commit
stringlengths
40
40
subject
stringlengths
1
1.49k
old_file
stringlengths
4
311
new_file
stringlengths
4
311
new_contents
stringlengths
1
29.8k
old_contents
stringlengths
0
9.9k
lang
stringclasses
3 values
proba
float64
0
1
450557e0bfb902de862e5fe42868d3fbf7165600
Add lc0983_minimum_cost_for_tickets.py from Hotel Schulz Berlin
lc0983_minimum_cost_for_tickets.py
lc0983_minimum_cost_for_tickets.py
"""Leetcode 983. Minimum Cost For Tickets Medium URL: https://leetcode.com/problems/minimum-cost-for-tickets/ In a country popular for train travel, you have planned some train travelling one year in advance. The days of the year that you will travel is given as an array days. Each day is an integer from 1 to 365. Train tickets are sold in 3 different ways: - a 1-day pass is sold for costs[0] dollars; - a 7-day pass is sold for costs[1] dollars; - a 30-day pass is sold for costs[2] dollars. The passes allow that many days of consecutive travel. For example, if we get a 7-day pass on day 2, then we can travel for 7 days: day 2, 3, 4, 5, 6, 7, and 8. Return the minimum number of dollars you need to travel every day in the given list of days. Example 1: Input: days = [1,4,6,7,8,20], costs = [2,7,15] Output: 11 Explanation: For example, here is one way to buy passes that lets you travel your travel plan: On day 1, you bought a 1-day pass for costs[0] = $2, which covered day 1. On day 3, you bought a 7-day pass for costs[1] = $7, which covered days 3, 4, ..., 9. On day 20, you bought a 1-day pass for costs[0] = $2, which covered day 20. In total you spent $11 and covered all the days of your travel. Example 2: Input: days = [1,2,3,4,5,6,7,8,9,10,30,31], costs = [2,7,15] Output: 17 Explanation: For example, here is one way to buy passes that lets you travel your travel plan: On day 1, you bought a 30-day pass for costs[2] = $15 which covered days 1, 2, ..., 30. On day 31, you bought a 1-day pass for costs[0] = $2 which covered day 31. In total you spent $17 and covered all the days of your travel. Note: - 1 <= days.length <= 365 - 1 <= days[i] <= 365 - days is in strictly increasing order. - costs.length == 3 - 1 <= costs[i] <= 1000 """ class Solution(object): def mincostTickets(self, days, costs): """ :type days: List[int] :type costs: List[int] :rtype: int """ pass def main(): pass if __name__ == '__main__': main()
Python
0.000001
a737126f8f8bcac1a00999f9e5c2a23bca9efd0d
Create hamming.py
hamming.py
hamming.py
#Python Problem 2 #hamming.py #Introduction to Bioinformatics Assignment 2 #Purpose:Calculate Hamming Distance #Your Name: Michael Thomas #Date: 10/10/15 #stores 3 database sequences seqList = ["AGGATACAGCGGCTTCTGCGCGACAAATAAGAGCTCCTTGTAAAGCGCCAAAAAAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGAGGCAGATTCGGAGGAAGGTCTGAAAAG", "AAAATACAGGGGGTTCTGCGCGACTTATGGGAGCTCCTTGTGCGGCGCCATTTTAAGCCTCACAGACTATGGCAGCAGCGTTGGCCCGGCAAAAGGAGCGGAGAGCGAGGGGAGGCGGAGACGGACGAAGGTCTGAGCAG", "CCCATACAGCCGCTCCTCCGCGACTTATAAGAGCTCCTTGTGCGGCGCCATTTTAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGCCCAAAACAGCGGAGAGCGAGGGGAGGCGGAGACGGAGGAAGGTCTGAGCAG"] #your query sequence s1 = "AGGATACAGCGGCTTCTGCGCGACTTATAAGAGCTCCTTGTGCGGCGCCATTTTAAGCCTCTCGGTCTGTGGCAGCAGCGTTGGCCCGGCCCCGGGAGCGGAGAGCGAGGGGAGGCGGAGACGGAGGAAGGTCTGAGGAG" count=[0,0,0] #outer loop to go through seqList[] for i in range(len(seqList)): #save each string to iterate trough on secondary loop seqi = seqList[i] #checks for non-matches between s1 and seqi and iterates count for j in range(len(s1)): if s1[j] != seqi[j]: count[i] = count[i] + 1 #Results #hamming distance for each sequence print "The Hamming distance dh(s1,seqList[0]) =", count[0] print "The Hamming distance dh(s1,seqList[1]) = ", count[1] print "The Hamming distance dh(s1,seqList[2]) = ", count[2]
Python
0.000001
290239e45b5a4eae88a5c92304b46bf74a04b616
update Enclosure.mime docstring [skip ci]
mailthon/enclosure.py
mailthon/enclosure.py
""" mailthon.enclosure ~~~~~~~~~~~~~~~~~~ Implements Enclosure objects- parts that collectively make up body of the email. :copyright: (c) 2015 by Eeo Jun :license: MIT, see LICENSE for details. """ from email.encoders import encode_base64 from email.message import Message from email.mime.base import MIMEBase from email.mime.text import MIMEText from os.path import basename from .helpers import guess from .headers import Headers, content_disposition class Enclosure(object): """ Base class for Enclosure objects to inherit from. An enclosure is a part of the enclosure in a real envelope- it contains part of the content to be sent. :param headers: Iterable of headers to include, stored in an RFC-compliant Headers mapping internally under the headers attribute. """ def __init__(self, headers=()): self.headers = Headers(headers) def mime_object(self): """ To be overriden. Returns the generated MIME object, without applying the internal headers. """ raise NotImplementedError def mime(self): """ Returns the finalised mime object, after applying the internal headers. Usually this is not to be overriden. """ mime = self.mime_object() self.headers.prepare(mime) return mime class PlainText(Enclosure): """ Enclosure that has a text/plain mimetype. :param content: Unicode or bytes string. :param encoding: Encoding used to serialize the content or the encoding of the content. :param headers: Optional headers. """ subtype = 'plain' def __init__(self, content, encoding='utf-8', **kwargs): Enclosure.__init__(self, **kwargs) self.content = content self.encoding = encoding def mime_object(self): return MIMEText(self.content, self.subtype, self.encoding) class HTML(PlainText): """ Subclass of PlainText with a text/html mimetype. """ subtype = 'html' class Binary(Enclosure): """ An Enclosure subclass for binary content. If the content is HTML or any kind of plain-text then the HTML or PlainText Enclosures are receommended since they have a simpler interface. :param content: A bytes string. :param mimetype: Mimetype of the content. :param encoding: Optional encoding of the content. :param encoder: An optional encoder_ function. :param headers: Optional headers. .. _encoder: https://docs.python.org/2/library/email.encoders.html """ def __init__(self, content, mimetype, encoding=None, encoder=encode_base64, **kwargs): Enclosure.__init__(self, **kwargs) self.content = content self.mimetype = mimetype self.encoding = encoding self.encoder = encoder def mime_object(self): mime = MIMEBase(*self.mimetype.split('/')) mime.set_payload(self.content) if self.encoding: del mime['Content-Type'] mime.add_header('Content-Type', self.mimetype, charset=self.encoding) self.encoder(mime) return mime class Attachment(Binary): """ Binary subclass for easier file attachments. Basically using this class has the advantage that fetching the file contents is lazy, which may be desired. Else use the Binary class. Also, the Content-Disposition header is automatically set. :param path: Absolute/Relative path to the file. :param headers: Optional headers. """ def __init__(self, path, headers=()): self.path = path self.mimetype, self.encoding = guess(path) self.encoder = encode_base64 heads = dict([content_disposition('attachment', basename(path))]) heads.update(headers) self.headers = Headers(heads) @property def content(self): """ Lazily returns the bytes contents of the file. """ with open(self.path, 'rb') as handle: return handle.read()
""" mailthon.enclosure ~~~~~~~~~~~~~~~~~~ Implements Enclosure objects- parts that collectively make up body of the email. :copyright: (c) 2015 by Eeo Jun :license: MIT, see LICENSE for details. """ from email.encoders import encode_base64 from email.message import Message from email.mime.base import MIMEBase from email.mime.text import MIMEText from os.path import basename from .helpers import guess from .headers import Headers, content_disposition class Enclosure(object): """ Base class for Enclosure objects to inherit from. An enclosure is a part of the enclosure in a real envelope- it contains part of the content to be sent. :param headers: Iterable of headers to include, stored in an RFC-compliant Headers mapping internally under the headers attribute. """ def __init__(self, headers=()): self.headers = Headers(headers) def mime_object(self): """ To be overriden. Returns the generated MIME object, without applying the internal headers. """ raise NotImplementedError def mime(self): """ Returns the finalised mime object, after applying the internal headers. """ mime = self.mime_object() self.headers.prepare(mime) return mime class PlainText(Enclosure): """ Enclosure that has a text/plain mimetype. :param content: Unicode or bytes string. :param encoding: Encoding used to serialize the content or the encoding of the content. :param headers: Optional headers. """ subtype = 'plain' def __init__(self, content, encoding='utf-8', **kwargs): Enclosure.__init__(self, **kwargs) self.content = content self.encoding = encoding def mime_object(self): return MIMEText(self.content, self.subtype, self.encoding) class HTML(PlainText): """ Subclass of PlainText with a text/html mimetype. """ subtype = 'html' class Binary(Enclosure): """ An Enclosure subclass for binary content. If the content is HTML or any kind of plain-text then the HTML or PlainText Enclosures are receommended since they have a simpler interface. :param content: A bytes string. :param mimetype: Mimetype of the content. :param encoding: Optional encoding of the content. :param encoder: An optional encoder_ function. :param headers: Optional headers. .. _encoder: https://docs.python.org/2/library/email.encoders.html """ def __init__(self, content, mimetype, encoding=None, encoder=encode_base64, **kwargs): Enclosure.__init__(self, **kwargs) self.content = content self.mimetype = mimetype self.encoding = encoding self.encoder = encoder def mime_object(self): mime = MIMEBase(*self.mimetype.split('/')) mime.set_payload(self.content) if self.encoding: del mime['Content-Type'] mime.add_header('Content-Type', self.mimetype, charset=self.encoding) self.encoder(mime) return mime class Attachment(Binary): """ Binary subclass for easier file attachments. Basically using this class has the advantage that fetching the file contents is lazy, which may be desired. Else use the Binary class. Also, the Content-Disposition header is automatically set. :param path: Absolute/Relative path to the file. :param headers: Optional headers. """ def __init__(self, path, headers=()): self.path = path self.mimetype, self.encoding = guess(path) self.encoder = encode_base64 heads = dict([content_disposition('attachment', basename(path))]) heads.update(headers) self.headers = Headers(heads) @property def content(self): """ Lazily returns the bytes contents of the file. """ with open(self.path, 'rb') as handle: return handle.read()
Python
0
fad2e9d7b05c072b4d25f9f6c51e25c87428f41d
add PyPI publisher, for pushing to packages.python.org
hyde/ext/publishers/pypi.py
hyde/ext/publishers/pypi.py
""" Contains classes and utilities that help publishing a hyde website to the documentation hosting on http://packages.python.org/. """ import os import getpass import zipfile import tempfile import httplib import urlparse from base64 import standard_b64encode import ConfigParser from hyde.fs import File, Folder from hyde.publisher import Publisher from hyde.util import getLoggerWithNullHandler logger = getLoggerWithNullHandler('hyde.ext.publishers.pypi') class PyPI(Publisher): def initialize(self, settings): self.settings = settings self.project = settings.project self.url = getattr(settings,"url","https://pypi.python.org/pypi/") self.username = getattr(settings,"username",None) self.password = getattr(settings,"password",None) self.prompt_for_credentials() def prompt_for_credentials(self): pypirc_file = os.path.expanduser("~/.pypirc") if not os.path.isfile(pypirc_file): pypirc = None else: pypirc = ConfigParser.RawConfigParser() pypirc.read([pypirc_file]) missing_errs = (ConfigParser.NoSectionError,ConfigParser.NoOptionError) # Try to find username in .pypirc if self.username is None: if pypirc is not None: try: self.username = pypirc.get("server-login","username") except missing_errs: pass # Prompt for username on command-line if self.username is None: print "Username: ", self.username = raw_input().strip() # Try to find password in .pypirc if self.password is None: if pypirc is not None: try: self.password = pypirc.get("server-login","password") except missing_errs: pass # Prompt for username on command-line if self.password is None: self.password = getpass.getpass("Password: ") # Validate the values. if not self.username: raise ValueError("PyPI requires a username") if not self.password: raise ValueError("PyPI requires a password") def publish(self): super(PyPI, self).publish() tf = tempfile.TemporaryFile() try: # Bundle it up into a zipfile logger.info("building the zipfile") root = self.site.config.deploy_root_path zf = zipfile.ZipFile(tf,"w",zipfile.ZIP_DEFLATED) try: for item in root.walker.walk_files(): logger.info(" adding file: %s",item.path) zf.write(item.path,item.get_relative_path(root)) finally: zf.close() # Formulate the necessary bits for the HTTP POST. # Multipart/form-data encoding. Yuck. authz = self.username + ":" + self.password authz = "Basic " + standard_b64encode(authz) boundary = "-----------" + os.urandom(20).encode("hex") sep_boundary = "\r\n--" + boundary end_boundary = "\r\n--" + boundary + "--\r\n" content_type = "multipart/form-data; boundary=%s" % (boundary,) items = ((":action","doc_upload"),("name",self.project)) body_prefix = "" for (name,value) in items: body_prefix += "--" + boundary + "\r\n" body_prefix += "Content-Disposition: form-data; name=\"" body_prefix += name + "\"\r\n\r\n" body_prefix += value + "\r\n" body_prefix += "--" + boundary + "\r\n" body_prefix += "Content-Disposition: form-data; name=\"content\"" body_prefix += "; filename=\"website.zip\"\r\n\r\n" body_suffix = "\r\n--" + boundary + "--\r\n" content_length = len(body_prefix) + tf.tell() + len(body_suffix) # POST it up to PyPI logger.info("uploading to PyPI") url = urlparse.urlparse(self.url) if url.scheme == "https": con = httplib.HTTPSConnection(url.netloc) else: con = httplib.HTTPConnection(url.netloc) con.connect() try: con.putrequest("POST", self.url) con.putheader("Content-Type",content_type) con.putheader("Content-Length",str(content_length)) con.putheader("Authorization",authz) con.endheaders() con.send(body_prefix) tf.seek(0) data = tf.read(1024*32) while data: con.send(data) data = tf.read(1024*32) con.send(body_suffix) r = con.getresponse() try: # PyPI tries to redirect to the page on success. if r.status in (200,301,): logger.info("success!") else: msg = "Upload failed: %s %s" % (r.status,r.reason,) raise Exception(msg) finally: r.close() finally: con.close() finally: tf.close()
Python
0
7b73c957ad52f9b846955b96b7cc6d0938587bb3
Add 3rd order covariance
src/conventional/cum3est.py
src/conventional/cum3est.py
#!/usr/bin/env python from __future__ import division import numpy as np from scipy.linalg import hankel import scipy.io as sio import matplotlib.pyplot as plt from tools import * def cum3est(y, maxlag, nsamp, overlap, flag, k1): """ UM3EST Third-order cumulants. Should be invoked via "CUMEST" for proper parameter checks Parameters: y: input data vector (column) maxlag: maximum lag to be computed samp_seg: samples per segment overlap: percentage overlap of segments flag : 'biased', biased estimates are computed [default] 'unbiased', unbiased estimates are computed. k1: the fixed lag in c3(m,k1): see below Output: y_cum: estimated third-order cumulant, C3(m,k1) -maxlag <= m <= maxlag """ (n1,n2) = np.shape(y) N = n1*n2 minlag = -maxlag overlap = np.fix(overlap/100 * nsamp) nrecord = np.fix((N - overlap)/(nsamp - overlap)) nadvance = nsamp - overlap y_cum = np.zeros([maxlag-minlag+1,1]) nd = np.arange(nsamp).T nlags = 1*maxlag + 1 zlag = 1 + maxlag if flag == 'biased': scale = np.ones([nlags, 1])/nsamp else: lsamp = nsamp - abs(k1) scale = make_arr((range(lsamp-maxlag, lsamp), range(lsamp, lsamp-maxlag,-1)), axis=1) (m2,n2) = scale.shape scale = np.ones([m2,n2]) / scale y = y.ravel(order='F') for i in xrange(nrecord): x = y[ind] x = x.ravel(order='F') - mean(x) cx = np.conj(x) z = x * 0 # create the "IV" matrix: offset for second lag if k1 > 0: z[q:nsamp-k1] = x[0:nsamp-k1, :] * cx[k1:nsamp, :] else: z[-k1:nsamp] = x[-k1:nsamp] * cx[0:nsamp+k1] # compute third-order cumulants y_cum[zlag] = y_cum[zlag] + (z.T * x) for k in xrange(maxlag): y_cum[zlag-k] = y_cum[zlag-k] + z[k:nsamp].T * x[0:nsamp-k] y_cum[zlag+k] = y_cum[zlag+k] + z[0:nsamp-k].T * x[k:nsamp] ind = ind + int(nadvance) y_cum = y_cum * scale/nrecord return y_cum
Python
0.999372
ded893c34db0c6de521e6d735d6fce30f16f3a51
Add WSGI file.
noodleamp.wsgi
noodleamp.wsgi
import os import pwd import sys BASE_DIR = os.path.dirname(os.path.abspath(__file__)) def path(*paths): return os.path.join(BASE_DIR, *paths) os.environ['NOODLEAMP_CONFIG'] = path('settings_local.py') # http://code.google.com/p/modwsgi/wiki/ApplicationIssues#User_HOME_Environment_Variable os.environ['HOME'] = pwd.getpwuid(os.getuid()).pw_dir activate_this = path('venv/bin/activate_this.py') execfile(activate_this, dict(__file__=activate_this)) BASE_DIR = os.path.join(os.path.dirname(__file__)) if BASE_DIR not in sys.path: sys.path.append(BASE_DIR) from noodleamp.server import app as application
Python
0
33393fcfcca30edafcf06df53550f4985033c459
Add numba error module
numba/error.py
numba/error.py
class NumbaError(Exception): "Some error happened during compilation"
Python
0
5784158855eba090c24bb93ece991fba3b1e1a67
Add never_cache to views
radmin/views.py
radmin/views.py
from django.http import HttpResponse from django.contrib.admin.views.decorators import staff_member_required from django.utils import simplejson as json from django.views.decorators.cache import never_cache from radmin.console import REGISTERED_NAMED_ITEMS, REGISTERED_TO_ALL from radmin.utils import * @never_cache @staff_member_required def entry_point(request): """ This is the entry point for radmin console.""" if request.is_ajax(): # grab get params location = request.GET.get('location', None) # where we are in the admin site param1 = request.GET.get('param1', None) # usually specifics about location, app_name or model_name etc param2 = request.GET.get('param2', None) # and additional field, can carry model id controls = [] # first lets do the globally registered controls for key,value in REGISTERED_TO_ALL.items(): controls.append({'label':value['label'],'target':key}) # check for admin_index stuff if location in REGISTERED_NAMED_ITEMS: value = REGISTERED_NAMED_ITEMS[location] controls.append({'label':value['label'],'target':location, 'data':param2}) if param1 in REGISTERED_NAMED_ITEMS: value = REGISTERED_NAMED_ITEMS[param1] controls.append({'label':value['label'],'target':param1, 'data':param2}) return HttpResponse(json.dumps(controls), mimetype="application/json") @never_cache @staff_member_required def runner(request): if request.is_ajax(): target = request.GET.get('target') data = request.GET.get('data', None) # now we have to do a look up and see if the target exists in commands dict if target in REGISTERED_NAMED_ITEMS: console_item = REGISTERED_NAMED_ITEMS[target] mod = radmin_import(console_item['callback']) if mod: try: if data: output = mod(data) else: output = mod() result = {'result':'success', 'output':output, 'display_result':console_item['display_result']} except Exception as e: result = {'result':'error', 'output':e, 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") else: result = {'result':'error', 'output':'No Module Found', 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") elif target in REGISTERED_TO_ALL: console_item = REGISTERED_TO_ALL[target] mod = radmin_import(console_item['callback']) if mod: try: result = {'result':'success', 'output':mod(),'display_result':console_item['display_result']} except Exception as e: result = {'result':'error', 'output':e, 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") else: result = {'result':'error', 'output':'No Module Found', 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") return HttpResponse(json.dumps({'result':'not_found_error'}), mimetype="application/json") def sample(): return "Hi there!"
from django.http import HttpResponse from django.contrib.admin.views.decorators import staff_member_required from django.utils import simplejson as json from radmin.console import REGISTERED_NAMED_ITEMS, REGISTERED_TO_ALL from radmin.utils import * @staff_member_required def entry_point(request): """ This is the entry point for radmin console.""" if request.is_ajax(): # grab get params location = request.GET.get('location', None) # where we are in the admin site param1 = request.GET.get('param1', None) # usually specifics about location, app_name or model_name etc param2 = request.GET.get('param2', None) # and additional field, can carry model id controls = [] # first lets do the globally registered controls for key,value in REGISTERED_TO_ALL.items(): controls.append({'label':value['label'],'target':key}) # check for admin_index stuff if location in REGISTERED_NAMED_ITEMS: value = REGISTERED_NAMED_ITEMS[location] controls.append({'label':value['label'],'target':location, 'data':param2}) if param1 in REGISTERED_NAMED_ITEMS: value = REGISTERED_NAMED_ITEMS[param1] controls.append({'label':value['label'],'target':param1, 'data':param2}) return HttpResponse(json.dumps(controls), mimetype="application/json") @staff_member_required def runner(request): if request.is_ajax(): target = request.GET.get('target') data = request.GET.get('data', None) # now we have to do a look up and see if the target exists in commands dict if target in REGISTERED_NAMED_ITEMS: console_item = REGISTERED_NAMED_ITEMS[target] mod = radmin_import(console_item['callback']) if mod: try: if data: output = mod(data) else: output = mod() result = {'result':'success', 'output':output, 'display_result':console_item['display_result']} except Exception as e: result = {'result':'error', 'output':e, 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") else: result = {'result':'error', 'output':'No Module Found', 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") elif target in REGISTERED_TO_ALL: console_item = REGISTERED_TO_ALL[target] mod = radmin_import(console_item['callback']) if mod: try: result = {'result':'success', 'output':mod(),'display_result':console_item['display_result']} except Exception as e: result = {'result':'error', 'output':e, 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") else: result = {'result':'error', 'output':'No Module Found', 'display_result':console_item['display_result']} return HttpResponse(json.dumps(result), mimetype="application/json") return HttpResponse(json.dumps({'result':'not_found_error'}), mimetype="application/json") def sample(): return "Hi there!"
Python
0
e8a5720c6959a3166c1c8a373ef00a390b89ac22
Add rasp2geotiff script
rasp2geotiff.py
rasp2geotiff.py
#!/usr/bin/env python import xcsoar import osr import gdal import numpy as np import os, sys import math idx_min_x = idx_max_x = idx_min_y = idx_max_y = 0 spa_x = spa_y = 0 lat_0 = lat_1 = lon_0 = 0 lat_c = lon_c = 0 raster_data = None def get_parameters(line): global idx_min_x, idx_max_x, idx_min_y, idx_max_y, spa_x, spa_y, lat_0, lat_1, lon_0, lat_c, lon_c splitted = line.split(' ') i = 0 while splitted[i] != 'Indexs=': i += 1 idx_min_x = int(splitted[i + 1]) idx_max_x = int(splitted[i + 2]) idx_min_y = int(splitted[i + 3]) idx_max_y = int(splitted[i + 4]) i = 0 while splitted[i] != 'Proj=': i += 1 if splitted[i + 1] != 'lambert': print "Error - no lambert projection found..." return spa_x = float(splitted[i + 2]) spa_y = float(splitted[i + 3]) lat_0 = float(splitted[i + 4]) lat_1 = float(splitted[i + 5]) lon_0 = float(splitted[i + 6]) lat_c = float(splitted[i + 7]) lon_c = float(splitted[i + 8]) def read_data(line, idx): splitted = line.split(' ') if len(splitted) != idx_max_x - idx_min_x + 1: print "Error - grid resolution wrong?!?" return for i in range(len(splitted)): raster_data[(idx_max_y - idx_min_y) - idx - 1, i] = float(splitted[i]) #raster_data[idx, i] = float(splitted[i]) i = 0 for line in open(sys.argv[1]): i += 1 if line == '---': continue if line.startswith('Model='): get_parameters(line) raster_data = np.zeros((idx_max_x - idx_min_x + 1, idx_max_y - idx_min_y + 1), dtype=np.float32) if i >= 5: read_data(line, i - 5) lcc = osr.SpatialReference() lcc.ImportFromProj4("+proj=lcc +lat_1=" + str(lat_1) + " +lat_0=" + str(lat_0) + " +lon_0=" + str(lon_0) + " +x_0=0 +y_0=0 +datum=WGS84 +units=m +no_defs") epsg4326 = osr.SpatialReference() epsg4326.ImportFromEPSG(4326) epsg4326_to_lcc = osr.CoordinateTransformation(epsg4326, lcc) width = (idx_max_x - idx_min_x) + 1 height = (idx_max_y - idx_min_y) + 1 center_lcc = epsg4326_to_lcc.TransformPoint(lon_c, lat_c) geotransform = [center_lcc[0] - width * spa_x / 2, spa_x, 0, center_lcc[1] + height * spa_y / 2, 0, -spa_y] driver = gdal.GetDriverByName('GTiff') dst_ds = driver.Create(sys.argv[1] + ".tiff", width, height, 1, gdal.GDT_Float32) dst_ds.SetProjection(lcc.ExportToWkt()) dst_ds.SetGeoTransform(geotransform) dst_ds.GetRasterBand(1).WriteArray(raster_data) dst_ds = None
Python
0
c1e801798d3b7e8d4c9ba8a11f79ffa92bf182f5
Add test cases for the logger
test/test_logger.py
test/test_logger.py
# encoding: utf-8 """ .. codeauthor:: Tsuyoshi Hombashi <tsuyoshi.hombashi@gmail.com> """ from __future__ import print_function from __future__ import unicode_literals import logbook from pingparsing import ( set_logger, set_log_level, ) import pytest class Test_set_logger(object): @pytest.mark.parametrize(["value"], [ [True], [False], ]) def test_smoke(self, value): set_logger(value) class Test_set_log_level(object): @pytest.mark.parametrize(["value"], [ [logbook.CRITICAL], [logbook.ERROR], [logbook.WARNING], [logbook.NOTICE], [logbook.INFO], [logbook.DEBUG], [logbook.TRACE], [logbook.NOTSET], ]) def test_smoke(self, value): set_log_level(value) @pytest.mark.parametrize(["value", "expected"], [ [None, LookupError], ["unexpected", LookupError], ]) def test_exception(self, value, expected): with pytest.raises(expected): set_log_level(value)
Python
0.000002
c559cdd34a2dc8f3129c1fed5235291f22329368
install crontab
install_crontab.py
install_crontab.py
#!/usr/bin/python2 from crontab import CronTab import sys CRONTAB_TAG = "ubuntu-cleanup-annoifier" def install_cron(): my_cron = CronTab(user=True) # job = my_cron.new(command=executable_path(args)) job = my_cron.new(command="dummy123") job.minute.on(0) job.hour.on(0) job.enable() job.set_comment(CRONTAB_TAG) my_cron.write_to_user( user=True ) def uninstall_cron(): my_cron = CronTab(user=True) my_cron.remove_all(comment=CRONTAB_TAG) my_cron.write_to_user( user=True ) if __name__ == "__main__": if sys.argv[1] == "i": install_cron() elif sys.argv[1] == "u": uninstall_cron()
Python
0.000001
ca8a7320cbec1d4fa71ec5a7f909908b8765f573
Allow underscores for release tags (#4976)
test_utils/scripts/circleci/get_tagged_package.py
test_utils/scripts/circleci/get_tagged_package.py
# Copyright 2016 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Helper to determine package from tag. Get the current package directory corresponding to the Circle Tag. """ from __future__ import print_function import os import re import sys TAG_RE = re.compile(r""" ^ (?P<pkg> (([a-z]+)[_-])*) # pkg-name-with-hyphens-or-underscores (empty allowed) ([0-9]+)\.([0-9]+)\.([0-9]+) # Version x.y.z (x, y, z all ints) $ """, re.VERBOSE) TAG_ENV = 'CIRCLE_TAG' ERROR_MSG = '%s env. var. not set' % (TAG_ENV,) BAD_TAG_MSG = 'Invalid tag name: %s. Expected pkg-name-x.y.z' CIRCLE_CI_SCRIPTS_DIR = os.path.dirname(__file__) ROOT_DIR = os.path.realpath( os.path.join(CIRCLE_CI_SCRIPTS_DIR, '..', '..', '..')) def main(): """Get the current package directory. Prints the package directory out so callers can consume it. """ if TAG_ENV not in os.environ: print(ERROR_MSG, file=sys.stderr) sys.exit(1) tag_name = os.environ[TAG_ENV] match = TAG_RE.match(tag_name) if match is None: print(BAD_TAG_MSG % (tag_name,), file=sys.stderr) sys.exit(1) pkg_name = match.group('pkg') if pkg_name is None: print(ROOT_DIR) else: pkg_dir = pkg_name.rstrip('-').replace('-', '_') print(os.path.join(ROOT_DIR, pkg_dir)) if __name__ == '__main__': main()
# Copyright 2016 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Helper to determine package from tag. Get the current package directory corresponding to the Circle Tag. """ from __future__ import print_function import os import re import sys TAG_RE = re.compile(r""" ^ (?P<pkg> (([a-z]+)-)*) # pkg-name-with-hyphens- (empty allowed) ([0-9]+)\.([0-9]+)\.([0-9]+) # Version x.y.z (x, y, z all ints) $ """, re.VERBOSE) TAG_ENV = 'CIRCLE_TAG' ERROR_MSG = '%s env. var. not set' % (TAG_ENV,) BAD_TAG_MSG = 'Invalid tag name: %s. Expected pkg-name-x.y.z' CIRCLE_CI_SCRIPTS_DIR = os.path.dirname(__file__) ROOT_DIR = os.path.realpath( os.path.join(CIRCLE_CI_SCRIPTS_DIR, '..', '..', '..')) def main(): """Get the current package directory. Prints the package directory out so callers can consume it. """ if TAG_ENV not in os.environ: print(ERROR_MSG, file=sys.stderr) sys.exit(1) tag_name = os.environ[TAG_ENV] match = TAG_RE.match(tag_name) if match is None: print(BAD_TAG_MSG % (tag_name,), file=sys.stderr) sys.exit(1) pkg_name = match.group('pkg') if pkg_name is None: print(ROOT_DIR) else: pkg_dir = pkg_name.rstrip('-').replace('-', '_') print(os.path.join(ROOT_DIR, pkg_dir)) if __name__ == '__main__': main()
Python
0
ee679b745e955e3d555b49500ae2d09aa3336abb
Add a util function for SNMP
confluent_server/confluent/snmputil.py
confluent_server/confluent/snmputil.py
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2016 Lenovo # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # This provides a simplified wrapper around snmp implementation roughly # mapping to the net-snmp commands # net-snmp-python was considered as the API is cleaner, but the ability to # patch pysnmp to have it be eventlet friendly has caused it's selection # This module simplifies the complex hlapi pysnmp interface import confluent.exceptions as exc import eventlet from eventlet.support.greendns import getaddrinfo import socket snmp = eventlet.import_patched('pysnmp.hlapi') def _get_transport(name): # Annoyingly, pysnmp does not automatically determine ipv6 v ipv4 res = getaddrinfo(name, 161, 0, socket.SOCK_DGRAM) if res[0][0] == socket.AF_INET6: return snmp.Udp6TransportTarget(res[0][4]) else: return snmp.UdpTransportTarget(res[0][4]) def walk(server, oid, secret, username=None, context=None): """Walk over children of a given OID This is roughly equivalent to snmpwalk. It will automatically try to be an snmpbulkwalk if possible. If username is not given, it is assumed that the secret is a community string, and v2c is used. If a username given, it'll assume SHA auth and DES privacy with the secret being the same for both. :param server: The network name/address to target :param oid: The SNMP object identifier :param secret: The community string or password :param username: The username for SNMPv3 :param context: The SNMPv3 context or index for community string indexing """ # SNMP is a complicated mess of things. Will endeavor to shield caller # from as much as possible, assuming reasonable defaults where possible. # there may come a time where we add more parameters to override the # automatic behavior (e.g. DES is weak, so it's a likely candidate to be # overriden, but some devices only support DES) tp = _get_transport(server) ctx = snmp.ContextData(context) if '::' in oid: mib, field = oid.split('::') obj = snmp.ObjectType(snmp.ObjectIdentity(mib, field)) else: obj = snmp.ObjectType(snmp.ObjectIdentity(oid)) eng = snmp.SnmpEngine() if username is None: # SNMP v2c authdata = snmp.CommunityData(secret, mpModel=1) else: authdata = snmp.UsmUserData(username, authKey=secret, privKey=secret) walking = snmp.bulkCmd(eng, authdata, tp, ctx, 0, 10, obj, lexicographicMode=False) for rsp in walking: errstr, errnum, erridx, answers = rsp if errstr: raise exc.TargetEndpointUnreachable(str(errstr)) elif errnum: raise exc.ConfluentException(errnum.prettyPrint()) for ans in answers: yield ans if __name__ == '__main__': import sys for kp in walk(sys.argv[1], sys.argv[2], 'public'): print(str(kp[0])) print(str(kp[1]))
Python
0
7f09311b2f7825bf1446a6e476f8d1909d501699
Add threshold helper
driver_station/src/targeting/threshold_helper.py
driver_station/src/targeting/threshold_helper.py
# # This file is part of KwarqsDashboard. # # KwarqsDashboard is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, version 3. # # KwarqsDashboard is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with KwarqsDashboard. If not, see <http://www.gnu.org/licenses/>. # import math import sys import cv2 import numpy as np import target_data from common import settings # using python 2.7, get some python 3 builtins from future_builtins import zip import logging logger = logging.getLogger(__name__) class ThresholdHelper(object): def __init__(self): self.size = None # debug settings self.show_hue = False self.show_sat = False self.show_val = False self.show_bin = False self.show_bin_overlay = False # thresholds are not initialized here, someone else does it def processImage(self, img): ''' Processes an image and thresholds it. Returns the original image, and a binary version of the image indicating the area that was filtered :returns: img, bin ''' # reinitialize any time the image size changes if self.size is None or self.size[0] != img.shape[0] or self.size[1] != img.shape[1]: h, w = img.shape[:2] self.size = (h, w) # these are preallocated so we aren't allocating all the time self.bin = np.empty((h, w, 1), dtype=np.uint8) self.hsv = np.empty((h, w, 3), dtype=np.uint8) self.hue = np.empty((h, w, 1), dtype=np.uint8) self.sat = np.empty((h, w, 1), dtype=np.uint8) self.val = np.empty((h, w, 1), dtype=np.uint8) # for overlays self.zeros = np.zeros((h, w, 1), dtype=np.bool) # these settings should be adjusted according to the image size # and noise characteristics # TODO: What's the optimal setting for this? For smaller images, we # cannot morph as much, or the features blend into each other. # TODO: tune kMinWidth # Note: if you set k to an even number, the detected # contours are offset by some N pixels. Sometimes. if w <= 320: k = 1 offset = (0,0) self.kHoleClosingIterations = 2 # originally 9 self.kMinWidth = 2 # drawing self.kThickness = 1 self.kTgtThickness = 1 # accuracy of polygon approximation self.kPolyAccuracy = 10.0 elif w <= 480: k = 2 offset = (1,1) self.kHoleClosingIterations = 9 # originally 9 self.kMinWidth = 5 # drawing self.kThickness = 1 self.kTgtThickness = 2 # accuracy of polygon approximation self.kPolyAccuracy = 15.0 else: k = 3 offset = (1,1) self.kHoleClosingIterations = 6 # originally 9 self.kMinWidth = 10 # drawing self.kThickness = 1 self.kTgtThickness = 2 # accuracy of polygon approximation self.kPolyAccuracy = 20.0 self.morphKernel = cv2.getStructuringElement(cv2.MORPH_RECT, (k,k), anchor=offset) logging.info("New image size: %sx%s, morph size set to %s, %s iterations", w,h,k, self.kHoleClosingIterations) # get this outside the loop ih, iw = self.size centerOfImageY = ih/2.0 # convert to HSV cv2.cvtColor(img, cv2.cv.CV_BGR2HSV, self.hsv) cv2.split(self.hsv, [self.hue, self.sat, self.val]) # Threshold each component separately # Hue cv2.threshold(self.hue, self.thresh_hue_p, 255, type=cv2.THRESH_BINARY, dst=self.bin) cv2.threshold(self.hue, self.thresh_hue_n, 255, type=cv2.THRESH_BINARY_INV, dst=self.hue) cv2.bitwise_and(self.hue, self.bin, self.hue) if self.show_hue: # overlay green where the hue threshold is non-zero img[np.dstack((self.zeros, self.hue != 0, self.zeros))] = 255 # Saturation cv2.threshold(self.sat, self.thresh_sat_p, 255, type=cv2.THRESH_BINARY, dst=self.bin) cv2.threshold(self.sat, self.thresh_sat_n, 255, type=cv2.THRESH_BINARY_INV, dst=self.sat) cv2.bitwise_and(self.sat, self.bin, self.sat) if self.show_sat: # overlay blue where the sat threshold is non-zero img[np.dstack((self.sat != 0, self.zeros, self.zeros))] = 255 # Value cv2.threshold(self.val, self.thresh_val_p, 255, type=cv2.THRESH_BINARY, dst=self.bin) cv2.threshold(self.val, self.thresh_val_n, 255, type=cv2.THRESH_BINARY_INV, dst=self.val) cv2.bitwise_and(self.val, self.bin, self.val) if self.show_val: # overlay red where the val threshold is non-zero img[np.dstack((self.zeros, self.zeros, self.val != 0))] = 255 # Combine the results to obtain our binary image which should for the most # part only contain pixels that we care about cv2.bitwise_and(self.hue, self.sat, self.bin) cv2.bitwise_and(self.bin, self.val, self.bin) # Fill in any gaps using binary morphology cv2.morphologyEx(self.bin, cv2.MORPH_CLOSE, self.morphKernel, dst=self.bin, iterations=self.kHoleClosingIterations) if self.show_bin: cv2.imshow('bin', self.bin) # overlay the binarized image on the displayed image, instead of a separate picture if self.show_bin_overlay: img[np.dstack((self.bin, self.bin, self.bin)) != 0] = 255 return img, self.bin
Python
0.000009
74e24debf55b003f1d56d35f4b040d91a0698e0a
Add example for cluster centroids method
example/under-sampling/plot_cluster_centroids.py
example/under-sampling/plot_cluster_centroids.py
""" ================= Cluster centroids ================= An illustration of the cluster centroids method. """ print(__doc__) import matplotlib.pyplot as plt import seaborn as sns sns.set() # Define some color for the plotting almost_black = '#262626' palette = sns.color_palette() from sklearn.datasets import make_classification from sklearn.decomposition import PCA from unbalanced_dataset.under_sampling import ClusterCentroids # Generate the dataset X, y = make_classification(n_classes=2, class_sep=2, weights=[0.1, 0.9], n_informative=3, n_redundant=1, flip_y=0, n_features=20, n_clusters_per_class=1, n_samples=5000, random_state=10) # Instanciate a PCA object for the sake of easy visualisation pca = PCA(n_components=2) # Fit and transform x to visualise inside a 2D feature space X_vis = pca.fit_transform(X) # Apply the random under-sampling cc = ClusterCentroids() X_resampled, y_resampled = cc.fit_transform(X, y) X_res_vis = pca.transform(X_resampled) # Two subplots, unpack the axes array immediately f, (ax1, ax2) = plt.subplots(1, 2) ax1.scatter(X_vis[y == 0, 0], X_vis[y == 0, 1], label="Class #0", alpha=0.5, edgecolor=almost_black, facecolor=palette[0], linewidth=0.15) ax1.scatter(X_vis[y == 1, 0], X_vis[y == 1, 1], label="Class #1", alpha=0.5, edgecolor=almost_black, facecolor=palette[2], linewidth=0.15) ax1.set_title('Original set') ax2.scatter(X_res_vis[y_resampled == 0, 0], X_res_vis[y_resampled == 0, 1], label="Class #0", alpha=.5, edgecolor=almost_black, facecolor=palette[0], linewidth=0.15) ax2.scatter(X_res_vis[y_resampled == 1, 0], X_res_vis[y_resampled == 1, 1], label="Class #1", alpha=.5, edgecolor=almost_black, facecolor=palette[2], linewidth=0.15) ax2.set_title('Cluster centroids') plt.show()
Python
0.000001
25cd25dab4de9e6963ffa622474b3f0bdcdc1e48
Create preprocessor.py
interpreter/preprocessor.py
interpreter/preprocessor.py
Python
0.000006
0c1ccd5180601d3ed3f5dc98b3330d40c014f7c0
Add simul. (#3300)
var/spack/repos/builtin/packages/simul/package.py
var/spack/repos/builtin/packages/simul/package.py
############################################################################## # Copyright (c) 2013-2016, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/llnl/spack # Please also see the LICENSE file for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class Simul(Package): """simul is an MPI coordinated test of parallel filesystem system calls and library functions. """ homepage = "https://github.com/LLNL/simul" url = "https://github.com/LLNL/simul/archive/1.16.tar.gz" version('1.16', 'd616c1046a170c1e1b7956c402d23a95') version('1.15', 'a5744673c094a87c05c6f0799d1f496f') version('1.14', 'f8c14f0bac15741e2af354e3f9a0e30f') version('1.13', '8a80a62d569557715d6c9c326e39a8ef') depends_on('mpi') def install(self, spec, prefix): make('simul') mkdirp(prefix.bin) install('simul', prefix.bin)
Python
0.000027
a4bd7e17d02f83e377287564788a3eda1000029a
add adp tests
pyiid/tests/test_scatter_adp.py
pyiid/tests/test_scatter_adp.py
from pyiid.tests import * from pyiid.experiments.elasticscatter import ElasticScatter __author__ = 'christopher' # rtol = 4e-4 # atol = 4e-4 rtol = 5e-4 atol = 5e-5 # Actual Tests def check_meta(value): value[0](value[1:]) def check_scatter_fq(value): """ Check two processor, algorithm pairs against each other for FQ calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_fq(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_fq(atoms) # test if not stats_check(ans1, ans2, rtol, atol): print value assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 # assert False def check_scatter_grad_fq(value): """ Check two processor, algorithm pairs against each other for gradient FQ calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_grad_fq(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_grad_fq(atoms) # test if not stats_check(ans1, ans2, rtol, atol): print value assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 def check_scatter_sq(value): """ Check two processor, algorithm pairs against each other for SQ calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_sq(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_sq(atoms) # test stats_check(ans1, ans2, rtol, atol) assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 def check_scatter_iq(value): """ Check two processor, algorithm pairs against each other for IQ calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_iq(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_iq(atoms) # test stats_check(ans1, ans2, rtol, atol) assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 def check_scatter_pdf(value): """ Check two processor, algorithm pairs against each other for PDF calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_pdf(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_pdf(atoms) # test stats_check(ans1, ans2, rtol, atol) assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 def check_scatter_grad_pdf(value): """ Check two processor, algorithm pairs against each other for gradient PDF calculation :param value: :return: """ # set everything up atoms, exp = value[:2] scat = ElasticScatter(exp_dict=exp, verbose=True) proc1, alg1 = value[-1][0] proc2, alg2 = value[-1][1] # run algorithm 1 scat.set_processor(proc1, alg1) ans1 = scat.get_grad_pdf(atoms) # run algorithm 2 scat.set_processor(proc2, alg2) ans2 = scat.get_grad_pdf(atoms) # test stats_check(ans1, ans2, rtol, atol) assert_allclose(ans1, ans2, rtol=rtol, atol=atol) # make certain we did not give back the same pointer assert ans1 is not ans2 tests = [ check_scatter_fq, check_scatter_sq, check_scatter_iq, check_scatter_pdf, check_scatter_grad_fq, check_scatter_grad_pdf ] test_data = list(product( tests, test_adp_atoms, test_exp, comparison_pro_alg_pairs)) def test_meta(): for v in test_data: yield check_meta, v if __name__ == '__main__': import nose nose.runmodule(argv=[ '-s', '--with-doctest', # '--nocapture', '-v', # '-x', ], # env={"NOSE_PROCESSES": 1, "NOSE_PROCESS_TIMEOUT": 599}, exit=False)
Python
0
6cb953dc01a77bc549c53cc325a741d1952ed6b6
Bump FIDO version to 1.3.12
fpr/migrations/0025_update_fido_1312.py
fpr/migrations/0025_update_fido_1312.py
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import migrations def data_migration_up(apps, schema_editor): """ Update identification tool FIDO to 1.3.12, correcting a character-spacing issue bug identified in PRONOM94 (again) """ idtool = apps.get_model('fpr', 'IDTool') idcommand = apps.get_model('fpr', 'IDCommand') # Update Fido tool idtool.objects\ .filter(uuid='c33c9d4d-121f-4db1-aa31-3d248c705e44')\ .update(version='1.3.12', slug='fido-1312') # Create new command using the new version of Fido old_fido_command = idcommand.objects\ .get(uuid='e586f750-6230-42d7-8d12-1e24ca2aa658') idcommand.objects.create( uuid='213d1589-c255-474f-81ac-f0a618181e40', description=u'Identify using Fido 1.3.12', config=old_fido_command.config, script=old_fido_command.script, script_type=old_fido_command.script_type, tool=idtool.objects.get(uuid='c33c9d4d-121f-4db1-aa31-3d248c705e44'), enabled=True ) old_fido_command.enabled = False old_fido_command.save() def data_migration_down(apps, schema_editor): """ Revert FIDO to previous version """ idtool = apps.get_model('fpr', 'IDTool') idcommand = apps.get_model('fpr', 'IDCommand') # Remove new ID Commands idcommand.objects\ .filter(uuid='213d1589-c255-474f-81ac-f0a618181e40').delete() # Revert Fido tool idtool.objects\ .filter(uuid='c33c9d4d-121f-4db1-aa31-3d248c705e44')\ .update(version='1.3.10', slug='fido-1310') # Restore Fido command idcommand.objects\ .filter(uuid='e586f750-6230-42d7-8d12-1e24ca2aa658')\ .update(enabled=True) class Migration(migrations.Migration): dependencies = [ ('fpr', '0024_update_fido'), ] operations = [ migrations.RunPython(data_migration_up, data_migration_down), ]
Python
0
8fa9a54c9a5ee683fc9e9d361a4eb7affe5e83ed
Add functions to paint game of life to screen
game_of_life.py
game_of_life.py
#!/usr/bin/env python from curses import wrapper from time import sleep def enumerate_lines(matrix): on = '*' off = ' ' for i, row in enumerate(matrix): yield i, ''.join(on if v else off for v in row) def paint(stdscr, matrix): stdscr.clear() for i, line in enumerate_lines(matrix): stdscr.addstr(i, 0, line) stdscr.refresh() size = 50 m1 = [ [i == j or i == size - j for j in xrange(0, size + 1)] for i in xrange(0, size + 1) ] m2 = [ [i == size / 2 or j == size / 2 for j in xrange(0, size + 1)] for i in xrange(0, size + 1) ] def main(stdscr): for i in xrange(0,100): matrix = m1 if i % 2 else m2 paint(stdscr, matrix) sleep(0.5) stdscr.getkey() wrapper(main)
Python
0
ff8cee4f98dde0533751dfd15308c5fdfdec3982
test file for rapid iteration
tests/quick_test.py
tests/quick_test.py
""" nosetests -sv --nologcapture tests/quick_test.py """ import datetime import os import random import sys sys.path = [os.path.abspath(os.path.dirname(__file__))] + sys.path os.environ['is_test_suite'] = 'True' os.environ['KERAS_BACKEND'] = 'theano' from auto_ml import Predictor from auto_ml.utils_models import load_ml_model from nose.tools import assert_equal, assert_not_equal, with_setup from sklearn.metrics import accuracy_score import dill import numpy as np import utils_testing as utils # def regression_test(): # # a random seed of 42 has ExtraTreesRegressor getting the best CV score, and that model doesn't generalize as well as GradientBoostingRegressor. # np.random.seed(0) # df_boston_train, df_boston_test = utils.get_boston_regression_dataset() # column_descriptions = { # 'MEDV': 'output' # , 'CHAS': 'categorical' # } # ml_predictor = Predictor(type_of_estimator='regressor', column_descriptions=column_descriptions) # ml_predictor.train(df_boston_train, model_names=['DeepLearningRegressor']) # test_score = ml_predictor.score(df_boston_test, df_boston_test.MEDV) # print('test_score') # print(test_score) # assert -3.35 < test_score < -2.8 def classification_test(model_name=None): np.random.seed(0) df_titanic_train, df_titanic_test = utils.get_titanic_binary_classification_dataset() column_descriptions = { 'survived': 'output' , 'embarked': 'categorical' , 'pclass': 'categorical' } ml_predictor = Predictor(type_of_estimator='classifier', column_descriptions=column_descriptions) ml_predictor.train(df_titanic_train, model_names=['DeepLearningClassifier']) test_score = ml_predictor.score(df_titanic_test, df_titanic_test.survived) print('test_score') print(test_score) assert -0.215 < test_score < -0.17
Python
0
34709ee5d69e59fe87bebb51d522e05abaf6ed8d
Add unit test for helper functions
test/unit/test_parser.py
test/unit/test_parser.py
# :coding: utf-8 import pytest import sphinxcontrib.parser def test_parse_repository_error(): """Raise an error if the path is incorrect.""" with pytest.raises(OSError): sphinxcontrib.parser.parse_repository("") def test_parse_repository_empty(temporary_directory): """Raise an empty environment.""" environment = dict( modules={}, classes={}, functions={}, variables={}, files={} ) assert sphinxcontrib.parser.parse_repository( temporary_directory ) == environment @pytest.fixture() def content_lines_with_docstrings(): return [ "/**", " * An function example.", " *", " * Detailed description.", " */", "function sum(a, b) {", " return a+b;", "}", "", "/*", " * Incorrect docstring", " */", "function doSomething() {", " console.log('something');", "}", "", "/*", "", " Incorrect docstring", "", "*/", "function doSomethingElse() {", " console.log('something_else');", "}", "", "", "/* A cool variable. */", "const Data = null", ] @pytest.mark.parametrize( ("content_lines", "line_number", "expected"), [ ( [ "/**", " * An function example.", " *", " * Detailed description.", " */", "function sum(a, b) {", " return a+b;", "}", ], 6, ( "An function example.\n" "\n" "Detailed description." ) ), ( [ "/** A cool variable. */", "const Data = null", ], 2, ( "A cool variable." ) ), ( [ "/*", " * Incorrect docstring", " */", "function doSomething() {", " console.log('something');", "}", ], 4, None ), ( [ "/*", "", " Incorrect docstring", "", "*/", "function doSomethingElse() {", " console.log('something_else');", "}", ], 6, None ), ( [ "// Incorrect docstring", "function doSomethingElse() {", " console.log('something_else');", "}", ], 2, None ), ( [ "", "function doSomethingElse() {", " console.log('something_else');", "}", ], 2, None ), ( [ "/** A cool variable. */", "const Data = null", ], 1, None ) ], ids=[ "valid element line number with multiline docstring", "valid element line number with one line docstring", "valid element line number with incorrect docstring 1", "valid element line number with incorrect docstring 2", "valid element line number with incorrect docstring 3", "valid element line number with no docstring", "invalid line_number", ] ) def test_parse_docstrings(content_lines, line_number, expected): """Return docstrings from a element's line number.""" assert sphinxcontrib.parser.parse_docstring( line_number, content_lines ) == expected def test_filter_comments(): """Remove all comments from content""" content = ( "'use strict' /* a beautiful comment */\n" "\n" "/*\n" "a long comment that can take a lot of places so\n" "we put it on several lines.\n" "*/\n" "\n" "// a variable docstring\n" "const DATA = 1;\n" "\n" "/**\n" " * Function docstring\n" " */\n" "function sum(a, b) {\n" " // Return the sum of a and b\n" " return a+b;\n" "}\n" ) expected = ( "'use strict' \n" "\n" "\n" "\n" "\n" "\n" "\n" "\n" "const DATA = 1;\n" "\n" "\n" "\n" "\n" "function sum(a, b) {\n" " \n" " return a+b;\n" "}\n" ) assert sphinxcontrib.parser.filter_comments(content) == expected @pytest.mark.parametrize( ("content", "expected"), [ ( "const emptyObject = {};", "const emptyObject = {};", ), ( "let test = {a: 1, b: 2, c: 3};", "let test = {};" ), ( ( "const element = {" " key1: value1," " key2: value2," " key3: value3," "};" "" "function sum(a, b) {" " return a+b" "}" "" ), ( "const element = {}" "" "" "" ";" "" "function sum(a, b) {}" "" "" "" ) ), ( ( "class AwesomeClass {" " constructor() {" " this.variable = 1;" " }" "" " increase() {" " this.variable += 1;" " }" "}" ), ( "class AwesomeClass {}" "" "" "" "" "" "" "" "" ) ) ], ids=[ "empty object", "simple object", "objects and functions on multiple lines", "nested class" ] ) def test_collapse_all(content, expected): """Collapse all objects, classes and functions.""" assert sphinxcontrib.parser.collapse_all(content) == expected @pytest.mark.parametrize( ("name", "hierarchy_folders", "module_names", "expected"), [ ( "example", ["module", "submodule", "test"], [], "example" ), ( "example", ["module", "submodule", "test"], ["another_module"], "example" ), ( "example", ["module", "submodule", "test"], ["module.submodule.test"], "module.submodule.test.example" ), ( "example", ["module", "submodule", "test"], ["submodule.test"], "submodule.test.example" ), ( "example", ["module", "submodule", "test"], ["another_module", "submodule.test", "test"], "submodule.test.example" ) ], ids=[ "no module", "one module not in hierarchy", "one module matching entire hierarchy", "one module matching part of the hierarchy", "several modules" ] ) def test_guess_module_name(name, hierarchy_folders, module_names, expected): """Return module name from initial name, hierarchy folders and modules.""" assert sphinxcontrib.parser.guess_module_name( name, hierarchy_folders, module_names ) == expected
Python
0.000001
c98a744f5f436ae2c6266a7bb5d32173cfd0e4a9
Add a script that scrapes the Socrata catalog, just in case we need that in another format
scripts/socrata_scraper.py
scripts/socrata_scraper.py
#!/usr/bin/python3 """ This is a basic script that downloads the catalog data from the smcgov.org website and pulls out information about all the datasets. This is in python3 There is an optional download_all argument that will allow you to download all of the datasets individually and in their entirety. I have included this as a demonstration, but it should not be commonly used because it takes a while and beats up on the smcgov data portal, which you should avoid. """ import sys import json import argparse import collections import urllib.request URL = "https://data.smcgov.org/api/catalog?limit=999999999&only=datasets" def main(args): category_data = collections.defaultdict(list) domain_data = collections.defaultdict(list) data_downloads = [] datasets_with_location = [] with urllib.request.urlopen(URL) as raw_data: data = json.loads(raw_data.read().decode('utf-8')) for result in data['results']: categories = result['classification']['categories'] domain = result['classification']['domain_category'] if categories is None or categories == []: categories = ['NULL'] permalink = result['permalink'] data_downloads.append('{}.json'.format(permalink)) domain_data[domain].append(permalink) for category in categories: category_data[category].append(permalink) if args.download_all: for download_url in data_downloads: with urllib.request.urlopen(download_url) as dataset_file: print('Downloading {}'.format(download_url)) dataset = json.loads(dataset_file.read().decode('utf-8')) if len(dataset) < 1: continue if 'location_1' in dataset[0].keys(): # Our best guess on which datasets have location info. datasets_with_location.append(download_url) if args.download_all: print('Datasets with location_1 key') print(datasets_with_location) print('----------------------------------------------------') print('Number of Datasets by Category') for key, values in category_data.items(): print(key, len(values)) print('----------------------------------------------------') print('Number of Datasets by Domain') for key, values in domain_data.items(): print(key, len(values)) if __name__=='__main__': import argparse parser = argparse.ArgumentParser() parser.add_argument('--download_all', help='Download all datasets', action='store_true') args = parser.parse_args() main(args=args)
Python
0
0c11d2740e561586bb4f9d2b67bda2ccc87e146e
Add new command to notify New Relic of deployment
ixdjango/management/commands/newrelic_notify_deploy.py
ixdjango/management/commands/newrelic_notify_deploy.py
""" Management command to enable New Relic notification of deployments .. moduleauthor:: Infoxchange Development Team <development@infoxchange.net.au> """ import pwd import os from subprocess import Popen, PIPE from urllib import urlencode from httplib2 import Http from django.conf import settings from django.core.management.base import NoArgsCommand import newrelic.agent class Command(NoArgsCommand): """ Loads the fixtures contained inside IX_FIXTURES setting variable. See http://redmine.office.infoxchange.net.au/issues/8376 """ URL = 'https://rpm.newrelic.com/deployments.xml' def handle_noargs(self, **options): newrelic.agent.initialize( settings.NEW_RELIC_CONFIG, settings.NEW_RELIC_ENV ) config = newrelic.agent.global_settings() if not config.monitor_mode: return # get the current git version git = Popen(('git', 'describe'), stdout=PIPE) ver, _ = git.communicate() ver = ver.strip() # get the current user user = pwd.getpwuid(os.getuid()) headers = { 'x-api-key': config.license_key } post = { 'deployment[app_name]': config.app_name, 'deployment[revision]': ver, 'deployment[user]': '%s (%s)' % (user.pw_gecos, user.pw_name), } print "Informing New Relic...", # post this data http = Http() response, _ = http.request(self.URL, 'POST', headers=headers, body=urlencode(post)) print response['status']
Python
0
c0ea919305bcedf080a2213f4c549c68fa4efa2d
test tools
tests/test_tools.py
tests/test_tools.py
import unittest2 as unittest from fabric.api import run import tempfile from mixins import WebServerMixin from parcel.tools import dl, rpull, rpush def tempname(): return tempfile.mkstemp()[1] import zlib, os def crc32(filename): CHUNKSIZE = 8192 checksum = 0 with open(filename, 'rb') as fh: bytes = fh.read(CHUNKSIZE) while bytes: checksum = zlib.crc32(bytes, checksum) bytes = fh.read(CHUNKSIZE) return checksum class ToolsTestSuite(unittest.TestCase, WebServerMixin): """Tools test cases.""" def test_dl(self): self.startWebServer() filename = tempname() dl("http://localhost:%s/tip.tar.gz"%self.port,filename) # there should be no differences between the files self.assertEquals(crc32(filename),crc32(os.path.join(self.webroot,'tip.tar.gz'))) # shutdown webserver self.stopWebServer()
Python
0.000002
9de5728e5fdb0f7dc606681df685eb084477d8d0
Add exercise
multiplyTwoNumbers.py
multiplyTwoNumbers.py
#!/usr/bin/env python def main(): a = input("Enter a number: ") b = input("Enter another number: ") print "The product of %d and %d is %d" % (a, b, a * b) main()
Python
0.000196
f883edc209928494c45693c5ecfd279bfbb09c97
Add partfrac1
timing/partfrac1.py
timing/partfrac1.py
import time from lcapy import * funcs = [1 / s, 1 / s**2, 1 / (s + 3), 1 / (s + 3)**2, (s + 3) / (s + 4), 1 / (s + 3)**2 / (s + 4), 1 / (s + 3)**3 / (s + 4), 1 / (s + 3) / (s + 4) / (s + 5), (s + 6) / (s + 3) / (s + 4) / (s + 5), 1 / (s + 3)**2 / (s + 4)**2, 1 / (s + 3)**3 / (s + 4)**2, s / (s + 3)**2 / (s + 4), s / (s + 3)**3 / (s + 4)] Ntrials = 10 methods = ('ec', 'sub') times = {} for func in funcs: ans1 = func.partfrac(method='ec') ans2 = func.partfrac(method='sub') if ans1 != func: print('Wrong answer for eq: ', func) if ans2 != func: print('Wrong answer for sub: ', func) for method in methods: times[method] = [] for func in funcs: start = time.perf_counter() for i in range(Ntrials): func.partfrac(method=method) stop = time.perf_counter() times[method].append((stop - start) / Ntrials) import numpy as np from matplotlib.pyplot import subplots, style, savefig, show index = np.arange(len(funcs)) fig, axes = subplots(1) axes.bar(index, times['ec'], 0.35, label='ec') axes.bar(index+0.35, times['sub'], 0.35, label='subs') axes.legend() axes.set_ylabel('Time (s)') show()
Python
0.999998
e71c232660a7480c2b56f6e76e83fad4c7e9da8a
Add ctm_test.py test for testing CRTC's CTM color matrix property.
py/tests/ctm_test.py
py/tests/ctm_test.py
#!/usr/bin/python3 import sys import pykms def ctm_to_blob(ctm, card): len=9 arr = bytearray(len*8) view = memoryview(arr).cast("I") for x in range(len): i, d = divmod(ctm[x], 1) if i < 0: i = -i sign = 1 << 31 else: sign = 0 view[x * 2 + 0] = int(d * ((2 ** 32) - 1)) view[x * 2 + 1] = int(i) | sign #print("%f = %08x.%08x" % (ctm[x], view[x * 2 + 1], view[x * 2 + 0])) return pykms.Blob(card, arr); if len(sys.argv) > 1: conn_name = sys.argv[1] else: conn_name = "" card = pykms.Card() res = pykms.ResourceManager(card) conn = res.reserve_connector(conn_name) crtc = res.reserve_crtc(conn) mode = conn.get_default_mode() fb = pykms.DumbFramebuffer(card, mode.hdisplay, mode.vdisplay, "XR24"); pykms.draw_test_pattern(fb); crtc.set_mode(conn, fb, mode) input("press enter to set normal ctm\n") ctm = [ 1.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 1.0 ] ctmb = ctm_to_blob(ctm, card) crtc.set_prop("CTM", ctmb.id) input("press enter to set new ctm\n") ctm = [ 0.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 0.0, 0.0 ] ctmb = ctm_to_blob(ctm, card) crtc.set_prop("CTM", ctmb.id) print("r->b g->r b->g ctm active\n") input("press enter to set new ctm\n") ctm = [ 0.0, 0.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 0.0 ] ctmb = ctm_to_blob(ctm, card) crtc.set_prop("CTM", ctmb.id) input("r->g g->b b->r ctm active\n") input("press enter to turn off the crtc\n") crtc.disable_mode() input("press enter to enable crtc again\n") crtc.set_mode(conn, fb, mode) input("press enter to remove ctm\n") crtc.set_prop("CTM", 0) input("press enter to exit\n")
Python
0
04477b11bbe7efa1720829691b7d1c3fe2a7a492
Add __init__
h2/__init__.py
h2/__init__.py
# -*- coding: utf-8 -*- """ h2 ~~ A HTTP/2 implementation. """ __version__ = '0.1.0'
Python
0.000917
95a40b92256374878c7fc6528fcaabf1939d9fce
Add a python script to parse DisplayList benchmarking output (#31266)
testing/benchmark/displaylist_benchmark_parser.py
testing/benchmark/displaylist_benchmark_parser.py
#!/usr/bin/env python3 # # Copyright 2013 The Flutter Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import argparse import json import sys import matplotlib.pyplot as plt from matplotlib.backends.backend_pdf import PdfPages as pdfp class BenchmarkResult: def __init__(self, name, backend, timeUnit, drawCallCount): self.name = name self.series = {} self.seriesLabels = {} self.backend = backend self.largeYValues = False self.yLimit = 200 self.timeUnit = timeUnit self.drawCallCount = drawCallCount def __repr__(self): return 'Name: % s\nBackend: % s\nSeries: % s\nSeriesLabels: % s\n' % (self.name, self.backend, self.series, self.seriesLabels) def addDataPoint(self, family, x, y): if family not in self.series: self.series[family] = { 'x': [], 'y': [] } self.series[family]['x'].append(x) self.series[family]['y'].append(y) if y > self.yLimit: self.largeYValues = True def setFamilyLabel(self, family, label): # I'm not keying the main series dict off the family label # just in case we get data where the two aren't a 1:1 mapping if family in self.seriesLabels: assert self.seriesLabels[family] == label return self.seriesLabels[family] = label def plot(self): figures = [] figures.append(plt.figure(dpi=1200, frameon=False, figsize=(11, 8.5))) for family in self.series: plt.plot(self.series[family]['x'], self.series[family]['y'], label = self.seriesLabels[family]) plt.xlabel('Benchmark Seed') plt.ylabel('Time (' + self.timeUnit + ')') title = '' # Crop the Y axis so that we can see what's going on at the lower end if self.largeYValues: plt.ylim((0, self.yLimit)) title = self.name + ' ' + self.backend + ' (Cropped)' else: title = self.name + ' ' + self.backend if self.drawCallCount != -1: title += '\nDraw Call Count: ' + str(int(self.drawCallCount)) plt.title(title) plt.grid(which='both', axis='both') plt.legend(fontsize='xx-small') plt.plot() if self.largeYValues: # Plot again but with the full Y axis visible figures.append(plt.figure(dpi=1200, frameon=False, figsize=(11, 8.5))) for family in self.series: plt.plot(self.series[family]['x'], self.series[family]['y'], label = self.seriesLabels[family]) plt.xlabel('Benchmark Seed') plt.ylabel('Time (' + self.timeUnit + ')') title = self.name + ' ' + self.backend + ' (Complete)' if self.drawCallCount != -1: title += '\nDraw Call Count: ' + str(int(self.drawCallCount)) plt.title(title) plt.grid(which='both', axis='both') plt.legend(fontsize='xx-small') plt.plot() return figures def main(): parser = argparse.ArgumentParser() parser.add_argument('filename', action='store', help='Path to the JSON output from Google Benchmark') parser.add_argument('-o', '--output-pdf', dest='outputPDF', action='store', default='output.pdf', help='Filename to output the PDF of graphs to.') args = parser.parse_args() jsonData = parseJSON(args.filename) return processBenchmarkData(jsonData, args.outputPDF) def error(message): print(message) exit(1) def extractAttributesLabel(benchmarkResult): # Possible attribute keys are: # AntiAliasing # HairlineStroke # StrokedStyle # FilledStyle attributes = ['AntiAliasing', 'HairlineStroke', 'StrokedStyle', 'FilledStyle'] label = '' for attr in attributes: try: if benchmarkResult[attr] != 0: label += attr + ', ' except KeyError: pass return label[:-2] def processBenchmarkData(benchmarkJSON, outputPDF): benchmarkResultsData = {} for benchmarkResult in benchmarkJSON: # Skip aggregate results if 'aggregate_name' in benchmarkResult: continue benchmarkVariant = benchmarkResult['name'].split('/') # The final split is always `real_time` and can be discarded benchmarkVariant.remove('real_time') splits = len(benchmarkVariant) # First split is always the benchmark function name benchmarkName = benchmarkVariant[0] # The last split is always the seeded value into the benchmark benchmarkSeededValue = benchmarkVariant[splits-1] # The second last split is always the backend benchmarkBackend = benchmarkVariant[splits-2] # Time taken (wall clock time) for benchmark to run benchmarkRealTime = benchmarkResult['real_time'] benchmarkUnit = benchmarkResult['time_unit'] benchmarkFamilyIndex = benchmarkResult['family_index'] benchmarkFamilyLabel = '' if splits > 3: for i in range(1, splits-2): benchmarkFamilyLabel += benchmarkVariant[i] + ', ' benchmarkFamilyAttributes = extractAttributesLabel(benchmarkResult) if benchmarkFamilyAttributes == '': benchmarkFamilyLabel = benchmarkFamilyLabel[:-2] else: benchmarkFamilyLabel = benchmarkFamilyLabel + benchmarkFamilyAttributes if 'DrawCallCount' in benchmarkResult: benchmarkDrawCallCount = benchmarkResult['DrawCallCount'] else: benchmarkDrawCallCount = -1 if benchmarkName not in benchmarkResultsData: benchmarkResultsData[benchmarkName] = BenchmarkResult(benchmarkName, benchmarkBackend, benchmarkUnit, benchmarkDrawCallCount) benchmarkResultsData[benchmarkName].addDataPoint(benchmarkFamilyIndex, benchmarkSeededValue, benchmarkRealTime) benchmarkResultsData[benchmarkName].setFamilyLabel(benchmarkFamilyIndex, benchmarkFamilyLabel) pp = pdfp(outputPDF) for benchmark in benchmarkResultsData: figures = benchmarkResultsData[benchmark].plot() for fig in figures: pp.savefig(fig) pp.close() def parseJSON(filename): try: jsonFile = open(filename, 'r') except: error('Unable to load file.') try: jsonData = json.load(jsonFile) except JSONDecodeError: error('Invalid JSON. Unable to parse.') return jsonData['benchmarks'] if __name__ == '__main__': sys.exit(main())
Python
0
2e2ad49c7ada145b5a4a81bd8941cf5e72d2d81b
Test case for wordaxe bug
rst2pdf/tests/input/test_180.py
rst2pdf/tests/input/test_180.py
# -*- coding: utf-8 -*- from reportlab.platypus import SimpleDocTemplate from reportlab.platypus.paragraph import Paragraph from reportlab.lib.styles import getSampleStyleSheet, ParagraphStyle from reportlab.lib.colors import Color from reportlab.platypus.flowables import _listWrapOn, _FUZZ from wordaxe.rl.NewParagraph import Paragraph from wordaxe.rl.styles import ParagraphStyle, getSampleStyleSheet def go(): styles = getSampleStyleSheet() style=styles['Normal'] p1 = Paragraph('This is a paragraph', style ) print p1.wrap(500,701) print p1._cache['avail'] print len(p1.split(500,701)) print len(p1.split(500,700)) go()
Python
0
698eee3db238189ba066670c4fe4a1193e6a942a
add flask-login
app/user/loginmanager.py
app/user/loginmanager.py
from flask.ext.login import LoginManager from models import User login_manager = LoginManager() @login_manager.user_loader def user_loader(user_id): return User.query.get(user_id) login_manager.login_view = '.login'
Python
0.000001
d5d8e16b5ccbbb65398ce015f020db3839fac409
add test_rotate.py
tests/transforms_tests/image_tests/test_rotate.py
tests/transforms_tests/image_tests/test_rotate.py
import random import unittest import numpy as np from chainer import testing from chainercv.transforms import flip from chainercv.transforms import rotate class TestRotate(unittest.TestCase): def test_rotate(self): img = np.random.uniform(size=(3, 32, 24)) angle = random.uniform(0, 180) out = rotate(img, angle) expected = flip(img, x_flip=True) expected = rotate(expected, -1 * angle) expected = flip(expected, x_flip=True) np.testing.assert_almost_equal(out, expected, decimal=6) testing.run_module(__name__, __file__)
Python
0.000003
de74c933b74d9066984fe040edf026b7d9f87711
Split problem statement 2
69_split_problem_statement_2.py
69_split_problem_statement_2.py
''' Open the file sample.txt and read it line by line. When you find a line that starts with 'From:' like the following line: From stephen.marquard@uct.ac.za Sat Jan 5 09:14:16 2008 You will parse the From line using split() and print out the second word in the line (i.e. the entire address of the person who sent the message). Then print out a count at the end. Hint: make sure not to include the lines that start with 'From:'. ''' fileName = raw_input("Enter file name : ") if len(fileName) < 1 : fileName = "sample.txt" openFile = open(fileName) count = 0 words = list() for line in openFile: if not line.startswith("From:"): continue count += 1 words = line.split() print words[1] print "There were", count, "lines in the file with 'From:' as the first word."
Python
0.99994
01029805a6fb3484cf803f0c0abd18232b4ad810
Add database tools
egoio/tools/db.py
egoio/tools/db.py
def grant_db_access(conn, schema, table, role): r"""Gives access to database users/ groups Parameters ---------- conn : sqlalchemy connection object A valid connection to a database schema : str The database schema table : str The database table role : str database role that access is granted to """ grant_str = """GRANT ALL ON TABLE {schema}.{table} TO {role} WITH GRANT OPTION;""".format(schema=schema, table=table, role=role) conn.execute(grant_str) def add_primary_key(conn, schema, table, pk_col): r"""Adds primary key to database table Parameters ---------- conn : sqlalchemy connection object A valid connection to a database schema : str The database schema table : str The database table pk_col : str Column that primary key is applied to """ sql_str = """alter table {schema}.{table} add primary key ({col})""".format( schema=schema, table=table, col=pk_col) conn.execute(sql_str) def change_owner_to(conn, schema, table, role): r"""Changes table's ownership to role Parameters ---------- conn : sqlalchemy connection object A valid connection to a database schema : str The database schema table : str The database table role : str database role that access is granted to """ sql_str = """ALTER TABLE {schema}.{table} OWNER TO {role};""".format(schema=schema, table=table, role=role) conn.execute(sql_str)
Python
0.000001
bc9072cee7ce880c30af83ee4c239ae9cf1ddbfe
Create NumberofIslandsII_001.py
lintcode/Number-of-Islands-II/NumberofIslandsII_001.py
lintcode/Number-of-Islands-II/NumberofIslandsII_001.py
# Definition for a point. # class Point: # def __init__(self, a=0, b=0): # self.x = a # self.y = b class UnionFind: def __init__(self, n, m): self.fathers = {} self.nsets = 0 self.grid = [[0 for _ in range(m)] for _ in range(n)] self.n = n self.m = m def build_island(self, i, j): self.grid[i][j] = 1 self.fathers[i * self.m + j] = i * self.m + j self.nsets += 1 nbrs = [] nbrs.append([i, j - 1]) nbrs.append([i, j + 1]) nbrs.append([i - 1, j]) nbrs.append([i + 1, j]) for nbr in nbrs: if -1 < nbr[0] < self.n and -1 < nbr[1] < self.m: if self.grid[nbr[0]][nbr[1]] == 1: idx1 = i * self.m + j idx2 = nbr[0] * self.m + nbr[1] self.union(idx1, idx2) def find(self, idx): return self.compressed_find(idx) def compressed_find(self, idx): fidx = self.fathers[idx] if fidx != idx: self.fathers[idx] = self.find(fidx) return self.fathers[idx] def union(self, i, j): fi = self.find(i) fj = self.find(j) if fi != fj: self.fathers[fi] = fj self.nsets -= 1 def get_nsets(self): return self.nsets class Solution: # @param {int} n an integer # @param {int} m an integer # @param {Pint[]} operators an array of point # @return {int[]} an integer array def numIslands2(self, n, m, operators): # Write your code here if n == 0 or m == 0: return 0 uf, res = UnionFind(n, m), [] for oper in operators: i, j = oper.x, oper.y if -1 < i < n and -1 < j < m: uf.build_island(i, j) res.append(uf.get_nsets()) return res
Python
0.000215
bc3f4575c7267db8f7841a82e8f6866c59d15237
Add some example function tests that use gaeftest
tests/test_functional.py
tests/test_functional.py
#!/usr/bin/python2.5 # # Copyright 2009 the Melange authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. __authors__ = [ '"Matthew Wilkes" <matthew@matthewwilkes.co.uk>', ] from gaeftest.test import FunctionalTestCase from zope.testbrowser import browser import os.path class MelangeFunctionalTestCase(FunctionalTestCase): """A base class for all functional tests in Melange. Tests MUST NOT be defined here, but the superclass requires a path attribute that points to the app.yaml. Utility functions MAY be declared here to be shared by all functional tests, but any overridden unittest methods MUST call the superclass version. """ path = os.path.abspath(__file__+"/../../app/app.yaml") class TestBranding(MelangeFunctionalTestCase): """Tests that ensure Melange properly displays attribution. Other notices, as required by the project and/or law, are tested here as well. """ def test_attribution(self): """Ensure that the front page asserts that it is a Melange app. """ tb = browser.Browser() tb.open("http://127.0.0.1:8080/site/show/site") self.assertTrue("Powered by Melange" in tb.contents) class TestLogin(MelangeFunctionalTestCase): """Tests that check the login system is functioning correctly. Also tests that users go through the correct registration workflow. """ def test_firstLogin(self): """Ensure that new users are prompted to create a profile. Also test that only new users are prompted. """ tb = browser.Browser() tb.open("http://127.0.0.1:8080") tb.getLink("Sign in").click() self.assertTrue("login" in tb.url) # fill in dev_appserver login form tb.getForm().getControl("Email").value = "newuser@example.com" tb.getForm().getControl("Login").click() self.assertTrue(tb.url.endswith("/show/site")) self.assertTrue('Please create <a href="/user/create_profile">' 'User Profile</a> in order to view this page' in tb.contents) tb.getLink("User Profile").click() # fill in the user profile cp = tb.getForm(action="create_profile") cp.getControl(name="link_id").value = "exampleuser" cp.getControl(name="name").value = "Example user" cp.getControl("Save").click() # if all is well, we go to the edit page self.assertTrue("edit_profile" in tb.url) tb.open("http://127.0.0.1:8080") # call to action no longer on front page self.assertFalse('Please create <a href="/user/create_profile">' 'User Profile</a> in order to view this page' in tb.contents)
Python
0.000001
1ced3a967742783ef649f7c7defecf333050d547
Update http_endpoint to use convert_xml()
jenkins_jobs/modules/notifications.py
jenkins_jobs/modules/notifications.py
# Copyright 2012 Hewlett-Packard Development Company, L.P. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ The Notifications module allows you to configure Jenkins to notify other applications about various build phases. It requires the Jenkins notification plugin. **Component**: notifications :Macro: notification :Entry Point: jenkins_jobs.notifications """ import xml.etree.ElementTree as XML import jenkins_jobs.modules.base from jenkins_jobs.modules.helpers import convert_mapping_to_xml def http_endpoint(registry, xml_parent, data): """yaml: http Defines an HTTP notification endpoint. Requires the Jenkins :jenkins-wiki:`Notification Plugin <Notification+Plugin>`. :arg str format: notification payload format, JSON (default) or XML :arg str event: job events that trigger notifications: started, completed, finalized or all (default) :arg str url: URL of the endpoint :arg str timeout: Timeout in milliseconds for sending notification request (30 seconds by default) :arg str log: Number lines of log messages to send (0 by default). Use -1 for all (use with caution). Example: .. literalinclude:: \ /../../tests/notifications/fixtures/http-endpoint002.yaml :language: yaml """ endpoint_element = XML.SubElement(xml_parent, 'com.tikal.hudson.plugins.notification.' 'Endpoint') supported_formats = ['JSON', 'XML'] supported_events = ['started', 'completed', 'finalized', 'all'] fmt = data.get('format', 'JSON').upper() event = data.get('event', 'all').lower() mapping = [ ('', 'format', fmt, supported_formats), ('', 'protocol', 'HTTP'), ('', 'event', event, supported_events), ('timeout', 'timeout', 30000), ('url', 'url', None), ('log', 'loglines', 0)] convert_mapping_to_xml(endpoint_element, data, mapping, fail_required=True) class Notifications(jenkins_jobs.modules.base.Base): sequence = 22 component_type = 'notification' component_list_type = 'notifications' def gen_xml(self, xml_parent, data): properties = xml_parent.find('properties') if properties is None: properties = XML.SubElement(xml_parent, 'properties') notifications = data.get('notifications', []) if notifications: notify_element = XML.SubElement(properties, 'com.tikal.hudson.plugins.' 'notification.' 'HudsonNotificationProperty') endpoints_element = XML.SubElement(notify_element, 'endpoints') for endpoint in notifications: self.registry.dispatch('notification', endpoints_element, endpoint)
# Copyright 2012 Hewlett-Packard Development Company, L.P. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ The Notifications module allows you to configure Jenkins to notify other applications about various build phases. It requires the Jenkins notification plugin. **Component**: notifications :Macro: notification :Entry Point: jenkins_jobs.notifications """ import xml.etree.ElementTree as XML from jenkins_jobs.errors import JenkinsJobsException import jenkins_jobs.modules.base def http_endpoint(registry, xml_parent, data): """yaml: http Defines an HTTP notification endpoint. Requires the Jenkins :jenkins-wiki:`Notification Plugin <Notification+Plugin>`. :arg str format: notification payload format, JSON (default) or XML :arg str event: job events that trigger notifications: started, completed, finalized or all (default) :arg str url: URL of the endpoint :arg str timeout: Timeout in milliseconds for sending notification request (30 seconds by default) :arg str log: Number lines of log messages to send (0 by default). Use -1 for all (use with caution). Example: .. literalinclude:: \ /../../tests/notifications/fixtures/http-endpoint002.yaml :language: yaml """ endpoint_element = XML.SubElement(xml_parent, 'com.tikal.hudson.plugins.notification.' 'Endpoint') supported_formats = ['JSON', 'XML'] fmt = data.get('format', 'JSON').upper() if fmt not in supported_formats: raise JenkinsJobsException( "format must be one of %s" % ", ".join(supported_formats)) else: XML.SubElement(endpoint_element, 'format').text = fmt XML.SubElement(endpoint_element, 'protocol').text = 'HTTP' supported_events = ['started', 'completed', 'finalized', 'all'] event = data.get('event', 'all').lower() if event not in supported_events: raise JenkinsJobsException( "event must be one of %s" % ", ".join(supported_events)) else: XML.SubElement(endpoint_element, 'event').text = event XML.SubElement(endpoint_element, 'timeout').text = str(data.get('timeout', 30000)) XML.SubElement(endpoint_element, 'url').text = data['url'] XML.SubElement(endpoint_element, 'loglines').text = str(data.get('log', 0)) class Notifications(jenkins_jobs.modules.base.Base): sequence = 22 component_type = 'notification' component_list_type = 'notifications' def gen_xml(self, xml_parent, data): properties = xml_parent.find('properties') if properties is None: properties = XML.SubElement(xml_parent, 'properties') notifications = data.get('notifications', []) if notifications: notify_element = XML.SubElement(properties, 'com.tikal.hudson.plugins.' 'notification.' 'HudsonNotificationProperty') endpoints_element = XML.SubElement(notify_element, 'endpoints') for endpoint in notifications: self.registry.dispatch('notification', endpoints_element, endpoint)
Python
0.000001
4856b426b380d4d46cccc2f5b8ab2212956a96c2
test of time module. not terribly fancy, but it does touch every function and variable in the module, verifies a few return values and even tests a couple of known error conditions.
Lib/test/test_time.py
Lib/test/test_time.py
import time time.altzone time.clock() t = time.time() time.asctime(time.gmtime(t)) if time.ctime(t) <> time.asctime(time.localtime(t)): print 'time.ctime(t) <> time.asctime(time.localtime(t))' time.daylight if int(time.mktime(time.localtime(t))) <> int(t): print 'time.mktime(time.localtime(t)) <> t' time.sleep(1.2) tt = time.gmtime(t) for directive in ('a', 'A', 'b', 'B', 'c', 'd', 'E', 'H', 'I', 'j', 'm', 'M', 'n', 'N', 'o', 'p', 'S', 't', 'U', 'w', 'W', 'x', 'X', 'y', 'Y', 'Z', '%'): format = '%' + directive time.strftime(format, tt) time.timezone time.tzname # expected errors try: time.asctime(0) except TypeError: pass try: time.mktime((999999, 999999, 999999, 999999, 999999, 999999, 999999, 999999, 999999)) except OverflowError: pass
Python
0
c851501cc8149685a9e9c023aa200b92c17a9078
Add decoder ida fields name
pida_fields.py
pida_fields.py
def decode_name_fields(ida_fields): i = -1 stop = len(ida_fields) while True: i += 1 if i == stop: break count = ord(ida_fields[i]) - 1 if count == 0: continue i += 1 yield ida_fields[i:i + count] i += count - 1
Python
0.000001
fab0b43c2f2c60ac9cf701fb275650f05ac0dfa2
add wrapper class for basic binary gpio
raspi_binary_gpio.py
raspi_binary_gpio.py
""" Author: Nate Levesque <public@thenaterhood.com> Language: Python3 Filename: raspi_binary_gpio.py Description: contains a class for reading/writing from the raspberry pi GPIO pins as two 8-bit arrays, like in assembly. Note that this is designed (originally) for writing/reading 8-bit arrays of switches or LEDs "in one shot" but if the hardware is designed using shift registers, it could also be used to display data on an 8xN LED display. The class requires integers which are then converted to binary in 8 bits. If the output results in more than 8 bits, the program will display up to the first 8, and set its error field to True. If the output fits in the output array, then the error field is set to false. Retrieving data does not set the error field. The class treats (as it was easier to wire it this way in my setup) the GPIO pins as one side of the connector is output and the other side is input. In the setup section this is more clear as it includes pin numbers. This can be changed by changing what pins are listed in the inpins and outpins (and if it's safe in your setup, they can be the same thing) """ import RPi.GPIO as io class gpio(): """ Manages IO for the raspberry pi GPIO as two 8-bit registers. This may expand to 16 bit both ways, but for my purposes right now, 8 bit is fine and with my setup it's safer to use it as two separate registers. """ __slots__=('register', 'error') def __init__( self, TxData=False ): """ Constructs the class with either the input from an array of up to 8 inputs (1 or 0) and returns it, or converts the argument integer to binary and displays it on the GPIO LED array. All returned arrays of input are lists of boolean values for each pin. Arguments: task (str): read or write, whether to read from an array of switches or 'write' to the output """ io.setmode(io.BOARD) # Whether to print variables as they're created, for debug # purposes debug = False # Defines the input and output pins to use inpins = [3, 5, 7, 11, 13, 15, 19, 21, 23] outpins = [8, 10, 12, 16, 18, 22, 24, 26] # Retrieves the data from the incoming pins if ( not TxData ): RxData = [] # Setting up and retrieving the state of each pin for pin in inpins: io.setup(pin, io.IN) RxData.append( io.input(pin) ) # Initializing the class slot for the data and printing # it in string form if debug is set self.register = RxData if debug: print( self ) # writes the data to the output pins if ( TxData ): # Converts the input to an array of True and False that # represents the binary 1 and 0 bits of the binary number self.register = self.createBinArray( self.DecToBinString( TxData ) ) if debug: print( self ) # Iterates backwards through the binary data (LSB -> MSB) # and outputs it over the designated output pins i = len( outpins ) - 1 while i >= 0: io.setup( outpins[i], io.OUT ) io.output( outpins[i], self.register[i] ) i -= 1 # Checks to see if the number fit in the number of output # pins and sets the error field to True if it did not if ( len( outpins ) < len( self.register ) ): self.error = True self.error = False def DecToBinString( self, integer ): """ Returns a string of the binary representation of an integer. Arguments: integer (int): an integer Returns: (str): the string of the binary rep of the integer """ return bin(integer)[2:] def createBinArray( self, binary ): """ Creates a binary array from a string of 1's and 0's Arguments: binary (str): a string representation of a binary number Returns: binArray (list): a list of boolean values that represent the binary number """ binArray = [] for digit in binary: if ( digit == '0' ): binArray.append( False ) if ( digit == '1' ): binArray.append( True ) while len( binArray ) < 8: binArray.insert(0, False) return binArray def __str__( self ): """ Returns a graphical representation of the bits stored in the class's 'register' field. """ r = '' for bit in self.register: if ( bit ): r = r + "@" else: r = r + "o" return r
Python
0
015c7f7fbab200084cf08bd1f7e35cbcd61b369e
Axonical hello world.
Sketches/PT/helloworld.py
Sketches/PT/helloworld.py
#!/usr/bin/env python import time from Axon.Component import component from Axon.Scheduler import scheduler class HelloPusher(component): def main(self): while True: time.sleep(0.5) # normally this would be a bad idea, since the entire scheduler will halt inside this component. self.send("\n!ednom ,tulas", 'outbox') yield 1 class Reverser(component): def main(self): while True: if self.dataReady('inbox'): item = self.recv('inbox') self.send(item[::-1], 'outbox') else: self.pause() yield 1 from Kamaelia.Chassis.Pipeline import Pipeline from Kamaelia.Util.Console import ConsoleEchoer thepipe = Pipeline(HelloPusher(), Reverser(), ConsoleEchoer()).activate() # thepipe = Pipeline(HelloPusher(), Reverser(), ConsoleEchoer()).run() scheduler.run.runThreads()
Python
0.999999
e869c7ef9e3d19da4c98cda57b5e22fb5a35cba5
Add first basic unittests using py.test
tests/test_validators.py
tests/test_validators.py
""" test_validators ~~~~~~~~~~~~~~ Unittests for bundled validators. :copyright: 2007-2008 by James Crasta, Thomas Johansson. :license: MIT, see LICENSE.txt for details. """ from py.test import raises from wtforms.validators import ValidationError, length, url, not_empty, email, ip_address class DummyForm(object): pass class DummyField(object): def __init__(self, data): self.data = data form = DummyForm() def test_email(): assert email(form, DummyField('foo@bar.dk')) == None assert email(form, DummyField('123@bar.dk')) == None assert email(form, DummyField('foo@456.dk')) == None assert email(form, DummyField('foo@bar456.info')) == None raises(ValidationError, email, form, DummyField('foo')) == None raises(ValidationError, email, form, DummyField('bar.dk')) == None raises(ValidationError, email, form, DummyField('foo@')) == None raises(ValidationError, email, form, DummyField('@bar.dk')) == None raises(ValidationError, email, form, DummyField('foo@bar')) == None raises(ValidationError, email, form, DummyField('foo@bar.ab12')) == None raises(ValidationError, email, form, DummyField('foo@bar.abcde')) == None def test_length(): field = DummyField('foobar') assert length(min=2, max=6)(form, field) == None raises(ValidationError, length(min=7), form, field) raises(ValidationError, length(max=5), form, field) def test_url(): assert url()(form, DummyField('http://foobar.dk')) == None assert url()(form, DummyField('http://foobar.dk/')) == None assert url()(form, DummyField('http://foobar.dk/foobar')) == None raises(ValidationError, url(), form, DummyField('http://foobar')) raises(ValidationError, url(), form, DummyField('foobar.dk')) raises(ValidationError, url(), form, DummyField('http://foobar.12')) def test_not_empty(): assert not_empty()(form, DummyField('foobar')) == None raises(ValidationError, not_empty(), form, DummyField('')) raises(ValidationError, not_empty(), form, DummyField(' ')) def test_ip_address(): assert ip_address(form, DummyField('127.0.0.1')) == None raises(ValidationError, ip_address, form, DummyField('abc.0.0.1')) raises(ValidationError, ip_address, form, DummyField('1278.0.0.1')) raises(ValidationError, ip_address, form, DummyField('127.0.0.abc'))
Python
0
54c358a296733d2a5236a9a776830f1b78682b73
Add lc040_combination_sum_ii.py
lc040_combination_sum_ii.py
lc040_combination_sum_ii.py
"""Leetcode 40. Combination Sum II Medium URL: https://leetcode.com/problems/combination-sum-ii/ Given a collection of candidate numbers (candidates) and a target number (target), find all unique combinations in candidates where the candidate numbers sums to target. Each number in candidates may only be used once in the combination. Note: All numbers (including target) will be positive integers. The solution set must not contain duplicate combinations. Example 1: Input: candidates = [10,1,2,7,6,1,5], target = 8, A solution set is: [ [1, 7], [1, 2, 5], [2, 6], [1, 1, 6] ] Example 2: Input: candidates = [2,5,2,1,2], target = 5, A solution set is: [ [1,2,2], [5] ] """ class Solution(object): def combinationSum2(self, candidates, target): """ :type candidates: List[int] :type target: int :rtype: List[List[int]] """ pass def main(): pass if __name__ == '__main__': main()
Python
0.004345
7fab8c2d014f013131bd4d6301f5f8e5268d6037
add leetcode Pow(x, n)
leetcode/powx-n/solution.py
leetcode/powx-n/solution.py
# -*- coding:utf-8 -*- class Solution: # @param x, a float # @param n, a integer # @return a float def pow(self, x, n): if n == 0: return 1 if n < 0: neg_flag = True n = -n else: neg_flag = False ret = 1 while n > 0: if n % 2 == 1: ret *= x x = x * x n //= 2 if neg_flag: return 1 / ret return ret
Python
0.000908
736103ea495c89defcae9bf6ab72aa7b89768026
add start of advisory module
updatebot/advise.py
updatebot/advise.py
# # Copyright (c) 2008 rPath, Inc. # # This program is distributed under the terms of the Common Public License, # version 1.0. A copy of this license should have been distributed with this # source file in a file called LICENSE. If it is not present, the license # is always available at http://www.rpath.com/permanent/licenses/CPL-1.0. # # This program is distributed in the hope that it will be useful, but # without any warranty; without even the implied warranty of merchantability # or fitness for a particular purpose. See the Common Public License for # full details. # """ Module for managing/manipulating advisories. """ from updatebot.errors import * class Advisor(object): """ Class for managing, manipulating, and distributing advisories. """ def __init__(self, cfg, rpmSource): self._cfg = cfg self._rpmSource = rpmSource
Python
0
27b9727926139ae2cfde6d3cdcdf5746ed28e03d
Add new package arbor (#11914)
var/spack/repos/builtin/packages/arbor/package.py
var/spack/repos/builtin/packages/arbor/package.py
# Copyright 2013-2019 Lawrence Livermore National Security, LLC and other # Spack Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) from spack import * class Arbor(CMakePackage): """Arbor is a high-performance library for computational neuroscience simulations.""" homepage = "https://github.com/arbor-sim/arbor/" url = "https://github.com/arbor-sim/arbor/archive/v0.2.tar.gz" version('0.2', sha256='43c9181c03be5f3c9820b2b50592d7b41344f37e1200980119ad347eb7bcf4eb') variant('vectorize', default=False, description='Enable vectorization of computational kernels') variant('gpu', default=False, description='Enable GPU support') variant('mpi', default=False, description='Enable MPI support') variant('python', default=False, description='Enable Python frontend support') variant('unwind', default=False, description='Enable libunwind for pretty stack traces') depends_on('cuda', when='+gpu') depends_on('mpi', when='+mpi') depends_on('libunwind', when='+unwind') extends('python@3.6:', when='+python') depends_on('py-mpi4py', when='+mpi+python', type=('build', 'run')) depends_on('cmake@3.9:', type='build') # mentioned in documentation but shouldn't be necessary when # using the archive # depends_on('git@2.0:', type='build') # compiler dependencies # depends_on(C++14) # depends_on('gcc@6.1.0:', type='build') # depends_on('llvm@4:', type='build') # depends_on('clang-apple@9:', type='build') # when building documentation, this could be an optional dependency depends_on('py-sphinx', type='build') def patch(self): filter_file( r'find_library\(_unwind_library_target unwind-\${libunwind_arch}', r'find_library(_unwind_library_target unwind-${_libunwind_arch}', 'cmake/FindUnwind.cmake' ) filter_file( r'target_compile_definitions\(arbor-private-deps ARB_WITH_UNWIND\)', # noqa: E501 r'target_compile_definitions(arbor-private-deps INTERFACE WITH_UNWIND)', # noqa: E501 'CMakeLists.txt' ) def cmake_args(self): args = [ '-DARB_VECTORIZE=' + ('ON' if '+vectorize' in self.spec else 'OFF'), # noqa: E501 '-DARB_WITH_GPU=' + ('ON' if '+gpu' in self.spec else 'OFF'), '-DARB_WITH_PYTHON=' + ('ON' if '+python' in self.spec else 'OFF'), ] if '+unwind' in self.spec: args.append('-DUnwind_ROOT_DIR={0}'.format(self.spec['libunwind'].prefix)) # noqa: E501 return args
Python
0
ac851c402952cf44b24dfdf5277765ff286dd994
convert embeddingns to js-friendly format
src/convert_embeddings_to_js.py
src/convert_embeddings_to_js.py
import h5py import json import numpy as np def load_embeddings(path): f = h5py.File(path, 'r') nemb = f['nemb'][:] f.close() return nemb def load_vocab(path): vocab = [] with open(path, 'rb') as f: for line in f.readlines(): split = line.split(' ') vocab.append((split[0], int(split[1].rstrip()))) # ignore UNK at position 0 return vocab[1:] def write_to_js(words, embeddings, path): word_vecs = {} for word, embedding in zip(words, embeddings): word_vecs[word] = embedding.tolist() with open(path, 'wb') as f: json.dump(word_vecs, f) f.write(';') def main(): nemb = load_embeddings(path='/tmp/embeddings.h5') vocab = load_vocab('/tmp/vocab.txt') words = [tup[0] for tup in vocab] # dont use UNK words = words[1:] nemb = nemb[1:] # lower precision, faster nemb = nemb.astype(np.float16) write_to_js(words, nemb[1:], path='../../word2vecjson/data/foodVecs.js') if __name__ == '__main__': main()
Python
0.999997
11efa5583bbeeee7c7823264f6f73715ea81edc0
Add trivial test for ECO fetching
luigi/tests/ontologies/eco_test.py
luigi/tests/ontologies/eco_test.py
# -*- coding: utf-8 -*- """ Copyright [2009-2017] EMBL-European Bioinformatics Institute Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from ontologies import eco def test_can_load_all_eco_terms(): source = eco.TermSources( quickgo_file='data/quickgo/rna.gpa' ) assert len(list(eco.to_load(source))) == 6
Python
0.000002
ec3b080b2f1922f4989b853db45475d185e314de
add all
examples/gcharttestapp/TestGChart00.py
examples/gcharttestapp/TestGChart00.py
import GChartTestAppUtil from pyjamas.chart.GChart import GChart """* Empty chart without anything on it except a title and footnotes """ class TestGChart00 (GChart): def __init__(self): GChart.__init__(self, 150,150) self.setChartTitle(GChartTestAppUtil.getTitle(self)) self.setChartFootnotes("Check: Consistent with a 'no data' chart (and it doesn't crash).")
Python
0.000308
4fdba8a1a5a2123843cc9eefd8949fb8996f59b2
Add a wrapper for ChromeOS to call into telemetry.
telemetry/telemetry/unittest/run_chromeos_tests.py
telemetry/telemetry/unittest/run_chromeos_tests.py
# Copyright 2014 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import logging import os import sys from telemetry.unittest import gtest_progress_reporter from telemetry.unittest import run_tests from telemetry.core import util def RunTestsForChromeOS(browser_type, unit_tests, perf_tests): stream = _LoggingOutputStream() error_string = '' logging.info('Running telemetry unit tests with browser_type "%s".' % browser_type) ret = _RunOneSetOfTests(browser_type, 'telemetry', os.path.join('telemetry', 'telemetry'), unit_tests, stream) if ret: error_string += 'The unit tests failed.\n' logging.info('Running telemetry perf tests with browser_type "%s".' % browser_type) ret = _RunOneSetOfTests(browser_type, 'perf', 'perf', perf_tests, stream) if ret: error_string = 'The perf tests failed.\n' return error_string def _RunOneSetOfTests(browser_type, root_dir, sub_dir, tests, stream): top_level_dir = os.path.join(util.GetChromiumSrcDir(), 'tools', root_dir) sub_dir = os.path.join(util.GetChromiumSrcDir(), 'tools', sub_dir) sys.path.append(top_level_dir) output_formatters = [gtest_progress_reporter.GTestProgressReporter(stream)] run_tests.config = run_tests.Config(top_level_dir, [sub_dir], output_formatters) return run_tests.RunTestsCommand.main(['--browser', browser_type] + tests) class _LoggingOutputStream(object): def __init__(self): self._buffer = [] def write(self, s): """Buffer a string write. Log it when we encounter a newline.""" if '\n' in s: segments = s.split('\n') segments[0] = ''.join(self._buffer + [segments[0]]) log_level = logging.getLogger().getEffectiveLevel() try: # TODO(dtu): We need this because of crbug.com/394571 logging.getLogger().setLevel(logging.INFO) for line in segments[:-1]: logging.info(line) finally: logging.getLogger().setLevel(log_level) self._buffer = [segments[-1]] else: self._buffer.append(s) def flush(self): # pylint: disable=W0612 pass
Python
0.000003
fcce65daf40bb1c198be7ddadee8769bf6feea9b
Create k-order-test.py
k-order-test.py
k-order-test.py
# -*- coding: utf-8 -*- """ Created on Thu Mar 6 16:41:40 2014 @author: xiao """ from k_order import * #number of items to recommand p=2 fadress = "/home/xiao/ProjetLibre/matrix/matrixInfo" readDataFromFile(fadress) getDu() recommendationListe = zeros((m,p)) ############################################ #### We need to recommend top items #### ############################################ #k=1 #recommend top p items for user u def recommendItems_u(u, p): #initialize recommendation items to be -1: null res = zeros(p)-1 D_bar_u = Omega_comp[u] r = f_bar_d(D_bar_u, u) indexOrder = argsort(r) indexOrder = indexOrder[::-1] if len(indexOrder) >= p: res = indexOrder[:p] else: res[:len(indexOrder)] = indexOrder return res #recommend top p items for all m users def recommendItems(p): for u in range(m): r = recommendItems_u(u, p) recommendationListe[u,:] = r def f_test(x): return x**2 - 3*x def test(): a = arange(5) b = f_test(a) c = argsort(b) c = c[::-1] return c #show def showRecomms(): for u in range(m): print "u:", u, ",",recommendationListe[u,:] k_os_AUC() recommendItems(p) showRecomms() ###################################################### #### We need to recommend most relavent users #### ###################################################### ###################################################### #### test normal AUC #### ###################################################### ###################################################### #### test normal WARP #### ###################################################### ###################################################### #### test K-os AUC #### ###################################################### ###################################################### #### test k-os WARP #### ######################################################
Python
0.000032
d73235dd994d3705178d0cff142293444977d764
Remove bad imports
odo/backends/tests/conftest.py
odo/backends/tests/conftest.py
import os import shutil import pytest @pytest.fixture(scope='session') def sc(): pyspark = pytest.importorskip('pyspark') return pyspark.SparkContext('local[*]', 'odo') @pytest.yield_fixture(scope='session') def sqlctx(sc): pyspark = pytest.importorskip('pyspark') try: yield pyspark.HiveContext(sc) finally: dbpath = 'metastore_db' logpath = 'derby.log' if os.path.exists(dbpath): assert os.path.isdir(dbpath) shutil.rmtree(dbpath) if os.path.exists(logpath): assert os.path.isfile(logpath) os.remove(logpath)
import os import shutil import pytest @pytest.fixture(scope='session') def sc(): pytest.importorskip('pyspark') from pyspark import SparkContext return SparkContext('local[*]', 'odo') @pytest.yield_fixture(scope='session') def sqlctx(sc): pytest.importorskip('pyspark') from odo.backends.sparksql import HiveContext, SQLContext, SPARK_ONE_TWO try: yield HiveContext(sc) if not SPARK_ONE_TWO else SQLContext(sc) finally: dbpath = 'metastore_db' logpath = 'derby.log' if os.path.exists(dbpath): assert os.path.isdir(dbpath) shutil.rmtree(dbpath) if os.path.exists(logpath): assert os.path.isfile(logpath) os.remove(logpath)
Python
0.000015
4c5a8f018af4377ce3f9367b0c66a51a6cad671b
add __init__.py
eatable/__init__.py
eatable/__init__.py
from .table import Table from .row import Row
Python
0.00212
2b15d2df8333db5f5cd6fcefaf56f5400baba95e
add test_results_table.py
metaseq/test/test_results_table.py
metaseq/test/test_results_table.py
from metaseq import results_table import metaseq import numpy as np fn = metaseq.example_filename('ex.deseq') d = results_table.ResultsTable(fn) def test_dataframe_access(): # different ways of accessing get the same data in memory assert d.id is d.data.id assert d['id'] is d.data.id def test_dataframe_subsetting(): assert all(d[:10].data == d.data[:10]) assert all(d.update(d.data[:10]).data == d.data[:10]) def test_copy(): e = d.copy() e.id = 'a' assert e.id[0] == 'a' assert d.id[0] != 'a' def smoke_tests(): #smoke test for repr print repr(d) def test_db(): # should work d.attach_db(None) d.attach_db(metaseq.example_filename('dmel-all-r5.33-cleaned.gff.db'))
Python
0.000104
2382c1c9daf2b17799ceb03f42a6917966b3162c
add kattis/cold
Kattis/cold.py
Kattis/cold.py
""" Problem: cold Link: https://open.kattis.com/problems/cold Source: Kattis """ N = int(input()) A = list(map(int, input().split())) answer = 0 for i in range(len(A)): answer += (A[i] < 0) print(answer)
Python
0.999545
dd93b450eb0cc92debd8b5cec82f3127c454d77f
put this back...
TheCannon/infer_labels.py
TheCannon/infer_labels.py
from __future__ import (absolute_import, division, print_function, unicode_literals) from scipy import optimize as opt import numpy as np LARGE = 200. SMALL = 1. / LARGE def _get_lvec(labels): """ Constructs a label vector for an arbitrary number of labels Assumes that our model is quadratic in the labels Parameters ---------- labels: numpy ndarray pivoted label values for one star Returns ------- lvec: numpy ndarray label vector """ nlabels = len(labels) # specialized to second-order model linear_terms = labels quadratic_terms = np.outer(linear_terms, linear_terms)[np.triu_indices(nlabels)] lvec = np.hstack((linear_terms, quadratic_terms)) return lvec def _func(coeffs, *labels): """ Takes the dot product of coefficients vec & labels vector Parameters ---------- coeffs: numpy ndarray the coefficients on each element of the label vector *labels: numpy ndarray label vector Returns ------- dot product of coeffs vec and labels vec """ lvec = _get_lvec(list(labels)) return np.dot(coeffs, lvec) def _infer_labels(model, dataset): """ Uses the model to solve for labels of the test set. Parameters ---------- model: tuple Coeffs_all, covs, scatters, chis, chisqs, pivots dataset: Dataset Dataset that needs label inference Returns ------- errs_all: Covariance matrix of the fit """ print("Inferring Labels") coeffs_all = model.coeffs scatters = model.scatters chisqs = model.chisqs pivots = model.pivots nlabels = dataset.tr_label.shape[1] fluxes = dataset.test_flux ivars = dataset.test_ivar nstars = fluxes.shape[0] labels_all = np.zeros((nstars, nlabels)) MCM_rotate_all = np.zeros((nstars, coeffs_all.shape[1] - 1, coeffs_all.shape[1]-1.)) errs_all = np.zeros((nstars, nlabels)) for jj in range(nstars): print(jj) flux = fluxes[jj,:] ivar = ivars[jj,:] flux_piv = flux - coeffs_all[:,0] * 1. # pivot around the leading term sig = np.sqrt(1./ivar + scatters**2) coeffs = np.delete(coeffs_all, 0, axis=1) # take pivot into account try: labels, covs = opt.curve_fit(_func, coeffs, flux_piv, p0=np.repeat(1, nlabels), sigma=sig, absolute_sigma=True) except TypeError: # old scipy version labels, covs = opt.curve_fit(_func, coeffs, flux_piv, p0=np.repeat(1, nlabels), sigma=sig) # rescale covariance matrix chi = (flux_piv-_func(coeffs, *labels)) / sig chi2 = (chi**2).sum() # FIXME: dof does not seem to be right to me (MF) dof = len(flux_piv) - nlabels factor = (chi2 / dof) covs /= factor labels = labels + pivots labels_all[jj,:] = labels errs_all[jj,:] = covs.diagonal() dataset.set_test_label_vals(labels_all) return errs_all
Python
0
652a03d96cbc5c06850fa62fa3507fb74ee3deab
Create python_ciphertext.py
Encryption/python_ciphertext.py
Encryption/python_ciphertext.py
#Simply how to make a ciphertext only with 1 line. >>> #hex_encode = 'summonagus'.encode('hex') >>> hex_encode = '73756d6d6f6e61677573' >>> chip = ''.join([ str(int(a)*2) if a.isdigit() and int(a) == 3 else str(int(a)/2) if a.isdigit() and int(a) == 6 else a for a in hex_encode ]) >>> >>> hex_encode '73756d6d6f6e61677573' >>> chip '76753d3d3f3e31377576' >>> >>>
Python
0.999975
8add0d44139b527d40aaa9da43d023ddde52c410
Add string python solution
HackerRank/PYTHON/Strings/alphabet_rangoli.py
HackerRank/PYTHON/Strings/alphabet_rangoli.py
#!/usr/bin/env python3 import sys from string import ascii_lowercase def print_rangoli(size): width = size * 4 - 3 alphabet = (ascii_lowercase[0:size])[::-1] res = [] for i in range(size): s = '' for a in alphabet[0:i+1]: s = '%s-%s' % (s, a) temp = s + s[::-1][1:] if len(temp) == width + 2: temp = temp[1:-1] res.append(temp) else: res.append(temp.center(width, '-')) print('\n'.join(res)) print('\n'.join(list(reversed(res[0:size - 1])))) if __name__ == '__main__': n = int(input()) print_rangoli(n)
Python
0.999999
eac74d731b01f732d23ce21e8132fa0785aa1ab2
Create visible_elements.py
visible_elements.py
visible_elements.py
# -*- coding: utf-8 -*- import unittest from selenium import webdriver from selenium.webdriver.support.wait import WebDriverWait from selenium.webdriver.common.by import By class visible_elements(unittest.TestCase): def setUp(self): self.driver = webdriver.Chrome("C://chromedriver/chromedriver.exe") self.driver.maximize_window() wait = WebDriverWait(self.driver, 10) def test_clickelements(self): self.driver.get("http://localhost/litecart/en/") rows = self.driver.find_elements_by_xpath("//li[@class='product column shadow hover-light']") def are_elements_present(self, *args): return len(self.driver.find_elements(*args)) == 1 are_elements_present(self, By.XPATH, "//div[@class='sticker sale']" and "//div[@class='sticker new']" ) in rows def tearDown(self): self.driver.close() if __name__ == "__main__": unittest.main()
Python
0.000003
eaa45d8a9a8cd26379ea7bd3bcee99cbab08d9e7
Remove hdf5 ~cxx constraint on netcdf
var/spack/repos/builtin/packages/netcdf/package.py
var/spack/repos/builtin/packages/netcdf/package.py
from spack import * class Netcdf(Package): """NetCDF is a set of software libraries and self-describing, machine-independent data formats that support the creation, access, and sharing of array-oriented scientific data.""" homepage = "http://www.unidata.ucar.edu/software/netcdf" url = "ftp://ftp.unidata.ucar.edu/pub/netcdf/netcdf-4.3.3.tar.gz" version('4.4.0', 'cffda0cbd97fdb3a06e9274f7aef438e') version('4.3.3', '5fbd0e108a54bd82cb5702a73f56d2ae') variant('mpi', default=True, description='Enables MPI parallelism') variant('hdf4', default=False, description='Enable HDF4 support') depends_on("m4") depends_on("hdf", when='+hdf4') # Required for DAP support depends_on("curl") # Required for NetCDF-4 support depends_on("zlib") depends_on("hdf5+mpi", when='+mpi') depends_on("hdf5~mpi", when='~mpi') def install(self, spec, prefix): # Environment variables CPPFLAGS = [] LDFLAGS = [] LIBS = [] config_args = [ "--prefix=%s" % prefix, "--enable-fsync", "--enable-v2", "--enable-utilities", "--enable-shared", "--enable-static", "--enable-largefile", # necessary for HDF5 support "--enable-netcdf-4", "--enable-dynamic-loading", # necessary for DAP support "--enable-dap" ] # Make sure Netcdf links against Spack's curl # Otherwise it may pick up system's curl, which could lead to link errors: # /usr/lib/x86_64-linux-gnu/libcurl.so: undefined reference to `SSL_CTX_use_certificate_chain_file@OPENSSL_1.0.0' LIBS.append("-lcurl") CPPFLAGS.append("-I%s" % spec['curl'].prefix.include) LDFLAGS.append( "-L%s" % spec['curl'].prefix.lib) if '+mpi' in spec: config_args.append('--enable-parallel4') CPPFLAGS.append("-I%s/include" % spec['hdf5'].prefix) LDFLAGS.append( "-L%s/lib" % spec['hdf5'].prefix) # HDF4 support # As of NetCDF 4.1.3, "--with-hdf4=..." is no longer a valid option # You must use the environment variables CPPFLAGS and LDFLAGS if '+hdf4' in spec: config_args.append("--enable-hdf4") CPPFLAGS.append("-I%s/include" % spec['hdf'].prefix) LDFLAGS.append( "-L%s/lib" % spec['hdf'].prefix) LIBS.append( "-l%s" % "jpeg") if 'szip' in spec: CPPFLAGS.append("-I%s/include" % spec['szip'].prefix) LDFLAGS.append( "-L%s/lib" % spec['szip'].prefix) LIBS.append( "-l%s" % "sz") # Fortran support # In version 4.2+, NetCDF-C and NetCDF-Fortran have split. # Use the netcdf-fortran package to install Fortran support. config_args.append('CPPFLAGS=%s' % ' '.join(CPPFLAGS)) config_args.append('LDFLAGS=%s' % ' '.join(LDFLAGS)) config_args.append('LIBS=%s' % ' '.join(LIBS)) configure(*config_args) make() make("install")
from spack import * class Netcdf(Package): """NetCDF is a set of software libraries and self-describing, machine-independent data formats that support the creation, access, and sharing of array-oriented scientific data.""" homepage = "http://www.unidata.ucar.edu/software/netcdf" url = "ftp://ftp.unidata.ucar.edu/pub/netcdf/netcdf-4.3.3.tar.gz" version('4.4.0', 'cffda0cbd97fdb3a06e9274f7aef438e') version('4.3.3', '5fbd0e108a54bd82cb5702a73f56d2ae') variant('mpi', default=True, description='Enables MPI parallelism') variant('hdf4', default=False, description="Enable HDF4 support") # Dependencies: depends_on("curl") # required for DAP support depends_on("hdf", when='+hdf4') depends_on("hdf5+mpi~cxx", when='+mpi') # required for NetCDF-4 support depends_on("hdf5~mpi", when='~mpi') # required for NetCDF-4 support depends_on("zlib") # required for NetCDF-4 support depends_on("m4") def install(self, spec, prefix): # Environment variables CPPFLAGS = [] LDFLAGS = [] LIBS = [] config_args = [ "--prefix=%s" % prefix, "--enable-fsync", "--enable-v2", "--enable-utilities", "--enable-shared", "--enable-static", "--enable-largefile", # necessary for HDF5 support "--enable-netcdf-4", "--enable-dynamic-loading", # necessary for DAP support "--enable-dap" ] # Make sure Netcdf links against Spack's curl # Otherwise it may pick up system's curl, which could lead to link errors: # /usr/lib/x86_64-linux-gnu/libcurl.so: undefined reference to `SSL_CTX_use_certificate_chain_file@OPENSSL_1.0.0' LIBS.append("-lcurl") CPPFLAGS.append("-I%s" % spec['curl'].prefix.include) LDFLAGS.append ("-L%s" % spec['curl'].prefix.lib) if '+mpi' in spec: config_args.append('--enable-parallel4') CPPFLAGS.append("-I%s/include" % spec['hdf5'].prefix) LDFLAGS.append( "-L%s/lib" % spec['hdf5'].prefix) # HDF4 support # As of NetCDF 4.1.3, "--with-hdf4=..." is no longer a valid option # You must use the environment variables CPPFLAGS and LDFLAGS if '+hdf4' in spec: config_args.append("--enable-hdf4") CPPFLAGS.append("-I%s/include" % spec['hdf'].prefix) LDFLAGS.append( "-L%s/lib" % spec['hdf'].prefix) LIBS.append( "-l%s" % "jpeg") if 'szip' in spec: CPPFLAGS.append("-I%s/include" % spec['szip'].prefix) LDFLAGS.append( "-L%s/lib" % spec['szip'].prefix) LIBS.append( "-l%s" % "sz") # Fortran support # In version 4.2+, NetCDF-C and NetCDF-Fortran have split. # Use the netcdf-fortran package to install Fortran support. config_args.append('CPPFLAGS=%s' % ' '.join(CPPFLAGS)) config_args.append('LDFLAGS=%s' % ' '.join(LDFLAGS)) config_args.append('LIBS=%s' % ' '.join(LIBS)) configure(*config_args) make() make("install")
Python
0.000001
5343c89686fd05cf251388e1f28bfd4343d4c277
Add python-based CPU implementation
src/CPU/color_histogram.py
src/CPU/color_histogram.py
from PIL import Image from collections import defaultdict import sys im = Image.open(sys.argv[1]) colors = defaultdict(int) for pixel in im.getdata(): colors[pixel] += 1 print colors
Python
0.000074
f408465521484032631adfe9dced21119ad2bf82
Revert "Delete old MultiServer implementation"
MultiServer.py
MultiServer.py
from multiprocessing import Process import subprocess import GlobalVars def botInstance(server, channels): args = ["python", "hubbebot.py"] args.append(server) for chan in channels: args.append(chan) subprocess.call(args) if __name__ == "__main__": for (server,channels) in GlobalVars.connections.items(): p = Process(target=botInstance, args=(server, channels)) p.start()
Python
0
2ef9618e705bb293641674ca5e7cc1f14daf3483
Set default branding for all organisations
migrations/versions/0285_default_org_branding.py
migrations/versions/0285_default_org_branding.py
"""empty message Revision ID: 0285_default_org_branding Revises: 0284_0283_retry Create Date: 2016-10-25 17:37:27.660723 """ # revision identifiers, used by Alembic. revision = '0285_default_org_branding' down_revision = '0284_0283_retry' from alembic import op import sqlalchemy as sa BRANDING_TABLES = ('email_branding', 'letter_branding') def upgrade(): for branding in BRANDING_TABLES: op.execute(""" UPDATE organisation SET {branding}_id = {branding}.id FROM {branding} WHERE {branding}.domain in ( SELECT domain FROM domain WHERE domain.organisation_id = organisation.id ) """.format(branding=branding)) def downgrade(): for branding in BRANDING_TABLES: op.execute(""" UPDATE organisation SET {branding}_id = null """.format(branding=branding))
Python
0
52b870d36370f46fdc33de2948504c2aec8db1a1
fix field names in network object
planetstack/core/migrations/0002_network_field_case.py
planetstack/core/migrations/0002_network_field_case.py
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations import timezones.fields class Migration(migrations.Migration): dependencies = [ ('core', '0001_initial'), ] operations = [ migrations.RenameField( model_name='networktemplate', old_name='controllerKind', new_name='controller_kind', ), migrations.RenameField( model_name='networktemplate', old_name='guaranteedBandwidth', new_name='guaranteed_bandwidth', ), migrations.RenameField( model_name='networktemplate', old_name='sharedNetworkId', new_name='shared_network_id', ), migrations.RenameField( model_name='networktemplate', old_name='sharedNetworkName', new_name='shared_network_name', ), migrations.RenameField( model_name='networktemplate', old_name='topologyKind', new_name='topology_kind', ), ]
Python
0.000003
9b584c6d23ad93fd497fb2e71d2343a954cea4e5
Create PaulFinalproject.py
PaulFinalproject.py
PaulFinalproject.py
Python
0
8462466f8a21f25f85b8a06076877361b2545a12
Add initialize script
PyResis/__init__.py
PyResis/__init__.py
__author__ = 'Yu Cao'
Python
0.000002
8fcc727f9a7fbd886bc900f9c24cf2711a0c5b99
Create Record.py
Record.py
Record.py
""" The MIT License (MIT) Copyright (c) <2016> <Larry McCaig (aka: Larz60+ aka: Larz60p)> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ from collections import namedtuple import json class Record(object): def __init__(self, filename=None): with open(filename, 'r') as f: self.j = f.read() self.record = json.loads(self.j, object_hook=lambda j: namedtuple('data', j.keys())(*j.values())) self.recindex = len(self.record) self.index = 0 def __iter__(self): self.index = self.recindex return self def __next__(self): if self.index == 0: raise StopIteration self.index -= 1 return self.record[self.index]
Python
0.000001
1708eb17fb9c232414b0e162754ca31b6fd9366c
Add tests for plagiarism filter command
services/comprehension/main-api/comprehension/tests/management/commands/test_pre_filter_responses.py
services/comprehension/main-api/comprehension/tests/management/commands/test_pre_filter_responses.py
import csv from io import StringIO from unittest.mock import call, MagicMock, patch from django.test import TestCase from ....views.plagiarism import PlagiarismFeedbackView from ....management.commands import pre_filter_responses Command = pre_filter_responses.Command class TestCommandBase(TestCase): def setUp(self): self.command = Command() class TestPreFilterResponsesCommand(TestCommandBase): def test_add_arguments(self): mock_parser = MagicMock() self.command.add_arguments(mock_parser) self.assertEqual(mock_parser.add_argument.call_count, 2) mock_parser.assert_has_calls([ call.add_argument('passage_source', metavar='PASSAGE_SOURCE', help='The path to the file with the passage'), call.add_argument('csv_input', metavar='CSV_PATH', help='The path to the input CSV file'), ]) @patch.object(PlagiarismFeedbackView, '_check_is_plagiarism') @patch.object(Command, '_retrieve_passage') @patch.object(csv, 'reader') @patch.object(csv, 'writer') @patch(f'{pre_filter_responses.__name__}.open') def test_extract_create_feedback_kwargs(self, mock_open, mock_writer, mock_reader, mock_retrieve, mock_check_plagiarism): mock_csv_input = 'MOCK_CSV_INPUT' kwargs = { 'passage_source': 'MOCK_PASSAGE_SOURCE', 'csv_input': mock_csv_input, } file_name = 'FAKE FILE NAME' mock_handler = mock_open.return_value mock_file_content = StringIO('HEADER\nVALUE') mock_handler.__enter__.return_value = mock_file_content mock_reader_row = 'MOCK_ROW' mock_reader.next.return_value = mock_reader_row mock_check_plagiarism.return_value = False self.command.handle(**kwargs) mock_open.assert_has_calls([ call(mock_csv_input, 'r'), call().__enter__(), call(f'filtered_{mock_csv_input}', 'w'), call().__enter__(), call().__exit__(None, None, None), call().__exit__(None, None, None), ]) mock_retrieve.assert_called_with(kwargs['passage_source']) mock_writer.assert_called()
Python
0
06ced5abe2226a234c2e2887fbf84f18dfa7ddc4
Update timer for new label. Clean up a bit and use more pyglet 1.1 features.
examples/timer.py
examples/timer.py
'''A full-screen minute:second timer. Leave it in charge of your conference lighting talks. After 5 minutes, the timer goes red. This limit is easily adjustable by hacking the source code. Press spacebar to start, stop and reset the timer. ''' import pyglet window = pyglet.window.Window(fullscreen=True) class Timer(object): def __init__(self): self.label = pyglet.text.Label('00:00', font_size=360, x=window.width//2, y=window.height//2, valign='center', halign='center') self.reset() def reset(self): self.time = 0 self.running = False self.label.text = '00:00' self.label.color = (255, 255, 255, 255) def update(self, dt): if self.running: self.time += dt m, s = divmod(self.time, 60) self.label.text = '%02d:%02d' % (m, s) if m >= 5: self.label.color = (180, 0, 0, 255) @window.event def on_key_press(symbol, modifiers): if symbol == pyglet.window.key.SPACE: if timer.running: timer.running = False else: if timer.time > 0: timer.reset() else: timer.running = True elif symbol == pyglet.window.key.ESCAPE: window.close() @window.event def on_draw(): window.clear() timer.label.draw() timer = Timer() pyglet.clock.schedule_interval(timer.update, 1) pyglet.app.run()
from pyglet import window from pyglet import text from pyglet import clock from pyglet import font w = window.Window(fullscreen=True) class Timer(text.Label): def stop(self): self.__time = 0 def reset(self): self.__time = 0 self.__running = False self.text = '00:00' def animate(self, dt): if self.__running: self.__time += dt m, s = divmod(self.__time, 60) self.text = '%02d:%02d'%(m, s) def on_text(self, text): if text == ' ': self.__running = not self.__running return True return False ft = font.load('', 360) timer = Timer('00:00', ft, x=w.width//2, y=w.height//2, valign='center', halign='center') timer.reset() clock.schedule(timer.animate) w.push_handlers(timer) while not w.has_exit: w.dispatch_events() clock.tick() w.clear() timer.draw() w.flip()
Python
0
064c1a5bd8790c9ea407f62de0428657354e979f
Create jcolor.py
jcolor.py
jcolor.py
# colors HEADER = '\033[95m' FAIL = '\033[91m' FGBLUE2 = '\033[94m' FGGREEN2 = '\033[92m' FGORANGE = '\033[93m' FGGRAY = '\033[30m' FGRED = '\033[31m' FGGREEN = '\033[32m' FGYELLOW = '\033[33m' FGBLUE = '\033[34m' FGMAG = '\033[35m' FGCYAN = '\033[36m' FGWHITE = '\033[37m' # FGGRAY = '\033[61m' BGBLACK = '\033[40m' BGRED = '\033[41m' BGGREEN = '\033[42m' BGYELLOW = '\033[43m' BGBLUE = '\033[44m' BGMAG = '\033[45m' BGCYAN = '\033[46m' BGWHITE = '\033[47m' # end color(s) ENDC = '\033[0m' # format settings BOLDON = '\033[1m' BOLDOFF = '\033[22m' ITALON = '\033[3m' ITALOFF = '\033[23m' UNDLNON = '\033[4m' UNDLNOFF = '\033[24m' INVON = '\033[7m' INVOFF = '\033[27m' STRKTHRUON = '\033[9m' STRKTHRUOFF = '\033[29m'
Python
0.000001
040911e2343ec6753c767eff44be2cf54eb33ff8
add file name to fasta sequence headers
add_file_name_to_reads.py
add_file_name_to_reads.py
import os import sys from Bio import SeqIO out = open(sys.argv[2], 'w') for records in SeqIO.parse(open(sys.argv[1], 'rU'), "fasta"): records.id = records.id.strip() + '%s' % sys.argv[1].split('.')[0] records.name = records.id records.description = records.id SeqIO.write(records, out, 'fasta')
Python
0
c420f6bf996c53fa8958956626c136ac0e9e55f6
Add sonos updater plugin.
beetsplug/sonosupdate.py
beetsplug/sonosupdate.py
# -*- coding: utf-8 -*- # This file is part of beets. # Copyright 2018, Tobias Sauerwein. # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, # distribute, sublicense, and/or sell copies of the Software, and to # permit persons to whom the Software is furnished to do so, subject to # the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. """Updates a Sonos library whenever the beets library is changed. This is based on the Kodi Update plugin. Put something like the following in your config.yaml to configure: kodi: host: localhost port: 8080 user: user pwd: secret """ from __future__ import division, absolute_import, print_function from beets import config from beets.plugins import BeetsPlugin import six import soco class SonosUpdate(BeetsPlugin): def __init__(self): super(SonosUpdate, self).__init__() self.register_listener('database_change', self.listen_for_db_change) def listen_for_db_change(self, lib, model): """Listens for beets db change and register the update""" self.register_listener('cli_exit', self.update) def update(self, lib): """When the client exists try to send refresh request to a Sonos controler. """ self._log.info(u'Requesting a Sonos library update...') # Try to send update request. try: device = soco.discovery.any_soco() device.music_library.start_library_update() except: self._log.warning(u'Sonos update failed') return self._log.info(u'Sonos update triggered')
Python
0
797114781ed4f31c265c58a76e39aa8ff6a16443
Add missing file from last commit
tensorpack/utils/compatible_serialize.py
tensorpack/utils/compatible_serialize.py
#!/usr/bin/env python import os from .serialize import loads_msgpack, loads_pyarrow, dumps_msgpack, dumps_pyarrow """ Serialization that has compatibility guarantee (therefore is safe to store to disk). """ __all__ = ['loads', 'dumps'] # pyarrow has no compatibility guarantee # use msgpack for persistent serialization, unless explicitly set from envvar if os.environ.get('TENSORPACK_COMPATIBLE_SERIALIZE', 'msgpack') == 'msgpack': loads = loads_msgpack dumps = dumps_msgpack else: loads = loads_pyarrow dumps = dumps_pyarrow
Python
0.000001
2f155e1dafd5302dfbf4607af81bfa979046be8e
add test file
junk/t.py
junk/t.py
def f(): print "hi" f()
Python
0.000001
cfb39d7389d63a293dc075d420f80276a34df193
Add minimal pygstc example to play a video
examples/pygstc/simple_pipeline.py
examples/pygstc/simple_pipeline.py
import time import sys from pygstc.gstc import * from pygstc.logger import * #Create a custom logger with loglevel=DEBUG gstd_logger = CustomLogger('simple_pipeline', loglevel='DEBUG') #Create the client with the logger gstd_client = GstdClient(logger=gstd_logger) def printError(): print("To play run: python3 simple_pipeline.py play VIDEO_PATH") print("To stop run: python3 simple_pipeline.py stop") print("To stop run: python3 simple_pipeline.py reverse") print("To stop run: python3 simple_pipeline.py slow_motion") if(len(sys.argv) > 1): if(sys.argv[1]=="play"): FILE_SOURCE = sys.argv[2] #pipeline is the string with the pipeline description pipeline = "playbin uri=file:"+FILE_SOURCE #Following instructions create and play the pipeline gstd_client.pipeline_create ("p0", pipeline) gstd_client.pipeline_play ("p0") print("Playing") # Check this # reverse and slow motion restart the pipeline elif(sys.argv[1]== "reverse"): gstd_client.event_seek("p0", rate=-1.0, format=3, flags=1, start_type=1, start=0, end_type=1, end=-1) print("Playing in reverse") elif(sys.argv[1]== "slow_motion"): gstd_client.event_seek("p0", rate=0.5, format=3, flags=1, start_type=1, start=0, end_type=1, end=-1) print("Playing in slow motion") elif(sys.argv[1]== "stop"): #Following instructions stop and delete the pipeline gstd_client.pipeline_stop ("p0") gstd_client.pipeline_delete ("p0") print("Pipeline deleted") else: printError() else: printError()
Python
0
f8d06f85e896c1098f58667c161d920f6d255d7b
Add utility for sent mail
sendmail/log_mail.py
sendmail/log_mail.py
# -*- coding: utf-8 -*- ############################################################################### # # Copyright (C) 2001-2014 Micronaet SRL (<http://www.micronaet.it>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published # by the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################### import os import sys from smtplib import SMTP from datetime import datetime # Parameter: smtp_host = 'smtp.qboxmail.com' smtp_port = 465 smtp_user = 'account@example.it'' smtp_password = 'password' from_address = 'from@example.it' to_address = 'dest@example.it' subject = 'Subject' body = 'body' # Send mail: smtp = SMTP() smtp.set_debuglevel(0) smtp.connect(smtp_host, smtp_port) smtp.login(smtp_user, smtp_password) date = datetime.now().strftime('%Y-%m-%s %H:%M') smtp.sendmail( from_addr, to_addr, 'From: %s\nTo: %s\nSubject: %s\nDate: %s\n\n%s' % ( from_addr, to_addr, subject, date, body, ), ) smtp.quit() # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
Python
0
ddac657da2743c7435e8408677406d37eaea5836
Add migration.
instance/migrations/0041_auto_20160420_1409.py
instance/migrations/0041_auto_20160420_1409.py
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('instance', '0040_auto_20160420_0754'), ] operations = [ migrations.AlterField( model_name='openstackserver', name='status', field=models.CharField(choices=[('pending', 'Pending'), ('building', 'Building'), ('booting', 'Booting'), ('ready', 'Ready'), ('terminated', 'Terminated'), ('unknown', 'Unknown'), ('failed', 'BuildFailed')], max_length=20, db_index=True, default='pending'), ), migrations.RunSQL( [ "UPDATE instance_openstackserver SET status = 'pending' WHERE status = 'new'", "UPDATE instance_openstackserver SET status = 'building' WHERE status = 'started'", "UPDATE instance_openstackserver SET status = 'booting' WHERE status = 'active' OR status = 'rebooting'", "UPDATE instance_openstackserver SET status = 'ready' WHERE status = 'booted' OR status = 'provisioning'", ], ) ]
Python
0
4c6964a6043c6c5bb3df7ad184e2c6a5537ca6da
Create __init__.py
intelmq/tests/bots/experts/fqdn2ip/__init__.py
intelmq/tests/bots/experts/fqdn2ip/__init__.py
Python
0.000429
ce5ca3ac3268af331150f66865072a049869b3b2
add abstraction magics
abstraction.py
abstraction.py
""" abstraction magics let's you turn a cell into a function In [1]: plot(x, f(y)) ...: xlabel('x') ...: ylabel('y') In [2]: %functionize 1 """ from IPython.utils.text import indent def parse_ranges(s): blocks = s.split(',') ranges = [] for block in blocks: if '-' in block: start, stop = [ int(b) for b in block.split('-') ] stop = stop + 1 # be inclusive? else: start = int(block) stop = start + 1 ranges.append((start, stop)) return ranges def functionize(line): shell = get_ipython() splits = line.split(' ', 1) range_str = splits[0] args = splits[1] if len(splits) > 1 else '' ranges = parse_ranges(range_str) get_range = shell.history_manager.get_range blocks = ["def cell_function(%s):" % args] for start, stop in ranges: cursor = get_range(0, start, stop) for session_id, cell_id, code in cursor: blocks.append(indent(code)) code = '\n'.join(blocks) shell.set_next_input(code) def load_ipython_extension(ip): ip.magics_manager.register_function(functionize)
Python
0.000088
9af5c4e79234a47ac26e5d1890e70f741363b18a
Create factorise_test.py
factorise_test.py
factorise_test.py
Python
0.000001
425a8e26d371038f6ebf7c80dd7faea0f1dd906e
Add base test for admin endpoints [WAL-883]
nodeconductor/core/tests/unittests/test_admin.py
nodeconductor/core/tests/unittests/test_admin.py
from django.contrib import admin from django.contrib.auth import get_user_model from django.test import TestCase from django.urls import reverse User = get_user_model() class TestAdminEndpoints(TestCase): def setUp(self): user, _ = User.objects.get_or_create(username='username', is_staff=True) self.client.force_login(user) self.admin_site_name = admin.site.name def _reverse_url(self, path): return reverse('%s:%s' % (self.admin_site_name, path)) def test_app_list_ulrs_can_be_queried(self): app_list_urls = dict() for model in admin.site._registry: app_list_url = reverse('%s:%s' % (self.admin_site_name, 'app_list'), args=(model._meta.app_label,)) app_list_urls.update({model._meta.app_label: app_list_url}) for url in app_list_urls.values(): response = self.client.get(url) self.assertEqual(response.status_code, 200) def test_base_admin_site_urls_can_be_queried(self): pages = ['index', 'login', 'logout', 'password_change', 'password_change_done', 'jsi18n'] for name in pages: url = self._reverse_url(name) response = self.client.get(url) self.assertIn(response.status_code, [200, 302]) def test_changelist_urls_can_be_queried(self): for model in admin.site._registry: url = self._reverse_url('%s_%s_changelist' % (model._meta.app_label, model._meta.model_name)) response = self.client.get(url) self.assertEqual(response.status_code, 200) def test_add_urls_can_be_queried(self): for model in admin.site._registry: model_fullname = '%s_%s' % (model._meta.app_label, model._meta.model_name) url = self._reverse_url('%s_add' % model_fullname) response = self.client.get(url) self.assertIn(response.status_code, [200, 403])
Python
0
90a30ae1b3165c03f6de5458c92f8ecb9d3f948a
Add homework min_three
domaci-zadaci/05/test_min_three.py
domaci-zadaci/05/test_min_three.py
from solutions import min_three import unittest import random class TestMinThree(unittest.TestCase): def test_1000_cases(self): for _ in range(1000): first = (random.random() - 0.5) * 2000 second = (random.random() - 0.5) * 2000 third = (random.random() - 0.5) * 2000 expected = min(first, second, third) actual = min_three(first, second, third) self.assertEqual(expected, actual) actual = min_three(first, third, second) self.assertEqual(expected, actual) actual = min_three(second, first, third) self.assertEqual(expected, actual) actual = min_three(second, third, first) self.assertEqual(expected, actual) actual = min_three(third, first, second) self.assertEqual(expected, actual) actual = min_three(third, second, first) self.assertEqual(expected, actual) if __name__ == '__main__': unittest.main()
Python
0.00046
aad51679cc2e4e719ed12e3983b54dcf15a2c06f
Update slack.py
graphite_beacon/handlers/slack.py
graphite_beacon/handlers/slack.py
import json from tornado import gen, httpclient as hc from graphite_beacon.handlers import AbstractHandler, LOGGER from graphite_beacon.template import TEMPLATES class SlackHandler(AbstractHandler): name = 'slack' # Default options defaults = { 'webhook': None, 'channel': None, 'username': 'graphite-beacon', } emoji = { 'critical': ':exclamation:', 'warning': ':warning:', 'normal': ':white_check_mark:', } def init_handler(self): self.webhook = self.options.get('webhook') assert self.webhook, 'Slack webhook is not defined.' self.channel = self.options.get('channel') if self.channel and not self.channel.startswith(('#', '@')): self.channel = '#' + self.channel self.username = self.options.get('username') self.client = hc.AsyncHTTPClient() def get_message(self, level, alert, value, target=None, ntype=None, rule=None): msg_type = 'slack' if ntype == 'graphite' else 'short' tmpl = TEMPLATES[ntype][msg_type] return tmpl.generate( level=level, reactor=self.reactor, alert=alert, value=value, target=target).strip() @gen.coroutine def notify(self, level, *args, **kwargs): LOGGER.debug("Handler (%s) %s", self.name, level) message = self.get_message(level, *args, **kwargs) data = dict() data['username'] = self.username data['text'] = message data['icon_emoji'] = self.emoji.get(level, ':warning:') if self.channel: data['channel'] = self.channel body = json.dumps(data) yield self.client.fetch(self.webhook, method='POST', body=body)
import json from tornado import gen, httpclient as hc from graphite_beacon.handlers import AbstractHandler, LOGGER from graphite_beacon.template import TEMPLATES class SlackHandler(AbstractHandler): name = 'slack' # Default options defaults = { 'webhook': None, 'channel': None, 'username': 'graphite-beacon', } emoji = { 'critical': ':exclamation:', 'warning': ':warning:', 'normal': ':white_check_mark:', } def init_handler(self): self.webhook = self.options.get('webhook') assert self.webhook, 'Slack webhook is not defined.' self.channel = self.options.get('channel') if self.channel and not self.channel.startswith('#'): self.channel = '#' + self.channel self.username = self.options.get('username') self.client = hc.AsyncHTTPClient() def get_message(self, level, alert, value, target=None, ntype=None, rule=None): msg_type = 'slack' if ntype == 'graphite' else 'short' tmpl = TEMPLATES[ntype][msg_type] return tmpl.generate( level=level, reactor=self.reactor, alert=alert, value=value, target=target).strip() @gen.coroutine def notify(self, level, *args, **kwargs): LOGGER.debug("Handler (%s) %s", self.name, level) message = self.get_message(level, *args, **kwargs) data = dict() data['username'] = self.username data['text'] = message data['icon_emoji'] = self.emoji.get(level, ':warning:') if self.channel: data['channel'] = self.channel body = json.dumps(data) yield self.client.fetch(self.webhook, method='POST', body=body)
Python
0
34908071bd11470806a84d9f76c630fd3fcc2d4b
test file :-)
tests/gsim/abrahamson_silva_2008_test.py
tests/gsim/abrahamson_silva_2008_test.py
# nhlib: A New Hazard Library # Copyright (C) 2012 GEM Foundation # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. from nhlib.gsim.abrahamson_silva_2008 import AbrahamsonSilva2008 from tests.gsim.utils import BaseGSIMTestCase # Test data have been generated from Fortran implementation # of Dave Boore available at: # http://www.daveboore.com/software_online.html # Note that the Fortran implementation has been modified not # to compute the 'Constant Displacement Model' term class AbrahamsonSilva2008TestCase(BaseGSIMTestCase): GSIM_CLASS = AbrahamsonSilva2008 def test_mean(self): self.check('AS08/AS08_MEAN.csv', max_discrep_percentage=0.1) def test_std_inter(self): self.check('AS08/AS08_STD_INTER.csv', max_discrep_percentage=0.1) def test_std_intra(self): self.check('AS08/AS08_STD_INTRA.csv', max_discrep_percentage=0.1) def test_std_total(self): self.check('AS08/AS08_STD_TOTAL.csv', max_discrep_percentage=0.1)
Python
0
9fc373bbfa606aeb23c237df9c8d9143e14b60a1
structure of preprocessing module for lea to fill in
code/python/seizures/preprocessing/preprocessing.py
code/python/seizures/preprocessing/preprocessing.py
import scipy.signal def preprocess_multichannel_data(matrix): n_channel,m= matrix.shape for i in range(n_channel): preprocess_single_channel(matrix[i,:]) def preprocess_single_channel(x): x = remove_elec_noise(x) x = hp_filter(x) x = remove_dc(x) return x def remove_dc(): """ Remove mean of signal :return: """ pass def remove_elec_noise(): """ Bandpass remove:49-51Hz :return: """ pass def hp_filter(): """ Anti_aliasing :return: """ pass
Python
0
3e7429a36532e7c731d5d254b853dd72bdd94c82
Create test.py
home/crap0101/test/500fup/test.py
home/crap0101/test/500fup/test.py
import operator import re import sys import time import urlparse import fhp.api.five_hundred_px as _fh import fhp.helpers.authentication as _a from fhp.models.user import User _TREG = re.compile('^(\d+)-(\d+)-(\d+).*?(\d+):(\d+):(\d+).*') _URL = 'http://500px.com/' _HTML_BEGIN = '''<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <HTML> <HEAD> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> <TITLE>following last updates</TITLE> </HEAD> <BODY> ''' _HTML_END = '''</BODY> </HTML>''' FMT_TEXT = 'txt' FMT_HTML = 'html' def get_time (s): return time.strptime(' '.join(_TREG.match(s).groups()), '%Y %m %d %H %M %S') def get_last_upload_photo (user): return sorted(user.photos, reverse=True, key=lambda p: get_time(p.created_at))[0] def get_sorted_data (user): return sorted([(u, u.photos[0].created_at) for u in user.friends], reverse=True, key=operator.itemgetter(1)) def _get_sorted_data (user): # like get_sorted_data but slower :-D return sorted([(u, get_last_upload_photo(u).created_at) for u in user.friends], reverse=True, key=operator.itemgetter(1)) def format_info_html (data): yield _HTML_BEGIN for user, date in data: yield '<a href="%s">%s</a> (%s)<p>' % ( urlparse.urljoin(_URL, user.username), user.fullname.strip(), date) #time.strftime('%Y-%m-%d %H:%M:%S', get_time(date))) # last for debug only yield _HTML_END def format_info_txt (data): for user, date in data: yield '%s (%s, %s)' % ( urlparse.urljoin(_URL, user.username), user.fullname.strip(), date) #time.strftime('%Y-%m-%d %H:%M:%S', get_time(date))) # last for debug only def print_info(data, fmt=FMT_HTML): if fmt == FMT_HTML: func = format_info_html elif fmt == FMT_TEXT: func = format_info_txt else: raise ValueError("unknown format <%s>" % fmt) for out in func(data): print out if __name__ == '__main__': _f = _fh.FiveHundredPx(_a.get_consumer_key(), _a.get_consumer_secret(), _a.get_verify_url()) username = sys.argv[1].encode('utf-8') me = User(username=username) sorted_uploads = get_sorted_data(me) print_info(sorted_uploads) ############################################## sys.exit() if 0: __t = [] #class for i in range(10): __t.append(time.localtime()) sleep(1) me.friends = 8 """ print type(me), dir(me), me.id print "------" print type(f), dir(f) for i in me.friends: print i.fullname, i.username, i.id, i.domain, dir(i) break if 0: for p in sorted((x.created_at for x in i.photos), reverse=True, key=lambda s:get_time(s)): print p break break for p in i.photos: print p, p.created_at, p.id break print list(f.get_user_friends(username)) print type(me), len(me) print dir(f) """
Python
0
42c82bc865d69b904ec688aa152caf3a247df1c6
Create frontdoor.py
home/pi/PirFrontDoor/frontdoor.py
home/pi/PirFrontDoor/frontdoor.py
#!/usr/bin/python import RPi.GPIO as GPIO import time import requests GPIO.setmode(GPIO.BCM) PIR_PIN = 22 GPIO.setup(PIR_PIN, GPIO.IN) def MOTION(PIR_PIN): print "Motion Detected!" payload = { 'value1' : 'Someone at Front Door'} r = requests.post("https://maker.ifttt.com/trigger/{Event}/with/key/{secret key}", data=payload) print r.text print "PIR Module Test (CTRL+C to exit)" time.sleep(2) print "Ready" try: GPIO.add_event_detect(PIR_PIN, GPIO.RISING, callback=MOTION) while 1: time.sleep(120) except KeyboardInterrupt: print "Quit" GPIO.cleanup()
Python
0.000024
1d7451fd6eca8a68832b676ef0a696e8de801533
Update services_and_index_sync.py
tendrl/node_agent/node_sync/services_and_index_sync.py
tendrl/node_agent/node_sync/services_and_index_sync.py
import json import etcd from tendrl.commons.event import Event from tendrl.commons.message import ExceptionMessage from tendrl.commons.message import Message from tendrl.commons.utils import etcd_utils # TODO(darshan) this has to be moved to Definition file TENDRL_SERVICES = [ "tendrl-node-agent", "etcd", "tendrl-api", "tendrl-gluster-integration", "tendrl-ceph-integration", "glusterd", "ceph-mon@*", "ceph-osd@*", "ceph-installer" ] def sync(sync_ttl=None): try: tags = [] # update node agent service details Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, Updating Service data"} ) ) for service in TENDRL_SERVICES: s = NS.tendrl.objects.Service(service=service) if s.running: service_tag = NS.compiled_definitions.get_parsed_defs()[ 'namespace.tendrl' ]['tags'][service.strip("@*")] tags.append(service_tag) if service_tag == "tendrl/server": tags.append("tendrl/monitor") s.save() # Try to claim orphan "provisioner_%integration_id" tag _cluster = NS.tendrl.objects.Cluster(integration_id=NS.tendrl_context.integration_id).load() try: if _cluster.is_managed == "yes": _tag = "provisioner/%s" % _cluster.integration_id _index_key = "/indexes/tags/%s" % _tag etcd_utils.read(_index_key) except etcd.EtcdKeyNotFound: tags.append(_tag) # updating node context with latest tags Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, updating node context " "data with tags" } ) ) NS.node_context = NS.tendrl.objects.NodeContext().load() current_tags = list(NS.node_context.tags) tags += current_tags NS.node_context.tags = list(set(tags)) NS.node_context.tags.sort() current_tags.sort() if NS.node_context.tags != current_tags: NS.node_context.save() # Update /indexes/tags/:tag = [node_ids] for tag in NS.node_context.tags: index_key = "/indexes/tags/%s" % tag _node_ids = [] try: _node_ids = NS._int.client.read(index_key).value _node_ids = json.loads(_node_ids) except etcd.EtcdKeyNotFound: pass if _node_ids: if NS.node_context.node_id in _node_ids: continue else: _node_ids += [NS.node_context.node_id] else: _node_ids = [NS.node_context.node_id] _node_ids = list(set(_node_ids)) etcd_utils.write(index_key, json.dumps(_node_ids)) if sync_ttl: etcd_utils.refresh(index_key, sync_ttl) Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, Updating detected " "platform" } ) ) except Exception as ex: Event( ExceptionMessage( priority="error", publisher=NS.publisher_id, payload={"message": "node_sync service and indexes " "sync failed: " + ex.message, "exception": ex} ) )
import json import etcd from tendrl.commons.event import Event from tendrl.commons.message import ExceptionMessage from tendrl.commons.message import Message from tendrl.commons.utils import etcd_utils # TODO(darshan) this has to be moved to Definition file TENDRL_SERVICES = [ "tendrl-node-agent", "etcd", "tendrl-api", "tendrl-gluster-integration", "tendrl-ceph-integration", "glusterd", "ceph-mon@*", "ceph-osd@*", "ceph-installer" ] def sync(sync_ttl=None): try: tags = [] # update node agent service details Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, Updating Service data"} ) ) for service in TENDRL_SERVICES: s = NS.tendrl.objects.Service(service=service) if s.running: service_tag = NS.compiled_definitions.get_parsed_defs()[ 'namespace.tendrl' ]['tags'][service.strip("@*")] tags.append(service_tag) if service_tag == "tendrl/server": tags.append("tendrl/monitor") s.save() # updating node context with latest tags Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, updating node context " "data with tags" } ) ) NS.node_context = NS.tendrl.objects.NodeContext().load() current_tags = list(NS.node_context.tags) tags += current_tags NS.node_context.tags = list(set(tags)) NS.node_context.tags.sort() current_tags.sort() if NS.node_context.tags != current_tags: NS.node_context.save() # Update /indexes/tags/:tag = [node_ids] for tag in NS.node_context.tags: index_key = "/indexes/tags/%s" % tag _node_ids = [] try: _node_ids = NS._int.client.read(index_key).value _node_ids = json.loads(_node_ids) except etcd.EtcdKeyNotFound: pass if _node_ids: if NS.node_context.node_id in _node_ids: continue else: _node_ids += [NS.node_context.node_id] else: _node_ids = [NS.node_context.node_id] _node_ids = list(set(_node_ids)) etcd_utils.write(index_key, json.dumps(_node_ids)) if sync_ttl: etcd_utils.refresh(index_key, sync_ttl) Event( Message( priority="debug", publisher=NS.publisher_id, payload={"message": "node_sync, Updating detected " "platform" } ) ) except Exception as ex: Event( ExceptionMessage( priority="error", publisher=NS.publisher_id, payload={"message": "node_sync service and indexes " "sync failed: " + ex.message, "exception": ex} ) )
Python
0.000001
bcb89187a398000d80c7c0b0ac5152e76edd2666
Remove TRT 4.0 restrictions on int32 test.
tensorflow/python/compiler/tensorrt/test/int32_test.py
tensorflow/python/compiler/tensorrt/test/int32_test.py
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Test conversion of graphs involving INT32 tensors and operations.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.python.compiler.tensorrt.test import tf_trt_integration_test_base as trt_test from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorflow.python.ops import array_ops from tensorflow.python.ops import math_ops from tensorflow.python.ops import nn from tensorflow.python.platform import test class ExcludeUnsupportedInt32Test(trt_test.TfTrtIntegrationTestBase): def _ConstOp(self, shape, dtype): return constant_op.constant(np.random.randn(*shape), dtype=dtype) def GetParams(self): """Test exclusion of ops which are not supported in INT32 mode by TF-TRT""" input_name = 'input' output_name = 'output' input_dims = [100, 4] dtype = dtypes.int32 g = ops.Graph() with g.as_default(): x = array_ops.placeholder(dtype=dtype, shape=input_dims, name=input_name) b = self._ConstOp((4, 10), dtype) x = math_ops.matmul(x, b) b = self._ConstOp((10,), dtype) x = nn.bias_add(x, b) x = array_ops.identity(x, name=output_name) return trt_test.TfTrtIntegrationTestParams( gdef=g.as_graph_def(), input_names=[input_name], input_dims=[[input_dims]], output_names=[output_name], expected_output_dims=[[[100, 10]]]) def GetConversionParams(self, run_params): """Return a ConversionParams for test.""" conversion_params = super(ExcludeUnsupportedInt32Test, self).GetConversionParams(run_params) return conversion_params._replace( max_batch_size=100, maximum_cached_engines=1, # Disable layout optimizer, since it will convert BiasAdd with NHWC # format to NCHW format under four dimentional input. rewriter_config_template=trt_test.OptimizerDisabledRewriterConfig()) def ExpectedEnginesToBuild(self, run_params): """Return the expected engines to build.""" return [] if __name__ == '__main__': test.main()
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Test conversion of graphs involving INT32 tensors and operations.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.python.compiler.tensorrt.test import tf_trt_integration_test_base as trt_test from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorflow.python.ops import array_ops from tensorflow.python.ops import math_ops from tensorflow.python.ops import nn from tensorflow.python.platform import test class ExcludeUnsupportedInt32Test(trt_test.TfTrtIntegrationTestBase): def _ConstOp(self, shape, dtype): return constant_op.constant(np.random.randn(*shape), dtype=dtype) def GetParams(self): """Test exclusion of ops which are not supported in INT32 mode by TF-TRT""" input_name = 'input' output_name = 'output' input_dims = [100, 4] dtype = dtypes.int32 g = ops.Graph() with g.as_default(): x = array_ops.placeholder(dtype=dtype, shape=input_dims, name=input_name) b = self._ConstOp((4, 10), dtype) x = math_ops.matmul(x, b) b = self._ConstOp((10,), dtype) x = nn.bias_add(x, b) x = array_ops.identity(x, name=output_name) return trt_test.TfTrtIntegrationTestParams( gdef=g.as_graph_def(), input_names=[input_name], input_dims=[[input_dims]], output_names=[output_name], expected_output_dims=[[[100, 10]]]) def GetConversionParams(self, run_params): """Return a ConversionParams for test.""" conversion_params = super(ExcludeUnsupportedInt32Test, self).GetConversionParams(run_params) return conversion_params._replace( max_batch_size=100, maximum_cached_engines=1, # Disable layout optimizer, since it will convert BiasAdd with NHWC # format to NCHW format under four dimentional input. rewriter_config_template=trt_test.OptimizerDisabledRewriterConfig()) def ExpectedEnginesToBuild(self, run_params): """Return the expected engines to build.""" return [] def ShouldRunTest(self, run_params): """Whether to run the test.""" # TODO(aaroey): Trt 4.0 forbids conversion for tensors with rank <3 in int8 # mode, which is a bug. Re-enable this when trt library is fixed. return not trt_test.IsQuantizationMode(run_params.precision_mode) if __name__ == '__main__': test.main()
Python
0
f94f1f698c8e9473b7c96ec7b1244e84fc4ebe5d
update unittest for MonoMixer
test/src/unittest/standard/test_monomixer_streaming.py
test/src/unittest/standard/test_monomixer_streaming.py
#!/usr/bin/env python # Copyright (C) 2006-2013 Music Technology Group - Universitat Pompeu Fabra # # This file is part of Essentia # # Essentia is free software: you can redistribute it and/or modify it under # the terms of the GNU Affero General Public License as published by the Free # Software Foundation (FSF), either version 3 of the License, or (at your # option) any later version. # # This program is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. See the GNU General Public License for more # details. # # You should have received a copy of the Affero GNU General Public License # version 3 along with this program. If not, see http://www.gnu.org/licenses/ from essentia_test import * from essentia.streaming import MonoMixer, AudioLoader class TestMonoMixer_Streaming(TestCase): left = [] right = [] def clickTrack(self): size = 100 offset = 10 self.left = [0]*size self.right = [0]*size for i in range(offset/2, size, offset): self.left[i] = 1.0 for i in range(offset, size, offset): self.right[i] = 1 output = [] for i in range(size): output.append((self.left[i], self.right[i])) return array(output) def testLeft(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='left') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqualVector(pool['mix'], self.left) def testRight(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='right') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqualVector(pool['mix'], self.right) def testMix(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='mix') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqual(sum(pool['mix']), 19*0.5) def testSingle(self): gen = VectorInput(array([(0.9, 0.5)])) chGen = VectorInput([2]) mixer = MonoMixer(type='mix') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertAlmostEqual(sum(pool['mix']), (0.9+0.5)*0.5) def testEmpty(self): inputFilename = join(testdata.audio_dir, 'generated', 'empty', 'empty.ogg') # NOTE: AudioLoader will through exception on "empty.wav" complaining that # it cannot read stream info, using "empty.ogg" therefore... loader = AudioLoader(filename=inputFilename) mixer = MonoMixer(type='left') pool = Pool() loader.audio >> mixer.audio mixer.audio >> (pool, "mix") loader.numberChannels >> mixer.numberChannels loader.sampleRate >> None loader.md5 >> None run(loader) self.assertEqualVector(pool.descriptorNames(), []) def testInvalidParam(self): self.assertConfigureFails(MonoMixer(), {'type':'unknown'}) suite = allTests(TestMonoMixer_Streaming) if __name__ == '__main__': TextTestRunner(verbosity=2).run(suite)
#!/usr/bin/env python # Copyright (C) 2006-2013 Music Technology Group - Universitat Pompeu Fabra # # This file is part of Essentia # # Essentia is free software: you can redistribute it and/or modify it under # the terms of the GNU Affero General Public License as published by the Free # Software Foundation (FSF), either version 3 of the License, or (at your # option) any later version. # # This program is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. See the GNU General Public License for more # details. # # You should have received a copy of the Affero GNU General Public License # version 3 along with this program. If not, see http://www.gnu.org/licenses/ from essentia_test import * from essentia.streaming import MonoMixer, AudioLoader class TestMonoMixer_Streaming(TestCase): left = [] right = [] def clickTrack(self): size = 100 offset = 10 self.left = [0]*size self.right = [0]*size for i in range(offset/2, size, offset): self.left[i] = 1.0 for i in range(offset, size, offset): self.right[i] = 1 output = [] for i in range(size): output.append((self.left[i], self.right[i])) return array(output) def testLeft(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='left') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqualVector(pool['mix'], self.left) def testRight(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='right') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqualVector(pool['mix'], self.right) def testMix(self): gen = VectorInput(self.clickTrack()) chGen = VectorInput([2]) mixer = MonoMixer(type='mix') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertEqual(sum(pool['mix']), 19*0.5) def testSingle(self): gen = VectorInput(array([(0.9, 0.5)])) chGen = VectorInput([2]) mixer = MonoMixer(type='mix') pool = Pool() gen.data >> mixer.audio mixer.audio >> (pool, "mix") chGen.data >> mixer.numberChannels chGen.push('data', 2) run(gen) self.assertAlmostEqual(sum(pool['mix']), (0.9+0.5)*0.5) def testEmpty(self): inputFilename = join(testdata.audio_dir, 'generated', 'empty', 'empty.wav') loader = AudioLoader(filename=inputFilename) mixer = MonoMixer(type='left') pool = Pool() loader.audio >> mixer.audio mixer.audio >> (pool, "mix") loader.numberChannels >> mixer.numberChannels loader.sampleRate >> None run(loader) self.assertEqualVector(pool.descriptorNames(), []) def testInvalidParam(self): self.assertConfigureFails(MonoMixer(), {'type':'unknown'}) suite = allTests(TestMonoMixer_Streaming) if __name__ == '__main__': TextTestRunner(verbosity=2).run(suite)
Python
0
1307070cfe27ca605bfcc279644b735ee941f627
Add work for ex21.py.
lpthw/ex31.py
lpthw/ex31.py
print "You enter a dark room with two doors. Do you go through door #1 or #2?" door = raw_input("> ") if door == "1": print "Ther's a giant bear here eating a cheese cake. What do you do?" print "1. Take the cake." print "2. Scream at the bear." bear = raw_input("> ") if bear == "1": print "The bear eats your face off. Good job!" elif bear == "2": print "The bear ears your legs off. Good job!" else: print "Well, doing %s is probably better. Bear runs away." % bear elif door == "2": print "You stare into the endless abyss at Cthulhu's retina." print "1. Blueberries." print "2. Yellow jacket clothespins." print "3. Understanding revolvers yelling melodies." insanity = raw_input("> ") if insanity == "1" or insanity == "2": print "Your body survives powered by a mind of jello. Good job!" else: print "The insanity rots your eyes into a pool of muck. Good job!" else: print "You stumble around and fall on a knife and die. Good job!"
Python
0
d3c6c91bc4b6214053b9a1d1d2291a402c164b86
add file
GridPixelPlot.py
GridPixelPlot.py
import kplr import numpy as np import matplotlib.pyplot as plt qua = 5 client = kplr.API() # Find the target KOI. koi = client.koi(282.02) originStar = koi.star # Find potential targets by Kepler magnitude koisOver = client.kois(where="koi_kepmag between %f and %f"%(originStar.kic_kepmag, originStar.kic_kepmag+0.1), sort=("koi_kepmag",1)) koisUnder = client.kois(where="koi_kepmag between %f and %f"%(originStar.kic_kepmag-0.1, originStar.kic_kepmag), sort=("koi_kepmag",1)) koisUnder.reverse() stars = [] stars.append(originStar.kepid) #Find 16 stars that are closest to the origin star in terms of Kepler magnitude i=0 j=0 while len(stars) <17: while koisOver[i].kepid in stars: i+=1 tmpOver = koisOver[i].star while koisUnder[j].kepid in stars: j+=1 tmpUnder =koisUnder[j].star if tmpOver.kic_kepmag-originStar.kic_kepmag > originStar.kic_kepmag-tmpUnder.kic_kepmag: stars.append(tmpUnder.kepid) j+=1 elif tmpOver.kic_kepmag-originStar.kic_kepmag < originStar.kic_kepmag-tmpUnder.kic_kepmag: stars.append(tmpOver.kepid) j+=1 else: stars.append(tmpUnder.kepid) stars.append(tmpOver.kepid) i+=1 j+=1 for tmp in stars: star = client.star(tmp) # Get a list of light curve datasets. tpfs = star.get_target_pixel_files(short_cadence=False) time, flux = [], [] for tpf in tpfs: with tpf.open() as f: hdu_data = f[1].data time.append(hdu_data["time"]) flux.append(hdu_data["flux"]) t = time[qua] data = flux[qua] data = np.nan_to_num(data) data = np.ma.masked_equal(data,0) shape = data.shape td = shape[0] x = shape[1] y = shape[2] # Plot the data f, axes = plt.subplots(x, y) for i in range(0,x): for j in range(0,y): axes[i,j].plot(t,data[0:td:1,i,j]) plt.setp( axes[i,j].get_xticklabels(), visible=False) plt.setp( axes[i,j].get_yticklabels(), visible=False) plt.subplots_adjust(left=None, bottom=None, right=None, top=None, wspace=0, hspace=0) plt.suptitle('Kepler %d Quarter %d\n Kepler magnitude %f'%(star.kepid, qua, star.kic_kepmag)) plt.savefig('%d-%d.png'%(star.kepid, qua)) plt.clf()
Python
0.000001
8515155d9d0df940eea758121124995320fce6bb
add experimental C/clang plugin
languages/c.py
languages/c.py
import os from lint.linter import Linter from lint.util import find class C(Linter): language = 'c' cmd = ('clang', '-xc', '-fsyntax-only', '-std=c99', '-Werror', '-pedantic') regex = ( r'^<stdin>:(?P<line>\d+):(?P<col>\d+):' r'(?:(?P<ranges>[{}0-9:\-]+):)?\s+' r'(?P<error>.+)' ) def communicate(self, cmd, code): includes = [] if self.filename: parent = os.path.dirname(self.filename) includes.append('-I' + parent) inc = find(parent, 'include') if inc: includes.append('-I' + inc) cmd += ('-',) + tuple(includes) return super(C, self).communicate(cmd, code)
Python
0
0026beea95ec26b8763feae270e79872f86de8a5
Add run_sample_tests for executing sample tests in Travis
stress_test/sample_test_confs/run_sample_tests.py
stress_test/sample_test_confs/run_sample_tests.py
#! /usr/bin/env python3.4 # Copyright (c) 2015 Intracom S.A. Telecom Solutions. All rights reserved. # # This program and the accompanying materials are made available under the # terms of the Eclipse Public License v1.0 which accompanies this distribution, # and is available at http://www.eclipse.org/legal/epl-v10.html """ Runner for sample tests """ import os def run_tests(): """ Method for running sample tests """ pass if __name__ == '__main__': run_tests()
Python
0
352b17d8139fb0d269e4c17c01fe8ee488961c3a
Create HR_miniMaxSum.py
HR_miniMaxSum.py
HR_miniMaxSum.py
#!/bin/python3 import math import os import random import re import sys # Complete the miniMaxSum function below. def miniMaxSum(arr): maxx = max(arr) minn = min(arr) mini = arr.copy() mini.remove(maxx) maxi = arr.copy() maxi.remove(minn) sum_min = sum(mini) sum_max = sum(maxi) print(sum_min, sum_max) if __name__ == '__main__': arr = list(map(int, input().rstrip().split())) miniMaxSum(arr)
Python
0.000003
b8fe92674773c7470c3b47899a8832bbb94771b4
Add path module
lib/oelite/path.py
lib/oelite/path.py
import os TOPDIR = os.getcwd() def init(topdir): global TOPDIR TOPDIR = topdir def relpath(path): """Return a relative version of paths compared to TOPDIR.""" global TOPDIR if path.startswith(TOPDIR): return path[len(TOPDIR):].lstrip("/") return path def which(path, filename, pathsep=os.pathsep): """Given a search path, find file.""" if isinstance(path, basestring): path = path.split(pathsep) for p in path: f = os.path.join(p, filename) if os.path.exists(f): return os.path.abspath(f) return '' # TODO: change to None, and fixup the breakage it causes
Python
0
8ce2da2ed2e445480ee2e10483a5fae1c7c677a0
Include self contained method for output to a view
lib/output_view.py
lib/output_view.py
import sublime import sublime_plugin ###----------------------------------------------------------------------------- def output_to_view(window, title, content, reuse=True, syntax=None, clear=True, settings=None): if not isinstance(content, str): content = "\n".join (content) view = None if reuse: for _view in window.views (): if _view.name () == title: view = _view break if view is None: view = window.new_file () view.set_scratch (True) view.set_name (title) if syntax is not None: view.assign_syntax (syntax) else: view.set_read_only (False) if clear is True: view.sel ().clear () view.sel ().add (sublime.Region (0, view.size ())) view.run_command ("left_delete") if window.active_view () != view: window.focus_view (view) if settings is not None: for setting in settings: view.settings ().set (setting, settings[setting]) # Sace current buffer size, selection information and view position saved_size = view.size () saved_sel = list(view.sel ()) saved_position = view.viewport_position () # Single select, position cursor at end of file, insert the data view.sel ().clear () view.sel ().add (sublime.Region (saved_size, saved_size)) view.run_command ("insert", {"characters": content}) # If the last selection was at the end of the buffer, replace that selection # with the new end of the buffer so the relative position remains the same. if sublime.Region (saved_size, saved_size) == saved_sel[-1]: saved_sel[-1] = sublime.Region (view.size (), view.size ()) # Clear current selection and add original selection back view.sel ().clear () for region in saved_sel: view.sel ().add (region) view.set_viewport_position (saved_position, False) view.set_read_only (True) ###-----------------------------------------------------------------------------
Python
0
0d35b502515a9775166e775c3462ca9300fe4517
add examples
examples/helpers.py
examples/helpers.py
# -*- coding: utf-8 -*- # from dolfin import as_backend_type import matplotlib.pyplot as plt import scipy.linalg def show_matrix(A): A = as_backend_type(A) A_matrix = A.sparray() # colormap cmap = plt.cm.gray_r A_dense = A_matrix.todense() # A_r = A_dense[0::2][0::2] # A_i = A_dense[1::2][0::2] cmap.set_bad('r') # im = plt.imshow( # abs(A_dense), cmap=cmap, interpolation='nearest', norm=LogNorm() # ) plt.imshow(abs(A_dense), cmap=cmap, interpolation='nearest') plt.colorbar() plt.show() return def get_eigenvalues(A): A = as_backend_type(A) A_matrix = A.sparray() return scipy.linalg.eigvals(A_matrix.todense())
Python
0
e333bc7b23a69a39392899a1d1c8e0bdf3523c3f
remove unused import [ci skip]
corehq/apps/app_manager/management/commands/build_apps.py
corehq/apps/app_manager/management/commands/build_apps.py
import contextlib import json from django.core.management.base import BaseCommand from lxml import etree import os from corehq.apps.app_manager.models import Application, RemoteApp _parser = etree.XMLParser(remove_blank_text=True) def normalize_xml(xml): xml = etree.fromstring(xml, parser=_parser) return etree.tostring(xml, pretty_print=True) @contextlib.contextmanager def record_performance_stats(filepath, slug): from guppy import hpy import time hp = hpy() before = hp.heap() start = time.clock() try: yield finally: end = time.clock() after = hp.heap() leftover = after - before with open(filepath, 'a') as f: f.write('{},{},{}\n'.format(slug, leftover.size, end - start)) class Command(BaseCommand): args = '<path_to_dir> <build-slug>' help = """ Pass in a path to a directory (dir, below) with the following layout: dir/ src/ [app-slug].json [app-slug].json ... """ def handle(self, *args, **options): path, build_slug = args app_slugs = [] perfpath = os.path.join(path, '{}-performance.txt'.format(build_slug)) if os.path.exists(perfpath): os.remove(perfpath) for name in os.listdir(os.path.join(path, 'src')): _JSON = '.json' if name.endswith(_JSON): app_slugs.append(name[:-len(_JSON)]) for slug in app_slugs: print 'Fetching %s...' % slug source_path = os.path.join(path, 'src', '%s.json' % slug) with open(source_path) as f: j = json.load(f) if j['doc_type'] == 'Application': app = Application.wrap(j) elif j['doc_type'] == 'RemoteApp': app = RemoteApp.wrap(j) app.version = 1 build_path = os.path.join(path, build_slug, slug) print ' Creating files...' with record_performance_stats(perfpath, slug): files = app.create_all_files() self.write_files(files, build_path) def write_files(self, files, path): for filename, payload in files.items(): filepath = os.path.join(path, filename) dirpath, filename = os.path.split(filepath) try: os.makedirs(dirpath) except OSError: # file exists pass with open(filepath, 'w') as f: if filepath.endswith('.xml'): payload = normalize_xml(payload) f.write(payload)
import contextlib from functools import wraps import json from django.core.management.base import BaseCommand from lxml import etree import os from corehq.apps.app_manager.models import Application, RemoteApp _parser = etree.XMLParser(remove_blank_text=True) def normalize_xml(xml): xml = etree.fromstring(xml, parser=_parser) return etree.tostring(xml, pretty_print=True) @contextlib.contextmanager def record_performance_stats(filepath, slug): from guppy import hpy import time hp = hpy() before = hp.heap() start = time.clock() try: yield finally: end = time.clock() after = hp.heap() leftover = after - before with open(filepath, 'a') as f: f.write('{},{},{}\n'.format(slug, leftover.size, end - start)) class Command(BaseCommand): args = '<path_to_dir> <build-slug>' help = """ Pass in a path to a directory (dir, below) with the following layout: dir/ src/ [app-slug].json [app-slug].json ... """ def handle(self, *args, **options): path, build_slug = args app_slugs = [] perfpath = os.path.join(path, '{}-performance.txt'.format(build_slug)) if os.path.exists(perfpath): os.remove(perfpath) for name in os.listdir(os.path.join(path, 'src')): _JSON = '.json' if name.endswith(_JSON): app_slugs.append(name[:-len(_JSON)]) for slug in app_slugs: print 'Fetching %s...' % slug source_path = os.path.join(path, 'src', '%s.json' % slug) with open(source_path) as f: j = json.load(f) if j['doc_type'] == 'Application': app = Application.wrap(j) elif j['doc_type'] == 'RemoteApp': app = RemoteApp.wrap(j) app.version = 1 build_path = os.path.join(path, build_slug, slug) print ' Creating files...' with record_performance_stats(perfpath, slug): files = app.create_all_files() self.write_files(files, build_path) def write_files(self, files, path): for filename, payload in files.items(): filepath = os.path.join(path, filename) dirpath, filename = os.path.split(filepath) try: os.makedirs(dirpath) except OSError: # file exists pass with open(filepath, 'w') as f: if filepath.endswith('.xml'): payload = normalize_xml(payload) f.write(payload)
Python
0