text
stringlengths
10
2.61M
# Longest String # I worked on this challenge [by myself, with: ]. # longest_string is a method that takes an array of strings as its input # and returns the longest string # # +list_of_words+ is an array of strings # longest_string(list_of_words) should return the longest string in +list_of_words+ # # If +list_of_wo...
class ExerciseDescription < ActiveRecord::Base default_scope { where(ended_at: nil) } belongs_to :user has_many :exercises has_many :taggings, as: :taggable has_many :tags, through: :taggings before_validation :set_uniquable_name # Validate associations validates :user, presence: true # Validate a...
require 'rosalind' describe Rosalind do let(:rosalind) { Rosalind.new } it "counts A, C, G and T #1" do actual = rosalind.counts_symbol("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") expected = "20 12 17 21" expect(actual).to eq(expected) end it "counts A, C, G and T #...
require 'lib/episode_helpers' ### # Compass ### compass_config do |config| # Require any additional compass plugins here. config.add_import_path "bower_components/foundation/scss" # Set this to the root of your project when deployed: config.http_path = "/" config.css_dir = "stylesheets" config.sass_dir = ...
require 'test/unit' require 'logger' require 'pp' require 'active_record' require 'action_controller' require 'marginalia' ActiveRecord::Base.establish_connection({ :adapter => ENV["DRIVER"] || "mysql", :host => "localhost", :username => "root", :database => "marginalia_test" }) RAILS_ROOT = __FILE__ cl...
class PlanActivity < ApplicationRecord belongs_to :plan belongs_to :activity end
#!/usr/bin/env ruby # # This script let you expand an ERB template from the command line # while optionally passing variables that will be expanded in the # template. # # Joint copyright: # Copyright 2012, Antoine "hashar" Musso # Copyright 2012, Wikimedia Foundation # Command line option parsing library require 'optp...
require 'action_view' class BasePresenter include ActionView::Helpers::UrlHelper, ActionView::Helpers::DateHelper, ActionView::Helpers::AssetTagHelper attr_reader :object def initialize(object) @object = object end def object_age_in_words distance_of_time_in_words(object.created_at.to_dat...
module Infuser module Helpers module Hashie def camelize_hash(hash) hash.each_with_object({}) do |(key, value), h| camelized_key = get_camelized_key(key) h[camelized_key] = value end end def get_camelized_key(key) camelized_key = key.to_s.split('_')....
require 'spec_helper' describe PresentationTrack do subject { PresentationTrack.new app_session: app_session } let(:app_session) { FactoryGirl.create :app_session } let(:local_file) { File.new File.join Rails.root, '.gitignore' } describe '#after_create' do let(:app_session) { FactoryGirl.create :app_sess...
# encoding: utf-8 require "#{File.dirname(__FILE__)}/lib/unicode_utils/version" suffix = ENV["SUFFIX"] gem_filename = "unicode_utils-#{UnicodeUtils::VERSION}.gem" task "default" => "quick-test" desc "Run unit tests." task "test" do ruby "-I lib test/suite.rb" end desc "Quick test run." task "quick-test" do ru...
require 'rethinkdb' class SetInstanceThreshold include RethinkDB::Shortcuts def id(id:) @id = id end def threshold(threshold:) @threshold = threshold end def execute(connection:) r.table('instance').get(@id).update({threshold: @threshold}).run(connection) end end
class CreateAdminAddresses < ActiveRecord::Migration def change create_table :admin_addresses do |t| t.text :address t.text :name t.timestamp :latest t.boolean :biostat t.timestamps end end end
require 'test_helper' class UserTest < ActiveSupport::TestCase def setup @joe = users(:joe) end # Enforces validation for fields test "Requires first_name, last_name, and email attributes" do @joe.first_name = nil assert !@joe.valid?, "User was created with invalid attributes!...
require 'rails_helper' RSpec.describe 'Stageモデルのテスト', type: :model do describe 'モデルのテスト' do it "有効なStageの場合は保存されるか" do expect(FactoryBot.build(:stage)).to be_valid end end describe 'バリデーションのテスト' do subject { stage.valid? } let!(:other_stage) { create(:stage) } let(:stage) { build(:stag...
module Api module V1 module Admin # app/controllers/users_controller.rb class RolesController < BaseApiController before_action :set_role, only: [:show, :update, :destroy] =begin @api {post} /admin/clients Crear clientes @apiName CreateClients @apiGroup Clients ...
# frozen_string_literal: true # rubocop:todo all require 'spec_helper' describe Mongo::Collection::View do let(:filter) do {} end let(:options) do {} end let(:view) do described_class.new(authorized_collection, filter, options) end before do authorized_collection.delete_many end ...
require 'os' # gem install os require 'pathname' if not OS.windows? then puts("Firefox settings link only supported on windows.") exit(1) end def link(from, to) File.symlink(from, to) end def find_firefox_profile() appDataPath = ENV['APPDATA'] firefoxAllProfilesPath = "#{appDataPath}\\Mozilla\\Fi...
require "rails_helper" RSpec.describe WatchedPokemonsController, type: :routing do describe "routing" do it "routes to #index" do expect(:get => "/watched_pokemons").to route_to("watched_pokemons#index") end it "routes to #new" do expect(:get => "/watched_pokemons/new").to route_to("watched...
class Api::Users::SignUpOp class << self def execute(params) User.create!(params[:login]) do |user| user.attributes = user_params(params) end end def allowed?(*) true end private def user_params(params) (params[:user].presence || params).slice(:login, :passwo...
FactoryGirl.define do factory :link, :class => Refinery::Fg::Link do sequence(:name) { |n| "refinery#{n}" } end end
module AnsiChameleon module SequenceGenerator class InvalidColorValueError < ArgumentError; end class InvalidEffectValueError < ArgumentError; end COLORS = [:black, :red, :green, :yellow, :blue, :magenta, :cyan, :white] EFFECTS = { :none => 0, :bright => 1, :underline => 4, :blink => 5, :reverse =>...
class RegistrationsController < Devise::RegistrationsController prepend_before_action :set_minimum_password_length private def sign_up_params params.require(:user).permit(:first_name, :last_name, :email, :password, :password_confirmation, :institution) end def account_update_params params.require(:u...
require 'spec_helper' describe "static_pages" do subject { page } describe "home page" do before { visit home_path } it { should have_title("LVE | Home") } end describe "about page" do before { visit about_path } it { should have_title("LVE | About") } end describe "help page" do ...
require 'spec_helper' describe Api::V1::FormsController do describe "GET #show" do before(:each) do @form = FactoryGirl.create :form get :show, id: @form.id end it "returns the information about a reporter on a hash" do form_response = json_response expect(form_response[:name]).t...
class CreateHistories < ActiveRecord::Migration def change create_table :histories do |t| t.integer :won_by_id t.integer :lost_by_id t.integer :card_id t.timestamps end add_index :histories, :won_by_id add_index :histories, :lost_by_id add_index :histories, :card_id ...
# == Schema Information # # Table name: artists # # id :integer not null, primary key # name :string(255) # body :text # description :text # url :string(255) # myspace_url :string(255) # facebook_url ...
# 1) def largest?(array, value) array.each do |item| return false if item > value end return true end # This is O(n) because the data grows proportionately along with the loop. # 2) def info_dump(customers) puts "Customer Names: " customers.each do |customer| puts "#{customer[:name]}" end put...
module ManageIQ::Providers::Amazon::CloudManager::Provision::Cloning def do_clone_task_check(clone_task_ref) source.with_provider_connection(:sdk_v2 => true) do |ec2| instance = ec2.instance(clone_task_ref) return false, :pending unless instance.exists? status = instance.state.name.to_sym ...
require 'spec_helper' describe 'User API' do before :each do Ingredient.destroy_all User.destroy_all FactoryGirl.create :user end after :each do Ingredient.destroy_all User.destroy_all end it 'allows you to add an ingredient' do api_login post user_ingredients_path(response...
require 'aethyr/core/objects/info/terrain' require 'aethyr/core/util/log' require 'aethyr/core/objects/inventory' require 'aethyr/core/util/guid' require 'aethyr/core/objects/info/info' module Location def initialize(*args, terrain_type: nil, indoors: nil, swimming: nil) super if info.terrain.nil? inf...
require 'minitest/autorun' require './robot' class TestRobotOutput < MiniTest::Unit::TestCase def setup @robot1 = Robot.new @robot2 = Robot.new end # def test_robot_exists # assert_equal "HKN65",@robot1.name # end def test_robot_nameis_5_characters assert_equal 5,@robot1.name.length e...
class Kalculator module Transform def self.run(node, &block) new_node = yield node if is_terminal?(new_node) new_node elsif new_node.first.is_a?(Symbol) args = new_node[1..-1].map{ |arg| run(arg, &block) } args.unshift(new_node.first) else new_node.map{|node...
require 'test_helper' class People::Friend::ContactsControllerTest < ActionController::TestCase setup do @friend = friends(:Friend_1) @person = people(:Person_1) @contact = contacts(:Contact_1) end test "should get index contacts" do get :index, person_id: @person, friend_id: @friend assert_...
class AddColumnsToContract < ActiveRecord::Migration def change add_column :contracts,:projectname, :string add_column :contracts,:buyerparty, :string add_column :contracts,:projectaddr, :string add_column :contracts,:remark, :string add_column :contracts,:contractno, :string add_column :contr...
[ :desc, :props, :returns, :methods, :class_methods, :belongs_to, :has_many, :has_one, :klass ].each do |dsl| require_relative "./dsl/#{dsl}_provider" end [ :methods, :class_methods, :klass, :args ].each do |dsl| require_relative "./dsl/#{dsl}" end require_relative './dsl/box' module Pa...
class Companies::DepartmentsController < ApplicationController #Developer: Marco&Marius # === Callbacks === before_action :set_company, only: [:index] def index @departments = Department.where(company_id: @company.id) end private def set_company @company = Company.includes(:departments).find(...
class DropTableClimbsTickLists < ActiveRecord::Migration def change drop_table :climbs_tick_lists end end
require_relative 'web_helpers' feature 'Registering a new user' do scenario 'visit /users/new and fill in the form' do visit '/users/new' expect(page).to have_content('Please sign up to use Chitter') fill_in('email', with: 'acav@gmail.com') fill_in('password', with: 'password') click_button('Sign...
module Skeptick class DslContext def swap(*args) if args.size != 0 && args.size != 2 raise ArgumentError, "wrong number of arguments (#{args.size} for 0, 2)" end args.empty? ? set('+swap') : set(:swap, args.join(',')) end end end
require 'rails_helper' feature 'Comments' do scenario 'Logged in user can add comments to task show, commenter is linked to user show page' do password = 'password' user = create_user(:password => password) project = create_project create_membership(project, user) task = create_task(project) ...
require 'spec_helper' require 'account' describe Account do let(:statement) { double(:statement) } let(:date_formatter) { double(:date_formatter, show_date: '01/01/2001') } let(:subject) { described_class.new(statement, date_formatter) } context('transactions') do describe('#deposit') do it('adds am...
module ResourceAuthentication module ActsAsResourceAuthentic module Base def self.included(klass) klass.class_eval do extend Config end end module Config def acts_as_resource_authentic(&block) yield self if block_given? acts_as_resourc...
class Sandbox < ApplicationRecord validates :name, presence: true validates :sandbox_type, presence: true validates :description, presence: true validates :start_date, presence: true validates :expected_end_date, presence: true validates :owner, presence: true validates :owner_team, presence: true end
class MadsElement < ActiveFedora::Rdf::Resource property :elementValue, predicate: MADS.elementValue end
class FixColumnDateFromOrderOfService < ActiveRecord::Migration def change change_column :order_of_services, :date_of_service, :date change_column :order_of_services, :date_of_issue, :date end end
require 'rails_helper' RSpec.describe User, type: :model do user = FactoryGirl.create(:user) it { is_expected.to have_many(:documents) } it { is_expected.to validate_presence_of(:fullname) } it { is_expected.to validate_presence_of(:email) } it { is_expected.to validate_presence_of(:password) } describe...
# == Schema Information # # Table name: projects # # id :integer not null, primary key # name :string not null # slug :string not null # team_id :integer # created_at :datetime not null # updated_at :datetime not null # # Indexes # # index_proje...
## #This class is generated by gem ActiveAdmin for creating Admin users # the class has no additional code ActiveAdmin.register AdminUser do ## # the index page of admin_users index do column :email column :current_sign_in_at column :last_sign_...
Given(/^some fields$/) do @user_data = {name: 'samuel', last_name: 'fisher'} end When(/^call new method$/) do @user = User.new(@user_data) end Then(/^I see the new object with a given fields$/) do expect(@user.instance_variables).not_to be_nil expect(@user.instance_variables.length).to be >= 1 end Given(/^a n...
class AddAccessibileToProjects < ActiveRecord::Migration[5.2] def change add_column :projects, :accessible, :boolean end end
Gem::Specification.new do |s| s.name = 'xml_file_renamer' s.version = '0.0.9' s.add_runtime_dependency "nokogiri", ["= 1.6.1"] s.executables << 'xml_file_renamer' s.date = '2014-08-14' s.summary = "Batch rename XML files - rule the world!" s.description = "A command line e...
ActiveAdmin.register User, as: 'Runner' do # == Allowed attributes permit_params :first_name, :last_name, :email, :dni, :sex, :dob, :city, :gym, :phone, :emergency_phone, :medical_insurance, :shirt_size # == Filters filter :first_name filter :last_name filter :dni filter :email filter ...
require_relative 'client' require_relative 'config' module PuppetX module CenturyLink class Clc < Puppet::Provider def self.read_only(*methods) methods.each do |method| define_method("#{method}=") do |v| fail "#{method} property is read-only once #{resource.type} created" ...
class Surrogate ::RSpec::Matchers.define :substitute_for do |original_class, options={}| comparison = nil subset_only = options[:subset] match do |mocked_class| comparison = ApiComparer.new(mocked_class, original_class).compare if subset_only (comparison[:instance][:not_on_actual] + ...
class Used_Bicycle < Bicycle attr_reader :age def initialize(input_options) super @age = input_options[:age] end end
Given(/^there is a project item ingest workflow in state '(.*)'$/) do |state| FactoryBot.create(:workflow_project_item_ingest, state: state) end And(/^I perform project item ingest workflows$/) do Workflow::ProjectItemIngest.all.each do |workflow| workflow.perform end end Then(/^there should be (\d+) projec...
def uni_chars(string) # edge cases? empty string if string.length == 0 return true end # declare an empty hash dict = {} # iterate over the split string and for each letter, add one to the value of the hash for that letter string.split('').each do |letter| # check the hash already has a key for...
require 'spec_helper' describe City do fixtures :cities, :locations before(:each) do @valid_attributes = { :city => "Delhi"} end it "should create a new instance given valid attributes" do City.create!(@valid_attributes) end it "should require a valid city name" do City.new(:city => " ").sh...
module Web::Controllers::Team::Positions class Show include Web::Action params do required(:team_id).filled(:int?) required(:id).filled(:int?) end expose :results def call(params) @results = GameRepository.compare_team(params[:team_id], params[:id]) end end end
class CreateMagazines < ActiveRecord::Migration def change create_table :magazines do |t| t.integer :client_id t.string :comment t.date :startmag t.date :stopmag t.decimal :price t.timestamps end end end
require 'spec_helper' describe JanusGateway::Transport::WebSocket do let(:url) { 'ws://example.com' } let(:protocol) { 'janus-protocol' } let(:ws_client) { Events::EventEmitter.new } let(:transport) { JanusGateway::Transport::WebSocket.new(url) } let(:data) { { 'janus' => 'success', 'transaction' => 'ABCDEFG...
require 'capistrano-scrip/utils' # monit is a free, open source process supervision tool for Unix and Linux. Capistrano::Configuration.instance.load do # Path to monit configuration template _cset(:monit_config_template) { "monit/monit_#{app_server}.conf.erb" } # The remote location of monit's config file _cse...
module Healthtap # Supports adding, reading, and updating items from DynamoDB class NoSql @db = nil @table_prefix = nil def self.connection if @db.nil? consul_settings = App.settings.consul access_key_id = consul_settings[:aws][:access_key_id] secret_access_key = consul_se...
require 'socket' class MicropostMailer < ActionMailer::Base def participated(participant, micropost) @participant = participant @micropost = micropost return mail(to: micropost.user.email, from: participant.name + " via Happpening <notification@happpening.com>", subject: participant.name + " ...
Gem::Specification.new do |s| s.name = 'dialogue' s.version = '0.0.0' s.date = '2013-07-17' s.summary = "dialogue" s.description = "A model for generating sequences with n-gram models" s.authors = ["Farhan Mannan"] s.email = 'farhanmannan@mac.com' s.homepage = 'http://...
class Light < ActiveRecord::Base ALLOWED = %w[red yellow green] extend FriendlyId friendly_id :name, use: :finders # Associations has_many :operators has_many :users, through: :operators has_many :watchers has_many :requests accepts_nested_attributes_for :operators, reject_if: :all_blank, allow_de...
require "spec_helper" describe "Artist" do let (:artist) { Artist.new } let (:song) { Song.new } let (:genre) { Genre.new } it "can initialize an artist" do expect(artist).to be_an_instance_of(Artist) end it "has a name" do artist.name = "Tupac" expect(artist.name).to eq("Tupac") end de...
#!/usr/bin/env ruby # https://adventofcode.com/2022/day/6 # --- Day 6: Tuning Trouble --- # The preparations are finally complete; you and the Elves leave camp on foot and begin to make your way toward the star fruit grove. # As you move through the dense undergrowth, one of the Elves gives you a handheld device. He...
module Locomotive class EditableLongText < EditableShortText ## methods ## def as_json(options = {}) Locomotive::EditableLongTextPresenter.new(self).as_json end end end
#!/usr/bin/env ruby $:.push File.dirname(__FILE__) require 'helpers/core' require 'helpers/db' USAGE = "look up something remembered with !remember" usage USAGE unless input puts "Usage: #{USAGE}" exit 1 end query = input.strip value = DB[:memory][query.downcase] if value puts "#{query.capitalize} is: #{valu...
# # Copyright 2009 Huygens Instituut for the History of the Netherlands, Den Haag, The Netherlands. # # This file is part of New Women Writers. # # New Women Writers is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundat...
module Ricer::Plug::Params class StaticParam < Base def expected_static_text(message) message.plugin.t("static_param_#{options[:text]}".to_sym) rescue options[:text] end def convert_in!(input, message) failed_input unless input == options[:text] || input == expected_static_text(messa...
class AddLastActivityAtToUsers < ActiveRecord::Migration def change add_column :users, :last_activity_at, :datetime, null: false, default: Time.now end end
# frozen_string_literal: true module LoginSteps step 'I am logged in' do create_user log_in end step 'I have a user account' do create_user end step 'I should be prompted for a login' do expect(page).to have_content('Log in') end step 'I log in' do log_in end step 'I should be...
require_relative 'game' require_relative 'guess' class GuessPrinter def initialize(guess_history) @guess_history = guess_history @last_guess = guess_history.last if @last_guess.results[:full_match] print_guess_history else system('clear') print_guess_history # puts "Last gues...
require_relative 'literals' require_relative '../scanner/scanner' require 'pry' module Scheme class Parser def initialize(input) @scanner = Scheme::Scanner.new(input) end def pretty_print root = parse_next_exp while root root.pprint(0) root = parse_next_exp end ...
class AddEditedColumnToRoutes < ActiveRecord::Migration[6.0] def change add_column :routes, :edited, :boolean, default: false end end
# frozen_string_literal: true require 'rails_helper' RSpec.describe FullSimulation, type: :model do before(:each) do @full_simulation = create(:full_simulation) end context 'validations' do it 'is valid with valid attributes' do expect(@full_simulation).to be_a(FullSimulation) expect(@full_...
class UpdateMailerPreview < ActionMailer::Preview def update_email UpdateMailer.with(owner: Owner.first).update_email end end
require 'spec_helper' describe 'PHP 7.2' do include_context 'php' do let(:php_version) { '7.2' } let(:php_packages) { Constants::PHP72_PACKAGES } let(:apache_version) { '2.4.18' } let(:apache_php_mod) { 'php7_module' } let(:ubuntu_version) { '16.04' } end before(:all) do image_name = "#{...
# frozen_string_literal: true class DelaySerializer < ActiveModel::Serializer attributes :delay_in_minutes end
class CreateMeetings < ActiveRecord::Migration def change create_table :meetings do |t| t.integer :message_id t.integer :meeting_state, :default => 0 t.string :alt_email t.integer :alt_phone t.date :meeting_date t.date :won_lost_date t.string :pipeline_state t.strin...
#!/usr/bin/env ruby require 'aliyun/oss' require 'optparse' require 'fileutils' require 'progress_bar' options = { delimiter: '/', max_depth: 1, download_dir: '.' } OptionParser.new do |opts| opts.banner = "Usage: oss-client command [options]" opts.on("--endpoint [STRING]", "Aliyun oss endpoint") do |str| ...
class UserSerializer < ActiveModel::Serializer attributes :name, :id has_many :comments, except: [:post, :user] has_many :posts, only: [:title, :id] end
class AddDateTimeStringColumns < ActiveRecord::Migration def change add_column :events, :start_str, :string add_column :events, :end_str, :string add_column :events, :sales_start_str, :string add_column :events, :sales_end_str, :string end end
module Super module Kafka class Producer include Super::Component DEFAULT_SETTINGS = { flush_interval: 1, timeout_interval: 30, max_buffer_size: 10 }.freeze inst_accessor :pool interface :configure, :boot, :produce, :flush, :shutdown %w[topic flush_i...
class ConferenceInvitee < ActiveRecord::Base attr_accessible :pin, :speaker, :moderator, :phone_number, :phone_number_attributes belongs_to :conference belongs_to :phone_book_entry has_one :phone_number, :as => :phone_numberable, :dependent => :destroy accepts_nested_attributes_for :phone_number before_...
# -*- mode: ruby -*- # vi: set ft=ruby : require 'yaml' current_dir = File.dirname(File.expand_path(__FILE__)) config_dir = "#{current_dir}/config" if File.file?("#{config_dir}/dev.yml") config = YAML.load_file("#{config_dir}/dev.yml") print "Loaded dev config: #{config}\n" else config = YAML.load_file("#{config...
# encoding: utf-8 require 'net/http' require 'uri' require 'json' require 'singleton' require 'open3' require_relative 'config' require_relative 'mfile' # Class to store language information class MLanguages attr_reader :raw def initialize(json) @raw = json['data']['detections'] end # Return all poss...
class Seller < ActiveRecord::Base belongs_to :member belongs_to :shipping_term has_many :products has_many :line_items, :through => :products, :order => "order_id DESC", :include => [:feedback] validates_presence_of :name validates_length_of :name, :within => 3..120 validates_uniqueness_of...
explanatory_variable :normalized_addr_la do type :numeric input Transaction dependencies :addr_la description "addr_la shifted and scaled by mean and standard deviation" calculate do |trans| ((addr_la.nil? ? current_sample.mean(:addr_la) : addr_la) - current_sample.mean(:addr_la)) / current_sample.stdev(:...
#-- # Copyright (c) 2006 Stephan Toggweiler # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publi...
class MenusController < ApplicationController skip_before_action :authenticate_user! before_action :set_storage def show # FIXME: Use a better abstraction for menu @items = @storage.items end private def set_storage @storage = Storage.new(point_of_sale_id: params[:id]) end end
class AddPriceToOrderHistory < ActiveRecord::Migration def change add_column :order_histories, :price, :money add_column :order_histories, :quantity, :float add_column :order_histories, :quantity_unit, :string, limit: 5 end end
module HTTP class People include HTTParty base_uri 'https://m.mit.edu/apis/people' def person(kerberos) JSON.parse(self.class.get("/#{kerberos}").body) end end end
module TheCityAdmin FactoryGirl.define do factory :group_role, :class => TheCityAdmin::GroupRole do created_at "04/30/2012" title nil user_api_url "https://api.onthecity.org/users/494335566" id 265005445 user_type "Offline User" user_id 494335566 last_engaged nil...
class CreateTasks < ActiveRecord::Migration[5.1] def change create_table :tasks do |t| t.references :service, foreign_key: true t.integer :contact t.references :motif, foreign_key: true t.datetime :time_limit t.datetime :processing_date t.boolean :status, default: true t....
class View < ActiveRecord::Base attr_accessible :viewed_id, :viewer_id belongs_to :viewer, class_name: 'User', foreign_key: 'viewer_id' belongs_to :viewed, class_name: 'User', foreign_key: 'viewed_id' end
class PaymentMailer < ActionMailer::Base default from: "Blue Arch Store Support <service.bluearchstore@gmail.com>" def payment_confirmation(payment) @payment = payment mail(to: @payment.email, subject: 'Please confirm payment and sign it') end def payment_pdf(payment) @payment = payment mail(t...