commit
stringlengths
40
40
subject
stringlengths
1
1.49k
old_file
stringlengths
4
311
new_file
stringlengths
4
311
new_contents
stringlengths
1
29.8k
old_contents
stringlengths
0
9.9k
lang
stringclasses
3 values
proba
float64
0
1
470063b8d468394432e729e7417c88263614b5f0
Create msub_cluster.py
snakemake_ChIPseq_pipeline/msub_cluster.py
snakemake_ChIPseq_pipeline/msub_cluster.py
Python
0.000046
a7b0fc1effd0e68018bc3c33f1dc0b952b23003b
update nav access restrictions
accelerator/migrations/0095_update_nav_tree_access_restrictions.py
accelerator/migrations/0095_update_nav_tree_access_restrictions.py
# Generated by Django 2.2.24 on 2022-03-29 16:24 from django.db import migrations def update_nav_access_restrictions(apps, schema_editor): NavTreeItem = apps.get_model('accelerator', 'NavTreeItem') urls = ['/judging/panel/', '/judging/commitments/', '/nav/judging'] nav_items = NavTreeItem.objects.filter(url__in=urls) # remove user_type restrictions nav_items.update(user_type='') # remove user_role restrictions [nav_item.user_role.clear() for nav_item in nav_items] class Migration(migrations.Migration): dependencies = [ ('accelerator', '0094_alter_startup_organization_fields'), ] operations = [ migrations.RunPython(update_nav_access_restrictions, migrations.RunPython.noop) ]
Python
0
645efb8ffcc3c9a3e41db2619430ffcb7a6d570f
Migrate Req/Ass to have verified/finished date
src/ggrc/migrations/versions/20160314140338_4fd36860d196_add_finished_date_to_request_and_.py
src/ggrc/migrations/versions/20160314140338_4fd36860d196_add_finished_date_to_request_and_.py
# Copyright (C) 2016 Google Inc., authors, and contributors <see AUTHORS file> # Licensed under http://www.apache.org/licenses/LICENSE-2.0 <see LICENSE file> # Created By: andraz@reciprocitylabs.com # Maintained By: andraz@reciprocitylabs.com """ add finished date to request and assessment Create Date: 2016-03-14 14:03:38.026877 """ # disable Invalid constant name pylint warning for mandatory Alembic variables. # pylint: disable=invalid-name import sqlalchemy as sa from alembic import op # revision identifiers, used by Alembic. revision = '4fd36860d196' down_revision = '39aec99639d5' def upgrade_table(table): """Add columns finished_date and verified_date and populate them.""" op.add_column(table, sa.Column('finished_date', sa.DateTime(), nullable=True)) op.add_column(table, sa.Column('verified_date', sa.DateTime(), nullable=True)) op.execute(""" UPDATE {} SET finished_date = updated_at WHERE status in ("Finished", "Verified", "Final") """.format(table)) op.execute(""" UPDATE {} SET verified_date = updated_at, status = "Final" WHERE status = "Verified" """.format(table)) def upgrade(): upgrade_table('requests') upgrade_table('assessments') def downgrade(): """Remove verified_date and finished_date columns.""" op.drop_column('assessments', 'verified_date') op.drop_column('assessments', 'finished_date') op.drop_column('requests', 'verified_date') op.drop_column('requests', 'finished_date')
Python
0
092a8081e4fcecec0dc18c1eadcec0a46c5c73fb
add the AFL wrapper program
analysis/afl.py
analysis/afl.py
#!/usr/bin/env python import argparse import os import subprocess from multiprocessing import Process from functools import reduce MEMORY='2G' def getArch(iid): query = 'select arch from image where id=' + iid + ';' arch = dbquery(query)[0][0] if arch == 'armel': arch = 'arm' elif arch == 'mipseb': arch = 'mips' return arch def dbquery(query): import psycopg2 db = psycopg2.connect(dbname = "firmware", user = "firmadyne", password = "firmadyne", host = "127.0.0.1") ret = None try: cur = db.cursor() cur.execute(query) except BaseException: traceback.print_exc() finally: if cur: ret = cur.fetchall() cur.close() return ret def extract(iid, bindir): print('Extracting binaries......') query = '''select filename from object_to_image where iid=''' + iid + ''' and score>0 and (mime='application/x-executable; charset=binary' or mime='application/x-object; charset=binary' or mime='application/x-sharedlib; charset=binary') order by score DESC;''' wanted = dbquery(query) wanted = reduce((lambda a, b: a + b), wanted) wanted = map((lambda a: '.' + a), wanted) wanted = reduce((lambda a, b: a + ' ' + b), wanted) cmd = 'tar xf ' + bindir + '/../../../../images/' + iid + '.tar.gz -C ' + bindir + ' ' + wanted subprocess.run([cmd], shell=True) print('Extracting library links......') query = '''select filename from object_to_image where iid=''' + iid + ''' and regular_file='f';''' wanted = dbquery(query) wanted = reduce((lambda a, b: a + b), wanted) wanted = filter((lambda a: 'lib' in a), wanted) wanted = map((lambda a: '.' + a), wanted) wanted = reduce((lambda a, b: a + ' ' + b), wanted) cmd = 'tar xf ' + bindir + '/../../../../images/' + iid + '.tar.gz -C ' + bindir + ' ' + wanted subprocess.run([cmd], shell=True) def setenvs(iid): arch = getArch(iid) afl_path = subprocess.run(['which', 'afl-qemu-trace'], stdout=subprocess.PIPE).stdout.decode().replace('\n', '') + '-' + arch if len(afl_path) == 0: print("Unknown architecture: " + arch) sys.exit(1) env = dict(os.environ.copy(), **{'AFL_INST_LIBS':'1'}, **{'AFL_EXIT_WHEN_DONE':'1'}, **{'AFL_NO_AFFINITY':'0'}, **{'AFL_PATH':afl_path}) return env def runAFL(args, ENVS): p = subprocess.Popen(args, env = ENVS) try: p.wait(timeout=20 * 60) # 20 min except subprocess.TimeoutExpired: # may check the status here to decide whether to terminate p.terminate() def fuzz(target, bindir, outdir, ENVS): print('Fuzzing ' + target + '......') outdir += '/' + target if not os.path.isdir(outdir): if os.path.exists(outdir): os.remove(outdir) os.makedirs(outdir, 0o755) inputcase = '/usr/share/afl/testcases/others/text' else: inputcase = '-' args = ['afl-fuzz', '-Q', '-M', 'master', '-m', MEMORY, '-i', inputcase, '-o', outdir, '-L', bindir, bindir + '/' + target] m = Process(target=runAFL, args=(args, ENVS)) m.start() args = ['afl-fuzz', '-Q', '-S', 'slave1', '-m', MEMORY, '-i', inputcase, '-o', outdir, '-L', bindir, bindir + '/' + target] s1 = Process(target=runAFL, args=(args, ENVS)) s1.start() args = ['afl-fuzz', '-Q', '-S', 'slave2', '-m', MEMORY, '-i', inputcase, '-o', outdir, '-L', bindir, bindir + '/' + target] s2 = Process(target=runAFL, args=(args, ENVS)) s2.start() args = ['afl-fuzz', '-Q', '-S', 'slave3', '-m', MEMORY, '-i', inputcase, '-o', outdir, '-L', bindir, bindir + '/' + target] s3 = Process(target=runAFL, args=(args, ENVS)) s3.start() # join m.join() s1.join() s2.join() s3.join() def process(iid, resultdir): subprocess.run(['echo core | sudo tee /proc/sys/kernel/core_pattern >/dev/null'], shell=True) bindir = resultdir + '/bin' outdir = resultdir + '/out' if not os.path.isdir(bindir): if os.path.exists(bindir): os.remove(bindir) os.makedirs(bindir, 0o755) if not os.path.isdir(outdir): if os.path.exists(outdir): os.remove(outdir) os.makedirs(outdir, 0o755) extract(iid, bindir) AFL_ENVS = setenvs(iid) query = '''select filename from object_to_image where iid=''' + iid + ''' and score>0 and mime='application/x-executable; charset=binary' order by score DESC;''' targets = dbquery(query) targets = reduce((lambda a, b: a + b), targets) targets = list(map((lambda a: '.' + a), targets)) for target in targets: fuzz(target, bindir, outdir, AFL_ENVS) def main(): parser = argparse.ArgumentParser(description="AFL wrapper program") parser.add_argument("id", action="store", help="firmware image ID") arg = parser.parse_args() resultdir = os.path.dirname(os.path.realpath(__file__)) + '/../results/' + arg.id + '/afl' process(arg.id, resultdir) if __name__ == '__main__': main ()
Python
0
b05ab5401e716eab305625ad369ec5d362ae491a
add andromercury tool
andromercury.py
andromercury.py
#!/usr/bin/env python # This file is part of Androguard. # # Copyright (C) 2012, Anthony Desnos <desnos at t0t0.fr> # All rights reserved. # # Androguard is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Androguard is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with Androguard. If not, see <http://www.gnu.org/licenses/>. import sys, re, os from optparse import OptionParser from androguard.core.bytecodes import apk sys.path.append("./elsim/") from elsim.elsign import dalvik_elsign sys.path.append("./mercury/client") from merc.lib.common import Session option_0 = { 'name' : ('-l', '--list'), 'help' : 'list all packages', 'nargs' : 1 } option_1 = { 'name' : ('-i', '--input'), 'help' : 'get specific packages (a filter)', 'nargs' : 1 } option_2 = { 'name' : ('-r', '--remotehost'), 'help' : 'specify ip of emulator/device', 'nargs' : 1 } option_3 = { 'name' : ('-p', '--port'), 'help' : 'specify the port', 'nargs' : 1 } option_4 = { 'name' : ('-o', '--output'), 'help' : 'output directory to write packages', 'nargs' : 1 } option_5 = { 'name' : ('-b', '--database'), 'help' : 'database : use this database', 'nargs' : 1 } option_6 = { 'name' : ('-c', '--config'), 'help' : 'use this configuration', 'nargs' : 1 } option_7 = { 'name' : ('-v', '--verbose'), 'help' : 'display debug information', 'action' : 'count' } options = [option_0, option_1, option_2, option_3, option_4, option_5, option_6, option_7] def display(ret, debug) : print "---->", ret[0], def main(options, arguments) : sessionip = "127.0.0.1" sessionport = 31415 if options.remotehost : sessionip = options.remotehost if options.port : sessionport = int(options.port) newsession = Session(sessionip, sessionport, "bind") # Check if connection can be established if newsession.executeCommand("core", "ping", None).data == "pong": if options.list : request = {'filter': options.list, 'permissions': None } apks_info = newsession.executeCommand("packages", "info", {}).getPaddedErrorOrData() print apks_info elif options.input and options.output : s = None if options.database != None or options.config != None : s = dalvik_elsign.MSignature( options.database, options.config, options.verbose != None, ps = dalvik_elsign.PublicSignature) request = {'filter': options.input, 'permissions': None } apks_info = newsession.executeCommand("packages", "info", request).getPaddedErrorOrData() print apks_info for i in apks_info.split("\n") : if re.match("APK path:", i) != None : name_app = i.split(":")[1][1:] print name_app, response = newsession.downloadFile(name_app, options.output) print response.data, response.error, if s != None : a = apk.APK( options.output + "/" + os.path.basename(name_app) ) if a.is_valid_APK() : display( s.check_apk( a ), options.verbose ) print else: print "\n**Network Error** Could not connect to " + sessionip + ":" + str(sessionport) + "\n" if __name__ == "__main__" : parser = OptionParser() for option in options : param = option['name'] del option['name'] parser.add_option(*param, **option) options, arguments = parser.parse_args() sys.argv[:] = arguments main(options, arguments)
Python
0
bad82f3c77dbeebdc2332d193f0c8290c5186862
add rudimentary api
frontend/app.py
frontend/app.py
import os import sys import inspect import json from flask import Flask # move to top level currentdir = os.path.dirname( os.path.abspath(inspect.getfile(inspect.currentframe()))) parentdir = os.path.dirname(currentdir) sys.path.insert(0, parentdir) from api.reporting import Report from api.apiutils import Scope, Relation from modelstore.elasticstore import StoreHandler from knowledgerepr import fieldnetwork from algebra import API path_to_serialized_model = parentdir + "/test/testmodel/" network = fieldnetwork.deserialize_network(path_to_serialized_model) store_client = StoreHandler() api = API(network, store_client) keyword_search = api.keyword_search neighbor_search = api.neighbor_search union = api.union intersection = api.intersection difference = api.difference db = Scope.DB source = Scope.SOURCE feld = Scope.FIELD content = Scope.CONTENT schema = Relation.SCHEMA schema_sim = Relation.SCHEMA_SIM content_sim = Relation.CONTENT_SIM entity_sim = Relation.ENTITY_SIM pkfk = Relation.PKFK app = Flask(__name__) @app.route('/query/<query>') def query(query): try: res = eval(query) res = json.dumps(res.data) except Exception as e: res = "error: " + str(e) return res @app.route('/convert/<nid>') def convert(nid): try: import pdb; pdb.set_trace() nid = int(nid) res = api._general_to_drs(nid) res = json.dumps(res.data) except Exception as e: res = "error: " + str(e) return res if __name__ == '__main__': app.run()
Python
0.000007
37baa669ed1e00fabddd33478fa75f4047075ce3
Create Python object detection script.
cs473vision/ObjectDetector.py
cs473vision/ObjectDetector.py
''' Created on Feb 28, 2014 @author: Vance Zuo ''' import numpy import cv2 class ObjectDetector(object): ''' classdocs ''' def __init__(self, params): ''' Constructor ''' self.bg_img = None self.fg_img = None return def load_image(self, bg_path, fg_path): self.bg_img = cv2.imread(bg_path) self.fg_img = cv2.imread(fg_path) return True def subtract_background(self): # Take simple difference naive = cv2.absdiff(self.bg_img, self.bg_img) cv2.imwrite("naive.png", naive) # MOG Subtraction bg_subtractor = cv2.BackgroundSubtractorMOG() bg_mask = bg_subtractor.apply(self.bg_img) fg_mask = bg_subtractor.apply(self.fg_img) cv2.imwrite("MOG.png", fg_mask) # MOG2 Subtraction bg_subtractor = cv2.BackgroundSubtractorMOG2() bg_mask = bg_subtractor.apply(self.bg_img) fg_mask = bg_subtractor.apply(self.fg_img) cv2.imwrite("MOG2.png", fg_mask) return
Python
0
4aacc8d55c138c405d561bbf9ddfd9ddab483e62
add wxPython example.
trypython/extlib/gui/wx01.py
trypython/extlib/gui/wx01.py
""" wxPython についてのサンプルです お決まりの Hello world について REFERENCES:: http://bit.ly/2OcHRh7 """ # noinspection PyPackageRequirements import wx from trypython.common.commoncls import SampleBase class Sample(SampleBase): def exec(self): app = wx.App() frm = wx.Frame(parent=None, title='Hello World') frm.Show() app.MainLoop() def go(): obj = Sample() obj.exec() if __name__ == '__main__': go()
Python
0
9566d71a267015005ad937cd92bd105d2ffff274
print users with multiple matching urls
twnews/print_urls_by_user.py
twnews/print_urls_by_user.py
""" Print users who were found for multiple urls. user url1 score1 url2 score2 ... """ import codecs from collections import defaultdict import json import sys from . import __data__ sys.stdout = codecs.getwriter('utf8')(sys.stdout) def print_urls_by_user(tweets_file=__data__ + '/tweets.json'): user2urls = defaultdict(lambda: set()) url2score = defaultdict(lambda: 0.) inf = codecs.open(tweets_file, 'rt', 'utf-8') for line in inf: js = json.loads(line) if 'url_query' in js: # valid line user2urls[js['user']['screen_name']].add(js['url_query']) url2score[js['url_query']] = float(js['url_score']) for user, urls in user2urls.iteritems(): if len(urls) > 1: print user + '\t' + '\t'.join('%s\t%.3f' % (u, url2score[u]) for u in urls) if __name__ == '__main__': print_urls_by_user()
Python
0.000006
bc9c057d57d4dbc2e3c70eaf3ac182df2b334107
fix bluffing again
player.py
player.py
import logging import card as c class Player(object): """ This class represents a player. It is basically a doubly-linked ring list with the option to reverse the direction. On initialization, it will connect itself to a game and its other players by placing itself behind the current player. """ def __init__(self, game, user): self.cards = list() self.game = game self.user = user self.logger = logging.getLogger(__name__) # Check if this player is the first player in this game. if game.current_player: self.next = game.current_player self.prev = game.current_player.prev game.current_player.prev.next = self game.current_player.prev = self else: self._next = self self._prev = self game.current_player = self for i in range(7): self.cards.append(self.game.deck.draw()) self.bluffing = False self.drew = False def leave(self): """ Leave the current game """ self.next.prev = self.prev self.prev.next = self.next self.next = None self.prev = None def __repr__(self): return repr(self.user) def __str__(self): return str(self.user) @property def next(self): return self._next if not self.game.reversed else self._prev @next.setter def next(self, player): if not self.game.reversed: self._next = player else: self._prev = player @property def prev(self): return self._prev if not self.game.reversed else self._next @prev.setter def prev(self, player): if not self.game.reversed: self._prev = player else: self._next = player def playable_cards(self): """ Returns a list of the cards this player can play right now """ playable = list() last = self.game.last_card self.logger.debug("Last card was " + str(last)) cards = self.cards if self.drew: cards = self.cards[-1:] for card in cards: if self.card_playable(card, playable): self.logger.debug("Matching!") playable.append(card) # You may only play a +4 if you have no cards of the correct color self.bluffing = False for card in playable: if card.color == last.color: self.bluffing = True break # You may not play a chooser or +4 as your last card if len(self.cards) == 1 and (self.cards[0].special == c.DRAW_FOUR or self.cards[0].special == c.CHOOSE): return list() return playable def card_playable(self, card, playable): """ Check a single card if it can be played """ is_playable = True last = self.game.last_card self.logger.debug("Checking card " + str(card)) if (card.color != last.color and card.value != last.value and not card.special): self.logger.debug("Card's color or value doesn't match") is_playable = False if last.value == c.DRAW_TWO and not \ card.value == c.DRAW_TWO and self.game.draw_counter: self.logger.debug("Player has to draw and can't counter") is_playable = False if last.special == c.DRAW_FOUR and self.game.draw_counter: self.logger.debug("Player has to draw and can't counter") is_playable = False if (last.special == c.CHOOSE or last.special == c.DRAW_FOUR) and \ (card.special == c.CHOOSE or card.special == c.DRAW_FOUR): self.logger.debug("Can't play colorchooser on another one") is_playable = False if not last.color or card in playable: self.logger.debug("Last card has no color or the card was " "already added to the list") is_playable = False return is_playable
import logging import card as c class Player(object): """ This class represents a player. It is basically a doubly-linked ring list with the option to reverse the direction. On initialization, it will connect itself to a game and its other players by placing itself behind the current player. """ def __init__(self, game, user): self.cards = list() self.game = game self.user = user self.logger = logging.getLogger(__name__) # Check if this player is the first player in this game. if game.current_player: self.next = game.current_player self.prev = game.current_player.prev game.current_player.prev.next = self game.current_player.prev = self else: self._next = self self._prev = self game.current_player = self for i in range(7): self.cards.append(self.game.deck.draw()) self.bluffing = False self.drew = False def leave(self): """ Leave the current game """ self.next.prev = self.prev self.prev.next = self.next self.next = None self.prev = None def __repr__(self): return repr(self.user) def __str__(self): return str(self.user) @property def next(self): return self._next if not self.game.reversed else self._prev @next.setter def next(self, player): if not self.game.reversed: self._next = player else: self._prev = player @property def prev(self): return self._prev if not self.game.reversed else self._next @prev.setter def prev(self, player): if not self.game.reversed: self._prev = player else: self._next = player def playable_cards(self): """ Returns a list of the cards this player can play right now """ playable = list() last = self.game.last_card self.logger.debug("Last card was " + str(last)) cards = self.cards if self.drew: cards = self.cards[-1:] for card in cards: if self.card_playable(card, playable): self.logger.debug("Matching!") playable.append(card) # You may only play a +4 if it's the only card you can play self.bluffing = bool(len(playable) - 1) # You may not play a chooser or +4 as your last card if len(self.cards) == 1 and (self.cards[0].special == c.DRAW_FOUR or self.cards[0].special == c.CHOOSE): return list() return playable def card_playable(self, card, playable): """ Check a single card if it can be played """ is_playable = True last = self.game.last_card self.logger.debug("Checking card " + str(card)) if (card.color != last.color and card.value != last.value and not card.special): self.logger.debug("Card's color or value doesn't match") is_playable = False if last.value == c.DRAW_TWO and not \ card.value == c.DRAW_TWO and self.game.draw_counter: self.logger.debug("Player has to draw and can't counter") is_playable = False if last.special == c.DRAW_FOUR and self.game.draw_counter: self.logger.debug("Player has to draw and can't counter") is_playable = False if (last.special == c.CHOOSE or last.special == c.DRAW_FOUR) and \ (card.special == c.CHOOSE or card.special == c.DRAW_FOUR): self.logger.debug("Can't play colorchooser on another one") is_playable = False if not last.color or card in playable: self.logger.debug("Last card has no color or the card was " "already added to the list") is_playable = False return is_playable
Python
0.000009
e5627134d9a2c052a523f66a2ec9867b3432fae2
Test Issue #461: ent_iob tag incorrect after setting entities.
spacy/tests/tokens/test_add_entities.py
spacy/tests/tokens/test_add_entities.py
from __future__ import unicode_literals import spacy from spacy.vocab import Vocab from spacy.matcher import Matcher from spacy.tokens.doc import Doc from spacy.attrs import * from spacy.pipeline import EntityRecognizer import pytest @pytest.fixture(scope="module") def en_vocab(): return spacy.get_lang_class('en').Defaults.create_vocab() @pytest.fixture(scope="module") def entity_recognizer(en_vocab): return EntityRecognizer(en_vocab, features=[(2,), (3,)]) @pytest.fixture def animal(en_vocab): return nlp.vocab.strings[u"ANIMAL"] @pytest.fixture def doc(en_vocab, entity_recognizer): doc = Doc(en_vocab, words=[u"this", u"is", u"a", u"lion"]) entity_recognizer(doc) return doc def test_set_ents_iob(doc): assert len(list(doc.ents)) == 0 tags = [w.ent_iob_ for w in doc] assert tags == (['O'] * len(doc)) doc.ents = [(doc.vocab.strings['ANIMAL'], 3, 4)] tags = [w.ent_iob_ for w in doc] assert tags == ['O', 'O', 'O', 'B'] doc.ents = [(doc.vocab.strings['WORD'], 0, 2)] tags = [w.ent_iob_ for w in doc] assert tags == ['B', 'I', 'O', 'O']
Python
0
7cee0980a67b827e4cf06c15e0f1c3b412f68c22
Create main.py to actually perform the test
main.py
main.py
import io import argparse def initialize_argument_parser(): parser = argparse.ArgumentParser(description='Simulate Indian health solutions') parser.add_argument('-s', '--solution', dest='solution', help='the solution to test', default='health kiosk') return vars(parser.parse_args()) if __name__ == "__main__": args = initialize_argument_parser() print 'Solution to test:', args['solution']
Python
0
233c7f0152a05afcef62b596f7c90abe7e9eec90
add a base pipeline for converting json to bigquery
pipeline/flatten_json.py
pipeline/flatten_json.py
"""Beam pipeline for converting json scan files into bigquery tables.""" from __future__ import absolute_import import argparse import json import logging from pprint import pprint import apache_beam as beam from apache_beam.io import ReadFromText from apache_beam.io.gcp.internal.clients import bigquery from apache_beam.options.pipeline_options import PipelineOptions from apache_beam.options.pipeline_options import SetupOptions bigquery_schema = { 'domain': 'string', 'ip': 'string', 'date': 'date', 'start_time': 'timestamp', 'end_time': 'timestamp', 'retries': 'integer', 'sent': 'string', 'received': 'string', 'error': 'string', 'blocked': 'boolean', 'success': 'boolean', 'fail_sanity': 'boolean', 'stateful_block': 'boolean' } # Future fields """ 'row_number', 'integer', 'domain_category': 'string', 'netblock': 'string', 'asn': 'string', 'as_name': 'string', 'as_full_name': 'string', 'as_traffic': 'integer', 'as_class': 'string', 'country': 'string', """ def get_bigquery_schema(): """Return a beam bigquery schema for the output table.""" table_schema = bigquery.TableSchema() for (name, field_type) in bigquery_schema.items(): field_schema = bigquery.TableFieldSchema() field_schema.name = name field_schema.type = field_type field_schema.mode = 'nullable' # all fields are flat table_schema.fields.append(field_schema) return table_schema def flatten_measurement(line): """Flattens a measurement string into several roundtrip rows. Args: line: a json string describing a censored planet measurement. example {'Keyword': 'test.com, 'Server': '1.2.3.4', 'Results': [{'Success': true}, {'Success': false}]} Returns: an array of dicts containing individual roundtrip information [{'column_name': field_value}] example [{'domain': 'test.com', 'ip': '1.2.3.4', 'success': true} {'domain': 'test.com', 'ip': '1.2.3.4', 'success': true}] """ scan = json.loads(line) pprint(scan) rows = [] for result in scan['Results']: rows.append({ 'domain': scan['Keyword'], 'ip': scan['Server'], 'date': result['StartTime'][:10], 'start_time': result['StartTime'], 'end_time': result['EndTime'], 'retries': scan['Retries'], 'sent': result['Sent'], 'received': result['Received'], 'error': result['Error'], 'blocked': scan['Blocked'], 'success': result['Success'], 'fail_sanity': scan['FailSanity'], 'stateful_block': scan['StatefulBlock'], }) pprint(rows) return rows def run(argv=None, save_main_session=True): parser = argparse.ArgumentParser() parser.add_argument( '--input', dest='input', # default='gs://firehook-scans/echo/CP_Quack-echo-2018-07-27-15-20-11/results.json', default='gs://firehook-dataflow-test/results-short.json', help='Input file to process.') parser.add_argument( '--output', dest='output', default='firehook-censoredplanet:test.example', help='Output file to write results to.') known_args, pipeline_args = parser.parse_known_args(argv) pipeline_args.extend([ # DataflowRunner or DirectRunner '--runner=DirectRunner', '--project=firehook-censoredplanet', '--region=us-east1', '--staging_location=gs://firehook-dataflow-test/staging', '--temp_location=gs://firehook-dataflow-test/temp', '--job_name=flatten-json-job', ]) pipeline_options = PipelineOptions(pipeline_args) pipeline_options.view_as(SetupOptions).save_main_session = save_main_session with beam.Pipeline(options=pipeline_options) as p: lines = p | ReadFromText(known_args.input) rows = (lines | 'flatten json' >> (beam.FlatMap(flatten_measurement))) rows | 'Write' >> beam.io.WriteToBigQuery( known_args.output, schema=get_bigquery_schema(), create_disposition=beam.io.BigQueryDisposition.CREATE_IF_NEEDED, # WRITE_TRUNCATE is slow when testing. # write_disposition=beam.io.BigQueryDisposition.WRITE_TRUNCATE write_disposition=beam.io.BigQueryDisposition.WRITE_APPEND) if __name__ == '__main__': logging.getLogger().setLevel(logging.INFO) run()
Python
0.000001
361c3496274a960c5e927899a39618f8fee9db0a
Add Basic Trellis Histogram to Examples
altair/vegalite/v2/examples/trellis_histogram.py
altair/vegalite/v2/examples/trellis_histogram.py
""" Trellis Histogram ----------------- This example shows how to make a basic trellis histogram. https://vega.github.io/vega-lite/examples/trellis_bar_histogram.html """ import altair as alt cars = alt.load_dataset('cars') chart = alt.Chart(cars).mark_bar().encode( x=alt.X("Horsepower", type="quantitative", bin=alt.BinTransform( maxbins=15 )), y='count(*):Q', row='Origin' )
Python
0
a7e8b3a2b63ed4717a783754446b30c4f288e76a
Create channelinfo.py
cogs/channelinfo.py
cogs/channelinfo.py
import discord from discord.ext import commands from random import randint, choice class Channelinfo: """Shows Channel infos.""" def __init__(self, bot): self.bot = bot @commands.command(aliases=['channel', 'cinfo', 'ci'], pass_context=True, no_pm=True) async def channelinfo(self, ctx, *, channel: discord.channel=None): """Shows channel informations""" if not channel: channel = ctx.message.channel # else: # channel = ctx.message.guild.get_channel(int(chan)) # if not channel: channel = self.bot.get_channel(int(chan)) data = discord.Embed() content = None if hasattr(channel, 'mention'): content = self.bot.bot_prefix+"**Informations about Channel:** "+channel.mention if hasattr(channel, 'changed_roles'): if len(channel.changed_roles) > 0: if channel.changed_roles[0].permissions.read_messages: data.color = discord.Colour.green() else: data.color = discord.Colour.red() if isinstance(channel, discord.TextChannel): _type = "Text" elif isinstance(channel, discord.VoiceChannel): _type = "Voice" else: _type = "Unknown" data.add_field(name="Type", value=_type) data.add_field(name="ID", value=channel.id) if hasattr(channel, 'position'): data.add_field(name="Position", value=channel.position) if isinstance(channel, discord.VoiceChannel): if channel.user_limit != 0: data.add_field(name="User Number", value="{}/{}".format(len(channel.voice_members), channel.user_limit)) else: data.add_field(name="User Number", value="{}".format(len(channel.voice_members))) userlist = [r.display_name for r in channel.members] if not userlist: userlist = "None" else: userlist = "\n".join(userlist) data.add_field(name="Users", value=userlist) data.add_field(name="Bitrate", value=channel.bitrate) elif isinstance(channel, discord.TextChannel): if channel.members: data.add_field(name="Members", value="%s"%len(channel.members)) if channel.topic: data.add_field(name="Topic", value=channel.topic, inline=False) _hidden = []; _allowed = [] for role in channel.changed_roles: if role.permissions.read_messages: _allowed.append(role.mention) else: _hidden.append(role.mention) if len(_allowed) > 0: data.add_field(name='Allowed Roles (%s)'%len(_allowed), value=', '.join(_allowed), inline=False) if len(_hidden) > 0: data.add_field(name='Restricted Roles (%s)'%len(_hidden), value=', '.join(_hidden), inline=False) if channel.created_at: data.set_footer(text=("Created on {} ({} days ago)".format(channel.created_at.strftime("%d %b %Y %H:%M"), (ctx.message.created_at - channel.created_at).days))) # try: await ctx.send(content if content else None, embed=data) # except: # await ctx.send(self.bot.bot_prefix+"I need the `Embed links` permission to send this") def setup(bot): bot.add_cog(Channelinfo(bot))
Python
0
333453fe6a74d7bada941ee7aeed3660452efcaf
add tests
tests/install_tests/test_cupy_builder/test_command.py
tests/install_tests/test_cupy_builder/test_command.py
from cupy_builder._command import filter_files_by_extension def test_filter_files_by_extension(): sources_cpp = ['a.cpp', 'b.cpp'] sources_pyx = ['c.pyx'] sources = sources_cpp + sources_pyx assert filter_files_by_extension( sources, '.cpp') == (sources_cpp, sources_pyx) assert filter_files_by_extension( sources, '.pyx') == (sources_pyx, sources_cpp) assert filter_files_by_extension( sources, '.cu') == ([], sources) assert filter_files_by_extension( sources_cpp, '.cpp') == (sources_cpp, []) assert filter_files_by_extension( sources_cpp, '.pyx') == ([], sources_cpp)
Python
0
8a7963644ff470fc7da8bc22a7f3fd6ef1be3ed2
define password generator.
rio/utils/token.py
rio/utils/token.py
# -*- coding: utf-8 -*- """ rio.utils.token ~~~~~~~~~~~~~~~ """ import random import string def password_generator(length): """Generate a random password. :param length: integer. """ return ''.join(random.choice(string.ascii_lowercase + string.digits) for _ in range(length))
Python
0.000001
1d4397860ffd297eb02b5f4b96b0e18a3c7e12cd
Add test recipes.
badgify/tests/recipes.py
badgify/tests/recipes.py
# -*- coding: utf-8 -*- from ..recipe import BaseRecipe from ..compat import get_user_model class BadRecipe(object): pass class NotImplementedRecipe(BaseRecipe): pass class Recipe1(BaseRecipe): name = 'Recipe 1' slug = 'recipe1' description = 'Recipe 1 description' @property def image(self): return 'image' @property def user_ids(self): return (get_user_model().objects.filter(love_python=True) .values_list('id', flat=True)) class Recipe2(BaseRecipe): name = 'Recipe 2' slug = 'recipe2' description = 'Recipe 2 description' @property def image(self): return 'image' @property def user_ids(self): return []
Python
0
f6c07ad620f7e3ef73fdad5f2d97d1dd911e390f
Create signal.py
signal.py
signal.py
#!/usr/bin/python3 # Send via Signal import os from pydbus import SystemBus from dateutil import parser from datetime import datetime eventhostname=os.environ.get ("NOTIFY_HOSTNAME", "<no host>") eventdatetimeString=os.environ.get ("NOTIFY_LONGDATETIME", "<no time>") if eventdatetimeString == "<no time>": eventdatetime = datetime(2017,1,1) else: eventdatetime = parser.parse (eventdatetimeString) eventduration=os.environ.get ("NOTIFY_LASTHOSTSTATECHANGE_REL", "<no duration>") eventhoststate=os.environ.get ("NOTIFY_HOSTSTATE", "<no state>") eventlasthoststate=os.environ.get ("NOTIFY_LASTHOSTSTATE", "<no last state>") bus = SystemBus() signal = bus.get ("org.asamk.Signal") message = eventhostname + ": " + eventhoststate + " after " + eventlasthoststate + " (" + eventdurati$ signal.sendMessage(message, [], ['+XXXXXXXXXXXXXXXXXXX'])
Python
0.000002
269e9821a52f1d68e2a48beb76b20c227dc84b55
add 0007(count one file omitting multiple-line comment)
robot527/0007/count_codes.py
robot527/0007/count_codes.py
#! usr/bin/python3 """ 第 0007 题:有个目录,里面是你自己写过的程序,统计一下你写过多少行代码。 包括空行和注释,但是要分别列出来。 """ class PyfileInfo: def __init__(self, file): self.file_name = file self.total_line_num = 0 self.blank_line_num = 0 self.comment_line_num = 0 def count_lines(self): if self.file_name[-3:] != '.py': print(self.file_name + ' is not a .py file!') return try: with open(self.file_name) as code: for each_line in code: self.total_line_num += 1 temp = each_line.strip() if temp == '': self.blank_line_num += 1 elif temp[0] == '#': self.comment_line_num += 1 except IOError as err: print('File error: ' + str(err)) import os target_path = '.' file_list = [f for f in os.listdir(target_path) if os.path.isfile(os.path.join(target_path, f))] #print(file_list, len(file_list)) pyfile_list = [os.path.join(target_path, f) for f in file_list if f[-3:] == '.py'] print(pyfile_list[0]) pyf1 = PyfileInfo(pyfile_list[0]) pyf1.count_lines() #pyf2 = PyfileInfo('test.c') #pyf2.count_lines() print('==' * 18) print('Total line number is:', pyf1.total_line_num) print('Blank line number is:', pyf1.blank_line_num) print('Comment line number is:', pyf1.comment_line_num)
Python
0
74d8390dce4dd5a8fe8a6f7f4304b80afadfec1d
Add basic calendar framework
app/calender.py
app/calender.py
class CalenderManager: def __init__(self): pass def add_event(self, user, starttime, endtime): pass def get_current_event(self): #Return NONE if no event pass def remove_event(self, id): pass def get_upcoming_events(self, num): pass
Python
0.000002
93a03023cf0c73b78680d431c828f4b9ebc49802
add disk_cache.py
3.下载缓存/3.disk_cache.py
3.下载缓存/3.disk_cache.py
#!/usr/bin/env python # coding:utf-8 import os import re import zlib import shutil import urlparse import cPickle as pickle from datetime import datetime, timedelta from link_crawler import link_crawler class DiskCache: """通过使用磁盘空间保存文件的方式对资源文件进行缓存 """ def __init__(self, cache_dir='cache', expires=timedelta(days=30), compress=True): """设置代码保存的磁盘位置、设置文件过期时长、设置是否对文件进行压缩 """ self.cache_dir = cache_dir self.expires = expires self.compress = compress def __getitem__(self, url): """从磁盘加载数据的URL """ path = self.url_to_path(url) if os.path.exists(path): with open(path, 'rb') as fp: data = fp.read() if self.compress: data = zlib.decompress(data) result, timestamp = pickle.loads(data) if self.has_expired(timestamp): raise KeyError(url + ' has expired') return result else: raise KeyError(url + ' does not exist') def __setitem__(self, url, result): """这个URL保存数据到磁盘 """ path = self.url_to_path(url) folder = os.path.dirname(path) if not os.path.exists(folder): os.makedirs(folder) data = pickle.dumps((result, datetime.utcnow())) if self.compress: data = zlib.compress(data) with open(path, 'wb') as fp: fp.write(data) def __delitem__(self, url): """删除这个关键的价值和任何空的子目录 """ path = self.url_to_path(url) try: os.remove(path) os.removedirs(os.path.dirname(path)) except OSError: pass def url_to_path(self, url): """为这个URL创建文件系统路径 """ components = urlparse.urlsplit(url) path = components.path if not path: path = '/index.html' elif path.endswith('/'): path += 'index.html' filename = components.netloc + path + components.query filename = re.sub('[^/0-9a-zA-Z\-.,;_ ]', '_', filename) filename = '/'.join(segment[:255] for segment in filename.split('/')) return os.path.join(self.cache_dir, filename) def has_expired(self, timestamp): """返回这个时间戳是否已经过期 """ return datetime.utcnow() > timestamp + self.expires def clear(self): """清除所有缓存的值 """ if os.path.exists(self.cache_dir): shutil.rmtree(self.cache_dir) if __name__ == '__main__': link_crawler('http://example.webscraping.com/', '/places/default/(index|view)', cache=DiskCache())
Python
0.000002
b0be4dfb0fa13bb708cfe3aaa9c1f576dd5ccaa6
Add initial EDID parser
src/edider/parser.py
src/edider/parser.py
#!/usr/bin/env python3 from itertools import zip_longest from collections import namedtuple import string import struct def grouper(iterable, n, fillvalue=None): "Collect data into fixed-length chunks or blocks" # grouper('ABCDEFG', 3, 'x') --> ABC DEF Gxx" args = [iter(iterable)] * n return zip_longest(*args, fillvalue=fillvalue) def bytes_to_bits(bstr): return ['{:08b}'.format(x) for x in bstr] def bytes_to_printable(bstr): bstr = bstr.decode('ascii', errors='ignore') return ''.join([x for x in bstr if x in string.printable]) def parse_descriptor(desc): # EDID Other Monitor Descriptors # Bytes Description # 0–1 Zero, indicates not a detailed timing descriptor # 2 Zero # 3 Descriptor type. FA–FF currently defined. 00–0F reserved for vendors. # 4 Zero # 5–17 Defined by descriptor type. If text, code page 437 text GENERAL_TXT = 254 if desc[0] != 0: return '' header = struct.unpack('5c', desc[0:5]) descr_type = header[3][0] rest = desc[5:] if descr_type == GENERAL_TXT: return bytes_to_printable(rest) print('Unexpected Descriptor type:', f'{descr_type:02X}') print(rest) return bytes_to_printable(rest) class EDIDSegmenter: def __init__(self, edid_bytes): "Pass the EDID as a bytes string" self._edid = edid_bytes def _get_bytes(self, offset, length): return self._edid[offset : offset+length] @property def fixed_header(self): return self._get_bytes(0, 8) @property def manufacturer_id(self): return self._get_bytes(8, 2) @property def product_code(self): return self._get_bytes(10, 2) @property def serial_number(self): return self._get_bytes(12, 4) @property def manufacture_week(self): return self._get_bytes(16, 1) @property def manufacture_year(self): return self._get_bytes(17, 1) @property def edid_version(self): return self._get_bytes(18, 1) @property def edid_revision(self): return self._get_bytes(19, 1) @property def horizontal_size(self): return self._get_bytes(21, 1) @property def vertical_size(self): return self._get_bytes(22, 1) @property def descriptor1(self): return self._get_bytes(54, 18) @property def descriptor2(self): return self._get_bytes(72, 18) @property def descriptor3(self): return self._get_bytes(90, 18) @property def descriptor4(self): return self._get_bytes(108, 18) def __repr__(self): cname = self.__class__.__name__ return f'{cname}({self._edid!r})' class EDIDParser(EDIDSegmenter): @property def manufacturer_id(self): alphabet = ' abcdefghijklmnopqrstuvwxyz' mid = super().manufacturer_id bits = bytes_to_bits(mid) bits = ''.join(bits) bits = bits[1:] # remove header zero letters = [int(''.join(x), 2) for x in grouper(bits, 5)] letters = [alphabet[i] for i in letters] return ''.join(letters).upper() @property def manufacture_year(self): year = super().manufacture_year[0] return 1990 + year @property def edid_version(self): return super().edid_version[0] @property def edid_revision(self): return super().edid_revision[0] @property def horizontal_size(self): "Horizontal size in cm" return super().horizontal_size[0] @property def vertical_size(self): "Vertical size in cm" return super().vertical_size[0] @property def descriptor1(self): desc = parse_descriptor(super().descriptor1) return desc.strip() @property def descriptor2(self): desc = parse_descriptor(super().descriptor2) return desc.strip() @property def descriptor3(self): desc = parse_descriptor(super().descriptor3) return desc.strip() @property def descriptor4(self): desc = parse_descriptor(super().descriptor4) return desc.strip() MonInfo = namedtuple('MonInfo', ('mfg', 'year', 'horizontal_size', 'vertical_size', 'descriptor')) def monitor_info(edid_bytes): edp = EDIDParser(edid_bytes) desc = [edp.descriptor1, edp.descriptor2, edp.descriptor3, edp.descriptor4] desc = [x for x in desc if x] desc = '; '.join(desc) return MonInfo( edp.manufacturer_id, edp.manufacture_year, edp.horizontal_size, edp.vertical_size, desc, ) if __name__ == '__main__': import x11read EXAMPL_EDID = x11read.get_output_edid(i_screen=0) x = monitor_info(EXAMPL_EDID) print(x)
Python
0.000001
9c33c1e7fcaf111e7a590b035974aa288bbe5895
Create weechat script
czar.py
czar.py
SCRIPT_NAME = 'czar' SCRIPT_AUTHOR = 'Samuel Damashek <samuel.damashek@gmail.com>' SCRIPT_VERSION = '1.0' SCRIPT_LICENSE = 'GPL3' SCRIPT_DESC = 'Run czar commands natively in WeeChat' SCRIPT_COMMAND = 'czar' try: import weechat except ImportError: print('This script must be run under WeeChat.') print('Get WeeChat now at: http://www.weechat.org/') exit(1) import hashlib, time czar_settings_default = { 'key' : ('', 'key for signing messages'), } czar_settings = {} def commandtoken(nick, command): timestr = str(int(time.time()) // 300) return hashlib.sha1("{}{}{}{}".format(timestr, nick, command, czar_settings['key']).encode()).hexdigest() def optoken(challenge, nick): return hashlib.sha1("{}{}{}".format(challenge, czar_settings['key'], nick).encode()).hexdigest() def czar_config_cb(data, option, value): global czar_settings pos = option.rfind('.') czar_settings[option[pos+1:]] = value return weechat.WEECHAT_RC_OK def czar_cmd_cb(data, buffer, args): args = args.split(' ') if args[0] == 'op': servername = (weechat.buffer_get_string(buffer, 'name').split('.'))[0] if len(args) > 2: plugin = weechat.buffer_get_string(buffer, 'plugin') name = weechat.buffer_get_string(buffer, 'name') name = '.'.join(name.split('.')[:-1]+[args[2]]) buf_context = weechat.buffer_search(plugin, name) else: buf_context = buffer weechat.command(buf_context, '%s: opme %s' % (args[1], commandtoken(weechat.info_get('irc_nick',servername), 'opme:'))) elif args[0] == 'cmd': servername = (weechat.buffer_get_string(buffer, 'name').split('.'))[0] cmdargs = ','.join(args[2:]) token = commandtoken(weechat.info_get('irc_nick',servername), ':'.join([args[1],cmdargs])) weechat.command(buffer, ';;%s %s %s' % (args[1], token, ' '.join(args[2:]))) else: weechat.prnt('', 'Invalid command in czar.') return weechat.WEECHAT_RC_OK if __name__ == '__main__': if weechat.register(SCRIPT_NAME, SCRIPT_AUTHOR, SCRIPT_VERSION, SCRIPT_LICENSE, SCRIPT_DESC, '', ''): version = weechat.info_get('version_number', '') or 0 for option, value in czar_settings_default.items(): if weechat.config_is_set_plugin(option): czar_settings[option] = weechat.config_get_plugin(option) else: weechat.config_set_plugin(option, value[0]) czar_settings[option] = value[0] if int(version) >= 0x00030500: weechat.config_set_desc_plugin(option, '%s (default: "%s")' % (value[1], value[0])) weechat.hook_config('plugins.var.python.%s.*' % SCRIPT_NAME, 'czar_config_cb', '') #weechat.hook_print('', '', 'CHALLENGE', 1, 'czar_msg_cb', '') weechat.hook_command(SCRIPT_COMMAND, SCRIPT_DESC, 'op|cmd', ' op <nick> [channel]: request to be opped in the current channel or [channel] if specified, by <nick>\n' 'cmd <cmd>: issue <cmd> to all bots (do not specify the cmdchar)', 'op|cmd', 'czar_cmd_cb', '')
Python
0
23086155315b39e814a1a73b49c80b19cbdb8e12
476. Number Complement
p476.py
p476.py
import unittest class Solution(object): def findComplement(self, num): """ :type num: int :rtype: int """ mask = num mask |= mask >> 1 mask |= mask >> 2 mask |= mask >> 4 mask |= mask >> 8 mask |= mask >> 16 return num ^ mask class Test(unittest.TestCase): def test(self): self._test(5, 2) self._test(1, 0) def _test(self, num, expected): actual = Solution().findComplement(num) self.assertEqual(actual, expected) if __name__ == '__main__': unittest.main()
Python
0.999999
af19c62cfa27f27cd37bf558ac77a7845dff7754
Create generate_chapters.py
sandbox/generate_chapters.py
sandbox/generate_chapters.py
@language python VOLUME = 'II' TOTAL_CHAPTERS = 42 URL = "http://www.feynmanlectures.caltech.edu/{0}_{1:02}.html" copied_position = p.copy() for index in range(1, TOTAL_CHAPTERS+1): new_node = copied_position.insertAsLastChild() new_node.h = "@chapter {0} Chapter {1:02} - ".format(VOLUME, index) new_node.b = URL.format(VOLUME, index) c.redraw_now()
Python
0.000009
48115d48da43f7f4517d8f55edee95d6c9e7cc45
Create saveGraphToFile.py
save-load/saveGraphToFile.py
save-load/saveGraphToFile.py
from py2neo import Graph, Node, Relationship graph = Graph() # Get username usr_name = input("Enter username: ") print ("Username: " + usr_name) # Get user_id usr_id = input("Enter user id: ") print ("User id: " + usr_id) print("Nodes") resultsAllNodes = graph.cypher.execute("MATCH (n) RETURN n") print(resultsAllNodes) print("Nodes plus relationships") resultsAll = graph.cypher.execute("START n=node(*) MATCH (n)-[r]->(m) RETURN n,r,m") print(resultsAll) query1 = "MATCH (user { username:'" query1 = query1 + usr_name query1 = query1 + "' })-[:" query1 = query1 + usr_id query1 = query1 + "]->(n) RETURN n" results = graph.cypher.execute(query1); print(results) query2 = "MATCH (user { username:'" query2 = query2 + usr_name query2 = query2 + "' })-[:" query2 = query2 + usr_id query2 = query2 + "]->(n)-[r]->(m) RETURN r" results2 = graph.cypher.execute(query2); print(results2) f = open('graph.txt', 'w') f.write(usr_name+"\n") f.write(usr_id+"\n") s = str(results) s2 = str(results2) f.write(s) f.write(s2) f.close()
Python
0.000001
34fff4bf13fa2c4d481a06339981db08239138ae
add test case of petitlyrics
lyric_engine/tests/test_petitlyrics.py
lyric_engine/tests/test_petitlyrics.py
# coding: utf-8 import os import sys module_dir = os.path.join(os.path.dirname(os.path.realpath(__file__)), '..', 'modules') sys.path.append(module_dir) import unittest from petitlyrics import PetitLyrics as Lyric class PetitLyricsTest(unittest.TestCase): def test_url_01(self): url = 'http://petitlyrics.com/lyrics/34690' obj = Lyric(url) obj.parse() self.assertEqual(obj.title, u'Tune The Rainbow') self.assertEqual(obj.artist, u'坂本 真綾') self.assertEqual(obj.lyricist, u'岩里 祐穂') self.assertEqual(obj.composer, u'菅野 よう子') self.assertEqual(len(obj.lyric), 819) def test_url_02(self): url = 'http://petitlyrics.com/lyrics/936622' obj = Lyric(url) obj.parse() self.assertEqual(obj.title, u'RPG') self.assertEqual(obj.artist, u'SEKAI NO OWARI') self.assertEqual(obj.lyricist, u'Saori/Fukase') self.assertEqual(obj.composer, u'Fukase') self.assertEqual(len(obj.lyric), 933) if __name__ == '__main__': unittest.main()
Python
0.002379
16fd4ba06b6da8ec33a83a8cfe2e38a130fb47b3
Add a module for common plotting routines that will be used.
plot.py
plot.py
#!/usr/bin/env python """ plot.py State Estimation and Analysis for PYthon Module with plotting utilities Written by Brian Powell on 10/18/13 Copyright (c)2013 University of Hawaii under the BSD-License. """ from __future__ import print_function import numpy as np from scipy import ndimage import os import re from matplotlib import pyplot as plt def stackbar(x, y, colors=None, **kwargs): """ Given an array of vectors in y, draw a bar chart for each one stacked on the prior. """ s=y[0,:] if colors is None: colors = [ "" for i in range(0,y.shape[0]) ] plt.bar(x, y[0,:], color=colors[0], **kwargs) for i in range(1,y.shape[0]): plt.bar(x, y[i,:], color=colors[i], bottom=s, **kwargs) s=s+y[i,:]
Python
0
cbbc6d943ebc4f7e1efa84f2c0b5d976de21101d
Add "imported from" source using a hardcoded list of items
scripts/claimit.py
scripts/claimit.py
# -*- coding: utf-8 -*- """ Copyright (C) 2013 Legoktm Copyright (C) 2013 Pywikipediabot team Distributed under the MIT License Usage: python claimit.py [pagegenerators] P1 Q2 P123 Q456 You can use any typical pagegenerator to provide with a list of pages Then list the property-->target pairs to add. """ import pywikibot from pywikibot import pagegenerators repo = pywikibot.Site().data_repository() source_values = {'en': pywikibot.ItemPage(repo, 'Q328'), 'sv': pywikibot.ItemPage(repo, 'Q169514'), 'de': pywikibot.ItemPage(repo, 'Q48183'), 'it': pywikibot.ItemPage(repo, 'Q11920'), 'no': pywikibot.ItemPage(repo, 'Q191769'), 'ar': pywikibot.ItemPage(repo, 'Q199700'), 'es': pywikibot.ItemPage(repo, 'Q8449'), 'pl': pywikibot.ItemPage(repo, 'Q1551807'), 'ca': pywikibot.ItemPage(repo, 'Q199693'), 'fr': pywikibot.ItemPage(repo, 'Q8447'), 'nl': pywikibot.ItemPage(repo, 'Q10000'), 'pt': pywikibot.ItemPage(repo, 'Q11921'), 'ru': pywikibot.ItemPage(repo, 'Q206855'), 'vi': pywikibot.ItemPage(repo, 'Q200180'), 'be': pywikibot.ItemPage(repo, 'Q877583'), 'uk': pywikibot.ItemPage(repo, 'Q199698'), 'tr': pywikibot.ItemPage(repo, 'Q58255'), } # TODO: This should include all projects imported_from = pywikibot.Claim(repo, 'p143') source = source_values.get(pywikibot.Site().language(), None) if source: imported_from.setTarget(source) def addClaims(page, claims): ''' The function will add the claims to the wikibase page ''' item = pywikibot.ItemPage.fromPage(page) pywikibot.output('Processing %s' % page) if not item.exists(): pywikibot.output('%s doesn\'t have a wikidata item :(' % page) #TODO FIXME: We should provide an option to create the page return False for claim in claims: if claim.getID() in item.get().get('claims'): pywikibot.output(u'A claim for %s already exists. Skipping' % (claim.getID(),)) #TODO FIXME: This is a very crude way of dupe checking else: pywikibot.output('Adding %s --> %s' % (claim.getID(), claim.getTarget().getID())) item.addClaim(claim) if source: claim.addSource(imported_from, bot=True) #TODO FIXME: We need to check that we aren't adding a duplicate def main(): gen = pagegenerators.GeneratorFactory() commandline_claims = list() for arg in pywikibot.handleArgs(): if gen.handleArg(arg): continue commandline_claims.append(arg) if len(commandline_claims) % 2: raise ValueError # or something. claims = list() for i in xrange (0, len(commandline_claims), 2): claim = pywikibot.Claim(repo, commandline_claims[i]) claim.setTarget(pywikibot.ItemPage(repo, commandline_claims[i+1])) claims.append(claim) generator = gen.getCombinedGenerator() if generator: for page in generator: addClaims(page, claims) if __name__ == "__main__": main()
# -*- coding: utf-8 -*- """ Copyright (C) 2013 Legoktm Copyright (C) 2013 Pywikipediabot team Distributed under the MIT License Usage: python claimit.py [pagegenerators] P1 Q2 P123 Q456 You can use any typical pagegenerator to provide with a list of pages Then list the property-->target pairs to add. """ import pywikibot from pywikibot import pagegenerators repo = pywikibot.Site().data_repository() def addClaims(page, claims): ''' The function will add the claims to the wikibase page ''' item = pywikibot.ItemPage.fromPage(page) pywikibot.output('Processing %s' % page) if not item.exists(): pywikibot.output('%s doesn\'t have a wikidata item :(' % page) #TODO FIXME: We should provide an option to create the page return False for claim in claims: if claim.getID() in item.get().get('claims'): pywikibot.output(u'A claim for %s already exists. Skipping' % (claim.getID(),)) #TODO FIXME: This is a very crude way of dupe checking else: pywikibot.output('Adding %s --> %s' % (claim.getID(), claim.getTarget().getID())) item.addClaim(claim) #TODO FIXME: We should add a source for each claim that is added #TODO FIXME: We need to check that we aren't adding a duplicate def main(): gen = pagegenerators.GeneratorFactory() commandline_claims = list() for arg in pywikibot.handleArgs(): if gen.handleArg(arg): continue commandline_claims.append(arg) if len(commandline_claims) % 2: raise ValueError # or something. claims = list() for i in xrange (0, len(commandline_claims), 2): claim = pywikibot.Claim(repo, commandline_claims[i]) claim.setTarget(pywikibot.ItemPage(repo, commandline_claims[i+1])) claims.append(claim) generator = gen.getCombinedGenerator() if generator: for page in generator: addClaims(page, claims) if __name__ == "__main__": main()
Python
0.000051
a57fcbd436780adfaacfefb426b53458c65e1012
Create pubnubStreamUnlimited.py
pubnubStreamUnlimited.py
pubnubStreamUnlimited.py
from pubnub.callbacks import SubscribeCallback from pubnub.enums import PNStatusCategory from pubnub.pnconfiguration import PNConfiguration from pubnub.pubnub import PubNub from tweepy.streaming import StreamListener from tweepy import OAuthHandler from tweepy import Stream import json # Variables that contains the user credentials to access Twitter API access_token = "Twitter_Access_Token" access_token_secret = "Twitter_Access_Token_Secret" consumer_key = "Twitter_Consumer_Key" consumer_secret = "Twitter_Consumer_Secret" # Configure personal subscribe and publish key pnconfigRachel = PNConfiguration() pnconfigRachel.subscribe_key = 'Pubnub_Subscribe_Key' pnconfigRachel.publish_key = 'Pubnub_Publish_Key' pubnubRachel = PubNub(pnconfigRachel) # Callback for any publish def my_publish_callback(envelope, status): # Check whether request successfully completed or not if not status.is_error(): print("Published") pass # Message successfully published to specified channel. else: print("Publish Error") pass # Handle message publish error. Check 'category' property to find out possible issue # because of which request did fail. # Request can be resent using: [status retry]; # This is a basic listener that just prints received tweets to stdout. class StdOutListener(StreamListener): # Initiate session_id for the Watson block session_Id = 0 def on_data(self, data): try: tweet = json.loads(data) self.session_Id = self.session_Id + 1 pubnubRachel.publish().channel("sentiment-analysis").message({"session_id":self.session_Id,"text":tweet['text']}).async(my_publish_callback) return True except KeyError: pass def on_error(self, status): print status # Callback for sentiment channel class SentimentSubscribeCallback(SubscribeCallback): # Your Initial State bucket key # Make sure to create a bucket in IS with the same key bucket_key = "pubnubtrump" def presence(self, pubnub, presence): pass # handle incoming presence data def status(self, pubnub, status): if status.category == PNStatusCategory.PNUnexpectedDisconnectCategory: pass # This event happens when radio / connectivity is lost elif status.category == PNStatusCategory.PNConnectedCategory: # Connect event. You can do stuff like publish, and know you'll get it. # Or just use the connected event to confirm you are subscribed for # UI / internal notifications, etc pass elif status.category == PNStatusCategory.PNReconnectedCategory: pass # Happens as part of our regular operation. This event happens when # radio / connectivity is lost, then regained. elif status.category == PNStatusCategory.PNDecryptionErrorCategory: pass # Handle message decryption error. Probably client configured to # encrypt messages and on live data feed it received plain text. # Here we construct and publish a payload made up of parameters from sentiment analysis def message(self, pubnub, message): previous_message = "placeholder" if previous_message != message.message: if 'session_sentiment' in message.message: payloadMsg = {"key": "Tweet","value": message.message['text']} if 'positive' in message.message['session_sentiment']: payloadPos = {"key": "Positive Level","value":message.message['session_sentiment']['positive']['count']} else: payloadPos = {"key": "Positive Level","value":0} if 'negative' in message.message['session_sentiment']: payloadNeg={"key": "Negative Level","value": message.message['session_sentiment']['negative']['count']} else: payloadNeg={"key": "Negative Level","value": 0} if 'neutral' in message.message['session_sentiment']: payloadNeut={"key": "Neutral Level","value": message.message['session_sentiment']['neutral']['count']} else: payloadNeut={"key": "Neutral Level","value": 0} payloadScore={"key": "Score","value": message.message['score']} if message.message['score'] > 0.25: payloadCoord={"key": "User Location Pos","value":TwitterSubscribeCallback.coord} elif message.message['score'] < -0.25: payloadCoord={"key": "User Location Neg","value":TwitterSubscribeCallback.coord} elif TwitterSubscribeCallback.coord == "none": payloadCoord={"key": "User Location","value":"No location data"} else: payloadCoord={"key": "User Location Neut","value":TwitterSubscribeCallback.coord} payload=merge(payloadMsg,payloadPos,payloadNeg,payloadNeut,payloadScore,payloadCoord) print payload payload = {"events": payload, "bucketKey": self.bucket_key} pubnubRachel.publish().channel("initial-state-streamer").message(payload).async(my_publish_callback) previous_message = message.message pass else: print "No sentiment message from Watson" pass else: print "Duplicate Message" pass # Function that batches all the events associated with one tweet def merge(set1,set2,set3,set4,set5,set6): lst=[] lst.append(set1) lst.append(set2) lst.append(set3) lst.append(set4) lst.append(set5) lst.append(set6) return lst #This handles Twitter authetification and the connection to Twitter Streaming API l = StdOutListener() auth = OAuthHandler(consumer_key, consumer_secret) auth.set_access_token(access_token, access_token_secret) stream = Stream(auth, l) #This line filters Twitter Streams to capture data by the keywords below stream.filter(track=['Trump','trump','POTUS','potus']) # Configure PubNub subscriptions pubnubRachel.add_listener(SentimentSubscribeCallback()) pubnubRachel.subscribe().channels('sentiment-analysis').execute()
Python
0.000001
dcca5e257336b7c28568c1a0535d4c3520836e8b
Create serializekiller.py
serializekiller.py
serializekiller.py
#!/usr/bin/env python #------------------------------------------------------------------------------- # Name: SerializeKiller # Purpose: Finding vulnerable vulnerable servers # # Author: (c) John de Kroon, 2015 #------------------------------------------------------------------------------- import os import subprocess import json import threading import time import socket import sys import argparse from datetime import datetime parser = argparse.ArgumentParser(prog='serializekiller.py', formatter_class=argparse.RawDescriptionHelpFormatter, description="""SerialIceKiller. Usage: ./serializekiller.py targets.txt """) parser.add_argument('file', help='File with targets') args = parser.parse_args() def nmap(url, retry = False, *args): global num_threads global shellCounter global threads num_threads +=1 found = False cmd = 'nmap --open -p 1099,5005,8880,7001,16200 '+url print "Scanning: "+url try: p = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.PIPE, shell=True) out, err = p.communicate() if "5005" in out: if(verify(url, "5005")): found = True if "8880" in out: if(verify(url, "8880")): found = True if "1099" in out: print " - (Possibly) Vulnerable "+url+" (1099)" found = True if "7001" in out: if(weblogic(url, 7001)): found = True if "16200" in out: if(weblogic(url, 16200)): found = True if(found): shellCounter +=1 num_threads -=1 except: num_threads -=1 threads -= 1 time.sleep(5) if(retry): print " ! Unable to scan this host "+url else: nmap(url, True) def verify(url, port, retry = False): try: cmd = 'curl -m 10 --insecure https://'+url+":"+port p = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.PIPE, shell=True) out, err = p.communicate() if "rO0AB" in out: print " - Vulnerable Websphere: "+url+" ("+port+")" return True cmd = 'curl -m 10 http://'+url+":"+port with open(os.devnull, 'w') as fp: p = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.PIPE, shell=True) out, err = p.communicate() if "rO0AB" in out: print " - Vulnerable Websphere: "+url+" ("+port+")" return True except: time.sleep(3) if(retry): print " ! Unable to verify vulnerablity for host "+url+":"+str(port) return False return verify(url, port, True) #Used this part from https://github.com/foxglovesec/JavaUnserializeExploits def weblogic(url, port): sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM) server_address = (url, port) sock.connect(server_address) # Send headers headers='t3 12.2.1\nAS:255\nHL:19\nMS:10000000\nPU:t3://us-l-breens:7001\n\n' sock.sendall(headers) data = sock.recv(1024) sock.close() if "HELO" in data: print " - Vulnerable Weblogic: "+url+" ("+str(port)+")" return True return False def dispatch(url): try: threading.Thread(target=nmap, args=(url, False, 1)).start() except: print " ! Unable to start thread. Waiting..." time.sleep(2) threads -= 2 dispatch(url) def worker(): with open(args.file) as f: content = f.readlines() for url in content: while((num_threads > threads)): time.sleep(1) url = str(url.replace("\r", '')) url = str(url.replace("\n", '')) url = str(url.replace("/", '')) dispatch(url) while(num_threads > 1): time.sleep(1) if(shellCounter > 0): shellCounterText = "\033[1;31m"+str(shellCounter)+"\033[1;m" else: shellCounterText = str(shellCounter) print "\r\n => scan done. "+shellCounterText+" vulnerable hosts found." print "Execution time: "+str(datetime.now() - startTime) exit() if __name__ == '__main__': startTime = datetime.now() print "\033[1;31mStart SerializeKiller...\033[1;m" print "This could take a while. Be patient.\r\n" num_threads = 0 threads = 30 shellCounter = 0 t = threading.Thread(target=worker).start()
Python
0.000044
94d40dfcf574d61df7def99a43d5b9fa0c75e244
Add py solution for 406. Queue Reconstruction by Height
py/queue-reconstruction-by-height.py
py/queue-reconstruction-by-height.py
from collections import defaultdict class Solution(object): def insert(self, now, p, front): lsize = 0 if now.left is None else now.left.val[1] if front <= lsize: if now.left is None: now.left = TreeNode((p, 1)) else: self.insert(now.left, p, front) else: if now.right is None: now.right = TreeNode((p, 1)) else: self.insert(now.right, p, front - lsize - 1) now.val = (now.val[0], now.val[1] + 1) def inOrder(self, cur): if cur: for x in self.inOrder(cur.left): yield x yield cur.val[0] for x in self.inOrder(cur.right): yield x def reconstructQueue(self, people): """ :type people: List[List[int]] :rtype: List[List[int]] """ if not people: return people people.sort(key=lambda x:(-x[0], x[1])) root = TreeNode((people[0], 1)) for p in people[1:]: self.insert(root, p, p[1]) return list(self.inOrder(root))
Python
0.000749
8fb97711dd84512a8a654de3dca2bee24689a2a7
add a test for pytestmark
pytest_tornado/test/test_fixtures.py
pytest_tornado/test/test_fixtures.py
import pytest from tornado import gen _used_fixture = False @gen.coroutine def dummy(io_loop): yield gen.Task(io_loop.add_callback) raise gen.Return(True) @pytest.fixture(scope='module') def preparations(): global _used_fixture _used_fixture = True pytestmark = pytest.mark.usefixtures('preparations') @pytest.mark.xfail(pytest.__version__ < '2.7.0', reason='py.test 2.7 adds hookwrapper, fixes collection') @pytest.mark.gen_test def test_uses_pytestmark_fixtures(io_loop): assert (yield dummy(io_loop)) assert _used_fixture
Python
0.000008
76ce9117ed92a743734cd5ba7e209617a7664ad1
Add partial benchmarking file for gala
benchmarks/bench_gala.py
benchmarks/bench_gala.py
import os from gala import imio, features, agglo, classify rundir = os.path.dirname(__file__) dd = os.path.abspath(os.path.join(rundir, '../tests/example-data')) em3d = features.default.paper_em() def setup_trdata(): wstr = imio.read_h5_stack(os.path.join(dd, 'train-ws.lzf.h5')) prtr = imio.read_h5_stack(os.path.join(dd, 'train-p1.lzf.h5')) gttr = imio.read_h5_stack(os.path.join(dd, 'train-gt.lzf.h5')) return wstr, prtr, gttr def setup_tsdata(): wsts = imio.read_h5_stack(os.path.join(dd, 'test-ws.lzf.h5')) prts = imio.read_h5_stack(os.path.join(dd, 'test-p1.lzf.h5')) gtts = imio.read_h5_stack(os.path.join(dd, 'test-gt.lzf.h5')) return wsts, prts, gtts def setup_trgraph(): ws, pr, ts = setup_trdata() g = agglo.Rag(ws, pr, feature_manager=em3d) return g def setup_tsgraph(): ws, pr, ts = setup_tsdata() g = agglo.Rag(ws, pr, feature_manager=em3d) return g def setup_trexamples(): gt = imio.read_h5_stack(os.path.join(dd, 'train-gt.lzf.h5')) g = setup_trgraph() (X, y, w, e), _ = g.learn_agglomerate(gt, em3d, min_num_epochs=5) y = y[:, 0] return X, y def setup_classifier(): X, y = setup_trexamples() rf = classify.DefaultRandomForest() rf.fit(X, y) return rf def setup_policy(): rf = classify.DefaultRandomForest() cl = agglo.classifier_probability(em3d, rf) return cl def setup_tsgraph_queue(): g = setup_tsgraph() cl = setup_policy() g.merge_priority_function = cl g.rebuild_merge_queue() return g
Python
0
79fb9449da73e70ef7ed9e1e6862da41fc42ab75
Add finalized source codes
src/hw1.py
src/hw1.py
import networkx as nx import numpy as np import matplotlib.pyplot as plt import pylab G = nx.Graph() G.add_edges_from([('1','2'),('1','4'),('2','3'),('2','4'),('3','4'),('4','5'),('5','6'),('5','7'),('6','7')]) # create the graph print G.nodes(), '\n', G.edges(), '\n', G.degree().values() # check graph is correct adj = nx.adj_matrix(G) print "adjency matrix: \n", adj.todense() # print adjency matrix k_ij = np.outer(G.degree().values(), G.degree().values()) mod = adj - k_ij / (2.*len(G.edges())) print "modularity matrix: \n", mod # suppose we only have 2 communities, we can iterate all the possible situations # and get the optimum partition modval_opt = -100000 z_opt = np.zeros((len(G.nodes()), 2)) for i in range(0, 2**(len(G.nodes())-1)): # iterate all the possible membership partition = np.matrix(map(int, list('{0:07b}'.format(i)))) # get a membership vector directly from the bits of an interger # e.g. i = 2, list('{0:07b}'.format(i)) will give a list # ['0', '0', '0', '0', '0','1','0'] # map(int, list) will change it to be a int list [..., 1, 0] Z = np.transpose(np.concatenate((partition, 1-partition))) # this is a 7x2 membership matrix # print Z, "\n" modval_partition = np.trace(Z.transpose() * mod * Z) / (2*len(G.edges())) if modval_opt < modval_partition: modval_opt = modval_partition z_opt = Z print "\n optimal community membership: \n", z_opt, "\n corresponds to maximum modularity value:\n", modval_opt # print the graph with community in different color and node size propotional to # its degree plt.figure(figsize=(8,6)) pos = nx.spring_layout(G) nx.draw_networkx_nodes(G, pos, node_color=np.array(z_opt.transpose())[0], node_size=400*np.array(G.degree().values()), alpha=0.8, linewidths=0) labels = {} for node in G.nodes(): labels[node] = r'$'+node+'$' nx.draw_networkx_labels(G, pos, labels, font_size=24) nx.draw_networkx_edges(G, pos, width=16, edge_color='g', alpha=0.5) plt.axis('off') plt.show() # for problem 3, to plot your facebook network. For me you can clearly see my #friends is divided into 2 communities. import codecs with codecs.open('myFacebook.gml','r', 'utf8') as f: # don't use networkx.read_gml() functions, it will have lines = f.readlines() # UnicodeDecodeError, use these three lines to load gml fbG = nx.readwrite.gml.parse_gml(lines, relabel=True) # into a networkx graph plt.figure(figsize=(18,12)) pos = nx.spring_layout(fbG) gender = [] wallcount = [] ids = {} deg = [] DegDict = fbG.degree() for name,attr in fbG.node.iteritems(): gender.append(0 if attr['sex'] == 'male' else 1) wallcount.append(attr['wallcount']) ids[name] = attr['id'] deg.append(DegDict[name]) nx.draw_networkx_nodes(fbG, pos, node_color=gender, node_size=200+40*np.array(deg), alpha=0.8, linewidths=0) nx.draw_networkx_edges(fbG, pos, width=1.8, edge_color='black', alpha=0.3) nx.draw_networkx_labels(fbG, pos, labels=ids, font_size=14, font_family='DejaVu Sans') # remove labels=ids will use name as labels plt.axis('off') plt.show()
Python
0.000002
180faadb24bf3b4d153f1c46c4883bdcc0b987ff
add a manifest (.cvmfspublished) abstraction class
python/cvmfs/manifest.py
python/cvmfs/manifest.py
#!/usr/bin/env python # -*- coding: utf-8 -*- """ Created by René Meusel This file is part of the CernVM File System auxiliary tools. """ import datetime class UnknownManifestField: def __init__(self, key_char): self.key_char = key_char def __str__(self): return self.key_char class ManifestValidityError: def __init__(self, message): Exception.__init__(self, message) class Manifest: """ Wraps information from .cvmfspublished""" def __init__(self, manifest_file): """ Initializes a Manifest object from a file pointer to .cvmfspublished """ for line in manifest_file.readlines(): if len(line) == 0: continue if line[0:2] == "--": break self._read_line(line) self._check_validity() def __str__(self): return "<Manifest for " + self.repository_name + ">" def __repr__(self): return self.__str__() def _read_line(self, line): """ Parse lines that appear in .cvmfspublished """ key_char = line[0] data = line[1:-1] if key_char == "C": self.root_catalog = data elif key_char == "X": self.certificate = data elif key_char == "H": self.history_database = data elif key_char == "T": self.last_modified = datetime.datetime.fromtimestamp(int(data)) elif key_char == "R": self.root_hash = data elif key_char == "D": self.ttl = int(data) elif key_char == "S": self.revision = int(data) elif key_char == "N": self.repository_name = data elif key_char == "L": self.unknown_field1 = data # TODO: ask Jakob what L means else: raise UnknownManifestField(key_char) def _check_validity(self): """ Checks that all mandatory fields are found in .cvmfspublished """ if not hasattr(self, 'root_catalog'): raise ManifestValidityError("Manifest lacks a root catalog entry") if not hasattr(self, 'root_hash'): raise ManifestValidityError("Manifest lacks a root hash entry") if not hasattr(self, 'ttl'): raise ManifestValidityError("Manifest lacks a TTL entry") if not hasattr(self, 'revision'): raise ManifestValidityError("Manifest lacks a revision entry") if not hasattr(self, 'repository_name'): raise ManifestValidityError("Manifest lacks a repository name")
Python
0.000001
e044dceeb4f6dd91a1e29228cde7906a114f36ba
add ping-listener.py
src/ping-listener.py
src/ping-listener.py
#!/usr/bin/python # This tool is for educational use only! # Description: Listen on a networkinterface for incomming pings (ICMP packets) # and display this pings on the console # Requirements: scapy + root privileges import sys from scapy.all import * from pprint import * def printusage(): """ Prints usage information """ print "Usage: {0} <iface>".format(sys.argv[0]) print " ---> This tool is for educational use only! <---" if len(sys.argv) < 2: printusage() sys.exit(1) def icmp_callback(packet): # print the whole networkpacket object on the console # TODO: Optimize output... pprint(packet) sniff(prn=icmp_callback, filter="icmp", iface=sys.argv[1], store=0)
Python
0
a2dd80d7bcd1096b554c43d085eabe1eb858fec8
Add code to create test data
code/make_test_data.py
code/make_test_data.py
from __future__ import absolute_import, division, print_function import nibabel as nib import numpy as np import os # Paths to directories containing the test subject's data path_data = "../data/ds005/testsub/" path_BOLD = path_data + "BOLD/task001_testrun/bold.nii.gz" path_behav = path_data + "behav/task001_testrun/behavdata.txt" # Create these directories os.makedirs(path_BOLD) os.makedirs(path_behav) # Give the BOLD data the identity affine for simplicity affine = np.eye(4) # The fMRI data consists of three volumes of shape (3, 3, 3) # Corner elements increase by 1 per unit time # Edge elements increase by 2 per unit time # Center of face elements increase by 3 per unit time # The center element increases by 4 per unit time data = np.array([[[[ 0, 1, 2], [ 1, 3, 5], [ 0, 1, 2]], [[ 1, 3, 5], [ 2, 5, 8], [ 1, 3, 5]], [[ 0, 1, 2], [ 1, 3, 5], [ 0, 1, 2]]], [[[ 1, 3, 5], [ 2, 5, 8], [ 1, 3, 5]], [[ 2, 5, 8], [ 3, 7, 11], [ 2, 5, 8]], [[ 1, 3, 5], [ 2, 5, 8], [ 1, 3, 5]]], [[[ 0, 1, 2], [ 1, 3, 5], [ 0, 1, 2]], [[ 1, 3, 5], [ 2, 5, 8], [ 1, 3, 5]], [[ 0, 1, 2], [ 1, 3, 5], [ 0, 1, 2]]]]) # BOLD.nii contains the above two elements BOLD = nib.nift1.NiftiImage(data, affine) nib.save(BOLD, path_BOLD) # The behavioral data consists of four rows: a row of headers, and one row for # each of three trials that occur at times 0.0, 2.0, and 4.0 behav = "onset\tgain\tloss\tPTval\trespnum\trespcat\tRT\n" behav = behav + "0.00\t10\t20\t-9.80\t4\t0\t1.077\n" behav = behav + "2.00\t20\t20\t0.20\t0\t-1\t0.000\n" behav = behav + "4.00\t30\t20\t10.20\t2\t1\t1.328" # Create behavdata.txt and open to write f = open(path_behav + "behavdata.txt") f.write(behav) f.close()
Python
0.000001
f2fb5fc41c78ac7722812aa1cdb54078bcbc70fe
Add Node test cases
coil/test/test_node.py
coil/test/test_node.py
"""Tests for coil.struct.Node""" import unittest from coil import errors from coil.struct import Node class BasicTestCase(unittest.TestCase): def testInit(self): r = Node() a = Node(r, "a") b = Node(a, "b") self.assertEquals(b.node_name, "b") self.assertEquals(b.node_path, "@root.a.b") self.assert_(b.container is a) self.assert_(b.tree_root is r) class PathTestCase(unittest.TestCase): def setUp(self): self.r = Node() self.a = Node(self.r, "a") self.b = Node(self.a, "b") def testRelative(self): self.assertEquals(self.r.relative_path("@root"), ".") self.assertEquals(self.r.relative_path("@root.a"), "a") self.assertEquals(self.r.relative_path("@root.a.b"), "a.b") self.assertEquals(self.r.relative_path("@root.a.b.c"), "a.b.c") self.assertEquals(self.a.relative_path("@root"), "..") self.assertEquals(self.a.relative_path("@root.a"), ".") self.assertEquals(self.a.relative_path("@root.a.b"), "b") self.assertEquals(self.a.relative_path("@root.a.b.c"), "b.c") self.assertEquals(self.b.relative_path("@root"), "...") self.assertEquals(self.b.relative_path("@root.a"), "..") self.assertEquals(self.b.relative_path("@root.a.b"), ".") self.assertEquals(self.b.relative_path("@root.a.b.c"), "c") self.assertEquals(self.b.relative_path("@root.x.y.z"), "...x.y.z") self.assertEquals(self.b.relative_path("@root.a.x.y"), "..x.y") def testAbsolute(self): self.assertEquals(self.r.absolute_path("."), "@root") self.assertEquals(self.r.absolute_path("a"), "@root.a") self.assertEquals(self.r.absolute_path(".a"), "@root.a") self.assertEquals(self.r.absolute_path("a.b"), "@root.a.b") self.assertEquals(self.b.absolute_path("."), "@root.a.b") self.assertEquals(self.b.absolute_path(".."), "@root.a") self.assertEquals(self.b.absolute_path("..."), "@root") self.assertEquals(self.b.absolute_path("x"), "@root.a.b.x") self.assertEquals(self.b.absolute_path(".x"), "@root.a.b.x") self.assertEquals(self.b.absolute_path("..x"), "@root.a.x") self.assertEquals(self.b.absolute_path("...x"), "@root.x") self.assertRaises(errors.CoilError, self.r.absolute_path, "..") self.assertRaises(errors.CoilError, self.a.absolute_path, "...") self.assertRaises(errors.CoilError, self.b.absolute_path, "....")
Python
0.000001
942b7c519a07a84c7f26077b78c23c60174e1141
Add VCF precalculator
scripts/precalc.py
scripts/precalc.py
# -*- coding: utf-8 -*- ''' Earth Engine precalculator for CLASlite Requires Python 2.6+ Public Domain where allowed, otherwise: Copyright 2010 Michael Geary - http://mg.to/ Use under MIT, GPL, or any Open Source license: http://www.opensource.org/licenses/ ''' import cgi, json, os, sys, time, urllib2 sys.path.append( os.path.abspath('../web/app') ) import private base = private.private['earth-engine-api'] auth = private.private['earth-engine-auth'] sat = 'LANDSAT/L7_L1T' bbox = '-61.6,-11.4,-60.8,-10.6' def fetch( api ): req = urllib2.Request( url = base + api, headers = { 'Authorization': 'GoogleLogin auth=' + auth } ) try: f = urllib2.urlopen( req, None, 600 ) data = f.read() f.close() return json.loads( data ) except urllib2.HTTPError, error: return error.read() def listImages( sat, bbox ): return fetch( 'list?id=%s&bbox=%s' %( sat, bbox ) )['data'] def calcVCF( id ): return fetch( vcfAPI(id) ) def vcfAPI( id ): return 'value?image={"creator":"CLASLITE/VCFAdjustedImage","args":[{"creator":"CLASLITE/AutoMCU","args":["%s",{"creator":"CLASLITE/Reflectance","args":[{"creator":"CLASLITE/Calibrate","args":["%s"]}]}]},"MOD44B_C4_TREE_2000"]}&fields=vcf_adjustment' %( id, id ) def main(): images = listImages( sat, bbox ) count = len(images) n = 0 for image in images: id = image['id'] n += 1 print 'Loading %d/%d: %s' %( n, count, id ) t = time.time() vcf = calcVCF( id ) t = time.time() - t report( vcf, t ) def report( vcf, t ): adjustment = vcf['data']['properties']['vcf_adjustment'] forest = adjustment['forest_pixel_count'] valid = adjustment['valid_pixel_count'] if valid > 0: percent = forest * 100 / valid else: percent = 0 print '%d seconds, %d%% forest' %( t, percent ) if __name__ == "__main__": main()
Python
0.000001
8b9a8f6443c1a5e184ececa4ec03baabca0973de
Add support for Pocket
services/pocket.py
services/pocket.py
from werkzeug.urls import url_decode import requests import foauth.providers class Pocket(foauth.providers.OAuth2): # General info about the provider provider_url = 'http://getpocket.com/' docs_url = 'http://getpocket.com/developer/docs/overview' category = 'News' # URLs to interact with the API request_token_url = 'https://getpocket.com/v3/oauth/request' authorize_url = 'https://getpocket.com/auth/authorize' access_token_url = 'https://getpocket.com/v3/oauth/authorize' api_domain = 'getpocket.com' available_permissions = [ (None, 'access your saved articles'), ] supports_state = False def get_authorize_params(self, redirect_uri, scopes): params = super(Pocket, self).get_authorize_params(redirect_uri, scopes) r = requests.post(self.request_token_url, data={ 'consumer_key': params['client_id'], 'redirect_uri': redirect_uri, }) data = url_decode(r.content) redirect_uri = '%s&code=%s' % (params['redirect_uri'], data['code']) return { 'request_token': data['code'], 'redirect_uri': redirect_uri, } def get_access_token_response(self, redirect_uri, data): return requests.post(self.get_access_token_url(), { 'consumer_key': self.client_id, 'code': data['code'], 'redirect_uri': redirect_uri }) def parse_token(self, content): data = url_decode(content) data['service_user_id'] = data['username'] return data def bearer_type(self, token, r): r.prepare_url(r.url, {'consumer_key': self.client_id, 'access_token': token}) return r
Python
0
8244d71a41032e41bd79741ec649fa78c6317efa
add mixins for tweaking smartmin behavior more easily
smartmin/mixins.py
smartmin/mixins.py
# simple mixins that keep you from writing so much code class PassRequestToFormMixin(object): def get_form_kwargs(self): kwargs = super(PassRequestToFormMixin, self).get_form_kwargs() kwargs['request'] = self.request return kwargs
Python
0
32dd2099f97add61cb31df7af796876a95695bb1
Add a sample permission plugin for illustrating the check on realm resources, related to #6211.
sample-plugins/public_wiki_policy.py
sample-plugins/public_wiki_policy.py
from fnmatch import fnmatchcase from trac.config import Option from trac.core import * from trac.perm import IPermissionPolicy class PublicWikiPolicy(Component): """Sample permission policy plugin illustrating how to check permission on realms. Don't forget to integrate that plugin in the appropriate place in the list of permission policies: {{{ [trac] permission_policies = PublicWikiPolicy, DefaultPermissionPolicy }}} Then you can configure which pages you want to make public: {{{ [public_wiki] view = Public* modify = PublicSandbox/* }}} """ implements(IPermissionPolicy) view = Option('public_wiki', 'view', 'Public*', """Case-sensitive glob pattern used for granting view permission on all Wiki pages matching it.""") modify = Option('public_wiki', 'modify', 'Public*', """Case-sensitive glob pattern used for granting modify permissions on all Wiki pages matching it.""") def check_permission(self, action, username, resource, perm): if resource: # fine-grained permission check if resource.realm == 'wiki': # wiki realm or resource if resource.id: # ... it's a resource if action == 'WIKI_VIEW': # (think 'VIEW' here) pattern = self.view else: pattern = self.modify if fnmatchcase(resource.id, pattern): return True else: # ... it's a realm return True # this policy ''may'' grant permissions on some wiki pages else: # coarse-grained permission check # # support for the legacy permission checks: no resource specified # and realm information in the action name itself. # if action.startswith('WIKI_'): return True # this policy ''may'' grant permissions on some wiki pages
Python
0.000003
1c39eb113be409ff304a675ef8a85e96a97b1d87
Add files via upload
basicTwitter.py
basicTwitter.py
''' RIT SPEX: Twitter posting basic. Basic python script for posting to twitter. Pre-Req: Python3 Tweepy library twitter Contributors: Evan Putnam Henry Yaeger John LeBrun Helen O'Connell ''' import tweepy #Tweet a picutre def tweetPicture(api ,picUrl): api.update_with_media(picUrl) #Tweet a post def tweetPost(api, postStr): api.update_status(postStr) def apiSetUp(conKey, conSec, accTok, accSec): ''' Sets up the api object. :param conKey: :param conSec: :param accTok: :param accSec: :return: ''' #Authenicates keys... auth = tweepy.OAuthHandler(conKey, conSec) auth.set_access_token(accTok, accSec) #Api object api = tweepy.API(auth) return api def main(): """ NOTE: Do not send code to others with the consumer keys and access tokens. It will allow them to access your twitter application. This program is simple. Enter 1 to post a twitter text post and 2 for an image post... :return: """ #REPLACE WITH CONSUMER KEYS conKey = "" conSec = "" #REPLACE WITH ACCESS TOKENS accTok = "" accSec = "" if conKey == "" or conSec == "" or accTok == "" or accSec == "": print("WARNING YOU HAVE NOT ENTERERED YOUR INFORMATION") #Authenicates keys... auth = tweepy.OAuthHandler(conKey, conSec) auth.set_access_token(accTok, accSec) #Api object api = tweepy.API(auth) print("Press and enter 1 to post a text tweet") print("Press and enter 2 to post an image tweet") option = int(input("Enter Option(1 or 2):")) if option == 1: post = (input("Enter Post:")) tweetPost(api, post) elif option == 2: print("Image must be in folder of program") imagePath = (input("Enter Image Path:")) tweetPicture(api,imagePath) if __name__ == '__main__': main()
Python
0
eb170653e64c5a874a773dc37c99dccb4dd42608
Add tools.color module (#41, #36))
xentica/tools/color.py
xentica/tools/color.py
"""A collection of color conversion helpers.""" def hsv2rgb(hue, sat, val): """ Convert HSV color to RGB format. :param hue: Hue value [0, 1] :param sat: Saturation value [0, 1] :param val: Brightness value [0, 1] :returns: tuple (red, green, blue) """ raise NotImplementedError def rgb2hsv(red, green, blue): """ Convert RGB color to HSV format. :param red: Red value [0, 1] :param green: Green value [0, 1] :param blue: Blue value [0, 1] :returns: tuple (hue, sat, val) """ raise NotImplementedError def genome2rgb(genome): """ Convert genome bit value to RGB color. :param genome: Genome as integer (bit) sequence. :returns: tuple (red, green, blue) """ raise NotImplementedError
Python
0
1d5f1576a5f92c1917fa29c457e4b7ad055f41ca
Add info for mono@5.4.0.167 (#5405)
var/spack/repos/builtin/packages/mono/package.py
var/spack/repos/builtin/packages/mono/package.py
############################################################################### # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/llnl/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class Mono(AutotoolsPackage): """Mono is a software platform designed to allow developers to easily create cross platform applications. It is an open source implementation of Microsoft's .NET Framework based on the ECMA standards for C# and the Common Language Runtime. """ homepage = "http://www.mono-project.com/" url = "https://download.mono-project.com/sources/mono/mono-5.0.1.1.tar.bz2" # /usr/share/.mono/keypairs needs to exist or be able to be # created, e.g. https://github.com/gentoo/dotnet/issues/6 variant('patch-folder-path', default=False, description='Point SpecialFolder.CommonApplicationData folder ' 'into Spack installation instead of /usr/share') # Spack's openssl interacts badly with mono's vendored # "boringssl", don't drag it in w/ cmake depends_on('cmake~openssl', type=('build')) depends_on('libiconv') depends_on('perl', type=('build')) version('5.4.0.167', '103c7a737632046a9e9a0b039d752ee1') version('5.0.1.1', '17692c7a797f95ee6f9a0987fda3d486') version('4.8.0.524', 'baeed5b8139a85ad7e291d402a4bcccb') def patch(self): if '+patch-folder-path' in self.spec: before = 'return "/usr/share";' after = 'return "{0}";'.format(self.prefix.share) f = 'mcs/class/corlib/System/Environment.cs' kwargs = {'ignore_absent': False, 'backup': True, 'string': True} filter_file(before, after, f, **kwargs) def configure_args(self): args = [] li = self.spec['libiconv'].prefix args.append('--with-libiconv-prefix={p}'.format(p=li)) return args
############################################################################### # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/llnl/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class Mono(AutotoolsPackage): """Mono is a software platform designed to allow developers to easily create cross platform applications. It is an open source implementation of Microsoft's .NET Framework based on the ECMA standards for C# and the Common Language Runtime. """ homepage = "http://www.mono-project.com/" url = "https://download.mono-project.com/sources/mono/mono-5.0.1.1.tar.bz2" # /usr/share/.mono/keypairs needs to exist or be able to be # created, e.g. https://github.com/gentoo/dotnet/issues/6 variant('patch-folder-path', default=False, description='Point SpecialFolder.CommonApplicationData folder ' 'into Spack installation instead of /usr/share') # Spack's openssl interacts badly with mono's vendored # "boringssl", don't drag it in w/ cmake depends_on('cmake~openssl', type=('build')) depends_on('libiconv') depends_on('perl', type=('build')) version('5.0.1.1', '17692c7a797f95ee6f9a0987fda3d486') version('4.8.0.524', 'baeed5b8139a85ad7e291d402a4bcccb') def patch(self): if '+patch-folder-path' in self.spec: before = 'return "/usr/share";' after = 'return "{0}";'.format(self.prefix.share) f = 'mcs/class/corlib/System/Environment.cs' kwargs = {'ignore_absent': False, 'backup': True, 'string': True} filter_file(before, after, f, **kwargs) def configure_args(self): args = [] li = self.spec['libiconv'].prefix args.append('--with-libiconv-prefix={p}'.format(p=li)) return args
Python
0
d03edd6670c130925fa8b947ebde03f2026602c3
remove redundant verbose prints
dj/scripts/mk_public.py
dj/scripts/mk_public.py
#!/usr/bin/python # mk_public.py - flip state on hosts from private to public # private = not listed, can be seen if you know the url # the presenters have been emaild the URL, # they are encouraged to advertise it. # public = advertised, it is ready for the world to view. # It will be tweeted at @NextDayVideo from steve.richardapi import update_video, MissingRequiredData from steve.restapi import API, get_content import youtube_uploader import gdata.youtube from gdata.media import YOUTUBE_NAMESPACE from atom import ExtensionElement import atom import pw from process import process import pprint from main.models import Show, Location, Episode, Raw_File, Cut_List class mk_public(process): ready_state = 9 def up_richard(self, ep): host = pw.richard[ep.show.client.richard_id] endpoint = 'http://{hostname}/api/v1'.format(hostname=host['host']) api = API(endpoint) vid = ep.public_url.split('/video/')[1].split('/')[0] response = api.video(vid).get( username=host['user'], api_key=host['api_key']) video_data = get_content(response) video_data['state'] = 1 try: update_video(endpoint, host['user'], host['api_key'], vid, video_data) except MissingRequiredData, e: # this shouldn't happen, prolly debugging something. import code code.interact(local=locals()) return True def up_youtube(self, ep): uploader = youtube_uploader.Uploader() uploader.user = ep.show.client.youtube_id return uploader.set_permission( ep.host_url ) def process_ep(self, ep): # set youtube to public # set richard state to live ret = True # if something breaks, this will be false # don't make public if there is no host_url (youtube) if ep.public_url and ep.host_url: ret = ret and self.up_richard(ep) if self.options.verbose: print "Richard public." if ep.host_url: ret = ret and self.up_youtube(ep) if self.options.verbose: print "Youtube public." return ret if __name__ == '__main__': p=mk_public() p.main()
#!/usr/bin/python # mk_public.py - flip state on hosts from private to public # private = not listed, can be seen if you know the url # the presenters have been emaild the URL, # they are encouraged to advertise it. # public = advertised, it is ready for the world to view. # It will be tweeted at @NextDayVideo from steve.richardapi import update_video, MissingRequiredData from steve.restapi import API, get_content import youtube_uploader import gdata.youtube from gdata.media import YOUTUBE_NAMESPACE from atom import ExtensionElement import atom import pw from process import process import pprint from main.models import Show, Location, Episode, Raw_File, Cut_List class mk_public(process): ready_state = 9 def up_richard(self, ep): host = pw.richard[ep.show.client.richard_id] endpoint = 'http://{hostname}/api/v1'.format(hostname=host['host']) api = API(endpoint) vid = ep.public_url.split('/video/')[1].split('/')[0] response = api.video(vid).get( username=host['user'], api_key=host['api_key']) video_data = get_content(response) video_data['state'] = 1 try: update_video(endpoint, host['user'], host['api_key'], vid, video_data) except MissingRequiredData, e: # this shouldn't happen, prolly debugging something. import code code.interact(local=locals()) return True def up_youtube(self, ep): uploader = youtube_uploader.Uploader() uploader.user = ep.show.client.youtube_id return uploader.set_permission( ep.host_url ) def process_ep(self, ep): if self.options.verbose: print ep.id, ep.name # set youtube to public # set richard state to live ret = True # if something breaks, this will be false # don't make public if there is no host_url (youtube) if ep.public_url and ep.host_url: ret = ret and self.up_richard(ep) if self.options.verbose: print "Richard public." if ep.host_url: ret = ret and self.up_youtube(ep) if self.options.verbose: print "Youtube public." return ret if __name__ == '__main__': p=mk_public() p.main()
Python
0.956212
197fb6ec004c0bf47ec7e2fd25b75564a3ecf6c4
Add tests for logging of rest requests
test/audit_logs/test_audit_log.py
test/audit_logs/test_audit_log.py
import datetime import pytest from girder import auditLogger @pytest.fixture def recordModel(): from girder.plugins.audit_logs import Record yield Record() @pytest.fixture def resetLog(): yield auditLogger for handler in auditLogger.handlers: auditLogger.removeHandler(handler) @pytest.mark.plugin('audit_logs') def testAnonymousRestRequestLogging(server, recordModel, resetLog): assert list(recordModel.find()) == [] server.request('/user/me') records = recordModel.find() assert records.count() == 1 record = records[0] assert record['ip'] == '127.0.0.1' assert record['type'] == 'rest.request' assert record['userId'] == None assert isinstance(record['when'], datetime.datetime) assert record['details']['method'] == 'GET' assert record['details']['status'] == 200 assert record['details']['route'] == ['user', 'me'] assert record['details']['params'] == {} @pytest.mark.plugin('audit_logs') def testFailedRestRequestLogging(server, recordModel, resetLog): server.request('/folder', method='POST', params={ 'name': 'Foo', 'parentId': 'foo' }) records = recordModel.find() assert records.count() == 1 details = records[0]['details'] assert details['method'] == 'POST' assert details['status'] == 401 assert details['route'] == ['folder'] assert details['params'] == { 'name': 'Foo', 'parentId': 'foo' } @pytest.mark.plugin('audit_logs') def testAuthenticatedRestRequestLogging(server, recordModel, resetLog, admin): server.request('/user/me', user=admin) records = recordModel.find() assert records.count() == 1 record = records[0] assert record['userId'] == admin['_id']
Python
0
9e96a7ff9ad715f58d07341bd571e63ef233ffdb
Create fizzbuzz.py
job_interview_algs/fizzbuzz.py
job_interview_algs/fizzbuzz.py
#!/usr/bin/env python # -*- coding: UTF-8 -*- ''' Created on 24 02 2016 @author: vlad ''' def multiple_of_3(number): return number % 3 == 0 def multiple_of_5(number): return number % 5 == 0 for i in range(1, 100): if not multiple_of_3(i) and not multiple_of_5(i): print i continue if multiple_of_3(i) and multiple_of_5(i): print "fizzbuzz" continue else: print ["fizz", "buzz"][multiple_of_5(i)]
Python
0.00001
8089750d5dccadb0603068eefec869df4f8360cc
Add fizzbuzz.py in strings folder
strings/fizzbuzz.py
strings/fizzbuzz.py
""" Wtite a function that returns an array containing the numbers from 1 to N, where N is the parametered value. N will never be less than 1. Replace certain values however if any of the following conditions are met: If the value is a multiple of 3: use the value 'Fizz' instead If the value is a multiple of 5: use the value 'Buzz' instead If the value is a multiple of 3 & 5: use the value 'FizzBuzz' instead """ """ There is no fancy algorithm to solve fizz buzz. Iterate from 1 through n Use the mod operator to determine if the current iteration is divisible by: 3 and 5 -> 'FizzBuzz' 3 -> 'Fizz' 5 -> 'Buzz' else -> string of current iteration return the results Complexity: Time: O(n) Space: O(n) """ def fizzbuzz(n): # Validate the input if n < 1: raise ValueError('n cannot be less than one') if n is None: raise TypeError('n cannot be None') result = [] for i in range(1, n+1): if i%3 == 0 and i%5 == 0: result.append('FizzBuzz') elif i%3 == 0: result.append('Fizz') elif i%5 == 0: result.append('Buzz') else: result.append(i) return result # Alternative solution def fizzbuzz_with_helper_func(n): return [fb(m) for m in range(1,n+1)] def fb(m): r = (m % 3 == 0) * "Fizz" + (m % 5 == 0) * "Buzz" return r if r != "" else m
Python
0.000001
9ea3c14983c7b2e32132f1ffe6bbbe7b4d19000c
Add Flyweight.py
Python/Flyweight/Flyweight.py
Python/Flyweight/Flyweight.py
#! /usr/bin/python # -*- coding: utf-8 -*- ''' Flyweight Pattern Author: Kei Nakata Data: Oct.14.2014 ''' class FlyweightFactory(object): def __init__(self): self.instances = dict() def getInstance(self, a, b): if (a, b) not in self.instances: self.instances[(a,b)] = Flyweight(a, b) return self.instances[(a, b)] class Flyweight(object): def __init__(self, a, b): self.a = a self.b = b def method(self): print self.a, self.b if __name__ == '__main__': factory = FlyweightFactory() a = factory.getInstance(1, 2) b = factory.getInstance(3, 2) c = factory.getInstance(1, 2) a.method() b.method() c.method() print id(a) print id(b) print id(c)
Python
0.000005
868a771e0ba049edd55ddf38db852c4d34824297
Add pod env tests
tests/test_spawner/test_pod_environment.py
tests/test_spawner/test_pod_environment.py
from unittest import TestCase from scheduler.spawners.templates.pod_environment import ( get_affinity, get_node_selector, get_tolerations ) class TestPodEnvironment(TestCase): def test_pod_affinity(self): assert get_affinity(None, None) is None assert get_affinity({'foo': 'bar'}, None) == {'foo': 'bar'} assert get_affinity(None, '{"foo": "bar"}') == {'foo': 'bar'} assert get_affinity({'foo': 'bar'}, '{"foo": "moo"}') == {'foo': 'bar'} def get_pod_node_selector(self): assert get_node_selector(None, None) is None assert get_node_selector({'foo': 'bar'}, None) == {'foo': 'bar'} assert get_node_selector(None, '{"foo": "bar"}') == {'foo': 'bar'} assert get_node_selector({'foo': 'bar'}, '{"foo": "moo"}') == {'foo': 'bar'} def get_pod_tolerations(self): assert get_tolerations(None, None) is None assert get_tolerations([{'foo': 'bar'}], None) == [{'foo': 'bar'}] assert get_tolerations(None, '[{"foo": "bar"}]') == [{'foo': 'bar'}] assert get_tolerations([{'foo': 'bar'}], '[{"foo": "moo"}]') == {'foo': 'bar'}
Python
0
d5b95c31cb50762a6aee1b460b377a200b34e249
Create createCW_readtxt.py
createCW_readtxt.py
createCW_readtxt.py
def readtext(f): with open(f.loc,encoding="ISO-8859-1") as k: content = k.read().splitlines() i=0 width=0 height=0 acc=0 across=[] dwn=0 down=[] solnblock=[] title="" author="" cpyrt="" notes="" Encoding_2 = "ISO-8859-1" while(content[i]!="<TITLE>"): i=i+1 i=i+1 temp="" while(content[i]!="</TITLE>"): temp=temp+content[i] i=i+1 title=temp i=i+1 if(content[i]=="<AUTHOR>"): i=i+1 temp="" while(content[i]!="</AUTHOR>"): temp=temp+content[i] i=i+1 author=temp i=i+1 if(content[i]=="<COPYRIGHT>"): i=i+1 temp="" while(content[i]!="</COPYRIGHT>"): temp=temp+content[i] i=i+1 cpyrt=temp i=i+1 if(content[i]=="<WIDTH>"): i=i+1 temp="" while(content[i]!="</WIDTH>"): temp=temp+content[i] i=i+1 width=int(temp) i=i+1 if(content[i]=="<HEIGHT>"): i=i+1 temp="" while(content[i]!="</HEIGHT>"): temp=temp+content[i] i=i+1 height=int(temp) i=i+1 if(content[i]=="<GRID>"): i=i+1 r=0 while(content[i]!="</GRID>"): j=0 solnblock.append([]) while(True): temp="" while(content[i][j]!=","): temp=temp+content[i][j] j=j+1 solnblock[r].append(temp) j=j+1 if(j==len(content[i])): break r=r+1 i=i+1 i=i+1 if(content[i]=="<ACROSS>"): i=i+1 while(content[i]!="</ACROSS>"): if(content[i]!="<NULL>"): across.append(content[i]) else: across.append("") i=i+1 acc=len(across) i=i+1 if(content[i]=="<DOWN>"): i=i+1 while(content[i]!="</DOWN>"): if(content[i]!="<NULL>"): down.append(content[i]) else: down.append("") i=i+1 dwn=len(down) i=i+1 if(content[i]=="<NOTEPAD>"): i=i+1 temp="" while(content[i]!="</NOTEPAD>"): temp=temp+content[i] i=i+1 notes=temp f.title=title f.author=author f.cpyrt=cpyrt f.notes=notes f.width=width f.height=height f.solnblock=solnblock f.acc=acc f.dwn=dwn f.across=across f.down=down f.loc="" return f def writetext(f): Encoding_2 = "ISO-8859-1" ofile=open(f.loc,mode='wb') ofile.write(("<TITLE>"+"\n").encode(Encoding_2)) msg=f.title+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</TITLE>"+"\n").encode(Encoding_2)) ofile.write(("<AUTHOR>"+"\n").encode(Encoding_2)) msg=f.author+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</AUTHOR>"+"\n").encode(Encoding_2)) ofile.write(("<COPYRIGHT>"+"\n").encode(Encoding_2)) msg=f.cpyrt+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</COPYRIGHT>"+"\n").encode(Encoding_2)) ofile.write(("<WIDTH>"+"\n").encode(Encoding_2)) msg=str(f.width)+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</WIDTH>"+"\n").encode(Encoding_2)) ofile.write(("<HEIGHT>"+"\n").encode(Encoding_2)) msg=str(f.height)+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</HEIGHT>"+"\n").encode(Encoding_2)) ofile.write(("<GRID>"+"\n").encode(Encoding_2)) for i in range(0,f.height): for j in range(0,f.width): msg=f.solnblock[i][j]+"," ofile.write(msg.encode(Encoding_2)) ofile.write(("\n").encode(Encoding_2)) ofile.write(("</GRID>"+"\n").encode(Encoding_2)) ofile.write(("<ACROSS>"+"\n").encode(Encoding_2)) for i in range(0,f.acc): if(f.across[i][1]==""): msg="<NULL>"+"\n" else: msg=f.across[i][1]+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</ACROSS>"+"\n").encode(Encoding_2)) ofile.write(("<DOWN>"+"\n").encode(Encoding_2)) for i in range(0,f.dwn): if(f.down[i][1]==""): msg="<NULL>"+"\n" else: msg=f.down[i][1]+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</DOWN>"+"\n").encode(Encoding_2)) ofile.write(("<NOTEPAD>"+"\n").encode(Encoding_2)) msg=f.notes+"\n" ofile.write(msg.encode(Encoding_2)) ofile.write(("</NOTEPAD>"+"\n").encode(Encoding_2)) ofile.close()
Python
0.000004
9ea17a6d3eb5f9af246be964651f5bef522f2d95
Map out the TrustChain data structure
src/trustchain.py
src/trustchain.py
class TrustChain: """ Node maintains one TrustChain object and interacts with it either in in the reactor process or some other process. If it's the latter, there needs to be some communication mechanism. type System = Map<Node, Chain>; // height (sequence number) should match the index type Chain = List<Block>; struct Node { pk: [u8; 32], addr: SocketAddr, // ... } struct Signature { pk: [u8; 32], sig: [u8, 32], } enum Block { TxBlock, CpBlock, } struct TxBlock { prev: Digest, h_s: u64, h_r: u64, s_s: Signature, s_r: Signature, m: String, // items below are not a part of the block digest validity: Valid | Invalid | Unknown } struct Cons { round: u64, blocks: List<CpBlock>, ss: List<Signature>, } struct CpBlock { prev: Digest, round: u64, // of the Cons con: Digest, // of the Cons p: bool, // promoter registration s: Signature, } """ def __init__(self): self.myself = None self.system = None def new_tx(self, tx): """ Verify tx, follow the rule and mutates the state to add it :return: None """ pass def new_cp(self, cp): """ Verify the cp, follow the rule a nd mutate the state to add it :return: None """ pass def pieces(self, tx): """ tx must exist, return the pieces of tx :param tx: :return: List<Block> """ pass def verify(self, tx, resp): """ :param tx: :param resp: :return: """ pass def _enclosure(self, tx): """ :param tx: :return: (CpBlock, CpBlock) """ pass
Python
0.999389
1c1e933fa9c6af1aa9d73f276ac7b79c2b86bdc3
add svn-clean-external-file.py
scripts/svn-clean-external-file.py
scripts/svn-clean-external-file.py
# written by Thomas Watnedal # http://stackoverflow.com/questions/239340/automatically-remove-subversion-unversioned-files import os import re def removeall(path): if not os.path.isdir(path): os.remove(path) return files=os.listdir(path) for x in files: fullpath=os.path.join(path, x) if os.path.isfile(fullpath): os.remove(fullpath) elif os.path.isdir(fullpath): removeall(fullpath) os.rmdir(path) unversionedRex = re.compile('^ ?[\?ID] *[1-9 ]*[a-zA-Z]* +(.*)') for l in os.popen('svn status --no-ignore -v').readlines(): match = unversionedRex.match(l) if match: removeall(match.group(1))
Python
0.000002
3ef1e39d476a8b3e41ff0b06dcd6f700c083682d
Add an ABC for all sub classes of `DataController`
data_controller/abc.py
data_controller/abc.py
from typing import Dict, Optional from data_controller.enums import Medium, Site from utils.helpers import await_func class DataController: """ An ABC for all classes that deals with database read write. """ __slots__ = () def get_identifier(self, query: str, medium: Medium) -> Optional[Dict[Site, str]]: """ Get the identifier of a given search query. :param query: the search query. :param medium: the medium type. :return: A dict of all identifiers for this search query for all sites, None if nothing is found. """ raise NotImplementedError def set_identifier(self, name: str, medium: Medium, site: Site, identifier: str): """ Set the identifier for a given name. :param name: the name. :param medium: the medium type. :param site: the site. :param identifier: the identifier. """ raise NotImplementedError def get_mal_title(self, id_: str, medium: Medium) -> Optional[str]: """ Get a MAL title by its id. :param id_: th MAL id. :param medium: the medium type. :return: The MAL title if it's found. """ raise NotImplementedError def set_mal_title(self, id_: str, medium: Medium, title: str): """ Set the MAL title for a given id. :param id_: the MAL id. :param medium: The medium type. :param title: The MAL title for the given id. """ raise NotImplementedError def medium_data_by_id(self, id_: str, medium: Medium, site: Site) -> Optional[dict]: """ Get data by id. :param id_: the id. :param medium: the medium type. :param site: the site. :return: the data for that id if found. """ raise NotImplementedError def set_medium_data(self, id_: str, medium: Medium, site: Site, data: dict): """ Set the data for a given id. :param id_: the id. :param medium: the medium type. :param site: the site. :param data: the data for the id. """ raise NotImplementedError async def get_medium_data(self, query: str, medium: Medium, loop=None) -> Optional[dict]: """ Get the cached data for the given search query. :param query: the search query. :param medium: the medium type. :param loop: the asyncio event loop, optional. If None is provided, will use the default event loop. :return: the cached data, for all sites that has the data. """ id_dict = await await_func( self.get_identifier, loop, query, medium ) if not id_dict: return return {site: data for site, data in { site: await await_func(self.medium_data_by_id, loop, id_, medium, site) for site, id_ in id_dict.items()}.items() if data}
Python
0.000003
2ce67897ade1ce8ae8b0fd00671fe61f4164a2bc
Add missing migration
oidc_apis/migrations/0002_add_multiselect_field_ad_groups_option.py
oidc_apis/migrations/0002_add_multiselect_field_ad_groups_option.py
# Generated by Django 2.0.9 on 2018-10-15 08:08 from django.db import migrations import multiselectfield.db.fields class Migration(migrations.Migration): dependencies = [ ('oidc_apis', '0001_initial'), ] operations = [ migrations.AlterField( model_name='api', name='required_scopes', field=multiselectfield.db.fields.MultiSelectField(blank=True, choices=[('email', 'E-mail'), ('profile', 'Profile'), ('address', 'Address'), ('github_username', 'GitHub username'), ('ad_groups', 'AD Groups')], help_text='Select the scopes that this API needs information from. Information from the selected scopes will be included to the API Tokens.', max_length=1000, verbose_name='required scopes'), ), ]
Python
0.0002
785a5767ee3482fddee37327b4bf3edeed94ff46
Add shootout attempt item definition
db/shootout_attempt.py
db/shootout_attempt.py
#!/usr/bin/env python # -*- coding: utf-8 -*- import uuid from db.common import Base from db.specific_event import SpecificEvent from db.player import Player from db.team import Team class ShootoutAttempt(Base, SpecificEvent): __tablename__ = 'shootout_attempts' __autoload__ = True STANDARD_ATTRS = [ "team_id", "player_id", "zone", "goalie_team_id", "goalie_id", "attempt_type", "shot_type", "miss_type", "distance", "on_goal", "scored" ] def __init__(self, event_id, data_dict): self.shootout_attempt_id = uuid.uuid4().urn self.event_id = event_id for attr in self.STANDARD_ATTRS: if attr in data_dict: setattr(self, attr, data_dict[attr]) else: if attr in ['scored', 'on_goal']: setattr(self, attr, False) else: setattr(self, attr, None) def __str__(self): player = Player.find_by_id(self.player_id) goalie = Player.find_by_id(self.goalie_id) plr_team = Team.find_by_id(self.team_id) goalie_team = Team.find_by_id(self.goalie_team_id) if self.attempt_type == 'GOAL': return "Shootout Goal: %s (%s) %s, %d ft. vs. %s (%s)" % ( player.name, plr_team.abbr, self.shot_type, self.distance, goalie.name, goalie_team.abbr) elif self.attempt_type == 'MISS': return "Shootout Miss: %s (%s) %s, %d ft., %s vs. %s (%s)" % ( player.name, plr_team.abbr, self.shot_type, self.distance, self.miss_type, goalie.name, goalie_team.abbr) elif self.attempt_type == 'SHOT': return "Shootout Shot: %s (%s) %s, %d ft. vs. %s (%s)" % ( player.name, plr_team.abbr, self.shot_type, self.distance, goalie.name, goalie_team.abbr)
Python
0
1dcf698a286dcdf0f2c5a70d3e9bb2b32d046604
add TestBEvents, currently skipped
tests/unit/Events/test_BEvents.py
tests/unit/Events/test_BEvents.py
from AlphaTwirl.Events import BEvents as Events from AlphaTwirl.Events import Branch import unittest import ROOT ##____________________________________________________________________________|| inputPath = '/Users/sakuma/work/cms/c150130_RA1_data/c150130_01_PHYS14/20150331_SingleMu/TTJets/treeProducerSusyAlphaT/tree.root' treeName = 'tree' ##____________________________________________________________________________|| @unittest.skip("skip BEvents") class TestBEvents(unittest.TestCase): def test_branch(self): inputFile = ROOT.TFile.Open(inputPath) tree = inputFile.Get(treeName) events = Events(tree) jet_pt = events.jet_pt met_pt = events.met_pt self.assertIsInstance(jet_pt, Branch) self.assertIsInstance(met_pt, Branch) self.assertEqual(0, len(jet_pt)) self.assertEqual(1, len(met_pt)) self.assertEqual(0.0, met_pt[0]) tree.GetEntry(0) self.assertEqual(2, len(jet_pt)) self.assertEqual(1, len(met_pt)) self.assertEqual(124.55626678466797, jet_pt[0]) self.assertEqual(86.90544128417969, jet_pt[1]) self.assertAlmostEqual(43.783382415771484, met_pt[0]) tree.GetEntry(1) self.assertEqual(3, len(jet_pt)) self.assertEqual(1, len(met_pt)) self.assertEqual(112.48554992675781, jet_pt[0]) self.assertEqual(52.32780075073242, jet_pt[1]) self.assertEqual(48.861289978027344, jet_pt[2]) self.assertAlmostEqual(20.483951568603516, met_pt[0]) ##____________________________________________________________________________||
Python
0
05a8129787d32bb605fee9b85c1c11e8c582c43e
Add messages utility tests
tests/unit/utils/test_messages.py
tests/unit/utils/test_messages.py
import mock import sys import unittest from bin.commands.utils import messages class TestMessages(unittest.TestCase): def setUp(self): # store private methods so they can be restored after tests that mock them self._print = messages._print def tearDown(self): messages._print = self._print @mock.patch('__builtin__.print') def test__print(self, mock_print): # given message = 'message' prefix = 'a prefix:' quiet = False exit_ = False file_ = sys.stdout # then messages._print(message, prefix, quiet, exit_, file_) # then mock_print.assert_called_once_with(prefix + ' ' + message, file=file_) @mock.patch('__builtin__.print') def test__print_quiet(self, mock_print): # given message = 'message' prefix = 'a prefix:' quiet = True exit_ = False file_ = sys.stdout # then messages._print(message, prefix, quiet, exit_, file_) # then mock_print.assert_not_called() @mock.patch('__builtin__.print') def test__print_andExit(self, mock_print): # given message = 'message' prefix = 'a prefix:' quiet = False exit_ = True file_ = sys.stdout # then try: messages._print(message, prefix, quiet, exit_, file_) self.fail('expected to exit but did not') # pragma: no cover except SystemExit: pass # then mock_print.assert_called_once_with(prefix + ' ' + message, file=file_) def test__print_messageNotAStr(self): # when with self.assertRaises(AssertionError) as context: messages._print(123) # then self.assertEqual(context.exception.message, 'message must be a str') def test__print_prefixNotAStr(self): # when with self.assertRaises(AssertionError) as context: messages._print('message', prefix=123) # then self.assertEqual(context.exception.message, 'prefix must be a str') def test__print_quietNotABool(self): # when with self.assertRaises(AssertionError) as context: messages._print('message', quiet='false') # then self.assertEqual(context.exception.message, 'quiet must be a bool') def test__print_exitNotABool(self): # when with self.assertRaises(AssertionError) as context: messages._print('message', exit_='false') # then self.assertEqual(context.exception.message, 'exit must be a bool') @mock.patch('bin.commands.utils.messages._print') def test_error(self, mock_print): # given message = 'the message' prefix = 'error prefix' exit_ = False # when messages.error(message, prefix=prefix, exit_=exit_) # then mock_print.assert_called_once_with(message, prefix=prefix, exit_=exit_, file_=sys.stderr) @mock.patch('bin.commands.utils.messages._print') def test_warn(self, mock_print): # given message = 'the message' # when messages.warn(message) # then mock_print.assert_called_once_with(message, prefix='warn:') @mock.patch('bin.commands.utils.messages._print') def test_usage(self, mock_print): # given message = 'the message' # when messages.usage(message) # then mock_print.assert_called_once_with(message, prefix='usage:') @mock.patch('bin.commands.utils.messages._print') def test_info(self, mock_print): # given message = 'the message' quiet = True # when messages.info(message, quiet) # then mock_print.assert_called_once_with(message, quiet=quiet)
Python
0
adf65027521124ea89e9c6c5ee2baf7366b2da46
Add example settings file for makam extractors
compmusic/extractors/makam/settings.example.py
compmusic/extractors/makam/settings.example.py
token = "" # Dunya API Token
Python
0
9722bc3fc0a3cf8c95e91571b4b085e07e5a124c
Create 6kyu_message_from_aliens.py
Solutions/6kyu/6kyu_message_from_aliens.py
Solutions/6kyu/6kyu_message_from_aliens.py
import re from collections import Counter d={ '|-|':'h', '[-':'e', '()':'o', '3]':'b', '_|':'l', '|':'i', '^|':'p', '/`':'y', ')(':'o', '?/':'r', '\/':'a', '|\|':'n', '</':'k', '~|~':'t', '=/':'f', ')|':'d', '|_|':'u', '(':'c', '-[':'e', '~\_':'s', '-[':'e', ']3':'b', '_/~':'z', '/\\/\\':'w', '<>':'x', '/\\':'v', '|/\|':'m', '_)(':'q', 'T_':'j', ',_(':'g', '__':' ' } def decode(m): splitters=["]","}",".","'","+"] splitter=[i for i,j in Counter(m).most_common()][0] r=[] for f in re.split('('+re.escape(splitter)+')+', m[::-1]): try: r.append(d[f]) except: continue return ''.join(r)
Python
0.000027
125c75ea246c2d95f0addbb31b2d82dde588f21d
Add a unit test for KaggleKernelCredentials.
tests/test_kaggle_kernel_credentials.py
tests/test_kaggle_kernel_credentials.py
import unittest from kaggle_secrets import GcpTarget from kaggle_gcp import KaggleKernelCredentials class TestKaggleKernelCredentials(unittest.TestCase): def test_default_target(self): creds = KaggleKernelCredentials() self.assertEqual(GcpTarget.BIGQUERY, creds.target)
Python
0
5e7f29a66e440e440b1f7a4848d17bb7ae01139b
Update from template.
ci/bootstrap.py
ci/bootstrap.py
#!/usr/bin/env python # -*- coding: utf-8 -*- from __future__ import absolute_import, print_function, unicode_literals import os import sys from os.path import exists from os.path import join if __name__ == "__main__": base_path = join(".tox", "configure") if sys.platform == "win32": bin_path = join(base_path, "Scripts") else: bin_path = join(base_path, "bin") if not exists(base_path): import subprocess print("Bootstrapping ...") try: subprocess.check_call(["virtualenv", base_path]) except Exception: subprocess.check_call([sys.executable, "-m", "virtualenv", base_path]) print("Installing `jinja2` and `matrix` into bootstrap environment ...") subprocess.check_call([join(bin_path, "pip"), "install", "jinja2", "matrix"]) activate = join(bin_path, "activate_this.py") exec(compile(open(activate, "rb").read(), activate, "exec"), dict(__file__=activate)) import jinja2 import matrix jinja = jinja2.Environment( loader=jinja2.FileSystemLoader(join("ci", "templates")), trim_blocks=True, lstrip_blocks=True, keep_trailing_newline=True ) tox_environments = {} for (alias, conf) in matrix.from_file("setup.cfg").items(): python = conf["python_versions"] deps = conf["dependencies"] if "coverage_flags" in conf: cover = {"false": False, "true": True}[conf["coverage_flags"].lower()] if "environment_variables" in conf: env_vars = conf["environment_variables"] tox_environments[alias] = { "python": "python" + python if "py" not in python else python, "deps": deps.split(), } if "coverage_flags" in conf: tox_environments[alias].update(cover=cover) if "environment_variables" in conf: tox_environments[alias].update(env_vars=env_vars.split()) for name in os.listdir(join("ci", "templates")): with open(name, "w") as fh: fh.write(jinja.get_template(name).render(tox_environments=tox_environments)) print("Wrote {}".format(name)) print("DONE.")
Python
0
db76495b4f41021e2613d79b6f5cb30c96fb4290
Add PriorityStore and PriorityItem
desmod/prioritystore.py
desmod/prioritystore.py
from collections import namedtuple from heapq import heappush, heappop from simpy import Store class PriorityItem(namedtuple('PriorityItem', 'priority item')): def __lt__(self, other): return self.priority < other.priority class PriorityStore(Store): def _do_put(self, event): if len(self.items) < self._capacity: heappush(self.items, event.item) event.succeed() def _do_get(self, event): if self.items: event.succeed(heappop(self.items))
Python
0
c74170968b3a200f17af083f027fe3b657cf6041
Add giveup function (#12)
singer/requests.py
singer/requests.py
def giveup_on_http_4xx_except_429(error): response = error.response if response is None: return False return not (response.status_code == 429 or response.status_code >= 500)
Python
0
b59745e72a3c0a98da517f00e95fbafcff0cee3d
Remove unnecessary import.
tests/test_charts_snep_input.py
tests/test_charts_snep_input.py
from __future__ import unicode_literals, division, absolute_import from tests import FlexGetBase, use_vcr class TestChartsSnepInput(FlexGetBase): __yaml__ = """ tasks: test: charts_snep_input: radio """ @use_vcr def test_input(self): self.execute_task('test') assert len(self.task.entries) == 60, 'Produces %i entries, expected 60' % len(self.task.entries)
Python
0
f8f28580df477ec353e5faf7b1da2404c3691a7f
test ddns module
tests/unit/modules/ddns_test.py
tests/unit/modules/ddns_test.py
# -*- coding: utf-8 -*- ''' :codeauthor: :email:`Rupesh Tare <rupesht@saltstack.com>` ''' # Import Salt Testing Libs from salttesting import TestCase, skipIf from salttesting.mock import ( mock_open, MagicMock, patch, NO_MOCK, NO_MOCK_REASON ) # Import Salt Libs from salt.modules import ddns try: import dns.query import dns.update import dns.tsigkeyring dns_support = True except ImportError as e: dns_support = False # Import salt libs import salt.utils import json # Globals ddns.__grains__ = {} ddns.__salt__ = {} @skipIf(NO_MOCK, NO_MOCK_REASON) class DDNSTestCase(TestCase): ''' TestCase for the salt.modules.ddns module ''' @patch('salt.modules.ddns.update') def test_add_host(self, ddns_update): ''' Test cases for Add, replace, or update the A and PTR (reverse) records for a host. ''' ddns_update.return_value = False self.assertFalse(ddns.add_host(zone='A', name='B', ttl=1, ip='172.27.0.0')) ddns_update.return_value = True self.assertTrue(ddns.add_host(zone='A', name='B', ttl=1, ip='172.27.0.0')) @patch('salt.modules.ddns.delete') def test_delete_host(self, ddns_delete): ''' Tests for delete the forward and reverse records for a host. ''' ddns_delete.return_value = False with patch.object(dns.query, 'udp') as mock: mock.answer = [{'address': 'localhost'}] self.assertFalse(ddns.delete_host(zone='A', name='B')) def test_update(self): ''' Test to add, replace, or update a DNS record. ''' file_data = json.dumps({'A': 'B'}) with patch('dns.message.make_query', return_value=True): with patch('dns.rdatatype.from_text', return_value=True): with patch('dns.rdata.from_text', return_value=True): mock = MagicMock(return_value=True) with patch.dict(ddns.__salt__, {'config.option': mock}): mock = MagicMock(return_value=True) with patch.dict(ddns.__salt__, {'file.file_exists': mock}): with patch('salt.utils.fopen', mock_open(read_data=file_data), create=True): with patch.object(dns.tsigkeyring, 'from_text', return_value=True): with patch.object(dns.query, 'udp') as mock: mock.answer = [{'address': 'localhost'}] self.assertFalse(ddns.update(zone='A', name='B', ttl=1, rdtype='C', data='D')) def test_delete(self): ''' Test to delete a DNS record. ''' file_data = json.dumps({'A': 'B'}) with patch.object(dns.query, 'udp') as mock: mock.answer = [{'address': 'localhost'}] mock = MagicMock(return_value=True) with patch.dict(ddns.__salt__, {'config.option': mock}): mock = MagicMock(return_value=True) with patch.dict(ddns.__salt__, {'file.file_exists': mock}): with patch('salt.utils.fopen', mock_open(read_data=file_data), create=True): with patch.object(dns.tsigkeyring, 'from_text', return_value=True): self.assertFalse(ddns.delete(zone='A', name='B')) if __name__ == '__main__': from integration import run_tests run_tests(DDNSTestCase, needs_daemon=False)
Python
0
ce01cc61ea62c717503d991826e6b9915b23900b
Fix usage print
check-bugs.py
check-bugs.py
#!/usr/bin/python import sys import re import pprint import collections Head = collections.namedtuple("Head", "file line") def parse(pn): ans = collections.defaultdict(str) head = None for l in open(pn): # ignore comments if l.startswith("#"): continue # found a header m = re.match("^\[(\S+):(\d+)\]+.*", l) if m: head = Head._make(m.groups()) continue # collect descriptions if head: ans[head] += l # chomp return dict((h, d.strip()) for (h, d) in ans.items()) def say_pass(reason): print "\033[1;32mPASS\033[m", reason def say_fail(reason): print "\033[1;31mFAIL\033[m", reason def stat_summary(ans): print("Summary:") for (h, d) in ans.items(): desc = d.split("\n")[0] print(" %-8s %+4s | %-30s .." % (h.file, h.line, desc)) if len(ans) >= 5: say_pass("found enough bugs") else: say_fail("found %s bugs, but need at least 5" % len(ans)) if __name__ == "__main__": if len(sys.argv) != 2: print("usage: %s [bugs.txt]" % sys.argv[0]) exit(1) ans = parse(sys.argv[1]) stat_summary(ans)
#!/usr/bin/python import sys import re import pprint import collections Head = collections.namedtuple("Head", "file line") def parse(pn): ans = collections.defaultdict(str) head = None for l in open(pn): # ignore comments if l.startswith("#"): continue # found a header m = re.match("^\[(\S+):(\d+)\]+.*", l) if m: head = Head._make(m.groups()) continue # collect descriptions if head: ans[head] += l # chomp return dict((h, d.strip()) for (h, d) in ans.items()) def say_pass(reason): print "\033[1;32mPASS\033[m", reason def say_fail(reason): print "\033[1;31mFAIL\033[m", reason def stat_summary(ans): print("Summary:") for (h, d) in ans.items(): desc = d.split("\n")[0] print(" %-8s %+4s | %-30s .." % (h.file, h.line, desc)) if len(ans) >= 5: say_pass("found enough bugs") else: say_fail("found %s bugs, but need at least 5" % len(ans)) if __name__ == "__main__": if len(sys.argv) != 2: print("usage: %s [bugs.txt]", sys.argv[0]) exit(1) ans = parse(sys.argv[1]) stat_summary(ans)
Python
0.000255
d6fa7713556582bab54efc3ba53d27b411d8e23c
update import statements
tamil/__init__.py
tamil/__init__.py
# -*- coding: utf-8 -*- # # (C) 2013 Muthiah Annamalai <ezhillang@gmail.com> # Library provides various encoding services for Tamil libraries # import utf8 import tscii import txt2unicode import txt2ipa def printchar( letters ): for c in letters: print(c, u"\\u%04x"%ord(c)) P = lambda x: u" ".join(x)
# -*- coding: utf-8 -*- # # (C) 2013 Muthiah Annamalai <ezhillang@gmail.com> # Library provides various encoding services for Tamil libraries # from . import utf8 from . import tscii from . import txt2unicode from . import txt2ipa def printchar( letters ): for c in letters: print(c, u"\\u%04x"%ord(c)) P = lambda x: u" ".join(x)
Python
0
97a8c8c2baffdeaf6b710cf875d2f8641b999338
Create adapter_16mers.py
select_random_subset/adapter_16mers.py
select_random_subset/adapter_16mers.py
#!/usr/bin/env python2 # -*- coding: utf-8 -*- """ Created on Sat Oct 21 14:15:18 2017 @author: nikka.keivanfar """ #see also: adapters.fa P5 = 'AATGATACGGCGACCACCGA' P7 = 'CAAGCAGAAGACGGCATACGAGAT' read1 = 'GATCTACACTCTTTCCCTACACGACGCTC' read2 = 'GTGACTGGAGTTCAGACGTGT' adapters = [P5, P7, read1, read2] #to do: streamline loops for all adapters combined P5_kmers = {} P7_kmers = {} read1_kmers = {} read2_kmers = {} k = 16 #P5 16mers for i in range(len(P5) - k + 1): kmer = P5[i:i+k] if P5_kmers.has_key(kmer): P5_kmers[kmer] += 1 else: P5_kmers[kmer] = 1 for kmer, count in P5_kmers.items(): print kmer + "\t" + str(count) P5mers = set(kmer) #P7 16mers for i in range(len(P7) - k + 1): kmer = P7[i:i+k] if P7_kmers.has_key(kmer): P7_kmers[kmer] += 1 else: P7_kmers[kmer] = 1 for kmer, count in P7_kmers.items(): print kmer + "\t" + str(count) P7mers = set(kmer) #read1 16mers for i in range(len(read1) - k + 1): kmer = read1[i:i+k] if read1_kmers.has_key(kmer): read1_kmers[kmer] += 1 else: read1_kmers[kmer] = 1 for kmer, count in read1_kmers.items(): print kmer + "\t" + str(count) read1mers = set(kmer) #read2 16mers for i in range(len(read2) - k + 1): kmer = read2[i:i+k] if read2_kmers.has_key(kmer): read2_kmers[kmer] += 1 else: read2_kmers[kmer] = 1 for kmer, count in read2_kmers.items(): print kmer + "\t" + str(count) read2mers = set(kmer)
Python
0.000001
7c6d3e65b21431e61093b76d52efb9af68ae5f36
initialize final model
code/final.py
code/final.py
# # Test set predictions using best final model (using all training data) from sklearn.model_selection import TimeSeriesSplit, train_test_split from keras.utils.visualize_util import plot from keras.models import Sequential from keras.layers import GRU, Dense, Masking, Dropout, Activation from keras.callbacks import EarlyStopping import numpy as np from itertools import product import cPickle as pkl from scipy.sparse import csr_matrix from utils import set_trace, plot_ROC from sklearn.metrics import roc_curve, auc, roc_auc_score import tensorflow as tf tf.python.control_flow_ops = tf # Load saved data print('Load saved data') X_train = pkl.load(open('data/X_train.np', 'rb')) X_test = pkl.load(open('data/X_test.np', 'rb')) y_train = pkl.load(open('data/y_train.np', 'rb')) y_test = pkl.load(open('data/y_test.np', 'rb')) X_train = X_train[1:X_train.shape[0]] # drop first sample so batch size is divisible y_train = y_train[1:y_train.shape[0]] # Label shift lahead = 0 # number of days ahead that are used to make the prediction if lahead!=0: y_train = np.roll(y_train,-lahead,axis=0) y_test = np.roll(y_test,-lahead,axis=0) else: pass # Define network structure epochs = 25 nb_timesteps = 1 nb_classes = 2 nb_features = X_train.shape[1] output_dim = 1 # Define cross-validated model parameters batch_size = 14 dropout = 0.25 activation = 'sigmoid' nb_hidden = 128 initialization = 'glorot_normal' # # Reshape X to three dimensions # # Should have shape (batch_size, nb_timesteps, nb_features) X_train = csr_matrix.toarray(X_train) # convert from sparse matrix to N dimensional array X_train = np.resize(X_train, (X_train.shape[0], nb_timesteps, X_train.shape[1])) print('X_train shape:', X_train.shape) X_test = csr_matrix.toarray(X_test) # convert from sparse matrix to N dimensional array X_test = np.resize(X_test, (X_test.shape[0], nb_timesteps, X_test.shape[1])) print('X_test shape:', X_test.shape) # Reshape y to two dimensions # Should have shape (batch_size, output_dim) y_train = np.resize(y_train, (X_train.shape[0], output_dim)) print('y_train shape:', y_train.shape) y_test = np.resize(y_test, (X_test.shape[0], output_dim)) print('y_test shape:', y_test.shape) # Initiate sequential model print('Initializing model') model = Sequential() # Stack layers # expected input batch shape: (batch_size, nb_timesteps, nb_features) # note that we have to provide the full batch_input_shape since the network is stateful. # the sample of index i in batch k is the follow-up for the sample i in batch k-1. model.add(Masking(mask_value=0., batch_input_shape=(batch_size, nb_timesteps, nb_features))) # embedding for variable input lengths model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization, batch_input_shape=(batch_size, nb_timesteps, nb_features))) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, return_sequences=True, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(GRU(nb_hidden, stateful=True, init=initialization)) model.add(Dropout(dropout)) model.add(Dense(output_dim, activation=activation)) # Configure learning process model.compile(optimizer='rmsprop', loss='binary_crossentropy', metrics=['binary_accuracy']) plot(model, to_file='results/final_model.png', # Plot graph of model show_shapes = True, show_layer_names = False) # Training early_stopping = EarlyStopping(monitor='loss', patience=1) print('Training') for i in range(epochs): print('Epoch', i+1, '/', epochs) model.fit(X_train, y_train, batch_size=batch_size, verbose=1, nb_epoch=1, shuffle=False, # turn off shuffle to ensure training data patterns remain sequential callbacks=[early_stopping]) # stop early if training loss not improving after 1 epoch model.reset_states() # Evaluation print('Evaluating results in terms of classification accuracy') loss = model.evaluate(X_test, y_test, batch_size=batch_size) # compute loss on test data, batch-by-batch print("%s: %.2f%%" % (model.metrics_names[1], loss[1]*100)) print('Evaluating results in terms of AUC') y_probs = model.predict_proba(X_test, batch_size=batch_size, verbose=1) print('AUC ' + str(roc_auc_score(y_test, y_probs))) y_pred = model.predict(X_test, batch_size=batch_size, verbose=1) # generate output predictions for test samples, batch-by-batch # Plot ROC curve plot_ROC(y_test, y_pred)
Python
0.000016
faf10aa246414e4f5be735da6b1c058ec7d546b9
remove like indexes from smsbillables
corehq/apps/smsbillables/migrations/0011_remove_like_indexes.py
corehq/apps/smsbillables/migrations/0011_remove_like_indexes.py
# encoding: utf-8 import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): db.execute("DROP INDEX IF EXISTS smsbillables_smsbillable_direction_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsbillable_domain_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsgatewayfeecriteria_backend_api_id_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsgatewayfeecriteria_backend_instance_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsgatewayfeecriteria_direction_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsgatewayfeecriteria_prefix_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsusagefeecriteria_direction_like") db.execute("DROP INDEX IF EXISTS smsbillables_smsusagefeecriteria_domain_like") def backwards(self, orm): # don't add it back pass models = { u'accounting.currency': { 'Meta': {'object_name': 'Currency'}, 'code': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '3'}), 'date_updated': ('django.db.models.fields.DateField', [], {'auto_now': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '25', 'db_index': 'True'}), 'rate_to_default': ('django.db.models.fields.DecimalField', [], {'default': "'1.0'", 'max_digits': '20', 'decimal_places': '9'}), 'symbol': ('django.db.models.fields.CharField', [], {'max_length': '10'}) }, u'smsbillables.smsbillable': { 'Meta': {'object_name': 'SmsBillable'}, 'api_response': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'date_created': ('django.db.models.fields.DateField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'date_sent': ('django.db.models.fields.DateField', [], {}), 'direction': ('django.db.models.fields.CharField', [], {'max_length': '10', 'db_index': 'True'}), 'domain': ('django.db.models.fields.CharField', [], {'max_length': '25', 'db_index': 'True'}), 'gateway_fee': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['smsbillables.SmsGatewayFee']", 'null': 'True'}), 'gateway_fee_conversion_rate': ('django.db.models.fields.DecimalField', [], {'default': "'1.0'", 'null': 'True', 'max_digits': '20', 'decimal_places': '9'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_valid': ('django.db.models.fields.BooleanField', [], {'default': 'True', 'db_index': 'True'}), 'log_id': ('django.db.models.fields.CharField', [], {'max_length': '50', 'db_index': 'True'}), 'phone_number': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'usage_fee': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['smsbillables.SmsUsageFee']", 'null': 'True'}) }, u'smsbillables.smsgatewayfee': { 'Meta': {'object_name': 'SmsGatewayFee'}, 'amount': ('django.db.models.fields.DecimalField', [], {'default': '0.0', 'max_digits': '10', 'decimal_places': '4'}), 'criteria': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['smsbillables.SmsGatewayFeeCriteria']"}), 'currency': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['accounting.Currency']"}), 'date_created': ('django.db.models.fields.DateField', [], {'auto_now_add': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}) }, u'smsbillables.smsgatewayfeecriteria': { 'Meta': {'object_name': 'SmsGatewayFeeCriteria'}, 'backend_api_id': ('django.db.models.fields.CharField', [], {'max_length': '100', 'db_index': 'True'}), 'backend_instance': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'db_index': 'True'}), 'country_code': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'max_length': '5', 'null': 'True', 'blank': 'True'}), 'direction': ('django.db.models.fields.CharField', [], {'max_length': '10', 'db_index': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'prefix': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '10', 'db_index': 'True', 'blank': 'True'}) }, u'smsbillables.smsusagefee': { 'Meta': {'object_name': 'SmsUsageFee'}, 'amount': ('django.db.models.fields.DecimalField', [], {'default': '0.0', 'max_digits': '10', 'decimal_places': '4'}), 'criteria': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['smsbillables.SmsUsageFeeCriteria']"}), 'date_created': ('django.db.models.fields.DateField', [], {'auto_now_add': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}) }, u'smsbillables.smsusagefeecriteria': { 'Meta': {'object_name': 'SmsUsageFeeCriteria'}, 'direction': ('django.db.models.fields.CharField', [], {'max_length': '10', 'db_index': 'True'}), 'domain': ('django.db.models.fields.CharField', [], {'max_length': '25', 'null': 'True', 'db_index': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}) } } complete_apps = ['smsbillables']
Python
0.000097
b405264320f258d4ea41cf32ef5f4956faa82f3f
Add subfigure
sphinxpp/subfig.py
sphinxpp/subfig.py
""" Adds subfigure functionality """ from docutils import nodes import docutils.parsers.rst.directives as directives from sphinx.util.compat import Directive from sphinx import addnodes class subfig(nodes.General, nodes.Element): pass def skip_visit(self, node): raise nodes.SkipNode def visit_subfig_tex(self, node): self.__body = self.body self.body = [] def depart_subfig_tex(self, node): figoutput = ''.join(self.body) figoutput = figoutput.replace('[htbp]', '[t]{%s\\linewidth}' % node['width']) figoutput = figoutput.replace('figure', 'subfigure') self.body = self.__body self.body.append(figoutput) def visit_subfig_html(self, node): self.__body = self.body self.body = [] def depart_subfig_html(self, node): figoutput = ''.join(self.body) figoutput = figoutput.replace('class="figure', 'style="width: %g%%" class="subfigure' % (float(node['width']) * 100)) self.body = self.__body self.body.append(figoutput) class subfigstart(nodes.General, nodes.Element): pass def visit_subfigstart_tex(self, node): self.body.append('\n\\begin{figure}\n\\centering\n\\capstart\n') def depart_subfigstart_tex(self, node): pass def visit_subfigstart_html(self, node): atts = {'class': 'figure compound align-center'} self.body.append(self.starttag(node['subfigend'], 'div', **atts)) def depart_subfigstart_html(self, node): pass class subfigend(nodes.General, nodes.Element): pass def visit_subfigend_tex(self, node): pass def depart_subfigend_tex(self, node): self.body.append('\n\n\\end{figure}\n\n') def visit_subfigend_html(self, node): pass def depart_subfigend_html(self, node): self.body.append('</div>') class SubFigEndDirective(Directive): has_content = True optional_arguments = 3 final_argument_whitespace = True option_spec = {'label': directives.uri, 'alt': directives.unchanged, 'width': directives.unchanged_required} def run(self): label = self.options.get('label', None) width = self.options.get('width', None) alt = self.options.get('alt', None) node = subfigend('', ids=[label] if label is not None else []) if width is not None: node['width'] = width if alt is not None: node['alt'] = alt if self.content: anon = nodes.Element() self.state.nested_parse(self.content, self.content_offset, anon) first_node = anon[0] if isinstance(first_node, nodes.paragraph): caption = nodes.caption(first_node.rawsource, '', *first_node.children) node += caption if label is not None: targetnode = nodes.target('', '', ids=[label]) node.append(targetnode) return [node] class SubFigStartDirective(Directive): has_content = False optional_arguments = 0 def run(self): node = subfigstart() return [node] def doctree_read(app, doctree): secnums = app.builder.env.toc_secnumbers for node in doctree.traverse(subfigstart): parentloc = node.parent.children.index(node) subfigendloc = parentloc while subfigendloc < len(node.parent.children): n = node.parent.children[subfigendloc] if isinstance(n, subfigend): break subfigendloc += 1 if subfigendloc == len(node.parent.children): return between_nodes = node.parent.children[parentloc:subfigendloc] subfigend_node = node.parent.children[subfigendloc] node['subfigend'] = subfigend_node for i, n in enumerate(between_nodes): if isinstance(n, nodes.figure): children = [n] prevnode = between_nodes[i-1] if isinstance(prevnode, nodes.target): node.parent.children.remove(prevnode) children.insert(0, prevnode) nodeloc = node.parent.children.index(n) node.parent.children[nodeloc] = subfig('', *children) node.parent.children[nodeloc]['width'] = subfigend_node['width'] node.parent.children[nodeloc]['mainfigid'] = subfigend_node['ids'][0] def setup(app): app.add_node(subfigstart, html=(visit_subfigstart_html, depart_subfigstart_html), singlehtml=(visit_subfigstart_html, depart_subfigstart_html), text=(skip_visit, None), latex=(visit_subfigstart_tex, depart_subfigstart_tex)) app.add_node(subfig, html=(visit_subfig_html, depart_subfig_html), singlehtml=(visit_subfig_html, depart_subfig_html), text=(skip_visit, None), latex=(visit_subfig_tex, depart_subfig_tex)) app.add_node(subfigend, html=(visit_subfigend_html, depart_subfigend_html), singlehtml=(visit_subfigend_html, depart_subfigend_html), text=(skip_visit, None), latex=(visit_subfigend_tex, depart_subfigend_tex)) app.add_directive('subfigstart', SubFigStartDirective) app.add_directive('subfigend', SubFigEndDirective) app.connect('doctree-read', doctree_read)
Python
0.000002
cfabe41b0d2f0cea143360fa1610baaaa87f8946
add python wrapper for network builder
side_project/network_builder/MNM_nb.py
side_project/network_builder/MNM_nb.py
import os import numpy as np import networkx as nx DLINK_ENUM = ['CTM', 'LQ', 'LTM', 'PQ'] DNODE_ENUM = ['FWJ', 'GRJ', 'DMOND', 'DMDND'] class MNM_dlink(): def __init__(self): self.ID = None self.len = None self.typ = None self.ffs = None self.cap = None self.rhoj = None self.lanes = None def __init__(self, ID, length, typ, ffs, cap, rhoj, lanes): self.ID = ID self.length = length #mile self.typ = typ #type self.ffs = ffs #mile/h self.cap = cap #v/hour self.rhoj = rhoj #v/miles self.lanes = lanes #num of lanes def is_ok(self, unit_time = 5): assert(self.length > 0.0) assert(self.ffs > 0.0) assert(self.cap > 0.0) assert(self.rhoj > 0.0) assert(self.lanes > 0) assert(self.typ in DLINK_ENUM) assert(self.cap / self.ffs < self.rhoj) assert(unit_time * self.ffs / 3600 >= self.length) class MNM_dnode(): def __init__(self): self.ID = None self.typ = None def __init__(self, ID, typ): self.ID = ID self.typ = typ def is_ok(self): assert(self.typ in DNODE_ENUM) class MNM_demand(): def __init__(self): self.demand_dict = dict() def add_demand(self, O, D, demand, overwriting = False): assert(type(demand) is np.ndarray) assert(len(demand.shape) == 1) if O not in self.demand_dict.keys(): self.demand_dict[O] = dict() if (not overwriting) and (D in self.demand_dict[O].keys()): raise("Error, exists OD demand already") else: self.demand_dict[O][D] = demand class MNM_od(): def __init__(self): self.O_dict = dict() self.D_dict = dict() def add_origin(self, O, Onode_ID, overwriting = False): if (not overwriting) and (O in self.O_dict.keys()): raise("Error, exists origin node already") else: self.O_dict[O] = Onode_ID def add_destination(self, D, Dnode_ID, overwriting = False): if (not overwriting) and (D in self.D_dict.keys()): raise("Error, exists destination node already") else: self.D_dict[D] = Dnode_ID class MNM_graph(): def __init__(self): self.graph = nx.DiGraph() self.edgeID_dict = nx.DiGraph() def add_edge(self, s, e, ID, create_node = False, overwriting = False): if (not overwriting) and ((s,e) in self.graph.edges()): raise("Error, exists edge in graph") elif (not create_node) and s in self.graph.nodes(): raise("Error, exists start node of edge in graph") elif (not create_node) and e in self.graph.nodes(): raige("Error, exists end node of edge in graph") else: self.graph.add_edge(s, e, ID = ID) self.edgeID_dict[ID] = (s, e) def add_node(self, node, overwriting = True): if (not overwriting) and node in self.graph.nodes(): raise("Error, exists node in graph") else: self.graph.add_node(node) class MNM_routing(): def __init__(self): print "MNM_routing" class MNM_routing_fixed(MNM_routing): def __init__(self): super(MNM_routing_fixed, self).__init__() self.required_items = ['num_path', 'choice_portion', 'route_frq', 'path_table'] class MNM_routing_adaptive(MNM_routing): """docstring for MNM_routing_adaptive""" def __init__(self): super(MNM_routing_adaptive, self).__init__() self.required_items = ['route_frq'] class MNM_routing_hybrid(MNM_routing): """docstring for MNM_routing_hybrid""" def __init__(self): super(MNM_routing_hybrid, self).__init__() self.required_items = [] class MNM_config(): def __init__(self): print "MNM_config" class MNM_network_builder(): def __init__(self): print "Test"
Python
0.000001
8a4931dd810079c1f78858c5058df74b0e696f72
Correct IrFilters_eval_domain when the third item starts with 'object.'
smile_action_rule/models/ir_filters.py
smile_action_rule/models/ir_filters.py
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2014 Smile (<http://www.smile.fr>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import time from openerp import api, models, fields from openerp.tools import ustr from openerp.tools.safe_eval import safe_eval as eval from ..tools import unquote class ActionFilter(models.Model): _inherit = 'ir.filters' @api.one @api.depends('domain') def _get_action_rule(self): localdict = {'object': unquote('object'), 'time': time, 'active_id': unquote("active_id"), 'uid': self._uid} eval_domain = eval(self.domain, localdict) self.action_rule = ', object.' in repr(eval_domain) action_rule = fields.Boolean('Only for action rules', compute='_get_action_rule', store=True) def get_filters(self, cr, uid, model, action_id=None): action_domain = self._get_action_domain(cr, uid, action_id) return self.search_read(cr, uid, action_domain + [ ('model_id', '=', model), ('user_id', 'in', (uid, False)), ('action_rule', '=', False), ], ['name', 'is_default', 'domain', 'context', 'user_id']) @api.multi def _eval_domain(self, record_ids=None): self.ensure_one() domain = [] eval_domain = eval(self.domain, {'object': unquote('object')}) for cond in eval_domain: if isinstance(cond, tuple) and 'object' in cond[2]: subdomain = [] records = self.env[self.model_id].browse(record_ids) for record in records: new_cond = (cond[0], cond[1], eval(ustr(cond[2]), {'object': record})) subdomain.append(new_cond) subdomain = list(set(subdomain)) subdomain = ['|'] * (len(subdomain) - 1) + subdomain domain.extend(subdomain) else: domain.append(cond) return domain
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2014 Smile (<http://www.smile.fr>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import time from openerp import api, models, fields from ..tools import unquote class ActionFilter(models.Model): _inherit = 'ir.filters' @api.one @api.depends('domain') def _get_action_rule(self): localdict = {'object': unquote('object'), 'time': time, 'active_id': unquote("active_id"), 'uid': self._uid} eval_domain = eval(self.domain.replace(' ', ''), localdict) self.action_rule = ',object.' in eval_domain action_rule = fields.Boolean('Only for action rules', compute='_get_action_rule', store=True) def get_filters(self, cr, uid, model, action_id=None): action_domain = self._get_action_domain(cr, uid, action_id) filter_ids = self.search(cr, uid, action_domain + [ ('model_id', '=', model), ('user_id', 'in', (uid, False)), ('action_rule', '=', False), ]) my_filters = self.read(cr, uid, filter_ids, ['name', 'is_default', 'domain', 'context', 'user_id']) return my_filters @api.multi def _eval_domain(self, record_ids=None): self.ensure_one() domain = [] eval_domain = eval(self.domain, {'object': unquote('object')}) for cond in eval_domain: if isinstance(cond, tuple) and 'object' in cond[2]: subdomain = [] records = self.env[self.model_id].browse(record_ids) for record in records: new_cond = (cond[0], cond[1], eval(cond[2], {'object': record})) subdomain.append(new_cond) subdomain = list(set(subdomain)) subdomain = ['|'] * (len(subdomain) - 1) + subdomain domain.extend(subdomain) else: domain.append(cond) return domain
Python
0
ca043c2d3fe5fbdd37f372e8a3ad8bfd1b501c89
Correct Workitem._execute monkeypatch
smile_action_rule/workflow/workitem.py
smile_action_rule/workflow/workitem.py
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2014 Smile (<http://www.smile.fr>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## from openerp import registry from openerp.workflow.workitem import WorkflowItem native_execute = WorkflowItem._execute def new_execute(self, activity, stack): if not registry(self.session.cr.dbname).get('base.action.rule'): return native_execute(self, activity, stack) cr, uid, ids = self.session.cr, self.session.uid, [self.record.id] # Retrieve the action rules to possibly execute rule_obj = registry(self.session.cr.dbname)['base.action.rule'] rules = rule_obj._get_action_rules_on_wkf(cr, uid, activity['id']) # Check preconditions pre_ids = {} for rule in rules: if rule.kind not in ('on_create', 'on_create_or_write'): pre_ids[rule] = rule_obj._filter(cr, uid, rule, rule.filter_pre_id, ids) # Call original method result = native_execute(self, activity, stack) # Check postconditions, and execute actions on the records that satisfy them for rule in rules: if rule.kind != 'on_unlink': post_ids = rule_obj._filter(cr, uid, rule, rule.filter_id, pre_ids[rule]) else: post_ids = pre_ids[rule] if post_ids: rule_obj._process(cr, uid, rule, post_ids) return result WorkflowItem._execute = new_execute
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2014 Smile (<http://www.smile.fr>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## from openerp import registry from openerp.workflow.workitem import WorkflowItem native_execute = WorkflowItem._execute def new_execute(self, activity, stack): cr, uid, ids = self.session.cr, self.session.uid, [self.record.id] # Retrieve the action rules to possibly execute rule_obj = registry(self.session.cr.dbname)['base.action.rule'] rules = rule_obj._get_action_rules_on_wkf(cr, uid, activity['id']) # Check preconditions pre_ids = {} for rule in rules: if rule.kind not in ('on_create', 'on_create_or_write'): pre_ids[rule] = rule_obj._filter(cr, uid, rule, rule.filter_pre_id, ids) # Call original method result = native_execute(self, activity, stack) # Check postconditions, and execute actions on the records that satisfy them for rule in rules: if rule.kind != 'on_unlink': post_ids = rule_obj._filter(cr, uid, rule, rule.filter_id, pre_ids[rule]) else: post_ids = pre_ids[rule] if post_ids: rule_obj._process(cr, uid, rule, post_ids) return result WorkflowItem._execute = new_execute
Python
0.000004
107e33ab3982f3f7fb56a1a2ac2b0eec0b67091b
Use universal newlines in gyp_helper.
build/gyp_helper.py
build/gyp_helper.py
# Copyright (c) 2012 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. # This file helps gyp_chromium and landmines correctly set up the gyp # environment from chromium.gyp_env on disk import os SCRIPT_DIR = os.path.dirname(os.path.realpath(__file__)) CHROME_SRC = os.path.dirname(SCRIPT_DIR) def apply_gyp_environment_from_file(file_path): """Reads in a *.gyp_env file and applies the valid keys to os.environ.""" if not os.path.exists(file_path): return with open(file_path, 'rU') as f: file_contents = f.read() try: file_data = eval(file_contents, {'__builtins__': None}, None) except SyntaxError, e: e.filename = os.path.abspath(file_path) raise supported_vars = ( 'CC', 'CHROMIUM_GYP_FILE', 'CHROMIUM_GYP_SYNTAX_CHECK', 'CXX', 'GYP_DEFINES', 'GYP_GENERATOR_FLAGS', 'GYP_GENERATOR_OUTPUT', 'GYP_GENERATORS', ) for var in supported_vars: file_val = file_data.get(var) if file_val: if var in os.environ: print 'INFO: Environment value for "%s" overrides value in %s.' % ( var, os.path.abspath(file_path) ) else: os.environ[var] = file_val def apply_chromium_gyp_env(): if 'SKIP_CHROMIUM_GYP_ENV' not in os.environ: # Update the environment based on chromium.gyp_env path = os.path.join(os.path.dirname(CHROME_SRC), 'chromium.gyp_env') apply_gyp_environment_from_file(path)
# Copyright (c) 2012 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. # This file helps gyp_chromium and landmines correctly set up the gyp # environment from chromium.gyp_env on disk import os SCRIPT_DIR = os.path.dirname(os.path.realpath(__file__)) CHROME_SRC = os.path.dirname(SCRIPT_DIR) def apply_gyp_environment_from_file(file_path): """Reads in a *.gyp_env file and applies the valid keys to os.environ.""" if not os.path.exists(file_path): return with open(file_path) as f: file_contents = f.read() try: file_data = eval(file_contents, {'__builtins__': None}, None) except SyntaxError, e: e.filename = os.path.abspath(file_path) raise supported_vars = ( 'CC', 'CHROMIUM_GYP_FILE', 'CHROMIUM_GYP_SYNTAX_CHECK', 'CXX', 'GYP_DEFINES', 'GYP_GENERATOR_FLAGS', 'GYP_GENERATOR_OUTPUT', 'GYP_GENERATORS', ) for var in supported_vars: file_val = file_data.get(var) if file_val: if var in os.environ: print 'INFO: Environment value for "%s" overrides value in %s.' % ( var, os.path.abspath(file_path) ) else: os.environ[var] = file_val def apply_chromium_gyp_env(): if 'SKIP_CHROMIUM_GYP_ENV' not in os.environ: # Update the environment based on chromium.gyp_env path = os.path.join(os.path.dirname(CHROME_SRC), 'chromium.gyp_env') apply_gyp_environment_from_file(path)
Python
0.000007
e6b9b471dba3d7ef0bac94454136b07ef3247093
Add 'tools/translation/' from commit '83e3aa43dd35a8c0ef0658303806e355204c7100'
tools/translation/nb_code_sync.py
tools/translation/nb_code_sync.py
#!/usr/bin/env python3 # Copyright 2019 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Keep translated notebook code in sync with the source-of-truth notebook. This tool attempts to make it easier to keep the community translation *code* in sync with the en/ source-or-truth notebooks. It intentionally ignores Markdown cells and only compares code cells. There must be the same amount of code cells in source notebook and translation notebook. Usage: nb_code_sync.py [--lang=en] site/lang/notebook.ipynb [...] Useful when used with interactive git workflow to selectively add hunks: git add --patch site/lang/notebook.ipynb Commands: y: stage this hunk n: do not stage this hunk s: split this hunk e: edit this hunk """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import errno import json import os import pathlib import re import sys from absl import app from absl import flags flags.DEFINE_enum("lang", "en", ["en", "js", "ko", "pt", "ru", "tr", "zh-cn"], "Language directory to import from.") flags.DEFINE_string("src", None, "Source file or parent directory of source.") flags.DEFINE_boolean("stdout", False, "Write to stdout instead of file.") flags.DEFINE_string("site_root", None, "Root directory of site docs.") class Notebook(object): """Represents a parsed .ipynb notebook file. Attributes: path: Path to the notebook file. data: All cells parsed from notebook. code_cells: Only code cells parsed from notebook. """ path = None def __init__(self, data): """Inits Notebook from parsed .ipynb notebook data.""" self.data = data self.code_cells = self._load_code_cells(self.data) @classmethod def from_path(cls, path): """Inits Notebook using path to .pynb file.""" pth = Notebook._check_path(path) with open(pth) as json_data: data = json.load(json_data) nb = Notebook(data) nb.path = pth return nb @staticmethod def is_notebook(path): """Test of a file is an .ipynb file based on extension.""" if not os.path.isfile(path): raise FileNotFoundError(errno.ENOENT, os.strerror(errno.ENOENT), path) return os.path.splitext(path)[-1].lower() == ".ipynb" @staticmethod def _check_path(pth): if not Notebook.is_notebook(pth): raise Exception("Notebook must be an .ipynb file: {}".format(pth)) path = pathlib.Path(pth) if not path.exists(): raise FileNotFoundError(errno.ENOENT, os.strerror(errno.ENOENT), path) return path def _load_code_cells(self, data): # parse code cells code_cells = [c for c in data["cells"] if c["cell_type"] == "code"] # Discard last cell if empty cell_source = code_cells[-1]["source"] # remove empty strings, then test if anything is left if not any(cell_source): del code_cells[-1] return code_cells @staticmethod def _strip_line(line): """Remove comments and any trailing whitespace.""" line = re.sub(r"^(.*?)#(.*)$", r"\1", line) return line.rstrip() @staticmethod def _is_source_code_equal(x_list, y_list): """Scrub lines of comments, remove empty lines, then compare.""" x_list = [Notebook._strip_line(line) for line in x_list if line] y_list = [Notebook._strip_line(line) for line in y_list if line] return x_list == y_list def _set_cell_source(self, cell_id, source): for i, cell in enumerate(self.data["cells"]): if cell["metadata"]["id"] == cell_id: self.data["cells"][i]["source"] = source break else: # for-loop exhausted raise Exception("Did not find cell id '{}' in notebook.".format(cell_id)) def update(self, notebook): """Update code cells that differ from the provided notebook.""" if len(self.code_cells) != len(notebook.code_cells): raise Exception("Notebooks must have same amount of code cells.") # Iterate all cells for destination reference for i, src_cell in enumerate(notebook.code_cells): dest_cell = self.code_cells[i] # Compare source code after scrubbing comments. # Ensures translated comments are preserved until the code changes. if not Notebook._is_source_code_equal(src_cell["source"], dest_cell["source"]): self._set_cell_source(dest_cell["metadata"]["id"], src_cell["source"]) def write(self, use_stdout=False): """Write notebook to file or print to screen.""" def print_file(outfile): json.dump(self.data, outfile, indent=2, ensure_ascii=False) outfile.write("\n") # add trailing newline if use_stdout: print_file(sys.stdout) else: with open(self.path, "w") as outfile: print_file(outfile) print("Wrote: {}".format(self.path)) def get_src_path(user_flags, notebook): """Get path of source notebook based on user flags or the destination file. Args: user_flags: Command-line arguments notebook: Destination notebook used to select source notebook. Returns: A Path of the source-of-truth notebook. Raises: FileNotFoundError: If user args for site_root or src are invalid locations. """ if user_flags.site_root: site_root = pathlib.Path(user_flags.site_root) else: site_root = pathlib.Path(__file__).parent.parent.joinpath("site") if not site_root.is_dir(): raise FileNotFoundError(errno.ENOENT, os.strerror(errno.ENOENT), site_root) if not user_flags.src: # Determine path from previous notebook and source language fp_relpath = notebook.path.relative_to(site_root) # relative path fp_relpath = pathlib.Path(*fp_relpath.parts[1:]) return site_root.joinpath(user_flags.lang, fp_relpath) elif os.path.isdir(user_flags.src): return pathlib.Path(user_flags.src) / notebook.path.name elif os.path.isfile(user_flags.src): return pathlib.Path(user_flags.src) else: raise FileNotFoundError(errno.ENOENT, os.strerror(errno.ENOENT), user_flags.src) def main(argv): if len(argv) < 2: raise app.UsageError("Missing command-line arguments.") for dest_path in argv[1:]: if not Notebook.is_notebook(dest_path): print("Not a notebook file, skipping: {}".format(dest_path), file=sys.stderr) continue dest_notebook = Notebook.from_path(dest_path) src_path = get_src_path(flags.FLAGS, dest_notebook) src_notebook = Notebook.from_path(src_path) dest_notebook.update(src_notebook) dest_notebook.write(flags.FLAGS.stdout) if __name__ == "__main__": app.run(main)
Python
0.000036
fbbaa3fc5b99eed88e039c232f129aaeab0a6f54
Bring table test coverage to 100%
tests/test_table.py
tests/test_table.py
#!/usr/bin/env python3 import nose.tools as nose from table import Table def test_init_default(): """should initialize table with required parameters and default values""" table = Table(num_cols=5, width=78) nose.assert_equal(table.num_cols, 5) nose.assert_equal(table.width, 78) nose.assert_equal(table.alignment, 'left') nose.assert_equal(table.title, None) nose.assert_equal(table.header, []) nose.assert_equal(table.rows, []) def test_init_optional(): """should initialize table with optional parameters if supplied""" table = Table(num_cols=5, width=78, alignment='right', title='Cache') nose.assert_equal(table.num_cols, 5) nose.assert_equal(table.width, 78) nose.assert_equal(table.alignment, 'right') nose.assert_equal(table.title, 'Cache') def test_get_separator(): """should return the correct ASCII separator string""" table = Table(num_cols=5, width=78) nose.assert_equal(table.get_separator(), '-' * 78) def test_str_title(): """should correctly display title""" table = Table(num_cols=5, width=12, title='Cache') nose.assert_regexp_matches( ''.join(('Cache'.center(12), '\n', ('-' * 12))), str(table)) def test_str_no_title(): """should not display title if not originally supplied""" table = Table(num_cols=5, width=12) nose.assert_equal(str(table).strip(), '') class TestAlignment(object): def _test_str_align(self, alignment, just): table_width = 16 num_cols = 2 col_width = table_width // num_cols table = Table( num_cols=num_cols, width=table_width, alignment=alignment) table.header = ['First', 'Last'] table.rows.append(['Bob', 'Smith']) table.rows.append(['John', 'Earl']) nose.assert_equal(str(table), '{}{}\n{}\n{}{}\n{}{}'.format( just('First', col_width), just('Last', col_width), '-' * table_width, just('Bob', col_width), just('Smith', col_width), just('John', col_width), just('Earl', col_width))) def test_str_align_left(self): """should correctly display table when left-aligned""" self._test_str_align( alignment='left', just=str.ljust) def test_str_align_center(self): """should correctly display table when center-aligned""" self._test_str_align( alignment='center', just=str.center) def test_str_align_right(self): """should correctly display table when right-aligned""" self._test_str_align( alignment='right', just=str.rjust)
Python
0
f392a90ae12a5f9aab04b22e82d493d0f93db9fd
Add first test
tests/test_utils.py
tests/test_utils.py
def test_ok(): assert True
Python
0.000029
e56a9781f4e7e8042c29c9e54966659c87c5c05c
Add a test for our more general views.
tests/test_views.py
tests/test_views.py
import pytest from django.core.urlresolvers import reverse def test_site_view(client): response = client.get(reverse('site-home')) assert response.status_code == 200 assert 'landings/home_site.html' in [template.name for template in response.templates]
Python
0
675b7fc917b5f99120ca4d6dcb79b3e821dbe72a
add Olin specific script
downloadOlin.py
downloadOlin.py
import os from downloadMailmanArchives import main class Struct: def __init__(self, **entries): self.__dict__.update(entries) if __name__ == '__main__': args = { 'archive_root_url': ['https://lists.olin.edu/mailman/private/carpediem/', 'https://lists.olin.edu/mailman/private/helpme/'], 'password' : os.environ.get('ARCHIVE_LOGIN', "fail"), 'username' : os.environ.get('ARCHIVE_PASS', "fail"), 'force' : True, 'dest' : './archives' } main(Struct(**args))
Python
0
53e0bb6c88d64cd1ee1717e19f51c8aed1ba5cdd
implement expect column values valid MBTI (#4702)
contrib/experimental/great_expectations_experimental/expectations/expect_column_values_to_be_valid_mbti.py
contrib/experimental/great_expectations_experimental/expectations/expect_column_values_to_be_valid_mbti.py
import re from typing import Optional from great_expectations.core.expectation_configuration import ExpectationConfiguration from great_expectations.execution_engine import PandasExecutionEngine from great_expectations.expectations.expectation import ColumnMapExpectation from great_expectations.expectations.metrics import ( ColumnMapMetricProvider, column_condition_partial, ) MBTI_REGEX = r"^(?i)([EI][NS][FT][PJ])$" # This class defines a Metric to support your Expectation. # For most ColumnMapExpectations, the main business logic for calculation will live in this class. class ColumnValuesToBeValidMbti(ColumnMapMetricProvider): # This is the id string that will be used to reference your metric. condition_metric_name = "column_values.valid_mbti" # This method implements the core logic for the PandasExecutionEngine @column_condition_partial(engine=PandasExecutionEngine) def _pandas(cls, column, **kwargs): def matches_mbti_regex(x): if re.match(MBTI_REGEX, str(x)): return True return False return column.apply(lambda x: matches_mbti_regex(x) if x else False) # This method defines the business logic for evaluating your metric when using a SqlAlchemyExecutionEngine # @column_condition_partial(engine=SqlAlchemyExecutionEngine) # def _sqlalchemy(cls, column, _dialect, **kwargs): # raise NotImplementedError # This method defines the business logic for evaluating your metric when using a SparkDFExecutionEngine # @column_condition_partial(engine=SparkDFExecutionEngine) # def _spark(cls, column, **kwargs): # raise NotImplementedError # This class defines the Expectation itself class ExpectColumnValuesToBeValidMbti(ColumnMapExpectation): """This Expectation validates data as conforming to the valid Myers–Briggs Type Indicator (MBTI).""" # These examples will be shown in the public gallery. # They will also be executed as unit tests for your Expectation. examples = [ { "data": { "well_formed_mbti": [ "INTP", "intp", "ESFJ", "INFP", ], "malformed_mbti": [ "", "INTP-", "IETP", "This is not a valid MBTI", ], }, "tests": [ { "title": "basic_positive_test", "exact_match_out": False, "include_in_gallery": True, "in": {"column": "well_formed_mbti"}, "out": {"success": True}, }, { "title": "basic_negative_test", "exact_match_out": False, "include_in_gallery": True, "in": {"column": "malformed_mbti"}, "out": {"success": False}, }, ], } ] # This is the id string of the Metric used by this Expectation. # For most Expectations, it will be the same as the `condition_metric_name` defined in your Metric class above. map_metric = "column_values.valid_mbti" # This is a list of parameter names that can affect whether the Expectation evaluates to True or False success_keys = ("mostly",) # This dictionary contains default values for any parameters that should have default values default_kwarg_values = {} def validate_configuration( self, configuration: Optional[ExpectationConfiguration] ) -> None: """ Validates that a configuration has been set, and sets a configuration if it has yet to be set. Ensures that necessary configuration arguments have been provided for the validation of the expectation. Args: configuration (OPTIONAL[ExpectationConfiguration]): \ An optional Expectation Configuration entry that will be used to configure the expectation Returns: None. Raises InvalidExpectationConfigurationError if the config is not validated successfully """ super().validate_configuration(configuration) if configuration is None: configuration = self.configuration # # Check other things in configuration.kwargs and raise Exceptions if needed # try: # assert ( # ... # ), "message" # assert ( # ... # ), "message" # except AssertionError as e: # raise InvalidExpectationConfigurationError(str(e)) # This object contains metadata for display in the public Gallery library_metadata = { "maturity": "experimental", "tags": ["experimental", "hackathon", "typed-entities"], "contributors": [ "@voidforall", ], } if __name__ == "__main__": ExpectColumnValuesToBeValidMbti().print_diagnostic_checklist()
Python
0.000109
a46f0a709747dbe90f0495e7e6b12c7b511baa7f
Delete duplicate wapp images
dupe_deleter.py
dupe_deleter.py
""" # Install QPython3 for android # https://github.com/qpython-android/qpython3/releases # Execute the below script in QPython3 """ import os, hashlib from operator import itemgetter from itertools import groupby image_list = [] folder_list = [r'/storage/emulated/0/whatsapp/media/whatsapp images/', r'/storage/emulated/0/whatsapp/media/whatsapp images/Sent'] for folder in folder_list: file_list = os.listdir(folder) for img_file in file_list: file_path = os.path.join(folder, img_file) if os.path.isfile(file_path): try: image_list.append([file_path, hashlib.sha1(open(file_path, 'rb').read()).hexdigest()]) except IOError: raise Exception('Error reading the file') image_list.sort(key=itemgetter(1)) groups = groupby(image_list, itemgetter(1)) for (img_hash, img_list_same_hash) in groups: z = [img for img in img_list_same_hash] i = 1 while i < len(z): os.remove(z[i][0]) print('Deleted ' + z[i][0]) i += 1
Python
0.000001
9f4452983e38d002e141ed0d2a9c865656a553ce
add todo stuff
main.py
main.py
#!/usr/bin/env python # __author__ = 'Dmitry Shihaleev' # __version__= '0.2' # __email__ = 'padavankun@gmail.com' # __license__ = 'MIT License'
Python
0
ab7c0d05a6bcf8be83409ccd96f2ed4a6fe65a73
Create main.py
main.py
main.py
#!/usr/bin/env python3 import sys import socket import string HOST = "chat.freenode.net" # You can change this to whatever you want PORT = 6667 NICK = "Your Nick Name" IDENT = "Your Identity" REALNAME = "Your REAL Name" MASTER = "The Master of this particular Slave" CHANNEL = "The Channel To join" readbuffer = "" s = socket.socket() s.connect((HOST, PORT)) # sets the nickname inside IRC channel s.send(bytes("NICK %s\r\n" % NICK, "UTF-8")) # Connects to the server using the provided inforamtion above. The 'bla' is irrelevent s.send(bytes("USER %s %s bla :%s\r\n" % (IDENT, HOST, REALNAME), "UTF-8")) # Joins the Channel s.send(bytes("JOIN #%s \r\n" % (CHANNEL), "UTF-8")) # starts a conversation with the 'master' when joining s.send(bytes("PRIVMSG %s :Hello Master\r\n" % MASTER, "UTF-8")) while True: readbuffer = readbuffer+s.recv(1024).decode("UTF-8") temp = str.split(readbuffer, "\n") readbuffer = temp.pop() for line in temp: line = str.rstrip(line) line = str.split(line) if(line[0] == "PING"): s.send(bytes("PONG %s\r\n" % line[1], "UTF-8")) if(line[1] == "PRIVMSG"): sender = "" for char in line[0]: if(char == "!"): break if(char != ":"): sender += char size = len(line) i = 3 message = "" while(i < size): message += line[i] + " " i = i + 1 message.lstrip(":") s.send(bytes("PRIVMSG %s %s \r\n" % (sender, message), "UTF-8")) for index, i in enumerate(line): print(line[index])
Python
0
12490fa92e54becca77c70d124d807b19d71afa1
Create main.py
main.py
main.py
# waypointviewer.py Waypoint Viewer Google Maps/Google AppEngine application # Copyright (C) 2011 Tom Payne # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import json from google.appengine.api.urlfetch import fetch from google.appengine.ext import webapp from google.appengine.ext.webapp import template from google.appengine.ext.webapp.util import run_wsgi_app import os.path import waypoint class MainPage(webapp.RequestHandler): def get(self): template_values = dict((key, self.request.get(key)) for key in ('kml', 'logo', 'tsk', 'title', 'wpt')) path = os.path.join(os.path.dirname(__file__), 'templates', 'index.html') self.response.out.write(template.render(path, template_values)) class WaypointviewerJs(webapp.RequestHandler): def get(self): template_values = dict((key, self.request.get(key)) for key in ('kml', 'logo', 'tsk', 'wpt')) path = os.path.join(os.path.dirname(__file__), 'templates', 'waypointviewer.js') self.response.headers['content-type'] = 'text/javascript' self.response.out.write(template.render(path, template_values)) class Wpt2json(webapp.RequestHandler): def get(self): debug = self.request.get('debug') wpt = self.request.get('wpt') response = fetch(wpt) content = response.content.decode('latin_1') feature_collection = waypoint.feature_collection(content.splitlines(), debug=debug) if debug: feature_collection_properties['content'] = content feature_collection_properties['content_was_truncated'] = response.content_was_truncated feature_collection_properties['final_url'] = response.final_url headers = dict((key, response.headers[key]) for key in response.headers) feature_collection_properties['headers'] = headers feature_collection_properties['status_code'] = response.status_code keywords = {'indent': 4, 'sort_keys': True} else: keywords = {} self.response.headers['content-type'] = 'application/json' self.response.out.write(json.dumps(feature_collection, **keywords)) app = webapp.WSGIApplication([('/', MainPage), ('/waypointviewer.js', WaypointviewerJs), ('/wpt2json.json', Wpt2json)], debug=True) def main(): run_wsgi_app(app) if __name__ == '__main__': main()
Python
0.000001
7e4cfdbdb6bcfd385bcbf9ddcca99b4e9800efaf
Create musy.py
musy.py
musy.py
import os def crear_carpeta(carpeta): if not os.path.exists(carpeta): os.makedirs(carpeta) def generar_datos_post(plantilla,post): return (plantilla.replace("*t",post["titulo"]) .replace("*d",post["resumen"]) .replace("*e",post["enlace"]) .replace("*c",post["contenido"]) ) def grabar_fichero(carpeta, nombre, datos): with open(os.path.join(carpeta,nombre), "w") as g: g.write(datos) g.close() plantilla = ''' <!DOCTYPE html> <html> <head> <meta charset="utf-8"> <meta http-equiv="X-UA-Compatible" content="IE=edge"> <meta name="viewport" content="width=device-width, initial-scale=1"> <title>*t</title> <meta name="description" content="*d"> <link rel="stylesheet" href="/css/main.css"> <link rel="stylesheet" href="/css/custom.css"> <link rel="canonical" href="http://sabiavida.com/*e/"> <link rel="alternate" type="application/rss+xml" title="Sabia Vida" href="http://sabiavida.com/feed.xml" /> </head> <body> <div class="page-content"> <div class="wrapper"> <div class="post"> <div class="container"> <div class="row"> <div class="col-md-11 col-lg-9"> <header class="post-header"> <h1><small><a href="http://sabiavida.com">SabiaVida</a></small> <br><br><br><div class="post_title">*t</div></h1> <p class="lead">de Miguel de Luis</p> </header> <article class="post-content"> <div class="container"> <div class="row"> <div class="col-md-11 col-lg-9"> <div class="jumbotron"> *c </div> </div> </div> </div> </article> </div> </div> </div> </div> </div> </div> <footer class="site-footer"> <div class="container"> <nav class="navbar navbar-default navbar-fixed-bottom hidden-xs" role="navigation"> <div class="container-fluid"> <div class="navbar-header"> <button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1"> <span class="sr-only">Toggle navigation</span> <span class="icon-bar"></span> <span class="icon-bar"></span> <span class="icon-bar"></span> </button> <a class="navbar-brand" href="http://sabiavida.com">SabiaVida</a> </div> <div class="collapse navbar-collapse" id="bs-example-navbar-collapse-1"> <ul class="nav navbar-nav"><li id="menu-item-10934" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-10934"><a href="http://sabiavida.com/contacto/">Contacto</a></li> <li id="menu-item-10935" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-10935"><a href="/archivos/">Archivos</a></li> <li id="menu-item-12525" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-12525"><a href="http://sabiavida.us2.list-manage1.com/subscribe?u=f89f0f12785e9891d2a51bbc2&#038;id=a3ff4967cf">Suscríbete</a></li> </div> </div> </nav> <div class="visible-xs"> <a class="btn btn-default btn-lg btn-block" href="/">inicio</a> <a class="btn btn-default btn-lg btn-block" href="http://sabiavida.com/contacto/">contacto</a> <a href="http://sabiavida.us2.list-manage1.com/subscribe?u=f89f0f12785e9891d2a51bbc2&#038;id=a3ff4967cf">Suscríbete</a> </div> </div> </footer> </body> </html> ''' posts = [ { "titulo":"Uno", "enlace":"uno-enlace", "resumen":"primer post", "contenido":''' <p>Este es el primer post</p> <p>¡Bien!</p> ''', }, { "titulo":"Dos", "enlace":"dos-enlace", "resumen":"segundo post", "contenido":''' <p>Este es el primer post</p> <p>¡Bien!</p> ''', } ] for post in posts: crear_carpeta(post["enlace"]) datos = generar_datos_post(plantilla,post) grabar_fichero(post["enlace"], 'index.html', datos)
Python
0.000001
34847fbe0e04a2da8957a0ba5de92856ca73c8cc
Add missing migration
osf/migrations/0054_auto_20170823_1555.py
osf/migrations/0054_auto_20170823_1555.py
# -*- coding: utf-8 -*- # Generated by Django 1.11.4 on 2017-08-23 20:55 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('osf', '0053_add_quickfiles'), ] operations = [ migrations.AlterField( model_name='abstractnode', name='type', field=models.CharField(choices=[('osf.node', 'node'), ('osf.collection', 'collection'), ('osf.registration', 'registration'), ('osf.quickfilesnode', 'quick files node')], db_index=True, max_length=255), ), ]
Python
0.0002
08df517cad06279120dc2ee9a4942bf86afc8323
add plot.py
plot.py
plot.py
#!/usr/bin/env python # a bar plot with errorbars import numpy as np import matplotlib.pyplot as plt import csv bar_width = 0.6 xstick_offset = 0.3 def to_float(str): return float(str.replace(',', '')) def plot_wc_time(algebras, time, std, output_name): """ Plot wall clock time """ assert len(algebras) == len(time) assert len(std) == len(time) ind = np.arange(len(time)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, time, width=bar_width, color='m', yerr=std) ax.set_ylabel('Time (sec)') ax.set_xlabel('Physical Algebra') ax.set_title('Wall clock time') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot_cpu_time(algebras, time, output_name): """ Plot cpu time """ assert len(algebras) == len(time) ind = np.arange(len(time)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, time, width=bar_width, color='m') ax.set_ylabel('Time (sec)') ax.set_xlabel('Physical Algebra') ax.set_title('Total CPU time') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot_shuffle_skew(algebras, skews, output_name): """ Plot max skew among shuffles """ assert len(algebras) == len(skews) ind = np.arange(len(skews)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, skews, width=bar_width, color='m') ax.set_ylabel('Skew (max/avg)') ax.set_xlabel('Physical Algebra') ax.set_title('Maximal skew in shuffle(s)') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot_shuffle_size(algebras, shuffle_size, output_name): """ Plot shuffle size """ assert len(algebras) == len(shuffle_size) ind = np.arange(len(shuffle_size)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, shuffle_size, width=bar_width, color='m') ax.set_ylabel('Number of tuples shuffled (million)') ax.set_xlabel('Physical Algebra') ax.set_title('Number of tuples shuffled') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot_output_skew(algebras, skews, output_name): """ Plot max skew among output """ assert len(algebras) == len(skews) ind = np.arange(len(skews)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, skews, width=bar_width, color='m') ax.set_ylabel('Skew (max/avg)') ax.set_xlabel('Physical Algebra') ax.set_title('Maximal skew in output') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot_hashtable_size(algebras, htsizes, output_name): """ """ assert len(algebras) == len(htsizes) ind = np.arange(len(htsizes)) # the x locations for the groups fig, ax = plt.subplots() ax.bar(ind, htsizes, width=bar_width, color='m') ax.set_ylabel('Memory usage (MB)') ax.set_xlabel('Physical Algebra') ax.set_title('Memory usage') ax.set_xticks(ind+xstick_offset) ax.set_xticklabels(algebras) print "outputing {}".format(output_name) plt.savefig(output_name, format='pdf') def plot(): fname = "SIGMOD Experiment - summary.csv" agbrs = ('RS_HJ', 'HC_HJ', 'BR_HJ', 'RS_LFJ', 'HC_LFJ', 'BR_LFJ') queries = ('triangle', 'clique', 'fb_q1') with open(fname, "rU") as f: csvreader = csv.reader(f) data = [r for r in csvreader] # output wall clock time for query in queries: time = [] std = [] for row in data: if row[0] == query: time.append(to_float(row[2])) std.append(to_float(row[3])) plot_wc_time(agbrs, time, std, "{}_wall_time.pdf".format(query)) # output cpu time for query in queries: time = [] for row in data: if row[0] == query: time.append(to_float(row[8])) plot_cpu_time(agbrs, time, "{}_cpu_time.pdf".format(query)) # output shuffle skew for query in queries: skews = [] for row in data: if row[0] == query: skews.append(to_float(row[7])) plot_shuffle_skew( agbrs, skews, "{}_shuffle_skew.pdf".format(query)) # output number of tuples shuffled in total for query in queries: shuffle_sizes = [] for row in data: if row[0] == query: shuffle_sizes.append(to_float(row[10])) plot_shuffle_size( agbrs, shuffle_sizes, "{}_shuffle_size.pdf".format(query)) # output output skew for query in queries: skews = [] for row in data: if row[0] == query: skews.append(to_float(row[11])) plot_shuffle_skew( agbrs, skews, "{}_output_skew.pdf".format(query)) # output hash table size for query in queries: htsizes = [] for row in data: if row[0] == query: htsizes.append(to_float(row[9])) plot_hashtable_size( agbrs, htsizes, "{}_memory.pdf".format(query)) if __name__ == '__main__': plot()
Python
0.000012
4102ab8fc24265aaee1ecbf673bec260b3b3e5df
add max sub arr impl
bioinformatics/dynamic_programming/max_sum_sub_arr1.py
bioinformatics/dynamic_programming/max_sum_sub_arr1.py
def max_sum_sub_arr(arr): score_vector = [0 for _ in range(len(arr))] def max_sum_sub_arr_detail(beg_idx): if beg_idx >= len(arr): return 0 elif arr[beg_idx] >= 0: score_vector[beg_idx] = arr[beg_idx] + max_sum_sub_arr_detail(beg_idx + 1) return score_vector[beg_idx] else: score_vector[beg_idx] = max(0, arr[beg_idx] + max_sum_sub_arr_detail(beg_idx + 1)) return score_vector[beg_idx] max_sum_sub_arr_detail(0) print score_vector return max(score_vector) if __name__ == '__main__': print max_sum_sub_arr([1, -2, 3, 10, -4, 7, 2, -5])
Python
0.000001
1043acdfe324e02bc2a8629ef8a47d6ae9befd7c
Add python script to get ECC608 Public Key
src/aiy/_drivers/_ecc608_pubkey.py
src/aiy/_drivers/_ecc608_pubkey.py
#!/usr/bin/env python3 import base64 import ctypes import sys CRYPTO_ADDRESS_DICT = { 'Vision Bonnet': 0x60, 'Voice Bonnet': 0x62, } class AtcaIfaceCfgLong(ctypes.Structure): _fields_ = ( ('iface_type', ctypes.c_ulong), ('devtype', ctypes.c_ulong), ('slave_address', ctypes.c_ubyte), ('bus', ctypes.c_ubyte), ('baud', ctypes.c_ulong) ) def main(): try: cryptolib = ctypes.cdll.LoadLibrary('libcryptoauth.so') except Exception: print('Unable to load crypto library, SW authentication required') sys.exit() try: for name, addr in CRYPTO_ADDRESS_DICT.items(): cfg = AtcaIfaceCfgLong.in_dll(cryptolib, 'cfg_ateccx08a_i2c_default') cfg.slave_address = addr << 1 cfg.bus = 1 # ARM I2C cfg.devtype = 3 # ECC608 status = cryptolib.atcab_init(cryptolib.cfg_ateccx08a_i2c_default) if status == 0: # Found a valid crypto chip. break else: cryptolib.atcab_release() if status: raise Exception serial = ctypes.create_string_buffer(9) status = cryptolib.atcab_read_serial_number(ctypes.byref(serial)) if status: raise Exception serial = ''.join('%02X' % x for x in serial.raw) print('Serial Number: %s\n' % serial, file=sys.stderr) pubkey = ctypes.create_string_buffer(64) status = cryptolib.atcab_genkey_base(0, 0, None, ctypes.byref(pubkey)) if status: raise Exception public_key = bytearray.fromhex( '3059301306072A8648CE3D020106082A8648CE3D03010703420004') + bytes(pubkey.raw) public_key = '-----BEGIN PUBLIC KEY-----\n' + \ base64.b64encode(public_key).decode('ascii') + '\n-----END PUBLIC KEY-----' print(public_key) status = cryptolib.atcab_release() if status: raise Exception except Exception: print('Unable to communicate with crypto, SW authentication required') if __name__ == '__main__': main()
Python
0.000001
b04503bddfa3b0d737308ac8ecb7f06ac866e6eb
Create __init__.py
__init__.py
__init__.py
Python
0.000429
0b891e401bf0e671d3bc6f0347a456f1cc5b07b3
add __init__.py for root package
__init__.py
__init__.py
import sysdic
Python
0.000018
14f175c294ec6b5dcd75887a031386c1c9d7060d
add __main__
__main__.py
__main__.py
from . import parser import sys if len(sys.argv) == 1: print("compile yarh to html") print("usage: yarh [YARH_FILE]...") print(" yarh -- [YARH_STRING]") print(" yarh [YARH_FILE]... -- [YARH_STRING]") sys.exit(1) fromfile = True for arg in sys.argv[1:]: if arg == "--": fromfile = False continue if fromfile: f = open(arg, "r") print(parser.parseyarh(f.read()).html()) else: print(parser.parseyarh(arg).html()) fromfile = True break if not fromfile: print(parser.parseyarh(sys.stdin.read()).html())
Python
0.000247
e29c8e2d55464ac765db60a5cc213bb943b60742
add [[Portal:Beer]] and [[Portal:Wine]] tagging request script
trunk/portalbeer.py
trunk/portalbeer.py
#!usr/bin/python import sys, os, re sys.path.append(os.environ['HOME'] + '/stuffs/pywiki/pywikipedia') import wikipedia as wiki site = wiki.getSite() page = 'Portal:Beer/Selected picture/' #get page list pages = [] num = 0 content = """\ {{Selected picture | image = | size = | caption = | text = | credit = | link = }} """ while num <=50: num +=1 pages.append(wiki.Page(site,page + str(num))) #for page in pages: # print page # wiki.showDiff(page.get(), content) # page.put(content, 'Updating per [[WP:BOTREQ]]') raw_content = """\ {{Selected picture | image = | size = | caption = | text = | credit = | link = }} [[Category:Wine Portal]] """ pagewine = 'Portal:Wine/Selected picture/' pages1 = [] num = 0 while num <50: num +=1 pages1.append(wiki.Page(site,pagewine + str(num))) for page in pages1: print page try: wikitext = page.get() newtext = re.sub('Portal:Wine/Selected picture/Layout','Selected picture', wikitext) wiki.showDiff(wikitext, newtext) page.put(newtext, 'Updating per [[WP:BOTREQ]]') except wiki.NoPage: page.put(raw_content, 'Updating per [[WP:BOTREQ]]')
Python
0.000001
b56525d084ccbf1fe569900338f00a37e763d7dd
Add test_runtime_performance test
congress/tests/policy/test_runtime_performance.py
congress/tests/policy/test_runtime_performance.py
# Copyright (c) 2015 VMware, Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # from congress.openstack.common import log as logging from congress.policy import base from congress.policy.compile import Literal from congress.policy import runtime from congress.tests import base as testbase from congress.tests import helper LOG = logging.getLogger(__name__) NREC_THEORY = 'non-recursive theory' DB_THEORY = 'database' class TestRuntimePerformance(testbase.TestCase): """Tests for Runtime performance that are not specific to any theory. To run one test: nosetests -v \ congress/tests/policy/test_runtime_performance.py:TestRuntimePerformance.test_foo To collect profiling data: python -m cProfile -o profile.out `which nosetests` -v \ congress/tests/policy/test_runtime_performance.py:TestRuntimePerformance.test_foo To parse and sort profiling data in different ways: import pstats pstats.Stats('profile.out').strip_dirs().sort_stats("cum").print_stats() pstats.Stats('profile.out').strip_dirs().sort_stats("time").print_stats() pstats.Stats('profile.out').strip_dirs().sort_stats("calls").print_stats() """ def setUp(self): super(TestRuntimePerformance, self).setUp() self._runtime = runtime.Runtime() self._runtime.create_policy(NREC_THEORY, kind=base.NONRECURSIVE_POLICY_TYPE) self._runtime.create_policy(DB_THEORY, kind=base.DATABASE_POLICY_TYPE) self._runtime.debug_mode() self._runtime.insert('', target=NREC_THEORY) def _create_event(self, table, tuple_, insert, target): return runtime.Event(Literal.create_from_table_tuple(table, tuple_), insert=insert, target=target) def test_insert_nonrecursive(self): MAX = 100 th = NREC_THEORY for i in range(MAX): self._runtime.insert('r(%d)' % i, th) def test_insert_database(self): MAX = 100 th = DB_THEORY for i in range(MAX): self._runtime.insert('r(%d)' % i, th) def test_update_nonrecursive(self): MAX = 10000 th = NREC_THEORY updates = [self._create_event('r', (i,), True, th) for i in range(MAX)] self._runtime.update(updates) def test_update_database(self): MAX = 1000 th = DB_THEORY updates = [self._create_event('r', (i,), True, th) for i in range(MAX)] self._runtime.update(updates) def test_indexing(self): MAX = 100 th = NREC_THEORY for table in ('a', 'b', 'c'): updates = [self._create_event(table, (i,), True, th) for i in range(MAX)] self._runtime.update(updates) # With indexing, this query should take O(n) time where n is MAX. # Without indexing, this query will take O(n^3). self._runtime.insert('d(x) :- a(x), b(x), c(x)', th) ans = ' '.join(['d(%d)' % i for i in range(MAX)]) self.assertTrue(helper.datalog_equal(self._runtime.select('d(x)', th), ans)) def test_select(self): # with different types of policies (exercise indexing, large sets, # many joins, etc) pass def test_simulate(self): # We're interested in latency here. We think the cost will be the sum # of the simulate call + the cost to do and undo the evaluation, so # this test should focus on the cost specific to the simulate call, so # the the test should do a minimal amount of evaluation. pass def test_runtime_initialize_tables(self): MAX = 1000 formulas = [('p', 1, 2, 'foo', 'bar', i) for i in range(MAX)] th = NREC_THEORY self._runtime.initialize_tables(['p'], formulas, th)
Python
0.000016
525a6d214d3f6f9731c16bbf10ed150d1fa24021
Create betweenness.py
src/betweenness.py
src/betweenness.py
''' Created on Feb 20, 2019 @author: Victor ''' from neo4j.v1 import GraphDatabase, basic_auth driver = GraphDatabase.driver("bolt://localhost") session = driver.session() query = '''CALL algo.betweenness.sampled.stream(null, null, {strategy:'random', probability:1.0, maxDepth:1, direction: 'both'}) YIELD nodeId, centrality MATCH (actor) WHERE id(actor) = nodeId and exists(actor.name) RETURN actor.name AS actor,centrality ORDER BY centrality DESC LIMIT 10;''' result = session.run(query) print("Top Central Nodes") print("-----------------") for record in result: print("%s %s" % (record["actor"].ljust(25, " "), record["centrality"])) session.close()
Python
0.000139