title
stringlengths
10
172
question_id
int64
469
40.1M
question_body
stringlengths
22
48.2k
question_score
int64
-44
5.52k
question_date
stringlengths
20
20
answer_id
int64
497
40.1M
answer_body
stringlengths
18
33.9k
answer_score
int64
-38
8.38k
answer_date
stringlengths
20
20
tags
listlengths
1
5
Removing \xa0 from string in a list
38,830,308
<p>I have a list with a bunch of words:</p> <pre><code>lista = ['Jeux Olympiques De Rio\xa02016', 'Sahara Ray', 'Michael Phelps', 'Amber Alert'] </code></pre> <p>I tried to replace the <code>'\xa0'</code>:</p> <pre><code>for element in listor: element = element.replace('\xa0',' ') </code></pre> <p>But it didn't work. Also, when I <code>print</code> the elements, it prints:</p> <pre><code>print(lista[0]) Jeux Olympiques De Rio 2016 </code></pre> <p>Does anyone have an idea on how to solve this?</p>
1
2016-08-08T13:19:36Z
38,830,660
<p>the easiest way:</p> <pre><code>lista = [el.replace('\xa0',' ') for el in lista] </code></pre>
2
2016-08-08T13:35:14Z
[ "python", "string", "python-3.x" ]
Using py2neo v3 with google app engine
38,830,407
<p>I'm trying to set a backend using py2neo on google app engine. It works just fine when pushed on the dev on app engine, however, unfortunately, it doesn't work when I use it on localhost.</p> <p>First, i've setted the HOME environment variable in python (thanks to that tip, my code works on my dev) but it doesn't fix the localhost problem</p> <p>Then, i've followed that advice <a href="http://stackoverflow.com/questions/16192916/importerror-no-module-named-ssl-with-dev-appserver-py-from-google-app-engine/16937668#16937668">&quot;ImportError: No module named _ssl&quot; with dev_appserver.py from Google App Engine</a> it prevents one exception but another rises after.</p> <p>Here is my traceback</p> <pre><code> ft1.1: Traceback (most recent call last): File "/Users/Arnaud/Documents/project/app/test/neo4j/test_graph_handler.py", line 13, in test_get_direct_neighbours selection = self.graph_handler.get_direct_neighbours("8") File "/Users/Arnaud/Documents/project/app/neo4j/graph_handler.py", line 20, in get_direct_neighbours labels(l) AS `relationship`" % self.protect(ean)) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 694, in run return self.begin(autocommit=True).run(statement, parameters, **kwparameters) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 370, in begin return self.transaction_class(self, autocommit) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 1212, in __init__ self.session = driver.session() File "/Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/session.py", line 126, in session connection = connect(self.address, self.ssl_context, **self.config) File "/Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/bolt.py", line 444, in connect if not store.match_or_trust(host, der_encoded_server_certificate): File "/Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/bolt.py", line 397, in match_or_trust f_out = os_open(self.path, O_CREAT | O_APPEND | O_WRONLY, 0o600) # TODO: Windows File "/Applications/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/devappserver2/python/stubs.py", line 73, in fake_open raise OSError(errno.EROFS, 'Read-only file system', filename) OSError: [Errno 30] Read-only file system: '/Users/Arnaud/.neo4j/known_hosts' </code></pre> <p>As everything lauches in a sandboxed environnement and with a fake user, the exception is normal but it does not happen on the dev.</p> <p>And here is /Users/Arnaud/Documents/project/app/neo4j/graph_handler.py:20</p> <pre><code> 13 def get_direct_neighbours(self, ean): 14 selection = self.graph.run("\ 15 MATCH\ 16 (:Product {ean: '%s'})--&gt;(l)&lt;--(n:Product)\ 17 RETURN\ 18 n.ean AS `ean`,\ 19 n.name AS `name`,\ 20 labels(l) AS `relationship`" % self.protect(ean)) 21 return selection </code></pre> <p>So to understand why it would work on the dev, I tried to localize where sandbox and dev execution start being different. and it is right here in /Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/bolt.py:427</p> <pre><code>427 if ssl_context and SSL_AVAILABLE: 428 host, port = host_port 429 if __debug__: log_info("~~ [SECURE] %s", host) 430 try: 431 s = ssl_context.wrap_socket(s, server_hostname=host if HAS_SNI else None) 432 except SSLError as cause: 433 error = ProtocolError("Cannot establish secure connection; %s" % cause.args[1]) 434 error.__cause__ = cause 435 raise error 436 else: 437 # Check that the server provides a certificate 438 der_encoded_server_certificate = s.getpeercert(binary_form=True) 439 if der_encoded_server_certificate is None: 440 raise ProtocolError("When using a secure socket, the server should always provide a certificate") 441 trust = config.get("trust", TRUST_DEFAULT) 442 if trust == TRUST_ON_FIRST_USE: 443 store = PersonalCertificateStore() 444 if not store.match_or_trust(host, der_encoded_server_certificate): 445 raise ProtocolError("Server certificate does not match known certificate for %r; check " 446 "details in file %r" % (host, KNOWN_HOSTS)) 447 else: 448 der_encoded_server_certificate = None </code></pre> <p>Because in the dev, ssl loading fails in ssl_compat.py while on localhost, it succeeds and so the code goes inside the if statement and fails at line 444</p> <p>To understand that I forced SSL_AVAILABLE to be falsy, however even with that I have wierd problems about app engine sockets which are not recognized as sockets</p> <pre><code>ft1.1: Traceback (most recent call last): File "/Users/Arnaud/Documents/project/app/test/neo4j/test_graph_handler.py", line 13, in test_get_direct_neighbours selection = self.graph_handler.get_direct_neighbours("8") File "/Users/Arnaud/Documents/project/app/neo4j/graph_handler.py", line 20, in get_direct_neighbours labels(l) AS `relationship`" % self.protect(ean)) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 694, in run return self.begin(autocommit=True).run(statement, parameters, **kwparameters) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 370, in begin return self.transaction_class(self, autocommit) File "/Users/Arnaud/Documents/project/app/libs/py2neo/database/__init__.py", line 1212, in __init__ self.session = driver.session() File "/Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/session.py", line 126, in session connection = connect(self.address, self.ssl_context, **self.config) File "/Users/Arnaud/Documents/project/app/libs/py2neo/packages/neo4j/v1/bolt.py", line 460, in connect ready_to_read, _, _ = select((s,), (), (), 0) File "/Applications/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 483, in select _SetState(request, _GetSocket(value), POLLIN) File "/Applications/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/api/remote_socket/_remote_socket.py", line 425, in _GetSocket raise ValueError('select only supported on socket objects.') ValueError: select only supported on socket objects. </code></pre> <p>If anyone have faced the same issues, I would be interested in that because having to push on the dev before any test quite painful.</p> <p><strong>EDIT:</strong> For those who would want to know, as I have no answer from nigel yet and I needed some fast solution, i've created my own class to send and recieve cypher requests, it's compatible with app engine and i've putted it on a gist: <a href="https://gist.github.com/ArnaudParan/e26f291ba8b3c08e5b762d549667c7d6" rel="nofollow">https://gist.github.com/ArnaudParan/e26f291ba8b3c08e5b762d549667c7d6</a> It's experimental and might not work if you ask for full nodes but if it can help, i publish it</p>
0
2016-08-08T13:23:49Z
38,831,353
<p>The 1st traceback could indicate that the py2neo package may be incompatible with <a href="https://cloud.google.com/appengine/docs/python/runtime#Python_The_sandbox" rel="nofollow">GAE's sandbox restrictions</a>. In particular it shows an attempt to open the <code>/Users/Arnaud/.neo4j/known_hosts</code> file in write mode (<code>os_open(self.path, O_CREAT | O_APPEND | O_WRONLY, 0o600)</code>) which is not allowed. Check if it's somehow possible to configure py2neo to not do that.</p> <p>The sandbox also has restrictions on sockets, see <a href="https://cloud.google.com/appengine/docs/python/sockets/#limitations_and_restrictions" rel="nofollow">Limitations and restrictions</a>.</p>
0
2016-08-08T14:05:23Z
[ "python", "google-app-engine", "ssl", "neo4j", "py2neo" ]
Groupby and any() | all()
38,830,423
<p>I have the following <code>pd.DataFrame</code></p> <pre><code>In [155]: df1 Out[155]: ORDER_ID ACQ DATE UID 2 3 False 2014-01-03 1 3 4 True 2014-01-04 2 4 5 False 2014-01-05 3 6 7 True 2014-01-08 5 7 8 False 2014-01-08 5 9 10 False 2014-01-10 6 0 11 False 2014-01-11 6 </code></pre> <p>where each entry is an order, with values for <code>ORDER_ID</code>, <code>DATE</code>, <code>UID</code> and <code>ACQ</code> (indicates whether this is the first order for the associated <code>UID</code> in the dataset).</p> <p>I am trying to filter and keep all orders that were placed by users that have made their first order inside the time period covered in the dataset (i.e. at least one of the orders of such users satisfy <code>ACQ == True</code>).</p> <p>So, the desired output would be:</p> <pre><code> ORDER_ID ACQ DATE UID 3 4 True 2014-01-04 2 6 7 True 2014-01-08 5 7 8 False 2014-01-08 5 </code></pre> <p>and I have managed to reach this by:</p> <pre><code>In [156]: df1.groupby('UID').filter(lambda x: x.ACQ.any() == True) Out[156]: ORDER_ID ACQ DATE UID 3 4 True 2014-01-04 2 6 7 True 2014-01-08 5 7 8 False 2014-01-08 5 </code></pre> <p>However, when I try to find all the orders that were placed by users that have made their first order outside the time period covered in the dataset (i.e. All their orders should satisfy <code>ACQ == False</code>) I seem to be lost. I have tried this:</p> <pre><code>In [159]: df1.groupby('UID').filter(lambda x: x.ACQ.all() == False) Out[159]: ORDER_ID ACQ DATE UID 2 3 False 2014-01-03 1 4 5 False 2014-01-05 3 6 7 True 2014-01-08 5 ## &lt;- This order is an acquisition, therefore all orders with UID == 5 should be filtered out. 7 8 False 2014-01-08 5 9 10 False 2014-01-10 6 0 11 False 2014-01-11 6 </code></pre> <p>How should I go about filtering out all the orders placed by users that have ALL their orders satisfy <code>ACQ == False</code>?</p> <p>Any ideas are very much appreciated, thanks!</p>
2
2016-08-08T13:24:27Z
38,830,719
<p>You need first use condition and then add <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.Series.all.html" rel="nofollow"><code>all</code></a>:</p> <pre><code>print (df1.groupby('UID').filter(lambda x: (x.ACQ == False).all())) ORDER_ID ACQ DATE UID 2 3 False 2014-01-03 1 4 5 False 2014-01-05 3 9 10 False 2014-01-10 6 0 11 False 2014-01-11 6 </code></pre>
1
2016-08-08T13:38:07Z
[ "python", "pandas" ]
Non-error message from another script when importing library
38,830,469
<p>I produced a very strange error today, using Python 2.7 on a Windows 10 system. I wrote a Python script, <code>C:\Users\$me\copy.py</code> looking something like this:</p> <pre><code>import subprocess import sys try: out = subprocess.check_output("do_stuff.bat") except subprocess.CalledProcessError as e: print "Doing stuff failed." do_stuff_did_something = out.find("String to be found in do_stuffs output.") if do_stuff_did_something == -1: print "Do_stuff didn't do it." else: print "Do_stuff did do it." </code></pre> <p>So far, so good, this works perfectly fine and does what it's supposed to do: run the batch file, look for a specific string in its output, and return a message according to whether it found the string or not.</p> <p>Some time afterwards, I installed the OpenOPC library. At some point which I don't clearly remember, this started happening:</p> <pre><code>C:\Users\$me&gt;python Python 2.7.11 (v2.7.11:6d1b6a68f775, Dec 5 2015, 20:40:30) [MSC v.1500 64 bit (AMD64)] on win32 Type "help", "copyright", "credits" or "license" for more information. &gt;&gt;&gt; import OpenOPC Do_stuff did do it. &gt;&gt;&gt; </code></pre> <p>This also happens if I run a <code>python script.py</code> including the OpenOPC import. It does not happen with any other libraries (that I tried). And it's not an error message since OpenOPC works perfectly fine. I'm just afraid that I somehow messed up something which might catch me later.</p> <p>I couldn't find a clue in <code>OpenOPC.py</code> as to when this message might get printed.</p> <p>The error persists after rebooting.</p> <p>So what happened here? How can I fix it?</p>
4
2016-08-08T13:26:31Z
38,830,626
<p>It's possible that your script is getting imported before (or because Python thinks it is part of) the <code>OpenOPC</code> library. Is your script by chance called <code>OpenOPC.py</code> or similar, or does it reside in a <a href="http://docs.python-guide.org/en/latest/writing/structure/#packages" rel="nofollow">package/folder hierarchy</a>?</p> <p>Alternatively, where did you save your original script? Is it in the package/module hierarchy of OpenOPC? That might also trigger its load in some unusual cases.</p> <p>Lastly: does the error behavior reoccur if your run your <code>python somescript.py</code> (where <code>somescript.py</code> is <em>not</em> the one containing the script content at the top of your question) from a new/different directory than the one you've been usually running it from?</p> <p>All of those tweaks will try to isolate the problem away from the situation in which your script is getting interpreted as part of the OpenOPC module. That's an unusual situation to be in, but is possible; if the problematic behavior goes away due to any of those steps, move/rename your script.</p>
1
2016-08-08T13:33:42Z
[ "python" ]
How to take info from particular amount of elements with the same class name?
38,830,500
<p>I have a lot of tables on the same screen. And i need to take tex from only one of it Simple example: Table:Phone</p> <pre><code>div id="phone_type" type-id="pass" class="panel panel-default sort_table"&gt; &lt;div class="panel-heading"&gt; &lt;h3 class="panel-title"&gt;PHONE&lt;/h3&gt; &lt;/div&gt; &lt;ul class="list-group ui-sortable"&gt; &lt;li class="list-group-item ui-sortable-handle" id="pass"&gt; &lt;div class="row"&gt; &lt;div class="col-md-8 col-xs-8 increase_padding"&gt;Home&lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" href="pass"&gt;Edit&lt;/a&gt; &lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" rel="nofollow" data-method="delete" href="pass"&gt;Delete&lt;/a&gt; &lt;/div&gt; &lt;/div&gt; &lt;/li&gt; &lt;li class="list-group-item ui-sortable-handle" id="pass"&gt; &lt;div class="row"&gt; &lt;div class="col-md-8 col-xs-8 increase_padding"&gt;Work&lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" href="pass"&gt;Edit&lt;/a&gt; &lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" rel="nofollow" data-method="delete" href="pass"&gt;Delete&lt;/a&gt; &lt;/div&gt; &lt;/div&gt; &lt;/li&gt; &lt;/ul&gt; &lt;/form&gt; &lt;/div&gt; &lt;/div&gt; </code></pre> <p>Table:Condo</p> <pre><code> &lt;div id="condo_type" type-id="pass" class="panel panel-default sort_table"&gt; &lt;div class="panel-heading"&gt; &lt;h3 class="panel-title"&gt;CONDO&lt;/h3&gt; &lt;/div&gt; &lt;ul class="list-group ui-sortable"&gt; &lt;li class="list-group-item ui-sortable-handle" id="pass"&gt; &lt;div class="row"&gt; &lt;div class="col-md-8 col-xs-8 increase_padding"&gt;Limited&lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" href="pass"&gt;Edit&lt;/a&gt; &lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" rel="nofollow" data-method="delete" href="pass"&gt;Delete&lt;/a&gt; &lt;/div&gt; &lt;/div&gt; &lt;/li&gt; &lt;li class="list-group-item ui-sortable-handle" id="pass"&gt; &lt;div class="row"&gt; &lt;div class="col-md-8 col-xs-8 increase_padding"&gt;Free&lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" href="pass"&gt;Edit&lt;/a&gt; &lt;/div&gt; &lt;div class="col-md-2 col-xs-2 text-center"&gt; &lt;a data-remote="true" rel="nofollow" data-method="delete" href="pass"&gt;Delete&lt;/a&gt; &lt;/div&gt; &lt;/div&gt; &lt;/li&gt; &lt;/ul&gt; &lt;/form&gt; &lt;/div&gt; &lt;/div&gt; </code></pre> <p>And i need to take text of <code>col-md-8 col-xs-8 increase_padding</code></p> <p>But the problem is that when i am using:</p> <pre><code>table_content = driver.find_elements_by_css_selector('.col-md-8.col-xs-8.increase_padding') </code></pre> <p>it also takes info from tables that i am currently don't need. But i need to take text only from 1 particular table. Those tables are dynamic, so I can't take particular amount from </p> <pre><code>table_content </code></pre> <p>and append it to another list. Is it a way to address to particular table and work with its outer HTML?</p>
0
2016-08-08T13:28:16Z
38,830,711
<p>Just make <em>context-specific searches</em>. E.g. If you need this element from a "phone type" table:</p> <pre><code>phone_type = driver.find_element_by_id("phone_type") print(phone_type.find_element_by_css_selector('.col-md-8.col-xs-8.increase_padding').text) </code></pre> <p>Or, in one go:</p> <pre><code>print(driver.find_element_by_css_selector('#phone_type .col-md-8.col-xs-8.increase_padding').text) </code></pre>
4
2016-08-08T13:37:43Z
[ "python", "selenium-webdriver" ]
To redirect os.system() output to a .txt file
38,830,596
<p>I'm new to Python. I have list of Unix commmands <code>("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev")</code> and I want to run them and redirect the entire output to a <code>.txt</code> file. I searched a lot but didn't get a proper solution, or I understood things wrongly.</p> <p>I'm able to get the output on stdout with this for loop but I can't redirect to a file. </p> <pre><code>def commandsoutput(): command = ("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev") for i in command: print (os.system(i)) commandsoutput() </code></pre>
2
2016-08-08T13:32:29Z
38,830,757
<p>This answer uses <code>os.popen</code>, which allows you to write the output of the command in your file:</p> <pre><code>import os def commandsoutput(): commands = ("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev") with open('output.txt','a') as outfile: for command in commands: outfile.write(os.popen(command).read()+"\n") commandsoutput() </code></pre>
1
2016-08-08T13:39:59Z
[ "python" ]
To redirect os.system() output to a .txt file
38,830,596
<p>I'm new to Python. I have list of Unix commmands <code>("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev")</code> and I want to run them and redirect the entire output to a <code>.txt</code> file. I searched a lot but didn't get a proper solution, or I understood things wrongly.</p> <p>I'm able to get the output on stdout with this for loop but I can't redirect to a file. </p> <pre><code>def commandsoutput(): command = ("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev") for i in command: print (os.system(i)) commandsoutput() </code></pre>
2
2016-08-08T13:32:29Z
38,830,786
<p><code>os.system</code> returns the exit code of the command, not its output. It is also deprecated. </p> <p>Use <code>subprocess</code> instead:</p> <pre><code>import subprocess def commandsoutput(): command = ("uname -a","uptime","df -h","ifconfig -a","chkconfig --list","netstat -rn","cat /proc/meminfo","ls -l /dev") with open('log.txt', 'a') as outfile: for i in command: subprocess.call(i, stdout=outfile) commandsoutput() </code></pre>
3
2016-08-08T13:41:12Z
[ "python" ]
Access Jupyter notebook running on Docker container
38,830,610
<p>I created a docker image with python libraries and Jupyter. I start the container with the option <code>-p 8888:8888</code>, to link ports between host and container. When I launch a Jupyter kernel inside the container, it is running on <code>localhost:8888</code> (and does not find a browser). I used the command <code>jupyter notebook</code></p> <p>But from my host, what is the IP address I have to use to work with Jupyter in host's browser ? </p> <p>With the command <code>ifconfig</code>, I find <code>eth0</code>, <code>docker</code>, <code>wlan0</code>, <code>lo</code> ...</p> <p>Thanks ! </p>
0
2016-08-08T13:33:01Z
38,936,551
<p>You need to run your notebook on <code>0.0.0.0</code>: <code>jupyter notebook -i 0.0.0.0</code>. Running on localhost make it available only from inside the container.</p>
0
2016-08-13T20:07:00Z
[ "python", "docker", "jupyter-notebook" ]
How to represent fractions in python
38,830,869
<p>I am trying to implement a method that takes a matrix from the matrix class i've defined and returns a triagonal matrix using gaussian elimination. Consider the following matrix:</p> <pre><code>m1 = [[2, -3, -4], [-1, 4, 5], [1, -3, -4]] </code></pre> <p>Basically i need to add to each row, a multiple of another previous row, until i end up with a matrix which has 0 in all places below the main diagonal. Following this process, i should have the following matrix:</p> <pre><code>m2 = [[2, -3, -4], [0, 5/2, 3], [0, 0, -1/5]] </code></pre> <p>The problem is that fractions like 1/3 will often come up and i wouldn't want to lose precision by using floats. So is there any way to represent fractions? Will i have to define special behaviour for those? For the sake of doing it by myself i don't want to use any external modules.</p>
-1
2016-08-08T13:45:24Z
38,830,986
<p>There is a class that does exactly what you want: <a href="https://docs.python.org/3.5/library/fractions.html" rel="nofollow"><code>fractions.Fraction</code></a>:</p> <pre><code>&gt;&gt;&gt; from fractions import Fraction &gt;&gt;&gt; print(Fraction(5, 6)) 5/6 </code></pre> <p>Fractions behave like regular numbers in most situations:</p> <pre><code>&gt;&gt;&gt; print(Fraction(5, 6) + 6) 41/6 &gt;&gt;&gt; print(Fraction(5, 6) + Fraction(1, 2)) 4/3 &gt;&gt;&gt; print(Fraction(5, 6) + 17.445) 18.278333333333332 </code></pre> <p>The last example shows that the fraction gets converted to a <code>float</code> if the other operand is a <code>float</code>. This makes sense, since you would not expect a float of undetermined precision to be converted to a <code>Fraction</code>.</p>
1
2016-08-08T13:50:26Z
[ "python", "matrix", "fractions" ]
Django update model entry using form fails
38,830,937
<p>I want to update a model entry using a form. the problem is that instead of updating the entry it creates a new entry.</p> <pre><code>def edit(request, c_id): instance = get_object_or_404(C, id=int(c_id)) if request.POST: form = CForm(request.POST, instance=instance) if form.is_valid(): form.save() return redirect('/a/b', c_id) else: form = CForm(instance=instance) args = {} args.update(csrf(request)) args['form'] = form args['c_id'] = c_id return render_to_response('a/b.html', args) </code></pre> <p>HTML code:</p> <pre><code>&lt;form action="/a/edit/{{ c_id }}/" method="post"&gt; {% csrf_token %} {% for field in form %} &lt;div class="fieldWrapper"&gt; {{ field.errors }} {{ field.label_tag }} {{ field }} {% if field.help_text %} &lt;p class="help"&gt;{{ field.help_text|safe }}&lt;/p&gt; {% endif %} &lt;/div&gt; {% endfor %} &lt;input type="submit" value="Submit"/&gt; &lt;/form&gt; </code></pre> <p>CForm class code</p> <pre><code>class CForm(forms.ModelForm): class Meta: model = C fields = ['name', 'code'] </code></pre>
0
2016-08-08T13:48:12Z
38,831,117
<p>You're checking the request for a <code>POST</code> method incorrectly. <a href="https://docs.djangoproject.com/ja/1.9/ref/request-response/#django.http.HttpRequest.POST" rel="nofollow"><code>request.POST</code></a> isn't a boolean, it contains a dictionary of post variables and is always going to have the CSRF token in it so it will always be "truthy". What you need is <a href="https://docs.djangoproject.com/ja/1.9/ref/request-response/#django.http.HttpRequest.method" rel="nofollow"><code>request.method</code></a>.</p> <p>Instead of:</p> <pre><code>if request.POST: </code></pre> <p>Replace it with:</p> <pre><code>if request.method == "POST": </code></pre>
2
2016-08-08T13:56:22Z
[ "python", "django", "forms" ]
How to make a function determining the winner of Tic-Tac-Toe more concise
38,830,944
<p>I'm writing a Python script which is supposed to allow human and computer players to play Tic Tac Toe. To represent the board, I'm using a 3x3 Numpy array with <code>1</code> and <code>0</code> for the marks of the players (instead of "X" and "O"). I've written the following function to determine the winner:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def winner(self): rows = [self.grid[i,:] for i in range(3)] cols = [self.grid[:,j] for j in range(3)] diag = [np.array([self.grid[i,i] for i in range(3)])] cross_diag = [np.array([self.grid[2-i,i] for i in range(3)])] lanes = np.concatenate((rows, cols, diag, cross_diag)) if any([np.array_equal(lane, np.ones(3)) for lane in lanes]): return 1 elif any([np.array_equal(lane, np.zeros(3)) for lane in lanes]): return 0 </code></pre> <p>So for example, if I execute</p> <pre><code>board = Board() board.grid = np.diag(np.ones(3)) print board.winner() </code></pre> <p>I get the result <code>1</code>. What bothers me slightly is the repetition of the <code>any</code> statements. I would think there would be a more concise, DRY way of coding this. (I was thinking of a switch/case as in MATLAB but this doesn't exist in Python). Any suggestions?</p>
2
2016-08-08T13:48:32Z
38,831,029
<p>I have made a loop instead, and return only once, to conform with PEP8 and to be honest to my personal coding standards :)</p> <p><code>enumerate</code> in the correct order will yield <code>0,zeromatrix</code> then <code>1,onematrix</code></p> <pre><code>rval = None for i,m in enumerate([np.zeros(3),np.ones(3)]): if any([np.array_equal(lane, m) for lane in lanes]): rval = i; break return rval </code></pre>
1
2016-08-08T13:52:20Z
[ "python", "numpy" ]
How to make a function determining the winner of Tic-Tac-Toe more concise
38,830,944
<p>I'm writing a Python script which is supposed to allow human and computer players to play Tic Tac Toe. To represent the board, I'm using a 3x3 Numpy array with <code>1</code> and <code>0</code> for the marks of the players (instead of "X" and "O"). I've written the following function to determine the winner:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def winner(self): rows = [self.grid[i,:] for i in range(3)] cols = [self.grid[:,j] for j in range(3)] diag = [np.array([self.grid[i,i] for i in range(3)])] cross_diag = [np.array([self.grid[2-i,i] for i in range(3)])] lanes = np.concatenate((rows, cols, diag, cross_diag)) if any([np.array_equal(lane, np.ones(3)) for lane in lanes]): return 1 elif any([np.array_equal(lane, np.zeros(3)) for lane in lanes]): return 0 </code></pre> <p>So for example, if I execute</p> <pre><code>board = Board() board.grid = np.diag(np.ones(3)) print board.winner() </code></pre> <p>I get the result <code>1</code>. What bothers me slightly is the repetition of the <code>any</code> statements. I would think there would be a more concise, DRY way of coding this. (I was thinking of a switch/case as in MATLAB but this doesn't exist in Python). Any suggestions?</p>
2
2016-08-08T13:48:32Z
38,831,050
<p>I found out one way, by using a Lambda function:</p> <pre><code>any_lane = lambda x: any([np.array_equal(lane, x) for lane in lanes]) if any_lane(np.ones(3)): return 1 elif any_lane(np.zeros(3)): return 0 </code></pre> <p>This adds an extra line to the code but makes it more legible overall, I reckon.</p>
0
2016-08-08T13:53:26Z
[ "python", "numpy" ]
How to make a function determining the winner of Tic-Tac-Toe more concise
38,830,944
<p>I'm writing a Python script which is supposed to allow human and computer players to play Tic Tac Toe. To represent the board, I'm using a 3x3 Numpy array with <code>1</code> and <code>0</code> for the marks of the players (instead of "X" and "O"). I've written the following function to determine the winner:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def winner(self): rows = [self.grid[i,:] for i in range(3)] cols = [self.grid[:,j] for j in range(3)] diag = [np.array([self.grid[i,i] for i in range(3)])] cross_diag = [np.array([self.grid[2-i,i] for i in range(3)])] lanes = np.concatenate((rows, cols, diag, cross_diag)) if any([np.array_equal(lane, np.ones(3)) for lane in lanes]): return 1 elif any([np.array_equal(lane, np.zeros(3)) for lane in lanes]): return 0 </code></pre> <p>So for example, if I execute</p> <pre><code>board = Board() board.grid = np.diag(np.ones(3)) print board.winner() </code></pre> <p>I get the result <code>1</code>. What bothers me slightly is the repetition of the <code>any</code> statements. I would think there would be a more concise, DRY way of coding this. (I was thinking of a switch/case as in MATLAB but this doesn't exist in Python). Any suggestions?</p>
2
2016-08-08T13:48:32Z
38,831,389
<p>Another option is to check the sum of <code>lanes</code>.</p> <pre><code> s = np.sum(lanes, axis=1) if 3 in s: return 1 elif 0 in s: return 0 </code></pre>
2
2016-08-08T14:06:35Z
[ "python", "numpy" ]
How to make a function determining the winner of Tic-Tac-Toe more concise
38,830,944
<p>I'm writing a Python script which is supposed to allow human and computer players to play Tic Tac Toe. To represent the board, I'm using a 3x3 Numpy array with <code>1</code> and <code>0</code> for the marks of the players (instead of "X" and "O"). I've written the following function to determine the winner:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def winner(self): rows = [self.grid[i,:] for i in range(3)] cols = [self.grid[:,j] for j in range(3)] diag = [np.array([self.grid[i,i] for i in range(3)])] cross_diag = [np.array([self.grid[2-i,i] for i in range(3)])] lanes = np.concatenate((rows, cols, diag, cross_diag)) if any([np.array_equal(lane, np.ones(3)) for lane in lanes]): return 1 elif any([np.array_equal(lane, np.zeros(3)) for lane in lanes]): return 0 </code></pre> <p>So for example, if I execute</p> <pre><code>board = Board() board.grid = np.diag(np.ones(3)) print board.winner() </code></pre> <p>I get the result <code>1</code>. What bothers me slightly is the repetition of the <code>any</code> statements. I would think there would be a more concise, DRY way of coding this. (I was thinking of a switch/case as in MATLAB but this doesn't exist in Python). Any suggestions?</p>
2
2016-08-08T13:48:32Z
38,832,650
<p>This can be done in two lines, starting from the board (<code>grid</code>): simple sums along columns, rows and the two main diagonals gives you a value of 0 or 3 depending on who is winning (or some intermediate values only if nobody is winning). You can thus calculate something like:</p> <pre><code># Score along each column, row and both main diagonals: scores = (grid.sum(axis=0).tolist() + grid.sum(axis=1).tolist() +[grid.trace(), np.flipud(grid).trace()]) # If there is no winner, None is declared the winner: print "Winner:", 1 if 3 in scores else 0 if 0 in scores else None </code></pre> <p>where <code>flipud()</code> transforms the diagonal into the anti-diagonal (the diagonal at 90° from the main diagonal) by flipping the array horizontally, so that a simple <code>trace()</code> gives the total value along the anti-diagonal.</p>
0
2016-08-08T15:05:14Z
[ "python", "numpy" ]
tkinter populate treeview using threading pool
38,830,958
<p>I'm looking for "best" way to populate treeview using threads. I have multiple mail account which I'm checking for new emails.</p> <p>My plan is to use <code>Queue</code> to store accounts which will be checked using <code>check_mail</code> method. This method will return a list of new mails.</p> <p>Can I use another <code>Queue</code> which I will populate with new mails and somehow loop while threads are alive?</p> <p>Is there any thread-safe, good pattern to solve this?</p>
0
2016-08-08T13:49:17Z
38,832,489
<p>Your question is very broad, so this answer will also be.</p> <p>Generally speaking, <code>tkinter</code> doesn't play well with multi-threading. You can do it, but must make sure only the main thread interacts with the GUI. A common way to do this is to use the <a href="http://infohost.nmt.edu/tcc/help/pubs/tkinter/web/universal.html" rel="nofollow">universal widget method</a> <code>after()</code> to schedule handling of data going out to or being retrieved from background threads, typically via <code>Queue</code>s, at regular intervals.</p>
0
2016-08-08T14:58:12Z
[ "python", "multithreading", "design-patterns", "tkinter" ]
tkinter populate treeview using threading pool
38,830,958
<p>I'm looking for "best" way to populate treeview using threads. I have multiple mail account which I'm checking for new emails.</p> <p>My plan is to use <code>Queue</code> to store accounts which will be checked using <code>check_mail</code> method. This method will return a list of new mails.</p> <p>Can I use another <code>Queue</code> which I will populate with new mails and somehow loop while threads are alive?</p> <p>Is there any thread-safe, good pattern to solve this?</p>
0
2016-08-08T13:49:17Z
38,868,204
<p>I'm not sure if this is the best idea but it works</p> <pre><code>class Main(tk.Frame): def __init__(self, master): tk.Frame.__init__(self, master) self.master = master self.some_service = SomeService() self.some_service.run() self.init_gui() self.after(60000, self.check_for_updates) # Use it to run service self.after(2000, self.update_gui) # Update GUI every 2 seconds. def check_for_updates(self): data = ['a', 'b', 'c', 'd'] self.some_service.populate_job_queue(data) self.after(60000, self.check_for_updates) def update_gui(self): if not self.some_service.update_queue.empty(): update = self.some_service.update_queue.get() ## Do something with update ## self.text.insert(tk.END, update) self.after(2000, self.update_gui) class SomeService(object): def __init__(self): self.update_queue = Queue() self.job_queue = Queue() def populate_job_queue(self, jobs): for job in jobs: self.job_queue.put(job) def run(self): for x in range(8): worker = Thread(target=self.do_something, daemon=True) worker.start() def do_something(self): ## Do something with data while True: if not self.job_queue.empty(): job = self.job_queue.get() # Do something self.update_queue.put(some_data) </code></pre>
0
2016-08-10T08:37:24Z
[ "python", "multithreading", "design-patterns", "tkinter" ]
Extract subarray from collection of 2D coordinates?
38,831,006
<p>In Python, I have a large 2D array containing data, and another Mx2 2D array containing a collection of M 2D coordinates of interest, e.g.</p> <pre><code>coords=[[150, 123], [151, 123], [152, 124], [153, 125]] </code></pre> <p>I would like to extract the Mx1 array containing the values of the data array at these coordinates (indices) locations. Obviously, <code>data[coords]</code> does not work.</p> <p>I suspect there is an easy way to do that, but stackoverflow failed me up to now. Thanks in advance for your help.</p> <p>EDIT: An example would be</p> <pre><code>data=[[0, 0, 0, 0, 0, 0, 1, 0], [0, 0, 0, 1, 2, 1, 0, 0], [0, 0, 0, 1, 23, 40, 0, 0], [0, 0, 0, 1, 1, 2, 0, 0], [0, 0, 3, 2, 0, 0, 0, 0], [0, 0, 4, 5, 6, 2, 1, 0], [0, 0, 0, 0, 1, 20, 0, 0], [0, 0, 0, 3, 1, 2, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0]] coords=[[1,4],[2,4],[2,5],[5,3],[6,5]] </code></pre> <p>and the desired output would be</p> <pre><code>out=[2,23,40,5,20] </code></pre>
2
2016-08-08T13:51:19Z
38,831,291
<p>You could use a <a href="http://docs.python.org/tutorial/datastructures.html#list-comprehensions" rel="nofollow">list comprehension</a>:</p> <pre><code>In [73]: [data[i][j] for i,j in coords] Out[73]: [2, 23, 40, 5, 20] </code></pre> <p>The result returned by the list comprehension is equivalent to</p> <pre><code>result = [] for i,j in coords: result.append(data[i][j]) </code></pre>
2
2016-08-08T14:02:59Z
[ "python", "arrays" ]
Twitter Streaming in Python: cp949 codec
38,831,077
<p>I am currently using tweepy to gather data using Streaming API.</p> <p>Here is my code and I ran this on Acaconda command prompt. When streaming starts, it returns tweets and then after giving few tweets it gives the following error:</p> <pre><code>Streaming Started ... RT @ish10040: Crack Dealer Released Early From Prison By Obama Murders Woman And Her 2 Young Kids… Exception in thread Thread-1: Traceback (most recent call last): File "C:\Users\Jae Hee\Anaconda2\lib\threading.py", line 801, in __bootstrap_inner self.run() File "C:\Users\Jae Hee\Anaconda2\lib\threading.py", line 754, in run self.__target(*self.__args, **self.__kwargs) File "C:\Users\Jae Hee\Anaconda2\lib\site-packages\tweepy\streaming.py", line 294, in _run raise exception UnicodeEncodeError: 'cp949' codec can't encode character u'\xab' in position 31: illegal multibyte sequence </code></pre> <p>I believe that it has to do with encoding so I used chcp 65001 to deal with this issue but it does not give the solution!</p> <p>Here is the code</p> <pre><code>auth = tweepy.OAuthHandler(consumer_key, consumer_secret) auth.set_access_token(access_token, access_token_secret) api = tweepy.API(auth) class MyStreamListener(tweepy.StreamListener): def on_status(self, status): print(status.text) def on_error(self, status_code): #returning False in on_data disconnects the stream if status_code == 420: return False def main(): myStreamListener = MyStreamListener() myStream = tweepy.Stream(auth = api.auth, listener = myStreamListener) print "Streaming Started ..." try: myStream.filter(track=['Obama'], async = True) except: print "error!" myStream.disconnect() if __name__ == '__main__': main() </code></pre>
0
2016-08-08T13:54:39Z
38,831,233
<p>All text produced and accepted through the twitter API should be encoded as UTF-8, so your code should be using that codec to decode what's coming back.</p> <p>See here: <a href="https://dev.twitter.com/overview/api/counting-characters" rel="nofollow">https://dev.twitter.com/overview/api/counting-characters</a></p>
0
2016-08-08T14:00:48Z
[ "python", "twitter", "tweepy" ]
Remove cancelling rows from Pandas Dataframe
38,831,088
<p>I have a list of invoices sent out to customers. However, sometimes a bad invoice is sent, which is later cancelled. My Pandas Dataframe looks something like this, except much larger (~3 million rows)</p> <pre><code>index | customer | invoice_nr | amount | date --------------------------------------------------- 0 | 1 | 1 | 10 | 01-01-2016 1 | 1 | 1 | -10 | 01-01-2016 2 | 1 | 1 | 11 | 01-01-2016 3 | 1 | 2 | 10 | 02-01-2016 4 | 2 | 3 | 7 | 01-01-2016 5 | 2 | 4 | 12 | 02-01-2016 6 | 2 | 4 | 8 | 02-01-2016 7 | 2 | 4 | -12 | 02-01-2016 8 | 2 | 4 | 4 | 02-01-2016 ... | ... | ... | ... | ... ... | ... | ... | ... | ... </code></pre> <p>Now, I want to drop all rows for which the <code>customer</code>, <code>invoice_nr</code> and <code>date</code> are identical, but the <code>amount</code> has opposite values.<br> Corrections of invoices always take place on the same day with identical invoice number. The invoice number is uniquely bound to the customer and always corresponds to one transaction (which can consist of multiple components, for example for <code>customer = 2</code>, <code>invoice_nr = 4</code>). Corrections of invoices only occur either to change <code>amount</code> charged, or to split <code>amount</code> in smaller components. Hence, the cancelled value is not repeated on the same <code>invoice_nr</code>.</p> <p>Any help how to program this would be much appreciated.</p>
4
2016-08-08T13:55:02Z
38,832,006
<p>What if you just do a groupby on all 3 fields? The resulting sums would net out any canceled invoices:</p> <pre><code>df2 = df.groupby(['customer','invoice_nr','date']).sum() </code></pre> <p>results in</p> <pre><code>customer invoice_nr date 1 1 2016/01/01 11 2 2016/02/01 10 2 3 2016/01/01 7 </code></pre>
0
2016-08-08T14:35:12Z
[ "python", "pandas" ]
Remove cancelling rows from Pandas Dataframe
38,831,088
<p>I have a list of invoices sent out to customers. However, sometimes a bad invoice is sent, which is later cancelled. My Pandas Dataframe looks something like this, except much larger (~3 million rows)</p> <pre><code>index | customer | invoice_nr | amount | date --------------------------------------------------- 0 | 1 | 1 | 10 | 01-01-2016 1 | 1 | 1 | -10 | 01-01-2016 2 | 1 | 1 | 11 | 01-01-2016 3 | 1 | 2 | 10 | 02-01-2016 4 | 2 | 3 | 7 | 01-01-2016 5 | 2 | 4 | 12 | 02-01-2016 6 | 2 | 4 | 8 | 02-01-2016 7 | 2 | 4 | -12 | 02-01-2016 8 | 2 | 4 | 4 | 02-01-2016 ... | ... | ... | ... | ... ... | ... | ... | ... | ... </code></pre> <p>Now, I want to drop all rows for which the <code>customer</code>, <code>invoice_nr</code> and <code>date</code> are identical, but the <code>amount</code> has opposite values.<br> Corrections of invoices always take place on the same day with identical invoice number. The invoice number is uniquely bound to the customer and always corresponds to one transaction (which can consist of multiple components, for example for <code>customer = 2</code>, <code>invoice_nr = 4</code>). Corrections of invoices only occur either to change <code>amount</code> charged, or to split <code>amount</code> in smaller components. Hence, the cancelled value is not repeated on the same <code>invoice_nr</code>.</p> <p>Any help how to program this would be much appreciated.</p>
4
2016-08-08T13:55:02Z
38,832,078
<pre><code>def remove_cancelled_transactions(df): trans_neg = df.amount &lt; 0 return df.loc[~(trans_neg | trans_neg.shift(-1))] groups = [df.customer, df.invoice_nr, df.date, df.amount.abs()] df.groupby(groups, as_index=False, group_keys=False) \ .apply(remove_cancelled_transactions) </code></pre> <p><a href="http://i.stack.imgur.com/dag21.png" rel="nofollow"><img src="http://i.stack.imgur.com/dag21.png" alt="enter image description here"></a></p>
3
2016-08-08T14:38:15Z
[ "python", "pandas" ]
Remove cancelling rows from Pandas Dataframe
38,831,088
<p>I have a list of invoices sent out to customers. However, sometimes a bad invoice is sent, which is later cancelled. My Pandas Dataframe looks something like this, except much larger (~3 million rows)</p> <pre><code>index | customer | invoice_nr | amount | date --------------------------------------------------- 0 | 1 | 1 | 10 | 01-01-2016 1 | 1 | 1 | -10 | 01-01-2016 2 | 1 | 1 | 11 | 01-01-2016 3 | 1 | 2 | 10 | 02-01-2016 4 | 2 | 3 | 7 | 01-01-2016 5 | 2 | 4 | 12 | 02-01-2016 6 | 2 | 4 | 8 | 02-01-2016 7 | 2 | 4 | -12 | 02-01-2016 8 | 2 | 4 | 4 | 02-01-2016 ... | ... | ... | ... | ... ... | ... | ... | ... | ... </code></pre> <p>Now, I want to drop all rows for which the <code>customer</code>, <code>invoice_nr</code> and <code>date</code> are identical, but the <code>amount</code> has opposite values.<br> Corrections of invoices always take place on the same day with identical invoice number. The invoice number is uniquely bound to the customer and always corresponds to one transaction (which can consist of multiple components, for example for <code>customer = 2</code>, <code>invoice_nr = 4</code>). Corrections of invoices only occur either to change <code>amount</code> charged, or to split <code>amount</code> in smaller components. Hence, the cancelled value is not repeated on the same <code>invoice_nr</code>.</p> <p>Any help how to program this would be much appreciated.</p>
4
2016-08-08T13:55:02Z
38,832,926
<p>You can use <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.DataFrame.filter.html" rel="nofollow"><code>filter</code></a> all values, where each group has values where sum is <code>0</code> and modulo by <code>2</code> is <code>0</code>:</p> <pre><code>print (df.groupby([df.customer, df.invoice_nr, df.date, df.amount.abs()]) .filter(lambda x: (len(x.amount.abs()) % 2 == 0 ) and (x.amount.sum() == 0))) customer invoice_nr amount date index 0 1 1 10 01-01-2016 1 1 1 -10 01-01-2016 5 2 4 12 02-01-2016 6 2 4 -12 02-01-2016 idx = df.groupby([df.customer, df.invoice_nr, df.date, df.amount.abs()]) .filter(lambda x: (len(x.amount.abs()) % 2 == 0 ) and (x.amount.sum() == 0)).index print (idx) Int64Index([0, 1, 5, 6], dtype='int64', name='index') print (df.drop(idx)) customer invoice_nr amount date index 2 1 1 11 01-01-2016 3 1 2 10 02-01-2016 4 2 3 7 01-01-2016 7 2 4 8 02-01-2016 8 2 4 4 02-01-2016 </code></pre> <p>EDIT by comment:</p> <p>If in real data are not duplicates for one invoice and one customer and one date, so you can use this way:</p> <pre><code> print (df) index customer invoice_nr amount date 0 0 1 1 10 01-01-2016 1 1 1 1 -10 01-01-2016 2 2 1 1 11 01-01-2016 3 3 1 2 10 02-01-2016 4 4 2 3 7 01-01-2016 5 5 2 4 12 02-01-2016 6 6 2 4 -12 02-01-2016 7 7 2 4 8 02-01-2016 8 8 2 4 4 02-01-2016 df['amount_abs'] = df.amount.abs() df.drop_duplicates(['customer','invoice_nr', 'date', 'amount_abs'], keep=False, inplace=True) df.drop('amount_abs', axis=1, inplace=True) print (df) index customer invoice_nr amount date 2 2 1 1 11 01-01-2016 3 3 1 2 10 02-01-2016 4 4 2 3 7 01-01-2016 7 7 2 4 8 02-01-2016 8 8 2 4 4 02-01-2016 </code></pre>
2
2016-08-08T15:18:03Z
[ "python", "pandas" ]
Convert Python to Java 8
38,831,101
<p>I’m working in a project that use java 8, this project is about get some geographic information and work with this. I already have done part of this work in python, and now I’m translating this part did in Python to java 8, well in Python I use this lines bellow to convert coordinates in Google format to Postgis format:</p> <pre><code>s1 = tuple(value.split(" ")) s2 = zip(s1[1::2], s1[::2]) </code></pre> <p><strong>For example:</strong></p> <p>I have a entrance like: value = "<strong>11.12345679</strong> <em>12.987655</em> <strong>11.3434454</strong> <em>12.1223323</em>" and so on The Python code above changes de entrance to: s2 = "<em>12.987655</em> <strong>11.12345679</strong> <em>12.1223323</em>" and so on.</p> <p>Changing the position of each coordinate pair, each entrance have thousands of coordinates. To get the same effect with java (before java 8): Using my knowledge of java (acquired before the java 8) I will need do that:</p> <pre><code>try { String result = "", right = "", left = ""; String[] txt = str.split(" "); for (int i = 0; i &lt; txt.length; i += 2) { right = txt[i]; left = txt[i + 1]; result += "," + left + " " + right; } return result.substring(1); } catch (ArrayIndexOutOfBoundsException e) { return null; } </code></pre> <p>I will execute the java code above thousands of times, my question is: Java 8 has some new way to do this code above more like Python ?</p> <p>My motivation to ask that question is because I came across with this news about Java 8:</p> <pre><code>List&lt;String&gt; someList = new ArrayList&lt;&gt;(); // Add some elements someList.add("Generic (1.5)"); someList.add("Functional (8)"); // Open a stream someList.stream() // Turn all texts in Upper Case .map(String::toUpperCase) // Loop all elemnst in Upper Case .forEach(System.out::println); </code></pre> <p><strong>Updating:</strong></p> <p>The solution of Jean-François Savard was perfect using Java 8 like I asked, thank you so much Jean-Francois Savard</p> <pre><code>String str = "11.12345679 12.987655 11.3434454 12.1223323 11.12345679 12.987655 11.3434454 12.1223323"; String[] strs = str.split(" "); str = IntStream.range(0, strs.length) .filter(i -&gt; i % 2 == 0) .mapToObj(i -&gt; strs[i + 1] + " " + strs[i]) .collect(Collectors.joining(",")); System.out.println(str); &gt;&gt; 12.987655 11.12345679,12.1223323 11.3434454,12.987655 11.12345679,12.1223323 11.3434454 </code></pre> <p>The solution shown by Vampire and Tukayi fit perfectly in my problem, thanks a lot guys</p> <pre><code>String str = "11.12345679 12.987655 11.3434454 12.1223323 11.12345679 12.987655 11.3434454 12.1223323"; str = str.replaceAll("([^\\s]+) ([^\\s]+)(?: |$)", ",$2 $1").substring(1); System.out.println(str); </code></pre>
-4
2016-08-08T13:55:33Z
38,831,186
<p>Java 8 added (among other things) Lambdas, Streams and Functional interfaces.</p> <p>You can use streams to simplify looping over objects. But the syntax like you see in Python isn't the same as in java like that.</p>
-5
2016-08-08T13:58:53Z
[ "java", "python", "postgis" ]
Convert Python to Java 8
38,831,101
<p>I’m working in a project that use java 8, this project is about get some geographic information and work with this. I already have done part of this work in python, and now I’m translating this part did in Python to java 8, well in Python I use this lines bellow to convert coordinates in Google format to Postgis format:</p> <pre><code>s1 = tuple(value.split(" ")) s2 = zip(s1[1::2], s1[::2]) </code></pre> <p><strong>For example:</strong></p> <p>I have a entrance like: value = "<strong>11.12345679</strong> <em>12.987655</em> <strong>11.3434454</strong> <em>12.1223323</em>" and so on The Python code above changes de entrance to: s2 = "<em>12.987655</em> <strong>11.12345679</strong> <em>12.1223323</em>" and so on.</p> <p>Changing the position of each coordinate pair, each entrance have thousands of coordinates. To get the same effect with java (before java 8): Using my knowledge of java (acquired before the java 8) I will need do that:</p> <pre><code>try { String result = "", right = "", left = ""; String[] txt = str.split(" "); for (int i = 0; i &lt; txt.length; i += 2) { right = txt[i]; left = txt[i + 1]; result += "," + left + " " + right; } return result.substring(1); } catch (ArrayIndexOutOfBoundsException e) { return null; } </code></pre> <p>I will execute the java code above thousands of times, my question is: Java 8 has some new way to do this code above more like Python ?</p> <p>My motivation to ask that question is because I came across with this news about Java 8:</p> <pre><code>List&lt;String&gt; someList = new ArrayList&lt;&gt;(); // Add some elements someList.add("Generic (1.5)"); someList.add("Functional (8)"); // Open a stream someList.stream() // Turn all texts in Upper Case .map(String::toUpperCase) // Loop all elemnst in Upper Case .forEach(System.out::println); </code></pre> <p><strong>Updating:</strong></p> <p>The solution of Jean-François Savard was perfect using Java 8 like I asked, thank you so much Jean-Francois Savard</p> <pre><code>String str = "11.12345679 12.987655 11.3434454 12.1223323 11.12345679 12.987655 11.3434454 12.1223323"; String[] strs = str.split(" "); str = IntStream.range(0, strs.length) .filter(i -&gt; i % 2 == 0) .mapToObj(i -&gt; strs[i + 1] + " " + strs[i]) .collect(Collectors.joining(",")); System.out.println(str); &gt;&gt; 12.987655 11.12345679,12.1223323 11.3434454,12.987655 11.12345679,12.1223323 11.3434454 </code></pre> <p>The solution shown by Vampire and Tukayi fit perfectly in my problem, thanks a lot guys</p> <pre><code>String str = "11.12345679 12.987655 11.3434454 12.1223323 11.12345679 12.987655 11.3434454 12.1223323"; str = str.replaceAll("([^\\s]+) ([^\\s]+)(?: |$)", ",$2 $1").substring(1); System.out.println(str); </code></pre>
-4
2016-08-08T13:55:33Z
38,844,665
<p>Define the following in your class to precompile a Regex pattern</p> <pre><code>private static final Pattern pattern = Pattern.compile("([^ ]++) ([^ ]++)(?: |$)"); </code></pre> <p>Then in your method use</p> <pre><code>if ((new StringTokenizer(str, " ").countTokens() % 2) == 1) { return null; } return pattern.matcher(str).replaceAll(",$2 $1").substring(1); </code></pre> <p>to get the same result as in your original code.</p> <hr> <p>If you depend on using Streams why-o-ever, here a Streams solution</p> <pre><code>String[] strs = str.split(" "); return IntStream.range(0, strs.length) .filter(i -&gt; i % 2 == 0) .mapToObj(i -&gt; strs[i + 1] + " " + strs[i]) .collect(Collectors.joining(",")); </code></pre>
0
2016-08-09T07:31:57Z
[ "java", "python", "postgis" ]
Annotation DB has no 'select' method in rpy2
38,831,169
<p>I have the following code in R:</p> <pre><code>require(hgu133a.db) entrezIDs &lt;- select(hgu133a.db, probeNames, "ENTREZID") </code></pre> <p>where <code>probeNames</code> is a list of strings corresponding to probes found in this database.</p> <p>I am attempting to translate it to Python using rpy2:</p> <pre><code>from rpy2.robjects.packages import importr hgu133a_db = importr('hgu133a.db') entrez_ids = hgu133a_db.select(hgu133a_db, probe_names, 'ENTREZID') </code></pre> <p>But receive the error:</p> <blockquote> <p>AttributeError: module 'hgu133a.db' has no attribute 'select'</p> </blockquote> <p>I've searched the documentation (<code>?select</code>) and as far as I can tell the database <strong>hgu133a.db</strong> inherits a <code>select</code> method from the <strong>AnnotationDbi</strong> class.</p> <p>How do I properly resolve the library where <code>select()</code> is coming from, so I can use it in Python?</p>
0
2016-08-08T13:58:20Z
38,832,083
<p>Apparently there are two issues with the above. First, <strong>AnnotationDbi</strong> should be used to resolve the <code>select()</code> method. Second, <code>hgu133a_db</code> is an <strong>InstallSTPackage</strong> object - instead one must use <code>hgu133a_db.hgu133a_db</code>. Putting it together, the translation from R to Python is:</p> <pre><code>from rpy2.robjects.packages import importr annotation_dbi = importr('AnnotationDbi') hgu133a_db = importr('hgu133a.db') entrez_ids = annotation_dbi.select(hgu133a_db.hgu133a_db, probe_names, 'ENTREZID') </code></pre>
0
2016-08-08T14:38:28Z
[ "python", "rpy2", "bioconductor" ]
Annotation DB has no 'select' method in rpy2
38,831,169
<p>I have the following code in R:</p> <pre><code>require(hgu133a.db) entrezIDs &lt;- select(hgu133a.db, probeNames, "ENTREZID") </code></pre> <p>where <code>probeNames</code> is a list of strings corresponding to probes found in this database.</p> <p>I am attempting to translate it to Python using rpy2:</p> <pre><code>from rpy2.robjects.packages import importr hgu133a_db = importr('hgu133a.db') entrez_ids = hgu133a_db.select(hgu133a_db, probe_names, 'ENTREZID') </code></pre> <p>But receive the error:</p> <blockquote> <p>AttributeError: module 'hgu133a.db' has no attribute 'select'</p> </blockquote> <p>I've searched the documentation (<code>?select</code>) and as far as I can tell the database <strong>hgu133a.db</strong> inherits a <code>select</code> method from the <strong>AnnotationDbi</strong> class.</p> <p>How do I properly resolve the library where <code>select()</code> is coming from, so I can use it in Python?</p>
0
2016-08-08T13:58:20Z
38,884,147
<p>[should have been a comment to @merv 's answer, but exceeded the number characters]</p> <p><code>rpy2</code>'s <code>importr()</code> is trying to help a being specific about which package namespace an R object is coming from, while R's common usage is much less so (and can lead to annoyances such as the loading order of R packages having an influence on which one of the functions with the same name is executed).</p> <p>The tradeoff with <code>importr</code> is that one has to know where an R symbol is coming from. There is a less-known function in <code>rpy2</code> that can help finding where a given R symbol is defined(*): <a href="https://rpy2.readthedocs.io/en/version_2.8.x/robjects_rpackages.html#finding-where-an-r-symbol-is-coming-from" rel="nofollow">https://rpy2.readthedocs.io/en/version_2.8.x/robjects_rpackages.html#finding-where-an-r-symbol-is-coming-from</a> .</p> <p>Otherwise, one can also use <code>r()</code> to retrieve the object that would be picked(*) in an R session.</p> <pre><code>from rpy2.robjects import r r('select') </code></pre> <p>(*: as mentioned earlier, the order in which R packages were loaded earlier in the session can have an influence on which R object is picked).</p>
1
2016-08-10T21:50:40Z
[ "python", "rpy2", "bioconductor" ]
Qt/Spyder scaling with 4K display
38,831,239
<p>I've recently made the switch from an old macbook pro to a razer blade stealth laptop. I have many programs that I've written that have pyqt4 GUIs, and I usually do most of my coding in spyder. Upon switching to a computer with a 4K screen spyder has become unusable as it does not scale properly, in addition all the GUIs that I have written don't scale correctly and are thus unusable.</p> <p>Does anyone have any experience with this problem and/or have any tips on how to get these things to scale correctly on high DPI screens?</p>
0
2016-08-08T14:01:00Z
38,832,329
<p>The next version of Spyder (3.0.0) will natively support high dpi screen and makes use for vector icons.</p> <p>You can try the latest beta (Spyder 3.0.0 beta4) if you want to be an early adopter.</p> <p>Check out the talk on "what's new in Spyder 3.0" at the last Scipy conference: <a href="https://www.youtube.com/watch?v=5boKDo1C144" rel="nofollow">https://www.youtube.com/watch?v=5boKDo1C144</a></p>
0
2016-08-08T14:50:21Z
[ "python", "qt", "pyqt", "spyder", "pyqtgraph" ]
JWT integration with django
38,831,298
<p>I am new to Django (not DRF) and I have a hard time configuring my authentication requirements. I have an external authentication service that gets a username and password and returns a JWT. After I have the JWT how should I save the token and provide it with every request from the browser. And after that where can I validate it?</p> <p>Thanks!</p>
0
2016-08-08T14:03:10Z
38,831,519
<p>For every call that your service get there should be header to that call</p> <pre><code>{'Authorization':'Token 9944b09199c62bcf9418ad846dd0e4bbdfc6ee4b'} </code></pre> <p>And you can use that in views.py as :</p> <pre><code> if request.user.is_authenticated(): </code></pre> <p>It has to be included in the settings file of that django project.</p> <pre><code>JWT_AUTH = { # 'JWT_ENCODE_HANDLER': # 'rest_framework_jwt.utils.jwt_encode_handler', # 'JWT_DECODE_HANDLER': # 'rest_framework_jwt.utils.jwt_decode_handler', # 'JWT_PAYLOAD_HANDLER': # 'rest_framework_jwt.utils.jwt_payload_handler', # 'JWT_PAYLOAD_GET_USER_ID_HANDLER': # 'rest_framework_jwt.utils.jwt_get_user_id_from_payload_handler', # 'JWT_RESPONSE_PAYLOAD_HANDLER': # 'rest_framework_jwt.utils.jwt_response_payload_handler', # 'JWT_SECRET_KEY': settings.SECRET_KEY, # 'JWT_ALGORITHM': 'HS256', # 'JWT_VERIFY': True, # 'JWT_VERIFY_EXPIRATION': False, # 'JWT_LEEWAY': 0, 'JWT_EXPIRATION_DELTA': datetime.timedelta(days=1), # 'JWT_AUDIENCE': None, # 'JWT_ISSUER': None, # 'JWT_ALLOW_REFRESH': False, # 'JWT_REFRESH_EXPIRATION_DELTA': datetime.timedelta(days=7), # 'JWT_AUTH_HEADER_PREFIX': 'JWT', } </code></pre> <p>Read more about it <a href="http://www.django-rest-framework.org/api-guide/authentication/#tokenauthentication" rel="nofollow">here</a>.</p>
0
2016-08-08T14:12:00Z
[ "python", "django", "jwt", "json-web-token" ]
Not getting an output when I call __str__ on a class instance?
38,831,442
<p>I am just a beginner so be easy on me. i was just playing with the <code>__str__</code> method and found that when I try to print the instance it just doesn't work</p> <pre><code>import random brand = ("Samsung","Nokia","Sony","ATAT","Reliance") no_of_sim = ("Dual-sim","Single-sim") color = ("Blue","Violet","Orange","Green") no_of_camera =("Front","Front-Back","Back") no_of_cores = ("Dual Core","Quad Core","Octa Core") additional = ("Bluetooth","NFS","Gps") class mobile: def __init__(self,**kwargs): name = self self.brand = random.choice(brand) self.sim = random.choice(no_of_sim) self.color = random.choice(color) self.camera = random.choice(no_of_camera) self.cores = random.choice(no_of_cores) self.additional = random.choice(additional) for key,value in kwargs.items(): setattr(self,key,value) def __str__(self): return "{} Is a {} color {} phone with {} facing cameras and it a {} with {}".format(self.__class__.__name__,self.color,self.brand,self.camera,self.cores,self,additional) </code></pre> <pre><code>from mobile_phone import mobile swiss = mobile() print(swiss) # It doesnt show up </code></pre>
0
2016-08-08T14:08:46Z
38,831,942
<p>There is a typo in the end of <strong>str</strong> method:</p> <pre><code>self,additional </code></pre> <p>It makes <strong>str</strong> method recursive. Changing "," to "." removes the problem.</p>
1
2016-08-08T14:32:32Z
[ "python" ]
Not getting an output when I call __str__ on a class instance?
38,831,442
<p>I am just a beginner so be easy on me. i was just playing with the <code>__str__</code> method and found that when I try to print the instance it just doesn't work</p> <pre><code>import random brand = ("Samsung","Nokia","Sony","ATAT","Reliance") no_of_sim = ("Dual-sim","Single-sim") color = ("Blue","Violet","Orange","Green") no_of_camera =("Front","Front-Back","Back") no_of_cores = ("Dual Core","Quad Core","Octa Core") additional = ("Bluetooth","NFS","Gps") class mobile: def __init__(self,**kwargs): name = self self.brand = random.choice(brand) self.sim = random.choice(no_of_sim) self.color = random.choice(color) self.camera = random.choice(no_of_camera) self.cores = random.choice(no_of_cores) self.additional = random.choice(additional) for key,value in kwargs.items(): setattr(self,key,value) def __str__(self): return "{} Is a {} color {} phone with {} facing cameras and it a {} with {}".format(self.__class__.__name__,self.color,self.brand,self.camera,self.cores,self,additional) </code></pre> <pre><code>from mobile_phone import mobile swiss = mobile() print(swiss) # It doesnt show up </code></pre>
0
2016-08-08T14:08:46Z
38,832,011
<p>You have a comma where you need a dot:</p> <pre><code>import random brand = ("Samsung","Nokia","Sony","ATAT","Reliance") no_of_sim = ("Dual-sim","Single-sim") color = ("Blue","Violet","Orange","Green") no_of_camera =("Front","Front-Back","Back") no_of_cores = ("Dual Core","Quad Core","Octa Core") additional = ("Bluetooth","NFS","Gps") class mobile: def __init__(self,**kwargs): name = self self.brand = random.choice(brand) self.sim = random.choice(no_of_sim) self.color = random.choice(color) self.camera = random.choice(no_of_camera) self.cores = random.choice(no_of_cores) self.additional = random.choice(additional) for key,value in kwargs.items(): setattr(self,key,value) def __str__(self): return("{} Is a {} color {} phone with " "{} facing cameras and it a {} with {}".format( self.__class__.__name__, self.color, self.brand, self.camera, self.cores, self.additional)) # changed from self,additional #from mobile_phone import mobile swiss = mobile() print(swiss) </code></pre> <p>Output:</p> <pre class="lang-none prettyprint-override"><code>mobile Is a Green color Reliance phone with Front-Back facing cameras and it a Dual Core with Bluetooth </code></pre>
0
2016-08-08T14:35:23Z
[ "python" ]
Am I using virtualenv wrong or is this a limitation of it?
38,831,613
<p>So I used <code>virtualenv</code> to define environments for a number of projects I am working on. I defined the <code>virtualenv</code> python as being version 3.4. Eventually, my global python was upgraded from 3.4.0 to 3.4.3. This proved to be a problem because the <code>virtualenv</code> was dependent on the global binaries (the contents of <code>/lib/python3.4</code> in my <code>virtualenv</code> is actually just links to the global binaries), and these aren't defined up to their minor versions. In other words, when the upgrade was done, the contents of the binary folder <code>/usr/lib/python3.4</code> was replaced. This is because python doesn't install things separately in 3.4.0 and 3.4.3 but only into a single folder named <code>/usr/lib/python3.4</code>. Since the python executable in my <code>virtualenv</code> was 3.4.0, there were obviously compatibility issues with the 3.4.3 binaries (it would fail to load <code>ctypes</code> which prevented just about anything python dependent to run). The only fix to this I've found is to downgrade my global python installation, but this feels "dirty". What if I had one project running 3.4.0 and another running 3.4.3 ? Is there no way to make them work in parallel on the same machine given that only one binary folder can exist for any 3.4.x installation ?</p> <p>I'm trying to understand if I'm missing something obvious here or if this is a common problem with <code>virtualenv</code>, given that I've heard quite a few people complain about issues with binares when using <code>virtualenv</code>.</p> <p>In the future, is there anyway of telling <code>virtualenvwrapper</code> to copy the binaries rather than link to them ?</p>
1
2016-08-08T14:16:14Z
38,833,295
<p>Virtualenvs were not desiged to be portable, both across machines or across Python versions.</p> <p>This means upgrading Python versions sometimes breaks virtualenvs. You need to recreate them and reinstall everything inside of it (run this in your virtualenv root):</p> <pre><code># Save a list of what you had installed pip freeze &gt; freeze.txt # Trash the entire virtualenv deactivate rm -rf lib/ bin/ share/ man/ include/ .Python pip-selfcheck.json # Create it anew virtualenv . # Install all libraries you had before pip install -r freeze.txt </code></pre>
2
2016-08-08T15:35:27Z
[ "python", "virtualenv" ]
How does asyncio's event loop know when an awaitable resource is ready?
38,831,687
<p>I'm learning Python asyncio for asynchronous programing. I know that the event loop watch over Future objects until they are ready and then resumes the appropriate coroutines to continue the execution in the point where the await keyword occurred. </p> <p>This is very understandable when you use something like <code>asyncio.sleep</code> because the sleeping function knows how many time it will take and so will know the event loop but <strong>what happens with something that relies on networking ( for example) where the waiting time is unknown?</strong>. </p> <p>How does the event loop know when a resource is ready or how many time will take to gather data from some source? </p>
0
2016-08-08T14:19:52Z
38,838,700
<blockquote> <p>How does the event loop know when a resource is ready or how many time will take to gather data from some source?</p> </blockquote> <p>The default event loop (based on <a href="https://docs.python.org/3.4/library/asyncio-eventloops.html#asyncio.SelectorEventLoop" rel="nofollow">SelectorEventLoop</a>) uses the <a href="https://docs.python.org/3.4/library/selectors.html#module-selectors" rel="nofollow">selector</a> module to keep track of all the resources to monitor and get notified when new data is ready. <a href="https://docs.python.org/3.4/library/selectors.html#selectors.BaseSelector.select" rel="nofollow">BaseSelector.select</a> is <a href="https://github.com/python/asyncio/blob/c288d5b771a4381655894e78afc97b4557c4d7f4/asyncio/base_events.py#L1276" rel="nofollow">where the magic happens</a>.</p>
2
2016-08-08T21:20:26Z
[ "python", "asynchronous", "python-asyncio" ]
Is it possible to overload operators for native datatypes?
38,831,695
<p>For example, if I try to do:</p> <pre><code>a_string + an_int </code></pre> <p>... where a_string is type 'str' and an_int is type 'int', or:</p> <pre><code>an_int + a_string </code></pre> <p>There would be a <code>TypeError</code> because there is no implicit conversion of the types. I understand that if I were using my own subclasses of int and string, I would be able to overload the <code>__add__()</code> method in my classes to achieve this. </p> <p>However, out of curiosity, I would like to know: would it be possible to overload the + operator in the class definitions of <code>int</code> and <code>str</code>, so that <code>__add__(int,str)</code> and <code>__add__(str,int)</code> automatically concatenate them as strings? </p> <p>If not, what are the reasons why a programmer should not overload the operators for a native datatype? </p>
3
2016-08-08T14:20:15Z
38,832,002
<p>In general, without reverting to the C-level API, you cannot modify attributes of builtin types (see <a href="http://stackoverflow.com/questions/2444680/how-do-i-add-my-own-custom-attributes-to-existing-built-in-python-types-like-a">here</a>). You can, however, subclass builtin types and do what you want on the new types. For the question you specifically asked (making the addition string based), you'd modify <a href="https://docs.python.org/3/reference/datamodel.html" rel="nofollow"><code>__add__</code> and <code>__radd__</code></a>:</p> <pre><code>class Int(int): def __add__(self, other): return Int(int(str(self) + str(other))) def __radd__(self, other): return Int(str(other) + str(self)) &gt;&gt;&gt; Int(5) + 3 53 &gt;&gt;&gt; 3 + Int(5) + 87 3587 </code></pre>
2
2016-08-08T14:35:04Z
[ "python", "operator-overloading", "overloading" ]
Is it possible to overload operators for native datatypes?
38,831,695
<p>For example, if I try to do:</p> <pre><code>a_string + an_int </code></pre> <p>... where a_string is type 'str' and an_int is type 'int', or:</p> <pre><code>an_int + a_string </code></pre> <p>There would be a <code>TypeError</code> because there is no implicit conversion of the types. I understand that if I were using my own subclasses of int and string, I would be able to overload the <code>__add__()</code> method in my classes to achieve this. </p> <p>However, out of curiosity, I would like to know: would it be possible to overload the + operator in the class definitions of <code>int</code> and <code>str</code>, so that <code>__add__(int,str)</code> and <code>__add__(str,int)</code> automatically concatenate them as strings? </p> <p>If not, what are the reasons why a programmer should not overload the operators for a native datatype? </p>
3
2016-08-08T14:20:15Z
38,832,741
<p>As pointed out above, you can't (unless you are up to building your own Python implementation). That is, you cannot change the way <code>'1'+1</code> is handled if encountered in code. But you can mess with builtin <em>functions</em> however you please:</p> <pre><code>&gt;&gt;&gt; int = str &gt;&gt;&gt; type(1) &lt;class 'int'&gt; &gt;&gt;&gt; type('1') &lt;class 'str'&gt; &gt;&gt;&gt; int(1) '1' &gt;&gt;&gt; type(int(1)) &lt;class 'str'&gt; </code></pre> <p>It's little more than an enlightening example of first-class functions' awesomeness, thoug. Any changes you make stay in a namespace you are making them in. Consider this:</p> <pre><code>&gt;&gt;&gt; str=int &gt;&gt;&gt; str('1') 1 &gt;&gt;&gt; str('asd') Traceback (most recent call last): File "&lt;stdin&gt;", line 1, in &lt;module&gt; ValueError: invalid literal for int() with base 10: 'asd' &gt;&gt;&gt; input() 2 '2' &gt;&gt;&gt; </code></pre> <p>You are using whatever you put in <code>str</code>, in this case <code>int</code>. But <code>input()</code> knows better and falls back to the builtins. There may be some weird trick with closures that'll make it refer to your implementation, but I can't find it. By the way, original <code>str</code> is in <code>__builtins__.str</code>, should you need it back.</p> <p>Pulling the same trick on builtin's methods doesn't work:</p> <pre><code>&gt;&gt;&gt; int.__add__ = str.__add__ Traceback (most recent call last): File "&lt;stdin&gt;", line 1, in &lt;module&gt; TypeError: can't set attributes of built-in/extension type 'int' </code></pre>
2
2016-08-08T15:09:25Z
[ "python", "operator-overloading", "overloading" ]
How to read a line from python currently in console?
38,831,703
<p>I want to use a line of code that can read what I was typing in console, for use with <code>asyncio</code> module in python. My code prints data when it receives it from the server, and after it does that, I want it to read what I was typing and save it to a variable. I am fine with having to use a non-standard module.</p> <p>Information about program:</p> <ul> <li>Currently reads stdin non-blocking using asyncio loop.run_in_executor</li> <li>Program runs using loop.create_connection, then uses loop.run_forever with the stdin reader added as a task.</li> </ul> <p>Code:</p> <pre><code>#!python3.5 #chatroom client import socket, sys, os, traceback, asyncio from threading import Lock DBG = False #More Error printing using full_error function #async stuf loop = asyncio.get_event_loop() lock = Lock() prev_stdin = "" #Server Location target = 'localhost' port = 17532 buffer_size = 1024 server = None transports = [] #an array of async.iotransport`s #Functions for Error handling full_error = lambda: traceback.print_exception(*sys.exc_info()) pause = lambda: None #make it global for below #Pause system compatability if os.name[0:5]=='posix': def pause(): os.system('read -n1 -r -p "Press any key to continue . . ." key') elif os.name[0:2]=='nt': def pause(): os.system("pause") else: def pause(): input("Press enter to continue . . .") def empty_stdin(): output = "" while True: temp = sys.stdin.buffer.read(1) if temp == "": break else: output += temp return output if DBG: loop.set_debug(DBG) async def write(): loop = asyncio.get_event_loop() while True: line = await loop.run_in_executor(None, sys.stdin.readline) line = prev_stdin + line prev_stdin = "" for i in transports: loop.call_soon(i.write,line.encode('utf-8')) class Server(asyncio.Protocol): def connection_made(self,transport): self.transport = transport transport.write(b"Connected") def data_received(self, data): print("\n%s"%data.decode('utf-8')) prev_stdin = empty_stdin() print(prev_stdin,) try: coro = loop.create_connection(Server, host=target, port=port) task = loop.create_task(coro) print("hi") print(transports) server, serverp = loop.run_until_complete(task) transports += [server] user_input = loop.create_task(write()) #loop.add_reader(sys.stdin, write) loop.run_forever() print('end') except Exception as e: if DBG: full_error() else: print(type(e)) print(e) pause() sys.exit() </code></pre>
-4
2016-08-08T14:20:53Z
38,926,940
<p>I solved the problem (Windows only) by using <code>msvcrt</code> to catch a single character and some code changes.</p> <p>New Functions/Changes</p> <ol> <li><p>draw_screen:</p> <ul> <li>clear screen using <code>os.system("cls")</code></li> <li><strong>print lines that I save when I print info (Could get laggy)</strong></li> <li>print a cursor with what I am currently typing (">> Hello")</li> </ul></li> <li><p>write:</p> <ul> <li><strong>replaced sys.stdin.readline with msvcrt.getch</strong></li> <li>A lot more changes</li> </ul></li> <li><p>everywhere:</p> <ul> <li><strong>Whenever I would print, instead add it to <code>screen</code> variable which is an array that holds everything. Then it calls draw_screen()</strong></li> <li>removed prev_stdin stuff</li> <li>removed some other print statements</li> </ul></li> </ol> <p>Final Code (For now):</p> <pre><code>#!python3.5 #chatroom client import sys, os, traceback, asyncio, msvcrt from threading import Lock DBG = False #More Error printing using full_error function screen = [] #holds lines of text that are printed to the screen line = "" #async stuf loop = asyncio.get_event_loop() lock = Lock() #Server Location target = 'localhost' port = 17532 buffer_size = 1024 server = None transports = [] #an array of async.iotransport`s #Functions for Error handling full_error = lambda: traceback.print_exception(*sys.exc_info()) #system compatable functions if os.name[0:5]=='posix': def pause(): os.system('read -n1 -r -p "Press any key to continue . . ." key') def cls(): os.system("clear") elif os.name[0:2]=='nt': def pause(): os.system("pause") def cls(): os.system("cls") else: def pause(): input("Press enter to continue . . .") def cls(): os.system("clear") def draw_screen(): cls() for i in screen: print(i) print("&gt; ", line, end="\r") #Draws current line of text being typed if DBG: loop.set_debug(DBG) async def write(): global line while True: temp = await loop.run_in_executor(None, msvcrt.getch) temp = temp.decode('utf-8') if temp == "\b": line = line[0:len(line)-1] elif not (temp == "\r" or temp == "\n"): line += temp else: for i in transports: loop.call_soon(i.write,line.encode('utf-8')) line = "" draw_screen() class Server(asyncio.Protocol): def connection_made(self,transport): self.transport = transport transport.write(b"Connected") def data_received(self, data): global screen screen += ["%s"%data.decode('utf-8')] draw_screen() try: coro = loop.create_connection(Server, host=target, port=port) task = loop.create_task(coro) server, serverp = loop.run_until_complete(task) transports += [server] user_input = loop.create_task(write()) loop.run_forever() print('end') except Exception as e: if DBG: full_error() else: print(type(e)) print(e) pause() sys.exit() </code></pre>
0
2016-08-12T21:50:34Z
[ "python", "console", "python-asyncio" ]
Reading hex to double-precision float python
38,831,808
<p>I am trying to <code>unpack</code> a hex string to a double in Python. </p> <p>When I try to unpack the following: </p> <pre><code>unpack('d', "4081637ef7d0424a"); </code></pre> <p>I get the following error: </p> <pre><code>struct.error: unpack requires a string argument of length 8 </code></pre> <p>This doesn't make very much sense to me because a double is 8 bytes long, and</p> <p>2 character <strong>=</strong> 1 hex value <strong>=</strong> 1 byte </p> <p>So in essence, a double of 8 bytes long would be a 16 character hex string.</p> <p>Any pointers of unpacking this hex to a double would be super appreciated. </p>
4
2016-08-08T14:25:41Z
38,831,901
<p>Try this:</p> <pre><code>a = "\x40\x81\x63\x7e\xf7\xd0\x42\x4a" unpack('d', a); </code></pre>
0
2016-08-08T14:30:59Z
[ "python", "hex" ]
Reading hex to double-precision float python
38,831,808
<p>I am trying to <code>unpack</code> a hex string to a double in Python. </p> <p>When I try to unpack the following: </p> <pre><code>unpack('d', "4081637ef7d0424a"); </code></pre> <p>I get the following error: </p> <pre><code>struct.error: unpack requires a string argument of length 8 </code></pre> <p>This doesn't make very much sense to me because a double is 8 bytes long, and</p> <p>2 character <strong>=</strong> 1 hex value <strong>=</strong> 1 byte </p> <p>So in essence, a double of 8 bytes long would be a 16 character hex string.</p> <p>Any pointers of unpacking this hex to a double would be super appreciated. </p>
4
2016-08-08T14:25:41Z
38,831,910
<p>You need to convert the hex digits to a binary string first:</p> <pre><code>struct.unpack('d', "4081637ef7d0424a".decode("hex")) </code></pre> <p>or</p> <pre><code>struct.unpack('d', binascii.unhexlify("4081637ef7d0424a")) </code></pre> <p>The latter version works in both Python 2 and 3, the former only in Python 2</p>
4
2016-08-08T14:31:14Z
[ "python", "hex" ]
Video Chat feature for Django and possibly Ionic
38,831,929
<p>I developed a website with Django (Python). This website allows users to make 1-to-1 video chat with each others. For the video chat feature I'm currently using WebRTC with quite good results.</p> <p>Now I'm planning to: </p> <ul> <li>upgrade to a paid service for video chat (to improve preformances and fix browser incompatibilities)</li> <li>ideally using the same paid service for a Ionic app (both Android and iOS) - so that service should provide Android/iOS SDKs</li> </ul> <p>I'm thinking about CometChat. Do you have any experience with it or other services? Any suggestion will be really appreciated.</p>
-2
2016-08-08T14:31:58Z
38,889,100
<p>You will have to create an API for charging your users and provide us the same according to the below-mentioned steps: </p> <ol> <li>Create a feature on your site which allows users to purchase credits (by making payment)</li> <li>Create a simple API to deduct credits and check number of credits </li> </ol> <p>Once you provide us the API, we will then modify CometChat so that when a user sends a message we can check the number of credits and deduct them using your API.</p> <p>Please let know if you need any further assistance about the same.</p> <p>Regards</p>
0
2016-08-11T06:45:16Z
[ "android", "python", "django", "video", "ionic-framework" ]
What is the "Python" way to parse through mroutes
38,831,931
<p>I am a network engineer who is trying to script out a specific "mroute" (multicast route) from some exported data. I am trying to figure out the most "pythonic" path to do this. </p> <p>The data looks something like this (nothing specific to my network, just lab exports):</p> <pre> (*,224.0.0.0/4) RPF nbr: 96.34.35.36 Flags: C RPF P Up: 1w5d (*,224.0.0.0/24) Flags: D P Up: 1w5d (*,224.0.1.39) Flags: S P Up: 1w5d (96.34.246.55,224.0.1.39) RPF nbr: 96.34.35.36 Flags: RPF Up: 1w4d Incoming Interface List Bundle-Ether434 Flags: F A, Up: 1w4d Outgoing Interface List BVI100 Flags: F, Up: 1w4d TenGigE0/0/0/3 Flags: F, Up: 1w4d TenGigE0/0/1/1 Flags: F, Up: 1w4d TenGigE0/0/1/2 Flags: F, Up: 1w4d TenGigE0/0/1/3 Flags: F, Up: 1w4d TenGigE0/1/1/1 Flags: F, Up: 1w4d TenGigE0/1/1/2 Flags: F, Up: 1w4d TenGigE0/2/1/0 Flags: F, Up: 1w4d TenGigE0/2/1/1 Flags: F, Up: 1w4d TenGigE0/2/1/2 Flags: F, Up: 1w4d Bundle-Ether234 (0/3/CPU0) Flags: F, Up: 2d17h Bundle-Ether434 Flags: F A, Up: 1w4d (*,224.0.1.40) Flags: S P Up: 1w5d Outgoing Interface List TenGigE0/2/1/0 Flags: II, Up: 1w5d </pre> <p>I have tried to replicate C style for loops to move the index incrementer up when I regex certain lines. </p> <p>The end result is I only want to show a multicast group if it has specific output in the "Outgoing" section.</p> <p>A horrible example of what I have tried so far (not complete, the data is handed off in a list):</p> <pre><code>myarray = [] myarray = output.split("\n") max_count = len(myarray) i= 0 while (i &lt; max_count): if (re.match(r"(^\()", myarray[i])): group = myarray[i] print group i+=1 while (re.match(r'(?!^\()', myarray[i])): if (re.match(r" Outgoing Interface List", myarray[i])): outgoing = myarray[i] print outgoing i+=1 while (re.match(r'(?!^\()', myarray[i])): print myarray[i] i+=1 else: i+=1 else: i+=1 </code></pre> <p>Thanks for any advice.</p>
1
2016-08-08T14:32:03Z
38,833,799
<p>Using a for loop eliminates having to use a variable counter, since it already returns the sequence number while looping.</p> <p>There's probably a simpler or better way still available to do it also, but here's just one way i thought of i hope you get the same results.</p> <pre><code>myarray = output.split("\n") for i in range(len(myarray)): if re.match('(^\()', myarray[i]): group = myarray[i] print group if (re.match('(?!^\()', myarray[i])): if re.match('\s+Outgoing Interface List', myarray[i]): outgoing = myarray[i] print outgoing if re.match('(?!^\()', myarray[i]): print myarray[i] </code></pre> <p>My results were:</p> <pre><code>(*,224.0.0.0/4) (*,224.0.0.0/24) (*,224.0.1.39) (96.34.246.55,224.0.1.39) (0/3/CPU0) (*,224.0.1.40) </code></pre>
1
2016-08-08T16:02:46Z
[ "python", "networking" ]
What is the "Python" way to parse through mroutes
38,831,931
<p>I am a network engineer who is trying to script out a specific "mroute" (multicast route) from some exported data. I am trying to figure out the most "pythonic" path to do this. </p> <p>The data looks something like this (nothing specific to my network, just lab exports):</p> <pre> (*,224.0.0.0/4) RPF nbr: 96.34.35.36 Flags: C RPF P Up: 1w5d (*,224.0.0.0/24) Flags: D P Up: 1w5d (*,224.0.1.39) Flags: S P Up: 1w5d (96.34.246.55,224.0.1.39) RPF nbr: 96.34.35.36 Flags: RPF Up: 1w4d Incoming Interface List Bundle-Ether434 Flags: F A, Up: 1w4d Outgoing Interface List BVI100 Flags: F, Up: 1w4d TenGigE0/0/0/3 Flags: F, Up: 1w4d TenGigE0/0/1/1 Flags: F, Up: 1w4d TenGigE0/0/1/2 Flags: F, Up: 1w4d TenGigE0/0/1/3 Flags: F, Up: 1w4d TenGigE0/1/1/1 Flags: F, Up: 1w4d TenGigE0/1/1/2 Flags: F, Up: 1w4d TenGigE0/2/1/0 Flags: F, Up: 1w4d TenGigE0/2/1/1 Flags: F, Up: 1w4d TenGigE0/2/1/2 Flags: F, Up: 1w4d Bundle-Ether234 (0/3/CPU0) Flags: F, Up: 2d17h Bundle-Ether434 Flags: F A, Up: 1w4d (*,224.0.1.40) Flags: S P Up: 1w5d Outgoing Interface List TenGigE0/2/1/0 Flags: II, Up: 1w5d </pre> <p>I have tried to replicate C style for loops to move the index incrementer up when I regex certain lines. </p> <p>The end result is I only want to show a multicast group if it has specific output in the "Outgoing" section.</p> <p>A horrible example of what I have tried so far (not complete, the data is handed off in a list):</p> <pre><code>myarray = [] myarray = output.split("\n") max_count = len(myarray) i= 0 while (i &lt; max_count): if (re.match(r"(^\()", myarray[i])): group = myarray[i] print group i+=1 while (re.match(r'(?!^\()', myarray[i])): if (re.match(r" Outgoing Interface List", myarray[i])): outgoing = myarray[i] print outgoing i+=1 while (re.match(r'(?!^\()', myarray[i])): print myarray[i] i+=1 else: i+=1 else: i+=1 </code></pre> <p>Thanks for any advice.</p>
1
2016-08-08T14:32:03Z
38,849,790
<p>Not sure that it is more pythonic, but i prefer to use iterator/generator instead of direct array indexing.</p> <pre><code>import re def print_out_ifaces( group, iterator ): """ function print output interfaces with its group (ip) It uses fact that you have empty line between 2 groups """ for iface_list in iterator: iface_list = iface_list.rstrip() #remove tail \n if not iface_list: return if not re.match( r" *Outgoing Interface List", iface_list ): continue print "group is " + group.rstrip() print iface_list # will print "Outgoing Interface List" for iface in iterator: iface = iface.rstrip(); #remove tail \n if not iface: print # add additional empty line beween 2 groups return print iface output = open( 'routes', 'r' ); # i saved your routes example in file "routes" #if your "output" is string with routes #then after "split('\n')" run "iter( myarray )" for line in output: if line.startswith( "(" ): # startswith much faster then checking first symbol by re group = line; print_out_ifaces( group, output ) </code></pre> <p>Also it's possible to use special tools for parsing (like Pyparsing or PLY), but I think it will be overkill for this task.</p>
0
2016-08-09T11:43:46Z
[ "python", "networking" ]
django auth system 'created'
38,832,122
<p><a href="http://i.stack.imgur.com/PejnM.png" rel="nofollow"><img src="http://i.stack.imgur.com/PejnM.png" alt="enter image description here"></a></p> <p>I'm working with django 1.7.11. I have a preexisting project and I've decided to try to use the built in admin panel (I have not created a superuser). When I opened the auth page I saw :</p> <p><a href="http://i.stack.imgur.com/WJMyK.png" rel="nofollow"><img src="http://i.stack.imgur.com/WJMyK.png" alt="enter image description here"></a></p> <p>Thinking there may be a problem with the tables I decided to delete the sqlite database and rerun everything:</p> <pre><code>$ python manage.py makemigrations app1 Migrations for 'app1': 0001_initial.py: - Create model Seller $ python manage.py migrate Operations to perform: Synchronize unmigrated apps: crispy_forms Apply all migrations: admin, contenttypes, auth, app1, sessions Synchronizing apps without migrations: Creating tables... Installing custom SQL... Installing indexes... Running migrations: Applying app1.0001_initial... FAKED $ python manage.py syncdb Operations to perform: Synchronize unmigrated apps: crispy_forms Apply all migrations: admin, contenttypes, auth, app1, sessions Synchronizing apps without migrations: Creating tables... Installing custom SQL... Installing indexes... Running migrations: No migrations to apply. You have installed Django's auth system, and don't have any superusers defined. Would you like to create one now? (yes/no): yes Created: Error: '' value has an invalid format. It must be in YYYY-MM-DD HH:MM[:ss[.uuuuuu]][TZ] format. Created: </code></pre> <p>How can I fix this?</p> <p>edit:</p> <p>app1/models.py:</p> <pre><code>from django.db import models # from django.contrib.auth.models import AbstractUser class Seller(models.Model): # Address contact_name = models.CharField(max_length=50) contact_address = models.CharField(max_length=50) contact_email = models.CharField(max_length=50) contact_phone = models.CharField(max_length=50) ............ created = models.DateTimeField(auto_now_add=True,unique=True) REQUIRED_FIELDS = ('contact_name','contact_email','contact_address','contact_phone') USERNAME_FIELD = 'created' </code></pre>
0
2016-08-08T14:40:16Z
38,833,806
<p>Your <code>username</code> field is set to <code>created</code>. Change it to contact_name to use a "name" to log in.</p> <p>However!... You should probably extend the AbstractUser model and not change the USERNAME_FIELD unless you really have to. The way you are doing it now will require you to write custom login views etc..</p> <p>EDIT:</p> <p>To use the default user model just delete the line AUTH_USER_MODEL from settings.py then re-run the createsupseruser management command. Then go back to the admin login page and login with the username and password.</p>
1
2016-08-08T16:03:16Z
[ "python", "django" ]
pyqt4: How to change button event without adding a new event?
38,832,143
<p>I have a click button that I want to change events when the button is pressed. A minimal version of the existing code looks like this:</p> <pre><code># Event that happens the first time def first_event(self): button.setText("Second Event") button.clicked.connect(second_event) # Event that happens the second time def second_event(self): button.setText("First Event") button.clicked.connect(first_event) button = QtGui.QPushButton("First Event") button.clicked.connect(first_event) </code></pre> <p>Unfortunately, instead of <strong>changing</strong> the event that happens, it simply <strong>adds</strong> and event to the clicked signal, meaning that the following happens:</p> <p>First button press - calls first_event</p> <p>Second button press - calls first_event and second_event</p> <p>Third button press - calls first_event twice and second_event</p> <p>etc...</p> <p>My desired behavior would be to have the button <strong>change functions when it is pressed</strong>, so that the resulting behavior would be:</p> <p>First button press - calls first_event</p> <p>Second button press - calls second_event</p> <p>Third button press - calls first_event</p> <p>etc...</p> <p>Is there a way to make it so that it changes the click event instead of adding a new one? Is there a way to remove events after the fact?</p>
0
2016-08-08T14:41:33Z
38,835,964
<p>I found a way to separate old events from signals using the <code>disconnect()</code> method. Here is an edited version that accomplishes what I originally wanted to do:</p> <pre><code># Event that happens the first time def first_event(self): button.setText("Second Event") button.clicked.disconnect() button.clicked.connect(second_event) # Event that happens the second time def second_event(self): button.setText("First Event") button.clicked.disconnect() button.clicked.connect(first_event) button = QtGui.QPushButton("First Event") button.clicked.connect(first_event) </code></pre> <p>It's worth noting that instead of doing this, I eventually did what ekhumoro mentioned in the comments, and created a wrapper function with a flag to record the current state, and then call <code>first_event()</code> or <code>second_event()</code> based on the value of the flag.</p>
0
2016-08-08T18:20:01Z
[ "python", "events", "signals", "pyqt4" ]
Traverse through .tar.gz directories and concatenate files (without uncompressing the folders)
38,832,182
<p>I have a folder of about 20000 tar.gz directories, each containing a bunch of files. I want to go in the source folder, traverse through the tar.gz directories (<strong>without decompressing</strong>) and concatenate the files so at the end I will have three big files.</p> <p>For e.g. I have a root folder <code>pnoc</code> which has <code>.tar.gz</code> directories, each compressed folder has three folders - <code>Kallisto</code>, <code>RSEM</code> and <code>Hugo</code>. I have uncompressed one such directory and looks like this:</p> <pre><code>pnoc/ ├── C021_0001_20140916_tumor_RNASeq.tar.gz ├── C021_0002_001113_tumor_RNASeq.tar.gz ├── C021_0003_001409_tumor_RNASeq.tar.gz ├── C021_0004_001418_tumor_RNASeq.tar.gz ├── C021_0005_001661_tumor_RNASeq.tar.gz ├── C021_0007_001669_tumor_RNASeq.tar.gz ├── C021_0008_001699_tumor_RNASeq.tar.gz ├── C021_0009_001766_tumor_RNASeq.tar.gz ├── C021_0010_001774_tumor_RNASeq.tar.gz ├── C021_0011_001786_tumor_RNASeq.tar.gz ├── C021_0012_001825_tumor_RNASeq.tar.gz ├── C021_0013_001872_tumor_RNASeq.tar.gz ├── CPBT_0001_1_tumor_RNASeq.tar.gz ├── CPBT_0003_1_tumor_RNASeq.tar.gz ├── CPBT_0004_1_tumor_RNASeq.tar.gz ├── CPBT_0005_1_tumor_RNASeq.tar.gz ├── CPBT_0006_1_tumor_RNASeq.tar.gz ├── CPBT_0007_1_tumor_RNASeq.tar.gz ├── CPBT_0008_1_tumor_RNASeq.tar.gz ├── CPBT_0009_1_tumor_RNASeq.tar.gz ├── IMPROPERLY_PAIRED.C021_0006_001666_tumor_RNASeq.tar.gz └── pnoc-manifest C021_0001_20140916_tumor_RNASeq ├── Kallisto │   ├── C021_0001_20140916_tumor_RNASeq.abundance.h5 │   ├── C021_0001_20140916_tumor_RNASeq.abundance.tsv │   └── C021_0001_20140916_tumor_RNASeq.run_info.json └── RSEM ├── C021_0001_20140916_tumor_RNASeq.rsem.genes.norm_counts.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.genes.raw_counts.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.isoform.norm_counts.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.isoform.raw_counts.tab ├── C021_0001_20140916_tumor_RNASeq.rsem_genes.results ├── C021_0001_20140916_tumor_RNASeq.rsem_isoforms.results └── Hugo ├── C021_0001_20140916_tumor_RNASeq.rsem.genes.norm_counts.hugo.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.genes.raw_counts.hugo.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.isoform.norm_counts.hugo.tab ├── C021_0001_20140916_tumor_RNASeq.rsem.isoform.raw_counts.hugo.tab ├── C021_0001_20140916_tumor_RNASeq.rsem_genes.hugo.results └── C021_0001_20140916_tumor_RNASeq.rsem_isoforms.hugo.results </code></pre> <p>So I want to concatenate all the *.abundance.tsv in one, *.rsem.genes.norm_counts.tab in second and *.rsem_genes.hugo.results in third file. What's the best and most efficient way to do that? I am okay with anything - <code>R</code>, <code>Python</code> or <code>Bash</code>.</p> <pre><code>$ find --version find (GNU findutils) 4.5.11 Copyright (C) 2012 Free Software Foundation, Inc. License GPLv3+: GNU GPL version 3 or later &lt;http://gnu.org/licenses/gpl.html&gt;. This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Written by Eric B. Decker, James Youngman, and Kevin Dalley. Features enabled: D_TYPE O_NOFOLLOW(enabled) LEAF_OPTIMISATION SELINUX FTS(FTS_CWDFD) CBO(level=2) </code></pre> <p>Thanks!</p>
3
2016-08-08T14:43:15Z
38,832,277
<p>Using <code>bash</code> <code>find</code> command as below; The <code>cat</code> command in <code>exec</code> is applied to all the files returned by the command. The <code>+</code> option is to ensure no more than one instance of the <code>cat</code> is spawned by the shell.</p> <p>Here <code>{}</code> denotes the files returned the find command. Refer more about <a href="http://tldp.org/LDP/abs/html/moreadv.html" rel="nofollow"><code>find -exec</code></a></p> <pre><code>find . -type f -name '*.abundance.tsv' -exec cat "{}" + &gt;&gt; ../AbundanceTSV.tsv find . -type f -name '*.rsem.genes.norm_counts.tab' -exec cat "{}" + &gt;&gt; ../GenesNormCounts.tab find . -type f -name '*.rsem_genes.hugo.results' -exec cat "{}" + &gt;&gt; ../HugoResults.results </code></pre>
3
2016-08-08T14:47:56Z
[ "python", "bash", "shell", "find" ]
Regex subbing in Python leads to ASCII characters appearing
38,832,203
<p>I am trying to use regex to replace some issues in some text.</p> <p>Strings look like this:</p> <p><code>a = "Here is a shortString with various issuesWith spacing"</code></p> <p>My regex looks like this right now: <code>new_string = re.sub("[a-z][A-Z]", "\1 \2", a)</code>.</p> <p>This takes those places with missing spaces (there is always a capital letter after a lowercase letter), and adds a space.</p> <p>Unfortunately, the output looks like this:</p> <p><code>Here is a shor\x01 \x02tring with various issue\x01 \x02ith spacing</code></p> <p>I want it to look like this:</p> <p><code>b = "Here is a short String with various issues With spacing"</code></p> <p>It seems that the regex is properly matching the correct instances of things I want to change, but there is something wrong with my substitution. I thought <code>\1 \2</code> meant replace with the first part of the regex, add a space, and then add the second matched item. But for some reason I get something else?</p>
1
2016-08-08T14:44:17Z
38,832,261
<pre><code>&gt;&gt;&gt; a = "Here is a shortString with various issuesWith spacing" &gt;&gt;&gt; re.sub("([a-z])([A-Z])", r"\1 \2", a) 'Here is a short String with various issues With spacing' </code></pre> <p>capturing group and backslash escaping was missing.</p> <p>you can go even further:</p> <pre><code>&gt;&gt;&gt; a = "Here is a shortString with various issuesWith spacing" &gt;&gt;&gt; re.sub('([a-z])([A-Z])', r'\1 \2', a).lower().capitalize() 'Here is a short string with various issues with spacing' </code></pre>
2
2016-08-08T14:47:12Z
[ "python", "regex", "string" ]
Regex subbing in Python leads to ASCII characters appearing
38,832,203
<p>I am trying to use regex to replace some issues in some text.</p> <p>Strings look like this:</p> <p><code>a = "Here is a shortString with various issuesWith spacing"</code></p> <p>My regex looks like this right now: <code>new_string = re.sub("[a-z][A-Z]", "\1 \2", a)</code>.</p> <p>This takes those places with missing spaces (there is always a capital letter after a lowercase letter), and adds a space.</p> <p>Unfortunately, the output looks like this:</p> <p><code>Here is a shor\x01 \x02tring with various issue\x01 \x02ith spacing</code></p> <p>I want it to look like this:</p> <p><code>b = "Here is a short String with various issues With spacing"</code></p> <p>It seems that the regex is properly matching the correct instances of things I want to change, but there is something wrong with my substitution. I thought <code>\1 \2</code> meant replace with the first part of the regex, add a space, and then add the second matched item. But for some reason I get something else?</p>
1
2016-08-08T14:44:17Z
38,832,267
<p>You need to define capturing groups, and use raw string literals:</p> <pre><code>import re a = "Here is a shortString with various issuesWith spacing" new_string = re.sub(r"([a-z])([A-Z])", r"\1 \2", a) print(new_string) </code></pre> <p>See the <a href="https://ideone.com/CoE8xR" rel="nofollow">Python demo</a>.</p> <p>Note that without the <code>r''</code> prefix Python interpreted the <code>\1</code> and <code>\2</code> as characters rather than as backreferences since the <code>\</code> was parsed as part of an escape sequence. In raw string literals, <code>\</code> is parsed as a literal backslash.</p>
1
2016-08-08T14:47:31Z
[ "python", "regex", "string" ]
Regex subbing in Python leads to ASCII characters appearing
38,832,203
<p>I am trying to use regex to replace some issues in some text.</p> <p>Strings look like this:</p> <p><code>a = "Here is a shortString with various issuesWith spacing"</code></p> <p>My regex looks like this right now: <code>new_string = re.sub("[a-z][A-Z]", "\1 \2", a)</code>.</p> <p>This takes those places with missing spaces (there is always a capital letter after a lowercase letter), and adds a space.</p> <p>Unfortunately, the output looks like this:</p> <p><code>Here is a shor\x01 \x02tring with various issue\x01 \x02ith spacing</code></p> <p>I want it to look like this:</p> <p><code>b = "Here is a short String with various issues With spacing"</code></p> <p>It seems that the regex is properly matching the correct instances of things I want to change, but there is something wrong with my substitution. I thought <code>\1 \2</code> meant replace with the first part of the regex, add a space, and then add the second matched item. But for some reason I get something else?</p>
1
2016-08-08T14:44:17Z
38,833,842
<p>You can have a try like this:</p> <pre><code>&gt;&gt;&gt;&gt; import re &gt;&gt;&gt;&gt; a = "Here is a shortString with various issuesWith spacing" &gt;&gt;&gt;&gt; re.sub(r"(?&lt;=[a-z])(?=[A-Z])", " ", a) &gt;&gt;&gt;&gt; Here is a short String with various issues With spacing </code></pre>
0
2016-08-08T16:04:43Z
[ "python", "regex", "string" ]
How to 'unpack' a list or tuple in Python
38,832,218
<p>I'm writing a Python program to play Tic Tac Toe, using Numpy arrays with "X" represented by <code>1</code> and "O" by <code>0</code>. The class includes a function to place a mark on the board:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def place_mark(self, pos, mark): self.grid[pos[0],pos[1]] = mark </code></pre> <p>so that, for example, </p> <pre><code>board = Board() board.place_mark([0,1], 1) print board.grid </code></pre> <p>yields</p> <pre><code>[[ nan 1. nan] [ nan nan nan] [ nan nan nan]] </code></pre> <p>I was wondering if the <code>pos[0], pos[1]</code> argument in the <code>place_mark</code> function could somehow be replaced by the 'unpacked' contents of <code>pos</code> (which is always a list of length 2). In Ruby this would be done using the splat operator: <code>*pos</code>, but this does not appear to be valid syntax in Python.</p>
2
2016-08-08T14:45:00Z
38,832,442
<p>As suggested by Lukasz, the input argument should be a tuple. In this example it can be converted to one:</p> <pre><code>def place_mark(self, pos, mark): self.grid[tuple(pos)] = mark </code></pre> <p>My question is not the same <a href="http://stackoverflow.com/questions/2238355/what-is-the-pythonic-way-to-unpack-tuples">What is the pythonic way to unpack tuples?</a> because <code>pos</code> does not constitute the input arguments to a function, but rather the indices of a 2-dimensional array.</p>
2
2016-08-08T14:55:46Z
[ "python", "numpy" ]
How to 'unpack' a list or tuple in Python
38,832,218
<p>I'm writing a Python program to play Tic Tac Toe, using Numpy arrays with "X" represented by <code>1</code> and "O" by <code>0</code>. The class includes a function to place a mark on the board:</p> <pre><code>import numpy as np class Board(): def __init__(self, grid = np.ones((3,3))*np.nan): self.grid = grid def place_mark(self, pos, mark): self.grid[pos[0],pos[1]] = mark </code></pre> <p>so that, for example, </p> <pre><code>board = Board() board.place_mark([0,1], 1) print board.grid </code></pre> <p>yields</p> <pre><code>[[ nan 1. nan] [ nan nan nan] [ nan nan nan]] </code></pre> <p>I was wondering if the <code>pos[0], pos[1]</code> argument in the <code>place_mark</code> function could somehow be replaced by the 'unpacked' contents of <code>pos</code> (which is always a list of length 2). In Ruby this would be done using the splat operator: <code>*pos</code>, but this does not appear to be valid syntax in Python.</p>
2
2016-08-08T14:45:00Z
38,832,648
<p>With Numpy, there's a difference between indexing with lists and multi-dimensional indexing. <code>self.grid[[0,1]]</code> is equivalent to concatenating <code>self.grid[0]</code> and <code>self.grid[1]</code>, each 3x1 arrays, into a 3x2 array.</p> <p>If you use tuples instead of lists for indexing, then it will be correctly interpreted as multi-dimensional indexing: <code>self.grid[(0, 1)]</code> is interpreted the same as <code>self.grid[0, 1]</code>.</p> <p>There is a <code>*</code> operator for unpacking sequences, but in the context of function arguments only, at least in Python 2. So, with lists you could also do this:</p> <pre><code>def place_mark(self, mark, x, y): self.grid[x, y] = mark place_mark(1, *[0, 1]) </code></pre> <p>NB. <a href="https://eev.ee/blog/2016/07/31/python-faq-why-should-i-use-python-3/#unpacking" rel="nofollow">(Expanded usefulness of <code>*</code> in Python 3)</a></p>
3
2016-08-08T15:05:10Z
[ "python", "numpy" ]
How to discretize large dataframe by columns with variable bins in Pandas/Dask
38,832,219
<p>I am able to discretize a Pandas dataframe by columns with this code:</p> <pre><code>import numpy as np import pandas as pd def discretize(X, n_scale=1): for c in X.columns: loc = X[c].median() # median absolute deviation of the column scale = mad(X[c]) bins = [-np.inf, loc - (scale * n_scale), loc + (scale * n_scale), np.inf] X[c] = pd.cut(X[c], bins, labels=[-1, 0, 1]) return X </code></pre> <p>I want to discretize each column using as parameters: loc (the median of the column) and scale (the <a href="https://en.wikipedia.org/wiki/Median_absolute_deviation" rel="nofollow">median absolute deviation</a> of the column).</p> <p>With small dataframes the time required is acceptable (since it is a single thread solution).</p> <p>However, with larger dataframes I want to exploit more threads (or processes) to speed up the computation.</p> <p>I am no expert of <a href="http://dask.pydata.org/en/latest/index.html" rel="nofollow">Dask</a>, which should provide the solution for this problem.</p> <p>However, in my case the discretization should be feasible with the code:</p> <pre><code>import dask.dataframe as dd import numpy as np import pandas as pd def discretize(X, n_scale=1): # I'm using only 2 partitions for this example X_dask = dd.from_pandas(X, npartitions=2) # FIXME: # how can I define bins to compute loc and scale # for each column? bins = [-np.inf, loc - (scale * n_scale), loc + (scale * n_scale), np.inf] X = X_dask.apply(pd.cut, axis=1, args=(bins,), labels=[-1, 0, 1]).compute() return X </code></pre> <p>but the problem here is that <code>loc</code> and <code>scale</code> are dependent on column values, so they should be computed for each column, either before or during the apply.</p> <p>How can it be done?</p>
2
2016-08-08T14:45:03Z
38,841,341
<p>I've never used <code>dask</code>, but I guess you can define a new function to be used in <code>apply</code>.</p> <pre><code>import dask.dataframe as dd import multiprocessing as mp import numpy as np import pandas as pd def discretize(X, n_scale=1): X_dask = dd.from_pandas(X.T, npartitions=mp.cpu_count()+1) X = X_dask.apply(_discretize_series, axis=1, args=(n_scale,), columns=X.columns).compute().T return X def _discretize_series(x, n_scale=1): loc = x.median() scale = mad(x) bins = [-np.inf, loc - (scale * n_scale), loc + (scale * n_scale), np.inf] x = pd.cut(x, bins, labels=[-1, 0, 1]) return x </code></pre>
1
2016-08-09T02:57:04Z
[ "python", "pandas", "dataframe", "parallel-processing", "dask" ]
Find number of breaks in a sequence
38,832,238
<p>I have a program that is parsing allele sequences. I am trying to write a code that determines if the allele is complete or not. To do so, I need to count the number of breaks in the reference sequence. A break is signified by a string of '-'. If there is more than one break I want the program to say "Incomplete Allele." </p> <p>How can I figure out how to count the number of breaks in the sequence? </p> <p>Here is an example of a "broken" sequence:</p> <pre><code>&gt;DQB1*04:02:01 ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ --ATGTCTTGGAAGAAGGCTTTGCGGAT-------CCCTGGAGGCCTTCGGGTAGCAACT GTGACCTT----GATGCTGGCGATGCTGAGCACCCCGGTGGCTGAGGGCAGAGACTCTCC CGAGGATTTCGTGTTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACCGAGCGCGT GCGGGGTGTGACCAGATACATCTATAACCGAGAGGAGTACGCGCGCTTCGACAGCGACGT GGGGGTGTATCGGGCGGTGACGCCGCTGGGGCGGCTTGACGCCGAGTACTGGAATAGCCA GAAGGACATCCTGGAGGAGGACCGGGCGTCGGTGGACACCGTATGCAGACACAACTACCA GTTGGAGCTCCGCACGACCTTGCAGCGGCGA----------------------------- ----------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ---GTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAAC CTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGG AATGACCAGGAGGAGACAACTGGCGTTGTGTCCACCCCCCTTATTAGGAACGGTGACTGG ACCTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGACGTCTACACCTGC CACGTGGAGCACCCCAGCCTCCAGAACCCCATCATCGTGGAGTGGCGGGCTCAGTCTGAA TCTGCCCAGAGCAAGATGCTGAGTGG----CATTGGAGGCTTCGTGCTGGGGCTGATCTT CCTCGGGCTGGGCCTTATTATC--------------CATCACAGGAGTCAGAAAGGGCTC CTGCACTGA--------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ </code></pre> <p>The code I have so far is as follows:</p> <pre><code>idx=[] for m in range(len(sequence)): for n in re.finditer('-',sequence[0]): idx.append(n.start()) counter=0 min_val=[] for n in range(len(idx)): if counter==idx[n]: counter=counter+1 elif counter !=0: min_val.append(idx[n-1]) counter=0 </code></pre> <p>My reasoning for the above code was if I could find the start positions of the '-' then I can see how many times they appear within the sequence and if they break the sequence at all. However, I know there are some flaws in the above code. </p>
4
2016-08-08T14:46:08Z
38,832,430
<p>I think this should do:</p> <pre><code>def test(sequence): sequence = ''.join(sequence.splitlines()[1:]) # remove first line (header and line breaks) S = [segments for segments in sequence.split('-') if block != ''] if len(S)&gt;2: # len(S) should be the number of remaining segments print "Incomplete Allele." </code></pre>
0
2016-08-08T14:55:15Z
[ "python", "string", "python-2.7" ]
Find number of breaks in a sequence
38,832,238
<p>I have a program that is parsing allele sequences. I am trying to write a code that determines if the allele is complete or not. To do so, I need to count the number of breaks in the reference sequence. A break is signified by a string of '-'. If there is more than one break I want the program to say "Incomplete Allele." </p> <p>How can I figure out how to count the number of breaks in the sequence? </p> <p>Here is an example of a "broken" sequence:</p> <pre><code>&gt;DQB1*04:02:01 ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ --ATGTCTTGGAAGAAGGCTTTGCGGAT-------CCCTGGAGGCCTTCGGGTAGCAACT GTGACCTT----GATGCTGGCGATGCTGAGCACCCCGGTGGCTGAGGGCAGAGACTCTCC CGAGGATTTCGTGTTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACCGAGCGCGT GCGGGGTGTGACCAGATACATCTATAACCGAGAGGAGTACGCGCGCTTCGACAGCGACGT GGGGGTGTATCGGGCGGTGACGCCGCTGGGGCGGCTTGACGCCGAGTACTGGAATAGCCA GAAGGACATCCTGGAGGAGGACCGGGCGTCGGTGGACACCGTATGCAGACACAACTACCA GTTGGAGCTCCGCACGACCTTGCAGCGGCGA----------------------------- ----------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ---GTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAAC CTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGG AATGACCAGGAGGAGACAACTGGCGTTGTGTCCACCCCCCTTATTAGGAACGGTGACTGG ACCTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGACGTCTACACCTGC CACGTGGAGCACCCCAGCCTCCAGAACCCCATCATCGTGGAGTGGCGGGCTCAGTCTGAA TCTGCCCAGAGCAAGATGCTGAGTGG----CATTGGAGGCTTCGTGCTGGGGCTGATCTT CCTCGGGCTGGGCCTTATTATC--------------CATCACAGGAGTCAGAAAGGGCTC CTGCACTGA--------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ </code></pre> <p>The code I have so far is as follows:</p> <pre><code>idx=[] for m in range(len(sequence)): for n in re.finditer('-',sequence[0]): idx.append(n.start()) counter=0 min_val=[] for n in range(len(idx)): if counter==idx[n]: counter=counter+1 elif counter !=0: min_val.append(idx[n-1]) counter=0 </code></pre> <p>My reasoning for the above code was if I could find the start positions of the '-' then I can see how many times they appear within the sequence and if they break the sequence at all. However, I know there are some flaws in the above code. </p>
4
2016-08-08T14:46:08Z
38,832,440
<p>It seems like you can just count the occurrances of <code>-+</code>, i.e. a sequence of <em>one or more</em> <code>-</code> symbols. The only problem are the line breaks, but you could either incorporate those into the regex, or split and join the string before matching.</p> <pre><code>&gt;&gt;&gt; sequence = """&gt;DQB1*04:02:01.....""" &gt;&gt;&gt; joined = ''.join(sequence.splitlines()) &gt;&gt;&gt; sum(1 for m in re.finditer("-+", joined)) 7 </code></pre> <p>Note: This includes the <code>-</code> at the start and end of the sequence.</p> <p>Or reverse the approach: Instead of counting the gaps, count the groups:</p> <pre><code>&gt;&gt;&gt; sum(1 for m in re.finditer("[GATC]+", joined)) 6 </code></pre>
0
2016-08-08T14:55:45Z
[ "python", "string", "python-2.7" ]
Find number of breaks in a sequence
38,832,238
<p>I have a program that is parsing allele sequences. I am trying to write a code that determines if the allele is complete or not. To do so, I need to count the number of breaks in the reference sequence. A break is signified by a string of '-'. If there is more than one break I want the program to say "Incomplete Allele." </p> <p>How can I figure out how to count the number of breaks in the sequence? </p> <p>Here is an example of a "broken" sequence:</p> <pre><code>&gt;DQB1*04:02:01 ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ --ATGTCTTGGAAGAAGGCTTTGCGGAT-------CCCTGGAGGCCTTCGGGTAGCAACT GTGACCTT----GATGCTGGCGATGCTGAGCACCCCGGTGGCTGAGGGCAGAGACTCTCC CGAGGATTTCGTGTTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACCGAGCGCGT GCGGGGTGTGACCAGATACATCTATAACCGAGAGGAGTACGCGCGCTTCGACAGCGACGT GGGGGTGTATCGGGCGGTGACGCCGCTGGGGCGGCTTGACGCCGAGTACTGGAATAGCCA GAAGGACATCCTGGAGGAGGACCGGGCGTCGGTGGACACCGTATGCAGACACAACTACCA GTTGGAGCTCCGCACGACCTTGCAGCGGCGA----------------------------- ----------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ---GTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAAC CTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCGGTGGTTTCGG AATGACCAGGAGGAGACAACTGGCGTTGTGTCCACCCCCCTTATTAGGAACGGTGACTGG ACCTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGACGTCTACACCTGC CACGTGGAGCACCCCAGCCTCCAGAACCCCATCATCGTGGAGTGGCGGGCTCAGTCTGAA TCTGCCCAGAGCAAGATGCTGAGTGG----CATTGGAGGCTTCGTGCTGGGGCTGATCTT CCTCGGGCTGGGCCTTATTATC--------------CATCACAGGAGTCAGAAAGGGCTC CTGCACTGA--------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------------------ ------------------------------------------------------------ </code></pre> <p>The code I have so far is as follows:</p> <pre><code>idx=[] for m in range(len(sequence)): for n in re.finditer('-',sequence[0]): idx.append(n.start()) counter=0 min_val=[] for n in range(len(idx)): if counter==idx[n]: counter=counter+1 elif counter !=0: min_val.append(idx[n-1]) counter=0 </code></pre> <p>My reasoning for the above code was if I could find the start positions of the '-' then I can see how many times they appear within the sequence and if they break the sequence at all. However, I know there are some flaws in the above code. </p>
4
2016-08-08T14:46:08Z
38,832,553
<p>You could just filter out all the '-' characters and based on the number of remaining segments determine number of breaks.</p> <pre><code>str_list = filter(None, sequence.split('-')) if len(str_list) &gt; 2: return "Incomplete Allele" else: return "Complete Allele" </code></pre>
1
2016-08-08T15:00:39Z
[ "python", "string", "python-2.7" ]
How to make the regexp ignore a new line in python?
38,832,239
<p>I use the regex like that</p> <pre><code>return(\s+([^"\n;]+))?; </code></pre> <p>in order to match the return statement in obj-c,but when I use it through python like this:</p> <pre><code>re.sub(r'return(\s+([^"\n;]+))?;',r'{\g&lt;0&gt;}',str(content)) </code></pre> <p>I find that it match like this statement</p> <pre><code>//please {return [self funcA];} </code></pre> <p>and make the code error.How can I deal with it ?</p>
2
2016-08-08T14:46:08Z
38,832,599
<p>I think the issue is that your regex has <code>\s</code> that matches any whitespace.</p> <p>You might want to just match literal spaces or tabs with <code>[ \t]</code>:</p> <pre><code>r'return([ \t]+([^"\n;]+))?;' </code></pre> <p>(<a href="https://regex101.com/r/mM6mK2/2" rel="nofollow">demo</a>) or - better:</p> <pre><code>r'return[ \t]+[^"\n;]*;' </code></pre> <p>See <a href="https://regex101.com/r/mM6mK2/3" rel="nofollow">the regex demo</a></p>
2
2016-08-08T15:02:51Z
[ "python", "regex" ]
pcapy.PcapError: eth1: You don't have permission to capture on that device
38,832,347
<p>I am trying to run pcapy_sniffer.py but i get this</p> <p>pcapy.PcapError: eth1: You don't have permission to capture on that device (socket: Operation not permitted)</p>
0
2016-08-08T14:50:48Z
38,832,386
<p>If you're running on linux or OS X try running as root or with <code>sudo</code>, otherwise if you're on windows try running as administrator.</p>
0
2016-08-08T14:53:03Z
[ "python", "scapy", "pcap" ]
Change pd datetime object to integer
38,832,486
<p>I have a pandas dataframe with two dates in them. I want to take the difference in days between them. But the resulting difference looks like a string ex ('7 days'). Is there a way to change this to just the integer date difference?</p> <pre><code>y['datePulled'] = pd.to_datetime(y['datePulled']) y['Dates'] = pd.to_datetime(y['Dates']) y['Datediff'] = y['datePulled'] - y['Dates'] y['Datediff'] 0 7 days 1 6 days 2 5 days 3 4 days 4 3 days 5 2 days 6 1 days </code></pre>
1
2016-08-08T14:57:50Z
38,832,514
<p>You can use:</p> <pre><code>(y['Datediff'] / np.timedelta64(1, 'D')).astype(int) </code></pre> <p>Or:</p> <pre><code>y['Datediff'].dt.days </code></pre> <p>Sample:</p> <pre><code>import pandas as pd import numpy as np y = pd.DataFrame({ 'datePulled': ['2016-01-05','2016-01-04'], 'Dates': ['2016-01-01','2016-01-02']}) y['datePulled'] = pd.to_datetime(y['datePulled']) y['Dates'] = pd.to_datetime(y['Dates']) y['Datediff'] = y['datePulled'] - y['Dates'] print (y) #output is float, cast to int y['Datediff1'] = (y['Datediff'] / np.timedelta64(1, 'D')).astype(int) y['Datediff2'] = y['Datediff'].dt.days print (y) Dates datePulled Datediff Datediff1 Datediff2 0 2016-01-01 2016-01-05 4 days 4 4 1 2016-01-02 2016-01-04 2 days 2 2 </code></pre> <p>In larger DataFrame first method is faster:</p> <pre><code>y = pd.concat([y]*1000).reset_index(drop=True) In [236]: %timeit (y['Datediff'] / np.timedelta64(1, 'D')).astype(int) 1000 loops, best of 3: 789 µs per loop In [237]: %timeit y['Datediff'].dt.days 100 loops, best of 3: 15.3 ms per loop </code></pre>
2
2016-08-08T14:59:09Z
[ "python", "date", "pandas" ]
TypeError: get() missing 1 required positional argument: 'self' - NOT USING CLASS - Python 3.5
38,832,494
<p>due to my crude knowledge of Python, I am expecting more mistakes with the following script than just the positional argument error. Hence, I would very much appreciate any and all kind of observations/corrections. Again, I would like, if at all possible, to fix the positional argument error without having to use class. Thank you all very much.</p> <pre><code># Python 3.5.1 from tkinter import * from tkinter import ttk root = Tk() root.geometry("300x200+150+50") total = 0.0 amount = 0.0 n = 0 x = 0 def total_amount(): total = Entry.get() print ('got total!') lb=ttk.Label(root, text="Enter total").grid(row=n, column=1) totalEnt=ttk.Entry(root).grid(row=n, column=2) button=ttk.Button(root, text='ok', command=total_amount).grid(row=n, column=3) if total !=0: while True: if amount &lt; total: while True: n = n + 1 if x == 0: def amount_entered(event): amount = amount + Entry.get() x = x + 1 print ('got amount!') lb=ttk.Label(root, text="Enter amount").grid(row=n, column=1) amountEnt=ttk.Entry(root).grid(row=n, column=2) button=ttk.Button(root, text='Ok', command=amount_entered).grid(row=n, column=3) elif x != 0: print ('gone from internal loop!') break elif sub == total: print ('done!') break else: print ('sum of amount(s) cannot be greater than total') else: pass root.mainloop() </code></pre>
0
2016-08-08T14:58:24Z
38,862,779
<p>You're getting the error message because .get() won't work on the class Entry. It will work on an object such as totalEnt that is an instance of Entry.</p> <p>So you need </p> <pre><code>total = totalEnt.get() </code></pre> <p>Also, something like</p> <pre><code>totalEnt=ttk.Entry(root).grid(row=n, column=2) </code></pre> <p>won't work. If you need to give a name to an object such as totalEnt, you need to create it first, then call grid on it.</p> <pre><code>totalEnt=ttk.Entry(root) totalEnt.grid(row=n, column=2) </code></pre> <p>You don't necessarily have to write any of your own classes, but to use tkinter (or probably any gui package in a object oriented language) you have to use some of the classes that are part of it. When you do something like</p> <pre><code>totalEnt=ttk.Entry(root) </code></pre> <p>You are creating an object, totalEnt, which is an instance of the class ttk.Entry. You imported the class from tkinter.</p>
0
2016-08-10T01:16:20Z
[ "python", "python-3.x", "variables", "tkinter", "arguments" ]
Saving print statement to new file
38,832,545
<p>New to python (should be noted). Go easy on me. </p> <p>I have written the following to isolate a very specific part of a file</p> <pre><code>for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): print line </code></pre> <p>the output appears as such </p> <pre><code>PLY/1,48.107478621032,-69.733975000000 PLY/2,48.163516399836,-70.032838888053 PLY/3,48.270000002883,-70.032838888053 PLY/4,48.270000002883,-69.712824977522 PLY/5,48.192379262383,-69.711801581207 PLY/6,48.191666671083,-69.532840015422 PLY/7,48.033358898628,-69.532840015422 PLY/8,48.033359033880,-69.733975000000 PLY/9,48.107478621032,-69.733975000000 </code></pre> <p>Ideally what I am hoping for is the output to create a CSV file with the coordinates. (The PLY/1, PLY/2 etc. Does not need to stay). Is this doable? If not, at least can the print statement result in a new textfile with the same name as the KAP file? </p>
1
2016-08-08T15:00:22Z
38,832,657
<p>you can use csv module</p> <pre><code>import csv with open('120301.csv', 'w', newline='') as file: writer = csv.writer(file) for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): writer.writerow(rec.split(',')) </code></pre> <p>In the similar way <code>csv.reader</code> can easily read records from your input file. <a href="https://docs.python.org/3/library/csv.html?highlight=csv#module-contents" rel="nofollow">https://docs.python.org/3/library/csv.html?highlight=csv#module-contents</a></p> <p><strong>edit #1</strong></p> <p>In python 2.x you should open the file in binary mode:</p> <pre><code>import csv with open('120301.csv', 'wb') as file: writer = csv.writer(file) for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): writer.writerow(rec.split(',')) </code></pre>
1
2016-08-08T15:05:42Z
[ "python", "writing" ]
Saving print statement to new file
38,832,545
<p>New to python (should be noted). Go easy on me. </p> <p>I have written the following to isolate a very specific part of a file</p> <pre><code>for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): print line </code></pre> <p>the output appears as such </p> <pre><code>PLY/1,48.107478621032,-69.733975000000 PLY/2,48.163516399836,-70.032838888053 PLY/3,48.270000002883,-70.032838888053 PLY/4,48.270000002883,-69.712824977522 PLY/5,48.192379262383,-69.711801581207 PLY/6,48.191666671083,-69.532840015422 PLY/7,48.033358898628,-69.532840015422 PLY/8,48.033359033880,-69.733975000000 PLY/9,48.107478621032,-69.733975000000 </code></pre> <p>Ideally what I am hoping for is the output to create a CSV file with the coordinates. (The PLY/1, PLY/2 etc. Does not need to stay). Is this doable? If not, at least can the print statement result in a new textfile with the same name as the KAP file? </p>
1
2016-08-08T15:00:22Z
38,832,783
<p>This is totally doable! Here are a couple links to some docs: <a href="https://docs.python.org/2/library/csv.html" rel="nofollow">https://docs.python.org/2/library/csv.html</a> #for writing/reading CSV. You could also just make your own CSV with the regular file reading/writing functions. </p> <pre><code>file = open('data', rw) output = open('output.csv', w) file.write('your infos') #add a comma to each string you output? </code></pre> <p>i think that should work. </p>
1
2016-08-08T15:11:00Z
[ "python", "writing" ]
Saving print statement to new file
38,832,545
<p>New to python (should be noted). Go easy on me. </p> <p>I have written the following to isolate a very specific part of a file</p> <pre><code>for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): print line </code></pre> <p>the output appears as such </p> <pre><code>PLY/1,48.107478621032,-69.733975000000 PLY/2,48.163516399836,-70.032838888053 PLY/3,48.270000002883,-70.032838888053 PLY/4,48.270000002883,-69.712824977522 PLY/5,48.192379262383,-69.711801581207 PLY/6,48.191666671083,-69.532840015422 PLY/7,48.033358898628,-69.532840015422 PLY/8,48.033359033880,-69.733975000000 PLY/9,48.107478621032,-69.733975000000 </code></pre> <p>Ideally what I am hoping for is the output to create a CSV file with the coordinates. (The PLY/1, PLY/2 etc. Does not need to stay). Is this doable? If not, at least can the print statement result in a new textfile with the same name as the KAP file? </p>
1
2016-08-08T15:00:22Z
38,832,918
<p>You could open the file at the beginning of your code and then just add a write statement after the print line. Something like this:</p> <pre><code>target = open(filename, 'w') for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): print line target.write(line) target.write("\n") #writes a new line </code></pre>
1
2016-08-08T15:17:45Z
[ "python", "writing" ]
Saving print statement to new file
38,832,545
<p>New to python (should be noted). Go easy on me. </p> <p>I have written the following to isolate a very specific part of a file</p> <pre><code>for line in open('120301.KAP'): rec = line.strip() if rec.startswith('PLY'): print line </code></pre> <p>the output appears as such </p> <pre><code>PLY/1,48.107478621032,-69.733975000000 PLY/2,48.163516399836,-70.032838888053 PLY/3,48.270000002883,-70.032838888053 PLY/4,48.270000002883,-69.712824977522 PLY/5,48.192379262383,-69.711801581207 PLY/6,48.191666671083,-69.532840015422 PLY/7,48.033358898628,-69.532840015422 PLY/8,48.033359033880,-69.733975000000 PLY/9,48.107478621032,-69.733975000000 </code></pre> <p>Ideally what I am hoping for is the output to create a CSV file with the coordinates. (The PLY/1, PLY/2 etc. Does not need to stay). Is this doable? If not, at least can the print statement result in a new textfile with the same name as the KAP file? </p>
1
2016-08-08T15:00:22Z
38,833,887
<p>The simplest way is to redirect stdout to a file:</p> <pre><code>for i in range(10): print str(i) + "," + str(i*2) </code></pre> <p>will output:</p> <pre><code>0,0 1,2 2,4 3,6 4,8 5,10 6,12 7,14 8,16 9,18 </code></pre> <p>if you run it as <code>python myprog.py &gt; myout.txt</code> the result go to myout.txt </p>
0
2016-08-08T16:06:42Z
[ "python", "writing" ]
Dynamic dict value access with dot separated string
38,832,563
<p>I'm using Python 3.5.1</p> <p>So what I am trying to do is pass in a dict a <em>dot separated string</em> representing the path to a key and a default value. I want to check for the keys existence and if it's not there , provide the default value. The problem with this is that the key I want to access could be nested in other dicts and I will not know until run time. So what I want to do is something like this:</p> <pre><code>def replace_key(the_dict, dict_key, default_value): if dict_key not in the_dict: the_dict[dict_key] = default_value return the_dict some_dict = {'top_property': {'first_nested': {'second_nested': 'the value'}}} key_to_replace = 'top_property.first_nested.second_nested' default_value = 'replaced' #this would return as {'top_property': {'first_nested': {'second_nested': 'replaced'}}} replace_key(some_dict, key_to_replace, default_value) </code></pre> <p>What I'm looking for is a way to do this without having to do a split on '.' in the string and iterating over the possible keys as this could get messy. I would rather not have to use a third party library. I feel like there is clean built in Pythonic way to do this but I just can't find it. I've dug through the docs but to no avail. If anyone has any suggestion as to how I could do this it would be very much appreciated. Thanks!</p>
1
2016-08-08T15:01:12Z
38,832,961
<p>You could use recursivity:</p> <pre><code>def replace_key(the_dict, dict_keys, default_value): if dict_keys[0] in the_dict: if len(dict_keys)==1: the_dict[dict_keys[0]]=default_value else: replace_key(the_dict[dict_keys[0]], dict_keys[1:],default_value) else: raise Exception("wrong key") some_dict = {'top_property': {'first_nested': {'second_nested': 'the value'}}} key_to_replace = 'top_property.first_nested.second_nested' default_value = 'replaced' #this would return as {'top_property': {'first_nested': {'second_nested': 'replaced'}}} replace_key(some_dict, key_to_replace.split("."), default_value) </code></pre> <p>But it still uses the split(). But maybe you consider it to be less messy?</p>
1
2016-08-08T15:19:40Z
[ "python", "python-3.x" ]
Get table name for field in database result in Python (PostgreSQL)
38,832,646
<p>I'm trying to get table name for field in result set that I got from database (Python, Postgres). There is a function in PHP to get table name for field, I used it and it works so I know it can be done (in PHP). I'm looking for similar function in Python.</p> <p><a href="http://php.net/manual/en/function.pg-field-table.php" rel="nofollow">pg_field_table()</a> function in PHP gets results and field number and "returns the name of the table that field belongs to". That is exactly what I need, but in Python.</p> <p>Simple exaple - create tables, insert rows, select data:</p> <pre><code>CREATE TABLE table_a ( id INT, name VARCHAR(10) ); CREATE TABLE table_b ( id INT, name VARCHAR(10) ); INSERT INTO table_a (id, name) VALUES (1, 'hello'); INSERT INTO table_b (id, name) VALUES (1, 'world'); </code></pre> <p>When using <code>psycopg2</code> or <code>sqlalchemy</code> I got right data and right field names but without information about table name.</p> <pre><code>import psycopg2 query = ''' SELECT * FROM table_a A LEFT JOIN table_b B ON A.id = B.id ''' con = psycopg2.connect('dbname=testdb user=postgres password=postgres') cur = con.cursor() cur.execute(query) data = cur.fetchall() print('fields', [desc[0] for desc in cur.description]) print('data', data) </code></pre> <p>The example above prints field names. The output is:</p> <pre><code>fields ['id', 'name', 'id', 'name'] data [(1, 'hello', 1, 'world')] </code></pre> <p>I know that there is <code>cursor.description</code>, but it does not contain table name, just the field name.</p> <p>What I need - some way to retrieve table names for fields in result set when using raw SQL to query data.</p> <p><strong>EDIT 1</strong>: I need to know if "hello" came from "table_a" or "table_b", both fields are named same ("name"). Without information about table name you can't tell in which table the value is.</p> <p><strong>EDIT 2</strong>: I know that there are some workarounds like SQL aliases: <code>SELECT table_a.name AS name1, table_b.name AS name2</code> but I'm really asking how to retrieve table name from result set.</p> <p><strong>EDIT 3</strong>: I'm looking for solution that allows me to write any raw SQL query, sometimes <code>SELECT *</code>, sometimes <code>SELECT A.id, B.id ...</code> and after executing that query I will get field names and table names for fields in the result set.</p>
2
2016-08-08T15:05:04Z
38,834,445
<p>It is necessary to query the <a href="https://www.postgresql.org/docs/current/static/catalog-pg-attribute.html" rel="nofollow"><code>pg_attribute</code> catalog</a> for the table qualified column names:</p> <pre><code>query = ''' select string_agg(format( '%%1$s.%%2$s as "%%1$s.%%2$s"', attrelid::regclass, attname ) , ', ') from pg_attribute where attrelid = any (%s::regclass[]) and attnum &gt; 0 and not attisdropped ''' cursor.execute(query, ([t for t in ('a','b')],)) select_list = cursor.fetchone()[0] query = ''' select {} from a left join b on a.id = b.id '''.format(select_list) print cursor.mogrify(query) cursor.execute(query) print [desc[0] for desc in cursor.description] </code></pre> <p>Output:</p> <pre><code> select a.id as "a.id", a.name as "a.name", b.id as "b.id", b.name as "b.name" from a left join b on a.id = b.id ['a.id', 'a.name', 'b.id', 'b.name'] </code></pre>
0
2016-08-08T16:39:38Z
[ "python", "postgresql", "psycopg2" ]
Suppress warnings in Hachoir
38,832,691
<p>I'm using <a href="http://hachoir3.readthedocs.io/index.html" rel="nofollow">hachior-parser</a> to grab the duration of a large set of video files. (I'm resetting the "Last modified" date based on the file's timestamp, plus its duration.) I'm using code adapted from <a href="http://stackoverflow.com/questions/17185348/how-to-get-avi-files-length">this question</a>.</p> <p>The problem I'm running into is that hachior reports four warnings for each file, and this is cluttering up my output. I still get my duration from the file, so I'd like to know how to suppress these warnings in the output, if possible.</p> <p>Python isn't really my strong suit, so I'm not sure where to look and the documentation for hachior seems pretty sparse on the error reporting. I'd prefer not to resort to grepping the lines from the output of my script.</p> <p><strong>Edit:</strong> Running <code>python -W ignore set_last_modified.py</code> results in the same <code>[warn]</code> lines being printed.</p> <pre class="lang-none prettyprint-override"><code>[warn] [/headers/stream[2]/stream_fmt] Can't get field "stream_hdr" from /headers/stream[2] [warn] [/headers/stream[2]/stream_fmt] [Autofix] Fix parser error: stop parser, add padding [warn] [/headers/stream[3]/stream_fmt] Can't get field "stream_hdr" from /headers/stream[3] [warn] [/headers/stream[3]/stream_fmt] [Autofix] Fix parser error: stop parser, add padding </code></pre>
0
2016-08-08T15:06:54Z
38,832,806
<p>You can use the <a href="https://docs.python.org/2/using/cmdline.html#cmdoption-W" rel="nofollow"><code>-W</code></a> option to suppress warnings in python. </p> <pre><code>python -W ignore my_file.py </code></pre> <p>Edit: since you've already tried the above, you could try the following. </p> <pre><code>import warnings # add the following before you call the function that gives warnings. warnings.filterwarnings("ignore") # run your function here </code></pre>
0
2016-08-08T15:12:29Z
[ "python", "hachoir-parser" ]
Suppress warnings in Hachoir
38,832,691
<p>I'm using <a href="http://hachoir3.readthedocs.io/index.html" rel="nofollow">hachior-parser</a> to grab the duration of a large set of video files. (I'm resetting the "Last modified" date based on the file's timestamp, plus its duration.) I'm using code adapted from <a href="http://stackoverflow.com/questions/17185348/how-to-get-avi-files-length">this question</a>.</p> <p>The problem I'm running into is that hachior reports four warnings for each file, and this is cluttering up my output. I still get my duration from the file, so I'd like to know how to suppress these warnings in the output, if possible.</p> <p>Python isn't really my strong suit, so I'm not sure where to look and the documentation for hachior seems pretty sparse on the error reporting. I'd prefer not to resort to grepping the lines from the output of my script.</p> <p><strong>Edit:</strong> Running <code>python -W ignore set_last_modified.py</code> results in the same <code>[warn]</code> lines being printed.</p> <pre class="lang-none prettyprint-override"><code>[warn] [/headers/stream[2]/stream_fmt] Can't get field "stream_hdr" from /headers/stream[2] [warn] [/headers/stream[2]/stream_fmt] [Autofix] Fix parser error: stop parser, add padding [warn] [/headers/stream[3]/stream_fmt] Can't get field "stream_hdr" from /headers/stream[3] [warn] [/headers/stream[3]/stream_fmt] [Autofix] Fix parser error: stop parser, add padding </code></pre>
0
2016-08-08T15:06:54Z
38,851,150
<p>I found the solution by checking the issues page for the project on BitBucket.</p> <p><a href="https://bitbucket.org/haypo/hachoir/issues/54/control-log-level-whith-the-python-api" rel="nofollow">https://bitbucket.org/haypo/hachoir/issues/54/control-log-level-whith-the-python-api</a></p> <pre class="lang-py prettyprint-override"><code>from hachoir_core import config as HachoirConfig HachoirConfig.quiet = True </code></pre>
0
2016-08-09T12:45:41Z
[ "python", "hachoir-parser" ]
How to assign months to their numeric equivalents in Python / Pandas?
38,832,968
<p>Currently, I'm using the following for loop based on an if condition for each month to assign months to their numeric equivalents. It seems to be quite efficient in terms of runtime, but is too manual and ugly for my preferences.</p> <p>How could this be better executed? I imagine it's possible to improve on it by simplifying/condensing the multiple if conditions somehow, as well as by using some sort of translator that is made for date conversions? Each of which would be preferable?</p> <pre><code>#make numeric month combined = combined.sort_values('month') combined.index = range(len(combined)) combined['month_numeric'] = None for i in combined['month'].unique(): first = combined['month'].searchsorted(i, side='left') last = combined['month'].searchsorted(i, side='right') first_num = list(first)[0] #gives first instance last_num = list(last)[0] #gives last instance if i == 'January': combined['month_numeric'][first_num:last_num] = "01" elif i == 'February': combined['month_numeric'][first_num:last_num] = "02" elif i == 'March': combined['month_numeric'][first_num:last_num] = "03" elif i == 'April': combined['month_numeric'][first_num:last_num] = "04" elif i == 'May': combined['month_numeric'][first_num:last_num] = "05" elif i == 'June': combined['month_numeric'][first_num:last_num] = "06" elif i == 'July': combined['month_numeric'][first_num:last_num] = "07" elif i == 'August': combined['month_numeric'][first_num:last_num] = "08" elif i == 'September': combined['month_numeric'][first_num:last_num] = "09" elif i == 'October': combined['month_numeric'][first_num:last_num] = "10" elif i == 'November': combined['month_numeric'][first_num:last_num] = "11" elif i == 'December': combined['month_numeric'][first_num:last_num] = "12" </code></pre>
1
2016-08-08T15:20:02Z
38,833,040
<p>You can use <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.to_datetime.html" rel="nofollow"><code>to_datetime</code></a>, then <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.Series.dt.month.html" rel="nofollow"><code>month</code></a>, convert to string and use <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.Series.str.zfill.html" rel="nofollow"><code>zfill</code></a>:</p> <pre><code>print (pd.to_datetime(df['month'], format='%B').dt.month.astype(str).str.zfill(2)) </code></pre> <p>Sample:</p> <pre><code>import pandas as pd df = pd.DataFrame({ 'month': ['January','February', 'December']}) print (df) month 0 January 1 February 2 December print (pd.to_datetime(df['month'], format='%B').dt.month.astype(str).str.zfill(2)) 0 01 1 02 2 12 Name: month, dtype: object </code></pre> <p>Another solution is <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.Series.map.html" rel="nofollow"><code>map</code></a> by dict <code>d</code>:</p> <pre><code>d = {'January':'01','February':'02','December':'12'} print (df['month'].map(d)) 0 01 1 02 2 12 Name: month, dtype: object </code></pre> <p><strong>Timings</strong>:</p> <pre><code>df = pd.DataFrame({ 'month': ['January','February', 'December']}) print (df) df = pd.concat([df]*1000).reset_index(drop=True) print (pd.to_datetime(df['month'], format='%B').dt.month.astype(str).str.zfill(2)) print (df['month'].map({'January':'01','February':'02','December':'12'})) In [200]: %timeit (pd.to_datetime(df['month'], format='%B').dt.month.astype(str).str.zfill(2)) 100 loops, best of 3: 13.5 ms per loop In [201]: %timeit (df['month'].map({'January':'01','February':'02','December':'12'})) 1000 loops, best of 3: 462 µs per loop </code></pre>
4
2016-08-08T15:22:51Z
[ "python", "datetime", "pandas" ]
How to assign months to their numeric equivalents in Python / Pandas?
38,832,968
<p>Currently, I'm using the following for loop based on an if condition for each month to assign months to their numeric equivalents. It seems to be quite efficient in terms of runtime, but is too manual and ugly for my preferences.</p> <p>How could this be better executed? I imagine it's possible to improve on it by simplifying/condensing the multiple if conditions somehow, as well as by using some sort of translator that is made for date conversions? Each of which would be preferable?</p> <pre><code>#make numeric month combined = combined.sort_values('month') combined.index = range(len(combined)) combined['month_numeric'] = None for i in combined['month'].unique(): first = combined['month'].searchsorted(i, side='left') last = combined['month'].searchsorted(i, side='right') first_num = list(first)[0] #gives first instance last_num = list(last)[0] #gives last instance if i == 'January': combined['month_numeric'][first_num:last_num] = "01" elif i == 'February': combined['month_numeric'][first_num:last_num] = "02" elif i == 'March': combined['month_numeric'][first_num:last_num] = "03" elif i == 'April': combined['month_numeric'][first_num:last_num] = "04" elif i == 'May': combined['month_numeric'][first_num:last_num] = "05" elif i == 'June': combined['month_numeric'][first_num:last_num] = "06" elif i == 'July': combined['month_numeric'][first_num:last_num] = "07" elif i == 'August': combined['month_numeric'][first_num:last_num] = "08" elif i == 'September': combined['month_numeric'][first_num:last_num] = "09" elif i == 'October': combined['month_numeric'][first_num:last_num] = "10" elif i == 'November': combined['month_numeric'][first_num:last_num] = "11" elif i == 'December': combined['month_numeric'][first_num:last_num] = "12" </code></pre>
1
2016-08-08T15:20:02Z
38,833,202
<p>You can use a map:</p> <pre><code>month2int = {"January":1, "February":2, ...} combined["month_numeric"] = combined["month"].map(month2int) </code></pre>
1
2016-08-08T15:30:36Z
[ "python", "datetime", "pandas" ]
How can I remove all non-alphanumeric characters from a string, except for '#', with regex?
38,833,054
<p>I currently have this line <code>address = re.sub('[^A-Za-z0-9]+', ' ', address).lstrip()</code> which will remove all special characters from my string <code>address</code>. How can I modify this line to keep <code>#</code>?</p>
1
2016-08-08T15:23:26Z
38,833,139
<p>In order to avoid removing the hash symbol, you need to add it into the <a href="http://www.regular-expressions.info/charclass.html#negated" rel="nofollow">negated character class</a>:</p> <pre><code>r'[^A-Za-z0-9#]+' ^ </code></pre> <p>See the <a href="https://regex101.com/r/xP1yL8/1" rel="nofollow">regex demo</a></p>
4
2016-08-08T15:28:14Z
[ "python", "regex" ]
Ruffus pipeline with internal inputs
38,833,119
<p>I'd like to create a pipeline with the Ruffus package for Python and I am struggling with its simplest concepts. Two tasks should be executed one after the other. The second task depends on output of the first task. In Ruffus documentation everything is designed for import/export from/to external files. I'd like to handle internal data types like dictionaries.</p> <p>The problem is that @follows doesn't take inputs and @transform doesn't take dicts. Am I missing something?</p> <pre><code>def task1(): # generate dict properties = {'status': 'original'} return properties @follows(task1) def task2(properties): # update dict properties['status'] = 'updated' return properties </code></pre> <p>Eventually the pipeline should combine a set of functions in a class that update the class object on the go.</p>
0
2016-08-08T15:26:56Z
38,849,678
<p>I suggest you only use the Ruffus decorators when there are input/output <em>files</em>. For example, if <code>task1</code> generates <code>file1.txt</code> and this is the input for <code>task2</code>, which generates <code>file2.txt</code> then you could write a pipeline as follows:</p> <pre><code>@originate("file1.txt") def task1(output): out_file = open(output,"w") # write stuff to out_file @follows(task1) @transform(task1, suffix("1.txt"),"2.txt") def task2(input,output): in_file = open(input,"r") # read in in_file and do stuff out_file = open(output,"w") # write stuff to out_file </code></pre> <p>If you just want to take a dictionary as an input, you don't need Ruffus, you can just call <code>task1</code> in <code>task2</code>:</p> <pre><code>def task1(): properties = {'status': 'original'} return properties def task2(): properties = task1() properties['status'] = 'updated' return properties </code></pre>
0
2016-08-09T11:38:20Z
[ "python", "cluster-computing", "distributed-computing", "pipeline" ]
Search for a part of a tuple in a list of tuples
38,833,275
<p>I am working on a sudoku solver in python. The coordinates of the boxes are given by this code:</p> <pre><code>for row in range(1, 10): for column in range(1,10): boxes.append((row, column)) </code></pre> <p>Later, I have a list of tuples in the format of (row, column, box, number). I need to organize them so that they are in the order of the first list. Both are the same length, so I though I could make a new list by finding each (row, column) pair in the larger list. In other words, for the item (1, 1), I want to find a tuple in the other list where item 0 is '1' and item 1 is '1'.</p> <p>How can I do this?</p>
0
2016-08-08T15:34:30Z
38,833,438
<p>I believe this should work for finding the (row, column) pair:</p> <pre><code>entry = [e for e in tuple_list if (e[0] == row and e[1] == column)][0] </code></pre> <p>You essentially end up with a list of all entries <code>e</code> that match the (1, 1) pattern and then get the first of these using <code>[0]</code>.</p> <p>Use this in a loop to find each one individually:</p> <pre><code>sorted_tuple_list = [] for row in range(1, 10): for column in range(1,10): entry = [e for e in tuple_list if (e[0] == row and e[1] == column)][0] sorted_tuple_list.append(entry) </code></pre>
0
2016-08-08T15:42:37Z
[ "python", "list", "tuples" ]
RabbitMQ: Consuming only one message at a time from multiple queues
38,833,309
<p>I'm trying to stay connected to multiple queues in RabbitMQ. Each time I pop a new message from one of these queue, I'd like to spawn an external process.</p> <p>This process will take some time to process the message, and I don't want to start processing another message from that specific queue until the one I popped earlier is completed. If possible, I wouldn't want to keep a process/thread around just to wait on the external process to complete and ack the server. Ideally, I would like to ack in this external process, maybe passing some identifier so that it can connect to RabbitMQ and ack the message.</p> <p>Is it possible to design this system with RabbitMQ? I'm using Python and Pika, if this is relevant to the answer.</p> <p>Thanks!</p>
0
2016-08-08T15:36:31Z
38,833,846
<p>RabbitMQ can do this.</p> <p>You only want to read from the queue when you're ready - so spin up a thread that can spawn the external process and watch it, then fetch the next message from the queue when the process is done. You can then have mulitiple threads running in parallel to manage multiple queues.</p> <p>I'm not sure what you want an ack for? Are you trying to stop RabbitMQ from adding new elements to that queue if it gets too full (because its elements are being processed too slowly/not at all)? There might be a way to do this when you add messages to the queues - before adding an item, check to make sure that the number of messages already in that queue is not "much greater than" the average across all queues?</p>
0
2016-08-08T16:04:44Z
[ "python", "rabbitmq", "amqp", "pika" ]
Merge dataframes on nearest datetime / timestamp
38,833,362
<p>I have two data frames as follows:</p> <pre><code>A = pd.DataFrame({"ID":["A", "A", "C" ,"B", "B"], "date":["06/22/2014","07/02/2014","01/01/2015","01/01/1991","08/02/1999"]}) B = pd.DataFrame({"ID":["A", "A", "C" ,"B", "B"], "date":["02/15/2015","06/30/2014","07/02/1999","10/05/1990","06/24/2014"], "value": ["3","5","1","7","8"] }) </code></pre> <p>Which look like the following:</p> <pre><code>&gt;&gt;&gt; A ID date 0 A 2014-06-22 1 A 2014-07-02 2 C 2015-01-01 3 B 1991-01-01 4 B 1999-08-02 &gt;&gt;&gt; B ID date value 0 A 2015-02-15 3 1 A 2014-06-30 5 2 C 1999-07-02 1 3 B 1990-10-05 7 4 B 2014-06-24 8 </code></pre> <p>I want to merge A with the values of B using the nearest date. In this example, none of the dates match, but it could the the case that some do.</p> <p>The output should be something like this:</p> <pre><code>&gt;&gt;&gt; C ID date value 0 A 06/22/2014 8 1 A 07/02/2014 5 2 C 01/01/2015 3 3 B 01/01/1991 7 4 B 08/02/1999 1 </code></pre> <p>It seems to me that there should be a native function in pandas that would allow this. </p> <p>Note: as similar question has been asked here <a href="http://stackoverflow.com/questions/21201618/pandas-merge-match-the-nearest-time-stamp-the-series-of-timestamps">pandas.merge: match the nearest time stamp &gt;= the series of timestamps</a></p>
0
2016-08-08T15:39:15Z
38,833,547
<p>You can use <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.DataFrame.reindex.html" rel="nofollow"><code>reindex</code></a> with <code>method='nearest'</code> and then <a href="http://pandas.pydata.org/pandas-docs/stable/generated/pandas.merge.html" rel="nofollow"><code>merge</code></a>:</p> <pre><code>A['date'] = pd.to_datetime(A.date) B['date'] = pd.to_datetime(B.date) A.sort_values('date', inplace=True) B.sort_values('date', inplace=True) B1 = B.set_index('date').reindex(A.set_index('date').index, method='nearest').reset_index() print (B1) print (pd.merge(A,B1, on='date')) ID_x date ID_y value 0 B 1991-01-01 B 7 1 B 1999-08-02 C 1 2 A 2014-06-22 B 8 3 A 2014-07-02 A 5 4 C 2015-01-01 A 3 </code></pre> <p>You can also add parameter <code>suffixes</code>:</p> <pre><code>print (pd.merge(A,B1, on='date', suffixes=('_', ''))) ID_ date ID value 0 B 1991-01-01 B 7 1 B 1999-08-02 C 1 2 A 2014-06-22 B 8 3 A 2014-07-02 A 5 4 C 2015-01-01 A 3 </code></pre>
1
2016-08-08T15:48:26Z
[ "python", "pandas" ]
dataframe append not visible out of function scope
38,833,433
<p>According to my understanding of python, mutable references to data can be modified within a function scope and reflect the change outside. However the behavior below confuses me:</p> <p>1) Consider a list:</p> <pre><code>my_list = [] def checklistappend( list ): list.append( 1 ) checklistappend( my_list ) print ( my_list ) </code></pre> <p>As expected the variable my_list = [1]</p> <p>2) However consider the following scenario with a dataframe:</p> <pre><code>my_df = pd.DataFrame(columns=['A']) def checkdfappend ( df ): df.append( [1] ) checkdfappend( my_df ) print( my_df ) </code></pre> <p>In this case the result of my_df is still an empty data frame with columns 'A' which is non-intuitive and the only explaination I can come up with is that the dataframe append method internally assigns to a new variable which is the behavior I would not expect.</p> <p>I am using python 2.7.2 with pandas 0.13.1 , changing either of which is not in my control.</p> <p>Is there another way to achieve the same objective without making so many copies ?</p>
0
2016-08-08T15:42:32Z
38,833,709
<p>You need to assign the output back to <code>df</code>.</p> <pre><code>df = df.append([1]) </code></pre>
0
2016-08-08T15:57:49Z
[ "python", "pandas", "pass-by-reference" ]
Python Scrapy Spider: Inconsistent results
38,833,506
<p>I would love to know what you guys think about this please. I have researched for a few days now and I can't seem to find where I am going wrong. Any help will be highly appreciated.</p> <p>I want to systematically crawl this url: <a href="https://studyacer.com/latest/" rel="nofollow">Question site</a> using the pagination to crawl the rest of the pages.</p> <p>My current code: </p> <pre><code>import scrapy from scrapy.linkextractors import LinkExtractor from scrapy.selector import Selector from scrapy.spiders import CrawlSpider, Rule from acer.items import AcerItem class AcercrawlerSpider(CrawlSpider): name = 'acercrawler' allowed_domains = ['studyacer.com'] start_urls = ['http://www.studyacer.com/latest'] rules = ( Rule(LinkExtractor(), callback='parse_item', follow=True), ) def parse_item(self, response): questions= Selector(response).xpath('//td[@class="word-break"]/a/@href').extract() for question in questions: item= AcerItem() item['title']= question.xpath('//h1/text()').extract() item['body']= Selector(response).xpath('//div[@class="row-fluid"][2]//p/text()').extract() yield item </code></pre> <p>When I ran the spider it doesn't throw any errors but instead outputs inconsistent results. Sometimes scraping an article page twice. I am thinking it might be something to do with the selectors I have used but I can't narrow it any further. Any help with this please?</p>
0
2016-08-08T15:46:17Z
38,834,852
<p>kevin; I had a similar but slightly different problem earlier today, where my crawlspider was visiting unwanted pages. Someone responded to my question with the suggestion of checking the linkextractor as you suggested here : <a href="http://doc.scrapy.org/en/latest/topics/link-extractors.html" rel="nofollow">http://doc.scrapy.org/en/latest/topics/link-extractors.html</a></p> <pre><code>class scrapy.linkextractors.lxmlhtml.LxmlLinkExtractor(allow=(), deny=(), allow_domains=(), deny_domains=(), deny_extensions=None, restrict_xpaths=(), restrict_css=(), tags=('a', 'area'), attrs=('href', ), canonicalize=True, unique=True, process_value=None) </code></pre> <p>I ended up reviewing my allow / deny components to focus the crawler on to specific subsets of pages. You can specify using regex to express the relevant substrings of the links to allow (include) or deny (exclude). I tested the expressions using <a href="http://www.regexpal.com/" rel="nofollow">http://www.regexpal.com/</a></p> <p>I found this approach was sufficient to prevent duplicates, but if you're still seeing them, I also found this article I was looking at earlier in the day on how to prevent duplicates, although I have to say I didn't have to implement this fix:</p> <p><a href="http://stackoverflow.com/questions/17660552/avoid-duplicate-url-crawling">Avoid Duplicate URL Crawling</a></p> <p><a href="http://stackoverflow.com/a/21344753/6582364">http://stackoverflow.com/a/21344753/6582364</a></p>
0
2016-08-08T17:04:09Z
[ "python", "css-selectors", "scrapy" ]
Match dictionary with list (Python)
38,833,527
<p>I have a dictionary of words with categories. I want to output the categories if the words match the words in my list. This is what my code looks like at the moment: </p> <pre><code>dictionary = { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } list_of_things = ["steve", "tom", "cat"] for categories,things in dictionary.iteritems(): for stuff in list_of_things: if stuff in things: print categories if stuff not in things: print "dump as usual" </code></pre> <p>Currently the output looks like this:</p> <pre><code>dump as usual dump as usual dump as usual human dump as usual dump as usual dump as usual dump as usual animal </code></pre> <p>But I want the output to look like this: </p> <pre><code>human dump as usual animal </code></pre> <p>I don't want my list to print everything it iterates through in the dictionary. I only want it to print terms that match. How would I do this? </p>
1
2016-08-08T15:47:25Z
38,833,578
<p>You could use a boolean inside the inner <code>for</code> loop, which changes from False (category not found) to True (category was found), and then only print the <code>categories</code> at the <em>end</em> of the <code>for</code> loop <code>if boolean = False:</code></p> <pre><code>isMatchFound = False for categories, things in dictionary.iteritems(): isMatchFound = False for stuff in list_of_things: if stuff in things: isMatchFound = True print stuff if isMatchFound == False: print("dump as usual") </code></pre>
1
2016-08-08T15:50:49Z
[ "python", "dictionary" ]
Match dictionary with list (Python)
38,833,527
<p>I have a dictionary of words with categories. I want to output the categories if the words match the words in my list. This is what my code looks like at the moment: </p> <pre><code>dictionary = { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } list_of_things = ["steve", "tom", "cat"] for categories,things in dictionary.iteritems(): for stuff in list_of_things: if stuff in things: print categories if stuff not in things: print "dump as usual" </code></pre> <p>Currently the output looks like this:</p> <pre><code>dump as usual dump as usual dump as usual human dump as usual dump as usual dump as usual dump as usual animal </code></pre> <p>But I want the output to look like this: </p> <pre><code>human dump as usual animal </code></pre> <p>I don't want my list to print everything it iterates through in the dictionary. I only want it to print terms that match. How would I do this? </p>
1
2016-08-08T15:47:25Z
38,833,669
<p>Depending on how much your actual data look like your example, you could do</p> <pre><code>category_thing= { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } list_of_things = ["steve", "tom", "cat"] thingset=set(list_of_things) # just for speedup for category,thing in category_thing.iteritems(): if thing in thingset: print category else: print "dump as usual" </code></pre> <p>or if your mapping really is as simple as in your example you can do</p> <pre><code>category_thing= { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } thing_category=dict((t,c) for c,t in category_thing.items()) # reverse the dict - if you have duplicate values (things), you should not do this list_of_things = ["steve", "tom", "cat"] for stuff in list_of_things: msg=thing_category.get(stuff,"dump as usual") print msg </code></pre>
1
2016-08-08T15:55:47Z
[ "python", "dictionary" ]
Match dictionary with list (Python)
38,833,527
<p>I have a dictionary of words with categories. I want to output the categories if the words match the words in my list. This is what my code looks like at the moment: </p> <pre><code>dictionary = { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } list_of_things = ["steve", "tom", "cat"] for categories,things in dictionary.iteritems(): for stuff in list_of_things: if stuff in things: print categories if stuff not in things: print "dump as usual" </code></pre> <p>Currently the output looks like this:</p> <pre><code>dump as usual dump as usual dump as usual human dump as usual dump as usual dump as usual dump as usual animal </code></pre> <p>But I want the output to look like this: </p> <pre><code>human dump as usual animal </code></pre> <p>I don't want my list to print everything it iterates through in the dictionary. I only want it to print terms that match. How would I do this? </p>
1
2016-08-08T15:47:25Z
38,833,814
<p>Since you want only 3 lines in output, your for-loops should be re-ordered.</p> <pre><code>for stuff in list_of_things: print_val = None for categories,things in dictionary.iteritems(): if stuff in things: print_val=categories if print_val is None: print_val="dump as usual" print print_val </code></pre>
0
2016-08-08T16:03:30Z
[ "python", "dictionary" ]
Match dictionary with list (Python)
38,833,527
<p>I have a dictionary of words with categories. I want to output the categories if the words match the words in my list. This is what my code looks like at the moment: </p> <pre><code>dictionary = { "object" : 'hat', "animal" : 'cat', "human" : 'steve' } list_of_things = ["steve", "tom", "cat"] for categories,things in dictionary.iteritems(): for stuff in list_of_things: if stuff in things: print categories if stuff not in things: print "dump as usual" </code></pre> <p>Currently the output looks like this:</p> <pre><code>dump as usual dump as usual dump as usual human dump as usual dump as usual dump as usual dump as usual animal </code></pre> <p>But I want the output to look like this: </p> <pre><code>human dump as usual animal </code></pre> <p>I don't want my list to print everything it iterates through in the dictionary. I only want it to print terms that match. How would I do this? </p>
1
2016-08-08T15:47:25Z
38,834,795
<p>First of all, your dictionary is poorly structured; it seems to have its keys and values swapped. By using the categories as keys, you can only have one object per category, which is probably not what you want. It also means that you have to read every entry in the dictionary in order to look up an item, which is generally a bad sign. The fix for this is simple: put the item on the left of the colon, and the category on the right. You can then use the 'in' operator to easily search the dictionary.</p> <p>As far as the question you are directly asking, you should be looping over the list_of_things first, checking each against the dictionary, then printing the result. This will print exactly one thing per item in the list.</p> <pre><code>dictionary = { 'hat' : 'object', 'cat' : 'animal', 'steve' : 'human' } list_of_things = ['steve', 'tom', 'cat'] for thing in list_of_things: if thing in dictionary: print dictionary[thing] else: print "dump as usual" </code></pre> <p>This outputs:</p> <pre><code>human dump as usual animal </code></pre>
1
2016-08-08T17:01:01Z
[ "python", "dictionary" ]
OSError: [Errno 8] Exec format error selenium
38,833,589
<p>Trying to learn how to use selenium, I managed to overcome first error which involved chrome driver not being in the path name but it has thrown up another error. </p> <pre><code> from selenium import webdriver from selenium.webdriver.common.keys import Keys driver = webdriver.Chrome('/Users/williamneal/Scratch/Titanic/chromedriver') driver.get("http://www.bbc.com") </code></pre> <p>The error: Traceback (most recent call last):</p> <pre><code> File "&lt;ipython-input-1-84256e62b8db&gt;", line 5, in &lt;module&gt; driver = webdriver.Chrome('/Users/williamneal/Scratch/Titanic/chromedriver') File "/Users/williamneal/anaconda/lib/python3.5/site-packages/selenium/webdriver/chrome/webdriver.py", line 62, in __init__ self.service.start() File "/Users/williamneal/anaconda/lib/python3.5/site-packages/selenium/webdriver/common/service.py", line 64, in start stdout=self.log_file, stderr=self.log_file) File "/Users/williamneal/anaconda/lib/python3.5/subprocess.py", line 950, in __init__ restore_signals, start_new_session) File "/Users/williamneal/anaconda/lib/python3.5/subprocess.py", line 1544, in _execute_child raise child_exception_type(errno_num, err_msg) OSError: [Errno 8] Exec format error </code></pre> <p>There is a potential solution <a href="http://stackoverflow.com/questions/36141032/python-selenium-chromedriver-oserror-errno-8-exec-format-error">here</a>, which involves installing Chrome Drivers via Home Brew but that option is not available to me. </p> <p>Any ideas?</p>
1
2016-08-08T15:51:47Z
38,836,361
<p>Looks like this is complaining about the format of chromedriver binary. It might be because of platform and chromedriver format mismatch. For example windows requires chromedriver.exe while there are different formats for linux and mac.</p> <p>If you don't want to install through package manager, just download chromedriver from <a href="https://sites.google.com/a/chromium.org/chromedriver/downloads" rel="nofollow">https://sites.google.com/a/chromium.org/chromedriver/downloads</a></p> <p>Note : Choose file as per your os</p> <p>Then place it anywhere on the os and pass that path as an argument. You can also set webdriver.chrome.driver environment variable if you don't want to pass the location every time.</p>
0
2016-08-08T18:44:12Z
[ "python", "selenium" ]
Python program to check matching of simple parentheses
38,833,819
<p>I am a Python newbie and I came across this exercise of checking whether or not the simple brackets "(", ")" in a given string are matched evenly.</p> <p>I have seen examples here using the stack command which I havent encountered yet.So I attempted a different approach. Can anyone tell me where I am going wrong?</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] else: if l == ")": clo = clo + [")"] else: return(ope, clo) if len(ope)==len(clo): return True else: return False </code></pre> <p>The idea is to pile up "(" and ")" into two separate lists and then compare the length of the lists. I also had another version where I had appended the lists ope and clo with the relevant i which held either ( or ) respectively.</p> <p>Thanks for your time!</p>
3
2016-08-08T16:03:36Z
38,834,005
<p>A very slightly more elegant way to do this is below. It cleans up the for loop and replaces the lists with a simple counter variable. It also returns false if the counter drops below zero so that <code>matched(")(")</code> will return <code>False</code>.</p> <pre><code>def matched(str): count = 0 for i in str: if i == "(": count += 1 elif i == ")": count -= 1 if count &lt; 0: return False return count == 0 </code></pre>
5
2016-08-08T16:13:37Z
[ "python" ]
Python program to check matching of simple parentheses
38,833,819
<p>I am a Python newbie and I came across this exercise of checking whether or not the simple brackets "(", ")" in a given string are matched evenly.</p> <p>I have seen examples here using the stack command which I havent encountered yet.So I attempted a different approach. Can anyone tell me where I am going wrong?</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] else: if l == ")": clo = clo + [")"] else: return(ope, clo) if len(ope)==len(clo): return True else: return False </code></pre> <p>The idea is to pile up "(" and ")" into two separate lists and then compare the length of the lists. I also had another version where I had appended the lists ope and clo with the relevant i which held either ( or ) respectively.</p> <p>Thanks for your time!</p>
3
2016-08-08T16:03:36Z
38,834,134
<p>Most blatant error done by you is:</p> <pre><code> if l == ")": clo = clo + [")"] else: return(ope, clo) # here </code></pre> <p>By using return, you exit from function when first char not equal to "(" or ")" is encountered. Also some indentation is off.</p> <p>Minimal change which allows your code to run (although it <strong>won't</strong> give correct answers for all possible input strings) is:</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] elif l == ")": clo = clo + [")"] if len(ope)==len(clo): return True else: return False </code></pre>
3
2016-08-08T16:21:27Z
[ "python" ]
Python program to check matching of simple parentheses
38,833,819
<p>I am a Python newbie and I came across this exercise of checking whether or not the simple brackets "(", ")" in a given string are matched evenly.</p> <p>I have seen examples here using the stack command which I havent encountered yet.So I attempted a different approach. Can anyone tell me where I am going wrong?</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] else: if l == ")": clo = clo + [")"] else: return(ope, clo) if len(ope)==len(clo): return True else: return False </code></pre> <p>The idea is to pile up "(" and ")" into two separate lists and then compare the length of the lists. I also had another version where I had appended the lists ope and clo with the relevant i which held either ( or ) respectively.</p> <p>Thanks for your time!</p>
3
2016-08-08T16:03:36Z
38,834,144
<p>The problem with your approach is that you don't consider the order. Following line would pass: <code>))) (((</code>. I'd suggest to keep the count of open and closed parenthesis:</p> <ul> <li><code>counter</code> starts from 0</li> <li>every <code>(</code> symbol increment counter</li> <li>every <code>)</code> symbol decrements counter</li> <li>if at any moment counter is negative it is an error</li> <li>if at the end of the line counter is 0 - string has matching parenthesis </li> </ul>
1
2016-08-08T16:22:06Z
[ "python" ]
Python program to check matching of simple parentheses
38,833,819
<p>I am a Python newbie and I came across this exercise of checking whether or not the simple brackets "(", ")" in a given string are matched evenly.</p> <p>I have seen examples here using the stack command which I havent encountered yet.So I attempted a different approach. Can anyone tell me where I am going wrong?</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] else: if l == ")": clo = clo + [")"] else: return(ope, clo) if len(ope)==len(clo): return True else: return False </code></pre> <p>The idea is to pile up "(" and ")" into two separate lists and then compare the length of the lists. I also had another version where I had appended the lists ope and clo with the relevant i which held either ( or ) respectively.</p> <p>Thanks for your time!</p>
3
2016-08-08T16:03:36Z
38,834,249
<p>This checks whether parentheses are properly matched, not just whether there is an equal number of opening and closing parentheses. We use a <code>list</code> as a stack and push onto it when we encounter opening parentheses and pop from it when we encounter closing parentheses.</p> <p>The main problem with your solution is that it only <em>counts</em> the number of parentheses but does not <em>match</em> them. One way of keeping track of the current depth of nesting is by pushing opening parentheses onto a stack and popping them from the stack when we encounter a closing parenthesis.</p> <pre><code>def do_parentheses_match(input_string): s = [] balanced = True index = 0 while index &lt; len(input_string) and balanced: token = input_string[index] if token == "(": s.append(token) elif token == ")": if len(s) == 0: balanced = False else: s.pop() index += 1 return balanced and len(s) == 0 </code></pre>
1
2016-08-08T16:28:34Z
[ "python" ]
Python program to check matching of simple parentheses
38,833,819
<p>I am a Python newbie and I came across this exercise of checking whether or not the simple brackets "(", ")" in a given string are matched evenly.</p> <p>I have seen examples here using the stack command which I havent encountered yet.So I attempted a different approach. Can anyone tell me where I am going wrong?</p> <pre><code>def matched(str): ope = [] clo = [] for i in range(0,len(str)): l = str[i] if l == "(": ope = ope + ["("] else: if l == ")": clo = clo + [")"] else: return(ope, clo) if len(ope)==len(clo): return True else: return False </code></pre> <p>The idea is to pile up "(" and ")" into two separate lists and then compare the length of the lists. I also had another version where I had appended the lists ope and clo with the relevant i which held either ( or ) respectively.</p> <p>Thanks for your time!</p>
3
2016-08-08T16:03:36Z
38,834,251
<p>this code works fine </p> <pre><code>def matched(s): p_list=[] for i in range(0,len(s)): if s[i] =='(': p_list.append('(') elif s[i] ==')' : if not p_list: return False else: del p_list[-1] if not p_list: return True else: return False </code></pre>
1
2016-08-08T16:28:43Z
[ "python" ]
Python - Pass a range of float (without step) as an argument of a function
38,833,828
<p>I created a function and I would like to be able to call it with a set of keyworded-parameters that I call <code>**criterias</code>:</p> <pre><code>def actionBasedOnParameters(**criterias): # my code </code></pre> <p>Inside this set of parameters one of them will be called 'SumInc' and I would like to pass a range to it. The range will be of the form of [1:15] or [1:] or [:15]. Something that will essentially let me check whether a variable in my code is greater than a certain boundary or lower than another boundary or both. In the same way, as these lines of codes do:</p> <pre><code>In [188]: 1 &lt;= 15.98877 &lt;= 15 Out[188]: False In [188]: 1 &lt;= 15.98877 Out[188]: True In [188]: 15.98877 &lt;= 15 Out[188]: False </code></pre> <p>But I am looking for a neater way to pass both boundaries without having to create a parameter for each and many if conditions to get things done.</p> <p>Something that would look like this:</p> <pre><code>In [189]: criterias = dict(SumInc=[:15]) def actionBasedOnParameters(**criterias): if criterias['SumInc'] is not None: if my_variable is in criterias['SumInc']: #action1 else: #action2 </code></pre> <p>Is there something of this kind existing?</p> <p>Thanks for your tips,</p>
0
2016-08-08T16:03:59Z
38,836,398
<p>Something like this?</p> <pre><code>criterias = dict(SumInc=(1,15)) def actionBasedOnParameters(**criterias): if 'SumInc' in criterias: lower, upper = criterias['SumInc'] if lower &lt;= my_variable &lt;= upper: #action1 else: #action2 infinity = float('inf') actionBasedOnParameters(SumInc=(1, 15)) actionBasedOnParameters(SumInc=(-infinity, 15)) actionBasedOnParameters(SumInc=(1, infinity)) </code></pre> <p>Also, you'd better use <code>'SumInc' in criterias</code> instead of <code>criterias['SumInc'] is not None</code> because in your case if there is no <code>'SumInc'</code> it will raise you a <code>KeyError</code> exception.</p>
2
2016-08-08T18:46:19Z
[ "python", "function", "arguments", "range", "keyword-argument" ]
pandas: sum of each column results a NaN value?
38,833,837
<p>I have a dataframe in pandas as below. I am trying to add a row with row-name ="Total", which is the sum of each column. I am using the following code : <strong>df.loc["Total"] = df.sum(axis =1)</strong></p> <p>I am getting NaN as a sum of each column. Any idea why and how to solve it ?</p> <p><a href="http://i.stack.imgur.com/9QXbb.jpg" rel="nofollow">dataframe with "Total" row</a></p>
-3
2016-08-08T16:04:29Z
38,833,949
<p>Use:</p> <pre><code>df.loc["Total"] = df.sum() </code></pre> <p>Or if need convert first string values of columns to float:</p> <pre><code>df.loc["Total"] = df.astype(float).sum() </code></pre> <p>Sample:</p> <pre><code>df = pd.DataFrame({'A':[1,2,3], 'B':[4,5,6], 'C':[7,8,9], 'D':[1,3,5], 'E':[5,3,6], 'F':[7,4,3]}) print (df) A B C D E F 0 1 4 7 1 5 7 1 2 5 8 3 3 4 2 3 6 9 5 6 3 df.loc["Total"] = df.sum() print (df) A B C D E F 0 1 4 7 1 5 7 1 2 5 8 3 3 4 2 3 6 9 5 6 3 Total 6 15 24 9 14 14 </code></pre>
0
2016-08-08T16:10:55Z
[ "python", "pandas", "sum", "row" ]
How can I add items to Context.data without loosing it once I exit the inner_function
38,833,859
<p>I am having some trouble with Python Closures, hoping someone here could help. Below is my code.</p> <pre><code>import time from multiprocessing import Process class Context(object): def __init__(self, x, y): self.x = x self.y = y self.data = [] context = Context(1, 2) def test(text): def inner_function(): for i in range(0, 10): text.data.append(i) time.sleep(1) print(text.data.__len__()) thread = Process(target=inner_function) thread.daemon = True thread.start() test(context) time.sleep(12) print("Final {0}".format(context.data.__len__())) </code></pre> <p>The output that I am seeing is</p> <pre><code>1 2 3 4 5 6 7 8 9 10 Final 0 </code></pre> <p>I want Final to have a value of 10. I am using Python 2.7</p>
0
2016-08-08T16:05:21Z
38,834,463
<p>Your problem is not about closures but about <a href="https://docs.python.org/2/library/multiprocessing.html#sharing-state-between-processes" rel="nofollow">sharing data between processes</a> as in <code>thread</code> everything works as expected but you do not pass back your data to the main process. </p> <p>You could return <code>context</code> explicity and maybe using <a href="https://docs.python.org/2/library/multiprocessing.html#multiprocessing.pool.multiprocessing.Pool.apply" rel="nofollow">Pool.apply</a> or apply_async is the right thing for this.</p>
1
2016-08-08T16:40:42Z
[ "python", "python-2.7", "closures" ]
How to force Django to delete objects using multiple inheritance
38,833,866
<p>I have an object model as follows:</p> <pre><code>class Corporation(models.Model): corp_id = models.AutoField(primary_key=True) original_name = models.CharField(max_length=1000, blank=True, null=True) address = models.ManyToManyField(Address, related_name='corp_address') class Person(models.Model): person_id = models.AutoField(primary_key=True) person_address = models.ManyToManyField(Address, related_name='person_address') class Address(models.Model): address1 = models.CharField(max_length=500, blank=True, null=True) address2 = models.CharField(max_length=500, blank=True, null=True) city = models.CharField(max_length=100, blank=True, null=True) state = models.CharField(max_length=100, blank=True, null=True) zipcode = models.CharField(max_length=20, blank=True, null=True) country = models.CharField(max_length=100, blank=True, null=True) class Committee(Corporation): name = models.CharField(blank=True, max_length=200, null=True) industry = models.CharField(blank=True, max_length=100, null=True) </code></pre> <p>When I create a Committee object, I create a Corporation and an Address object. A single Address object may have multiple Corporations pointing to it.</p> <p>However, when I do Committee.objects.delete(), Django deletes the Committee object but not the related Corporation or Address object.</p> <p>When I delete a Committee object, I want to delete the associated Address object if another object does not point to it. I also want to delete the associated Corporation object if another object does not point to it.</p> <p>How can I do this conditional cascaded delete?</p>
1
2016-08-08T16:05:40Z
38,833,974
<p>Check out <a href="https://docs.djangoproject.com/ja/1.9/ref/models/fields/#module-django.db.models.fields.related" rel="nofollow">on_delete</a> set to cascade in django which will delete the associated records also . </p> <p>In your models please add on_delete = models.CASCADE in this fashion:</p> <pre><code> class Car(models.Model): manufacturer = models.ForeignKey( 'Manufacturer', on_delete=models.CASCADE) </code></pre> <p>Here is a good <a href="http://stackoverflow.com/questions/3937194/django-cascade-deletion-in-manytomanyrelation">post</a> which explains models.CASCADE delete and ManyToMany relation on Django.</p>
1
2016-08-08T16:12:06Z
[ "python", "django", "multiple-inheritance" ]
Write Custom Python-Based Gradient Function for an Operation? (without C++ Implementation)
38,833,934
<p>I'm trying to write a custom gradient function for 'my_op' which for the sake of the example contains just a call to tf.identity() (ideally, it could be any graph).</p> <pre><code>import tensorflow as tf from tensorflow.python.framework import function def my_op_grad(x): return [tf.sigmoid(x)] @function.Defun(a=tf.float32, python_grad_func=my_op_grad) def my_op(a): return tf.identity(a) a = tf.Variable(tf.constant([5., 4., 3., 2., 1.], dtype=tf.float32)) sess = tf.Session() sess.run(tf.initialize_all_variables()) grad = tf.gradients(my_op(a), [a])[0] result = sess.run(grad) print(result) sess.close() </code></pre> <p>Unfortunately I get the following error:</p> <pre><code>Traceback (most recent call last): File "custom_op.py", line 19, in &lt;module&gt; grad = tf.gradients(my_op(a), [a])[0] File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/function.py", line 528, in __call__ return call_function(self._definition, *args, **kwargs) File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/function.py", line 267, in call_function compute_shapes=False) File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/ops.py", line 2285, in create_op raise TypeError("Input #%d is not a tensor: %s" % (idx, a)) TypeError: Input #0 is not a tensor: &lt;tensorflow.python.ops.variables.Variable object at 0x1080d2710&gt; </code></pre> <p>I know that it is possible to create a custom C++ operation, but in my case I just need to write a custom gradient for a function which can be easily written in Python using standard TensorFlow operations, so I would like to avoid writing unnecessary C++ code.</p> <p>Also, I'm using the upstream version of TensorFlow from GitHub.</p>
1
2016-08-08T16:10:13Z
38,862,401
<p>Note that python_grad_func needs the same interface as ops.RegisterGradient (<a href="https://github.com/tensorflow/tensorflow/blob/master/tensorflow/python/framework/function.py#L349" rel="nofollow">https://github.com/tensorflow/tensorflow/blob/master/tensorflow/python/framework/function.py#L349</a>). </p> <p>Here is the modified code example:</p> <pre><code>def my_op_grad(op, grad): ### instead of my_op_grad(x) return tf.sigmoid(op.inputs[0]) @function.Defun(a=tf.float32, python_grad_func=my_op_grad) def my_op(a): return tf.identity(a) def main(unused_argv): a = tf.Variable(tf.constant([-5., 4., -3., 2., 1.], dtype=tf.float32)) sess = tf.Session() sess.run(tf.initialize_all_variables()) a = tf.identity(a) #workaround for bug github.com/tensorflow/tensorflow/issues/3710 grad = tf.gradients(my_op(a), [a])[0] result = sess.run(grad) print(result) sess.close() </code></pre> <p>Output:</p> <pre><code>[ 0.00669286 0.98201376 0.04742587 0.88079709 0.7310586 ] </code></pre>
1
2016-08-10T00:22:52Z
[ "python", "tensorflow", "gradient-descent" ]
Write Custom Python-Based Gradient Function for an Operation? (without C++ Implementation)
38,833,934
<p>I'm trying to write a custom gradient function for 'my_op' which for the sake of the example contains just a call to tf.identity() (ideally, it could be any graph).</p> <pre><code>import tensorflow as tf from tensorflow.python.framework import function def my_op_grad(x): return [tf.sigmoid(x)] @function.Defun(a=tf.float32, python_grad_func=my_op_grad) def my_op(a): return tf.identity(a) a = tf.Variable(tf.constant([5., 4., 3., 2., 1.], dtype=tf.float32)) sess = tf.Session() sess.run(tf.initialize_all_variables()) grad = tf.gradients(my_op(a), [a])[0] result = sess.run(grad) print(result) sess.close() </code></pre> <p>Unfortunately I get the following error:</p> <pre><code>Traceback (most recent call last): File "custom_op.py", line 19, in &lt;module&gt; grad = tf.gradients(my_op(a), [a])[0] File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/function.py", line 528, in __call__ return call_function(self._definition, *args, **kwargs) File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/function.py", line 267, in call_function compute_shapes=False) File "/Users/njk/tfm/lib/python3.5/site-packages/tensorflow/python/framework/ops.py", line 2285, in create_op raise TypeError("Input #%d is not a tensor: %s" % (idx, a)) TypeError: Input #0 is not a tensor: &lt;tensorflow.python.ops.variables.Variable object at 0x1080d2710&gt; </code></pre> <p>I know that it is possible to create a custom C++ operation, but in my case I just need to write a custom gradient for a function which can be easily written in Python using standard TensorFlow operations, so I would like to avoid writing unnecessary C++ code.</p> <p>Also, I'm using the upstream version of TensorFlow from GitHub.</p>
1
2016-08-08T16:10:13Z
39,565,081
<p>The following seems work fine. Do you have any reason prefering python_grad_func instead?</p> <pre><code>@tf.function.Defun(tf.float32, tf.float32) def bprop(x, dy): return tf.sigmoid(x) @tf.function.Defun(tf.float32, grad_func=bprop) def fprop(x): return x # identity a = tf.Variable(tf.constant([-5., 4., -3., 2., 1.], dtype=tf.float32)) with tf.Session() as sess: sess.run(tf.initialize_all_variables()) a = tf.identity(a) grad = tf.gradients(fprop(a), [a]) result = sess.run(grad) print(result) </code></pre>
0
2016-09-19T03:50:42Z
[ "python", "tensorflow", "gradient-descent" ]
Compare only part of two of three items in triple
38,833,937
<p>I have a list that goes something like this, and new content is added in a loop.</p> <pre><code>list = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] </code></pre> <p>In the loop I want to add items like so:</p> <pre><code>list.append(("strawberry", "b", 4)) </code></pre> <p>however, this cannot occur if the first and second item in that sequence is already in the list together. For instance, the following list cannot be added to <code>list</code> because the first item already contains "banana" together with "a".</p> <pre><code>("banana", "a", 5) # Should NOT be appended ("banana", "c", 6) # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended </code></pre> <p>In a regular list we'd do something like the following to avoid duplicates:</p> <pre><code>if not item in list: list.append(item) </code></pre> <p>but note that my case does only involve partial duplicate, i.e. the first two items cannot be identical between sublists.</p> <p>I am looking for a very efficient solution because the list can contain thousands of items.</p>
1
2016-08-08T16:10:21Z
38,834,137
<p>A time-efficient solution would be to keep a <code>set</code> with added items</p> <pre><code>li = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] se= set(t[:2] for t in li) add=[ ("banana", "a", 5), # Should NOT be appended ("banana", "c", 6), # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended ] for t in add: ct=t[:2] if ct not in se: li.append(t) se.add(ct) </code></pre> <p>after that, <code>li</code> is <code>[('banana', 'a', 0), ('banana', 'b', 1), ('coconut', 'a', 2), ('banana', 'c', 6), ('strawberry', 'a', 7)]</code> </p>
0
2016-08-08T16:21:34Z
[ "python", "list", "duplicates", "append" ]
Compare only part of two of three items in triple
38,833,937
<p>I have a list that goes something like this, and new content is added in a loop.</p> <pre><code>list = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] </code></pre> <p>In the loop I want to add items like so:</p> <pre><code>list.append(("strawberry", "b", 4)) </code></pre> <p>however, this cannot occur if the first and second item in that sequence is already in the list together. For instance, the following list cannot be added to <code>list</code> because the first item already contains "banana" together with "a".</p> <pre><code>("banana", "a", 5) # Should NOT be appended ("banana", "c", 6) # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended </code></pre> <p>In a regular list we'd do something like the following to avoid duplicates:</p> <pre><code>if not item in list: list.append(item) </code></pre> <p>but note that my case does only involve partial duplicate, i.e. the first two items cannot be identical between sublists.</p> <p>I am looking for a very efficient solution because the list can contain thousands of items.</p>
1
2016-08-08T16:10:21Z
38,834,141
<p>you may check the presence of an new item with</p> <pre><code>#check for every item if newItem matches an Item in the list if not any( True for item in list if newItem[:2]==item[:2] ): # add your newItem </code></pre>
1
2016-08-08T16:21:48Z
[ "python", "list", "duplicates", "append" ]
Compare only part of two of three items in triple
38,833,937
<p>I have a list that goes something like this, and new content is added in a loop.</p> <pre><code>list = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] </code></pre> <p>In the loop I want to add items like so:</p> <pre><code>list.append(("strawberry", "b", 4)) </code></pre> <p>however, this cannot occur if the first and second item in that sequence is already in the list together. For instance, the following list cannot be added to <code>list</code> because the first item already contains "banana" together with "a".</p> <pre><code>("banana", "a", 5) # Should NOT be appended ("banana", "c", 6) # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended </code></pre> <p>In a regular list we'd do something like the following to avoid duplicates:</p> <pre><code>if not item in list: list.append(item) </code></pre> <p>but note that my case does only involve partial duplicate, i.e. the first two items cannot be identical between sublists.</p> <p>I am looking for a very efficient solution because the list can contain thousands of items.</p>
1
2016-08-08T16:10:21Z
38,834,175
<p>You can use tuples as keys in a dictionary:</p> <pre><code>fruits = { ('banana', 'a'): 0, ('banana', 'b'): 1, ('coconut', 'a'): 2, } </code></pre> <p>Then, you can just check if <code>(item[0], item[1])</code> is already in the dictionary:</p> <pre><code>item = ('strawberry', 'b', 4) if (item[0], item[1]) not in fruits: fruits[item[0], item[1]] = item[2] </code></pre> <p>If you want to preserve order, you can use <a href="https://docs.python.org/2/library/collections.html#collections.OrderedDict" rel="nofollow">OrderedDict</a> instead of the built-in dictionary.</p> <p>This avoids using more memory to store a set of keys and is also efficient regarding lookup.</p>
1
2016-08-08T16:23:55Z
[ "python", "list", "duplicates", "append" ]
Compare only part of two of three items in triple
38,833,937
<p>I have a list that goes something like this, and new content is added in a loop.</p> <pre><code>list = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] </code></pre> <p>In the loop I want to add items like so:</p> <pre><code>list.append(("strawberry", "b", 4)) </code></pre> <p>however, this cannot occur if the first and second item in that sequence is already in the list together. For instance, the following list cannot be added to <code>list</code> because the first item already contains "banana" together with "a".</p> <pre><code>("banana", "a", 5) # Should NOT be appended ("banana", "c", 6) # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended </code></pre> <p>In a regular list we'd do something like the following to avoid duplicates:</p> <pre><code>if not item in list: list.append(item) </code></pre> <p>but note that my case does only involve partial duplicate, i.e. the first two items cannot be identical between sublists.</p> <p>I am looking for a very efficient solution because the list can contain thousands of items.</p>
1
2016-08-08T16:10:21Z
38,834,306
<pre><code>data = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] items = [("banana", "a", 5), ("banana", "c", 6), ("strawberry", "a", 7)] for item in items: if item[:2] not in map(lambda x: x[:2], data): data.append(item) </code></pre> <p>Output:</p> <pre><code> [('banana', 'a', 0), ('banana', 'b', 1), ('coconut', 'a', 2), ('banana', 'c', 6), ('strawberry', 'a', 7)] </code></pre>
1
2016-08-08T16:31:20Z
[ "python", "list", "duplicates", "append" ]
Compare only part of two of three items in triple
38,833,937
<p>I have a list that goes something like this, and new content is added in a loop.</p> <pre><code>list = [("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2)] </code></pre> <p>In the loop I want to add items like so:</p> <pre><code>list.append(("strawberry", "b", 4)) </code></pre> <p>however, this cannot occur if the first and second item in that sequence is already in the list together. For instance, the following list cannot be added to <code>list</code> because the first item already contains "banana" together with "a".</p> <pre><code>("banana", "a", 5) # Should NOT be appended ("banana", "c", 6) # SHOULD be appended ("strawberry", "a", 7) # SHOULD be appended </code></pre> <p>In a regular list we'd do something like the following to avoid duplicates:</p> <pre><code>if not item in list: list.append(item) </code></pre> <p>but note that my case does only involve partial duplicate, i.e. the first two items cannot be identical between sublists.</p> <p>I am looking for a very efficient solution because the list can contain thousands of items.</p>
1
2016-08-08T16:10:21Z
38,834,467
<p>I would highly recommend using a <em>dictionary</em> for this type of data coupling structure, along with <strong>O(1)</strong> look-up times, you'll also be implementing better design. However, you could do this with your current data structure using the following:</p> <p><strong>Sample output:</strong></p> <p><em>With current structure</em>: </p> <pre><code>l = [ ("banana", "a", 0), ("banana", "b", 1), ("coconut", "a", 2) ] items_to_add = [("banana", "a", 5), ("banana", "c", 6), ("strawberry", "a", 7)] for item_to_add in items_to_add: if not item_to_add[:2] in [i[:2] for i in l]: l.append(item_to_add) print l &gt;&gt;&gt; [('banana', 'a', 0), ('banana', 'b', 1), ('coconut', 'a', 2), ('banana', 'c', 6), ('strawberry', 'a', 7)] </code></pre> <p>Other wise, you can use a dictionary (<em>factor out your two first elements to be your key</em>):</p> <p><em>With dictionary</em>:</p> <pre><code>d = { ("banana", "a") : 0, ("banana", "b") : 1, ("coconut", "a") : 2 } items_to_add = [("banana", "a", 5), ("banana", "c", 6), ("strawberry", "a", 7)] for item_to_add in items_to_add: key = item_to_add[:2] value = item_to_add[-1] if not key in d: d[key] = value print d &gt;&gt;&gt; {('coconut', 'a'): 2, ('strawberry', 'a'): 7, ('banana', 'c'): 6, ('banana', 'a'): 0, ('banana', 'b'): 1} </code></pre> <p>A dictionary works very well in this scenario as you're trying to leverage properties of <strong>key/value</strong> data structure. Unique keys are ensured, and this will be the most efficient route as well. </p>
1
2016-08-08T16:40:59Z
[ "python", "list", "duplicates", "append" ]
Using Python to manipulate 31-bits
38,833,978
<p>I have a specification which outlines how instructions should be sent over serial.</p> <p>Currently I am crafting the packets that will go over the connection.</p> <p>One segment of the packet, requires a 32-bit (4 byte) binary number. The first 31-bits are 'data' and the last bit is merely a flag.</p> <p>So, The max decimal number that could fit in data is: 2147483647 (2^31). Data could never be bigger than this, Cool!</p> <p>My problem, is how do I go about encoding the data to 31-bits binary, then setting the final bit to enable the flag?</p> <p>Say my data is <code>7AAAAAAA</code> what is the desirable way of converting this to 31 bit binary then adding 1 or a 0 to the end?</p> <p><strong>Edit - I'm Using Python 3.4</strong></p>
2
2016-08-08T16:12:16Z
38,834,214
<p>The only thing which comes to my mind is operation on strings</p> <p>Say we have two variables:</p> <pre><code>&gt;&gt;&gt; data = '7AAAAAAA' &gt;&gt;&gt; flag = '1' </code></pre> <p>Convert the data hex to number</p> <pre><code>&gt;&gt;&gt; num = int(data, 16) &gt;&gt;&gt; num 2058005162 </code></pre> <p>Convert the number to string binary representation:</p> <pre><code>&gt;&gt;&gt; bin_num = bin(num) &gt;&gt;&gt; bin_num '0b1111010101010101010101010101010' </code></pre> <p>Append flag to the end</p> <pre><code>&gt;&gt;&gt; bin_num += flag &gt;&gt;&gt; bin_num '0b11110101010101010101010101010101' </code></pre> <p>Evaluate string to get number and convert back to hex or whatever you need:</p> <pre><code>&gt;&gt;&gt; eval(bin_num) 4116010325 </code></pre> <p><strong>#edit1</strong></p> <p>In order to extend the value to 4-bytes you can use:</p> <pre><code>&gt;&gt;&gt; final_val = eval(bin_num) &gt;&gt;&gt; int.to_bytes(final_val, 4, 'big') b'\xf5UUU' </code></pre> <p><strong>#edit2</strong></p> <pre><code>def convert(data, flag): with_flag = eval(bin(int(data, 16)) + flag) return int.to_bytes(with_flag, 4, 'big') def unconvert(byte_data): bin_str = bin(int.from_bytes(byte_data, 'big')) flag = bin_str[-1] data = bin_str[:-1] return (hex(eval(data)), flag) </code></pre>
1
2016-08-08T16:26:28Z
[ "python", "binary", "hex", "python-3.4", "pyserial" ]
Using Python to manipulate 31-bits
38,833,978
<p>I have a specification which outlines how instructions should be sent over serial.</p> <p>Currently I am crafting the packets that will go over the connection.</p> <p>One segment of the packet, requires a 32-bit (4 byte) binary number. The first 31-bits are 'data' and the last bit is merely a flag.</p> <p>So, The max decimal number that could fit in data is: 2147483647 (2^31). Data could never be bigger than this, Cool!</p> <p>My problem, is how do I go about encoding the data to 31-bits binary, then setting the final bit to enable the flag?</p> <p>Say my data is <code>7AAAAAAA</code> what is the desirable way of converting this to 31 bit binary then adding 1 or a 0 to the end?</p> <p><strong>Edit - I'm Using Python 3.4</strong></p>
2
2016-08-08T16:12:16Z
38,834,450
<p>I think you can use binary shift to add your flag to a number:</p> <pre><code>a = 0x7AAAAAAA # 2058005162 = 0b1111010101010101010101010101010 f = 1 # 1 = 0b1 packet = a + (f &lt;&lt; 31) # a + 0b10000000000000000000000000000000 bin(packet) # 0b11111010101010101010101010101010 </code></pre> <p>To unpack you can use mask and binary AND like this:</p> <pre><code>mask = (1 &lt;&lt; 31) - 1 # 2147483647 = 0b1111111111111111111111111111111 a = packet &amp; mask # 2058005162 = 0b1111010101010101010101010101010 f = packet &gt;&gt; 31 # 1 = 0b1 </code></pre>
2
2016-08-08T16:39:53Z
[ "python", "binary", "hex", "python-3.4", "pyserial" ]
Using Python to manipulate 31-bits
38,833,978
<p>I have a specification which outlines how instructions should be sent over serial.</p> <p>Currently I am crafting the packets that will go over the connection.</p> <p>One segment of the packet, requires a 32-bit (4 byte) binary number. The first 31-bits are 'data' and the last bit is merely a flag.</p> <p>So, The max decimal number that could fit in data is: 2147483647 (2^31). Data could never be bigger than this, Cool!</p> <p>My problem, is how do I go about encoding the data to 31-bits binary, then setting the final bit to enable the flag?</p> <p>Say my data is <code>7AAAAAAA</code> what is the desirable way of converting this to 31 bit binary then adding 1 or a 0 to the end?</p> <p><strong>Edit - I'm Using Python 3.4</strong></p>
2
2016-08-08T16:12:16Z
38,834,714
<p>See if this works, similar to other answers but accounts for original bit length.</p> <p>Define the final number of bits</p> <pre><code>&gt;&gt;&gt; bits = 16 </code></pre> <p>Start with a bytes literal</p> <pre><code>&gt;&gt;&gt; a = b'10' </code></pre> <p>Convert to an <code>int</code></p> <pre><code>&gt;&gt;&gt; b = int(a, base = 16) </code></pre> <p>Shift left to the required bit length</p> <pre><code>&gt;&gt;&gt; shift = bits - b.bit_length() &gt;&gt;&gt; c = b &lt;&lt; shift </code></pre> <p>Add the <em>flag</em></p> <pre><code>&gt;&gt;&gt; d = c | 1 &gt;&gt;&gt; &gt;&gt;&gt; a b'10' &gt;&gt;&gt; b 16 &gt;&gt;&gt; c 32768 &gt;&gt;&gt; d 32769 &gt;&gt;&gt; bin(b) '0b10000' &gt;&gt;&gt; bin(c) '0b1000000000000000' &gt;&gt;&gt; bin(d) '0b1000000000000001' &gt;&gt;&gt; </code></pre>
0
2016-08-08T16:55:46Z
[ "python", "binary", "hex", "python-3.4", "pyserial" ]
Use a.empty, a.bool(), a.item(), a.any() or a.all()
38,834,028
<pre><code>import random import pandas as pd heart_rate = [random.randrange(45,125) for _ in range(500)] blood_pressure_systolic = [random.randrange(140,230) for _ in range(500)] blood_pressure_dyastolic = [random.randrange(90,140) for _ in range(500)] temperature = [random.randrange(34,42) for _ in range(500)] respiratory_rate = [random.randrange(8,35) for _ in range(500)] pulse_oximetry = [random.randrange(95,100) for _ in range(500)] vitalsign = {'heart rate' : heart_rate, 'systolic blood pressure' : blood_pressure_systolic, 'dyastolic blood pressure' : blood_pressure_dyastolic, 'temperature' : temperature, 'respiratory rate' : respiratory_rate, 'pulse oximetry' : pulse_oximetry} df = pd.DataFrame(vitalsign) df.to_csv('vitalsign.csv') mask = (50 &lt; df['heart rate'] &lt; 101 &amp; 140 &lt; df['systolic blood pressure'] &lt; 160 &amp; 90 &lt; df['dyastolic blood pressure'] &lt; 100 &amp; 35 &lt; df['temperature'] &lt; 39 &amp; 11 &lt; df['respiratory rate'] &lt; 19 &amp; 95 &lt; df['pulse oximetry'] &lt; 100 , "excellent", "critical") df.loc[mask, "class"] </code></pre> <p>it seems to be that,</p> <p>error that i am receiving : ValueError: The truth value of a Series is ambiguous. Use a.empty, a.bool(), a.item(), a.any() or a.all(). how can i sort it out</p>
0
2016-08-08T16:14:54Z
38,834,238
<p>solution is easy:</p> <p>replace</p> <pre><code> mask = (50 &lt; df['heart rate'] &lt; 101 &amp; 140 &lt; df['systolic blood pressure'] &lt; 160 &amp; 90 &lt; df['dyastolic blood pressure'] &lt; 100 &amp; 35 &lt; df['temperature'] &lt; 39 &amp; 11 &lt; df['respiratory rate'] &lt; 19 &amp; 95 &lt; df['pulse oximetry'] &lt; 100 , "excellent", "critical") </code></pre> <p>by </p> <pre><code>mask = ((50 &lt; df['heart rate'] &lt; 101) &amp; (140 &lt; df['systolic blood pressure'] &lt; 160) &amp; (90 &lt; df['dyastolic blood pressure'] &lt; 100) &amp; (35 &lt; df['temperature'] &lt; 39) &amp; (11 &lt; df['respiratory rate'] &lt; 19) &amp; (95 &lt; df['pulse oximetry'] &lt; 100) , "excellent", "critical") </code></pre>
0
2016-08-08T16:28:00Z
[ "python", "pandas" ]
Use a.empty, a.bool(), a.item(), a.any() or a.all()
38,834,028
<pre><code>import random import pandas as pd heart_rate = [random.randrange(45,125) for _ in range(500)] blood_pressure_systolic = [random.randrange(140,230) for _ in range(500)] blood_pressure_dyastolic = [random.randrange(90,140) for _ in range(500)] temperature = [random.randrange(34,42) for _ in range(500)] respiratory_rate = [random.randrange(8,35) for _ in range(500)] pulse_oximetry = [random.randrange(95,100) for _ in range(500)] vitalsign = {'heart rate' : heart_rate, 'systolic blood pressure' : blood_pressure_systolic, 'dyastolic blood pressure' : blood_pressure_dyastolic, 'temperature' : temperature, 'respiratory rate' : respiratory_rate, 'pulse oximetry' : pulse_oximetry} df = pd.DataFrame(vitalsign) df.to_csv('vitalsign.csv') mask = (50 &lt; df['heart rate'] &lt; 101 &amp; 140 &lt; df['systolic blood pressure'] &lt; 160 &amp; 90 &lt; df['dyastolic blood pressure'] &lt; 100 &amp; 35 &lt; df['temperature'] &lt; 39 &amp; 11 &lt; df['respiratory rate'] &lt; 19 &amp; 95 &lt; df['pulse oximetry'] &lt; 100 , "excellent", "critical") df.loc[mask, "class"] </code></pre> <p>it seems to be that,</p> <p>error that i am receiving : ValueError: The truth value of a Series is ambiguous. Use a.empty, a.bool(), a.item(), a.any() or a.all(). how can i sort it out</p>
0
2016-08-08T16:14:54Z
38,834,618
<p>As user2357112 mentioned in the comments, you cannot use chained comparisons here. For elementwise comparison you need to use <code>&amp;</code>. That also requires using parentheses so that <code>&amp;</code> wouldn't take precedence. </p> <p>It would go something like this:</p> <pre><code>mask = ((50 &lt; df['heart rate']) &amp; (101 &gt; df['heart rate']) &amp; (140 &lt; df['systolic... </code></pre> <p>In order to avoid that, you can build series for lower and upper limits:</p> <pre><code>low_limit = pd.Series([90, 50, 95, 11, 140, 35], index=df.columns) high_limit = pd.Series([160, 101, 100, 19, 160, 39], index=df.columns) </code></pre> <p>Now you can slice it as follows:</p> <pre><code>mask = ((df &lt; high_limit) &amp; (df &gt; low_limit)).all(axis=1) df[mask] Out: dyastolic blood pressure heart rate pulse oximetry respiratory rate \ 17 136 62 97 15 69 110 85 96 18 72 105 85 97 16 161 126 57 99 16 286 127 84 99 12 435 92 67 96 13 499 110 66 97 15 systolic blood pressure temperature 17 141 37 69 155 38 72 154 36 161 153 36 286 156 37 435 155 36 499 149 36 </code></pre> <p>And for assignment you can use np.where:</p> <pre><code>df['class'] = np.where(mask, 'excellent', 'critical') </code></pre>
2
2016-08-08T16:49:38Z
[ "python", "pandas" ]
Calculating mean value in DataFrame using a mask
38,834,031
<p>I have the following DataFrame:</p> <pre><code> DATA Price1 Price2 Price3 sys dis 27 0.8 43.89 83.06 33.75 0.9 2.56 12.19 2.48 1.0 42.28 1.87 1.93 1.2 22.70 1.41 3.64 1.4 20.38 1.36 2.02 28 0.8 22.024 35.47 16.96 0.9 2.69 36.41 19.33 1.0 59.30 8.90 11.41 1.2 25.08 4.55 11.99 1.4 26.85 3.30 7.37 1.6 437.82 3.50 5.65 1.8 55.21 2.91 1.84 2.0 32.54 4.68 5.03 2.5 52.91 5.42 6.58 </code></pre> <p>I need to calculate <code>mean</code> Prices for <code>dis &lt; 1.0</code> and seperately for <code>dis &gt; 1.0</code>. </p> <p>I've tried to create a mask function:</p> <pre><code>def mask(df): df.loc[df.index.get_level_values('dis').between(0.8,1.0), 'Price1'].mean() df.loc[df.index.get_level_values('dis').between(1.0,2.6), 'Price1'].mean() return df print (df_new.ix[:,'Price1']).apply(mask) </code></pre> <p>Thought I am getting the following error : </p> <blockquote> <p>AttributeError: ("'Float64Index' object has no attribute 'between'").</p> </blockquote>
1
2016-08-08T16:15:02Z
38,834,158
<p>easiest solution is</p> <pre><code>df['price_low']=df.ix[df.reset_index()['dis'] &lt; 1,'price'] df['price_high']=df.ix[df.reset_index()['dis'] &gt; 1, 'price'] df.price_low.mean() df.price_high.mean() </code></pre>
0
2016-08-08T16:22:53Z
[ "python", "pandas", "dataframe" ]
Calculating mean value in DataFrame using a mask
38,834,031
<p>I have the following DataFrame:</p> <pre><code> DATA Price1 Price2 Price3 sys dis 27 0.8 43.89 83.06 33.75 0.9 2.56 12.19 2.48 1.0 42.28 1.87 1.93 1.2 22.70 1.41 3.64 1.4 20.38 1.36 2.02 28 0.8 22.024 35.47 16.96 0.9 2.69 36.41 19.33 1.0 59.30 8.90 11.41 1.2 25.08 4.55 11.99 1.4 26.85 3.30 7.37 1.6 437.82 3.50 5.65 1.8 55.21 2.91 1.84 2.0 32.54 4.68 5.03 2.5 52.91 5.42 6.58 </code></pre> <p>I need to calculate <code>mean</code> Prices for <code>dis &lt; 1.0</code> and seperately for <code>dis &gt; 1.0</code>. </p> <p>I've tried to create a mask function:</p> <pre><code>def mask(df): df.loc[df.index.get_level_values('dis').between(0.8,1.0), 'Price1'].mean() df.loc[df.index.get_level_values('dis').between(1.0,2.6), 'Price1'].mean() return df print (df_new.ix[:,'Price1']).apply(mask) </code></pre> <p>Thought I am getting the following error : </p> <blockquote> <p>AttributeError: ("'Float64Index' object has no attribute 'between'").</p> </blockquote>
1
2016-08-08T16:15:02Z
38,834,889
<p>You could use boolean comparators:</p> <pre><code>mean_low = df.loc[(df.index.get_level_values('dis') &lt; 1.0), 'Price1'].mean() mean_high = df.loc[(df.index.get_level_values('dis') &gt; 1.0), 'Price1'].mean() </code></pre>
2
2016-08-08T17:06:52Z
[ "python", "pandas", "dataframe" ]