catarina Ixtahuacán y Nahualá han experimentado recientemente una escalada de tensiones originadas por la demarcación de los límites municipales (ACLED, 2022;de la Roca Girón, 2021;Hernández Bonilla et al., 2018;Tejiendo Paz, 2021). Aunque mantienen un conflicto permanente desde 1884, la violencia intercomunal se ha incrementado recientemente durante los periodos previos a la temporada de cosecha (ACLED, 2022;García, 2022). Estas tensiones se han agravado aún más debido al creciente aumento de actividades de grupos criminales en la región, que buscan controlar las rutas del narcotráfico, así como participar en el contrabando de personas de estas comunidades hacia los Estados Unidos a cambio de títulos de propiedad (ACLED, 2022;ICG, 2017;Tejiendo Paz, 2021). Del mismo modo, en los municipios de Tajumulco e Ixchiguán, en el departamento de San Marcos, ha habido conflictos sociales por recursos naturales claves como la tierra y el agua (Latin News, 2017). Estas tensiones se han exacerbado debido a la creciente violencia vinculada a la actividad del narcotráfico, el cultivo de amapola y la guerra territorial entre dos cárteles mexicanos: el Cártel de Sinaloa y el Cártel Jalisco Nueva Generación (Latin News, 2017;López, 2021).Una mayor intensidad y frecuencia de los periodos de sequía, las precipitaciones y los fenómenos climáticos extremos se asocian a una menor producción agrícola y a una menor disponibilidad de tierras para el cultivo, lo que probablemente conduzca a la escasez de recursos y a una mayor competencia por la tierra y los recursos hídricos dentro de las comunidades, así como entre ellas.Teniendo en cuenta la inseguridad ya existente provocada por la violencia y las tensiones relacionadas con el acceso, el suministro y el pago de servicios básicos (por ejemplo, agua potable y electricidad), la escasez de recursos provocada por el cambio climático puede dar lugar a una mayor incidencia de los conflictos entre las comunidades locales y los cárteles de la droga."}

main/part_2/0110684555.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"39ce90bc8ff1333bc170270850560c4a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f14268c2-1f4e-46f6-b168-88ca4bb5674a/retrieve","id":"-178259523"},"keywords":[],"sieverID":"ecb12511-b880-45d3-bfea-778ad9dd2551","content":"Ethiopia battled with chronic drought in the aftermath of the 2015 El Nino, which caused widespread crop and livestock losses. The SNNP and Amhara regions were among those worst affected and farmers needed emergency support to rebuild their livelihoods.Although cereal-based diets predominate in the region, potato and sweetpotato are grown widely. They are suitable crops for challenging conditions since they are highly efficient in transforming water into calories, have a short maturity period, and can be harvested during the 'hunger months' before the cereals ripen. Orangefleshed sweetpotato provides a rich source of vitamin A, commonly deficient among Ethiopian children and women of reproductive age.Working with local partners, particularly the Bureau of Agriculture and Natural Resources Development (BoANRD), the International Potato Center (CIP) implemented an emergency project in 2016 to improve the nutrition and food security of households in SNNP. It was been highly successful in providing planting materials and increasing yields among drought-affected households. However, many more families continued struggling to grow sufficient food. Building on the lessons learned, CIP expanded its activities to additional farmers in phase II.The goal was to improve the food and nutrition security of at least 41,000 drought-affected farmers (243,000 people). The project provided immediate access to improved seed potato and sweetpotato planting materials, offering productive and well-adapted varieties. It also offered training on production and post-harvest technologies, and raised awareness of nutritional needs.The project introduced new, high-yielding varieties of potato and vitamin A-rich orange-fleshed and highly productive and drought-tolerant white-fleshed sweetpotatoes. In addition to distributing planting materials to farmers, the project supplied producer cooperatives with high quality seed to renew their stock to ensure producers have access to quality planting material.Capacity building activities were vital to ensure effective dissemination and build long-term community resilience to drought. Efforts focused on 'training of trainers' and 'model farmers' approaches, in collaboration with local partners, and covered production technologies, CIP's 'Triple S' (sand, storage, and sprouting) technology to preserve planting material between cultivation seasons and family nutrition.Potato and sweetpotato are widely grown by women in their backyards, providing valuable food and income for family needs. Interestingly, as potato and sweetpotato cultivation has expanded, women have retained involvement in production and marketing, thus enabling them to play a greater role in family decision-making.Mindsets among farmers are also changing, with male farmers increasingly listening to advice from women who have attended training courses. In line with the Ethiopian government's development plan to increase gender equality in agriculture, phase II sought reach 6,300 women farmers who are household heads.Potato and sweetpotato are ideal food security crops, producing good harvests even under challenging growing conditions. This project directly provided around 20,000 Ethiopian farm households in the Southern Nations, Nationalities and People's (SNNP) region with quality planting materials and training, enabling them to rebuild their food security following a period of severe drought. Phase II will extend benefits to an additional 20,000 families in need of emergency support in SNNP and Amhara regions.The first phase benefited nearly 20,000 households (about 126,000 people) by providing them with planting materials. After the first harvest, the farmers shared their planting material with their neighbors. The farmers welcomed the new potato varieties, reporting that they matured earlier, gave higher yields, improved disease resistance, and had better cooking characteristics than their traditional types. They were particularly impressed with the 'Gudene' , which both tasted good and on average yielded more than 50 t/ ha in high potential districts.Although slightly skeptical about the new orange-fleshed sweetpotato, smallholder families have embraced it and love its taste. They use it sparingly, mixing it with other traditional foods to ensure adequate intake of vitamin A. In addition to improving food security, the new varieties produce valuable planting materials, which fetch a good price. Farmers now sell seed potatoes and sweetpotato vine cuttings, as well as any surplus harvest, generating valuable cash for medicines, household items, and school fees. Many have also invested in building more sustainable and resilient livelihoods. production methods, integrated pest management, postharvest handling and storage, and family nutrition. Trainees shared this knowledge with other farmers, and for the first time BoANRD included similar training modules in its own programs. Efforts to include women in capacity building were particularly successful in the area of food preparation and nutrition, which involved more than 14,000 participants.The second phase targeted 21,000 additional droughtaffected farm households in the Amhara and SNNP regions. The same varieties of potato and sweetpotato were distributed to farmers who have lost their crops and planting materials, were willing to plant potato and sweetpotato, and had sufficient land available. Priority was given to femaleheaded households and those with most dependents. Sustainability was built in by working with farmer and commercial seed and vine suppliers to ensure quality planting materials continue to be available when CIP support ends. Farmers received training in conservation of sweetpotato planting material, rapid multiplication techniques, managing the potato crop for seed, and storage and handling of seed potato. The project aimed to increase the proportion of women attending training on crop production and post-harvest technologies to 40%, with a target of over 80% for those attending nutrition training.  "}

main/part_2/0134891468.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"3297e3f8f8beb691989bdfec79fb7263","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/606ed1a9-5df6-4ccb-b0bd-6f530d0732c6/content","id":"-1815312887"},"keywords":["Triticum turgidum var. durum","Puccnia triticina","genes","resistencia","susceptibilidad Triticum turgidum var. durum","Puccnia triticina","genes","resistance","susceptibility"],"sieverID":"fdb70c11-165a-40ea-90ff-4fdb18e4a68b","content":"La roya de la hoja, causada por el hongo Puccnia triticina E., es una enfermedad que cuando se presenta, genera pérdidas hasta del 100 % en el rendimiento de grano del trigo cristalino (Triticum turgidum ssp. durum L.). Como medida de protección genética en la construcción piramidal de nuevos genotipos resistentes es necesario identificar en el germoplasma con resistencia a esta enfermedad, el número de genes involucrados y su acción génica. Con este propósito, durante el ciclo de cultivo otoño-invierno 2017-2018, se cruzaron los progenitores susceptibles Atred#1 y Atred#2 con las líneas resistentes de trigo cristalino procedentes de Etiopía WC-2 no. 100, DW-K2 no. 47, Oda, 2000/01 population FR. no. 43, 2000/01 population 37-30 BDI no. 63 y 2000/01 population 37-30 BDI no. 12. Las generaciones filiales de las cruzas se obtuvieron alternadamente en CIMMYT-Batán, Estado de México y CIMMYT-CENEB, Ciudad Obregón, Sonora, hasta obtener las Familias F 3 y F 4 . Con base en los análisis de segregantes de tales familias, se encontró que, en las seis líneas etíopes, la resistencia a la roya de la hoja es conferida por dos genes dominantes.Los trigos harinero (Triticum aestivum) y cristalino (Triticum turgidum ssp. durum) son la base de la alimentación en muchas culturas; además, con el trigo cristalino, se añade un alto aporte de fósforo, calcio, magnesio, silicio, vitaminas del grupo B y contenido energético (Reynolds et al., 2014). El grano de trigo harinero, hexaploide con el genoma AABBDD, se usa para la extracción de harina, que es utilizada para la elaboración de pan, galletas y otros productos alimenticios, mientras que del trigo cristalino, tetraploide con el genoma AABB (Huerta-Espino y Skovmand, 2000), se extrae la sémola para la elaboración de pastas y macarrones. El consumo de ambas fuentes constituye el 40 % del gasto de los hogares mexicanos y proporciona el 10 % del total de calorías (SIAP, 2021).Un problema fitopatológico importante al que se enfrenta este cultivo es la roya de la hoja, causada por el hongo Puccinia triticina E. La roya de la hoja puede causar graves pérdidas de rendimiento al afectar la biomasa, el peso del grano y número de granos por m 2 (Herrera-Foessel et al., 2005). Los daños al follaje causan pérdidas del rendimiento hasta del 100 %; sus infecciones tempranas disminuyen el número de granos por espiga, peso hectolítrico y calidad del grano (Dubin y Rajaram, 1996). La concentración proteica del grano disminuye la translocación de asimilados, aumenta la transpiración por el daño generado a la epidermis y afecta la acumulación de hidratos de carbono (Fleitas et al., 2014); por tal motivo, este problema se ha abordado con resistencia genética. En este sentido, y por lo general, las variedades formadas pueden poseer un gen dominante de resistencia; sin embargo, esta resistencia puede ser de poca duración, de 3 a 5 años, pues el patógeno evoluciona rápidamente hacia nuevas formas de virulencia (Singh and Dubin, 1997).El trigo cristalino en México permaneció altamente resistente a la roya de la hoja hasta el año 2001. En ese año se identificó la nueva raza BBG/BN que fue capaz de causar daños en más del 80 % de la colección de trigos cristalinos del Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), al igual que en la variedad Altar C84 que había permanecido resistente por más de 20 años (Huerta-Espino et al., 2009;Singh et al., 2004).En México se identificaron alrededor de 50 razas fisiológicas del hongo causante de la roya de la hoja, mediante un conjunto de líneas diferenciales que sólo poseen un gen de resistencia específico; sin embargo, para conocer la dinámica de la interacción planta-patógeno es necesario realizar muestreos a lo largo del ciclo del cultivo para vigilar las reacciones de virulencia de las razas de roya, ya que una misma variedad puede ser susceptible en ciertas regiones productoras de trigo y resistente en otras (Rodríguez-García et al., 2009). La interacción plantapatógeno se ajusta a la teoría de gen a gen; por lo tanto, por cada gen de resistencia en la planta existe un gen correspondiente de avirulencia en el patógeno (Flor, 1971). En el caso de la roya de la hoja, que preferentemente ataca a los trigos cristalinos en México, existen siete razas: BBB/ BNG, BBB/BNJ, BBG/BNC, BCG/BNC, BBG/BPC, CBG/BPC (Huerta-Espino et al., 2020) y BBG/BPC-Cirno, siendo en la actualidad esta última la más importante, ya que venció la resistencia de Cirno C2008 en 2017 (Huerta-Espino et al., 2017).La mayoría de los nuevos genotipos de trigos cristalinos que se cultivan en México son resistentes a la roya de la hoja, tanto en estado de plántula como de planta adulta, por la presencia del gen Lr14a, para el cual, aún no existe virulencia en este país (Huerta-Espino et al., 2020); sin embargo, ya existe virulencia para este gen en el sur de Francia (Goyeau et al., 2010).Las razas del hongo causante de la roya de la hoja evolucionan y adquieren virulencia para los genes de resistencia, por lo que es necesario identificar nuevas fuentes de resistencia o nuevos genes y localizarlos en el genoma, ya sea de forma tradicional o mediante marcadores moleculares. Con su ubicación en el genoma, es posible orientar los cruzamientos entre progenitores complementarios y asistir en la selección de segregantes mediante marcadores moleculares con el fin de acumular genes que aportan resistencia a roya de la hoja (Ren et al., 2017).Por lo anterior, el objetivo de este estudio fue identificar la acción génica y el número de genes involucrados en la resistencia a roya de la hoja, mediante el estudio de las progenies de cruzas de seis genotipos de trigo cristalino resistentes con las variedades susceptibles Atred#1 y Atred#2.Se utilizaron seis genotipos criollos de trigo cristalino procedentes de Etiopía: WC-2 no. 100, DW-K2 no. 47, Oda, 2000/01 population FR. no. 43, 2000/01 population 37-30 BDI no. 63 (BDI63) y 2000/01 population 37-30 BDI no. 12 (BDI12), que son resistentes a roya de la hoja; además de Atred#1 y Atred#2, genotipos susceptibles a la roya que alcanzan severidad del 100 % (Cuadro 1). Estos trigos fueron introducidos a México y evaluados por su resistencia a la roya de la hoja en el ciclo 2016 en CIMMYT-Batán.Se realizaron cruzamientos entre los genotipos resistentes a la raza BBG/BP-Cirno de roya de la hoja con los genotipos susceptibles Atred#1 y Atred#2 (Cuadro 2), durante el ciclo otoño-invierno 2017 en el Centro Internacional de Maíz y Trigo-Campo Experimental Norman E. Borlaug (CIMMYT-CENEB), Sonora, México. Los progenitores se sembraron en tres fechas con un intervalo de 10 días, con la finalidad de que la etapa de floración coincidiera y así realizar los cruzamientos.Obtención de las generaciones filiales F 1 , F 2 , F 3 y F 4 Las semillas F 1 , provenientes de una espiga de cada cruza, se sembraron en el CIMMYT-Batán, donde se cosechó una planta para obtener la semilla F 2 , que se sembró en el CIMMYT-CENEB en diciembre de 2017. En mayo de 2018, en CIMMYT-Batán, se sembraron las semillas de una espiga de las plantas F 2 en un surco de 1.5 m de longitud y ancho de 0.5 m.La semilla de las familias F 3 se sembraron el 30 de noviembre de 2019 en CIMMYT-CENEB para obtener familias F 4 . Las familias de cada cruza fueron sembradas en un diseño completamente al azar sin repeticiones en un surco doble de 1.2 m de largo y 0.8 m de ancho. Las familias F 3 y F 4 se obtuvieron por selección de una espiga de las plantas F 2 y de las familias F 3 respectivamente.Se utilizó la raza BBG/BP-Cirno, que venció la resistencia de la variedad Cirno C2008 (Huerta-Espino et al., 2017). La fórmula de avirulencia/virulencia de esta raza es: Lr1, Lr2a, Lr2b, Lr2c, Lr3, Lr3bg, Lr3ka, Lr9, Lr13, Lr14a, Lr15, Lr16, Lr17, Lr18, Lr19, Lr21, Lr24, Lr25, Lr26, Lr28, Lr29, Lr30, Lr32, Lr35, Lr36, Lr61/Lr10, Lr11, Lr12, Lr14b, Lr20, Lr23, Lr27, Lr31, Lr33, Lr72, Cam (Huerta-Espino et al., 2017;Singh et al., 2004).Para inducir la epidemia en el lote de las familias F 3 en CIMMYT-Batán y F 4 en CIMMYT-CENEB, se sembró la variedad de trigo Cirno como bordo, que actuó como fuente de inóculo del patógeno. Se inoculó con esporas de la raza BBG/BP-Cirno en una concentración 1 × 10 6 esporas mL -1 en aceite mineral Soltrol ® (Chevron Phillips Chemical Company, USA) 40 días después de la siembra y se roció totalmente a las hojas de las plantas. A la segunda y tercera semana se inocularon nuevamente los bordos para asegurar el establecimiento del hongo.Se realizaron tres evaluaciones en cada tipo de familias, la primera cuando los progenitores susceptibles Atred#1 y Atred#2 presentaron 20 % de severidad en la hoja bandera y las otras dos a intervalos de ocho días. La tercera evaluación se realizó cuando Atred#1 y Atred#2 presentaron el 100 % de severidad en la hoja bandera. En todos los casos la evaluación de la enfermedad se realizó siguiendo la escala modificada de Cobb (Peterson et al.,1948). Las familias de cada cruza se agruparon con base en las siguientes características:1. Familias homocigóticas resistentes con una respuesta similar al progenitor resistente, con 1 a 5 % de severidad. 2. Familias heterocigóticas que incluyen: a) plantas con resistencia intermedia (10 a 20 % de severidad) y b) plantas con severidad mayor al 30 %. 3. Familias homocigóticas susceptibles con una respuesta de severidad entre 90 y 100 %.Se calcularon las frecuencias esperadas de las familias F 3 y F 4 respectivamente, para determinar el número de genes involucrados en la resistencia, bajo la hipótesis de que las frecuencias genotípicas son las correspondientes para dos pares de genes.Cuadro 1. Progenitores criollos resistentes procedentes de Etiopía y los genotipos susceptibles Atred#1 y Atred#2. Las frecuencias fenotípicas observadas y esperadas se compararon mediante la prueba de χ 2 . El valor de tablas y la significancia se determinaron de acuerdo con la χ 2 que obtuvieron las proporciones de las familias de cada cruza. Para el valor de tablas se usaron n-1 grados de libertad, donde n es el número de clasificación de familias F 4 (Infante y Zárate, 1990).En los seis progenitores se confirmó su resistencia; cuando los progenitores Atred#1 y Atred#2 mostraron el 100 % de severidad, esos genotipos solamente presentaron entre 0 y 1 %. En las pruebas de χ 2 de las familias F 3 y F 4 sólo se tuvieron tres categorías: familias susceptibles, familias resistentes y familias segregantes, ello por las distintas combinaciones gaméticas esperadas para dos pares de genes en cada generación segregante; sin embargo, para su análisis se tuvieron sólo dos categorías, las familias susceptibles y otras (familias resistentes + familias segregantes) por la posible variación continua a causa de la presencia de otros genes de efectos menores exclusivos para planta adulta.Los resultados indicaron que la distribución de frecuencias fenotípicas relativas de las familias F 3 y F 4 se ajustó a dos genes independientes con dominancia completa, a una probabilidad de 0.05 (Cuadros 3 y 4).El proceso para determinar el número de genes se basó en registrar el número de familias homocigóticas susceptibles pues éstas son más fáciles de identificar en campo, bajo el supuesto de que la virulencia del patógeno es recesiva y que la resistencia en la planta es dominante (Roelfs y Grotht, 1988).Para el caso de la F 3 , en las seis cruzas, se postula la presencia de dos genes dominantes con una frecuencia de 15:1 en la F 3 y 13.75:2.25 en la F 4 , puesto que a medida que aumenta el número de generaciones de autofecundación disminuye la proporción de individuos heterocigóticos. Por cada generación de autofecundación la proporción de heterocigotos se reduce a la mitad; sin embargo, las proporciones en F 3 y F 4 coinciden en que la resistencia se basa en dos genes dominantes.El conocimiento de la resistencia a la roya de la hoja en el trigo cristalino en México ha sido muy limitado, en parte debido a que las razas de P. triticina que preferentemente atacan al trigo cristalino son avirulentas a la mayoría de los genes que confiere resistencia a la roya de la hoja en trigos harineros; por lo tanto, se espera que los genes efectivos presentes en los genotipos de trigo cristalino sean diferentes de los que son efectivos en el trigo harinero contra las razas que atacan este cultivo.; sin embargo, durante mucho tiempo se desconocía si los trigos cristalinos compartían los mismos genes de resistencia que los presentes en el genoma A y B del trigo harinero. Estudios recientes permitieron la identificación de varios genes (Lr3a, Lr14a, Lr23, Lr27+31) en trigos cristalinos que se encuentran comúnmente inefectivos en el trigo harinero, debido a la alta frecuencia de virulencia entre las poblaciones de P. triticina; sin embargo, estos genes mencionados son eficaces para la mayoría de las razas que atacan a los trigos cristalinos.En la última década se realizaron extensos esfuerzos en INIFAP y CIMMYT para mejorar la información y así la resistencia a la roya de la hoja. Varias de las fuentes de resistencia que se identificaron en el CIMMYT se han vuelto ineficaces debido a la detección de virulencia en el Noroeste de México con las nuevas razas de roya de la hoja que vencieron la resistencia de Altar C84, Atil C2001, Jupare C2001, Banamichi C2004, y recientemente la resistencia de CIRNO C2008 (Huerta-Espino et al., 2009;2017;Singh et al., 2004).Para reducir la vulnerabilidad del trigo cristalino a la roya de la hoja se ha hecho énfasis en encontrar una solución más duradera en el control de esta enfermedad, lo que incluye la identificación de nuevas fuentes de resistencia, especialmente en trigos introducidos de un centro de diversificación como lo es Etiopía (Hammer y Diederichsen 2009), y por lo tanto, parte fundamental de esta investigación.Aunque se han llevado a cabo varios estudios de herencia para determinar la base genética de la resistencia a la roya de la hoja en trigo cristalino (Gupta et al.,1995;Herrera-Foessel et al., 2005;Mariscal et al., 2007;Singh et al., 1993;Zhang y Knott, 1993), los resultados que se pueden obtener usando las razas actuales pueden ser diferentes si los genes identificados ya no son efectivos para las nuevas razas, de ahí la importancia de la identificación de nuevas fuentes de resistencia y de las pruebas de campo contra las razas actuales que provienen de trigos cristalinos.Mediante cruzas entre dos progenitores o por postulación, se ha determinado la presencia de diferentes genes de resistencia a la roya de la hoja en trigos cristalinos, como el Lr3 en el cultivar Storlom (Herrera-Foessel et al., 2007), o Lr14a identificado en Colosseo y Somateria (Soleiman et al., 2014); Lr10, Lr14b, Lr16, Lr17, Lr23, Lr27, Lr31 y otros genes que se han identificado en genotipos de trigo cristalinos (Huerta-Espino et al., 2011a), incluyendo el gen Lr72 presente en Altar C84 y Atil C2000 (Herrera-Foessel et al., 2014).Los estudios genéticos también reportaron la presencia del gen dominante LrCam, derivado de un trigo criollo de Etiopía, que es el que le confiere resistencia a la variedad Cirno C2008 y que ahora ya es inefectivo a la raza BBG/BP-Cirno que evolucionó de la preexistente BBG/BP (Huerta-Espino et al., 2017). Un gen dominante y un gen recesivo han sido reportados en el trigo invernal Elinia 48, mientras que en Mirlo 26 la resistencia fue atribuida a un gen recesivo. La progenie del entrecruzamiento de estos dos genotipos indicó que el gen recesivo fue común (Delgado-Sánchez et al., 2016).En otro estudio, en la cruza de CWI52345 con Altar C84 se identificó un gen dominante (Huerta et al., 2011b), al igual que en cuatro poblaciones derivadas de los progenitores Amria, Byblos, Geromtel_3 y Tunsyr_2 con el progenitor susceptible Atred #2 evaluados con la raza BBG/BP, donde se determinó que existe un gen dominante en Amria y Byblos localizado en el cromosoma 7BL, mientras que en Geromtel_3 y Tunsyr_2 el gen de resistencia se localizó en el cromosoma 6BS (Kthiri et al., 2018). Un gen dominante denominado Lr79 fue identificado en el genotipo australiano Aus26582 y localizado en el cromosoma 3BL (Qureshi et al., 2018), mientras que en el trigo cristalino PI 192051, criollo de Portugal, también se idéntico un gen dominante localizado en la región pericentromérica del cromosoma 4A (Aoun et al., 2019).La presencia de dos genes complementarios, como en el caso de Jupare C2001 (Herrrera-Foessel et al., 2005) y Banamichi C2004, (Huerta Espino et al., 2009) han sido reportados en Don Ricardo y Don Valentín (Soleiman et al., 2014); Syria 1740 y CMH82A.1062 (Mariscal et al., 2007).Los resultados del presente estudio coinciden con lo reportado por Gupta et al. (1995), quienes indicaron la presencia de dos genes dominantes presentes en la variedad PBW 34, temporalmente designados como Lrd1 y Lrd2, mientras que Lrd1 y Lrd3 estuvieron presentes en la variedad DWL 5023, y también con lo reportado por Kthiri et al. (2019) en la variedad Gaza, donde se identificó la presencia de dos genes con dominancia completa en respuesta a la inoculación con la raza BBG/BP, localizados en los cromosomas 6B y 6BL respectivamente.La presencia de tres genes no es lo más común, pero existen estudios, como lo reportado en la cruza de Jupare C2001 con Altar C84+Lr14a que mostró una segregación de 19:38:7 (familias homocigóticas resistentes: familias segregando: familias homocigóticas susceptibles), que corresponde a tres genes de resistencia, dos complementarios dominantes (Lr27+Lr31) provenientes Cuadro 3. Distribución y frecuencias relativas de las familias F 3 . de Jupare C2001 y uno dominante (Lr14a) proveniente de Altar+Lr14a (Huerta-Espino et al., 2010).Es necesario incorporar en las nuevas variedades de trigo cristalino los genes de resistencia a roya de la hoja que se identificaron en el presente estudio, considerando también las fuentes de resistencia de raza no especifica identificadas sólo después de la aparición de la raza que venció la resistencia de Altar C84 (Singh et al., 2004), entre las cuales están Playero, Planeta y Trile, donde la resistencia fue controlada por al menos tres genes heredados independientemente con efecto aditivo, mientras que en Piquero, Amic, Bergand, Tagua y Knipa la resistencia fue determinada por al menos dos genes con efectos aditivos (Herrera-Foessel et al., 2008) y recientemente la de Cirno C2008 (Huerta-Espino et al., 2017).Los resultados de este estudio indican la presencia de dos genes dominantes en cada uno de los progenitores evaluados, sin embargo; para demostrar si estos genes son comunes o diferentes entre sí e identificar cuáles son sus diferencias es necesario realizar las cruzas para la prueba de alelismo; por lo tanto, el análisis molecular ayudará a la localización de estos genes en el genoma del trigo cristalino.La resistencia que presentan los progenitores es de herencia simple y condicionada por dos genes independientes. El tipo de acción génica en todas las cruzas fue de dominancia completa. Los seis progenitores: WC-2, DW-K2, Oda, FR43, BDI63 y BDI12 pueden emplearse como fuente de resistencia a la roya de la hoja para la raza BBG/BP-Cirno y para las otras razas que preferentemente atacan trigos cristalinos existentes en México. Las fuentes de resistencia aquí identificadas proveen opciones adicionales para los programas de mejoramiento genético de trigos cristalinos."}

main/part_2/0145332239.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"61d0a6069b99d906287561c402d56029","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ac7cc055-3173-41fa-8f27-1925f13c08bb/retrieve","id":"1642106731"},"keywords":[],"sieverID":"7c01ec5f-a86f-4374-9053-318d7c9f13f5","content":"• The study gathered information available in the published and grey literature on safety of:dairy products and zoonoses from cattle in Tanzania pork and zoonoses from pigs in Uganda• Areas covered: prevalence, risk factors, control and impacts of a list of hazards in each value chain• What is the prevalence and relative importance of each of the selected hazards in people, pigs, pork, dairy cattle, dairy products and wildlife?• What type of impacts do each of the selected hazards have with respect to (i) economic burden/cost, (ii) DALYs, (iii) health, (iv) social and (v) environment?• What are risk factors for each of the selected hazards in each of the selected populations?• What are the available control strategies for each of the selected hazards and their effectiveness?• Four online databases were used: PubMed, CAB Direct, Web of Science and African Journals Online • Foodborne hazards are under-represented in published literature• Most papers cover prevalence and risk factor studies, very few cover control options and impact• Diverse research methods used and reporting is inconsistent; this makes it difficult to combine results• For the dairy value chain, most studies done at the farm and retailer levels; very few involve consumers• For the pork value chain, porcine cysticercosis is the most frequently studied foodborne hazard • For now, difficult to draw firm conclusions but the results show the range of pathogens present in the value chains studied • Systematic surveys required for comparative assessments"}

main/part_2/0147697112.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"7230c37b4b31944c04f4a0fa0afd16b1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f976cd70-3697-4564-943e-5f19ec5d36e7/retrieve","id":"1433226663"},"keywords":[],"sieverID":"e7e98658-ac93-4322-b8d4-92de4e7f8f6e","content":"Disclaimer: This document is intended to disseminate research and practices about production and utilization of roots, tubers and bananas and to encourage debate and exchange of ideas. The views expressed in the papers are those of the author(s) and do not necessarily reflect the official position of RTB, CGIAR or the publishing institution.1. Purpose: to provide actionable evidence on policy and investment options to accelerate seed system and market development in countries where vegetatively propagated crops (VPCs) are important to food security and agricultural development 2. Level: entire seed system (national level and key production areas for the selected crop) c. secondary data analysis, drawing on data related to seed use, sources, prices, and related information contained in existing household, farm, and market surveys, where available d. field visits using key informant interviews and focus group discussions with seed producers, traders in local markets where formal and common seed is traded, and researchers at experimental stations that produce seed e. workshops with key stakeholders in each country to validate and triangulate data and information collected and analyzed using the above methods 11. Which methods can be used in combination with the tool: literature review, document analysis, key informant interviews (KII), focus group discussion (FGD), stakeholder validation workshop 12. Gender: KII checklists specifically ask about gender differences regarding use and implications of regulations for VPC seed producers and users (gender responsiveness level 1: gender is a significant factor in this tool, but it is not the main reason for using it)"}

main/part_2/0158100985.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"c84ebdc0e4e4cf2c907812684316ee9f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/38a66639-2b56-40da-b3cf-a2ab1e4f86a3/retrieve","id":"-1759247293"},"keywords":[],"sieverID":"a7e18e49-9f75-470d-a9ee-3d2387eabc62","content":"• 5 fundamental dimensions for assessing adaptation progress: climate hazards, impacts, adaptive capacity, adaptation options, adaptation goals• Similarities in governmental and livestock keeper perspectives, but also notable differences:• Adaptation actions and outcomes across scales • Rich descriptions of progress (social, economic, institutional, ecological dimensions) • Contextual differentiation of progress (e.g., by livestock production system)Take home message/ conclusions• National contexts crucial for the design & sustained implementation of adaptation tracking• Need for a fit-for-context approach to designing adaptation tracking methods • Pay attention to contextual variations and areas of convergence → coproduction of adaptation tracking methods• Adaptation tracking as a promising space for theorizing and examining multi-scalar policy processes?• Clarifying the added-value • Evidence-based identification of \"causal matrix of variables\""}

main/part_2/0158580092.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"afbf488c04392fc14ee9605efbc38d52","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5ba6633f-0a10-45e6-b0fb-3d01c6f39256/retrieve","id":"-1784134039"},"keywords":[],"sieverID":"1cdbfa84-cb1a-4b87-9606-557c59c3b925","content":"The objectives of this training session are meant not only to teach and review aspects of hygiene, carcass handling and biosecurity practices along the smallholder pork value chain but also to inspire dialogue between course moderators/ instructors and participants supporting future improvement and growth in Uganda.The training takes place over two days, requiring approximately four-six hours a day.The course takes place at easily accessible local venues. Attendees are given an appropriate travel allowance to cover their daily travel costs.Breakfast/coffee/tea/water are provided, with a mid-morning snack, and lunch on day one. Name tags, pens and a small spiral bound notebook are provided for attendees. A round-trip transportation allowance is also provided for the attendees.Course moderators/instructors conduct a post-course follow-up visit and questionnaire to determine both the value and effectiveness of the training. The information obtained will is used to amend and strengthen future courses.Initial site visit and introduction to the district veterinary officer It is imperative that course moderators/instructors contact and visit the respective district veterinary officer (DVO) in the region in which the course is to be taught. Course moderators/instructors should be expected to introduce themselves, the project and the course formalities including topics, objectives, duration, the training module and the proposed location.Respective roles and responsibilities throughout the course should be presented and understood by all involved. Course moderators/instructors should engage the DVO to act and speak as a liaison between the course moderators/ instructors (the organization) and the people of his district throughout the course. Course moderators/instructors are strongly encouraged to keep good meeting records, list of attendees and maintain appropriate contact with the DVO from this point on.Course moderators/instructors should clearly establish the fact that they will need to closely collaborate with the DVO to engage attendees including local producers, butchers and traders, as well as to determine the venues for the course activities on day one and two. Visiting the district with the DVO may help to support your integrity, as well as provide an estimate of the size of venue, cost of food, beverages and travel allowance which will be provided to course participants. While visiting the district, a short assessment should be made to assess the potential audience and more importantly any specific area which may need particular attention.The DVO will also help determine the most appropriate slaughter slab for the practical exercise on day two. The day two exercise is intended to review the entire slaughter process. It would be best to find a slaughter slab with an associated pork joint to streamline the teaching/discussion as we follow the pork through the entire slaughter process. Be sure there is easy access and ample room for your group's size. A group which is too large may be find it challenging to hear and participate in course content.Day one is in a classroom setting comprising three individual rotating sections each chaired by an individual and approximately 40 minutes in length at a predetermined venue.The day one material is presented in three individual group sessions which include:• Section 1: Hygiene and sanitation at the slaughter slab • Section 2: Personal hygiene • Section 3: Hygiene at the pork joint and carcass handling Section 1: Hygiene and sanitation at the slaughter slab I.Introduction to hygiene and sanitation at the slaughter slabCourse moderator/instructor tips and talking points:• Introduce yourself and the project that you are working on• Mention that you enjoyed visiting the district, meeting them and learning about their operations• Mention that you would like talk about your experiences and perhaps make suggestions in areas which you were aware that improvements could be made• May need to work to really engage members of the group using names tags to involve attendees• Course moderators/instructors should focus on a particular area such as:• How do you recognize a sick pig?• Discuss recognizing a sick or compromised pig without knowing why the animal is sick Be sure to explain that there are some conditions which may be treated…and the value of working with their paraveterinarian in terms of treatment protocols Be sure to explain the value of the welfare of the animal. Sick animals may be in pain and require medical treatment. Sick animals do not grow as well• Use the illustrations in the publication to help present this visually. You may want to print out individual 'conditions' depicting a sick or compromised pig to make your point with the audience• Can they identify a sick animal?• Can they understand why it is not in their best interest to slaughter and eat a sick animal? a) Body (omubiri)- • Using the image and publication, describe healthy versu. unhealthy skin.• You may want to mention African swine fever lesions and other differential diagnoses d) Temperament (embeera)-• Similarly, using the images , describe how walking the pens and looking at the temperament of the animals can help you determine which animals may be ill.The slaughter slab (Webasalira embizzi)  IV. Stress these five points An attendance appreciation gift is also given to the attendees at the conclusion of day two and a sanitation/hygiene starter package including a basin, brush, bleach, hand soap, hand towel and scrub brush. The appropriate use of these items is to be thoroughly described within the individual break-out sessions on day one by in Sections 2 and 3. The value of each item will vary depending upon your available budget-our initial cost/gift was approximately X UGS .Notes for class moderators/instructors  "}

main/part_2/0183281131.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"b113c67496fd877d7002e78c2d57ee91","source":"gardian_index","url":"https://www.fao.org/3/cb1203fr/cb1203fr.pdf","id":"556248108"},"keywords":[],"sieverID":"2e2af803-c1c8-43ae-823e-a3a59a520beb","content":"Les appellations employées dans ce produit d'information et la présentation des données qui y figurent n'impliquent de la part de l'Organisation des Nations Unies pour l'alimentation et l'agriculture (FAO) aucune prise de position quant au statut juridique ou au stade de développement des pays, territoires, villes ou zones ou de leurs autorités, ni quant au tracé de leurs frontières ou limites. Le fait qu'une société ou qu'un produit manufacturé, breveté ou non, soit mentionné ne signifie pas que la FAO approuve ou recommande ladite société ou ledit produit de préférence à d'autres sociétés ou produits analogues qui ne sont pas cités.f Les autorités et les experts des secteurs forestier et agricole qui contribuent déjà à l'adaptation au changement climatique et à la formulation des PNA.Cette publication peut également être utilisée par les pays pour informer la préparation des projets d'adaptation tels que ceux qui seront financés par le Fonds vert pour le climat (FVC), y compris les projets de préparation et en particulier ceux qui entrent dans le cadre du fond de préparation FVC-PNA.Ces nouvelles directives ont vu le jour à l'issue d'un processus consultatif auquel ont participé des experts de pays, d'agences internationales et d'organismes de recherche, ainsi que le secrétariat de la CCNUCC et le LEG. Les directives s'appuient sur les enseignements tirés dans les pays et de ceux issus du programme «Intégrer l'agriculture dans les plans d'adaptation nationaux» (PNA-Ag), programme codirigé par la FAO et le Programme des Nations Unies pour le développement (PNUD).Ce programme a pour objectif de répondre aux besoins d'adaptation au changement climatique dans le secteur agricole en intégrant la question de l'adaptation dans les processus nationaux de planification et de budgétisation des 11 pays partenaires.Dans le cadre de l'adoption de l'Agenda 2030 des objectifs de développement durable et de l'accord de Paris, la communauté internationale s'est fixée des objectifs collectifs ambitieux. L'utilisation des terres est la pierre angulaire de toutes ces ambitions, en particulier pour ce qui est des engagements pris par les pays et qui sont énoncés dans leurs CDN. En raison de leur rôle important dans l'atténuation, l'adaptation, la gestion durable des ressources naturelles et la sécurité alimentaire, les forêts et les arbres sont au coeur de cette approche intégrée. Nous espérons que cette publication aidera les pays et les autres parties prenantes à intégrer et à hiérarchiser ces objectifs dans le cadre de l'adaptation au changement climatique et des autres processus de planification pertinents.Les discussions sur la question des forêts et des arbres dans le contexte du changement climatique ont longtemps porté principalement sur leur potentiel d'atténuation. Cependant, le potentiel d'atténuation des forêts et des arbres dépend également de leur capacité à s'adapter au changement climatique et à la pression humaine accrue sur les ressources qu'ils fournissent. En outre, les forêts et les arbres jouent un rôle crucial dans la résilience des paysages et des populations ainsi que dans leur capacité à s'adapter au changement climatique. Le processus des plans d'adaptation nationaux (PNA) offre une opportunité de mieux intégrer ces rôles dans les stratégies et les politiques nationales.La contribution des forêts et des arbres aussi bien à l'adaptation qu'à l'atténuation est associée à, et dépend de, nombreuses politiques sectorielles qui orientent l'utilisation des terres et de l'eau, notamment celles qui concernent l'aménagement du territoire, la gestion de l'eau, l'énergie, le bâtiment et l'agriculture. Puisque le PNA concerne l'ensemble de l'économie, il donne l'occasion d'examiner les interactions entre tous les secteurs économiques de manière coordonnée et cohérente. En fait, pour arriver á une adaptation efficace, il est nécessaire d'intégrer ces interactions et d'en tirer des enseignements pour la planification et la mise en oeuvre. L'objectif de cette publication est de faciliter l'intégration des forêts, des arbres et de l'agroforesterie dans un tel processus. Les objectifs du processus des PNA, convenus lors de la COP 17 (décision 5/CP.17), sont les suivants: i) réduire la vulnérabilité aux effets du changement climatique en renforçant la capacité d'adaptation et la résilience; et ii) faciliter une intégration cohérente de l'adaptation au changement climatique, aux politiques, programmes et activités pertinents, nouveaux et existants, en particulier aux processus et stratégies de planification du développement, dans tous les secteurs concernés et à différents niveaux, le cas échéant.La décision 5/CP.17 énumère les principes directeurs du processus d'élaboration des PNA, à savoir:f un processus de planification continu au niveau national avec des mises à jour et des résultats itératifs;f qui est la propriété du pays, qui est dirigé par le pays;f qui n'est pas normatif, mais flexible et basé sur les besoins des pays;f qui s'appuie sur les efforts d'adaptation existants et évite de les dupliquer;f qui est participatif et transparent;f qui renforce la cohérence de la planification de l'adaptation et du développement;f qui est soutenu par une surveillance et un examen complet;f qui tient compte des groupes, des communautés et des écosystèmes vulnérables;Ciel jaunâtre -Tourbière en feu. Approche de régénération naturelle assistée à la restauration forestière dans les Philippines. Exemple de processus de formulation et de mise en oeuvre d'un PNA Source: LEG, 2012 f qui est guidé par les meilleures données scientifiques disponibles;f qui prend en compte les connaissances traditionnelles et indigènes;f qui est sensible au genre.Les premières directives pour la formulation des PNA figurent dans l'annexe de la décision 5/CP.17. Elles sont complétées par les directives techniques pour le processus d'élaboration des PN , qui ont été élaborées par le Groupe d'experts des pays les moins avancés en réponse au paragraphe 15 de la décision 5/CP.17 et sont disponibles en plusieurs langues 1 . Ces directives techniques constituent labase de la formulation et de la mise en oeuvre des PNA (voir figure 1). Par conséquent, l'accord intègre sa contribution au développement durable dans le cadre de l'objectif d'adaptation. La plupart des pays qui ont intégré une composante d'adaptation dans leur contribution nationale déterminée (CND) 3 , ont également défini un objectif ou une vision à long terme pour l'orienter (CCNUCC, 2015). Ces objectifs sont étroitement liés aux objectifs de développement tels que l'éradication de la pauvreté, le développement économique ou l'amélioration du niveau de vie, de la sécurité et des droits de l'homme; et dans certains cas, ils mentionnent explicitement les objectifs de développement durable (ODD). Plusieurs pays en développement ont mentionné l'objectif d'être un pays émergent avec une économie à revenu moyen d'ici 2030. Par exemple, la CND de l'Éthiopie combine des objectifs ambitieux de développement, d'atténuation et d'adaptation en donnant une place centrale aux secteurs de l'agriculture, y compris la protection et le rétablissement des forêts pour leurs services économiques et écosystémiques afin d'arriver à plus de 7 millions d'hectares boisés ou reboisés.Ces objectifs et buts de développement sont susceptibles d'orienter la préparation des PNA correspondants. En fait, comme le PNA est un vaste processus national orienté vers l'avenir, il doit tenir compte des objectifs nationaux à moyen et long terme. Contrairement aux programme d'action national aux fins de l'adaptation (PANA) qui répondent aux besoins les plus urgents des PMA, les PNA s'inscrivent sur le long terme et doivent donc prendre en considération l'adaptation d'un pays qui est lui-même en évolution.Pour ces raisons, et également compte tenu des liens intrinsèques entre l'adaptation et la réalisation des objectifs de développement durable, le groupe d'experts invite les pays à adopter un cadre intégrateur pour les plans d'adaptation nationaux et les objectifs de développement durable, l'iFrame PNA-ODD, afin de faciliter l'intégration des approches et l'examen explicite de la manière de contribuer à la réalisation des objectifs de développement durable par le biais des PNA (CCNUCC, 2017).Le LEG note que les approches systémiques intégratives sont utiles pour aborder la cohérence et la synergie des mesures d'adaptation à de multiples échelles et niveaux, y compris dans le temps, en tenant compte d'autres cadres pertinents tels que les ODD et le Cadre de Sendai pour la réduction des risques de catastrophe 2015-2030(CCNUCC, 2018)). Une approche systémique de l'adaptation peut grandement faciliter et renforcer l'intégration de la foresterie dans les PNA, en tirant parti de son potentiel de changement transformationnel. Les forêts et autres formations arborées doivent elles-mêmes être appréhendées comme des systèmes.Les forêts et les arbres sont étroitement liés et souvent intégrés à d'autres systèmes agricoles. Par les services écosystémiques qu'elles fournissent, les forêts sont également liées à plusieurs autres grands systèmes: biodiversité, eau, production d'énergie, établissements humains, pour reprendre les thèmes identifiés par les pays eux-mêmes (voir section 3.4).Compte tenu des relations profondes qui existent entre les forêts, les arbres et les autres systèmes, l'adoption d'une approche systémique de l'adaptation permet une prise en compte plus efficace des contributions des forêts et Le dialogue a également souligné l'importance des aspects sociaux et économiques de la production laitière. Dans l'ensemble, les participants ont estimé qu'il était nécessaire de développer des systèmes de production qui attirent les jeunes générations dans les exploitations. Cela va des systèmes automatisés qui prévoient du temps pour le repos et les loisirs, à la nécessité de mettre en place des instruments financiers, une assurance contre les risques climatiques et des fonds pour aider à atténuer l'effet des fluctuations de prix et de l'augmentation des coûts de production liés aux événements climatiques extrêmes.Le dialogue sur l'adaptation des forêts a été organisé avec le soutien de l'Association uruguayenne des producteurs forestiers (Sociedad de productores forestales). Définitions utilisées pour les évaluations des ressources forestières de la FAO«Terrain de plus de 0,5 hectare avec des arbres de plus de 5 mètres de haut et un couvert végétal de plus de 10 pour cent, ou avec des arbres capables d'atteindre ces seuils in situ. Elle n'inclut pas les terres qui sont principalement utilisées à des fins agricoles ou urbaines».Parmi les forêts, la FAO distingue à nouveau trois catégories:• La forêt primaire: «Forêt naturellement régénérée d'espèces indigènes, où il n'y a pas d'indications clairement visibles d'activités humaines et où les processus écologiques ne sont pas sensiblement perturbés».• Les autres forêts naturellement régénérées: «Forêt naturellement régénérée où il y a des indications clairement visibles d'activités humaines».• Les forêts plantées: «Forêts composées principalement d'arbres établis par plantation et/ou ensemencement délibéré». Cette catégorie comprend les «plantations», définies comme des «Forêts plantées qui sont gérées de manière intensive et qui répondent à TOUS les critères suivants au moment de la plantation et de la maturité des arbres: une ou deux espèces, une classe d'âge homogène et un espacement régulier. Sont spécifiquement exclues: les forêts plantées à des fins de protection ou de restauration de l'écosystème».«Terrain non défini comme «forêt», d'une superficie supérieure à 0,5 hectare, avec des arbres de plus de 5 mètres de haut et un couvert végétal de 5 à 10 pour cent, ou avec des arbres capables d'atteindre ces seuils, ou encore avec un couvert combiné d'arbustes, de buissons et d'arbres supérieur à 10 pour cent. Elles n'incluent pas les terres qui sont principalement utilisées à des fins agricoles ou urbaines».«Terres considérées comme «Autres terres», qui sont principalement utilisées à des fins agricoles ou urbaines et qui présentent des parcelles de plus de 0,5 hectare avec un couvert végétal de plus de 10 pour cent d'arbres pouvant atteindre une hauteur de 5 mètres à maturité. * Plus de détails/explications sur les définitions peuvent être trouvés dans FAO (2018cFAO ( , 2018d)). Les paysages en mosaïque avec des arbres et des fragments de forêt fournissent divers services écosystémiques, notamment des services de régulation du cycle de l'eau, de pollinisation et de lutte contre les parasites (Ricketts, 2004;Ricketts et al., 2008;Holzschuch et al., 2010) et, selon leur répartition, ils peuvent contribuer à la connectivité des zones forestières, réduisant ainsi l'impact de la fragmentation qui peut affecter la santé de la forêt et induire une perte de biodiversité (Bogaert et al., 2011). En outre, la fragmentation et la faible connectivité des parcelles forestières affectent la capacité des pollinisateurs, des ennemis naturels des parasites, de l'eau et des nutriments à se déplacer dans un paysage (Vira et al., 2015).  (Pramova et al., 2012).Les arbres contribuent à une diversification des sources de nourriture et de revenus qui peut aider à amortir les chocs économiques induits par le changement climatique. En outre, des systèmes diversifiés sont susceptibles de fournir une plus grande résilience à une volatilité accrue de l'approvisionnement et des prix des denrées alimentaires (Vira et al., 2015), qu'elle soit liée au climat ou non. Dans de nombreuses communautés, les aliments forestiers (y compris le gibier sauvage) sont utilisés comme filet de sécurité pendant la période de soudure ou de famine ou en cas de mauvaises récoltes (Blackie et al., 2014;Keller et al., 2006;Shackleton et Shackleton, 2004;Sunderland et al., 2013;Karjalainen et al., 2010, Koffi et al., 2017) f la collecte de données et d'informations pour évaluer l'importance de la foresterie et de l'agroforesterie (y compris les cultures arboricoles), en tant que secteur économique, en tant que moyen d'existence pour une partie de la population et en tant que fournisseur d'autres services écosystémiques;f un examen des institutions, des politiques et des mesures qui ont des répercussions sur la foresterie et l'agroforesterie, dans les domaines de la Foresterie, de l'agriculture, de la pêche ainsi que dans d'autres secteurs connexes tels que la gestion de l'eau, l'aménagement du territoire et l'énergie;f les principaux points de la CND relatifs à la contribution des forêts et des arbres à l'atténuation et à l'adaptation, y compris la restauration, le boisement, la réduction de la déforestation;f les autres engagements connexes, tels que les engagements de restauration;f un examen des évaluations existantes de la vulnérabilité et des risques pour les forêts et les arbres;f l'identification des stratégies, politiques, plans et investissements qui auront une influence sur le secteur forestier, y compris par exemple les stratégies d'aménagement du territoire, l'agriculture et les objectifs de sécurité alimentaire;f les perspectives d'évolution, y compris une projection des vecteurs potentiels de changement;f l'identification des principales lacunes en matière de connaissances;f l'identification des lacunes et des capacités institutionnelles.Cette étape devrait avoir une portée nationale et, au besoin, se concentrer sur des zones géographiques, des forêts, des productions Les impacts/risques du changement climatique pour les forêts, les arbres et l'agroforesterie, ainsi que pour les personnes qui en dépendent, ont-ils été évalués?Existe-t-il des évaluations de la vulnérabilité des forêts et des populations qui en dépendent?Des outils d'analyse tels que l'évaluation de la vulnérabilité et des risques, l'analyse de scénarios, l'analyse coûts-bénéfices sont-ils utilisés pour comprendre les besoins d'adaptation du secteur?Ces analyses prennent-elles en compte les sous-secteurs, la diversité des acteurs (petite échelle, grande échelle), les zones géographiques (provinces/districts, communauté, national) et les écosystèmes?Les résultats de ces analyses sont-ils pris en compte dans la planification et l'élaboration des politiques?Des options d'adaptation appropriées ont-elles été identifiées pour les forêts et les systèmes arboricoles?État de préparation du secteur de la pêche et de l'aquaculture en matière de financement, de suivi et de communication dans le cadre du PNA Existe-t-il entre le secteur forestier et les autres secteurs de l'économie un cadre commun de financement de l'adaptation au changement climatique ?Les coûts de l'adaptation pour le secteur ont-ils été évalués? Qu'est-ce qui ressort de leur comparaison avec (i) la valeur du secteur, (ii) le budget de développement du secteur (iii) le budget alloué par le secteur á la question de l'adaptation? Analyse sommaire de l'évaluation des besoins en capacités au sein de l'Autorité nationale de gestion de la sécheresse du Kenya Un autre aspect important de la recherche est de savoir dans quelle mesure le secteur forestier a été impliqué dans la planification et les efforts d'adaptation au climat et comment cela peut être capitalisé.Les questions suivantes peuvent étayer cette analyse:✔ Le pays dispose-t-il d'un PANA ou d'un autre document/d'une autre stratégie national/e de planification de l'adaptation 5 ?f Si oui, cela inclut-il la foresterie?f Comment le secteur a-t-il été inclus dans son élaboration?f S'il n'a pas été inclus, à quelles contraintes s'est-il heurté?f Quels étaient les principaux acteurs non gouvernementaux impliqués dans ce processus (institutions de recherche, secteur privé, ONG)?f Quels sont les résultats du PANA en ce qui concerne l'adaptation des forêts et des systèmes arboricoles au changement climatique?f Quel est l'impact du plan d'adaptation existant sur le développement du secteur forestier?f Existe-t-il des exemples de plans ou de stratégies infranationaux et comment le secteur forestier est-il couvert?✔ Le secteur forestier est-il officiellement engagé dans le processus de formulation et de mise en oeuvre du PNA du pays?f Si oui, comment et dans quelle mesure? (mécanismes de mobilisation, contributions à ce jour, etc.)f Quelles sont les parties prenantes impliquées (recherche, secteur privé, ONG)?f Comment les communautés locales, les petits exploitants sont-ils associés?f Si ce n'est pas le cas, comment y remédier?✔ Le secteur a-t-il pris part à des discussions, plans ou stratégies sur le changement climatique f Si oui, qu'en est-il ressorti et comment peuton aller plus loin? Si non, pourquoi?f Des mécanismes de consultation sont-ils en place?f L'adaptation au changement climatique dans le secteur forestier est-elle spécifiquement mentionnée dans l'un des documents stratégiques du pays?✔ Les politiques, stratégies et plans de développement forestier passés et actuels tiennent-ils compte des facteurs de changement climatique?f Comment le pfn du pays prend-t-il en compte la question du changement climatique?f Savons-nous ce qui est nécessaire, de quoi s'agit-il?f Comment ces programmes affectent-ils le secteur?f Quelle est leur pertinence?f Pourraient-ils être intégrés dans le PNA tels quels ou après révision ou validation?f Si non, pourquoi? et pourrait-on (ou devraiton) les modifier?Les objectifs de cette étape sont les suivants:f Identifier les points d'entrée, y compris le pfn du pays pour engager les forêts, les arbres et l'agroforesterie dans le PNA.f Comprendre les possibilités existantes pour la foresterie de s'engager dans le processus de formulation et de mise en oeuvre du PNA.f Identifier les lacunes politiques et organisationnelles à combler pour soutenir la planification de l'adaptation au sein du secteur forestier, notamment par le biais du pfn, et faciliter la participation du secteur à une planification plus large et intersectorielle de l'adaptation au changement climatique.f Identifier un point focal, une unité ou une équipe spéciale ou tout autre mécanisme ou organe officiellement reconnu chargé de diriger l'intégration des forêts, des arbres et de l'agroforesterie au cours du processus de formulation et de mise en oeuvre du PNA.f Identifier les lacunes en matière de compétences et définir une stratégie pour les combler.  (Bee, 2016). Au niveau mondial, on observe une différenciation significative entre les sexes en ce qui concerne la collecte des produits forestiers, avec d'importantes différences régionales (Sunderland et al., 2014). Ces différences de connaissances et de rôles contribuent à des capacités et des stratégies d'adaptation différenciées face à une base de ressources naturelles en évolution (Djoudi et Brockhaus, 2011).Les inégalités entre les sexes et les normes limitant l'accès et le contrôle des femmes sur les ressources, telles que la terre, le capital et les services techniques, peuvent entraver leur capacité à relever les défis du changement climatique (Brody et al., 2008;Lambrou et Piana, 2006;Rodenberg, 2009). Pour ces raisons, les vulnérabilités spécifiques doivent être pleinement intégrées dans le processus du PNA (voir l'exemple de l'Ouganda dans l'encadré 8).E NC A DR É 8 .Un processus de PNA pour l'agriculture sensible au genre en Ouganda Changement des précipitations de la neige à la pluie.Modification du débit des rivières; plus grande variabilité des débits.Inondations. «Vidage» des zones de frai des poissons.Montée du niveau de la mer.Modification du profil des rivières, en particulier près de la mer.Expansion des zones à risque d'inondation.Mettre en place une stratégie de protection des forêts.Villes, installations humaines, infrastructures Gérer correctement l'interface forêtzone urbaine afin de minimiser le risque d'incendie de forêt.Dans son PNA pour les secteurs agricoles, l'Ouganda accorde une importance particulière au rôle de la foresterie dans l'adaptation de tous les secteurs agricoles (voir encadré 9).E NC A DR É 9.La foresterie dans le PNA de l'agriculture de l'Ouganda Réduction des revenus forestiers; réduction des services écosystémiques forestiers.Mettre en oeuvre et intensifier les mesures de mesures de gestion des ravageurs et des maladies; adapter les pratiques sylvicoles.Pertes de vies humaines; dommages aux infrastructures; réduction des revenus forestiers et des services écosystémiques; pertes de faune et de flore.Mettre en oeuvre et intensifier la gestion des incendies de forêt en adaptant les pratiques sylvicoles.Dommages aux forêts et aux infrastructures (villes, routes, barrages); réduction de la qualité de l'eau.Entreprendre des mesures de gestion des bassins versants (y compris la protection et l'augmentation de la couverture végétale: réduction de l'intensité de la récolte et des autres utilisations).Réduction de la disponibilité des produits forestiers.Augmentation des dommages causés par le vent; réduction des valeurs de pâturage.Planter des brise-vent; maintenir le couvert des arbres; modifier la composition des espèces et des variétés.Réduction des revenus forestiers et des services écosystémiques; risque accru de parasites et de maladies.Changement d'espèces et adaptation de la taille des arbres pour réduire les risques; récolte de sauvetage; lutte contre les parasites et les maladies.Exposition accrue des terres aux dommages causés par les tempêtes; réduction de la productivité des pêcheries côtières.Accroître la protection, la restauration et et la mise en valeur des mangroves et autres forêts côtières.Réduction des fonctions des écosystèmes forestiers; perte de la biodiversité forestière.Restaurer/accroître la connectivité des forêts et des corridors de la faune sauvage; favoriser la migration; prendre des mesures de conservation ex-situ.Source: FAO, 2016a  2007).Vulnérabilité: la propensión o predisposición a verse adversamente afectados; en función de los posibles impactos (exposición y sensibilidad a la exposición) y la capacidad adaptativa (FAO, 2014b).Annexe 2. Liste de contrôle des éléments de l'inventaireCette liste de contrôle vise à faciliter l'inventaire (voir section 5.1). Elle a été préparée dans le cadre du programme PNA -Ag et adaptée à la foresterie et à l'agroforesterie, en respectant sa structure globale pour faciliter l'intégration de la foresterie aux autres sous-secteurs de l'agriculture (cultures, élevage, pêche et aquaculture).  Ici, il est question de l'analyse d'autres évaluations d'options d'adaptation au changement climatique liées à la foresterie et à l'agroforesterie, y compris les analyses coûts-avantages existantes, les analyses multicritères, les évaluations d'impact ainsi que la portée actuelle de ces travaux.Analyse de l'existence de systèmes de suivi, de mesure et de rapport sur l'impact des interventions.b. Analyse des capacités des parties prenantes et des institutions dans le domaine de la foresterie et de l'agroforesterieCeci est lié au point A.2c. Il s'agit des évaluations des capacités et des lacunes institutionnelles.Liste et analyse des évaluations des capacités institutionnelles, des besoins et des insuffisances au sein de la foresterie et de l'agroforesterie et des institutions de planification, de financement et de budgétisation de l'adaptation au changement climatique dans les secteurs de la foresterie et de l'agroforesterie.Liste et analyse des projets/rapports d'évaluation des compétences liés à la planification et à la budgétisation de l'adaptation au changement climatique dans le domaine de la foresterie et de l'agroforesterie, y compris les compétences en matière de hiérarchisation des options d'adaptation, d'évaluation de l'impact, de planification de l'adaptation tenant compte des questions de genre, et de suivi et d'évaluation des projets d'adaptation dans le domaine de la foresterie et de l'agroforesterie.Résumé des défis et des opportunités d'intégration de la foresterie et de l'agroforesterie dans le processus du PNA en [pays], y compris les barrières institutionnelles, les défis de coordination et de ressources (données, financement, capacité), sur la base de la section 3.Résumé des principales possibilités de renforcement des capacités et de développement, y compris les liens institutionnels.Feuille de route pour la planification de l'adaptation: des Insuffisances à la mise en oeuvre des activités.Selon le casAnnexe 3: Outils de connaissance Le processus de priorisation des options d'adaptation qui ont été identifiées peut prendre plusieurs formes. Le processus de priorisation suggéré ici commence par une évaluation générale de toutes les options d'adaptation pré-identifiées. Ensuite, il passe à une présélection des «top x» options d'adaptation les plus appropriées en fonction de leur adéquation, de leur impact, des avantages pour les moyens d'existence et les écosystèmes, de leur accessibilité et de la capacité à les mettre en oeuvre. Il se termine par une analyse plus fine de chaque option présélectionnée sur la base de critères plus spécifiques afin de déterminer ce qui doit être choisi et retenu. -Les résultats changent au fur et à mesure que de nouvelles options sont envisagées.-Elle devient compliquée si de nombreux critères et options sont pris en compte.-Une échelle subjective peut conduire à des erreurs.-Le renforcement des capacités transdisciplinaires peut être sapé aux dépens de l'opportunité.-Les logiciels peuvent dissimuler des jugements de valeur contradictoires.-Les informations qualitatives ou quantitatives sur le changement climatique.-L'efficacité à travers l'apport des experts ou la consultation des acteurs.Source: Watkiss et Hunt, 2013. Les tableaux synthétiques peuvent prendre plusieurs formes. En définitive, ils refléteront les caractéristiques (ou critères) qui ont été mises en avant ou qui ont été jugées essentielles au cours du processus de priorisation. Par exemple, le tableau 4 met l'accent sur les coûts et bénéfices estimés (ceux-ci ne doivent pas nécessairement être monétisés dans le tableau synthétique mais peuvent être considérés comme ayant une valeur élevée, moyenne ou faible. Une option alternative serait de mettre l'accent sur les acteurs responsables de la mise en oeuvre et sur les différentes périodes d'action. Il peut également illustrer le nombre important de mesures d'adaptation qui ont été envisagées et le caractère «onéreux» de chaque mesure (Garrett et al., 2015).  "}

main/part_2/0225537357.json

@@ -0,0 +1 @@
+{"metadata":null,"keywords":null,"sieverID":"2b1c2798-423c-4257-a7a1-45bc56348c1f","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}

main/part_2/0229911179.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"2e08e4dbcefdb0334f6d2c6b2b9fcab4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1b5baf10-e27d-4817-a764-a9e9319b0a23/retrieve","id":"1350920028"},"keywords":[],"sieverID":"956c6322-4b85-4ff1-962a-14b21b27d9f2","content":"This document series compiles key indicators from the three levels of the baseline for each site. Indicators include: demography and basic site characteristics of each site, rainfall distribution, changes in farming practices and land management, income sources, food security and food sources, asset ownership by households and involvement in organisations and more.This CCAFS baseline indicator document was developed for the CCAFS site at Haryana/Karnal in India.  Relative importance in the portfolio of organisations placed on climate or weather related activitiesOrganisational priorities"}

main/part_2/0250052809.json

@@ -0,0 +1 @@
+{"metadata":null,"keywords":null,"sieverID":"28e86812-5f4f-46fa-97ba-9b5d88274a84","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}

main/part_2/0270800727.json

@@ -0,0 +1 @@
+{"metadata":null,"keywords":null,"sieverID":"d5a18c54-b9d5-49ba-b640-67cf9959ffcf","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}

main/part_2/0292776676.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"83a1629889be9ced8b082941c3dd77ed","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/41c923f8-1225-4ea6-b473-b77aa765c0aa/retrieve","id":"-975836220"},"keywords":[],"sieverID":"37f15b54-3fb1-44dd-acd9-efb2afa0c413","content":"• The State of Food Security and Nutrition in the World 2020 (FAO):• 47.5% of Kenyans cannot afford a nutrient adequate diet How can we re-imagine, co-create and implement agri-food systems that deliver food and livelihoods on the ground, while ensuring that agriculture is a net positive contributor to staying within planetary boundaries?What is Nature Positive Agriculture?• According to the UN Food System Summit, Nature Positive Agriculture is characterized by a regenerative, non-depleting and nondestructive use of natural resources.• It is based on stewardship of the environment and biodiversity as the foundation of critical ecosystem services, including carbon sequestration and soil, water, and climate regulation.• Nature Positive Food Systems refer to protection, sustainable management and restoration of productive system.• Finally, nature positive food systems cover the growing demand for food in a sufficient way and include sustainable and healthy nutrition."}

main/part_2/0294348094.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"9b1baf545941bc747da192344d33cb2a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d79acd78-659c-4e2e-beae-9f2214f19f2d/retrieve","id":"271477684"},"keywords":[],"sieverID":"ac6ef8aa-f3a3-45fa-8831-ede636e7f042","content":"Cookies are a popular snack worldwide, but the presence of gluten in most wheat-based cookies poses problems for people with gluten intolerance. Furthermore, gluten-free products are often deficient in nutraceuticals. This study investigated the potential of two traditional Indian rice landraces, Kalanamak and Chak-hao, as alternative cereals for producing whole grain gluten-free cookies with enriched bioactive compounds. The study also evaluated the influence of whole grain rice flours (WGRFs) and different sweeteners on the physical and biochemical properties of the cookies. The substitution of refined wheat flour with WGRFs significantly affected the physical and chemical properties of the cookies. WGRF cookies were generally crispier and had a lower spread ratio resulting in higher sensory evaluation scores. The added health benefits of WGRF derived cookies are likely due to the inherently higher levels of bioactive compounds such as quercetin equivalents with higher hydrogen peroxide scavenging (HPS) capacity and antioxidant activity derived from 2,2-diphenyl-1-picrylhydrazyl (DPPH) in Chak-hao rice and jaggery. This work shows that WGRFs from Kalanamak and Chak-hao could be viable alternatives to refined wheat flour for producing gluten-free cookies with enhanced nutraceutical benefits.Rice (Oryza sativa L.) has been a fundamental part of the human diet for thousands of years and has played a significant role in the green revolution to achieve food security in Asia. However, the milling process removes the outer bran and embryo, which results in white rice grain with a high glycemic index and reduced nutrient content (Anacleto et al., 2019). In contrast, brown rice is an unpolished whole grain that contains more dietary fiber, amino acids, phytosterols, phenolics, and bioactive compounds compared to white rice (Brotman et al., 2021;Tiozon et al., 2021). Additionally, pigmented rice varieties, such as red rice, black rice, and purple rice, have been found to be even more nutrient-dense than brown rice due to their enriched antioxidant properties (Itagi et al., 2023;Mbanjo et al., 2020). Kalanamak, which gets its name from the black husk (kala) and salt (namak), is a prominent landrace from Uttar Pradesh. Chak-hao, a black rice accession, is a fragrant variety of sticky rice, which derives its name from its delicious taste (Kowsalya et al., 2022). Both of these landraces are widely cultivated in geographical indicator regions. Our previous research has shown that popped rice made from these landraces retain high levels of phytochemicals and antioxidants, making them not just flavorful, but also nutritious (Itagi et al., 2023). Due to changes in lifestyle and socioeconomic conditions and increased awareness of their nutritional benefits, pigmented rice, as a stand-alone food product or as an ingredient in food products, has attracted increased attention in recent years (Itagi et al., 2023;Kasote et al., 2021). Therefore, the deployment of geographical indicator (GI)-tagged rice landraces can help in the development of additional rice food products with unique and desirable traits to diversify the consumer demands.A considerable proportion of the world population exhibits intolerance and sensitivity to gluten, which is an integral component of grains belonging to the Triticeae tribe such as wheat, rye, barley, and oats. The development of a gluten-free (GF) diet to cater for people with gluten intolerance and celiac disease has been undertaken by studying alternative starch sources from grain outside of the tribe Triticeae (Vici et al., 2016). Due to the increased prevalence of gluten intolerance and celiac disease, the market for GF foods are projected to reach almost $24 billion by 2027 (Aguiar et al., 2023). It is well known that rice is extensively used to make GF foods, but most of these prior studies used refined white sugar and commercial rice flour normally made from polished rice, which is rich in starch and lacks nutrients (Paz et al., 2020). Because of this, GF diets usually lack adequate levels of essential nutrients, including micronutrients and bioactives, which can have a number of negative health implications. To ensure that people receive the best dietary intervention, it is crucial to develop GF food products derived from whole grain of nutritious rice varieties or landraces and assess the nutritional value of foods that fall within this diet group (Vici et al., 2016).Functional foods and nutraceuticals, that offer benefits beyond meeting caloric requirements, are becoming more and more familiar to consumers. Cookies are a widely consumed snack that is crunchy and sweet, which are either baked or fried. In general, cookies are handy and have a long shelf life and these are created from a blend of ingredients including flour, sugar, eggs, and fats (Giuberti et al., 2017). Jaggery is a natural sweetener that is popular in India due to its perceived health advantages, wherein the majority of the vitamins and minerals present in sugarcane are retained. Hence substituting white sugar with sweeteners like brown sugar and jaggery in cookies offer extra functionality and health advantages (Iqbal et al., 2017).Despite vast research on the role of rice in a GF diet, traditional whole-grain Indian rice landraces have not been fully investigated to test its potential to develop GF-free functional foods and cookies. Additionally, little information is known about the physicochemical, functional, and nutritional qualities of landraces when they are added to food matrices. The goal of the current work was to create formulations of novel, functional, nutraceutical-rich, gluten-free whole grain rice flour for making cookies using two well-known, GI-tagged, aromatic Indian rice landraces (Kalanamak from Uttar Pradesh and Chak-hao from Manipur) and raw sugarcane products (jaggery and brown sugar). Cookies made as a result were examined for their physical and chemical properties, nutritional content, nutraceuticals, and sensory qualities. The findings of this study will offer useful knowledge for manufacturing GF high-quality convenience snacks from Indian rice landraces that are nutrient-dense and palatable.Popular GI-tagged landraces Chak-hao (black aromatic waxy rice) and Kalanamak aromatic rice (non-pigmented) were cultivated under well-maintained irrigated conditions during the monsoon season of 2021 at the International Rice Research Institute South Asia Regional Centre (ISARC) experimental farm in Varanasi, Uttar Pradesh. Paddies were dehusked, milled and prepared rice flour according to Itagi et al. (2023). The refined wheat flour (RWF), salted butter, white sugar, brown sugar, and jaggery available in local standard brands were purchased from the local market (Varanasi, India).The Paddy Osaw Industrial Products,Pvt. Ltd.,Indosaw,Ambala,Haryana,India) was used to de-hull around 1 kg of paddy. Rubber rollers had to be adjusted in order to produce dehulled whole grain rice.Grain that had been dehulled was washed and dried. The dehulled rice grains from the Kalanamak and Chak-hao varieties were processed in a laboratory mill (UDY Corporation, Cyclone Sample Mill, Screen-0.25 mm, Fort Collins, Colorado, USA) to make rice flour and sieved to a particle size of about 1 mm. The rice flour samples were stored in airtight containers in a refrigerator (4 • C), before being subjected to product formulations.Analytical grade reagents were utilized to measure nutritional components. The National Institute of Standards and Technology (NIST®) (Gaithersburg, MD, USA) provided the standard reference material (rice flour, 1568 b). Methanol and hexane of HPLC grade were procured from Fisher Scientific Co. in India. Takadiastase, DPPH (1,1diphenyl-2-picrylhydrazyl radical), and Folin-Ciocalteu (FC) reagent were provided by Parke, Davis and Co., Ltd. in the United States and SRL (Sisco Research Laboratories Pvt. Ltd., India), respectively. Merck, India, provided the sodium hydroxide, other reagents, solvents, and standards for fatty acids, vitamins, and minerals. All aqueous solutions were prepared using ultrapure water (Milli-Q water purification system, LAB Q Ultra, India).Cookies were prepared following the Approved Method 10-50D (AACC, 2000) with slight modifications on ingredients: RWF (control) and WGRF (from Kalanamak or Black rice) (100 g), salted butter (65 g), water (12-14 mL), sweetener (white sugar, brown sugar or jaggery) (50 g/100 g) and chopped cashew nuts as toppings (2 g/100 g). The creaming process of the salted butter and powdered sweetener was carried out in a planetary mixer (Berjaya laboratory in Kuala Lumpur, Malaysia). Subsequently, flour and water were added to the mixture. The cookie batter was portioned using a standard tablespoon and manually shaped into circular forms. The baking process was conducted in a commercial baking oven (Arise Equipments, New Delhi, India) that had been preheated to a temperature of 180 • C, for 18-20 min. After cooling for 30 min at ambient temperature, the cookies were subsequently transferred to an airtight container made of clear polyethylene terephthalate (PET). A comparative analysis was conducted to assess the physical, nutritional, nutraceutical, and sensory attributes of cookies prepared using Kalanamak and Chak-hao WGRF in contrast to those made with RWF.The MC of flour and cookie samples (2 g) was determined according to the AOAC (1990) approved method. The a w of samples was measured using a Model Series 4 TE water activity analyzer (Aqua Lab, Meter Group Inc., Pullman, WA, USA). The experiments were conducted in triplicates (Itagi et al., 2023).Using an analytical balance (GR-202, A&D Co., Japan), cookie weight was calculated. A digital Vernier caliper with 0.001mm accuracy was used to measure the cookies diameter and thickness. The diameter/ thickness formula was used to calculate the spread ratio (SR) of cookies after baking (Naseer et al., 2021). A colorimeter (Chroma Meter CR-410, Konica Minolta, Inc., Osaka, Japan) was used to assess the color of the cookies. The measuring head was placed in the center of each sample after the instrument's calibration was completed using a reference standard that was white in color. Color values using the CIE L* a* b* scales were recorded using five samples for each cookie formulation. Following that, the mean values were documented as L* = lightness (100 = white, 0 = black), a* (-a* = greenness, +a* = redness), and b* (-b* = -blueness, +b* = yellowness) (Selvakumaran et al., 2019). The browning index was calculated following (Klunklin & Savage, 2018).The texture analysis of cookies was conducted to determine their breaking strength, utilizing a TA. XT plus texture analyzer (Stable Micro Systems Ltd, Surrey, UK) equipped with a 50 kg load cell. The peak force required to break a single whole cookie was recorded and the average value of ten replicates was reported (Pal et al., 2019).The Kjeldahl method was employed to determine the protein content (Kjeltec™ 8200, Kjeltec, Foss, Sweden). The fat was extracted with petroleum ether (40-60 • C) through a Foss ST243 Soxtec Extraction Unit and quantified through gravimetric analysis (Itagi et al., 2023). The determination of ash content was carried out through the incineration of the samples at a temperature of 550 • C (AOAC, 2000). The estimation of total carbohydrate in the samples was carried out following FAO (2003, p. 77) and the Gross Energy (Calories/100 g dry matter) was calculated based on the methods outlined by Ganogpichayagrai and Suksaard (2020).All the trace mineral compounds and metals were quantified using an ICP-MS (Agilent 7800 ICP-MS) by following the prior protocol outlined in Itagi et al. (2023). For the vitamin analyses, finely ground samples (5 g) were weighed in a 100 mL volumetric flask, added with HCl (30 mL, 0.1 mol/L), and incubated at 120 • C for 30 min. Then, the pH was adjusted to 7 with NaOH (0.1 N). Takadiastase (5 mL, 1 mol/L) was added, followed by overnight incubation at 35 • C. The sample was diluted to 100 mL with distilled deionized water and filtered (0.22 μm, PVDF Whatman filter paper). A 10 μL of the filtrate and standards were analyzed using LC-MS/MS that had an autosampler and MS detector (Agilent Technologies, 6470 Triple Quad LC-MS/MS). This system was equipped with a 1.8-μm Agilent ZORBAX RRHD Eclipse Plus C-18 stationary phase in 3.0 mm × 100 mm formats. The mobile phase of gradient delivery composed of a mixture of solvent A (water: formic acid, 100:0.3, v/v) and B (methanol: formic acid, 100:0.3, v/v) and had a flow rate of 0.50 mL/min (0-0.4 min, 1% B; 0.4-6 min, 1%-45% B; 6-7.5 min, 45-90% B; 7.5-9min, 90%-1% B). The standard vitamins B1, B2, B5, and B6 appear at 0.96, 7.2, 4.8, and 2.2 min retention times (Rezaei et al., 2022).The Megazyme K-TDFR kit (Megazyme Wicklow, Ireland) was utilized to evaluate the levels of total dietary fiber (TDF), insoluble (IDF), and soluble (SDF). The computation of IDF and SDF was performed utilizing the Megazyme Mega-Calculation method (Itagi et al., 2023).The total starch was conducted utilizing a Megazyme assay kit specifically designed for total starch (Megazyme K-TSTA, Wicklow, Ireland) (Itagi et al., 2023). The determination of amylose content was conducted in accordance with the methodology outlined by Cuevas et al. (2018), and the categorization of samples was based on the contents as described by Graham (2002). The quantification of the overall quantity of soluble sugar present in the cookies was carried out using the anthrone method as described in Roy et al. (2021).Oryzanol extraction and estimation were done following the method described in Itagi et al. (2023). The findings were reported in mg per 100 g, and all subsequent measurements were taken with the same spectrophotometer.2.8.6. Estimation of total phenolic content and antioxidant potential 2.8.6.1. Extraction of phenolic content. A 1g sample was subjected to extraction using 10 mL of petroleum ether in an ultrasonicator (PCI Analytics, India) for 15 min. After centrifugation (5 min at 2520×g), the supernatant was decanted and collected. The polyphenols were extracted from defatted samples following Itagi et al. (2023). 2.8.6.2. Total phenolic content (TPC). FC reagent (800 μl) and Na 2 CO (7.5 g/100 mL) (2 mL) were added to 200 μl of sample. Then, the sample volume was increased to 7 mL with deionized water and then left to stand in a lightprotected environment for 30 min. The absorbance was taken at 725 nm. TPC was reported according to Itagi et al. (2023). 2.8.6.3. Total flavonoid content (TFC). The extract (1 mL) was diluted to 5 mL with ultrapure water, followed by the addition of NaNO 2 (5 g/100 mL) (300 μl). The mixture was incubated for 5 min. Next, AlCl 3 (10 g/ 100 mL) (600 μl) was added, and the mixture was incubated for an additional 6 min. A 2 mL NaOH (1 mol/L) was added, and the volume was adjusted to 10 mL. The quantification of TFC was performed by measuring the absorbance at a wavelength of 510 nm, and the resulting values were expressed as milligrams of catechin equivalents (CE) per 100 g of the sample, as previously reported by Itagi et al. (2023). 2.8.6.4. Total anthocyanin content (TAC). A mixture comprising of 2 mL of potassium chloride buffer (0.03 mol/L, pH 1.0) and 2 mL of sodium acetate buffer (0.4 mol/L, pH 4.5) was introduced to 20 μl of extract.Following a 15min incubation period, the absorbance was quantified at 550 nm and 700 nm relative to a blank sample consisting of ultrapure water. TAC was recorded in terms of milligrams of cyanidin-3-glucoside (C-3-G) equivalents per 100 g of the sample (Itagi et al., 2023).2.8.6.5. Total antioxidant capacity. The extract (500 μL) was combined with phosphomolybdenum reagent (0.6 mol/L sulfuric acid, 28 mmol/L sodium phosphate, and 4 mmol/L ammonium molybdate) (1.23 mL) and incubated at 90 • C for 90 min. The total antioxidant capacity was reported as quercetin equivalents (QE) per 100 g of the sample at an absorbance of 695 nm (Itagi et al., 2023).2.8.6.6. Hydrogen peroxide scavenging capacity (HAS). The extract (0.4 mL) was combined with 40 mmol/L H 2 O 2 (0.6 mL). The mixture was diluted to 2 mL with 50 mmol/L sodium phosphate buffer (pH 7.4) and then incubated for 40 min at 30 • C. The findings were reported as mg quercetin equivalents (QE) per 100 g of sample (Itagi et al., 2023).2.8.6.7. DPPH radical scavenging activity. The DPPH assay was conducted on 500 μL of extract according to Itagi et al. (2023). The results were represented in terms of % DPPH radical scavenging activity.A 200 μL of volume of freshly made FRAP reagent (300 mmol/L acetate buffer (pH 3.6):10 mmol/L 2,4,6-tri (2-pyridyl)-1,3,5-triazine solution:20 mmol/L FeCl solution, (10:1:1, v:v:v)) was added to 20 μL of extract. At 620 nm, the mixture's absorbance was measured after 5 min at 37 • C incubation. Results were expressed as mmol/L Trolox Equivalents per gram of material (Tomasina et al., 2012).2.8.6.9. Targeted bioactive profiling. The defatted samples were used to extract the phenolic compounds. One milliliter of 80% aqueous methanol (acidified with 1% HCl) was added to a 50 mg sample. After sonication for 10 min at 120 W, 800 μL of the supernatant was collected and centrifuged (28000×g, 10 min). Extraction was done twice, and the pooled supernatant was filtered through a 0.22 PVDF membrane filter, then subjected to liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-MS/MS) to profile and identify phenolic compounds. The HPLC system used in this study was an Agilent 6470 Triple quad LC/MS System (Agilent Technologies, Santa Clara, CA, USA) equipped with column C18, 2.1 × 100 mm, 1.8 μm which was used for phenolic compound separation. Mobile phases A and B were composed of solvent A (water: formic acid, 100:0.3, v/v) and B (methanol: formic acid, 100:0.3, v/v), respectively. The flow rate was set at 0.40 mL/min (0-0.5 min, 10% B; 0.5-5 min, 10%-40% B; 5-12 min, 40-80% B; 12-15 min, 80%-2% B) and the column was maintained at 40 • C. An aliquot of each sample solution (10 μL) was injected into the system equipped with an ESI source and a triple-quadrupole mass spectrometer (MS/MS). The ESI source and the MS/MS were operated in the negative ion and positive ion multiple reaction monitoring (MRM) modes, respectively. All measurements were conducted in duplicate. Calibrations with R 2 = 0.99 were used.FA content in samples was analyzed following a method by Jarukas et al. ( 2020), with slight modifications. Powdered samples were extracted with hexane (1:7, w/v) in a shaking water bath (65 • C, 30 min), then centrifuged at 7000×g for 15 min. Total lipid fraction was recovered after solvent removal in a stream of nitrogen. The samples were then derivatized using 2 mL of 7% (v/v) BF 3 in methanol and 1 mL of toluene and placed in a warm bath at 80 • C for 45 min. After the addition of 5 mL of distilled water, the trans-methylated FAs were extracted with 1 mL hexane. The aliquot of the hexane phase was analyzed by gas chromatography. An Agilent 7890B gas chromatograph (Agilent Technologies, USA) with a Flame-Ionization Detector was used to separate and quantify FAs. One microliter aliquot of the hexane phase was injected in split-mode onto a DB-Wax column (30 m × 0.25 mm ID, 0.25 μm DB-Wax (J&W 122-7032)). The injector temperature was set at18 min. The carrier gas was Hydrogen. Detector gasses were Hydrogen: 40 mL/min; Air: 450 mL/min; Helium make-up gas: 30 mL/min. An electronic pressure control in the constant flow mode was used. The FAME calibration standards were used for the quantification of FAs in the various lipid extracts.A hedonic sensory evaluation was conducted on cookies made from whole grain rice flour. The evaluators were 27 volunteer staff members from ISARC (Varanasi) (untrained), ranging in age from 23 to 58 years and including both male and female participants. Each of the panelists has provided their informed consent to partake in the study. The sensory evaluation was conducted within the confines of the sensory and product development laboratory at CERVA. The cookies were prepared in advance of the sensory evaluation and were subsequently stored at ambient temperature. In the context of sensory evaluation, the samples were presented in their entirety on white plastic dishes that were labeled with codes. The panelists were then served the samples in a randomized sequence. The panelists were furnished with distilled water and unsalted crackers to rinse their palates in between tastings. The cookies underwent an evaluation process that assessed their surface color, surface cracking pattern, crumb color, texture, mouth feel, flavor, aroma, and overall acceptability. The evaluation was conducted using a nine-point hedonic scale which ranged from \"like extremely\" to \"dislike extremely,\" corresponding to the highest and lowest scores of \"9\" and \"1\" respectively (Naseer et al., 2021).The experiments were performed in triplicate (n = 3), unless stated otherwise, and the results were reported as the mean values along with their standard deviations. Data from the results were analyzed statistically using one-way ANOVA, followed by a Tukey's post hoc test (P < 0.05) using R statistical package, version 4.2.1 (R Foundation for Statistical Computing, Vienna, Austria). To reveal a distinct clustering between data sets, the principal component analysis (PCA) scores plot was used. The correlation between physical properties and texture profile, nutritional composition, bioactives, and antioxidant activity for each rice genotype was analyzed by Pearson's correlation. All data visualizations were performed using the R statistical package.Kalanamak from Uttar Pradesh and Chak-hao from Manipur are popular GI-tagged Indian rice landraces that are renowned for their aroma and superior grain quality (Kowsalya et al., 2022). The bran and broken rice (byproducts of the rice milling process) of these two landraces are likewise known to possess higher nutraceutical properties. Rather than being used as a low-value commodity for fodder, these byproducts could be instead leveraged as raw material in food applications with enriched functional properties for different value-added product development purposes. In this study, whole grain rice flour derived from the well-known aromatic rices, Kalanamak (greenish brown) and Chak-hao (black rice), and raw sugarcane products (jaggery and brown sugar) were used to explore novel formulations of nutraceutical-rich gluten-free cookies. The physicochemical, nutritional, and sensory properties of these cookies were compared with that of refined wheat-based cookies and discussed.Along with texture and flavor, the surface color of a baked product is a crucial factor in the initial acceptability of baked products among consumers. The flour and sweetener had remarkable and complex effects on the color formulation of the resulting cookies, as shown in Fig. 1. A higher L* value, which indicates lightness, is observed in refined wheat flour (RWF) and Kalanamak whole grain rice flour (KWGRF)based cookies than in black whole grain rice flour (BWGRF)based cookies. RWF cookies made with white sugar were noted with the highest L* values, which could be attributed to the typical light color of well-milled wheat kernels. The lower L* values of all BWGRF cookies, on the other hand, can be attributed to the presence of pigmented bran in the present study. These findings align with previous studies by Joo and Choi (2012) and Jang et al. (2010) that observed a decreasing L* value with increasing rice bran substitution in a cookie formulation. Moreover, the L* value of Kalanamak whole grain rice flour white sugar (KWGRFWS) cookie was not substantially different from refined wheat flour white sugar (RWFWS) cookie and was similar to that reported by Joo and Choi (2012) for cookies made from commercially available rice flour. Differences in rice flour color were attributed to their polyphenols, which relate to the purple color of the rice grain (Buenafe et al., 2022;Klunklin & Savage, 2018). The L* values generally decreased with the addition of jaggery as it contains reducing sugars that could participate in the Maillard reaction. Chand et al. (2011) reported that reducing sugars in jaggery typically increases with storage regardless of the storage conditions. The Maillard reaction, which occurs during the baking process, is another factor that affects the final color of baked food items (Giuberti et al., 2017). This reaction could result in reddish-brown hues from the interaction of reducing sugars with proteins and explain the lower L* value of 60.49 for refined wheat flour brown sugar (RWFBS) cookie compared to a higher value of 67.00 for Kalanamak whole grain rice flour brown sugar (KWGRFBS) cookie (Ryan & Brewer, 2006). All WGRF cookies had significantly lower redness (a*) and yellowness (b*) compared to RWF cookies, with BWGRF showing the lowest values for both parameters. The differences in a* and b* values were presumably correlated with the differences in the amino acid profile and content of reducing sugars responsible for the intensity of the Maillard reaction (Torbica et al., 2012;Zucco et al., 2011).The physical and chemical characteristics of RWF and WGRF from Kalanamak and Chak-hao rice, and their corresponding cookies were shown in Table 1. The WGRF samples exhibited lower moisture content (9.93% and 10.13% for KWGRF and BWGRF, respectively) compared to RWF (13.71%). These findings are consistent with previous studies that have also reported lower moisture content in rice flour relative to wheat flour (Islam et al., 2012;Rai et al., 2014;Torbica et al., 2012). Moisture content is a crucial consideration for flour storage since flour with a moisture content exceeding 13% is more prone to microbial deterioration (Oppong et al., 2021). Accordingly, the moisture content of WGRFs in the present study was below the threshold level, indicating that both flour samples (BWGRF and KWGRF) have a satisfactory shelf life. Due to water evaporation during baking, which results in the distinctive crusty features of cookies, all cookie formulations exhibited considerably lower moisture content in PC1 than flour samples (Fig. 2b). Regardless of flour type, the moisture content values of cookies prepared with jaggery were up to 51% higher than those prepared with refined white sugar. This distinction may be ascribed to the hygroscopic character of inverted sugar and the presence of mineral ions in jaggery (Lamdande et al., 2018;Rao & Singh, 2022). Apart from moisture content, the water activity (a w ) also exhibited lowest in cookies, in comparison to flour (PC1,  Values are expressed as the mean of three (3) replicates for moisture content, a w , total amylose, and total sugar, and ten (10) for thickness, diameter, spread ratio, weight and, hardness parameters ± standard deviation; \"-\"-Not applicable parameters; Different lowercase and uppercase letters denote a significant difference (P < 0.05).Fig. 2b). All cookie samples had values in the range of 0.28-0.35, while the wheat flour exhibits less than 0.85. Interestingly, the KWGRFWS cookies have the lowest a w value (0.22) (Table 1). Lower MC and a w values are crucial for extending the shelf life of the final product and reducing the risk of foodborne illnesses. In addition, appropriate packaging materials are also necessary for quality preservation and shelf-life extension (Itagi et al., 2023;Yildiz & Gocmen, 2021).The term \"hardness\", which describes the amount of force used to distort a sample, is measured among various cookies. In general, the hardness values of RWF (3.97-5.01N) and BWGRF (3.97-5.40N) cookies were comparable. Interestingly, all KWGRF cookies had a low breaking point (2.25-2.49 N) (Table 1). The contribution to PC1 (Fig. 2b) was significantly influenced by the hardness value and spread ratio, which accounts for the characteristic features of the cookie samples. These results are consistent with those of Yildiz and Gocmen (2021) and Paz et al. (2020), who reported a reduction in hardness values when substituting rice flour for wheat flour in a cookie formulation. In addition, these studies attribute the high hardness values to the higher protein content of RWF compared to WGRF. Proteins on the surface of starch granules function as adhesives, which strengthen the starch-protein bond in cookie dough and increase the overall hardness of the cookie (Ryan & Brewer, 2006). In addition, a higher DF content may also enhance the texture of cookies. This was the case with GF cookies made with almond flour (Yildiz & Gocmen, 2021). Likewise, BWGRF had a DF that was up to 49% greater than the other two flour types, which may explain the higher hardness values of BWGRF cookies. Yildiz and Gocmen (2021) propose that DF can reduce the amount of free water in the dough, thereby decreasing the resulting spread ratio of cookies.Differences in starch, DF, and protein proportions in the flour could account for the dimensional property variations (Mudgil et al., 2017). Diameter, thickness, and spread ratio are typical parameters used to determine cookie quality. The cookies in the study varied in diameter (37-40.44 mm), with significant differences observed primarily among KWGRF cookies (Table 1). In addition, the WGRF substitution led to an increase in the overall thickness of the cookies. These changes are reflected in spread ratio values. In general, cookies with a higher spread ratio are regarded as the most commercially appealing (Giuberti et al., 2017;Mudgil et al., 2017). Table 2 suggests that replacing RWF with WGRF resulted in a slight reduction in the spread ratio of cookies. However, the spread ratio values of BWGRF cookies were almost equivalent to those of the control, indicating that they are commercially viable. Additionally, BWGRF cookies were heavier than RWF and KWGRF cookies. Ryan and Brewer (2006) observed that cookies made with low-protein flour tended to be smaller in diameter and have lower spread ratios, indicating denser properties.Although RWF had the highest protein levels (13.24 g/100g), followed by BWGRF (12.41 g/100g), and KWGRF (10.55 g/100g), the cookies derived from the flour has substantially lowered the protein content (Table 2). RWF cookies contained protein ranging between 7.90 and 8.50%. Compared to KWGRF cookies (7.09-7.80 g/100g), BWGRF cookies retained higher protein levels (7.17-8.50 g/100g). Prior studies reported cookies made from rice and wheat flour of regular varieties (Islam et al., 2012;Klunklin & Savage, 2018;Torbica et al., 2012). Also observed was a significant difference in the total carbohydrates of the flour samples. KWGRF was found to have the highest carbohydrate level (74.15 g/100g), which was 3% and 4% higher than BWGRF and RWF, respectively. Variations in flour carbohydrate content could be attributed to differences in protein and lipid content (Oppong et al., 2021). However, in this study, only protein showed a strong positive correlation with total carbohydrates (Fig. 4b). All cookie samples exhibited a significant drop in carbohydrates, which may be ascribed to amylose and amylopectin leaching from the starch granules when it swells during the thermal process (Itagi et al., 2023).The fat content of flour samples ranged from 0.87 in RWF to 3.34 g/ 100g in KWGRF (Table 2). These differences in lipid content are primarily attributed to the presence of bran components in both WGRFs, which are virtually absent from RWF due to the nature of processing (Ciccoritti et al., 2017;Oppong et al., 2021). The addition of extra fat resulted in an increase of total fat in the range 25.83-27.76 g/100g (Table 2). The fat content of resulting cookies remains higher, regardless of the sweetener used (Klunklin & Savage, 2018).The fatty acid profile of BWGRF and KWGRF cookies generally contain higher levels of unsaturated and polyunsaturated FAs such as oleic, myristic, linoleic, linolenic, and gadoleic acid (shown in Fig. 5a), compared to RWF and RWFbased cookies (Supplementary Table 1). Unsaturated and polyunsaturated FAs are crucial in reducing cholesterol levels which provides various health benefits (Ciccoritti et al., 2017;Joo & Choi, 2012;Kasote et al., 2021;Ruan et al., 2015). Among the fatty acids profiled across samples, oleic acid is particularly abundant in WGRF and its cookies (Fig. 5d). This is particularly the case in KWGRF.Several studies suggest that oleic acid is the most prevalent fatty acid in rice bran (Joo & Choi, 2012;Ruan et al., 2015). Ash content across flour samples ranged from 0.64 to 1.90 g/100g. Similar trends were observed among the cookies. The ash content contributes to the distinction of BWGRFJ cookies from other cookie samples (PC2, Fig. 2b). Cookies made with jaggery had more ash content (1.80-2.20 g/100g) than those made with brown sugar (1.19-1.44 g/ 100g) and white sugar (1.19-1.44 g/100g). Similar results were observed by Lamdande et al. (2018) when substituting jaggery for sugar in a muffin formulation. Previously, it was reported that white sugar has an ash value of approximately 0.015% (McKee et al., 2015), while brown sugar and jaggery have values of approximately 0.20% and 1.56%, respectively (Lamdande et al., 2018). The ash content reflects the mineral, fiber, and inorganics remaining in the sample after it has been heated to a very high temperature, eradicating moisture, volatiles, and organics compounds (Altındag et al., 2015;Islam et al., 2012). Values are expressed as the means of (3) replicates for total carbohydrate, protein, ash, energy, fat, and minerals two (2) replicates for fiber and vitamins ± standard deviation; Different lowercase letters between rows denote a significant difference (P < 0.05).ICP-MS data of flour samples revealed varying mineral concentrations between samples (Table 2). KWGRF flour samples had the highest Mg content (1692 mg/kg), followed by BWGRF (1491 mg/kg) and RWF (428.1 mg/kg). The K, Fe, and Zn values in BWGRF were substantially higher than those in the other two varieties of flour. Interestingly in the baked cookies of BWGRF made with white and brown sugar, the Mg and K levels were reduced, and substituting with jaggery maintained the Mg and K levels to the same basal level as in the flour. The mineral content of jaggery-sweetened cookies was found to be generally higher than that of white and brown sugar. For instance, KWGRF cookies with jaggery offer the highest % daily value for Mn per 32g serving (26.99%, KWGRF with jaggery). In PC1, Fe distinguishes KWGRF jaggery-formulated cookies from the other formulations (Fig. 2a). KWGRF jaggeryformulated cookies could provide a 6.26% daily value of Fe per 32g serving. The enhanced mineral content in KWGRF and BWGRF cookies could therefore be attributed to the application of mineral rich WGRFs and the inclusion of jaggery in the formulation. During dough preparation and baking, jaggery crystals dissolve as a result of their interaction with water molecules. This may have caused micronutrients from jaggery crystals to migrate throughout the cookie matrix resulting in mineral-rich cookies (Verma et al., 2019). The presence of vitamin and mineral-rich rice bran in pigmented varieties as compared to non-pigmented varieties also likely accounted for these results (Ciccoritti et al., 2017;Oppong et al., 2021). Lamdande et al. (2018) made comparable findings on muffins formulated with jaggery. In many regions of Asia and Africa, jaggery has a well-established reputation as a nutraceutical due to its abundance of essential amino acids, antioxidants, phenolics, minerals such as Mg, K, Fe, Zn, and Cu, and vitamins. This nutrient-dense profile made jaggery a suitable substitute for white and brown sugar (Lamdande et al., 2018;Rao & Singh, 2022).The WGRF cookies, regardless of the sweetener used, generally retained the highest levels of B-vitamin (B1, B2, B5, and B6) than RWFbased cookies (Table 2). The vitamin B5 content of cookie samples ranged from 1.66 to 0.54 μg/g, with the BWGRFJ cookies containing the most vitamin B5 and RWFBS cookies containing the least. BWGRFJ cookies also retained the highest vitamin B2 (1.43 μg/g) and vitamin B6 (1.73 μg/g), while BWGRFWS and KWGRFWS had the highest vitamin B1 level (0.71 μg/g), among cookie samples examined in the present study. These results are predominantly attributed to the presence of bran components in both WGRFs, as these components are a known abundant source of B-vitamins, which provide a variety of health benefits (Kasote et al., 2021;Tiozon et al., 2021).Table 3 presents the levels of γ-oryzanol, phenolics, and total antioxidant capacities in flour and cookie samples. In general, our findings concur with previous research indicating that whole grain rice is an abundant source of bioactive compounds. Furthermore, pigmented whole grain rice is far superior to non-pigmented rice with enriched nutraceutical properties (Goufo & Trindade, 2014;Itagi et al., 2023;Kasote et al., 2021;Tiozon et al., 2021). BWGRF (37.56mg/100 g rice flour) had 4-folds and 1.7-folds more γ-oryzanol than KWGRF and RWF, respectively. γ-oryzanol distinguishes jaggery-sweetened BWGRF cookies (48.82 mg/100 g rice flour) from the other formulations (PC2, Fig. 2b). These BWGRF cookies had 35% and 105% γ-oryzanol than KWGRFJ and RWFJ cookies. Previous reports have shown that γ-oryzanol concentrates on the rice bran (Goufo & Trindade, 2014;Kumari et al., 2015). The presence of bran in both WGRFs may account for the high oryzanol content of the resulting cookies. Recent research evidence suggests that γ-oryzanol may alleviate obesity and cognitive impairment, highlighting its importance to bioactive rice research (Mastinu et al., 2019;Masuzaki et al., 2019).There was a general decline in the levels of total phenolic compounds (TPC) upon baking. Be that as it may, in comparison to RWC cookies with added refined white sugar, the cookies made from KWGRWS have 2-folds higher phenolics and BWGRWS cookies have 5-folds higher phenolics content (Table 3). Interestingly, the KWGR and BWGR formulated with jaggery not only retained the highest levels of phenolics, but also flavonoids, and anthocyanins (Table 3; Fig. 3b). The TPC value of BWGRFJ cookies (178.1 mg GAE/100g) was 1.5 times greater than in KWGRFJ cookies, 6 times greater than in RWFJ, and 8-times greater than that of RWFWS cookies, which is the formulation with the lowest TPC observation. The total flavonoid content (TFC) of the BWGRF-based cookies had a higher total anthocyanin content (TAC) than cookie samples derived from other flours. In addition, the TAC values of BWGRFJ cookies (434.2 mg C-3-GE/100g) were 13-folds greater than those of RWFJ cookies, which had the lowest TAC results. Antioxidants derived from pigmented rice protect vital lipids, proteins, and DNA from oxidative stress. Therefore, the potential of the antioxidants to combat free radicals was assessed through in vitro techniques (Goufo & Trindade, 2014;Tiozon et al., 2021). Across antioxidant capacity assays (total antioxidant capacity, hydrogen peroxide scavenging activity (HAS), DPPH radical scavenging activity, and FRAP), phytochemical rich BWGRF consistently demonstrated the highest values (289.4 mg QE/100g, total antioxidant capacity; 275.1 mg QE/100g, HAS; 79.06%, DPPH; 8.56 mM TE/g, FRAP). A study conducted by Iqbal et al. (2017) on the antioxidant content and capacity of raw and processed sugars showed that jaggery had 118 and 138 times more phenolic compounds than brown and white sugar, respectively. The DPPH radical scavenging and reducing power of the samples followed a similar pattern. Retaining higher levels of TPC, TFC and TAC correlated strongly with antioxidant properties (Fig. 4a). This is further supported by the strong positive correlation between bioactive compounds and antioxidant capacity, especially hesperidin, rutin, ellagic acid, and quercetin with FRAP and DPPH (Fig. 4a). Heating starch in water causes the granules to rupture. Phenolic and bioactive compounds in the matrix could complex with starch molecules either through inclusion (where the compounds are captured within the starch helices), or non-inclusion (where the compounds are trapped between the helices) (Sudlapa & Suwannaporn, 2023). This complexation process occurred during baking. These results highlight the potential of formulating nutritionally superior GF-products from whole grain rice and nutrient-dense sweetener such as jaggery.The sensory properties of cookies produced using WGRF and RWF with three different sweeteners (white sugar, brown sugar, and jaggery) were evaluated, and the results are presented in Fig. 6. KWGRF cookies sweetened with white sugar were rated the highest in all sensory properties (8.00) except for crumb color (Fig. 6c). The panelists preferred the crumb color of BWGRF cookies with jaggery (8.00), followed by RWF with white sugar (7.85). In terms of surface color (8.00) and cracking patterns (8.00), BWGRF cookies formulated with jaggery were a close second to KWGRF cookies with white sugar. For aroma, the panelists showed the highest preference for KWGRF cookies with jaggery (7.89). The preference for mouthfeel in KWGRF and RWF cookies (both versions of sweetened with white sugar), could be due to a clean mouthfeel without any residue formation, attributed to lower TDF compared to BWGRF cookies. Similar findings were reported by Baumgartner et al. (2018) on cookies made with dephytinized oat flour. Yildiz and Gocmen (2021) argued that gluten-free bakery products have weaker sensory properties and may not meet consumer expectations due to their harder structure, darker color, unpleasant appearance, and dry-sandy feeling in the mouth compared to conventional gluten-containing products. However, our results suggest that KWGRF and BWGRF cookies, particularly those made with white sugar and jaggery, could compete with RWF-based cookies and thus may be more preferred by consumers.The whole grain cookies made from GI-tagged rice landraces, Kalanamak and Chak-hao, offer distinct sensory qualities and are nutritious that are rich in polyunsaturated fatty acids, minerals, fiber, and bioactive compounds. The Chak-haobased cookies retained the highest levels of phytochemicals with greater antioxidant activities and adding jaggery as sugar alternative exhibited higher levels of Fe and helped to retain higher antioxidant compounds upon baking. These cookies demonstrate good shelf-life stability with a w levels under 0.85. Although gluten-free formulations spread less than the wheat control, sensory evaluation suggests that acceptability of KWGRF and BWGRF cookies are comparable to RWFbased cookies. The rising demand for nutritious foods provides manufacturers an opportunity to diversify their products to cater to specific markets. Future research can explore the development of more gluten-free functional foods using Kalanamak and Chak-hao rice, catering to both local and global demands. Investigating packaging and storage options is also essential for maintaining shelf stability and nutritional quality.All panelists granted informed consent before taking part in the study. The research protocol was explained to the panelists, detailing the cookies and their ingredients. Panelists could opt out of evaluation sessions without needing to explain their choice. Evaluations were conducted at the Center of Excellence in Rice Value Addition, Product  "}

main/part_2/0297847279.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"6672ab9ed56ddd0d28c2e0fc35328f23","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9bbbab93-f694-4785-b022-c9423f56abff/retrieve","id":"-15011861"},"keywords":[],"sieverID":"0d1bcf12-5002-4df7-bd73-6f30b92036b3","content":"On tiny farms that are 0.5-1ha, crop diversification is severely constrained by limited land. Intercropping systems ensure farm crop diversity on such farms, but are often constrained by unacceptable yield penalties on either or both component crops, if the crops are not ecologically compatible.Photo A. Groundnut and pigeopea plants explore resources in different 'niches'resulting in little intraspecific competition.• The groundnut-pigeopea DLR system success hinges on the very slow initial growth of pigeonpea. • It follows that the groundnut component grows as if solecropped until its reproductive stage (insignificant competition for water, nutrients and sunlight with small pigeonpea plants).• Pigeonpea only starts rapid growth when the groundnut component has approached maturity (mature groundnut understory -Photo B). • After this, pigeonpea continues to grow on its own in the field, forms pods, and will be harvested later. • This legume -legume intercrop system 'doubles' grain legume crops and 'doubles' soil fertility benefits as both groundnut and pigeonpea add soil fertility through biological N2-fixation, when the residues are retained in the field. • This leads to more intensified production of maize grown in sequence -a form of N fertilizer subsidy to farms that do not access adequate mineral N fertilizersThis product has been extensively tested in Malawi, with the following results:1. Increased labour productivity: On smallholder farms in Malawi, land preparation involves hand hoe construction of ridges on which crops are planted (Photo C). This is extremely labour demanding, usually on infertile soils that do not support large crop yields. The DLR accelerates soil fertility restoration, and better returns to labour for current and rotational crops.The groundnut -pigeonpea DLR technology has consistently resulted in land equivalency rations (LER) of at least 1.3. LER is a measure of land productivity, and a number >1 indicates that intercropping is advantageous. This is especially critical for small farms of <1 ha that are largely under water limited rain-fed agriculture, with only one feasible cropping cycle per year. With increased farm fragmentation, as the trend in Africa, the DLR contributes to offsetting the effects of reduced farm sizes. "}

main/part_2/0298906438.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"4b1fec810a0f1be3b10990f761b1cfde","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d0756371-4f08-4f8f-ab5c-e1f65ace0a9e/retrieve","id":"-628967680"},"keywords":[],"sieverID":"6519de0f-2035-4e3f-915a-06b996826f35","content":"Health, food security, environmental sustainability and increased smallholder incomeLeveraging legumes to combat poverty, hunger, malnutrition and environmental degradation.Our goal is to enhance the food security, income and health of resource-poor farmers in Africa through research on beans. To achieve this goal, we work in partnership with farmers and rural communities, Non-Government Organizations. "}

main/part_2/0313460833.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"9b6384d6ef2f0592eab76ea8c5dd8d85","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/05c09288-a791-4ea7-b464-bcfbc9c3c467/retrieve","id":"342590870"},"keywords":[],"sieverID":"40481e9f-8783-40f4-8f4e-e45b4c8219b0","content":"Easy to use KASP assay -advantages ❖ Requires only two components: KASP assay and master mix ❖ Compatible with relative crude DNA extraction methods ❖ Flexible primer design ❖ Signal can be read on qPCR and FRETcapable plate readers ❖ Scaling up is possible Low cost ❖ Low reaction volumes -down to 1 uLkeep reagent costs to a minimum ❖ Relative robust assay means less time spent on repeats ❖ Cost benefits enable you to perform more assays overall, improving the quality of your data."}

main/part_2/0338410738.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"5ff33b5da79b1bdf778eeb9d73fbeaa1","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/1428d14b-0c2f-4a08-9efa-61f0c7073824/content","id":"-69827821"},"keywords":["Zea mays","maize","biofortification","β-cryptoxanthin","β-carotene","carotenoids","NIRS"],"sieverID":"5f8dcf87-88fe-4f98-bb68-40f256dc2ed4","content":"Vitamin A deficiency (VAD) is a public health issue worldwide. Provitamin A (PVA) biofortified maize serves as an alternative to help combat VAD. Breeding efforts to develop maize varieties with high PVA carotenoid content combine molecular and phenotypic selection strategies. The phenotypic assessment of carotenoids is currently done using liquid chromatography, a precise but time-and resource-consuming methodology. Using near-infrared spectroscopy (NIRS) could increase the breeding efficiency. This study used ultra-performance liquid chromatography (UPLC) data from 1857 tropical maize genotypes as a training set and NIRS data to do an independent test of a set of 650 genotypes to predict PVA carotenoids using Bayesian and modified partial least square (MPLS) regression models. Both regression methods produced similar prediction accuracies for the total carotenoids (r 2 = 0.75), lutein (r 2 = 0.55), zeaxanthin (r 2 = 0.61), β-carotene (r 2 = 0.22) and β-cryptoxanthin (BCX) (r 2 = 0.57). These results demonstrate that Bayesian and MPLS regression of BCX on NIRS data can be used to predict BCX content, the current focus on PVA enhancement, and thus offers opportunities for high-throughput phenotyping at a low cost, especially in the early stages of PVA maize breeding pipeline when many genotypes must be screened.Vitamin A deficiency (VAD) remains a public health problem in many low-and middleincome countries. Although the global prevalence of VAD in children under the age of 5 years has declined from approximately 39% to 30% over the past two decades, little progress has been made in South Asia and sub-Saharan Africa, where VAD still affects 44 and 48% of children under 5 years, respectively [1].Provitamin A (PVA) carotenoids, (e.g., β-cryptoxanthin, αand β-carotene) are the precursors of vitamin A, which is an essential nutrient for different systems of the human body that helps prevent morbidity, mortality from infections, and childhood blindness [2]. These carotenoids are found in many vegetables, fruits, and, albeit in lower concentrations, in yellow maize. In addition to PVA carotenoids, lutein, and zeaxanthin are the predominant carotenoids in yellow maize [3,4].The analysis and quantification of carotenoids can be challenging due to the large number of naturally occurring carotenoids, the susceptibility of these compounds to degradation, and the wide range of concentrations of carotenoids and their various isomers found in nature [5]. Several methods have been considered in search of a fast, accurate, and cheap assay to screen PVA content in maize grain to support PVA maize breeding programs. Some of the proposed methods have included visual color scoring, the use of colorimetry, and liquid chromatography [6,7]. Currently, PVA maize breeding pipelines rely mainly on lab wet chemical techniques based on liquid chromatography and DNA markers to select for PVA carotenoids [7,8]. However, due to logistical and technical reasons, DNA markers may not be a practical option for small breeding programs in develloping countries. Still, even when DNA markers are used, validation of PVA content with accurate phenotypic data is necessary.Ultra-performance liquid chromatography (UPLC) has been an effective method for generating high-quality PVA data for maize biofortification programs. However, it can be laborious, expensive, and generates chemical waste [7,9]. Given the chemical structure and characteristics of the different carotenoids present in maize, visual color determination and colorimetric tests may help selection in the early stages, but they fail to precisely discriminate among provitamin A carotenoids. Further, visual color scoring has low throughput and can be subjective [6,7,10].Recently, researchers have used low-cost non-destructive tools such as near-infrared spectroscopy (NIRS) and nuclear magnetic resonance as a high-throughput phenotype for predicting grain yield and other end quality traits in various crop species [11,12]. NIRS is considered a high-throughput phenotyping tool and is especially suited to the needs of maize breeding programs because the equipment can be installed on research plot combiners and information on quality traits and routine yield data can be obtained simultaneously [9,13,14]. It is fast, simple, and, in some cases, it can be non-destructive; it also allows for measuring different compounds at the same time. NIRS covers the range from 780 nm to 2500 nm of the electromagnetic spectrum, and thus it measures the interactions between electromagnetic radiation and vibrational properties of chemical bonds [13,15]. For maize breeding programs, NIRS has been successfully used to screen for protein, oil, starch, kernel density, anthocyanins, tryptophan, lysine, and popping capacity, among many other traits [14,[16][17][18][19].Different mathematical methods have been applied to NIRS spectral data to make predictions on other samples where the response variables were not measured. Partial least squares (PLS) is a useful multivariate method, it can analyze data with strong collinearity (correlated), noise, and several X-and Y-variables [20]. The PLS method is a practical approach for cases where the number of predictors is larger than the number of observations and has demonstrated better performance than principal component regression. The PLS approach was originally developed by World-systems analysis and for predicting chemical variables from spectral data [21,22], where the number of variables is larger than the number of observations and there is high collinearity among variables. Details of the PLS theory and its similarities with principal components regression and stepwise multiple linear regression are described by Aastveit and Martens [23].Rincent et al. [12] used high-throughput phenotyping for wheat lines and a tree species (poplar) irradiated with infrared measured absorbance from 400 to 2500 nm. Using the NIR wavelength data analyzed as NIR Best Linear Unbiased Predictor (NIR BLUP) (NIR similarity matrix) in grains and leaves, the authors obtained better prediction accuracy than using GBLUP (genomic similarity matrix). Hayes et al. [11] used a multi-trait approach incorporating NIR and nuclear magnetic resonance information to the genomic models for end-use quality traits in wheat. The authors found that genomic predictions ranged from 0.00-0.47, whereas after adding information using NIR and nuclear magnetic resonance, prediction accuracy increased from 0.00 to 0.69.Cuevas et al. [24] used a wheat dataset including NIR, genomic information, and pedigree information. Results from the Bayesian NIR linear regression model (NB) showed that NIR wavelength alone achieved less prediction accuracy than the genomic information alone. Interestingly, pedigree + NIR information achieved slightly lower prediction accuracy than genomic information + NIR. For fitting the models and making predictions, Cuevas et al. [24] used the BGGE function from the library of the same name [25].The main objectives of this study were to: (1) investigate whether NIR can be used to predict carotenoid content in maize grain samples, and (2) compare the prediction accuracies for two regression models: Bayesian and PLS. We used data from 1857 samples as a training set to predict carotenoid content in an independent set of 650 maize samples.The grain samples used in this study were obtained from the PVA maize breeding program at the International Maize and Wheat Improvement Center (CIMMYT) and included samples from 5 growing seasons (2018 to 2019) and environments in Mexico and Zimbabwe, as well as from different crop management conditions. We used 3 groups of datasets. Group 1 included 1857 cultivars that were used to develop the NIRS calibrations and as training sets and fitting the Bayesian model. Group 2 included 390 cultivars that were used for prediction, and group 3 included 650 cultivars used for prediction or as independent validation. Out of those 650 cultivars, only 260 were completely new, since the remaining 390 were the ones included in group 2. See Data Availability Statement.A total of 50-100 kernels per sample were milled using a cyclotec mill (FOSS Tecator 1093) with a 0.5 mm sieve. A sub-sample of the obtained flour was used for chemical carotenoid analysis by UPLC and the remnant flour was stored at −80 • C in paper envelopes until they were scanned to obtain the NIRS spectra. Moisture content in each sample was between 8-10%.All chemicals used for UPLC analyses were HPLC-grade and purchased from Millipore-Sigma. Ultrapure water was used for UPLC and carotenoid extraction. The standards for β-carotene (BC) were purchased from Millipore-Sigma, while those for lutein (LUT), zeaxanthin (ZEA), and β-cryptoxanthin (BCX) were purchased from Carotenature.Carotenoid extraction and quantification were performed as described by Palacios-Rojas [26]. Briefly, 600-mg samples (fine powder of maize kernels) in 6 mL of ethanol (with 0.1% butylated hydroxytoluene) underwent 5 min precipitation in an 85 • C water bath before being subjected to 10 min saponification with 500 µL of 80% (w/v) KOH in water. After saponification, samples were immediately placed in ice to which 3 mL of cold deionized water was added. Two hundred microliters of the internal standard (β-apo-8 -carotenal) were added, and samples were vortexed. Carotenoids were extracted three times with 3 mL of hexane by centrifugation at 800 g, and the hexane fraction was extracted. The combined extracted hexane layers were dried under nitrogen and reconstituted in 500 µL of 50:50 methanol:dichloroethane (v/v). All carotenoid extraction procedures and analyses were conducted under yellow light. Two microliters of the sample were injected into Acquity UPLC Water equipment. Separation was performed using an Acquity UPLC BEH C18 1.7 µm, 2.1 × 100 mm column, and an Acquity column in-line filter. LUT, ZEA, BCX, and BC were identified based on their characteristic spectra and by comparing their retention times with known standard solutions. 9-cis-β-Carotene (9-cis-BC) and 13-cis-β-carotene (13-cis-BC) were identified and quantified based on BC standards. PVA was computed as all-trans-BC + (1/2) (13-cis-BC) + (1/2) (9-cis-BC) + (1/2) (BCX). Total carotenoids (TC) were computed as all-trans-BC + 9-cis-BC + 13-cis-BC + LUT + ZEA + BCX.The milled material (2-3 g per sample) was scanned by NIRS monochromator model FOSS 6500 (FOSS NIRSystem, Inc., Silver Spring, MD, USA) using small ring cups (internal diameter of 35 mm and depth of 8 mm). Spectra of the samples were collected between 400 and 2500 nm at 2 nm intervals, and each spectrum consisted of 32 scans, which were automatically averaged and saved as absorbance intensity [log (1/R)].All mathematical procedures on the spectral information and calibration development using PLS were performed with WinISI III software from Infrasoft International (FOSS NIRSystems, Inc., Silver Spring, MD, USA). The Bayesian NIR linear regression model was implemented using R codes [27] (see Appendix A).The main purpose of PLS modeling is to decompose both the design matrix predictor (X) and matrix of response (Y) as X = TP and Y = UQ where T and U are projection matrices of X and Y scores and P and Q are orthogonal loading matrices. The method will produce the PLS regression estimates for the response predicted value. In this research, the coefficients of PLS regression were generated with dataset 1 by using the WinISI III software (FOSS NIRSystems, Inc., Silver Spring, MD, USA).Prior to the PLS regression, spectra were pretreated by applying a first-derivative transformation defined by 1,4,4,1 for ZEA, BCX, 13-cis-BC, BC, PVA, and TC, and 2,4,4,1 for LUT and 9-cis-BC, where the first number is the degree of the derivative, the second number is the gap between data points for subtraction, and the third and fourth numbers are the data points used for smoothing. This mathematical pretreatment of the spectral data eliminates the background of constant correlation due to any existing correlation between carotenoid content and particle size [28].The results of the prediction calculations were monitored by checking the t outliers with t > 2.5; the global neighborhood distances (GH) values which are used to determine outliers or samples with unique characteristics; and the X outliers (not the usual spectral data) >10; samples with t > 2.5 were deleted from the sample file. Between 3.61 and 4.79% of the samples were left out for each carotenoid.The standard deviation (SD) between NIRS and reference determinations for the calibration [the standard error of calibration (SEC)] and validation sets [the standard error of prediction (SEP)] were calculated. We also calculated the coefficient of determination of calibration (R2c) and the coefficient of determination of validation (R2v) (the fraction of the variance of the reference values explained by the variance of NIRS determinations) [29].The ratio of standard deviation (RPD) was calculated as the ratio between the SD of the reference value and the standard error of cross-validation (SECV). RPD is indicative of the usefulness of the NIRS calibrations. If this ratio exceeds a value of 3, the prediction accuracy of the calibration equation is higher compared to ratio values lower than 2. In addition, we determined the ratio between the SD and the SEP of each trait because the quality and robustness of a NIRS calibration can also be judged by the SEP and SD/ SEP [19]; an SD/SEP ratio lower than 2 indicates unsuitable calibrations, while ratios between 2 and 3, 3 and 5, and 5 and 10 indicate calibrations with limited, satisfactory, and good quality, respectively. Caution is required when interpreting the SD/SEP ratio because it depends strongly on the distribution and number of reference values. Therefore, the SD/SEP ratio cannot be regarded as the ultimate criterion for prediction quality. However, in combination with SEP, the SD/SEP ratio is helpful for judging the predicted values and may prevent erroneous conclusions concerning the real quality of a calibration model [29].The Bayesian regression model is represented by:where the response vector y representing the values of PVA measured in n maize genotypes is explained by an overall mean µ plus a random vector Z N IR u related to the NIR data and a random error ε.The component Z N IR u that explains the variation in PVA due to NIR comprises the incidence matrix Z N IR that joins the NIR to the observations of PVA of the maize genotypes; also, u is a random vector with normal distribution N(0, σ 2 u K), where the variance-covariance K is a positive semidefinite matrix previously constructed with the NIR data. In addition, ε is the vector of random errors with normal distribution with mean zero and constant variance σ 2 e . For simplicity, we denote matrix X as the matrix of the first or second derivative of the NIRs. Thus, K models the relationships between the NIRs and is a function of X, and when K models the linear relationship between NIRs, it could be named NIRS BLUP (NB) and is computed as K = NB = XX p , where p represents the number of columns of X and the NB establishes the NIR similarity between maize lines, that is, how each cultivar is related to the others based on the electromagnetic spectrum.With the first and second derivatives of the NIR, we formed matrices NIR BLUP, NB1, and NB2, respectively, for the linear NIRs relationship. For the first and second derivatives of the matrix of NIRs, we used the Savitzky Golay function from the prospectr package [30] in R software (R Core Team, 2021). For fitting the models and making predictions, we used the BGGE function from the BGGE library [25]. As mentioned in Granato et al., 2018, the BGGE is an algorithm constructed to fit models within a Bayesian framework that uses the Gibbs sampler for the Monte Carlo Markov Chain (MCMC), which allows convergence to a posterior predictive distribution that provides the predictive values. The R codes used to analyze the data can be found in the Appendix A.The model was fit to the training dataset of 1857 genotypes and 1050 NIRS data ranging in wavelength from 400 nm to 2498 nm (see Table 1). Therefore, the training dataset was a matrix of order 1857 × 1050. The software 'prospectr ' [30] was used to compute the first and second derivative of the NIRs (X) using the Savitzky-Golay method, to better the noise from the NIR evaluation process. To evaluate the model with dataset of group 1 (1857 cultivars), we formed 50 random partitions, and in each partition, we randomly selected 70% of the data to form the training set and 30% of the data for the testing set. Additionally, we formed 50 random partitions, and, in each one, we randomly selected 60% of the data to form the training set and 40% of the data for the testing set. For both random partitions, we computed the Pearson correlations between the observed values versus the predicted ones. The average Pearson correlation across all partitions and their associated standard deviations are presented in Table 1.We performed the prediction of the 650 cultivars of group 3 (testing set) using as the training set the 1857 cultivars from group 1. The prediction accuracy (correlation between observed and predictive values) for each trait can be observed on the last column of Table 2. The second validation was performed forming 50 random samples where for each sample the training set is formed with 1857 cultivars from dataset group 1 and 8 (2%) randomly selected cultivars from group 2. Thus, the testing set comprises the 382 remaining cultivars from group 2 (382). Results of this validation are presented in the last column of Table 1. The summary statistics for each carotenoid of all the genotypes used in the calibration of the models are shown in Table 3. A wide range was observed for all carotenoids, which was expected due to the genotypic differences and environmental effects resulting from the use of samples from different environments. As expected, ZEA and LUT were the predominant carotenoids (about 42.7% of the TC; with values up to 29.06 and 10.88 mg kg −1 , respectively). Some high levels of BC were also observed (values up to 20.93 mg kg −1 , 25.2% of the TC). BCX values up to 19.16 mg kg −1 (18.59% of the TC) were found in this germplasm, most likely due to recent breeding efforts to increase BCX in the PVA biofortified germplasm at CIMMYT. Breeding for increased BCX is justified by the increasing evidence indicating that BCX is more stable and bioaccessible than BC [31][32][33][34]. Thus, the BCX concentration in this set of samples is higher compared to other reports in temperate and tropical germplasm [32,35,36]. The data ranges for BC and PVA content are similar to those previously reported in maize [3,36]. A wide range of variation in the carotenoid content ensures that NIR calibration models are robust. When the PVA breeding program was started, variation for PVA carotenoids was limited, and, as a result, many attempts to develop NIR models were not successful [3].  As expected, high and positive correlation coefficients between 13-cis-BC, BC, and 9-cis-BC with PVA were observed, because these parameters are used to calculate PVA carotenoids (Table 4). LUT and ZEA contents are correlated with each other (R 2 = 0.89) and they are also highly correlated with total carotenoids (TC) (R 2 = 0.614 and 0.719, respectively); this is because LUT and ZEA are the two major carotenoid compounds present in maize. Similar correlations were reported by Sutko et al. [37] between LUT and ZEA with TC (r = 0.69 and 0.81, respectively). BC did not significantly relate to TC (R 2 = 0.189), possibly because it is an intermediate compound in the carotenoid biosynthesis pathway, whereas LUT and ZEA are final products [37,38]. C v = 0.65-0.93) (Table 3), indicating that the calibrations were homogeneous. Based on the RPD values (above 1.5), all calibrations can provide meaningful estimates of each carotenoid [13,19] and therefore they can be very useful for PVA biofortification breeding programs.The results of the independent validation for the different carotenoids, including standard errors of prediction (SEP) and R 2 values for each trait, are summarized in Table 2. The SEP obtained in the validation were lower than their respective SD, indicating that NIRS models can predict carotenoid content in maize flour [28]. In addition, the SD/SEP ratio for all calibrations was between 2.52-5.88 (Table 2), suggesting that the calibrations were of good quality. However, the coefficients of determination were low for BC, 9-cis-BC, 13-cis-BC, and PVA (R 2 v = 0.12-0.22) and moderate to high for BCX, ZEA, LUT, and TC (R 2 v = 0.55-0.75). According to Martínez-Valdivieso et al. [28], R 2 values above 0.50 would indicate that over 50% of the variation in predicted values (carotenoid content) would be attributable to variation in NIRS data, allowing for discrimination between genotypes with high carotenoid concentration and genotypes with low carotenoid concentration. Previous studies have shown that models with an R 2 of 0.60-0.82 can be used for screening and approximate quantitative carotenoid predictions [13,28].Pearson's correlations were calculated between observed and predicted values, and for BCX, ZEA, LUT, and TC they were between 0.74 and 0.87. The data suggest that these carotenoids could be adequately predicted with NIR spectroscopy data.The package R BGGE [25] with 30,000 iterations was used for fitting the model in Equation (1). First, we fitted dataset 1 with 1857 maize samples (without discriminating for outliers). In addition to predicting all 650 maize lines (TST) using all the training sets of 1857 maize lines (TRN) (as shown in Table 2), we performed a random cross-validations study considering dataset 1, dataset 2, and both (as explained above). The results of the Bayesian prediction models are shown in Table 1. Using NIR1 BLUP, the correlation between the fitted values and the observed values for PVA was 0.91, whereas this correlation when using NIR2 BLUP was 0.90; both results are like those obtained with PLS.Table 1 shows results for PVA, BCX, and BC from the random cross-validation of dataset 1 considering 50 random samples each with a sample size of 70% for training (TRN) and sample size of 30% for testing (TST). The mean NIR1 BLUP prediction accuracy for 50 random samples (70% training and 30% testing) measured by the correlations between the observed and the predicted values was 0.88 and 0.834 for PVA and BCX, respectively, and 0.87, 0.825, and 0.825 for NIR2. Furthermore, when 50 random samples (60% training and 40% testing) were taken from the data training dataset of the 1847 genotypes for PVA, but with a TRN set of 60% and a TST set of 40%, the mean correlation between the observed and predicted values was 0.878 for NIR1 and 0.865 for NIR2. For BCX, the mean correlation was 0.829 and 0.821 for NIR1 and NIR2, respectively.The NIR prediction accuracy for 10 random samples using as TRN all data from dataset 1 (1857 maize lines) plus 8 randomly selected from the 392 maize lines (from dataset 2), with the rest of the 384 lines from dataset 2 comprising the TST, is also included in Table 1. The PVA mean correlations between the observed and the predicted value were 0.38 for NIR1 BLUP versus 0.32 for NIR2 BLUP. For BCX, the predicted value was 0.753 and 0.754 for NIR1 BLUP and NIR2 BLUP, respectively. Based on these results, the rest of the analyses were done using the NIR1 model.For BC, the accuracy of the NIR predictions NIR accuracy was very similar to those obtained for BCX except for the last case of NIR prediction using 10 random samples where the mean correlations between the observed and the predicted value were 0.395 and 0.326 for NIR1 BLUP and NIR2 BLUP, respectively.The correlations between observed and predicted values for both MPLS and Bayesian NIR linear regression models are shown in Table 2. The differences between R 2 and Pearson correlation coefficients are because the WinISI software discarded outliers, whereas the codes used for fitting the Bayesian NIR linear regression used all the data. In general, the MPLS gave a slight increase in prediction accuracy when predicting the traits of the 650 lines as compared to the results obtained by the Bayesian NIR linear regression.In a previous study, Brenna and Berardo [39] developed PLS predictions models by NIRS, for LUT, ZEA, BCX, BC, and TC content using 61 varieties of Italian yellow maize (82 samples for calibration and cross-validation and 40 samples to test the goodness of fit of the developed equations). They obtained high values for both R 2 C (0.82-0.97) and R 2 v (0.64-0.95). As the first step in our efforts to apply NIR in the breeding program for PVA biofortified maize, the reported parameters and models were used in tropical germplasm. Although the R 2 C values for LUT, ZEA, BCX, BC and TC were between 0.68 and 0.9, the R 2 v were lower: LUT (0.44), ZEA (0.5), BCX (0.48), BC (0.06) and TC (0.73). Thus, we tested alternative parameters and models and obtained higher R 2 v (Table 2) than when using the parameters described by Brenna and Berardo [37]. The poor fit of the Brenna and Berardo NIR models to the tropical germplasm dataset used in this study could be, as they pointed out, due to scarce genetic and agronomic diversity in the sample set used to develop the models. In this study, we used grain samples from a diverse set of tropical PVA genotypes from varying agronomic management practices, over 2 years. In contrast, Brenna and Berardo [39] used 61 Italian maize genotypes with narrow variation for BC (0-2.8 mg kg −1 ) and BCX (0-6.1 mg kg −1 ), compared to the ranges in the PVA samples used in this study (BC, 0.09-20.93 mg kg −1 and BCX, 0.04-19.16 mg kg −1 ). It is also worth noting that the percentage of outliers eliminated to calibrate in Brenna and Berardo [39] was 10 to 22%, except for LUT (1.3%), while in this research the percentage of eliminated outliers was between 3.61 and 4.79%.Recently, Kahrıman et al. [40] developed NIRS models for carotenoid content in yellow maize using 250 samples of landraces and breeding material improved for higher total carotenoid content (200 samples for calibration and 50 samples for validation). However, the R 2 v for both PVA carotenoids was low (0.233 for BC and 0.161 for BCX). Differences in the scanning interval (1200-2400 nm), and the range of concentrations for TC, BC, BCX, and ZEA could explain the differences in the results obtained in this study. Similar R 2 v values obtained for LUT (0.55), ZEA (0.61) and BCX (0.57) were reported for LUT, violaxanthin and BC in potato flour (0.60) and for LUT in banana flour (0.56) [41,42]. For potatoes, Bonierbale et al. [42] indicated that the developed calibrations can be used at least to differentiate samples with high, medium, and low concentrations of carotenoids. On the other hand, Davey et al. [41] mentioned that their model was unsuitable for measuring lutein content, but this was because the RPD value was <1.5.As mentioned above, for PVA breeding purposes, currently the focus is on the selection of high BCX germplasm. Using the PLS NIR model described here and selecting the top 20% BCX values resulted in the selection of more than 75% of the high BCX values according to the reference method. Such percentages increase to more than 87% if only the top 10% BCX values are selected. Thus, the prediction model can increase the efficiency and throughput of phenotypic selection in the breeding program.To meet current and future maize and other crops production challenges there is a need to increase breeding efficiency. Advances in high-throughput genotyping are providing fast and inexpensive genomic information. However, molecular breeding strategies, such as marker-assisted recurrent selection (MARS) and genomic selection still require phenotypic data [43]. Maize breeding programs focused on increasing carotenoid content around the world require robust, fast, and inexpensive methods to screen large numbers of genotypes. Liquid chromatography (HPLC or UPLC) can accurately identify and quantify carotenoids. However, this technique is slow, labor-intensive, and expensive [6,19,39]. In comparison to NIRS methodology, UPLC requires extensive sample preparation, long analysis time (24 to 26 h per sample, compared to 7 to 10 min by NIR per sample), experienced technicians, and expensive equipment and chemical reagents. NIRS offers a fast and simple screening option, with the capability to measure multiple traits at the same time. Based on estimates of our laboratory costs, the NIR analysis cost is approximately 10 times cheaper (US 4.8 per sample) compared with US 48 per sample by UPLC.Taking the general PVA breeding scheme used at CIMMYT (Figure 1), the cost of screening 1550 samples with NIR and 120 samples with UPLC would be US 7440. If the same number of samples is screened with UPLC alone, the cost would be US 80,160. Thus, the development and use of the proposed NIR models presented here may help breeding programs reduce phenotyping costs and increase throughput, especially when NIRS equipment is installed on research plot combines. High-throughput phenotyping helps breeders to quickly make evaluations and timely select the desired genotypes in the breeding populations. Although molecular tools accelerate and facilitate this process, phenotypic data are very relevant, especially in complex traits. However, phenotyping can increase the breeding process and, in some cases, could also slow down the breeding process as data can be obtained at the end of the growing cycle or just before the next planting season. NIR technology is a powerful highthroughput technology that meets the demand of plant breeding for large-scale evaluation of seed and grain composition in short periods of time. It can provide several compounds High-throughput phenotyping helps breeders to quickly make evaluations and timely select the desired genotypes in the breeding populations. Although molecular tools accelerate and facilitate this process, phenotypic data are very relevant, especially in complex traits. However, phenotyping can increase the breeding process and, in some cases, could also slow down the breeding process as data can be obtained at the end of the growing cycle or just before the next planting season. NIR technology is a powerful high-throughput technology that meets the demand of plant breeding for large-scale evaluation of seed and grain composition in short periods of time. It can provide several compounds simultaneously.Using a large and diverse set of data, it was possible to develop NIR calibration models by two methods: by using the software provided by NIR suppliers and by developing the equations independently using Bayesian models developed in R.With the NIRS models developed here, it is possible to differentiate samples with high, medium, and low concentrations of LUT and BCX. During validation, it was possible to demonstrate the selection of more than 80% of BCX genotypes with concentrations higher than 3 mg kg −1 , which is very relevant for PVA breeding programs. For ZEA and TC, NIRS models can be used for approximate quantitative predictions. In the case of BC, 13-cis-BC, and 9-cis-BC, the coefficient of determination in calibration and the RPD suggest that prediction models have the potential to be useful but must be improved.Using NIR models will greatly decrease the breeding cost and enhance the efficiency of the program. Nevertheless, for the final stage of breeding and before varietal registration, wet chemistry analysis is always recommended for more precise and accurate data."}

main/part_2/0340840727.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"6fe756174c33d81630afc0ce8ec6bea1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ecb44eda-1113-49e4-b779-efb3019931c9/retrieve","id":"-430624449"},"keywords":[],"sieverID":"c6a17201-8ce7-4ad7-b9f3-df9ebf76be41","content":"The SPHI is now in its second five-year phase, with the ambitious goal of reaching 10 million households by 2020 with improved varieties of sweetpotato and their diversified use. By December 2017, 4.5 million households have been reached. While some governments recognize the potential role of sweetpotato to improve health and wealth across a range of agro-ecologies, the number of dedicated staff working on sweetpotato related research and dissemination is still limited. The diversified use of sweetpotato by private sector processors in SSA is growing but much more remains to be done.We want to see a growing and vibrant CoP, with sweetpotato researchers, development farmers, traders, private sector processors and consumers able to obtain and apply sweetpotato knowledge effectively. We want to see an ever growing number of organizations and governments committed to the SPHI goals and sharing their strategies and lessons learned with others. Sweetpotato Support Platforms (SSPs) at the sub-regional level (East and Central Africa; Southern Africa; West Africa), started in 2010, continue to support breeding and germplasm exchange.Where are we working? The SPHI Steering Committee (SSC) comprises five donor organizations and 11 other research and development organizations committed to achieving the SPHI goal 2 . Development organizations share the number of direct and indirect beneficiaries reached annually, which are reported in the annual Status of Sweetpotato in Sub-Saharan Africa report.Knowledge and best practice is shared through the Sweetpotato Knowledge Portal, which anyone can register and contribute to, the development of tools and toolkits to facilitate standardized data collection across projects and countries, the annual production of update progress briefs on research achievements and projects, and support to four CoP technical working groups. The four CoP groups are: 1) Breeding and Genomics, 2) Seed Systems and Crop Management, 3) Marketing, Processing, and Utilization, and 4) Monitoring, Learning and Evaluation (MLE). Each group meets annually and a sub-group of the Seed Systems CoP focused on pre-basic seed has one additional meeting. We also have active information exchange through Facebook (sweetpotatoknowledge) and Twitter (@oursweetpotato).1 Kenya, Uganda, Tanzania, Ethiopia, Rwanda, Burundi, DR Congo, Zambia, Malawi, Mozambique, Angola, Madagascar, South Africa, Nigeria, Ghana, Burkina Faso, and Benin.Reaching 10 million African households by 2020    Passport to Good Health (Fig. 3). This 39-page booklet is the size of a passport and contains key facts and figures about orange-fleshed sweetpotato as well as contact information concerning where to get access to varieties and organizations belonging to the SPHI Steering Committee.• This was the first year that awards were given from the Excellence in Sweetpotato Endowment Fund set up by Jan Low with part of her award from the World Food Prize. The $500 Best Sweetpotato Scientific Paper of 2016 was awarded to Dr. Earnest Baafi of the Crops Research Institute (Fig. 4). The second $500 award for Communication for Change went to a team from Helen Keller International and SPRING, for a community video produced both in French and English promoting the use of OFSP.   "}

main/part_2/0351269018.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"0886a7819ecef50946cdae1c863b4bf4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/34a1609b-1594-4497-a50a-c774bce09b3d/retrieve","id":"344007066"},"keywords":[],"sieverID":"7504f2bc-1301-4ed1-8aed-6dd06805c488","content":"With climatic uncertainty, including floods, droughts, cyclones and heat waves, projected to increase in the future, agriculture and food security are more vulnerable than ever. This instability puts productivity, incomes and ecosystems at risk. Poor smallholder farming communities will be hardest hit.In 11 countries, Bioversity International is working through its Seeds for Needs initiative to help farmers adapt better to climate change through the use of agricultural biodiversity.The Seeds for Needs concept is simple -if an array of different crops is grown on a farm or in a landscape, farmers are more likely to be able to cope with unpredictable weather. But farmers do not always have access to information or planting material to help them choose different crops or varieties that suit their conditions.Seeds for Needs started in Ethiopia in 2009 and now has project sites in eleven countries. Cambodia: rice, sweet potato; Colombia: beans; Ethiopia: barley, wheat; Honduras: beans; India: rice, wheat; Kenya and Tanzania: sorghum, pigeon pea, cowpea; Laos: cucumber, long bean, rice, sweet corn, watermelon; Papua New Guinea: taro, sweet potato; Rwanda and Uganda: beansFarmer involved in the Seeds for Needs initiative, India. Credit: Bioversity Intenational/ C.Zanzanaini Seeds for Needs addresses both these issues by:• Exposing farmers to more crop varieties, increasing their knowledge about different traits.• Strengthening their local seed systems so they have access to seeds that fit changing needs.Farmers are directly part of evaluating and selecting varieties throughout the growing season, providing feedback on their preferred traits to scientists. Since 2011, the initiative has been using a crowdsourcing approach: each farmer is given three randomly-assigned varieties out of a broader selection to compare with their own varieties. By carrying out these mini trials with such a small number of varieties, more farmers can participate as 'citizen scientists'. The initiative is also using mobile technology as a cheap and accessible way to communicate with farmers.The Seeds for Needs initiative is now working with around 10,000 farmers worldwide. From 25,000 varieties of durum wheat and barley, 500 were short listed using geographic information system (GIS) technology and characterization. Out of this short list, farmers and scientists selected 50 to test for local adaptation.All of the 500 varieties have been made available to farmers either through established or new community seedbanks in the three regions where Bioversity International works.Seeds for Needs in India started with some 30 farmers in 2011 and has exponentially increased to 5,000 farmers through crowdsourcing. In the coming two years, Bioversity International hopes to work with over 30,000 famers, with a strong focus on increasing women farmers' access to knowledge and information.The initiative has also set up weather sensors, known as iButtons, in farmers' fields to record local temperature and humidity. This data is then compared with feedback from farmers on crop performance. Bioversity International is developing a data analysis software called ClimMob to help identify trends and give farmers feedback based on the collected data.Farmers scoring durum wheat varieties according to their preferred traits in a field trail, Northern Ethiopia. Credit: Bioversity International/C.FaddaFarmer observing neighbour's wheat trials in India. Credit: Bioversity International/C.Zanzanaini Bioversity International's Seeds for Needs initiative provides an effective and cost-efficient way to provide farmers with vital information and improve their seed systems. The aim is to test and then develop solutions at scale, ensuring more potential benefits to more farmers and their families. Now more than ever, there is the potential to create lasting solutions for resilience and climate adaptation for smallholder farming communities worldwide."}

main/part_2/0351950623.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"325bba706febaeb4cd645dde82708580","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/09ee3d95-a5a1-42de-bb78-c4ca7e35ca4f/content","id":"1522890176"},"keywords":[],"sieverID":"a0fbe026-1fd6-4f90-b3fd-6303f4cded04","content":"Aimed at agricultural research and development (AR&D) professionals working with maize and legume value chains, this resource highlights a set of issues to consider in relation to the integration of gender in value chain analysis for development. The resource draws on empirical research addressing the following two questions: (i) Where and how can maize-legume systems be scaled to contribute to sustainable intensifi cation of maize-based farming? (ii) What would the potential impacts be, in the medium term, across food systems in Mozambique?Women in Macate working together in one of the women's farm to ease labor burden. Photo: Maria da Luz Quinhentos.The study analyzed the maize and legume value chains, using a rapid assessment approach and Integrating Gender into Agricultural Value Chains (INGIA-VC) analytical framework. It focused on six villages in Macate and Angonia districts. The two districts are under the Sustainable Intensifi cation for Maize-Legume Cropping Systems for Food Security in Eastern and Southern Africa (SIMLESA) research sites. We used data from focus group discussions (FGDs) held in 2016 with men and women farmers and key informant interviews in the value chain.A total of 16 FGDs were conducted with men and women farmers totaling 169 farmers (72 men and 97 women). Specifi cally, ten FGDs were held with farmer associations. Separate focus groups were held for men and women farmers (six groups of men and four groups of women). Key informant interviews were conducted with a total of 12 processors (ten small-scale and two medium-to-large scale), four input suppliers, ten buyers/traders, and two maize breeders.The maize value chain in Mozambique involves many actors including input suppliers, farmers, traders and buyers, processors, and consumers. The legume value chain also includes input suppliers, farmers, traders and buyers, and consumers, but there are no legume processors. Below we provide a brief synopsis of the aspects of the value chains, ranging from factors of production, decision making, access to markets, and control over income and processing as provided by the respondents of the study.Land is acquired through inheritance and village allocation, but farmers can add land by buying or renting from other farmers. Customary norms and practices give advantage to men as owners of land compared to women. In Macate District, land is inherited through the male line (patrilineal), while in Angonia, land is traditionally inherited though the female line (matrilineal). Nevertheless, in most of the villages men appear to be the primary land and customary rights holders. Women's access to, and control of, land is limited.Farming is family-based and involves all household members, except the very young and very old. In most of the communities, men and women farm together performing almost the same activities. Women and men work at every stage of agricultural production, ranging from clearing land, planting, weeding, harvesting, and processing to commercialization of the produce. Moreover, women play a crucial role within the household and are responsible for seed storage, providing food, cooking and caring for the household.The only activity that women do not perform is pesticide application. It is considered dangerous for women and children to manage chemical products due to the health risks that pesticides pose.Children are involved in planting, weeding, harvest, and storage.legume is cash generating, such as soybean, men often take control of decisions and income generated.Both men and women are involved in the marketing of maize and legumes. However, cultural norms restrict women's mobility, thus reducing their access to distant and more profi table markets. Women sell their products at the farm gate and local markets in small amounts occasionally, whenever they need money for household expenses.In Macate District, respondents revealed that most women sell mainly in local markets. When the markets are far away, men take charge of transporting the products to the market, because women are expected to take care of the children and the house.Men and women farm together in the same plot and the decision about how much land is allocated to maize and legumes is made jointly by husband and wife within the household. In some cases, they have separate plots and women help with farming activities in the husband's plot.Results show that in most cases men have the fi nal decision about the maize varieties to grow, while women have some decision-making power regarding certain legumes (i.e., cowpeas and groundnuts), which are mostly for household consumption. The results show that women mostly decide about growing groundnuts and cowpeas, because they are responsible for kitchen matters and assuring that the household is fed. However, when the In Angonia District, low level of literacy and gender norms that restrict women's use of certain transportation negatively infl uence women's participation in marketing. Men mainly use bicycles and oxen carts to transport products to markets, while women have to carry loads on their heads or pay for transportation. This means that men can sell larger loads compared to women. Furthermore, men in the district revealed that they participate in marketing because they have the skills to negotiate the prices and better understand the math/accounting compared to women. The respondents added that women have low level of education, which makes them unable to read the scales well and do the mathematics involved in transactions; thus, they sometimes end up being cheated by buyers.Women in Angonia transporting agricultural products to market. Photo: Maria da Luz Quinhentos.Table 1. Constraints in maize and legume production and marketingProduction Low availability of improved seed at local market and high use of local and recycled seed.Maize and legume yields are low due to the use of low-yielding varieties and consequently farmers obtain low income.Prohibitive cost of seed and lack of money to pay for seed and other inputs.Maize and legume yields are low due to the use of low-yielding varieties and consequently farmers obtain low income.Lack of credit for inputs.Only few farmers have access to improved varieties of seeds and farmers become discouraged about adopting improved varieties.Production Women have di culties managing pesticides and women rely on men for application.Low pest control resulting in yield reduction.Marketing The literacy levels for women is low. Their inability to read and do math reduces their negotiation skills, and thus disadvantages them in market participation.Cultural and gender norms inhibit women's travel to markets: restrictions to use bicycles and oxen carts limit access to markets with larger loads.Women have to sell their produce at lower prices in small quantities at local markets (transported on head), in their houses or farm gate. This reduces the profi tability of maize and legume production, discourages expansion and limits control of income by women.Cultural norms give men the power of decision-making over the income as the household head.Women, especially in polygamous households, have less control over the income from maize and legume sales.Participation in training sessions and access to information are not fairly or evenly shared between men and women in Angonia District. The results show that men have more knowledge about maize and legume production, are more likely to participate in project programs, trainings, demonstration plots, to visit other distant farms and gain more experience compared to women. However, in Macate District, farmers believe that both men and women have the same knowledge about maize production since it is a food crop, even though, as in Angonia, men are the ones who tend to attend trainings and technical meetings on maize and legumes, while women are taking care of household matters. On the other hand, women are more knowledgeable about legumes and actively participate in all farming activities. The fi ndings indicate that promoting women's participation in the production of legumes and cash crops such as the common bean and soybean is an opportunity to empower women, increase their household income and households' food security.Lastly, farmers noted that in recent years, there has been an increase in the number of women participating in training sessions due to the activities of projects, including SIMLESA, in the villages.All the input shops were owned by married men, aged between 40 and 54 years. The inputs sold include seed, fertilizers, pesticides, and herbicides. The major challenges faced by retailers in their businesses included lack of capital to buy inputs to stock enough and satisfy customers during times of high demand, low access to credit, di culties paying back the credit due to bad harvests and low income, and bad quality of seed obtained from some seed companies. In terms of labor, there are di erences in the activities that men and women perform. Most employees were men; they perform activities that require strength, including lifting bags in loading and unloading, while women were assigned light activities including cashier and registration of products. On the demand side, women's access to sources of improved agricultural inputs is restricted because of di erent responsibilities assigned to men and women within their households and women's limited control of fi nances. Moreover, the fi ndings show the low mobility of women from villages to distant markets.In towns/cities men are the main customers of inputs, while at the village level, women are the main customers.Local processors have milling machines and are involved in the milling of maize, obtained from local households and producers. The business is dominated by men.Major challenges faced by both male and female local processors are related to failures in the machines, decrease in demand because customers cannot a ord the milling, and di culties in paying taxes. There are less customers because of higher milling prices due to growing fuel costs. At the same time, there are more and more processors and available milling facilities, competing for the customers.Moreover, decrease in business revenue makes it di cult for the processors to pay monthly taxes to the government.All local processors were operating small family businesses, and family members assist in running the business, with a small number of male employees. Few women in the villages sought work outside the household and farming, and the few jobs available for women usually entailed fetching water and cooking for male employees.The larger-scale processors need to hire labor for their business. The companies reported hiring both men and women; however, the number of men employees was higher than women in both companies with one company employing 36 people (31 men and fi ve women) and the other employing 150 people in the factory (137 men and 13 women).Most of these activities are physically demanding and require strength, and considered di cult for women to perform. Thus, there are more male than female employees. Men are considered able to perform most of the activities, and women work mainly in the reception, accounting and storage sectors.Table 2. Challenges faced in maize and legumes buying and tradingGeneral constraint Di culty in accessing credit. Buyers and traders relying on personal savings are forced to operate small-sized businesses. The majority of men and women indicated that there are di culties in accessing credit from the banks or other sources due to the small size of their business and lack of collateral. Only a very small proportion of men had acquired business loans.Gender-based constraint Women have more di culty accessing capital to startup businesses.E orts to increase women's representation at this node of the value chain must consider improving women's access to start-up businesses.Cultural norms reduce women's mobility to villages.Women have household duties and responsibilities and must stay home taking care of the house and children and are inhibited from traveling to distant villages where they can obtain larger grain supplies lower prices.Products bought in villages must be loaded and transported. In the study area, women reported not to be performing the loading work as it requires a lot of physical strength.Loading demands physical strength and women hire people to help, which increases costs and reduces profi ts. Less women buy from villages at a lower price.Women's low literacy put them at disadvantage in market participation.Their inability to read and do math reduces their negotiation skills.The participation of women in more lucrative and profi table markets is very low due to cultural norms. The results show that men were more likely to buy directly from producers in the villages compared to women. Women traders are more concentrated at the local level and only a few trade crops from the villages. In addition, women traders incur extra costs in order to hire and pay men to help them with the packaging, loading and unloading of bags, these costs are not incurred by male traders, as they themselves bag and load the crops.• Facilitate farmers' access to improved maize and legumes seeds. For adoption and expansion of improved maize and legumes to take place more e ciently and in greater quantity, it is important to facilitate the availability of improved seed and other inputs at local markets. Moreover, there is a need to support local private sector involvement in seed production, making sure that the maize and legume seeds that are produced are of the highest quality to improve yield and marketability of the harvest. In addition, there is a need to stimulate farmers' demand for certifi ed seeds, and support the delivery to farmers, especially women.• Improve farmers' access to credit for inputs:Governments and para-statal organizations in Mozambique need to start creating fi nancial products that are farmer friendly (i.e., repayment terms that are within reach of the farmers, particularly interest rates that are manageable). However, the provision of loans needs to go hand-in-hand with mentoring programs, in which well-trained and seasoned loan o cers, who have insight into the smallholder farming business in Mozambique, can train women, men, and youth farmers on e ective agricultural business practices in order for the borrower farmer to be able to pay the loan as required. Another alternative for smallholder farmers, who seek access to loans, is the pooling of resources in informal savings clubs. Farmers can form a group, make savings, and use the group savings to acquire a loan.• Access to market: There is a need to promote and increase women's access to lucrative markets and address the mobility issues. This can include working with existing women's and youth groups to strengthen their access to market opportunities, as well as related services via Information Communication Technology (ICT). In addition, strong gender trainings and policies which target male farmers need to be crafted and executed to educate male farmers about the importance of making sure that their wives/women also have an equal say in terms of the revenue collected from agricultural sells, so that women are not left behind in terms of income/fi nancial access and are able to reap the rewards of their hard labor. Village leaders need to be involved in campaigns to make sure that women are not only involved at the end of the value chain.• Access to information, knowledge and training: low levels of women's participation in agricultural extension services should be addressed. In terms of policy priorities, there is a need to tailor extension services to women's needs, and to use social networks to spread agricultural knowledge. Bringing agricultural training and advice to women's doorsteps through farmer fi eld schools and mobile phone applications, and identifying female volunteer farm advisors to spread information within women's social networks is necessary.• Increase the participation of women in project activities, including demonstration plots, fi eld days and exchange visits. Promote greater representation of women in leadership positions within the associations in order to voice women's concerns.• Focus on crops that give women advantage in terms of ownership of the proceeds and other decision-making processes. There is a potential for expansion of legumes such as soybeans and common beans. Encourage women to adopt improved legume seeds and promote value addition through processing the legumes. For instance, the processing of soybeans is important for food and nutritional security and income for the rural households.• Support women to improve their basic business skills through adult education interventions, and ensure enrolment and retention of girls in school, along with strengthening school curricula for basic life-skills.• Provide and increase access to credit services for business expansion.• Support women to be more involved in trade activities through programs, which support and educate women about the importance of being entrepreneurs in the agricultural sector, and how to trade and how to operate a business.• Encourage and support more women to start and own businesses.• Facilitate access to credit for both men and women.This "}

main/part_2/0352656545.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"73e8600034ceb50effd684d82df49a87","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/26cf0a7f-033e-4a1a-a8cb-2739c67f036a/retrieve","id":"-483791957"},"keywords":[],"sieverID":"b7f9638f-abed-429c-a84c-2152ec13e331","content":"Dr. Bhandari opened his welcome address by narrating the history of rice production in Bangladesh. During the 1970s, the country was considered a mere bottomless basket. Since then, rice production increased by 3.5 times, transforming the country into a role model on agriculture and development. However, rice farming still faces many challenges, including rice scarcity. Water management is becoming an important issue as well. With these challenges, no \"one-size-fits-all\" solution can be made. Bangladesh needs location-specific ones.IRRI's innovative technologies are part of the solution. Their AWD technique demonstrates a 30% reduction in water use and no yield loss, presenting an increase in profit. However, adoption of this technique has been slow. Dr. Bhandari hoped that this workshop would promote large-scale AWD implementation.Several advantages of using AWD include:• reduces water demand for irrigation;• reduces GHG emissions by 50%;• and presents a low-cost implementation.Dr. Salahuddin added that the primary approach of the project was to work with NW-FAN.Initially, the implementors chose the pump owners they would want to work with. Afterwards, they talked to the chosen pump owners and gave them orientation and training.The trained farmers then disseminated the technology to their fellow farmers. IRRI and the Bangladesh Rice Research Institute (BRRI) helped them in the technology dissemination.With the assistance of Network members, the farmers mapped the types of irrigation being applied and the areas where AWD could be implemented.Dr. Salahuddin added that there are 1,612,613 tube wells around Bangladesh, among which they have identified 1,400,000 wells that could adopt AWD technology. From the policy perspective, the AWD technique can contribute in at least 5 Farmers initially wanted to know whether they were actually reducing water usage or saving electricity or diesel. Whole catchment areas were mapped for potential points of AWD pipe establishment, including the level of land and the area of farm lands. Data were collected and eventually analyzed at the Hazi Danesh Institute.In the first phase, 17 shallow tube well owners started using AWD. In the second phase, 19 shallow tube well owners in 11 upazilas were included, covering 152 acres of land. By the final phase, 50 pump owners in the 11 upazilas were providing water to 800 farmers across 337 acres of land. The major goal was to connect all farmer organizations to mobilize and implement the AWD technique. Mr. Rashid added that this network could potentially turn into a union of AWD farmers. It is equally important to mobilize local governments and district irrigation committees as they provide licensing and other services to tube well owners. Encouraging agricultural entrepreneurs to use AWD technologies for agricultural crops other than rice is also essential.Dr. Salahuddin, Consultant, IRRI Dr. Salahuddin facilitated the video presentation session. Farmers in the video testified to the benefits of AWD technology, including reduction of water input. IRRI trained farmers on the use of irrigation devices and the technique, but what was especially important for the success of the project was the collaboration between farmers and pump owners.Dr. Salahuddin, Consultant, IRRI Dr. Salahuddin opened the floor to farmers and pump owners for them to share their experiences on the benefits of AWD and what they wanted IRRI to know going forward.Md. Motiar Rahman, a pump owner from Rangpur RDRS, shared that farmers were initially reluctant to use the technique. However, once they saw the benefits, they felt that it was a sustainable farming technique for generations to come.Md. Shajahan Ali, a farmer from Rangpur RDRS, shared that his yield has doubled since he started using AWD. His tiller has increased, and now he uses less water for irrigation, saving around 300 taka. Since using the magic pipe, he does not need to weed his fields as often as before. Pump owners and other farmers in the nearby villages saw his success with the AWD technique and were encouraged to adopt it.Kishory Mohan Roy, a pump owner from Rajarhat RDRS, said that 18-20 farmers from his village attended the meeting on AWD. The 18 farmers who decided to use AWD received a total of 16 magic pipes. They were initially confused as to why they had fewer pipes than other farmers, but then learned they had enough based on the landform. They were surprised at the increased tiller and yield while their water dependence decreased. The farmers tracked their progress and frequency of irrigation and compared their results with those who did not adopt the AWD technique. They found that they irrigated 6-7 fewer times and saved on diesel fuel needed to run irrigation pumps. Roy promoted AWD and convinced two more farmers to adopt it.Md. Kazi Jikrul, a pump owner, shared that farmers were initially hesitant to adopt the technology. When farmers learned that they would save on irrigation costs using AWD, they collaborated with pump owners to map out pump locations and install magic pipes.Dr. Samsuzzam gave a background on FAN and how it was conceptualized for North Bengal as a platform for organizations to work together. To confront \"monga,\" BRRI and IRRI took the lead to provide the expertise in the platform. He went on to introduce the work NIDS has been doing in Rangpur, especially in supporting this project.Dr. Samsuzzam highlighted the key benefits of AWD projects. Rangpur and Dinajpur farmers who have adopted this practice has seen high tillering. In some cases, farmers had experienced a 10-11 percent yield increase. They have reduced their frequency of irrigation, which has lowered the burning of diesel in pumps. AWD then lowers their dependence on water. On scientific terms, tiller has increased the overall rice yield. Moreover, alternate periods of drying had lowered the use of fertilizer as rice plants absorb nutrients better when paddies are not flooded.He added that AWD worked this time around under IRRI due to FAN collaboration. Knowing the benefits of the technology, he said that they should look for a way forward to sustain its benefits and ensure long-term partnership. One sustainable solution is incentivizing pump owners and the farmers. As stated in the Article 8 of their National Agriculture Policy, AWD was tried and tested already, generating fruitful results. They should ensure its popularization then. To allow more farmers to adopt AWD, Dr. Samsuzzam suggested to cap the amount of irrigation water. He cited the case of Rajshahi, where a prepaid card system is practiced to avoid the overuse of water by the farmers. He advised that they could adopt the system in the north west and license the irrigation system to ensure more stakeholders would join to save water.Dr. Salahuddin, Consultant, IRRI Dr. Salahuddin opened the floor for FAN members attending the workshop to share their feedback on AWD and their experiences.Underground water levels are decreasing every day. To keep them stable, farmers should reduce at least 30 percent of their water uptake. Farmers who practice AWD need 36 percent less water for irrigation, making it a viable solution. Furthermore, using less water is beneficial because some nutrients become available when the land is dry. Less fertilizer is required, and more tiller is produced. Overall, using less water is beneficial to produce and maintain underground water levels.To make AWD more effective, implementation of the technology should be specific. It is necessary to know the main stakeholders, farmer demands, coping systems, and the location. Clarifying AWD with pump owners is critical to ensure farmers disseminate the technology in a sustainable manner.Alauddin Ali, Udayankur Seba Sangstha, Nilphamari When we organized, there were several challenges. First of all, people wanted to use their traditional ways of farming and put too much water, as much as 3000 liters for 1 kilogram of rice. They believed that putting more fertilizer and pesticides would be better for their yields. However, if they keep going in this manner, they will not have drinking water. Farmers also do not want to reduce their water use because they are paying for a certain amount anyway.Better communication and mobility are now allowing people from one part of the country to know what is happening in another part of the country in terms of water and agricultural problems. The challenge is to change people's behaviors in the villages.To prevent farmers from blaming AWD for pests and crop losses, which occur naturally, it is important to have multiple stakeholders, such as pump owners, supporting the technology.The difference between the first time AWD was implemented and the attempt now is our approach. Now, we included more stakeholders. Alongside this, farmers were trained on the technology, generating much better results.Dr. Saiful Huda, Professor, Hajee Mohammad Danesh Science and Technology University AWD works well but the implementation and strategy have some issues. There is a law stating that by 2030, 20% of farmers will use the AWD technique, which will increase tiller, reduce irrigation and pests. We need a positive approach and more funding going forward.Abdul Al Mamun, Director, RDA, Bogra Mr. Mamun strongly believes that social engineering is a crucial method for dissemination of AWD technology. He added that mechanization of farming is essential in saving water.We should be concerned with how much groundwater is being recharged and how much water can be saved. Each district of Bangladesh is different and so are their agricultural needs. We need multiple technologies alongside AWD for a sustainable solution.When we lack data, securing funding for projects that would benefit agriculture is difficult. We need more information on the emission reduction potential of our projects, as well as their capacity to decrease pesticide and fertilizer use, to attract international funders. We need a cost-benefit analysis and coordination among local level stakeholders and the government. A long-term plan needs to be worked out rather than a project-based implementation of AWD.We must develop a mechanism to encourage farmers and pump owners to adopt AWD.Groundwater is a national asset; use should be rationed. Industry uses significant amounts of groundwater alongside agriculture. However, AWD cannot be used everywhere in an upazila. Third party independent evaluation is crucial to assess the effectiveness of AWD. We need more clarification on the benefits of the technology as economic incentives are the most attractive to farmers. Volumetric pricing over area pricing of water for irrigation is important in preventing overuse.AWD is a proven technology, yet our farmers are not willing to adopt it. A conflict of interest between farmers and pump owners has created a barrier. We have to find a mechanism to sustain AWD. Creating a pump rental system in which farmers pay for the amount of water they use with their own electricity or diesel can be a solution.Due to conflict of interest, a community-based approach to implement AWD will be more sustainable.A total of 31,200 AWD pumps have been distributed by BADC since 2009-2018. To encourage more farmers and pump owners to collaborate, they held motivational training sessions on AWD techniques. She also highlighted that land use patterns are not similar in all the areas of Bangladesh; therefore, the AWD technique has some limitations. A monitoring committee that will supervise the proper implementation of AWD technique in the field is necessary.Land leveling using a remote sensing system is important to distribute water evenly in the field, preventing accumulation in certain areas.Dr. Khaled Kamal, Chief Information Officer, AIS When a project is implemented, people tend to work with AWD, but once it is over, farmers do not continue the practice. Pump owners do not cooperate and farmers do not see the benefit. Community mobilization is then crucial to ensure the benefit of the technology persist even after the project ends.Muyeed wanted to know if there was GHG quantification on AWD versus non AWD systems in Bangladesh. He was particularly interested in methane and nitrous oxide emission and carbon sequestration levels. If so, this information should be made accessible to people.Dr. Sander addressed the queries of Dr. Muyeed. He said that there have been hundreds of studies on emissions around the world. However, there are only two in Bangladesh. They need more data. Nonetheless, it is clear how much they can save with AWD: roughly 50%. Dr. Md. Nasiruzzaman appreciated the statements made by the participants and the experience shared by farmers and pump owners. He added that reducing the amount of water used is important because groundwater levels are decreasing while salinity intrusion and vulnerability to earthquakes are increasing. Those who use groundwater will have to move when it runs low. Farmers still use too much water because they have to pay for a certain amount to pump owners up front; financially, it does not make sense to reduce consumption. If farmers had a prepaid meter system to access water instead, they would have to think more deeply about the amount they would need to farm their land.Right now, 50,000 farmers are targeted to adopt AWD, but this is not enough. More should be taught. If they learn it once, they can take that knowledge wherever they go. Why farmers do not continue or adopt the AWD technique should be researched and each Upazila Committee and pump owner should be trained on AWD and its importance. Lastly, excess use of fertilizer is another issue. Quoting granular and pill urea amounts is important in preventing too much consumption.Dr. Md. Enamul Kabir, Executive Director, RDRS Dr. Enamul Kabir started his speech by thanking all the discussants and panel members for all the great inputs and knowledge sharing. He presented his speech from the perspective of water, sanitation and hygiene as he has a long track of working in this sector. He mentioned two things, one of which is the necessity of available data. Even if it is one of the significant resources in decision making, they often lack accessible and quality data.Dr. Kabir also shared that BMDA has been performing a major role in irrigation as reflected in the 11 million tube wells that were set up in the villages. The United Nations Children's Fund had first pointed out the problem of depleting groundwater supply. Compounding this problem is the high volume of water being wasted.Aside from this challenge, he discussed about his one research where he studied 16 upazila and how many areas in them were suffering from groundwater depletion. He found out that only two upazilas were challenged with groundwater recharge problem; others were having automatic recharges. Building from these results, he thought that water recharge problem could have been controlled already if they were consuming water appropriately.He also acknowledged that Bangladesh would face the severe impacts of climate change. Emitting relatively small amounts of carbon dioxide, the country must then focus its emission reduction efforts on methane. It can be the reason why Bangladesh can be tagged as a methane contributor worldwide. Dr. Kabir reiterated the critical role of water saving technologies to address this problem.Before ending his speech, Dr. Kabir noted that various challenges and opportunities may still hamper their large-scale implementation efforts. In the next phase, they should work with more stakeholders such as upazila committees, unions, and standing committees, among others, to sustain the whole ecosystem and the human lives within it.Chowdhury, the former Agriculture Minister, any further establishment of deep tube wells was stopped. Mr. Hossain thought that this was a wrong step and only kept them from utilizing their water supply. He cited the large amounts of water from the Himalayas that are not being used by farmers in Rangpur district. The supply could have helped in increasing the groundwater levels instead of just allowing it to flow to the sea.Illegal shallow machine connection is another severe problem in different areas. The numerous illegal connections pressure the water underground. It decreases the water supply and affects soil heath.Mr. Hossain also shared an incident of women's deaths due to illegal wiring (\"Phata Tar\") of shallow machines. During his visit to the women, he was informed that only 2 pumps were set legally while 6 pumps around the original shallow machines were illegally connected. In many cases, people cut the connection of legal pumps and close their outlets. As a response, he discussed the situation with the local chairman and asked for the detection of illegal connectors and forbid them. However, this situation may continue if proper steps are not taken.Mr. Hossain mentioned holistic approaches that integrate soil types in different regions. It is also important to consider soil health improvement practices. Farmers must build this kind of mindset to protect their lands and improve soil quality. To complement this mindset, he shared various low-water hungry crops invented by BRRI and other organizations, which could be used to reduce the water usage.Nonetheless, among many problems, groundwater recharge would emerge as a severe issue in the future. Rainwater harvesting techniques will be crucial in supplying water in the farms. There are various rural-based techniques that can also be scaled to recharge groundwater. To supplement these water-saving techniques, carbon and methane emissions from the croplands must be quantified. Finally, he recommended to recruit young farmers to implement the new techniques.Dr. Saleemul Huq, Director, ICCCAD Dr.Saleemul Huq thanked all the participants, including the chief guest, special guest and guest of honor, for their valuable inputs. He stated that Bangladesh may be one of the most climate-vulnerable countries in the world, but it does not share the same risks as other countries. \"Medicines are not the same for all diseases,\" Dr. Huq said as he emphasized country-specific initiatives for their agriculture sector. A few initiatives he noted were the development of rice varieties that require less water and technological solutions for a sustainable agriculture.He brought up GOBESHONA network, which has been generating researches on climate engineering, social science, and climate change adaptation and mitigation, among others, over the last 5 years. Around 2500 articles are currently available at the Network. It also conducts an annual international climate change conference every January, where many researchers in and out the country are provided platforms to present their work. Two major objectives of the Network were to improve the accessibility of technical knowledge to the general public and the sustainability of projects.Dr. Salahuddin from IRRI would hold a session on AWD technique next January. He proposed to explore climate financing opportunities from global donors and see if they could quantify the methane gas emissions to \"sell\" in the global market. He also suggested to the Government of Bangladesh to revisit and revise, if necessary, the Bangladesh Climate Change Strategy and Action Plan (BCCSAP).Dr. Huq said that steps would be taken to include AWD and methane gas emission plans in the revised BCCSAP to accelerate broader implementation. He finally stated that unless we adopt a coordinated plan, it would be hard to reach a goal. It is then crucial to follow a coordinated approach in the climate change sector to obtain sustainability in farming.Bjoern Ole Sander thanked everyone for their kind participation in making the workshop successful. On behalf of IRRI, Dr. Sander expressed his gratitude to the chief guests, panel members, partners, government organizations and the farmers for their significant contribution in the implementation of the project."}

main/part_2/0388418472.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"8b8d7d3e71be4d22cd9ca009bbc5fa21","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/43a8fd82-ce77-40f4-8476-3cdc23b4ea6c/content","id":"-637574041"},"keywords":["Diuraphis noxia","Russian wheat aphid","distribution","damage rate","wheat"],"sieverID":"0b0236b3-7cb7-47b1-acdc-f7c887b8eeb6","content":"The Russian wheat aphid, Diuraphis noxia (Kurdjumov) (Hemiptera: Aphididae), is one of the most economically important and widely distributed pests of wheat in the world. In 1962, D. noxia caused crop losses between 25 and 60% in the central province of Konya, Turkey. In this study, the current status of the pest in wheat-producing areas of Turkey was investigated along a route from Izmir to Manisa,Russian wheat aphid, Diuraphis noxia (Kurdjumov) (Hemiptera: Aphididae), is one of the most damaging pests of small grains in the world. The presumed area of origin of D. noxia is central Asia (Stary, 1996;Lukasova et al., 1999;Stary et al., 2003) and the Caucasus region bordered on the north by Russia, on the west by the Black Sea and Turkey, on the east by the Caspian Sea, and on the south by Iran (Kazemi et al., 2001;Pathak et al., 2007). D. noxia was first reported in 1901 in the Crimea (Kovalev et al., 1991), and spread from the original site of its accidental introduction to the former Soviet Union (Moldova and Ukraine) in 1912, South Africa in 1978 (Walters et al., 1980), Central America (Mexico) in 1980 (Gilchrist et al., 1984), USA in 1986 (Stoetzel, 1987;Webster et al., 1987) and Canada in 1988 (Kindler and Springer, 1989). Grain production in South Africa and the United States has been limited by D. noxia since being introduced (Stoetzel, 1987;Shufran et al., 2007;Liu et al., 2010). In Egypt, Sudan and Ethiopia, D. noxia had been a minor pest until it flared up in Kenya in 1995 where it has remained the most important pest of wheat and barley (Pathak et al., 2004). D. noxia has also spread to Central Europe from its area of origin (Lukasova et al., 1999). Various populations of Russian wheat aphid, now widely distributed in South Africa, French and Central and North America, have a common ancestral origin from Turkey (Puterka et al., 1993). Classification of their geographical and genetic distance indicated random establishment by commerce rather than migration. The same ancestral origin was identified for the French population, which was attributed to the presumed spread of Russian wheat aphid from the east to west Mediterranean area (Puterka et al., 1993). Turkey is therefore geographically important for the distribution of D. noxia.Two expansion routes for the spread of D. noxia in Central Europe were suggested by Stary (1999). The first route may originate in the Ukraine, extending to Moldovia, Romania, Serbia and Hungary. The second route may originate in Turkey, extending through Macedonia to Serbia and Hungary. In Turkey, D. noxia was first recorded in Bitlis province in 1959 and a few years later in Isparta and Ankara provinces, wider areas of Central Anatolia and some areas of Adiyaman and Malatya provinces (Tuatay and Remaudière, 1964). Crop losses ranging from 25 to 60% were caused by the pest in Konya province in 1962 (Duran and Koyuncu, 1974;Altinayar, 1981).D. noxia causes longitudinal chlorotic streaks, spike deformation, leaf rolling and stunting in the host plant, which results in lower grain yield and poor grain quality (Fouche et al., 1984;Stary, 1999;Smith et al., 2004). D. noxia has limited grain production in South Africa and the United States since it was being introduced (Stoetzel, 1987;Shufran et al., 2007;Liu et al., 2010). The pest generally prefers drier sites, poorly fertilized or neglected fields, especially border areas or those where plants are widely spaced or relatively weak owing to lower fertilization and/or drought (Stary, 1999).)New biotypes of D. noxia discovered in several important wheat-producing countries have damaged wheat varieties that were previously considered resistant (Haley et al., 2004;Mirak et al., 2004;Smith et al., 2004;Burd et al., 2006;Tolmay et al., 2007).This research was conducted to determine the current status of the Russian wheat aphid in major wheatproducing areas of Turkey. The aims of the study were to: 1) determine the distribution of Russian wheat aphid, 2) identify wheat-producing areas with potential yield losses due to this pest, and 3) provide a guideline for grain industries in Turkey. Information from this study should assist government agencies and wheat breeding companies in developing strategies for minimizing yield losses due to Russian wheat aphid.This study was carried out throughout the major wheat-producing areas of Turkey in May 2010. One-hundred wheat fields were surveyed along a transect of approximately 1900 km from Izmir to Manisa, Usak, Kutahya, Eskisehir, Aksehir, Ankara, Konya, Aksaray, Nevsehir and Yozgat. The area around Erzurum was also surveyed. Along the survey route, a wheat field was examined every 20 km. Five to ten random plant samples were evaluated in various parts of each field. Records of occurrence, population Turanli et al. 5397 density, percentage of infestation and damage rate of D. noxia for about 50 plants were taken from each field. The GPS co-ordinates and altitude of each field were recorded and the distribution was plotted on a map.Plants were checked visually for damage symptoms in each field and the field was recorded as infested (at any level) or uninfested (no symptoms). When symptoms were detected, more detailed data on population density, percentage of infestation and damage rate were taken which were as follows: longitudinal chlorotic streaks, spike deformation, leaf rolling and stunting in the host plant.Aphid population density was graded on a scale of 1 to 3 where 1 = 1 to 10 individuals, 2 = 11 to 100 individuals and 3 = >100 individuals per plant (Jankielsohn and Oelofse, 2010).The percentage of D. noxia infestation was calculated by evaluating 50 plants within each field. It was scored low if the infested plants were 1 to 10%, medium 11 to 30%, high 31 to 50% and very high 51 to 100% (Jankielsohn and Oelofse, 2010).Damage caused by the pest was determined using a 1 to 5 scale where 1= no damage, 2= chlorotic spots on leaves, 3= striping on leaves, 4= rolling of leaves and 5= dead plant (Jankielsohn and Oelofse, 2010).Observations were made in different parts of each field to determine the main and alternative host plants of the pest.D. noxia occurred in 58 of the 100 fields surveyed; wheat fields in the vicinity of Izmir, Manisa, Usak, Kutahya, Eskisehir, Aksehir, Ankara, Konya, Aksaray, Nevsehir and Yozgat were infested. None of the sampled fields in the vicinity of Erzurum were infested; it was the only uninfested province in the whole survey area (Figure 1). The co-ordinates and altitude of each field are shown in Table 1.The population density of D. noxia was low (1 to 10 individuals per plant) in 23 fields, medium (11 to 100 per plant) in 22 fields and high (>100 per plant) in 13 fields (Table 1). Numerous factors may influence the population density of D. noxia at different localities including environmental factors such as temperature, rainfall, humidity and growth stage of the plant. In most of the sampled fields, the wheat plants were at the heading stage. Wheat plants at or before the flag leaf stage generally had larger populations of D. noxia and a higher percentage of infestation (Figure 1 and Table 1).The percentage of infested plants was low (1 to 10%) in 31 fields, medium (11 to 30%) in 12 fields, high (31 to 50%) in three fields and very high (51 to 100%) in three fields. In nine fields, the pest was sampled on alternative host plants such as volunteer oats and Alopecurus myosuroides (Poaceae). The percentage of infestation was very high in all fields where the growth stage was at or before flag leaf stage (Table 1). At this growth stage, wheat is more vulnerable to infestation than at later growth stages and the pest can spread quickly through the crop.The damage score was three in 40 of 58 infested localities, and four at 13 localities with noticeable leaf rolling (Figure 2). This damage coincided with high population density and high percentage infestation (Table 1).In this survey, most of the D. noxia (71%) was collected from bread or durum wheat; 10% from barley, 8% from volunteer oats (Avena fatua), 6% from volunteer wheat, 4% from false barley (Hordeum murinum) and 1% from natural grasses. Alternative host plants are important for the survival of Russian wheat aphid when wheat is not available for feeding. Volunteer oats and wild barley that were abundant in and around many of the wheat fields can serve as alternative hosts. D. noxia was also sampled from a grass species, A. myosuroides which had purple streaking as a result of feeding damage. It is a common plant in wheat-growing areas and may be a good alternate host plant for the pest.This paper presents the results of a survey of Russian wheat aphids including sampling locations, varieties and developmental stages of host plants, infestation and damage rates. According to previous studies, the distribution of the pest D. noxia in Turkey has been limited to central Anatolia (Isparta, Ankara, Adiyaman, Malatya and Konya) (Tuatay and Remaudière, 1964 1993). However, in the survey conducted here, Russian wheat aphid occurred in nearly all (85%) wheat-producing areas in western and central Anatolia. Konya, Eskisehir and Yozgat provinces, which are the main wheatproducing areas, were densely populated with Russian wheat aphid. Wheat is the major agricultural crop in these regions and the presence of this pest is significant and poses a high risk for significant yield losses. This study showed that population levels of the pest on young plants were usually higher than the older plants. Generally, mature plants had less damage and infestation than young plants. D. noxia was more common in wheat fields at higher than 850 m (Table 1). The damage and infestation rates were also higher especially in wheat fields higher than 950 m. Our results were parallel with the findings of Haile (1981). In the aforementioned study, D. noxia was widespread in all the barley and wheat growing areas of Ethiopia in 1976 and was considered to be the leading pest of cereals in the highlands of Ethiopia. Behle and Michels (1990) further reported that nymph production was optimal at temperatures between 5 and 20°C, and the nymph production was at peak at 4 nymphs per day. This temperature range was also typical at continental climate and high altitudes between 800 and 1200 m during the growing season of wheat in central Anatolia.In a study comparing the occurrence of D. noxia between localities and years (1989 and 1990 growing seasons) in Konya province, the pest was present in small numbers during autumn 1989 but increased to epidemic levels at the end of wheat heading in 1990 (Elmali, 1998). Du Toit and Walters (1984) reported yield losses between 35 and 60% as a result of damage from D. noxia in South Africa, and they also found that, wheat plants were most sensitive to infestation by D. noxia from flag leaf stage to flower initiation. In another study, yield per plant was significantly reduced by infestation during the heading stage (Girma et al., 1993). The population density of Russian wheat aphid in the Czech Republic increased in crops in late June and early July, after which aphids left the maturing wheat plants (Stary, 1999).A study conducted in Konya province in 1962, reported that injury levels from D. noxia were relatively low but this was attributed to unsuitable conditions for wheat growth during the period when the pest population was increasing. Once the pest population had increased, crop losses caused by the pest ranged from 25 to 60%, indicating that the pest can cause high crop losses when conditions are suitable for the pest (Elmali, 1998).During surveying in the present study, it was observed that sowing date may be an effective cultural practice for controlling damage by D. noxia during epidemic periods. In late-sown (January, 2010) wheat (Sample 73 in Table 1), 60% of plants did not produce any spikes due to damage from Russian wheat aphid. This finding was similar to that of Elmali (1998) who revealed that Russian wheat aphid populations were three times higher on latesown (January) than early-sown (October) wheat. It can be concluded that sowing date is a crucial cultural control method for D. noxia. It is important to identify possible alternative host plants in any pest control program.In this survey, alternative host plants of Russian wheat aphid were observed, for example, wild and volunteer wheat and barley, as found by Elmali (1998). In that study, it was suggested that the pest moved to Hordeum murinum L. sp. glaucum, Phalaris spp. and volunteer wheat and barley plants which were the main sources of infestation for winter wheat. These plants were an accepted source of new infestation in the following wheat season. In another study, Agropyron cristatum, Bromus tectorum, Elymus canadensis and ThinopyrumTuranli et al. 5403intermedium were recorded as non-cultivated grass hosts at field sites where specimens of the pest were collected (Aubrey et al., 2009). The importance of Russian wheat aphid in North America has increased because they can survive on a broad range of grasses that can grow throughout barley and wheat producing areas (Kindler and Springer, 1989). In the Czech Republic, during the post-harvest period in summer, D. noxia was often found on volunteer small-grains in stubble fields and to a lesser degree on nearby weed grasses. In the following year, new populations appear from those host plants from mid-September to mid-or late-October. Wheat, barley and triticale were identified as host crop plants and H. murinum was the only wild host plant established (Stary, 1999).In conclusion, D. noxia can increase rapidly when environmental conditions are favorable, and reach damaging levels. In addition to its damage through feeding, Russian wheat aphid can also act as a vector of plant pathogenic viruses including Barley Yellow Dwarf Virus, Barley Mosaic Virus, and Sugarcane Mosaic Virus (Damsteegt et al., 1992). Damage caused by D. noxia can also change due to the development of new and more virulent biotypes. Since D. noxia has become a widespread and a significant pest of small-grain-growing areas of the world, it is important to work on a global management plan. Identifying the distribution of D. noxia in different areas of Turkey will also be an opportune time to search for new genetic resources conferring resistance to the pest, which would play a key role in breeding new commercial wheat cultivars for Turkey."}

main/part_2/0390706891.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"3fca127bbaae4291a05b13fad4025f2e","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/6ab5c4cc-3d47-49ad-9c75-53dfbd67f295/content","id":"-1367090553"},"keywords":[],"sieverID":"87bfc434-2a0a-4b77-a4d0-a33ebfe0d7be","content":"CIMMYT®) (www.cimmyt.org) es un organismo internacional, sin fines de lucro, que se dedica a la investigación científica y la capacitación relacionadas con el maíz y el trigo en los países en desarrollo. Basados en la solidez de nuestra ciencia y en nuestras asociaciones colaborativas, generamos, compartimos y aplicamos conocimientos y tecnologías con el objeto de incrementar la seguridad alimentaria, mejorar la productividad y la rentabilidad de los sistemas de producción agrícola, y conservar los recursos naturales. El CIMMYT recibe fondos para su agenda de investigación de varias fuentes, entre ellas, del Grupo Consultivo para la Investigación Agrícola Internacional (CGIAR) (www.cgiar.org), gobiernos nacionales, fundaciones, bancos de desarrollo e instituciones públicas y privadas.El CIMMYT y los autores expresan su reconocimiento por los fondos designados para la edición de este manual mediante el proyecto del Fondo Mixto del Consejo Nacional de Ciencia y Tecnología (CONACYT) -Estado de México, con clave EDOMEX-2005-C01-10, titulado \"Tecnologías integrales para reducir las pérdidas en postcosecha de maíz en el Estado de México\".© Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT) 2007. Derechos reservados. Las designaciones empleadas en la presentación de los materiales incluidos en esta publicación de ninguna manera expresan la opinión del CIMMYT o de sus patrocinadores respecto al estado legal de cualquier país, territorio, ciudad o zona, o de las autoridades de éstos, o respecto a la delimitación de sus fronteras. El CIMMYT autoriza el uso razonable de este material, siempre y cuando se cite la fuente.El grano de maíz es una fuente importante de carbohidratos y proteínas para la gente de escasos recursos en el mundo. Sin embargo, existen factores que limitan su producción, entre ellos, los insectos, los roedores y las enfermedades, que no sólo menguan los rendimientos al alimentarse del grano, sino que lo contaminan y reducen su calidad.Las variedades de maíz con resistencia a plagas son conocidas desde hace tiempo por los agricultores. Los programas de mejoramiento han seleccionado variedades resistentes a las plagas y las enfermedades más importantes que afectan el cultivo de maíz en el mundo. Existen asimismo prácticas locales y tecnologías alternas que contribuyen a disminuir el ataque de las plagas y reducen las pérdidas durante el almacenamiento en ambientes adversos. Desafortunadamente, muchas de estas nuevas tecnologías y prácticas no están al alcance de los agricultores mexiquenses, a quienes beneficiarían enormemente.El objetivo de este manual es proporcionar al lector una guía para identificar las plagas más comunes, para aplicar tecnologías alternas en su manejo (insectos benéficos, prácticas tradicionales, variedades resistentes y su evaluación a nivel local) y, finalmente, para que pueda adoptar prácticas preventivas que contribuyan a reducir las pérdidas asociadas con las plagas en almacén.Los insectos se convierten en plagas cuando el tamaño de la población o los daños que causan, o ambos, exceden los valores normales. A estos límites se les conoce como umbral de daño económico, el cual constituye una amenaza para las cosechas y un riesgo para la inversión del agricultor (Figura 1).Las plagas son capaces de infestar el maíz en cualquiera de las etapas de desarrollo y durante el almacenamiento; atacan cualquier parte de la planta, incluso el grano, y se les asocia a enfermedades y otros riesgos sanitarios, como la presencia de hongos y toxinas. El maíz almacenado es una fuente ideal de alimento para los insectos, que están adaptados a situaciones de confinamiento.Figura . Ataque típico de Sitophilus zeamais a granos de maíz almacenado.En el caso del maíz, las plagas de almacén causan pérdidas de rendimiento, disminución del valor comercial, pérdidas de calidad en el grano y del valor nutritivo del mismo. Esto, de manera directa, reduce los ingresos del agricultor y su familia y pone en riesgo su seguridad alimentaria.Los insectos suelen tener distintos e importantes estados de desarrollo, dependiendo del tipo de metamorfosis; sin embargo, puede decirse que los principales estados son huevo, larva o ninfa, pupa o crisálida y adultos (Figura 2).Los insectos tienen tres regiones bien definidas: cabeza, tórax y abdomen. La aparición de plagas en poco tiempo se debe a la elevada tasa de reproducción de los insectos, a su tamaño pequeño y a su amplia capacidad de adaptación y supervivencia.El grupo de las palomillas (gusano elotero, cogollero, barrenadores y palomillas de almacén) y los escarabajos (gusanos de raíz y de alambre, gallinas ciegas, gorgojos y barrenadores del grano) son algunos de los insectos más importantes y que más daños causan al maíz. Estas plagas atacan los cultivos durante el desarrollo de la planta o durante el almacenamiento.Este manual contiene una descripción de las plagas de almacén de mayor importancia, así como información sobre algunas plagas secundarias asociadas al periodo de almacenamiento. Para facilitar su identificación, se incluyen imágenes de insectos en las etapas en que causan mayores daños.En esta guía se hacen recomendaciones específicas y generales de medidas de control y tecnologías asociadas para cada plaga, las cuales han sido generadas en los últimos 12 años por la Unidad de Entomología del CIMMYT. En cuanto al control, éste puede ser de tipo biológico (enemigos naturales de las plagas, usualmente denominados parasitoides o insectos benéficos), cultural (prácticas ancestrales que los agricultores aplican en forma ordinaria) o químico (aplicación de químicos sintéticos y fumigación). Asimismo, se dan ejemplos de variedades de maíz con resistencia a diferentes plagas, con base en el conocimiento de la resistencia natural de la planta huésped.Las plagas de insectos varían de acuerdo con la región, la estación del año y el sistema y el periodo del almacenamiento. Por ejemplo, se consideran plagas primarias aquellos insectos que atacan el grano integro, sin daño previo. Son las más importantes durante el almacenamiento; sus fuentes de alimento son limitadas y mueren cuando éstas se agotan o cuando las poblaciones alcanzan altos niveles. Los insectos de esta clase pueden sobrevivir en los residuos de grano dentro de la estructura de almacenamiento. En muchos casos los daños que provocan comienzan en el campo, antes del almacenamiento. Dentro del grupo de plagas primarias se encuentran el gorgojo del maíz (Sitophilus zeamais), el barrenador grande del grano (Prostephanus truncatus) y la palomilla de los granos (Sitotroga cereallela). Las plagas secundarias, por el contrario, no atacan los granos íntegros, sino que se alimentan de aquellos que ya han sido dañados por plagas primarias o sometidos a manejo o procesamiento. Las plagas secundarias tienen una variedad de alimentos más amplia y es posible que hagan su aparición en estadios muy tempranos de almacenamiento. Sin embargo, los daños no se consideran de importancia hasta que son causados por plagas primarias. Entre las plagas secundarias se encuentran la polilla bandeada (Plodia interpuctella), el escarabajo castaño (Tribolium castaneum) y el barrenillo de los granos (Rhyzoperta dominica).Un grano de maíz consta de tres estructuras:• Pericarpio, la capa externa o cascarita del grano.• Endospermo, la parte donde se encuentran los nutrientes del grano: almidón.• Embrión, la parte de la semilla de donde emergen nuevas plántulas, ricas en proteínas, grasas y vitaminas (Figura 3). ¿Cómo es el insecto?El gorgojo adulto mide entre 3.3 y 5 mm de largo; es de color pardo negruzo o rojizo; su cabeza se proyecta en forma de pico y su tórax es alargado y cónico, con manchas ovales en el dorso (Figura 4).Su distribución es mundial, aunque afecta mayormente a las zonas tropicales y subtropicales húmedas, y también se le encuentra en zonas templadas. En el Estado de México se localiza en las zonas sur y noroeste. ¿Cuándo ataca y qué daños causa?Estos insectos infestan las mazorcas en el campo durante el secado del grano y antes de la cosecha, o cuando el grano es almacenado.Los mayores daños al grano los ocasionan las larvas y los adultos. Los adultos perforan el grano para ovipositar, mientras que las larvas forman surcos en el endospermo al alimentarse (Figura 5). La presencia del gorgojo favorece el ataque de otros insectos. Cuando hay mucha humedad y los insectos atacan el grano, se crea un foco de infección que ocasiona calentamiento en el maíz y, en consecuencia, fuertes infestaciones. Las hembras depositan sus huevos en perforaciones que hacen en el grano y luego los cubren con un mucílago transparente. Una hembra produce hasta 250 huevos en su vida reproductiva. Las larvas (Figura 6a) se alimentan del endospermo del grano, hasta que se transforman en pupa (Figura 6b).Cuando se convierten en adultos, perforan el grano y salen al medio ambiente. Su ciclo de vida depende de la temperatura, pero varía entre 30 y 113 días. En zonas templadas hay de 2 a 3 generaciones por año. Existen varias opciones para controlar el gorgojo del maíz, la cuales se presentan en seguida en forma abreviada. Para mayor información, se recomienda ver el apartado de métodos de control.El enemigo natural del gorgojo es una avispita perteneciente a la familia de los Pteromalidae, la Hymenoptera, que comúnmente se encuentra en el maíz almacenado, junto con la plaga.Se le identifica fácilmente porque es pequeña y tiene una tonalidad verde metálico (Figura 7). Estas avispas no deben eliminarse.La avispita actúa de la siguiente manera: primero localiza la galería que formó la larva del gorgojo (Figura 6); después, introduce su ovipositor en el pericarpio y coloca un huevecillo muy cerca de la larva del gorgojo; eclosiona y se ancla a su hospedante. La larva de la avispa (b) se desarrolla a expensas de su hospedero (Figura 8). Por último, la avispita emerge después de 14 días. La larva del gorgojo muere. Prácticas tradicionales. Para el gorgojo del maíz se recomienda aplicar mezclas de agentes protectores (cal, tierra diatomea o tizate) entre capa y capa de grano, o vaciar los agentes y mezclarlos con el grano. En pruebas de laboratorio y campo se ha demostrado que evitan el libre movimiento de los insectos, ya que las sustancias se adhieren a su cutícula, causándoles serios daños y en algunos casos la muerte. Se recomienda además el uso de las siguientes plantas como agentes repelentes: epazote común, harina de chícharo, hojas de eucalipto, hojas del árbol Neem u hoja de maravilla que pueden reducir hasta en un 25% la presencia del gorgojo. Para la preparación adecuada de estos agentes, así como detalles de los mismos, véase la sección de plantas y minerales.En casos de infestaciones importantes, se recomienda fumigar con agentes como fosfuro de aluminio (fosfina). Para su aplicación dirigida y segura, véase la sección fumigantes-insecticidas.Variedades resistentes. Existen variedades nativas y criollos con resistencia al gorgojo, entre los cuales se cuentan accesiones de Sinaloa y Yucatán, y de regiones del Caribe. En el Estado de México se pueden conseguir variedades comerciales con niveles de tolerancia aceptables.Barrenador grande del grano (Prostephanus truncatus H.)Figura . Barrenador grande de granos, barrenador del maíz, gorgojo chato, Prostephanus truncatus.El adulto se reconoce por la forma cilíndrica y alargada de su cuerpo, con terminación en cuadro; mide de 3 a 4 mm de longitud; es de color café rojizo a café oscuro, con fino punteado. Una característica peculiar es que el protórax cubre la cabeza del insecto como si fuera una capucha.Los barrenadores se encuentran principalmente en Norteamérica, Mesoamérica y América del Sur, aunque también se han detectado en África. En el Estado de México están presentes en las zonas norte, centro y oriente. Son originarios de los bosques, donde infestan diferentes tipos de madera. Con el advenimiento de las prácticas para almacenar grano en estructuras de madera, los insectos se han desplazado a los almacenes de grano de maíz.Los barrenadores voladores infestan tanto el grano almacenado como las mazorcas maduras, en el campo o durante el secado del maíz. Pueden atravesar la cubierta de la mazorca y taladrar el olote.La característica principal del ataque de este insecto es la gran cantidad de polvillo parecido a la harina que los adultos producen al taladrar y alimentarse de los granos (Figura 10). Los granos dañados se identifican fácilmente porque están cubiertos de una película de polvillo. En infestaciones severas los adultos pueden llegar a dañar las estructuras de madera o los contenedores de plástico. Es considerada como la plaga que más pérdidas y daños causa.Figura. 0 Ataque característico de P. truncatus en mazorcas.¿Cómo se desarrolla la infestación?Los barrenadores desovan en el grano o en el polvillo que producen. Una hembra de barrenador produce hasta 400 huevos en su vida reproductiva, con una tasa de incremento de la población de 40 veces/mes. En su estado larval se alimentan de grano o del polvillo de los granos que infestan (Figura 11). Después se transforman en pupas dentro de los granos; para salir, los adultos hacen un orificio en la cubierta. El tiempo de desarrollo completo va de 4 a 6 semanas y pueden alcanzar una longevidad de hasta 34 semanas (Figura 12).Figura . Larvas de P. truncathus en grano de maíz infestado.A continuación se proporcionan algunos ejemplos de cómo controlar el barrenador del grano. Para información general, véase el apartado de métodos de control. ¿Cómo es el insecto?Son pequeñas palomillas de color amarillo a grisáceo, que miden de 6 a 9 mm de longitud y cuya expansión alar es de 13-19 mm (Figura 14). Sus alas anteriores son de color amarillento con puntos pequeños e irregulares (a); las alas posteriores son más pequeñas y de color uniforme (b). Ambos pares de alas tienen flecos de pelo en el margen distal. La distribución de este insecto es mundial pero se concentra en zonas tropicales y templadas. En el Estado de México se localiza en mayor proporción en la zona norte, centro y oriente.Estos insectos pueden infestar los cultivos en el campo, pero es más frecuente encontrarlos en almacén. Atacan todo tipo de cereales, sobre todo maíz y trigo. La presencia de la palomilla se detecta fácilmente al mover las mazorcas o el grano almacenado. Las larvas perforan el grano y se alimentan en su interior. El daño que causan en las mazorcas tiene una apariencia muy peculiar, que semeja pequeñas ventanas de edificios (Figura 15).Figura . Daño típico de S. cerealella en mazorcas de maíz ¿Cómo se desarrolla la infestación?Las palomillas tienden a poner huevos parecidos a escamas en grupos (Figura 16), que cambian de blanco a rojo al acercarse la emergencia de la larva.La hembra pone un promedio de 150 huevos. Las larvas recién nacidas son diminutas y blancuzcas. Las larvas horadan los granos y completan su desarrollo en el interior, hasta la emergencia del adulto.A continuación se presentan algunos ejemplos para el control de la palomilla. Para información general, véase el apartado de métodos de control.Control biológico. La avispa Pteromalus cerealella es el parasitoide de S. cerealella; su acción es muy efectiva y, además, ayuda a disminuir la presencia de otras plagas asociadas (Figura 17).Prácticas tradicionales. Normalmente las palomillas se introducen en los granos por los pequeños huecos que hay entre uno y otro. Un sistema sencillo de control consiste en mezclar los granos con arena o cenizas. Como las palomillas son muy frágiles y no pueden introducirse en materiales compactos, al usar este método sólo podrán dañar una delgada capa de grano.Control químico. En casos de infestaciones importantes se recomienda hacer fumigaciones residuales y preventivas. Véase la sección de fumigantes-insecticidas.Variedades resistentes. Existen variedades nativas y criollos con resistencia a las palomillas. En el Estado de México se pueden conseguir variedades comerciales con niveles de tolerancia aceptables.Figura Avispita Pteromalus cerealella.En su estado adulto es una palomilla con expansión alar de aproximadamente 1.9 cm. Se diferencia fácilmente de otras palomillas de granos almacenados por las tres franjas en sus alas: una angosta de color café rojizo y una más ancha del mismo tono, separadas por otra de color blancuzco, ésta última a un tercio de la base de las alas.Figura . Polilla de la fruta seca, palomilla de la harina, palomilla bandeada, Plodia interpunctella.Palomilla india de la harina (Plodia interpunctella H.)¿Dónde se encuentra?La distribución de este insecto es mundial. En el Estado de México se localiza en mayor proporción en las zonas norte y oriente.Ataca una gran cantidad de alimentos secos y cereales confinados en depósitos, almacenes, silos y molinos. El mayor daño lo causan las larvas, debido a que devoran el embrión del grano y dejan excremento visible en esa región (Figura 19). Provocan daños secundarios cuando las larvas comienzan a formar una red densa de seda, que da un aspecto desagradable a los granos.Figura . Daño típico causado por P. interpunctella.La hembra pone de 60 a 300 huevos, aislados o en grupos, en los granos almacenados que le servirán de alimento. Las larvas del último estadio son muy activas (Figura 20), por lo que salen del interior de un grano para desplazarse a otro, e incluso ascienden por las paredes del contenedor. Las larvas completamente desarrolladas forman pupas (capullos blancos y sedosos) en la parte exterior de la masa del grano.Figura 0. Larva (izquierda) y pupa (derecha) de P. interpunctella.Control biológico. La avispa Bracon hebetor es un ectoparásito que se alimenta de larvas de P. interpunctella; suele ser más común en zonas tropicales y subtropicales (Figura 21); completa su ciclo de vida en 14 días. Detecta la presencia de su presa mediante compuestos volátiles que emanan de las heces fecales y secreciones mandibulares de la larva.Control químico. En casos de infestaciones importantes se recomienda fumigar. Véase la sección de fumigantes-insecticidas.Variedades resistentes. Existen variedades nativas y criollos con resistencia a esta clase de palomillas. En el Estado de México se pueden conseguir variedades comerciales con niveles de tolerancia aceptables.Gorgojo castaño de la harina (Tribolium castaneum H.) ¿Cómo es el insecto?El adulto es delgado y mide de 3 a 4 mm de largo; es de color que va de rojizo castaño a marrón negruzco. Se le identifica por los últimos tres segmentos antenales, que son proporcionalmente más anchos y mejor definidos que los anteriores.Las larvas son alargadas, de color blanco cremoso hasta tornarse amarillo marrón, y generalmente miden de 5 a 6 mm de longitud.Suele considerarse una plaga secundaria y se asocia con la presencia de plagas primarias. En clima frío solo se le encuentra en recintos donde haya calor. Los adultos y las larvas se alimentan ya sea de granos o harinas almacenados, o de vegetales secos en molinos y silos. Los productos que son infestados por gorgojos castaños despiden un olor fuerte y se tiñen de color marrón, lo cual hace que sean poco aprovechables.Es difícil detectar los huevos ya que son depositados de manera aislada en los granos. La hembra pone un promedio de 350 a 400 huevos durante más de un año. El desarrollo total tarda de siete semanas a tres meses. La larva se transforma en pupa dentro del producto infestado. El adulto puede volar y vivir más de tres años.Control biológico. Este insecto tiene una marcada tendencia caníbal y es depredador de huevecillos y larvas de otras plagas de almacén, incluso de parasitoides como Bracon hebetor.Control químico. En casos de infestaciones importantes se recomienda fumigar. Veáse la sección de fumigantes-insecticidas.(Rhyzoperta dominica F.)El adulto mide de 2 a 3 mm de largo; es de color pardo rojizo o negruzco; su cuerpo es cilíndrico y alargado, pero su cabeza y protórax son curvados (los tres últimos segmentos son antenales, triangulares y aplanados). Las larvas tienen cuerpo blanco y cabeza marrón. Las pupas son blancas y se vuelven oscuras cuando el adulto está a punto de emerger.Figura . Barrenador pequeño de los granos, taladrillo de los granos, Rhyzoperta dominica.En zonas tropicales, subtropicales y templadas donde existen depósitos con temperaturas adecuadas. Se le considera una plaga secundaria y los daños que causa se asocian con la presencia de plagas primarias.Infesta diversos granos, pero ataca principalmente al maíz y el trigo. En el caso del trigo se le considera una plaga primaria porque deteriora los granos enteros. Los daños más comunes son perforaciones irregulares y formación de polvillo.La hembra oviposita entre 300 y 500 huevos en su etapa reproductiva; se sabe que el ciclo de vida dura aproximadamente cuatro semanas. Su capacidad de reproducción se incrementa cuando la temperatura es de más de 23°C, por lo que la infestación es más frecuente en zonas tropicales.Control químico. Este insecto es muy resistente a insecticidas como el malatión. En casos de infestación importante se recomienda fumigar con una mezcla de organofosforados (fostoxina) y piretroides sintéticos.Contaminación con hongos/aflatoxinas. Otro aspecto que tiene que considerarse en el almacenamiento de maíz es la contaminación por hongos y sustancias altamente tóxicas que se asocian a éstos. Las especies de hongos más comunes en almacén son del género Penicillium sp., Aspergillus sp. y Fusarium sp. (Figuras 24a-c).Penicullium sp. Infección asociada a daño en las mazorcas causado por insectos. Los síntomas que presenta son la aparición de polvo azul-verdoso que cubre el grano y el olote. Los granos dañados por el hongo adquieren un color amarillento y hay formación de rayas en el pericarpio.Aspergillus sp. Es un problema serio cuando se almacenan mazorcas con alto grado de humedad. Los síntomas que lo identifican son los grupos de esporas de color verde-amarillo que cubren el grano y el olote. Estos hongos producen toxinas del tipo aflatoxinas.Fusarium sp. Es el patógeno más común de la mazorca en todo el mundo. La infección comienza en granos individuales y continúa en el micelio, identificable por su apariencia algodonosa con rayas blancas en la superficie de los granos.Produce micotoxinas llamadas fumonisinas. Figura . Hembra de Rattus norvegicus.¿Cómo es la plaga y dónde se encuentra?Los roedores son plagas que causan problemas no sólo en los granos almacenados sino en la salud humana. Los roedores poseen filosos incisivos que crecen de 10 a 12 cm al año, y para desgastarlos necesitan roer constantemente. Esta característica los hace ser muy destructores. Existen tres especies de roedores: rata común (Rattus norvegicus), rata de techo (Rattus rattus) y rata de casa (Mus músculos).Es una plaga con distribución cosmopolita. Cabe destacar que en muchas zonas el ataque de roedores constituye una plaga no insectil de gran importancia (Figura 25).Figura . Grano dañado por R. Norvegicus.Los roedores ocasionan daños tanto al grano que está en el campo como en el almacén. Pueden consumir grandes cantidades de grano (Figura 26), sobre todo si las estructuras de almacenamiento no cuentan con protección contra plagas de este tipo. Recordemos que las ratas son portadoras de pulgas, que transmiten bacterias al ser humano, y de enfermedades graves, como la rabia.¿Cómo se desarrolla la infestación?Los roedores presentan el índice de reproducción más alto entre los mamíferos. Son capaces de poblar completamente un cultivo partiendo de una baja población. Se sabe que se reproducen de 6 a 10 veces por año con un promedio de 8 crías por parto, las cuales, a su vez, alcanzan la madurez sexual a los tres o cuatro meses de edad.¿Cómo puedo identificar la presencia de roedores?Algunos de los indicios para detectar la presencia de roedores son excrementos (forma y tamaño de una especie a otra), orina (de olor característico y color fosforescente bajo luz ultravioleta), roeduras (algunas especies ocasionan más daño que otras), madrigueras, veredas y huellas.El control físico-mecánico incluye prácticas de limpieza y ordenamiento del almacén; asimismo, se sugiere que las estructuras sean a prueba de roedores y que se coloquen trampas.Control químico. Uso de rodenticidas parafinados a base de anticoagulantes, como la bromadiolona, bromadifacum.Control biológico. Los depredadores comunes son los búhos, los gavilanes, los halcones y los gatos domésticos.Selección de maíces para resistencia a plagas de almacén en infestaciones naturalesFigura . Galera de gorgojos para evaluación de granos almacenados en zonas rurales.Dada la importancia de cultivar variedades resistentes a plagas, una opción es evaluar y seleccionar maíces resistentes bajo infestación natural en las fincas de los agricultores, en virtud de que es una tarea sencilla y poco costosa.Para aplicar esta técnica se necesita un depósito de almacenamiento, por ejemplo, una troje, una bodega o una estructura con techo para impedir la entrada del agua de lluvia, pero con excelente ventilación para que los insectos puedan entrar. Evítese la entrada de animales domésticos.La estructura deberá estar provista de anaqueles o largueros metálicos para colocar muestras en bolsas. La capacidad se determinará conforme a lo que se requiera para la evaluación.Las muestras de maíz deben recolectarse directamente en el campo para evitar posibles daños o deterioro a causa de la humedad del suelo, la lluvia o las aves. Si se desea caracterizar un material en sus tres formas de almacenamiento, es decir, grano, mazorca y con cobertura, se deben cosechar 18 mazorcas de cada genotipo.Figura . Forma de almacén para la evaluación de materiales resistentes a plagas de almacén.Para cada una de las formas de almacenamiento se utilizan dos bolsas de nailon en las que se ponen, en cada una, tres mazorcas o el grano de éstas y una etiqueta. Los ensayos deben hacerse por duplicado y colocarse juntos. Inclúyase por lo menos un testigo susceptible en cada ensayo (por ejemplo la CML244XCML346 del CIMMYT), para poder hacer comparaciones.La duración del ensayo se determina dependiendo de la plaga que predomine en la región donde vaya a realizarse. Para el gorgojo de maíz se necesitan 90 días, mientras que para el barrenador grande del grano bastan sólo 60. Los testigos susceptibles que se incluyan pueden servir como indicadores del mejor momento para llevar a cabo la evaluación; es decir, cuando el grado de daño sea de entre 6 y 8 (Tabla 1). Se recomienda evaluar el ensayo el mismo día o dentro del menor tiempo posible para minimizar las diferencias entre la primera y la última evaluación.Figura . Mazorca con valor de resistencia (izquierda) y mazorca susceptible con valor (derecha) en la escala visual de daños.Mejorar las prácticas de almacén ¿Cómo prevenir las infestaciones por plagas?Con el propósito de prevenir infestaciones y daños durante el almacenamiento, hay por lo menos tres fuentes de infestación que deben evitarse:Infestación proveniente del campo. Ésta ocurre cuando los insectos rondan el maíz durante el tiempo de maduración. Es posible que los insectos hayan estado antes en almacenes infestados, y aunque al principio el grado de infección sea muy bajo, podría incrementarse durante el período de resguardo del grano. Por lo menos seis semanas antes de la cosecha, asegúrese de que su almacén no contenga material infestado.Poblaciones residuales en los sitios de almacén. La estructura de almacenamiento debe ser limpiada y tratada, asegurándose de que paredes, pisos y techos queden perfectamente limpios. De ser necesario, el usuario deberá reparar los contenedores, eliminar todo tipo de objetos en el interior y aplicar insecticida.Infestación cruzada o contaminación por entrada de material infestado. Para evitar contaminación con grano infestado, todo el grano del ciclo anterior debe ser desalojado del contenedor y sometido a tratamiento químico. No se debe permitir la mezcla de granos de diferentes ciclos si no han sido previamente tratados.¿Cómo almacenar mejor la cosecha?Para obtener mejores resultados, sugerimos a los usuarios de la presente guía tener en cuenta las siguientes recomendaciones.• Doblar el tallo de la planta por debajo de la mazorca para evitar que entre el agua y daños causados por las aves.• Revisar si el grano ya llegó a la madurez. Esto se determina tomando algunas mazorcas y observando si ya se ha formado una línea oscura en el grano.• Evitar que el grano pase mucho tiempo en el campo una vez que llegue a la madurez.• Si el maíz va a cosecharse con cobertura o totomoxtle, asegúrese de que el grano esté en proceso de secado y de que no haya indicios de plagas.• Si fuera éste el caso, observe si hay agujeros, harina (polvillo) o insectos.• Si va a cosechar únicamente mazorcas, asegúrese de separar y seleccionar las que estén dañadas. Almacene aquellas que estén sanas y utilice de inmediato las que muestren daños.• Es importante realizar el secado lo antes posible para evitar que el grano se infeste.• El maíz debe secarse al sol durante algún tiempo.• Para confirmar que el maíz está seco, coloque una muestra de grano en un frasco, ciérrelo y expóngalo al sol durante una hora. Si se forman gotas de agua en las paredes, déjelo secar por más tiempo. En caso contrario, póngalo al sol dos días más para asegurarse de que el grano esté seco.• Otro método de evaluación es mediante el sonido del crujir del maíz.• Algunas formas alternativas de secado son el calor seco o el humo de una fogata.• Considere una segunda selección manual de las mazorcas para retirar aquellas que estén dañadas o infestadas.• Si va a desgranar, es importante tamizar el grano para eliminar basura o insectos.• Haga limpieza nuevamente antes de colocarlo en el depósito de almacenamiento.• Elija el lugar de almacenamiento: cuarto, bodega, troje, tapanco, etc.• Limpie perfectamente el área destinada al almacén. Esto incluye la eliminación de la cosecha del ciclo anterior, a fin de evitar contaminación por plagas existentes. El espacio debe estar seco y fresco para prevenir la aparición de plagas.• Si el almacenamiento se hace en costales, éstos deben hervirse y secarse antes de utilizarlos; si son bolsas de plástico, asegúrese de que estén completamente limpias.• Si utiliza tambos, lávelos perfectamente para eliminar restos de óxidos o solventes, déjelos secar y, de ser necesario, píntelos.• Silo metálico. Es un recipiente excelente para almacenar grano. El único cuidado que se requiere es colocarlo a la sombra y guardar el maíz bien seco.• Los tratamientos se aplican cuando se vacía el grano en el contenedor u otro depósito de almacenamiento.• Si va aplicar tratamientos con agentes inertes, minerales o polvos de plantas, asegúrese de mezclar perfectamente los ingredientes con el grano, en la proporción que se indica en la tabla.• Para el grano que se almacena en costales, tambos o silos, se aplica la dosis del agente elegido, se mezcla perfectamente y se deposita en el contenedor.• Si utiliza plantas intactas o frescas, colóquelas en la capa del grano que está en contacto con el ambiente.• Si emplea un tratamiento con pastillas, hay que tomar PRECAUCIONES. Las pastillas de fosfina son muy peligrosas y únicamente personas capacitadas deben aplicarlas. NUNCA las utilice en el interior de casas-habitación.El grano almacenado debe revisarse con regularidad para detectar oportunamente la presencia de plagas y aplicar un nuevo tratamiento.Nombre: Boldo (Peumus Boldus, M)Preparación y dosis: Las plantas se secan al sol y se muelen hasta obtener un polvo fino. Use hasta 20 gramos por cada kilogramo de maíz y mezcle.Se recomienda emplear insecticidas únicamente cuando las poblaciones de plagas alcanzan valores anormales y ponen en riesgo el grano almacenado. Para aplicar el agente elegido, el usuario deberá apegarse a las instrucciones del fabricante, considerando que las sustancias de esta clase son muy peligrosas.Nombre: Fosfina Precauciones • Este fumigante es muy peligroso si no se emplea correctamente. Léanse las instrucciones del envase.• Para realizar una fumigación, asegúrese de que dispone de contenedores herméticos o cerrados (bidones, sacos de plástico); de que el grano quedará protegido por toldos o telas de plástico o guardado en tambos o silos metálicos.• No lo utilice en pabellones o cuartos destinados a la vivienda.• El gas de fosfina se vende en forma de tabletas de fosfuro de aluminio, que liberan fosfina al entrar en contacto con la humedad del aire. NUNCA toque las pastillas; se recomienda utilizar guantes.• Coloque las pastillas en recipientes para facilitar su eliminación al término de la tarea; puede utilizar frascos con tapa abierta, charolas o envases metalicos.• Tras aplicar la sustancia, mantenga el producto cerrado herméticamente, durante tres días por lo menos.• Al terminar, ventile el contenedor, teniendo cuidado de no aspirar los gases que emanen del interior.• Permita que se ventile por un par días y luego retire cuidadosamente los residuos, colóquelos en una bolsa y elimínelos.La cantidad de pastillas que vaya a utilizarse se determinará conforme a la capacidad del recipiente o silo y no del volumen almacenado. Así, pues, se sugiere aplicar:• Tres (3) pastillas para un contenedor hermético de una tonelada.• Dos (2) pastillas para un tambo de 250 litros.• Una (1) pastilla por cada cuatro costales, colocados en bolsas de plástico suficientemente grandes.El tratamiento puede repetirse después de tres o cuatro meses, dependiendo de la reincidencia de las plagas.Umbral económico. Es la densidad de población a la cual deben tomarse acciones de control e impedir que una creciente población de plagas alcance niveles de daño económico.Plaga "}

main/part_2/0400403220.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"fd94c804fd92e9b211b8fe7e03784a2a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5f3d1d57-12a3-4aff-a5d4-9e80e1386b64/retrieve","id":"-2052261485"},"keywords":[],"sieverID":"ff0e6594-0c95-4edf-9fd8-d9a1b01ca35d","content":"CGIAR Initiative Ukama Ustawi: Diversification For Resilient Agribusiness Ecosystems in East And Southern Africa Initiative (UU) supports climate-resilient agricultural livelihoods and agribusiness ecosystems to help millions of vulnerable smallholders transition from hard to sustain maize-mixed systems to sustainably intensified, diversified, and de-risked agrifood systems with a solid maize base. The WP3 of UU supports enterprises in strengthening the capacity to run profitable and sustainable agribusinesses to incentivize and enable diversification, intensification, and de-risking of maize-mixed systems through a sciencebased accelerator program. As a part of the accelerator program, an international consultant is tasked to produce a methodology for organizing the innovation bundling process based on the inception report approved by the UU management 1 and the market study conducted by the UU team 2 . This report presents the methodology for executing the innovation bundling process within the science-based accelerator program. It provides details on i) the innovation bundling approach, ii) the operationalization workflow, iii) the data sources used in the bundling process, iv) the strategic innovation themes of the accelerator program, v) repositories of high-readiness core innovative solutions co-developed by CGIAR and vi) complementary solutions that are necessary to use the core innovations at scale in Kenya successfully, Rwanda, Uganda, and Zambia.The science-based accelerator program for climate-smart agribusinesses is a business acceleration program with triple goals of increasing the use of climate solutions co-developed by CGIAR, improving the capabilities of small private enterprises to operate sustainable businesses and mobilizing resources of small private enterprises. The accelerator program adopted and implemented by the UU builds on the AICCRA (Accelerating Impacts of CGIAR Climate Research for Africa) accelerator program implemented in the second half of 2021 3 and has the following four stages The first stage, innovation bundle development, consists of four steps; market analysis, innovation selection, packaging, and co-validation (Figure 1). Market analysis is a base analysis of the agricultural sectors in Kenya, Rwanda, Uganda, and Zambia. It presents the key factors influencing the commercial success of a private enterprise and the significant problems the innovative solutions need to consider to increase the use of climate solutions at scale. It guides the selection process of the enterprise and innovation configurations (EICo) that would best address the contextual problems and have the highest likelihood of achieving the UU objectives. The second step, selection, is a systematic prioritization process in which the applications to the UU science-based acceleration program are ranked based on their likelihood of achieving impact. It ensures that the EICos focuses on the best-bet innovations. The third step, packaging, is a stepwise combination of core innovations proposed by the enterprises to solve livelihood problems with complementary solutions addressing critical bottlenecks such as finance, supply chain, market services, regulatory system, extension services, and entrepreneurial capabilities constraints. Finally, co-validation is a participatory and interactive process in which stakeholders provide feedback to the EICos. It ensures that the innovation bundles consider the priorities of various stakeholders.The methodology described by this report focuses on the innovation bundle development stage of the science-based accelerator program. Since the first stage, market analysis is done based on industry-standard protocols, the methodology focuses on steps 2 to 4.The science-based accelerator program executed by the UU aims at i. build the capabilities of small agribusiness to have and generate commercial and social benefits from the use of climate-smart solutions,ii. mobilize complementary long-term finance for small agribusinesses,iii. increasing the use of scientific CGIAR climate solutions at scale in the short and medium terms, i.e., 2-3 years.To achieve these triple objectives, the innovation bundle development process must have a peculiar approach. Precisely, the process should The innovation bundle development approach used in this report systematically responds to the aspects above and presents the following workflows and practices.The innovation bundle development workflow designed based on the approach flow has 4 steps, market analysis, selection, packaging, and co-validation.A summary of the market analysis and its value added to be completed in the final version based on the final configuration of the process.The selection of high-impact potential EICos, is organized into five substeps; formulating selection criteria, organizing a call for applications, eligibility check, core-team rapid assessment of the EICos, and assessing the impact potential of EICos.Science-based accelerator programs aim to build the capabilities of small enterprises and enable them to have sustainable businesses while creating social impact for a broad range of beneficiaries in rural areas. In addition, UU has a particular objective to increase the use of science-based climate innovations at scale. These dual objectives require a combination of criteria from a diverse pool. Specifically, the criteria should include• market relevance that can play a significant role but are not as commonly referred to in selecting high-impact potential EICos. Group A is also divided into two further groups. A1 refers to the criteria that are easy to provide information, therefore, can be used in the rapid assessment substep. In contrast, A2 refers to the criteria that are not straightforward and sometimes derived from analytics, therefore suitable for the assessment substep. A1 criteria have three level ranking (high, medium, low), while A2 criteria have two levels (true and false). B group criteria are not designated a ranking yet as they are not envisaged to be used in the selection but provided as an annex (Annex -1) for general usage. The UU Accelerator program will provide significant support to small enterprises with highimpact potential and a small grant to the most successful entrepreneurs in the accelerator program. However, this support won't be sufficient to sustain the enterprise's business unless they are well positioned in the market and have established support networks for their capital, human resources, and input needs. Therefore, a high-impact small enterprise must be informed about and complement existing enterprises and be connected to networks.A1: Business Landscape Criteria for rapid assessment • include a CGIAR science-based climate solution as the core innovation,• include a CGIAR science-based climate solution as the complementary innovation,• include multiple CGIAR science-based climate solutions,• include a complete CGIAR innovation package.Innovation and scaling theory and practices showed that it takes a few decades to achieve impact at scale in the agricultural sector from the period the solution has been conceptualized.To identify the innovative solutions that can achieve impact in the short and medium term as the UU aims, it is necessary to ensure that the solutions in the EICos have high maturity or readiness.A1: Scaling and Impact Readiness Criteria for rapid assessment Following an internal consultation process, four of these themes, i.eMechanized irrigation, conservation agriculture, nutrition-sensitive climate-smart agriculture, and agricultural risk management, were identified as the CGIAR strength areas that would make the maximum contribution to the EICos. Therefore, the accelerator program will prioritize the EICos that capitalize on science-based solutions in these four investment themes.Mechanization or mechanized agriculture is the process of using agricultural machinery to mechanize the work of agriculture, greatly increasing farm worker productivity and input use efficiency. CGIAR has developed mechanized equipment such as 2-wheel tractors, direct maize shelling, reaper harvester, and many product-practice bundles solar powered irrigation, supplementary irrigation, mechanized raised bed machines, etc., that are proven to reduce climate change impact of agriculture and increase the resilience of farmers.Conservation agriculture is a farming system that promotes minimum soil disturbance, Agricultural risk management is the identification, evaluation, and prioritization of risks in agricultural activities, including coordinated and economical applications to minimize, monitor, and control the probability or impact of unfortunate events and maximize the realization of opportunities. They make farming more predictable and increase the resilience of farmers. CGIAR teams have produced multiple agricultural risk management solutions such as insurance instruments for crop production, flooding, and general climate disasters, risk assessment tools, methodologies for farming risk profiling, gender integrations, and other tools and approaches.To be written later. The process 2Scale and others go through to maximize the number of relevant applications. Some comments are hereTo be written later. The enterprise database 2Scale has and its contribution to the innovation bundle development.To be written later. The platform of VC4A and its contribution to the effectiveness and efficiency of innovation bundle development.The eligibility check is the third sub-step of the innovation bundle development process. Previous experiences with the innovation accelerator programs show that although a call for applications defines a specific context, it is not uncommon to have applications focusing on the work outside of this context. In addition, some applications do not include all the information necessary to assess all relevant aspects of the EICos.# basic criteria are used to check the eligibility of the business • The application includes all the critical information necessary to assess the impact potential of the EICos. • The enterprise is registered in at least one of the eligible countries (Kenya, Rwanda, Uganda, or Zambia) • The enterprise has been operational in these countries for more than 3 months • The enterprise has at least 3 partners or employees Rapid assessment is the fourth substep of the innovation bundle development process. It is done by a core team of experts who manage the innovation bundle development process via the use of the proven acceleration service platform. The service platform provides information about the market, business landscape, agribusiness capacity and prospects, science-based CGIAR solution portfolio, and scaling and impact readiness criteria included in the A1 group (Table 1). Rapid assessment reduces the number of applications and provides a short list of relatively high-potential EICos. The description of the method 2Scale will use to select the short-list to be added laterAssessment is the fifth sub-step of the selection process, and only short-listed EICos go through the assessment process. The assessment is done using the A2 group market, business landscape, agribusiness capacity and prospects, science-based CGIAR solution portfolio, and scaling and impact readiness criteria (Table 2). In addition to the core team members, a (technical) expert group evaluates the information provided by the applications using the criteria listed in Table 2. Innovative solutions produced or used by the high-ranking EICos will be going through a two substep packaging process; a participatory functional gap identification workshop and complementary solution selection process.In the scaling diagnosis sub-step, the innovator and service teams of the EICos will participate in a facilitated workshop in which they identify and agree on the shortcoming scaling essentials inhibiting the use of their solutions at scale together with the technical experts from the CGIAR based on the core innovative solution their existing business focus on. Initially, each innovator or service team member is asked to answer assessment questions about the scaling essentials listed in Table 3 and provide their answers individually. After the answers, the facilitator checks if there is a consensus on the answers by the all team. If there is a consensus, the facilitator asks the next question. If there is no consensus, the members who give a minority answer are asked to explain their reasoning. After the explanation, the other members of the team reflect and the team agrees on the same answers. If a specific essential is considered a shortcoming, it will be noted. Then the facilitator asks the question about the next function and the individual assessment, reflection, and agreement cycle are repeated.The workshop finishes once all the essentials are discussed by the team. The CGIAR experts respond to the technical questions asked by the innovator and service team members and, where relevant, make their contributions. Are there any other complementary solutions that will increase the benefit of the solution your business is offering?16 Efficiency of the core solution Are there any other complementary solutions that will decrease the cost of providing the solutions you are offering?In the innovation packaging process, the innovator and service teams of the EICos identify complementary innovations that address the shortcoming scaling essentials identified in the scaling diagnosis sub-step. Based on the specific shortcoming, the enterprise teams are offered information about CGIAR science-based complementary solutions proven to improve the specific essentials in the context the enterprise operates (Annex -2).The complementary CGIAR solutions are sourced from reduce unit costs 36. Provide a standardized framework for assessing and evaluating the impact of CSA solutions to help agribusinesses and agritechs to attract funding and position themselves in the market as sustainability and resilience-driven players 37. Embed an approach focusing more on the adaptive capacity of the agri-food system to increase the resilience of farmers and agribusinesses from funders, policies, and technologies. 38. Provide incentives to ensure farmers' ability to adopt sustainable solutions and compete with market alternatives, while maintaining livelihoods and meeting food needs 39. Empowering women and youth through training and resources to commercialize their activities can not only help formalize their role, but also 40. Shift the mindset of the opportunities at the value chain 41. Support women and youth in inclusively diversifying crops and enterprises and foster employment opportunities across different areas of the value chain. 42. Support women in investing in post-production activities and taking up service enterprises to deepen incomes 43. Promote productive labor through automation and digitalization, and support women in moving from production to higher-value chains. 44. Inspire youth 45. Provide clarity on stage terminology, investment type, conditions, and methods for monitoring impact 46. Ensure the availability of data on the sector to help drive funding in the agritech sector. 47. Contribute to making the sector more collaborative and provide data 48. Help educate investors and other supporters on sector-specific issues to ensure more strategic and methodological investment processes 49. Increase co-investment opportunities between investors with different areas of expertise to leverage technical strengths 50. Partners with local investors for ensuring on-the-ground portfolio management, context expertise and experience, and business integrity 51. Partners with agriculture research organizations who can provide technical expertise in integrating CSA themes in investment strategies, assisting to de-risk investments by supporting environmental and social (E&S) due diligence of companies pre-investment and E&S management post-investment 52. Activate the investor landscape at the growth stage to showcase the opportunities and encourage more early-stage funders to invest 53. Provide a reliable reporting process for startups, and understand the weight of different metrics in the analysis of results to assert the short-and long-term impact of a solution. 54. Define indicators for measurement, such as the number of rural farmers reached, percentage rise in farmer incomes and the number of households brought out of poverty or food insecurity 55. Increase co-investment or opt for blended finance instruments with technical assistance facilities to mitigate some of the risks 56. Provide data, networks, and events to connect investors with opportunities that meet their needs and requirements 57. Collaborate with local ESOs to source agritechs and access a qualified deal flow 58. Provide access to information on existing regulations governing the sector in countries of interest to help investors understand the ease or difficulty in investing in a certain sector or country 59. Presents different criteria for attracting investments 60. Feed into an existing climate smart agriculture investment plans 61. Integrate a gender lens in their mandate 62. Supply women and youth with both technical and financial capacity to build their linked businesses 63. Improve access to market data and infrastructure to facilitate access to farmers located outside of hubs 64. Foster partnerships through local smallholder farmers networks and cooperatives 65. Increase collaboration with agritechs providing solutions to connect easily with farmers 66. Collaborate with local agrodealers to sell products 67. Ensure an advisory service for smallholder farmers after receiving inputs using new extension models and apps where possible. 68. Deliver up-to-date information on market trends and consumer expectations 69. Equip with tools and mechanisms to benchmark and be aware of the competition 70. Help lighten restrictions and limitations related to access to debt financing. 71. Has diversified funding options 72. Attracts co-investments to minimize risks 73. Provide access to data on funders or other corporates in the value chain supporting the agriculture sector to find co-investors 74. Develop networks to help corporates expand to new markets and reach new customers 75. Support development of skills and knowledge needed to support expansion 76. Improve the testing and standards checking process to accelerate market entry 77. Facilitate market entry by putting in place regional agreements to encourage cross-border trade and exchange of goods and services 78. Develop strong risk management tools to minimize the impact of the risks 79. Embed CSA solutions rooted in adaptation and mitigation to strengthen resilience "}

main/part_2/0420169942.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"c2745c25be15f0985953217065a516e3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/da3c0abc-f094-42f3-9002-538619d0a38f/retrieve","id":"-2013916125"},"keywords":["Food consumption","food security","food sources","and food perceptions"],"sieverID":"05ce9108-fc5a-4b2c-a765-ac1725c80ca5","content":"Transforming Agrifood Systems in South Asia (TAFSSA) district agrifood systems assessment aims to provide a reliable, accessible, and integrated evidence base that links farm production, market access, dietary patterns, climate risk responses, and natural resource management with gender as a cross-cutting issue in rural areas of Bangladesh, India, and Nepal. It is designed to be a district-level multiyear assessment. Using data collected in March-April 2023, this data note describes what people are eating, where they get their food, household food insecurity, and perceptions about food. This is one of a set of data notes that, together, provide a holistic picture of the agrifood system in the district.TAFSSA's district agrifood systems assessment aimed to interview three respondents per household: a female adult (aged 20+ years), a male adult (aged 20+ years), and an adolescent (aged 10-19 years). Information on the household and respondent sampling strategy is provided at the end of this data note.In this data note, you will first find information on background characteristics of the households and individuals who were interviewed. This is followed by information on what people are eating, which was captured using several measurement methods. Respondents were asked about the foods they ate the day before the interview (24-hour recall) and about how often they ate certain foods in the past week (food frequency questionnaire). The 24-hour recall was conducted using the Global Diet Quality Score (GDQS) application, which also captured when (at what eating occasion such as breakfast, a snack between lunch and dinner, etc.) people ate each food item.In addition to what people eat, you will find information in this data note on where they get their food and, if they buy it, what types of markets or shops they buy it from.Finally, you will learn why people choose to eat certain healthy and unhealthy foods. Respondents were asked about availability, accessibility, taste, and other factors that may influence their decisions to consume certain foods. More details about the measurement methods are found on the following pages. Diets were measured by asking people about everything they ate or drank on the previous day, from the time they woke up until the time they went to bed and didn't eat or drink anything more. This includes all snacks and foods and drinks consumed at home and outside the home.To capture this information, we used the Global Diet Quality Score (GDQS) application (Bromage et al. 2021). The GDQS allows us to understand diet quality, which is associated with the risk of disease. We report the percentage of individuals with at least minimum dietary diversity (FAO and FHI 360, 2016) (Figure 4A), that is those who consume at least 5 of the following 10 food groups daily: 1) grains, white roots and tubers, and plantains, 2) pulses (beans, peas, and lentils), 3) nuts and seeds, 4) dairy, 5) meat, poultry, and fish, 6) eggs, 7) dark green leafy vegetables, 8) other vitamin A-rich fruits and vegetables, 9) other vegetables, and 10) other fruits.We also computed metrics that indicate how healthy or unhealthy diets are (Figure 4B). Higher GDQS-and GDQS+ scores indicate better diet quality. We then grouped GDQS scores into 3 categories to indicate diet related noncommunicable disease risk (Figure 4C).On the following pages, we show the percentage of individuals who consume various food groups (Figure 5), the consumption quantity by food group (Figure 6), the most commonly consumed foods (Figure 7), how many times per day people eat (Figure 8), who eats at various eating occasions (Figure 9). ✓ Dietary diversity was higher among adult females than adult males or adolescents. ✓ Adolescents were at slightly higher diet related NCD risk compared to adults.   ✓ Adolescents, adult males, and adult females had a similar number of eating occasions per day. ✓ More than 90% of respondents ate lunch and dinner, whereas 60% of adults and 54% of adolescents consumed breakfast. ✓ Adolescents often consumed food in the afternoon between lunch and dinner. In addition to the GDQS, which provided information about all foods consumed in the previous 24 hours, we selected a set of 25 \"sentinel foods\" to better understand how frequently these foods are consumed, food sources, where people buy food, and their perceptions about food.Respondents were asked how frequently they consumed these foods in the past 7 days (Figure 10). They were also asked about where their household gets each food (purchased from outside, own production, received from others, received from government, gather/forage) (Figure 11). If they said their household purchases the food, we asked them where it is purchased (haat, retail shop, farm, government ration shop, or other market type) (Figure 12).For a few foods, we dug deeper to understand people's food perceptions, or what they think about the foods. This included whether they know of a vendor who sells the food, if the food is safe to eat, easy to acquire near where they spend most of their time, is not too expensive, is fast and easy to prepare, tastes good, fills their stomach, is nutritious, and if their family enjoys eating it (Figure 13). Understanding these perceptions provides insights into drivers or barriers of consumption of healthy and unhealthy foods. ✓ Most households purchased their food rather than producing it themselves. ✓ About half of the households consumed rice and wheat from their own production; 79% of households consumed green leafy vegetables from their own production. ✓ Receiving food from the government or gathering/foraging food was not a common food source. The views and opinions expressed in this publication are those of the author(s) and are not necessarily representative of or endorsed by CGIAR, centers, our partner institutions, or donors. This data note has not been peer reviewed."}

main/part_2/0422375958.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"04c7c5182771214a8db679667b6eb50c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8b517562-06d1-4f03-a4af-ea1b5cc8b504/retrieve","id":"1163569198"},"keywords":[],"sieverID":"733e2e4d-5192-4afb-b313-016f9e3dc88c","content":"lo que se considera que llena los requisitos para poder ser presentado ante la comunidad científica de CATIE.Panel intergubernamental de expertos para el cambio climático El incremento poblacional para el año 2050 impulsa el crecimiento en la demanda de alimentos aproximadamente en un 50%, en el caso de la leche y carne el aumento sería de 73 y 58%, respectivamente (Gerber et al 2013). Este aumento en la demanda de productos de origen animal conlleva a la búsqueda de la máxima eficiencia productiva y consecuentemente la intensificación de los sistemas productivos, buscando con esto aumentar los rendimientos de leche por unidad de área y a la vez conduce a reducción en el número de animales necesarios para satisfacer la demanda, cada vez en menor área disponible (Styles et al. 2018).En Costa Rica el 79% de las fincas destinadas a la producción de leche utilizan el pastoreo como su principal sistema de alimentación (INEC 2019), evidenciando que la intensificación de la producción ganadera se ha basado en el uso eficiente de las pasturas, todo esto en busca de lograr la máxima productividad por área, reducir los costos de producción, mejorar la eficiencia en el uso de los recursos y buscar convertirlos en sistemas sostenibles ante las presiones del cambio climático (Pezo 2018).Los sistemas de lechería especializada representan el 15.4% y los sistemas doble propósito representan el 21.7% del inventario ganadero de Costa Rica (1,633,467 animales) (INEC 2019). Gran parte de estos sistemas se ubican en condiciones de trópico húmedo, zonas donde las restricciones de humedad son limitadas o inexistentes y propician el crecimiento de las especies forrajeras, permitiendo un alto aporte de biomasa disponible para los animales y dando oportunidad a incrementos en la capacidad de carga de la finca. No obstante, estas zonas productivas enfrentan retos relacionados mayormente a la gestión del recurso forrajero, ya que se ha puesto mayor interés a la cantidad de biomasa y se ha dejado por un lado lo que respecta a la calidad nutricional, siendo necesarios el uso de suplementos externos para mantener la producción y comprometiendo la rentabilidad del sistema productivo (Lezcano et al 2012).La transición hacia la intensificación sostenible de los sistemas de producción de ganado bovino requerirá de la promoción y adopción de forrajes mejorados, así como leguminosas y no leguminosas forrajeras que pueden cumplir un rol estratégico con su aporte de nitrógeno tanto al suelo como a la dieta, y consecuentemente mejorar el valor nutritivo de la dieta de los animales, con menores emisiones de gases de efecto invernadero (GEI) (Gaviria-Uribe et al 2020).El Panel Intergubernamental de Expertos para el Cambio Climático (IPCC) la ganadería a nivel mundial es responsable del 14.5% de las emisiones de gases de efecto invernadero (GEI) de origen antropogénico, y el 65% de estas emisiones proviene del ganado vacuno (IPCC 2007). La producción de leche bovina emite aproximadamente el 20% de GEI entre todos los rubros de producción vacuna. La intensidad de emisiones por kilogramo de proteína animal es más baja en las ganaderías de leche que en las ganaderías de carne, en las cuales se alcanza un 40% de emisiones (Vermeulen et al 2012;Gerber et al 2013). No obstante, Manzetto et al. (2020) compararon mediante análisis de ciclo de vida los sistemas de producción bovina de Costa Rica, encontrando que los sistemas intensivos de lechería especializada reflejan la menor huella potencial de calentamiento global (1.86 -2.56 kg CO2 (kg LCGP ) -1 ) comparado a los sistemas doble propósito, en donde la huella es superior (4.54 -5.32 kg CO2 (kg LCGP ) -1 ). Las diferencias entre estos sistemas son el resultado de la alta productividad, el menor uso de instalaciones y el manejo de las excretas en los sistemas de producción intensiva; además, concluyen que la alta productividad de los sistemas es representativa de procesos eficientes de en la gestión de pastoreo.Las ganaderías tradicionales de baja producción, donde predominan sistemas de pastoreo extensivos con gramíneas en monocultivo, generan niveles superiores de emisiones entéricas, producto de la baja gestión del hato, dietas con alta proporción de alimentos con bajo valor nutritivo y pasturas degradadas; por otro lado, en los sistemas industrializados con altos niveles productivos, las emisiones derivadas directamente de la producción, la alimentación y el estiércol, son fuentes importantes de emisiones junto a la fermentación entérica (Gerber et al. 2013).Esta problemática requiere de la incorporación e implementación de prácticas que contribuyan a mejorar los sistemas productivos mediante el uso de especies forrajeras adaptadas a cada sistema, contribuyendo a la adaptación y mitigación de los efectos del cambio climático y logrando el máximo incremento en la eficiencia productiva y la rentabilidad. De este modo, existe gran potencial para manejar y recuperar áreas degradadas por inadecuado manejo del pastoreo, mediante la incorporación de árboles en los sistemas ganaderos. Diversos estudios han provisto la evidencia de cómo los sistemas silvopastoriles (SSP) son una alternativa para el desarrollo sostenible del sector agropecuario (Milera 2013).Los SSP son considerados alternativas productivas de ganar-ganar, ya que sus objetivos y principios de gestión están orientados al incremento de la productividad de los sistemas pecuarios con beneficios colaterales al ambiente. Donde se logra incrementar los ingresos mediante la diversificación de productos, mejorando la resiliencia ante el cambio climático a través de las condiciones micro climáticas que los árboles y arbustos proveen a los animales y las pasturas. Además, aprovechando los beneficios de mitigación en la reducción de emisiones de gases de efecto invernadero e incrementando el secuestro de carbono en la biomasa y sistema radicular de los árboles, arbustos y las pasturas (Ibrahim et al. 2001).Las asociaciones de árboles, arbustivas y pastos mejorados representan una alternativa promisoria para la producción animal en el trópico (López-Vigoa 2017). Estas asociaciones producen mayor cantidad de biomasa de alta calidad durante todo el año (López et al. 2015b citado por López-Vigoa 2017) y se logra mejor balance de nutrientes en los animales; obteniendo mejoras en condición corporal y una alta respuesta inmune junto a un entorno favorable que permitirá incrementar el bienestar animal y con ello una mejor resiliencia (López-Vigoa 2017).Existe un gran número de arbustos y árboles, tanto especies leguminosas como no leguminosas con gran potencial para la producción de rumiantes (Topps 1992, Vandermeulen et al. 2018citado por Ku-Vera et al. 2020b). Estos mejoran la calidad nutricional de la dieta del ganado en pastoreo, mediante el aumento de la concentración de proteína dietética y reducen la producción de metano por efecto de metabolitos secundarios como taninos y saponinas presentes en las plantas (Mayorga et al. 2014citado por Benaouda et al. 2017). La presencia de altas concentraciones de metabolitos secundarios vegetales como taninos y su relación con la reducción de emisiones de metano (Herrero 2016) se da a través de una variedad de mecanismos implícitos en el microbioma del rumen (Ku-Vera et al. 2020b).En un estudio de fermentación in vitro realizado por Cardona-Inglesias et al. (2017) donde incluyeron Thitonia diversifolia como parte de la dieta en un SSP comparado con kikuyo en monocultivo, encontraron una reducción de la producción de metano de 24.8% y 27.4% a las 24 y 48 h respectivamente, además de la alta digestibilidad que presentó a las 24 horas. Así mismo, Albores-Moreno y colaboradores (2019) encontraron una reducción 12.78% de producción de metano en el rumen al incorporar un 30% de follaje de Leucaena leucocephala.Se debe garantizar el uso de especies adaptadas, que tengan excelente respuesta a la captación de energía solar, que garanticen altos rendimientos de biomasa, eficiencia en la captación de CO2 y toleren las condiciones que garantizan el manejo adecuado del pastoreo o bien de áreas que se destinan al corte y acarreo; logrando ayudar a la resolución de los problemas mencionados mediante la intensificación de cada sistema y la incorporación del concepto de diversidad. (Milera 2013). En ese sentido, es necesario que todo sistema productivo utilice los recursos locales para obtener la mayor rentabilidad al lograr la reducción de los costos respecto al de los alimentos con altos niveles de granos y cereales (Wanapat 2009).Ante la creciente demanda de alimentos y la limitante de recursos para una población creciente, surge la necesidad de buscar la mejora en la eficiencia alimenticia en los animales de granja, fundamentándose en obtener la mayor cantidad de productos de alto valor biológico (carne y leche) con la menor cantidad de recursos alimenticios. Los sistemas silvopastoriles se han convertido en una herramienta para la gestión de la eficiencia productiva; reconociendo que los forrajes constituyen la base de la alimentación en los sistemas productivos ganaderos dedicados a la producción de leche y que estos se convierten en productos de origen animal de alto valor biológico a bajo costo, Así mismo, mejoran la competitividad y la gestión climática y ambiental de los sistemas productivos ganaderos.El pasto Cayman (Urochloa híbrido cv. CIAT BRO2/1752) es una forrajera nueva que se está incorporando en los sistemas de producción de leche y carne como monocultivo, pero se carece de información científica que respalde los procesos adecuados de manejo que faciliten la toma de decisiones y permitan obtener el máximo potencial productivo con el menor impacto ambiental. Son reducidos los estudios que evalúan el asocio de gramíneas con árboles forrajeros (Tithonia diversifolia y Leucaena diversifolia) en condiciones de pastoreo en trópico húmedo. A pesar de la alta producción de biomasa del pasto en estas condiciones no hay datos suficientes sobre hábitos de selectividad por parte de los animales en estas especies arbóreas que tienen rasgos funcionales diferentes.Por esta razón la presente investigación está orientada a evaluar el desempeño productivo de este pasto, tanto en monocultivo como en asocio con las leñosas forrajeras arriba mencionadas. Lo anterior con el objetivo de lograr una mayor producción de biomasa de alta calidad nutricional y con esto mejorar la eficiencia de conversión de los nutrientes contenidos en las especies forrajeras evaluadas hacia la producción de leche. En este sentido, se estaría promoviendo un modelo de producción más autónomo, competitivo y resiliente al cambio climático con bajas emisiones de carbono.Evaluar la disponibilidad del componente forrajero, desempeño productivo y potencial de mitigación en la producción de metano in vitro en sistemas silvopastoriles mejorados; basados en pasto Cayman (Urochloa híbrido cv. CIAT BRO2/1752) solo, y en asocio con Thitonia diversifolia y Leucaena diversifolia en el trópico húmedo de Costa Rica.3.2.1 Determinar la disponibilidad y calidad nutricional del forraje en sistemas basados en pasto Cayman (Urochloa híbrido cv. CIAT BRO2/1752) como monocultivo y en asocio con leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia).3.2.2 Evaluar el efecto de las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) en la producción y calidad de leche en vacas cruzadas 3.2.3 Estimar la producción de metano in vitro en dietas basadas en diferentes proporciones de pasto Cayman (Urochloa híbrido cv. CIAT BRO2/1752), Tithonia diversifolia, Leucaena diversifolia y alimento balanceado.El desarrollo de la investigación es de tipo observacional cuantitativo debido a la naturaleza de la investigación, utilizando un diseño experimental con parcelas divididas en bloques completos aleatorizados, con tres tratamientos (Cayman monocultivo, Cayman en asocio con Tithonia diversifolia y Cayman en asocio con Leucaena diversifolia), con cuatro repeticiones (parcelas). Donde se evaluará la disponibilidad, determinando la producción de biomasa y calidad nutricional de las especies forrajeras. Producción y calidad de leche utilizando un diseño completo al azar con medidas repetidas en el tiempo. Para la producción de metano in vitro se realizarán las combinaciones bajo los criterios de diferentes relaciones forraje:concentrado (100:0, 80:20, 70:30. 60:40) y el componente forraje (Cayman:T.diversifolia y L. diversifolia) en una proporción dada (100:0, 80:20 y 70:30), donde se utilizará la metodología establecida por Theodorou y colaboradores (1994).Observacional cuantitativo Experimental cuantitativo 1. Determinar la disponibilidad de biomasa y calidad nutricional del forraje en sistemas basados en pasto Cayman (Brachiaria híbrido cv. CIAT BRO2/1752) como monocultivo y en asocio con leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia).X 2. Evaluar el efecto del pasto Cayman (Brachiaria híbrido cv. CIAT BRO2/1752) en monocultivo y en asocio con leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) en la producción y calidad de leche en vacas cruzadas. X 3.4. Preguntas de investigación 3.4.1 ¿Cuál es la disponibilidad de biomasa del pasto Cayman en monocultivo y en asocio con las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia)?3.4.2 ¿Cuál es la calidad nutricional del pasto Cayman y de las forrajeras (Tithonia diversifolia y Leucaena diversifolia)?3.4.3 ¿Cuál es el efecto de la alimentación en los sistemas de pastoreo de pasto Cayman y de las forrajeras (Tithonia diversifolia y Leucaena diversifolia) sobre la producción y calidad de leche producida?3.4.4 ¿Cuánto son las emisiones de metano in vitro del pasto Cayman solo, en asocio con las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) y con las diferentes combinaciones de suplemento balanceado.3.4.5.¿Como la integración de las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) con pasto Cayman incrementa la producción de forraje y la cantidad de proteína en el sistema?3.5.1 H1: La disponibilidad de biomasa y calidad nutricional del pasto Cayman en asocio con Tithonia diversifolia y Leucaena diversifolia es mayor que establecido en sistemas de monocultivo.3.5.2 H2: La producción y composición de la leche es diferente en el asocio del pasto Cayman con Tithonia diversifolia y Leucaena diversifolia en comparación con el monocultivo.La adición de alimento balanceado modifica las emisiones de metano in vitro en dietas de pasto Cayman con las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) en diferentes proporciones.4.1. Rol de la estabilidad en la producción forrajera para la adaptación de sistemas ganaderos al cambio climático.El interés por la intensificación sostenible en sistemas productivos del trópico húmedo, donde los forrajes, además de ser la fuente principal de alimentación, son la opción más económica y 3. Estimar el potencial de mitigación del pasto Cayman en sistemas de monocultivo y en asocio con Tithonia diversifolia y Leucaena diversifolia suplementado con alimento balanceado, mediante la producción de metano in vitro.practica para el ganado (Rosales y Pinzón 2005), que junto a un adecuado manejo son claves para lograr sistemas de producción competitivos, sostenibles y de bajas emisiones de carbono (Manzetto et al. (2020). En el trópico húmedo, se dan condiciones climáticas que permiten obtener altas producciones de biomasa durante gran parte del año (Wing Ching-Jones 2008), sin embargo, el bajo consumo por parte de los animales y la reducida calidad nutricional de las pasturas consecuencia de la baja gestión de estas, son limitantes en estas condiciones (Lezcano et al. 2012).Se han seleccionado especies mejoradas de pasto basado en atributos relacionados a su capacidad productiva, su calidad nutricional y la adaptación a diferentes condiciones edafoclimáticas. Siendo el pasto Cayman una de estas alternativas por su tolerancia a altos niveles de humedad en el suelo, alta producción de forraje y altos contenidos de proteína (Arango et al 2016), no obstante, las emisiones de GEI asociadas a esta especie son aún desconocidas (Gaviria-Uribe et al. 2020).También la integración con otras especies no leguminosas como la T. diversifolia y leguminosas como L. diversifolia, presentan bondades relacionadas al alto consumo de forrajes de superior calidad nutricional, al mismo tiempo que se asegura la persistencia de las pasturas y consecuentemente se logra la sostenibilidad a largo plazo con relación a la capacidad de fijación de nitrogeno (Palma & Gonzales-Rebeldes 2018).Como parte de las medidas propuestas para adaptar los sistemas productivos al cambio climático se plantea el establecimiento y gestión adecuada de los sistemas de producción de forrajes. Los sistemas ganaderos a nivel mundial están en dependencia de la disponibilidad de los recursos naturales, lo que provoca que se vean afectados en gran medida por la variabilidad climática estacional y anual, llevando esto a la reducción en la disponibilidad del recurso forrajero y por consiguiente mermas en el desempeño y productividad animal (Steinfeld et al. 2009;Nardone et al. 2010;Berrang-Ford et al. 2010;Dulal et al. 2011).Según Villanueva et al. (2009) los árboles o arbustos dispersos en potreros son fundamental para la adaptación al cambio climático. Así mismo, Murgueitio et al. (2014) afirman que la presencia de árboles en los potreros produce sombra, permite la reducción de la temperatura, mantiene la humedad de los suelos logrando una mayor productividad y calidad de los forrajes y además reduce la estacionalidad de la producción de carne y leche obteniendo estabilidad de la producción en el tiempo. De acuerdo con Navas (2003) en un estudio realizado con diferentes arreglos silvopastoriles (árboles en grupo, arboles individuales y cercas vivas) en comparación a pastos en monocultivo, encontró que para los SSP las temperaturas eran menores, reportando diferencias de 3.6 °C, 2.9 ° C y 1.7 °C, respectivamente. Además, Navas & Montaña (2019) en un estudio estableciendo T. diversifolia para bancos forrajeros midieron la macrofauna al inicio y al final, encontrando un efecto positivo sobre la macrofauna del suelo, donde esta especie favoreció la reaparición de termitas, lombrices y hormigas, donde inicialmente no había.Según DeRamus et al. (2003) la mejor estrategia de mitigación de metano es mediante la mejora de las dietas de los rumiantes, donde se mejore el aporte energético de los alimentos utilizados en la alimentación con mínimos efectos en el ambiente. Existe evidencia que las dietas con leguminosas y especies arbóreas en los SSP tienen efectos positivos en la reducción de emisiones, además, de mostrar mejoría en las características edáficas y de bienestar animal (Carmona et al. 2005). De acuerdo con Herrero et al. (2016) una excelente gestión de los pastizales podría potencialmente revertir las pérdidas de carbono en el suelo y secuestrar cantidades importantes de carbono en suelos de pastoreo y esto podría ser una opción viable, ya que se puede implementar mediante prácticas que mejoren la producción de forraje.Según Pezo e Ibrahim (1996) un sistema silvopastoril se consolida como una opción de producción pecuaria que bajo un sistema de manejo integral se tiene la presencia de leñosas perennes (árboles o arbustos), que interactúan con los componentes tradicionales de los sistemas pecuarios (forrajeras herbáceas y animales). Según Ku Vera et al. (2014) por los múltiples beneficios que los SSP presentan, estos han sido presentados como una opción dentro de la producción sostenible, ya que además del incremento en la cantidad de biomasa forrajera, se evidencia un incremento en la calidad nutritiva o mayor contenido de nutrientes que son disponibles al consumo por parte de los animales.Rivera y colaboradores (2015) encontraron una mayor productividad por unidad de área de 35% en los sistemas silvopastoriles respecto al pastoreo convencional, dicho incremento productivo se explica por la calidad de la dieta, menores tenores de fibra y elevado aporte de proteína, lo que permite hacer un mejor uso del suelo y una mejor gestión de los recursos.Según Ku-Vera et al. (2020b) los pastos tropicales se caracterizan por el alto contenido de carbohidratos estructurales (celulosa, hemicelulosa) y bajos contenidos de proteína, limitando la fermentación anaeróbica de la materia seca impactando en largos periodos de retención en el retículo-rumen lo que induce a mayor producción de metano entérico. Así mismo, Rivera et al. (2015) reporta que las especies gramíneas presentan niveles bajos de nutrientes, pero al combinarse con la arbustiva T. diversifolia mejoran el aporte total de nutrientes creando un mejor balance nutricional, lo que permite promover el potencial productivo de las vacas de leche, aunado a esto permite una mejor digestibilidad de la dieta logrando un incremento en el consumo voluntario de los animales, lo que se ve reflejado en mayor producción y calidad de la leche producida ((Paciullo et al. 2011;Buza et al 2014citado por Rivera et al. 2015).Tithonia diversifolia Hemsl. A Gray. es un arbusto de la familia Asterácea, originario del sur de México, América central y parte de Sur América, ampliamente distribuido en la actualidad en los trópicos húmedos y subhúmedos de América Central y del Sur, Asia y África (Crespo et al. 2011).T. diversifolia presenta alta capacidad de adaptación a diferentes pisos altitudinales, encontrándose a partir del nivel del mar hasta 2400 msnm, donde se adapta a suelos de alta y baja fertilidad (Ruiz et al. 2012). Tiene alto potencial para la producción de alimento de calidad, debido a que tiene la capacidad de acumular cantidades de nitrógeno en sus hojas de manera similar a las leguminosas, tiene niveles altos de P en sus tejidos debido a que es capaz de absorberlo de profundidades donde no es accesible a los forrajes, alta masa radicular, alta capacidad para extraer los nutrientes del suelo, tolera condiciones de acidez y baja fertilidad en el suelo y es una planta rústica. Además, tiene un crecimiento rápido y es poco exigente de insumos y manejo para su cultivo (Martínez & Leyva 2014).Rivera y colaboradores en el (2015) compararon un SSP utilizando T. diversifolia en una densidad de 5,000 arbustos/ha con pastos (Urocholoa decumbens y Urochloa brizantha) tanto en el SSP como en monocultivo y encontraron que el SSP produjo 243 g de MS/m 2 y de esto el 15% es aportado por T. diversifolia y el sistema convencional reportó 169 g de MS/m 2 es decir el SSP reporta un 30% más de producción de biomasa en comparación con el monocultivo. Así mismo reporta una producción de leche por unidad de área 33.1% superior en el SSP, respecto al sistema en monocultivo.En un estudio realizado por Navas & Montaña (2019) estableciendo T. diversifolia a una distancia de 1 x 1 m entre planta y 1.5 m de ancho de callejón, encontraron una producción de biomasa de 25.5 t/ha/año de MS, además encontraron valores de proteína de 14% en el periodo con condiciones de 0 mm de precipitación y 24% en periodo con precipitaciones de 323 mm, cada periodo con duración de 45 días, lo que refleja alto potencial para mejorar los sistemas alimentarios aun en condiciones de sequía.Según Arías (2017) realizó un estudio sustituyendo 25% y 50% de la MS del suplemento concentrado por T. diversifolia en la dieta de vacas lecheras pastoreando pasto estrella (C. nlemfluensis), donde encontró producciones diarias de 19.4 kg de leche cuando se sustituyó el 25% de la MS del suplemento concentrado con T. diversifolia; siendo esto superior a la sustitución del 50% del suplemento, además de aumentar la producción logró reducir los costos en 9.06% con respecto a la dieta testigo.Árbol o arbusto de crecimiento erecto perteneciente a la familia Fabaceae. Descrita como leguminosa perenne y leñosa, originaria de Centroamérica, nativa de México, Guatemala, Honduras, El Salvador y Nicaragua. Se ubica como la especie más cultivada a nivel mundial después de L. leucocephala, donde se diferencia de esta por la mayor tolerancia a acidez de los suelos y adaptabilidad a mayores alturas sobre el nivel del mar que le permiten adaptarse a condiciones frías y lograr mayor producción de biomasa. Como parte de los beneficios ecológicos que hace sobresalir a esta especie resalta su importancia en el control y prevención de la erosión del suelo, mejoras en drenaje y nivel de fertilidad, fijación de N atmosférico con niveles que oscilan entre 38 a 180 kilogramos de nitrógeno por hectárea (Palma & Gonzales-Rebeldes 2018).La producción de materia seca (hoja) varía entre 10 y 16 toneladas por hectárea, alcanzando niveles de proteína cruda del 23%, 52% FDN, 17% FDA y 53% de digestibilidad in vitro de la materia seca. La incorporación de esta especie a los sistemas productivos pecuarios se da mediante forraje de corta y acarreo, como banco de proteína y mediante asocio con pasturas de tipo gramíneas (Martinez 2014).En un estudio realizado por Enciso et al. (2019) donde compararon el pasto Cayman en monocultivo y en asocio con L. diversifolia, encontraron producción de biomasa total de 22.5 ton/ha/año y 32.2 ton/ha/año, respectivamente. Así mismo, encontraron valores de proteína cruda de 6.7% para el pasto Cayman en monocultivo, 8.25% para Cayman en asocio con L. diversifolia y 26.7% para L. diversifolia, resultados que se vieron reflejados en un aumento de la producción animal del 49% por ha, en comparación con el monocultivo de pasto Cayman.Peralta y colaboradores (2012) reportan ganancias diarias de peso de 1.25 kg/día, en pastoreo con Panicum máximum y Leucaena Leucocephala durante tres horas días, versus el testigo solo Panicum máximum que solo obtuvo 0.82 kg/día, obteniendo un rendimiento menor del 35% por animal.Quintero-Anzueta y colaboradores (2017) realizaron un experimento donde compararon pasto Cayman en monocultivo, pasto Cayman en una relación de 70% con 15% de Canavalia brasiliensis y 15% de L.diversifolia, encontrando niveles de proteína cruda de la gramínea Cayman de 6.8% y en la relación encontraron concentraciones de 11.0% de proteína, mejorando en un 62% la dieta cuando se incorporaron las leguminosas.En los sistemas de pastoreo actual se cuenta con una amplia variedad de materiales genéticos que están disponibles para la alimentación de los rumiantes, donde los pastos del género Urochloa están en constante estudio, tanto a nivel de parcelas experimentales como en estudios establecidos dentro de los sistemas productivos; con el objetivo de definir si son una alternativa prometedora para establecer en los sistemas de pastoreo de las ganaderías tropicales de la región. En las gramíneas al igual que en la mayoría de las plantas utilizadas en la alimentación animal, la producción de biomasa está estrechamente relacionada con el régimen o distribución de las precipitaciones, siendo el recurso hídrico uno de los principales factores que afectan su desarrollo. Con bajas precipitaciones o distribución irregular de estas, se propician condiciones de déficit hídrico en el suelo que afecta de manera negativa el crecimiento, desarrollo y la persistencia de las pasturas. (Martin et al. 2018).El pasto Cayman (Urochloa híbrido cv. CIAT BRO2/1752) con hábito de crecimiento macollado produce abundantes estolones, que en condiciones de alta humedad modifica su hábito de crecimiento, desarrollando temprano en su ciclo de crecimiento gran número de tallos decumbentes que producen macollas y raíces en los nudos, característica similar a la de Brachiaria humidicola. Estas raíces superficiales sirven como sostén de la planta, absorbiendo nutrientes y suministrando oxígeno a la planta en condiciones adversas de drenaje deficiente ante los excesos de humedad (CIAT 2018) (Martin et al. 2018). Martin et al. (2018) evaluaron la respuesta del pasto Cayman al estrés hídrico, donde utilizaron dos tratamientos (100% regado y 50% de la evapotranspiración del cultivo) y tres periodos de cosecha (30, 60 y 80 días después de siembra) donde encontraron rendimientos de 5 ton/ha y 12.7 ton/ha de materia seca para los primeros 30 días y no encontraron diferencias significativas para los rendimientos de 60 y 80 días después de la siembra.Hernandez y colaboradores (2014) evaluaron el desempeño de Cayman en el trópico muy húmedo de Costa Rica, donde utilizaron una densidad de siembra de 7 kg/ha en un área de 5 ha. Se evaluaron tres tratamientos que corresponden a tres cargas animales (1 UA/ha, 2 UA/ha y 3 UA/ha), donde encontraron producciones de materia seca de 8.8 ton/ha, 8.2 ton/ha y 5.8 ton/ha de materia respectivamente. En esos pastos los valores de proteína cruda fueron en promedio de 8.3%.En un estudio realizado por Soto-Blanco & Abarca-Monge (2018) donde estudiaron machos en crecimiento de la raza Brahman con pesos de 358 kg de peso vivo, alimentados completamente con pasto Cayman, encontraron ganancias diarias de peso de 670 gramos por día, con un consumo de materia seca de 12.8 kg peso vivo y 9.6% de proteína cruda. Así mismo, reportan 14.5 g de metano por kg de MS, según los autores estos valores son bajos ya que la relación entre la emisión y el consumo fue adecuada.Hernandez-Chaves y colaboradores (2020) evaluaron el crecimiento del forraje y la respuesta de los animales bajo un sistema de Pastoreo Racional Voisin (PRV) tomando en cuenta las épocas de lluvia, encontrando producciones de biomasa de 6.5 ton/ha por ciclo de 42 días y mayor producción para la época lluviosa de 6.613 ton/ha por ciclo de 42 días. Así mimo, encontraron ganancias diarias de peso de 860 gramos para la época lluviosa y 720 para la época seca, en ambas épocas sin suplementación y sin diferencias significativas.El metano es un gas producido en el rumen y se emite continuamente durante todo el día; en su mayoría eructado a la atmósfera por la boca y en menor medida por las fosas nasales y el ano, dichas emisiones representan una pérdida del 3-12% de la ingesta bruta de energía para el animal (IPCC 2006citado por Ku-Vera et al. 2020b).Según Archimáde et al. (2011y 2018citado por Ku-Vera et al. (2020a) hay muchos factores que influyen en la producción de metano; como el tipo de forraje si es una planta C3 o C4, composición química, relación forraje:concentrado, tasa de paso del alimento a través del rumen, etapa fisiológica, raza y sexo, todos integrados dentro de una expresión única en la ingesta de la dieta que se expresa en materia seca. Según Ku-Vera y colaboradores (2020b) existe un potencial considerable para manipular el destino del hidrógeno metabólico en el rumen, lejos de la síntesis de metano hacia la formación de ácido propiónico que consume el hidrógeno disponible, alimentando a rumiantes con plantas que contienen metabolitos secundarios.Las plantas forrajeras cumplen un rol importante en la mitigación del cambio climático, cuando se implementan estrategias de alimentación que incluye el consumo de forraje de alto valor nutritivo, incluidas las leguminosas que contengan taninos condensados. Llegano a disminuir hasta 15% de las emisiones de metano, comparado con forrajes de baja digestibilidad (ANDRADE et al., 2012;GERBER et al., 2013;MONTAGNINI et al., 2015, citado por Buitrago-Guillen et al. 2018).Albores-Moreno et al. (2020) evaluaron el efecto de la sustitución del pasto Cenchrus purpureus en la producción de metano, donde se sustituyó el 30% de este con seis forrajeras (N. emarginata, T. amygdalifolia, C. gaumeri, P. piscipula, L. leucocephala y H. albicans), encontrando que la suplementación con L. leucocephala disminuyó la producción de metano en el rumen en un 12.78%.Soto-Blanco y Abarca-Monge (2018) midieron la emisión de metano entérico en ganado de la raza Brahman en el trópico de Costa Rica, utilizaron ocho machos con un peso de 358.6 kg de peso vivo y alimentados con pasto Cayman el 100% de la dieta y encontraron producciones de metano de 168.5 g/animal por día.Prieto-Manrique y colaboradores realizaron un estudio donde midieron los efectos en animales que pastaron en gramíneas (pasto estrella Cynodon nlemfuensis y pasto guinea Megathyrsus maximus) en sistemas silvopastoriles con L. Leucocephala, en una proporción de graminea:leucaena de 80:20 y de forraje concentrado 70:30. Los resultados obtenidos de las diferentes relaciones fueron más altos para la dieta de estrella con suplemento, con niveles de 100ml/gramo y la más baja fue para la mezcla con L. Leucocephala de 70% y 30% concentrado con 68.01 ml/gramo. Cardona-Iglesias et al. (2017) reportan producciones de metano in vitro de 31.4% y 32.1% menos al incluir botón de oro en las dietas versus no incluirlas en una dieta con pasto Kikuyo Cenchrus clandestinus y suplementadas con concentrado, Según Cardona-Iglesias et al. (2017) la reducción se debe a un mejor balance de los nutrientes en la dieta y a la presencia de metabolitos secundarios como taninos y saponinas (Carmona et al 2005).Según Yañez-Ruiz y colaboradores (2016) las técnicas de fermentación in vitro han sido utilizadas para evaluar el valor nutritivo de los alimentos para rumiantes y en la última década para evaluar el efecto de las diferentes estrategias nutricionales en la producción de metano. Hatew et al. (2017) investigaron la relación entre la producción de metano in vitro e in vivo medida simultáneamente, con dos fuentes y dos niveles de almidón, suministradas a 16 vacas lecheras de la raza Holstein-Friesianas, todas equipadas con cánula en el rumen. En este experimento adaptaron las vacas durante 12 días con cada una de las dietas a evaluar, al finalizar el periodo de adaptación fueron sometidas por cinco días a cámaras de respiración de calorimetría indirecta de circuito abierto controlados por climas idénticos. Para la producción de metano in vitro se incubaron los 4 tratamientos (dos fuentes y dos niveles de almidón) y dos adicionales que fueron ensilaje y pulpa de remolacha, estas fueron inoculadas con 60 mL de licor ruminal amortiguado con una solución de fluido buffer, provenientes de vacas donantes previamente adaptadas a cada una de estas dietas. La medición de metano se realizó por medio de cromatografía de gases. Donde encontraron producciones in vivo de metano para las dos fuentes de 597 y 545 L/d y para los dos niveles 581 y 557 L/día en comparación con las producciones de metano in vitro 828 y 751 L/día ; 797 y 570 L/día respectivamente, Dichos resultados mostraron que hay una correlación entre la producción de metano in vivo e in vitro (0.54; p=0.040) cuando los resultados se expresaron por unidad de materia orgánica fermentable en rumen, sin mostrar correlación cuando los resultados se expresaron en materia orgánica ingerida (0.04; p=0.878); los autores atribuyen estos resultados a que la digestión in vivo de materia incluye los efectos combinados de la fermentación del rumen y la fermentación del tracto posterior, reflejando esto la fermentación del rumen solamente a diferencia de la fermentación in vitro.Macome y colaboradores (2017) realizaron un estudio evaluando la producción de metano in vitro, utilizaron ensilajes de centeno con tres fechas de madurez (28, 41 y 62 días) y dos cantidades de fertilización (65 y 150 Kg de N/ha). Los seis tratamientos fueron utilizados en 54 vacas de la raza Holstein-Fresianas en una dieta de ensilaje:concentrado (80:20) de materia seca. Los resultados reportados por los autores indican que no hubo una correlación entre la producción in vitro e in vivo (R 2 0.01; p=0.08), concluyendo que la variación entre las vacas donantes era superior en comparación con las diferencias entre los diferentes tratamientos.El estudio será realizado en la finca comercial del Centro Agronómico Tropical de Investigación y Enseñanza (CATIE), ubicada a 640 msnm en Turrialba, provincia de Cartago, Costa Rica. La precipitación media anual es de 2600 mm, con una temperatura media anual de 23 °C. El experimento será realizado entre los meses de octubre 2020 a abril del 2021, realizando durante este periodo tres muestreos que corresponden a tres repeticiones.Figura 1. Localización del estudioSe utilizará un diseño experimental de bloques completos al azar (BCA), utilizando 4 bloques. Cada bloque está constituido por tres tratamientos (Cuadro 2) y cuatro repeticiones por tratamiento, con tamaños de parcela de 2500 m 2 . En todos los bloques se realizó primero la siembra de pasto Cayman y posteriormente a la siembra del pasto se sembraron entre cuatro y nueve surcos con doble hilera de plantas de Leucaena diversifolia y Tithonia diversifolia con distanciamiento de 5 m entre surcos, 1 m entre plantas y 1 m entre cada hilera dentro de cada surco (Cuadro 3), obteniendo densidades de siembra que van desde 576 a 648 plantas por parcela (2500 m 2 ) equivalente a 2304 y 2592 plantas/ha Cuadro 2. Identificación de tratamientos Cuadro 3. Distribución de plantas en los tratamientos.El establecimiento del pasto Cayman se realizó en noviembre del 2018, donde se realizaron prácticas de labranza, consistiendo estás en una pasada de arado y dos pasadas de rastra, seguidamente se realizó la siembra al voleo utilizando 8 kg de semilla por hectárea, distribuida de forma manual y posteriormente tapada con una rama jalada por el tractor.Las leñosas fueron establecidas de agosto a septiembre de 2019. Previo a la siembra se realizó la aplicación de herbicida sobre el pasto Cayman ya establecido, aplicándolo en franjas de 1.5 metros de ancho y correspondiendo cada franja a los respectivos surcos establecidos para cada leñosa forrajera. En el caso de T. diversifolia la siembra se realizó en callejones utilizando material vegetativo (estacas), donde se utilizaron dos estacas en equis (X) por punto de siembra; para L. diversifolia la siembra se realizó en callejones utilizando plantas en bolsa plástica que habían sido sembradas y manejadas previamente en viveros mediante semilla sexual.El establecimiento de L. diversifolia se realizó en callejones, sembrada a doble hilera con una distancia entre planta 1 m y 1 m entre filas con 5 m de callejón, para ambos asocios la densidad de siembra del pasto Cayman fue igual al del monocultivo mencionado anteriormente. Cada tratamiento está representado en cuatro parcelas de 2500 m 2 cada una, para un total de una hectárea por tratamiento. Se consideró un periodo de establecimiento de 12 meses, durante el cual se realizó un corte de uniformización entre 0.15-0.30 m de altura sobre la base del suelo para la especie T. diversifolia y a 0.8 m para la especie L.diversifolia; para el pasto Cayman se realizó dos cortes a una altura de 10 cm con el objetivo de uniformizar las parcelas y tener un punto de partida para las evaluaciones.3. Disponibilidad de biomasa y calidad forrajera:Para la variable producción de biomasa y calidad nutricional se utilizará un diseño de bloques completos al azar (DBA), con una estructural trifactorial de tratamientos dadas por el factor forraje con tres niveles (Cayman, T. diversifolia y L. diversifolia), factor posición (dentro de las hileras, a 0.5 m de las leñosas y a 2.5 m al centro de las leñosas) y el factor tiempo (3 ciclos de cosecha), en parcelas divididas donde el tratamiento forraje se encuentra en la parcela principal dentro de cada bloque y las tres posiciones (dentro de las hileras, a 0.5 m y a 2.5 al centro) son las subparcelas que representan la posición y el tiempo de cosecha.con el modelo Yijkl= µ+Fi+Pj+Tk+FPij+FTik+PTjk+FPTijk+βl+Ppil+Spil+Ɛijkl ~ N (0, Ϭ 2 ) donde:Yijk Producción de biomasa total µ Media general Fi Efecto del i-ésima Forrajera (i=Cayman, T.diversifolia y L. diversifolia) Pj Efecto de la j-ésima posición Tk Efecto de la k-ésima factor tiempo (k= tres ciclos de cosecha) FPij Efecto de la interacción de la i-ésima forrajera en la j-esima posición FTik Efecto de la interacción de la i-ésima forrajera en el k-ésimo tiempo PTjk Efecto de la interacción de la j-ésima posición en el k-ésimo tiempo FPTijk Efecto de la interacción de la i-ésima forrajera en la j-ésima posición en el k-ésimo tiempo βl Efecto aleatorio del l-ésimo bloque Ppil Efecto aleatorio de la i-ésima forrajera en el l-ésimo bloque (error \"A\" de la forrajera) Spj(il) Efecto subparcela de la j-ésima posición (error \"B\" para posición) además, βl Efecto de bloque ~ N (0, Ϭ 2 β)Ppil Efecto de parcela principal ~ N (0, Ϭ 2 pp ) Spj(il) Efecto de subpacela ~ N (0, Ϭ 2 sp ) Ɛijkl Error asociado a la ijkl-ésima observación de forma normal e independiente con esperanza cero y varianza σ 2 . Los cuatro efectos aleatorios son mutuamente independientes.Para el tratamiento en monocultivo se realizará el muestreo de forma sistemática en cada parcela, seleccionando 24 puntos de muestreo en forma de zig-zag, con los que se formará una muestra compuesta. Cada muestra será colectada utilizando un marco de 0.5 m x 0.5 m (0.25 m 2 ) (Lopez-Guerrero 2011), cortada a una altura de 10 cm sobre la base del suelo y pesada con una balanza digital. El muestreo de pasto Cayman en asocio se realizará de forma sistemática, seleccionando puntos de muestreo en forma de zig-zag, en el recorrido se obtendrán muestras dentro de las hileras de cada surco (8 muestras), a 0.5 m de las hileras (8 muestras) y en el punto medio entre surcos, que es 2.5 m al centro (8 muestras). De cada uno de los tres puntos de muestreo (dentro hileras, a 0.5 m de las hileras y 2.5 m al centro) saldrá una muestra compuesta por tratamiento, en cada bloque. Todas las muestras serán pesadas en campo con una balanza digital y de cada muestra compuesta se tomarán dos muestras de 1 kg, una muestra será enviado al laboratorio para el análisis bromatológico y la otra se utilizará para la variable relación hoja tallo.Para la estimación de biomasa en las especies leñosas, el muestreo se realizará de forma sistemática seleccionando una planta cada 8 m en cada fila, sin tomar en cuenta los límites de cada parcela para reducir los efectos de borde. El recorrido en la selección de los puntos de muestro iniciará en el lado izquierdo y finalizará en el lado derecho de cada surco. Las plantas de T. diversifolia y L. diversifolia serán cosechadas cada 50 días a una altura de 0.25 m y 0.8 m respectivamente. Todas las muestras serán pesadas de manera individual utilizando una balanza digital, para las estimaciones de la biomasa total. Del total de plantas muestreadas se seleccionarán de forma aleatoria 5 plantas por tratamiento en cada bloque, separando la biomasa de cada planta en cuatro fracciones: Fracción fina (Hojas (HF) y Tallos (TF) con diámetro menor a 5 mm) y Fracción gruesa (Hojas (HG) y Tallos (TG) mayores a 5 mm) (Garcia et al. 2008, Bacab et al. 2012, Rodríguez et ál. 2001). La biomasa comestible será estimada mediante la suma de las fracciones HF, TF y HG (Pérez 2012, Rodríguez et al. 2001, Lombo 2012). Después de separar las fracciones estas serán pesadas por separado: fina (hojas y tallos) y gruesa (hojas y tallos), tomando una muestra compuesta de 200 gramos de cada una de las fracciones para cuantificar el contenido de materia seca, en un horno gravitacional a 60 °C durante 72 horas, con esto realizar las estimaciones de la variable relación hoja tallo (Lombo 2012).Las fracciones utilizadas (HF, TF y HG) para las estimaciones de la variable comestible serán mezcladas entre ellas para formar una muestra compuesta, de la cual se separará 1 kg que será enviado al laboratorio para realizar los respectivos analices bromatológicos. Con los datos de materia seca (%) se realizarán las extrapolaciones de los datos para estimar la variable de biomasa seca comestible (kg ha -1 )En el análisis de calidad se realizará a cada muestra por separado de T. diversifolia, L. diversifolia y pasto Cayman. Mediante el análisis bromatológico se realizará la estimación de las variables incluidas como indicadores de calidad nutricional, dicho análisis será realizado mediante análisis proximal por química humedad con las metodologías de la AOAC (1996) en el laboratorio de bromatología de la Cooperativa Dos Pinos.-Materia seca (%) -Proteína cruda (%) -Fibra detergente neutro (%) -Fibra detergente ácido (%) -Digestibilidad in vitro de la materia seca (%) 5.5. Producción diaria y calidad de lechePara la variable producción diaria y calidad de leche se utilizará un diseño completo al azar (DCA) con medidas repetidas en el tiempo, donde cada vaca representará una unidad experimental, con el modelo Yijk=µ+Fi+Tj+FTij+Vk+Ɛijk, ~ N (0, Ϭ 2 ) donde:Yijk Producción de leche µ Media general Fi Efecto de la i-ésima forrajeras (i=Cayman, T.diversifolia y L. diversifolia) Tj Efecto del j-ésimo tiempo FTij Efecto de la interacción de la i-ésima forrajera en el j-ésimo tiempo Vk Efecto aleatorio de la k-esima vaca que es el sujeto en las medidas repetidas Ɛijk Error asociado a la ijk-ésima observación de forma normal e independiente con esperanza cero y varianza σ 2 . Para la variable producción diaria y calidad de leche se utilizarán vacas con cruce F1 (Jersey x Gyr y Jersey x Sahiwal) previamente pesadas y que se encuentren entre 2 y 5 lactancias, con 60 y 100 días en leche (DEL), manejadas en tres grupos y siendo cada grupo representativo a cada uno de los tratamientos evaluados. La cantidad de animales que ingresarán al pastoreo de cada uno de los tratamientos será estimada basándose en la disponibilidad del forraje determinada mediante un muestreo pre-pastoreo.Durante el periodo de evaluación las vacas de los diferentes tratamientos ingresarán de forma simultánea a cada una de las parcelas de 2500 m 2 , pasando por un periodo de acostumbramiento a las condiciones experimentales durante siete días, basado en la investigación de Mojica-Rodríguez y colaboradores (2019) quienes realizaron un ensayo midiendo el perfil lipofílico en vacas en pastoreo basado en el estudio de Jeffery (1970), quien sugirió un periodo de acostumbramiento de cuatro días mínimo, y del estudio de Stoobs y Sandland (1972) quienes sugirieron un periodo de acostumbramiento entre cuatro a nueve días para evaluar el efecto de forrajes sobre la producción de leche de vacas en pastoreo. Así mismo, Rivera y colaboradores (2015) evaluaron el efecto de la oferta y el consumo de T. diversifolia en la calidad y productividad, donde utilizaron seis días de acostumbramiento y cuatro días de medición. Seguido al periodo de acostumbramiento se tendrá un periodo de siete días correspondiente a la toma de datos de las variables enumeradas.Cada parcela de 2500 m 2 tendrá un periodo de ocupación de 3.5 días, dividiendo cada parcela en tres partes iguales mediante cuerda electrificada para un mejor aprovechamiento y gestión de la pastura. Esto será aplicado para cada una de las parcelas, para lo cual dos parcelas serán para el periodo de acostumbramiento y dos parcelas para el periodo de toma de muestras. Para calidad de leche y para producción se tomará los datos cada tres días durante un periodo de 14 días. Dando como resultado un ciclo de pastoreo de 14 días, posterior a esto para completar el periodo de descanso de 60 días requerido para las arbustivas de acuerdo con Ochoa (2011) citado por (Mejia-Díaz et al. 2017) se dejarán en descanso las áreas hasta el siguiente ciclo de evaluación.Durante el periodo de muestreo (siete días) y en cada ordeño se medirá la producción diaria por vaca durante los dos ordeños (AM/PM), mediante el pesaje en la sala de ordeño.Para las variables de calidad y composición láctea se tomará una muestra de leche de 50 ml en cada ordeño (AM/PM) colectadas en recipiente estéril, la muestra correspondiente a los dos ordeños será mezcladas para formar una muestra compuesta por día por vaca, la cual será enviada a laboratorio para los análisis de grasa, proteína y solidos totales. Estas muestras enviadas a laboratorio corresponderán a los días 2, 4 y 6 dentro del periodo de muestreo.Para la variable producción de metano in vitro se utilizará un diseño de muestreo en bloques con dos repeticiones (tiempo 1 y 2) para aumentar el espacio de inferencia, en estructura factorial incompleta (tipo: forrajeras y dosis: relación forraje:concentrado) en 27 tratamientos siguiendo el modelo Yijk=µ+Mi+ βj +Ɛijk, ~ N (0, Ϭ 2 ) donde:Producción de metano in vitro µ Medía general Mi Efecto del i-ésimo tratamiento βj Efecto aleatorio del l-ésimo bloque ~ N (0, Ϭ 2 β)Error asociado a la ij-ésima observación de forma normal e independiente con esperanza cero y varianza σ 2 .Para la producción de metano in vitro se tomarán muestras compuestas de Cayman, T. diversifolia y L. diversifolia con sus combinaciones, más la adición de alimento balanceado Vap Feed™ 16%, utilizado en la lechería comercial de CATIE.La distribución de los tratamientos se realizará basado en las relaciones forraje:concentrado 60:40, 70:30 y 80:20 (Cuadro 3). Estas relaciones se establecen basándose en el estudio de Van Wyngaard et al. (2018), quienes evaluaron el efecto de tres relaciones de forraje concentrado (100%, 78% y 60%) en las emisiones de metano en vacas en pastoreo. Las relaciones de gramínea:arbustiva que se utilizarán (70:30 y 80:20 ) se establecen tomando como referencia el estudio de Mahecha (2007); quien utilizó hasta un 35% de inclusión de T. diversifolia obteniendo mejores resultados con 25% de inclusión al igual que Arias (2017).Se enviarán al laboratorio 25 muestras en materia fresca de 200 gramos de pasto Cayman, 13 muestras en materia fresca de 200 gramos de T. diversifolia y 13 muestras en materia fresca deSe espera encontrar una mayor disponibilidad y calidad nutricional en los sistemas de pasto Cayman en asocio con Tithonia diversifolia y Leucaena diversifolia.Con la integración de las leñosas forrajeras (Tithonia diversifolia y Leucaena diversifolia) con pasto Cayman en la dieta de vacas cruzadas se espera que aumenten la producción y la cantidad de solidos en la leche.Al adicionar alimento balanceado en diferentes proporciones respecto al forraje (Cayman y leñosas), se pretende encontrar la combinación que genera las menores emisiones de metano in vitro."}

main/part_2/0442369456.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"f041d7029f8806a3bf26f0f165610a06","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2c4288c4-8118-4208-a73b-4d5cb0696445/retrieve","id":"-1562476336"},"keywords":[],"sieverID":"ce63fb99-81cf-4fa9-9760-46bee4942aad","content":"Research and development efforts to strengthen farmers' linkage with markets often focus on the systematic assessment of market chains, formulation of pro-poor policy recommendations, and the introduction of macrolevel enabling mechanisms. Meanwhile there is growing recognition of the critical need for action-learning approaches for enhancing smallholder producers' capacity to better manage farm businesses within dynamic market chains. Traditional agricultural extension generally deals with production-focused, technology-driven learning content. Yet it is now widely acknowledged that farmers also need to acquire knowledge, skills and attitude to improve their participation in and benefit from market chains.The main objective of this paper is to analyse key learning approaches in enhancing farmers' capacity to link with markets, in particular by comparing: 1) crop management-and marketing-based curricular frameworks, 2) farmer-group and chainwide participatory processes, 3) classroom-and field-oriented learning settings, and 4) single-activity and season-long learning designs. The paper assesses the emerging trends in farmer capacity strengthening towards a more experiential learning process with a market chain perspective -as exemplified by the participatory market chain approach and farmer business school. It highlights experiences and lessons from the root and tuber crops sector, drawn from collaborative work by the International Potato Center and partners in developing countries of Asia, Latin America and Africa. Finally the paper identifies needs and opportunities to further improve capacity strengthening approaches, including their potential adaptation and upscaling across agricultural market chains and contexts.The International Potato Center (CIP) is one of the 15 centres that make up CGIAR, the Consultative Group on International Agricultural Research. CIP has a long history of research into technological on-farm innovations, because many of the CGIAR centres were created as crop improvement centres, introducing varieties as part of the green revolution. The centre has recently become part of the discussion and debate on markets, which is an exciting development.The products of CIP's research benefit the poor, including both the producers and the consumers. The centre has a mandate to work on root and tuber crops, which gives it the extra challenge of adding value to crops that are otherwise neglected and under-utilised. This paper gives an overview of the work CIP does in terms of strengthening farmer capacity in South America, Africa and Asia.At the centre's base in Peru in South America, CIP has started work on value chains. The aim of the studies there, on the DNA of the various potatoes, is to stimulate market demand and conserve genetic diversity. The potato best known in the Asia Pacific region is yellow, but there are actually 4000 varieties of potato, and they come in purple, orange and red. If you go to one of the supermarkets in Lima, Peru, and buy a packet of potato chips you find they are multi-coloured, and that is stimulating market demand for the potato in Peru. In turn, the demand gives an incentive to farmers to conserve native potatoes in the highland Andes.In Africa, there is a different value chain. CIP is creating demand based on the nutritional value of an otherwise low-status food, the chip potato. The strategy is to improve the nutrition of the centre's target populations, which are women and children younger than 5 years, by promoting consumption of chip potatoes, based on the value of sweet potatoes as a source of Vitamin A.In Asia, CIP works across East Asia to South Asia. One example is the work in Indonesia on collective brand development for traditional potato snack foods. That includes, for example, making use of the non-marketable potatoes that are not accepted by FritoLay or Indofood. CIP encourages their use in traditional potato snack foods, one of which is called jacket potato chips, and CIP is creating a collective brand, capitalising on local culture of West Java.In the Philippines, CIP's focus is on the link to the industry for feed, on valueadded processing for sweet potatoes as a raw material for the feed industry.In CIP's work on linking farmers to markets, the research and development have several key themes. One theme focuses on enabling policy, institutions and safety nets. Another theme is in marketing support services, enhancing access. CIP looks mainly at partnerships between market chain actors, improving coordination and collaboration between them. Of course, farmers have a vital role in relation to partnerships in market chains. Much of CIP's work is focused on how to link small farmers into agriculture market chains, in terms of decisionmaking and action. This paper focuses not on the dynamics of market chains, but rather on an important element of how farmers decide and take action on market opportunities and participation in market chains. From the viewpoints of research and development, CIP is exploring the role of capacity strengthening, so that farmers are able to make decisions and take actions that allow them to not only participate but also benefit from these chains.In relation to work on capacity strengthening for farmers to link with markets, there are three key points to highlight:  The International Potato Center works in South America, Africa and Asia to enhance appreciation of the value of tuber crops, and farmers' knowledgeThe International Potato Center uses several approaches in strengthening farmers' capacity not only to produce crops but also to understand the market, the stakeholders involved, and the business aspects of their own farmsMarket and Supermarket Issues for DevelopmentWhen talking about linking farmers with markets, the CIP teams have found it important to ask: \"Which farmers are we talking about?\". In working with farmers, that question has been particularly relevant in parts of Asia. Which farmers is CIP trying to link? The farmers who are already doing business with markets, or the farmers who are 10-20 hours of travel away from the nearest urban centre?There is a need to deconstruct the farmer 'stereotype'. In many parts of Asia, there are farmers who produce food for the household, which is called subsistence, as well as for the market. There is an increasing tension, which can be illustrated with Cassava. Cassava serves as a food crop, but now it is becoming an industrial crop for producing starch and bio-ethanol. How does the farmer decide between his food security needs and opportunities for the market?Should CIP be working with the farmers who are smallholders, or the large-scale farmers? (It should be noted that a small farmer in Australia is a big farmer in Asia.) It is not always clear what is meant by 'small', by 'scale'. In some contexts, being small is about scale of production; in other contexts it is about landholdings; in other contexts it is about the number of children that the farmer has, who can work as labour for the farm. It is important to determine whether the aim is to link smallholders or large-scale farmers.There are also farmers who are becoming vertically integrated, so to speak. In talking about farmers, does the word mean the cultivator, or the cultivator who at the same time is the local trader and service provider? At many of CIP's training courses for farmers as learners, across Asia, during break times these farmers are doing negotiations and loans with other participants. So it is quite important to know which actual farmers are being invited. They may be cultivators, or they may be landless -basically, hired labourers.Another group is the full-time farmers and the farmers with non-farm livelihood roles. Surveys done in Asia have found that many of the so called farming households actually derive almost half of their income now from non-farm and non-rural livelihoods: the latter can include remittances from relatives working in cities and abroad. Are these still farming households or should they be termed 'rural households', when a significant part of household income comes from other than their own farming?A second aspect of capacity strengthening is 'farmer learning approaches'. Agricultural extension has a long history of training farmers in ways to increase production. Review of training curricula and extension approaches shows that 90-95% of the learning content is about how to grow and how to increase yield. Normally, marketing is only an afterthought.More recently, learning approaches have looked at market chains, bringing in different actors across chain-wide platforms to enhance farmer participation. ForEnhancing farmers' capacity to with markets -Campilan example, farmers and traders and retailers and wholesalers come together and discuss combinations and opportunities for collaboration.CIP has found, however, that often farmers are not ready to come onto these platforms. In Latin America where there is a long history of social action, it is very easy for farmers to speak up; they are not afraid to sit beside other more powerful actors, such as wholesalers. In Asia, on the other hand, in many of the countries, that is usually not the case. When small farmers from rural areas have come face to face with supermarket representatives, almost always the farmers have not said anything. It has become evident that there is a need for capacity building beforehand, to prepare these small farmers before they meet other actors in the market chain. Now a third approach is emerging: that is, farmers learning to grow and sell; farmers preparing themselves for subsequent interactions with the other actors in the market chain.In talking about markets, it is very important to remember that, really, the task of marketing is just one part of a broader repertoire of tasks that farmers do. For example, when staff of the International Potato Center go to a farm they expect to see potatoes. However, you can be sure that the farmer, knowing that the price of cabbage is going up the next season, will shift to the next crop.When helping farmers learn about marketing, it is important to understand the livelihoods portfolio. Farmers go into product diversification and different crops, or they may choose to specialise. Their decisions, as far as linking with markets, are often influenced by this broader portfolio of livelihoods that they engage in.The social environment is another important factor that CIP considers. Is the training for farmers as individuals, as organisations or as networks? Are they coming to CIP's capacity-building events as individual entrepreneurs or as members of a cooperative or informal network of producers or local entrepreneurs?Learning-experience is a third important context for learning. Needsassessments for CIP's training courses have shown that there is very little prior exposure to marketing training, especially in public-sector extension in developing countries. Prior exposure to marketing itself, and to what happens outside the boundaries of the farm, helps farmers learn.The last aspect of the learning context is the value system. It is often thought that economic gains are central to value-chain development or benefits for market-farmers. Yet, particular social norms are also important, as well as the social values that farmers hold. Farmers consider trade-offs and compromises between economic gain and building social capital, for example. Indeed, there are some social norms that prevent particular participants from taking part in training. Some countries in Asia make it very difficult for women participants to travel alone and to visit and do a market-chain assessment because many cultures frown on women travelling alone. So how can women participate fully in learning events when there are social constraints?Five key approaches in capacity strengthening have emerged over the years. The three that are applied predominately are participatory market assessment, multistakeholder dialogue, and single-event training.Participatory market assessment often involves farmers learning to do market assessment, appraisal and analytical exercises. The outcome is often an analysis and appraisal, and there is an assumption that the farmers later on will be able to apply what they have learned from the appraisal.The second type, multi-stakeholder dialogue, builds on market assessment and brings in external experts. They come together in a dialogue with a range of stakeholders at a platform for consultation and negotiation, discussing policy recommendations. Both this and the participatory market assessment approach basically focus on detailed analysis and appraisal, and the assumption is that action follows on, based on what people have learnt on this joint-learning platform.The third approach is single-event training: classic extension training for farmers. This is often done over three days or one week; it is classroom-based with a structured curriculum, and farmers learn about business skills.More recently, another approach has emerged, called chain-wide action learning. This also uses a structured curriculum, but the difference is there is an action component to it. As well as doing the market assessment, the farmers are testing innovations, and there is an evaluation of the outcomes of the learning, which involves different actors on the chain.A fifth approach, which CIP has recently tested in work with the Asia project, is called the farmer business school. It recognises the need for prior training for farmers before they get into contact with, or interact with, the rest of the actors in the chain. It has a farmer-focused curriculum with interactive events with other chain partners, and the action component facilitates testing and innovation within the farmer business school.CIP has also examined different content areas for use in farmer capacity strengthening. Three or more years of pilot trials have shown CIP what farmers seek to learn and what other actors in the market chain would like farmers to learn. Naturally, these include the classic business management skills, business planning and financial management.An interesting finding is that farmers themselves and the other actors in the chain have suggested and seen the need for a wider range of capabilities that includes, for example, social and ethical conduct. Another need is for 'market chain orientation', to help in characterising market chains and identifying market opportunities; and how to develop loyalty and successive contracts for market agreements. Organisations and services is another area; people want to know what the options are for groups organising themselves into businesses in Asia where the cooperative is almost the one and only solution to organising farmers.Enhancing farmers' capacity to link with markets -Campilan How do they access business support services? Also, capabilities in developing and testing innovations, such as value-adding technologies and institutional and commercial innovations, are seen as useful.In summary, here are some key design principles for farmer learning.The CIP teams believe that the first step in any capacity-strengthening for farmers is to change their view of the farm, from production system to business enterprise. In Australia and many advanced countries in Asia, this seems like common sense, but that is not the case in many other countries. In centralised economies, in central Asia for example, when CIP started working there 10 years ago, the team found it difficult to start talking about pricing or even quality, because those farmers for many years had been told what to produce and where to sell. They never bothered about markets; these people did not have a concept of price or of market.The second principle is that the successful farm business requires a capacity not only for technological change but more importantly for nurturing relationships with market chain actors and partners. One example is the wholesaler Bimandiri, which acts as one of these assemblers, playing the linking role between supermarkets and farmers, but beyond that role in the market chain it also supports capacity strengthening. CIP is teaching farmers about standards, sorting and grading and other aspects that lie behind the market chain.A very important principle is that learning-approaches have to support farmers' everyday decisions between preserving or growing limited assets; between investing for immediate benefits or for longer-term returns; between concrete economic rewards or less tangible social values.The final principle is that the farmers learn better where they are in a familiar place and social setting. In designing CIP's learning curricula, the centre's teams have found that farmers learn better when they are taught in a farm environment, in sync with the season and production and marketing, and in a familiar group-interactive setting. "}

main/part_2/0447959830.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"6b44d0b7e856f80fed2cdb323be259ec","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0d8e3971-5d89-408c-b9d3-d7f2d68bf07f/retrieve","id":"483754393"},"keywords":[],"sieverID":"c7bd39b2-fe59-4205-93a6-a0bf42d78230","content":"To improve the natural biological control of AfRGM, rice varieties/test entries (FAROs 36,44,66,and 67 in Nigeria,and FKRs 19 and 64 in Burkina Faso) were planted/surrounded with Paspalum scrobiculatum to increase the carry-over of parasitoids from PGM to AfRGM at hot spot locations in Nigeria (Bida in Northcentral and Abakaliki in Southeast) and in the Vallée du Kou rice scheme of Burkina Faso (Figure 1). Key Results: The results showed that the average rice yield was higher in fields surrounded with Paspalum scrobiculatum compared to the control fields without Paspalum in both countries (Bida and Abakaliki in Nigeria (Table 1) and Vallée du Kou rice scheme in Burkina Faso (Figure 2).  "}

main/part_2/0451136933.json

@@ -0,0 +1 @@
+{"metadata":null,"keywords":null,"sieverID":"89434ae1-20a9-4e08-b981-7eb9a8573db6","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}

main/part_2/0454089547.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"673555602c256528d0156942672f6a27","source":"gardian_index","url":"https://www.cifor.org/publications/pdf_files/Books/SOF-2021-12E.pdf","id":"-492410895"},"keywords":[],"sieverID":"9e37b5e6-2fe2-4be9-9a43-e5104428c262","content":"The aim of this chapter is to take stock of forest landscape restoration in Central Africa. First, we clarify the concept of landscape restoration. Second, we present some cases illustrative of forest landscape restoration in Central Africa. Finally, we cover the question of governance and then offer some conclusions. 1 https://www.decadeonrestoration.org/strategy The forests of the Congo Basin | 319 Forest Landscape Restoration (FLR) in Central AfricaViews on forest landscape restoration (FLR) often differ. Ecological rehabilitation, which seeks to restore pre-existing ecosystems in terms of specific compositions and community structures, is not always feasible. FLR works differently, to reconstitute certain ecosystem functions in order to improve the well-being of the people who live or will live in those landscapes. In this way, FLR also contributes to climate-change adaptation and mitigation and to biodiversity conservation. These two forms of response to forest ecosystem degradation can be combined in local or regional landscape planning.FLR is a long-term process that seeks to limit continued degradation of existing forest ecosystems and/or to repair them (i.e., forest rehabilitation), so as to sustainably improve the living environment of local people 1 . Reducing forest degradation involves changing the rules of interaction between natural and social dynamics (e.g., patterns of resource appropriation). FLR may, of course, include forest rehabilitation actions, such as plantations, assisted natural regeneration, or water and soil management (e.g., terraces, anti-erosion ditches, mulching, soil conditioning) on areas that are individually owned or common property, but it cannot be reduced to and confused with these actions. FLR is a long-term and changing process that involves adaptations to social, demographic or institutional change, or to change in stakeholder perception or environmental conditions. It requires shared vision at various levels, co-construction with stakeholders, and monitoring systems. FLR should be part of local land use planning via a decision-making process, and this latter must precede the setting out of its objectives and methods of action. This decision-making process determines the framework for the long-term restoration of the ecosystems in question.Landscape restoration is therefore not limited to planting projects, and -given societal demands -it is very rarely a return to the original ecosystems. Source: https://afr100.org/content/countries At its 9th Ordinary Session in November 2016 in Kigali, Rwanda, the COMIFAC Council of Ministers gave its support to the AFR100 process. This should help COMIFAC countries to meet their commitments to reverse the trend of forest and land degradation, by restoring 15 percent of degraded forests by 2020 and 25 percent by 2025 in Central Africa (COMIFAC 2014).At the national and subnational levels, there are methods to determine the general framework and objectives of FLR (see the case of the CAR below). At the local level, a very different approach is needed to ensure that local populations are fully involved in the decision-making process. Indeed, it is important that they themselves determine how their living environment and habits will be transformed with the purpose of restoring, over the long term, the landscapes that provide them with the renewable resources and ecosystem services on which they depend. Linkage between the top-down decision-making process of the national framework and the bottom-up process from the local populations is critical and probably unique to each country, when it exists.The FLR process involves a multistakeholder dimension at the local level and requires the establishment of a consultation strategy which seeks to empower each category of stakeholders. This, in turn, should motivate their involvement in the various stages. Women's contribution to knowledge is crucial and must be equal to that of men, as they are most often excluded from decision-making processes.The processes of degradation are often a precursor to deforestation (Vancutsem et al. 2021). In Central Africa, when forest tracks are opened, it enables the local population to clear the forest for growing crops. The multiplication in the number of these fields increases along with population growth, leading to complete deforestation, when logging alone would not have caused it. These processes are not inevitable: they are due to an institutional and governance situation that is unable to control the activities that generate forest degradation. In other words, it is not so much logging, roads and tracks which cause deforestation as the lack of suitable institutions to control and limit the various processes of degradation.The Central Africa region had long seemed spared by forest degradation (Tchatchou et al. 2015), especially compared to other large tropical forest basins in Brazil and Indonesia. But today acceleration of degradation and deforestation in the regions is observed, by both the JRC 3 (Vancutsem et al. 2021) and by Global Forest Change.Given the increasing degradation of forest ecosystems in Central Africa, it is essential that landscape restoration incorporate measures to slow it down. In line with countries' commitments, the challenge is to find trade-offs that allow the people who live there to produce the goods they need (e.g., food, wood and energy), all the while maintaining the forest ecosystems that ensure the sustainability of agronomic systems and provide other ecosystem services (see Chapter 7).Slash-and-burn and subsistence agriculture are the leading cause of forest cover loss in the Central African humid zone (GFW). 4 Around cities, in areas of high population density, or along roads, slashand-burn practices used by elders are no longer a sustainable system of agriculture, but a major cause of degradation and deforestation. In the past, these practices led to small clearings within large forest areas. The fallow system at the time was long and thus viable, as it allowed return to secondary forests. Today, that system is characterized by a process of degradation, with increasingly short fallow periods and made worse by the excessive use of fires, this latter being the main tool of a precarious peasant population with limited options. Uncertainties about land rights leave these people with no choice but to assert these rights by means of axe and chainsaw.The main causes of degradation in the driest areas are exploitation of firewood, excessive use of pastoral fires and the roaming of livestock. Other causes that can have a significant local impact include agro-industries, mining (which is often informal) and refugee camps. These can lead to significant local degradation of ecosystems and even to definite deforestation.There are also indirect causes. For example, land and forest management is linked to the institutional framework specific to each territory and each country. These institutions are based on perceptions of the state of forest resources and land. With the exception of countries such as Rwanda and Burundi, there is a widely shared perception in Central Africa that there are abundant forest resources and land (abundance theory). As a result, forestry policies have focused on developing, i.e., exploiting natural resources rather than investing in their long-term management. These policies have thus created conflicts either with local populations due to lack of participation or transparency, or between government agencies due to lack of coordination. Finally, rural populations, within existing institutional frameworks, also often have the same approach: exploiting to develop and appropriate space, by destroying the existing ecosystem, according to the rights of clearance.Other indirect causes of forest degradation stem from inconsistencies in international public policies. Many efforts were made in the 1970s and 1980s to develop forest plantations. Such efforts could have alleviated the pressure logging causes in natural forests today, but they were abandoned in the 1990s because of structural adjustments. A whole body of technical knowledge was lost this way, even though major forest rehabilitation programmes are being considered today. This organization started the actions to combat desertification and drought via the initial phase of Operation Green Sahel. This programme promoted mass reforestation to respond to the degradation of the environment.To comply with its commitments to the UNCCD, Cameroon produced the National Action Plan to Combat Desertification (NAP/LCD) in 2006. This plan relaunched Operation Green Sahel, which incorporates the new guidelines of the Convention. Later, to cope with land degradation on cottongrowing areas in the old cotton basin of North Cameroon, a plot-based land restoration system was set up to develop soil fertility preservation habits among cotton producers. An analysis of the second progress report on the Bonn Challenge states that, from 2004 to 2017, reforestation actions in Cameroon were carried out on an estimated 2 million ha of degraded lands. 5Within the framework of the Bonn Challenge and AFR100, Cameroon has undertaken to restore 12 million ha. As part of this approach, and following several consultations with the partners involved in the process, out of 10 projects under development, two major projects co-signed by the MINEPDED and the MINFOF were programmed for implementation in 2021. The first, the Largescale Forest Landscape Restoration in Africa project, aims at the large-scale restoration of forest landscapes. In Cameroon, it is funded through the IKI initiative by the German Federal Ministry of the Environment, Nature Conservation and Nuclear Safety (BMU). The second is a programme made up of several projects, each with different forms of implementation depending on the stakeholders involved (public and private stakeholders, Decentralized Territorial Community, NGOs).Cameroon has also undertaken to implement the Great Green Wall, whose new approach advocated by the African Union is to involve countries that did not directly participate in the launch of the initiative. As early as 2015, Cameroon took action along with the UNCCD to promote the concept of \"land degradation neutrality (LDN),\" which has been defined as \"a state in which the amount and quality of land resources necessary (i) to support ecosystem functions and services and (ii) to enhance food security remains stable or increases within specified temporal and spatial scales and ecosystems.\" Cameroon has proposed its programme to determine national land degradation neutrality targets; it aims to improve land productivity by at least 10 percent nationwide and by 90 percent in municipalities located in priority areas for fighting land degradation.The National Plantation Forests Development Programme (NPFDP), validated in 2019 by the forest administration and development partners, could be the basis for the rehabilitation of degraded landscapes and forests in Cameroon. The National Forestry Development Agency (ANAFOR) is responsible for directly or indirectly supporting the implementation of the said programme.To do so, it carries out studies, looks for financing, provides seeds and seedlings and develops consulting expertise. Even though financial support is not yet available, this programme offers the opportunity to reconcile restoration actions using a landscape approach, with the involvement of local populations via decentralized local authorities. Under this programme, the main objective of ANAFOR is to facilitate the planning, establishment and development of private and community forest plantations, the development of value chains, and a sustainable forestry economy generating jobs and growth.Research objectives have been determined in order to capitalize on and improve the contribution of research to the development of FLR actions. The programme has made it possible to identify various fields of research including both the enhancement of local knowledge and the development of procedures for tracking the socioeconomic impacts of FLR. However, research in Cameroon continues to suffer from a lack of resources to meet all these challenges.The current orientations for financing FLR are identified through two sources, the Cameroon Public Investment Budget and external aid. The Public Investment Budget coming from the government ministries is mainly allocated to the rural sector (MINEPDED, MINFOF, MINADER, MINEPIA, etc.). Depending on their relevance, the actions are included in the operational programmes or made to be part of a project.External resources via bilateral or multilateral cooperation can focus on FLR actions, or they may approach FLR from related issues (resilience of family farming, decentralization, management of permanent or non-permanent forests, innovations in agriculture, green cocoa farming, biodiversity protection, etc.). However, as indicated in the FLR Strategic Framework, there is a need to diversify the sources of support for FLR funding.In short, the rehabilitation of landscapes in Cameroon has given rise to quite a number of strategy papers, and many past and current reforestation projects -which can by default be assimilated to landscape restoration actions -have been implemented in various regions of the country. These projects make up a body of experiences that could help facilitate implementation of FLR in the country. Finally, the personnel involved in FLR in Cameroon have participated in conferences and exchanges of experience, which represents still another asset for developing FLR there.However, structural problems in Cameroon make for serious obstacles. While FLR requires actions that cut across the fields of action of the various government ministries, these latter operate in silos, with each one tending to act in isolation, according to its own policy. This generates approaches locally that are contradictory and that lead to land conflicts. Other structural problems include the weakness of national research on forest ecology, forestry, agronomy and forest plantations. This weakness is linked in particular to the lack of stable financing, which is an obstacle to stimulating the innovations needed for FLR on the ground. Despite all the efforts made in the past to involve local populations in decision-making (Diaw et al. 2016), real implementation of this approach faces difficulty on the ground. Yet, we do know that without involvement by local stakeholders, FLR will not be sustainable. Means and tools are still lacking when it comes to monitoring and evaluating restoration efforts whose goal is to improve knowledge and correct approaches.AFR100 proposes the Restoration Opportunities Assessment Methodology (ROAM), a guide developed by WRI and IUCN. ROAM helps to identify and organize national and regional priorities, and it proposes models with calculations of the costs and benefits of mitigation of possible carbon emissions according to the options selected by the study (Maginnis et al. 2014). Certain Central African countries now use this guide as a flexible and affordable framework to quickly identify and analyse the potential of FLR and to designate areas where there are opportunities at the national and regional levels.In the CAR, the Ministry of the Environment, Sustainable Development, Water, Forests, Hunting and Fisheries (MEDDEFCP), in collaboration with WRI, conducted a study between 2016 and 2018 using this ROAM methodology, which led to the development of a strategy paper to guide the country's FLR policy.The paper assessed FLR opportunities for the various regions of the CAR (CAR, WRI and KfW 2017).The initial results of the geospatial analysis of this study highlighted a great opportunity for rehabilitation, called \"secondary forest restoration,\" on the basis of population density.In areas hosting large numbers of people displaced as a result of sociopolitical conflicts, rehabilitation of degraded spaces is a means of improving their living conditions as well as those of local populations. At the same time, it helps maintain ecosystem functions. The existence of refugees and internal displaced persons in Africa is not a new phenomenon, but unfortunately it is growing. According to the UNHCR, there were 20.36 million refugees worldwide, including 6.33 million in sub-Saharan Africa and 0.38 million in Cameroon. To this should be added an even greater number of internally displaced persons: 41.43 million worldwide, including 17.66 million in sub-Saharan Africa and 0.67 million in Cameroon (UNHCR 2018;Laird et al. 2022). These persons often remain displaced a very long time, and their status becomes permanent. Cohabitation between host populations and refugees can be a source of conflict due to the high demand for land for subsistence needs.This situation impacts the surrounding landscapes. For this reason, beyond the urgent need to care for displaced people in the short term, planning should also adopt strategies to ensure the sustainability of natural resources for their longer-term livelihood needs through FLR.Faced with this major challenge, the Governing Multifunctional Landscapes in Sub-Saharan Africa (GML) project led by CIFOR-ICRAF seeks to contribute to sustainable management of wood fuel value chains in sub-Saharan Africa. In Cameroon, the focus has been on restoring degraded landscapes in sites in several communes in the East Region that are host to refugees from the CAR. Since more than 70 percent of these refugees live in local communities, outside of the officially designated camps, more than 78,000 seedlings of wood energy and/or fruit tree species were planted along the corridor between the municipalities of Mandjou and Garoua-Boulaï between 2020 and 2021. This is of course only the beginning of the FLR process: financial and technical support also need to be provided over the long term to ensure sustainability.To this end, the strategy has been to involve the stakeholders active in these landscapes, at all stages.The map (Figure 12.1) shows the potential for FLR by reforestation around densely populated urban areas. The aim is to restore secondary forests through reforestation activities or through conservation of deforested or degraded areas around urban areas in the CAR.Four key variables were taken into account to identify these potential areas: populations, cities, forest areas and slopes. These variables cover the CAR's 16 prefectures and have the same weight (25 percent) in the analyses for identifying these areas. The results of these analyses estimate that the surface areas with medium and high restoration potential are about 5 and 48 million ha respectively.This map was produced with the purpose of directing the CAR's FLR policy towards deforested or degraded areas around urban areas via various conservation concession projects, botanical gardens and green spaces.The DRC is often portrayed as a country of megabiodiversity, but the speeding up of landscape degradation there calls for more restoration efforts. The country is also committed to landscape restoration and is developing a provincial FLR strategy, which will be followed by a national strategy. Both strategies were due to be validated in June 2021.These efforts have led to participation in international initiatives. In 2016, the DRC embarked on the process of restoring 8 million ha of degraded and deforested land as part of the Bonn Challenge. It ratified the CBD in December 1994, the UNFCCC in January 1995, and the UNCCD in September 1997. The implementation of these initiatives has helped the country to acquire a legal arsenal on forest and biodiversity conservation. There is a very strong link between FLR and the Nationally Determined Climate Contributions (NDCs) and these other global Reducing Emissions from Deforestation and forest Degradation (REDD+) and CBD processes to which the DRC is committed.For FLR, the national and provincial strategies under preparation emphasize the restoration of deforested and degraded ecosystems and landscapes. This restoration must be combined with other objectives, such as improvement of economic activities, food security, and people's ability to adapt to climate change and climate-mitigation projects. FLR must therefore be included into various types of development projects in order to benefit from various funding opportunities.The provincial and national strategies are also aligned with the CAFI (Central African Forest Initiative) objectives. The objectives of the letter of intent between the government and CAFI for the 2016-2020 period were to reduce the loss of forest cover from 300,000 ha/year to 200,000 ha/ year by 2020. To achieve this, several programmes were developed that would focus on the key reforms needed in land-use planning, land policy to better secure land rights in the rural sector, and investments that enhance existing actions at provincial and territorial levels in REDD+ regions.FLR in the DRC benefits from the country's commitment in 2009 to the REDD+ process. The DRC aims to reduce national emissions from deforestation by 56 percent by 2035, in a context of sustained economic development and poverty reduction. The DRC's REDD+ strategy has identified the direct causes of deforestation and forest degradation: slash-and-burn agriculture, artisanal wood harvesting, carbonization, wood fuel, mining and bush fires. The main underlying causes include population growth, institutional aspects such as political decisions, poor governance and civil wars, infrastructure development and urbanization. In 2012, the country adopted its National REDD+ Framework Strategy, which is part of a long-term global vision for development.This REDD+ strategy includes actions that contribute to the country's FLR. In particular, these actions include (i) the finalization and deployment of a concerted policy for the local management of natural and forest resources supported by payment mechanisms for environmental services; (ii) the rehabilitation of protected areas covering about 13 percent of national territory; (iii) extension of their surface areas to 17 percent; and (iv) the planting of 3 million ha of forests by 2025 (DRC 2012).In 2015, the Government of the DRC adopted a REDD+ Investment Plan to mobilize the funding needed for the implementation of the National REDD+ Framework Strategy. It also established the FONAREDD+ National Fund, which received USD 200 million in financing from CAFI and other initiatives. Thanks to this financial support, at least seven REDD+ integrated programmes have been launched in the provinces (Équateur, Maï-Ndombe, Kwilou, Mongala, Maniema, and others).These many international conventions ratified by the DRC, plus the REDD+ strategy, act as a great advantage for FLR. Policy documents are developed to help achieve the objectives set out in these conventions, in particular forest and biodiversity conservation and climate-change mitigation and adaptation. Most of them offer opportunities for financing FLR.The DRC has developed a series of legal instruments which, if properly implemented, act as an asset for promoting FLR initiatives. There are a number of bodies that can take action on land management and on procedures for proving land rights. Draft edicts on land-tenure security, worked out by development partners and civil society organizations, have never been promulgated.The environment in South Kivu is threatened by exacerbated deforestation due to logging of construction timber, firewood and charcoal. Slashand-burn agriculture and bush fires lead to the destruction of ecosystems and landscapes there.The resurgence of jurisdictional disputes between customary powers and the land administration is exacerbating land conflicts between municipalities. There are many such conflicts on limits, inheritances, forms of ownership, and double sales, leading to endless legal proceedings.of suspension, monitoring and evaluation of forest capital restoration interventions; as well as the Law on the Conservation of Nature (2014).However, the DRC continues to suffer from structural weaknesses in FLR implementation. Its institutional and technical capacities are insufficient to implement an integrated and effective approach to restoration at the provincial and local levels that would make it possible to fight land degradation and achieve sustainable management. There is no mechanism for intersectoral coordination at the provincial, local or chieftaincy levels, including on the environment, agriculture, forestry, land affairs and mining.While political commitment to FLR does exist at the highest level in the DRC, it is not currently on the provincial agenda. Despite the constitutional prerogatives and the decentralization laws that bestow power to legislate to the Provincial Assembly and to the provincial government, these latter do not make the decrees and decisions needed for natural resources.There has been little research in the South Kivu region in recent decades. But there are plans to develop research at the institutional level in South Kivu Province as part of the development of provincial and national FLR strategies, particularly on the following: (i) highlighting the value of indigenous species for restoration; (ii) scale-up of anti-erosion, agroforestry, and sustainable agriculture activities; (iii) more resilient and sustainable agricultural practices; (iv) the production and sustainable exploitation of wood fuel and timber; (v) the impact of artisanal and industrial mining; and (vi) sustainable pasture management.In South Kivu Province, the ROAM approach (see above) has made it possible to identify restoration priorities. Combined with the research results, these data provide useful information for FLR. Basic information, including maps on degradation in this province, already exists.Within the framework of the national REDD+ strategy, plans are under consideration for relaunching research applied to deforestation and degradation linked to agriculture and other factors outside the forest sector. This is why research should be a real lever for land use and development planning, by encouraging decision makers to anticipate the impacts of their choices beyond the sector they are responsible for. This research should take into account social and environmental impact assessments of development projects. To this end, it is essential to develop partnerships between Congolese universities and international research centres, such as the programme for Reviving Agricultural and Forestry Research (REAFOR, 2006(REAFOR, -2011) ) financed by the European Commission and implemented by FAO.In its 2016 updated policy paper and national biodiversity action plan, the DRC incorporated a research strategy focused in particular on the green economy and on understanding the links between poverty, environmental degradation and climate change.The main source of financing for REDD+ was the National REDD+ Fund (FONAREDD), with USD 200 million between 2016 and 2020. A new letter of intent between CAFI and the Government is currently under negotiation.The Land Degradation Neutrality Target Setting Programme (LDN TSP) aims to (i) achieve 100 percent restoration of degraded land by 2030; (ii) ensure that people use all land sustainably; (iii) contribute, in doing so, to improving the livelihoods of those people; and (iv) increase forest cover by 8 million ha through the restoration of degraded forest landscapes.There is much international support for FLR in the DRC. As early as the 1940s, the Belgian colonial administration adopted binding measures to slow down the degradation of natural forests and to develop forest heritage through State-owned, municipal and private afforestation at a rate of 1 ha per 300 households.Following independence, Burundi decided to provide itself with a forestry policy and regulations.The country drew up its first policy paper, \"Development of Burundi's Forest Sector,\" in 1969.Through it, the Government of Burundi set the national exploitation quota for natural forests at 650 ha per year and reforestation at 100,000 ha for 30 years (Département des Forêts 2012).In 1973, the Department of Water and Forests, in collaboration with the Institute of Agricultural Sciences of Burundi (ISABU), organized the first forest symposium to work out priority orientations and actions for the development of the forest sector. Differently from the 1969 policy paper, the conclusions of this symposium deplored the damage caused by the exploitation of natural forests. Instead, they encouraged the protection of these formations and insisted -already at that time -on land use planning and the need for forest legislation.In addition, in order to meet the ever-growing population's needs for timber for various purposes while at the same time preserving the environment, the Burundian Government initiated a huge reforestation programme in 1978. The quantitative target was to have 20 percent of national territory reforested by the year 2000 (Besse et al. 1991).As a result of these efforts, the national forest cover rate rose from 3 percent in 1978 to 8 percent in 1992. Approximately 75,000 ha were planted during this period. However, the war that was waged in the country from 1993 to 2003 led to the degradation of forest resources; more than 30 percent of man-made formations and 14 percent of natural formations were reportedly destroyed during this period (Ndikumagenge 1997;UNDP 1996). In this way, the rate of forest cover was estimated at 5 percent in 2005.In 2015, Burundi, with the support of the International Union for Conservation of Nature (IUCN), organized a workshop that identified the main strengths and weaknesses of the forest sector. This country has a great wealth of natural ecosystems and of plant and animal biological diversity. These ecosystems offer varied ecosystem services that contribute to the socioeconomic and ecological development of the country. They also help reduce global warming. However, these forest ecosystems -despite the advantages they generate -are under anthropogenic pressure from expansion of agricultural land, heavy reliance on wood as an energy source, bush fires and urbanization.More broadly, as part of its FLR policy, Burundi ratified the three Rio conventions in the 1990s: the UNCCD, the UNFCCC and the CBD. The strategies and action plan developed by the country as part of the implementation of these three conventions converge on the development of the forest sector to fight land degradation, preserve biological diversity and its habitat, and promote climate-change mitigation and adaptation.In addition, a national forest policy, in line with other national, international, regional and subregional policies, was developed in 2012. The aim of this policy is to develop and manage forest resources rationally, by increasing the proportion of forest cover to 20 percent by 2025.A National Convergence Plan, in accordance with the COMIFAC Convergence Plan, has also been developed and implemented. It provides for regular assessment of progress made within the framework of FLR. Meanwhile, as part of the Bonn Challenge, Burundi undertook to restore landscapes covering 2 million ha in 2020.In the past, Burundi has conducted research on erosion and restoration opportunities; these should be updated. Indeed, quantitative studies on water erosion of cultivated soils have proven that rainfall characteristics (the volume of precipitation and its intensity) are the predominant factors. Added to this is the frequency and duration of precipitation. Studies on runoff and soil losses have shown that the increase of these losses is commensurate with the intensity of climatic events, and they have revealed a certain uniformity of behaviour according to the soil. As Burundi is a highly agricultural country, the influence of cultivation practices and anti-erosion systems has also been pointed out.The quantitative experimental study of water erosion in Burundi helped to better identify the respective shares of the various factors of erosion and those likely to reduce it significantly. For example, on bare ground, soil losses due to sheet erosion and rill erosion are very high. Many traditional crops grown in the direction of the slope cause significant soil losses, making them unsuitable for maintaining soil productivity and fertility. Vegetation cover of any kind is the main factor that considerably reduces water erosion of soils. Furthermore, improvement in anti-erosive cultivation practices (e.g., level line mounds, contour strip cropping, crop associations of different plant cycles, and live fencing on contour strips) reduce erosion and runoff by a factor of 2 to 50. Mulching completely reduces soil losses regardless of the slope. The only problem remains its availability in densely populated rural areas. Closed ditches on level lines, low walls and benches have limited effectiveness and require much work. Burundian peasants should therefore be discouraged from using them. Meanwhile, agroforestry is turning out to be useful both for biomass production and for ensuring a sustainable balance between fertility conservation and agricultural production.Like other Parties to the UNFCCC, Burundi has committed to reducing its GHG emissions, by 3 percent from 2016 to 2030 unconditionally (by increasing its forest cover by 60,000 ha at a rate of 4,000 ha/year) or by 20 percent under condition of international aid, through (i) the reforestation of 120,000 ha at a rate of 8,000 ha/year from 2016 to 2030 and (ii) replacement, by the 2030 deadline, of 100 percent of all traditional charcoal ovens, with a view to limiting losses resulting from the production of charcoal and all traditional household cooking stoves. If the targets set by the country are met, 180,000 ha will have been gained by 2030, and the rate of forest cover will be 14.88 percent not including natural forests (Republic of Burundi 2019).As Burundi is heavily involved in the various initiatives, national and regional policies are benefiting from regional subprojects on landscape restoration. These are the international commitments showing the interactions and synergies between the various conventions and initiatives (CBD, REDD, CCC, NAP/LCD, SDGs, Montreal Convention, Aichi Targets) and national policies (FLEGT, NEPAD, NRP, REDD+, PRSP, NBSAP, COMIFAC CP).12.3 What kind of governance can remove barriers to FLR in Central Africa?As noted above, mobilization for the restoration of degraded land is gaining ground in Central Africa, and national initiatives are growing in number through the African Forest Landscape Restoration Initiative (AFR100 6 ) sponsored by the African Union. Some Central African countries (see table 12.1) have made national commitments to promote integrated landscape and forest management, all through a large-scale reforestation programme (CAR, Cameroon, Burundi), but also through substantive work on soil and water resources management (Cameroon, Burundi) or by building on previous initiatives, such as REDD+ (DRC). These efforts are linked to other international commitments in the field of sustainable development, such as the SDGs, those related to forest exploitation, and the reduction of greenhouse gas emissions.Landscape restoration is supported by many international donors, such as the AfDB, the EU, BMZ, BMU, the GEF and AFD, through various initiatives (e.g., CAFI, AFR100). Countries also contribute directly to this effort through their budgets, via national initiatives such as \"Ewe Burundi Urambaye\" and the national budget in Cameroon.At the national level, many efforts have already been made to establish the framework of the restoration process at the scale of a large region or a country (CAR, Cameroon, Burundi, DRC). Proposals also exist to define FLR at the local level of land use planning (DRC). We can thus see a twofold movement taking shape in Central Africa: a framework for restoration at the country level in connection with land use planning in a top-down movement and, on the contrary, processes that are more bottom-up, for setting the FLR objectives at the local level (as in Cameroon). The ROAM approach proposed by WRI and IUCN helps the countries that wish to do so to achieve this national framework.But these countries still face great difficulties in implementing their very ambitious FLR objectives.The list of barriers to this implementation is long. They are more generally linked to sustainable management of natural resources and include problems of limited capacity at various levels, particularly at the local level and lack of possibilities for individuals to change their behaviour. But the causes are above all institutional and related to non-compliance with rules and the law, the sectoral approach to rural development, conflicts of interest or land, as well as security (as in the CAR, Cameroon, Burundi and the DRC). This last cause -security -is a prerequisite for FLR, because it is difficult to think about the long term when one does not know what will happen from one day to the next. Governance has also been identified as one of the main barriers to renewable resource management and FLR.The International Fund for Agricultural Development (IFAD) is making great efforts to restore forest landscapes. IFAD's main objective is to promote food security and the fight against poverty in rural areas. Since 1980, IFAD has run 13 projects and programmes, of which 8 are completed and 5 still ongoing. The average annual disbursements of IFAD's portfolio in Burundi range from USD 14 million to USD 16 million per year.As IFAD sees it, environmental restoration is one of the key elements in achieving good food production that can ensure food security. This is reflected in programmes including protection of watershed soils (to preserve their fertility and to safeguard hydroagricultural infrastructure in marshes), restoration of plant cover (to preserve the water table that feeds marshes and drinking-water sources), and land cover of soil by cultivated fodder (to feed livestock).The IFAD Transitional Programme of Post-Conflict Reconstruction contribution to FLR targets local governance issues including community development (legal and gender support, income-generating activities) and food security (seeds, fertilizers, rice, marshland development, cattle and pig farming, environmental restoration, infrastructure and health promotion).The programme distributed 12 million agroforestry seedlings (Eucalyptus, Cedrela, Grevillea), 1.7 million cultivated fodder seedlings (Calliandra, Leucaena, Bana grass, Tripsacum) and 0.3 million fruit seedlings (avocado, guava and mandarin trees). More than 100,000 families have received these seedlings, and the area of protected watersheds exceeds 7,000 ha (IUCN 2015).Governance is a set of elements that lie at the intersection of institutions, networks, directives, regulations, norms, policies, social practices, public and private stakeholders, and local and indigenous communities (Borrini-Feyerabend et al. 2014). All these stakeholders involved may initially have divergent interests.Governance is central to FLR insofar as it allows for \"good practices\" that are crucial for local, national and regional initiatives to generate convincing results. Examples are inclusive decisionmaking and public participation, which enable the stakeholders concerned to take part in decisionmaking alongside the State (McLain et al. 2019). While there are many definitions of \"governance,\" it could be summed up as follows in this context:The purpose of the governance of forest landscape rehabilitation is to reconcile, within the framework of the law and the rules in use, the interests of the various stakeholders who will influence the economic development and environmental quality of the territories considered, in particular by including the local populations into the decision-making process.This good governance includes the implementation, monitoring and evaluation of restoration methods, and it requires converting FLR into policies, programmes, and projects (van Oosten et al. 2018) and producing rules and standards that structure and coordinate it.To generate relevant ecological, social, and economic results at various scales, FLR must be based on the determinants of its governance (Mansourian 2016;Bigombe Logo et al. 2021). These determinants include (i) relevant and adequate policies; (ii) effective regulation and coordination of implementation actions; (iii) inclusive decision-making; (iv) respect for the rights of women, local communities and indigenous peoples; (v) devolution of responsibilities; (vi) equitable access and sharing of benefits; and (vii) sufficient funding. Overall, evaluations conducted in the subregion in the past decade have called for improved governance (Yanggen et al. 2010;Hagen et al. 2011;Oyono 2015).In terms of the governance of renewable resources, we are not starting from scratch, as concepts have evolved for at least three decades (Buttoud et al. 2016). The idea of co-management was intended to involve users -often local stakeholders -directly in the management of renewable resources, in consultation with the various levels of the State and its agencies. Co-management is a sharing of decision-making and responsibilities between the State and users. It is a strong idea that has rarely been applied in the region. Adaptive co-management enriches the idea of co-management by recognizing that the stakeholders act in complex socio-ecosystems. Also, the relationships between them must be dynamic and be able to adapt to any kind of event, such as climate change or the outbreak of a virus. Finally, the concept of multistakeholder governance (i.e., adaptive multilevel governance) further increases complexity, by integrating stakeholders at multiple levels.FLR supposes several aspects at work: (i) bodies that work on climate change; (ii) the SDGs at international and national levels; (iii) the development goals of central or decentralized governments;(iv) stakeholders throughout value chains; (v) and local stakeholders. FLR falls indeed within the scope of multistakeholder governance.One of the challenges facing governance and landscape restoration remains the involvement of local and indigenous communities in decision-making processes. The forest landscapes to be governed and restored are located on lands whose rights have been contested between central governments and local and indigenous communities since the colonial period (Oyono 2014). In order not to exacerbate conflicts between States and their partners on the one hand and local and indigenous communities on the other, governance and FLR must be organized using inclusive decision-making processes. Participation and involvement of local and indigenous communities are widely paid lip service in speeches and documents, but rarely observed in practice. To keep up appearances, forms of involvement and participation are very often presented by decision makers and professionals as an end in themselves. However, such approaches create more problems at the local level than they solve.Inclusive decision-making requires a consultation process in which views are shared, objectives reconciled and options for action discussed before any consensus is reached. In the reality of Central Africa, this type of process has rarely been put into practice, as it must be distinguished from mere information or consultation. In a public information meeting, information is one-way, but local administrative authorities and land investors of course mistakenly confuse such meetings with stakeholder participation. In a consultation, on the other hand, local and indigenous communities are asked to express their views freely: these latter may be taken into account or (more commonly) not. Decision makers, investors, administrative authorities and professionals often make decisions improperly, prior to meeting with local and indigenous communities. This is typically the case for projects that are discussed above all between development agencies and donors. Ultimately, consultation consists in a confrontation of points of view before decisions are taken. The resulting synthesis effort is likely to \"give a voice\" to local and indigenous communities. If their voices were to be heard in an FLR programme, concerted management of forest landscapes would be possible.There is strong demand for recognition of customary land and forest rights throughout the subregion (Oyono 2014). In many parts of Central Africa, peasant farmers' most effective way of asserting their right to land is to \"break the forest.\" This situation is a source of conflicts on land and a hindrance to FLR activities. Inclusive decision-making is a means of reducing this risk. It also empowers local and indigenous communities on their lands and makes them less vulnerable in legal matters (Oyono 2014). This is the meaning of \"free, prior and informed consent\" (FPIC) developed as part of the REDD+ process (Borreill and Lewis 2009). This mechanism is based on the fact, for example, that in a landscape restoration programme, local and indigenous communities, after receiving extensive information, may be free to say \"yes\" or \"no\" -without pressure or retaliation -to the request for their adherence to the process (FAO 2017). However, this crucial mechanism is slow to be institutionalized and put into practice.The management of a country's natural heritage cannot be limited to protected areas such as national parks and wildlife reserves, as most of the natural areas designated for biodiversity preservation, with the exception of the largest and most spectacular national parks, are not large enough to ensure the long-term conservation of all species and biological processes. Most species of mammals and birds have strong needs for home ranges and distribution areas. For their survival, it is thus essential to create and develop forest networks with zoning that includes both conservation and production areas within the extensive forest landscapes. This way, all ecological and genetic variations can be covered without neglecting marginal areas.Sectoral management -in which everyone exploits a common good without coordination and consultation -can only lead to competition or even conflicts between users (e.g., sector against sector, upstream against downstream, protected areas against production areas, etc.) and ultimately to an unsustainable use of limited and vulnerable resources.On the other hand, an integrated approach to forest landscapes that includes forest, ecological and socioeconomic components is seen as a prerequisite for the sustainable and multifunctional management of tropical forests at the landscape level. Indeed, the integrated approach provides the opportunity to control the impact of human activities on the connectivity between natural habitats and ecological processes throughout the landscape and thus prevent protected areas strictly speaking from becoming isolated pockets of biodiversity. The end goal is to avoid the depletion of each renewable resource and then to ensure that all management measures are integrated into the regional plan for the territory's sustainable development.This supra-sectoral integrated management approach seeks to ensure the sustainability of natural environments by integrating them into a broader logic of land use planning and sustainable development on a landscape scale. One of its major challenges is ongoing collaboration between the various forest and hunting concessionaires, the managers of protected areas and the local populations.However, the transformation from sectoral management of landscape mosaic components to integrated management of forest landscapes is a long process requiring a rigorous approach, a change in mindsets and a constant effort to improve strategic and operational decision-making processes. This difficulty can be seen at several levels.At the level of institutional decision makers and government administration, there are conflicts of competences between administrations; for example, in Cameroon, the ministries of the Environment (MINEPDED), of Agriculture (MINADER), of Forests and Fauna (MINFOF), of Water and Energy (MINEE) and of Mines (MINMIDT) all work on the same aspects of the environment: soil, water and ecosystems. The actions of some constitute obstacles to the actions of others because of the lack of concerted vision. This results in contradictory authorizations being issued. Some agricultural projects, for example, do not take into account environmental requirements, let alone current forestry regulations.Stakeholders on the ground, such as some loggers or mine operators, are taking advantage of the legal loopholes created by sectoral conflicts, which are furthering a constant and disorderly rush towards these resources. The difficulties in coordinating stakeholders for the preservation of biodiversity can only be overcome by the good governance described above. This implies that all stakeholders respect the rules that take into account the supporting capacity of habitats and the rate of natural regeneration of biological resources. Only with a critical look at the past, a clear vision of the future, and a well-defined way forward can FLR become operational and contribute to the preservation of ecosystems. There is a need for a new vision as well as for a new approach to forest landscapes linked with land use and sustainable development planning.It is in the interest of civil society to engage in this participatory process bringing together all the representatives of the main users and managers with their partners, so as to ensure full and unreserved ownership and participation by all stakeholders. Civil society should play the role of a coordinator that further integrates local interrelationships in order to create synergies between all types of programmes that are taking place within the forest landscape in question.Two main challenges for stakeholder coordination emerge: (a) The implementation of measures to compensate for damage to ecosystems and biodiversity. Such compensation could be demanded for pollution of water, land and air, for example, resulting from the use of pesticides, herbicides, fertilizers and other chemicals. (b) A more equitable distribution of profits, i.e., a greater share of the taxes and revenues generated on-site, should be reinvested directly into the conservation and sustainable development of production areas. This can free up financial resources that can mitigate the effects of agricultural fronts that are developing to the detriment of wooded areas.The restoration of a forest landscape is a complex operation and requires constant monitoring of the ecological and socioeconomic effects. This must be done based on the initial objectives, which, depending on the circumstances, reconcile these two aspects by giving a greater or lesser weight to one or the other.In the monitoring and evaluation of ecological effects, the actions carried out must be recorded, whether they are successes or failures. We could consider that the main criterion for an ecological assessment is how well the process of rehabilitating a degraded landscape progresses so that it reaches a stage with structures and properties similar to those of a local spontaneous forest. In this case, the indicators may be the degree to which animal populations originally home there are restocked in the rehabilitated forest. These \"bio-indicator\" animals serve as a \"barometer\" for the \"health\" of the forest.At the scale of a managed landscape or a managed forest range, the restoration of ecosystem integrity and the quality of forest biotopes cannot be assessed by just the number of species or by an index of biodiversity; rather, they should be assessed by the long-term viability of forest fauna. Indications of changes in the abundance and distribution of forest animals are what are most useful for wildlife habitat restoration and natural habitat management. The purpose of monitoring the restoration results is to reveal the changes over space and time. The expanse of the distribution area, its continuous or discontinuous form, and whether or not its functional dynamics are undergoing progression or regression are relevant criteria for assessing the viability of a population and the integrity of its home range.For example, during the restoration of a degraded forest, the planner expects a change in the composition and structure of the forest ecosystem: on the one hand an increase in the areas of \"mature forest\" with an almost closed canopy, and on the other a change in the structure of the undergrowth and the reduction of open land to small clearings.A concept based on the management and monitoring of forest fauna will enable a rapid and periodic analysis of the dynamics of animal populations that act as indicators. The identification of evolving trends will make it possible to assess the impact of the developments undertaken and, even better, establish a prognosis on the probable development of the future restoration. Using such a scenario, rehabilitation measures can be continually adapted to the new knowledge acquired, in order to pilot FLR.The minimum size of specific habitats and their connectivity are essential factors for the survival of forest vertebrate species and for the maintenance of associated plant associations. These factors are useful for monitoring the relevance of the zoning established within a forest range undergoing restoration. For this reason, the effectiveness of the mosaic of managed areas in restoring biodiversity can be assessed only on the basis of a few selected individual species, the so-called target species.Monitoring should be accompanied by further research, the subjects and themes of which should be oriented according to the request of the managers and users of the areas benefiting from ecological restoration. Research should be seen as an ancillary aspect of monitoring and evaluation systems, through which certain trending phenomena will be analysed more in-depth than in standardized monitoring.The monitoring and evaluation of economic and societal effects are equally important to ensure the sustainability of the FLR process. These indicators may relate to the contribution of the local populations over time to the FLR processes and, conversely, to the improvement by the FLR of those people's living environment and incomes. The support of indigenous peoples and local communities is a crucial factor for the success of restoration actions. However, it is conditional on a change in behaviour based on an effective awareness of the challenges of restoring natural environments and the benefits they can derive from enhancing the value of biodiversity. This adhesion can be achieved only through a sustained programme focused on dialogue, information, education and communication (IEC) in the various restoration zones. The main challenge of the IEC programme is to mobilize all stakeholders, including users and managers as well as the authorities, to take up environmental opportunities and problems, with a long-term vision, for the restoration and sustainability of forest landscapes.FLR is rightly seen as a priority for the countries of Central Africa (Besseau et al. 2018;Begeladze 2020). Given the critical mass of threats to the health of forest ecosystems in the subregion, national responses appear robust (Begeladze 2020;Tunk et al. 2016). FLR in Central Africa, while not a completely new idea, is triggering new types of processes that build on recent climate-change mitigation efforts such as REDD+. We are at the very beginning of these processes.In many countries, these processes are still in an initial phase, at which evaluation is not yet possible. Many country commitments and strategies have been initiated within the framework of FLR, significant funding is being put in place, and some smaller projects are already underway. There is an urgent need to establish multicriteria monitoring and evaluation systems in order to steer this rehabilitation process.In Central Africa, implementation of the FLR process reveals a lack of accompanying research in the areas of (i) genetic resource conservation; (ii) species selection; (iii) germplasm improvement; (iv) planting techniques; (v) assisted natural regeneration; (vi) research on governance, including landtenure issues and inclusive decision-making processes; (vii) socioeconomic research, including value chains; and (viii) innovation and evaluation processes, particularly the assessment of ecological and socioeconomic impacts. Some of this research requires long-term arrangements that are difficult to maintain in Central Africa and are very rarely funded.Forest landscape rehabilitation relies heavily on local populations, as in many cases it involves changes in agricultural and forest resource-management practices. FLR involves investing in developmental aspects that are too costly to be borne by these local populations alone. Meanwhile, governments in the region have great difficulty in providing basic services to their people, such as infrastructure and health care, education, access to electricity and drinking water, and accessible roads.The financing of FLR therefore relies mainly on donors and the private sector. However, most donors carry out development projects over four to five years, with performance indicators associated with these durations. As rehabilitation is a long-term process, donors must also adapt their practices. Often, they want the local population to be involved, but they are not prepared to allow for the time needed on the ground to consult them beforehand. The financing of FLR may also be based on the principle of compensation or on corporate social responsibility.Land restoration has long been seen as a way to revitalize ecosystems and build resilience to climate change, but it can also have great economic and entrepreneurial potential. The monitoring of FLR programmes currently being implemented in Central Africa should include indicators that can inform us about these different dimensions of FLR."}

main/part_2/0456423269.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"2401dc05bab70ba0e79223bfb14f0e23","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/03fab7c7-efc3-4ad2-b36f-50e7f873b5a5/retrieve","id":"1536026157"},"keywords":[],"sieverID":"c33c1f2c-8384-444a-84a4-9ce54ce595c8","content":"The publications in this series cover a wide range of subjects-from computer modeling to experience with water user associations-and vary in content from directly applicable research to more basic studies, on which applied work ultimately depends. Some research reports are narrowly focused, analytical and detailed empirical studies; others are wide-ranging and synthetic overviews of generic problems.Although most of the reports are published by IWMI staff and their collaborators, we welcome contributions from others. Each report is reviewed internally by IWMI staff, and by external reviewers. The reports are published and distributed both in hard copy and electronically (www.iwmi.org) and where possible all data and analyses will be available as separate downloadable files. Reports may be copied freely and cited with due acknowledgment.However, there is one goal that is focused explicitly on water -Goal 6. Sustainable management of water implies that, as part of water resources management activities, sufficient water is left for ecosystems so that they can continue to provide services to society into the future. This, essentially, points to the need to ensure environmental flows (EF) in order to meet the SDGs. However, in most countries, there is a lack of awareness of EF at multiple stakeholder levels, and a lack of consistent, easy-to-use, readily available EF data to feed into the SDG process. If countries are to implement EF-related SDG targets over the next 15 years, baseline EF information is a prerequisite, and a process to incorporate such information into the targets needs to be developed.This research study focused on making data on EF, and sustainable surface water (SR) and groundwater (BF) abstractions available at a global, regional and subregional level. The first EF assessment at global scale, carried out by the International Water Management Institute (IWMI) in 2004, was modified to provide EF information for the calculation of SDG target indicators. The spatial resolution of the analysis was improved from 0.5 to 0.1 degrees, and environmental water 'needs' were estimated for both surface runoff and groundwater. The desired flow and environmental conditions of rivers are defined by four environmental management classes (EMCs). The percentage of flow required relative to pristine conditions, and the volume of groundwater and surface water that may be withdrawn without impacting EF are calculated for each EMC globally. The EF for each EMC are based on modifying synthetic, pre-development natural flows derived from the global hydrological model PCR-GLOBWB. Since the actual river flow and environmental condition of rivers vary across the world, the study also provides an estimate of the most likely current EMC for each grid cell globally, based on a modified \"Incident Biodiversity Threat\".Finally, an online, publicly available, interactive tool, the 'Global Environmental Flow Information System' developed by IWMI, enables users to select areas either at a country or river basin level (or any area of choice), identify existing and/or desired EMC, and get estimates of associated EF, baseflow (BF) contribution, and corresponding sustainable surface water and groundwater abstractions. These estimates can then be compared either directly with the information on actual water withdrawals in the selected area or fed into the SDG target indicators.One of the main events of 2015 was the adoption of the 17 Sustainable Development Goals (SDGs) by world leaders of the 193 United Nations (UN) member countries (United Nations 2015). Between now and 2030, the SDGs aim \"to end poverty and hunger everywhere; to combat inequalities within and among countries; to build peaceful, just and inclusive societies; to protect human rights and promote gender equality and the empowerment of women and girls; and to ensure the lasting protection of the planet and its natural resources. … also to create conditions for sustainable, inclusive and sustained economic growth, shared prosperity and decent work for all, taking into account different levels of national development and capacities\" (United Nations 2015). The 17 SDGs have 169 targets. The goals and their targets have been developed after extensive negotiations between the 193 UN member countries. As such, they reflect the results of a political, rather than a scientific, process. Water is a crosscutting theme across many of the SDGs with direct or indirect impacts related to: ending poverty (Goal 1), ending hunger (sustainable agriculture, improved nutrition) (Goal 2), sustainable economic growth (Goal 8), sustainable cities (Goal 11), sustainable consumption and production patterns (Goal 12), climate change mitigation (Goal 13), and protecting and restoring ecosystems (Goal 15). There is, notably, also one SDG that focuses explicitly on water -Goal 6 (\"Ensure availability and sustainable management of water and sanitation for all\"). Sustainable management of water implies that, as part of water resources management activities, sufficient water is left for ecosystems so that they can continue to provide services to society into the future. This, essentially, points to the need to ensure environmental flows (EF) in order to meet the SDGs.The EF concept entered water management discussions in the mid to late twentieth century after extensive dam construction led to large-scale obstruction of free flowing rivers and significant loss of ecosystem services. Initial concerns were related to the impact of dams on game fish species, such as salmon, in rivers, leading to the concept of minimum flows in the rivers (or minimum instream flows). Over subsequent decades, the concept of EF has evolved to encompass river flow variability, river connectivity (longitudinal and lateral), ecosystem services and human well-being, and many methods have been developed to quantify EF. Acreman and Dunbar (2004) classified methods for evaluating and ensuring EF into four main categories of increasing complexity: (i) lookup tables -methods that define EF by rule-of-thumb, based on simple indices; (ii) desktop analysis -methods that are based on statistical analysis of time series of available data (either hydrological data only or hydrological data with ecological data); (iii) functional analysis -methods that link aspects of hydrology with ecology (i.e., direct response of species); and (iv) hydraulic habitat analysis and modeling -methods that link hydraulic characteristics with ecology.It is difficult to provide definitive evidence in support of the performance of different methods for evaluating and ensuring EF, as there are many factors that guide the selection of a particular methodology. These include the scale and objective of the study; the level and quality of data available; and the resources available to carry out the study. While lookup tables and desktop analysis tend to be more suitable for quick assessments or large-scale studies with low involvement of stakeholders, the other two methods (financial analysis, and hydraulic habitat analysis and modeling) are more suited to local and regional studies, where there is more interaction with local experts and stakeholders. In general, the latter two methods can be regarded as producing outputs of higher confidence, as they normally require site-specific field investigations. Poff and Matthews (2013) divided the history of EF theory and methodology development into four eras: (i) pre-1980s -defined as reductionist, where the goal was to have minimum flows to protect a single species of interest; (ii) late 1980s to mid-1990s -defined as the \"emergence and synthesis\" period, where ecological theory became part of the discourse on EF; (iii) mid-1990s to mid-2000s -defined as the \"consolidation and expansion\" period, when ecosystems were considered on par with human needs and EF moved out of the realm of academics to become tools for ensuring and implementing environmental policies espoused by local and regional nongovernmental organizations (NGOs); and (iv) post mid-2000s -defined as \"globalization\", where the concept of EF has been taken up at a regional and global scale, supported by tools for their implementation, due to emergence and increasing popularity of regional-and global-scale hydrological models (e.g., Smakhtin et al. 2004a;Pastor et al. 2014), and with greater awareness of threats to global ecosystems (Vörösmarty et al. 2004;Döll et al. 2009;Vörösmarty et al. 2010).The first attempt to calculate EF requirement at a global scale was undertaken by Smakhtin et al. (2004aSmakhtin et al. ( , 2004b)). Their proposed methodology was a desktop approach based on ecological hypotheses and hydrological data simulated by the global WaterGAP model (Döll et al. 2003) with a 0.5 degree spatial grid. Their approach focused only on surface water and considered only a single ecosystem scenario -that of a \"fair\" ecosystems condition. The EF requirement was calculated for low and high flow conditions (defined as the environmental low flow requirement and environmental high flow requirement, respectively), which were aggregated to represent the total EF requirement per annum. A similar approach was used by Hanasaki et al. (2008) to include EF in their assessment of global water resources. Hoekstra and Mekonnen (2011) used the \"presumptive standard\" methodology developed by Richter et al. (2012) to define EF requirement for major global rivers in their analysis of global water scarcity. Presumptive standards implied precautionary EF that may be used in areas where detailed analysis of EF had not been undertaken. The precautionary EF is based on precautionary principle to risk management, which states that, if an action is suspected of causing harm to the environment, in the absence of scientific consensus, the burden of proof that the action is not harmful falls on those taking action. Such an approach can help prevent irreversible damage to a river ecosystem until a more detailed, site-specific analysis of EF is conducted. The presumptive standards are calculated as a percentage-based range around historic flows. For global-scale studies on EF, Pastor et al. (2014) compared the performance of three existing and two newly developed EF methodologies in the context of 11 different case studies, where locally accessed, more detailed, estimates of EF were also available. Their analysis showed that the performance of EF methodologies depends upon the type of the flow regime (stable versus variable -stable being flows with less intra-annual variability compared to \"variable\" flows) and streamflow \"condition\" (low versus high).There is no single 'best' EF methodology that can be universally applied under all circumstances. Many EF methods exist (e.g., http://waterdata.iwmi.org/applications/efm/efm_ home.php -accessed on February 8, 2017), and each one of these methods has its pros and cons; the method selected must be determined by the needs and resources of the study.From the perspective of the SDG process, it is important to offer countries some baseline data and tools to help with preliminary estimates of EF, which may be improved at a later stage when relevant capacity is developed. Naturally, for some \"EF-advanced\" countries, such estimates will not be required.Most of the previous global EF studies have focused on required river flow, with little attention being given to the source of this flow (surface water or groundwater) and hence limited understanding of sustainable limits of water abstraction from these interconnected sources. Gleeson et al. (2012) calculated groundwater footprints for major global aquifers and included the environmental contribution of groundwater to streamflow. In the analysis, the authors arbitrarily considered monthly streamflow that is exceeded 90% of the time (Q90) as a proxy for EF, which is met by groundwater. Contribution from groundwater is a crucial component of river flow, especially during the months without rainfall. If river flow can be conceptualized to be made up of surface runoff (SR) and contribution from groundwater (baseflow [BF]), and the same can be done for EF, the excess of each resource can be translated into respective abstraction limits. Such an approach was developed by Ebrahim and Villholth (2016) to estimate sustainable groundwater abstraction based on recession flows in catchments in South Africa. Groundwater is moving up the development agenda, and explicit thresholds of sustainable withdrawals, from both surface water and groundwater, need to be incorporated into EF methodologies. The role of groundwater in future food security and climate change mitigation is well recognized (Famiglietti 2014), thus making it critical to explicitly consider groundwater within the EF discourse.The next section of the report discusses the role of EF in the SDGs. This is followed by the methods and data used in this study. Results are discussed in the fourth section together with details of the web-based interface for calculating EF online.The \"SDG on water\" (SDG 6) has six targets, of which at least three explicitly or implicitly cover the issues of sustainability of water resources development and freshwater ecosystem maintenance. These targets are as follows: Target 6.4: By 2030, substantially increase water-use efficiency across all sectors and ensure sustainable withdrawals and supply of freshwater to address water scarcity, and substantially reduce the number of people suffering from water scarcity.Target 6.5: By 2030, implement integrated water resources management at all levels, including through transboundary cooperation as appropriate.Target 6.6: By 2020, protect and restore water-related ecosystems, including mountains, forests, wetlands, rivers, aquifers and lakes.Each SDG target has at least one measurable indicator, and many such indicators are still emerging in the ongoing global discourse on how to operationalize the targets (http:// www.unwater.org/news-events/news-details/ en/c/428698/ -accessed on February 8, 2017). Target 6.4 promotes efficient use of water by different sectors of the economy. The associated indicator calculates the level of water stress in each country, thus quantifying the pressure on renewable national freshwater resources. The Water Stress Indicator (Stress%), calculated at annual time scale, is defined as the total freshwater withdrawn (TWW) by all sectors divided by the difference between the total renewable freshwater resources (TRWR) and environmental water requirements (Env), and multiplied by 100 (Equation [1]).(1)The indicator in this form was first proposed by Smakhtin et al. (2004b) for surface water resources. In Equation (1), TWW includes surface water and groundwater, and TRWR includes internal (generated within a country) and external (generated outside but made available within a country) renewable freshwater resources. Env is the environmental water requirements, established to protect the basic environmental services of freshwater ecosystems. In some versions of the Water Stress Indicator, Env is established separately for surface water and groundwater, where \"surface Env\" is essentially the EF and \"groundwater Env\" is the groundwater remaining in the aquifer to play its ecological role at subsurface level. Stress% should not exceed a certain desired threshold, which needs to be defined as a societal choice.Although not yet explicit in indicators of Target 6.5 on integrated water resources management (IWRM), this target would have to consider EF as part of water resources management to make the latter truly holistic. To properly practice IWRM, each country (or basin authority) would need to know the EF, so that river water withdrawals and groundwater abstraction can be managed within sustainable limits.Target 6.6 is developed with the intension of protecting water-related ecosystems, so that they can continue to provide ecosystem services for human well-being. This includes protecting wetlands, rivers, aquifers and lakes, which are connected to each other through the flux of water, both on the surface and underground. While environmental flows naturally play an important part in protecting water-related ecosystems, the indicator for Target 6.6 relies on the Water Stress Indicator of Target 6.4 to provide that information. The indicator for Target 6.6 explicitly notes this connection.Therefore, environmental flows need to become an integral part of the SDG discourse, but there is still lack of consistency and also awareness of EF in many countries. If countries are to accept and implement EF over the next 15 years in the context of achieving the SDG targets by 2030, some initial EF information needs to be provided. Countries can then make further decisions on what additional data, resources and capacity they will need to invest in, in order to improve assessments and be compliant with the SDGs.This research study advances on the work conducted by Smakhtin et al. (2004a) ( h t t p : / / w a t e r d a t a . i w m i . o r g / A p p l i c a t i o n s / Global_Assessment_Environmental_Water_ Requirements_Scarcity/ -accessed on February 8, 2017) on the first global EF assessment, together with a follow-up hydrology-based approach to estimate EF time series (Smakhtin and Eriyagama 2008) (http://www.iwmi.cgiar.org/resources/modelsand-software/environmental-flow-calculators/accessed on February 8, 2017), to help provide EF information which could be useful for the calculation of indicators for the SDG targets.To estimate EF globally, natural river flow at a global scale is required. Continuous and consistent observed hydrological time series at global scale are not available. Global hydrological models (GHMs) are used to obtain such data. Sood and Smakhtin (2015) provide a review of GHMs. This research study used PCRaster Global Water Balance (PCR-GLOBWB) model (version 2.0) which was developed by Utrecht University (Wada et al. 2016). This model was selected for three reasons. First, it operates at 0.1 degree spatial resolution (compared to other models, which are mostly 0.5 degree resolution). Second, since the discharge components from surface water (SR) and groundwater (BF) act as incremental contributions to river flow, these contributions can be added up as independent incremental contributions at the grid scale. The actual flow in the river may be a bit different to the aggregated runoff due to routing processes that take place in a stream channel, but there is a trade-off between the ability to aggregate at different landscape scales versus ignoring the impact of routing on streamflow. Third, the PCR-GLOBWB model has been used in many studies dealing with groundwater issues (e.g., Wada et al. 2010Wada et al. , 2012;;Sutanudjaja et al. Forthcoming). Simulated monthly streamflow from 1960 to 2010 (51 years) for natural conditions (i.e., no human interventions such as abstractions, reservoirs and irrigation) was used. The 'Global Environmental Flow Calculator' (GEFC) software (Smakhtin and Eriyagama 2008) was then used with the simulated flow time series to calculate EF for different environmental management classes (EMCs) that relate to the current or desired condition of a river, and are perceived as scenarios of the environmental state of rivers. An attempt was also made to infer the most probable current EMC for rivers globally by linking EMCs with the \"health\" of rivers (e.g., Vörösmarty et al. 2010). The EF were then split, for each EMC, into surface water and groundwater contributions, which were subsequently used to estimate sustainable abstractions from surface water and groundwater. The details of these methodological components are summarized below.  2011) and Wada et al. (2016). A summary of the main features of the model and model parameterization over the land, excluding the Antarctic, are given below.For each grid cell and daily time step, the PCR-GLOBWB model simulates the water storage in two vertically stacked soil layers and an underlying groundwater layer, as well as the water exchange between the layers (infiltration, percolation, recharge and capillary rise) and between the top layer and the atmosphere (rainfall, evapotranspiration and snowmelt). The model also calculates canopy interception and snow storage. Sub-grid variability is taken into account by considering separately tall and short vegetation, open water (lakes, reservoirs, floodplains and wetlands), different soil types based on the Food and Agriculture Organization of the United Nations (FAO) Digital Soil Map of the World (FAO 2003), and the area fraction of saturated soil calculated by the improved ARNO rainfall-runoff model (Todini 1996;Hagemann and Gates 2003). The groundwater layer represents the deeper part of the soil that is exempt from any direct influence of vegetation and constitutes an active groundwater reservoir fed by recharge and discharge to rivers. The groundwater store is explicitly parameterized based on lithology and topography assuming a linear reservoir model (Kraaijenhoff van de Leur 1958). The simulated local direct runoff, interflow (which collectively forms SR) and BF were routed along the drainage network based on channel characteristics at a 0.1 o spatial resolution derived from the Hydrological data and maps based on SHuttle Elevation Derivatives at multiple Scales (HydroSHEDS) dataset (http://hydrosheds.cr.usgs.gov/index. php/ -accessed on February 8, 2017). The total flow generated in each grid is the sum of SR and BF. The drainage network above 60 o N was supplemented using the Simulated Topological Network (STN) (Vörösmarty et al. 2000) and the topographic data from the HYDRO1k database (http://gcmd.nasa.gov/records/GCMD_HYDRO1k. html -accessed on February 8, 2017). The routing in the river network was based on the characteristic distances, where volumes of water are transported over a distance based on the channel width and depth, the gradient derived from the elevation and drainage network, and the Manning's roughness coefficient (Wada et al. 2014).Reservoirs are located on the drainage or river network based on the newly available and extensive Global Reservoir and Dam Database (GRanD), which contains 6,862 reservoirs with a total storage capacity of 6,197 km 3 . A dynamic irrigation scheme has been implemented that separately parameterizes paddy and nonpaddy crops and dynamically links with the daily surface and soil water balance, taking into consideration the feedback between the application of irrigation water and the corresponding changes in surface and soil water balance. For this research study, natural river flow time series for the entire globe at a resolution of 0.1 degree spatial resolution and monthly temporal resolution were calculated as a sum of simulated monthly SR (i.e., contribution of surface runoff to river flow) and monthly BF (i.e., contribution of groundwater to river flow) from the model.The GEFC (Smakhtin and Eriyagama 2008)  Monthly 'natural' flow time series from the PCR-GLOBWB model were converted into a FDC, represented by a table of flows corresponding to 17 fixed probabilities of exceedance: 0.01%, 0.1%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9% and 99.99%. These points ensure coverage of nearly the entire range of possible flow values at any location/grid cell. To generate EF FDCs for any EMC, this 'natural' or 'reference' FDC is shifted step-wise laterally to the left along the probability axis to generate flow regimes with progressively lower flows. An FDC shift by one step means that a flow which was exceeded 99.99% of the time in the original FDC will now be exceeded 99.9% of the time, the flow at 99.9% becomes the flow at 99%, the flow at 99% becomes the flow at 95%, etc. (Figure 2). A linear extrapolation is used to define the 'new low flows' at the lower tail (dry season) of a shifted curve. With each shift, a new EF regime (corresponding to an EMC) is defined, in which, although the peak flows are reduced, the natural flow pattern (considered vital for ecosystem health) still remains intact. Shift of a FDC to the left implies that the general pattern of flow variability is preserved, although with every shift part of the variability is 'lost'. This loss is due to the reduced assurance of monthly flows, i.e., the same flow will be occurring less frequently and the total amount of EF, expressed as the mean annual flow, is reduced. It is an arbitrary categorization, but it is assumed that each step of reduction in flow leads to a decline in the state of the health of the river, which warrants a change in its EMC. More details of the method are discussed in Smakhtin and Anputhas (2006).If any one of the four EMCs (A to D) considered in this study is assumed for the entire world, it becomes a 'scenario' of environmental water management and EF for such a scenario can also be calculated. It is also possible to try and determine the most probable present EMC for rivers globally. One way of doing this is to relate The modified index map was resampled to 0.1 degree spatial resolution (using ArcGIS software) to ensure it is compatible with the current study. The value of the index ranges from 0 to 1 (0 being no threat and 1 being the highest threat). The index was grouped into five classes 0-0.25, 0.25-0.5, 0.5-0.65, 0.65-0.6 and > 0.75 to represent EMCs A, B, C, D and E-F, respectively. This grouping is arbitrary but consistent with the analysis by Vörösmarty et al. (2010). According to these authors, a moderate threat level is reached when the index is above 0.5. This essentially corresponds to EMCs C and D in Table 1. Thus, below 0.5, the index represents EMCs A and B. The authors also suggest that a high threat level is represented by an index value of 0.75 or greater, which may correspond to EMCs E and F in Table 1.It has to be noted that the four EMCs (considered in this study) are assumed applicable to the entire world, but this needs to be viewed from the perspective of an individual country. Similarly, the most probable present EMC scenario may be derived by more detailed, country-specific approaches, especially where pertinent local data are available.To provide an approximate estimate of the groundwater-related EF component, the study separated river flow into SR ('quick' component) and BF ('slow' component), the latter broadly representing flow from subsurface stores. Evapotranspiration from groundwater in the vicinity of the river channel was ignored. Many automated techniques exist that facilitate this separation. Nathan and McMahon (1990) developed a recursive digital filter method to separate BF from a daily streamflow hydrograph using the following algorithm:(2)(3)Where: q t and b t are the filtered SR and BF at time step t, respectively; Q t is the total streamflow at time t, and β is the filter parameter.Although the Nathan and McMahon (1990) approach was initially developed for separating BF from daily river flow time series, Smakhtin (2001) illustrated the application of the same algorithm to monthly streamflows by adjusting the value of the filter parameter.1 According to Nathan and McMahon (1990), based on applications of daily data in catchments ranging from 4.2 to 210 km 2 in Australia, the value of β is in the range of 0.90 to 0.95. Smakhtin (2001) suggested that this value ranges between 0.91 and 0.94. Chapman (1991), however, argued that, since the β value represents the catchment characteristics, defining a single value for all catchments is unrealistic. This is especially true at the global scale. Therefore, a methodology was developed here to calculate the β value for each grid globally.Using the aggregated hydrological model monthly output of SR and BF to natural river flow, equations ( 2) and (3) were run at grid level for multiple values (increments of 0.05) of β between 0.85 and 0.99. The value of β that provided the least mean squared error between 1 Hughes et al. (2003) presented a slightly modified form of the Nathan and McMahon (1990) algorithm for monthly BF separation from monthly streamflow data:(4) A new filter parameter, α, was introduced to better represent the shape of BF. This is a generalized form of the equation used by Nathan and McMahon (1990) and Smakhtin (2001), where the value of α is 0.5. Equation (4) was tested on 70 observed monthly streamflow time series and its output (where α was allowed to vary between 0 and 0.5) was compared with the Smakhtin ( 2001) algorithm (where α was fixed at 0.5). The introduction of a flexible parameter improved the shape of the BF by shifting the peak of the BF, although the total BF remains the same. Since the focus of this particular study is on annual BF values, introducing another variable adds complexity without major accuracy gains. Hence, the original algorithm of Nathan and McMahon (1990) modified by Smakhtin (2001) for monthly data was used.the calculated BF and the BF derived from the hydrological model was selected as the β value for that grid. It was assumed that, for an individual grid cell, the value of β remains constant for all EMCs. Sustainable withdrawal of surface water and groundwater was calculated for the EF representing different EMCs using Equations ( 1) and ( 2) and the optimal β value. It was assumed that the groundwater aquifer is connected to the river channel, which might not always be true, especially in arid and semi-arid regions. The reduced (lower EMC) flow records were calculated by converting the FDCs for each EMC back into monthly time series (as described in Smakhtin andEriyagama 2008, andHughes andSmakhtin 1996), thus maintaining similar patterns of flow as the natural system. The difference between filtered SR (i.e., total flow minus BF) in natural conditions and the filtered SR contribution to EF for each EMC (i.e., total EF minus corresponding 'environmental' BF) was assumed to approximate a 'sustainable' surface water withdrawal for each EMC.To calculate exploitable groundwater, BFs (under natural and EMC flow conditions) were converted into volumes of shallow groundwater storage (assuming linear storage) that generate these flows within the contributing catchment (Ebrahim and Villholth 2016). The assumption behind this analysis is that the BF component of EF determines or constrains the groundwater storage, which is necessary to maintain the BFs. It was assumed that the relationship between aquifer storage and BF is not impacted by water withdrawal. Also, it was assumed that the low flow is comprised entirely of BF: discharge from snowmelt, and natural lakes and wetlands was ignored. The time series of differences between natural (reference) aquifer volume (or similarly estimated presentday aquifer volume) and the 'EF-driven' aquifer volume, in principle, represent a time series of exploitable groundwater. This analysis considers a change in storage of aquifers and not necessarily abstraction of groundwater. However, the temporal and spatial scale of this analysis is not adequate for a more detailed analysis. The difference between annual BF under natural conditions and the annual BF contribution to EF for each EMC provides an estimate of the acceptable change in BF (∆BF) for that EMC. Sustainable groundwater abstraction can be calculated based on equation ( 5).(5)Where: K is the characteristic drainage time scale (T), which is the inverse of the recession constant. K values per grid were taken from the PCR-GLOBWB (version 2.0) model.The overall methodology is illustrated in Figure 3. Corresponding to a given EMC, there is an acceptable reduction in streamflow that would preserve EF components. The new flow is shown in the figure as 'EF'. The shaded portion in the channel depicts the water that can be sustainably withdrawn from the channel for EF. It can be conceptually divided into SR and BF withdrawals. The rectangle on the right side represents the aquifer storage connected to the river channel that contributes to BF. The acceptable BF withdrawal for the EMC translates into an acceptable level of groundwater reduction in the aquifer storage. Thus, the shaded portions in the 'aquifer storage' represent the sustainable aquifer water withdrawals to maintain EF for the specific EMC.The shaded portion within the stream channel can shift up or down (indicating smaller/larger portion of BF contribution to abstracted water), which will affect the amount of water that can be sustainably removed from the aquifer storage. In other words, if more river flow is abstracted (than estimated) as sustainable surface water abstraction, a corresponding reduction in groundwater abstraction will have to take place (using the linear aquifer approach), but only to the extent possible within the total sustainable water withdrawal for that EMC. In contrast, groundwater withdrawals may not replace allowable surface water withdrawals, because river flow may be comprised exclusively of BF during rainless periods, thereby compromising EF.Figures 4 to 7 show the global maps of the EF (total, i.e., groundwater plus surface water) derived for EMCs A to D, respectively, as a percentage of natural long-term discharge. Figure 4 shows the percentage of natural discharge required if all the rivers, globally, had an EMC of A; Figure 5 shows the same for EMC of B, etc. Arid and semi-arid regions w i t h n e g l i g i b l e s t r e a m f l o w s h a v e b e e n excluded from calculations. To define regions with negligible flows, land use was used as   The total global annual runoff for natural conditions, simulated by the PCRGLOB-WB model, is 50,969 km 3 . Shiklomanov (2000) estimated the global annual river discharge to the ocean as 43,000 km 3 . van Beek et al. (2011) summarized discharges from other global studies and found that it ranged from 29,485 km 3 to 44,560 km 3 . Oki and Kanae (2006) presented a value of 45,500 km 3 as river discharge to the oceans. As discussed in the section above, for this analysis, runoff (i.e., SR and BF) is considered and not the river discharge. Thus, certain processes, such as evaporation in river channels, transmission losses, interactions between river channels and delta regions, and water draining into inland water bodies, are not considered and may be the reason for the higher runoff in this study compared to the river discharge calculated by other studies. Nijssen et al. (2001) also highlighted this with an example of Niger River in West Africa, where the river discharge decreases even though the watershed area increases as one goes downstream. Thus, in some regions, flow routing can have a significant impact on the river discharge in comparison to the runoff generated. From the figures, it is clear that, for EMC A, the annual flow in the rivers, on average, needs to be 40,784 km 3 , which is about 80% of the annual flow in the rivers. Spatially, the percentage ranges from 72% in Australia to 83% in South America and Oceania for EMC A. This reduces as the EMC is lowered to Class D, where most of the rivers require, on average, about 42% of their natural flow, and significant parts of the globe can 'cope' with even less than 20%. For EMC D, the continental variation ranges from 33% for Australia to 48% for South America. Table 3 shows the long-term average annual river flow (51 years) per continent for natural flows and for EMCs A to D. The contribution of groundwater (or BF) to the annual discharge of the rivers in the considered areas is highly variable. Figure 8 shows average annual groundwater contribution to total river flow for natural conditions as a percentage of total flow. Table 4 provides the continent-level distribution of the annual contribution of groundwater (BF) to river flow -for natural flow and the four EMCs considered in this study. At a global level, and for the areas under consideration, BF constitutes about 41% of the total annual natural river flow. This is on the lower side compared to other global studies conducted by, for example, Beck et al. (2013), where the BF component of total streamflow ranges from 49% to 77% (based on Köppen-Geiger climatic zones). When compared to the natural flows, about 76.5% of the natural BF is required to meet EMC A requirements. This goes down to 38.5% of the natural BF to meet EMC D requirements. Figures 9 and 10 show groundwater that can be extracted (10 -3 Mm 3 a -1 ) sustainably from each 0.1 degree grid cell for EMCs A and D, respectively (the pattern of groundwater abstraction maps for classes B and C is broadly similar). Based on the required contribution of groundwater to the EF, the amount of groundwater that can be extracted sustainably in the major world regions is shown in Table 5. This calculation assumes that the contribution to the EF is being met by surface water and groundwater in the same proportion as it is in the natural flow. For EMC A, about 148.9 km 3 a -1 of groundwater, globally, can be abstracted sustainably. For EMCs B, C and D, these numbers are 255.5, 328.4 and 376.2 km 3 a -1 , respectively. Giordano (2009) used data from FAO's AQUASTAT database to show total global groundwater abstraction as 658 km 3 a -1 . From modelling, the global total and non-renewable groundwater abstractions in 2000 were estimated to be 734 and 234 km 3 a -1 , respectively (Wada et al. 2012). The figure for renewable groundwater abstraction (the difference: 500 km 3 a -1 ) is larger than the sustainable level for EMC D (376.2 km 3 a -1). While significant uncertainty relates to the estimation of groundwater abstraction from renewable and non-renewable resources (Döll et al. 2014), the finding that estimates of groundwater abstraction from renewable resources is significantly higher than the estimate of sustainable abstraction for all EMCs, as estimated in this study, highlights the fact that the PCR-GLOBWB model does not take into account EFs. As seen, streamflow is significantly impacted by levels of abstraction (streamflow depletion) in many regions of the world already. There is significant regional variation in withdrawals. Some regions, such as northwestern India, the northern parts of China and the western US, have much higher groundwater abstractions than the sustainable limits (as discussed above) and are now mining non-renewable groundwater. In Figure 11, it can be seen that large parts of North America, Europe and Asia fall into EMC C. In these regions, the natural flows of the rivers have been substantially modified. Most of these regions also have high agricultural activity. These factors present poor levels of EMC, and correspondingly high levels of abstraction indicate that the residual potential for increasing abstractions is limited and would shift the EMC to even more degraded levels.Based on the estimated existing EMCs for the globe, EF (Figure 12) and sustainable groundwater abstraction (Figure 13) have been calculated. This assumes that surface water is abstracted sustainably, i.e., the surface water component of the EF is satisfied. Figures 12  and 13 show the percentage of EF required and sustainable groundwater abstraction limits, respectively, if the current EMC is to be maintained. Thus, if currently (partially) degraded rivers are to be kept in, at least, the same class, they need a smaller percentage of natural flow to maintain the current EMC than for higher EMCs. The information provided by these figures may be seen as the approximate threshold levels required to prevent rivers from degrading further.  Globally, about 1.6% of groundwater recharge (12,666 km 3 a -1 ) can be sustainably abstracted at present-day EMC. Not all the groundwater recharge stays as groundwater. As discussed above, a large portion of groundwater recharge reaches the streamflow as baseflow. to define targets of water abstractions for the selected areas/regions. Figure 14 provides details of the steps that have to be followed when using IWMI's Global Environmental Flow Information System.Step 1: Either a predefined country or river basin boundary is selected. The user can also define an area of interest more specifically, e.g., at sub-national administrative level. In Figure 14, India is selected.Step 2: Based on the area selected in step 1, the tool will calculate EF as an average percentage of natural river flow for the selected area for the 'current probable' EMC.It will also provide an estimate of additional sustainable surface water and groundwater that can be abstracted (in cubic meters) for the current EMC.Step 3: Select any EMC to obtain information on the sustainable surface water and groundwater that can be abstracted.Step 4: Click on the 'Summarize Area' button. This will open a pop-up window with the aggregated numbers for EF shown in a table format. The 'Download' button in the pop-up window allows the user to download gridlevel data.This information can then be used in the SDG indicators to calculate indicator values, if current water abstraction data exist. FIGURE 14. Steps that have to be followed when using IWMI's Global Environmental Flow Information System to estimate sustainable surface water and groundwater abstractions for a selected area.Step 1Step 3Step 2Step 4Tables 7 and 8   In general, both the case studies (Ganges River Basin/India and Tana River Basin/Kenya) show that this tool gives a very conservative value for sustainable groundwater abstraction. As mentioned above, this tool calculates the permissible change in storage of a shallow aquifer rather than the actual groundwater withdrawn. First, some of the groundwater abstracted may be compensated with the groundwater recharge and is hence not included in this analysis. Second, it is assumed that the proportion of the BF component of EF at an annual level is the same as the natural EF. This too leads to a conservative estimate of sustainable groundwater abstraction. Finally, the analysis can only consider the shallow aquifer that is hydrologically connected to a river system. Due to the lack of global datasets on depths of shallow and deep aquifers, the shallow aquifers deeper than the riverbed or deep aquifers are not covered in this study -these may also contribute to sustainable groundwater abstraction.Goal 6 of the SDGs is focused explicitly on water. Target 6.4 of the SDGs requires that an estimate of the environmental water component of both surface water and groundwater is known to ensure that abstractions of water are sustainable. However, in most countries, there is a lack of awareness of EF at multiple stakeholder levels, and a lack of consistent, easy-to-use, readily available EF data to feed into the SDG process. This research study focused on making data on EF, and sustainable surface water (SR) and groundwater (BF) abstractions available at a global, regional and subregional level. Using 0.1 degree spatial resolution data on SR and BF for natural flow conditions, annual EF values were quantified with the help of the Global Environmental Flow Calculator, developed by IWMI, and based on the outputs of the PCR-GLOBWB model. EF were defined for four EMCs. The contribution of groundwater to EF was also calculated, by filtering baseflow from total flow and converting BFs into utilizable (available for abstraction) groundwater storage volumes. Finally, sustainable groundwater and surface water withdrawals relative to pristine conditions were estimated for the four EMCs considered in this study.The analysis was carried out for each grid cell independently. This enables aggregation of EF requirements for any country, or at subnational scale, which will be required by the SDG process. The outputs derived in this study provide initial, hydrology-based information to assist countries in assessing the SDG 6 indicators -at least as baselines, and especially for those countries which have not yet made their own EF assessments.Being based exclusively on the natural flow variability of rivers, the tools presented do not take into account water quality issues and no local ecological data were used. Also, the approach does not differentiate between the contribution of groundwater and snowmelt to the 'slow flow', which may lead to an overestimation of the BF and by implication groundwater availability, in those regions where the contribution of snowmelt to the river flows in warmer months is significant. Only the shallow aquifers that are hydrologically connected to the streams are considered. Determination of relative surface water and groundwater availability hinges on the separation of BF from total streamflow. This was partly constrained by using modelled streamflow components and the BF separation method. Ultimately, the decision on the optimal share of abstraction between groundwater and surface water must depend on local assessments.The above are limitations of the approach presented. Naturally, a number of assumptions had to be made while working at a global level with such a complex issue as environmentally sustainable water management of rivers and aquifers. It is important to stress that the data and tools described in this report are developed exclusively for the purpose of filling data gaps for some SDG 6 indicators, particularly those related to SDG target 6.4.2, where EF are used explicitly. These data, and the process and tools suggested, may be useful in defining initial values of relevant SDG indicators, for certain areas/countries where other data alternatives are not yet available. Therefore, this report also aims to stimulate further work in this direction, and try and ensure that EF are not ignored completely and \"left to be dealt with in the future.\" The data for EF to be used as input to SDG 6 are available, and the existing science and practice of EF assessment, globally, can step into the SDG process to help improve such estimates and monitor the EFrelated targets over the lifetime of the SDGs."}

main/part_2/0462226297.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"170bbb44401108cb8f61740e7c0b556f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ad6fdbaa-001c-4cdf-8aa3-ac9847f85151/retrieve","id":"-366055012"},"keywords":[],"sieverID":"49915ede-677c-415a-bccf-e1d96ac1692b","content":"Multistakeholder platforms (MSPs) that bring together a range of actors to collaboratively address land and natural resource governance issues are increasingly common in sub-Saharan Africa. However, the extent to which such platforms effectively harmonise complex social-ecological challenges and deliver improved outcomes is poorly understood. This study examines how MSPs across different scales of governance in Zambia have influenced and facilitated more integrated landscape governance. Based on literature review, policy document analysis and key informant interviews, we found that MSPs vary in form, function, influence and efficacity. Both formal and informal MSPs were found to enhance deliberative governance through the participation of key actors who contribute towards efforts to reconcile diverging and potentially conflicting interests. At the national level, MSPs benefit from broad actor presence and opportunities to lobby for policy and institutional change. Legally instituted MSPs at the district level provide a bridge between national policy development and local resource governance. Meanwhile, informal and formal local-level MSPs are strong in addressing resource conflicts and fostering community coordination and customary rules and regulations. However, local-level MSPs are less successful in influencing policy change due to weak linkages with formal governance institutions. These weak linkages between local and national governance levels have negative downward effects (i.e. poor policy performance and policies not taking root at the local level). We conclude that while MSPs offer the potential to improve stakeholder dialogue, deliberate feedback loops and enhanced linkages with other stakeholders at both district and national levels are needed to achieve more collaborative, equitable and effective landscape governance.Deforestation, forest degradation and unsustainable use of natural resources are persistent challenges in sub-Saharan Africa, often perpetuated by weak governance arrangements (Riggs et al., 2018;Nansikombi et al., 2020;Mihaylova, 2023). These challenges have compromised food security, worsened the impacts of climate change, and forced forest fringe communities into extreme poverty (Naeem et al., 2016;Ehara et al., 2023). Global environmental policy frameworks such as the Paris Agreement and the Sustainable Development Goals (SDGs) acknowledge the interconnectedness of these issues and the need to address them holistically (Akhtar-Schuster et al., 2017;Reed et al., 2020). Acknowledging that sectoral solutions have typically proven inadequate to address these interconnected challenges as they fail to account for externalities or unforeseen outcomes (Vermunt et al., 2020), multistakeholder platforms (MSPs) are widely used in environmental management policies as dialogue-focused and collaborative mechanisms to facilitate negotiations of trade-offs and synergies between conservation, development and livelihoods (Estrada-Carmona et al., 2014;Kusters et al., 2018;Barletti and Larson, 2019;Reed et al., 2019;Sirimorok and Rusdianto, 2020). Such MSPs are becoming more prevalent in the global South (Bisseleua et al., 2018;Omotayo and Zikhali, 2019;Ratner et al., 2022;Siangulube, 2023). Despite the abundant literature on MSPs providing theoretical insights into the broader principles of participation and widespread uptake of MSPs in various contexts (Elia et al., 2020;Sirimorok and Rusdianto, 2020;Sigalla et al., 2021;Sarmiento Barletti et al., 2022), there is little empirical evidence of their effectiveness in the tropics beyond measuring beneficiaries' perceptions (van Ewijk and Ros-Tonen, 2020). Hence, more empirical studies are needed to enhance triple loop learning in policy and practice-whereby actors not only ask whether they do things 'right' (single-loop learning) and do the 'right things' (second-loop learning) but also question whether the right things are done (third-loop learning) (Pahl-Wostl, 2009).Integrated landscape approaches (ILAs), embedded in the broader landscape governance theory, are among the recently acknowledged ways for dealing with multiple and often conflicting stakeholder interests in complex political and social-ecological systems and propose the use of MSPs (Sayer et al., 2013;Kusters et al., 2018;Reed et al., 2016Reed et al., , 2020)). Guiding principles for landscape approaches reflect contemporary efforts to facilitate cross-scale and cross-sector engagement to reconcile conservation and development goals (Sayer et al., 2013). The ILA literature contends that competing claims of stakeholders require an inclusive approach that considers the importance of synergising diverse stakeholder interests at multiple scales (Reed et al., 2019;Pedroza-Arceo et al., 2022). MSPs are central to this thinking, recognising that no single actor or entity alone can address complex landscape-scale 'wicked problems' and achieve integrated landscape governance 1 (van Oosten, 2013; Haines-Young and Potschin, 2014;  Ros-Tonen et al., 2014; Stickler et al., 2018). Instead, flexible and transparent concerted efforts of multiple stakeholders are needed (Balint et al., 2011;Defries and Nagendra, 2017).Notwithstanding numerous limitations and acknowledging that MSPs are not the panacea to solve cross-scale problems (Søreide and Truex, 2013;Sirimorok and Rusdianto, 2020), their potential to facilitate participation and actor engagement are under extensive discussion and increasingly regarded as useful in overcoming institutional fragmentation (Ros-Tonen et al., 2018;Riggs et al., 2018). Authors in the landscape governance literature use a variety of terms that are synonymous with MSPs (e.g., multistakeholder forums, stakeholder platforms, stakeholder partnerships, and networks) (Barletti and Larson 2019;van Ewijk and Ros-Tonen 2020). In this paper, we conceptualise MSPs as a) physical or virtual forums that assume different forms and purposes in either voluntary or statutory settings; b) spaces for stakeholder participation to resolve temporal or long-term problems through dialogue; c) institutionalised rather than ad hoc meeting spaces; and d) involving multiple actors or stakeholder groups (Djalante, 2012;Brouwer et al., 2015;Bisseleua et al., 2018). This paper focuses on physical, formal and informal MSPs established to facilitate the negotiation of conservation and development objectives in a Zambian natural resource governance context.Zambia has seen a proliferation of MSPs at national, district and local governance levels because of the devolution of natural resource governance and decision-making. Given the co-existence of several sectors and actors in a legal pluralism arrangement (different governance regimes with overlapping jurisdictions (Bavinck and Gupta, 2014)), there is a need to better understand how different multistakeholder platforms facilitate stakeholder participation and reconcile multiple interests in the context of natural resource governance to foster conservation goals. To the best of our knowledge, no such examination of the potential of MSPs or similar modes of governance across different governance scales that facilitate more integrated landscape governance has been conducted in Zambia to date. Focusing on the Kalomo District in the Southern Province of Zambia, this study seeks to draw lessons on the potential of MSPs to establish common concerns and negotiate conflicting aims and interests. This serves to inform the ongoing COLANDS 2 initiative about the potential implementation of ILAs in the Kalomo District. To achieve this overarching goal, we ask how MSPs across different jurisdictional levels facilitate participation in natural resource governance and decision-making and how they navigate and help reconcile multiple and conflicting stakeholder interests to pursue conservation and development goals in the Kalomo District of Zambia.To answer these questions, we first provide context to natural resource governance in Zambia, showing its nested nature and involvement of multiple stakeholders. The methodology section presents specifics on the study area, the sampling method, and the methods used to collect data on national, district and local MSPs with varied interests and mandates. The result section analyses the potential of MSPs to facilitate participation and reconcile various stakeholder interests by negotiating synergies and trade-offs and links the mandates and interests of the MSPs to the principles for an integrated landscape approach (Sayer et al., 2013). The paper concludes that improving stakeholder participation and dialogue, creating deliberate feedback loops, and enhancing cross-level linkages between stakeholders and policymakers can help to implement an ILA for more collaborative, equitable and effective landscape governance.Natural resource governance in Zambia is largely driven by the central government. Like most tropical African countries with polycentric governance arrangements (Potts, 2020), Zambia's policy framework struggles to support natural resource conservation and sustainable development, partly due to institutional conflicts about their mandates and policy incoherence in a 'nested landscape' (Kalaba et al., 2014). The recent Eighth National Development Plan (ENDP 2017(ENDP -2021)), a national policy on development, acknowledges such discords (O'Connor et al., 2020;GRZ, 2022). The plan recognises integrated multi-sectoral approaches to development, emphasising inclusive participation in sustainable development planning. While several legal provisions encourage inclusivity in natural resource governance, the 'how' to operationalise remains challenging (Ashraf et al., 2016;Kalaba, 2016). For example, the 2013 decentralisation policy that set the stage for equitable stakeholder participation in both statutory and customary institutions lacks a coherent implementation framework.The Department of Climate Change and Natural Resources of the Ministry of Green Economy and Environment is responsible for the conservation of natural resources as well as the formulation, coordination, and implementation of policies and programmes, with the support of several government agencies and non-state actors (Table 1). Various policies and legislations also recognise traditional institutions as important partners in biodiversity protection, especially on customary lands and in game management areas. With the decentralisation of natural resource governance, additional actors such as timber companies, charcoal associations, civil society, research organisations and community cooperatives have emerged. Furthermore, with increasing demand for natural resources such as timber and wildlife from emerging economies such as China, landscape governance in the global South, including Zambia, is becoming increasingly complex. This is because both visible and non-visible landscape actors with varying capacities, positions of power, legitimacies, expectations, and practises influence the conservation-development agenda (Sabatier, 1991;Schusser et al., 2015;Siangulube et al., 2023). Therefore, landscape governance approaches require integrating social-political mechanisms that foster actor negotiations and identify common concerns, the hope being that such a paradigm shift could lead to more equitable natural resource governance and management. 3This research was carried out in Kalomo District (Fig. 1) in Zambia between November 2019 and October 2020. The study area lies in the Kafue Basin in southern Zambia in a mixed land-use complex comprising a tourism corridor, agricultural cropland and pasture, a national park and settlements. The district's governance system is marked by legal pluralism, with statutory governance falling under central government agencies. Under customary governance, Kalomo District has three independent chiefdoms: Sipatunyana, Chikanta and Siachitema. In terms of natural resource governance, the district is a typical illustration of a contested landscape characterised by weak institutional linkages, tensions between different governance levels, and disputes over land use and access to natural resources. The increasing demand for land for agricultural expansion, infrastructure development, and increasing production for national and international markets have placed further pressure on the forest resource base.The district hosts the Kalomo Hills forest reserve (No. P13), southern Zambia's largest local forest reserve. The forest reserve borders the oldest national park in Zambia and the second largest in Africa, the Kafue National Park (Thapa, 2012). It was gazetted under Government Notice No. 102 of 1952 to be a source of biomass energy for the district and to protect the Ngwezi, Sichifulo, Kalomo, Nanzhila and Chitongo water recharge systems. The forest reserve, which lies in the Siachitema and Chikanta Chiefdoms, has undergone tremendous pressure, and vegetation cover decreased in extent from over 138,844 ha in 1984 to about 40,255 ha in 2020 (Moombe et al., 2020;Mbanga et al., 2021).Purposive sampling was used to select relevant MSPs at the national, district and community levels. This means that the decision on the 3 Natural resource management is understood in this paper as the measures taken to sustainably manage renewable resources such as forests, water, wildlife and soils. Natural resource governance refers to the political, legal and institutional framework for natural resource management and defines who has a say in decisions taken regarding the allocation and use of natural resources (adapted from Ros-Tonen et al., 2008). choice of the units of analysis-the MSPs-was based on the following selection criteria: a) having a mandate and interest in enhancing conservation and development, b) being an institutionalised physical MSP (statutory, customary or hybrid; based on legal provisions or voluntary association); and c) contributing to a representative sample of MSPs operating at national, district and local levels, with local being defined as being embedded in one or more of the three chiefdoms of Kalomo District. The subsections below specify the sampling process for each level and how participants representing each level-the units of observation-were selected for an interview (see Table 2).We reviewed various documents to identify and make a list of appropriate national MSPs (see supplementary material, Appendix A). We sought to identify MSPs with a combination of conservation and development objectives among its mandates and a direct or indirect impact on activities in Kalomo District, which resulted in an initial list of seven MSPs. Next, we employed snowball sampling to identify more MSPs. In this iterative process, additional MSPs were added to the list, while others were removed, the latter mainly because they had either no conservation objectives in their mandate or did not have any activities in the study area. We assumed that the sampling had reached the saturation level when no new MSPs were added to the list based on our criteria (Marshall, 1996). The final list consisted of four MSPs that met the criteria, all of which were included, implying a 100% response rate.Due to COVID-19 restrictions that rendered many respondents unavailable, we altered the initial research design, which envisioned interviewing at least three persons in each MSP. Instead, we purposively selected one representative from each MSP by considering their previous experience and roles by reviewing past reports and meeting minutes, if available. To mitigate research bias associated with relying on a single respondent and improve the validity and credibility of the findings, we employed data triangulation by interviewing additional respondents from comparable MSPs. These respondents are referred to as validation respondents in Table 2. Even though these respondents were not associated with the targeted MSPs, they were selected using the same criteria. Therefore, responses from all respondents are deemed adequate to answer the study's research questions (see the discussion section). A semi-structured questionnaire was used (see Section 3.3 and supplementary material, Appendix B).Two relevant district-level MSPs were identified through document analysis: the District Development Coordinating Committee (DDCC) and the Consultative Working Group (CWG). The DDCC is a formal district platform that brings together all heads of government agencies, traditional leaders, and representatives of civil society organisations and the private sector. The CGW is an informal MSP composed of various district-level organisations with an interest in Kalomo Hills forest reserve issues. The latter platform functions as an entry point for implementing a landscape approach through the COLANDS initiative that aims to operationalise landscape approaches and learn from the experience.The DDCC platform discusses all development and environmental management-related activities in the district, and participation is mandatory for government agencies, CSOs and some private sector actors with a presence in the district. The convenors of DDCC meetings provided an attendance list consisting of 56 names, of which 33 were selected based on the selection criterion that they had participated in MSP activities for at least one year (2019)(2020). We assumed that if a potential respondent had consistently participated in MSP processes for at least a year, they would have gained adequate knowledge to respond to the questions. Of the 33 qualifying respondents, 18 were responsive, while the remaining 15 were unavailable for interviews due to COVID-19 restrictions and other commitments on scheduled dates, implying a response rate of 55%. Based on similar criteria, 29 respondents were selected from the CWG attendance lists, of whom three were already selected as participants in DDCC meetings, resulting in 26 interviewees, representing a 100% response rate. A semi-structured questionnaire was used for the MSP respondents (see supplementary material, Appendix A material).The local community MSPs-the Village Productivity Committees (VPCs)-are formal local-level MSPs composed of members elected through village meetings held every two years for a maximum of three consecutive terms. The VPC membership varies from one village to another (between 10 and 15 members) and usually has fair gender and age representations.At the local level, a cluster sampling technique was used, where a village was considered a cluster. Five villages were selected in three chiefdoms (Section 3.1, Fig. 1) based on how active a VPC was. A village register was used to identify members who have served in the VPC at any given time. In each cluster, two representatives were randomly selected from the village registers (one currently serving in MSP and the other being an ex-member). A total of 10 were involved as informants in the five clusters. The response rate was 100%, given that all selected respondents were available for interviews.Five additional respondents were purposely selected for validation (see Table 2). Of the 74 MSP representatives sampled for interviews, 63 were interviewed, implying an 85% response rate. The remaining 15% were unavailable for various reasons, mainly due to other commitments on scheduled times or because COVID-19 health guidelines 4 restricted social interactions in certain places.The study employed a combination of data collection methods, i.e., participant observation in workshops, focus group discussions, semistructured interviews, and text analysis of peer-reviewed and grey literature, policy documents, and media reports. Although the study focuses on Kalomo District, data collection was much broader, given that some MSPs operate at the national level. The main themes that guided data collection were derived from the research questions (see Section 1) and included terms of participation, decision-making procedures, common and conflicting interests among actors, issues and arrangements referring to specific natural resources (forest, land, water), and the potential for integrated approaches. Supplementary sources of information included published reports of organisations championing or seen to be critical of the MSPs in different sectors. The five respondents randomly selected for validation were interviewed using an open-ended questionnaire (see supplementary material, Appendix C). Finally, the first author attended six MSP meetings between August 2019 and October 2020, including National Charcoal Dialogue, CWG and VPC meetings. Qualitative data was coded based on these themes and analysed using MAXQDA software (Kuckartz and Rädiker, 2019).Below, we address the two research questions and analyse how MSPs across different jurisdictional levels facilitate stakeholder participation in natural resource governance and decision-making (4.1; research question 1) and how they help navigate and reconcile multiple and conflicting stakeholder interests (4.2; research question 2).MSPs differ by whether they were established by law (ZCCN, IMCCC, DCCC, VPCs) or by voluntary associations (ZCBNRMF, ACF, CWG-see Table 2 for acronyms), as well as by jurisdictional level (national, district, local). The type of MSP determines who participates and on what terms.Most national-level MSPs have clear mandates, but stakeholder representation and terms and conditions for participation vary from platform to platform. Some national MSPs have strict representation requirements, while others operate an 'open door' policy. For example, the Zambia Community-based Natural Resources Management Forum (ZCBNRF) and the Zambia Climate Change Network (ZCCN) are both membership-based and require that a representative of an organisation agrees to the set rules and pays membership fees. Other platforms, such as the Agriculture Consultative Forum (ACF), draw their membership \"from any interested organisation, individual, or group\". 5 Yet, in other MSPs, participation is restricted to specific interest holders and by invitation only (e.g., climate change policy matters in the IMCC) (see Table 3). There are transparent procedures for participating in these spaces in all cases, which is critical to legitimacy. In the words of one respondent, \"Fair representation can impact the legitimacy and acceptability of MSPs' decisions\". 6 The national MSPs are mostly driven by experts and technocrats from government agencies, business communities, and civil society organisations interested in or affected by environmental governance. This wide spectrum of stakeholders from diverse interest groups, whose mandates relate to various developmental and environmental policies, is important to foster a crossbreed of actions, a necessary element for integration (e.g., in the ZCBNRMF). The ACF engages diverse stakeholders to lobby for small-scale farmers and agriculture commodity associations to participate in business decision-making influencing the agriculture and natural resource sectors.At the district level, the District Administration determines stakeholder engagement in the DDCC MSP. Stakeholders in this MSP include state institutions, the private sector, and traditional leaders to discuss broader district challenges. The district CWG MSP invites stakeholders from a wide range of sectors, most of whom are already members of DDCC with specific interests in livelihoods, conservation, and developmental issues in the Kalomo landscape. In both MSPs, there is overlapping membership of state and non-state actors. The presence of civil society organisations that represent marginalised people in the district and local spaces enables MSPs across governance scales to share and discuss issues of common concern.Due to the diversified composition of district-level platforms-they extend beyond the village and district capitals where decisions are made-the selection of representatives and facilitators is more complex and problematic than at the national level. For instance, only heads of departments or institutions are considered, some of whom are not familiar with local dynamics, while they are supposed to serve as the link between the government and community interests \"even though we tend to represent more the interests of the government and implement policies\". 7 The facilitation of DDCC meetings lacks objectivity and neutrality as it is moderated by the District Commissioner, who also serves as a controlling authority for government departments. This institutional set-up may compromise impartial deliberations.Representation of communities by traditional leaders and headmen is equally problematic in the DDCC and CWG. While these leaders are 'link actors' of local-level MSPs where they are de facto members, one of the respondents 7 observed that the Chiefs \"do not fully represent the aspirations of the community members on contentious issues\" such as settlements, access to forest resources, and licensing schemes of forest products (notably charcoal). These speculations were based on what some respondents perceived as \"bribes\": \"Traditional leaders receive a salary from central government\". 8 Another respondent cited the case of the Kalomo Hills forest reserve as being \"poorly represented by traditional leaders [Chief] at the DDCC\". 9 In contrast, CWG meetings are facilitated by scientists from the Centre for International Forestry Research (CIFOR), a research and capacity-building institution engaged in multi-stakeholder dialogues about forest issues. Usually, the facilitators are chosen from among participants depending on the nature of the issues under consideration. Unlike the DDCC, this approach enhances good facilitation and objectivity and helps moderate power imbalances in CWG sessions.At the community level, engagement in VCPs is through elected community members who represent village-level people. In addition, participation in these spaces can be through invitation. Some community members deemed influential (based on affluence or formal education) are invited to special meetings to engage in matters of common interest, such as land-use conflicts and boundary disputes, and discuss development priorities and bylaws, among others. Occasionally, village head persons nominate these influential individuals to CWG meetings. Although this may foster linkages between MSPs, in one village, such an individual was a source of misinformation and was not held accountable.Community members generally trust their governing structures and processes built over several generations. Through a transparent, participatory process, local communities convene to elect representatives. Almost every village MSP meeting is moderated by the village headperson as a de facto facilitator, except for contentious issues such as complex land disputes, which are facilitated by a senior headperson. However, these facilitators are conflicted between trying to hold spaces of equitable dialogue and enforcing cultural norms that dictate behaviour in traditional settings. Thus, cultural norms are inherently embedded in MSP protocols, limiting effective engagement, especially for women and youths who are discouraged from publicly disagreeing with the elders.MSPs from all three governance levels (national, district, and local) have some degree of influence on natural resource governance and development outcomes. Given a wide constituency of stakeholders, national MSPs influence policies and mobilise financial and technical resources with spillover effects on the Kalomo landscape in the short and long term. For example, one respondent said the strength of national MSPs lies in their ability to \"mobilise stakeholders from the government, mining, banking sectors, timber associations, traditional leaders, donor communities and civil society to advocate for reforms in the taxation of natural resources as well as to strengthen environmental impact assessment procedures\". 10 Such reforms are likely to positively strengthen natural resource management at both the national and district level. The district-and local-level MSPs particularly engage stakeholders to \"mediate in conflicts over natural resources\" 11 by facilitating Source: Interviews 2019-2020.7 Interview with a VCP member, Village 1 in Kalomo District,August 2020. 8 Interview with a VPC member, Village 1 in Kalomo District, August 2020. 9 Interview with a VPC member, Village 3 in Kalomo District, August, 2020. 10 Interview with a National MSP respondent, Lusaka, December 2020.11 Interview with a respondent from the District MSP, Kalomo, August 2020.dialogue around conservation and development issues. Table 3 provides an overview of the terms of stakeholder participation per jurisdictional level and MSP and the degree of influence on natural resource governance and decision-making.We cross-tabulated, evaluated, and contrasted the mandates of all MSPs (Table 3) to identify common and competing interests across stakeholders (supplementary material, Appendix E). In general, interests represented by national-level MSPs primarily focus on policy dialogue and lobbying, information sharing, and influencing government decisions in natural resource management. The district-level MSPs focus on reconciling the interests of various groups, coordinating policy implementation by key state and non-state actors, and mobilising financial and social capital (networks) to implement activities aimed at fostering conservation. Local-level MSPs are interested in ensuring the enforcement of local rules and regulations regarding equitable access to land and natural resources and mediating conflict resolution at the village level. There are synergies among MSPs based on their mandates and activities. All national MSPs have common interests in policy lobbying and influencing government decisions, except for the ACF, whose interests do not directly relate to other national MSPs. The ACF focuses more on agro-enterprise development in the agriculture and natural resource sectors (business). At the district level, the DDCC and CWG reveal strong synergies in fostering district-level dialogue and communicating policy development, which can be attributed to overlapping membership. In turn, this synergy of district MSPs positively impacts attempts to reduce resource-use conflicts in and around the Kalomo Hills forest reserve.Additionally, we found conflicts of interest among some MSPs. The VPCs of villages 2 and 3 (see Fig. 1) conflict with ZCBNRMF mandates in which the latter 'blame' VPCs for undermining conservation efforts by not stopping settlement, engaging in agriculture, and grazing in the forest reserve, thus compromising the integrity of the natural resource base in the forest reserve. Following this, the CWG acted as a bridging institution between VPCs, government agencies (agriculture and forestry), and the ZCBNRMF to initiate dialogue on sustainable natural resource management in the Kalomo Hills forest reserve.To assess whether and how MSPs are instrumental in reconciling multiple stakeholder interests, we first asked respondents to list the five most important functions of their MSPs. Responses based on similar terms, phrases, and meanings were grouped, resulting in seven categories (Table 4).The results indicate that 82% of respondents believe that their MSP helps explain policies and facilitate uptake at the grassroots level, allowing diverse interests to converge in policy implementation. This has positive implications for narrowing policy-implementation gaps at the community level, where natural resources policies are translated into actions. Respondents identified district MSPs as suitable bridges between national policy development and local resource management, although we did not find concrete evidence to support this. About 73% of respondents, mainly from the district level, considered MSPs necessary for building stakeholder networks that are key in reconciling various interests by exchanging ideas and experiences. All respondents from community MSPs identified the VPCs as important in brokering power differences, which they considered important for conflict resolution and efforts to reconcile multiple stakeholder interests. Furthermore, they perceive MSPs as important in helping to harness a shared vision, identify common goals, and enhance problem-solving. This contrasts quite strongly with national and district-level respondents, suggesting that higher-level actors do not consider power or shared goals so important as they have the power to determine the goals. Despite the very small sample size at the national level, there was no consensus on any role, which seems problematic. While participants in national and district MSPs see financial and technical resource mobilisation as important functions of MSPs, those at the local level do not. This analysis also shows that the governance level influences perceptions about the role of MSPs in reconciling multiple stakeholder interests.Respondents considered the policy framework as significant for the functioning of MSPs. Laws and regulations mentioned as enabling the functioning of MSPs for natural resource governance across scales are shown in Appendix D (Supplementary material).We found more policy awareness at the national and district levelsAligning integrated landscape approach principles to MSPs at various jurisdictional levels. Enhance good governance practices by defining mutually agreed goals and transparent consensusbuilding processes towards a theory of change.Define clear rules on how to access resources, define clear roles and responsibilities of all stakeholders and how conflicting interests can be resolved and recourse to be taken.P8. Participatory and user-friendly monitoring.Different stakeholders can be part of the monitoring process, use and share the information, and integrate such knowledge into their respective activities.Harnessing actions to address landscape-level threats and allow recovery after perturbation to continue accessing goods and services from a system -+ + +Deliberately enhance skills to take up roles and responsibilities and participate in decision-making through capacity building.Scale to assess which ILA principle aligns with MSP objectives: + /+ + align (strongly). -/-align (weakly). ± do not align. Source: Compiled by the author based on fieldwork in 2020.than at the community level. One prominent VPC respondent, for example, stated that he was unaware of the Forest Act of 2015, the principal statute governing forest management. This could point to a disconnect between MSPs who advocate for regulations and local people who are meant to support efforts to implement natural resource management policies on the ground. Furthermore, certain regulations noted by respondents at the national and district levels, such as the decentralisation policy, the Environmental Management Act, and REDD+ , have a focus that supports ILAs, negotiating trade-offs between conservation and development. Respondents from all MSPs acknowledged that policies rarely translate into tangible benefits at the grassroots level due to poor communication and weak linkages of MSPs with policymakers. Most district and local respondents noted that policy decisions on environment and development at the national level fail to take root in communities because \"local institutions are not linked to higher-level policymakers\". As such, \"legal frameworks need to be better aligned with local needs and interests\". 12 Local-level MSP respondents stressed that while statutory laws and policies are well intended, they are insufficient to address local needs. Customary rules and regulations enforced through VPCs are closely tied to local settings and are better able to address local problems. An example of such a claim was a comparison of local rules and statutory regulations in the Kalomo Hills forest reserve. For example, VPCs in Villages 2, 3 and 4 guide people to manage forest patches between agriculture fields, and communities strictly adhere to this advice. In contrast, the Forest Department issues tree felling permits (for charcoal, fuel wood, or timber), which only the powerful traders can afford, undermining local rules and capacity. Given the logistical barrier for the poor, tree-felling permits are unworkable in rural communities, and only local rules are deemed suitable to address the resource problem. This contrast illustrates the disconnect between local rules enforced in VPCs and statutory regulations advocated by national MSPs.Finally, it is important to assess whether the MSPs align with the principles of integrated landscape approaches (Sayer et al., 2013), as this indicates their potential to reconcile diverging stakeholder objectives. Table 5 lists and summarises the principles and indicates the extent to which the MSPs studied align with them. The scores are based on whether a principle is reflected in the mandates given for each MSP and comes over explicitly (++ and +), mildly ( ± ) or is not mentioned at all (-). Overall, there is strong alignment between the MSP mandates and the ILA principles at all levels, particularly regarding common concern entry points, multiple stakeholders and scales, negotiated and transparent change logic, and participatory and userfriendly monitoring. Local MSPs feature more strongly in clarifying rights and responsibilities but comparatively less in strengthening stakeholder capacities.This paper unpacked various MSPs across different scales of governance and their potential to facilitate stakeholder participation for equitable and sustainable natural resource governance. It identified the synergies across MSPs and provided insights into why stakeholder engagement, representation, transparency, and legitimacy issues are important for MSP effectiveness and reconciling landscape interests in integrated landscape governance. It did so in the context of landscape governance, which focuses on managing the interconnected sociopolitical components of landscapes and balancing various stakeholders' interests and goals by designing effective engagement processes (Görg, 2007;Meinzen-Dick et al., 2022). Zambia's policies and legislation on resource governance support inclusive participation, from problem identification to developing and pursuing collective solutions (see supplementary material, Appendix D). This aligns with the contemporary discourse on participatory governance, defined as a \"subset of governance theory which puts emphasis on democratic engagement, in particular through deliberative practices\" (Fischer, 2012, p. 457). The rest of this discussion summarises the main insights acquired from the analysis.First, the analysis contributed insights into the design of MSPs and participatory processes in landscape governance, revealing various modes of participation (based on institutional affiliation, voluntary association, or open invitations, spheres of influence (e.g., policy, reconciling competing interests, conflict resolution), jurisdictions (national, district or local communities) and mandates. Beyond modes of participation, the effectiveness of MSPs is determined by how inclusive the participatory decision-making processes are regarding composition, agenda setting, moderation, and facilitation (see Brouwer et al., 2015). This study showed that all MSPs benefit from broad actor presence. However, such broad-based participation challenges MSP design in terms of representativeness (particularly of actors at the community level) and the capacity to deal with cultural impediments and power imbalances. This calls for neutral moderators to navigate these challenges, as we noted in district and local MSPs. Critics of MSP narratives draw attention to such institutional design challenges that gloss over these complexities, claiming a failure to recognise the roles and responsibilities of different stakeholders, power imbalances, and legitimacy issues (McKeon, 2017;Schleifer, 2019). However, this study shows that while MSPs differed in their structures, goals, and mandates, their functionality was somehow transparent in defining the rules of the game of participation processes. We contend that enhancing this transparency further may contribute to better MSP performance, leading to desired ILA outcomes (MacDonald et al., 2022;Ratner et al., 2022).Second, this study underscored the importance of institutional linkages, cross-scale interactions, and building networks to leverage impacts. There is an appreciable level of interaction among MSPs within the same scale of governance through member overlaps. However, our comparison of MSPs at different levels and analysis of how these cross-scale spaces interact with each other is not yet sufficiently developed for the MSPs to be called effective in facilitating more integrated landscape governance. Legally instituted MSPs at the district level provide a bridge between national policy development and local resource governance. Meanwhile, informal and formal local-level MSPs are strong in addressing resource conflicts and fostering community coordination and customary rules and regulations. The national MSPs remain largely sector-focused and show weak institutional linkages with local MSPs. Yet, national and district MSPs have common interests, such as policy lobbying, as do district and local level MSPs. In the context of ILA Principle 2 on 'common concerns' (see Table 5), similar interests can be reconciled and negotiated for better collective outcomes on what Foley et al., (2017, p. 123) refer to as \"pooling capabilities\"-a key feature of ILA implementation. In Kalomo District, MSP participants are often drawn from the same constituency of stakeholders. Traditional leaders, for example, are members of local MSPs and are invited to the Consultative Working Group (CWG) and District Development Coordinating Committees (DDCC). This institutional overlap holds the potential to represent a departure from the exclusionary participation prevalent in most MSPs towards a more integrated participatory process aimed at achieving a 'win-more lose-less' outcome (Mai and Sunderland, 2009;Sayer et al., 2013;Sunderland et al., 2013). The key assumption underlying integrating these MSPs across scales is that they create opportunities to mobilise multiple stakeholders, facilitate the sharing of knowledge and technology, and maximise resources.Third, we looked at the representativeness of MSPs. Stakeholder representation, as other studies have argued, is the most practical way to foster inclusivity and effective decision-making outcomes in MSPs (Larson and Barletti, 2020;Sirimorok and Rusdianto, 2020). However, if representatives are not well selected, the contradictory feature of representative governance approaches can lead to undesirable outcomes detached from local realities and people's aspirations because decisions are made by a few elected or appointed actors with cultural, economic, or political power. In this study, some local communities expressed concerns regarding their representatives (chiefs) having self-seeking agendas (while attending DDCC MSPs meetings), potentially undermining effective representations. District-and local-level MSPs still struggle with fostering inclusive dialogue (equitable participation of women and youths). However, the data used for this study does not permit drawing definite conclusions about how well the interests of the groups are represented in the studied MSPs, and more research is required to explore this subject. Yet, representation is important in ensuring the legitimacy of MSPs and other discursive spaces through what Dryzek and Niemeyer, designate as a discursive representation which entails \"acting for others in terms of the discourses to which they subscribe\" (Dryzeks and Niemeyer, 2006, p.481;Birnbaum et al., 2015).Fourth, and related to the previous point, is the democratic quality of deliberative processes (Belfer et al., 2019;Birnbaum et al., 2015). In this regard, participatory governance proponents anticipate that decision outcomes of inclusive dialogue will likely better reconcile the interests of most stakeholders, thus increasing the chances of their acceptability (Hendriks, 2009). In this regard, Parkinson (2003, p. 180) speaks about the \"reflective assent\" of stakeholders, which entails dialogue until one's predispositions align with common concerns. Such reconciling efforts must consider the preferences and interests of different stakeholders and governance values such as legitimacy, shared trust, and inter-actor communication. For the MSPs studied in this paper and others in similar contexts, it means that in-depth reflections are needed on how inclusive approaches (such as ILAs) can support legitimate and inclusive conversations leading to what others refer to as discursive legitimation (Steffek, 2009;Berg and Lidskog 2018).Fifth, the study revealed the importance of enabling legislation as a prerequisite for negotiating and reconciling stakeholder interests. In this respect, national and district MSPs focus on reconciling policy reforms, while local MSPs focus on resolving resource conflicts. Reflecting on the differences between local-level MSPs and those at the national and district levels, local-level institutions are more successful in conflict resolution and applying traditional rules to conserve landscape resources despite less knowledge about enabling formal policies. This suggests that local MSPs successfully resolve problems because they apply customary rules rather than engage with formal bureaucratic policies and regulations and have the freedom to do so. The implication for ILA implementation is that MSPs are context-specific, and factors that facilitate their effectiveness must be understood in their settings.Finally, participatory governance focuses on resolving tangible problems by bringing together the impacted parties to discuss trade-offs (Kearney et al., 2007). Since the World Bank's Comprehensive Development Framework of the 1990' s, regions in the global South embraced participatory governance approaches in resource management (Crook and Manor, 2000). This shift resonates with ILAs and is envisaged to improve local stewardship (Ribot, 2006). In the context of the Kalomo landscape, it is important to assess whether MSPs are essential to implementing ILAs, as stated in the literature (Reed et al., 2016(Reed et al., , 2020;;Kusters et al., 2018). The analysis showed that, overall, there is strong alignment between the MSP mandates and the ILA principles at all levels, confirming that MSPs are key entry points for implementing landscape approaches.Additional research is required to address three shortcomings in this study. First, we focused more on the functionality of MSPs at the district landscape level where COLANDS' ILA initiatives are targeted. Due to time limitations and the unavailability of other potential respondents in most national MSPs following COVID-19 restrictions, the sampling intensity of national MSPs was not exhaustive; thus, other perspectives might have been left out. Through triangulation, we tried to circumvent this weakness. Second, further research would be necessary to better understand how the perspectives of the marginalised groups are represented within MSPs. Third, we recommend further investigations into how intra-MSP dynamics, such as power dynamics, affect stakeholder engagement.Integrated landscape governance, encompassing landscape approaches, proposes using multistakeholder platforms as participatory mechanisms to facilitate equitable stakeholder participation in a multilevel landscape governance system. This study shows that while MSPs provide opportunities for policymakers, traditional authorities, civil society organisations and land and resource users to negotiate their interests, participation in the studied MSPs is complex. These institutions of governance vary in form, function, influence and efficacity depending on the jurisdictional level at which they operate. MSPs have clear mandates and well-defined stakeholders, of which some are common across MSPs, which is a starting point for considering landscape-level integration. However, the lack of deliberate mechanisms for crossscale collaborations impedes the effective reconciling of landscapelevel stakeholder interests, and this calls for a reflection on how MSPs could be designed to build synergies based on common goals and mandates, a feature that is lacking in most MSP designs, including those studied in the Kalomo District.The study shows that both legally instituted and informal MSPs align with ILA aims of enhancing processes aimed at negotiating conservation and development trade-offs. Specifically, local-level MSPs appeared to be instrumental in resolving conflicts using local rules, but their efficacy in translating national-level policies to sustain local needs and aspirations remains limited due to weak cross-level linkages with national and district MSPs. On the other hand, legally instituted MSPs at the district level provide a bridge between national policy development and local resource governance, while national MSPs benefit from broad actor presence and opportunities to lobby for policy and institutional change.Although cross-scale linkages have not yet been sufficiently developed for the MSPs to effectively facilitate more integrated landscape governance in the study area, we conclude that MSPs are essential for implementing integrated landscape approaches. Therefore, improving cross-level linkages between stakeholders and policymakers, strengthening stakeholder participation and dialogue, and creating deliberate feedback loops can help improve the implementation of integrated landscape approaches and collaboration and achieve equitable and effective landscape governance. We acknowledge that MSPs are not a panacea to resolving the conservation-development dichotomy due to some limitations, including the difficulty in ensuring equitable participation of all stakeholders across governance levels. The deliberative democratic processes underlying MSPs ought to allow representations of the voices of the majority, thus underpinning the importance of legitimacy and acceptability of the decisions in MSPs. But whether the voices of vulnerable groups, such as women and youths, are adequately heard remains subject to further research. This paper recommends that MSPs need improved institutional designs that guarantee equitable representation of all stakeholder groups from the local level in higher-level policy processes, including the voices of the marginalised. Improved communication and cross-level interactions with local MSPs can help achieve this. "}

main/part_2/0466183105.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"31fec4f02e5c74f82b9ad6f7a1ac1d4b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c51a4938-19a3-469b-9ce9-b1328049b6d8/retrieve","id":"1795952109"},"keywords":[],"sieverID":"523df548-c8b7-4dce-a76d-a21584d6c30d","content":"-Feed is the main constraint in livestock production and productivity -There are various options to improve feed availability -While the barriers to adoption might be complex, a lot can change if we eliminate barriers related to attitude, knowledge, and practice -Define the behavioral change required o A shift from extensive to intensive production system o A shift from low-quality to high-quality livestock feeding o Embracing forages as a key component of the livestock system o Having the knowledge and skills on forage production and utilization-BCC is an interactive process with communities to transfer tailored messages using a variety of communication channels to develop positive behavior -BCC is increasingly referred as social BCC and even dropping the "}

main/part_2/0469114318.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"0b817650063fe9531af88d9a51889c70","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H012019.pdf","id":"-28431713"},"keywords":[],"sieverID":"57466b8f-90d1-401d-bf2a-f05dfb26f2de","content":"I x u c A n o N MANAGEMENT FOR diversified cropping, or crop diversification of rice-based agriculture in general, is an important research and policy issue which has been anractirig a lot of attention in Sri Laiika as well as elsewhere in tropical Asia. The rapidly growing body of literature it1 the field best testifies to this increasing attention in recent years (IIMI 1987;Schuh aiid Barghouti 1987;World Bank 1988;Bhuiyan 1989;Miranda 1989;Valera 1989;IIMI 1990a). A basic factor, among others, behind such a rather abrupt proliferation of research in this field is the fact that the rice sector of many countries in this part of the world has come to a tuniiiig pnint; the introduction and diffusion of new rice seed-fertilizer technology coupled with the expansion of irrigated rice land in the last two decades or so has helped a number of countries in the regioii to either approach or attain self-sufficiency in rice, with a consequence of a long-term declining trend in the world rice price. The farmers i n rice-based irrigation system aeed to diversify their income sources, while the demand fnr agricultural products diversifies from the major staple to various non-staple items as the economy grows. A logical deduction is that diversification of rice-based agriculture iii general aiid crop diversification of rice-based irrigation systems in particular, and research thereof, are a necessity.It is well-recognizc.d that the nature of this issue of irrigation management for crop diversification in rice-based systems is so multifaceted that multidisciplinary approaches, embracing eogineering, agronomy, soil science, economics, tnanagemeut, and other social as well as natural sciences, are necessary in its research. h fact, research in this field, as any other farming-system research, has usually been carried out in this multidisciplinary mode.Generally speaking, however, this multifaceted nature of the issue, coupled with its very location specific nature, often leaves research in this field at loose ends, e.g., partiality in analyses with certain ad hoc assumptions in facets that are not in main focus, difficulty in 153 deriving general conclusioiislprinciples that could be applicable under different settings, research-based recommendations that are rarely followed by farmers in actual farmiug, aiid the like. In other words, the multifaceted nature inherently makes the issue/subje.ct of crop diversification elusive, which means that, whenever certain research in this field is undertaken, it is always important to keep in mind lhe entire StrUcNre of the issue in ils full spectrum while identifying clearly the specific problems to be addressed in the research.The purpose of this paper is to reexamine briefly, mainly based on recent literature in the field in general, and experiences in Sri Lanka in particular, the structure of crop diversification of rice-based irrigation systems as an object of research and policy in order to facilitate understanding of the coiifiguratioii and weak (often missing) links in this multifaceted researchlpolicy topic. The primary intention of doing such a \"thought exercise\" is to help refine research subjects to be studied under this research aehvork. It is further hoped that the exercise would be useful h proinoting successful crop diversification in tire irrigation systems in Asia where few countries, iiicludiiig the fast-developing east h i a n countries, have been fully successful so far in attaining it oii a sustainable basis.If crop diversification, or, more generally, agricultural diversification is defined as the process of broadening and maintaining the sources of iucomes of rural households, as defined in a World Bank report (World Bank 1988; Schuh and Barghouti 1987), it is not a new issue. The origin of the issue could be traced back at least lo the eighteenth-celiNry Agricultural Revolution in England, if not to the early civilizations in Mesopotamia and the Nile Delta.As an economy s t a m growing from a static, traditional agriculture-based society to a dynamic, industrial one, the traditional agriculture, which is characterized by producing a limited list of traditional staple food crops, is bound to be diversified, in order to meet the increasing demand for lion-traditional food commodities. This process begins with increases in the productivity of traditional agriculture due to technological advances. Accompanying this is a relative decline in the iinportaiice of the agricultural sector as a whole in the total economy, which process is called \"structural transformation.\" In this broadest framework or dimension, agricultural diversification and structural transformation are two sides of a coin; as an economy develops, rural households are forced to maintain and increase their incomes through diversifying their farming while transferring some of their resources, especially labor, to other income generating activities in the nonfarm sectors.At the dawn of the industrial revolution, British crop agriculNre experienced a major transformation in which the old cropping pattern was replaced by the Norfolk crop rotation with such new strategic fodder crops as clover and turnip. In nineteenth-century Denmark, Danish agriculture successfully transformed itself through diversification from the old grain-based pattern to the one based on a new aop-livestock combination. I s the early twentieth century, Japanese rice fanners succeeded in introducing sericulture production into the rice production cycle with a result of significantly diversifying their income sources.All these early examples of agricultural diversification occurred in response to changes in productand factormarketswithin a broader framework of structural transformation (Hayami 1989).Of course, we do not always have lo go so far in dealing with the contemporary issue of crop diversification in Asia, which emerged in sharp profile in the 1980s because of the historic low level of world rice (and wheat, to a lesser extent) pric.es in the early 1980s, which in turn was partly a result of the successes in \"Green Revolution\" technology in Asian developing countries. In pursuing crop diversification, governments in these countries (which have promoted self-sufficiency programs in staple foods). donor agencies (such as the World Bank and ADB, which have invested in crop specific agricultural projects), and practitioners of iiiternational agricultural research institutes (who have been niostly crop specific), arc concerned inainly about low levels ofworld prices and the surplus sitnatioii iii production of staple food crops, resulting in low incomes for the fanners producing these crops,aiid low ratesofreturnson the investinent5 that have beeninade thus far inagriculture.particularly in irrigation ilifrastructure.In such a context, agricultural crop diversification tends to be considered as a problem within the agricultural sector, or even within the snialler sector of \"irrigated agriculture.\" In the case of this research network on crop diversification, the focus is naturally confined to the '\"irrigated agriculture\" sector. The issue can be dealtwith at each level, from the fanners' field level to the macro-economic level. However, it should always be recognized that, since crop diversification in Asia is inevitably a part of the structural transforination process of the economies, policies for diversification at each level must be consistent with each other and with the broadest fraiiiework of structural transforination.The process of structural traiisfonnation is nothing but the process of economic developintiit that requires efficient resource allocation. One immediate implication of this understanding is, therefore. that policies for agricultural diversification at the macro-economic level aud at any lower level should be such that efficient resource allocations among the sectors of the. econoniy as well as within the agricultural sector and betwcen its subsectors are facilitated.011 tlie other hand, the process of structural transforniation is nothing but the process of adjustinent in which the agricultural sector adjusts itself to new economic conditions that arc created by eronoinir development. This adjustment is not cost free, but rather entails paiiiSul costs to the agriculture sector. Most distinct amoag thein would be increases in income inequity in the society, which is an inevitable consequence of the development, the intrinsic nature of which is unbalanced growth among the sectors. There has been a growing conccrii ainoiiggoveriiiiiciits and dotior agencies about this problem, and, as a coilsequence, existiiig policies for agricultural divenificatioii at any level vcry often aim at allcviating poverty or improviiig the inconic distribution in rural areas.Difficulties arise if the relationship between these two basic problems, efficiency and equity, is not one-to-one, and unfortunately this is often indeed the case. At l a s t in the short run, the potential solutions to these problem do not necessarily correspond. The best example to illustrate this difficulty can he found in pricing policy, which is always central to any policy framework for agricultural diversification at any level. Price support for a certain crop is obviously the easiest and most effective way to maintain or improve the income level of the farmers who grow the crop, and therefore it is always a strong tcinptation for policyinakers to resort to this measure. It is also obvious, however, that, by keeping the price ofa crop higher than the equilibrium level it1 the market, the resources that otherwise leave for other sectors remaia in thr crop sector, thus impinging against the efficient resource allocation and thereby structural transforination. Although huge budgetary costs that are to he home by the governments if price support is extended beyond a staple crop lo othrr subsidiary crops virtually negate this optioii ia diversification policy, econoinists arr. usually not in Savor of price support maialy on account of efficiency consideration in the loiig run (Tinnner 1986).Conventional wisdoiii among economists as to this trade-off betwccii cificiency and equity is that economic developlnent based ou efficient resource allocatioii in the long run solves the illcome distribution problem; this is the U-Curvr Hypothesis found by Kuznrts (Kuznets 1955) and further evidenced einpirically by others (e.g., Ahluwalia 1976). Taking this wisdom as granted, a practical solution to this trade-off is to introduce explicit timr dimensions into the argument; when changes are so abrupt and adjustnient costs are so high that the welfare of the losiilg party is intolerably endangered, adopt suinc kind or pricrstabilizing incasurcs iii the short run, while not losing the sight for efficiency in the long run.This argument directly implies that thr issue of agricultural diversification involves difkreiit time dimensions; divcrsificatioii policies intended to mitigate adjustment difficultirs in tlic short run InUSt lint override the efficiency perspective in struc.tural adjustinelits in thr long run.The recognition that the problem of rural poverty could he solved oidy through the development of the entire economy reminds us of thr role of the agriculture srctor in economic dcvelopnient. As explained ill development ecoiioniics textbooks, an importaut role of agriculture a t ancarly stage ofeconoinic development is tosupply resources, financial as well as human, to the rest of the economy. I n developing countries in Asia, rxcrpt iii traditional rice exporting countries, this role has been inaiiily playrd by the plantation scctnr (Thorbecke and Svejiiar 1987, for the Sri Lailkail case), and the irrigation sector has heen absorbing from lhe other sectors resources mainly ill the form of irrigation iiivrstIncIits. This direction has been right; it was imperative for the development of a country to estahlish a prnductive domestic food production sector. Many countries whicli neglected their fnod sector iii the past paid a high price in ternis of lost drvelopment. However, now that the irrigated land base has beeii well-established in niany of thrsc countries with near or full ricr. sr.lf-suflicieiicy. the role of the irrigation srctor should hr changed from a resource takrr to a rrsourcc contributor to the rest of the economy. Thr shift from the traditional \"construction\" phase to the \"management\" phase, which has been going on in the irrigation sector in Asia (Aluwihare and Kikuchi 1990), releases a bulk of resources from the sector. Crop diversification iii the sector with import-substituting andlor export promoting noiuice crops will further strengthen this role of the irrigation sector to the econoinic developrnent of the economy as a whole.Crop diversification in the irrigation sector thus considered, therefore, precludes any policy which envisages a continuous net inflow of resources to the irrigatioii sector on a secular basis. The introduction of price support incasures at a significant scale for nonrice crops is one such policy which naturally ends up absorbing, not supplying, resources from the rest of the economy in an unproductive inaiiuer. It should always he clear that, when cmisidered in the broader context, crop dive.rsification is inore a means or process to attain econoinic development, rather than a n objective by itself.A inore crucial implication of the whole arguiiieiitabove is ~atagriculturallrropdiversifi~atioii is a precess of dynamic adjustinrnt rather than a static target of establishing certain cropping patterns. Tlie elusiveness as a policy issue largely stenis from this characteristic of crop diversification. How it makes diwrsificatioii policy difficult to deal with is appare.nt if coinparrd to the pnlicy for rice sell-sufficiency which offers a very clear-cut stationary target. In diversification policy, there caiinot be such a target, or, if any, it is at best a \"moving\" target. Since racb couutry has heterogeueous agricultural regions, it is not possible, iinr feasible, to set up a certaiii cropping patterii for the muiitry as a whole. Certaiii cropping pattrrns may be established specific to a certaiii region or area o f a country, but they keep clianging according to changes in the outside world. In certain agricultural regionalareas, the best opportunity for divrrsificatioti inay exist i s switching a part of the rural labor force froin the nonfarni sectors while an increase in the size of operation is being required iii the farm scctnr.Given such a distiiict nature of the issue, the only definite policy target that caii he cstahlishrd. cutting across the full range of the issuc, would he to build flexibility into agriculture in geiicml, and the traditional staple crop production system ill particular, by which the iievrr-ending adjustnient proccss is niadc smoother. This should he the strategic target for wliatever policy related 11) agrirulturallcrop diversification: price and income policy, iiivrstmriit policy, land and labor policy, market and credit policy, research and extensioii policy. and so on. A good exaniple of-the need to build in the flexibility is found ill the irrigation systems iii Asia which are constructed and operated solely forgrowiiig rice. An attempt to make such rigid system amenable to diversified crop production, which is thc major re.se.arch t h e m of this research network, is nothing hut an effort to bring about llexibility iii irrigated agriculture.Finally, in this section, a short reinark should be made on geometric dimensions of the issue; horizontal and vertical diversification. Agriculturalicrop diversificatioii intended in the preseut Asian context is primarily horizontal diversification; diversification through the introduction of nonrice crops in replacement of, or in addition to, rice.It should be noted that at the natioual level, horizontal diversification can he attained through regional '\"specialization.\" Because of possible regioual comparative advaleages resulting from soil-climatic couditions and otber location-specific factors, and of the economies of srale, this could he a n efficient route to national level diversification. 111 fact, this method has been the major oue adopted by developed countries, such as the U.S.A. and Japan, in their diversification processes. Among the developing countries in Asia, Thailand is the country that is most often nientioned as successful in diversifying agriculture.Although crop diversification in the rice-based farming system has been iu progress in some regions of Thailaud (Plusquellec and Wickhain 198.5), the major stream of agricultural diversification has been through \"specialization\" away from rice (World Bank 1988). There. is a serious implication for attempts to diversify crops in rice-based farniing systems while keeping rice as a major crop; such attempts are handicapped ia terms of exploitiiigefficieiicy to the exteut that comparative advantage and scale economies ofsuch a system diverge from those in \"specialized\" systems.Vertical diversification refers to a process iii which value-added of certain crops is iucreased through processing the mops iuto otber commodities, e.g., rice to rice cake, soybeaii to soybean curd, niaugo to mango juice, etc. Since the potential of diversil-icatioii in this direction i n iucreasing the income-earning opportunities of rural population is no doubt large, any policy towards agricultural diversification should take this potential into account. Here too, howevcr, the ecouon)y of scale through specialii.ation would work critically in many fronts; marketing, processing plants, quality control of raw niatcrials, etc.We, have to recoguize that diversificatioii in rice-based farming system may have disadvantages in this respect too.The issue of crop diversific.atioii is multifaceted, and so, any general discussion on this issue iucludes some kind of cnumeratioii of the farcts involved. For instance, the World Bank report referred to ill the previous section, categorizes the facets into agronomic, technical, and economic factors (World Bauk 1988), while Moya and Miranda (1989), dealiiig specifically with crop diversificatioii iii rice-based irrigatioii systems, orgaiiix their discussions into technical, ecouomic, and social and iiistitutional issues.A similar aneinpt to show research facets involved in the issue of crop divrrsificatioir in rice-based irrigation systems. and liriks brhveeii the,m, is presented i n  Engineering facers. The engineering issues can be classified into a few compoiienls of different dimensioiis: structural c.apacity of irrigation schemes at different levels from the iiiaiii system down to the fanners' field, aiid water rnanageinent at respective levels.Since nonrice crops generally require water in ways that are different from rice, the structural capacity of irrigation systems which were designed and constructed solely for growing rice may iiot he adequate for irrigatiiig iioiirice crops. Continuous delivery ofwater at low tlow rates in the iiiaiii part of the systems is typical for rice irrigation, whereas inaiiy noiuice crops require intermittent water supply with high flow rates. The capacity of a conveyance system for rice may iiotbe adequate. The intennitteitt water supply may require inore controlled water release, which may, in Nm, necessitate better measureinelit devices at various levels of the systems. Some argue that substantial costs will be entailed iii converting rice-based system into multiple-cropping systems (World Bank 1986, 1988 Bhuiyaii 1989). The issue of how to make rice-based irrigation system flexible to accorniitodate nonrice crops in relation lo their physical capacity coines under the heading of \"physical infrastructure\" i n Figure 1.Recent research carried out by llM1 and others suggests that rice-based irrigation systeiiis indeed have the flexibility to make it reasonably possible to grow nourice crops in the dry scasoii (Miranda 1989;Bbuiyaii 1989). If this is taken forgranted, then conies the questioii of how to inailage the systems towards tionrice crop cultivatioii which generally rcquires furrow irrigatioii as opposed to hasiii irrigatioii for rice cultivation. The inauagemeat issues associated with the shift from rice to nmuice crops may be dealt with according to different levels in the systems, froin the inaiii system down to the farmers' fields.At tlic main system level, water availability iii a system for a certain seasoii is deteriniiied by the physical structure of the system, and hy rainfall and other associated factors; givcii the water availability, water release and distrihutioit plans at the nniii, secondary, and tertiary levels are made, and, at the on-farm level, proper methods of irrigation and drainage for nonrirr crops are deterininrd. The issues at each level, needless to say, are closely related 10 each other. For iiistance. the availability of water and the type of rotation needed for intennittent irrigatioii depend on the type of crop to be grown.Considered along this line, oil-farin water inanagemelit seems to be an issue which has been relatively better researched as coinpared to inaiii system inaiiageinent for diversified cropping. It is ofteii said, for instance, that diversified cropping could save the water in the systrin which can be utilized to expand the planted area in the same season or in the following scasoiis. If this wcrc the case, crop diversification would be instruinental in eihancing the efficient use of scarce water (Moya aiid Miraiida 1989). Little evidence, however, has been accuinulated to denionstrate this iinpact.Agronomic fiicets. Issues such as crop water requirements and soil-water-plant relatioiis come under this facet. Rice is the plant that is best grown with wet puddled soil andlor with ponded water, while nonrice crops fit lighter soil textures, and can withstand neither waterlogging nor prolonged water stress. Cultivation of nonrice crops on lowland soils has inherent disadvantages relative to lowland rice. On the research side, agronomy of lowland rice cultivation has been one of the best-researched fields, and that of nonrice crops under upland conditions also has a long research history. Reflecting the disadvantages, agronomy of upland crops to be grown in lowland paddies has been a relatively neglected field of research, though efforts have been made in recent years in this field (FA0 1984(FA0 ,1986)).Institutional facets. Noiuice crops, if grown in rice-based irrigation systems, generally require more deliberate delivery, distribution, and management of water than rice does. Diversified cropping is more demanding in terms ofsystem operation and management. The management practices adopted in rice cultivation, typically top-down planning and i nplementation, are in most cases not congruent with diversified cropping (Stone 1987). The deep-rooted rice monoculture pattern in these systems has brought about among the managers of the systems a n ingrained mentality of low-intcnsity, safety-first type of management (Moya and Miranda 1989). All issues related to inakiug irrigation syslern management flexible and accountable to farmers' needs fall under this facet.Examples of the issues iii this facet, among others, are: the role of farmers' organizations and their participation in system management; fanner-agency interaction and interface; information channels and control; agcncy motivation; and so on. It should he noted that many issues in this facet are not specific tocrop diversification. Most of them are issues that are applicable to the systems where rice is the sole crop lo be grown. Diversified crops only make the issues more acute than otherwise.Economicfncets. The issues in this facet revolve around the profitability of nonrice crops which are supposed to replace, or be added to, rice in rice-based systems. When reviewins the literature on crop diversification in general, not necessarily limited to that of rice-based systems and even excluding that written by economists, it is rather difficult to find a paper which has no mention of market and marketing problems, profitability of nonrice crops relative to rice, lhe needs of credit provisions, and other related economic issues.These economic issues can be arranged according to the flow of the issues as showii in Figure 1. First, the markets, both for outputs and inputs, determine tlic prices. Second, these prices together with production technology available lo the farmers determine the profitability of crops. And, third, the farmers choose crops to be grown depending OII the profitability.Some qualifications are necessary along this line. First, the issue of '\"marketing\" is an important part of '\"market issues.\" The market is tbe mechanism through which price signals are transmitted. There are cases where the market is either not working well or even nonexistent. For instance, it is an often heard problem in the crop diversificatios business that crops grown by farmers cannot find buyers, or that some inputs for nonrice crops, such as seeds and fertilizers, are nnt available to farmers in time. These are typical marketing problems in which high \"traiisactioiici~sts\" due to imperfect markets are involved; the '\"real'' prices to the farmers are lower for outputs and higher forthe. inputs than the \"nominal\" prices by the transaction costs.The second qualification is that the tenn \"profitability\" here is a loosely defined one; it does not uecessarily imply that the farmer is a \"profit\" maximizer. He may be so, or he may he an \"income\" maximizer. What he iiiaxiinizes may depend oii the basis on which he operates his fami. This leads to the third qualification that farmers' decision on crop choice may be restricted not only by economic consideration of their own but also by other factors such as their status in the farniing community. The fourth qualification, also related to this, is on distributive impacts of diversified cropping, which are determined by crops to be grown, prices in output and input markets, production technology, and the ownership of the inputs used in the production process. Crop selections made by individual farmers imply certaio income distribution consequences to the farming community. Their selections could diverge froin the oues which give the highest income increase to, and the best income distribution in, the community.Apparent and obvious links exist among the facets. It could be said that crop diversification ill rirc-based irrigation syste.ms is a research issue which should be studied in its entirety to observe how these facets are closely re1ate.d lo each other, rather than study each facet independently.For examplc, the issues of \"owfarin water management,\" classified as a part of tlic \"engineering\" facet in Figure 1, largely overlap those. of the \"agronomic\" facet. Without kilowledge 011 soil-water-plant relations for a certain noilrice crop or a sequence of crops, inigatioii and drainage ine.thods to he adopted 011 farmers' fields cannot be detennined. Similarly, given specific characteristics of a n irrigation syskin, such as soil, water availability, and possible water dclivrry plan, the best cultivatioii inethods for nonricc crops must he sought. Water maoagement at the farin level aiid agronoinic pote.iitials together dctermiiie the level of \"crop production technology,\" or production functions iii economic terms, available t o the farmers. Water availahility at the fariii level may al.fect even more directly \"farmers' crop choice,\" as pointed out by soiiic. observers (Miranda 1989, Bhuiyaii 1989).The issues in the \"institutioual\" facet are also associated iiitiiiiately with other facets. Plaiiiiiiig and iinpleiiieiitatioiI of water delivery and distribution in a system for diversified crops are issues more of iiiaiiageineiit (therefore institutional) tlian ofeagineering. in which agency 's iiiotivatioii arid accouiitability 10 fanncn' needs, fanner-agency interaction, aiid inlbrmation control are all iiiore deiiianding than iii the rice monoculture system. Needs exist no1 o i l l y 011 the side of the inanaging agency but also oil the side of farmers to be better organized for ensuring more prccise water management at tertiary as well as on-farm levels. More often thaii not, diversified cropping iii an irrigation system rcquires collective actions ofcerlaiii degrees among the farmers iii the system, evcn for the choice of crops to be grown.1150, h e choice of crnps becomes ail iiistitutional issue rather than a narrow economic issur J f all ilidividual fanner's decisioii making.111 addition to the facets explained thus far, two inore facets are. shown in Figure 1; cxtctisioii service and socioecnnoiiiic factors. The importance ofthe foruier is obvious. The Lariiiers i n rice-based irrigatioii systeins are used to growing rice, atid iioiuice crops to he growi~ inay be exotic fur thein. 111 such cases, productioii trrhiiology for nonrice crops, without effective extension services, remains as potential, not available to the farmers. I1 may play a critical role, if the choice of crops is to be made collectively.In Figure 1, socioeconomic factors are distinguished from \"economic\" factors in order to make the flow of issues in the latter clearer. If the related markets and production technology are given, and if fanners are profit maximizers, the issue of economic profitability and crop choice is fairly straightforward, even though risk and uncertainty inherent in noiuice crop cultivation, as compared to rice, complicate the issue. However, farinen operate in a certain cultural domain wherein class struclure and other social traits restrict the process of agricultural production and the distribution of generated and are endowedwith cultural and institutional traits, the factors here give more decisive impacts and effects to the \"economic\" factors. The socioeconomic factors as such are also closely related to the '\"institutional\" issues. Without due understanding of the basic cultural characteristics of the community, it is rather difficult to think of sustainable solutions to the institutional issues.Central to the interlocking issue of crop diversification in rice-based systems in Figure 1 is \"crops to be grown,\" which replace rice. Unless a list of substitute c r o p is specified, neither agronomic nor engine.ering research on-farm water inaiiagemeiit can hr designed. Ever1 if some crops are recommended by authorities, farmers may iiot adopt them for economic or other reasons. Without viable nonrice crops, the whole business of crop divrrsificatioii docs not go ahead at all, which would be the worst nightinare crop diversificatioii advocates can c.ver have. All this means that a series of issues in the \"ecnnomir\" facet of Figure 1 are vital to the whole issue.First of all, it should be pointcd out that the issue network in Figure 1 is open-ended toward the northeast corner of the figure. That is, the output markets in general lie out of the control of the system ~nanage~neiit and of the fanners in the systems, and in most cases, even of the goveminent policymakers. All changes, which occur in the markets outside the systems, de.pending on changes in demand and supply, domestic as well as international, are brought into the system and affect directly the profitability of crops, and hence the list of crops to be grown. The input markets have similar characteristics, but to a much lesser extent. Fnr instance, a clrange in fertilizer price affects the agricultural income, through the productiori process, of certain crops growii. However, the. cost of fertilizer is oiily a part of the total production cost, and the price. change affects, more or less alike, all crops that need the fertilizer.This open-ended nature makes the issue ofcropdiversificationelusive and keeps its target moving. There exists some uncertainty in other facets of the issue too. For instance, water availability in a system depends on rainfall which is beyond the control of managing agency and farmers. However, this problem of stochastic nature can, or should, be dealt with at the system level, and does not the completeness end. With less available water, for instance, crops which require less water can be selected, provided that such crops are economically viable, which depends eventually on the output markets.The fact that crop selection at the system level is subject the system means that diversification in rice-based systems as a research and policy issue comprises at least two different levels: the national and the system levels. Since any attempt at the system level to establish the list of crops is constrained by the conditions a t the national level, and not vice versa, it is critical to have a clear understanding on the markets and a clear policy at the national level as to crop diversification. Although policies at the national level affect not only rice-based irrigation systems but also other subsectors of agriculture, such as rain-fed agriculture, firm policies at the system level cannot be spelled out without them. In most of the countries where effons have be.eii made to diversify crops in rice-based systen~s, the most serious gap seems to exist in this macro-level policy/understanding, in general, and interactioii bctween the macro-national level and the micro-system level. in particular.Thc literature in the field, available at hand, gives a mixed picture about the nonrice. crops tbal perform better than rice in terms olcconoinic returns and which can, thereby, replace it in rice-based systems. Some of the literature show that there are nonrice crops which are niore profitable than rice (e.g., Adriaiio and Cabezon 1987, for the Philippines, Miranda 1989, for Indonesia, the Philippines and Sri Laoka). Some others fail to identify such crops (c.g., World Bank 1986 for Thailasd). Our study in Sri Lanka reveals that possible nonrice crops for rice-based systems can be grouped into two broad categories: low-value crops which generate value-added at best as high as, or generally lower than ric.e, and high-value crops ofwhich value-addcd is far better than rice (IIMI 199Ob). Most traditional food crops sucli as corn aiid various legumes fall in the Sirst category. The second group consisb of traditiooal high-value crops, such as chili aiid onion, and exotic exportable crops, such as gherkin and asparagus. Il~nonrice crops were to be substituted for instead of adding to, rice 111 crop diversilication, only those in the second group could be candidate crops F a b l e 1). It shouldhenoted tliatthesc high-valuecropsarecharacterized by very highlaborand capital intrnsity as coinpared to rice production.It should be noted further that thesr results are obtained using micro-level data. It is suggested therefore that, given the present price structurc and technology, there are some noiuirc crops that can be substituted for rice, though the list of such crops is rather short. What is 1101 known is the list of nonrict. crops in the mediumto long-run where both price a i d tcclmology are variable.Chili, iii Sri Lanka, would be a good case to illustrate the nature of the problem, particularly of traditional higli-value crops which are produced mainly for domestic consumption. This is thc crop which has traditionally been planted, mostly in the Northern Province of the country, but, because of its high substitutability for rice, it has become an important noiirirc crop iii recent years in rice-based irrigation systems in Sri Lanka, particularly in the North-Central Province.. The statistics iii Table 2 are from the Agricultural Resrarrli and Trainiiig Institute (ARTI) of Sri Laiika (1989). The domestic production of chili bas been increasing quite rapidly due mainly to the increase in its cultivation in rice-based systems. As a result, it is estimated that the domestic production exceeds the domestic however emerges, if we look a i the which shows that the imports have also been increasing, makmg the total supply-demand ratio around or more than 1.5. Had these statistics been reliable, and should the demand elasticity of chili been rather low as slated in ARTl (1989), the domestic price of chili would have declined drastically. However, such a drastic decline in the price due to this oversupply has, fortunately to the farmers, not been reported yet, though !he real price to the farmers has declined slightly from the end of 1987 lo 1989.The puzzle is why the oversupply bas not resulted in a sharp price fall. There are three possible explanations: first, the data on production are not reliable; second, the data on consumption are not reliable or the domestic demand for chili is more elastic than expected; and third, a part of domestic production was exported (this means that the demand curve is highly elastic). Unless the right answer to this question is given through further research, it is too dangerous to promote chili cultivation beyond the present level. If the first explanation is right and if the demand curve for chili is indeed inelastic, the result of overproduction could be disastrous to the fanners.Whatthis \"chiliproblem\"suggests istheneed to havegood knowledgeonoulputmarkets, international as well as domestic. Without it, no firm national policy for crop diversification can be established. In this sense, it was a quite legitimate approach that was taken for crop diversification research in the Philippines, in which IIMI-ADB irrigation management research was preceded by 1FPR'-ADB food crop sector research (Rosegrant et al. 1987).The type. of analysis made in this study using the domestic resouice cost approach (e.g., comparative advantage, import substitution, and export promotion), are quite useful and essential for realizing the configuration of nourice crops to be adopted for crop diversification, although this approach itself is static in nature so that it has certain limitations. Going into crop diversification without this kind of information is just like sailing in an ocean without a compass. Not only in Sri Lanka but also in other countries, this kind of research should be done periodically.It may he interesting to note that this Philippine study by IFPRI shows that rice still has a comparative advantage and is one of the most efficient crops to be grown in irrigation systems (Rosegrant el al. 1987: Gonzales 1989). This could he the case for other countries loo, implying that, if crop diversification is to be promoted, more research to improve the productivity of candidate nonrice crops relative to rice would be a prerequisite. A basic contention of promoting crop diversification in rice-based systems is that many developing countries in Asia have attained or are approaching self-sufficiency in rice. This study and some others (Bhuiyan 1989) suggest a need to reexamine this contenlion periodically in the light of rapid changes in demand due to population increase and general economic development, and in agricultural technology. The national policy on crop diversification in ricebased systems canna1 be independelit of the national policy on rice.Marketing is the most often mentioned weak or missing link in crop diversification. This pertains to the issue of the '\"market\" as explained earlier. The existence of a \"marketing\" problem insufficient in the market. More however, due to the underdevelopment of market channels through which price signals are transmitted from the markets to the fields and through which crop products are marketed the other way around. The agricultnral/rural marketing systems in developing countries are complex, comprising numerous actors, such as middlemen, local traders, transportagents, processors, export agents, and governmental or semi-governmental marketing agencies. In spite fact that an efficient marketing system is critical not only for diversification but also for agricultural development general, linle attention, beyond the mere mentioning of its importance (Schuh and Barghouti 1987, World Bank 198s), has been paid to this sector.This negligence of rural marketing systems can be explained partly by the traditional, stereotype image of middlemen and merchants: the ones who exploit peasants through the practice of monopolistic pricing and usury. The fact that most of rural marketing systems in developing countries belong to the informal sector has also made it difficult lo study this sector. However, recent studies have been accumulating evidence that indicate that iiidigenous rural marketing systems are quite competitive and thereby efficient in transmitting price incentives (Siamwalla 1978, Unnevehr 1984, Hayami et al. 1987). It should be remarked that these studies were done in the areas where crop diversification has been mostprogressive, such as Thailand and Java, Indonesia. This evidence, coupled with the evidence that governmental organizations are typically less efficient in the field of marketing, imply that the role of the government with respect to rural marketing lies not in direct iiitervention in the markets through controls on prices and profits but in providing conditions under which the markets are well-developed and functioning.It seeins that Sri Lanka is a country where the traditional negative image of middlemen and traders has rather been prevalent and government intervention into the rural markets has been pervasive. If so, the first policy step necessary for a long-term success in crop diversification would be to foster efficient rural marketing systems, no inaner how long it takes. Without it, any effort at crop diversification is bound to face failure in the long run. Crop diversification is synonymous with building flexibility into traditional agriculture, and it hinges on the flexible, efficient marketing sector. The so-called \"dependency syndrome.\" in agriculture and other sectors of the economy is the antonym of flexibility as such.Credit is another problem quite often mentioned in the crop diversification business. Although credit is not an input in an ordinary sense, this is a part of the market problem. It is said that while market-oriented iionrice crops require high cash inputs, credit is not available to farmers, or if available, it is at too high rates of interest. Provided that there is a well-functioning marketing sector. nonavailability of credit could be an obvious sign that the crops are not economically viableandiortoo risky togrow. High interest rates in informal lending are nothing but a sign that opporlmiity costs of money, loan-default risk, and costs involved in financial transactions are all high. Negative image of, or prejudice against, informal money lenders has and this has given way to cheap credit sector adopted in almost all developing countries. Confusion among policymakers on the role and functioii of rural financial markets has been widespread. Just as in the case of middlemen and traders, however, the empirical evidences from recent studies indicate that the informal financial market in rural areas in developing countries are much more efficient than ever thought, importantly, that the cheap credit policies adopted in these countries have contributed negatively to rural development, in spite of all good intentions envisaged in these policies (Howell 1980(Howell , A d a m et al. 1984)).This does not necessarily mean that a government must not intervene in the financial markets. Under the condition of underdeveloped financial markers, a government would do so in such a way to help the markets develop. The introduction of a formal credit system may be one of them, but it should be implemented so as to be effective in mobilizing rural financial markets. The traditional cheap credit policy has little economic ground to be justified even as a means of infant industry protection. If there exist good economic OpporNnities for noiuice crops, credit would become available to farmers in one way or another. As a matter of fact, it is a widespread practice in rural Asia that middlemen and traders advance credit to farmers to purchase cash inputs in exchange for the exclusive right to purchase crops to be marketed from the farmers (Siamwalla 1978;Hayami el al. 1987;Pingali et al. 1989). This kind of credit is usually interest-free. It should also be noted that, contrary to the popular view, this kind of credit arraugeinents emcrge when the market is fairly competitive; it is neither exploitative nor of the feudal bondage type. A typical case is reported by Pingali et a]. (1989) for an irrigation system in Central Luzon, the Philippines, in that middlemen and traders advance interest-free loans to the rice farmers who grow onion in the dry season. If crops are \"economically viable,\" then, credit follows.It may seem that the situation in Sri Lanka i n this respec.t too is not so encouraging. However, there are signs indicating that the rural financial market is working. For example, IIMI (1990b) reports that fairly large amounts of infonnal loans are available to fanners in an irrigation system in the southern part of the country. Bouman (1984) reports that informal financial arrangements i n Sri Lanka provide very valuable services to many rural people. Although much research needs to be done in this field, it is certain that there is a potential. What is important for policymakers is not to demolish such a potential but to set up policies that will help develop efficient and flexible rural financial markets.As pointed out by Schuh andBarghouti (1987) andWorld Bank (1988), an important and dfcclive policy towards this end would be credit programs for middlemen and traders. Since the primary bottleneck for crop divrrsification could be in marketing the output, not in getting fanners to grow the crop when profitable, such programs could be instrumental in building flexibility in the marketing system in general and for speeding up the crop diversification process in particular. In this sense, the two-step loail now envisioned in Sri Lanka, if implemented properly, could be a n effective ineaiu to mobilize rural markets.The need to make rural markets flexible applies to the input markets as well. As complaints in Sri Lanka are often heard that seeds, fertilizers, and agrochemicals are not in markets is presumably relatively be rigidity through the development of efficient markets for these inputs. What is not sowell-recognized are the workings of other input markets such as labor, land, and draft power.Farmers in developing countries in Asia, unlike the typical peasant described by Chayanov, are integrated with the market economy not only in the output side but also in the input side. They purchase inputs in the market. Labor and land are not the exception. Particularly in well-irrigated of landless laborers, whose income depends on hired labor in rice farming, is substantial. It is not uncommon in many Asian countries to find rice villages where the population of the landless laborers is much more than that of \"farmers\" who cultivate land as owners or as tenants of some sort. A significant portion of the income generated in rice farming is eanied by these landless laborers. Sri Lanka is not an exception in this respect. The percentage of rice income earned by hired laborers is as high as 20-30 percent of the total rice income generated in many irrigation systems. In some areas, more than 90 percent of the total labor requirements in rice production is met by hued laborers.Crop diversification under such conditions would have profound implications in the local labor markets. One implication is its impact on income distribution among rural people. It is often said that crop diversification is necessary in order to increase \"fanners' income.\" In many rice growing areas, this should always be restated as including landless laborers' income. Should the income of rural households be of concern, more emphasis should be put on landless laborers who are the poorest of the poor in rural communities. This point of view seems to be usually lacking in policy consideration for crop diversification.Anolher implication is changes in labor requirements due to crop diversification. In Asia, rice is a labor-intensive crop. Some nonrice crops are, however. more labor-intensive than rice. Although the labor is generally a relatively abundant resource in these countries, there could be a case in which seasonal boalenecks in labor supply emerge with new cropping patterns. The solution to this depends critically on how flexibly and efficiently the labor market works.As to the income distribution implication, the land market is even more important than labor, becauseland is the resource that ismostscarce in Asiancountries,and because tenancy arrangements are pervasive in many rice growing regions there. It is also imprtant in tenns of efficient resource allocation. Even if legal restrictions to tenancy arrangements exist, tenancy transactions are popularly practiced by fanners. There is a tendency for the incidence of tenancy in rice growing regions to be more in the dry season than in the wet season, and that diversified cropping in these regions increases it even further (Kasryno el al. 1982; Pingali el al. 1989). For example, Pingali el al. (19891, studying an irrigation system in the Philippines where crop diversification is in progress in the dry season, reports that farmers adopt seasonal tenancy arrangements tocope with labor constraints and inherent risks in the nonrice crops grown. This suggests that the flexible land market helps crop diversification, and that rigidity in it. if any, should be minimized. It is counterproductive to treat the land market as if no tenancy problem exists. In order to maximize the efficient use of the land resource, crop diversification should be promoted on the basis of a flexible land market.Mechanization nowadays popular to see tractors and threshing machines in this region. A distinct characteristic of this kind of input. as compared to inputs like fertilizer, is its indivisibility which could bring a scale economy into peasant production. Once this comes in, farm size becomes an important issue not only io terms of income distribution but in terms of efficiency. However, it is fairly comnioii throughout the rice growing areas in the Asian tropics to see well-developed custom service markets for these agricultural (Siregar and Kikuchi 1988). if there is a bonleneck in these services, as in Sri Lanka where such bottlenecks reportedly exist in many irrigation systems, in relation to the time allowable for land preparation, the reasons why the markets are not working properly should be looked into.I n essence, how these input markets work is crucial to a successful promotion of crop diversification. It determines not only the supply of inputs necessary for diversified cropping, but also how the income generated is distributed among the agents involved in the production process. The flexibility of these markets is an integral part of the flexibility that is needed for crop diversification. Understanding of the role lo be played by the markets is grossly iiwfficient both in research and iii policy arenas related to crop diversification.Mention should be made of the link between the markets and the nonmarket elements inherent in the management of irrigation systems. Irrigation water could be \"marketed\" under certain technological conditions, which the irrigation system in Asia generally lack. This elitails the free supply and utilization ofwater in an irrigation system in this part of the world which makes the market mechanism inoperative and which necessitates collective action among the agents involved in the system. For instance, such matters as the ensuring of adequate water distribution, regulation of timing of water supply, and prevention of excess water use can only be dealt with by coordination among the agents through collective action, not through the market in a narrowly defined sense (Pingali 1990). A shift from a rice monoculture Qattenl to diversified cropping makes this need for collective action more imperative.In almost all the countries under consideration, a major means of attaining this collective action is through the fonnation of strong water users' associations or farmers' organizations. As shown in Figure 1, the facets of \"Institutional issues\" and '\"Socioeconomic factors\" are all related to the issues of farmers' organizations and their linkages with the managing agencies, if any. These are the facet? that constitute the links where the markets outside as well as inside irrigation systems meet with the nonmarket elements of system management.Although it is well-recognized that the institutional aspects of irrigation management are of critical importance for better system performance, particularly when diversified cropping is envisaged, what is not clearly understood is how they are related to the markets.These market and lionmarket linkages in system management range over a wide spectrum; some need collective action more than others. Moreover, even fora certaiii aspect, the degree of need could differ from one system lo the other, depending on the prevailing socioeconomic and sociocultural environmenls. For instance, solutions to conflicts in water distribution between the head-end may collective action, in the market But some market, may exist under othercircumstances where waterrights are clearly specified and some compensation paymenls to losers can be enforced.There seems to be a tendency among those involved in irrigation management in Sri Lanka, as well as elsewhere, to consider that market mechanism and system management are two independent things which never go together. Needless to say, the market is not always a substitute for collective action. It is counterproductive lo assume that institutions such as farmers' organizations can always be a better substitute for the market. The need is for certain amicable combinations of these two extremes. which is perhaps the most serious challenge that research has to confront in paving the way for successful crop diversification in rice-based systems in the long run.Crop diversification in rice-based irrigation systems is often treated as if problems in it can be solved by government or system management directives; if there is a need to diversify crops, the need should be there; if certain crops are to be substituted for rice, farmers should plant the crops; ifcertain inputs are needed to these crops, they should be there; and so forth. Crop diversification is an inevitable process that the agriculture sector has to adopt as the economy grows; it is a part of the structural transformation process of the economy. This process is designed to build flexibility into agriculture. Acommand type mode of operation is furthermost to this approach. Instead, the success of crop diversification critically hiiiges on the markets. Only with well-functioning markets could its objectives be attained, while being consistent with the long-run need of structural transformation and efficient resource allocation.Crop diversification in rice-based systems is not easy to attain. Timmer (1989, which is an earlier version of the World Bank (1988) report, mentions Thailand and Japan as the countries where agricultural diversification has been successful; Thailand without government intervention, and Japan with heavy intervention. It should be noted that the major type of diversification that has progressed in both countries is not the one in rice-based systems but that through regional specialization away from rice. In the case of postwar Japan, agriculture as a whole has been diversified adding livestock and horticulture production lo staple food production, butthe rice sector itselfhas failed to diversify. The failure is twofold: rice farming has remained largely as monoculture despite all policy efforts made by the government lo promote diversification, and it has totally lost its economic viability because of too heavy protection through rice price-support. This experience in Japan clearly suggests that crop diversification policy is not independent ofrice policy. Both should be consistent with each other and with long-run needs of the economy.Unlike policies to attain rice self-sufficiency, policy targets for crop diversification keep moving, and the issue sttucture of crop diversification is open-ended towards the output markets. Research, that makes clear the conditions rice and nonrice, needs to be carried out periodically. The comparative advantage of producing certain crops domestically relative to imports should be examined carefully according to changes in the markets and in the economy, in order to keep renewing the list of crops to be grown in rice-based systems.It is worth remembering that major success cases of agricultural diversification in the past accompanied technological as well as institutional innovations consistent with the conditions of product and factor markers. In the case of the eighteenth-century English Agricultural Revolution, new technology in the form of new crop rotation systems was the technological basis with the enclosure as the institutional basis; the consolidation of communal pasture and farmland into single private units facilitated the introduction of an integrated system of crop-livestock production. At the turn of the century in Denmark, small grain farmers succeeded in introducing efficient dairy farming; accompanied were the technological innovation in the fonn of the centrifugal cream separator and the institutional innovation in the form of the cooperative creamery. Similarly, in Meiji, Japan, the introduction of sericulture alongside rice fanning was made possible by the invention of the summer-fall cocoon rearing technology supported by a series of institutional innovations such as the establishment of silk inspection stations, national and prefectural silkworm egg inultiplicatioii stations, sericulture colleges, and sericulture cooperatives. As stated by Hayaini (1989), \"the scope of success for agricultural diversification strategy is but limited if it simply attempts lo divert resources from the production of basic cereals to other crops and livestock products with no major technological innovation in either farm production or processing and marketing. If this resource reallocation would be enforced by government programs such as price supports and inputlcredit subsidies, it would prove to be counterproductive for the purpose that agricultural diversification tries to achieve.In spite of all difficulties, crop diversification will be the direction that many rice-based irrigation systems have to take in the long ruii as well as in the short run, if they are to be a part of the agricultural sector which is bound to diversify as the economy develops. Research efforts in irrigation management for crop diversification should all be aimed at the ultimate objective of making rice-based systems as flexible as possible. To build flexibility into the systems is nothing but to provide necessary conditions for diversification. A part of sufficient conditions for diversification is coming from outside the systems, but necessary conditions can be prepared within the systems as well."}

main/part_2/0513202896.json

@@ -0,0 +1 @@
+{"metadata":null,"keywords":null,"sieverID":"2f59a5f5-a3d9-486c-87cb-9d87bd44b419","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}

main/part_2/0516636695.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"cf8e43b5e2d93c18137758648696ff80","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/db632a4a-190a-4dc1-b157-b72ec895e0f1/retrieve","id":"1690113957"},"keywords":[],"sieverID":"f6845f85-49f5-441b-8099-9eda259fb833","content":"• SRBSDV incidence was also surveyed in districts of Punjab, North-western India. A total of 34,000 hectares in 13 districts were assessed. Out of 13 districts surveyed only SAS Nagar showed the highest damage by SRBSDV (15-20%). • Surveys conducted in 2022 showed massive SRBSDV infection was reported from Haryana and Punjab regions in India. These areas were closely monitored in 2023 however, no SRBSDV-diseased plants were observed.• In China and Vietnam, SRBSDV has still been a problem up to the present. Since SRBSDV incidences were not reported in India in 2023, the surveillance plan was dropped. We will keep updated on the situation in India for the monitoring of the disease."}

main/part_2/0524083962.json

@@ -0,0 +1 @@
+{"metadata":{"gardian_id":"1ff23094c95b22fd8f9585d1c8b3aab8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a8b70292-fed6-404d-9202-328d2dcda02e/retrieve","id":"-1648986728"},"keywords":[],"sieverID":"1083941b-51a2-4d8d-ae0d-149728690864","content":"Expose farmers to relevant technologies and making available to them helps them to strengthen their innovation capacities for further adaptation and expansion; 2.Engage marketers (traders and processors) and complementary service providers creates a room for bean sector to grow and improve farmers incentives leading to more productive investments in their bean crop; 3.Long term partnership between NARS, other value chain actors and CIAT has been a key to success; 4.With this approach, PABRA is determined to facilitate seed access to more farmers (15 millions in the next 5 years ) particularly women.This approach has significantly enhanced seed access to more farmers particularly women (56.35 % ) and also contributed to improved crop management . This led also to increased bean yield e.g. Ethiopia (see Fig. 5)Need for targeted and impact oriented seed systems:Since 2003 PABRA initiated a wider impact programme. Closer to 14 millions of farmers accessed one or two bean varieties across 20 countries. Though improved varieties play a major role, alone will not increase the bean productivity at expected yield. Integrated crop management (ICM) supported by relevant information are required to increase productivity of 15 millions farmers (new PABRA target in next five years ) especially poor farmers (50 % being women). To achieve these targets, PABRA facilitates the establishment of partners owned multi-stakeholders' platform which aims at bring in complementary skills and resources to deliver required bean based technologies and other supportive innovations.Research on delivery processes is equally important as generation of technologies for five reasons: 1.Inadequate supply of quality seed and other production inputs 2.To adapt tools/delivery processes 3.To ensure equity in the technology delivery (gender and wealth) 4.To test best options to delivery the technologies faster, widely and efficiently 5.To institutionalize and sustain the outcomes Increased ownership by partners who share roles and responsibility  Increased availability and access to quality seed access (see Fig. 2&3) Change in production systems e.g. timely planting, adequate plant population, use of complementary inputs, timely weeding and harvesting and post harvest management (see Fig. 1) Increase in bean production,yield (see Fig. 5), market volume and price; Impact on farmers' income and livelihoods  Increased investment by actors along the value chain actors (farmers, small and large, traders and government..Process /key activities :Engage multiple stakeholders and partners along the bean value chain and complementary services providers including financial and insurance, transport Enhance skills and knowledge of partners Create and sustain demand of farmers and other value chains actors Engage higher level agricultural policy makers Engage bean industry (traders and processors) Increase the availability of basic seed of released varieties Sensitize farmers on the use of ICM such, timely improved soil fertility , adequate weeding. Institutionalize a multi-stakeholders platform to carry out seasonal reviews and planning sessions  Two major approaches have been used to access seeds : decentralized (women led small seed enterprises -see Fig. 2) and seed companies and their agro-dealer networks who sell affordable seed packs (see Fig . 3 ) especially in countries where the seed industry is relatively developed.Objectives and rationale for research on delivery For more information : j.c.rubyogo@cgiar.org"}