query
stringlengths
11
289
positive
stringlengths
1
4.52k
negatives
listlengths
2
10
Spatial distribution of COVID-19 cases and epidemic spread rate in South Sumatra Province of Indonesia
Currently, many countries all over the world are facing the second wave of COVID-19. Therefore, this study aims to analyze the spatial distribution of COVID-19 cases, epidemic spread rate, spatial pattern during the first to the second waves in the South Sumatra Province of Indonesia. This study used the geographical information system (GIS) software to map the spatial distribution of COVID-19 cases and epidemic spread rate. The spatial autocorrelation of the COVID-19 cases was carried out using Moran's I, while the Pearson correlation was used to examining the relationship between meteorological factors and the epidemic spread rate. Most infected areas and the direction of virus spread were predicted using wind rose analysis. The results revealed that the epidemic rapidly spread from August 1 to December 1, 2020. The highest epidemic spread rate was observed in the Palembang district and in its peripheral areas (dense urban areas), while the lowest spread rate was found in the eastern and southern parts of South Sumatra Province (remote areas). The spatial correlation characteristic of the epidemic distribution exhibited a negative correlation and random distribution. Air temperature, wind speed, and precipitation have contributed to a significant impact on the high epidemic spread rate in the second wave. In summary, this study offers new insight for arranging control and prevention strategies against the potential of second wave strike.
[ "This paper uses the exploratory spatial data analysis and the geodetector method to analyze the spatial and temporal differentiation characteristics and the influencing factors of the COVID-19 (corona virus disease 2019) epidemic spread in mainland China based on the cumulative confirmed cases, average temperature, and socio-economic data. The results show that: (1) the epidemic spread rapidly from January 24 to February 20, 2020, and the distribution of the epidemic areas tended to be stable over time. The epidemic spread rate in Hubei province, in its surrounding, and in some economically developed cities was higher, while that in western part of China and in remote areas of central and eastern China was lower. (2) The global and local spatial correlation characteristics of the epidemic distribution present a positive correlation. Specifically, the global spatial correlation characteristics experienced a change process from agglomeration to decentralization. The local spatial correlation characteristics were mainly composed of the'high-high' and 'low-low' clustering types, and the situation of the contiguous layout was very significant. (3) The population inflow from Wuhan and the strength of economic connection were the main factors affecting the epidemic spread, together with the population distribution, transport accessibility, average temperature, and medical facilities, which affected the epidemic spread to varying degrees. (4) The detection factors interacted mainly through the mutual enhancement and nonlinear enhancement, and their influence on the epidemic spread rate exceeded that of single factors. Besides, each detection factor has an interval range that is conducive to the epidemic spread.", "The institution of social distancing and punitive measures to contain the spread of COVID-19 through human-to-human transmission has environmental, health and economic impact. While the global pandemic has led to the enhancement of the health system and decline of emissions, economic development appears deteriorating. Here, we present the global environmental, health and economic dimension of the effect of COVID-19 using qualitative and empirical assessments. We report the health system policies, environmental sustainability issues, and fiscal, monetary and exchange rate measures introduced during lockdown across countries. While air pollution is reported to have declined, municipal and medical waste is increasing. The COVID-19 global pandemic uncertainty ranks the UK as the country with the highest uncertainty level among 143 countries. The USA has introduced 100% of pre-COVID-19 crisis level GDP, the highest policy cut-rate among 162 countries. Science, innovation, research and development underpin COVID-19 containment measures implemented across countries. Our study demonstrates the need for future research to focus on environment-health-economic nexus-a trilemma that has a potential trade-off.", "The purpose of this study was to explore the temporal and spatial characteristics of COVID-19 transmission and its influencing factors in China, from January to October 2020. About 81,000 COVID-19 confirmed case data, Baidu migration index data, air pollutants, meteorological data, and government response strictness index data were collected from 31 provincial-level regions (excluding Hong Kong, Macao, and Taiwan) and 337 prefecture-level cities. The spatio-temporal characteristics of COVID-19 were explored using spatial autocorrelation, hot spot, and spatio-temporal scanning statistics. At the same time, Spearman rank correlation analysis and multiple linear regression were used to explore the relationship between influencing factors and confirmed COVID-19 cases. The distribution of COVID-19 in China tends to be stable over time, with spatial correlation and prominent clustering regions. Spatio-temporal scanning analysis showed that most COVID-19 high-incidence months were from January to March at the beginning of the epidemic, and the area with the highest aggregation risk was Hubei Province (RR=491.57) which was 491.57 times the aggregation risk of other regions. Among the meteorological variables, the daily average temperature, wind speed, precipitation, and new COVID-19 cases were negatively correlated. The air pollution concentration and migration index were positively correlated with new confirmed cases, and the government response strict index was strongly negatively correlated with confirmed COVID-19 cases. Environmental temperature has a certain inhibitory effect on the transmission of COVID-19; the air pollution concentration and migration index have a certain promoting effect on the transmission of COVID-19. The strict government response index indicates that the greater the intensity of government intervention, the fewer COVID-19 cases will occur.", "In 2020, Coronavirus Disease 2019 (COVID-19), caused by the SARS-CoV-2 (Severe Acute Respiratory Syndrome Corona Virus 2) Coronavirus, unforeseen pandemic put humanity at big risk and health professionals are facing several kinds of problem due to rapid growth of confirmed cases. That is why some prediction methods are required to estimate the magnitude of infected cases and masses of studies on distinct methods of forecasting are represented so far. In this study, we proposed a hybrid machine learning model that is not only predicted with good accuracy but also takes care of uncertainty of predictions. The model is formulated using Bayesian Ridge Regression hybridized with an n-degree Polynomial and uses probabilistic distribution to estimate the value of the dependent variable instead of using traditional methods. This is a completely mathematical model in which we have successfully incorporated with prior knowledge and posterior distribution enables us to incorporate more upcoming data without storing previous data. Also, L2 (Ridge) Regularization is used to overcome the problem of overfitting. To justify our results, we have presented case studies of three countries, -the United States, Italy, and Spain. In each of the cases, we fitted the model and estimate the number of possible causes for the upcoming weeks. Our forecast in this study is based on the public datasets provided by John Hopkins University available until 11th May 2020. We are concluding with further evolution and scope of the proposed model." ]
Ceftazidime Pharmacokinetics in Children and Adolescents with Obesity
The aim of this study was to evaluate ceftazidime pharmacokinetics (PK) in a cohort that includes a predominate number of children and adolescents with obesity and assess the efficacy of competing dosing strategies.
[ "The increased prevalence of obesity presents challenges for clinicians aiming to provide optimised antimicrobial dosing in the intensive care unit. Obesity is likely to exacerbate the alterations to antimicrobial pharmacokinetics when the chronic diseases associated with obesity exist with the acute pathophysiological changes associated with critical illness. The purpose of this paper is to review the potential pharmacokinetic (PK) changes of antimicrobials in obese critically ill patients and the implications for appropriate dosing. We found that hydrophilic antimicrobials (e.g. β-lactams, vancomycin, daptomycin) were more likely to manifest altered pharmacokinetics in critically ill patients who are obese. In particular for β-lactam antibiotics, obesity is associated with a larger volume of distribution (V(d)). In obese critically ill patients, piperacillin is also associated with a lower drug clearance (CL). For doripenem, these PK changes have been associated with reduced achievement of pharmacodynamic (PD) targets when standard drug doses are used. For vancomycin, increases in Vd are associated with increasing total body weight (TBW), meaning that the loading dose should be based on TBW even in obese patients. For daptomycin, an increased Vd is not considered to be clinically relevant. For antifungals, little data exist in obese critically ill patients; during fluconazole therapy, an obese patient had a lower V(d) and higher CL than non-obese comparators. Overall, most studies suggested that standard dosage regimens of most commonly used antimicrobials are sufficient to achieve PD targets. However, it is likely that larger doses would be required for pathogens with higher minimum inhibitory concentrations.", "The NONMEM program is the most widely used nonlinear regression software in population pharmacokinetic/pharmacodynamic (PK/PD) analyses. In this article we describe a programming library, Perl-speaks-NONMEM (PsN), intended for programmers that aim at using the computational capability of NONMEM in external applications. The library is object oriented and written in the programming language Perl. The classes of the library are built around NONMEM's data, model and output files. The specification of the NONMEM model is easily set or changed through the model and data file classes while the output from a model fit is accessed through the output file class. The classes have methods that help the programmer perform common repetitive tasks, e.g. summarising the output from a NONMEM run, setting the initial estimates of a model based on a previous run or truncating values over a certain threshold in the data file. PsN creates a basis for the development of high-level software using NONMEM as the regression tool.", "Ceftazidime disposition after an intravenous dose of 50 mg/kg infused over 20 min was followed in 10 subjects with cystic fibrosis (CF) hospitalized with acute pulmonary exacerbations and in 10 healthy subjects. Serum ceftazidime elimination t 1/2 decreased from 105.3 +/- 12.4 min (mean +/- SD) in controls to 90.0 +/- 11.1 min in subjects with CF. Calculated distribution volumes were both larger in subjects with CF. When normalized for body surface area, total body clearance (Cl) was 41.9% greater in the CF group (142.4 +/- 16.9 and 100.5 +/- 10.3 ml/min/1.73 m2). Normalization for body weight revealed 64.8% greater Cl in subjects with CF. Fraction of dose recovered in urine was of the same order for each group, while renal clearance (ClR) was 40.9% greater in the subjects with CF (130.1 +/- 11.4 and 92.7 +/- 11.6 ml/min/1.73 m2). Five subjects with CF were restudied while infection-free 119 to 219 days after the original study day. With the exception of a 10% increase in the volume of distribution at steady state while infection-free, kinetic parameters were much the same. No changes in Cl or ClR were evident from one study day to the next. Acute pulmonary infection does not appear to alter ceftazidime clearance in CF. The mechanism underlying increased ceftazidime Cl and ClR in CF is not apparent from the present data.", "In patients with infection, improving the probability of positive treatment outcomes depends on optimizing the interactions between the host, pathogen, and drug. In this setting, optimal regimens must be utilized which not only maximize effectiveness in a specific patient, but also minimize the development of microbial resistance. The probability of achieving a specifically targeted antimicrobial exposure can be assessed using Monte Carlo simulation, a technique which integrates an agent's in vitro potency distribution (i.e., minimum inhibitory concentrations [MICs]) with the pharmacokinetic profile. The targeted pharmacodynamic parameters assessed by this technique include the ratio of peak concentration (C(max)) to MIC (C(max) : MIC); the ratio of the area under the plasma concentration-time curve (AUC) to MIC (AUC : MIC), and the time the drug concentration exceeds the MIC (T > MIC). Some antimicrobials, e.g., the aminoglycosides, are most effective/bactericidal when they have a high C(max) : MIC ratio; others, e.g., the fluoroquinolones, are more effective when the AUC : MIC ratio is high. In both of these scenarios, organism eradication is concentration-dependent, and the therapeutic goal is to maximize drug exposure. Like the fluoroquinolones, the efficacy of telithromycin, a newly developed ketolide, is most related to the AUC : MIC ratio. Outcome for other agents, such as the beta-lactams, is best predicted by the T > MIC; in this case, organism eradication is time-dependent, and the therapeutic goal is to optimize the duration of antimicrobial exposure. This article discusses how the use of currently available antimicrobials can be optimized through an appreciation of pharmacodynamic profiling.", "Ceftazidime is a broad-spectrum cephalosporin with high-level activity against a variety of Gram-negative pathogens, including Pseudomonas aeruginosa. Improved outcomes are associated with cumulative percentages of a 24-h period that the drug concentration exceeds the MIC under steady-state pharmacokinetic conditions (%TMIC) of >45 to 70% of the dosing interval. Optimal dosing to achieve a 90% probability of target attainment (PTA) in patients receiving high-flux hemodialysis (HFHD) is unknown. We used existing data from six anephric adults receiving hemodialysis to construct a population model with the Pmetrics package for R. From the final model's joint probability density, we simulated the PTA for various ceftazidime dosing regimens, HFHD schedules, and organism MICs. For HFHD every 48 h and 1 g of ceftazidime given posthemodialysis, the PTA exceeds 90% for all isolates with MICs of ≤8 μg/ml, assuming a goal of 70%TMIC. For 72-h dialysis intervals, postdialysis dosing of 1 g is adequate for achievement of the 70%TMIC goal only for organisms with MICs of ≤4 μg/ml, while 2 g is adequate for organisms with MICs of ≤8 μg/ml. A dose of 500 mg once daily, regardless of HFHD schedule, has a 90% PTA for organisms with MICs of ≤16 μg/ml, while 1 g once daily may achieve 100% PTA even for resistant organisms with a MIC of 32 μg/ml. Therefore, to ensure maximal ceftazidime activity, once-daily dosing of 500 mg to 1 g ceftazidime in patients receiving HFHD may be preferable for critically ill patients when MIC data are unavailable and for more resistant organisms with ceftazidime MICs of 16 to 32 μg/ml." ]
Big Data and the Right to Health in China
Individuals have the right to health according to the Constitution and other laws in China. Significant barriers have prevented the full realisation of the right to health in the COVID-19 era. Big data technology, which is a vital tool for COVID-19 containment, has been a central topic of discussion, as it has been used to protect the right to health through public health surveillance, contact tracing, real-time epidemic outbreak monitoring, trend forecasting, online consultations, and the allocation of medical and health resources in China. Big data technology has enabled precise and efficient epidemic prevention and control and has improved the efficiency and accuracy of the diagnosis and treatment of this new form of coronavirus pneumonia due to Chinese institutional factors. Although big data technology has successfully supported the containment of the virus and protected the right to health in the COVID-19 era, it also risks infringing on individual privacy rights. Chinese policymakers should understand the positive and negative impacts of big data technology and should prioritise the Personal Information Protection Law and other laws that are meant to protect and strengthen the right to privacy.
[ "In December, 2019, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a novel coronavirus, emerged in Wuhan, China. Since then, the city of Wuhan has taken unprecedented measures in response to the outbreak, including extended school and workplace closures. We aimed to estimate the effects of physical distancing measures on the progression of the COVID-19 epidemic, hoping to provide some insights for the rest of the world. To examine how changes in population mixing have affected outbreak progression in Wuhan, we used synthetic location-specific contact patterns in Wuhan and adapted these in the presence of school closures, extended workplace closures, and a reduction in mixing in the general community. Using these matrices and the latest estimates of the epidemiological parameters of the Wuhan outbreak, we simulated the ongoing trajectory of an outbreak in Wuhan using an age-structured susceptible-exposed-infected-removed (SEIR) model for several physical distancing measures. We fitted the latest estimates of epidemic parameters from a transmission model to data on local and internationally exported cases from Wuhan in an age-structured epidemic framework and investigated the age distribution of cases. We also simulated lifting of the control measures by allowing people to return to work in a phased-in way and looked at the effects of returning to work at different stages of the underlying outbreak (at the beginning of March or April). Our projections show that physical distancing measures were most effective if the staggered return to work was at the beginning of April; this reduced the median number of infections by more than 92% (IQR 66-97) and 24% (13-90) in mid-2020 and end-2020, respectively. There are benefits to sustaining these measures until April in terms of delaying and reducing the height of the peak, median epidemic size at end-2020, and affording health-care systems more time to expand and respond. However, the modelled effects of physical distancing measures vary by the duration of infectiousness and the role school children have in the epidemic. Restrictions on activities in Wuhan, if maintained until April, would probably help to delay the epidemic peak. Our projections suggest that premature and sudden lifting of interventions could lead to an earlier secondary peak, which could be flattened by relaxing the interventions gradually. However, there are limitations to our analysis, including large uncertainties around estimates of R0 and the duration of infectiousness. Bill & Melinda Gates Foundation, National Institute for Health Research, Wellcome Trust, and Health Data Research UK.", "There is a new public health crises threatening the world with the emergence and spread of 2019 novel coronavirus (2019-nCoV) or the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The virus originated in bats and was transmitted to humans through yet unknown intermediary animals in Wuhan, Hubei province, China in December 2019. There have been around 96,000 reported cases of coronavirus disease 2019 (COVID-2019) and 3300 reported deaths to date (05/03/2020). The disease is transmitted by inhalation or contact with infected droplets and the incubation period ranges from 2 to 14 d. The symptoms are usually fever, cough, sore throat, breathlessness, fatigue, malaise among others. The disease is mild in most people; in some (usually the elderly and those with comorbidities), it may progress to pneumonia, acute respiratory distress syndrome (ARDS) and multi organ dysfunction. Many people are asymptomatic. The case fatality rate is estimated to range from 2 to 3%. Diagnosis is by demonstration of the virus in respiratory secretions by special molecular tests. Common laboratory findings include normal/ low white cell counts with elevated C-reactive protein (CRP). The computerized tomographic chest scan is usually abnormal even in those with no symptoms or mild disease. Treatment is essentially supportive; role of antiviral agents is yet to be established. Prevention entails home isolation of suspected cases and those with mild illnesses and strict infection control measures at hospitals that include contact and droplet precautions. The virus spreads faster than its two ancestors the SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV), but has lower fatality. The global impact of this new epidemic is yet uncertain.", "During the first week of March, the coronavirus disease 2019 (COVID-19) outbreak reached more than 100 countries with over 100,000 cases. Health care authorities have already initiated awareness and preparedness activities worldwide. A poor understanding of the disease among health care workers (HCWs) may result in delayed treatment and result in the rapid spread of the infection. This study aimed to investigate the knowledge and perceptions of HCWs about COVID-19. A cross-sectional, web-based study was conducted among HCWs about COVID-19 during the first week of March 2020. A 23-item survey instrument was developed and distributed randomly to HCWs using social media; it required 5 minutes to complete. A chi-square test was used to investigate the level of association among variables, with significance set to P<.05. Of 529 participants, a total of 453 HCWs completed the survey (response rate: 85.6%); 51.6% (n=234) were male, 32.1% (n=147) were aged 25-34 years, and most were doctors (n=137, 30.2%) and medical students (n=134, 29.6%). Most participants (n=276, 61.0%) used social media to obtain information on COVID-19. A significant proportion of HCWs had poor knowledge of its transmission (n=276, 61.0%) and symptom onset (n=288, 63.6%) and showed positive perceptions of COVID-19. Factors such as age and profession were associated with inadequate knowledge and a poor perception of COVID-19. As the global threat of COVID-19 continues to emerge, it is critical to improve the knowledge and perceptions of HCWs. Educational interventions are urgently needed to reach HCWs worldwide, and further studies are warranted.", "In the early stages of the outbreak of coronavirus disease 2019 (COVID-19) in Hubei, China, the local health-care system was overwhelmed. Physicians and nurses who had no infectious disease expertise were recruited to provide care to patients with COVID-19. To our knowledge, no studies on their experiences of combating COVID-19 have been published. We aimed to describe the experiences of these health-care providers in the early stages of the outbreak. We did a qualitative study using an empirical phenomenological approach. Nurses and physicians were recruited from five COVID-19-designated hospitals in Hubei province using purposive and snowball sampling. They participated in semi-structured, in-depth interviews by telephone from Feb 10 to Feb 15, 2020. Interviews were transcribed verbatim and analysed using Haase's adaptation of Colaizzi's phenomenological method. We recruited nine nurses and four physicians. Three theme categories emerged from data analysis. The first was \"being fully responsible for patients' wellbeing-'this is my duty'\". Health-care providers volunteered and tried their best to provide care for patients. Nurses had a crucial role in providing intensive care and assisting with activities of daily living. The second category was \"challenges of working on COVID-19 wards\". Health-care providers were challenged by working in a totally new context, exhaustion due to heavy workloads and protective gear, the fear of becoming infected and infecting others, feeling powerless to handle patients' conditions, and managing relationships in this stressful situation. The third category was \"resilience amid challenges\". Health-care providers identified many sources of social support and used self-management strategies to cope with the situation. They also achieved transcendence from this unique experience. The intensive work drained health-care providers physically and emotionally. Health-care providers showed their resilience and the spirit of professional dedication to overcome difficulties. Comprehensive support should be provided to safeguard the wellbeing of health-care providers. Regular and intensive training for all health-care providers is necessary to promote preparedness and efficacy in crisis management. National Key R&D Program of China, Project of Humanities and Social Sciences of the Ministry of Education in China.", "The first cluster of COVID-19 cases was reported in Wuhan, China on December 29th, 2019. Since then, China has experienced a pandemic of COVID-19. This study aims to present the context in which the pandemic has evolved, the government's response and the pandemic's impact on public health and national economy. A review was conducted to collect relevant data from press releases and government reports. COVID-19 poses a major public health threat on China with a cumulative number of cases over 89,000 (data cut-off date: August 9th, 2020). Between January and February 2020, China implemented a series of escalating policies (including a stringent nation-wide lockdown) to combat the pandemic. Therefore, it has been to a large extent limited to the Wuhan region. Social media such as WeChat and SinaWeibo played a crucial role in disseminating government information and public campaigns during the pandemic. Technologies were adopted to enable contact tracing and population travel patterns. The Chinese central government mobilized healthcare resources including healthcare personnel and medical materials to Wuhan in a highly effective way. Both central and regional governments launched financial policies to stimulate the economy, including special loans, tax extension, reduction or waiver. Nevertheless, the economy in China was significantly impacted especially during the lockdown period. China has responded to the COVID-19 epidemic in a highly centralized and effective way. Balancing the needs to prevent a future pandemic and to boost economic recovery remains a challenge." ]
SARS-CoV-2 and thrombocytopenia in COVID-19
Despite endorsed and exponential research to improve diagnostic and therapeutic strategies, efforts have not yet converted into a better prospect for patients infected with the novel coronavirus (2019nCoV), and still, the name of SARS-CoV-2 is coupled with numerous unanswered questions. One of these questions is concerning how this respiratory virus reduces the number of platelets (PLTs)? The results of laboratory examinations showed that about a quarter of COVID-19 cases experience thrombocytopenia, and more remarkably, about half of these patients succumb to the infection due to coagulopathy. These findings have positioned PLTs as a pillar in the management as well as stratifying COVID-19 patients; however, not all the physicians came into a consensus about the prognostic value of these cells. The current review aims to unravel the contributory role of PLTs s in COVID-19; and alsoto summarize the original data obtained from international research laboratories on the association between COVID-19 and PLT production, activation, and clearance. In addition, we provide a special focus on the prognostic value of PLTs and their related parameters in COVID-19. Questions on how SARS-CoV-2 induces thrombocytopenia are also responded to. The last section provides a general overview of the most recent PLT- or thrombocytopenia-related therapeutic approaches. In conclusion, since SARS-CoV-2 reduces the number of PLTs by eliciting different mechanisms, treatment of thrombocytopenia in COVID-19 patients is not as simple as it appears and serious cautions should be considered to deal with the problem through scrutiny awareness of the causal mechanisms.
[ "Growing clinical evidence has implicated complement as a pivotal driver of COVID-19 immunopathology. Deregulated complement activation may fuel cytokine-driven hyper-inflammation, thrombotic microangiopathy and NET-driven immunothrombosis, thereby leading to multi-organ failure. Complement therapeutics have gained traction as candidate drugs for countering the detrimental consequences of SARS-CoV-2 infection. Whether blockade of terminal complement effectors (C5, C5a, or C5aR1) may elicit similar outcomes to upstream intervention at the level of C3 remains debated. Here we compare the efficacy of the C5-targeting monoclonal antibody eculizumab with that of the compstatin-based C3-targeted drug candidate AMY-101 in small independent cohorts of severe COVID-19 patients. Our exploratory study indicates that therapeutic complement inhibition abrogates COVID-19 hyper-inflammation. Both C3 and C5 inhibitors elicit a robust anti-inflammatory response, reflected by a steep decline in C-reactive protein and IL-6 levels, marked lung function improvement, and resolution of SARS-CoV-2-associated acute respiratory distress syndrome (ARDS). C3 inhibition afforded broader therapeutic control in COVID-19 patients by attenuating both C3a and sC5b-9 generation and preventing FB consumption. This broader inhibitory profile was associated with a more robust decline of neutrophil counts, attenuated neutrophil extracellular trap (NET) release, faster serum LDH decline, and more prominent lymphocyte recovery. These early clinical results offer important insights into the differential mechanistic basis and underlying biology of C3 and C5 inhibition in COVID-19 and point to a broader pathogenic involvement of C3-mediated pathways in thromboinflammation. They also support the evaluation of these complement-targeting agents as COVID-19 therapeutics in large prospective trials.", "Coronavirus disease 2019 (COVID-19) is a novel infectious disease with lack of established laboratory markers available to evaluate illness severity. In this study, we investigate whether platelet count could differentiate between COVID-19 patients with or without severe disease. Additionally, we evaluate if thrombocytopenia is associated with severe COVID-19. An electronic search in Medline, Scopus and Web of Science was performed to identify studies reporting data on platelet count in COVID-19 patients. A meta-analysis was performed, with calculation of weighted mean difference (WMD) of platelet number in COVID-19 patients with or without severe disease and odds ratio (OR) of thrombocytopenia for severe form of COVID-19. Nine studies with 1779 COVID-19 patients, 399 (22.4%) with severe disease, were included in the meta-analysis. The pooled analysis revealed that platelet count was significantly lower in patients with more severe COVID-19 (WMD -31 × 109/L; 95% CI, from -35 to -29 × 109/L). A subgroup analysis comparing patients by survival, found an even lower platelet count was observed with mortality (WMD, -48 × 109/L; 95% CI, -57 to -39 × 109/L. In the four studies (n = 1427) which reported data on rate of thrombocytopenia, a low platelet count was associated with over fivefold enhanced risk of severe COVID-19 (OR, 5.1; 95% CI, 1.8-14.6). Low platelet count is associated with increased risk of severe disease and mortality in patients with COVID-19, and thus should serve as clinical indicator of worsening illness during hospitalization.", "BACKGROUNDSince December 2019, an outbreak of coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in Wuhan, and is now becoming a global threat. We aimed to delineate and compare the immunological features of severe and moderate COVID-19.METHODSIn this retrospective study, the clinical and immunological characteristics of 21 patients (17 male and 4 female) with COVID-19 were analyzed. These patients were classified as severe (11 cases) and moderate (10 cases) according to the guidelines released by the National Health Commission of China.RESULTSThe median age of severe and moderate cases was 61.0 and 52.0 years, respectively. Common clinical manifestations included fever, cough, and fatigue. Compared with moderate cases, severe cases more frequently had dyspnea, lymphopenia, and hypoalbuminemia, with higher levels of alanine aminotransferase, lactate dehydrogenase, C-reactive protein, ferritin, and D-dimer as well as markedly higher levels of IL-2R, IL-6, IL-10, and TNF-α. Absolute numbers of T lymphocytes, CD4+ T cells, and CD8+ T cells decreased in nearly all the patients, and were markedly lower in severe cases (294.0, 177.5, and 89.0 × 106/L, respectively) than moderate cases (640.5, 381.5, and 254.0 × 106/L, respectively). The expression of IFN-γ by CD4+ T cells tended to be lower in severe cases (14.1%) than in moderate cases (22.8%).CONCLUSIONThe SARS-CoV-2 infection may affect primarily T lymphocytes, particularly CD4+ and CD8+ T cells, resulting in a decrease in numbers as well as IFN-γ production by CD4+ T cells. These potential immunological markers may be of importance because of their correlation with disease severity in COVID-19.TRIAL REGISTRATIONThis is a retrospective observational study without a trial registration number.FUNDINGThis work is funded by grants from Tongji Hospital for the Pilot Scheme Project, and partly supported by the Chinese National Thirteenth Five Years Project in Science and Technology for Infectious Disease (2017ZX10202201).", "Immune thrombocytopenia, often known as immune thrombocytopenic purpura (ITP), has emerged as an important complication of COVID-19. A systematic review was done to analyze the clinical profile and outcomes in a total of 45 cases of new-onset ITP in COVID-19 patients described in literature until date. A comprehensive approach is essential for diagnosing COVID-19-associated ITP after excluding several concomitant factors that can cause thrombocytopenia in COVID-19. Majority of ITP cases (71%) were found to be elderly (> 50 years) and 75% cases had moderate-to-severe COVID-19. Three patients (7%) were in the pediatric age group. Reports of ITP in asymptomatic COVID-19 patients (7%) underscore the need for COVID-19 testing in newly diagnosed patients with ITP irrespective of COVID-19 symptoms amid this pandemic. ITP onset occurred in 20% cases 3 weeks after onset of COVID-19 symptoms, with many reports after clinical recovery. SARS-CoV-2-mediated immune thrombocytopenia can be attributed to the underlying immune dysregulation, susceptibility mutations in SOCS 1, and other mechanisms, including molecular mimicry, cryptic antigen expression, and epitope spreading. No bleeding manifestations were reported in 31% cases at diagnosis. Severe life-threatening bleeding was uncommon. One case of mortality was attributed to intracranial hemorrhage. Secondary Evans syndrome was diagnosed in one case. Good initial response to short course of glucocorticoids and intravenous immunoglobulin has been found with the exception of delayed lag response in one case. Thrombopoietin receptor agonist usage as a second-line agent has been noted in few cases for short duration with no adverse events. In the relatively short follow-up period, four relapses of ITP were found.", "A relatively high mortality of severe coronavirus disease 2019 (COVID-19) is worrying, and the application of heparin in COVID-19 has been recommended by some expert consensus because of the risk of disseminated intravascular coagulation and venous thromboembolism. However, its efficacy remains to be validated. Coagulation results, medications, and outcomes of consecutive patients being classified as having severe COVID-19 in Tongji hospital were retrospectively analyzed. The 28-day mortality between heparin users and nonusers were compared, as was a different risk of coagulopathy, which was stratified by the sepsis-induced coagulopathy (SIC) score or D-dimer result. There were 449 patients with severe COVID-19 enrolled into the study, 99 of them received heparin (mainly with low molecular weight heparin) for 7 days or longer. D-dimer, prothrombin time, and age were positively, and platelet count was negatively, correlated with 28-day mortality in multivariate analysis. No difference in 28-day mortality was found between heparin users and nonusers (30.3% vs 29.7%, P = .910). But the 28-day mortality of heparin users was lower than nonusers in patients with SIC score ≥4 (40.0% vs 64.2%, P = .029), or D-dimer >6-fold of upper limit of normal (32.8% vs 52.4%, P = .017). Anticoagulant therapy mainly with low molecular weight heparin appears to be associated with better prognosis in severe COVID-19 patients meeting SIC criteria or with markedly elevated D-dimer.", "Changes in platelet count are common in COVID-19 patients. The platelet count reflects the thrombocyte turnover, acting as a sensitive indicator of illness severity that is of great clinical utility to monitor a quickly changing health condition of patients affected by aggressive viral infections. This study aims to investigate the significance of platelet count during the progression of the disease in COVID-19 patients. A total of 532 COVID-19 patients were involved in the cohort study from the First People's Hospital of Jiangxia District in Wuhan from January 7, 2020, to February 28, 2020. We collected the clinical characteristics and laboratory data of patients. Patients still hospitalized before February 29, 2020, died on admission, with malignant tumors, previous gastrointestinal surgery, missing baseline platelet count, or platelet count detected only once, were excluded. We used a generalized additive model and generalized additive mixed model to compare trends in platelet count over time among survivors and non-survivors, with an adjustment for potential confounders. During the follow-up, twenty-nine subjects died (mortality rate, 5.45%). The platelets among non-survivors decreased and among survivors increased gradually within 1 week after admission. In addition, the difference between the two groups showed an increasing trend during 1 week after admission. This difference increased by an average of 5.3 × 10^9/L daily. In the early stage, platelet count can dynamically reflect the pathophysiological changes in COVID-19 patients. Early decrease in platelet count was associated with mortality in patients with COVID-19. Causality, however, cannot be deduced from our data.", "COVID-19 induces haemocytometric changes. Complete blood count changes, including new cell activation parameters, from 982 confirmed COVID-19 adult patients from 11 European hospitals were retrospectively analysed for distinctive patterns based on age, gender, clinical severity, symptom duration, and hospital days. The observed haemocytometric patterns formed the basis to develop a multi-haemocytometric-parameter prognostic score to predict, during the first three days after presentation, which patients will recover without ventilation or deteriorate within a two-week timeframe, needing intensive care or with fatal outcome. The prognostic score, with ROC curve AUC at baseline of 0.753 (95% CI 0.723-0.781) increasing to 0.875 (95% CI 0.806-0.926) on day 3, was superior to any individual parameter at distinguishing between clinical severity. Findings were confirmed in a validation cohort. Aim is that the score and haemocytometry results are simultaneously provided by analyser software, enabling wide applicability of the score as haemocytometry is commonly requested in COVID-19 patients." ]
The Role of Traditional Chinese Medicine in Cardiovascular Diseases
Calcium, as a second messenger, plays an important role in the pathogenesis of cardiovascular diseases (CVDs). The malfunction of calcium signaling in endothelial cells and vascular smooth muscle cells promotes hypertension. In cardiomyocytes, calcium overload induces apoptosis, leading to myocardial infarction and arrhythmias. Moreover, the calcium-calcineurin-nuclear factor of activated T cells (NFAT) pathway is essential for expressing the cardiac pro-hypertrophic gene. Heart failure is also characterized by reduced calcium transient amplitude and enhanced sarcoplasmic reticulum (SR) calcium leakage. Traditional Chinese medicine (TCM) has been used to treat CVDs for thousands of years in China. Because of its multicomponent and multitarget characteristics, TCM's unique advantages in CVD treatment are closely related to the modulation of multiple calcium handling proteins and calcium signaling pathways in different types of cells involved in distinct CVDs. Thus, we systematically review the diverse mechanisms of TCM in regulating calcium pathways to treat various types of CVDs, ranging from hypertrophic cardiomyopathy to diabetic heart disease.
[ "Total aralosides of Aralia elata (Miq) Seem (TASAES) from Chinese traditional herb Longya Aralia chinensis L was found to improve cardiac function. The present study was to determine the protective effects of TASAES on diabetic cardiomyopathy, and the possible mechanisms. Therefore, a single dose of streptozotocin was used to induce diabetes in Wister rats. Diabetic rats were immediately treated with low, medium and high doses of TASAES at 4.9, 9.8 mg/kg and 19.6 mg/kg body weight by gavage, respectively, for eight weeks. Cardiac function was evaluated by in situ hemodynamic measurements, and patch clamp for the L-type Ca2+ channel current I(Ca(2+)-L) and transient outward K+ channel current (I(to)). Histopathological changes were observed under light and electron microscope. The expression of pro-fibrotic factor, connective tissue growth factor (CTGF) was monitored using immunohistochemistry staining. Compared with diabetic group, medium and high doses, but not low dose, of TASAES showed a significant protection against diabetes-induced cardiac dysfunction, shown by increased absolute value of left ventricular systolic pressure (LVSP) and maximum rates of pressure development (+/-dp/dt(max)), and enhanced amplitude of I(Ca(2+)-L) (P<0.05). Histological staining indicated a significant inhibition of diabetes-caused pathological changes and up-regulation of CTGF expression (P< 0.05). The results suggest that TASAES prevents diabetes-induced cardiac dysfunction and pathological damage through up-regulating I(Ca(2+)-L) in cardiac cells and decreasing CTGF expression.", "The changes in cardiac function caused by calcium overload are reviewed. Intracellular Ca(2+) may increase in different structures [e.g. sarcoplasmic reticulum (SR), cytoplasm and mitochondria] to an excessive level which induces electrical and mechanical abnormalities in cardiac tissues. The electrical manifestations of Ca(2+) overload include arrhythmias caused by oscillatory (V(os)) and non-oscillatory (V(ex)) potentials. The mechanical manifestations include a decrease in force of contraction, contracture and aftercontractions. The underlying mechanisms involve a role of Na(+) in electrical abnormalities as a charge carrier in the Na(+)-Ca(2+) exchange and a role of Ca(2+) in mechanical toxicity. Ca(2+) overload may be induced by an increase in [Na(+)](i) through the inhibition of the Na(+)-K(+) pump (e.g. toxic concentrations of digitalis) or by an increase in Ca(2+) load (e.g. catecholamines). The Ca(2+) overload is enhanced by fast rates. Purkinje fibers are more susceptible to Ca(2+) overload than myocardial fibers, possibly because of their greater Na(+) load. If the SR is predominantly Ca(2+) overloaded, V(os) and fast discharge are induced through an oscillatory release of Ca(2+) in diastole from the SR; if the cytoplasm is Ca(2+) overloaded, the non-oscillatory V(ex) tail is induced at negative potentials. The decrease in contractile force by Ca(2+) overload appears to be associated with a decrease in high energy phosphates, since it is enhanced by metabolic inhibitors and reduced by metabolic substrates. The ionic currents I(os) and I(ex) underlie V(os) and V(ex), respectively, both being due to an electrogenic extrusion of Ca(2+) through the Na(+)-Ca(2+) exchange. I(os) is an oscillatory current due to an oscillatory release of Ca(2+) in early diastole from the Ca(2+)-overloaded SR, and I(ex) is a non-oscillatory current due to the extrusion of Ca(2+) from the Ca(2+)-overloaded cytoplasm. I(os) and I(ex) can be present singly or simultaneously. An increase in [Ca(2+)](i) appears to be involved in the short- and long-term compensatory mechanisms that tend to maintain cardiac output in physiological and pathological conditions. Eventually, [Ca(2+)](i) may increase to overload levels and contribute to cardiac failure. Experimental evidence suggests that clinical concentrations of digitalis increase force in Ca(2+)-overloaded cardiac cells by decreasing the inhibition of the Na(+)-K(+) pump by Ca(2+), thereby leading to a reduction in Ca(2+) overload and to an increase in force of contraction.", "Shengmai injection (SMI) is a classical traditional Chinese medicine (TCM) officially recorded in Pharmacopoeia of the People's Republic of China (version 2015) and has long been used to treat heart failure in China. However scientific evidence for the anti-oxidative stress potential of SMI used in traditional medicine is lacking. The present study aimed to evaluate the efficacy of SMI in alleviating H2O2‑induced Oxidative Stress the underlying mechanisms MATERIALS AND METHODS: H2O2-induced oxidative stress model of cardiomyocytes was established with primary cultured neonatal rat cardiomyocytes. CCK8 cell viability assay and lacatate dehydrogenase cytotoxicity assay were performed to ensure the safety dose and lowest effective dose for the mode employing CCK-8 cell viability assay kit and lactate dehydrogenase cytotoxicity assay kit. ROS levels were determined using CM-H2DCFDA fluorescent probe in cardiomyocytes with H2O2-induced oxidative stress. The change of NAD(P)H level in cardiomyocytes was evaluated during the process of oxidative stress. The content of myocardial cytosolic Ca2+ and Ca2+ was determined using Fura-2/AM and Rhod 2-AM fluorescent probe in mitochondrial in the process of oxidative stress. Annexin V-FITC/PI double staining was applied to examine the apoptotic cells in cardiomyocytes with oxidative stress. To identify the apoptosis after oxidative stress myocardial cells with the application of Annexin V-FITC/PI double staining apoptosis detection kit. Quantitative polymerase chain reaction (RT-PCR) was applied to measure the expression of antioxidant enzymes: catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GSR). Western blot was performed to observe the phosphorylation of AKT and ERK1/2. SMI was shown to significantly attenuate oxidative stress-induced cell proliferation arrest and apoptosis in neonatal rat cardiomyocytes. In addition, SMI treatment could decrease the production of reactive oxygen species (ROS), nicotinamide adenine dinucleotide (NADH) and malondialdehyde (MDA), and reduce the overloads of cytoplasmic Ca2+ and mitochondrial Ca2+ induced by H2O2. SMI could also restore the mRNA expression and activities of SOD, GSR, and CAT suppressed by H2O2. Mechanistically, SMI upregulated intracellular AKT phosphorylation and downregulate ERK1/2 phosphorylation in H2O2-treated cardiomyocytes. Pretreatment with LY294002, an AKT phosphorylation inhibitor, suppressed the protective role of SMI in cardiomyocytes, while pretreatment with PD98059, an ERK1/2 phosphorylation inhibitor, enhanced the effect of SMI. In conclusion, SMI may attenuate oxidative stress-induced damage in cardiomyocytes potentially through the AKT and ERK1/2 pathway and can function as a promising injectable traditional Chinese medicine to treat oxidative stress-induced injury.", "Although aberrant Ca(2+) release (i.e. Ca(2+) 'leak') from the sarcoplasmic reticulum (SR) through cardiac ryanodine receptors (RyR2) is linked to heart failure (HF), it remains unknown whether and under what conditions SR-derived Ca(2+) can actually cause HF. We tested the hypothesis that combining dysregulated RyR2 function with facilitated Ca(2+) uptake into SR will exacerbate abnormal SR Ca(2+) release and induce HF. We also examined the mechanisms for these alterations. We crossbred mice deficient in expression of cardiac calsequestrin (CASQ2) with mice overexpressing the skeletal muscle isoform of SR Ca(2+)ATPase (SERCA1a). The new double-mutant strains displayed early mortality, congestive HF with left ventricular dilated hypertrophy, and decreased ejection fraction. Intact right ventricular muscle preparations from double-mutant mice preserved normal systolic contractile force but were susceptible to spontaneous contractions. Double-mutant cardiomyocytes while preserving normal amplitude of systolic Ca(2+) transients displayed marked disturbances in diastolic Ca(2+) handling in the form of multiple, periodic Ca(2+) waves and wavelets. Dysregulated myocyte Ca(2+) handling and structural and functional cardiac pathology in double-mutant mice were associated with increased rate of apoptotic cell death. Qualitatively similar results were obtained in a hybrid strain created by crossing CASQ2 knockout mice with mice deficient in phospholamban. We demonstrate that enhanced SR Ca(2+) uptake combined with dysregulated RyR2s results in sustained diastolic Ca(2+) release causing apoptosis, dilated cardiomyopathy, and early mortality. Our data also suggest that up-regulation of SERCA activity must be advocated with caution as a therapy for HF in the context of abnormal RyR2 function.", "Shensong Yangxin (SSYX) is one of the compound recipe of Chinese materia medica. This study was conducted to investigate the effects of SSYX on sodium current (I(Na)), L-type calcium current (I(Ca, L)), transient outward potassium current (I(to)), delayed rectifier current (I(K)), and inward rectifier potassium currents (I(K1)) in isolated ventricular myocytes. Whole cell patch-clamp technique was used to study ion channel currents in enzymatically isolated guinea pig or rat ventricular myocytes. SSYX decreased peak I(Na) by (44.84 +/- 7.65)% from 27.21 +/- 5.35 to 14.88 +/- 2.75 pA/pF (n = 5, P < 0.05). The medicine significantly inhibited the I(Ca, L). At concentrations of 0.25, 0.50, and 1.00 g/100 ml, the peak I(Ca, L) was reduced by (19.22 +/- 1.10)%, (44.82 +/- 6.50)% and (50.69 +/- 5.64)%, respectively (n = 5, all P < 0.05). SSYX lifted the I - V curve of both I(Na) and I(Ca, L) without changing the threshold, peak and reversal potentials. At the concentration of 0.5%, the drug blocked the transient component of I(to) by 50.60% at membrane voltage of 60 mV and negatively shifted the inactive curve and delayed the recovery from channel inactivation. The tail current density of I(K) was decreased by (30.77 +/- 1.11)% (n = 5, P < 0.05) at membrane voltage of 50 mV after exposure to the medicine and the time-dependent activity of I(K) was also inhibited. Similar to the effect on I(K), the SSYX inhibited I(K1) by 33.10% at the test potential of -100 mV with little effect on reversal potential and the rectification property. The experiments revealed that SSYX could block multiple ion channels such as I(Na) I(Ca, L), I(k), I(to) and I(K1), which may change the action potential duration and contribute to some of its antiarrhythmic effects.", "Voltage-gated ion channels control generation and propagation of action potentials in excitable cells. Significant progress has been made in understanding structure and function of the voltage-gated ion channels, highlighted by the high-resolution open-state structure of the voltage-gated potassium channel, K(v)1.2. However, because the structure of the closed state is unknown, the gating mechanism remains controversial. We adapted the rosetta membrane method to model the structures of the K(v)1.2 and KvAP channels using homology, de novo, and domain assembly methods and selected the most plausible models using a limited number of experimental constraints. Our model of K(v)1.2 in the open state is very similar in overall topology to the x-ray structure of this channel. Modeling of KvAP in the open state suggests that orientation of the voltage-sensing domain relative to the pore-forming domain is considerably different from the orientation in the K(v)1.2 open state and that the magnitude of the vertical movement of S4 is significantly greater. Structural modeling of closed state of K(v)1.2 suggests gating movement that can be viewed as a sum of two previously suggested mechanisms: translation (2-4 A) plus rotation ( approximately 180 degrees ) of the S4 segment as proposed in the original \"sliding helix\" or \"helical screw\" models coupled with a rolling motion of the S1-S3 segments around S4, similar to recent \"transporter\" models of gating. We propose a unified mechanism of voltage-dependent gating for K(v)1.2 and KvAP in which this major conformational change moves the gating charge across the electric field in an analogous way for both channels.", "Like chili peppers, gingers produce pungent stimuli by a group of vanilloid compounds that activate the nociceptive transient receptor potential vanilloid 1 (TRPV1) ion channel. How these compounds interact with TRPV1 remains unclear. We used computational structural modelling, functional tests (electrophysiology and calcium imaging), and mutagenesis to investigate the structural mechanisms underlying ligand-channel interactions. The potency of three principal pungent compounds from ginger -shogaol, gingerol, and zingerone-depends on the same two residues in the TRPV1 channel that form a hydrogen bond with the chili pepper pungent compound, capsaicin. Computational modelling revealed binding poses of these ginger compounds similar to those of capsaicin, including a \"head-down tail-up\" orientation, two specific hydrogen bonds, and important contributions of van der Waals interactions by the aliphatic tail. Our study also identified a novel horizontal binding pose of zingerone that allows it to directly interact with the channel pore when bound inside the ligand-binding pocket. These observations offer a molecular level explanation for how unique structures in the ginger compounds affect their channel activation potency. Mechanistic insights into the interactions of ginger compounds and the TRPV1 cation channel should help guide drug discovery efforts to modulate nociception." ]
How do intrinsically disordered regions in proteins facilitate liquid-liquid phase separation?
Liquid-liquid phase separation (LLPS) of intrinsically disordered regions (IDRs) in proteins can drive the formation of membraneless compartments in cells. Phase-separated structures enrich for specific partner proteins and exclude others. Previously, we showed that the IDRs of metazoan DNA replication initiators drive DNA-dependent phase separation in vitro and chromosome binding in vivo, and that initiator condensates selectively recruit replication-specific partner proteins (Parker et al., 2019). How initiator IDRs facilitate LLPS and maintain compositional specificity is unknown. Here, using
[ "Cells chemically isolate molecules in compartments to both facilitate and regulate their interactions. In addition to membrane-encapsulated compartments, cells can form proteinaceous and membraneless organelles, including nucleoli, Cajal and PML bodies, and stress granules. The principles that determine when and why these structures form have remained elusive. Here, we demonstrate that the disordered tails of Ddx4, a primary constituent of nuage or germ granules, form phase-separated organelles both in live cells and in vitro. These bodies are stabilized by patterned electrostatic interactions that are highly sensitive to temperature, ionic strength, arginine methylation, and splicing. Sequence determinants are used to identify proteins found in both membraneless organelles and cell adhesion. Moreover, the bodies provide an alternative solvent environment that can concentrate single-stranded DNA but largely exclude double-stranded DNA. We propose that phase separation of disordered proteins containing weakly interacting blocks is a general mechanism for forming regulated, membraneless organelles.", "Protein phase separation is implicated in formation of membraneless organelles, signaling puncta and the nuclear pore. Multivalent interactions of modular binding domains and their target motifs can drive phase separation. However, forces promoting the more common phase separation of intrinsically disordered regions are less understood, with suggested roles for multivalent cation-pi, pi-pi, and charge interactions and the hydrophobic effect. Known phase-separating proteins are enriched in pi-orbital containing residues and thus we analyzed pi-interactions in folded proteins. We found that pi-pi interactions involving non-aromatic groups are widespread, underestimated by force-fields used in structure calculations and correlated with solvation and lack of regular secondary structure, properties associated with disordered regions. We present a phase separation predictive algorithm based on pi interaction frequency, highlighting proteins involved in biomaterials and RNA processing.", "Phase separation of biomolecules leading to the formation of assemblies with distinct material properties has recently emerged as a new paradigm underlying subcellular organization. The discovery that disordered proteins, long associated with aggregation in neurodegenerative disease, are also implicated in driving liquid phase separation has galvanized significant interest in exploring the relationship between misregulated phase transitions and disease. This review summarizes recent work linking liquid phase separation to neurodegeneration, highlighting a pathological role for altered phase behavior and material properties of proteins assembled via liquid phase separation. The techniques that recent and current work in this area have deployed are also discussed, as is the potential for these discoveries to promote new research directions for investigating the molecular etiologies of neurodegenerative diseases.", "TAR DNA-binding protein of 43 kDa (TDP-43) forms granulo-filamentous aggregates in affected brain regions of >95% of patients with ALS and ∼50% of patients with frontotemporal degeneration (FTD). Furthermore, in disease, TDP-43 becomes N-terminally truncated resulting in protein deposits that are mainly composed of the C-terminal prion-like domain (PrLD). The PrLD is inherently aggregation-prone and is hypothesized to drive protein aggregation of TDP-43 in disease. Here, we establish that the N-terminal region of the protein is critical for rapid TDP-43 granulo-filamentous aggregation. We show that the biopolymer poly(ADP-ribose), or PAR, inhibits granulo-filamentous aggregation of TDP-43 by engaging PAR-binding motifs (PBMs) embedded in the TDP-43 nuclear-localization sequence. We demonstrate that progressive N-terminal truncation of TDP-43 can decelerate aggregation kinetics and promote formation of thread-like filaments. Thus, the N-terminal region and the PBMs of TDP-43 promote rapid granulo-filamentous aggregation and antagonize formation of thread-like fibrils. These findings illustrate the complexity of TDP-43 aggregation trajectories.", "The transition between soluble intrinsically disordered tau protein and aggregated tau in neurofibrillary tangles in Alzheimer's disease is unknown. Here, we propose that soluble tau species can undergo liquid-liquid phase separation (LLPS) under cellular conditions and that phase-separated tau droplets can serve as an intermediate toward tau aggregate formation. We demonstrate that phosphorylated or mutant aggregation prone recombinant tau undergoes LLPS, as does high molecular weight soluble phospho-tau isolated from human Alzheimer brain. Droplet-like tau can also be observed in neurons and other cells. We found that tau droplets become gel-like in minutes, and over days start to spontaneously form thioflavin-S-positive tau aggregates that are competent of seeding cellular tau aggregation. Since analogous LLPS observations have been made for FUS, hnRNPA1, and TDP43, which aggregate in the context of amyotrophic lateral sclerosis, we suggest that LLPS represents a biophysical process with a role in multiple different neurodegenerative diseases.", "The normally soluble TAR DNA-binding protein 43 (TDP-43) is found aggregated both in reversible stress granules and in irreversible pathogenic amyloid. In TDP-43, the low-complexity domain (LCD) is believed to be involved in both types of aggregation. To uncover the structural origins of these two modes of β-sheet-rich aggregation, we have determined ten structures of segments of the LCD of human TDP-43. Six of these segments form steric zippers characteristic of the spines of pathogenic amyloid fibrils; four others form LARKS, the labile amyloid-like interactions characteristic of protein hydrogels and proteins found in membraneless organelles, including stress granules. Supporting a hypothetical pathway from reversible to irreversible amyloid aggregation, we found that familial ALS variants of TDP-43 convert LARKS to irreversible aggregates. Our structures suggest how TDP-43 adopts both reversible and irreversible β-sheet aggregates and the role of mutation in the possible transition of reversible to irreversible pathogenic aggregation.", "Constitutive heterochromatin is an important component of eukaryotic genomes that has essential roles in nuclear architecture, DNA repair and genome stability, and silencing of transposon and gene expression. Heterochromatin is highly enriched for repetitive sequences, and is defined epigenetically by methylation of histone H3 at lysine 9 and recruitment of its binding partner heterochromatin protein 1 (HP1). A prevalent view of heterochromatic silencing is that these and associated factors lead to chromatin compaction, resulting in steric exclusion of regulatory proteins such as RNA polymerase from the underlying DNA. However, compaction alone does not account for the formation of distinct, multi-chromosomal, membrane-less heterochromatin domains within the nucleus, fast diffusion of proteins inside the domain, and other dynamic features of heterochromatin. Here we present data that support an alternative hypothesis: that the formation of heterochromatin domains is mediated by phase separation, a phenomenon that gives rise to diverse non-membrane-bound nuclear, cytoplasmic and extracellular compartments. We show that Drosophila HP1a protein undergoes liquid-liquid demixing in vitro, and nucleates into foci that display liquid properties during the first stages of heterochromatin domain formation in early Drosophila embryos. Furthermore, in both Drosophila and mammalian cells, heterochromatin domains exhibit dynamics that are characteristic of liquid phase-separation, including sensitivity to the disruption of weak hydrophobic interactions, and reduced diffusion, increased coordinated movement and inert probe exclusion at the domain boundary. We conclude that heterochromatic domains form via phase separation, and mature into a structure that includes liquid and stable compartments. We propose that emergent biophysical properties associated with phase-separated systems are critical to understanding the unusual behaviours of heterochromatin, and how chromatin domains in general regulate essential nuclear functions." ]
Quality of life and type 1 diabetes mellitus: A cross-sectional descriptive study
This study investigated the association between the quality of life (QOL) and type 1 diabetes mellitus (DM), a lifelong disease that requires constant management. A complex set of factors influence the QOL of people with type 1 DM, and understanding these factors requires further research. This research is a cross-sectional descriptive study. A survey on related variables such as acceptance of disease and efficacy for self-management of diabetes, was conducted among 111 participants with type 1 DM. The collected data were analyzed using PASW Statistics program, and factors influencing participants' QOL were identified through hierarchical multiple regression. The study followed the Guidelines of Systematic Reporting of Examination in the STROBE checklist. The results showed that four variables exerted a significant effect on QOL (blood glucose level at hypoglycemia and complications in Model 1; efficacy for self-management of diabetes and acceptance and action in Model 2), and all the variables explained a majority of the variance in QOL. The results indicate that management of severe hypoglycemia and prevention of complications is crucial. Interventions should be developed to enhance coping abilities to improve efficacy for self-management for those with diabetes and promote their acceptance of the disease.
[ "To assess gender differences in Quality of life (QoL) and in sociodemographic, clinical and psychological factors associated with impaired QoL in adults with long-standing type 1 diabetes mellitus (DM1). Cross-sectional evaluation in a random cohort of DM1 adult patients from a tertiary care hospital. QoL was evaluated using translated and validated self-administered Diabetes QoL questionnaire (Es-DQoL), and results transformed into a 0-100 scale. Psychological assessment included a planned psychological interview and self-reported questionnaires (Beck Depression Inventory II, State-Trait Anxiety Inventory Form Y, Fear of hypoglycaemia Scale, Medical Outcomes Study Social Support Survey). A total of 312 patients (51.6% male; 38.2 ± 12.7 years; HbA1c 7.5 ± 1.1% (58.5 ± 14.2 mmol/mol); 20.4 ± 12.0 years of DM1) were included in the analysis. Male and female subgroups showed similar sociodemographic and diabetes-related features and comparable social support. Among female patients, higher frequency of depression [31.7% (IC95% 26.2-40.8) vs. 14.9% (IC95% 10.1-20.8), p < 0.05] and anxiety [23.2% (IC95% 19.3-33.14) vs. 13.0% (IC95% 8.1-18.4), p < 0.05] and severity of depressive and anxious symptoms were also found. Compared to male patients, female patients showed lower QoL [75 (IC95% 73.6-77.5) vs. 80 (IC95% 75.7-83.1), p < 0.05] and scored significantly worse in subscale Diabetes-related worries [69 (IC95% 50.0-81.0) vs. 75 (IC95% 72.9-79.0), p < 0.05]. Fear of hypoglycemia and severity of depressive and anxious symptoms were factors independently associated to lower QoL in men and women while high frequency of glycemic excursions was a female-specific predictive one. Adult women with long-standing DM1 showed lower QoL probably related to higher frequency and severity of psychopathological syndromes. Depressive and anxious symptoms and, among women, exposure to glycemic excursions were identified as modifiable, QoL-related variables. Educational, technological and psychological interventions are needed in order to improve QoL in DM1 patients.", "The effects of illness and treatment of diabetes mellitus extend beyond medical outcomes. We therefore evaluated health-related quality of life (HRQOL) in children (aged 8-12 years) and adolescents (aged 13-16 years) with type 1 diabetes to compare their results with healthy peers and to identify HRQOL determinants. A total of 68 children and adolescents from a tertiary care clinic which specialises in the management of diabetes, completed the generic KINDL-R questionnaire. This instrument for children and adolescents has six dimensions and an additional module assessing condition-related HRQOL. Overall, the HRQOL was not different between patients with type 1 diabetes and healthy controls. In some areas, children and adolescents with diabetes reported a better HRQOL compared to healthy peers: adolescents reported better psychological well-being (P < 0.05) and children higher levels of well-being in the school domain (P < 0.05). In general, children reported a better HRQOL (P < 0.05) than adolescents with type 1 diabetes confirming age-related differences in HRQOL in the general population. Lower HbA1c (<8%) and intensified insulin therapy (>3 injections/day) were associated with a better HRQOL in different domains (P < 0.05). The subscale \"chronic illness\" showed a better HRQOL (P < 0.001) in children and adolescents with diabetes compared to age-matched controls with other chronic conditions. Children and adolescents from a paediatric department specialising in diabetes management report good health-related quality of life. Younger age, good metabolic control and intensified insulin therapy are associated with a better health-related quality of life. Dimensions of health-related quality of life appear to play different roles at different ages, emphasising the importance of the multidimensional health-related quality of life concept and the value of age-appropriate self-reports.", "This study tested the hypothesis that both trait anxiety and hypoglycemic history contribute to fear of hypoglycemia (FOH) both in adolescents with type 1 diabetes mellitus (T1DM) and in their parents, and relationships between FOH and other variables including metabolic control, symptom perception, and use of insulin pump therapy. Thirty-nine parent-adolescent pairs completed questionnaires assessing background and clinical information, hypoglycemic episodes, FOH, and trait anxiety. Adolescent blood was also sampled for glycosylated hemoglobin A1c (HbA1c) measurement. In adolescents, both trait anxiety and frequency of severe hypoglycemic episodes were significant predictors of FOH, together accounting for almost 50% of the variance. Parental FOH was not predicted by their own trait anxiety or their child's hypoglycemic history but by whether they believed that their child carried emergency glucose. FOH was not related to metabolic control, although adolescents who experienced recent severe hypoglycemia (SH) with unconsciousness had significantly higher HbA1c. Parental trait anxiety significantly correlated with child trait anxiety, but parent-child levels of FOH were unrelated. Neither trait anxiety nor FOH related to reported symptoms, and FOH was not lower in parents with insulin pump therapy. Consistent with findings from adult patient populations, trait anxiety levels and recent experiences with hypoglycemia predict FOH in adolescents with T1DM. In parents, however, beliefs about their adolescents' ability to cope with hypoglycemic episodes predicted FOH. FOH in adolescents with T1DM and their parents is a complex construct influenced by multiple personality and situational and behavioral factors, and its impact on diabetes management remains unclear.", "Diabetes requires complex self-management routines to prevent the development of functional disability. Relative to people without diabetes, those with diabetes are more likely to have comorbid major depressive disorder (MDD) and generalized anxiety disorder (GAD), which also increase the likelihood of functional disability. Social support is associated with positive health outcomes in people with comorbid diabetes and mental disorders and may serve as a buffer against functional disability, though this possibility has yet to be examined. This study examined whether social support moderates the association between MDD or GAD and functional disability in adults with diabetes. Adults with MDD or GAD were expected to report greater disability than those without MDD or GAD. This association was expected to be stronger in people reporting lower social support relative to those reporting higher social support. Data came from the cross-sectional 2012 Canadian Community Health Survey-Mental Health (n = 1764). Diabetes status, social support, and functional disability were assessed via self-report; past-year MDD and GAD were assessed with structured diagnostic interviews. Linear regression analyses, conducted separately for MDD and GAD, indicated main effects of past-year MDD and GAD, such that those with a mental disorder reported greater functional disability than those without a mental disorder. Social support did not moderate the associations between either MDD and functional disability or GAD and functional disability. In this nationally representative population study, both MDD and GAD predicted greater functional disability in adults with diabetes. Social support, however, did not moderate these associations.", "Hypoglycaemia in Type 1 diabetes is associated with mortality and morbidity, especially where awareness of hypoglycaemia is impaired. Clinical pathways for access to continuous glucose monitoring (CGM) and flash glucose monitoring technologies are unclear. We assessed the impact of CGM and flash glucose monitoring in a high-risk group of people with Type 1 diabetes. A randomized, non-masked parallel group study was undertaken. Adults with Type 1 diabetes using a multiple-dose insulin-injection regimen with a Gold score of ≥ 4 or recent severe hypoglycaemia were recruited. Following 2 weeks of blinded CGM, they were randomly assigned to CGM (Dexcom G5) or flash glucose monitoring (Abbott Freestyle Libre) for 8 weeks. The primary outcome was the difference in time spent in hypoglycaemia (below 3.3 mmol/l) from baseline to endpoint with CGM versus flash glucose monitoring. Some 40 participants were randomized to CGM (n = 20) or flash glucose monitoring (n = 20). The participants (24 men, 16 women) had a median (IQR) age of 49.6 (37.5-63.5) years, duration of diabetes of 30.0 (21.0-36.5) years and HbA1c of 56 (48-63) mmol/mol [7.3 (6.5-7.8)%]. The baseline median percentage time < 3.3 mmol/l was 4.5% in the CGM group and 6.7% in the flash glucose monitoring. At the end-point the percentage time < 3.3 mmol/l was 2.4%, and 6.8% respectively (median between group difference -4.3%, P = 0.006). Time spent in hypoglycaemia at all thresholds, and hypoglycaemia fear, were different between groups, favouring CGM. CGM more effectively reduces time spent in hypoglycaemia in people with Type 1 diabetes and impaired awareness of hypoglycaemia compared with flash glucose monitoring. (Clinical Trial Registry No: NCT03028220)." ]
mRNA N6-methyladenine methylation in osteoporosis, arthritis and osteosarcoma
RNA modification is a type of post-transcriptional modification that regulates important cellular pathways, such as the processing and metabolism of RNA. The most abundant form of methylation modification is RNA N6-methyladenine (m6A), which plays various post-transcriptional regulatory roles in cellular biological functions, including cell differentiation, embryonic development and disease occurrence. Bones play a pivotal role in the skeletal system as they support and protect muscles and other organs, facilitate movement and ensure haematopoiesis. The development and remodelling of bones require a delicate and accurate regulation of gene expression by epigenetic mechanisms that involve modifications of histone, DNA and RNA. The present review discusses the enzymes and proteins involved in mRNA m6A methylation modification and summarises current research progress and the mechanisms of mRNA m6A methylation in common orthopaedic diseases, including osteoporosis, arthritis and osteosarcoma.
[ "The most abundant mRNA post-transcriptional modification is N(6)-methyladenosine (m(6)A), which has broad roles in RNA biology. In mammalian cells, the asymmetric distribution of m(6)A along mRNAs results in relatively less methylation in the 5' untranslated region (5'UTR) compared to other regions. However, whether and how 5'UTR methylation is regulated is poorly understood. Despite the crucial role of the 5'UTR in translation initiation, very little is known about whether m(6)A modification influences mRNA translation. Here we show that in response to heat shock stress, certain adenosines within the 5'UTR of newly transcribed mRNAs are preferentially methylated. We find that the dynamic 5'UTR methylation is a result of stress-induced nuclear localization of YTHDF2, a well-characterized m(6)A 'reader'. Upon heat shock stress, the nuclear YTHDF2 preserves 5'UTR methylation of stress-induced transcripts by limiting the m(6)A 'eraser' FTO from demethylation. Remarkably, the increased 5'UTR methylation in the form of m(6)A promotes cap-independent translation initiation, providing a mechanism for selective mRNA translation under heat shock stress. Using Hsp70 mRNA as an example, we demonstrate that a single m(6)A modification site in the 5'UTR enables translation initiation independent of the 5' end N(7)-methylguanosine cap. The elucidation of the dynamic features of 5'UTR methylation and its critical role in cap-independent translation not only expands the breadth of physiological roles of m(6)A, but also uncovers a previously unappreciated translational control mechanism in heat shock response.", "N6-methyladenosine (m6A) is the most abundant reversible methylation modification of eukaryotic mRNA, and it plays vital roles in tumourigenesis. This study aimed to explore the role of the m6A demethylase ALKBH5 in pancreatic cancer (PC). The expression of ALKBH5 and its clinicopathological impact were evaluated in PC cohorts. The effects of ALKBH5 on the biological characteristics of PC cells were investigated on the basis of gain-of-function and loss-of-function analyses. Subcutaneous and orthotopic models further uncovered the role of ALKBH5 in tumour growth. mRNA and m6A sequencing and assays of m6A methylated RNA immunoprecipitation-qPCR (MeRIP-qPCR) were performed to identify the targeted effect of ALKBH5 on PER1. P53-binding sites in the ALKBH5 promoter were investigated by ChIP and luciferase assays to reveal the interplay between ALKBH5 and PER1-activated ATM-CHK2-P53/CDC25C signalling. ALKBH5 loss characterized the occurrence and poor clinicopathological manifestations in patients with PC. Overexpression of ALKBH5 reduced tumoural proliferative, migrative, invasive activities in vitro and ameliorated tumour growth in vivo, whereas ALKBH5 knockdown facilitated PC progression. Mechanistically, ALKBH5 posttranscriptionally activated PER1 by m6A demethylation in an m6A-YTHDF2-dependent manner. PER1 upregulation led to the reactivation of ATM-CHK2-P53/CDC25C signalling, which inhibited cell growth. P53-induced activation of ALKBH5 transcription acted as a feedback loop regulating the m6A modifications in PC. ALKBH5 serves as a PC suppressor by regulating the posttranscriptional activation of PER1 through m6A abolishment, which may highlight a demethylation-based approach for PC diagnosis and therapy.", "N6-methyladenosine (m6A) is the most abundant epigenetic modification in eukaryotic mRNAs and is essential for multiple RNA processing events during mammalian development and disease control. Here we show that conditional knockout of the m6A methyltransferase Mettl3 in bone marrow mesenchymal stem cells (MSCs) induces pathological features of osteoporosis in mice. Mettl3 loss-of-function results in impaired bone formation, incompetent osteogenic differentiation potential and increased marrow adiposity. Moreover, Mettl3 overexpression in MSCs protects the mice from estrogen deficiency-induced osteoporosis. Mechanistically, we identify PTH (parathyroid hormone)/Pth1r (parathyroid hormone receptor-1) signaling axis as an important downstream pathway for m6A regulation in MSCs. Knockout of Mettl3 reduces the translation efficiency of MSCs lineage allocator Pth1r, and disrupts the PTH-induced osteogenic and adipogenic responses in vivo. Our results demonstrate the pathological outcomes of m6A mis-regulation in MSCs and unveil novel epitranscriptomic mechanism in skeletal health and diseases.", "Methylation of the N(6) position of adenosine (m(6)A) is a posttranscriptional modification of RNA with poorly understood prevalence and physiological relevance. The recent discovery that FTO, an obesity risk gene, encodes an m(6)A demethylase implicates m(6)A as an important regulator of physiological processes. Here, we present a method for transcriptome-wide m(6)A localization, which combines m(6)A-specific methylated RNA immunoprecipitation with next-generation sequencing (MeRIP-Seq). We use this method to identify mRNAs of 7,676 mammalian genes that contain m(6)A, indicating that m(6)A is a common base modification of mRNA. The m(6)A modification exhibits tissue-specific regulation and is markedly increased throughout brain development. We find that m(6)A sites are enriched near stop codons and in 3' UTRs, and we uncover an association between m(6)A residues and microRNA-binding sites within 3' UTRs. These findings provide a resource for identifying transcripts that are substrates for adenosine methylation and reveal insights into the epigenetic regulation of the mammalian transcriptome.", "N6-methyladenosine (m6A) is a common modification of mRNA with potential roles in fine-tuning the RNA life cycle. Here, we identify a dense network of proteins interacting with METTL3, a component of the methyltransferase complex, and show that three of them (WTAP, METTL14, and KIAA1429) are required for methylation. Monitoring m6A levels upon WTAP depletion allowed the definition of accurate and near single-nucleotide resolution methylation maps and their classification into WTAP-dependent and -independent sites. WTAP-dependent sites are located at internal positions in transcripts, topologically static across a variety of systems we surveyed, and inversely correlated with mRNA stability, consistent with a role in establishing \"basal\" degradation rates. WTAP-independent sites form at the first transcribed base as part of the cap structure and are present at thousands of sites, forming a previously unappreciated layer of transcriptome complexity. Our data shed light on the proteomic and transcriptional underpinnings of this RNA modification.", "Rheumatoid arthritis (RA) is a systemic autoimmune disease for which the etiology has not been fully elucidated. Previous studies have shown that the development of RA has genetic and epigenetic components. As one of the most highly abundant RNA modifications, the N6-methyladenosine (m6A) modification is necessary for the biogenesis and functioning of RNA, and modification aberrancies are associated with various diseases. However, the specific functions of m6A in the cellular processes of RA remain unclear. Recent studies have revealed the relationship between m6A modification and immune cells associated with RA. Therefore, in this review, we focused on discussing the functions of m6A modification in the regulation of immune cells and immune-related bone homeostasis associated with RA. In addition, to gain a better understanding of the progress in this field of study and provide the proper direction and suggestions for further study, clinical application studies of m6A modification were also summarized.", "DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects mismatches generated during DNA replication and escape proofreading. MMR proteins also participate in many other DNA transactions, such that inactivation of MMR can have wide-ranging biological consequences, which can be either beneficial or detrimental. We begin this review by briefly considering the multiple functions of MMR proteins and the consequences of impaired function. We then focus on the biochemical mechanism of MMR replication errors. Emphasis is on structure-function studies of MMR proteins, on how mismatches are recognized, on the process by which the newly replicated strand is identified, and on excision of the replication error." ]
Changes in urinary neurotrophins in children with overactive bladder after TENS therapy
This article aims to explore changes in urinary concentrations of selected neurotrophins in the course of TENS therapy in children with overactive bladder (OAB). A two-group open-label prospective study was conducted. The intervention group comprised 30 children aged between 5 and 12 years old with OAB refractory to conservative therapy. They received 12 weeks of TENS therapy in a home setting. The urinary neurotrophins, NGF, BDNF, NT3, NT4, were measured by ELISA at baseline and at the end of the TENS therapy. Total urinary neurotrophins levels were standardized to mg of creatinine (Cr). We compared the results with the reference group of 30 participants with no symptoms of bladder overactivity. The results revealed that children with OAB both before and after TENS therapy had higher NGF, BDNF, and NT4 concentrations in total and after normalization to Cr than the reference group in contrast to NT3. The response to the therapy expressed as a decrease of urinary neurotrophins after TENS depended on the age and the presenting symptoms. In conclusion, children older than 8 years of age with complaints of daytime incontinence responded better to TENS.
[ "Increased voiding frequency and urgency are among the most prevalent storage lower urinary tract symptoms (LUTS), often diagnosed as part of overactive bladder syndrome (OAB). It has been suggested that these symptoms are caused by excessive sensory activation of the neural micturition circuit. It seems likely that sensory pathway remodelling is also responsible for pain perception upon bladder filling in patients with bladder pain syndrome (BPS). Neurotrophins-including nerve growth factor (NGF), brain-derived nerve factor (BDNF), neurotrophin-3 (NT-3) and neurotrophin-4 (NT-4)-represent master modulators of neural plasticity, both in peripheral and central nervous systems. Accumulating evidence points towards a role for neurotrophins in the control of neural sensory function during micturition and indicates their involvement in the emergence of OAB-related and BPS-related LUTS. Neurotrophins could potentially be used as urinary biomarkers to improve diagnostic accuracy for OAB and BPS and monitor therapy effectiveness. Proof-of-principle clinical evidence has confirmed that NGF is a potential target for treating human bladder overactivity.", "Urethral obstruction produces increased voiding frequency (0.7 +/- 0.06 to 1.1 +/- 0.08 h-1) and hypertrophy of the urinary bladder (89 +/- 1.7 to 708 +/- 40 mg) with profound increments in the dimensions of afferent (4, 6) and efferent neurons (299 +/- 4.7 to 573 +/- 8.6 microns2) supplying this organ in the rat. We discovered that hypertrophied bladders of rat and human contain significantly more nerve growth factor (NGF) per milligram wet weight, protein, and DNA than normal bladders. The temporal correlation between NGF content, neuronal hypertrophy, and bladder weight was consistent with a role for this growth factor in the neurotrophic effects associated with obstruction. Autoimmunity to NGF abolished the hypertrophy of NGF-sensitive bladder neurons in the pelvic ganglion after obstruction. Relief of urethral obstruction reduced bladder size (349 +/- 78 mg), but neuronal hypertrophy (460.2 +/- 10.2 microns2) and elevated NGF levels were only partially reversed. Bladder hypertrophy (133 +/- 4.3 mg) induced by osmotic diuresis slightly increased ganglion cell area (365.2 +/- 6.1 microns2) and only doubled NGF content of the bladder. These findings provide important new evidence that parenchymal cells in the hypertrophied bladder can synthesize NGF and possibly other molecular messengers that act to alter the size and function of neurons in adult animals and man.", "Nerve growth factor (NGF) and prostaglandins (PG) in the urinary bladder can be affected by pathology of bladder, and this change can be noted in the urine. This study was performed to investigate the changes in urinary NGF and PG in male patient with overactive bladder (OAB) symptoms. The study group included 75 male patients with OAB symptoms and 20 males without bladder symptoms as controls. Evaluation included history-taking, urinalysis, International Prostate Symptom Score (IPSS) and urodynamic study. The NGF, PGE2, PGF(2alpha) and PGI2 levels in voided urine were analyzed by enzyme linked immunosorbent assay and these results were compared in control and OAB patients. Also, the urinary levels of NGF and PG were correlated with IPSS score and urodynamic parameters in OAB patients. The urinary levels of NGF and PGE2 were signi fi cantly increased in patients with OAB compared with control (P < 0.05). The urodynamic study in OAB patients showed that more than half of the patients had detrusor overactivity and bladder outlet obstruction. The incidence of detrusor underactivity was noted in seven patients in the OAB group. The urinary level of PGE2 was decreased in patients with detrusor underactivity compared with patients without detrusor underactivity (P < 0.05), and negatively correlated with maximum bladder capacity in OAB patients (P < 0.05). NGF and PG may have important role in male patients with OAB, and the urinary level of PGE2 can change according to detrusor function. Therefore, these results may be used as urinary markers to evaluate the OAB symptoms.", "Interstitial cystitis (IC) is a chronic symptom-complex characterized by pathological sensation of the bladder (i.e. bladder pain in addition to augmented sensory signals such as urinary frequency and urgency) without evidence of bacterial cystitis or other identifiable lower urinary tract disease. Patients with IC typically describe feeling the urge to void frequently, as well as pain in the bladder and/or urethra. The painful sensation may be described as burning, pressure, sharp, or aching, and is often difficult for the patient to localize precisely. Multiple theories as to the cause of IC have been proposed with varying degrees of evidence. The current body of literature supports the idea that IC is associated with an intrinsic pathology of the bladder urothelial cells. The identification and complete characterization of antiproliferative factor (APF), which is uniquely expressed by urothelial cells in bladders affected by IC, are major advances in the understanding of IC. Additionally, urothelial cells have been likened to neurons because of their ability to express neuronal receptors and release neurotransmitters. The purinergic pathway has been shown to be upregulated in urothelial cells in bladders affected by IC. These new findings should help to direct the development of newer clinical treatments for IC. A complete understanding of IC will only be possible with parallel advances in both basic and clinical sciences." ]
Lean Healthcare: An Integrative Literature Review
Several health services have used lean healthcare to seek continuous improvement of their processes. Therefore, it is important to investigate the evidence available in the literature about the most used lean tools in the health area to review processes and the main results achieved by the researchers. As an integrative literature review methodology was used, it was conducted in five databases, using the descriptor "quality improvement" and the keyword "Lean Healthcare". A total of 33 complete articles were selected for analysis. The most recurrent tools were: define, measure, analyze, improve and control (DMAIC); value stream map (VSM); suppliers, inputs, process, outputs, customers analysis (SIPOC), Ishikawa Diagram and 5S. Through the analysis of waste, different interventions were implemented and the main results achieved were reduction in times (processing, waiting, cycle and total), costs, workload and increase in the number of calls. The findings enabled the identification of the main lean tools used in the health area to achieve better results. In particular, we highlight recent studies that have explored the lean six sigma healthcare approach. The results, in addition to contributing to the literature, will also assist managers in choosing the best tool to achieve continuous improvement in hospitals and other health services.
[ "The work is a part of a project about the application of the Lean Six Sigma to improve health care processes. A previously published work regarding the hip replacement surgery has shown promising results. Here, we propose an application of the DMAIC (Define, Measure, Analyse, Improve, and Control) cycle to improve quality and reduce costs related to the prosthetic knee replacement surgery by decreasing patients' length of hospital stay (LOS) METHODS: The DMAIC cycle has been adopted to decrease the patients' LOS. The University Hospital \"Federico II\" of Naples, one of the most important university hospitals in Southern Italy, participated in this study. Data on 148 patients who underwent prosthetic knee replacement between 2010 and 2013 were used. Process mapping, statistical measures, brainstorming activities, and comparative analysis were performed to identify factors influencing LOS and improvement strategies. The study allowed the identification of variables influencing the prolongation of the LOS and the implementation of corrective actions to improve the process of care. The adopted actions reduced the LOS by 42%, from a mean value of 14.2 to 8.3 days (standard deviation also decreased from 5.2 to 2.3 days). The DMAIC approach has proven to be a helpful strategy ensuring a significant decreasing of the LOS. Furthermore, through its implementation, a significant reduction of the average costs of hospital stay can be achieved. Such a versatile approach could be applied to improve a wide range of health care processes.", "An urgent need in American health care is improving quality and efficiency while controlling costs. One promising management approach implemented by some leading health care institutions is Lean, a quality improvement philosophy and set of principles originated by the Toyota Motor Company. Health care cases reveal that Lean is as applicable in complex knowledge work as it is in assembly-line manufacturing. When well executed, Lean transforms how an organization works and creates an insatiable quest for improvement. In this article, we define Lean and present 6 principles that constitute the essential dynamic of Lean management: attitude of continuous improvement, value creation, unity of purpose, respect for front-line workers, visual tracking, and flexible regimentation. Health care case studies illustrate each principle. The goal of this article is to provide a template for health care leaders to use in considering the implementation of the Lean management system or in assessing the current state of implementation in their organizations.", "To evaluate the predictors of prolonged Intensive Care Unit (ICU) stay and the impact on resource utilization. Prospective study. Adult medical/surgical ICU in a tertiary-care teaching hospital. All admissions to the ICU (numbering 947) over a 20-month period were enrolled. Data on demographic and clinical profile, length of stay, and outcome were collected prospectively. The ICU length of stay and mechanical ventilation days were used as surrogate parameters for resource utilization. Potential predictors were analyzed for possible association with prolonged ICU stay (length of stay > 14 days). Patients with prolonged ICU stay formed only 11% of patients, but utilized 45.1% of ICU days and 55.5% of mechanical ventilation days. Non-elective admissions, readmissions, respiratory or trauma-related reasons for admission, and first 24-hour evidence of infection, oliguria, coagulopathy, and the need for mechanical ventilation or vasopressor therapy had significant association with prolonged ICU stay. Mean APACHE II and SAPS II were slightly higher in patients with prolonged stay. ICU outcome was comparable to patients with < or = 14 days ICU stay. Patients with prolonged ICU stay form a small proportion of ICU patients, yet they consume a significant share of the ICU resources. The outcome of this group of patients is comparable to that of shorter stay patients. The predictors identified in the study can be used in targeting this group to improve resource utilization and efficiency of ICU care.", "To verify the impact of the Lean Six Sigma methodology in reducing incorrect entries of non-appropriated revenues and expenses. Process for the review and application of the Lean Six Sigma methodology between December 2015 and September 2016, in a high-complexity general hospital in the city of São Paulo (SP). A total of 3,756,814 (100%) entries were audited between December 2015 and September 2016. The Sigma level evolved over the course of the process and increased from 3.44 Sigma in December 2015 to 5.92 Sigma in September 2016. Entries classified as non-appropriated revenues and expenses were brought down to 0% at the end of the study. The use of the Lean Six Sigma methodology was efficient in reducing incorrect entries, calculating costs, ensuring compliance in rendering of accounts and accurately determining cost-outcome ratios.", "The purpose of this study was to improve the organization of work, reduce physical effort, and obtain greater satisfaction of workers in the Pre-analytical Area of the Clinical Biochemistry Service at the Miguel Servet University Hospital of Zaragoza, in Spain, by applying Lean techniques. Such techniques were applied in two steps to obtain a final situation where the reduction of the space occupied, the required physical effort, and the work time is clear. The satisfaction of the workers was analyzed during the whole process by means of surveys, concluding that the sum of all the improvements managed to increase the satisfaction of the professionals. One key aspect to get these results was to use always the information and opinions of the staff making them feel the protagonists of the process. For that, it was essential the role of the agent of change that fundamentally sought the involvement of professionals in the improvement processes. Another key point was the careful application of Lean techniques always little by little, by applying small changes that became habits and achieved permanent results. In conclusion, in this work, a methodology to improve involvement and satisfaction of workers in health care has been presented and validated." ]
Economic Burden of Stroke in Primary and Referral Healthcare: A Systematic Review
Globally, one of the main causes of non-communicable disease as a cause of death every year is stroke. The objective of this study was to analyze the burden in consequence of stroke. This research used a systematic review method. Furthermore, a search for articles was carried out in June-July 2020. Four databases were used to search articles from 2015 to 2020. Eligible studies were identified, analyzed, and reported following the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines. The inclusion criteria were prospective cost studies, retrospective cost studies, database analysis, mathematical models, surveys, and COI studies that assess burden of stroke in primary and referral healthcare (hospital-based). The results showed that from four databases, 9270 articles were obtained, and 13 articles were qualified. A total of 9270 articles had the identified search keywords, but only 13 articles met the set criteria for inclusion. The criteria for inclusion were stroke patients, the economic burden of stroke disease based on cost of illness method, which is approximately equal to USD 1809.51-325,108.84 (direct costs 86.2%, and indirect costs 13.8%). Those that used the health expenditure method did not present the total cost; instead, only either direct or indirect cost of health expenditure were reported. For most hospital admissions due to stroke, LOS (length of stay) was the dominant cost. The high economic burden to manage stroke justifies the promotion and preventive efforts by the policymakers and motivates the practice of healthy lifestyles by the people.
[ "Stroke registries are used in many settings to measure stroke treatment and outcomes, but rarely include data on health economic outcomes. We aimed to extend the Sentinel Stroke National Audit Programme registry of England, Wales and Northern Ireland to derive and report patient-level estimates of the cost of stroke care. An individual patient simulation model was built to estimate health and social care costs at one and five years after stroke, and the cost-benefits of thrombolysis and early supported discharge. Costs were stratified according to age, sex, stroke type (ischaemic or primary intracerebral haemorrhage) and stroke severity. The results were illustrated using data on all patients with stroke included in Sentinel Stroke National Audit Programme from April 2015 to March 2016 (n = 84,184). The total cost of health and social care for patients with acute stroke each year in England, Wales and Northern Ireland was £3.60 billion in the first five years after admission (mean per patient cost: £46,039). There was fivefold variation in the magnitude of costs between patients, ranging from £19,101 to £107,336. Costs increased with older age, increasing stroke severity and intracerebral hemorrhage stroke. Increasing the proportion of eligible patients receiving thrombolysis or early supported discharge was estimated to save health and social care costs by five years after stroke. The cost of stroke care is large and varies widely between patients. Increasing the proportion of eligible patients receiving thrombolysis or early supported discharge could contribute to reducing the financial burden of stroke. Extending stroke registers to report individualised data on costs may enhance their potential to support quality improvement and research.", "Stroke is a major global disease that requires extensive care and support from society and relatives. The aim of this study was to identify and quantify the long-term informal support and to estimate the annual cost of informal support provided by spouses to their stroke surviving partner. Data were based on the 7-year follow-up of the Sahlgrenska Academy Study on Ischemic Stroke. One-third of the spouses stated that they provided support to their stroke surviving partner. The magnitude of the support was assessed with a study-specific time-diary and was estimated for independent and dependent stroke survivors based on the scores of the modified Rankin Scale. To deal with skewed data, a two-part econometric model was used to estimate the annual cost of informal support. Cohabitant dyads of 221 stroke survivors aged <70 at stroke onset were included in the study. Spouses of independent stroke survivors (n = 188) provided on average 0.15 hr/day of practical support and 0.48 hr/day of being available. Corresponding figures for spouses of dependent stroke survivors (n = 33) were 5.00 regarding practical support and 9.51 regarding being available. The mean annual cost of informal support provided for independent stroke survivors was estimated at €991 and €25,127 for dependent stroke survivor. The opportunity cost of informal support provided to dependent midlife stroke survivors is of a major magnitude many years after stroke onset and should be considered in economic evaluations of health care.", "The purpose of this paper is to investigate the determinants influencing the costs of cardiovascular disease in the regional health service in Italy's Apulia region from 2014 to 2016. Data for patients with acute myocardial infarction (AMI), heart failure (HF), and atrial fibrillation (AF) were collected from the hospital discharge registry. Generalized linear models (GLM), and generalized linear mixed models (GLMM) were used to identify the role of random effects in improving the model performance. The study was based on socio-demographic variables and disease-specific variables (diagnosis-related group, hospitalization type, hospital stay, surgery, and economic burden of the hospital discharge form). Firstly, both models indicated an increase in health costs in 2016, and lower spending values for women (p < 0.001) were shown. GLMM indicates a significant increase in health expenditure with increasing age (p < 0.001). Day-hospital has the lowest cost, surgery increases the cost, and AMI is the most expensive pathology, contrary to AF (p < 0.001). Secondly, AIC and BIC assume the lowest values for the GLMM model, indicating the random effects' relevance in improving the model performance. This study is the first that considers real data to estimate the economic burden of CVD from the regional health service's perspective. It appears significant for its ability to provide a large set of estimates of the economic burden of CVD, providing information to managers for health management and planning.", "Few studies from low- and middle-income countries have assessed stroke and cerebral reperfusion costs from the private sector. To measure the in-hospital costs of ischemic stroke (IS), with and without cerebral reperfusion, primary intracerebral hemorrhage (PIH), subarachnoid hemorrhage (SAH) and transient ischemic attacks (TIA) in two private hospitals in Joinville, Brazil. Prospective disease-cost study. All medical and nonmedical costs for patients admitted with any stroke type or TIA were consecutively determined in 2016-17. All costs were adjusted to the gross domestic product deflator index and purchasing power parity. We included 173 patients. The median cost per patient was US$3,827 (IQR: 2,800-8,664) for the 131 IS patients; US$2,315 (IQR: 1,692-2,959) for the 27 TIA patients; US$16,442 (IQR: 5,108-33,355) for the 11 PIH patients and US$28,928 (IQR: 12,424-48,037) for the four SAH patients (p < 0.00001). For the six IS patients who underwent intravenous thrombolysis, the median cost per patient was US$11,463 (IQR: 8,931-14,291), and for the four IS patients who underwent intra-arterial thrombectomy, the median cost per patient was US$35,092 (IQR: 31,833-37,626; p < 0.0001). A direct correlation was found between cost and length of stay (r = 0.67, p < 0.001). Stroke is a costly disease. In the private sector, the costs of cerebral reperfusion for IS treatment were three-to-ten times higher than for usual treatments. Therefore, cost-effectiveness studies are urgently needed in low- and middle-income countries.", "Liver diseases are one of the main causes of death, and their ever-increasing prevalence is threatening to cause significant damage both to individuals and society as a whole. This damage is especially serious for the economically active population in Korea. From the societal perspective, it is therefore necessary to consider the economic impacts associated with liver diseases, and identify interventions that can reduce the burden of these diseases. The cost-of-illness study is considered to be an essential evaluation technique in health care. By measuring and comparing the economic burdens of diseases to society, such studies can help health-care decision-makers to set up and prioritize health-care policies and interventions. Using economic theories, this paper introduces various study methods that are generally applicable to most disease cases for estimating the costs of illness associated with mortality, morbidity, disability, and other disease characteristics. It also presents concepts and scopes of costs along with different cost categories from different research perspectives in cost estimations. By discussing the epidemiological and economic grounds of the cost-of-illness study, the reported results represent useful information about several evaluation techniques at an advanced level, such as cost-benefit analysis, cost-effectiveness analysis, and cost-utility analysis.", "This study aims to estimate the annual economic cost per hemiplegic patient in Turkey. Between September 2014 and December 2014, a total of 84 hemiplegic patients (53 males, 31 females; mean age 61.4±13.5 years; range 28-89 years) with stroke for 12 months were included in the study. Type of cerebrovascular accident and complications were evaluated. Hospital records and data from the relatives of the patients were used to calculate the cost. Annual costs were evaluated starting from first hospitalization. Direct costs were calculated with the sum of hospital care (acute care, diagnostic investigations, treatment and rehabilitation), medications, medical visits, outpatient rehabilitation and orthopedic aids. Indirect costs were calculated by taking the income loss due to absence from work into consideration. Prices of medical resources were obtained from the 2014 Healthcare Implementation Notification payment list. At the end of the study, the average direct cost and indirect cost per patient were calculated respectively as 10,594.90±6,554.20 Turkish liras and 9,357.10±10,195.60 Turkish liras (4,606.47±2,849.65 USD and 4,068.30±4,432.86 USD). We found a negative correlation between total cost and age (p=0.001), and a positive correlation with duration of hospitalization (p=0.001) and number of complications (p=0.049). We were unable to find any relation of cost with sex and cerebrovascular accident type. Spasticity (p=0.028) and epilepsy (p=0.037) being among the complications were observed to increase the cost. Stroke is an important economic burden for Turkish population. Preventive social measures are necessary to reduce this cost.", "The shift of the Noncommunicable Diseases (NCDs) epidemic, including cardiovascular disease, from developed to Low and Middle Income Countries (LMIC), creates new challenges in contexts where there is poor information on healthcare costs. Clearly this information is essential for planning, and its relevance is even more valuable as a driver for prevention and control of NCDs. This paper begins to address that handicap by estimating the healthcare cost of Cardiovascular Disease (Coronary Heart Disease and Stroke) in Colombia, using a person-based approach. Results show that the annual healthcare cost of a person with Coronary Heart Disease is between INT$ 4,277 and INT$ 4,846, while the cost for a person with Stroke varies between INT$5,816 and INT$6,616. The expansion of the NCDs epidemic combined with such high costs threatens the financial sustainability of health systems; primary prevention and policies targeting structural and intermediate determinants of health are a promising way to make health systems financially sustainable." ]
Mechanism of increased thermostability of Methanocaldococcus jannaschii glutamine amidotransferase
Stability of proteins from hyperthermophiles (organisms existing under boiling water conditions) enabled by a reduction of conformational flexibility is realized through various mechanisms. A succinimide (SNN) arising from the post-translational cyclization of the side chains of aspartyl/asparaginyl residues with the backbone amide -NH of the succeeding residue would restrain the torsion angle Ψ and can serve as a new route for hyperthermostability. However, such a succinimide is typically prone to hydrolysis, transforming to either an aspartyl or β-isoaspartyl residue. Here, we present the crystal structure of Methanocaldococcus jannaschii glutamine amidotransferase and, using enhanced sampling molecular dynamics simulations, address the mechanism of its increased thermostability, up to 100°C, imparted by an unexpectedly stable succinimidyl residue at position 109. The stability of SNN109 to hydrolysis is seen to arise from its electrostatic shielding by the side-chain carboxylate group of its succeeding residue Asp110, as well as through n → π
[ "The accurate prediction of the binding affinity changes of drugs caused by protein mutations is a major goal in clinical personalized medicine. We have developed an ensemble-based free energy approach called thermodynamic integration with enhanced sampling (TIES), which yields accurate, precise, and reproducible binding affinities. TIES has been shown to perform well for predictions of free energy differences of congeneric ligands to a wide range of target proteins. We have recently introduced variants of TIES, which incorporate the enhanced sampling technique REST2 (replica exchange with solute tempering) and the free energy estimator MBAR (Bennett acceptance ratio). Here we further extend the TIES methodology to study relative binding affinities caused by protein mutations when bound to a ligand, a variant which we call TIES-PM. We apply TIES-PM to fibroblast growth factor receptor 3 (FGFR3) to investigate binding free energy changes upon protein mutations. The results show that TIES-PM with REST2 successfully captures a large conformational change and generates correct free energy differences caused by a gatekeeper mutation located in the binding pocket. Simulations without REST2 fail to overcome the energy barrier between the conformations, and hence the results are highly sensitive to the initial structures. We also discuss situations where REST2 does not improve the accuracy of predictions.", "The enhanced thermostability of thermophilic proteins with respect to their mesophilic counterparts is often attributed to the enthalpy effect, arising from strong interactions between protein residues. Intuitively, these strong interresidue interactions will rigidify the biomolecules. However, the present work utilizing neutron scattering and solution NMR spectroscopy measurements demonstrates a contrary example that the thermophilic cytochrome P450, CYP119, is much more flexible than its mesophilic counterpart, CYP101A1, something which is not apparent just from structural comparison of the two proteins. A mechanism to explain this apparent contradiction is that higher flexibility in the folded state of CYP119 increases its conformational entropy and thereby reduces the entropy gain during denaturation, which will increase the free energy needed for unfolding and thus stabilize the protein. This scenario is supported by thermodynamic data on the temperature dependence of unfolding free energy, which shows a significant entropic contribution to the thermostability of CYP119 and lends an added dimension to enhanced stability, previously attributed only to presence of aromatic stacking interactions and salt bridge networks. Our experimental data also support the notion that highly thermophilic P450s such as CYP119 may use a mechanism that partitions flexibility differently from mesophilic P450s between ligand binding and thermal stability.", "Metadynamics is an established sampling method aimed at reconstructing the free-energy surface relative to a set of appropriately chosen collective variables. In standard metadynamics, the free-energy surface is filled by the addition of Gaussian potentials of preassigned and typically diagonal covariance. Asymptotically the free-energy surface is proportional to the bias deposited. Here, we consider the possibility of using Gaussians whose variance is adjusted on the fly to the local properties of the free-energy surface. We suggest two different prescriptions: one is based on the local diffusivity and the other on the local geometrical properties. We further examine the problem of extracting the free-energy surface when using adaptive Gaussians. We show that the standard relation between the bias and the free energy does not hold. In the limit of narrow Gaussians an explicit correction can be evaluated. In the general case, we propose to use instead a relation between bias and free energy borrowed from umbrella sampling. This relation holds for all kinds of incrementally deposited bias. We illustrate on the case of alanine dipeptide the advantage of using adaptive Gaussians in conjunction with the new free-energy estimator both in terms of accuracy and speed of convergence.", "The REST2 method is successfully applied to investigate the thermal stability of chignolin CLN025 and of Trp-cage. As opposed to temperature replica exchange, REST2 relies on the rescaling of the protein potential energy, which allows a smaller number of replicas. The shape of the stability curve reconstructed on the basis of the corresponding-state principle is in very good agreement with experimental data; for chignolin, the effect of mutations is also recovered.", "Designing tight-binding ligands is a primary objective of small-molecule drug discovery. Over the past few decades, free-energy calculations have benefited from improved force fields and sampling algorithms, as well as the advent of low-cost parallel computing. However, it has proven to be challenging to reliably achieve the level of accuracy that would be needed to guide lead optimization (∼5× in binding affinity) for a wide range of ligands and protein targets. Not surprisingly, widespread commercial application of free-energy simulations has been limited due to the lack of large-scale validation coupled with the technical challenges traditionally associated with running these types of calculations. Here, we report an approach that achieves an unprecedented level of accuracy across a broad range of target classes and ligands, with retrospective results encompassing 200 ligands and a wide variety of chemical perturbations, many of which involve significant changes in ligand chemical structures. In addition, we have applied the method in prospective drug discovery projects and found a significant improvement in the quality of the compounds synthesized that have been predicted to be potent. Compounds predicted to be potent by this approach have a substantial reduction in false positives relative to compounds synthesized on the basis of other computational or medicinal chemistry approaches. Furthermore, the results are consistent with those obtained from our retrospective studies, demonstrating the robustness and broad range of applicability of this approach, which can be used to drive decisions in lead optimization.", "A consensus classification and nomenclature are defined for RNA backbone structure using all of the backbone torsion angles. By a consensus of several independent analysis methods, 46 discrete conformers are identified as suitably clustered in a quality-filtered, multidimensional dihedral angle distribution. Most of these conformers represent identifiable features or roles within RNA structures. The conformers are given two-character names that reflect the seven-angle delta epsilon zeta alpha beta gamma delta combinations empirically found favorable for the sugar-to-sugar \"suite\" unit within which the angle correlations are strongest (e.g., 1a for A-form, 5z for the start of S-motifs). Since the half-nucleotides are specified by a number for delta epsilon zeta and a lowercase letter for alpha beta gamma delta, this modular system can also be parsed to describe traditional nucleotide units (e.g., a1) or the dinucleotides (e.g., a1a1) that are especially useful at the level of crystallographic map fitting. This nomenclature can also be written as a string with two-character suite names between the uppercase letters of the base sequence (N1aG1gN1aR1aA1cN1a for a GNRA tetraloop), facilitating bioinformatic comparisons. Cluster means, standard deviations, coordinates, and examples are made available, as well as the Suitename software that assigns suite conformer names and conformer match quality (suiteness) from atomic coordinates. The RNA Ontology Consortium will combine this new backbone system with others that define base pairs, base-stacking, and hydrogen-bond relationships to provide a full description of RNA structural motifs.", "The phosphoserine/threonine binding protein 14-3-3 stimulates the catalytic activity of protein kinase C-epsilon (PKCepsilon) by engaging two tandem phosphoserine-containing motifs located between the PKCepsilon regulatory and catalytic domains (V3 region). Interaction between 14-3-3 and this region of PKCepsilon is essential for the completion of cytokinesis. Here, we report the crystal structure of 14-3-3zeta bound to a synthetic diphosphorylated PKCepsilon V3 region revealing how a consensus 14-3-3 site and a divergent 14-3-3 site cooperate to bind to 14-3-3 and so activate PKCepsilon. Thermodynamic data show a markedly enhanced binding affinity for two-site phosphopeptides over single-site 14-3-3 binding motifs and identifies Ser 368 as a gatekeeper phosphorylation site in this physiologically relevant 14-3-3 ligand. This dual-site intra-chain recognition has implications for other 14-3-3 targets, which seem to have only a single 14-3-3 motif, as other lower affinity and cryptic 14-3-3 gatekeeper sites might exist." ]
How do I get a list of all the rows in a table?
The
[ "Alzheimer's disease (AD) is a neurodegenerative disorder with impairment of cognitive function and personality. The synaptic loss, neuronal atrophy and degeneration of cholinergic nuclei in the basal forebrain may be associated with a reduction in oxidative metabolism of glucose, a fall in acetyl CoA and ATP. Current pharmacological strategies, aimed at increasing cholinergic activity include acetylcholinesterase (AChE) inhibitors, cholinergic agonists, acetylcholine (ACh) releasers and stimulants of nerve growth factors (NGF). AChE inhibitors, physostigmine and Tacrine can slow the decline of cognitive function and memory in some patients with mild or moderate AD, if given for at least 3-6 months in sufficient doses to inhibit brain AChE. Their main disadvantages are low oral bioavailability, peripheral cholinergic hyperactivity and liver toxicity with Tacrine. Newer, less toxic AChE inhibitors, with selective central activity, formulations of physostigmine, selective Ml and nicotinic agonists are becoming available with improved bioavailability and pharmacokinetics. These may increase the likelihood of therapeutic benefit in AD. Nootropic drugs, e.g. piracetam, which release ACh and are relatively non-toxic could possibly slow the progression of the disease. A combination of an AChE inhibitor, piracetam and a stimulator of NGF may show additive effects on memory processes but with a lower incidence of untoward effects.", "Treatments for cognitive deficits associated with central nervous system (CNS) disorders such as Alzheimer disease and schizophrenia remain significant unmet medical needs that incur substantial pressure on the health care system. The α7 nicotinic acetylcholine receptor (nAChR) has garnered substantial attention as a target for cognitive deficits based on receptor localization, robust preclinical effects, genetics implicating its involvement in cognitive disorders, and encouraging, albeit mixed, clinical data with α7 nAChR orthosteric agonists. Importantly, previous orthosteric agonists at this receptor suffered from off-target activity, receptor desensitization, and an inverted U-shaped dose-effect curve in preclinical assays that limit their clinical utility. To overcome the challenges with orthosteric agonists, we have identified a novel selective α7 positive allosteric modulator (PAM), BNC375. This compound is selective over related receptors and potentiates acetylcholine-evoked α7 currents with only marginal effect on the receptor desensitization kinetics. In addition, BNC375 enhances long-term potentiation of electrically evoked synaptic responses in rat hippocampal slices and in vivo. Systemic administration of BNC375 reverses scopolamine-induced cognitive deficits in rat novel object recognition and rhesus monkey object retrieval detour (ORD) task over a wide range of exposures, showing no evidence of an inverted U-shaped dose-effect curve. The compound also improves performance in the ORD task in aged African green monkeys. Moreover, ex vivo 13C-NMR analysis indicates that BNC375 treatment can enhance neurotransmitter release in rat medial prefrontal cortex. These findings suggest that α7 nAChR PAMs have multiple advantages over orthosteric α7 nAChR agonists for the treatment of cognitive dysfunction associated with CNS diseases. SIGNIFICANCE STATEMENT: BNC375 is a novel and selective α7 nicotinic acetylcholine receptor (nAChR) positive allosteric modulator (PAM) that potentiates acetylcholine-evoked α7 currents in in vitro assays with little to no effect on the desensitization kinetics. In vivo, BNC375 demonstrated robust procognitive effects in multiple preclinical models across a wide exposure range. These results suggest that α7 nAChR PAMs have therapeutic potential in central nervous system diseases with cognitive impairments.", "Activation of brain alpha7 nicotinic acetylcholine receptors (alpha7 nAChRs) has broad therapeutic potential in CNS diseases related to cognitive dysfunction, including Alzheimer's disease and schizophrenia. In contrast to direct agonist activation, positive allosteric modulation of alpha7 nAChRs would deliver the clinically validated benefits of allosterism to these indications. We have generated a selective alpha7 nAChR-positive allosteric modulator (PAM) from a library of GABAA receptor PAMs. Compound 6 (N-(4-chlorophenyl)-alpha-[[(4-chloro-phenyl)amino]methylene]-3-methyl-5-isoxazoleacet-amide) evokes robust positive modulation of agonist-induced currents at alpha7 nAChRs, while preserving the rapid native characteristics of desensitization, and has little to no efficacy at other ligand-gated ion channels. In rodent models, it corrects sensory-gating deficits and improves working memory, effects consistent with cognitive enhancement. Compound 6 represents a chemotype for allosteric activation of alpha7 nAChRs, with therapeutic potential in CNS diseases with cognitive dysfunction.", "The currents of α7 nicotinic acetylcholine receptors activated by acetylcholine (ACh) are brief. The channel has high permeability to calcium relative to monovalent cations and shows inward rectification. It has been previously noted that in the presence of positive allosteric modulators (PAMs), currents through the channels of α7 receptors differ from normal α7 currents both in sensitivity to specific channel blockers and their current-voltage (I-V) relationships, no longer showing inward rectification. Linear I-V functions are often associated with channels lacking calcium permeability, so we measured the I-V functions of α7 receptors activated by ACh when PAMs were bound to the allosteric binding site in the transmembrane domain. Currents were recorded in chloride-free Ringer's solution with low or high concentrations of extracellular calcium to determine the magnitude of the reversal potential shift in the two conditions as well as the I-V relationships. ACh-evoked currents potentiated by the allosteric agonist-PAMs (ago-PAMs) (3aR,4S,9bS)-4-(4-bromophenyl)-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinoline-8-sulfonamide (GAT107) and 3-(3,4-difluorophenyl)-N-(1-(6-(4-(pyridin-2-yl)piperazin-1-yl)pyrazin-2-yl)ethyl)propenamide (B-973B) showed reduced inward rectification and calcium-dependent reversal potential shifts decreased by 80%, and 50%, respectively, compared with currents activated by ACh alone, indicative of reduced calcium permeability. Currents potentiated by 3a,4,5,9b-tetrahydro-4-(1-naphthalenyl)-3H-cyclopentan[c]quinoline-8-sulfonamide were also linear and showed no calcium-dependent reversal potential shifts. The ago-PAMs GAT-107 and B-973B stimulated increases in intracellular calcium in stably transfected HEK293 cells. However, these calcium signals were delayed relative to channel activation produced by these agents and were insensitive to the channel blocker mecamylamine. Our results indicate that, although allosterically activated α7 nicotinic ACh receptor may affect intracellular calcium levels, such effects are not likely due to large channel-dependent calcium influx. SIGNIFICANCE STATEMENT: Positive allosteric modulators (PAMs) of α7 nicotinic acetylcholine receptor can increase channel activation by two or more orders of magnitude, raising the concern that, due to the relatively high calcium permeability of α7 receptors activated by acetylcholine alone, such efficacious PAMs may have cytotoxic side effects. We show that PAMs alter the ion conduction pathway and, in general, reduce the calcium permeability of the channels. This supports the hypothesis that α7 effects on intracellular calcium may be independent of channel-mediated calcium influx.", "In addition to the devastating symptoms of psychosis, many people with schizophrenia also suffer from cognitive impairment. These cognitive symptoms lead to marked dysfunction and can impact employability, treatment adherence, and social skills. Deficits in P50 auditory gating are associated with attentional impairment and may contribute to cognitive symptoms and perceptual disturbances. This nicotinic cholinergic-mediated inhibitory process represents a potential new target for therapeutic intervention in schizophrenia. This chapter will review evidence implicating the nicotinic cholinergic, and specifically, the alpha7 nicotinic receptor system in the pathology of schizophrenia. Impaired auditory sensory gating has been linked to the alpha7 nicotinic receptor gene on the chromosome 15q14 locus. A majority of persons with schizophrenia are heavy smokers. Although nicotine can acutely reverse diminished auditory sensory gating in people with schizophrenia, this effect is lost on a chronic basis due to receptor desensitization. The alpha7 nicotinic agonist 3-(2,4 dimethoxy)benzylidene-anabaseine (DMXBA) can also enhance auditory sensory gating in animal models. DMXBA is well tolerated in humans and a new study in persons with schizophrenia has found that DMXBA enhances both P50 auditory gating and cognition. alpha7 Nicotinic acetylcholine receptor agonists appear to be viable candidates for the treatment of cognitive disturbances in schizophrenia.", "The alpha7 nicotinic acetylcholine receptor (nAChR), a homopentameric, rapidly activating and desensitizing ligand-gated ion channel with relatively high degree of calcium permeability, is expressed in the mammalian central nervous system, including regions associated with cognitive processing. Selective agonists targeting the alpha7 nAChR have shown efficacy in animal models of cognitive dysfunction. Use of positive allosteric modulators selective for the alpha7 receptor is another strategy that is envisaged in the design of active compounds aiming at improving attention and cognitive dysfunction. The recent discovery of novel positive allosteric modulators such as 1-(5-chloro-2-hydroxyphenyl)-3-(2-chloro-5-trifluoromethylphenyl)urea (NS-1738) and 1-(5-chloro-2,4-dimethoxyphenyl)-3-(5-methylisoxazol-3-yl)urea (PNU-120596) that are selective for the alpha7 nAChRs but display significant phenotypic differences in their profile of allosteric modulation, suggests that these molecules may act at different sites on the receptor. Taking advantage of the possibility to obtain functional receptors by the fusion of proteins domains from the alpha7 and the 5-HT(3) receptor, we examined the structural determinants required for positive allosteric modulation. This strategy revealed that the extracellular N-terminal domain of alpha7 plays a critical role in allosteric modulation by NS-1738. In addition, alpha7-5HT(3) chimeras harboring the M2-M3 segment showed that spontaneous activity in response to NS-1738, which confirmed the critical contribution of this small extracellular segment in the receptor gating. In contrast to NS-1738, positive allosteric modulation by PNU-120596 could not be restored in the alpha7-5HT(3) chimeras but was selectively observed in the reverse 5HT(3)-alpha7 chimera. All together, these data illustrate the existence of distinct allosteric binding sites with specificity of different profiles of allosteric modulators and open new possibilities to investigate the alpha7 receptor function.", "The α7 nicotinic acetylcholine receptor (α7 nAChR) is a ligand-gated Ca2+-permeable homopentameric ion channel implicated in cognition and neuropsychiatric disorders. Pharmacological enhancement of α7 nAChR function has been suggested for improvement of cognitive deficits. In the present study, we characterized a thiazolyl heterocyclic derivative, 6-(2-chloro-6-methylphenyl)-2-((3-fluoro-4-methylphenyl)amino)thiazolo[4,5-d]pyrimidin-7(6H)-one (JWX-A0108), as a novel type I α7 nAChR positive allosteric modulator (PAM), and evaluated its ability to reverse auditory gating and spatial working memory deficits in mice. In Xenopus oocytes expressing human nAChR channels, application of JWX-A0108 selectively enhanced α7 nAChR-mediated inward current in the presence of the agonist ACh (EC50 value = 4.35 ± 0.12 µM). In hippocampal slices, co-application of ACh and JWX-A0108 (10 µM for each) markedly increased both the frequency and amplitude of spontaneous inhibitory postsynaptic currents (sIPSCs) recorded in pyramidal neurons, but JWX-A0108 did not affect GABA-induced current in oocytes expressing human GABAA receptor α1β3γ2 and α5β3γ2 subtypes. In mice with MK-801-induced deficits in auditory gating, administration of JWX-A0108 (1, 3, and 10 mg/kg, i.p.) dose-dependently attenuates MK-801-induced auditory gating deficits in five prepulse intensities (72, 76, 80, 84, and 88 dB). Furthermore, administration of JWX-A0108 (0.03, 0.1, or 0.3 mg/kg, i.p.) significantly reversed MK-801-induced impaired spatial working memory in mice. Our results demonstrate that JWX-A0108 is a novel type I PAM of α7 nAChR, which may be beneficial for improvement of cognitive deficits commonly found in neuropsychiatric disorders such as schizophrenia and Alzheimer's disease.", "The α7 nicotinic acetylcholine receptor (nAChR) is a promising drug target for a number of neurological disorders including chronic pain and inflammatory diseases. Since α7 can function as a ligand-gated ion channel, drug development initially focused on ligands that were selective activators of the α7 ion channel. However, the best α7 drugs for chronic pain and inflammation indications may not be ion channel activators but rather \"silent agonists\", which bind to the receptor but preferentially induce non-conducting states that modulate signal transduction in non-neuronal cells. One such compound is NS6740. We show that NS6740 selectively induces prolonged desensitization of α7 nAChRs. There are two forms of α7 desensitization that can be distinguished by their sensitivity to the positive allosteric modulators (PAMs). At high concentrations, NS6740 preferentially induces PAM-insensitive desensitization, which over the course of several minutes reverts to the sensitive form. NS6740 was tested in several pain models after in vivo administration in the mouse. Although it had no effects in acute thermal pain, NS6740 induced significant dose- and time-dependent antinociceptive activity in formalin- and acetic acid-induced nociceptive behaviors as well as in the chronic constrictive nerve injury (CCI) model for neuropathic pain. The antinociceptive activity of NS6740 in these models was α7-dependent. In addition, NS6740 administration reversed pain-induced aversion, an important affective component of pain. The time and concentration dependence of the effects were consistent with NS6740 induction of PAM-insensitive non-conducting states, suggesting that signal transduction required for analgesia is accomplished by α7 receptors in that conformation.", "1. Pharmacological studies of alpha7 nicotinic acetylcholine receptors are confounded by the fact that rapid desensitization to high agonist concentration causes alpha7 peak responses to occur well in advance of complete solution exchange. For this reason, peak currents are an invalid measure of response to applied agonist concentrations. We show that results comparable to those that have been corrected for instantaneous concentration are obtained if net charge is used as the measure of receptor response. 2. Dose response curves obtained with these methods indicate that alpha7 receptors are approximately 10 fold more sensitive to agonist than previously reported. The agonists, ACh, choline, cytisine, GTS-21, 4OH-GTS-21 and 4-MeO-CA have the same rank order potency for both human and rat receptors: 4-MeO-CA > 4OH-GTS-21 > GTS-21 > cytisine > ACh > choline. However, differences in efficacy exist between rat and human receptors. GTS-21 is more efficacious for rat than human alpha7 receptors and cytosine more efficacious for human than rat alpha7 receptors. 3. Choline is the least potent agonist for both human and rat alpha7, with a potency approximately 10 fold lower than that of ACh. While the EC50 for the activation of alpha7 receptors by choline (400-500 microM) is outside the normal physiological range (10-100 microM), choline can nonetheless produce detectable levels of channel activation in the physiological concentration range. Since these concentrations are relatively non-desensitizing, the contribution of choline-activated alpha7 receptor current may play a significant role in the regulation of calcium homeostasis in alpha7-expressing neurons.", "The neurotransmitter acetylcholine (ACh) can regulate neuronal excitability by acting on the cys-loop cation-conducting ligand-gated nicotinic ACh receptor (nAChR) channels. These receptors are widely distributed throughout the central nervous system (CNS), being expressed on neurons and non-neuronal cells, where they participate in a variety of physiological responses such as anxiety, the central processing of pain, food intake, nicotine seeking behavior, and cognitive functions. In the mammalian brain, nine different subunits have been found thus far, which assemble into pentameric complexes with much subunit diversity; however, the α7 and α4β2 subtypes predominate in the CNS. Neuronal nAChR dysfunction is involved in the pathophysiology of many neurological disorders. Here we will briefly discuss the functional makeup and expression of the nAChRs in mammalian brain, and their role as targets in neurodegenerative diseases (in particular Alzheimer's disease, AD), neurodevelopmental disorders (in particular autism and schizophrenia), and neuropathic pain." ]
Effect of walnut shell filler on selected properties of polyurethane composites
In the following study, polyurethane (PUR) composites were modified with 2 wt.% of walnut shell filler modified with selected mineral compounds-perlite, montmorillonite, and halloysite. The impact of modified walnut shell fillers on selected properties of PUR composites, such as rheological properties (dynamic viscosity, foaming behavior), mechanical properties (compressive strength, flexural strength, impact strength), dynamic-mechanical behavior (glass transition temperature, storage modulus), insulation properties (thermal conductivity), thermal characteristic (temperature of thermal decomposition stages), and flame retardant properties (e.g., ignition time, limiting oxygen index, heat peak release) was investigated. Among all modified types of PUR composites, the greatest improvement was observed for PUR composites filled with walnut shell filler functionalized with halloysite. For example, on the addition of such modified walnut shell filler, the compressive strength was enhanced by ~13%, flexural strength by ~12%, and impact strength by ~14%. Due to the functionalization of walnut shell filler with thermally stable flame retardant compounds, such modified PUR composites were characterized by higher temperatures of thermal decomposition. Most importantly, PUR composites filled with flame retardant compounds exhibited improved flame resistance characteristics-in all cases, the value of peak heat release was reduced by ~12%, while the value of total smoke release was reduced by ~23%.
[ "The article presents characteristics of wood/polypropylene composites, where the wood was treated with propolis extract (EEP) and innovative propolis-silane formulations. Special interest in propolis for wood impregnation is due to its antimicrobial properties. One propolis-silane formulation (EEP-TEOS/VTMOS) consisted of EEP, tetraethyl orthosilicate (TEOS), and vinyltrimethoxysilane (VTMOS), while the other (EEP-TEOS/OTEOS) contained EEP, tetraethyl orthosilicate (TEOS), and octyltriethoxysilane (OTEOS). The treated wood fillers were characterized by Fourier transform infrared spectroscopy (FTIR), atomic absorption spectrometry (AAS), and X-ray diffraction (XRD), while the composites were investigated using differential scanning calorimetry (DSC), X-ray diffraction (XRD), and optical microscopy. The wood treated with EEP and propolis-silane formulations showed resistance against moulds, including Aspergillus niger, Chaetomium globosum, and Trichoderma viride. The chemical analyses confirmed presence of silanes and constituents of propolis in wood structure. In addition, treatment of wood with the propolis-silane formulations produced significant changes in nucleating abilities of wood in the polypropylene matrix, which was confirmed by an increase in crystallization temperature and crystal conversion, as well as a decrease in half-time of crystallization parameters compared to the untreated polymer matrix. In all the composites, the formation of a transcrystalline layer was observed, with the greatest rate recorded for the composite with the filler treated with EEP-TEOS/OTEOS. Moreover, impregnation of wood with propolis-silane formulations resulted in a considerable improvement of strength properties in the produced composites. A dependence was found between changes in the polymorphic structures of the polypropylene matrix and strength properties of composite materials. It needs to be stressed that to date literature sources have not reported on treatment of wood fillers using bifunctional modifiers providing a simultaneous effect of compatibility in the polymer-filler system or any protective effect against fungi.", "The following article debates on the properties of cellulose-filled ethylene-norbornene copolymer (EN) composites. Natural fibers employed in this study have been modified via two different approaches: solvent-involving (S) and newly developed non-solvent (NS). The second type of the treatment is fully eco-friendly and was carried out in the planetary mill without incorporation of any additional, waste-generating substances. Composite samples have been investigated with the use of spectroscopic methods (FT-IR), differential scanning calorimetry (DSC), static mechanical analysis, and surface-free energy measurements. It has been proved that the possible filler-polymer matrix interaction changes may occur due to the performed modifications. The highest reinforcement was evidenced for the composite sample filled with cellulose treated via a NS approach-TS = (34 ± 2) MPa, Eb = (380 ± 20)%. Additionally, a surface free energy polar part exhibited a significant increase for the same type of modification. Consequently, this could indicate easier wetting of the material which may contribute to the degradation process enhancement. Successfully developed cellulose-filled ethylene-norbornene copolymer composite compromises the rules of green chemistry and sustainable development by taking an advantage of renewable natural resources. This bio-inspired material may become an eco-friendly alternative for commonly used polymer blends.", "Propolis is a natural bee product with various beneficial biological effects. The health-promoting properties of propolis depend on its chemical composition, particularly the presence of phenolic compounds. The aim of this study was to evaluate the relationship between extraction solvent (acetone 100%, ethanol 70% and 96%) and the antifungal, antioxidant, and cytoprotective activity of the extracts obtained from propolis. Concentrations of flavonoids and phenolic acids in the propolis extracts were determined using ultrahigh-performance liquid chromatography. The antioxidant potential of different extracts was assessed on the basis of 2,2-diphenyl-1-picrylhydrazyl (DPPH·) free-radical-scavenging activity, Fe3+-reducing power, and ferrous ion (Fe2+)-chelating activity assays. The ability of the extracts to protect human red blood cell membranes against free-radical-induced damage and their antifungal activity was also determined. The results showed that the concentration of flavonoids in the propolis extracts was dependent on the solvent used in the extraction process and pinocembrin, chrysin, galangin, and coumaric acid were the most abundant phenols. All extracts exhibited high antioxidant potential and significantly protected human erythrocytes against oxidative damage. On the other hand, the antifungal activity of the propolis extracts depended on the solvent used in extraction and the fungal strains tested. It needs to be stressed that, to the best of our knowledge, there is no study relating the effect of solvent used for extraction of Polish propolis to its phenolic profile, and its antifungal, antioxidant, and cytoprotective activity." ]
TRPV1 receptor in primary hyperalgesia
Subpopulations of primary nociceptors (C- and Aδ-fibers), express the TRPV1 receptor for heat and capsaicin. During cutaneous inflammation, these afferents may become sensitized, leading to primary hyperalgesia. It is known that TRPV1
[ "To compare the heat responses of mechanically sensitive and mechanically insensitive A-fiber nociceptors, an electrical search technique was used to locate the receptive fields of 156 A-fibers that innervated the hairy skin in the anesthetized monkey (77 A beta-fibers, 79 A delta-fibers). Two-thirds of these afferents were either low-threshold mechanoreceptors (n = 91) or low-threshold cold receptors (n = 11). Nine A beta-fibers and 41 A delta-fibers were cutaneous nociceptors, and four A delta-fibers innervated subcutaneous tissue. The majority of cutaneous A-fiber nociceptors were heat sensitive (43/50 = 86%). Heat-insensitive cutaneous A-fiber nociceptors consisted of one cold nociceptor, three silent nociceptors, and three high-threshold mechanoreceptors. Two types of response were observed to an intense heat stimulus (53 degrees C, 30 s). Type I (n = 26) was characterized by a long latency (mean: 5 s) and a late peak discharge (16 s). Type II (n = 17) was characterized by a short latency (0.2 s) and an early peak discharge (0.5 s). Type I fibers exhibited faster conduction velocities (25 vs. 14 m/s) and higher heat thresholds (> 53 vs. 47 degrees C, 1-s duration) than type II fibers. The possibility that the type I heat response was a result of sensitization was tested in three fibers by determining the heat threshold to 30-s duration stimuli (42-46 degrees C). For this long stimulus duration heat thresholds were reproducible across multiple runs, and the threshold to the 1-s duration stimulus was not altered by these tests. Thus fibers with a type I heat response were not high-threshold mechanoreceptors that developed a heat response through sensitization. Fibers with a type II heat response had significantly higher mechanical thresholds (median: 15 bar) than fibers with a type I heat response (5 bar). This finding accounts for the observation that type II heat responses were infrequently observed in earlier studies wherein the search technique depended on mechanical responsiveness. Fibers with a type II response exhibited a graded response to heat stimuli, marked fatigue to repeated applications of heat stimuli, and adaptation to sustained heat stimuli similar to that seen in C-fiber nociceptors. First pain sensation to heat is served by type II A-fiber nociceptors that are mechanically insensitive. Type I A-fiber nociceptors likely signal pain to long-duration heat stimuli and may signal first pain sensation to mechanical stimuli.", "Polymodal nociceptors respond to mechanical, thermal and chemical stimuli. Whereas sensitivities to heat and to the irritant substance capsaicin have recently been linked via the properties of the vanilloid receptor type 1 receptor ion channel, sensitivity to noxious mechanical stimuli such as the pinpricks used in clinical neurology seems to be unrelated. We investigated the peripheral neural basis of pinprick pain using quantitative psychophysical techniques combined with selective conduction block by nerve compression and selective desensitization by topical capsaicin treatment. Complete A-fibre block by compression of the superficial radial nerve (criterion: loss of first pain sensation) lowered the stimulus-response function for pinprick pain (-82 +/- 6% versus baseline). Topical pretreatment of the skin with a 10% capsaicin cream also lowered the pinprick stimulus-response function (-32 +/- 10%), whereas laser-evoked heat pain was eliminated completely (-96 +/- 2%). Under combined capsaicin desensitization and A-fibre blockade, pinprick pain was eliminated completely (-98 +/- 1%). Intradermal injection of 40 microg capsaicin into normal skin between two skin areas that had been pretreated with either capsaicin cream or vehicle produced secondary hyperalgesia with a 260% enhancement of the stimulus-response function for pinprick pain in both areas. In contrast, axon reflexive flare spread only into the vehicle-treated area. These results suggest that capsaicin-sensitive afferents, including polymodal A-fibre and C-fibre nociceptors, make a small contribution to pinprick pain and that capsaicin-insensitive C-fibres do not contribute significantly to either mechanical or heat pain. Pinprick pain is mediated primarily by capsaicin-insensitive A-fibre nociceptors, which include high-threshold mechanoreceptors and type I mechano-heat nociceptors. In addition, central sensitization to input from these A-fibre nociceptors is the primary mechanism that accounts for the enhanced pain in response to punctate mechanical stimuli in the zone of secondary hyperalgesia. These capsaicin-insensitive A-fibre nociceptors may also mediate hyperalgesia in neuropathic pain.", "The recently cloned vanilloid receptor (VR1) is postulated to account for heat and capsaicin sensitivity in unmyelinated afferents. We sought to determine whether heat and capsaicin sensitivity also coexist in myelinated nociceptive afferents. Action potential (AP) activity was recorded from single A-fiber nociceptors that innervated the hairy skin in monkey. Before intradermal injection of capsaicin (10 microg/10 microl) into the receptive field, nociceptors were classified as heat-sensitive (threshold, </=53 degrees C, 1 sec) or heat-insensitive afferents and as mechanically sensitive (von Frey threshold, <6 bar) or mechanically insensitive afferents. All heat-sensitive afferents (n = 16) were insensitive to mechanical stimuli but responded to the intradermal injection of capsaicin (69 +/- 7 APs in 10 min). Responsiveness to mechanical stimuli, thermal stimuli, and capsaicin varied in their receptive fields; the majority of receptive field sites (24 of 36) were responsive to only one or two stimulus modalities, whereas only eight sites responded to all three modalities. For most heat-insensitive afferents, the activity induced by the capsaicin injection did not exceed the activity induced by needle insertion alone. However, the largest response to capsaicin (314 +/- 98 APs in 10 min) was observed for five afferents that were insensitive to heat as well as mechanical stimuli and therefore may be classified as cutaneous chemoreceptors. These results suggest that A-fiber nociceptors play a role in the pain and hyperalgesia associated with capsaicin injection. Our finding that a subgroup of capsaicin-sensitive A-fiber nociceptors are insensitive to heat predicts the existence of heat-insensitive capsaicin receptors.", "Ultraviolet-B-induced erythema (one, two, or four times the minimal erythema dose) was reduced but not abolished by application of 1% indomethacin gel immediately after irradiation of human skin. Continuous synthesis of prostaglandins is reflected by similar levels of indomethacin-mediated inhibition of erythema at any time within 48 h after irradiation. Repeated applications of indomethacin did not increase the inhibition. Twenty-four hours after irradiation with four minimal erythema doses, mean prostaglandin E2 levels in suction blisters were 27.2 ng per ml (SEM 11) compared with 8.6 ng per ml in unirradiated skin (n = 25; p < 0.01). Prosta glandin E2 levels in dermal tissues, sampled by microdialysis (depth 0.6 +/- 0.1 mm), were 310 pg per ml (SEM 123) and 237 pg per ml (SEM 88) in irradiated and unirradiated skin, respectively (n = 7, n.s.). Nitric oxide also made a significant contribution to ultraviolet-B-induced erythema. Ultraviolet erythema was inhibited by L-NAME in a dose-related fashion with 2 mM L-NAME causing total abolition of the response. L-NAME was effective at all time points up to 48 h suggesting that NO was produced continuously. NO was undetectable in suction blister fluid but in dermal microdialysate NO was present at 44.3 ng per ml (SEM 6.2) following ultraviolet B compared with 26.0 ng per ml (SEM 8.0) in unirradiated skin (p < 0.05), approximately 1000 times the molar concentration of prostaglandin E2. These findings confirm prostaglandin E2 and NO to be mediators of ultraviolet-induced erythema. They also show that there is prolonged synthesis of both mediators within the erythemal response and that synthesis of NO is induced by lower doses of ultraviolet B compared with that of prostaglandin E2." ]
Adaptor of DNA sensor STING is an important adaptor in NK cell function in HBeAg-negative chronic hepatitis B virus infection
NK cells play crucial roles in defending against persistent HBV. However, NK cells present dysfunction in chronic hepatitis B virus (CHB) infection, and the associated mechanism is still not fully understood. Except for the regulatory receptors, NK cells could also be regulated by the surface and intracellular pattern recognition receptors (PRRs). In the present study, we found that the level of the adaptor of DNA sensor STING in NK cells was significantly decreased in HBeAg-negative CHB patients, and it was positively associated with the degranulation ability of NK cells. Compared to NK cells from healthy donors, NK cells from HBeAg-negative CHB patients displayed a lower responsiveness to cGAMP stimulation. Further investigation showed that HBsAg could inhibit the STING expression in NK cells and suppress the response of NK cells to cGAMP. Significantly, STAT3 was identified to be a transcription factor that directly regulated STING transcription by binding to the promoter. In addition, STAT3 positively regulated the STING associated IFN-α response of NK cells. These findings suggested that STING is an important adaptor in NK cell recognition and activation, while HBsAg disturbs NK cell function by the STAT3-STING axis, providing a new mechanism of NK disability in HBeAg-negative CHB infection.
[ "The recognition of microbial nucleic acids is a major mechanism by which the immune system detects pathogens. Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor that activates innate immune responses through production of the second messenger cGAMP, which activates the adaptor STING. The cGAS-STING pathway not only mediates protective immune defense against infection by a large variety of DNA-containing pathogens but also detects tumor-derived DNA and generates intrinsic antitumor immunity. However, aberrant activation of the cGAS pathway by self DNA can also lead to autoimmune and inflammatory disease. Thus, the cGAS pathway must be properly regulated. Here we review the recent advances in understanding of the cGAS-STING pathway, focusing on the regulatory mechanisms and roles of this pathway in heath and disease.", "The immunoreceptor NKG2D originally identified in natural killer (NK) cells recognizes ligands that are upregulated on tumor cells. Expression of NKG2D ligands (NKG2DL) is induced by the DNA damage response (DDR), which is often activated constitutively in cancer cells, revealing them to NK cells as a mechanism of immunosurveillance. Here, we report that the induction of retinoic acid early transcript 1 (RAE1) ligands for NKG2D by the DDR relies on a STING-dependent DNA sensor pathway involving the effector molecules TBK1 and IRF3. Cytosolic DNA was detected in lymphoma cell lines that express RAE1 and its occurrence required activation of the DDR. Transfection of DNA into ligand-negative cells was sufficient to induce RAE1 expression. Irf3(+/-);Eμ-Myc mice expressed lower levels of RAE1 on tumor cells and showed a reduced survival rate compared with Irf3(+/+);Eμ-Myc mice. Taken together, our results suggest that genomic damage in tumor cells leads to activation of STING-dependent DNA sensor pathways, thereby activating RAE1 and enabling tumor immunosurveillance.", "Detection of cytosolic DNA activates a downstream signaling molecule called STimulator of INterferon Genes (STING). Inappropriate or excessive activation of STING can lead to autoimmune disease. A new paper in Cell addresses the important question of how STING-dependent signaling is normally constrained.", "The DNA damage response (DDR) upregulates the expression of NKG2D ligands (NKG2DLs).1,2 We have recently reported that the DDR also induces the presence of cytosolic DNA in B-cell lymphoma cells, which leads to the activation of STING-dependent cytosolic DNA sensor pathways and the expression of RAE-1 ligands for NKG2D.3.", "Hepatitis B virus (HBV) is a hepatotropic virus that can establish a persistent and chronic infection in humans through immune anergy. Currently, 3.5% of the global population is chronically infected with HBV, although the incidence of HBV infections is decreasing owing to vaccination and, to a lesser extent, the use of antiviral therapy to reduce the viral load of chronically infected individuals. The course of chronic HBV infection typically comprises different clinical phases, each of which potentially lasts for decades. Well-defined and verified serum and liver biopsy diagnostic markers enable the assessment of disease severity, viral replication status, patient risk stratification and treatment decisions. Current therapy includes antiviral agents that directly act on viral replication and immunomodulators, such as interferon therapy. Antiviral agents for HBV include reverse transcriptase inhibitors, which are nucleoside or nucleotide analogues that can profoundly suppress HBV replication but require long-term maintenance therapy. Novel compounds are being actively investigated to achieve the goal of HBV surface antigen seroclearance (functional cure), a serological state that is associated with a higher remission rate (thus, no viral rebound) after treatment cessation and a lower rate of cirrhosis and hepatocellular carcinoma. This Primer addresses several aspects of HBV infection, including epidemiology, immune pathophysiology, diagnosis, prevention and management.", "NK cells play an important role in early control of HBV infection. The function of NK cells is inhibited in chronic hepatitis B virus (CHB) infection, although the underlying mechanism remains unknown. We found that the expression of STAT3 decreased in peripheral NK cells of CHB patients, and was associated with low levels of degranulation and IFN-γ secretion. In addition, STAT3 levels were positively correlated with cytolysis-associated molecules and antiviral cytokines, such as CD107a, granzyme B, perforin, and IFN-γ. HBsAg directly inhibited the expression and activation of STAT3 in NK cells, and knocking down STAT3 expression in NK cells inhibited proliferation, decreased cyclin d1 levels, and suppressed responsiveness to IL-21 stimulation. Furthermore, STAT3 directly bound to the promoter of NKp46, an important activating receptor of NK cells, to regulate its transcription and expression. Taken together, our findings indicate that STAT3 is an important positive regulator of NK cells, and provide a new mechanism of NK cell dysfunction in CHB." ]
Dynamic tailoring in a narrative-driven mobile exergame for adolescents: A cluster-randomized controlled trial
Physical activity interventions for youth are direly needed given low adherence to physical activity guidelines, but many interventions suffer from low user engagement. Exergames that require bodily movement while played may provide an engaging form of physical activity intervention but are not perceived as engaging to all. This study aimed to evaluate whether dynamic tailoring in a narrative-driven mobile exergame for adolescents played in leisure settings, can create higher user engagement compared to a non-tailored exergame. A cluster-randomized controlled trial assessed differences in user engagement between a dynamically tailored (based on an accelerometer sensor integrated in a T-shirt) and non-tailored condition. In total, 94 participants (M age = 14.61 ± 1.93; 35% female) participated and were assigned to one of the two conditions. User engagement was measured via a survey and game metric data. User engagement was low in both conditions. Narrative sensation was higher in the dynamically tailored condition, but the non-tailored condition showed longer play-time. User suggestions to create a more appealing game included simple and more colorful graphics, avoiding technical problems, more variety and shorter missions and multiplayer options. Less cumbersome or more attractive sensing options than the smart T-shirt may offer a more engaging solution, to be tested in future research.
[ "Exergames, more specifically console-based exergames, are generally enjoyed by adolescents and known to increase physical activity. Nevertheless, they have a reduced usage over time and demonstrate little effectiveness over the long term. In order to increase playing time, mobile exergames may increase potential playing time, but need to be engaging and integrated in everyday life. The goal of the present study was to examine the context of gameplay for mobile exergaming in adolescents&rsquo; everyday life to inform game design and the integration of gameplay into everyday life. Eight focus groups were conducted with 49 Flemish adolescents (11 to 17 years of age). The focus groups were audiotaped, transcribed, and analyzed by means of thematic analysis via Nvivo 11 software (QSR International Pty Ltd., Victoria, Australia). The adolescents indicated leisure time and travel time to and from school as suitable timeframes for playing a mobile exergame. Outdoor gameplay should be restricted to the personal living environment of adolescents. Besides outdoor locations, the game should also be adaptable to at-home activities. Activities could vary from running outside to fitness exercises inside. Furthermore, the social context of the game was important, e.g., playing in teams or meeting at (virtual) meeting points. Physical activity tracking via smart clothing was identified as a motivator for gameplay. By means of this study, game developers may be better equipped to develop mobile exergames that embed gameplay in adolescents&rsquo; everyday life.", "The aim of the current study was to evaluate the effects of and adherence to an active video game promotion intervention on anthropometrics, sedentary screen time and consumption of sugar-sweetened beverages and snacks among non-active video gaming adolescents who primarily were of healthy weight. We assigned 270 gaming (i.e. ≥ 2 hours/week non-active video game time) adolescents randomly to an intervention group (n = 140) (receiving active video games and encouragement to play) or a waiting-list control group (n = 130). BMI-SDS (SDS = adjusted for mean standard deviation score), waist circumference-SDS, hip circumference and sum of skinfolds were measured at baseline, at four and ten months follow-up (primary outcomes). Sedentary screen time, physical activity, consumption of sugar-sweetened beverages and snacks, and process measures (not at baseline) were assessed with self-reports at baseline, one, four and ten months follow-up. Multi-level-intention to treat-regression analyses were conducted. The control group decreased significantly more than the intervention group on BMI-SDS (β = 0.074, 95%CI: 0.008;0.14), and sum of skinfolds (β = 3.22, 95%CI: 0.27;6.17) (overall effects). The intervention group had a significantly higher decrease in self-reported non-active video game time (β = -1.76, 95%CI: -3.20;-0.32) and total sedentary screen time (Exp (β = 0.81, 95%CI: 0.74;0.88) than the control group (overall effects). The process evaluation showed that 14% of the adolescents played the Move video games every week ≥ 1 hour/week during the whole intervention period. The active video game intervention did not result in lower values on anthropometrics in a group of 'excessive' non-active video gamers (mean ~ 14 hours/week) who primarily were of healthy weight compared to a control group throughout a ten-month-period. Even some effects in the unexpected direction were found, with the control group showing lower BMI-SDS and skin folds than the intervention group. The intervention did result in less self-reported sedentary screen time, although these results are likely biased by social desirability. Dutch Trial Register NTR3228.", "Less than 15% of children and adolescents participate regularly in physical activity (PA) and, with ever-increasing obesity, strategies to improve PA levels in youth are urgently needed. Exergaming offers a PA alternative that may be especially attractive in our increasingly technophilic society. However, there are no observational studies of exergaming in population-based samples of adolescents. The purpose of this study was to investigate potential sociodemographic, lifestyle, psychosocial, weight-related, and mental health correlates of exergaming as well as describe the type, timing, and intensity of exergaming in a population-based sample of adolescents. Data on exergame use and potential sociodemographic, lifestyle, psychosocial, weight-related, and mental health correlates of exergaming were collected in mailed self-report questionnaires completed by 1241 grade 10 and 11 students from the Montreal area with a mean age of 16.8 years (SD = 0.05 years; 43% male) participating in the AdoQuest study. The independent correlates of exergaming were identified in multivariable logistic regression models. Nearly one-quarter (24%) of participants reported exergaming. Exergamers played 2 days per week on average, for ∼50 minutes each bout; 73% of exergamers played at a moderate or vigorous intensity. Exergamers were more likely than nonexergamers to be girls, to play nonactive video games, to watch ≥2 hours of television per day, to be stressed about weight, and to be nonsmokers. Many adolescents exergame at intensity levels that could help them achieve current moderate-to-vigorous PA recommendations. Interventions that encourage exergaming may increase PA and decrease sedentary behavior in select youth subgroups, notably in girls.", "Low physical activity levels and high levels of sedentary time among adolescents call for population wide interventions. Public open spaces can be important locations for adolescents' physical activity. This study aimed to describe the prevalence, frequency and context of public open space visitation and to gain insight into the individual, social and physical environmental factors associated with public open space use among 12- to 16-year-old Flemish (Belgian) adolescents. Global positioning system devices, accelerometers and one-on-one interviews were used to measure location-specific activity levels, time spent at, reasons for using and accompaniment at public open spaces among 173 adolescents. Multilevel hurdle and gamma models were used to estimate the associations between the independent variables (age, gender, ethnicity, education, sport club membership and accompaniment) and the amount of time, sedentary time, light-, moderate- to vigorous- and vigorous-intensity physical activity at public open spaces. Three out of four participants had visited a public open space (for recreational purposes) and participants were most often accompanied by friends/classmates. Mainly public transportation stops/stations were used, and subsequently the most reported reason for public open space use was \"to wait for something or someone\". Furthermore, boys, younger adolescents, non-western-European adolescents and lower educated adolescents were more likely to use public open spaces. Additionally, boys and younger adolescents were more likely to accumulate physical activity at public open spaces. The only social environmental variable associated with time spent at public open spaces was accompaniment by siblings: adolescents spent more time at public open spaces when accompanied by their siblings. Public open spaces may be effective areas to promote physical activity among groups at risk for physical inactivity (i.e. low educated and non-western-European adolescents). Additionally, girls and older adolescents were less likely to visit and be physically active at public open spaces. Therefore, urban planners should consider adding attractive features, in order to encourage physical activity among girls and older adolescents at public open spaces. Furthermore, creating public open spaces that are attractive for youth of all ages could contribute to adolescents visiting public open spaces accompanied by siblings.", "Digital games combining exercise with game play, known as exergames, can improve youths' health status and provide social and academic benefits. Exergame play increases caloric expenditure, heart rate, and coordination. Psychosocial and cognitive impacts of exergame play may include increased self-esteem, social interaction, motivation, attention, and visual-spatial skills. This article summarizes the literature on exergames, with a special emphasis on physical education courses and the potential of exergames to improve students' physical health, as well as transfer effects that may benefit related physical, social, and academic outcomes.", "After school is a critical period in the physical activity and sedentary behaviour patterns of young people. Interventions to promote physical activity during these hours should be informed by existing evidence. The present study provides a systematic review of interventions to promote physical activity in young people conducted in the hours immediately after school. The review was conducted in accordance with guidelines from the National Institute for Health and Clinical Excellence. Studies were located through searches of electronic databases, including MEDLINE, EMBASE, PsychINFO and ERIC. For included studies, data were extracted and methodological quality assessed using standardised forms. Ten papers, reporting nine studies, met inclusion criteria. Three studies reported positive changes in physical activity and six indicated no change. Evidence suggests that single-behaviour interventions may be most effective during these hours. Limitations in study design, lack of statistical power and problems with implementation have likely hindered the effectiveness of interventions in the after-school setting to date. Further work is required to develop interventions during this critical period of the day.", "Electronic media have often been considered to have a negative impact on the sleep of children and adolescents, but there are no comprehensive reviews of research in this area. The present study identified 36 papers that have investigated the relationship between sleep and electronic media in school-aged children and adolescents, including television viewing, use of computers, electronic gaming, and/or the internet, mobile telephones, and music. Many variables have been investigated across these studies, although delayed bedtime and shorter total sleep time have been found to be most consistently related to media use. A model of the mechanisms by which media use may affect sleep is presented and discussed as a vehicle for future research." ]
Social Impacts of Years of Potential Life Lost and Excess Mortality Due to COVID-19 in Brazil
In November 2020, Brazil ranked third in the number of cases of coronavirus disease 2019 (COVID-19) and second in the number of deaths due to the disease. We carried out a descriptive study of deaths, mortality rate, years of potential life lost (YPLL) and excess mortality due to COVID-19, based on SARS-CoV-2 records in SIVEP-Gripe (Ministry of Health of Brazil) from 16 February 2020, to 1 January 2021. In this period, there were 98,025 deaths from COVID-19 in Brazil. Men accounted for 60.5% of the estimated 1.2 million YPLLs. High YPLL averages showed prematurity of deaths. The population aged 45-64 years (both sexes) represented more than 50% of all YPLLs. Risk factors were present in 69.5% of deaths, with heart disease, diabetes and obesity representing the most prevalent comorbidities in both sexes. Indigenous people had the lowest number of deaths and the highest average YPLL. However, in indigenous people, pregnant women and mothers had an average YPLL of over 35 years. The excess mortality for Brazil was estimated at 122,914 deaths (9.2%). The results show that the social impacts of YPLL due to COVID-19 are different depending on gender, race and risk factors. YPLL and excess mortality can be used to guide the prioritization of health interventions, such as prioritization of vaccination, lockdowns, or distribution of facial masks for the most vulnerable populations.
[ "This study describes possible transmission of novel coronavirus disease 2019 (COVID-19) from an asymptomatic Wuhan resident to 5 family members in Anyang, a Chinese city in the neighboring province of Hubei.", "Epidemiological studies have highlighted the disparate impact of coronavirus disease 2019 (COVID-19) on racial and ethnic minority and socioeconomically disadvantaged populations, but data at the neighborhood-level is sparse. The objective of this study was to investigate the disparate impact of COVID-19 on disadvantaged neighborhoods and racial/ethnic minorities in Chicago, Illinois. Using data from the Cook County Medical Examiner, we conducted a neighborhood-level analysis of COVID-19 decedents in Chicago and quantified age-standardized years of potential life lost (YPLL) due to COVID-19 among demographic subgroups and neighborhoods with geospatial clustering of high and low rates of COVID-19 mortality. We show that age-standardized YPLL was markedly higher among the non-Hispanic (NH) Black (559 years per 100,000 population) and the Hispanic (811) compared with NH white decedents (312). We demonstrate that geomapping using residential address data at the individual-level identifies hot-spots of COVID-19 mortality in neighborhoods on the Northeast, West, and South areas of Chicago that reflect a legacy of residential segregation and persistence of inequality in education, income, and access to healthcare. Our results may contribute to ongoing public health and community-engaged efforts to prevent the spread of infection and mitigate the disproportionate loss of life among these communities due to COVID-19 as well as highlight the urgent need to broadly target neighborhood disadvantage as a cause of pervasive racial inequalities in life and health.", "Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2; COVID-19) has created an urgent need to identify child abuse and neglect (CAN) and efficiently allocate resources to improve the coordination of responses during a public health crisis. To provide unique insights into the spatial and temporal distribution of CAN in relation to COVID-19 outcomes and identify areas where CAN has increased or decreased during the pandemic. Children under 18 years old reported to the Los Angeles Police Department for CAN. CAN incidents in the city of Los Angeles. Negative binomial regression was used to explore associations between the implementation of social distancing protocols and reported CAN during COVID-19. Spatiotemporal analysis identified locations of emerging hot and cold spots during the pandemic. Associations between neighborhood structural factors (e.g., school absenteeism, poverty, unemployment, housing insecurity and birth assets) and hot and cold spot patterns were explored. There was a statistically significant decline in reports of CAN during the COVID-19 pandemic but no significant trends following the implementation of social distancing measures (e.g. safer at home orders, school closures). Compared to consecutive cold spots, severe housing burden, the number of assets children have at birth, poverty, school absenteeism and labor force participation were significantly associated with new and intensifying hotspots of CAN during the COVID-19 pandemic. Our findings reinforce the utility of developing intervention strategies that minimize harm to children by targeting resources to specific challenges facing families enduring the COVID-19 experience.", "Human coronaviruses (HCoVs) were first described in the 1960s for patients with the common cold. Since then, more HCoVs have been discovered, including those that cause severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), two pathogens that, upon infection, can cause fatal respiratory disease in humans. It was recently discovered that dromedary camels in Saudi Arabia harbor three different HCoV species, including a dominant MERS HCoV lineage that was responsible for the outbreaks in the Middle East and South Korea during 2015. In this review we aim to compare and contrast the different HCoVs with regard to epidemiology and pathogenesis, in addition to the virus evolution and recombination events which have, on occasion, resulted in outbreaks amongst humans.", "As of June 19, 2020 there are more than 8.6 million COVID-19 cases worldwide with over 450,000 deaths. Providing obstetrical care in the setting of the pandemic poses challenges to the healthcare system in that, in comparison to many other medical specialties, obstetrical care cannot be deferred. Pregnant patients represent a high risk population for exposure and infection with respiratory pathogens and, as they require multiple points of contact with the healthcare system, are especially vulnerable. The purpose of this review is assess current epidemiology and outcomes research related to COVID-19 with a focus on obstetric patients. This review covers the global spread of the SARS-CoV-2 virus, symptomatology, modes of transmission, and current knowledge gaps related to epidemiology and outcomes for the obstetric population.", "To investigate the rate of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) positivity in asymptomatic pregnant women admitted to hospital for delivery in a Turkish pandemic center. This prospective cohort study was conducted in Ankara City Hospital between April, 15, 2020 and June, 5, 2020. A total of 206 asymptomatic pregnant women (103 low-risk pregnant women without any defined risk factor and 103 high-risk pregnant women) were screened for SARS-CoV-2 positivity upon admission to hospital for delivery. Detection of SARS-CoV2 in nasopharyngeal and oropharyngeal samples was performed by Real Time Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) method targeting RdRp (RNA dependent RNA polymerase) gene. Two groups were compared in terms of demographic features, clinical characteristics and SARS-CoV-2 positivity. Three of the 206 pregnant women participating in the study had positive RT-PCR tests (1.4 %) and all positive cases were in the high-risk pregnancy group. Although, one case in the high-risk pregnancy group had developed symptoms highly suspicious for COVID-19, two repeated RT-PCR tests were negative. SARS-CoV-2 RT-PCR positivity rate was significantly higher in the high-risk pregnancy group (2.9 % vs 0%, p = 0.04). Healthcare professionals should be cautious in the labor and delivery of high-risk pregnant women during the pandemic period and universal testing for COVID-19 may be considered in selected populations.", "The ongoing outbreak of the recently emerged novel coronavirus (2019-nCoV) poses a challenge for public health laboratories as virus isolates are unavailable while there is growing evidence that the outbreak is more widespread than initially thought, and international spread through travellers does already occur. We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material available. Here we present a validated diagnostic workflow for 2019-nCoV, its design relying on close genetic relatedness of 2019-nCoV with SARS coronavirus, making use of synthetic nucleic acid technology. The workflow reliably detects 2019-nCoV, and further discriminates 2019-nCoV from SARS-CoV. Through coordination between academic and public laboratories, we confirmed assay exclusivity based on 297 original clinical specimens containing a full spectrum of human respiratory viruses. Control material is made available through European Virus Archive - Global (EVAg), a European Union infrastructure project. The present study demonstrates the enormous response capacity achieved through coordination of academic and public laboratories in national and European research networks." ]
Genome-scale microRNA expression profiles in a lung squamous cell carcinoma cohort
This study developed a novel methodology to correlate genome-scale microRNA (miRNA) expression profiles in a lung squamous cell carcinoma (LUSC) cohort (
[ "While microRNAs (miRNAs) were widely considered to repress target genes at mRNA and/or protein levels, emerging evidence from in vitro experiments has shown that miRNAs can also activate gene expression in particular contexts. However, this counterintuitive observation has rarely been reported or interpreted in in vivo conditions. We systematically explored the positive correlation between miRNA and gene expressions and its potential implications in tumorigenesis, based on 8375 patient samples across 31 major human cancers from The Cancer Genome Atlas (TCGA). We found that positive miRNA-gene correlations are surprisingly prevalent and consistent across cancer types, and show distinct patterns than negative correlations. The top-ranked positive correlations are significantly involved in the immune cell differentiation and cell membrane signaling related processes, and display strong power in stratifying patients in terms of survival rate. Although intragenic miRNAs generally tend to co-express with their host genes, a substantial portion of miRNAs shows no obvious correlation with their host gene plausibly due to non-conservation. A miRNA can upregulate a gene by inhibiting its upstream suppressor, or shares transcription factors with that gene, both leading to positive correlation. The miRNA/gene sites associated with the top-ranked positive correlations are more likely to form super-enhancers compared to randomly chosen pairs. Wet-lab experiments revealed that positive correlations partially remain in in vitro condition. Our study brings new insights into the critical role of miRNA in gene regulation and the complex mechanisms underlying miRNA functions, and reveals both biological and clinical significance of miRNA-associated gene activation.", "RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.", "We introduce two large-scale resources for functional analysis of microRNA (miRNA): a decoy library for inhibiting miRNA function and a sensor library for monitoring microRNA activity. To take advantage of the sensor library, we developed a high-throughput assay called Sensor-seq to simultaneously quantify the activity of hundreds of miRNAs. Using this approach, we show that only the most abundant miRNAs in a cell mediate target suppression. Over 60% of detected miRNAs had no discernible activity, which indicated that the functional 'miRNome' of a cell is considerably smaller than currently inferred from profiling studies. Moreover, some highly expressed miRNAs exhibited relatively weak activity, which in some cases correlated with a high target-to-miRNA ratio or increased nuclear localization of the miRNA. Finally, we show that the miRNA decoy library can be used for pooled loss-of-function studies. These tools are valuable resources for studying miRNA biology and for miRNA-based therapeutics.", "A critical step during human microRNA maturation is the processing of the primary microRNA transcript by the nuclear RNaseIII enzyme Drosha to generate the approximately 60-nucleotide precursor microRNA hairpin. How Drosha recognizes primary RNA substrates and selects its cleavage sites has remained a mystery, especially given that the known targets for Drosha processing show no discernable sequence homology. Here, we show that human Drosha selectively cleaves RNA hairpins bearing a large (>/=10 nucleotides) terminal loop. From the junction of the loop and the adjacent stem, Drosha then cleaves approximately two helical RNA turns into the stem to produce the precursor microRNA. Beyond the precursor microRNA cleavage sites, approximately one helix turn of stem extension is also essential for efficient processing. While the sites of Drosha cleavage are determined largely by the distance from the terminal loop, variations in stem structure and sequence around the cleavage site can fine-tune the actual cleavage sites chosen.", "MicroRNAs (miRNAs) are small, noncoding RNAs that regulate expression of many genes. Recent studies suggest roles of miRNAs in carcinogenesis. We and others have shown that expression profiles of miRNAs are different in lung cancer vs. normal lung, although the significance of this aberrant expression is poorly understood. Among the reported down-regulated miRNAs in lung cancer, the miRNA (miR)-29 family (29a, 29b, and 29c) has intriguing complementarities to the 3'-UTRs of DNA methyltransferase (DNMT)3A and -3B (de novo methyltransferases), two key enzymes involved in DNA methylation, that are frequently up-regulated in lung cancer and associated with poor prognosis. We investigated whether miR-29s could target DNMT3A and -B and whether restoration of miR-29s could normalize aberrant patterns of methylation in non-small-cell lung cancer. Here we show that expression of miR-29s is inversely correlated to DNMT3A and -3B in lung cancer tissues, and that miR-29s directly target both DNMT3A and -3B. The enforced expression of miR-29s in lung cancer cell lines restores normal patterns of DNA methylation, induces reexpression of methylation-silenced tumor suppressor genes, such as FHIT and WWOX, and inhibits tumorigenicity in vitro and in vivo. These findings support a role of miR-29s in epigenetic normalization of NSCLC, providing a rationale for the development of miRNA-based strategies for the treatment of lung cancer.", "When, ∼20 years ago, investigators first determined that components of the genome considered nonfunctional had, in fact, gene regulatory capacity, they probably had no idea of their potential in controlling cell fate and were forced to revise and somehow reorganize their view of the molecular biology. Indeed, it is currently well documented how a class of small non-coding RNAs, microRNAs, are conserved among the species, expressed in different tissues and cell types and involved in almost every biological process, including cell cycle, growth, apoptosis, differentiation and stress response, exerting a finely tuned regulation of gene expression by targeting multiple molecules. As a consequence of the widespread range of processes they are able to influence, it is not surprising that miRNA deregulation is a hallmark of several pathological conditions, including cancer. Indeed, the aberrant expression of these tiny molecules in human tumors is not just a casual association, but they can exert a causal role, as oncogenes or tumor suppressors, in different steps of the tumorigenic process, from initiation and development to progression toward the acquisition of a metastatic phenotype. An increasing body of evidence has indeed proved the importance of miRNAs in cancer, suggesting their possible use as diagnostic, prognostic and predictive biomarkers and leading to exploit miRNA-based anticancer therapies, either alone or in combination with current targeted therapies, with the goal to improve disease response and increase cure rates. Here, we review our current knowledge about miRNA involvement in cancer.", "We investigated whether microRNA expression profiles can predict clinical outcome of NSCLC patients. Using real-time RT-PCR, we obtained microRNA expressions in 112 NSCLC patients, which were divided into the training and testing sets. Using Cox regression and risk-score analysis, we identified a five-microRNA signature for the prediction of treatment outcome of NSCLC in the training set. This microRNA signature was validated by the testing set and an independent cohort. Patients with high-risk scores in their microRNA signatures had poor overall and disease-free survivals compared to the low-risk-score patients. This microRNA signature is an independent predictor of the cancer relapse and survival of NSCLC patients.", "The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.", "MicroRNAs have recently emerged as key posttranscriptional regulators of eukaryotic gene expression, yet our understanding of how microRNA expression is itself controlled has remained rudimentary. This review describes recent insights into the mechanisms governing microRNA transcription and processing in vertebrates and their implications for understanding the regulation of microRNA biogenesis.", "MicroRNAs (miRNAs) are approximately 21-25 nt long and interact with mRNAs to lead to either translational repression or RNA cleavage through RNA interference. A previous study showed that human immunodeficiency virus 1 (HIV-1) nef dsRNA from AIDS patients who are long-term non-progressors inhibited HIV-1 transcription. In the study reported here, nef-derived miRNAs in HIV-1-infected and nef transduced cells were identified, and showed that HIV-1 transcription was suppressed by nef-expressing miRNA, miR-N367, in human T cells. The miR-N367 could reduce HIV-1 LTR promoter activity through the negative responsive element of the U3 region in the 5'-LTR. Therefore, nef miRNA produced in HIV-1-infected cells may downregulate HIV-1 transcription through both a post-transcriptional pathway and a transcriptional neo-pathway." ]
Modulation of maternal lipid metabolism during normal pregnancy and in gestational diabetes mellitus
The aim of the current study was to test the hypothesis that maternal lipid metabolism was modulated during normal pregnancy and that these modulations are altered in gestational diabetes mellitus (GDM). We tested this hypothesis using an established mouse model of diet-induced obesity with pregnancy-associated loss of glucose tolerance and a novel lipid analysis tool, Lipid Traffic Analysis, that uses the temporal distribution of lipids to identify differences in the control of lipid metabolism through a time course. Our results suggest that the start of pregnancy is associated with several changes in lipid metabolism, including fewer variables associated with de novo lipogenesis and fewer PUFA-containing lipids in the circulation. Several of the changes in lipid metabolism in healthy pregnancies were less apparent or occurred later in dams who developed GDM. Some changes in maternal lipid metabolism in the obese-GDM group were so late as to only occur as the control dams' systems began to switch back towards the non-pregnant state. These results demonstrate that lipid metabolism is modulated in healthy pregnancy and the timing of these changes is altered in GDM pregnancies. These findings raise important questions about how lipid metabolism contributes to changes in metabolism during healthy pregnancies. Furthermore, as alterations in the lipidome are present before the loss of glucose tolerance, they could contribute to the development of GDM mechanistically.
[ "We aimed to assess the relationship among the sex hormone-binding globulin (SHBG), homeostasis model assessment (HOMA), glycosylated hemoglobin (HbA1c), and cholesterol panel values to predict subsequent gestational diabetes mellitus (GDM) in low-risk pregnancies. Thirty-eight pregnant women with GDM and 295 low-risk pregnant women without GDM were included in this study. Maternal blood samples were obtained during the first trimester examination to determine the SHBG, HbA1c, fasting blood glucose, insulin, thyroid stimulating hormone (TSH), free thyroxine, total cholesterol, triglycerides (TG), high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol (LDL-C) levels. The variables that exhibited statistically significant differences between the groups and independent predictors for GDM were examined using logistic regression analysis. The risk of developing GDM, according to cutoff values, was determined using receiver operating characteristic (ROC) curve analysis. The SHBG, HOMA, LDL, and TG levels were found to be the significant independent markers for GDM [adjusted odds ratio (OR) = 0.991; 95% confidence interval (CI), 0.986-995; OR = 1.56; 95% CI, 1.24-1.98; OR = 1.02; 95% CI, 1.01-1.04; and OR = 1.01; 95% CI, 1.00-1.02, respectively]. The HbA1c, body mass index, and mean arterial pressure values were nonindependent predictors of GDM. The areas under the ROC curve used to determine the predictive accuracy of SHBG, HOMA, TG, and LDL-C for development of GDM were 0.73, 0.75, 0.70, and 0.72, respectively. For a false positive rate of 5% for the prediction of GDM, the values of the sensitivities were 21.1, 26.3, 21.1, and 18.4%, respectively. The HOMA, SHBG, TG, and LDL-C levels are independent predictors for subsequent development of GDM in low-risk pregnancies, but they exhibit low sensitivity.", "We examined the associations of gestational diabetes mellitus (GDM) and women's weight status from pre-pregnancy through post-delivery with the risk of developing dysglycaemia [impaired fasting glucose, impaired glucose tolerance, and type 2 diabetes (T2D)] 4-6 years post-delivery. Using Poisson regression with confounder adjustments, we assessed associations of standard categorisations of prospectively ascertained pre-pregnancy overweight and obesity (OWOB), gestational weight gain (GWG) and substantial post-delivery weight retention (PDWR) with post-delivery dysglycaemia (n = 692). Women with GDM had a higher risk of later T2D [relative risk (95% CI) 12.07 (4.55, 32.02)] and dysglycaemia [3.02 (2.19, 4.16)] compared with non-GDM women. Independent of GDM, women with pre-pregnancy OWOB also had a higher risk of post-delivery dysglycaemia. Women with GDM who were OWOB pre-pregnancy and had subsequent PDWR (≥ 5 kg) had 2.38 times (1.29, 4.41) the risk of post-delivery dysglycaemia compared with pre-pregnancy lean GDM women without PDWR. No consistent associations were observed between GWG and later dysglycaemia risk. In conclusion, women with GDM have a higher risk of T2D 4-6 years after the index pregnancy. Pre-pregnancy OWOB and PDWR exacerbate the risk of post-delivery dysglycaemia. Weight management during preconception and post-delivery represent early windows of opportunity for improving long-term health, especially in those with GDM.", "Gestational diabetes mellitus (GDM) is a common pregnancy complication with increased maternal and perinatal morbidity. However, significant long-term morbidity also exists for the mother and offspring. Women with previous GDM have a very high risk of developing overt diabetes, primarily type 2 diabetes, later in life. Moreover, the risk of the metabolic syndrome is increased 3-fold in these women. Their offspring have an 8-fold risk of diabetes/prediabetes at 19-27 years of age. Thus, GDM is part of a vicious circle which increases the development of diabetes in the coming generations.", "Changes in the maternal nutritional environment during fetal development can influence offspring's metabolic risk in later life. Animal models have demonstrated that offspring of diet-induced obese dams develop metabolic complications, including nonalcoholic fatty liver disease. In this study we investigated the mechanisms in young offspring that lead to the development of nonalcoholic fatty liver disease (NAFLD). Female offspring of C57BL/6J dams fed either a control or obesogenic diet were studied at 8 wk of age. We investigated the roles of oxidative stress and lipid metabolism in contributing to fatty liver in offspring. There were no differences in body weight or adiposity at 8 wk of age; however, offspring of obese dams were hyperinsulinemic. Oxidative damage markers were significantly increased in their livers, with reduced levels of the antioxidant enzyme glutathione peroxidase-1. Mitochondrial complex I and II activities were elevated, while levels of mitochondrial cytochrome c were significantly reduced and glutamate dehydrogenase was significantly increased, suggesting mitochondrial dysfunction. Offspring of obese dams also had significantly greater hepatic lipid content, associated with increased levels of PPARγ and reduced triglyceride lipase. Liver glycogen and protein content were concomitantly reduced in offspring of obese dams. In conclusion, offspring of diet-induced obese dams have disrupted liver metabolism and develop NAFLD prior to any differences in body weight or body composition. Oxidative stress may play a mechanistic role in the progression of fatty liver in these offspring." ]
The Canonical Unidirectional Scenario of Sex Chromosome Evolution
Until recently, the field of sex chromosome evolution has been dominated by the canonical unidirectional scenario, first developed by Muller in 1918. This model postulates that sex chromosomes emerge from autosomes by acquiring a sex-determining locus. Recombination reduction then expands outwards from this locus, to maintain its linkage with sexually antagonistic/advantageous alleles, resulting in Y or W degeneration and potentially culminating in their disappearance. Based mostly on empirical vertebrate research, we challenge and expand each conceptual step of this canonical model and present observations by numerous experts in two parts of a theme issue of
[ "Sex-specific chromosomes, like the W of most female birds and the Y of male mammals, usually have lost most genes owing to a lack of recombination. We analyze newly available genomes of 17 bird species representing the avian phylogenetic range, and find that more than half of them do not have as fully degenerated W chromosomes as that of chicken. We show that avian sex chromosomes harbor tremendous diversity among species in their composition of pseudoautosomal regions and degree of Z/W differentiation. Punctuated events of shared or lineage-specific recombination suppression have produced a gradient of \"evolutionary strata\" along the Z chromosome, which initiates from the putative avian sex-determining gene DMRT1 and ends at the pseudoautosomal region. W-linked genes are subject to ongoing functional decay after recombination was suppressed, and the tempo of degeneration slows down in older strata. Overall, we unveil a complex history of avian sex chromosome evolution.", "In contrast to the rather stable regulatory regimes established over more that 100 million years in birds and mammals, sex determination in fish might frequently undergo evolutionary changes bringing the sex-determining cascade under new master sex regulators. This phenomenon, possibly associated with the emergence of new sex chromosomes from autosomes, would explain the frequent switching between sex determination systems observed in fish. In the medaka Oryzias latipes, the Y-specific master sex-determining gene dmrt1bY has been formed through duplication of the autosomal gene dmrt1 onto another autosome, thus generating a new Y chromosome. Dmrt1bY emerged about 10 million years ago and is restricted to several Oryzias species, indicating that the Y chromosome of the medaka is evolutionarily much younger than mammalian and bird sex chromosomes. Fertile males without dmrt1bY have been detected in some medaka populations, and this gene might even have been inactivated in one Oryzias species, indicating the existence of sexual regulators already able to supplant dmrt1bY. Studies on other models have confirmed that fish sex chromosomes are generally young and occurred independently in different fish lineages. The identification of new sex-determining genes in these species will shed new light on the exceptional evolutionary instability governing sex determination in fish.", "Sexual systems are highly diverse and have profound consequences for population dynamics and resilience. Yet, little is known about how they evolved. Using phylogenetic Bayesian modelling and a sample of 4614 species, we show that gonochorism is the likely ancestral condition in teleost fish. While all hermaphroditic forms revert quickly to gonochorism, protogyny and simultaneous hermaphroditism are evolutionarily more stable than protandry. In line with theoretical expectations, simultaneous hermaphroditism does not evolve directly from gonochorism but can evolve slowly from sequential hermaphroditism, particularly protandry. We find support for the predictions from life history theory that protogynous, but not protandrous, species live longer than gonochoristic species and invest the least in male gonad mass. The distribution of teleosts' sexual systems on the tree of life does not seem to reflect just adaptive predictions, suggesting that adaptations alone may not fully explain why some sexual forms evolve in some taxa but not others (Williams' paradox). We propose that future studies should incorporate mating systems, spawning behaviours, and the diversity of sex determining mechanisms. Some of the latter might constrain the evolution of hermaphroditism, while the non-duality of the embryological origin of teleost gonads might explain why protogyny predominates over protandry in teleosts.", "In therian mammals (placentals and marsupials), sex is determined by an XX female: XY male system, in which a gene (SRY) on the Y affects male determination. There is no equivalent in other amniotes, although some taxa (notably birds and snakes) have differentiated sex chromosomes. Birds have a ZW female: ZZ male system with no homology with mammal sex chromosomes, in which dosage of a Z-borne gene (possibly DMRT1) affects male determination. As the most basal mammal group, the egg-laying monotremes are ideal for determining how the therian XY system evolved. The platypus has an extraordinary sex chromosome complex, in which five X and five Y chromosomes pair in a translocation chain of alternating X and Y chromosomes. We used physical mapping to identify genes on the pairing regions between adjacent X and Y chromosomes. Most significantly, comparative mapping shows that, contrary to earlier reports, there is no homology between the platypus and therian X chromosomes. Orthologs of genes in the conserved region of the human X (including SOX3, the gene from which SRY evolved) all map to platypus chromosome 6, which therefore represents the ancestral autosome from which the therian X and Y pair derived. Rather, the platypus X chromosomes have substantial homology with the bird Z chromosome (including DMRT1) and to segments syntenic with this region in the human genome. Thus, platypus sex chromosomes have strong homology with bird, but not to therian sex chromosomes, implying that the therian X and Y chromosomes (and the SRY gene) evolved from an autosomal pair after the divergence of monotremes only 166 million years ago. Therefore, the therian X and Y are more than 145 million years younger than previously thought.", "Triggers and biological processes controlling male or female gonadal differentiation vary in vertebrates, with sex determination (SD) governed by environmental factors or simple to complex genetic mechanisms that evolved repeatedly and independently in various groups. Here, we review sex evolution across major clades of vertebrates with information on SD, sexual development and reproductive modes. We offer an up-to-date review of divergence times, species diversity, genomic resources, genome size, occurrence and nature of polyploids, SD systems, sex chromosomes, SD genes, dosage compensation and sex-biased gene expression. Advances in sequencing technologies now enable us to study the evolution of SD at broader evolutionary scales, and we now hope to pursue a sexomics integrative research initiative across vertebrates. The vertebrate sexome comprises interdisciplinary and integrated information on sexual differentiation, development and reproduction at all biological levels, from genomes, transcriptomes and proteomes, to the organs involved in sexual and sex-specific processes, including gonads, secondary sex organs and those with transcriptional sex-bias. The sexome also includes ontogenetic and behavioural aspects of sexual differentiation, including malfunction and impairment of SD, sexual differentiation and fertility. Starting from data generated by high-throughput approaches, we encourage others to contribute expertise to building understanding of the sexomes of many key vertebrate species. This article is part of the theme issue 'Challenging the paradigm in sex chromosome evolution: empirical and theoretical insights with a focus on vertebrates (Part I)'.", "Degeneration of the nonrecombining chromosome is a common feature of sex chromosome evolution, readily evident by the presence of a pair of largely heteromorphic chromosomes, like in eutherian mammals and birds. However, in ratites (order Palaeognathae, including, e.g., ostrich), the Z and W chromosomes are similar in size and largely undifferentiated, despite avian sex chromosome evolution was initiated > 130 Ma. To better understand what may limit sex chromosome evolution, we performed ostrich transcriptome sequencing and studied genes from the nonrecombining region of the W chromosome. Fourteen gametologous gene pairs present on the W chromosome and Z chromosome were identified, with synonymous sequence divergence of 0.027-0.177. The location of these genes on the Z chromosome was consistent with a sequential increase in divergence, starting 110-157 and ending 24-30 Ma. On the basis of the occurrence of Z-linked genes hemizygous in females, we estimate that about one-third of the Z chromosome does not recombine with the W chromosome in female meiosis. Pairwise d(N)/d(S) between gametologs decreased with age, suggesting strong evolutionary constraint in old gametologs. Lineage-specific d(N)/d(S) was consistently higher in W-linked genes, in accordance with the lower efficacy of selection expected in nonrecombining chromosomes. A higher ratio of GC > AT:AT > GC substitutions in W-linked genes supports a role for GC-biased gene conversion in differentially driving base composition on the two sex chromosomes. A male-to-female (M:F) expression ratio of close to one for recombining genes and close to two for Z-linked genes lacking a W copy show that dosage compensation is essentially absent. Some gametologous genes have retained active expression of the W copy in females (giving a M:F ratio of 1 for the gametologous gene pair), whereas for others W expression has become severely reduced resulting in a M:F ratio of close to 2. These observations resemble the patterns of sex chromosome evolution seen in other avian and mammalian lineages, suggesting similar underlying evolutionary processes, although the rate of sex chromosome differentiation has been atypically low. Lack of dosage compensation may be a factor hindering sex chromosome evolution in this lineage.", "There is increasing evidence for frequent turnover in sex chromosomes in vertebrates. Yet experimental systems suitable for tracing the detailed process of turnover are rare. In theory, homologous turnover is possible if the new sex-determining locus is established on the existing sex-chromosome. However, there is no empirical evidence for such an event. The genus Takifugu includes fugu (Takifugu rubripes) and its two closely-related species whose sex is most likely determined by a SNP at the Amhr2 locus. In these species, males are heterozygous, with G and C alleles at the SNP site, while females are homozygous for the C allele. To determine if a shift in the sex-determining locus occurred in another member of this genus, we used genetic mapping to characterize the sex-chromosome systems of Takifugu niphobles. We found that the G allele of Amhr2 is absent in T. niphobles. Nevertheless, our initial mapping suggests a linkage between the phenotypic sex and the chromosome 19, which harbors the Amhr2 locus. Subsequent high-resolution analysis using a sex-reversed fish demonstrated that the sex-determining locus maps to the proximal end of chromosome 19, far from the Amhr2 locus. Thus, it is likely that homologous turnover involving these species has occurred. The data also showed that there is a male-specific reduction of recombination around the sex-determining locus. Nevertheless, no evidence for sex-chromosome differentiation was detected: the reduced recombination depended on phenotypic sex rather than genotypic sex; no X- or Y-specific maker was obtained; the YY individual was viable. Furthermore, fine-scale mapping narrowed down the new sex-determining locus to the interval corresponding to approximately 300-kb of sequence in the fugu genome. Thus, T. niphobles is determined to have a young and small sex-determining region that is suitable for studying an early phase of sex-chromosome evolution and the mechanisms underlying turnover of sex chromosome." ]
Comparison of the histomorphometric results and efficacy of freeze-dried bone allograft in combination with platelet-rich fibrin and PRF membrane for socket preservation
The aim of the present clinical study was to assess and compare the histomorphometric results and efficacy of freeze-dried bone allograft (FDBA) in combination with platelet-rich fibrin (PRF), and PRF as a sole grafting material for socket preservation. Ninety patients in need of tooth extraction and implant restoration were included in this study. The participants were randomly divided into three groups based on post-extraction clinical protocol: socket preservation procedure with allograft in combination with a PRF membrane (PRFm), PRF as a sole grafting material, and a control group. A total of 90 implants were placed four months post-extraction. During the surgical re-entry a bone biopsy was harvested with a trephine drill. Histological samples were prepared and analyzed for percentage vital bone and connective tissue. One-way ANOVA with Bonferroni post-hoc analysis were used to assess the results. Both test groups revealed a significantly higher percentage of vital bone formation compared to the control group. No statistically significant differences regarding vital bone formation and connective tissue quantity between the tested groups were observed (FDBA + PRFm: 3.29 ± 13.03%; and PRF: 60.79 ± 9.72%). From a clinical and histological point of view, both materials in the test groups are suitable for the filling of post-extraction sockets without bone defects. Both of the tested groups revealed a significantly higher percentage of vital bone formation compared to the control group.
[ "The aim of this study was to compare bone block grafts fixed at a distance (BBG-D) with the SonicWeld Rx shell technique (Poly-D-L-Lactide foil fixed at a distance, augmented with autogenous and deproteinized bovine bone particles (SWST)) for lateral alveolar ridge augmentation. In this single-blinded, randomized, controlled trial, 30 patients with a bucco-palatal bone width of ≤3 mm were randomized into the treatment groups: \"BBG-D\" and \"SWST\". Bone width was measured with cone beam computed tomography (CBCT). One implant was placed at each grafted site. Frequencies of complications, bone gain and bone resorption in the CBCT were assessed as outcomes. Fifteen sites were augmented in each treatment group. One graft (7%) in the BBG-D group and five (33%) in the SWST group were lost (p = 0.17). In the SWST group, two implants (20%) were lost and none in the BBG-D group (p = 0.18). The rate of pooled severe complications (loss of graft and/or implant) was different (p = 0.035). Five (33%) wound dehiscences happened in the SWST group and none in the BBG-D group (p = 0.042). Seven (47%) nonsevere complications (wound dehiscence, inflammation, transient nerve injury) happened in the SWST group and one (7%) in the BBG-D group (p = 0.035). At the one-year evaluation, there were no significant differences in bone loss at the mesial, distal or buccal implant shoulder between treatment groups. Within the limitations of this study, the BBG-D method remains the gold standard for lateral alveolar ridge augmentation compared to the shell technique because of the lower complication rates.", "The objective of this investigation was to examine whether determination of bone density (BD) with a cone beam computed tomography (CBCT) scan could help predict the primary stability (PS) of the implants and to investigate whether associations between the histomorphometric findings and the CBCT scan could be observed. In this randomized clinical study, the efficacy of alveolar ridge preservation (ARP) with a combination of a collagen cone and a collagen membrane procedure after tooth extraction was investigated. CBCT scans were obtained after a healing period of 8 (±1) weeks. Subsequently, the CBCT scans were evaluated in terms of BD at different heights of the former socket. Eleven (±1) weeks after tooth extraction, implant placement was performed and PS was measured with resonance frequency analysis. Potential associations among the radiologically measured BD, the histomorphometric results, and the PS were analyzed. No direct association was observed between the radiologically determined BD and the histomorphometric findings. No significant associations could be found between the BD and the PS. No significant associations were observed among the BD determined by the CBCT, the histomorphometric findings, and the PS.", "The relationship of conventional multi-slice computed tomography (CT)- and cone beam CT (CBCT)-based gray density values and the primary stability parameters of implants that were placed by stereolithographic surgical guides were analyzed in this study. Eighteen edentulous jaws were randomly scanned by a CT (CT group) or a CBCT scanner (CBCT group) and radiographic gray density was measured from the planned implants. A total of 108 implants were placed, and primary stability parameters were measured by insertion torque value (ITV) and resonance frequency analysis (RFA). Radiographic and subjective bone quality classification (BQC) was also classified. Results were analyzed by correlation tests and multiple regressions (p < .05). CBCT-based gray density values (765 ± 97.32 voxel value) outside the implants were significantly higher than those of CT-based values (668.4 ± 110 Hounsfield unit, p < .001). Significant relations were found among the gray density values outside the implants, ITV (adjusted r(2)  = 0.6142, p = .001 and adjusted r(2)  = 0.5166, p = .0021), and RFA (adjusted r(2)  = 0.5642, p = .0017 and adjusted r(2)  = 0.5423, p = .0031 for CT and CBCT groups, respectively). Data from radiographic and subjective BQC were also in agreement. Similar to the gray density values of CT, that of CBCT could also be predictive for the subjective BQC and primary implant stability. Results should be confirmed on different CBCT scanners.", "Gray level is the range of shades of gray in the pixels, representing the x-ray attenuation coefficient that allows for tissue density assessments in computed tomography (CT). An in-vitro study was performed to investigate the relationship between computed gray levels in 3 cone-beam CT (CBCT) scanners and 1 multislice spiral CT device using 5 software programs. Six materials (air, water, wax, acrylic, plaster, and gutta-percha) were scanned with the CBCT and CT scanners, and the computed gray levels for each material at predetermined points were measured with OsiriX Medical Imaging software (Geneva, Switzerland), OnDemand3D (CyberMed International, Seoul, Korea), E-Film (Merge Healthcare, Milwaukee, Wis), Dolphin Imaging (Dolphin Imaging & Management Solutions, Chatsworth, Calif), and InVivo Dental Software (Anatomage, San Jose, Calif). The repeatability of these measurements was calculated with intraclass correlation coefficients, and the gray levels were averaged to represent each material. Repeated analysis of variance tests were used to assess the differences in gray levels among scanners and materials. There were no differences in mean gray levels with the different software programs. There were significant differences in gray levels between scanners for each material evaluated (P <0.001). The software programs were reliable and had no influence on the CT and CBCT gray level measurements. However, the gray levels might have discrepancies when different CT and CBCT scanners are used. Therefore, caution is essential when interpreting or evaluating CBCT images because of the significant differences in gray levels between different CBCT scanners, and between CBCT and CT values.", "The aim of this in vitro study was to evaluate the effect of shape, diameter and length of implants on their primary stability based on resonance frequency analysis. Replace select tapered and Branemark MK III implants were selected. Each of these two selected groups was divided into nine subgroups based on the implant length (IL) (short, medium and long) and the implant diameter (ID) (narrow platform [NP], regular platform [RP] and wide platform [WP]). Five implants were assigned to each of the nine subgroups. Implants were placed in artificial bone blocks with bone quality similar to D3 bone. Immediately after the implant placement, its primary stability was measured using Osstell Mentor equipment. T-test and Tukey's honest significant difference Post hoc were performed for data analysis. Statistical significance was defined at P < 0.05. Replace select system showed significantly higher primary stability compared to the Branemark system, when using the short implants for all three diameters (P ≤ 0.004). However, in medium length implants there were no significant differences between the two implant systems (P ≥ 0.31). In long implants, only when the NP and RP implants were used, the Replace Select system showed significantly higher primary stability compared to the Branemark system (P = 0.000). In the replace select system, long implants had a significantly higher primary stability compared to medium and short length implants (P ≤ 0.003). In the NP and RP Branemark implants, short implants showed significantly lower primary stability compared to medium and long implants (P ≤ 0.002). However, in WP Branemark implants, primary stability increased significantly with increasing the IL from short to medium and from medium to long (P = 0.000). There were also significant differences between NP and the two other wider implants in both systems (P = 0.000). The use of tapered implants is recommended, especially, when the use of short implants is necessary. The use of RP implants is also preferred to WP implants, because thicker bone wall will remain in place when applying RP implants. Furthermore, no significant difference was observed between RP and WP implants.", "Ridge preservation protocols reduce crestal remodeling after tooth extraction. There is insufficient evidence on bone grafting in combination with platelet-rich plasma (PRP) or recombinant human platelet-derived growth factor (rhPDGF-BB). The aim of this study is to evaluate healing of grafted and nongrafted sockets and the effect of PRP and rhPDGF-BB on early remodeling. Forty-one patients whose treatment plan included extraction of anterior or premolar teeth were randomized into four groups. Group 1: collagen plug (control). Group 2: mineralized freeze-dried bone allograft (FDBA)/β-tricalcium phosphate (β-TCP)/collagen plug. Group 3: FDBA/β-TCP/PRP/collagen plug. Group 4: FDBA/β-TCP/rhPDGF-BB/collagen plug. At 8 weeks, a core was harvested from the center of 41 sockets. Histomorphometric analysis took place. Differences were analyzed using one-way analysis of variance (ANOVA) or chi-square tests for continuous and categorical data. Pairwise comparisons were tested using least squares means. Spearman correlation coefficients were used to evaluate the relationship of bone growth with potential confounders. A P value < .05 was considered statistically significant. ANOVA did not indicate statistical significance in age, gender, smoking, ethnicity, or race distribution. Significant differences in tissue distribution were identified between groups and between different thirds of harvested core. More new bone and amorphous organic matrix was noted in the control group. In sites where bone graft was combined with growth factors, the amount of residual particles was less than in sites where bone graft was used alone. Inclusion of bone replacement graft suppressed new bone formation during early healing. Inclusion of PRP and rhPDGF-BB produced less residual bone graft material, indicating more rapid turnover of bone graft. All treatment modalities achieved a significant amount of new vital bone at 8 weeks postextraction." ]
what is adenylate kinase
Adenylate kinase (ADK) is widely distributed in organisms and plays an important role in cellular energy homeostasis. In plants, ADK has important functions in plant growth and development regulation as well as in adaptation to the environment. However, little information is available about the
[ "In the last two years the Pfam database (http://pfam.xfam.org) has undergone a substantial reorganisation to reduce the effort involved in making a release, thereby permitting more frequent releases. Arguably the most significant of these changes is that Pfam is now primarily based on the UniProtKB reference proteomes, with the counts of matched sequences and species reported on the website restricted to this smaller set. Building families on reference proteomes sequences brings greater stability, which decreases the amount of manual curation required to maintain them. It also reduces the number of sequences displayed on the website, whilst still providing access to many important model organisms. Matches to the full UniProtKB database are, however, still available and Pfam annotations for individual UniProtKB sequences can still be retrieved. Some Pfam entries (1.6%) which have no matches to reference proteomes remain; we are working with UniProt to see if sequences from them can be incorporated into reference proteomes. Pfam-B, the automatically-generated supplement to Pfam, has been removed. The current release (Pfam 29.0) includes 16 295 entries and 559 clans. The facility to view the relationship between families within a clan has been improved by the introduction of a new tool.", "Cold temperatures trigger the expression of the CBF family of transcription factors, which in turn activate many downstream genes that confer freezing tolerance to plants. It has been shown previously that the cold regulation of CBF3 involves an upstream bHLH-type transcription factor, ICE1. ICE1 binds to the Myc recognition sequences in the CBF3 promoter. Apart from Myc recognition sequences, CBF promoters also have Myb recognition sequences. We report here that the Arabidopsis MYB15 is involved in cold-regulation of CBF genes and in the development of freezing tolerance. The MYB15 gene transcript is up-regulated by cold stress. The MYB15 protein interacts with ICE1 and binds to Myb recognition sequences in the promoters of CBF genes. Overexpression of MYB15 results in reduced expression of CBF genes whereas its loss-of-function leads to increased expression of CBF genes in the cold. The myb15 mutant plants show increased tolerance to freezing stress whereas its overexpression reduces freezing tolerance. Our results suggest that MYB15 is part of a complex network of transcription factors controlling the expression of CBFs and other genes in response to cold stress.", "The BLAST programs are widely used tools for searching protein and DNA databases for sequence similarities. For protein comparisons, a variety of definitional, algorithmic and statistical refinements described here permits the execution time of the BLAST programs to be decreased substantially while enhancing their sensitivity to weak similarities. A new criterion for triggering the extension of word hits, combined with a new heuristic for generating gapped alignments, yields a gapped BLAST program that runs at approximately three times the speed of the original. In addition, a method is introduced for automatically combining statistically significant alignments produced by BLAST into a position-specific score matrix, and searching the database using this matrix. The resulting Position-Specific Iterated BLAST (PSI-BLAST) program runs at approximately the same speed per iteration as gapped BLAST, but in many cases is much more sensitive to weak but biologically relevant sequence similarities. PSI-BLAST is used to uncover several new and interesting members of the BRCT superfamily.", "The development and maturation of fruits has received considerable scientific scrutiny because of both the uniqueness of such processes to the biology of plants and the importance of fruit as a significant component of the human diet. Molecular and genetic analysis of fruit development, and especially ripening of fleshy fruits, has resulted in significant gains in knowledge over recent years. Great strides have been made in the areas of ethylene biosynthesis and response, cell wall metabolism, and environmental factors, such as light, that impact ripening. Discoveries made in Arabidopsis in terms of general mechanisms for signal transduction, in addition to specific mechanisms of carpel development, have assisted discovery in more traditional models such as tomato. This review attempts to coalesce recent findings in the areas of fruit development and ripening.", "Many plant developmental and stress responses require the coordinated interaction of the jasmonate and other signalling pathways, such as those for ethylene, salicylic acid and abscisic acid. Recent research in Arabidopsis has uncovered several key players that regulate crosstalk between these signalling pathways and that shed light on the molecular mechanisms modulating this coordinated interaction. Genes that are involved in the regulation of protein stability through the ubiquitin-proteasome pathway (COI1, AXR1 and SGT1b), signalling proteins (MPK4) and transcription factors (AtMYC2, ERF1, NPR1 and WRKY70) form a regulatory network that allows the plant to fine-tune specific responses to different stimuli.", "The TomExpress platform was developed to provide the tomato research community with a browser and integrated web tools for public RNA-Seq data visualization and data mining. To avoid major biases that can result from the use of different mapping and statistical processing methods, RNA-Seq raw sequence data available in public databases were mapped de novo on a unique tomato reference genome sequence and post-processed using the same pipeline with accurate parameters. Following the calculation of the number of counts per gene in each RNA-Seq sample, a communal global normalization method was applied to all expression values. This unifies the whole set of expression data and makes them comparable. A database was designed where each expression value is associated with corresponding experimental annotations. Sample details were manually curated to be easily understandable by biologists. To make the data easily searchable, a user-friendly web interface was developed that provides versatile data mining web tools via on-the-fly generation of output graphics, such as expression bar plots, comprehensive in planta representations and heatmaps of hierarchically clustered expression data. In addition, it allows for the identification of co-expressed genes and the visualization of correlation networks of co-regulated gene groups. TomExpress provides one of the most complete free resources of publicly available tomato RNA-Seq data, and allows for the immediate interrogation of transcriptional programs that regulate vegetative and reproductive development in tomato under diverse conditions. The design of the pipeline developed in this project enables easy updating of the database with newly published RNA-Seq data, thereby allowing for continuous enrichment of the resource.", "We report the isolation by differential display of a novel tomato ethylene-responsive cDNA, designated ER5. RT-PCR analysis of ER5 expression revealed an early (15 min) and transient induction by ethylene in tomato fruit, leaves and roots. ER5 mRNA accumulated during 2 h of ethylene treatment and thereafter underwent a dramatic decline leading to undetectable expression after 5 h of treatment. The full-length cDNA clone of 748 bp was obtained and DNA sequence analysis showed strong homologies to members of the atypical hydrophobic group of the LEA protein family. The predicted amino acid sequence shows 67%, 64%, 64%, and 61% sequence identity with the tomato Lemmi9, soybean D95-4, cotton Lea14-A, and resurrection plant pcC27-45 gene products, respectively. As with the other members of this group, ER5 encodes a predominantly hydrophobic protein. Prolonged drought stress stimulates ER5 expression in leaves and roots, while ABA induction of this ethylene-responsive clone is confined to the leaves. The use of 1-MCP, an inhibitor of ethylene action, indicates that the drought induction of ER5 is ethylene-mediated in tomato roots. Finally, wounding stimulates ER5 mRNA accumulation in leaves and roots. Among the Lea gene family this novel clone is the first to display an ethylene-regulated expression." ]
The effect of CD39 and CD73 inhibitors on the expresion of tumour-associated macrophages in mice with colon cancer
This study was designed to investigate the effect of cluster differentiation (CD)39 and CD73 inhibitors on the expresion of tumour-associated macrophages (TAMs), M1- versus M2-tumour phenotypes in mice with colon cancer.
[ "Autoimmune diseases are characterized by an imbalance between regulatory T cells and effector T-cell subsets, such as Th1 and Th17 cells. Studies have confirmed that natural CD4+Foxp3+ Tregs were unstable and dysfunctional in the presence of pro-inflammatory cytokines. In the current study, human CD39hi Tregs and CD39low Tregs were sorted from Tregs in vitro after 7 days of expansion. The functions of both Treg subsets were investigated under inflammatory conditions in vitro and in vivo. In the presence of IL-1β and IL-6, cultured CD4+CD39hi Tregs maintained stable forkhead box protein 3 expression, whereas CD4+CD39low Tregs lost Foxp3 expression and trans-differentiated into Th1 or Th17 cells. Decreased IL-1βR and IL-6R expression on the CD39hi Tregs was the primary mechanism responsible for Treg stability. In addition, reduced activation of downstream molecules, such as STAT1 and STAT3, through the modulation of CpG demethylation played an important role. Finally, human CD4+CD39hi Tregs but not CD4+CD39low Tregs protected against xenograft versus host disease in model mice. These results strongly implied the physiological importance of CD39 expression and suggested that manipulation of CD39hi Tregs might represent a novel strategy for the treatment of autoimmune diseases.", "Regulatory T cells (Tregs) are a subpopulation of CD4(+) T cells that are essential for maintaining the homeostasis of the immune system, limiting self-reactivity and excessive immune responses against foreign antigens. In cancer, infiltrated Tregs inhibit the effector lymphocytes and create a favorable environment for the growth of the tumor. Although Tregs mediate immunosuppression through multiple, non-redundant, cell-contact dependent and independent mechanisms, a growing body of evidence suggests an important role for the CD39-CD73-adenosine pathway. CD39 ectonucleotidase is the rate-limiting enzyme of a cascade leading to the generation of suppressive adenosine that alters CD4 and CD8 T cell and natural killer cell antitumor activities. Here, we review the recent literature supporting CD39 as a promising therapeutic target in oncology. In vitro and in vivo experiments involving knockout models and surrogate inhibitors of CD39 provide evidence in support of the anticancer activity of CD39 inhibition and predict a favorable safety profile for CD39 inhibitory compounds. In addition, we report the ongoing development of CD39-blocking monoclonal antibodies as potential anticancer drugs. Indeed, CD39 antagonistic antibodies could represent novel therapeutic tools for selectively inhibiting Treg function without depletion, a major limitation of current Treg-targeting strategies.", "We explored the mechanism of action of CD39 antibodies that inhibit ectoenzyme CD39 conversion of extracellular ATP (eATP) to AMP and thus potentially augment eATP-P2-mediated proinflammatory responses. Using syngeneic and humanized tumor models, we contrast the potency and mechanism of anti-CD39 mAbs with other agents targeting the adenosinergic pathway. We demonstrate the critical importance of an eATP-P2X7-ASC-NALP3-inflammasome-IL18 pathway in the antitumor activity mediated by CD39 enzyme blockade, rather than simply reducing adenosine as mechanism of action. Efficacy of anti-CD39 activity was underpinned by CD39 and P2X7 coexpression on intratumor myeloid subsets, an early signature of macrophage depletion, and active IL18 release that facilitated the significant expansion of intratumor effector T cells. More importantly, anti-CD39 facilitated infiltration into T cell-poor tumors and rescued anti-PD-1 resistance. Anti-human CD39 enhanced human T-cell proliferation and Th1 cytokine production and suppressed human B-cell lymphoma in the context of autologous Epstein-Barr virus-specific T-cell transfer. SIGNIFICANCE: Overall, these data describe a potent and novel mechanism of action of antibodies that block mouse or human CD39, triggering an eATP-P2X7-inflammasome-IL18 axis that reduces intratumor macrophage number, enhances intratumor T-cell effector function, overcomes anti-PD-1 resistance, and potentially enhances the efficacy of adoptive T-cell transfer.This article is highlighted in the In This Issue feature, p. 1631.", "In many solid tumor types, tumor-associated macrophages (TAMs) are important components of the tumor microenvironment (TME). Moreover, TAMs infiltration is strongly associated with poor survival in solid tumor patients. In this review, we describe the origins of TAMs and their polarization state dictated by the TME. We also specifically focus on the role of TAMs in promoting tumor growth, enhancing cancer cells resistance to chemotherapy and radiotherapy, promoting tumor angiogenesis, inducing tumor migration and invasion and metastasis, activating immunosuppression. In addition, we discuss TAMs can be used as therapeutic targets of solid tumor in clinics. The therapeutic strategies include clearing macrophages and inhibiting the activation of TAMs, promoting macrophage phagocytic activity, limiting monocyte recruitment and other targeted TAMs therapies.", "Chemotaxis, the movement of cells along chemical gradients, is critical for the recruitment of immune cells to sites of inflammation; however, how cells navigate in chemotactic gradients is poorly understood. Here, we show that macrophages navigate in a gradient of the chemoattractant C5a through the release of adenosine triphosphate (ATP) and autocrine \"purinergic feedback loops\" that involve receptors for ATP (P2Y(2)), adenosine diphosphate (ADP) (P2Y(12)), and adenosine (A2a, A2b, and A3). Whereas macrophages from mice deficient in pannexin-1 (which is part of a putative ATP release pathway), P2Y(2), or P2Y(12) exhibited efficient chemotactic navigation, chemotaxis was blocked by apyrase, which degrades ATP and ADP, and by the inhibition of multiple purinergic receptors. Furthermore, apyrase impaired the recruitment of monocytes in a mouse model of C5a-induced peritonitis. In addition, we found that stimulation of P2Y(2), P2Y(12), or adenosine receptors induced the formation of lamellipodial membrane protrusions, causing cell spreading. We propose a model in which autocrine purinergic receptor signaling amplifies and translates chemotactic cues into directional motility.", "Extracellular adenosine triphosphate (ATP) is known to boost immune responses in the tumor microenvironment but might also contribute directly to cancer cell death. CD39/ENTPD1 is the dominant ectonucleotidase expressed by endothelial cells and regulatory T cells and catalyzes the sequential hydrolysis of ATP to AMP that is further degraded to adenosine by CD73/ecto-5'-nucleotidase. We have previously shown that deletion of Cd39 results in decreased growth of transplanted tumors in mice, as a result of both defective angiogenesis and heightened innate immune responses (secondary to loss of adenosinergic immune suppression). Whether alterations in local extracellular ATP and adenosine levels as a result of CD39 bioactivity directly affect tumor growth and cytotoxicity has not been investigated to date. We show here that extracellular ATP exerts antitumor activity by directly inhibiting cell proliferation and promoting cancer cell death. ATP-induced antiproliferative effects and cell death are, in large part, mediated through P2X(7) receptor signaling. Tumors in Cd39 null mice exhibit increased necrosis in association with P2X(7) expression. We further demonstrate that exogenous soluble NTPDase, or CD39 expression by cocultured liver sinusoidal endothelial cells, stimulates tumor cell proliferation and limits cell death triggered by extracellular ATP. Collectively, our findings indicate that local expression of CD39 directly promotes tumor cell growth by scavenging extracellular ATP. Pharmacological or targeted inhibition of CD39 enzymatic activity may find utility as an adjunct therapy in cancer management.", "As the rate-limiting enzyme in ATP/ADP-AMP-adenosine pathway, CD39 would be a novel checkpoint inhibitor target in preventing adenosine-triggered immune-suppressive effect. In addition, CD39hi Tregs, but not CD25hi Tregs, exhibit sustained Foxp3 levels and functional abilities, indicating it could represent a new specific marker of Tregs. Similarly, inhibition of CD39 enzymatic function at the surface of tumor cells alleviates their immunosuppressive activity. Far from conclusive, present research revealed that CD39 also dephosphorylated and thus inactivated self- and pathogen-associated phosphoantigens of Vγ9Vδ2 T cells, which may be the most promising subpopulation for cellular vaccine. CD39 is also tightly related to Th17 cells and can be regarded as a Th17 cells marker. In this review, we focus on present research of CD39 ectoenzyme and provide insights into its clinical application." ]
Oxidative stress in the plasma and erythrocytes of varicose veins
The varicose vein results from the inefficient functioning of the valves in the lower limb veins, making the blood flow slow down and leading to blood stasis and hypoxia. This type of vein dysfunction might be a result of the development of oxidative stress. We compared oxidative stress markers in the plasma and erythrocytes obtained from peripheral veins and varicose veins in the same patients (glutathione, nonenzymatic antioxidant capacity (NEAC), catalase (CAT) and acetylcholinesterase (AChE) activity, thiols, thiobarbituric acid-reactive substance (TBARS), and protein carbonyls). We found a decrease in NEAC in the plasma obtained from the varicose veins compared to the peripheral veins. We detected a decrease in thiols in the plasma, hemolysate, and plasma membranes and increase in protein carbonyl compounds and TBARS levels in the varicose veins. These changes were accompanied by a decrease in CAT and AChE activity. For the first time, our results show changes in the plasma, erythrocyte membrane, and hemolysate protein properties in varicose vein blood in contrast to the plasma and erythrocytes in peripheral vein blood from the same patients. The increased oxidative stress accompanying varicose vein disease might result from the local inefficiency of the antioxidant defense system.
[ "Xanthine oxidase (XO) is a central mechanism of oxidative injury as occurs following ischemia. During the early period of reperfusion, both nitric oxide (NO(*)) and superoxide (O-*(2)) generation are increased leading to the formation of peroxynitrite (ONOO(-)); however, questions remain regarding the presence and nature of the interactions of NO(*) or ONOO(-) with XO and the role of this process in regulating oxidant generation. Therefore, we determined the dose-dependent effects of NO(*) and ONOO(-) on the O-*(2) generation and enzyme activity of XO, respectively, by EPR spin trapping of O-*(2) using 5-(diethoxyphosphoryl)-5-methyl-1-pyrroline-N-oxide and spectrophotometric assay. ONOO(-) markedly inhibited both O-*(2) generation and XO activity in dose-dependent manner, while NO(*) from NO(*) gas in concentrations up to 200 microM had no effect. Furthermore, we observed that NO(*) donors such as NOR-1 also inhibited O-*(2) generation and XO activity; however, these effects were O-*(2)-dependent and blocked by superoxide dismutase or ONOO(-) scavengers. Finally, we found that ONOO(-) totally abolished the Mo(V) EPR spectrum. These changes were irreversible, suggesting oxidative disruption of the critical molybdenum center of the catalytic site. Thus, ONOO(-) formed in biological systems can feedback and down-regulate XO activity and O-*(2) generation, which in turn may serve to limit further ONOO(-) formation.", "Concentrations of up to 1.5 milliunits/ml xanthine oxidase (XO) (1.1 micrograms/ml) are found circulating in plasma during diverse inflammatory events. The saturable, high affinity binding of extracellular XO to vascular endothelium and the effects of cell binding on both XO catalytic activity and differentiated vascular cell function are reported herein. Xanthine oxidase purified from bovine cream bound specifically and with high affinity (Kd = 6 nM) at 4 degreesC to bovine aortic endothelial cells, increasing cell XO specific activity up to 10-fold. Xanthine oxidase-cell binding was not inhibited by serum or albumin and was partially inhibited by the addition of heparin. Pretreatment of endothelial cells with chondroitinase, but not heparinase or heparitinase, diminished endothelial binding by approximately 50%, suggesting association with chondroitin sulfate proteoglycans. Analysis of rates of superoxide production by soluble and cell-bound XO revealed that endothelial binding did not alter the percentage of univalent reduction of oxygen to superoxide. Comparison of the extent of CuZn-SOD inhibition of native and succinoylated cytochrome c reduction by cell-bound XO indicated that XO-dependent superoxide production was occurring in a cell compartment inaccessible to CuZn-SOD. This was further supported by the observation of a shift of exogenously added XO from extracellular binding sites to intracellular compartments, as indicated by both protease-reversible cell binding and immunocytochemical localization studies. Endothelium-bound XO also inhibited nitric oxide-dependent cGMP production by smooth muscle cell co-cultures in an SOD-resistant manner. This data supports the concept that circulating XO can bind to vascular cells, impairing cell function via oxidative mechanisms, and explains how vascular XO activity diminishes vasodilatory responses to acetylcholine in hypercholesterolemic rabbits and atherosclerotic humans. The ubiquity of cell-XO binding and endocytosis as a fundamental mechanism of oxidative tissue injury is also affirmed by the significant extent of XO binding to human vascular endothelial cells, rat lung type 2 alveolar epthelial cells, and fibroblasts.", "Although the aetiology of varicose veins remains unknown, recent studies have focused on endothelial cell integrity and function. Among the regulatory factors of vessel tone, synthesises, pro- and anti-inflammatory, adhesion molecules and the transcription factor hypoxia inducible factor-1 alpha (HIF-1alpha), which are responsible for recruiting leukocytes, are very important. Investigation in this study focused on the expression of ICAM-1, E-selectin and HIF-1alpha on endothelial cells using immunostaining and RT-PCR in varicose vein specimens compared with controls. Findings of this study showed alterations of the intima, such as focal intimal discontinuity and denudation of endothelium in varicose veins. Based on data derived from immunostaining and RT-PCR, no major differences were identified between ICAM-1 and E-selectin expression in varicose vein specimens compared with controls. In contrast, immunostaining results identified HIF-1alpha expression in five (5/20) varicose vein specimens, whereas no control saphenous vein specimens expressed HIF-1alpha. These findings could explain other evidence of hypoxia in varicose veins. Finally, results already obtained in this investigation suggest that the process of pathogenesis of varicose veins is not restricted to the role of adhesion molecules.", "Objective Our objective was to evaluate the state of oxidative stress in the great saphenous varicose vein wall and blood of varicose vein patients taken from the antecubital vein. Methods The superoxide dismutase, reduced glutathione (GSH) and total antioxidant status were measured with commercially available colorimetric kits in erythrocytes, plasma and varicose vein wall of 65 patients (second degree of clinical state classification, etiology, anatomy and pathophysiology) aged 22-70 (49 women, 16 men) in comparison to normal great saphenous vein walls collected from 10 patients who underwent coronary artery bypass graft and blood collected from 20 healthy individuals. Results A statistically significant decrease (p < 0.001) in superoxide dismutase activity in erythrocytes and the increase (p < 0.05) in superoxide dismutase activity in varicose vein has been observed. There have been no significant changes in the concentration of GSH in plasma and in varicose vein. The decreased concentration of total antioxidant status in plasma (p < 0.001) and in varicose vein wall (p < 0.05) in comparison to the control has been noticed. Conclusion The varicose vein patients are affected by oxidative stress. Our results indicate impaired antioxidant defense mechanism in the blood of varicose vein patients. In contrast to the blood, an increased process of antioxidant defense in the varicose vein wall was noticed.", "There is growing evidence that cardiovascular disease is associated with progressive changes in the production of free radicals and radical-derived reactive species. These intermediates react with all major cellular constituents and may serve several physiological and pathophysiological functions. The nitration of protein tyrosine residues has been used as a footprint for in vivo production of radical and nonradical reactive species. Tyrosine nitration may alter protein function and metabolism and therefore, provides for further dysfunctional changes. This review focuses on an appearance of tyrosine nitrated proteins in cardiovascular tissues under different settings of cardiovascular disease. Sources of reactive species, putative mechanisms of protein nitration in vivo, as well as protein nitration under normal physiological conditions, are also described. The goal of this review is to attract more attention to identification of specific proteins, which undergo tyrosine nitration and to study a correlation between their altered function and pathology. Understanding how protein nitration affects disease progression may offer a unique option for design of antioxidant therapy for the treatment of cardiovascular complications. At the same time, protein nitration can be a biological marker of efficiency of antioxidant therapy.", "Much evidence has suggested that the superoxide generated by xanthine oxidase (XOD) within the endothelial cell triggers characteristic free-radical-mediated tissue injuries. Although it has been reported that XOD exists not only in the cytoplasm, but also on the outside surface of the endothelial cell membrane, it is not clear how XOD localizes on the outside of the plasma membrane. Purified human xanthine oxidase (h-XOD) had an affinity for heparin-Sepharose. The binding was largely independent of the pH over the physiological range, whereas it tended to increase at lower pH and to decrease at higher pH. Exposure of h-XOD to the lysine-specific reagent trinitrobenzenesulphonic acid or the arginine-specific reagent phenylglyoxal caused it to lose its affinity for heparin-Sepharose. The binding of h-XOD to heparin is apparently of electrostatic nature, and both lysine and arginine residues are involved in the binding. h-XOD was found to bind to cultured porcine aortic endothelial cells, and this binding was inhibited by the addition of heparin or pretreatment of the cells with heparinase and/or heparitinase. Intravenous injection of heparin into two healthy persons led to a prompt increase in plasma h-XOD concentration. These results suggest that XOD localizes on the outside surface of endothelial cells by association with polysaccharide chains of heparin-like proteoglycans on the endothelial-cell membranes. Superoxide extracellularly generated by XOD may injure the source-endothelial-cell membrane and also attract and activate closely appositional neutrophils, which themselves actually cause progressive oxidative damage.", "A dynamic cycle exists in which haemoglobin is S-nitrosylated in the lung when red blood cells are oxygenated, and the NO group is released during arterial-venous transit. The vasoactivity of S-nitrosohaemoglobin is promoted by the erythrocytic export of S-nitrosothiols. These findings highlight newly discovered allosteric and electronic properties of haemoglobin that appear to be involved in the control of blood pressure and which may facilitate efficient delivery of oxygen to tissues. The role of S-nitrosohaemoglobin in the transduction of NO-related activities may have therapeutic applications.", "Oxygen free radicals generated by xanthine oxidase have been implicated in cardiac damage. The activity of xanthine oxidase/reductase in adult rat heart is considerable. Its assay gives controversial results for other species, for example, rabbits and humans. Therefore, we perfused isolated hearts of various species, including explanted human hearts, to measure the conversion of exogenous hypoxanthine to xanthine and urate. We assayed these purines with high-performance liquid chromatography. The apparent xanthine oxidoreductase activities, calculated as release of xanthine plus 2x urate, were (milliunits per gram wet weight, mean +/- SEM) mice 33 +/- 3 (n = 5), rats 28.5 +/- 1.4 (n = 9), guinea pigs 14.4 +/- 1.0 (n = 5), rabbits 0.59 +/- 0.09 (n = 5), pigs less than 0.1 (n = 6), humans 0.31 +/- 0.04 (n = 7), and cows 3.7 +/- 0.8 (n = 4). In rabbit heart the conversion of hypoxanthine to xanthine was slow, and that of xanthine to urate was even slower. On the other hand, guinea pig and human heart released little xanthine, indicating that xanthine breakdown exceeds its formation. We conclude that isolated perfused mouse, rat, guinea pig, and also bovine hearts show considerable xanthine oxidoreductase activity, contrasting rabbit, porcine, and diseased human hearts.", "The mechanism of xanthine oxidase (XO) inactivation by hydrogen peroxide (H2O2) and its biologic significance are unclear. We found that addition of increasing concentrations of H2O2 progressively decreased xanthine oxidase activity in the presence but not the absence of xanthine in vitro. Inactivation of XO by H2O2 was also enhanced by anaerobic reduction of XO by xanthine. Inactivation of XO by H2O2 was accompanied by production of hydroxyl radical (.OH), measured as formation of formaldehyde from dimethylsulfoxide (DMSO). In contrast, addition of H2O2 to deflavo XO did not produce .OH. Inactivation of XO by H2O2 was decreased by simultaneous addition of the .OH scavenger, DMSO. However, inactivation of XO by H2O2 and formation of .OH were not decreased following addition of the metal chelator. DETAPAC, and/or the O2 scavenger, superoxide dismutase. The results suggest that inactivation of XO by H2O2 occurs by production of .OH following direct reduction of H2O2 by XO at the flavin site.", "Antibodies to xanthine oxidase from bovine milk lipid globules localize the antigen in capillary endothelial cells of many tissues including liver, heart, lung and kidney, but not in other epithelial, endothelial or mesenchymal cell types. The antigen from bovine capillaries was purified by immunoaffinity chromatography and shown by chemical, enzymatic and immunological methods to be indistinguishable from milk xanthine oxidase. Using an ultrasensitive radioimmunoassay, concentrations of this protein were found to be 1 000-10 000-fold higher in capillary endothelial cells than in other cells studied except mammary epithelial cells which were also rich in xanthine oxidase. Similar results were obtained with human cells and tissues. In the cytoplasm of capillary endothelial cells, xanthine oxidase was present as a dehydrogenase which was rapidly converted to the O-2-radical-producing oxidase form after release by cell disrupture. This conversion was partly prevented by addition of thiol reagents. Free xanthine oxidase was not detected in human serum, even from patients with extensive capillary lesions. However, specific-apparently constitutive--antibodies (IgG) were present at high concentrations (1-8% of total IgG) in the sera of all individuals tested. A role of these specific antibodies in the removal of the potentially hazardous oxidase form of xanthine oxidase is discussed." ]
Quad-Orbitrap and Triple Quad-TOF workflows for the analysis of human follicular fluid proteome
We present two separate label-free quantitative workflows based on different high-resolution mass spectrometers and LC setups, which are termed after the utilized instrument: Quad-Orbitrap (nano-LC) and Triple Quad-TOF (micro-LC) and their directed adaptation toward the analysis of human follicular fluid proteome. We identified about 1000 proteins in each distinct workflow using various sample preparation methods. With assistance of the Total Protein Approach, we were able to obtain absolute protein concentrations for each workflow. In a pilot study of twenty samples linked to diverse oocyte quality status from four donors, 455 and 215 proteins were quantified by the Quad-Orbitrap and Triple Quad-TOF workflows, respectively. The concentration values obtained from both workflows correlated to a significant degree. We found reasonable agreement of both workflows in protein fold changes between tested groups, resulting in unified lists of 20 and 22 proteins linked to oocyte maturity and blastocyst development, respectively. The Quad-Orbitrap workflow was best suited for an in-depth analysis without the need of extensive fractionation, especially of low abundant proteome, whereas the Triple Quad-TOF workflow allowed a more robust approach with a greater potential to increase in effectiveness with the growing number of analyzed samples after the initial effort of building a comprehensive spectral library.
[ "Mass spectrometry (MS)-based proteomics measures peptides derived from proteins by proteolytic cleavage. Before performing the analysis by matrix-assisted laser desorption/ionization-tandem mass spectrometry (MALDI-MS/MS), nanoelectrospray-MS/MS (NanoES-MS/MS) or liquid chromatography-MS/MS (LC-MS/MS), the peptide mixtures need to be cleaned, concentrated and often selectively enriched or pre-fractionated, for which we employ simple, self-made and extremely economical stop-and-go-extraction tips (StageTips). StageTips are ordinary pipette tips containing very small disks made of beads with reversed phase, cation-exchange or anion-exchange surfaces embedded in a Teflon mesh. The fixed nature of the beads allows flexible combination of disks with different surfaces to obtain multi-functional tips. Disks containing different surface functionalities and loose beads such as titania and zirconia for phosphopeptide enrichment can be combined. Incorporation into an automated workflow has also been demonstrated. Desalting and concentration takes approximately 5 min while fractionation or enrichment takes approximately 30 min.", "We describe a proteomic approach combining the multi-enzyme digestion FASP-sample processing strategy and the 'Total Protein Approach' applied to absolute quantification of proteins in Escherichia coli. Consecutive digestion of whole cell lysates with LysC and trypsin allowed the generation of two populations of peptides at a yield of 76%. Subsequent two 4-hour LC-MS/MS analyses allowed the identification of 19,000 unique peptides per sample. Notably, only 1.2 and 2.4% of the identified peptides were found to be incompletely cleaved by the LysC and trypsin, respectively. The analysis resulted in the identification of 2200 proteins per sample. We show high reproducibility of the approach, allowing the accurate estimation of cellular protein concentrations. Quantitative analysis of the DNA content per sample enabled the calculation of the protein content per bacterial cell and, as a result, estimation of protein copy numbers. The accuracy of these estimations was confirmed by analyzing protein complexes with known subunit stoichiometry and cellular abundances. In stationary culture, a single bacterium contains about 6500 copies of ribosomes, 300 molecules of RNA polymerase and 10 DNA polymerase assembles. The here presented experimental and computational workflow offers an easy way to analyze proteomes quantitatively. We demonstrate a proteomic workflow for in-depth analysis of small proteomes with minimal fractionation extent and mass spectrometry measuring time. For the first time we provide the quantitative picture of the Escherichia coli proteome at protein copy number.", "The Reactome Knowledgebase (https://reactome.org) provides molecular details of signal transduction, transport, DNA replication, metabolism and other cellular processes as an ordered network of molecular transformations in a single consistent data model, an extended version of a classic metabolic map. Reactome functions both as an archive of biological processes and as a tool for discovering functional relationships in data such as gene expression profiles or somatic mutation catalogs from tumor cells. To extend our ability to annotate human disease processes, we have implemented a new drug class and have used it initially to annotate drugs relevant to cardiovascular disease. Our annotation model depends on external domain experts to identify new areas for annotation and to review new content. New web pages facilitate recruitment of community experts and allow those who have contributed to Reactome to identify their contributions and link them to their ORCID records. To improve visualization of our content, we have implemented a new tool to automatically lay out the components of individual reactions with multiple options for downloading the reaction diagrams and associated data, and a new display of our event hierarchy that will facilitate visual interpretation of pathway analysis results.", "The IUPHAR/BPS Guide to PHARMACOLOGY (GtoPdb, www.guidetopharmacology.org) and its precursor IUPHAR-DB, have captured expert-curated interactions between targets and ligands from selected papers in pharmacology and drug discovery since 2003. This resource continues to be developed in conjunction with the International Union of Basic and Clinical Pharmacology (IUPHAR) and the British Pharmacological Society (BPS). As previously described, our unique model of content selection and quality control is based on 96 target-class subcommittees comprising 512 scientists collaborating with in-house curators. This update describes content expansion, new features and interoperability improvements introduced in the 10 releases since August 2015. Our relationship matrix now describes ∼9000 ligands, ∼15 000 binding constants, ∼6000 papers and ∼1700 human proteins. As an important addition, we also introduce our newly funded project for the Guide to IMMUNOPHARMACOLOGY (GtoImmuPdb, www.guidetoimmunopharmacology.org). This has been 'forked' from the well-established GtoPdb data model and expanded into new types of data related to the immune system and inflammatory processes. This includes new ligands, targets, pathways, cell types and diseases for which we are recruiting new IUPHAR expert committees. Designed as an immunopharmacological gateway, it also has an emphasis on potential therapeutic interventions." ]
Immune Checkpoint Inhibitors in Recurrent Metastatic and Locally Advanced Squamous Cell Carcinoma of the Head and Neck
Recurrent metastatic (RM) and locally advanced (LA) squamous cell carcinoma of the head and neck (SCCHN) are devasting disease states with limited therapeutic options and poor overall survival. Targeting the epidermal growth factor receptor (EGFR) is one area that has helped improve outcomes in this disease. Anti-EGFR based therapies have been shown to improve overall survival and mitigate the significant toxicities incurred from standard radiation, chemotherapy, and/or surgical options. Cetuximab, the most well-studied anti-EGFR monoclonal antibody, has demonstrated a positive impact on outcomes for RM and LA SCCHN. However, the development of early resistance to cetuximab highlights the need for a wider arsenal of therapy for RM and LA diseases. The use of immune checkpoint inhibitors has recently transformed the treatment of recurrent SCCHN. Drugs such as pembrolizumab and nivolumab have demonstrated success in recent clinical trials and have been approved for the treatment of advanced disease. Given the positive results of both EGFR targeted agents and immune checkpoint inhibitors, ongoing trials are studying their synergistic effects.
[ "Squamous cell carcinoma of the head and neck is characterized by an immunosuppressive environment and evades immune responses through multiple resistance mechanisms. A breakthrough in cancer immunotherapy employing immune checkpoint inhibitors has evolved into a number of clinical trials with antibodies against programmed cell death 1 (PD-1), its ligand PD-L1 and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) for patients with squamous cell carcinoma of the head and neck. CheckMate141 and KEYNOTE-048 were practice-changing randomized phase 3 trials for patients with platinum-refractory and platinum-sensitive recurrent or metastatic squamous cell carcinoma of the head and neck, respectively. Furthermore, many combination therapies using anti-CTLA-4 inhibitors, tyrosine kinase inhibitors and immune accelerators are currently under investigation. Thus, the treatment strategy of recurrent or metastatic squamous cell carcinoma of the head and neck is becoming more heterogeneous and complicated in the new era of individualized medicine. Ongoing trials are investigating immunotherapeutic approaches in the curative setting for locoregionally advanced disease. This review article summarizes knowledge of the role of the immune system in the development and progression of squamous cell carcinoma of the head and neck, and provides a comprehensive overview on the development of immunotherapeutic approaches in both recurrent/metastatic and locoregionally advanced diseases.", "Enhanced phosphoinositide 3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway is one of the key adaptive changes accounting for epidermal growth factor receptor (EGFR) inhibitor-resistant growth in head and neck squamous cell carcinoma (HNSCC). We designed a phase II clinical trial of EGFR tyrosine kinase inhibitor (TKI), erlotinib, in association with the mTOR inhibitor, everolimus, based on the hypothesis that the downstream effects of Akt through inhibition of mTOR may enhance the effectiveness of the EGFR-TKI in patients with recurrent/metastatic HNSCC. Patients with histologically or cytologically confirmed platinum-resistant HNSCC received everolimus 5 mg and erlotinib 150 mg daily orally until disease progression, intolerable toxicity, investigator or patient decision. Cytokines and angiogenic factors profile, limited mutation analysis and p16 immunohistochemistry status were included in the biomarker analysis. Of the 35 assessable patients, 3 (8%) achieved partial response at 4 weeks, 1 confirmed at 12 weeks; overall response rate at 12 weeks was 2.8%. Twenty-seven (77%) patients achieved disease stabilization at 4 weeks, 11 (31%) confirmed at 12 weeks. Twelve-week progression-free survival (PFS) was 49%, median PFS 11.9 weeks and median overall survival (OS) 10.25 months. High neutrophil gelatinase lipocalin (P = 0.01) and vascular endothelial growth factor (VEGF) (P = 0.04) plasma levels were significantly associated with worse OS. The combination of erlotinib and everolimus did not show significant benefit in unselected patients with platinum-resistant metastatic HNSCC despite a manageable toxicity profile. Markers of tumor invasion and hypoxia identify a group of patients with particularly poor prognosis. NCT00942734.", "As epidermal growth factor receptor (EGFR) is overexpressed in approximately 90% of squamous cell carcinomas of the head and neck (SCCHN), several therapeutic agents that target EGFR have been evaluated for the treatment of SCCHN. Although patients with SCCHN derive clinical benefit from anti-EGFR agents, most notably the EGFR monoclonal antibody cetuximab, these patients eventually become resistant to EGFR-based therapies; preclinical studies have shown activation of secondary signaling pathways that lead to resistance to EGFR inhibition and, as such, serve as potential therapeutic targets to overcome resistance to EGFR inhibitors. This review summarizes the results of recently completed trials of anti-EGFR agents in SCCHN, highlights the various mechanisms that drive resistance to EGFR inhibitors in SCCHN, and focuses on several novel targeted agents that could potentially help overcome resistance to EGFR-based therapies in SCCHN. Expert commentary: Due to the development of resistance to EGFR-targeted therapies, novel treatment approaches to overcome resistance are a key unmet need for SCCHN.", "EGFR gene mutations and increased EGFR copy number have been associated with favorable response to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (EGFR-TKI) in patients with non-small-cell lung cancer (NSCLC). In contrast, KRAS mutation has been shown to predict poor response to such therapy. We tested the utility of combinations of these three markers in predicting response and survival in patients with NSCLC treated with EGFR-TKIs. Patients with advanced NSCLC treated with EGFR-TKI with available archival tissue specimens were included. EGFR and KRAS mutations were analyzed using PCR-based sequencing. EGFR copy number was analyzed using fluorescence in situ hybridization. The study included 73 patients, 59 of whom had all three potential markers successfully analyzed. EGFR mutation was detected in 7 of 71 patients (9.8%), increased EGFR copy number in 32 of 59 (54.2%), and KRAS mutation in 16 of 70 (22.8%). EGFR mutation (P<0.0001) but not increased EGFR copy number (P=0.48) correlated with favorable response. No survival benefit was detected in patients with either of these features. KRAS mutation correlated with progressive disease (P=0.04) and shorter median time to progression (P=0.0025) but not with survival. Patients with both EGFR mutation and increased EGFR copy number had a >99.7% chance of objective response, whereas patients with KRAS mutation with or without increased EGFR copy number had a >96.5% chance of disease progression. KRAS mutation should be included as indicator of resistance in the panel of markers used to predict response to EGFR-TKIs in NSCLC.", "Despite the development of standard therapies, including surgery, radiotherapy and chemotherapy, survival rates for head and neck squamous cell carcinoma (HNSCC) have not changed significantly over the past three decades. Complete recovery is achieved in <50% of patients. The treatment of advanced HNSCC frequently requires multimodality therapy and involves significant toxicity. The promising, novel treatment option for patients with HNSCC is molecular-targeted therapies. The best known targeted therapies include: Epidermal growth factor receptor (EGFR) monoclonal antibodies (cetuximab, panitumumab, zalutumumab and nimotuzumab), EGFR tyrosine kinase inhibitors (gefitinib, erlotinib, lapatinib, afatinib and dacomitinib), vascular endothelial growth factor (VEGF) inhibitor (bevacizumab) or vascular endothelial growth factor receptor (VEGFR) inhibitors (sorafenib, sunitinib and vandetanib) and inhibitors of phosphatidylinositol 3-kinase/serine/threonine-specific protein kinase/mammalian target of rapamycin. There are also various inhibitors of other pathways and targets, which are promising and require evaluation in further studies.", "Second-line treatment options for advanced head and neck squamous cell carcinoma (HNSCC) are limited. The phase Ib KEYNOTE-012 study evaluated the safety and the efficacy of pembrolizumab for the treatment of HNSCC after long-term follow-up. Multi-centre, non-randomised trial included two HNSCC cohorts (initial and expansion) in which 192 patients were eligible. Patients received pembrolizumab 10 mg/kg every 2 weeks (initial cohort; N = 60) or 200 mg every 3 weeks (expansion cohort; N = 132). Co-primary endpoints were safety and overall response rate (ORR; RECIST v1.1; central imaging vendor review). Median follow-up was 9 months (range, 0.2-32). Treatment-related adverse events (AEs) of any grade and grade 3/4 occurred in 123 (64%) and 24 (13%) patients, respectively. No deaths were attributed to treatment-related AEs. ORR was 18% (34/192; 95% CI, 13-24%). Median response duration was not reached (range, 2+ to 30+ months); 85% of responses lasted ≥6 months. Overall survival at 12 months was 38%. Some patients received 2 years of treatment and the responses were ongoing for more than 30 months; the durable anti-tumour activity and tolerable safety profile, observed with long-term follow-up, support the use of pembrolizumab as a treatment for recurrent/metastatic HNSCC.", "The epidermal growth factor receptor inhibitor erlotinib is an approved treatment for chemotherapy-refractory advanced non-small-cell lung cancer (NSCLC). Because activated epidermal growth factor receptor signals through the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (mTOR) pathway, adding the oral mTOR inhibitor everolimus to erlotinib may improve efficacy by blocking multiple components of the same pathway. We conducted a phase I study to determine feasible dosages of combination therapy with erlotinib and everolimus for previously treated metastatic or unresectable NSCLC. Participants had advanced NSCLC progressing after two or less previous chemotherapy regimens. Feasibility of daily/weekly everolimus plus daily erlotinib was determined using a 6 + 6 dose-escalation design based on the rate of dose-limiting toxicities. Antitumor activity was assessed by the Response Evaluation Criteria In Solid Tumors study. Of the 94 patients enrolled, 90% had stage IV NSCLC, 19% never smoked, and 15% were current smokers. Eighty-nine patients experienced one or more adverse events possibly related to any study medication. The most common dose-limiting toxicities were stomatitis (n = 5), rash (n = 4), and diarrhea (n = 3). Maximum tolerated doses were everolimus 5 mg per day or 50 mg per week plus erlotinib 150 mg per day. In daily everolimus cohorts (n = 74), nine patients achieved a complete/partial response and 28 had stable disease (median duration disease control, 9.3 months). In weekly everolimus cohorts (n = 20), no tumor response was observed; seven patients had stable disease (median duration, 9.6 months). Combination therapy with everolimus 5 mg per day or 50 mg per week and erlotinib 150 mg per day provided acceptable tolerability and disease control. A randomized phase II study evaluating this combination in comparison with erlotinib alone is complete and is being analyzed." ]
Patellofemoral instability in the pediatric and adolescent patient.
Patellofemoral instability (PFI) encompasses symptomatic patellar instability, patella subluxations, and frank dislocations. Previous studies have estimated the incidence of acute patellar dislocation at 43 per 100,000 children younger than age 16 years. The medial patellofemoral ligament (MPFL) complex is a static soft tissue constraint that stabilizes the patellofemoral joint serving as a checkrein to prevent lateral displacement. The causes of PFI are multifactorial and not attributed solely to anatomic features within the knee joint proper. Specific anatomic features to consider include patella alta, increased tibial tubercle-trochlear groove distance, genu valgum, external tibial torsion, femoral anteversion, and ligamentous laxity. The purpose of this paper is to provide a review of the evaluation of PFI in the pediatric and adolescent patient with a specific focus on the contributions of coronal and transverse plane deformities. Moreover, a framework will be provided for the incorporation of bony procedures to address these issues.
[ "First-time lateral patellar dislocations have historically been treated with a nonoperative approach; a clinical tool to predict patients who are most likely to redislocate may have clinical utility. (1) To determine if there are discriminating factors present between patients who redislocated their patellas and those who did not after a first-time lateral patellar dislocation and (2) to use this information to develop a model that can predict the recurrence risk of lateral patellar dislocation in this population. Case-control study; Level of evidence, 3. The study population included those with first-time lateral patellar dislocation, magnetic resonance imaging within 6 weeks, and 2-year minimum follow-up. Cohort A was from a prospective study with 2-year follow-up. Cohort B was a prospectively identified cohort with retrospective chart review. Follow-up was obtained clinically or via mail for patients without 2-year clinical follow-up. Sixty-one patients (42%) out of 145 with primary lateral patellar dislocation had recurrent dislocation within 2 years. Stepwise logistic regression analysis demonstrated that skeletal immaturity (odds ratio, 4.05; 95% CI, 1.86-8.82; P = .0004), sulcus angle (odds ratio, 4.87; 95% CI, 2.01-11.80; P = .0005), and Insall-Salvati ratio (odds ratio, 3.0; 95% CI, 1.34-6.70; P = .0074) were significant predictors of redislocation. Receiver operator characteristic curves defined the cut points to be sulcus angle ≥154° and Insall-Salvati ratio ≥1.3. The probability of redislocation based on the presence of factors was 5.8% with no factors present and 22.7% with any 1 factor present, increasing to 78.5% if all 3 factors were present. This model demonstrates a high risk of lateral patellar redislocation when a patient presents with skeletal immaturity as well as magnetic resonance measurements of sulcus angle ≥154° and patellar height as measured by Insall-Salvati ratio ≥1.3. A patient will have a low risk of lateral patellar redislocation with the inverse findings.", "A medial patellofemoral ligament reconstruction (MPFL) with an additional derotational femoral osteotomy is suggested for patients suffering from patellar instability and an increased internal femoral torsion (IT). This biomechanical study investigated whether an isolated MPFL reconstruction could restore patellofemoral biomechanics for 10° and 20° relatively increased internal femoral torsion. Eight fresh-frozen cadaver knees were tested on a specially designed knee simulator, which bend the knee from 0° to 90° flexion. Patellar motion (tilt and shift) and patellofemoral pressure (pressure shift, mean and peak pressure) were evaluated for 0°, 10° and 20° of IT with a native and reconstructed MPFL. An isolated MPFL reconstruction, compared to a native MPFL with the same femoral torsion showed a significant medial shift of the center of force (10° IT p < 0.001; 20° IT p = 0.02) and patella shift (10° and 20° IT p < 0.001) but no significant change in patella tilt (10° IT n.s.; 20° IT n.s.) for 10° and 20° IT. There was a significant medial shift in the center of force for 10° IT (10° IT p = 0.04) and a non-significant lateral shift for 20° IT (20° IT n.s.) in comparison to the native MPFL with 0° of femoral torsion. Patella shift was directed medially for 10° IT (10° IT p = 0.002). In knee flexion angles up to 30°, the patella remained more lateral for 20° IT and showed a different motion pattern (20° IT n.s.). Patella tilt showed a significant lateral tilt for 10° and 20° IT (10° IT p = 0.01; 20° IT p = 0.002). MPFL reconstruction as an isolated therapy only appears to be reasonable for 10° increased IT. While for an increased IT of 20°, a lateralizing force vector remains and an additional femoral derotational osteotomy is recommendable. These findings may assist surgeons in the decision making of surgical procedures in patients suffering from patella instability.", "Compared with skeletally mature patients, skeletally immature patients are at a higher risk of acute traumatic patellar dislocation. Surgical treatment is the standard of care for patients with recurrent instability and requires important and technically challenging physeal considerations. Physeal-sparing medial patellofemoral ligament reconstruction is the treatment of choice for these patients, replacing older nonanatomic extensor mechanism realignment techniques. Implant-mediated guided growth is an important adjunct to correct genu valgum angular deformities that contribute to patellar instability. Patient-specific surgical techniques and proper surgical indications are crucial for successful outcomes.", "Corrective osteotomies are often planned and performed on the basis of normal anatomical proportions. We have evaluated the length and torsion of the segments of the lower limb in normal individuals, to analyse the differences between left and right sides, and to provide tolerance figures for both length and torsion. We used CT on 355 adult patients and measured length and torsion by the Ulm method. We excluded all patients with evidence of trauma, infection, tumour or any congenital disorder. The mean length of 511 femora was 46.3 +/- 6.4 cm (+/-2SD) and of 513 tibiae 36.9 +/- 5.6 cm; the mean total length of 378 lower limbs was 83.2 +/- 11.4 cm with a tibiofemoral ratio of 1 to 1.26 +/- 0.1. The 99th percentile level for length difference in 178 paired femora was 1.2 cm, in 171 paired tibiae 1.0 cm and in 60 paired lower limbs 1.4 cm. In 505 femora the mean internal torsion was 24.1 +/- 17.4 degrees, and in 504 tibiae the mean external torsion was 34.9 +/- 15.9 degrees. For 352 lower limbs the mean external torsion was 9.8 +/- 11.4 degrees. The mean torsion angle of right and left femora in individuals did not differ significantly, but mean tibial torsion showed a significant difference between right (36.46 degrees of external torsion) and left sides (33.07 degrees of external torsion). For the whole legs torsion on the left was 7.5 +/- 18.2 degrees and 11.8 +/- 18.8 degrees, respectively (p < 0.001). There was a trend to greater internal torsion in femora in association with an increased external torsion in tibiae, but we found no correlation. The 99th percentile value for the difference in 172 paired femora was 13 degrees; in 176 pairs of tibiae it was 14.3 degrees and for 60 paired lower limbs 15.6 degrees. These results will help to plan corrective osteotomies in the lower limbs, and we have re-evaluated the mathematical limits of differences in length and torsion.", "Anterior knee pain is one of the more frustrating problems that orthopaedic surgeons treat. This study investigates the results of surgical correction of miserable malalignment syndrome associated with significant patellofemoral pain. The authors identified and retrospectively reviewed 14 consecutive patients with 27 limbs associated with excessive femoral anteversion, excessive tibial outward rotation, and patellofemoral pain. All of the patients were initially reviewed by the senior author and subsequently treated by ipsilateral outward femoral osteotomy and inward tibial osteotomy. All of the patients had failed nonoperative treatment. No persistent complications were seen. Subjectively and clinically, all of the patients were reviewed at an average of 5.2 (range 2.0-12) years after surgery. All of the patients reported full satisfaction with their surgery and outcomes. Most of the current literature discusses alignment in association with patellofemoral pain in the form of the extensor mechanism alignment. When evaluating patients with patellofemoral pain, it is imperative to assess the rotational profiles of the femur and tibia. The authors recommend that rotational osteotomies be performed in patients with patellofemoral pain and associated excessive femoral and tibial torsion, otherwise known as miserable malalignment syndrome.", "Skeletal geometry, soft tissues, and neuromuscular control influence the patellofemoral gliding mechanism. Abnormal skeletal geometry - such as increased femoral anteversion, trochlear dysplasia, patella alta, increased tibial external torsion, increased tibial tubercle lateralization, and variations of combined deformities - may lead to patellofemoral complaints. Altered vectors and forces acting on the patellofemoral joint can cause cartilage failure with later arthrosis, instability, and musculotendinous insufficiency. Osteotomy with soft tissue repair might be the best treatment, depending on the primary pathology. Surgery aims to eliminate the underlying pathomorphology.", "Clinical assessment of femoral anteversion (FA) in children with cerebral palsy (CP) is frequently determined by the trochanteric prominence angle test (TPAT). Limited three-dimensional volumetric imaging by axial tomography of the femur was performed before surgery for 35 hips in 20 children with CP. The TPAT was performed before the imaging study for 31 hips in 18 children. The TPAT angle was within 10 degrees of the FA as determined from the computed tomography scans (Murphy technique) for 17 femurs (55%). The most prominent portion of the greater trochanter was located anterior to the femoral neck axis (mean 27 degrees, range 0 degrees-52 degrees) on the three-dimensional images in 34 of 35 hips. A simulated TPAT, measured from the imaging studies, consistently underestimated the FA as determined by the Murphy technique (mean 10 degrees, range 0 degrees-18 degrees). Accurate clinical assessment of FA by the TPAT in children with CP presumes that the prominence of the greater trochanter lies perpendicular to the axis of the femoral neck. Three-dimensional imaging showed the prominence to be anterior, to a variable degree, to the femoral neck axis, which in addition to clinical factors such as obesity compromises the accuracy of this clinical maneuver." ]
Heterologous expression of porcine NK-lysine in the small intestine
Porcine NK-Lysine (PNKL) is a new antimicrobial peptide (AMP) identified in the small intestine. In this study, PNKL protein was obtained through heterologous expression in
[ "Caspase-2, the second mammalian caspase to be identified and the most evolutionarily conserved caspase, has eluded classification. The lack of a profound phenotype in the caspase-2-deficient mouse resulted in decreased interest in caspase-2 for many years. However, advances in the field, including the identification of a potential activation complex and the development of methods to detect active caspase-2, now illuminate our understanding of the function of this caspase. These studies suggest that caspase-2 induces death through two pathways. First, caspase-2 induces cell death independently of the mitochondrial pathway, in a manner similar to that of ced-3, a caspase in Caenorhabditis elegans. Second, caspase-2 also induces cell death upstream of the mitochondrial pathway. The choice of pathway may depend on the type of death stimulus. The placing of caspase-2 upstream and independent of mitochondrial dysfunction provides a potentially new therapeutic target for aberrant cell death.", "Caspases belong to a diverse clan of proteolytic enzymes known as clan CD with highly disparate functions in cell signaling. The caspase members of this clan are only found in animals, and most of them orchestrate the demise of cells by the highly distinct regulated cell death phenotypes known as apoptosis and pyroptosis. This review looks at the mechanistic distinctions between the activity and activation mechanisms of mammalian caspases compared to other members of clan CD. We also compare and contrast the role of different caspase family members that program anti-inflammatory and pro-inflammatory cell death pathways.", "Clan CD forms a structural group of cysteine peptidases, containing seven individual families and two subfamilies of structurally related enzymes. Historically, it is most notable for containing the mammalian caspases, on which the structures of the clan were founded. Interestingly, the caspase family is split into two subfamilies: the caspases, and a second subfamily containing both the paracaspases and the metacaspases. Structural data are now available for both the paracaspases and the metacaspases, allowing a comprehensive structural analysis of the entire caspase family. In addition, a relative plethora of structural data has recently become available for many of the other families in the clan, allowing both the structures and the structure-function relationships of clan CD to be fully explored. The present review compares the enzymes in the caspase subfamilies with each other, together with a comprehensive comparison of all the structural families in clan CD. This reveals a diverse group of structures with highly conserved structural elements that provide the peptidases with a variety of substrate specificities and activation mechanisms. It also reveals conserved structural elements involved in substrate binding, and potential autoinhibitory functions, throughout the clan, and confirms that the metacaspases are structurally diverse from the caspases (and paracaspases), suggesting that they should form a distinct family of clan CD peptidases.", "NK-lysin is an effector protein of cytotoxic T lymphocytes and natural killer cells. Mammalian NK-lysin is known to possess antibacterial property and antitumor activity. Homologues of NK-lysin have been identified in several teleost species, but the natural function of fish NK-lysin remains essentially unknown. In this study, we identified a NK-lysin, CsNKL1, from half-smooth tongue sole (Cynoglossus semilaevis) and analyzed its expression, genetic organization, and biological effect on pathogen infection. CsNKL1 is composed of 135 residues and shares 33.1-56.5% overall sequence identities with other teleost NK-lysin. CsNKL1 possesses a Saposin B domain and six conserved cysteine residues that in mammals are known to form three intrachain disulfide bonds essential to antimicrobial activity. The genomic sequence of the ORF region of CsNKL1 is 1240bp in length and, like human NK-lysin, contains five exons and four introns. Expression of CsNKL1 occurred in multiple tissues and was upregulated by bacterial and viral infection in a time dependent manner. When CsNKL1 was overexpressed in tongue sole, significant upregulation of interleukin-1 and chemokines was observed in spleen and head kidney. Following bacterial and viral infection, the pathogen loads in the tissues of CsNKL1-overexpressing fish were significantly lower than those in control fish. These results indicate that CsNKL1 possesses the novel capacities of immunomodulation and enhancing antimicrobial defense against pathogens of both bacterial and viral nature.", "Antimicrobial host defense peptides are produced by all complex organisms as well as some microbes and have diverse and complex antimicrobial activities. Collectively these peptides demonstrate a broad range of antiviral and antibacterial activities and modes of action, and it is important to distinguish between direct microbicidal and indirect activities against such pathogens. The structural requirements of peptides for antiviral and antibacterial activities are evaluated in light of the diverse set of primary and secondary structures described for host defense peptides. Peptides with antifungal and antiparasitic activities are discussed in less detail, although the broad-spectrum activities of such peptides indicate that they are important host defense molecules. Knowledge regarding the relationship between peptide structure and function as well as their mechanism of action is being applied in the design of antimicrobial peptide variants as potential novel therapeutic agents.", "Caspase-14 is a unique member of the evolutionarily conserved family of cysteinyl aspartate-specific proteinases, which are mainly involved in inflammation and apoptosis. However, recent evidence also implicates these proteases in proliferation and differentiation. Although most caspases are ubiquitously expressed, caspase-14 expression is confined mainly to cornifying epithelia, such as the skin. Moreover, caspase-14 activation correlates with cornification, indicating that it plays a role in terminal keratinocyte differentiation. The determination of in vitro conditions for caspase-14 activity paved the way to identifying its substrates. The recent development of caspase-14-deficient mice underscored its importance in the correct degradation of (pro)filaggrin and in the formation of the epidermal barrier that protects against dehydration and UVB radiation. Here, we review the current knowledge on caspase-14 in skin homeostasis and disease.", "The Drosophila Apaf-1 related killer (Dark) forms an apoptosome that activates Dronc, an apical procaspase in the intrinsic cell death pathway. To study this process, we assembled a large Dark complex in the presence of dATP. Remarkably, we found that cytochrome c was not required for assembly and when added, cytochrome c did not bind to the Dark complex. We then determined a 3D structure of the Dark complex at 18.8A resolution using electron cryo-microscopy and single particle methods. In the structure, eight Dark subunits form a wheel-like particle and two of these rings associate face-to-face. In contrast, Apaf-1 forms a single ring that is comprised of seven subunits and each Apaf-1 binds a molecule of cytochrome c. We then used relevant crystal structures to model the Dark complex. This analysis shows that a single Dark ring and the Apaf-1 apoptosome share many key features. When taken together, the data suggest that a single ring in the Dark complex may represent the Drosophila apoptosome. Thus, our analysis provides a domain model of this complex and gives insights into its function." ]
Vascular tissue engineering in regenerative medicine
Vascularization is among the top challenges that impede the clinical application of engineered tissues. This challenge has spurred tremendous research endeavor, defined as vascular tissue engineering (VTE) in this article, to establish a pre-existing vascular network inside the tissue engineered graft prior to implantation. Ideally, the engineered vasculature can be integrated into the host vasculature via anastomosis to supply nutrient to all cells instantaneously after surgery. Moreover, sufficient vascularization is of great significance in regenerative medicine from many other perspectives. Due to the critical role of vascularization in successful tissue engineering, we aim to provide an up-to-date overview of the fundamentals and VTE strategies in this article, including angiogenic cells, biomaterial/bio-scaffold design and bio-fabrication approaches, along with the reported utility of vascularized tissue complex in regenerative medicine. We will also share our opinion on the future perspective of this field.
[ "Endothelial progenitor cells (EPCs) have potential for promoting vascular repair and revascularization of ischemic retina. However, the highly heterogeneous nature of these cells causes confusion when assessing their biological functions. The purpose of this study was to provide a comprehensive comparison between the two main EPC subtypes, early EPCs (eEPCs) and outgrowth endothelial cells (OECs), and to establish the potential of OECs as a novel cell therapy for ischemic retinopathy. Two types of human blood-derived EPCs were isolated and compared using immunophenotyping and multiple in vitro functional assays to assess interaction with retinal capillary endothelial cells and angiogenic activity. OECs were delivered intravitreally in a mouse model of ischemic retinopathy, and flat mounted retinas were examined using confocal microscopy. These data indicate that eEPCs are hematopoietic cells with minimal proliferative capacity that lack tube-forming capacity. By contrast, OECs are committed to an endothelial lineage and have significant proliferative and de novo tubulogenic potential. Furthermore, only OECs are able to closely interact with endothelial cells through adherens and tight junctions and to integrate into retinal vascular networks in vitro. The authors subsequently chose OECs to test a novel cell therapy approach for ischemic retinopathy. Using a murine model of retinal ischemia, they demonstrated that OECs directly incorporate into the resident vasculature, significantly decreasing avascular areas, concomitantly increasing normovascular areas, and preventing pathologic preretinal neovascularization. As a distinct EPC population, OECs have potential as therapeutic cells to vascularize the ischemic retina.", "Self-assembled microvasculature from cocultures of endothelial cells (ECs) and stromal cells has significantly advanced efforts to vascularize engineered tissues by enhancing perfusion rates in vivo and producing investigative platforms for microvascular morphogenesis in vitro. However, to clinically translate prevascularized constructs, the issue of EC source must be resolved. Endothelial progenitor cells (EPCs) can be noninvasively supplied from the recipient through adult peripheral and umbilical cord blood, as well as derived from induced pluripotent stem cells, alleviating antigenicity issues. EPCs can also differentiate into all tissue endothelium, and have demonstrated potential for therapeutic vascularization. Yet, EPCs are not the standard EC choice to vascularize tissue constructs in vitro. Possible reasons include unresolved issues with EPC identity and characterization, as well as uncertainty in the selection of coculture, scaffold, and culture media combinations that promote EPC microvessel formation. This review addresses these issues through a summary of EPC vascular biology and the effects of tissue engineering design parameters upon EPC microvessel formation. Also included are perspectives to integrate EPCs with emerging technologies to produce functional, organotypic vascularized tissues.", "Blood vessel growth in the skeletal system and osteogenesis seem to be coupled, suggesting the existence of molecular crosstalk between endothelial and osteoblastic cells. Understanding the nature of the mechanisms linking angiogenesis and bone formation should be of great relevance for improved fracture healing or prevention of bone mass loss. Here we show that vascular growth in bone involves a specialized, tissue-specific form of angiogenesis. Notch signalling promotes endothelial cell proliferation and vessel growth in postnatal long bone, which is the opposite of the well-established function of Notch and its ligand Dll4 in the endothelium of other organs and tumours. Endothelial-cell-specific and inducible genetic disruption of Notch signalling in mice not only impaired bone vessel morphology and growth, but also led to reduced osteogenesis, shortening of long bones, chondrocyte defects, loss of trabeculae and decreased bone mass. On the basis of a series of genetic experiments, we conclude that skeletal defects in these mutants involved defective angiocrine release of Noggin from endothelial cells, which is positively regulated by Notch. Administration of recombinant Noggin, a secreted antagonist of bone morphogenetic proteins, restored bone growth and mineralization, chondrocyte maturation, the formation of trabeculae and osteoprogenitor numbers in endothelial-cell-specific Notch pathway mutants. These findings establish a molecular framework coupling angiogenesis, angiocrine signals and osteogenesis, which may prove significant for the development of future therapeutic applications.", "Putative endothelial cell (EC) progenitors or angioblasts were isolated from human peripheral blood by magnetic bead selection on the basis of cell surface antigen expression. In vitro, these cells differentiated into ECs. In animal models of ischemia, heterologous, homologous, and autologous EC progenitors incorporated into sites of active angiogenesis. These findings suggest that EC progenitors may be useful for augmenting collateral vessel growth to ischemic tissues (therapeutic angiogenesis) and for delivering anti- or pro-angiogenic agents, respectively, to sites of pathologic or utilitarian angiogenesis.", "Studies of the last decades have revealed the importance of angiogenesis for normal growth and for the pathogenesis of numerous diseases. Much less studied is lymphangiogenesis, the growth of lymphatic vessels, which drain extravasated fluid, proteins, and cells and transport them back to the venous circulation. Nonetheless, insufficient lymphangiogenesis causes incapacitating lymphedema, while lymphatic growth around tumors may facilitate metastatic spread of malignant cells that ultimately kill the patient. The recent discovery of the key lymphangiogenic factors VEGF-C and VEGF-D and their receptor VEGFR-3 has allowed novel insights into how the lymphatic vessels and blood vessels coordinately grow and affect human disease. In addition, these studies have opened novel diagnostic and therapeutic avenues for the treatment of lymphedema and metastasis. This overview highlights the recent insights and developments in the field of lymphatic vascular research.", "We sought to establish whether a reduction in endothelial progenitor cells (EPCs) has a putative role in peripheral vascular disease (PVD) of type 2 diabetic patients. Peripheral vascular disease is a common and severe complication of diabetes mellitus. Impaired collateralization of diabetic vasculopathy has been extensively shown, but causes leading to its pathogenesis are not fully understood. Recently, EPCs have been found to contribute to vascular repair and angiogenesis. Diabetes has been associated with low levels of circulating EPCs, but no data are available in the literature on the relationship between EPCs and PVD in diabetes. Flow cytometric analysis was used to quantify circulating progenitor cells (CPCs, CD34+) and EPCs (CD34+KDR+) in 51 patients and 17 control subjects. The CPCs and EPCs from diabetic patients were reduced by 33% and 40%, respectively, compared with healthy subjects (p < 0.001). An inverse correlation was found between the number of EPCs and the values of fasting glucose (r = -0.49, p = 0.006). Peripheral vascular disease was associated with a 47% reduction in EPCs (p < 0.0001) and EPC levels directly correlated with the ankle-brachial index (r = 0.70, p = 0.01). The subgroup of diabetic patients with PVD also had reduced CPCs by 32% (p = 0.037), whereas patients with ischemic foot lesions had the lowest levels of both EPCs and CPCs (p = 0.02). Our data demonstrate decreased EPC levels in diabetic patients and, for the first time, show that PVD is associated with an extensively low number of EPCs. Depletion of circulating EPCs in diabetic patients may be involved in the pathogenesis of peripheral vascular complications.", "Traumatic skeletal muscle injuries cause irreversible tissue damage and impaired revascularization. Engineered muscle is promising for enhancing tissue revascularization and regeneration in injured muscle. Here we fabricated engineered skeletal muscle composed of myotubes interspersed with vascular endothelial cells using spatially patterned scaffolds that induce aligned cellular organization, and then assessed their therapeutic benefit for treatment of murine volumetric muscle loss. Murine skeletal myoblasts co-cultured with endothelial cells in aligned nanofibrillar scaffolds form endothelialized and aligned muscle with longer myotubes, more synchronized contractility, and more abundant secretion of angiogenic cytokines, compared to endothelialized engineered muscle formed from randomly-oriented scaffolds. Treatment of traumatically injured muscle with endothelialized and aligned skeletal muscle promotes the formation of highly organized myofibers and microvasculature, along with greater vascular perfusion, compared to treatment of muscle derived from randomly-oriented scaffolds. This work demonstrates the potential of endothelialized and aligned engineered skeletal muscle to promote vascular regeneration following transplantation.", "Corneal neovascularization is a serious condition that can lead to a profound decline in vision. The abnormal vessels block light, cause corneal scarring, compromise visual acuity, and may lead to inflammation and edema. Corneal neovascularization occurs when the balance between angiogenic and antiangiogenic factors is tipped toward angiogenic molecules. Vascular endothelial growth factor (VEGF), one of the most important mediators of angiogenesis, is upregulated during neovascularization. In fact, anti-VEGF agents have efficacy in the treatment of neovascular age-related macular degeneration, diabetic retinopathy, macular edema, neovascular glaucoma, and other neovascular diseases. These same agents have great potential for the treatment of corneal neovascularization. We review some of the most promising anti-VEGF therapies, including bevacizumab, VEGF trap, siRNA, and tyrosine kinase inhibitors.", "Bone is a richly vascularized connective tissue. As the main source of oxygen, nutrients, hormones, neurotransmitters and growth factors delivered to the bone cells, vasculature is indispensable for appropriate bone development, regeneration and remodeling. Bone vasculature also orchestrates the process of hematopoiesis. Blood supply to the skeletal system is provided by the networks of arteries and arterioles, having distinct molecular characteristics and localizations within the bone structures. Blood vessels of the bone develop through the process of angiogenesis, taking place through different, bone-specific mechanisms. Impaired functioning of the bone blood vessels may be associated with the occurrence of some skeletal and systemic diseases, i.e., osteonecrosis, osteoporosis, atherosclerosis or diabetes mellitus. When a disease or trauma-related large bone defects appear, bone grafting or bone tissue engineering-based strategies are required. However, a successful bone regeneration in both approaches largely depends on a proper blood supply. In this paper, we review the most recent data on the functions, molecular characteristics and significance of the bone blood vessels, with a particular emphasis on the role of angiogenesis and blood vessel functioning in bone development and regeneration, as well as the consequences of its impairment in the course of different skeletal and systemic diseases.", "Growth of the human rhabdomyosarcoma A673 cell line in nude mice is substantially reduced but not completely suppressed after systemic administration of the antihuman vascular endothelial growth factor (VEGF) monoclonal antibody (Mab) A.4.6.1. Potentially, such escape might be attributable to incomplete local penetration of the antibody because of a diffusion barrier associated with tumor growth. Alternatively, it might reflect a compensatory up-regulation of murine VEGF, produced by the stroma of the host, or of other angiogenic factor genes. To test these potential mechanisms, systemic administration of Mab A.4.6.1, was performed in conjunction with intratumoral administration of an irrelevant antibody, an antihuman VEGF Fab or mFlt(1-3)-IgG that neutralizes both human and murine VEGF. Tumor growth in the systemic-plus-intratumoral anti-VEGF group was not different from that in the systemic anti-VEGF-plus-intratumoral-control antibody group, arguing against the possibility that bioavailability is the factor that limits the antitumor efficacy of Mab A.4.6.1. However, intratumoral mFlt(l-3)-IgG administration dramatically enhanced the activity of systemic anti-VEGF Mab and resulted in complete suppression of tumor growth, which indicated that host VEGF significantly contributes to tumor growth. Systemic administration of mFlt(1-3)-IgG alone replicated these findings. Histological analysis of residual tumor tissues revealed an almost complete absence of host-derived vasculature and massive tumor-cell necrosis in the mFlt(1-3)-IgG groups. Such extensive necrotic areas were not present in the other groups. Real-time reverse transcription-PCR analysis of total RNA derived from tumor tissues indicated strong up-regulation of both human and murine VEGF as well as other genes regulated by hypoxia. Our findings emphasize the need to completely block VEGF for maximal inhibition of tumor growth." ]
Physical Fitness and Fall Risk Factors in Community-Dwelling Older Women
The purposes of this study were to compare the differences in physical fitness between community-dwelling older women fallers and non-fallers, with and without a risk of falling, and to investigate the relation between physical fitness and falling risk factors. This study was a secondary data analysis from a community- and exercise-based fall-prevention program. Baseline assessments pertaining to body weight and height, self-reported chronic diseases, the 12-item fall risk questionnaire (FRQ), senior fitness test, single-leg stand test, and handgrip strength test were extracted. Participants (
[ "To construct and validate a frailty index (FI) that is clinically sensible and practical for geriatricians by basing it on a routinely used comprehensive geriatric assessment (CGA) instrument. Secondary analysis of a 3-month randomized, controlled trial of a specialized mobile geriatric assessment team. Rural Nova Scotia. Participants were seen in their homes. Frail older adults, of whom 92 were in the intervention group and 77 in the control group. A standard CGA form that accounts for impairment, disability, and comorbidity burden was scored and summed as a frailty index (FI-CGA). The FI-GCA was stratified to describe three levels of frailty. Patients were followed for up to 12 months to determine how well the index predicted adverse outcomes (institutionalization or mortality, whichever came first). The three levels of frailty were mild (FI-CGA 0-7), moderate (FI-CGA 7-13), and severe (FI-CGA>13). Demographic and social traits were similar across groups, but greater frailty was associated with worse function (r=0.55) and mental status (r=0.33). Those with moderate and severe frailty had a greater risk of adverse outcomes than those with mild frailty (unadjusted hazard ratio=1.9 and 5.5, respectively). There was no difference between frailty groups in mean 3-month goal-attainment scaling scores. Intrarater reliability was 0.95. The FI-CGA is a valid, reliable, and sensible clinical measure of frailty that permits risk stratification of future adverse outcomes.", "BMD and clinical risk factors predict hip and other osteoporotic fractures. The combination of clinical risk factors and BMD provide higher specificity and sensitivity than either alone. INTRODUCTION AND HYPOTHESES: To develop a risk assessment tool based on clinical risk factors (CRFs) with and without BMD. Nine population-based studies were studied in which BMD and CRFs were documented at baseline. Poisson regression models were developed for hip fracture and other osteoporotic fractures, with and without hip BMD. Fracture risk was expressed as gradient of risk (GR, risk ratio/SD change in risk score). CRFs alone predicted hip fracture with a GR of 2.1/SD at the age of 50 years and decreased with age. The use of BMD alone provided a higher GR (3.7/SD), and was improved further with the combined use of CRFs and BMD (4.2/SD). For other osteoporotic fractures, the GRs were lower than for hip fracture. The GR with CRFs alone was 1.4/SD at the age of 50 years, similar to that provided by BMD (GR = 1.4/SD) and was not markedly increased by the combination (GR = 1.4/SD). The performance characteristics of clinical risk factors with and without BMD were validated in eleven independent population-based cohorts. The models developed provide the basis for the integrated use of validated clinical risk factors in men and women to aid in fracture risk prediction.", "Falls are a common and often devastating problem among older people, causing a tremendous amount of morbidity, mortality and use of health care services including premature nursing home admissions. Most of these falls are associated with one or more identifiable risk factors (e.g. weakness, unsteady gait, confusion and certain medications), and research has shown that attention to these risk factors can significantly reduce rates of falling. Considerable evidence now documents that the most effective (and cost-effective) fall reduction programmes have involved systematic fall risk assessment and targeted interventions, exercise programmes and environmental-inspection and hazard-reduction programmes. These findings have been substantiated by careful meta-analysis of large numbers of controlled clinical trials and by consensus panels of experts who have developed evidence-based practice guidelines for fall prevention and management. Medical assessment of fall risks and provision of appropriate interventions are challenging because of the complex nature of falls. Optimal approaches involve interdisciplinary collaboration in assessment and interventions, particularly exercise, attention to co-existing medical conditions and environmental inspection and hazard abatement.", "To compare the validity of a parsimonious frailty index (components: weight loss, inability to rise from a chair, and poor energy (Study of Osteoporotic Fractures (SOF) index)) with that of the more complex Cardiovascular Health Study (CHS) index (components: unintentional weight loss, low grip strength, poor energy, slowness, and low physical activity) for prediction of adverse outcomes in older men. Prospective cohort study. Six U.S. centers. Three thousand one hundred thirty-two men aged 67 and older. Frailty status categorized as robust, intermediate stage, or frail using the SOF index and criteria similar to those used in CHS index. Falls were reported three times for 1 year. Disability (>or=1 new impairments in performing instrumental activities of daily living) ascertained at 1 year. Fractures and deaths ascertained during 3 years of follow-up. Analysis of area under the receiver operating characteristic curve (AUC) statistics compared for models containing the SOF index versus those containing the CHS index. Greater evidence of frailty as defined by either index was associated with greater risk of adverse outcomes. Frail men had a higher age-adjusted risk of recurrent falls (odds ratio (OR)=3.0-3.6), disability (OR=5.3-7.5), nonspine fracture (hazard ratio (HR)=2.2-2.3), and death (HR=2.5-3.5) (P<.001 for all models). AUC comparisons revealed no differences between models with the SOF index and models with the CHS index in discriminating falls (AUC=0.63, P=.97), disability (AUC=0.68, P=.86), nonspine fracture (AUC=0.63, P=.90), or death (AUC=0.71 for model with SOF index and 0.72 for model with CHS index, P=.19). The simple SOF index predicts risk of falls, disability, fracture, and mortality in men as well as the more-complex CHS index.", "Effective multifactorial interventions reduce the frequent falling rate of older patients by 30% to 40%. However, clinical consensus suggests reserving these interventions for high-risk patients. Limiting fall prevention programs to high-risk patients implies that clinicians must recognize features that predict future falls. To identify the prognostic value of risk factors for future falls among older patients. Search of MEDLINE (1966-September 2004), CINAHL (1982-September 2004), and authors' own files to identify prospective cohort studies of risk factors for falls that performed a multivariate analysis of such factors. Two reviewers independently determined inclusion of articles and assessed study quality. Disagreements were resolved by consensus. Included studies were those identifying the prognostic value of risk factors for future falls among community-dwelling persons 65 years and older. Clinically identifiable risk factors were identified across 6 domains: orthostatic hypotension, visual impairment, impairment of gait or balance, medication use, limitations in basic or instrumental activities of daily living, and cognitive impairment. Eighteen studies met inclusion criteria and provided a multivariate analysis including at least 1 of the risk factor domains. The estimated pretest probability of falling at least once in any given year for individuals 65 years and older was 27% (95% confidence interval, 19%-36%). Patients who have fallen in the past year are more likely to fall again [likelihood ratio range, 2.3-2.8]. The most consistent predictors of future falls are clinically detected abnormalities of gait or balance (likelihood ratio range, 1.7-2.4). Visual impairment, medication variables, decreased activities of daily living, and impaired cognition did not consistently predict falls across studies. Orthostatic hypotension did not predict falls after controlling for other factors. Screening for risk of falling during the clinical examination begins with determining if the patient has fallen in the past year. For patients who have not previously fallen, screening consists of an assessment of gait and balance. Patients who have fallen or who have a gait or balance problem are at higher risk of future falls.", "The effect of change in weight in later years on risk of osteoporotic fractures in uncertain. Prior studies have assessed the relationship between weight change and risk of hip fracture only and have not examined whether the association between weight loss and increased risk of hip fracture is because of voluntary or involuntary weight loss. To determine the association between weight change in later years and the risk of fractures in elderly women and to assess the effect of weight loss intention on this relationship. The association between weight change and fracture risk was assessed in 6754 ambulatory, non-black women aged 65 years or older enrolled in the Study of Osteoporotic Fractures who had measurements of weight performed at both the baseline and fourth examinations (mean, 5.7 years between examinations). These 6754 women were followed up for all incident nonspine fractures and frailty fractures (defined as fractures of the proximal femur, pelvis, and proximal humerus) occurring after the fourth examination (average follow-up, 19.5 months). All incident fractures were confirmed by radiographic report. During an average of 19.5 months after the fourth examination, 264 women (4%) had at least 1 nonspine fracture, including 83 women who suffered frailty fractures. After adjustment for age, women who lost weight between the baseline and fourth examinations had an increased risk of subsequent nonspine fracture (relative risk [RR] per 10% decrease in weight, 1.32; 95% confidence interval [CI], 1.11-1.55). This observed increase in the risk of nonspine fracture was entirely caused by an increase in the risk of frailty fracture (age-adjusted RR per 10% decrease in weight, 1.86; 95% CI, 1.42-2.43). Weight change was not significantly related to other types of nonspine fractures (age-adjusted RR per 10% decrease in weight, 1.09; 95% CI, 0.90-1.33). Further adjustment for cigarette smoking, physical activity, estrogen use, medical conditions, health status, body weight, femoral neck bone mass, and rate of change in calcaneal bone mass did not substantially alter the association between weight change and frailty fracture (multivariate RR per 10% decrease in weight 1.68; 95% CI, 1.17-2.41). Weight change was an even stronger predictor of risk of frailty fracture in those women who were not trying to lose weight (multivariate RR per 10% decrease in weight, 1.81; 95% CI, 1.26-2.61). Involuntary weight loss in later years substantially increases the risk of frailty fracture including hip fracture in elderly women. Weight change is not related to risk of other nonspine fractures in older women.", "A standard phenotype of frailty was associated with an increased risk of adverse outcomes including mortality in a recent study of older adults. However, the predictive validity of this phenotype for fracture outcomes and across risk subgroups is uncertain. To determine whether a standard frailty phenotype was independently associated with risk of adverse health outcomes in older women and to evaluate the consistency of associations across risk subgroups defined by age and body mass index (BMI), we ascertained frailty status in a cohort of 6724 women>or=69 years and followed them prospectively for incident falls, fractures, and mortality. Frailty was defined by the presence of three or more of the following criteria: unintentional weight loss, weakness, self-reported poor energy, slow walking speed, and low physical activity. Incident recurrent falls were defined as at least two falls during the subsequent year. Incident fractures (confirmed with x-ray reports), including hip fractures, and deaths were ascertained during an average of 9 years of follow-up. After controlling for multiple confounders such as age, health status, medical conditions, functional status, depressive symptoms, cognitive function, and bone mineral density, frail women were subsequently at increased risk of recurrent falls (multivariate odds ratio=1.38, 95% confidence interval [CI], 1.02-1.88), hip fracture (multivariate hazards ratio [MHR]=1.40, 95% CI, 1.03-1.90), any nonspine fracture (MHR=1.25, 95% CI, 1.05-1.49), and death (MHR=1.82, 95% CI, 1.56-2.13). The associations between frailty and these outcomes persisted among women>or=80 years. In addition, associations between frailty and an increased risk of falls, fracture, and mortality were consistently observed across categories of BMI, including BMI>or=30 kg/m2. Frailty is an independent predictor of adverse health outcomes in older women, including very elderly women and older obese women." ]
[Hyaluronic acid, corticosteroids and platelet-rich plasma in the treatment of temporomandibular joint osteoarthritis].
Temporomandibular joint osteoarthritis (TMJ OA) is a low-inflammatory disorder with multifactorial etiology. The aim of this review was to present the current state of knowledge regarding the mechanisms of action and the efficacy of hyaluronic acid (HA), corticosteroids (CS) and platelet-rich plasma (PRP) in the treatment of TMJ OA.: The PubMed database was analyzed with the keywords: "(temporomandibular joint) AND ((osteoarthritis) OR (dysfunction) OR (disorders) OR (pain)) AND ((treatment) OR (arthrocentesis) OR (arthroscopy) OR (injection)) AND ((hyaluronic acid) OR (corticosteroid) OR (platelet rich plasma))". After screening of 363 results, 16 studies were included in this review. Arthrocentesis alone effectively reduces pain and improves jaw function in patients diagnosed with TMJ OA. Additional injections of HA, either low-molecular-weight (LMW) HA or high-molecular-weight (HMW) HA, or CS at the end of the arthrocentesis do not improve the final clinical outcomes. CS present several negative effects on the articular cartilage. Results related to additional PRP injections are not consistent and are rather questionable. Further studies should be multicenter, based on a larger group of patients and should answer the question of whether other methods of TMJ OA treatment are more beneficial for the patients than simple arthrocentesis.
[ "A theoretical boundary friction model is proposed for predicting the frictional behavior of articular cartilage, including its time-dependent, velocity-dependent, and load-dependent responses. This theoretical model uses the framework of the biphasic theory for articular cartilage, and provides a mathematical formulation for the principle that interstitial fluid pressurization contributes significantly to reduction of the effective friction coefficient. Several examples of the application of this theory are provided, which demonstrate that a variety of experimentally observed cartilage frictional behaviors can now be theoretically predicted.", "To compare the effect between intra-articular infiltration of low molecular weight (LMW-HA) and high molecular weight hyaluronic acid (HMW-HA) on the histopathological characteristics of the cartilage and disc of the temporomandibular joint (TMJ) osteoarthritis (OA) induced in rabbits. An experimental study was conducted on 38 rabbit TMJs. The effect of different hyaluronic acids was compared at 30 and 135 days. Histopathological analysis was performed. Cartilage damage was assessed with the OARSI scale. The severity of the induced OA according to OARSI was 3.4 degrees in the mandibular condyle (MC) and 3.2 in the mandibular fossa (MF); the articular disc (AD) presented disorganization of the collagen fibers, with randomly arranged hypertrophic chondrocytes. At 30 days, untreated TMJs worsened. TMJ treated with LMW-HA reduced its severity to 1.5 degrees in MC and 1.6 in MF, the AD presented histological aspects within normal limits. TMJ treated with HMW-HA presented 2.4 degrees in MC and 2.2 in MF, the AD maintained characteristics similar to the group with OA. At 135 days, all groups worsened. Exogenous HA is effective in the management of TMJ-OA induced in rabbits, showing cartilage and articular disc repair at 30 days. The LMW-HA group had better effects on joint tissue than HMW-HA 30 days after treatment. However, at 135 days, both groups presented regression of joint tissue repair. HA is effective in the anti-arthritic treatment of TMJ-OA induced in rabbits; LMW-HA shows better results in cartilage and articular disc repair than HMW-HA.", "Hyaluronan, lubricin and phospholipids, molecules ubiquitous in synovial joints, such as hips and knees, have separately been invoked as the lubricants responsible for the remarkable lubrication of articular cartilage; but alone, these molecules cannot explain the extremely low friction at the high pressures of such joints. We find that surface-anchored hyaluronan molecules complex synergistically with phosphatidylcholine lipids present in joints to form a boundary lubricating layer, which, with coefficient of friction μ≈0.001 at pressures to over 100 atm, has a frictional behaviour resembling that of articular cartilage in the major joints. Our findings point to a scenario where each of the molecules has a different role but must act together with the others: hyaluronan, anchored at the outer surface of articular cartilage by lubricin molecules, complexes with joint phosphatidylcholines to provide the extreme lubrication of synovial joints via the hydration-lubrication mechanism.", "Background: Temporomandibular joint osteoarthritis (TMJ OA) is a degenerative joint disease. The aim of this review was to present the general characteristics of orally administered nonsteroidal anti-inflammatory drugs (NSAIDs) and to present the efficacy of NSAIDs in the treatment of TMJ OA. Methods: PubMed database was analyzed with the keywords: \"(temporomandibular joint) AND ((disorders) OR (osteoarthritis) AND (treatment)) AND (nonsteroidal anti-inflammatory drug)\". After screening of 180 results, 6 studies have been included in this narrative review. Results and Conclusions: Nonsteroidal anti-inflammatory drugs are one of the most commonly used drugs for alleviation of pain localized in the orofacial area. The majority of articles predominantly examined and described diclofenac sodium in the treatment of pain in the course of TMJ OA. Because of the limited number of randomized studies evaluating the efficacy of NSAIDs in the treatment of TMJ OA, as well as high heterogeneity of published researches, it seems impossible to draw up unequivocal recommendations for the usage of NSAIDs in the treatment of TMJ OA. However, it is highly recommended to use the lowest effective dose of NSAIDs for the shortest possible time. Moreover, in patients with increased risk of gastrointestinal complications, supplementary gastroprotective agents should be prescribed.", "Lubrication is key for the efficient function of devices and tissues with moving surfaces, such as articulating joints, ocular surfaces and the lungs. Indeed, lubrication dysfunction leads to increased friction and degeneration of these systems. Here, we present a polymer-peptide surface coating platform to non-covalently bind hyaluronic acid (HA), a natural lubricant in the body. Tissue surfaces treated with the HA-binding system exhibited higher lubricity values, and in vivo were able to retain HA in the articular joint and to bind ocular tissue surfaces. Biomaterials-mediated strategies that locally bind and concentrate HA could provide physical and biological benefits when used to treat tissue-lubricating dysfunction and to coat medical devices.", "The purpose of this study was to compare the efficacy and the complications of intra-articular temporomandibular joint (TMJ) injections in 40 patients with osteoarthritis of the TMJ. The subjects were randomly divided into two groups, and the patients received either two intra-articular injections with sodium hyaluronate or two intra-articular injections with corticosteroids, 14 days apart. The effect of the treatment was evaluated 14 days, 1 and 6 months after the initial injection and was based on the following measurements: pain intensity, pain localization, joint sounds, mandibular function and complications. Both groups of patients had less pain intensity at the 6-month follow-up, and there was significantly less pain intensity in the group of patients receiving sodium hyaluronate compared with corticosteroids (P = 0.001). A decrease in crepitation was seen in both groups. In the 20 subjects receiving sodium hyaluronate both the mandibular vertical opening and protrusion increased significantly (P < 0.000). Lateral movement from the affected side increased both in subjects injected with sodium hyaluronate (P = 0.024), and those injected with corticosteroids (P = 0.042). In conclusion, this study confirms that injections in the TMJ with sodium hyaluronate or corticosteroids may reduce pain and improve function in patients with osteoarthritis. The injections were more effective in patients with only TMJ pain compared with patients suffering from both TMJ and myofascial pain. Injection with sodium hyaluronate was significantly more effective in decreasing pain intensity than corticosteroids. Temporary pain after injections may be observed.", "Glucocorticoids (GCs) are endogenous hormones that are crucial for the homeostasis of the organism and adaptation to the external environment. Because of their anti-inflammatory effects, synthetic GCs are also extensively used in clinical practice. However, almost all cells in the body are sensitive to GC regulation. As a result, these mediators have pleiotropic effects, which may be undesirable or detrimental to human health. Here, we summarize the recent findings that contribute to deciphering the molecular mechanisms downstream of glucocorticoid receptor activation. We also discuss the complex role of GCs in infectious diseases such as sepsis and COVID-19, in which the balance between pathogen elimination and protection against excessive inflammation and immunopathology needs to be tightly regulated. An understanding of the cell type- and context-specific actions of GCs from the molecular to the organismal level would help to optimize their therapeutic use." ]
Preoperative prediction of the MIB-1 index in intracranial meningioma
The MIB-1 index is an essential predictor of progression-free-survival (PFS) in meningioma. To date, the MIB-1 index is not available in preoperative treatment planning. A preoperative score estimating the MIB-1 index in patients with intracranial meningiomas has not been investigated so far. Between 2013 and 2019, 208 patients with tumor morphology data, MIB-1 index data, and plasma fibrinogen and serum C-reactive protein (CRP) data underwent surgery for intracranial WHO grade I and II meningioma. An optimal MIB-1 index cut-off value (≥6/<6) in the prediction of recurrence was determined by ROC curve analysis (AUC: 0.71; 95% CI: 0.55-0.87). A high MIB-1 index (≥6%) was present in 50 cases (24.0%) and was significantly associated with male sex, peritumoral edema, low baseline CRP, and low fibrinogen level in the multivariate analysis. A scoring system ("FORGE") based on sex, peritumoral edema, preoperative CRP value, and plasma fibrinogen level supports prediction of the MIB-1 index (sensitivity 62%, specificity 79%). The MIB-1 labeling index and the FORGE score are significantly associated with an increased risk of poor PFS time. We suggest a novel score ("FORGE") to preoperatively estimate the risk of an increased MIB-1 index (≥6%), which might help in surgical decision making and follow-up interval determination and inform future trials investigating inflammatory burden and proliferative activity.
[ "OBJECTIVE During the last decade, the primary objective for large vestibular schwannoma (VS) management has progressively shifted, from tumor excision to nerve preservation by using a combined microsurgical and radiosurgical approach. The aim of this study was to provide a systematic review and meta-analysis of the available literature regarding the combined strategy of subtotal resection (STR) followed by stereotactic radiosurgery (SRS) for large VSs. METHODS The authors performed a systematic review and meta-analysis in compliance with the PRISMA guidelines for article identification and inclusion using the PubMed, Embase, and Cochrane databases. Established inclusion criteria were used to screen all identified relevant articles published before September 2017 without backward date limit. RESULTS The authors included 9 studies (248 patients). With a weighted mean follow-up of 46 months (range 28-68.8 months), the pooled rate of overall tumor control was 93.9% (95% CI 91.0%-96.8%). Salvage treatment (second STR and/or SRS) was necessary in only 13 (5.24%) of 18 patients who experienced initial treatment failure. According to the House-Brackmann (HB) grading scale, functional facial nerve preservation (HB grade I-II) was achieved in 96.1% of patients (95% CI 93.7%-98.5%). Serviceable hearing after the combined approach was preserved in 59.9% (95% CI 36.5%-83.2%). CONCLUSIONS A combined approach of STR followed by SRS was shown to have excellent clinical and functional outcomes while still achieving a tumor control rate comparable to that obtained with a total resection. Longer-term follow-up and larger patient cohorts are necessary to fully evaluate the rate of tumor control achieved with this approach.", "There are substantial challenges in the radiologic evaluation of tumor size during clinical trials, and it is important for neuroradiologists to have a firm understanding of these issues. This review will examine measurement approaches, response criteria, selection of lesions for measurement, technical imaging considerations, interval between tumor measurements and response confirmation, and validity of imaging as a measure of efficacy.", "Clinical and radiological features that help predict the growth potential of meningioma would be beneficial. The purpose of this study is to clarify the characteristics related to proliferating potential using the MIB-1 staining index. We analyzed the relationship of MIB-1 staining indices to characteristics of 342 consecutive patients with meningioma surgically removed between 1995 and 2004 by logistic regression analysis. One hundred and forty-nine of the patients with meningioma were >or=60 in age; 89 male; 48 recurrent; 203 symptomatic; 157 at the skull base; 124 over 20 cm(3); 24 multiple; 136 with edema; 117 with calcification. The MIB-1 staining index in 56 of 296 grade I meningiomas in WHO classification was >or= 3.0; in 27 of 28 grade II; and in 17 of 18 grade III, respectively. Logistic regression analysis demonstrated that male (odds ratio [OR], 2.374, p=0.003), recurrence (OR, 7.574, p=0.0001), skull base (OR, 0.540, p=0.035), calcification (OR, 0.498, p=0.019) were independent risk factors for a high MIB-1 staining index (>or=3.0); age, symptomatic, volume, multiple, edema were not. Male, recurrence, non-skull base, absence of calcification are independent risk factors for a high proliferative potential. These should be taken into consideration when managing meningiomas.", "Surgical treatment of giant vestibular schwannomas (GVS) is challenging. The philosophy of incomplete tumor resection may balance the preservation of facial nerve function and long-term tumor control. We aimed to evaluate the outcome of facial nerve function and tumor control in treating GVS via our institutional surgical strategy. From September 2009 to August 2014, 218 patients who underwent surgical treatment of GVS were enrolled in our study. The clinical features, extent of resections, facial nerve outcome, and the tumor regrowth free rate of these patients were retrospectively analyzed. The treatment strategy of this disease was discussed. All patients had anatomic preservation of the facial nerve. Gross total resection (GTR) was achieved in 58 patients (28.6%), near-total resection (NTR) in 103 (50.7%), and subtotal resection (STR) in 42 (20.7%). Two patients died because of postoperative complications. After a mean follow-up of 39.7 ± 18.3 months, a favorable facial nerve outcome was achieved in 58.6%, 79.6%, and 83.3% of patients who underwent GTR, NTR, and STR, respectively. During follow-up, 20 patients had tumor regrowth and were treated by stereotactic radiosurgery (SRS), and tumor regrowth free rates were 96.6%, 92.2%, and 76.2% in GTR, NTR, and STR, respectively. The extent of resection was the independent risk factor for poor facial nerve function (P = 0.006). A surgical philosophy of prioritizing facial nerve preservation over total tumor resection was recommended in treatment of GVS. Favorable facial nerve outcome and tumor control were achieved after NTR of the tumors.", "The aim of this study was to evaluate the role of certain cell-cycle regulatory proteins in the recurrence of atypical meningiomas. These proteins were analyzed with immunohistochemical staining to identify predisposing factors for the recurrence of atypical meningiomas. The authors retrospectively reviewed the medical records of patients with atypical meningiomas diagnosed in the period from January 2000 to June 2012 at the Department of Neurosurgery at Samsung Changwon Hospital and Dong-A University Medical Center. Clinical data included patient sex and age at the time of surgery, presenting symptoms at diagnosis, location and size of tumor, extent of surgery, use of postoperative radiotherapy, duration of follow-up, and recurrence. Immunohistochemical staining for cell-cycle regulatory proteins (p16, p15, p21, p27, cyclin-dependent kinase [CDK] 4 and 6, phosphorylated retinoblastoma [pRB] protein, and cyclin D1) and proliferative markers (MIB-1 antigen, mitosis, and p53) was performed on archived paraffin-embedded tissues obtained during resection. The recurrence rate and time to recurrence were assessed using Kaplan-Meier analysis. Of the 67 atypical meningiomas eligible for analysis, 26 (38.8%) recurred during the follow-up period (mean duration 47.7 months, range 8.4-132.1 months). Immunohistochemically, there was overstaining for p16 in 44 samples (65.7%), for p15 in 21 samples (31.3%), for p21 in 25 samples (37.3%), for p27 in 32 samples (47.8%), for CDK4 in 38 samples (56.7%), for CDK6 in 26 samples (38.8%), for pRB protein in 42 samples (62.7%), and for cyclin D1 in 49 samples (73.1%). Multivariate analysis using the Cox proportional-hazards regression model showed that incomplete resection (HR 4.513, p < 0.001); immunohistochemical understaining for p16 (HR 3.214, p < 0.001); immunohistochemical overstaining for CDK6 (HR 3.427, p < 0.001), pRB protein (HR 2.854, p = 0.008), and p53 (HR 2.296, p = 0.040); and increased MIB-1 labeling index (HR 2.665, p = 0.013) and mitotic index (HR 2.438, p = 0.024) predicted the recurrence of atypical meningiomas after resection. Findings in this study indicated that p16, CDK6, and pRB protein were associated with the recurrence of atypical meningiomas.", "Facial nerve palsy is a severe morbid condition that occurs after vestibular schwannoma (VS) surgery. The objective of this study was to evaluate facial nerve outcomes based on surgical techniques, tumour size, and immunohistochemical factors. One hundred eighteen patients with VS were retrospectively analysed. Gross total resection (GTR) was achieved in 83 patients, and subtotal resection (STR) was achieved in 35 patients. Follow-up was 60 months (median). Facial nerve outcomes were assessed for 24 months after surgery. Analysis of the MIB-1 index was performed in 114 patients (97%) to evaluate recurrence and facial nerve outcomes. Immediately after surgery, 16 of 35 patients (45.7%) with STR and 21 of 83 patients (25.3%) with GTR had a good (House-Brackmann (HB) score ≤ 2) facial nerve outcome (p = 0.029). Semi-sitting positioning (p = 0.002) and tumour size class of 3 (> 4 cm) were also associated with worse HB outcomes after 2 years (p = 0.004) in univariate analyses. The MIB-1 index was significantly correlated with diffuse infiltration of tumour-associated CD45+ lymphocytes (r = 0.63, p = 0.015) and CD68+ macrophages (r = 0.43, p = 0.021). ROC analysis found an AUC of 0.73 (95% CI = 0.60-0.86, p = 0.003) for the MIB-1 index in predicting poor facial nerve outcomes. Binary logistic regression analysis revealed an MIB-1 index ≥ 5% (16/28 (57.1%) vs. 5/40 (12.5%); p < 0.001, OR = 14.0, 95% CI = 3.2-61.1) and a tumour size class of 3 (6/8 (75.0%) vs. 2/8 (25.0%); p = 0.01, OR = 14.56, 95% CI = 1.9-113.4) were predictors of poor HB scores (≥ 3) after 1 year. An MIB-1 index ≥ 5% seems to predict worse long-term facial nerve outcomes in VS surgery.", "Objective. Proliferative activity in tumor tissues is assessed as the percentage of Ki-67/MIB-1-positive cells, or the proliferative index (PI). The PI is routinely assessed manually. However, the subjectivity of manual assessments might result in poor reproducibility. We hypothesized that digital assessments might reduce the error. Method. In our study, we assessed Ki-67/MIB-1 PIs, both manually and digitally, with tissue microarrays constructed from 141 human meningioma samples. Spearman-rank correlation and κ statistics were applied for correlation and agreement analyses, respectively. Mann-Whitney U tests were used to compare MIB-1 PIs between groups. Prognostic ability was assessed with Kaplan-Meier and Cox regression analyses. Results. We found a significant, high correlation (Spearman ρ = 0.832, P < .01) and moderate agreement (κ coefficient = 0.617, observed agreement = 80.9%) between the 2 methods. Both methods found significantly different Ki-67/MIB-1 PIs for different World Health Organization grades (P < .05). Neither method showed significant prognostic value. Conclusion. Digital determinations of Ki-67/MIB-1 PIs in human meningiomas are feasible for the daily routine.", "Peri-tumoral edema in intracranial meningiomas occurs frequently and obviously impacts the morbidity and mortality of these predominantly benign neoplasms. Several causative factors (age, gender, volume, location…) have been unsuccessfully investigated. Despite recent progresses in metabolic imaging and molecular biology, the pathogenesis of peri-tumoral edema remains debated. Hypotheses include vascular endothelial growth factor, metalloproteinases and interleukins among many others. It is probable that this pathogenesis encompasses all these factors with different levels. The current review aims to shed the light on the investigated factors involved in the pathogenesis of peri-tumoral edema in meningiomas and identify the potential therapeutic targets.", "The treatment goal for vestibular schwannomas (VS) has been changed from total removal of the tumor to functional preservation with long-term tumor growth control. The small- to medium-sized VS can be treated by stereotactic radiosurgery, but large VS require surgical decompression for the relief of cerebellar dysfunction and increased intracranial pressure. We have been performing planned partial surgical resections followed by gamma knife radiosurgery (GKS) for large VS. Here, we evaluate a recent series of such cases from the standpoint of functional outcomes. From January 2000 to May 2013, we treated 40 patients with large unilateral VS (maximum tumor diameter at least 25 mm) with planned partial tumor removal followed by GKS for functional preservation. The median maximum diameter of the tumors was 32.5 mm (range 25-52 mm). All patients underwent surgery via the retrosigmoid approach, and tumors situated on the ventral and in the internal auditory canal intentionally were not removed, thus preserving cranial nerve functions. GKS was performed 1-12 months after surgical resection (median interval 3 months). The median tumor volume at GKS was 3.3 cm(3) (range 0.4-10.4 cm(3)) and the median prescribed dose was 12 Gy (range 10-12 Gy). The median follow-up period after GKS was 65 months (18-156 months). At the final follow-up, facial nerve preservation (House-Brackmann grade I-II) was achieved in 38 patients (95%; House-Brackmann grade I: 92.5%, II: 2.5%). Among the 14 patients with preoperative pure tone average (PTA) less than 50 dB, 6 of them (42.9%) maintained PTA less than 50 dB at the last follow-up. Two patients improved from severe hearing loss to PTA less than 50 dB (1 patient after surgery and 1 patient one and half years after GKS). Five- and 10-year tumor growth control occurred in 86% of patients. Four patients (10%) required salvage surgery; the predictive factor was tumor volume greater than 6 cm(3) at GKS (P = 0.01). Planned partial removal of large VS followed by GKS achieved a high rate of facial nerve and hearing preservation. To achieve long-term tumor growth control, the tumor volume at GKS after planned partial surgical resection should be smaller than 6 cm(3). Our results revealed that patients with hearing preservation postoperatively have a chance of maintaining hearing function, even though the possibility exists of deterioration by long-term follow-up after surgical intervention and GKS. Furthermore, some patients with severe hearing loss before treatment have the chance of hearing improvement, even those with large VS.", "The expression of the human Ki-67 protein is strictly associated with cell proliferation. During interphase, the antigen can be exclusively detected within the nucleus, whereas in mitosis most of the protein is relocated to the surface of the chromosomes. The fact that the Ki-67 protein is present during all active phases of the cell cycle (G(1), S, G(2), and mitosis), but is absent from resting cells (G(0)), makes it an excellent marker for determining the so-called growth fraction of a given cell population. In the first part of this study, the term proliferation marker is discussed and examples of the applications of anti-Ki-67 protein antibodies in diagnostics of human tumors are given. The fraction of Ki-67-positive tumor cells (the Ki-67 labeling index) is often correlated with the clinical course of the disease. The best-studied examples in this context are carcinomas of the prostate and the breast. For these types of tumors, the prognostic value for survival and tumor recurrence has repeatedly been proven in uni- and multivariate analysis. The preparation of new monoclonal antibodies that react with the Ki-67 equivalent protein from rodents now extends the use of the Ki-67 protein as a proliferation marker to laboratory animals that are routinely used in basic research. The second part of this review focuses on the biology of the Ki-67 protein. Our current knowledge of the Ki-67 gene and protein structure, mRNA splicing, expression, and cellular localization during the cell-division cycle is summarized and discussed. Although the Ki-67 protein is well characterized on the molecular level and extensively used as a proliferation marker, the functional significance still remains unclear. There are indications, however, that Ki-67 protein expression is an absolute requirement for progression through the cell-division cycle." ]
how many envelope proteins does a pestivirus contain?
Pestiviruses contain three envelope proteins: E
[ "The pestivirus glycoprotein E(rns), a ribonuclease, is expressed on the surface of virions and in infected cells as a disulfide-linked homodimer. E(rns) is involved in the infection process and its RNase activity is probably involved in viral replication and pathogenesis. The most C-terminal cysteine residue forms an intermolecular disulfide bond with another E(rns) monomer, resulting in an E(rns) dimer. To study the function of dimerisation of E(rns) for viral replication, the cysteine residue at amino acid position 438 was mutated into a serine residue. The mutated C438S gene was cloned into a vector containing an infectious cDNA copy of the CSFV C-strain genome. Using reverse genetics, a mutant virus was generated that only expressed monomeric E(rns), confirming that Cys 438 is essential for homo-dimerization. Characterization of this mutant virus and of a baculovirus-expressed C438S mutant protein indicated that the loss of the dimeric state of E(rns) reduced the affinity of binding of virions and E(rns) to heparan sulphate (HS), the receptor for E(rns) on the cell surface of SK6 cells. This suggests that interaction of virus-bound E(rns) homodimers with membrane associated HS may be a joined action of the two HS-binding domains (one in each monomer) present in the homodimer.", "Hepatitis C virus (HCV) glycoproteins E1 and E2 assemble to form a noncovalent heterodimer which, in the cell, accumulates in the endoplasmic reticulum (ER). Contrary to what is observed for proteins with a KDEL or a KKXX ER-targeting signal, the ER localization of the HCV glycoprotein complex is due to a static retention in this compartment rather than to its retrieval from the cis-Golgi region. A static retention in the ER is also observed when E2 is expressed in the absence of E1 or for a chimeric protein containing the ectodomain of CD4 in fusion with the transmembrane domain (TMD) of E2. Although they do not exclude the presence of an intracellular localization signal in E1, these data do suggest that the TMD of E2 is an ER retention signal for HCV glycoprotein complex. In this study chimeric proteins containing the ectodomain of CD4 or CD8 fused to the C-terminal hydrophobic sequence of E1 were shown to be localized in the ER, indicating that the TMD of E1 is also a signal for ER localization. In addition, these chimeric proteins were not processed by Golgi enzymes, indicating that the TMD of E1 is responsible for true retention in the ER, without recycling through the Golgi apparatus. Together, these data suggest that at least two signals (TMDs of E1 and E2) are involved in ER retention of the HCV glycoprotein complex.", "Processing of the boundary region between the putative structural and nonstructural regions of the hepatitis C virus precursor polyprotein was analyzed by in vitro translation using reticulocyte lysate in the presence of canine microsomal membranes. At this boundary in the precursor polyprotein, the most carboxy-terminal of the structural proteins, gp70 (E2), is proximal to the amino terminal of the nonstructural protein p21 (NS2). The presence of a novel microsomal membrane-dependent cleavage site was observed at the region upstream of the amino-terminal end of p21 (NS2) in the precursor polyprotein. The cleavage site was assigned to amino acid residues 746/747 in the hepatitis C virus precursor polyprotein. Inefficient cleavage of this site resulted in the production of two forms of E2 products with different sizes of peptide backbones. Translation and cleavage of various C-terminal deletion constructs established the significance of the C-terminal hydrophobic amino acid sequences of E2 products in membrane anchoring.", "The hepatitis C virus (HCV) genome encodes two envelope glycoproteins (E1 and E2). These glycoproteins interact to form a noncovalent heterodimeric complex which in the cell accumulates in endoplasmic reticulum (ER)-like structures. The transmembrane domain of E2, at least, is involved in HCV glycoprotein complex localization in this compartment. In principle, ER localization of a protein can be the consequence of actual retention in this organelle or of retrieval from the Golgi. To determine which of these two mechanisms is responsible for HCV glycoprotein complex accumulation in the ER, the precise localization of these proteins was studied by immunofluorescence, and the processing of their glycans was analyzed. Immunolocalization of HCV glycoproteins after nocodazole treatment suggested an ER retention. In addition, HCV glycoprotein glycans were not modified by Golgi enzymes, indicating that the ER localization of these proteins is not because of their retrieval from the cis Golgi. Retention of HCV glycoprotein complexes in the ER without retrieval suggests that this compartment plays an important role for the acquisition of the envelope of HCV particles. A true retention in the ER was also observed for E2 expressed in the absence of E1 or for a chimeric protein containing the ectodomain of CD4 in fusion with the transmembrane domain of E2. These data indicate that, in HCV glycoprotein complex, the transmembrane domain of E2, at least, is responsible for true retention in the ER, without recycling through the Golgi.", "Pestiviruses represent important pathogens of farm animals that have evolved unique strategies and functions to stay within their host populations. E(rns), a structural glycoprotein of pestiviruses, exhibits RNase activity and represents a virulence factor of the viruses. E(rns) forms disulfide linked homodimers that are found in virions and virus-infected cells. Mutation or deletion of cysteine 171, the residue engaged in intermolecular disulfide bond formation, results in loss of dimerization as tested in coprecipitation and native protein gel electrophoresis analyses. Nevertheless, stable virus mutants with changes affecting cysteine codon 171 could be recovered in tissue culture. These mutants grew almost as well as the parental viruses and exhibited an RNase-positive phenotype. E(rns) dimerization-negative mutants of classical swine fever virus were found to be attenuated in pigs even though the virus clearly replicated and induced a significant neutralizing antibody response in the animals.", "Hepatitis C virus (HCV) is a member of Hepacivirus and belongs to the family of Flaviviridae. HCV infects millions of people worldwide and may lead to cirrhosis and hepatocellular carcinoma. HCV envelope proteins, E1 and E2, play critical roles in viral cell entry and act as major epitopes for neutralizing antibodies. However, unlike other known flaviviruses, it has been challenging to study HCV envelope proteins E1E2 in the past decades as the in vitro expressed E1E2 heterodimers are usually of poor quality, making the structural and functional characterization difficult. Here we express the ectodomains of HCV E1E2 heterodimer with either an Fc-tag or a de novo designed heterodimeric tag and are able to isolate soluble E1E2 heterodimer suitable for functional and structural studies. Then we characterize the E1E2 heterodimer by electron microscopy and model the structure by the coevolution based modeling strategy with Rosetta, revealing the potential interactions between E1 and E2. Moreover, the E1E2 heterodimer is applied to examine the interactions with the known HCV receptors, neutralizing antibodies as well as the inhibition of HCV infection, confirming the functionality of the E1E2 heterodimer and the binding profiles of E1E2 with the cellular receptors. Therefore, the expressed E1E2 heterodimer would be a valuable target for both viral studies and vaccination against HCV.", "The biosynthesis of human CD8 glycoprotein in transfected rat epithelial cells produces an unglycosylated precursor, an intermediate species only initially O-glycosylated, and a doublet mature form carrying neutral and sialylated O-linked oligosaccharides with the core-2 structure (Pascale, M. C., Malagolini, N., Serafini-Cessi, F., Migliaccio, G., Leone, A., and Bonatti, S. (1992) J. Biol. Chem. 267, 9940-9947). In this study the most relevant post-translational events: dimerization, addition of the first O-linked GalNAc, fulfillment of O-linked chains, as well as expression of involved glycosyltransferases, have been examined and correlated with the localization and transit rate of CD8 through the exocytic pathway. The glycosyltransferase activities measured in rat epithelial cells transfected with human CD8 DNA are entirely consistent with the primary structure assigned to CD8 oligosaccharides. The half-time of appearance of the initially O-glycosylated precursor and mature form was estimated to be 4 and 14 min, respectively, and the half-time for delivery of mature CD8 to the cell surface was found to be about 30 min, indicating a very fast routing. Pulse experiments with [35S]cysteine at 37 degrees C followed by chase-periods at low temperatures showed that folding/dimerization occurs before routing to the Golgi apparatus, whereas the addiction of O-linked GalNAc appears to take place later, very likely in cis-Golgi cisternae. Treatment of cells with monensin accumulated the intermediate CD8 form carrying non-elongated O-linked GalNAc, whereas brefeldin A treatment produced a sialylated glycoprotein species with a mobility faster than the mature CD8. These results indicate that the two drugs affect assembly of O-linked chains at different time of their processing." ]
Induction of astaxanthin synthesis in Phaffia rhodozyma
Phaffia rhodozyma is a basidiomycetous yeast that synthesizes astaxanthin (ASX), which is a powerful and highly valuable antioxidant carotenoid pigment. P. rhodozyma cells accrue ASX and gain an intense red-pink coloration when faced with stressful conditions such as nutrient limitations (e.g., nitrogen or copper), the presence of toxic substances (e.g., antimycin A), or are affected by mutations in the genes that are involved in nitrogen metabolism or respiration. Since cellular accrual of ASX occurs under a wide variety of conditions, this yeast represents a valuable model for studying the growth conditions that entail oxidative stress for yeast cells. Recently, we proposed that ASX synthesis can be largely induced by conditions that lead to reduction-oxidation (redox) imbalances, particularly the state of the NADH/NAD+ couple together with an oxidative environment. In this work, we review the multiple known conditions that elicit ASX synthesis expanding on the data that we formerly examined. When considered alongside the Mitchell's chemiosmotic hypothesis, the study served to rationalize the induction of ASX synthesis and other adaptive cellular processes under a much broader set of conditions. Our aim was to propose an underlying mechanism that explains how a broad range of divergent conditions converge to induce ASX synthesis in P. rhodozyma. The mechanism that links the induction of ASX synthesis with the occurrence of NADH/NAD+ imbalances may help in understanding how other organisms detect any of a broad array of stimuli or gene mutations, and then adaptively respond to activate numerous compensatory cellular processes.
[ "Non-proliferating cells generate the bulk of cellular ATP by fully oxidizing respiratory substrates in mitochondria. Respiratory substrates cross the mitochondrial outer membrane through only one channel, the voltage dependent anion channel (VDAC). Once in the matrix, respiratory substrates are oxidized in the tricarboxylic acid cycle to generate mostly NADH that is further oxidized in the respiratory chain to generate a proton motive force comprised mainly of membrane potential (ΔΨ) to synthesize ATP. Mitochondrial ΔΨ then drives the release of ATP(4-) from the matrix in exchange for ADP(3-) in the cytosol via the adenine nucleotide translocator (ANT) located in the mitochondrial inner membrane. Thus, mitochondrial function in non-proliferating cells drives a high cytosolic ATP/ADP ratio, essential to inhibit glycolysis. By contrast, the bioenergetics of the Warburg phenotype of proliferating cells is characterized by enhanced aerobic glycolysis and the suppression of mitochondrial metabolism. Suppressed mitochondrial function leads to lower production of mitochondrial ATP and hence lower cytosolic ATP/ADP ratios that favor enhanced glycolysis. Thus, the cytosolic ATP/ADP ratio is a key feature that determines if cell metabolism is predominantly oxidative or glycolytic. Here, we describe two novel mechanisms to explain the suppression of mitochondrial metabolism in cancer cells: the relative closure of VDAC by free tubulin and the inactivation of ANT. Both mechanisms contribute to low ATP/ADP ratios that activate glycolysis.", "Xanthophyllomyces dendrorhous is an excellent industrial source for production of natural astaxanthin, but the yield of astaxanthin is relative low due to the contradiction between biomass weight and astaxanthin accumulation. Glutamate, a metabolite connecting nitrogen and carbon metabolisms, is probably a promising entry point to interfere cellular metabolisms. Thus, the effect of glutamate on cell growth and astaxanthin accumulation in X. dendrorhous was investigated. Results showed that glutamate feeding facilitated glucose consumption and further led to the increment of astaxanthin content with little influence of cell growth. A comparative proteomics study was applied to decipher the regulatory mechanisms of enhanced astaxanthin biosynthesis in X. dendrorhous as a response to the glutamate feeding. The expressions of proteins with the highest degree of fold change were involved in carbohydrate, amino acids, and carotenogenesis metabolisms as well as redox and stress-associated metabolisms. In addition, a possible regulatory model of enhanced astaxanthin accumulation in response to glutamate feeding in X. dendrorhous is also proposed.", "1. Mitochondria prepared from Torulopsis utilis grown in a chemostat with iron-limited growth were found to lack energy conservation but not electron flow in that segment of the respiratory chain leading from intramitochondrial NADH to the cytochromes [i.e. the site 1 segment (Lehninger, 1964)]. 2. Site 1 energy conservation was present in mitochondria prepared from cells grown under conditions of limitation by glycerol, ammonium and magnesium. Phosphate-limited growth resulted in mitochondrial preparations without respiratory control. 3. Mitochondria from cells grown under conditions of iron limitation were insensitive to the respiratory inhibitor piericidin A, whereas sensitivity was present in mitochondria prepared from glycerol-, ammonium-, magnesium- or phosphate-limited cells. 4. These observations are considered to provide indirect evidence for a role of non-haem iron in the mechanism of energy conservation and also piericidin A sensitivity in T. utilis mitochondria. 5. A readily constructed and inexpensive pH-measuring and -controlling circuit is described for use with continuous-culture apparatus.", "Mitochondria are the energetic, metabolic, redox, and information signaling centers of the cell. Substrate pressure, mitochondrial network dynamics, and cristae morphology state are integrated by the protonmotive force Δp or its potential component, ΔΨ, which are attenuated by proton backflux into the matrix, termed uncoupling. The mitochondrial uncoupling proteins (UCP1-5) play an eminent role in the regulation of each of the mentioned aspects, being involved in numerous physiological events including redox signaling. Recent Advances: UCP2 structure, including purine nucleotide and fatty acid (FA) binding sites, strongly support the FA cycling mechanism: UCP2 expels FA anions, whereas uncoupling is achieved by the membrane backflux of protonated FA. Nascent FAs, cleaved by phospholipases, are preferential. The resulting Δp dissipation decreases superoxide formation dependent on Δp. UCP-mediated antioxidant protection and its impairment are expected to play a major role in cell physiology and pathology. Moreover, UCP2-mediated aspartate, oxaloacetate, and malate antiport with phosphate is expected to alter metabolism of cancer cells. A wide range of UCP antioxidant effects and participations in redox signaling have been reported; however, mechanisms of UCP activation are still debated. Switching off/on the UCP2 protonophoretic function might serve as redox signaling either by employing/releasing the extra capacity of cell antioxidant systems or by directly increasing/decreasing mitochondrial superoxide sources. Rapid UCP2 degradation, FA levels, elevation of purine nucleotides, decreased Mg2+, or increased pyruvate accumulation may initiate UCP-mediated redox signaling. Issues such as UCP2 participation in glucose sensing, neuronal (synaptic) function, and immune cell activation should be elucidated. Antioxid. Redox Signal. 29, 667-714.", "Magnesium deficiency and oxidative stress have been identified as correlative factors in many diseases. The origin of free radicals correlated with oxidative damage resulting from Mg-deficiency is unclear at the cellular level. To investigate whether hydrogen peroxide (H2O2) is associated in the oxidative stress induced by Mg-deficiency, the effect of Mg2+ deficiency (0, 0.4, 0.7 mM) on the metabolism of H2O2 was investigated in cultured chick embryo hepatocytes. After being cultured in the media with various concentrations of Mg2+ for 1, 2, 4, 6 and 10 days, parameters of H2O2 production, catalase activity, lipid peroxidation, intracellular total Mg and cell viability were analyzed. Results demonstrated that long-term incubation of chick embryo hepatocyte in extracellular Mg2+-deprivative and Mg2+-deficient (0.4 mM) states significantly enhanced the production of H2O2 (approximately twofold, respectively) and lipid peroxidation in the cell cultures, while decreasing the cell viability. Additionally, the reversing action of Mg2+ re-added to 1.0 mM and the partial reversing action of dimethylthiourea suggested that (i) [Mg2+]e deficiency induced the increase of H2O2 production, (ii) [Mg2+]e deficiency decreased catalase activity in chick embryo hepatocyte in vitro, subsequently causing oxidative stress and cell peroxidative damage.", "Commercial production of carotenoids from microorganisms competes mainly with synthetic manufacture by chemical procedures. Efficient stimulation of carotenoid biosynthesis is expected to promote accumulation of carotenoid by microbes. This review describes the variety of environmental and cultural stimulants studied during the last few decades which enhance volumetric production and cellular accumulation of commercially important carotenoids from microalgae, fungi and bacteria. Stimulation of carotenoid production by white-light illumination and temperature fluctuation is discussed along with supplementation of metal ions, salts, organic solvents, preformed precursors and several other chemicals in the culture broth. Reports on the improvements in yield are reviewed and assessed from a biotechnology point of view.", "Lack of magnesium suppresses cell growth, but the molecular mechanism is not examined in detail. We examined the effect of extracellular magnesium deficiency on cell cycle progression and the expression of cell cycle regulators in renal epithelial NRK-52E cells. In synchronized cells caused by serum-starved method, over 80% cells were distributed in G1 phase. Cell proliferation and percentage of the cells in S phase in the presence of MgCl(2) were higher than those in the absence of MgCl(2) , suggesting that magnesium is involved in the cell cycle progression from G1 to S phase. After serum addition, the expression levels of p21(Cip1) and p27(Kip1) in the absence of MgCl(2) were higher than those in the presence of MgCl(2) . The exogenous expression of p21(Cip1) or p27(Kip1) increased the percentage in G1 phase, whereas it decreased that in S phase. The mRNA levels and promoter activities of p21(Cip1) and p27(Kip1) in the absence of MgCl(2) were higher than those in the presence of MgCl(2) . The phosphorylated p53 (p-p53) level was decreased by MgCl(2) addition. Pifithrin-α, a p53 inhibitor, decreased the p-p53, p21(Cip1) and p27(Kip1) levels, and the percentage in G1 phase in the absence of MgCl(2) . Rotenone, a mitochondrial respiratory inhibitor, decreased ATP content and increased the p-p53 level in the presence of MgCl(2) . Together, lack of magnesium may increase p21(Cip1) and p27(Kip1) levels mediated by the decrease in ATP content and the activation of p53, resulting in the suppression of cell cycle progression from G1 to S phase in NRK-52E cells." ]
Cortico-striatal and cortico-cerebellar functional connectivity in developmental coordination disorder
Developmental dyslexia (DD) and developmental coordination disorder (DCD) are distinct diagnostic disorders. However, they also frequently co-occur and may share a common etiology. It was proposed conceptually a neural network framework that explains differences and commonalities between DD and DCD through impairments of distinct or intertwined cortico-subcortical connectivity pathways. The present study addressed this issue by exploring intrinsic cortico-striatal and cortico-cerebellar functional connectivity in a large (
[ "Comorbidity, co-occurrence and continuum are three terms used when referring to developmental problems such as Developmental Coordination Disorder (DCD), but they can be confusing and misleading. Further, the terms can be upsetting to parents, and are not always helpful in guiding the selection of clinical interventions. The main purpose of this paper is to question some of the terminology we employ when referring to DCD and other developmental problems. A secondary purpose is to discuss some of the conceptual frameworks that have been proposed that attempt to address the issue of the interrelationships among developmental problems. The terminology is examined by first referring to the basic dictionary definitions. Second, data we have published that relate to the issues of co-occurrence and continuum are reviewed in light of the terminology questions. Finally, we review some alternative conceptual frameworks which more accurately describe the relationships among developmental problems. The term 'comorbidity' has limited relevance to developmental problems, and its use is questionable. In contrast, co-occurrence and continuum are more useful terms to use in regard to developmental problems. Concepts such as atypical brain development and minor neurological dysfunction provide some possible explanations for the increased levels of co-occurrence of developmental disorders in children who are more severely affected.", "During the past 30 years, research into developmental disorders has fragmented, emphasizing differences rather than commonalities. We propose that reunification might be achieved by using a \"neural-systems\" approach. Deficits in dyslexia are attributed to an intact declarative learning system combined with an impaired procedural learning system--a network that includes prefrontal language systems and basal ganglia, parietal and cerebellar structures. A typology is provided for other prevalent learning disabilities; this framework focuses on different learning skills in the understanding of learning disabilities and emphasizes the diagnostic significance of \"secondary\" symptoms. This approach highlights the need for development of \"neurocognitive\" tests to probe the function of components of each neural system and improve strategies for explanation, diagnosis and support of developmental disorders.", "There is strong converging evidence suggesting that developmental dyslexia stems from a phonological processing deficit. However, this hypothesis has been challenged by the widely admitted heterogeneity of the dyslexic population, and by several reports of dyslexic individuals with no apparent phonological deficit. In this paper, we discuss the hypothesis that a phonological deficit may not be the only core deficit in developmental dyslexia and critically examine several alternative proposals. To establish that a given cognitive deficit is causally related to dyslexia, at least two conditions need to be fulfilled. First, the hypothesized deficit needs to be associated with developmental dyslexia independently of additional phonological deficits. Second, the hypothesized deficit must predict reading ability, on both empirical and theoretical grounds. While most current hypotheses fail to fulfil these criteria, we argue that the visual attentional deficit hypothesis does. Recent studies providing evidence for the independence of phonological and visual attentional deficits in developmental dyslexia are reviewed together with empirical data showing that phonological and visual attentional processing skills contribute independently to reading performance. A theoretical model of reading is outlined in support of a causal link between a visual attentional disorder and a failure in reading acquisition.", "To better understand the neural and performance factors that may underlie developmental coordination disorder (DCD), and implications for a multi-component account. A systematic review of the experimental literature published between June 2011 and September 2016 was conducted using a modified PICOS (population, intervention, comparison, outcomes, and study type) framework. A total of 106 studies were included. Behavioural data from 91 studies showed a broad cluster of deficits in the anticipatory control of movement, basic processes of motor learning, and cognitive control. Importantly, however, performance issues in DCD were often shown to be moderated by task type and difficulty. As well, we saw new evidence of compensatory processes and strategies in several studies. Neuroimaging data (15 studies, including electroencephalography) showed reduced cortical thickness in the right medial orbitofrontal cortex and altered brain activation patterns across functional networks involving prefrontal, parietal, and cerebellar regions in children with DCD than those in comparison groups. Data from diffusion-weighted magnetic resonance imaging suggested reduced white matter organization involving sensorimotor structures and altered structural connectivity across the whole brain network. Taken together, results support the hypothesis that children with DCD show differences in brain structure and function compared with typically developing children. Behaviourally, these differences may affect anticipatory planning and reduce automatization of movement skill, prompting greater reliance on slower feedback-based control and compensatory strategies. Implications for future research, theory development, and clinical practice are discussed.", "The classic neurologic model for reading, based on studies of patients with acquired alexia, hypothesizes functional linkages between the angular gyrus in the left hemisphere and visual association areas in the occipital and temporal lobes. The angular gyrus also is thought to have functional links with posterior language areas (e.g., Wernicke's area), because it is presumed to be involved in mapping visually presented inputs onto linguistic representations. Using positron emission tomography , we demonstrate in normal men that regional cerebral blood flow in the left angular gyrus shows strong within-task, across-subjects correlations (i.e., functional connectivity) with regional cerebral blood flow in extrastriate occipital and temporal lobe regions during single word reading. In contrast, the left angular gyrus is functionally disconnected from these regions in men with persistent developmental dyslexia, suggesting that the anatomical disconnection of the left angular gyrus from other brain regions that are part of the \"normal\" brain reading network in many cases of acquired alexia is mirrored by its functional disconnection in developmental dyslexia.", "Previous research investigating children with Developmental Coordination Disorder (DCD) has consistently reported increased intra- and inter-individual variability during motor skill performance. Statistically characterizing this variability is not only critical for the analysis and interpretation of behavioral data, but also may facilitate our understanding of the processes underlying DCD. Thus, the primary purpose of this research was to demonstrate the utility of a flexible statistical technique, a random coefficient model (RCM), that characterizes the increased intra- and inter-individual variability in children with and without DCD. We analyzed data from a sensorimotor adaptation task during which participants executed discrete aiming movements under conditions of rotated visual feedback. To highlight the advantages of this statistical approach, we contrasted the results from the RCM with those from a traditionally employed general linear model (GLM). The RCM revealed differences between the two groups of children that the GLM did not detect; and, characterized trajectories of change for each individual. The RCM provides researchers an opportunity to probe behavioral deficits at the individual level and may provide new insights into the behavioral heterogeneity in children with DCD.", "Postural control is a fundamental component of action in which deficits have been shown to contribute to motor difficulties in children with developmental coordination disorder (DCD). The purpose of this study was to examine anticipatory postural adjustments (APAs) in children with DCD in a bimanual load-lifting task. Sixteen children with reported motor problems (two females, 14 males; mean age 9 y; SD 2 y) and 16 typically developing, age-matched children (six females, 10 males; mean age 9 y; SD 2 y) took part in the study. The task required the children to maintain a stable elbow angle, despite imposed or voluntary unloading of the forearm. APAs were assessed using electromyography and kinematics analysis. Although children with DCD could compensate for the consequences of unloading, the results demonstrated that APAs were less efficient in children with DCD than in typically developing children. A positive and significant coefficient of regression between the flexor inhibition latency and the postural stabilization was only found in typically developing children. The impaired fine-tuning of the muscle contribution and the poor stabilization performances demonstrate poor predictive modelling in DCD." ]
X-ray crystallographic study of protein kinase PIM-1 with three inhibitors
We performed an X-ray crystallographic study of complexes of protein kinase PIM-1 with three inhibitors comprising an adenosine mimetic moiety, a linker, and a peptide-mimetic (d-Arg)
[ "A systematic analysis reveals that out of 20 protein kinases examined, specific for either Ser/Thr or Tyr, the majority are extremely sensitive to staurosporine, with IC50 values in the low nanomolar range. A few of them however, notably protein kinases CK1 and CK2, mitogen-activated protein (MAP) kinase and protein-tyrosine kinase CSK, are relatively refractory to staurosporine inhibition, exhibiting IC50 values in the micromolar range. With all protein kinases tested, namely PKA, CK1, CK2, MAP kinase (ERK-1), c-Fgr, Lyn, CSK and TPK-IIB/p38Syk, staurosporine inhibition was competitive with respect to ATP, regardless of its inhibitory power. In contrast, either uncompetitive or noncompetitive kinetics of inhibition with respect to the phosphoacceptor substrate were exhibited by Ser/Thr and Tyr-specific protein kinases, respectively, consistent with a different mechanism of catalysis by these two sub-families of kinases. Computer modeling based on PKA crystal structure in conjunction with sequence analysis suggest that the low sensitivity to staurosporine of CK2 may be accounted for by the bulky nature of three residues, Val66, Phe113 and Ile174 which are homologous to PKA Ala70, Met120 and Thr183, respectively. In contrast these PKA residues are either conserved or replaced by smaller ones in protein kinases highly sensitive to staurosporine inhibition. On the other hand, His160 which is homologous to PKA Glu170, appears to be responsible for the unique behaviour of CK2 with respect to a staurosporine derivative (CGP44171A) bearing a negatively charged benzoyl substituent: while CGP44171A is 10- 100-fold less effective than staurosporine against PKA and most of the other protein kinases tested, it is actually more effective than staurosporine for CK2 inhibition, but it looses part of its efficacy if it is tested on a CK2 mutant (H160D) in which His160 has been replaced by Asp. It can be concluded from these data that the catalytic sites of protein kinases are divergent enough as to allow a competitive inhibitor like staurosporine to be fairly selective, a feature that can be enhanced by suitable modifications designed based on the structure of the catalytic site of the kinase.", "Glioblastoma (GBM) is the most common and aggressive brain tumor and is associated with poor prognosis. GBM cells are frequently resistant to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and finding new combinatorial therapies to sensitize glioma cells to TRAIL remains an important challenge. PIM kinases are serine/threonine kinases that promote cell survival and proliferation and are highly expressed in different tumors. In this work, we studied the role of PIM kinases as regulators of TRAIL sensitivity in GBM cells. Remarkably, PIM inhibition or knockdown facilitated activation by TRAIL of a TRAIL-R2/DR5-mediated and mitochondria-operated apoptotic pathway in TRAIL-resistant GBM cells. The sensitizing effect of PIM knockdown on TRAIL-induced apoptosis was mediated by enhanced caspase-8 recruitment to and activation at the death-inducing signaling complex (DISC). Interestingly, TRAIL-induced internalization of TRAIL-R2/DR5 was significantly reduced in PIM knockdown cells. Phospho-proteome profiling revealed a decreased phosphorylation of p62/SQSTM1 after PIM knockdown. Our results also showed an interaction between p62/SQSTM1 and the DISC that was reverted after PIM knockdown. In line with this, p62/SQSTM1 ablation increased TRAIL-R2/DR5 levels and facilitated TRAIL-induced caspase-8 activation, revealing an inhibitory role of p62/SQSTM1 in TRAIL-mediated apoptosis in GBM. Conversely, upregulation of TRAIL-R2/DR5 upon PIM inhibition and apoptosis induced by the combination of PIM inhibitor and TRAIL were abrogated by a constitutively phosphorylated p62/SQSTM1S332E mutant. Globally, our data represent the first evidence that PIM kinases regulate TRAIL-induced apoptosis in GBM and identify a specific role of p62/SQSTM1Ser332 phosphorylation in the regulation of the extrinsic apoptosis pathway activated by TRAIL.", "PIM2 (proviral integration site for Moloney murine leukemia virus 2) kinase plays an important role as an oncogene in multiple cancers, such as leukemia, liver, lung, myeloma, prostate and breast cancers. PIM2 is largely expressed in both leukemia and solid tumors, and it promotes the transcriptional activation of genes involved in cell survival, cell proliferation, and cell-cycle progression. Many tumorigenic signaling molecules have been identified as substrates for PIM2 kinase, and a variety of inhibitors have been developed for its kinase activity, including SMI-4a, SMI-16a, SGI-1776, JP11646 and DHPCC-9. Here, we summarize the signaling pathways involved in PIM2 kinase regulation and PIM2 mechanisms in various neoplastic diseases. We also discuss the current status and future perspectives for the development of PIM2 kinase inhibitors to combat human cancer, and PIM2 will become a therapeutic target in cancers in the future.", "Structural coverage of the human kinome has been steadily increasing over time. The structures provide valuable insights into the molecular basis of kinase function and also provide a foundation for understanding the mechanisms of kinase inhibitors. There are a large number of kinase structures in the PDB for which the Asp and Phe of the DFG motif on the activation loop swap positions, resulting in the formation of a new allosteric pocket. We refer to these structures as \"classical DFG-out\" conformations in order to distinguish them from conformations that have also been referred to as DFG-out in the literature but that do not have a fully formed allosteric pocket. We have completed a structural analysis of almost 200 small molecule inhibitors bound to classical DFG-out conformations; we find that they are recognized by both type I and type II inhibitors. In contrast, we find that nonclassical DFG-out conformations strongly select against type II inhibitors because these structures have not formed a large enough allosteric pocket to accommodate this type of binding mode. In the course of this study we discovered that the number of structurally validated type II inhibitors that can be found in the PDB and that are also represented in publicly available biochemical profiling studies of kinase inhibitors is very small. We have obtained new profiling results for several additional structurally validated type II inhibitors identified through our conformational analysis. Although the available profiling data for type II inhibitors is still much smaller than for type I inhibitors, a comparison of the two data sets supports the conclusion that type II inhibitors are more selective than type I. We comment on the possible contribution of the DFG-in to DFG-out conformational reorganization to the selectivity.", "Cell-penetrating peptide (CPP) can directly penetrate the cytosol (cytolysis) and is expected to be a potent vector for a drug delivery system (DDS). Although there is general agreement that CPP cytolysis is related to dynamic membrane deformation, a distinctive process has yet to be established. Here, we report the key process and factors controlling CPP cytolysis. To elucidate the task, we have introduced trypsin digestion of adsorbed CPP onto giant unilamellar vesicle (GUV) to quantify the adsorption and internalization (cytolysis) separately. Also, the time-course analysis was introduced for the geometric calculation of adsorption and internalization amount per lipid molecule consisting of GUV. As a result, we found that adsorption and internalization assumed to occur successively by CPP molecule come into contact with membrane lipid. Adsorption is quick to saturate within 10 min, while cytolysis of each CPP on the membrane follows successively. After adsorption is saturated, cytolysis proceeds further linearly by time with a different rate constant that is dependent on the osmotic pressure. We also found that temperature and lipid composition influence cytolysis by modulating lipid mobility. The electrolyte in the outer media is also affected as a chemical mediator to control CPP cytolysis by following the Hoffmeister effect for membrane hydration. These results confirmed the mechanism of cytolysis as temporal and local phase transfer of membrane lipid from Lα to Mesh1, which has punctured bilayer morphologies.", "Cationic cell-penetrating peptides have been widely used to enhance the intracellular delivery of various types of cargoes, such as drugs and proteins. These reagents are chemically similar to the multi-basic peptides that are known to be potent proprotein convertase inhibitors. Here, we report that both HIV-1 TAT47-57 peptide and the Chariot reagent are micromolar inhibitors of furin activity in vitro. In agreement, HIV-1 TAT47-57 reduced HT1080 cell migration, thought to be mediated by proprotein convertases, by 25%. In addition, cyclic polyarginine peptides containing hydrophobic moieties which have been previously used as transfection reagents also exhibited potent furin inhibition in vitro and also inhibited intracellular convertases. Our finding that cationic cell-penetrating peptides exert potent effects on cellular convertase activity should be taken into account when biological effects are assessed.", "Hundreds of small RNAs of approximately 22 nucleotides, collectively named microRNAs (miRNAs), have been discovered recently in animals and plants. Although their functions are being unravelled, their mechanism of biogenesis remains poorly understood. miRNAs are transcribed as long primary transcripts (pri-miRNAs) whose maturation occurs through sequential processing events: the nuclear processing of the pri-miRNAs into stem-loop precursors of approximately 70 nucleotides (pre-miRNAs), and the cytoplasmic processing of pre-miRNAs into mature miRNAs. Dicer, a member of the RNase III superfamily of bidentate nucleases, mediates the latter step, whereas the processing enzyme for the former step is unknown. Here we identify another RNase III, human Drosha, as the core nuclease that executes the initiation step of miRNA processing in the nucleus. Immunopurified Drosha cleaved pri-miRNA to release pre-miRNA in vitro. Furthermore, RNA interference of Drosha resulted in the strong accumulation of pri-miRNA and the reduction of pre-miRNA and mature miRNA in vivo. Thus, the two RNase III proteins, Drosha and Dicer, may collaborate in the stepwise processing of miRNAs, and have key roles in miRNA-mediated gene regulation in processes such as development and differentiation." ]
Perinatal exposure to mono-butyl phthalate affects follicle-stimulating hormone, testosterone, and inhibin B levels in male infants
Phthalates affect development of male reproductive system acting as an antiandrogenic agents. We sought to explore if perinatal exposure to phthalates could alter male hormone levels in humans during the first months of life. A cohort of 83 pregnant women and their male infants were studied. Five phthalate metabolites were measured in the mother's urine during the first, second, and third trimesters of pregnancy and during the first, third, and sixth months of life in the infants. Luteinizing hormone (LH), follicle-stimulating hormone (FSH), testosterone and inhibin B were analyzed. Association between phthalate exposure and hormone variation was assessed using regression models for longitudinal data. Mono-butyl phthalate reduced FSH concentration (ß = -0.0012 international units [IU]/L,
[ "Using a novel and highly selective technique, we measured monoester metabolites of seven commonly used phthalates in urine samples from a reference population of 289 adult humans. This analytical approach allowed us to directly measure the individual phthalate metabolites responsible for the animal reproductive and developmental toxicity while avoiding contamination from the ubiquitous parent compounds. The monoesters with the highest urinary levels found were monoethyl phthalate (95th percentile, 3,750 ppb, 2,610 microg/g creatinine), monobutyl phthalate (95th percentile, 294 ppb, 162 microg/g creatinine), and monobenzyl phthalate (95th percentile, 137 ppb, 92 microg/g creatinine), reflecting exposure to diethyl phthalate, dibutyl phthalate, and benzyl butyl phthalate. Women of reproductive age (20-40 years) were found to have significantly higher levels of monobutyl phthalate, a reproductive and developmental toxicant in rodents, than other age/gender groups (p < 0.005). Current scientific and regulatory attention on phthalates has focused almost exclusively on health risks from exposure to only two phthalates, di-(2-ethylhexyl) phthalate and di-isononyl phthalate. Our findings strongly suggest that health-risk assessments for phthalate exposure in humans should include diethyl, dibutyl, and benzyl butyl phthalates.", "Daily administration of 2g/kg/day di(2-ethylhexyl)phthalate (DEHP) to immature rats was found to cause testicular atrophy and reduce zinc concentration. Specific activities of testicular enzymes associated with postmeiotic spermatogenic cells, such as lactate dehydrogenase isozyme-X, hyaluronidase and sorbitol dehydrogenase, were lower than those of control by day 10, coincident with degeneration of spermatogenic cells. The specific activities of enzymes associated with premeiotic spermatogenic cells, Sertoli cells or interstitial cells (beta-glucuronidase, gamma-glutamyl transpeptidase and malate dehydrogenase) were higher than those of control by day 10. The specific activities of alcohol dehydrogenase and aldolase, zinc containing enzymes, increased after DEHP treatment in spite of the decrease in zinc concentration in the testis. In conclusion, changes in several testicular cell-specific enzymes appear to be useful biochemical markers of testicular injury induced by testicular toxicants such as DEHP. However, these changes occurred after or simultaneous with massive histological or morphological changes rather than prior to such changes.", "The current United States Environmental Protection Agency (EPA) classification of di(2-ethylhexyl)phthalate (DEHP) as a B2 \"probable human\" carcinogen is based on outdated information. New toxicology data and a considerable amount of new mechanistic evidence were used to reconsider the cancer classification of DEHP under EPA's proposed new cancer risk assessment guidelines. The total weight-of-evidence clearly indicates that DEHP is not genotoxic. In vivo administration of DEHP to rats and mice results in peroxisome proliferation in the liver, and there is strong evidence and scientific consensus that, in rodents, peroxisome proliferation is directly associated with the onset of liver cancer. Peroxisome proliferation is a transcription-mediated process that involves activation by the peroxisome proliferator of a nuclear receptor in rodent liver called the peroxisome proliferator-activated receptor (PPARalpha). The critical role of PPARalpha in peroxisomal proliferation and carcinogenicity in mice is clearly established by the lack of either response in mice genetically modified to remove the PPARalpha. Several mechanisms have been proposed to explain how, in rodents, peroxisome proliferation can lead to the formation of hepatocellular tumors. The general consensus of scientific opinion is that PPARalpha-induced mitogenesis and cell proliferation are probably the major mechanisms responsible for peroxisome proliferator-induced hepatocarcinogenesis in rodents. Oxidative stress appears to play a significant role in this increased cell proliferation. It triggers the release of TNFalpha by Kupffer cells, which in turn acts as a potent mitogen in hepatocytes. Rats and mice are uniquely responsive to the morphological, biochemical, and chronic carcinogenic effects of peroxisome proliferators, while guinea pigs, dogs, nonhuman primates, and humans are essentially nonresponsive or refractory; Syrian hamsters exhibit intermediate responsiveness. These differences are explained, in part, by marked interspecies variations in the expression of PPARalpha, with levels of expression in humans being only 1-10% of the levels found in rat and mouse liver. Recent studies of DEHP clearly indicate a nonlinear dose-response curve that strongly suggests the existence of a dose threshold below which tumors in rodents are not induced. Thus, the hepatocarcinogenic effects of DEHP in rodents result directly from the receptor-mediated, threshold-based mechanism of peroxisome proliferation, a well-understood process associated uniquely with rodents. Since humans are quite refractory to peroxisomal proliferation, even following exposure to potent proliferators such as hypolipidemic drugs, it is concluded that the hepatocarcinogenic response of rodents to DEHP is not relevant to human cancer risk at any anticipated exposure level. DEHP should be classified an unlikely human carcinogen with a margin of exposure (MOE) approach to risk assessment. The most appropriate and conservative point of reference for assessing MOEs should be 20 mg/kg/day, which is the mouse NOEL for peroxisome proliferation and increased liver weight. Exposure of the general human population to DEHP is approximately 30 microg/kg body wt/day, the major source being from residues in food. Higher exposures occur occupationally [up to about 700 microg/kg body wt/day (mainly by inhalation) based on current workplace standards] and through use of certain medical devices [e.g., up to 457 microg/kg body wt/day for hemodialysis patients (intravenous)], although these have little relevance because the routes of exposure bypass critical activation enzymes in the gastrointestinal tract.", "Phthalate diesters are commonly used and have been well established as environmental endocrine disruptors. However, few studies have examined their effects on sex steroid hormones in children. We followed children over time to examine the association between pre- and post-natal phthalate exposure and sex steroid hormone levels at 2, 5, 8, and 11 years of age. We recruited 430 pregnant women from central Taiwan from 2000 to 2001 and assessed their children at birth, 2, 5, 8, and 11 years of age. We studies children with at least one measurement for both phthalate and hormone levels during each any of the follow-up time point (n = 193). Estradiol, free testosterone, testosterone, and progesterone were measured from venous blood. Three monoesters of di-2-ethylhexyl phthalate (DEHP), mono-benzyl phthalate, mono-n-butyl phthalate, mono-ethyl phthalate, and mono-methyl phthalate were measured in maternal urine collected during the 3rd trimester and child urine collected at each follow-up point. The sum of mono-2-ethylhexyl phthalate (∑MEHP) was calculated by summing the concentrations of the three DEHP monoesters. Generalized estimating equation regression analysis with repeated measures was used to estimate associations between phthalate metabolites and hormone levels. After adjustment for potential confounders, maternal ∑MEHP level was associated with decreased levels of progesterone in girls (β = -0.309 p = 0.001). The child ∑MEHP concentration was associated with decreased levels of progesterone for girls (β = -0.194, p = 0.003) and with decreased levels of free testosterone for boys (β = -0.124, p = 0.004). Early-life DEHP exposure may alter sex steroid hormones of children over time, which may pose potential reproductive health risks.", "Several members of the phthalate ester family have antiandrogenic properties, yet little is known about how exposure to these ubiquitous environmental contaminants early in development may affect sexual development. We conducted experiments to determine effects of in utero and lactational exposure to the most prevalent phthalate ester, di(2-ethylhexyl) phthalate (DEHP), on male reproductive system development and sexual behavior. Sprague-Dawley rats were dosed with corn oil or DEHP (0, 375, 750, or 1,500 mg/kg/day, per os) from gestation day 3 through postnatal day (PND) 21. Dose-related effects on male offspring included reduced anogenital distance, areola and nipple retention, undescended testes, and permanently incomplete preputial separation. Testis, epididymis, glans penis, ventral prostate, dorsolateral prostate, anterior prostate, and seminal vesicle weights were reduced at PND 21, 63, and/or 105-112. Additional dose-related effects included a high incidence of anterior prostate agenesis, a lower incidence of partial or complete ventral prostate agenesis, occasional dorsolateral prostate and seminal vesicle agenesis, reduced sperm counts, and testicular, epididymal, and penile malformations. Many DEHP-exposed males were sexually inactive in the presence of receptive control females, but sexual inactivity did not correlate with abnormal male reproductive organs. These results suggest that in utero and lactational DEHP exposure also inhibited sexually dimorphic central nervous system development. No major abnormalities were found in any of eight control litters, but DEHP caused severe male reproductive system toxicity in five of eight litters at 375 mg/kg/day, seven of eight litters at 750 mg/kg/day, and five of five litters at 1,500 mg/kg/day. These results demonstrate that the male reproductive system is far more sensitive to DEHP early in development than when animals are exposed as juveniles or adults. The effects of DEHP on male reproductive organs and sexual behaviors and the lack of significant effects on time to vaginal opening and first estrus in their littermates demonstrate that DEHP (and/or its metabolites) affects development of the male reproductive system primarily by acting as an antiandrogen. The pattern of effects of in utero and lactational DEHP exposure differed from patterns caused by other phthalate esters, and the preponderance of anterior prostate agenesis appears to be unique among all chemicals. These results suggest that DEHP acts partly by mechanisms distinct from those of other antiandrogens.", "Phthalate esters (PE) such as DEHP are high production volume plasticizers used in vinyl floors, food wraps, cosmetics, medical products, and toys. In spite of their widespread and long-term use, most PE have not been adequately tested for transgenerational reproductive toxicity. This is cause for concern, because several recent investigations have shown that DEHP, BBP, DBP, and DINP disrupt reproductive tract development of the male rat in an antiandrogenic manner. The present study explored whether the antiandrogenic action of DEHP occurs by (1) inhibiting testosterone (T) production, or by (2) inhibiting androgen action by binding to the androgen receptor (AR). Maternal DEHP treatment at 750 mg/kg/day from gestational day (GD) 14 to postnatal day (PND) 3 caused a reduction in T production, and reduced testicular and whole-body T levels in fetal and neonatal male rats from GD 17 to PND 2. As a consequence, anogenital distance (AGD) on PND 2 was reduced by 36% in exposed male, but not female, offspring. By GD 20, DEHP treatment also reduced testis weight. Histopathological evaluations revealed that testes in the DEHP treatment group displayed enhanced 3ss-HSD staining and increased numbers of multifocal areas of Leydig cell hyperplasia as well as multinucleated gonocytes as compared to controls at GD 20 and PND 3. In contrast to the effects of DEHP on T levels in vivo, neither DEHP nor its metabolite MEHP displayed affinity for the human androgen receptor at concentrations up to 10 microM in vitro. These data indicate that DEHP disrupts male rat sexual differentiation by reducing T to female levels in the fetal male rat during a critical stage of reproductive tract differentiation." ]
Autophagosome Maturation and Pathophysiology
Autophagy is a versatile degradation system for maintaining cellular homeostasis whereby cytosolic materials are sequestered in a double-membrane autophagosome and subsequently delivered to lysosomes, where they are broken down. In multicellular organisms, newly formed autophagosomes undergo a process called 'maturation', in which they fuse with vesicles originating from endolysosomal compartments, including early/late endosomes and lysosomes, to form amphisomes, which eventually become degradative autolysosomes. This fusion process requires the concerted actions of multiple regulators of membrane dynamics, including SNAREs, tethering proteins and RAB GTPases, and also transport of autophagosomes and late endosomes/lysosomes towards each other. Multiple mechanisms modulate autophagosome maturation, including post-translational modification of key components, spatial distribution of phosphoinositide lipid species on membranes, RAB protein dynamics, and biogenesis and function of lysosomes. Nutrient status and various stresses integrate into the autophagosome maturation machinery to coordinate the progression of autophagic flux. Impaired autophagosome maturation is linked to the pathogenesis of various human diseases, including neurodegenerative disorders, cancer and myopathies. Furthermore, invading pathogens exploit various strategies to block autophagosome maturation, thus evading destruction and even subverting autophagic vacuoles (autophagosomes, amphisomes and autolysosomes) for survival, growth and/or release. Here, we discuss the recent progress in our understanding of the machinery and regulation of autophagosome maturation, the relevance of these mechanisms to human pathophysiology and how they are harnessed by pathogens for their benefit. We also provide perspectives on targeting autophagosome maturation therapeutically.
[ "Transverse (T)-tubules make-up a specialized network of tubulated muscle cell membranes involved in excitation-contraction coupling for power of contraction. Little is known about how T-tubules maintain highly organized structures and contacts throughout the contractile system despite the ongoing muscle remodeling that occurs with muscle atrophy, damage and aging. We uncovered an essential role for autophagy in T-tubule remodeling with genetic screens of a developmentally regulated remodeling program in Drosophila abdominal muscles. Here, we show that autophagy is both upregulated with and required for progression through T-tubule disassembly stages. Along with known mediators of autophagosome-lysosome fusion, our screens uncovered an unexpected shared role for Rab2 with a broadly conserved function in autophagic clearance. Rab2 localizes to autophagosomes and binds to HOPS complex members, suggesting a direct role in autophagosome tethering/fusion. Together, the high membrane flux with muscle remodeling permits unprecedented analysis both of T-tubule dynamics and fundamental trafficking mechanisms.", "Autophagy is used to degrade components of the cytoplasm and functions as a cell survival mechanism during nutrient deprivation. Autophagic structures have also been observed in many types of dying cells, but experimental evidence for autophagy playing a role in the regulation of programmed cell death is limited. We have recently shown that the autophagy genes Atg7 and Beclin1 are required for the death of certain cells, thus demonstrating that this mechanism of proteolysis is involved in both survival and death. The factors that enable autophagy to regulate distinct cell survival and death responses are not clear, and future work is needed to determine the mechanism(s) that regulate autophagic cell death.", "Selective autophagy is a quality control pathway through which cellular components are sequestered into double-membrane vesicles and delivered to specific intracellular compartments. This process requires autophagy receptors that link cargo to growing autophagosomal membranes. Selective autophagy is also implicated in various membrane trafficking events. Here we discuss the current view on how cargo selection and transport are achieved during selective autophagy, and point out molecular mechanisms that are congruent between autophagy and vesicle trafficking pathways.", "GTP activates the interaction between the synaptic vesicle proteins rabphilin and rab3. This raises the question of whether rabphilin is a resident vesicle protein that recruits rab3 in a stage-dependent fashion, or if it is instead an effector protein recruited by rab3. We now show that rabphilin, like rab3, dissociates from synaptic vesicles after exocytosis in a manner requiring both Ca2+ and membrane fusion. Rabphilin interacts with GTP-rab3 via a N-terminal domain comprising a novel Zn2+(-)finger motif, and this interaction is essential for rabphilin binding to synaptic vesicles. Thus, in the same way that ras recruits raf to the plasma membrane, rab3 reversibly recruits rabphilin to synaptic vesicles in a stage-dependent manner. These results reveal an unexpected similarity between the molecular mechanisms by which small G protein function in recruiting effector proteins to membranes during membrane traffic and signal transduction.", "Autophagy is essential for maintaining cellular homeostasis in neurons, where autophagosomes undergo robust unidirectional retrograde transport along axons. We find that the motor scaffolding protein JIP1 binds directly to the autophagosome adaptor LC3 via a conserved LIR motif. This interaction is required for the initial exit of autophagosomes from the distal axon, for sustained retrograde transport along the midaxon, and for autophagosomal maturation in the proximal axon. JIP1 binds directly to the dynein activator dynactin but also binds to and activates kinesin-1 in a phosphorylation-dependent manner. Following JIP1 depletion, phosphodeficient JIP1-S421A rescues retrograde transport, while phosphomimetic JIP1-S421D aberrantly activates anterograde transport. During normal autophagosome transport, residue S421 of JIP1 may be maintained in a dephosphorylated state by autophagosome-associated MKP1 phosphatase. Moreover, binding of LC3 to JIP1 competitively disrupts JIP1-mediated activation of kinesin. Thus, dual mechanisms prevent aberrant activation of kinesin to ensure robust retrograde transport of autophagosomes along the axon.", "Autophagy is a catabolic 'self-eating' pathway that is emerging as a crucial integration point in cell physiology. With its own set of genes, the autophagy pathway communicates with virtually all signalling networks and organelles. Recent advances have been made in understanding the origin of the autophagosomal membrane, novel regulators, and the mechanisms by which specific intracellular membranes become autophagy substrates. New studies on noncanonical autophagy, mediated by subsets of autophagy proteins, and the role of autophagy proteins in non-autophagy pathways are also emerging in many different biological contexts. Our understanding of canonical autophagy, including membrane origin and autophagy proteins, needs to be considered together with emerging noncanonical pathways.", "The ability of cells to respond to changes in nutrient availability is essential for the maintenance of metabolic homeostasis and viability. One of the key cellular responses to nutrient withdrawal is the upregulation of autophagy. Recently, there has been a rapid expansion in our knowledge of the molecular mechanisms involved in the regulation of mammalian autophagy induction in response to depletion of key nutrients. Intracellular amino acids, ATP, and oxygen levels are intimately tied to the cellular balance of anabolic and catabolic processes. Signaling from key nutrient-sensitive kinases mTORC1 and AMP-activated protein kinase (AMPK) is essential for the nutrient sensing of the autophagy pathway. Recent advances have shown that the nutrient status of the cell is largely passed on to the autophagic machinery through the coordinated regulation of the ULK and VPS34 kinase complexes. Identification of extensive crosstalk and feedback loops converging on the regulation of ULK and VPS34 can be attributed to the importance of these kinases in autophagy induction and maintaining cellular homeostasis.", "During the process of autophagy, autophagosomes undergo a maturation process consisting of multiple fusions with endosomes and lysosomes, which provide an acidic environment and digestive function to the interior of the autophagosome. Here we found that a fusion protein of monomeric red-fluorescence protein and LC3, the most widely used marker for autophagosomes, exhibits a quite different localization pattern from that of GFP-LC3. GFP-LC3 loses fluorescence due to lysosomal acidic and degradative conditions but mRFP-LC3 does not, indicating that the latter can label the autophagic compartments both before and after fusion with lysosomes. Taking advantage of this property, we devised a novel method for dissecting the maturation process of autophagosomes. mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) showed a GFP and mRFP signal before the fusion with lysosomes, and exhibited only the mRFP signal subsequently. Using this method, we provided evidence that overexpression of a dominant negative form of Rab7 prevented the fusion of autophagosomes with lysosomes, suggesting that Rab7 is involved in this step. This method will be of general utility for analysis of the autophagosome maturation process.", "The endocytic and autophagic pathways are involved in the membrane trafficking of exogenous and endogenous materials to lysosomes. However, the mechanisms that regulate these pathways are largely unknown. We previously reported that Rubicon, a Beclin 1-binding protein, negatively regulates both the autophagic and endocytic pathways by unidentified mechanisms. In this study, we performed database searches to identify potential Rubicon homologues that share the common C-terminal domain, termed the RH domain. One of them, PLEKHM1, the causative gene of osteopetrosis, also suppresses endocytic transport but not autophagosome maturation. Rubicon and PLEKHM1 specifically and directly interact with Rab7 via their RH domain, and this interaction is critical for their function. Furthermore, we show that Rubicon but not PLEKHM1 uniquely regulates membrane trafficking via simultaneously binding both Rab7 and PI3-kinase.", "Autophagy is an evolutionarily conserved process by which cytoplasmic proteins and organelles are catabolized. During starvation, the protein TOR (target of rapamycin), a nutrient-responsive kinase, is inhibited, and this induces autophagy. In autophagy, double-membrane autophagosomes envelop and sequester intracellular components and then fuse with lysosomes to form autolysosomes, which degrade their contents to regenerate nutrients. Current models of autophagy terminate with the degradation of the autophagosome cargo in autolysosomes, but the regulation of autophagy in response to nutrients and the subsequent fate of the autolysosome are poorly understood. Here we show that mTOR signalling in rat kidney cells is inhibited during initiation of autophagy, but reactivated by prolonged starvation. Reactivation of mTOR is autophagy-dependent and requires the degradation of autolysosomal products. Increased mTOR activity attenuates autophagy and generates proto-lysosomal tubules and vesicles that extrude from autolysosomes and ultimately mature into functional lysosomes, thereby restoring the full complement of lysosomes in the cell-a process we identify in multiple animal species. Thus, an evolutionarily conserved cycle in autophagy governs nutrient sensing and lysosome homeostasis during starvation." ]
The size-weight illusion: an impossible experience for somatosensation
Impossible figures represent the world in ways it cannot be. From the work of M. C. Escher to any popular perception textbook, such experiences show how some principles of mental processing can be so entrenched and inflexible as to produce absurd and even incoherent outcomes that could not occur in reality. However, impossible experiences of this sort are mostly limited to visual perception; are there "impossible figures" for other sensory modalities? Here, we import a known magic trick into the laboratory to report and investigate an impossible experience for somatosensation-one that can be physically felt. We show that, even under full-cue conditions with objects that can be freely inspected, subjects can be made to experience a single object alone as feeling heavier than a group of objects that includes the single object as a member-an impossible and phenomenologically striking experience of weight. Moreover, we suggest that this phenomenon-a special case of the size-weight illusion-reflects a kind of "anti-Bayesian" perceptual updating that amplifies a challenge to rational models of perception and cognition.
[ "Illusions are characterized by inconsistencies. For instance, in the motion aftereffect, we see motion without an equivalent change in position. We used a simple pencil-and-paper experiment to determine whether illusions that influence an object’s apparent size give rise to equivalent changes in apparent positions along the object’s outline. We found different results for two equally strong size illusions. The Ebbinghaus illusion affected perceived positions in a way that was consistent with its influence on perceived size, but a modified diagonal illusion did not affect perceived positions. This difference between the illusions might explain why there are so many conflicting reports about the effects of size illusions on the maximum grip aperture during reach-to-grasp movements.", "Over the centuries, magicians have developed extensive knowledge about the manipulation of the human mind-knowledge that has been largely ignored by psychology. It has recently been argued that this knowledge could help improve our understanding of human cognition and consciousness. But how might this be done? And how much could it ultimately contribute to the exploration of the human mind? We propose here a framework outlining how knowledge about magic can be used to help us understand the human mind. Various approaches-both old and new-are surveyed, in terms of four different levels. The first focuses on the methods in magic, using these to suggest new approaches to existing issues in psychology. The second focuses on the effects that magic can produce, such as the sense of wonder induced by seeing an apparently impossible event. Third is the consideration of magic tricks-methods and effects together-as phenomena of scientific interest in their own right. Finally, there is the organization of knowledge about magic into an informative whole, including the possibility of a science centered around the experience of wonder.", "Visual, multisensory and cognitive illusions in magic performances provide new windows into the psychological and neural principles of perception, attention, and cognition. We investigated a magic effect consisting of a coin \"vanish\" (i.e., the perceptual disappearance of a coin after a simulated toss from hand to hand). Previous research has shown that magicians can use joint attention cues such as their own gaze direction to strengthen the observers' perception of magic. Here we presented naïve observers with videos including real and simulated coin tosses to determine if joint attention might enhance the illusory perception of simulated coin tosses. The observers' eye positions were measured, and their perceptual responses simultaneously recorded via button press. To control for the magician's use of joint attention cues, we occluded his head in half of the trials. We found that subjects did not direct their gaze at the magician's face at the time of the coin toss, whether the face was visible or occluded, and that the presence of the magician's face did not enhance the illusion. Thus, our results show that joint attention is not necessary for the perception of this effect. We conclude that social misdirection is redundant and possibly detracting to this very robust sleight-of-hand illusion. We further determined that subjects required multiple trials to effectively distinguish real from simulated tosses; thus the illusion was resilient to repeated viewing.", "We investigated an individual ability to identify whether choices were made freely or forced by external parameters. We capitalized on magical setups where the notion of psychological forcing constitutes a well trodden path. In live stage magic, a magician guessed cards from spectators while inquiring how freely they thought they had made the choice. Our data showed a marked blindness in the introspection of free choice. Spectators assigned comparable ratings when choosing the card that the magician deliberately forced them compared to any other card, even in classical forcing, where the magician literally handles a card to the participant This observation was paralleled by a laboratory experiment where we observed modest changes in subjective reports by factors with drastic effect in choice. Pupil dilatation, which is known to tag slow cognitive events related to memory and attention, constitutes an efficient fingerprint to index subjective and objective aspects of choice.", "Just as vision scientists study visual art and illusions to elucidate the workings of the visual system, so too can cognitive scientists study cognitive illusions to elucidate the underpinnings of cognition. Magic shows are a manifestation of accomplished magic performers' deep intuition for and understanding of human attention and awareness. By studying magicians and their techniques, neuroscientists can learn powerful methods to manipulate attention and awareness in the laboratory. Such methods could be exploited to directly study the behavioural and neural basis of consciousness itself, for instance through the use of brain imaging and other neural recording techniques.", "When magicians perform spectacles that seem to defy the laws of nature, they do so by manipulating psychological reality. Hence, the principles underlying the art of conjuring are potentially of interest to psychological science. Here, we argue that perceptual and cognitive principles governing how humans experience hidden things and reason about them play a central role in many magic tricks. Different from tricks based on many other forms of misdirection, which require considerable skill on the part of the magician, many elements of these tricks are essentially self-working because they rely on automatic perceptual and cognitive processes. Since these processes are not directly observable, even experienced magicians may be oblivious to their central role in creating strong magical experiences and tricks that are almost impossible to debunk, even after repeated presentations. We delineate how insights from perceptual psychology provide a framework for understanding why these tricks work so well. Conversely, we argue that studying magic tricks that work much better than one intuitively would believe provides a promising heuristic for charting unexplored aspects of perception and cognition.", "This paper surveys more than twenty types of tactile illusions and discusses several of their aspects. These aspects include the ease with which they can be demonstrated and whether they have clear visual analogs. The paper also shows how to construct equipment made of simple supplies able to deliver well-controlled tactile signals in order to conveniently demonstrate four different tactile illusions.", "In a well-known magic trick known as multiplying balls, conjurers fool their audience with the use of a semi-spherical shell, which the audience perceives as a complete ball [1]. Here, we report that this illusion persists even when observers touch the inside of the shell with their own finger. Even more intriguingly, this also produces an illusion of bodily self-awareness in which the finger feels shorter, as if to make space for the purely illusory volume of the visually completed ball. This observation provides strong evidence for the controversial and counterintuitive idea that our experience of the hidden backsides of objects is shaped by genuine perceptual representations rather than mere cognitive guesswork or imagery [2].", "Magical ideation and belief in the paranormal is considered to represent a trait-like character; people either believe in it or not. Yet, anecdotes indicate that exposure to an anomalous event can turn skeptics into believers. This transformation is likely to be accompanied by altered cognitive functioning such as impaired judgments of event likelihood. Here, we investigated whether the exposure to an anomalous event changes individuals' explicit traditional (religious) and non-traditional (e.g., paranormal) beliefs as well as cognitive biases that have previously been associated with non-traditional beliefs, e.g., repetition avoidance when producing random numbers in a mental dice task. In a classroom, 91 students saw a magic demonstration after their psychology lecture. Before the demonstration, half of the students were told that the performance was done respectively by a conjuror (magician group) or a psychic (psychic group). The instruction influenced participants' explanations of the anomalous event. Participants in the magician, as compared to the psychic group, were more likely to explain the event through conjuring abilities while the reverse was true for psychic abilities. Moreover, these explanations correlated positively with their prior traditional and non-traditional beliefs. Finally, we observed that the psychic group showed more repetition avoidance than the magician group, and this effect remained the same regardless of whether assessed before or after the magic demonstration. We conclude that pre-existing beliefs and contextual suggestions both influence people's interpretations of anomalous events and associated cognitive biases. Beliefs and associated cognitive biases are likely flexible well into adulthood and change with actual life events.", "One remarkable aspect of human cognition is our ability to reason about physical events. This article provides novel evidence that intuitive physics is subject to a peculiar error, the classic conjunction fallacy, in which people rate the probability of a conjunction of two events as more likely than one constituent (a logical impossibility). Participants viewed videos of physical scenarios and judged the probability that either a single event or a conjunction of two events would occur. In Experiment 1 (n = 60), participants consistently rated conjunction events as more likely than single events for the same scenes. Experiment 2 (n = 180) extended these results to rule out several alternative explanations. Experiment 3 (n = 100) generalized the finding to different scenes. This demonstration of conjunction errors contradicts claims that such errors should not appear in intuitive physics and presents a serious challenge to current theories of mental simulation in physical reasoning." ]
Mesenchymal and immune cell interactions in pancreatic ductal adenocarcinomas
Fibroblasts display extensive transcriptional heterogeneity, yet functional annotation and characterization of their heterocellular relationships remains incomplete. Using mass cytometry, we chart the stromal composition of 18 murine tissues and 5 spontaneous tumor models, with an emphasis on mesenchymal phenotypes. This analysis reveals extensive stromal heterogeneity across tissues and tumors, and identifies coordinated relationships between mesenchymal and immune cell subsets in pancreatic ductal adenocarcinoma. Expression of CD105 demarks two stable and functionally distinct pancreatic fibroblast lineages, which are also identified in murine and human healthy tissues and tumors. Whereas CD105-positive pancreatic fibroblasts are permissive for tumor growth in vivo, CD105-negative fibroblasts are highly tumor suppressive. This restrictive effect is entirely dependent on functional adaptive immunity. Collectively, these results reveal two functionally distinct pancreatic fibroblast lineages and highlight the importance of mesenchymal and immune cell interactions in restricting tumor growth.
[ "The poor prognosis for patients with pancreatic ductal adenocarcinoma (PDAC) impels an improved understanding of disease biology to facilitate the development of better therapies. PDAC typically features a remarkably dense stromal reaction, featuring and established by a prominent population of cancer-associated fibroblasts (CAF). Genetically engineered mouse models and increasingly sophisticated cell culture techniques have demonstrated important roles for fibroblasts in PDAC progression and therapy response, but these roles are complex, with strong evidence for both tumor-supportive and tumor-suppressive or homeostatic functions. Here, we review the recent literature that has improved our understanding of heterogeneity in fibroblast fate and function in this disease including the existence of distinct fibroblast populations, and highlight important avenues for future study. SIGNIFICANCE: Although the abundant stromal reaction associated with pancreatic cancer has long been appreciated, the functions of the CAF cells that establish this stromal reaction remain unclear. An improved understanding of the transcriptional and functional heterogeneity of pancreatic CAFs, as well as their tumor-supportive versus tumor-suppressive capacity, may facilitate the development of effective therapies for this disease.", "High-throughput sequencing technologies, such as the Illumina Genome Analyzer, are powerful new tools for investigating a wide range of biological and medical questions. Statistical and computational methods are key for drawing meaningful and accurate conclusions from the massive and complex datasets generated by the sequencers. We provide a detailed evaluation of statistical methods for normalization and differential expression (DE) analysis of Illumina transcriptome sequencing (mRNA-Seq) data. We compare statistical methods for detecting genes that are significantly DE between two types of biological samples and find that there are substantial differences in how the test statistics handle low-count genes. We evaluate how DE results are affected by features of the sequencing platform, such as, varying gene lengths, base-calling calibration method (with and without phi X control lane), and flow-cell/library preparation effects. We investigate the impact of the read count normalization method on DE results and show that the standard approach of scaling by total lane counts (e.g., RPKM) can bias estimates of DE. We propose more general quantile-based normalization procedures and demonstrate an improvement in DE detection. Our results have significant practical and methodological implications for the design and analysis of mRNA-Seq experiments. They highlight the importance of appropriate statistical methods for normalization and DE inference, to account for features of the sequencing platform that could impact the accuracy of results. They also reveal the need for further research in the development of statistical and computational methods for mRNA-Seq.", "Dermal fibroblasts represent a heterogeneous population of cells with diverse features that remain largely undefined. We reveal the presence of at least two fibroblast lineages in murine dorsal skin. Lineage tracing and transplantation assays demonstrate that a single fibroblast lineage is responsible for the bulk of connective tissue deposition during embryonic development, cutaneous wound healing, radiation fibrosis, and cancer stroma formation. Lineage-specific cell ablation leads to diminished connective tissue deposition in wounds and reduces melanoma growth. Using flow cytometry, we identify CD26/DPP4 as a surface marker that allows isolation of this lineage. Small molecule-based inhibition of CD26/DPP4 enzymatic activity during wound healing results in diminished cutaneous scarring. Identification and isolation of these lineages hold promise for translational medicine aimed at in vivo modulation of fibrogenic behavior.", "Inferring cell-signaling networks from high-throughput data is a challenging problem in systems biology. Recent advances in cytometric technology enable us to measure the abundance of a large number of proteins at the single-cell level across time. Traditional network reconstruction approaches usually consider each time point separately, resulting thus in inferred networks that strongly vary across time. To account for the possibly time-invariant physical couplings within the signaling network, we extend the traditional graphical lasso with an additional regularizer that penalizes network variations over time. ROC evaluation of the method on in silico data showed higher reconstruction accuracy than standard graphical lasso. We also tested our approach on single-cell mass cytometry data of IFNγ-stimulated THP1 cells with 26 phospho-proteins simultaneously measured. Our approach recapitulated known signaling relationships, such as connection within the JAK/STAT pathway, and was further validated in characterizing perturbed signaling network with PI3K, MEK1/2 and AMPK inhibitors.", "We describe a new method, Tag-seq, which employs ultra high-throughput sequencing of 21 base pair cDNA tags for sensitive and cost-effective gene expression profiling. We compared Tag-seq data to LongSAGE data and observed improved representation of several classes of rare transcripts, including transcription factors, antisense transcripts, and intronic sequences, the latter possibly representing novel exons or genes. We observed increases in the diversity, abundance, and dynamic range of such rare transcripts and took advantage of the greater dynamic range of expression to identify, in cancers and normal libraries, altered expression ratios of alternative transcript isoforms. The strand-specific information of Tag-seq reads further allowed us to detect altered expression ratios of sense and antisense (S-AS) transcripts between cancer and normal libraries. S-AS transcripts were enriched in known cancer genes, while transcript isoforms were enriched in miRNA targeting sites. We found that transcript abundance had a stronger GC-bias in LongSAGE than Tag-seq, such that AT-rich tags were less abundant than GC-rich tags in LongSAGE. Tag-seq also performed better in gene discovery, identifying >98% of genes detected by LongSAGE and profiling a distinct subset of the transcriptome characterized by AT-rich genes, which was expressed at levels below those detectable by LongSAGE. Overall, Tag-seq is sensitive to rare transcripts, has less sequence composition bias relative to LongSAGE, and allows differential expression analysis for a greater range of transcripts, including transcripts encoding important regulatory molecules.", "Digital gene expression (DGE) technologies measure gene expression by counting sequence tags. They are sensitive technologies for measuring gene expression on a genomic scale, without the need for prior knowledge of the genome sequence. As the cost of sequencing DNA decreases, the number of DGE datasets is expected to grow dramatically. Various tests of differential expression have been proposed for replicated DGE data using binomial, Poisson, negative binomial or pseudo-likelihood (PL) models for the counts, but none of the these are usable when the number of replicates is very small. We develop tests using the negative binomial distribution to model overdispersion relative to the Poisson, and use conditional weighted likelihood to moderate the level of overdispersion across genes. Not only is our strategy applicable even with the smallest number of libraries, but it also proves to be more powerful than previous strategies when more libraries are available. The methodology is equally applicable to other counting technologies, such as proteomic spectral counts. An R package can be accessed from http://bioinf.wehi.edu.au/resources/", "High-throughput sequencing assays such as RNA-Seq, ChIP-Seq or barcode counting provide quantitative readouts in the form of count data. To infer differential signal in such data correctly and with good statistical power, estimation of data variability throughout the dynamic range and a suitable error model are required. We propose a method based on the negative binomial distribution, with variance and mean linked by local regression and present an implementation, DESeq, as an R/Bioconductor package." ]
Comparison of the AcrySof IQ PanOptix trifocal intraocular lens and the TECNIS Symfony extended depth-of-focus lens
To compare the visual performance of the AcrySof IQ PanOptix trifocal intraocular lens and the TECNIS Symfony extended depth-of-focus lens at near and distance visual ranges.
[ "To compare the visual outcomes and quality of vision of 2 new diffractive multifocal intraocular lenses (IOLs) with those of a monofocal IOL. Fatebenefratelli e Oftalmico Hospital, Milan, Italy. Prospective case series. Patients had bilateral cataract surgery with implantation of a trifocal IOL (Panoptix), an extended-range-of-vision IOL (Symfony), or a monofocal IOL (SN60WF). Postoperative examinations included assessing distance, intermediate, and near visual acuity; binocular defocus; intraocular and total aberrations; point-spread function (PSF); modulation transfer function (MTF); retinal straylight; and quality-of-vision (QoV) and spectacle-dependence questionnaires. Seventy-six patients (152 eyes) were assessed for study eligibility. Twenty patients (40 eyes) in each arm of the study (60 patients, 120 eyes) completed the outcome assessment. At the 4-month follow-up, the trifocal group had significantly better near visual acuity than the extended-range-of-vision group (P = .005). The defocus curve showed the trifocal IOL had better intermediate/near performance than the extended-range-of-vision IOL and both multifocal IOLs performed better than the monofocal IOL. Intragroup comparison of the total higher-order aberrations, PSF, MTF, and retinal straylight were not statistically different. The QoV questionnaire results showed no differences in dysphotopsia between the multifocal IOL groups; however, the results were significantly higher than in the monofocal IOL group. Both multifocal IOLs seemed to be good options for patients with intermediate-vision requirements, whereas the trifocal IOL might be better for patients with near-vision requirements. The significant perception of visual side effects indicates that patients still must be counseled about these effects before a multifocal IOL is implanted.", "Ray propagation visualization and optical performance analysis of four different intraocular lenses (IOLs). In this laboratory study, four IOLs with different optical designs were assessed: a monofocal AcrySof IQ SN60WF [Alcon], a diffractive-refractive bifocal AcrySof IQ Restor SN6AD1 [Alcon], a diffractive trifocal AcrySof IQ PanOptix TFNT00 [Alcon], and a diffractive extended-depth-of-focus (EDOF) Symfony ZXR00 [Johnson&Johnson]. An experimental set-up with a water bath containing 0.01% fluorescein solution and monochromatic green laser light (532 nm) was used to visualize the propagation of light rays. Also, the optical performance of the IOLs was evaluated by measuring the modulation transfer function (MTF) values at a pupil sizes of 3.0 and 4.5 mm on the optical bench OptiSpheric® IOL PRO II (Trioptics GmbH, Germany). Both the diffractive-refractive bifocal IOL and the EDOF IOL showed two defined foci for distance and near vision. In the diffractive trifocal IOL, three distinct foci for distance, intermediate, and near vision could be visualized. The ray propagation visualization technique allows a qualitative assessment and comparison of light energy distribution between different IOL models. The measured Through-Focus Response (TFR) quantitatively confirmed the evaluated ray propagation behavior.", "To analyze changes in the eye's refractive properties when a toric intraocular lens (IOL) rotates. Fundación Oftalmológica del Mediterráneo, Valencia, Spain. Experimental study. The matrix definition of astigmatism was used in this theoretical study and compared with another vector representation. Two methods were compared: (1) The cylinder, C, resulting from the addition of 2 cylinders C(1) and C(2) whose axes form an angle a, is obtained by the addition of 2 vectors of values C(1) and C(2) forming an angle 2a; (2) the power matrix, F, of a thin astigmatic dioptric system that decomposes naturally into 3 orthogonal components: the purely spherical part F(nes,) the ortho-astigmatism F(or), and oblique astigmatism F(ob). The residual cylinder was one third of the corneal astigmatism when a toric IOL rotated ±10 degrees when the cylinder values for the cornea (C(1)) and IOL (C(2)) were equal. Nevertheless, in most cases C(1) is greater than C(2); therefore, the residual astigmatism did not change noticeably with small rotations. The angle of rotation, b, which annuls the astigmatism correction, could be obtained from the following: cos(π + 2b) = -r/2, with r being the ratio between the IOL and cornea cylinders. The 2 methods gave equivalent results. When the IOL cylinder had a value different from that of the corneal astigmatism, a better choice would be a lower, rather than higher, cylinder value to reduce residual astigmatism. In general, toric IOL rotations less than 10 degrees changed the eye's refraction less than 0.50 diopter. Thus, small axis rotations are not an obstacle for satisfactory astigmatism correction with toric IOLs. No author has a financial or proprietary interest in any material or method mentioned.", "To compare bilateral implantation of a multifocal intraocular lens (IOL) versus a monofocal lens with respect to visual function, patient satisfaction, and quality of life. Seven clinical sites in Germany and 1 site in Austria. A prospective randomized masked clinical trial included 124 randomly assigned bilateral pseudophakic individuals, 64 of whom had bilateral implantation of an Array(R) foldable multifocal IOL (model SA-40N, Allergan) and 60 of whom had bilateral implantation of an AMO(R)PhacoFlex II(R) silicone monofocal IOL (model SI-40NB). Clinical data included binocular uncorrected and corrected distance and near visual acuities, complications, adverse events, and reports of halos and glare. Quality-of-life data were collected on 3 occasions using the modified Cataract TyPE Specification instrument. The functional status of the 2 groups was compared from baseline to final postoperative interview. Three months after surgery, a higher proportion in the Array group achieved a Jaeger value of J3 (20/40 Snellen) or better uncorrected binocular near visual acuity and 0.5 (20/40) or better distance-corrected binocular near visual acuity than in the monofocal groups (97% versus 68% and 95% versus 59%, respectively; P <.001). A higher proportion in the multifocal group achieved both 0.5 (20/40) and J3 or better uncorrected binocular distance and near visual acuities (97% versus 66%; P <.001). Those in the Array group were more likely than those in the monofocal group to never wear glasses overall (41% versus 12%; P <.001). Multifocal patients rated their vision without glasses better overall, at near and at intermediate distances (P <.05), and demonstrated better visual function for near tasks and social activities. Those who had bilateral implantation of the Array multifocal IOL obtained better uncorrected and distance-corrected near visual acuities and reported better overall vision, less limitation in visual function, and less spectacle dependency than patients with bilateral monofocal IOLs.", "The purpose of this study is to compare the optical characteristics of the novel PanOptix presbyopia-correcting trifocal intraocular lens (IOL) and the multifocal ReSTOR +3.0 D IOL, through in vitro bench investigations. The optical characteristics of AcrySof(®) IQ PanOptix™ (PanOptix) and AcrySof(®) IQ ReSTOR +3.0 D (ReSTOR +3.0 D) IOLs were evaluated by through-focus Badal images, simulated headlight images, and modulation transfer function (MTF) measurements which determine resolution, photic phenomena, and image quality. Through-focus Badal images of an Early Treatment of Diabetic Retinopathy Study chart were recorded at both photopic and mesopic pupil sizes. Simulated headlight images were taken on an MTF bench with a 50-μm pinhole target and a 5.0 mm pupil at the distance focus of the IOL. MTF curves were measured with a 3.0 mm pupil, and spatial frequencies equivalent to 20/40 and 20/20 visual acuities were recorded to illustrate the through-focus MTF curves. Far-, intermediate-, and near-focus MTF values were obtained. Bench Badal image testing and MTF measurements showed that PanOptix has a near focus at a distance of 42 cm and an additional intermediate focus at a distance of about 60 cm. The near focus for ReSTOR +3.0 D is at 45 cm. PanOptix and ReSTOR +3.0 D have comparable photopic distances and near MTF values. Additionally, PanOptix provided a substantial continuous range of vision from distance to intermediate and to near compared with ReSTOR +3.0 D. The halo propensity for PanOptix was slightly higher than that for ReSTOR +3.0 D. Laboratory-based in vitro simulations showed that PanOptix trifocal IOL has comparable resolution and image quality performance in distance and near foci compared with ReSTOR +3.0 D IOL. PanOptix showed better resolution and image quality performance at the intermediate focus than ReSTOR +3.0 D IOL.", "To calculate the diameter of halos perceived by patients with multifocal intraocular lenses (IOLs) and to stimulate halos in patients with refractive multifocal IOLs in a clinical experiment. Calculations were done to show the diameter of halos in the case of the bifocal intraocular lens. 24 patients with a refractive multifocal IOLs and five patients with a monofocal IOL were asked about their subjective observation of halos and were included in a clinical experiment using a computer program (Glare & Halo, FW Fitzke and C Lohmann, Tomey AG) which simulates a light source of 0.15 square degrees (sq deg) in order to stimulate and measure halos. Halo testing took place monoculary, under mesopic conditions through the distance and the near focus of the multifocal lens and through the focus of the monofocal lens. The halo diameter depends on the pupil diameter, the refractive power of the cornea, and distance focus of the multifocal IOL as well as the additional lens power for the near focus. 23 out of 24 patients with a refractive multifocal IOL described halos at night when looking at a bright light source. Only one patient was disturbed by the appearance of halos. Under test conditions, halos were detected in all patients with a refractive multifocal IOL. The halo area testing through the distance focus was 1.05 sq deg +/- 0.41, through the near focus 1.07 sq deg +/- 0.49 and in the monofocal lens 0.26 sq deg +/- 0.13. Under high contrast conditions halos can be stimulated in all patients with multifocal intraocular lenses. The halo size using the distance or the near focus is identical." ]
Evaluation of ultrafiltration and polyethylene glycol precipitation methods for the detection of severe acute respiratory syndrome coronavirus 2 in wastewater
Wastewater surveillance of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is an emerging public health tool to understand the spread of Coronavirus Disease 2019 (COVID-19) in communities. The performance of different virus concentration methods and PCR methods needs to be evaluated to ascertain their suitability for use in the detection of SARS-CoV-2 in wastewater. We evaluated ultrafiltration and polyethylene glycol (PEG) precipitation methods to concentrate SARS-CoV-2 from sewage in wastewater treatment plants and upstream in the wastewater network (e.g., manholes, lift stations). Recovery of viruses by different concentration methods was determined using Phi6 bacteriophage as a surrogate for enveloped viruses. Additionally, the presence of SARS-CoV-2 in all wastewater samples was determined using reverse transcription quantitative PCR (RT-qPCR) and reverse transcription droplet digital PCR (RT-ddPCR), targeting three genetic markers (N1, N2 and E). Using spiked samples, the Phi6 recoveries were estimated at 2.6-11.6% using ultrafiltration-based methods and 22.2-51.5% using PEG precipitation. There was no significant difference in recovery efficiencies (p < 0.05) between the PEG procedure with and without a 16 h overnight incubation, demonstrating the feasibility of obtaining same day results. The SARS-CoV-2 genetic markers were more often detected by RT-ddPCR than RT-qPCR with higher sensitivity and precision. While all three SARS-CoV-2 genetic markers were detected using RT-ddPCR, the levels of E gene were almost below the limit of detection using RT-qPCR. Collectively, our study suggested PEG precipitation is an effective low-cost procedure which allows a large number of samples to be processed simultaneously in a routine wastewater monitoring for SARS-CoV-2. RT-ddPCR can be implemented for the absolute quantification of SARS-CoV-2 genetic markers in different wastewater matrices.
[ "Since the beginning of COVID-19 pandemic studies on viral shedding have reported that this virus is excreted in feces in most patients. High viral loads are found at the sewage pipeline or at the entrance of wastewater treatment plants from cities where the number of COVID-19 cases are significant. In Quito (Ecuador) as in many other cities worldwide, wastewater is directly discharged into natural waters. The aim of this study was to evaluate SARS-CoV-2 presence in urban streams from a low sanitation context. Three river locations along the urban rivers of Quito were sampled on the 5th of June during a peak of COVID-19 cases. River samples were evaluated for water quality parameters and afterwards, concentrated for viral analysis using skimmed milk flocculation method. The viral concentrates were quantified for SARS-CoV-2 (N1 and N2 target regions) and Human Adenovirus as a human viral indicator. The results showed that SARS-CoV-2 was detected for both target regions in all samples analyzed in a range of 2,91E+05 to 3,19E+06 GC/L for N1 and from 2,07E+05 to 2,22E+06 GC/L for N2. The high values detected in natural waters from a low sanitation region have several implications in health and ecology that should be further assessed.", "Enteric viruses are shed in the feces and may be present in environmental waters. Their detection in wastewater, even at low concentration, is a major challenge. In this study, recoveries of Echovirus 7 (EV7), virions and RNA in wastewater, using virus concentration methods were determined to evaluate the detection of infectious viruses and the possibility of recovering viral genomes. Two virus concentration methods, PEG precipitation method and two-phase separation method, were applied to recovery experiments of EV7-virions from wastewater, in parallel with recovery experiments of EV7 RNA. The titration of EV7 virions was carried out by cell culture using human rhabdomyosarcoma tumor tissue and the EV7 RNA quantification was performed by real-time PCR. The mean recovery yields of EV7 virions using the PEG precipitation method and the two-phase separation method were 78.5 ± 10.99 and 83.1 ± 0.28 %, respectively. Besides, EV7 RNA recoveries obtained using the PEG precipitation method were four times higher than those using the two-phase separation method. According to our results, the two methods enable to concentrate both infectious viruses and viral genomes. Moreover, considering the protocol time and cost together with the ratio of the EV7 virion recovery to the EV7 RNA recovery, the two-phase separation method (83.1/2.71 %, or 30.6) seems to be more appropriate for selective concentration of viral virions than the PEG precipitation method (78.5/10.33 %, or 7.6).", "To evaluate viral loads at different stages of disease progression in patients infected with the 2019 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during the first four months of the epidemic in Zhejiang province, China. Retrospective cohort study. A designated hospital for patients with covid-19 in Zhejiang province, China. 96 consecutively admitted patients with laboratory confirmed SARS-CoV-2 infection: 22 with mild disease and 74 with severe disease. Data were collected from 19 January 2020 to 20 March 2020. Ribonucleic acid (RNA) viral load measured in respiratory, stool, serum, and urine samples. Cycle threshold values, a measure of nucleic acid concentration, were plotted onto the standard curve constructed on the basis of the standard product. Epidemiological, clinical, and laboratory characteristics and treatment and outcomes data were obtained through data collection forms from electronic medical records, and the relation between clinical data and disease severity was analysed. 3497 respiratory, stool, serum, and urine samples were collected from patients after admission and evaluated for SARS-CoV-2 RNA viral load. Infection was confirmed in all patients by testing sputum and saliva samples. RNA was detected in the stool of 55 (59%) patients and in the serum of 39 (41%) patients. The urine sample from one patient was positive for SARS-CoV-2. The median duration of virus in stool (22 days, interquartile range 17-31 days) was significantly longer than in respiratory (18 days, 13-29 days; P=0.02) and serum samples (16 days, 11-21 days; P<0.001). The median duration of virus in the respiratory samples of patients with severe disease (21 days, 14-30 days) was significantly longer than in patients with mild disease (14 days, 10-21 days; P=0.04). In the mild group, the viral loads peaked in respiratory samples in the second week from disease onset, whereas viral load continued to be high during the third week in the severe group. Virus duration was longer in patients older than 60 years and in male patients. The duration of SARS-CoV-2 is significantly longer in stool samples than in respiratory and serum samples, highlighting the need to strengthen the management of stool samples in the prevention and control of the epidemic, and the virus persists longer with higher load and peaks later in the respiratory tissue of patients with severe disease.", "Four viral concentration methods were evaluated for their efficiency in recovering murine norovirus-1 (MNV-1) (surrogate for human noroviruses (NoV)) and MS2 bacteriophages from processing water (1L) and four different types of irrigation water (bore hole water, rain water, open well and river water) (2-5L). Three methods were based on the viral adsorption and elution principle, two methods using an electronegative HA-membrane (Katayama et al., 2002), one method using an electropositive Zetapor membrane according to CEN/TC275/WG6/TAG4 and the fourth method was based on size exclusion using a tangential flow filtration system. Detection of MNV-1 was achieved by real-time RT-PCR and detection of MS2 by double-layer plaque assay. For the recovery of MNV-1, the method using an electronegative HA-filter in combination with an elution buffer earlier optimized by Hamza et al. (2009) (Method 1) performed best for all types of water (recovery: 5.8-21.9%). In case of MS2 detection, the best method depended upon the type of water although Method 1 provided the most consistent recovery. To complete this evaluation, the Method 1 was evaluated further for the concentration of human enteric viruses (GI and GII NoV, hepatitis A virus (HAV) and rotaviruses) in the same five types of water. Although detection of rotaviruses (RV) was somewhat less efficient, Method 1 proved reliable for the detection of NoV and HAV in all water types. Mean recovery efficiencies ranging from 4.8% for detection of GI NoV in open well water to 32.1% for detection of HAV in bore hole water, depending on the water type and the viral pathogen analyzed.", "The ongoing global pandemic of coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has been a Public Health Emergency of International Concern, which was officially declared by the World Health Organization. SARS-CoV-2 is a member of the family Coronaviridae that consists of a group of enveloped viruses with single-stranded RNA genome, which cause diseases ranging from common colds to acute respiratory distress syndrome. Although the major transmission routes of SARS-CoV-2 are inhalation of aerosol/droplet and person-to-person contact, currently available evidence indicates that the viral RNA is present in wastewater, suggesting the need to better understand wastewater as potential sources of epidemiological data and human health risks. Here, we review the current knowledge related to the potential of wastewater surveillance to understand the epidemiology of COVID-19, methodologies for the detection and quantification of SARS-CoV-2 in wastewater, and information relevant for human health risk assessment of SARS-CoV-2. There has been growing evidence of gastrointestinal symptoms caused by SARS-CoV-2 infections and the presence of viral RNA not only in feces of infected individuals but also in wastewater. One of the major challenges in SARS-CoV-2 detection/quantification in wastewater samples is the lack of an optimized and standardized protocol. Currently available data are also limited for conducting a quantitative microbial risk assessment (QMRA) for SARS-CoV-2 exposure pathways. However, modeling-based approaches have a potential role to play in reducing the impact of the ongoing COVID-19 outbreak. Furthermore, QMRA parameters obtained from previous studies on relevant respiratory viruses help to inform risk assessments of SARS-CoV-2. Our understanding on the potential role of wastewater in SARS-CoV-2 transmission is largely limited by knowledge gaps in its occurrence, persistence, and removal in wastewater. There is an urgent need for further research to establish methodologies for wastewater surveillance and understand the implications of the presence of SARS-CoV-2 in wastewater.", "Half a century ago scientists attempted the detection of poliovirus in water. Since then other enteric viruses responsible for gastroenteritis and hepatitis have replaced enteroviruses as the main target for detection. However, most viral outbreaks are restricted to norovirus and hepatitis A virus, making them the main targets in water. The inclusion of virus analysis in regulatory standards for viruses in water samples must overcome several shortcomings such as the technical difficulties and high costs of virus monitoring, the lack of harmonised and standardised assays and the challenge posed by the ever-changing nature of viruses. However, new tools are nowadays available for the study and direct surveillance of viral pathogens in water that may contribute to fulfil these requirements.", "To determine the occurrence of eight human enteric viruses in surface water and sewage samples from different geographical areas in Kenya. Enteric viruses were recovered from the water and sewage sources by glass-wool adsorption elution and/or polyethylene glycol/NaCl precipitation and detected by singleplex real-time and conventional PCR and reverse transcriptase-PCR assays. One or more enteric viruses were detected in nearly all sewage and river water samples except the urban Mbagathi River. The VP7 (G types) and the VP4 (P types) of the rotaviruses (RV) were characterized by multiplex nested PCR methods. The G and P types could be determined in 95·5% of the RV strains, respectively. Mixed G types were detected with G12 and G1 predominating, and unusual G types, G5 and G10, were present. P[4] predominated in the urban Karen sewage samples, while P[8] predominated in the urban and rural streams. The high prevalence of RVs in surface water highlights the importance of assessing the water sources used for domestic purposes for viral contamination. This study demonstrates the benefit of environmental surveillance as an additional tool to determine the epidemiology of RVs and other enteric viruses circulating in a given community." ]
what is the main flavonoid component extracted from?
Baicalin, the main flavonoid component extracted from
[ "Baicalin is a natural compound isolated from Chinese herb, which has been reported as an anti-inflammatory drug. Here, we demonstrated that Baicalin treatment could reduce urine protein, inhibit anti-ds-DNA antibody titers, and ameliorate lupus nephritis in MRL/lpr lupus-prone mice. Baicalin inhibited Tfh cell differentiation and IL-21 production, but promoted Foxp3+ regulatory T cell differentiation including part of follicular regulatory T (Tfr) cells. Intravenous injection of Baicalin-induced Foxp3+ regulatory T cells could relieve nephritis, inhibit Tfh cell differentiation and IL-21 production. Baicalin inhibited mTOR activation, reduced mTOR agonist-mediated Tfh cell expansion and increased Tfr cells. These data suggest that Baicalin attenuates lupus autoimmunity by up- and downregulating the differentiation of Tfr cells and Tfh cells, respectively. Baicalin and ex vivo expanded Foxp3+ regulatory T cells are promising therapeutics for the treatment of lupus.", "Baicalin has been shown to be effective for various animal models of cardiovascular diseases, such as pulmonary hypertension, atherosclerosis and myocardial ischaemic injury. However, whether baicalin plays a role in cardiac hypertrophy remains unknown. Here we investigated the protective effects of baicalin on cardiac hypertrophy induced by pressure overload and explored the potential mechanisms involved. C57BL/6J-mice were treated with baicalin or vehicle following transverse aortic constriction or Sham surgery for up to 8 weeks, and at different time points, cardiac function and heart size measurement and histological and biochemical examination were performed. Mice under pressure overload exhibited cardiac dysfunction, high mortality, myocardial hypertrophy, increased apoptosis and fibrosis markers, and suppressed cardiac expression of PPARα and PPARβ/δ. However, oral administration of baicalin improved cardiac dysfunction, decreased mortality, and attenuated histological and biochemical changes described above. These protective effects of baicalin were associated with reduced heart and cardiomyocyte size, lower fetal genes expression, attenuated cardiac fibrosis, lower expression of profibrotic markers, and decreased apoptosis signals in heart tissue. Moreover, we found that baicalin induced PPARα and PPARβ/δ expression in vivo and in vitro. Subsequent experiments demonstrated that long-term baicalin treatment presented no obvious cardiac lipotoxicity. The present results demonstrated that baicalin attenuates pressure overload induced cardiac dysfunction and ventricular remodeling, which would be due to suppressed cardiac hypertrophy, fibrosis, apoptosis and metabolic abnormality.", "After activation, CD4(+) helper T (Th) cells differentiate into distinct effector subsets. Although chemokine (C-X-C motif) receptor 5-expressing T follicular helper (Tfh) cells are important in humoral immunity, their developmental regulation is unclear. Here we show that Tfh cells had a distinct gene expression profile and developed in vivo independently of the Th1 or Th2 cell lineages. Tfh cell generation was regulated by ICOS ligand (ICOSL) expressed on B cells and was dependent on interleukin-21 (IL-21), IL-6, and signal transducer and activator of transcription 3 (STAT3). However, unlike Th17 cells, differentiation of Tfh cells did not require transforming growth factor beta (TGF-beta) or Th17-specific orphan nuclear receptors RORalpha and RORgamma in vivo. Finally, naive T cells activated in vitro in the presence of IL-21 but not TGF-beta signaling preferentially acquired Tfh gene expression and promoted germinal-center reactions in vivo. This study thus demonstrates that Tfh is a distinct Th cell lineage.", "Although nonclassical estrogen actions initiated at the cell surface have been described in many tissues, the identities of the membrane estrogen receptors (mERs) mediating these actions remain unclear. Here we show that GPR30, an orphan receptor unrelated to nuclear estrogen receptors, has all the binding and signaling characteristics of a mER. A high-affinity (dissociation constant 2.7 nm), limited capacity, displaceable, single binding site specific for estrogens was detected in plasma membranes of SKBR3 breast cancer cells that express GPR30 but lack nuclear estrogen receptors. Progesterone-induced increases and small interfering RNA-induced decreases in GPR30 expression in SKBR3 cells were accompanied by parallel changes in specific estradiol-17beta (E2) binding. Plasma membranes of human embryonic kidney 293 cells transfected with GPR30, but not those of untransfected cells, and human placental tissues that express GPR30 also displayed high-affinity, specific estrogen binding typical of mERs. E2 treatment of transfected cell membranes caused activation of a stimulatory G protein that is directly coupled to the receptor, indicating GPR30 is a G protein-coupled receptor (GPCR), and also increased adenylyl cyclase activity. The finding that the antiestrogens tamoxifen and ICI 182,780, and an environmental estrogen, ortho,para-dichlorodiphenyldichloroethylene (o,p'-DDE), have high binding affinities to the receptor and mimic the actions of E2 has important implications for both the development and treatment of estrogen-dependent breast cancer. GPR30 is structurally unrelated to the recently discovered family of GPCR-like membrane progestin receptors. The identification of a second distinct class of GPCR-like steroid membrane receptors suggests a widespread role for GPCRs in nonclassical steroid hormone actions.", "CD4+CD25+ regulatory T cells (Treg) are instrumental in the maintenance of immunological tolerance. One critical question is whether Treg can only be generated in the thymus or can differentiate from peripheral CD4+CD25- naive T cells. In this paper, we present novel evidence that conversion of naive peripheral CD4+CD25- T cells into anergic/suppressor cells that are CD25+, CD45RB-/low and intracellular CTLA-4+ can be achieved through costimulation with T cell receptors (TCRs) and transforming growth factor beta (TGF-beta). Although transcription factor Foxp3 has been shown recently to be associated with the development of Treg, the physiological inducers for Foxp3 gene expression remain a mystery. TGF-beta induced Foxp3 gene expression in TCR-challenged CD4+CD25- naive T cells, which mediated their transition toward a regulatory T cell phenotype with potent immunosuppressive potential. These converted anergic/suppressor cells are not only unresponsive to TCR stimulation and produce neither T helper cell 1 nor T helper cell 2 cytokines but they also express TGF-beta and inhibit normal T cell proliferation in vitro. More importantly, in an ovalbumin peptide TCR transgenic adoptive transfer model, TGF-beta-converted transgenic CD4+CD25+ suppressor cells proliferated in response to immunization and inhibited antigen-specific naive CD4+ T cell expansion in vivo. Finally, in a murine asthma model, coadministration of these TGF-beta-induced suppressor T cells prevented house dust mite-induced allergic pathogenesis in lungs.", "Flavonoids, a group of natural compounds found in a variety of vegetables and herbal medicines, have been intensively reported on regarding their estrogen-like activities and particularly their ability to affect bone metabolism. Here, different subclasses of flavonoids were screened for their osteogenic properties by measuring alkaline phosphatase activity in cultured rat osteoblasts. The flavone baicalin derived mainly from the roots of Scutellaria baicalensis showed the strongest induction of alkaline phosphatase activity. In cultured osteoblasts, application of baicalin increased significantly the osteoblastic mineralization and the levels of mRNAs encoding the bone differentiation markers, including osteonectin, osteocalcin, and collagen type 1α1. Interestingly, the osteogenic effect of baicalin was not mediated by its estrogenic activity. In contrast, baicalin promoted osteoblastic differentiation via the activation of the Wnt/β-catenin signaling pathway; the activation resulted in the phosphorylation of glycogen synthase kinase 3β and, subsequently, induced the nuclear accumulation of the β-catenin, leading to the transcription activation of Wnt-targeted genes for osteogenesis. The baicalin-induced osteogenic effects were fully abolished by DKK-1, a blocker of Wnt/β-catenin receptor. Moreover, baicalin also enhanced the mRNA expression of osteoprotegerin, which could regulate indirectly the activation of osteoclasts. Taken together, our results suggested that baicalin could act via Wnt/β-catenin signaling to promote osteoblastic differentiation. The osteogenic flavonoids could be very useful in finding potential drugs, or food supplements, for treating post-menopausal osteoporosis.", "Previous studies reported that the total flavonoids from the stems and leaves of Scutellaria baicalensis Georgi (TFSS) could enhance and improve learning and memory abilities in experimental animals, and reduce the neuronal pathologic alterations induced by some reagents in mice. The present study examined whether TFSS can improve memory dysfunction, neuronal damage, and abnormal free radicals induced by permanent cerebral ischemia in rats. The permanent cerebral ischemic model in rats was produced by bilateral ligation of the common carotid arteries. The influence of permanent cerebral ischemia on learning and memory was determined in the Morris water maze. The neuronal damage in the hippocampus and cerebral cortex was assessed by the neuronal morphologic observations. The contents of malondialdehyde (MDA) and nitric oxide (NO), and the activities of superoxide dismutase (SOD) and catalase (CAT) in the hippocampus and cerebral cortex were measured using thiobarbituric acid, nitrate reductase, xanthine-xanthine oxidase, and ammonium molybdate spectrophotometric methods, respectively. In learning and memory performance tests, cerebral ischemic rats always required a longer latency time to find the hidden platform and spent a shorter time in the target quadrant in the Morris water maze. TFSS 17.5-70 mg.kg(-1) daily orally administered to ischemic rats for 20 d, from day 16-35 after operation differently reduced the prolonged latency and increased swimming time spent in the target quadrant. In neuronal morphologic observations, daily oral TFSS 17.5-70 mg.kg(-1) for 21 d, from day 16-36 after operation markedly inhibited the ischemia-induced neuronal damage. In addition, the increased contents of MDA and NO, and SOD activity, and the decreased activity of CAT in the hippocampus and cerebral cortex induced by cerebral ischemia were differently reversed. The reference drug piracetam (140 mg.kg(-1) per day for 20-21 d) similarly improved impaired memory and neuronal damage but had no significant effects on free radicals in ligated rats. TFSS can improve memory deficits and neuronal damage in rats after permanent cerebral ischemia, which may be beneficial in the treatment of cerebrovascular dementia." ]
Improved bacterial luciferase for autobioluminescence imaging
Using the lux operon (luxCDABE) of bacterial bioluminescence system as an autonomous luminous reporter has been demonstrated in bacteria, plant and mammalian cells. However, applications of bacterial bioluminescence-based imaging have been limited because of its low brightness. Here, we engineered the bacterial luciferase (heterodimer of luxA and luxB) by fusion with Venus, a bright variant of yellow fluorescent protein, to induce bioluminescence resonance energy transfer (BRET). By using decanal as an externally added substrate, color change and ten-times enhancement of brightness was achieved in Escherichia coli when circularly permuted Venus was fused to the C-terminus of luxB. Expression of the Venus-fused luciferase in human embryonic kidney cell lines (HEK293T) or in Nicotiana benthamiana leaves together with the substrate biosynthesis-related genes (luxC, luxD and luxE) enhanced the autonomous bioluminescence. We believe the improved luciferase will forge the way towards the potential development of autobioluminescent reporter system allowing spatiotemporal imaging in live cells.
[ "Autofluorescent protein tags represent one of the major and, perhaps, most powerful tools in modern cell biology for visualization of various cellular processes in vivo. In addition, advances in confocal microscopy and the development of autofluorescent proteins with different excitation and emission spectra allowed their simultaneous use for detection of multiple events in the same cell. Nevertheless, while autofluorescent tags are widely used in plant research, the need for a versatile and comprehensive set of vectors specifically designed for fluorescent tagging and transient and stable expression of multiple proteins in plant cells from a single plasmid has not been met by either the industrial or the academic communities. Here, we describe a new modular satellite (SAT) vector system that supports N- and C-terminal fusions to five different autofluorescent tags, EGFP, EYFP, Citrine-YFP, ECFP, and DsRed2. These vectors carry an expanded multiple cloning site that allows easy exchange of the target genes between different autofluorescence tags, and expression of the tagged proteins is controlled by constitutive promoters, which can be easily replaced with virtually any other promoter of interest. In addition, a series of SAT vectors has been adapted for high throughput Gateway recombination cloning. Furthermore, individual expression cassettes can be assembled into Agrobacterium binary plasmids, allowing efficient transient and stable expression of multiple autofluorescently tagged proteins from a single vector following its biolistic delivery or Agrobacterium-mediated genetic transformation.", "Lumazine protein (LumP) is a fluorescent accessory protein having 6,7-dimethyl-8-(1'-d-ribityl) lumazine (DMRL) as its authentic chromophore. It modulates the emission of bacterial luciferase to shorter wavelengths with increasing luminous strength. To obtain structural information on the native structure as well as the interaction with bacterial luciferase, we have determined the crystal structures of LumP from Photobacterium kishitanii in complexes with DMRL and its analogues, riboflavin (RBF) and flavin mononucleotide (FMN), at resolutions of 2.00, 1.42, and 2.00 A. LumP consists of two beta barrels that have nearly identical folds, the N-terminal and C-terminal barrels. The structures of LumP in complex with all of the chromophores studied are all essentially identical, except around the chromophores. In all of the structures, the chromophore is tethered to the narrow cavity via many hydrogen bonds in the N-terminal domain. These are absent in the C-terminal domain. Hydrogen bonding in LumP-FMN is decreased in comparison with that in LumP-RBF because the phosphate moiety of FMN protrudes out of the narrow cavity. In LumP-DMRL, the side chain of Gln65 is close to the ring system, and a new water molecule that stabilizes the ligand is observed near Ser48. Therefore, DMRL packs more tightly in the ligand-binding site than RBF or FMN. A docking simulation of bacterial luciferase and LumP suggests that the chromophore is located close enough for direct energy transfer to occur. Moreover, the surface potentials around the ligand-binding sites of LumP and bacterial luciferase exhibit complementary charge distributions, which would have a significant effect on the interaction between LumP and luciferase.", "Efficient bioluminescence resonance energy transfer (BRET) from a bioluminescent protein to a fluorescent protein with high fluorescent quantum yield has been utilized to enhance luminescence intensity, allowing single-cell imaging in near real time without external light illumination. We applied BRET to develop an autoluminescent Ca(2+) indicator, BRAC, which is composed of Ca(2+)-binding protein, calmodulin, and its target peptide, M13, sandwiched between a yellow fluorescent protein variant, Venus, and an enhanced Renilla luciferase, RLuc8. Adjusting the relative dipole orientation of the luminescent protein's chromophores improved the dynamic range of BRET signal change in BRAC up to 60%, which is the largest dynamic range among BRET-based indicators reported so far. Using BRAC, we demonstrated successful visualization of Ca(2+) dynamics at the single-cell level with temporal resolution at 1 Hz. Moreover, BRAC signals were acquired by ratiometric imaging capable of canceling out Ca(2+)-independent signal drifts due to change in cell shape, focus shift, etc. The brightness and large dynamic range of BRAC should facilitate high-sensitive Ca(2+) imaging not only in single live cells but also in small living subjects.", "Prospects of obtaining plants glowing in the dark have captivated the imagination of scientists and layman alike. While light emission has been developed into a useful marker of gene expression, bioluminescence in plants remained dependent on externally supplied substrate. Evolutionary conservation of the prokaryotic gene expression machinery enabled expression of the six genes of the lux operon in chloroplasts yielding plants that are capable of autonomous light emission. This work demonstrates that complex metabolic pathways of prokaryotes can be reconstructed and function in plant chloroplasts and that transplastomic plants can emit light that is visible by naked eye.", "The luxG gene is part of the lux operon of marine luminous bacteria. luxG has been proposed to be a flavin reductase that supplies reduced flavin mononucleotide (FMN) for bacterial luminescence. However, this role has never been established because the gene product has not been successfully expressed and characterized. In this study, luxG from Photobacterium leiognathi TH1 was cloned and expressed in Escherichia coli in both native and C-terminal His6-tagged forms. Sequence analysis indicates that the protein consists of 237 amino acids, corresponding to a subunit molecular mass of 26.3 kDa. Both expressed forms of LuxG were purified to homogeneity, and their biochemical properties were characterized. Purified LuxG is homodimeric and has no bound prosthetic group. The enzyme can catalyze oxidation of NADH in the presence of free flavin, indicating that it can function as a flavin reductase in luminous bacteria. NADPH can also be used as a reducing substrate for the LuxG reaction, but with much less efficiency than NADH. With NADH and FMN as substrates, a Lineweaver-Burk plot revealed a series of convergent lines characteristic of a ternary-complex kinetic model. From steady-state kinetics data at 4 degrees C pH 8.0, Km for NADH, Km for FMN, and kcat were calculated to be 15.1 microM, 2.7 microM, and 1.7 s(-1), respectively. Coupled assays between LuxG and luciferases from P. leiognathi TH1 and Vibrio campbellii also showed that LuxG could supply FMNH- for light emission in vitro. A luxG gene knockout mutant of P. leiognathi TH1 exhibited a much dimmer luminescent phenotype compared to the native P. leiognathi TH1, implying that LuxG is the most significant source of FMNH- for the luminescence reaction in vivo.", "Bioluminescent and fluorescent reporter systems have enabled the rapid and continued growth of the optical imaging field over the last two decades. Of particular interest has been noninvasive signal detection from mammalian tissues under both cell culture and whole animal settings. Here we report on the advantages and limitations of imaging using a recently introduced bacterial luciferase (lux) reporter system engineered for increased bioluminescent expression in the mammalian cellular environment. Comparison with the bioluminescent firefly luciferase (Luc) system and green fluorescent protein system under cell culture conditions demonstrated a reduced average radiance, but maintained a more constant level of bioluminescent output without the need for substrate addition or exogenous excitation to elicit the production of signal. Comparison with the Luc system following subcutaneous and intraperitoneal injection into nude mice hosts demonstrated the ability to obtain similar detection patterns with in vitro experiments at cell population sizes above 2.5 × 10(4) cells but at the cost of increasing overall image integration time.", "Monitoring calcium fluxes in real time could help to understand the development, the plasticity, and the functioning of the central nervous system. In jellyfish, the chemiluminescent calcium binding aequorin protein is associated with the green fluorescent protein and a green bioluminescent signal is emitted upon Ca(2+) stimulation. We decided to use this chemiluminescence resonance energy transfer between the two molecules. Calcium-sensitive bioluminescent reporter genes have been constructed by fusing green fluorescent protein and aequorin, resulting in much more light being emitted. Chemiluminescent and fluorescent activities of these fusion proteins have been assessed in mammalian cells. Cytosolic Ca(2+) increases were imaged at the single-cell level with a cooled intensified charge-coupled device camera. This bifunctional reporter gene should allow the investigation of calcium activities in neuronal networks and in specific subcellular compartments in transgenic animals.", "The use of fluorescent proteins has revolutionized our understanding of biological processes. However, the requirement for external illumination precludes their universal application to the study of biological processes in all tissues. Although light can be created by chemiluminescence, light emission from existing chemiluminescent probes is too weak to use this imaging modality in situations when fluorescence cannot be used. Here we report the development of the brightest luminescent protein to date, Nano-lantern, which is a chimera of enhanced Renilla luciferase and Venus, a fluorescent protein with high bioluminescence resonance energy transfer efficiency. Nano-lantern allows real-time imaging of intracellular structures in living cells with spatial resolution equivalent to fluorescence and sensitive tumour detection in freely moving unshaved mice. We also create functional indicators based on Nano-lantern that can image Ca(2+), cyclic adenosine monophosphate and adenosine 5'-triphosphate dynamics in environments where the use of fluorescent indicators is not feasible. These luminescent proteins allow visualization of biological phenomena at previously unseen single-cell, organ and whole-body level in animals and plants." ]
Aspirin effects in non-steroidal anti-inflammatory drugs-exacerbated respiratory disease
Non-steroidal Anti-inflammatory drugs (NSAID)-exacerbated respiratory disease (N-ERD) is characterized by nasal polyposis, chronic rhinosinusitis, adult-onset asthma and hypersensitive reactions to cyclooxygenase-1 (COX-1) inhibitors. Among the available treatments for this disease, a combination of endoscopic sinus surgery followed by aspirin desensitization and aspirin maintenance therapy has been an effective approach. Studies have shown that long-term aspirin maintenance therapy can reduce the rate of nasal polyp recurrence in patients with N-ERD. However, the exact mechanism by which aspirin can both trigger and suppress airway disease in N-ERD remains poorly understood. In this review, we summarize current knowledge of aspirin effects in N-ERD, cardiovascular disease, and cancer, and consider potential mechanistic pathways accounting for the effects of aspirin in N-ERD.
[ "Lipoxin (LX) A4, an endogenous anti-inflammatory eicosanoid, has been found to be low in patients with severe asthma. However, few studies also suggested more diminished LX A4 levels in aspirin-exacerbated respiratory disease (AERD) when compared with aspirin-tolerant asthma (ATA). It is, therefore, currently not clear whether the asthma severity or the presence of AERD has a primary role in the disturbed LX metabolism. To detect LX A4 and 15-epi-LX A4 levels in asthma patients with and without AERD of comparable severity. The study groups consisted of 22 subjects with AERD, 22 subjects with ATA and 10 volunteers without asthma and aspirin sensitivity. Whole-blood samples were stimulated with calcium ionophore, A23187 (5 x 10(-5) m) and A23187 (5 x 10(-5) m)+aspirin (10(-4) m). LX A4 and 15-epi-LX A4 levels were analysed by the enzyme immune assay method. Severe asthma patients in both AERD [0.5 (0.8)] ng/mL and ATA [0.5 (0.45) ng/mL] groups showed diminished generation for LX A4 to stimulation with A23187 in comparison with other severity degrees in their groups (P=0.02 and 0.046, respectively). LX A4 generation in both severe groups was comparable with each other (P>0.05). Although severe cases with AERD showed a diminished capacity to generate 15-epi-LX A4, this did not reach statistical significance. This study indicated that diminished LX A4 generation was unique to severe asthma phenotype regardless of comorbid aspirin sensitivity. Clinical Implications Lower LX A4 levels in severe asthma would suggest a possibility for LX analogues as future treatment options in these patients.", "Chronic rhinosinusitis with nasal polyps (CRSwNP) and asthma frequently coexist and are always present in patients with aspirin exacerbated respiratory disease (AERD). Although the pathogenic mechanisms of this condition are still unknown, AERD may be due, at least in part, to an imbalance in eicosanoid metabolism (increased production of cysteinyl leukotrienes (CysLTs) and reduced biosynthesis of prostaglandin (PG) E2), possibly increasing and perpetuating the process of inflammation. PGE2 results from the metabolism of arachidonic acid (AA) by cyclooxygenase (COX) enzymes, and seems to play a central role in homeostasis maintenance and inflammatory response modulation in airways. Therefore, the abnormal regulation of PGE2 could contribute to the exacerbated processes observed in AERD. PGE2 exerts its actions through four G-protein-coupled receptors designated E-prostanoid (EP) receptors EP1, EP2, EP3, and EP4. Altered PGE2 production as well as differential EP receptor expression has been reported in both upper and lower airways of patients with AERD. Since the heterogeneity of these receptors is the key for the multiple biological effects of PGE2 this review focuses on the studies available to elucidate the importance of these receptors in inflammatory airway diseases.", "Prostaglandins are lipid autacoids derived from arachidonic acid. They both sustain homeostatic functions and mediate pathogenic mechanisms, including the inflammatory response. They are generated from arachidonate by the action of cyclooxygenase isoenzymes, and their biosynthesis is blocked by nonsteroidal antiinflammatory drugs, including those selective for inhibition of cyclooxygenase-2. Despite the clinical efficacy of nonsteroidal antiinflammatory drugs, prostaglandins may function in both the promotion and resolution of inflammation. This review summarizes insights into the mechanisms of prostaglandin generation and the roles of individual mediators and their receptors in modulating the inflammatory response. Prostaglandin biology has potential clinical relevance for atherosclerosis, the response to vascular injury and aortic aneurysm.", "Aspirin-induced asthma (AIA) and aspirin-induced urticaria/ angioedema (AIU) are two major aspirin-related allergies. We summarize recent findings related to their molecular genetic mechanisms in order to identify genetic susceptibility markers for differentiating AIU and AIA. The overproduction of cysteinyl leukotriene has been suggested as a mechanism in both AIU and AIA. Increased expression of CYSLTR1 with CYLSTR1 and CYSLTR2 polymorphisms are new findings in AIA, while the ALOX5 promoter polymorphism has been noted in AIU. An HLA study suggested that DPB1*0301 is a strong genetic marker for AIA, and that HLA DRB1*1302 and DQB1*0609 are markers for AIU susceptibility. Several single nucleotide polymorphisms (SNPs) in the promoters of EP2, TBX21, COX-2, Fc epsilon RIbeta, and TBXA2R were associated with AIA, while an Fc epsilon RIalpha promoter polymorphism was associated with AIU. The functional studies of the key genes involved in AIA and AIU are summarized. The identification and functional study of genetic markers for AIA and AIU susceptibility would further elucidate the pathogenic mechanisms and facilitate the development of early diagnostic markers to establish therapeutic targets.", "One hundred seven known aspirin (ASA)-sensitive patients with rhinosinusitis-asthma were studied from 1975 to 1988. Forty-two of the patients avoided ASA and served as the control group. Thirty-five patients were desensitized to ASA and treated with daily ASA treatment (Rx) for as long as 8 years (mean, 3.75 years) to May 1988 and were designated the continuous group. Thirty patients, initially desensitized to ASA and treated with daily ASA, who stopped Rx permanently after a mean duration of 2 years, were designated the discontinued group. Retrospective analyses of baselines revealed that both continuous and discontinued groups during ASA Rx demonstrated statistically significant reduction in number of hospitalizations per year, emergency room visits per year, outpatient visits per year, upper respiratory infections-sinusitis-antibiotics per year, need for nasal polypectomies and additional sinus operations, and improvement in sense of smell compared to the control group. Simultaneously, the ASA-Rx groups were able to significantly reduce systemic corticosteroid dosage, corticosteroid bursts per year, and, in the continuous group only, significantly reduce inhaled corticosteroids. All three groups maintained control of respiratory symptoms. ASA desensitization followed by long-term daily ASA Rx appears to improve ASA-sensitive rhinosinusitis-asthma and concomitantly allows reduction of systemic corticosteroids.", "The prostaglandin endoperoxide H synthases-1 and 2 (PGHS-1 and PGHS-2; also cyclooxygenases-1 and 2, COX-1 and COX-2) catalyze the committed step in prostaglandin synthesis. PGHS-1 and 2 are of particular interest because they are the major targets of nonsteroidal anti-inflammatory drugs (NSAIDs) including aspirin, ibuprofen, and the new COX-2 inhibitors. Inhibition of the PGHSs with NSAIDs acutely reduces inflammation, pain, and fever, and long-term use of these drugs reduces fatal thrombotic events, as well as the development of colon cancer and Alzheimer's disease. In this review, we examine how the structures of these enzymes relate mechanistically to cyclooxygenase and peroxidase catalysis, and how differences in the structure of PGHS-2 confer on this isozyme differential sensitivity to COX-2 inhibitors. We further examine the evidence for independent signaling by PGHS-1 and PGHS-2, and the complex mechanisms for regulation of PGHS-2 gene expression.", "Lipoxins (LX) are bioactive eicosanoids that carry a tetraene structure and serve as regulators of inflammation, in part by inhibiting neutrophil migration and adhesion. Lipoxin A4 is rapidly regulated by conversion to inactive LX metabolites via local metabolism that involves dehydrogenation as the predominant route. Here, several LXA4 analogs were designed that resisted rapid conversion by both differentiated HL-60 cells and recombinant 15-hydroxyprostaglandin dehydrogenase, systems where native LXA4 is degraded within minutes. The rank order of conversion by recombinant dehydrogenase was LXA4 methyl ester > PGE2 approximately PGE2 methyl ester > LXA4 >>> the novel LXA4 analogs. In addition, 15(R/S)-methyl-LXA4, 15-cyclohexyl-LXA4, and 16-phenoxy-LXA4 proved to retain LXA4 bioactivity and inhibited neutrophil transmigration across polarized epithelial cell monolayers as well as adhesion to vascular endothelial cells. These results indicate that LXA4 analogs can be designed using these criteria to resist rapid transformation and to retain biological actions of native LXA4. Moreover, the results suggest that LXA4 stable analogs can be useful tools both in vitro and in vivo to evaluate LXA4 actions and therapeutic potential." ]
Postreplicative Pulsed-Field Gel Electrophoresis in the First Cell Cycle of Yeast
The key role of Topoisomerase II (Top2) is the removal of topological intertwines between sister chromatids. In yeast, inactivation of Top2 brings about distinct cell cycle responses. In the case of the conditional top2-5 allele, interphase and mitosis progress on schedule but cells suffer from a chromosome segregation catastrophe. We here show that top2-5 chromosomes fail to enter a Pulsed-Field Gel Electrophoresis (PFGE) in the first cell cycle, a behavior traditionally linked to the presence of replication and recombination intermediates. We distinguished two classes of affected chromosomes: the rDNA-bearing chromosome XII, which fails to enter a PFGE at the beginning of S-phase, and all the other chromosomes, which fail at a postreplicative stage. In synchronously cycling cells, this late PFGE retention is observed in anaphase; however, we demonstrate that this behavior is independent of cytokinesis, stabilization of anaphase bridges, spindle pulling forces and, probably, anaphase onset. Strikingly, once the PFGE retention has occurred it becomes refractory to Top2 re-activation. DNA combing, two-dimensional electrophoresis, genetic analyses, and GFP-tagged DNA damage markers suggest that neither recombination intermediates nor unfinished replication account for the postreplicative PFGE shift, which is further supported by the fact that the shift does not trigger the G
[ "Topoisomerase II (Top2) removes topological linkages between replicated chromosomes. Top2 inhibition leads to mitotic catastrophe (MC) when cells unsuccessfully try to split their genetic material between the two daughter cells. Herein, we have characterized the fate of these daughter cells in the budding yeast. Clonogenic and microcolony experiments, in combination with vital and apoptotic stains, showed that 75% of daughter cells become senescent in the short term; they are unable to divide but remain alive. Decline in cell vitality then occurred, yet slowly, uncoordinatedly when comparing pairs of daughters, and independently of the cell death mediator Mca1/Yca1. Furthermore, we showed that senescence can be modulated by ploidy, suggesting that gross chromosome imbalances during segregation may account for this phenotype. Indeed, we found that diploid long-term survivors of the MC are prone to genomic imbalances such as trisomies, uniparental disomies and terminal loss of heterozygosity (LOH), the latter affecting the longest chromosome arms.", "Eukaryotic chromosome replication is initiated from numerous origins and its activation is temporally controlled by cell cycle and checkpoint mechanisms. Yeast has been very useful in defining the genetic elements required for initiation of DNA replication, but simple and precise tools to monitor S phase progression are lacking in this model organism. Here we describe a TK(+) yeast strain and conditions that allow incorporation of exogenous BrdU into genomic DNA, along with protocols to detect the sites of DNA synthesis in yeast nuclei or on combed DNA molecules. S phase progression is monitored by quantification of BrdU in total yeast DNA or on individual chromosomes. Using these tools we show that yeast chromosomes replicate synchronously and that DNA synthesis occurs at discrete subnuclear foci. Analysis of BrdU signals along single DNA molecules from hydroxyurea-arrested cells reveals that replication forks stall 8-9 kb from origins that are placed 46 kb apart on average. Quantification of total BrdU incorporation suggests that 190 'early' origins have fired in these cells and that late replicating territories might represent up to 40% of the yeast genome. More generally, the methods outlined here will help understand the kinetics of DNA replication in wild-type yeast and refine the phenotypes of several mutants.", "Improperly attached chromosomes activate the mitotic checkpoint that arrests cell division before anaphase. Cells can maintain an arrest for several hours but eventually will resume proliferation, a process we refer to as adaptation. Whether adapting cells bypass an active block or whether the block has to be removed to resume proliferation is not clear. Likewise, it is not known whether all cells of a genetically homogeneous population are equally capable to adapt. Here, we show that the mitotic checkpoint is operational when yeast cells adapt and that each cell has the same propensity to adapt. Our results are consistent with a model of the mitotic checkpoint where adaptation is driven by random fluctuations of APC/CCdc20, the molecular species inhibited by the checkpoint. Our data provide a quantitative framework for understanding how cells overcome a constant stimulus that halts cell cycle progression.", "Replication perturbations activate DNA damage tolerance (DDT) pathways, which are crucial to promote replication completion and to prevent fork breakage, a leading cause of genome instability. One mode of DDT uses translesion synthesis polymerases, which however can also introduce mutations. The other DDT mode involves recombination-mediated mechanisms, which are generally accurate. DDT occurs prevalently postreplicatively, but in certain situations homologous recombination is needed to restart forks. Fork reversal can function to stabilize stalled forks, but may also promote error-prone outcome when used for fork restart. Recent years have witnessed important advances in our understanding of the mechanisms and DNA structures that mediate recombination-mediated damage-bypass and highlighted principles that regulate DDT pathway choice locally and temporally. In this review we summarize the current knowledge and paradoxes on recombination-mediated DDT pathways and their workings, discuss how the intermediate DNA structures may influence genome integrity, and outline key open questions for future research." ]
Anderson-Fabry disease: a review of the literature
Anderson-Fabry disease is an X-linked inborn error of glycosphingolipid catabolism caused by a deficiency of α-galactosidase A. The incidence ranges between 1: 40,000 and 1:117,000 of live male births. In Italy, an estimate of incidence is available only for the north-western Italy, where it is of approximately 1:4000. Clinical symptoms include angiokeratomas, corneal dystrophy, and neurological, cardiac and kidney involvement. The prevalence of symptomatic female carriers is about 70%, and in some cases, they can exhibit a severe phenotype. Previous studies suggest a correlation between skewed X chromosome inactivation and symptoms in carriers of X-linked disease, including Fabry disease. In this review, we briefly summarize the disease, focusing on the clinical symptoms of carriers and analysis of the studies so far published in regards to X chromosome inactivation pattern, and manifesting Fabry carriers. Out of 151 records identified, only five reported the correlation between the analysis of XCI in leukocytes and the related phenotype in Fabry carriers, in particular evaluating the Mainz Severity Score Index or cardiac involvement. The meta-analysis did not show any correlation between MSSI or cardiac involvement and skewed XCI, likely because the analysis of XCI in leukocytes is not useful for predicting the phenotype in Fabry carriers.
[ "Fabry disease (FD) is a genetic disorder resulting from deficiency of the lysosomal enzyme α-galactosidase A (α-Gal A) which leads to globotriaosylceramide (GL-3) accumulation in multiple tissues. We report on the safety and pharmacodynamics of migalastat hydrochloride, an investigational pharmacological chaperone given orally every other day (QOD) to females with FD. This was an open-label, uncontrolled, Phase 2 study of 12 weeks with extension to 48 weeks in nine females with FD. Doses of 50mg, 150 mg and 250 mg were given QOD. At multiple time points, α-Gal A activity and GL-3 levels were quantified in blood cells, kidney and skin. GL-3 levels were also evaluated through skin and renal histology. Each individual GLA mutation was retrospectively categorized as being amenable or not to migalastat HCl based on an in vitro α-Gal A transfection assay developed in human embryonic kidney (HEK)-293 cells. Migalastat HCl was generally well tolerated. Patients with amenable mutations seem to demonstrate greater pharmacodynamic response to migalastat HCl compared to patients with non-amenable mutations. The greatest declines in urine GL-3 were observed in the three patients with amenable GLA mutations that were treated with 150 or 250 mg migalastat HCl QOD. Additionally, these three patients all demonstrated decreases in GL-3 inclusions in kidney peri-tubular capillaries. Migalastat HCl is a candidate oral pharmacological chaperone that provides a potential novel genotype-specific treatment for FD. Treatment resulted in GL-3 substrate decrease in female patients with amenable GLA mutations. Phase 3 studies are ongoing.", "Fabry disease is a metabolic disorder without a specific treatment, caused by a deficiency of the lysosomal enzyme alpha-galactosidase A (alpha-gal A). Most patients experience debilitating neuropathic pain and premature mortality because of renal failure, cardiovascular disease, or cerebrovascular disease. To evaluate the safety and efficacy of intravenous alpha-gal A for Fabry disease. Double-blind placebo-controlled trial conducted from December 1998 to August 1999 at the Clinical Research Center of the National Institutes of Health. Twenty-six hemizygous male patients, aged 18 years or older, with Fabry disease that was confirmed by alpha-gal A assay. A dosage of 0.2 mg/kg of alpha-gal A, administered intravenously every other week (12 doses total). Effect of therapy on neuropathic pain while without neuropathic pain medications measured by question 3 of the Brief Pain Inventory (BPI). Mean (SE) BPI neuropathic pain severity score declined from 6.2 (0.46) to 4.3 (0.73) in patients treated with alpha-gal A vs no significant change in the placebo group (P =.02). Pain-related quality of life declined from 3.2 (0.55) to 2.1 (0.56) for patients receiving alpha-gal A vs 4.8 (0.59) to 4.2 (0.74) for placebo (P =.05). In the kidney, glomeruli with mesangial widening decreased by a mean of 12.5% for patients receiving alpha-gal vs a 16.5% increase for placebo (P =.01). Mean inulin clearance decreased by 6.2 mL/min for patients receiving alpha-gal A vs 19.5 mL/min for placebo (P =.19). Mean creatinine clearance increased by 2.1 mL/min (0.4 mL/s) for patients receiving alpha-gal A vs a decrease of 16.1 mL/min (0.3 mL/s) for placebo (P =.02). In patients treated with alpha-gal A, there was an approximately 50% reduction in plasma glycosphingolipid levels, a significant improvement in cardiac conduction, and a significant increase in body weight. Intravenous infusions of alpha-gal A are safe and have widespread therapeutic efficacy in Fabry disease.", "Fabry disease (FD) is an X-linked lysosomal storage disease caused by alpha-galactosidase A deficiency. The Fabry Registry is a global clinical effort to collect longitudinal data on FD. In the past, most \"carrier\" females were usually thought to be clinically unaffected. A systematic effort has been made to enroll all FD females, regardless of symptomology. Of the 1077 enrolled females in the Registry, 69.4% had symptoms and signs of FD. The median age at symptom onset among females was 13 years, and even though 84.1% had a positive family history, the diagnosis was not made until a median age of 31 years. Twenty percent experienced major cerebrovascular, cardiac, or renal events, at a median age of 46 years. Among adult females with estimated glomerular filtration rate (eGFR) data (N=638), 62.5% had an eGFR <90 ml/min/1.73 m2 and 19.0% had eGFR <60 ml/min/1.73 m2. Proteinuria 300 mg/day was present in 39.0% of females, and 22.2% had >1 gram/day. Quality of life (QoL), as measured by the SF-36((R)) survey, was impaired at a later age than in males, but both genders experience significantly impaired QoL from the third decade of life onward. Thus, females with FD have a significant risk for major organ involvement and decreased QoL. Females should be regularly monitored for signs and symptoms of FD, and considered for enzyme replacement therapy.", "Fabry disease is an X-linked lysosomal storage disorder caused by mutations in the gene encoding alpha-galactosidase A (alpha-Gal A), with consequent accumulation of its major glycosphingolipid substrate, globotriaosylceramide (GL-3). Over 500 Fabry mutations have been reported; approximately 60% are missense. The iminosugar 1-deoxygalactonojirimycin (DGJ, migalastat hydrochloride, AT1001) is a pharmacological chaperone that selectively binds alpha-Gal A, increasing physical stability, lysosomal trafficking, and cellular activity. To identify DGJ-responsive mutant forms of alpha-Gal A, the effect of DGJ incubation on alpha-Gal A levels was assessed in cultured lymphoblasts from males with Fabry disease representing 75 different missense mutations, one insertion, and one splice-site mutation. Baseline alpha-Gal A levels ranged from 0 to 52% of normal. Increases in alpha-Gal A levels (1.5- to 28-fold) after continuous DGJ incubation for 5 days were seen for 49 different missense mutant forms with varying EC(50) values (820 nmol/L to >1 mmol/L). Amino acid substitutions in responsive forms were located throughout both structural domains of the enzyme. Half of the missense mutant forms associated with classic (early-onset) Fabry disease and a majority (90%) associated with later-onset Fabry disease were responsive. In cultured fibroblasts from males with Fabry disease, the responses to DGJ were comparable to those of lymphoblasts with the same mutation. Importantly, elevated GL-3 levels in responsive Fabry fibroblasts were reduced after DGJ incubation, indicating that increased mutant alpha-Gal A levels can reduce accumulated substrate. These data indicate that DGJ merits further evaluation as a treatment for patients with Fabry disease with various missense mutations.", "Fabry disease is a rare X-linked lysosomal storage disease characterized by the dysfunction of multiple systems, including significant gastrointestinal involvement such as diarrhea, abdominal pain, early satiety and nausea. The gastrointestinal symptoms of Fabry disease are thought to be due to neuropathic and myopathic changes leading to symptoms of dysmotility that are encountered in many other disorders. The gastrointestinal symptoms can often be one of the presenting signs of the disease in childhood, but can be misdiagnosed by gastroenterologists for many years due to their nonspecific presentation. As the chief treatment for Fabry is enzyme-replacement therapy that has been shown to stabilize and possibly reverse disease course, recognition of these symptoms and early diagnosis in an attempt to prevent progression with treatment, is critical.", "Gaucher disease (GD), the most prevalent lysosomal storage disease, is caused by a deficiency of glucocerebrosidase (GCase). The identification of small molecules acting as agents for enzyme enhancement therapy is an attractive approach for treating different forms of GD. A thermal denaturation assay utilizing wild type GCase was developed to screen a library of 1,040 Food and Drug Administration-approved drugs. Ambroxol (ABX), a drug used to treat airway mucus hypersecretion and hyaline membrane disease in newborns, was identified and found to be a pH-dependent, mixed-type inhibitor of GCase. Its inhibitory activity was maximal at neutral pH, found in the endoplasmic reticulum, and undetectable at the acidic pH of lysosomes. The pH dependence of ABX to bind and stabilize the enzyme was confirmed by monitoring the rate of hydrogen/deuterium exchange at increasing guanidine hydrochloride concentrations. ABX treatment significantly increased N370S and F213I mutant GCase activity and protein levels in GD fibroblasts. These increases were primarily confined to the lysosome-enriched fraction of treated cells, a finding confirmed by confocal immunofluorescence microscopy. Additionally, enhancement of GCase activity and a reduction in glucosylceramide storage was verified in ABX-treated GD lymphoblasts (N370S/N370S). Hydrogen/deuterium exchange mass spectrometry revealed that upon binding of ABX, amino acid segments 243-249, 310-312, and 386-400 near the active site of GCase are stabilized. Consistent with its mixed-type inhibition of GCase, modeling studies indicated that ABX interacts with both active and non-active site residues. Thus, ABX has the biochemical characteristics of a safe and effective enzyme enhancement therapy agent for the treatment of patients with the most common GD genotypes.", "Fabry disease (FD) is an X-linked hereditary defect of glycosphingolipid storage caused by mutations in the gene encoding the lysosomal hydrolase α-galactosidase A (GLA, α-gal A). To date, over 400 mutations causing amino acid substitutions have been described. Most of these mutations are related to the classical Fabry phenotype. Generally in lysosomal storage disorders a reliable genotype/phenotype correlation is difficult to achieve, especially in FD with its X-linked mode of inheritance. In order to predict the metabolic consequence of a given mutation, we combined in vitro enzyme activity with in vivo biomarker data. Furthermore, we used the pharmacological chaperone (PC) 1-deoxygalactonojirimycin (DGJ) as a tool to analyse the influence of individual mutations on subcellular organelle-trafficking and stability. We analysed a significant number of mutations and correlated the obtained properties to the clinical manifestation related to the mutation in order to improve our knowledge of the identity of functional relevant amino acids. Additionally, we illustrate the consequences of different mutations on plasma lyso-globotriaosylsphingosine (lyso-Gb3) accumulation in the patients' plasma, a biomarker proven to reflect the impaired substrate clearance caused by specific mutations. The established system enables us to provide information for the clinical relevance of PC therapy for a given mutant. Finally, in order to generate reliable predictions of mutant GLA defects we compared the different data sets to reveal the most coherent system to reflect the clinical situation.", "Fabry disease is an X-linked glycosphingolipid storage disorder caused by a deficiency of alpha-galactosidase A. Affected patients experience debilitating neuropathic pain and have premature mortality due to renal failure, cardiovascular disease or cerebrovascular complications. The disease may be X-linked dominant, since most females heterozygous for Fabry disease are affected clinically. We evaluated the safety, efficacy and pharmacokinetics of agalsidase alfa (Replagal) administered intravenously to female patients with Fabry disease in an open-label, single-centre study. Fifteen severely affected patients received agalsidase alfa at 0.2 mg/kg every other week for up to 55 weeks. Agalsidase alfa was safe and well-tolerated in female patients. None of the patients developed antibodies or experienced an infusion reaction to agalsidase alfa. The pharmacokinetic profile of agalsidase alfa in female patients is comparable to the pharmacokinetics of agalsidase alfa in male patients. Mean urine sediment and plasma Gb3 levels decreased from baseline at 13, 27 and 41 weeks. A significant decrease in left ventricular mass from baseline was seen at weeks 27 (p = 0.003) and 41 (p = 0.039), and a significant reduction in QRS durations was seen at week 27 (p = 0.007). Furthermore, there was a significant improvement in quality of life. Renal function did not deteriorate in these 15 female patients over the 13- to 41-week period of observation. We conclude that enzyme replacement therapy with agalsidase alfa was safe and effective in female patients heterozygous for Fabry disease.", "Isofagomine (IFG) is an acid β-glucosidase (GCase) active site inhibitor that acts as a pharmacological chaperone. The effect of IFG on GCase function was investigated in GCase mutant fibroblasts and mouse models. IFG inhibits GCase with K(i) ∼30 nM for wild-type and mutant enzymes (N370S and V394L). Fibroblasts treated with IFG at μM concentrations showed enhancement of WT and mutant GCase activities and protein levels. Administration of IFG (30 mg/kg/day) to the mice homozygous for GCase mutations (V394L, D409H, or D409V) led to increased GCase activity in visceral tissues and brain extracts. IFG effects on GCase stability and substrate levels were evaluated in a mouse model (hG/4L/PS-NA) that has doxycycline-controlled human WT GCase (hGCase) expression driven by a liver-specific promoter and is also homozygous for the IFG-responsive V394L GCase. Both human and mouse GCase activity and protein levels were increased in IFG-treated mice. The liver-secreted hGCase in serum was stabilized, and its effect on the lung and spleen involvement was enhanced by IFG treatment. In 8-week IFG-treated mice, the accumulated glucosylceramide and glucosylsphingosine were reduced by 75 and 33%, respectively. Decreases of storage cells were correlated with >50% reductions in substrate levels. These results indicate that IFG stabilizes GCase in tissues and serum and can reduce visceral substrates in vivo.", "Reliable estimates of the frequency of Gaucher disease-producing mutations are not available. The high frequency of Gaucher disease in the Ashkenazi Jewish population is due to the occurrence of a mutation at nucleotide (nt) 1226. We have screened 593 DNA samples from normal Ashkenazi Jews, as well as 62 DNA samples from all our Ashkenazi Jewish patients with Gaucher disease, for the presence of the 1226 mutation. In the 593 presumed normal Ashkenazi Jewish individuals the 1226 mutation was identified in the heterozygous state in 37 and in the homozygous state in two, giving a gene frequency of .035 for the mutation. This 1226 mutation represented 73% of the 124 Gaucher disease alleles in Jewish Gaucher disease patients. Accordingly we estimate that the gene frequency for Gaucher disease among the Ashkenazi Jewish population is .047, which is equivalent to a carrier frequency of 8.9% and a birth incidence of 1:450." ]
Liver Cholesterol and Bile Acid Metabolism in Alzheimer's Disease
Alzheimer's disease (AD) is a neurodegenerative disease characterized by progressive cognitive impairment. It is hypothesized to develop due to the dysfunction of two major proteins, amyloid-β (Aβ) and microtubule-associated protein, tau. Evidence supports the involvement of cholesterol changes in both the generation and deposition of Aβ. This study was performed to better understand the role of liver cholesterol and bile acid metabolism in the pathophysiology of AD. We used male and female wild-type control (C57BL/6J) mice to compare to two well-characterized amyloidosis models of AD, APP/PS1, and
[ "Cholesterol balance is achieved both by synthesis in the body and by absorption in the gastrointestinal tract. Cholesterol synthesis and absorption are also critical determinants of plasma LDL cholesterol concentrations. In clinical practice, inhibitors of synthesis and inhibitors of absorption are both effective methods of lowering LDL cholesterol concentrations and may be utilized in combination. This review rationalizes these mechanisms of LDL reductions by placing them in the context of cholesterol balance as it is determined by digestive lipid metabolism.", "Bile acids are synthesized via the classic pathway initiated by cholesterol 7alpha-hydroxylase (CYP7A1), and via alternate pathways, one of which is initiated by sterol 27-hydroxylase (CYP27). These studies used mice lacking cholesterol 7alpha-hydroxylase (Cyp7a1(-/-)) to establish whether the loss of the classic pathway affected cholesterol homeostasis differently in males and females, and to determine if the rate of bile acid synthesis via alternate pathways was responsive to changes in the enterohepatic flux of cholesterol and bile acids. In both the Cyp7a1(-/-) males and females, the basal rate of bile acid synthesis was only half of that in matching Cyp7a1(+/+) animals. Although bile acid pool size contracted markedly in all the Cyp7a1(-/-) mice, the female Cyp7a1(-/-) mice maintained a larger, more cholic acid-rich pool than their male counterparts. Intestinal cholesterol absorption in the Cyp7a1(-/-) males fell from 46% to 3%, and in the matching females from 58% to 17%. Bile acid synthesis in Cyp7a1(+/+) males and females was increased 2-fold by cholesterol feeding, and 4-fold by cholestyramine treatment, but was not changed in matching Cyp7a1(-/-) mice by either of these manipulations. In the Cyp7a1(-/-) mice fed cholesterol, hepatic cholesterol concentrations increased only marginally in the males, but rose almost 3-fold in the females. CYP7A1 activity and mRNA levels were greater in females than in males, and were increased by cholesterol feeding in both sexes. CYP27 activity and mRNA levels did not vary as a function of CYP7A1 genotype, gender, or dietary cholesterol intake. We conclude that in the mouse the rate of bile acid synthesis via alternative pathways is unresponsive to changes in the enterohepatic flux of cholesterol and bile acid, and that factors governing gender-related differences in bile acid synthesis, pool size, and pool composition play an important role in determining the impact of CYP7A1 deficiency on cholesterol homeostasis in this species.", "Bile acids repress the transcription of cytochrome P450 7A1 (CYP7A1), which catalyzes the rate-limiting step in bile acid biosynthesis. Although bile acids activate the farnesoid X receptor (FXR), the mechanism underlying bile acid-mediated repression of CYP7A1 remained unclear. We have used a potent, nonsteroidal FXR ligand to show that FXR induces expression of small heterodimer partner 1 (SHP-1), an atypical member of the nuclear receptor family that lacks a DNA-binding domain. SHP-1 represses expression of CYP7A1 by inhibiting the activity of liver receptor homolog 1 (LRH-1), an orphan nuclear receptor that is known to regulate CYP7A1 expression positively. This bile acid-activated regulatory cascade provides a molecular basis for the coordinate suppression of CYP7A1 and other genes involved in bile acid biosynthesis.", "Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.", "Obesity and elevated serum lipids are associated with a threefold increase in the risk of developing atherosclerosis, a condition that underlies stroke, myocardial infarction, and sudden cardiac death. Strategies that aim to reduce serum cholesterol through modulation of liver enzymes have been successful in decreasing the risk of developing atherosclerosis and reducing mortality. Statins, which inhibit cholesterol biosynthesis in the liver, are considered among the most successful compounds developed for the treatment of cardiovascular disease. However, recent debate surrounding their effectiveness and safety prompts consideration of alternative cholesterol-lowering therapies, including increasing cholesterol catabolism through bile acid (BA) synthesis. Targeting the enzymes that convert cholesterol to BAs represents a promising alternative to other cholesterol-lowering approaches that treat atherosclerosis as well as fatty liver diseases and diabetes mellitus. Compounds that modify the activity of these pathways have been developed; however, there remains a lack of consideration of biological sex. This is necessary in light of strong evidence for sexual dimorphisms not only in the incidence and progression of the diseases they influence but also in the expression and activity of the proteins affected and in the manner in which men and women respond to drugs that modify lipid handling in the liver. A thorough understanding of the enzymes involved in cholesterol catabolism and modulation by biological sex is necessary to maximize their therapeutic potential.", "Bile acid (BA) synthesis is essential in cholesterol and lipid homoeostasis. Serum samples from 435 normal and 23 cholecystectomized subjects were obtained after overnight fasting and assayed for markers of BA and cholesterol synthesis, as well as cholesterol absorption. We determined whether BA synthesis was related to fibroblast growth factor 19 (FGF19; a circulating metabolic regulator that is thought to inhibit BA synthesis), gender, age and serum lipids. Bile acid synthesis varied more than 9-fold in normal individuals and was 29% higher in men than in women. Whilst low-density lipoprotein cholesterol increased with age, BA and cholesterol synthesis were stable. BA production was positively correlated with serum triglycerides (TGs), and 35% of individuals with a high level (>95th percentile) of BA synthesis had hypertriglyceridaemia (HTG) (>95th percentile). Serum FGF19 levels varied by 7-fold in normal individuals and were related inversely to BA synthesis but were not related to gender, plasma lipids or history of cholecystectomy. Bile acid synthesis has a wide inter-individual variation, is lower in women than in men and is correlated positively with serum TGs. High BA production is frequently linked to HTG. Age-related hypercholesterolaemia is not associated with changes in BA or cholesterol production, nor to an increase in cholesterol absorption. In humans, the circulating level of FGF19 may regulate hepatic BA production under fasting conditions.", "Bile acid synthesis occurs mainly via two pathways: the \"classic\" pathway, initiated by microsomal cholesterol 7alpha-hydroxylase (CYP7A1), and an \"alternative\" (acidic) pathway, initiated by sterol 27-hydroxylase (CYP27). CYP27 is located in the inner mitochondrial membrane, where cholesterol content is very low. We hypothesized that cholesterol transport into mitochondria may be rate-limiting for bile acid synthesis via the \"alternative\" pathway. Overexpression of the gene encoding steroidogenic acute regulatory (StAR) protein, a known mitochondrial cholesterol transport protein, led to a 5-fold increase in bile acid synthesis. An increase in StAR protein coincided with an increase in bile acid synthesis. CYP27 overexpression increased bile acid synthesis by <2-fold. The rates of bile acid synthesis following a combination of StAR plus CYP27 overexpression were similar to those obtained with StAR alone. TLC analysis of (14)C-labeled bile acids synthesized in cells overexpressing StAR showed a 5-fold increase in muricholic acid; in chloroform-extractable products, a dramatic increase was seen in bile acid biosynthesis intermediates (27- and 7,27-hydroxycholesterol). High-performance liquid chromatography analysis showed that 27-hydroxycholesterol accumulated in the mitochondria of StAR-overexpressing cells only. These findings suggest that cholesterol delivery to the inner mitochondrial membrane is the predominant rate-determining step for bile acid synthesis via the alternative pathway.", "The liver is the main site of estrogen metabolism, and liver disease is usually associated with an abnormal estrogen status. However, little is known about the mechanism underlying this connection. Here, we investigated the effects of bile acid (BA)-activated farnesoid X receptor (FXR) on the metabolism of 17β-estradiol (E2) during blockage of bile flow (cholestasis). Correlations between BA levels and E2 concentrations were established in patients with cholestasis, and hepatic expression profiles of key genes involved in estrogen metabolism were investigated in both WT and FXR-/- mice. We found that the elevated E2 level positively correlated with BA concentrations in the patients with cholestasis. We further observed that bile duct ligation (BDL) increases E2 levels in mouse serum, and this elevation effect was alleviated by deleting the FXR gene. Of note, FXR down-regulated the expression of hepatic sulfotransferase SULT1E1, the primary enzyme responsible for metabolic estrogen inactivation. At the molecular level, we found that FXR competes with the protein acetylase CREB-binding protein (CBP) for binding to the transcription factor hepatocyte nuclear factor 4α (HNF4α). This competition decreased HNF4α acetylation and nuclear retention, which, in turn, repressed HNF4α-dependent SULT1E1 gene transcription. These findings suggest that cholestasis induces BA-activated FXR activity, leading to downstream inhibition of SULT1E1 and hence impeding hepatic degradation of estrogen.", "Bile acids derived from cholesterol and oxysterols derived from cholesterol and bile acid synthesis pathways are signaling molecules that regulate cholesterol homeostasis in mammals. Many nuclear receptors play pivotal roles in the regulation of bile acid and cholesterol metabolism. Bile acids activate the farnesoid X receptor (FXR) to inhibit transcription of the gene for cholesterol 7alpha-hydroxylase, and stimulate excretion and transport of bile acids. Therefore, FXR is a bile acid sensor that protects liver from accumulation of toxic bile acids and xenobiotics. Oxysterols activate the liver orphan receptors (LXR) to induce cholesterol 7alpha-hydroxylase and ATP-binding cassette family of transporters and thus promote reverse cholesterol transport from the peripheral tissues to the liver for degradation to bile acids. LXR also induces the sterol response element binding protein-1c that regulates lipogenesis. Therefore, FXR and LXR play critical roles in coordinate control of bile acid, cholesterol, and triglyceride metabolism to maintain lipid homeostasis. Nuclear receptors and bile acid/oxysterol-regulated genes are potential targets for developing drug therapies for lowering serum cholesterol and triglycerides and treating cardiovascular and liver diseases.", "The sterol storage disorder cerebrotendinous xanthomatosis (CTX) is characterized by abnormal deposition of cholesterol and cholestanol in multiple tissues. Deposition in the central nervous system leads to neurological dysfunction marked by dementia, spinal cord paresis, and cerebellar ataxia. Deposition in other tissues causes tendon xanthomas, premature atherosclerosis, and cataracts. In two unrelated patients with CTX, we have identified different point mutations in the gene (CYP27) encoding sterol 27-hydroxylase, a key enzyme in the bile acid biosynthesis pathway. Transfection of mutant cDNAs into cultured cells results in the synthesis of immunoreactive sterol 27-hydroxylase protein with greatly diminished enzyme activity. We have localized the CYP27 gene to the q33-qter interval of human chromosome 2, and to mouse chromosome 1, in agreement with the autosomal recessive inheritance pattern of CTX. These findings underscore the essential role played by sterols in the central nervous system and suggest that mutations in other sterol metabolizing enzymes may contribute to diseases with neurological manifestations." ]
Extracellular vesicles as mediators and deliverers of cardioprotection in acute myocardial infarction
New treatments are urgently needed to reduce myocardial infarct size and prevent adverse post-infarct left ventricular remodeling, in order to preserve cardiac function, and prevent the onset of heart failure in patients presenting with acute myocardial infarction (AMI). In this regard, extracellular vesicles (EVs) have emerged as key mediators of cardioprotection. Endogenously produced EVs are known to play crucial roles in maintaining normal cardiac homeostasis and function, by acting as mediators of intercellular communication between different types of cardiac cells. Endogenous EVs have also been shown to contribute to innate cardioprotective strategies such as remote ischemic conditioning. In terms of EV-based therapeutics, stem cell-derived EVs have been shown to confer cardioprotection in a large number of small and large animal AMI models, and have the therapeutic potential to be applied in the clinical setting for the benefit of AMI patients, although several challenges need to be overcome. Finally, EVs may be used as vehicles to deliver therapeutics to the infarcted heart, providing a potential synergist approach to cardioprotection. In this review article, we highlight the various roles that EVs play as mediators and deliverers of cardioprotection, and discuss their therapeutic potential for improving clinical outcomes following AMI.
[ "Our objective was to determine whether human diabetic myocardium is amenable to the cardioprotective actions of ischaemic preconditioning. Human right atrial appendages were harvested from diabetic and non-diabetic patients undergoing elective coronary artery bypass graft surgery. The atrial trabeculae were isolated and subjected to 90 min. of hypoxia followed by 120 min. of reoxygenation, following which the percentage recovery of baseline contractile function was determined. The atrial trabeculae were randomized to: (i) controls (groups 1 and 3); (ii) standard hypoxic preconditioning (HPC) protocol consisting of 4 min. of hypoxia/16 min. of reoxygenation before the 90 min. index hypoxic period (groups 2 and 4); (iii) Prolonged HPC protocol consisting of: 7 min. of hypoxia /16 min. of reoxygenation before the index hypoxic period (group 5). In addition, basal levels of Akt phosphorylation were determined in right atrial appendages harvested from non-diabetic patients and diabetic patients to determine whether PI3K-Akt signalling is down-regulated in the diabetic heart. Standard HPC improved baseline contractile function in human atrial trabeculae harvested from non-diabetic patients (52.4 +/- 3.8% with HPC versus 30.0 +/- 3.2% in control: P = 0.001; N = 6/group), but not in atrial trabeculae isolated from diabetic patients (22.6 +/- 3.3% with HPC versus 28.5 +/- 1.9% in control: P > 0.05; N = 6/group). However, the prolonged HPC protocol did improve baseline contractile function in atrial trabeculae harvested from diabetic patients (42.0 +/- 2.4% with HPC versus 28.5 +/- 1.9% in control: P= 0.001; N > or = 6/group). Western blot analysis demonstrated lower levels of phosphorylated Akt in diabetic myocardium compared to non-diabetic myocardium (0.13 +/- 0.03 arbitrary units versus 0.39 +/- 0.11 arbitrary units: P= 0.047; N > or = 4/group). From the data obtained it appears that the threshold for preconditioning the diabetic myocardium is elevated which may be related to the down-regulation of the PI3K-Akt pathway.", "Naturally secreted nanovesicles known as exosomes are required for the regenerative effects of cardiosphere-derived cells (CDCs), and exosomes mimic the benefits of CDCs in rodents. Nevertheless, exosomes have not been studied in a translationally realistic large-animal model. We sought to optimize delivery and assess the efficacy of CDC-secreted exosomes in pig models of acute (AMI) and convalescent myocardial infarction (CMI). In AMI, pigs received human CDC exosomes (or vehicle) by intracoronary (IC) or open-chest intramyocardial (IM) delivery 30 min after reperfusion. No-reflow area and infarct size (IS) were assessed histologically at 48 h. Intracoronary exosomes were ineffective, but IM exosomes decreased IS from 80 ± 5% to 61 ± 12% (P= 0.001) and preserved left ventricular ejection fraction (LVEF). In a randomized placebo-controlled study of CMI, pigs 4 weeks post-myocardial infarction (MI) underwent percutaneous IM delivery of vehicle (n = 6) or CDC exosomes (n = 6). Magnetic resonance imaging (MRI) performed before and 1 month after treatment revealed that exosomes (but not vehicle) preserved LV volumes and LVEF (−0.1 ± 2.2% vs. −5.4 ± 3.6%, P= 0.01) while decreasing scar size. Histologically, exosomes decreased LV collagen content and cardiomyocyte hypertrophy while increasing vessel density. Cardiosphere-derived cell exosomes delivered IM decrease scarring, halt adverse remodelling and improve LVEF in porcine AMI and CMI. While conceptually attractive as cell-free therapeutic agents for myocardial infarction, exosomes have the disadvantage that IM delivery is necessary.", "Mesenchymal stromal cells (MSCs) exhibit antiapoptotic and proangiogenic functions in models of myocardial infarction which may be mediated by secreted small extracellular vesicles (sEVs). However, MSCs have frequently been harvested from aged or diseased patients, while the isolated sEVs often contain high levels of impurities. Here, we studied the cardioprotective and proangiogenic activities of size-exclusion chromatography-purified sEVs secreted from human foetal amniotic fluid stem cells (SS-hAFSCs), possessing superior functional potential to that of adult MSCs. We demonstrated for the first time that highly pure (up to 1.7 × 1010 particles/µg protein) and thoroughly characterised SS-hAFSC sEVs protect rat hearts from ischaemia-reperfusion injury in vivo when administered intravenously prior to reperfusion (38 ± 9% infarct size reduction, p < 0.05). SS-hAFSC sEVs did not protect isolated primary cardiomyocytes in models of simulated ischaemia-reperfusion injury in vitro, indicative of indirect cardioprotective effects. SS-hAFSC sEVs were not proangiogenic in vitro, although they markedly stimulated endothelial cell migration. Additionally, sEVs were entirely responsible for the promigratory effects of the medium conditioned by SS-hAFSC. Mechanistically, sEV-induced chemotaxis involved phosphatidylinositol 3-kinase (PI3K) signalling, as its pharmacological inhibition in treated endothelial cells reduced migration by 54 ± 7% (p < 0.001). Together, these data indicate that SS-hAFSC sEVs have multifactorial beneficial effects in a myocardial infarction setting.", "The cardioprotection of ischaemic preconditioning may be abolished in diabetic patients especially when some oral hypoglycaemics are used. The dose-response effect of gliclazide and glibenclamide on ischaemic preconditioning and the action of glibenclamide on signal transduction in human myocardium were investigated using right atrial appendages from cardiac surgery patients. Glibenclamide (0.1, 1, 3 and 10 microM) and gliclazide (1, 10, 30 and 100 microM) were added for 10 min prior to ischaemic preconditioning. The cardioprotection was abolished by glibenclamide at all concentrations and by gliclazide at supratherapeutic concentrations of 30 and 100 microM. Glibenclamide abolished the protective effect of mitoK(ATP) channel opening but not that of protein kinase C (PKC) or p38 mitogen activated protein kinase (p38MAPK) activation. In conclusion, glibenclamide and gliclazide differential effects may be a result of differential sensitivities. Glibenclamide does not block protection conferred by either PKC or p38MAPK activation. These findings may have clinical implications in ischaemic heart disease.", "We have shown previously that human diabetic myocardium cannot be preconditioned. Here, we have investigated the basis of this cardioprotective deficit. Right atrial sections from four patient groups-non-diabetic, insulin-dependent diabetes mellitus (IDDM), non-insulin-dependent diabetes mellitus (NIDDM) receiving glibenclamide, and NIDDM receiving metformin-were subjected to one of the following protocols: aerobic control, simulated ischemia/reoxygenation, ischemic preconditioning before ischemia, and pharmacological preconditioning with alpha 1 agonist phenylephrine, adenosine, the mito-K(ATP) channel opener diazoxide, the protein kinase C (PKC) activator phorbol-12-myristate-13-acetate (PMA), or the p38 mitogen-activated protein kinase (p38MAPK) activator anisomycin. Cellular damage was assessed using creatine kinase leakage and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) reduction. In mitochondrial preparations from non-diabetic and diabetic myocardium, mitochondrial membrane potential (Psi(m)) was assessed using JC-1 dye, and production of reactive oxygen species was determined. Preconditioning with ischemia, phenylephrine, adenosine, or diazoxide failed to protect diabetic myocardium. However, activation of PKC or p38MAPK was still protective. In isolated non-diabetic mitochondria, diazoxide partially depolarized Psi(m), an effect not seen in diabetic mitochondria. Furthermore, diazoxide increased superoxide production in non-diabetic but not in diabetic mitochondria. Our results show that the cardioprotective deficit in diabetic myocardium arises upstream of PKC and p38MAPK. We suggest that mitochondrial dysfunction in diabetic myocardium, possibly dysfunctional mito-K(ATP) channels, leads to impaired depolarization and superoxide production, and that this causes the inability to respond to preconditioning.", "Cardiosphere-derived cells (CDCs) confer cardioprotection in acute myocardial infarction by distinctive macrophage (Mϕ) polarization. Here we demonstrate that CDC-secreted exosomes (CDCexo) recapitulate the cardioprotective effects of CDC therapy known as cellular postconditioning. Rats and pigs underwent myocardial infarction induced by ischemia/reperfusion before intracoronary infusion of CDCexo, inert fibroblast exosomes (Fbexo; control), or vehicle. Two days later, infarct size was quantified. Macrophages were isolated from cardiac tissue or bone marrow for downstream analyses. RNA sequencing was used to determine exosome content and alterations in gene expression profiles in Mϕ. Administration of CDCexo but not Fbexo after reperfusion reduces infarct size in rat and pig models of myocardial infarction. Furthermore, CDCexo reduce the number of CD68+ Mϕ within infarcted tissue and modify the polarization state of Mϕ so as to mimic that induced by CDCs. CDCexo are enriched in several miRNAs (including miR-146a, miR-181b, and miR-126) relative to Fbexo. Reverse pathway analysis of whole-transcriptome data from CDCexo-primed Mϕ implicated miR-181b as a significant (P=1.3x10-21) candidate mediator of CDC-induced Mϕ polarization, and PKCδ (protein kinase C δ) as a downstream target. Otherwise inert Fbexo loaded selectively with miR-181b alter Mϕ phenotype and confer cardioprotective efficacy in a rat model of myocardial infarction. Adoptive transfer of PKCδ-suppressed Mϕ recapitulates cardioprotection. Our data support the hypothesis that exosomal transfer of miR-181b from CDCs into Mϕ reduces PKCδ transcript levels and underlies the cardioprotective effects of CDCs administered after reperfusion.", "Pre-, post-, and remote conditioning of the myocardium are well described adaptive responses that markedly enhance the ability of the heart to withstand a prolonged ischemia/reperfusion insult and provide therapeutic paradigms for cardioprotection. Nevertheless, more than 25 years after the discovery of ischemic preconditioning, we still do not have established cardioprotective drugs on the market. Most experimental studies on cardioprotection are still undertaken in animal models, in which ischemia/reperfusion is imposed in the absence of cardiovascular risk factors. However, ischemic heart disease in humans is a complex disorder caused by, or associated with, cardiovascular risk factors and comorbidities, including hypertension, hyperlipidemia, diabetes, insulin resistance, heart failure, altered coronary circulation, and aging. These risk factors induce fundamental alterations in cellular signaling cascades that affect the development of ischemia/reperfusion injury per se and responses to cardioprotective interventions. Moreover, some of the medications used to treat these risk factors, including statins, nitrates, and antidiabetic drugs, may impact cardioprotection by modifying cellular signaling. The aim of this article is to review the recent evidence that cardiovascular risk factors and their medication may modify the response to cardioprotective interventions. We emphasize the critical need to take into account the presence of cardiovascular risk factors and concomitant medications when designing preclinical studies for the identification and validation of cardioprotective drug targets and clinical studies. This will hopefully maximize the success rate of developing rational approaches to effective cardioprotective therapies for the majority of patients with multiple risk factors." ]
Development and validation of the School Attachment Monitor (SAM)
Attachment research has been limited by the lack of quick and easy measures. We report development and validation of the School Attachment Monitor (SAM), a novel measure for largescale assessment of attachment in children aged 5-9, in the general population. SAM offers automatic presentation, on computer, of story-stems based on the Manchester Child Attachment Story Task (MCAST), without the need for trained administrators. SAM is delivered by novel software which interacts with child participants, starting with warm-up activities to familiarise them with the task. Children's story completion is video recorded and augmented by 'smart dolls' that the child can hold and manipulate, with movement sensors for data collection. The design of SAM was informed by children of users' age range to establish their task understanding and incorporate their innovative ideas for improving SAM software.
[ "Attachment is transmitted from one generation to the next. Adult attachment has been shown to predict the security or insecurity of children's attachment relationship with their parents. In search for the mechanism of intergenerational transmission of attachment sensitive parenting has been the main focus of research during the past four decades. Meta-analytic work confirmed the role of sensitive parenting, but a large explanatory gap remains to be explained. Parental mentalization has not yet fulfilled its promise as a bridge across the transmission gap. Here we suggest a model of intergenerational transmission that includes context and differential susceptibility, and we argue that the concept of parenting should be broadened to include autonomy support, limit-setting, protective parenting, parental warmth, and repair of mismatches.", "In this longitudinal investigation, Bell and Ainsworth's (1972) Baltimore study on maternal responsiveness, infant crying and infant attachment security was replicated and extended. Each of the 50 families was observed at home during more than 20 hours, and infant crying behavior as well as maternal responses were recorded. Mothers and their infants were observed in the Strange Situation procedure at 15 months of age. Descriptive results showed that infants produced about the same number of crying bouts across the first 40 weeks after birth, but the duration of the bouts decreased by half during this period. The duration of crying peaked in the first nine weeks. The descriptive data are remarkably similar to the findings of Bell and Ainsworth (1972). Maternal responsiveness influenced crying behavior. Contrary to our expectations, the more frequently mothers ignored their infants' crying bout in the first nine-week period, the less frequently their infants cried in the following nine-week period, even if intervening variables like earlier crying and synchronous responsiveness were controlled for. 'Benign neglect' of fussing may stimulate the emergent abilities in infants to cope with mild distress. Extending an earlier report on this investigation (Hubbard & van IJzendoorn, 1991), we found that crying at home did not differentiate between secure and insecure attachment classifications, and it was not related to Strange Situation crying. Mothers of avoidant infants responded most promptly to their infants' crying. The failure to replicate the Baltimore findings was interpreted in terms of 'differential responsiveness'.", "Few objective data are available regarding infants' night waking behaviors and the development of self-soothing during the first year of life. This cross-sectional study examined 80 infants in one of four age groups (3, 6, 9, or 12 mo) for four nights by using videosomnography to code nighttime awakenings and parent-child interactions. A large degree of variability was observed in parents' putting the infant to bed awake or asleep and in responding to vocalizations after nighttime awakenings. Most infants woke during the night at all ages observed. Younger infants tended to require parental intervention at night to return to sleep, whereas older infants exhibited a greater proportion of self-soothing after nighttime awakenings. However, even in the 12-month-old group, 50% of infants typically required parental intervention to get back to sleep after waking. Results emphasize the individual and contextual factors that effect the development of self-soothing behavior during the first year of life.", "To develop a brief standardised observational schedule for Reactive Attachment Disorder (RAD) in school-age children to aid clinician recognition of these behaviours. A new structured observational schedule for symptoms of RAD was developed using unstructured observation of children in a clinic waiting room setting. The measure's ability to discriminate between a sample of children with RAD and a normative sample was established by comparing scores in these two groups. Children aged 5-8 years (n = 77 [38 RAD cases and 39 controls]) were observed with their primary caregiver in a standardised waiting room setting. A structured observational tool was developed that tested the reliability, sensitivity and specificity of each item. The schedule has good internal consistency (0.75). The individual items on the observational schedule were predominantly highly discriminatory between cases and comparisons, showing both reasonable sensitivity and excellent specificity. Certain questions were dropped due to poor discrimination and/or poor inter-rater reliability. The 10-item observational schedule for RAD in school-age children provides a promising tool for assessment, although further research will be required to evaluate its ability to discriminate between RAD and other disorders.", "This study examined associations between mother-infant nighttime interactions and mother-infant attachment when infants were 12 months old. Forty-four mother-infant pairs participated in this study. For three consecutive nights at home, babies were observed in their cribs using a digital video system. Mothers reported on their nighttime interactions with their babies using a self-report diary and completed a questionnaire regarding child temperament. Attachment was assessed in the Strange Situation (Ainsworth, Blehar, Waters, & Wall, 1978). Mothers of securely attached infants had nighttime interactions that were generally more consistent, sensitive and responsive than those of insecurely attached infants. Specifically, in secure dyads, mothers generally picked up and soothed infants when they fussed or cried after an awakening.", "Narrative, the creation of imaginative projects and experiences displayed in expressions of movement and voice, is how human cooperative understanding grows. Human understanding places the character and qualities of objects and events of interest within stories that portray intentions, feelings, and ambitions, and how one cares about them. Understanding the development of narrative is therefore essential for understanding the development of human intelligence, but its early origins are obscure. We identify the origins of narrative in the innate sensorimotor intelligence of a hypermobile human body and trace the ontogenesis of narrative form from its earliest expression in movement. Intelligent planning, with self-awareness, is evident in the gestures and motor expressions of the mid-gestation fetus. After birth, single intentions become serially organized into projects with increasingly ambitious distal goals and social meaning. The infant imitates others' actions in shared tasks, learns conventional cultural practices, and adapts his own inventions, then names topics of interest. Through every stage, in simple intentions of fetal movement, in social imitations of the neonate, in early proto-conversations and collaborative play of infants and talk of children and adults, the narrative form of creative agency with it four-part structure of 'introduction,' 'development,' 'climax,' and 'resolution' is present. We conclude that shared rituals of culture and practical techniques develop from a fundamental psycho-motor structure with its basic, vital impulses for action and generative process of thought-in-action that express an integrated, imaginative, and sociable Self. This basic structure is evident before birth and invariant in form throughout life. Serial organization of single, non-verbal actions into complex projects of expressive and explorative sense-making become conventional meanings and explanations with propositional narrative power. Understanding the root of narrative in embodied meaning-making in this way is important for practical work in therapy and education, and for advancing philosophy and neuroscience.", "This study addresses the extent to which insecure and disorganized attachments increase risk for externalizing problems using meta-analysis. From 69 samples (N = 5,947), the association between insecurity and externalizing problems was significant, d = 0.31 (95% CI: 0.23, 0.40). Larger effects were found for boys (d = 0.35), clinical samples (d = 0.49), and from observation-based outcome assessments (d = 0.58). Larger effects were found for attachment assessments other than the Strange Situation. Overall, disorganized children appeared at elevated risk (d = 0.34, 95% CI: 0.18, 0.50), with weaker effects for avoidance (d = 0.12, 95% CI: 0.03, 0.21) and resistance (d = 0.11, 95% CI: -0.04, 0.26). The results are discussed in terms of the potential significance of attachment for mental health." ]
Minimal number of Lennard-Jones parameters for molecular simulations
Force fields used in molecular simulations contain numerical parameters, such as Lennard-Jones (LJ) parameters, which are assigned to the atoms in a molecule based on a classification of their chemical environments. The number of classes, or types, should be no more than needed to maximize agreement with experiment, as parsimony avoids overfitting and simplifies parameter optimization. However, types have historically been crafted based largely on chemical intuition, so current force fields may contain more types than needed. In this study, we seek the minimum number of LJ parameter types needed to represent key properties of organic liquids. We find that highly competitive force field accuracy is obtained with minimalist sets of LJ types; e.g. two H types and one type apiece for C, O, and N atoms. We also find that the fitness surface has multiple minima, which can lead to local trapping of the optimizer.
[ "This unit is the first in a series of four units covering the analysis of nucleic acid structure by molecular modeling. This unit provides an overview of computer simulation of nucleic acids. Topics include the static structure model, computational graphics and energy models, generation of an initial model, and characterization of the overall three-dimensional structure.", "The article reviews the application of biomolecular simulation methods to understand the structure, dynamics and interactions of nucleic acids with a focus on explicit solvent molecular dynamics simulations of guanine quadruplex (G-DNA and G-RNA) molecules. While primarily dealing with these exciting and highly relevant four-stranded systems, where recent and past simulations have provided several interesting results and novel insight into G-DNA structure, the review provides some general perspectives on the applicability of the simulation techniques to nucleic acids.", "Molecular dynamics simulations capture the behavior of biological macromolecules in full atomic detail, but their computational demands, combined with the challenge of appropriately modeling the relevant physics, have historically restricted their length and accuracy. Dramatic recent improvements in achievable simulation speed and the underlying physical models have enabled atomic-level simulations on timescales as long as milliseconds that capture key biochemical processes such as protein folding, drug binding, membrane transport, and the conformational changes critical to protein function. Such simulation may serve as a computational microscope, revealing biomolecular mechanisms at spatial and temporal scales that are difficult to observe experimentally. We describe the rapidly evolving state of the art for atomic-level biomolecular simulation, illustrate the types of biological discoveries that can now be made through simulation, and discuss challenges motivating continued innovation in this field.", "A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.", "The factors that determine the conformation and stability of G-quadruplex forming sequences remain poorly understood. Here we demonstrate the influence of cosolvents on the conformation and stability of the human telomeric sequence d(A(GGGTTA)3GGG)) in both K(+) and Na(+) containing solutions using a combination of circular dichroism, NMR, and thermodynamics. Molecular crowding arguments have previously been used to suggest that the parallel quadruplex form may be biologically relevant. However, the small cosolvents previously used, PEG 200 and 400, are actually dehydrating agents. We have used acetonitrile as a non-hydrogen-bonding dehydrating agent; similar conformational transitions were observed in K(+) solution. Moreover, NMR analysis shows that the resulting structure contains non-anti guanine glycosyl torsion angles suggesting that the conformation present in acetonitrile is not identical to the all-parallel crystal structure, despite the supposed parallel type CD spectrum.", "Conformational stability of G-quartets found in telomeric DNA quadruplex structures requires the coordination of monovalent ions. Here, an extensive Hartree-Fock and density functional theory analysis of the energetically favored position of Li+, Na+, and K+ ions is presented. The calculations show that at quartet-quartet distances observed in DNA quadruplex structures (3.3 A), the Li+ and Na+ ions favor positions of 0.55 and 0.95 A outside the plane of the G-quartet, respectively. The larger K+ ion prefers a central position between successive G-quartets. The energy barrier separating the minima in the quartet-ion-quartet model are much smaller for the Li+ and Na+ ions compared with the K+ ion; this suggests that K+ ions will not move as freely through the central channel of the DNA quadruplex. Spin-spin coupling constants and isotropic chemical shifts in G-quartets extracted from crystal structures of K+- and Na+-coordinated DNA quadruplexes were calculated with B3LYP/6-311G(d). The results show that the sizes of the trans-hydrogen-bond couplings are influenced primarily by the hydrogen bond geometry and only slightly by the presence of the ion. The calculations show that the R(N2N7) distance of the N2-H2...N7 hydrogen bond is characterized by strong correlations to both the chemical shifts of the donor group atoms and the (h2)J(N2N7) couplings. In contrast, weaker correlations between the (h3)J(N1C6') couplings and single geometric factors related to the N1-H1...O6=C6 hydrogen bond are observed. As such, deriving geometric information on the hydrogen bond through the use of trans-hydrogen-bond couplings and chemical shifts is more complex for the N1-H1...O6=C6 hydrogen bond than for the N2-H2...N7 moiety. The computed trans-hydrogen-bond couplings are shown to correlate with the experimentally determined couplings. However, the experimental values do not show such strong geometric dependencies.", "Molecular dynamics and thermodynamic integration calculations have been carried out on a set of G-rich single-strand, duplex, triplex, and quadruplex DNAs to study the structural and stability changes connected with the guanine --> 6-thioguanine (G --> S) mutation. The presence of 6-thioguanine leads to a shift of the geometry from the B/A intermediate to the pure B-form in duplex DNA. The G --> S mutation does not largely affect the structure of the antiparallel triplex when it is located at the reverse-Hoogsteen position, but leads to a non-negligible local distortion in the structure when it is located at the Watson-Crick position. The G --> S mutation leads to destabilization of all studied structures: the lowest effect has been observed for the G --> S mutation in the reverse-Hoogsteen strand of the triplex, a medium effect has been observed in the Watson-Crick strand of the triplex and duplex, and the highest influence of the G -->S mutation has been found for the quadruplex structures." ]
Hepatic macrophages in the healthy and injured liver
The liver is an essential immunological organ due to its gatekeeper position to bypassing antigens from the intestinal blood flow and microbial products from the intestinal commensals. The tissue-resident liver macrophages, termed Kupffer cells, represent key phagocytes that closely interact with local parenchymal, interstitial and other immunological cells in the liver to maintain homeostasis and tolerance against harmless antigens. Upon liver injury, the pool of hepatic macrophages expands dramatically by infiltrating bone marrow-/monocyte-derived macrophages. The interplay of the injured microenvironment and altered macrophage pool skews the subsequent course of liver injuries. It may range from complete recovery to chronic inflammation, fibrosis, cirrhosis and eventually hepatocellular cancer. This review summarizes current knowledge on the classification and role of hepatic macrophages in the healthy and injured liver.
[ "Although macrophages are widely recognized to have a profibrotic role in inflammation, we have used a highly tractable CCl(4)-induced model of reversible hepatic fibrosis to identify and characterize the macrophage phenotype responsible for tissue remodeling: the hitherto elusive restorative macrophage. This CD11B(hi) F4/80(int) Ly-6C(lo) macrophage subset was most abundant in livers during maximal fibrosis resolution and represented the principle matrix metalloproteinase (MMP) -expressing subset. Depletion of this population in CD11B promoter-diphtheria toxin receptor (CD11B-DTR) transgenic mice caused a failure of scar remodeling. Adoptive transfer and in situ labeling experiments showed that these restorative macrophages derive from recruited Ly-6C(hi) monocytes, a common origin with profibrotic Ly-6C(hi) macrophages, indicative of a phenotypic switch in vivo conferring proresolution properties. Microarray profiling of the Ly-6C(lo) subset, compared with Ly-6C(hi) macrophages, showed a phenotype outside the M1/M2 classification, with increased expression of MMPs, growth factors, and phagocytosis-related genes, including Mmp9, Mmp12, insulin-like growth factor 1 (Igf1), and Glycoprotein (transmembrane) nmb (Gpnmb). Confocal microscopy confirmed the postphagocytic nature of restorative macrophages. Furthermore, the restorative macrophage phenotype was recapitulated in vitro by the phagocytosis of cellular debris with associated activation of the ERK signaling cascade. Critically, induced phagocytic behavior in vivo, through administration of liposomes, increased restorative macrophage number and accelerated fibrosis resolution, offering a therapeutic strategy to this orphan pathological process.", "The side effects of current immunosuppressive drugs have impeded the development of therapies for immune diseases. Selective regulation of STAT signaling is an attractive strategy for treating immune disorders. In this study, we used a small-molecule compound to explore possible means of targeting STAT1 for the treatment of Th1-mediated inflammation. Selective regulation of STAT1 signaling in T cells from C57BL/6 mice was accomplished using fusaruside, a small-molecule compound that triggers the tyrosine phosphorylation of Src homology 2-containing protein tyrosine phosphatase 2 (SHP-2). The interaction of tyrosine phosphorylated SHP-2 (pY-SHP-2) with cytosolic STAT1 prevented the recruitment of STAT1 to IFN-γR and specifically inhibited STAT1 signaling, resulting in a reduction in Th1 cytokine production and an improvement in 2, 4, 6-trinitrobenzene sulfonic acid-induced colitis in mice. Blocking the pY-SHP-2-STAT1 interaction, with SHP-2 inhibitor NSC-87877 or using T cells from conditional SHP-2 knockout mice, reversed the effects of fusaruside, resulting in STAT1 activation and worsened colitis. The fusaruside-induced ability of pY-SHP-2 to selectively sequestrate STAT1 from recruitment to the receptor is independent of its function as a phosphatase, demonstrating a novel role for SHP-2 in regulating both STAT1 signaling and Th1-type immune responses. These findings could lead to increased options for the treatment of Crohn's disease and other Th1-mediated inflammatory diseases.", "Pathogen- and injury-related danger signals as well as cytokines released by immune cells influence the functional differentiation of macrophages in chronic inflammation. Recently, the liver-derived plasma protein, histidine-rich glycoprotein (HRG), was demonstrated, in mouse tumor models, to mediate the transition of alternatively activated (M2) to proinflammatory (M1) macrophages, which limit tumor growth and metastasis. We hypothesized that liver-derived HRG is a critical endogenous modulator of hepatic macrophage functionality and investigated its implications for liver inflammation and fibrosis by comparing C57BL/6N wild-type (WT) and Hrg(-/-) mice. In homeostatic conditions, hepatic macrophages were overall reduced and preferentially polarized toward the anti-inflammatory M2 subtype in Hrg(-/-) mice. Upon chronic liver damage induced by CCl4 or methionine-choline-deficient (MCD) diet, liver injury and fibrosis were attenuated in Hrg(-/-) , compared to WT, mice. Macrophage populations were reduced and skewed toward M2 polarization in injured livers of Hrg(-/-) mice. Moreover, HRG-deficient mice showed significantly enhanced hepatic vascularization by micro-computed tomography and histology, corroborating proangiogenic activities of M2-polarized liver macrophages. Purified HRG protein induced, but HRG-deficient serum prevented, M1 macrophage differentiation in vitro. Accordingly, Hrg(-/-) mice transplanted with Hrg(+/+) bone marrow, but not Hrg(-/-) -transplanted Hrg(+/+) mice, remained protected from experimental steatohepatitis. Consistent with these findings, patients with chronic hepatitis C and nonalcoholic steatohepatitis significantly up-regulated hepatocytic HRG expression, which was associated with M1 polarization of adjacent macrophages. Liver-derived HRG, similar to alarmins, appears to be an endogenous molecular factor promoting polarization of hepatic macrophages toward the M1 phenotype, thereby promoting chronic liver injury and fibrosis progression, but limiting angiogenesis. Therefore, controlling tissue levels of HRG or PGF might be a promising strategy in chronic inflammatory liver diseases.", "A key feature of inflammation is the timely recruitment of leukocytes, including monocytes, from blood into tissues, the latter maturing into macrophages over a period of 2-3 days. Using multi-channel spinning disk microscopy, we identified a rapid pathway of macrophage recruitment into an injured organ via a non-vascular route requiring no maturation from monocytes. In response to a sterile injury in liver, a reservoir of fully mature F4/80(hi)GATA6(+) peritoneal cavity macrophages rapidly invaded into afflicted tissue via direct recruitment across the mesothelium. The invasion was dependent on CD44 and DAMP molecule ATP and resulted in rapid replication and switching of macrophage toward an alternatively activated phenotype. These macrophages dismantled the nuclei of necrotic cells releasing DNA and forming a cover across the injury site. Rapid invasion of mature macrophages from body cavity with capacity for induction of reparative phenotype may impact altered tissues ranging from trauma to infections to cancer. VIDEO ABSTRACT.", "Liver injury impacts hepatic inflammation in part via Toll-like receptor (TLR) signalling. Triggering receptor expressed on myeloid cells 2 (TREM-2) modulates TLR4-mediated inflammation in bone marrow (BM)-derived macrophages but its function in liver injury is unknown. Here we hypothesised that the anti-inflammatory effects of TREM-2 on TLR signalling may limit hepatic injury. TREM-2 expression was analysed in livers of humans with various forms of liver injury compared with control individuals. Acute and chronic liver injury models were performed in wild type and Trem-2 mice. Primary liver cells from both genotypes of mice were isolated for in vitro experiments. TREM-2 was expressed on non-parenchymal hepatic cells and induced during liver injury in mice and man. Mice lacking TREM-2 exhibited heightened liver damage and inflammation during acute and repetitive carbon tetrachloride and acetaminophen (APAP) intoxication, the latter of which TREM-2 deficiency was remarkably associated with worsened survival. Liver damage in Trem-2 mice following chronic injury and APAP challenge was associated with elevated hepatic lipid peroxidation and macrophage content. BM transplantation experiments and cellular reactive oxygen species assays revealed effects of TREM-2 in the context of chronic injury depended on both immune and resident TREM-2 expression. Consistent with effects of TREM-2 on inflammation-associated injury, primary hepatic macrophages and hepatic stellate cells lacking TREM-2 exhibited augmented TLR4-driven proinflammatory responses. Our data indicate that by acting as a natural brake on inflammation during hepatocellular injury, TREM-2 is a critical regulator of diverse types of hepatotoxic injury.", "Hepatocyte cellular dysfunction and death induced by lipids and macrophage-associated inflammation are characteristics of nonalcoholic steatohepatitis (NASH). The fatty acid palmitate can activate death receptor 5 (DR5) on hepatocytes, leading to their death, but little is known about how this process contributes to macrophage-associated inflammation. We investigated whether lipid-induced DR5 signaling results in the release of extracellular vesicles (EVs) from hepatocytes, and whether these can induce an inflammatory macrophage phenotype. Primary mouse and human hepatocytes and Huh7 cells were incubated with palmitate, its metabolite lysophosphatidylcholine, or diluent (control). The released EV were isolated, characterized, quantified, and applied to macrophages. C57BL/6 mice were placed on chow or a diet high in fat, fructose, and cholesterol to induce NASH. Some mice also were given the ROCK1 inhibitor fasudil; 2 weeks later, serum EVs were isolated and characterized by immunoblot and nanoparticle-tracking analyses. Livers were collected and analyzed by histology, immunohistochemistry, and quantitative polymerase chain reaction. Incubation of primary hepatocytes and Huh7 cells with palmitate or lysophosphatidylcholine increased their release of EVs, compared with control cells. This release was reduced by inactivating mediators of the DR5 signaling pathway or rho-associated, coiled-coil-containing protein kinase 1 (ROCK1) inhibition. Hepatocyte-derived EVs contained tumor necrosis factor-related apoptosis-inducing ligand and induced expression of interleukin 1β and interleukin 6 messenger RNAs in mouse bone marrow-derived macrophages. Activation of macrophages required DR5 and receptor-interacting protein kinase 1. Administration of the ROCK1 inhibitor fasudil to mice with NASH reduced serum levels of EVs; this reduction was associated with decreased liver injury, inflammation, and fibrosis. Lipids, which stimulate DR5, induce release of hepatocyte EVs, which activate an inflammatory phenotype in macrophages. Strategies to inhibit ROCK1-dependent release of EVs by hepatocytes might be developed for the treatment of patients with NASH.", "A recently defined family of cytokines, consisting of ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), oncostatin M (OSM), and interleukin-6 (IL-6), utilize the Jak-Tyk family of cytoplasmic tyrosine kinases. The beta receptor components for this cytokine family, gp130 and LIF receptor beta, constitutively associate with Jak-Tyk kinases. Activation of these kinases occurs as a result of ligand-induced dimerization of the receptor beta components. Unlike other cytokine receptors studied to date, the receptors for the CNTF cytokine family utilize all known members of the Jak-Tyk family, but induce distinct patterns of Jak-Tyk phosphorylation in different cell lines." ]
Angiostrongylus costaricensis: 50 years of research
Angiostrongylus costaricensis is a zoonotic parasitic nematode described for the first time in 1971 by Pedro Morera and Rodolfo Céspedes in Costa Rica. This parasite causes an infection known as abdominal angiostrongyliasis, affecting mainly school-aged children and young adults. Infection with A. costaricensis has been associated with a myriad of rodent and mollusk species in the Americas and the Caribbean, as its natural hosts and reservoirs. In this commemorative review, we highlight the extensive research collected through a 50-year journey, which includes ecological, pathological, and molecular studies on A. costaricensis and its implicated disease. We also identify major knowledge gaps in its evolutionary history, the ecological role of imported and invasive mollusk species, and immune response. We propose that the advent of -omics analyses will allow us to gather novel information regarding A. costaricensis biology and infection dynamics, as well as to promote the design of much-needed sensitive and specific diagnostic tools.
[ "Angiostrongylus cantonensis is the most common cause of eosinophilic meningitis in humans after ingestion of raw or inadequately cooked intermediate hosts or food contaminated with infective third-stage larvae. Frogs are known to be a paratenic host of A. cantonensis, but have never been reported as the infectious source of human angiostrongyliasis in Taiwan. We report the first case of eosinophilic meningitis caused by A. cantonensis after ingestion of raw frogs (Rana plancyi).", "Angiostrongylus costaricensis is a parasitic nematode of rodents and molluscs are the intermediate hosts. Nocturnal collection of molluscs and search for infective third stage larvae of A. costaricensis was carried out in 18 endemic foci identified by the notification of a confirmed diagnosis in human biopsies or surgical specimens. Molluscs were digested in acidic solution and isolation of larvae eventually present was done in a Baermann funnel. Larvae identified by the presence of a delicate groove in the tail were counted to assess the individual parasitic burden. Four species were found infected, with ranges of prevalence in parenthesis: Phyllocaulis variegatus (7% to 33.3%); Bradybaena similaris (11.7% to 24.1%); Belocaulus angustipes (8.3%) and Phyllocaulis soleiformis (3.3% to 14.2%). Parasitic burden varied from 1 to 75 with P. variegatus, 1 to 98 with B. similaris. 1 to 13 with B. angustipes and 1 larvae in each of two specimens of P. solciformis. P. variegatus was present in all sites and was found infected with the highest prevalence figures and the highest individual parasitic burdens. These data stress the importance of veronicellid slugs as intermediate hosts for A. costaricensis in the endemic areas in Rio Grande do Sul, Brazil.", "The human cases of eosinophilic meningitis recently reported from Brazil have focused the attention of the public health agencies on the role the introduced snail Achatina fulica plays as hosts of the metastrongylid nematodes. Determining the potential of this snail to host and develop infective larval stages of metastrongylids in the wild and identify the species harbored by them is crucial for designing effective control measures. Here we assess if A. fulica may act as intermediate host of A. cantonensis at the peridomiciliary areas of a patient's house from state of Pernambuco (PE), who was diagnosed with eosinophilic meningitis and a history of ingesting raw molluscs. Larvae obtained from naturally infected A. fulica were orally administered to Rattus norvegicus. The worms were collected from the pulmonary artery and brain, and were morphologically characterized and compared to the Japan isolate of A. cantonensis. Adult worms and infective L(3) larvae (PE isolate) recovered from A. fulica specimens were also analyzed by polymerase chain reaction and restriction fragment length polymorphism of ITS2 region from rDNA and compared to A. cantonensis (ES isolate), A. vasorum (MG isolate) and A. costaricensis (RS isolate). The large size of the spicules (greater than those observed in other species of Angiostrongylus) and the pattern of the bursal rays agree with the original species description by Chen (1935). Furthermore, the morphology of the PE isolate was similar to that of Japan isolate. The PCR-RFLP profiles obtained were distinctive among species and no variation in patterns was detected among adult individuals from A. cantonensis isolates from PE and ES. The importance of A. fulica as an intermediate host of eosinophilic menigoencepahlitis in Brazil is emphasized.", "Angiostrongylus costaricensis is a nematode parasitic of rodents. Man may become infected by ingestion of the third stage larvae produced within the intermediate hosts, usually slugs from the family Veronicellidae. An epidemiological study carried out in a locality in southern Brazil (western Santa Catarina State) where these slugs are a crop pest and an important vector for A. costaricensis has documented for the first time the natural infection of Deroceras laeve with metastrongylid larvae. This small limacid slug is frequently found amid the folds of vegetable leaves and may be inadvertently ingested. Therefore D. laeve may have an important role in transmission of A. costaricensis to man.", "Angiostrongyliasis is a food-borne parasitic disease caused by the nematode Angiostrongylus cantonensis that can lead to eosinophilic meningitis (EM) or meningoencephalitis in humans. Angiostrongylus cantonensis is prevalent in the Pacific Islands. In recent years, a large number of outbreaks and severe cases have occurred. Several species of mollusk, such as snails and slugs, act as intermediate and paratenic hosts of A. cantonensis. In this study, two cases of EM were found to have been caused by infection with A. cantonensis due to consumption of raw centipedes. To survey the A. cantonensis infections acquired through centipedes that the patients had bought at a vegetable market, we performed etiological examinations and polymerase chain reaction amplification of A. cantonensis genes. Third-instar larvae of A. cantonensis were detected in the centipedes, and specific genes from A. cantonensis were detected in all the specimens. This indicates that the centipede may act as a competent host for the transmission of A. cantonensis. To our knowledge, this is the first report of A. cantonensis infection through the consumption of centipedes.", "Abdominal angiostrongyliasis is a parasitic zoonosis, endemic in the American continent. Its etiological agent is Angiostrongylus costaricensis, a nematode whose definitive hosts are rats and other rodents and the intermediate hosts, slugs. Mammals acquire the infection by consuming vegetables contaminated with L3 larvae. The disease shows a heterogeneous clinical spectrum and given its low incidence its diagnosis is a great challenge. In Colombia, the first case was reported in 1979 and until 1998, only five additional cases have been reported. However, in the last two decades, no new cases were reported. Here we discuss two cases of children from Huila and Caquetá departments who developed the disease. Both cases required long in-patient care and multiple surgical interventions. The diagnosis was achieved by histopathological observation of parasitic elements inside the mesenteric arteries. One of the children died while the other fully recovered. We discuss the epidemiology, pathogenic cycle, clinical presentation, diagnosis, and prevention strategies of this disease paying particular attention to our patients' features and the Colombian context.", "Angiostrongylus costaricensis has a broad geographic distribution spanning from North to South America and the infections of vertebrates with this nematode can result in abdominal complications. Human infections are diagnosed by histological or serological methods because the isolation of larvae from feces is not feasible, as most parasites become trapped in intestinal tissues due to intense eosinophilic inflammation. Because A. costaricensis is difficult to maintain in the laboratory, an immunodiagnostic IgG enzyme-linked immunosorbent assay (ELISA) using antigens from the congeneric Angiostrongylus cantonensis species was evaluated against a panel of serum samples from patients who were histologically diagnosed with A. costaricensis infections. Sera from uninfected individuals and individuals infected with other parasites were used as controls. The sensitivity and specificity of the assay were estimated at 88.4% and 78.7%, respectively. Because the use of purified or cloned antigens has not been established as a reliable diagnostic tool, the use of heterologous antigens may provide a viable alternative for the development of an ELISA-based immunodetection system for the diagnosis of abdominal angiostrongyliasis." ]
Dexamethasone and SARS-CoV-2: A Double-Edged Sword
In the context of the coronavirus disease 2019 (COVID-19) pandemic, the global healthcare community has raced to find effective therapeutic agents against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To date, dexamethasone is the first and an important therapeutic to significantly reduce the risk of death in COVID-19 patients with severe disease. Due to powerful anti-inflammatory and immunosuppressive effects, dexamethasone could attenuate SARS-CoV-2-induced uncontrolled cytokine storm, severe acute respiratory distress syndrome and lung injury. Nevertheless, dexamethasone treatment is a double-edged sword, as numerous studies have revealed that it has significant adverse impacts later in life. In this article, we reviewed the literature regarding the adverse effects of dexamethasone administration on different organ systems as well as related disease pathogenesis in an attempt to clarify the potential harms that may arise in COVID-19 patients receiving dexamethasone treatment. Overall, taking the threat of COVID-19 pandemic into account, we think it is necessary to apply dexamethasone as a pharmaceutical therapy in critical patients. However, its adverse side effects cannot be ignored. Our review will help medical professionals in the prognosis and follow-up of patients treated with dexamethasone. In addition, given that a considerable amount of uncertainty, confusion and even controversy still exist, further studies and more clinical trials are urgently needed to improve our understanding of the parameters and the effects of dexamethasone on patients with SARS-CoV-2 infection.
[ "Alzheimer's disease (AD) is the most common neurodegenerative disease. However, effective drugs for this disease have not yet been developed. The analysis of big data indicated that childhood herpes virus infection may be associated with the incidence of AD, suggesting that anti-herpetic drugs, such as acyclovir, may have preventive and suppressive effects in AD therapy. Moreover, short-term use of dexamethasone (DXMT), a clinical used synthetic corticosteroid, could effectively inhibit AD-related neuroinflammation. In this study, we have found that the combination of acyclovir and DXMT, but not acyclovir or DXMT alone, could protect against AD causing β-amyloid (Aβ) oligomer-induced spatial cognitive impairments. Moreover, acyclovir and DXMT could prevent Aβ oligomer-induced over-activation of microglia and astrocytes, and over-expression of pro-inflammatory cytokines, indicating that anti-AD effects of drug combination might be at least partially via neuroinflammation inhibition and immunomodulation. Furthermore, Aβ oligomer-induced decrease of PSD-95 and increase of pTau expression was prevented by the combination of acyclovir and DXMT, suggesting the involvement of synaptic protective effects of the drug combination. Taken together, our studies indicated that the combination of acyclovir and DXMT might be an alternative therapy for the treatment of AD.", "On 11 March 2020, the World Health Organization announced the Corona Virus Disease-2019 (COVID-19) as a global pandemic, which originated in China. At the host level, COVID-19, caused by the Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), affects the respiratory system, with the clinical symptoms ranging from mild to severe or critical illness that often requires hospitalization and oxygen support. There is no specific therapy for COVID-19, as is the case for any common viral disease except drugs to reduce the viral load and alleviate the inflammatory symptoms. Tuberculosis (TB), an infectious disease caused by Mycobacterium tuberculosis (Mtb), also primarily affects the lungs and has clinical signs similar to pulmonary SARS-CoV-2 infection. Active TB is a leading killer among infectious diseases and adds to the burden of the COVID-19 pandemic worldwide. In immunocompetent individuals, primary Mtb infection can also lead to a non-progressive, asymptomatic latency. However, latent Mtb infection (LTBI) can reactivate symptomatic TB disease upon host immune-suppressing conditions. Importantly, the diagnosis and treatment of TB are hampered and admixed with COVID-19 control measures. The US-Center for Disease Control (US-CDC) recommends using antiviral drugs, Remdesivir or corticosteroid (CST), such as dexamethasone either alone or in-combination with specific recommendations for COVID-19 patients requiring hospitalization or oxygen support. However, CSTs can cause immunosuppression, besides their anti-inflammatory properties. The altered host immunity during COVID-19, combined with CST therapy, poses a significant risk for new secondary infections and/or reactivation of existing quiescent infections, such as LTBI. This review highlights CST therapy recommendations for COVID-19, various types and mechanisms of action of CSTs, the deadly combination of two respiratory infectious diseases COVID-19 and TB. It also discusses the importance of screening for LTBI to prevent TB reactivation during corticosteroid therapy for COVID-19.", "Steroids are drugs that have been used extensively in a variety of conditions. Although widely prescribed for their anti-inflammatory and immunosuppressive properties, glucocorticoids have several side effects, being hyperglycemia one of the most common and representative. In the present review, we discuss the main epidemiologic characteristics associated with steroid use, with emphasis on the identification of high risk populations. Additionally we present the pathophysiology of corticosteroid induced hyperglycemia as well as the pharmacokinetics and pharmacodynamics associated with steroid use. We propose a treatment strategy based on previous reports and the understanding of the mechanism of action of both, the different types of glucocorticoids and the treatment options, in both the ambulatory and the hospital setting. Finally, we present some of the recent scientific advances as well as some options for future use of glucocorticoids.", "Infection-triggered perturbation of the immune system could induce psychopathology, and psychiatric sequelae were observed after previous coronavirus outbreaks. The spreading of the Severe Acute Respiratory Syndrome Coronavirus (COVID-19) pandemic could be associated with psychiatric implications. We investigated the psychopathological impact of COVID-19 in survivors, also considering the effect of clinical and inflammatory predictors. We screened for psychiatric symptoms 402 adults surviving COVID-19 (265 male, mean age 58), at one month follow-up after hospital treatment. A clinical interview and a battery of self-report questionnaires were used to investigate post-traumatic stress disorder (PTSD), depression, anxiety, insomnia, and obsessive-compulsive (OC) symptomatology. We collected sociodemographic information, clinical data, baseline inflammatory markers and follow-up oxygen saturation levels. A significant proportion of patients self-rated in the psychopathological range: 28% for PTSD, 31% for depression, 42% for anxiety, 20% for OC symptoms, and 40% for insomnia. Overall, 56% scored in the pathological range in at least one clinical dimension. Despite significantly lower levels of baseline inflammatory markers, females suffered more for both anxiety and depression. Patients with a positive previous psychiatric diagnosis showed increased scores on most psychopathological measures, with similar baseline inflammation. Baseline systemic immune-inflammation index (SII), which reflects the immune response and systemic inflammation based on peripheral lymphocyte, neutrophil, and platelet counts, positively associated with scores of depression and anxiety at follow-up. PTSD, major depression, and anxiety, are all high-burden non-communicable conditions associated with years of life lived with disability. Considering the alarming impact of COVID-19 infection on mental health, the current insights on inflammation in psychiatry, and the present observation of worse inflammation leading to worse depression, we recommend to assess psychopathology of COVID-19 survivors and to deepen research on inflammatory biomarkers, in order to diagnose and treat emergent psychiatric conditions.", "Systemic arterial hypertension (referred to as hypertension herein) is a major risk factor of mortality worldwide, and its importance is further emphasized in the context of the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection referred to as COVID-19. Patients with severe COVID-19 infections commonly are older and have a history of hypertension. Almost 75% of patients who have died in the pandemic in Italy had hypertension. This raised multiple questions regarding a more severe course of COVID-19 in relation to hypertension itself as well as its treatment with renin-angiotensin system (RAS) blockers, e.g. angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin receptor blockers (ARBs). We provide a critical review on the relationship of hypertension, RAS, and risk of lung injury. We demonstrate lack of sound evidence that hypertension per se is an independent risk factor for COVID-19. Interestingly, ACEIs and ARBs may be associated with lower incidence and/or improved outcome in patients with lower respiratory tract infections. We also review in detail the molecular mechanisms linking the RAS to lung damage and the potential clinical impact of treatment with RAS blockers in patients with COVID-19 and a high cardiovascular and renal risk. This is related to the role of angiotensin-converting enzyme 2 (ACE2) for SARS-CoV-2 entry into cells, and expression of ACE2 in the lung, cardiovascular system, kidney, and other tissues. In summary, a critical review of available evidence does not support a deleterious effect of RAS blockers in COVID-19 infections. Therefore, there is currently no reason to discontinue RAS blockers in stable patients facing the COVID-19 pandemic.", "There has been a significant progress in our understanding of the molecular mechanisms by which calcium (Ca2+) ions mediate various types of cardiac arrhythmias. A growing list of inherited gene defects can cause potentially lethal cardiac arrhythmia syndromes, including catecholaminergic polymorphic ventricular tachycardia, congenital long QT syndrome, and hypertrophic cardiomyopathy. In addition, acquired deficits of multiple Ca2+-handling proteins can contribute to the pathogenesis of arrhythmias in patients with various types of heart disease. In this review article, we will first review the key role of Ca2+ in normal cardiac function-in particular, excitation-contraction coupling and normal electric rhythms. The functional involvement of Ca2+ in distinct arrhythmia mechanisms will be discussed, followed by various inherited arrhythmia syndromes caused by mutations in Ca2+-handling proteins. Finally, we will discuss how changes in the expression of regulation of Ca2+ channels and transporters can cause acquired arrhythmias, and how these mechanisms might be targeted for therapeutic purposes.", "Peripheral nerve blocks (PNBs) have revolutionized distal extremity surgery reducing pain and improving hospital efficiency. Perineural dexamethasone has been administered with PNBs to prolong their effects, although the safety of dexamethasone has not been established in the literature. This study aimed to determine if the addition of dexamethasone affected the postoperative neurological sensory status for foot and ankle surgeries and the recovery of nerve injuries. We hypothesized that the rate of persistent nerve injury would be higher in the dexamethasone group. This is a retrospective observational cohort study of prospectively collected data of all patients from a single foot and ankle surgeon's practice. Perineural dexamethasone was routinely used as an adjunct by the regional anesthesia group until a clinical trend of increased paresthesia was found on short-term follow-up, which led to the discontinuation of its use. In this study, the cohort that received dexamethasone with ropivacaine was compared with the cohort that received ropivacaine alone. The primary outcome was a separate sensory nerve status sheet that was completed for every distal nerve territory for every patient at their follow-up visits at 2 weeks, 6 weeks, 3 months, and 6 months. Univariate analysis and a logistic regression model were used to determine the association between dexamethasone and delayed nerve recovery. A total of 250 patients were included in the study, with 117 patients in the dexamethasone group and 133 in the ropivacaine-only group. The rates of nerve injuries were not different between the groups (72 [62%] in the dexamethasone group vs 79 [59%] in the ropivacaine-only group). However, nerve injury symptoms were more likely to persist and not fully recover in the dexamethasone group (n = 47, 65%) compared with the ropivacaine-only group (n = 32, 41%) (OR, 2.12; P = .006). Perineural dexamethasone added to PNBs may be associated with delayed nerve recovery after foot and ankle surgery. It may be prudent to avoid its use until its full safety profile is established in larger prospective trials. Level III, retrospective comparative study." ]
Radiation therapy for head and neck rhabdomyosarcoma.
The use of radiation therapy is an important part of multimodality treatment for rhabdomyosarcoma. The specific doses, treatment volumes, and techniques used in radiation therapy can vary dramatically based upon a number of factors including location, tumor size, and molecular characteristics, resulting in complex decisions in treatment planning. This article reviews the principles of evaluation and management for head and neck rhabdomyosarcoma including a summary of the historical studies upon which current management is based.
[ "Rhabdomyosarcoma is the most common soft-tissue sarcoma in children. The most common sites are head and neck, genitourinary tract and extremities. In this review we outline the clinical and radiologic features of paediatric rhabdomyosarcoma, as well as imaging considerations and imaging of relapse.", "Intergroup Rhabdomyosarcoma Study (IRS)-II, (1978-1984) had the general goals of improving the survival and treatment of children with rhabdomyosarcoma (RMS). Nine hundred ninety-nine previously untreated eligible patients entered the study after surgery and were randomized or assigned to therapy by IRS Clinical Group (I-IV), tumor site, and histologic type. Outcomes were compared between treatments and with results of IRS-I (1972-1978). Patients in Group I, excluding extremity alveolar (EA) RMS, were randomized to standard vincristine (V), dactinomycin (A), and cyclophosphamide (C) or standard VA. At 5 years, disease-free survival (DFS) and survival (S) rates were similar between VAC and VA (DFS: 80%, 70%, P = 0.47; S: 85%, 84%, P = 0.73). Patients in Group II, excluding EA RMS, received radiation and were randomized to intensive VA or repetitive-pulse VAC. Outcomes were similar for rates of DFS (69%, 74%, P = 0.83) and S (88%, 79%, P = 0.17). Patients in Group III, excluding certain pelvic tumors, received radiation and were randomized to repetitive-pulse VAC or repetitive-pulse VAdrC-VAC (Adr, Adriamycin [doxorubicin]). Complete remission (CR) rates were close at 74%, 78%, respectively (P = 0.32), as were percentages in CR (73%) and S (66%) rates; the latter outcomes were significantly better than IRS-I (CR: 56%, P < 0.001; S: 50%, P < 0.001). Central nervous system prophylaxis for Group III patients with cranial parameningeal sarcoma increased S rate to 67% from 45% in IRS-I (P < 0.001). Patients in Group IV received the same regimens as Group III; the CR rate was 53%, 38% remained in CR and S rate was 27% with and 26% without Adr (P = 0.90). At 5 years, S rate for IRS-II, including EA and all pelvic tumors, was 63%: an 8% increase over IRS-I (P < 0.001). Outcomes by primary site were as good as, or better than, the IRS-I experience. Combining all Groups and treatments in IRS-II, the major improvement in S rate at 5 years between studies was in nonmetastatic patients (71% for IRS-II versus 63% for IRS-I, P = 0.01).", "Rhabdomyosarcoma (RMS) is the most common soft-tissue sarcoma of childhood. This paper is focuses on imaging for diagnosis, staging, and follow-up of noncraniofacial RMS.", "Recent Children's Oncology Group (COG) trials tested the efficacy of reduced therapy in an effort to lessen late effects compared to the Intergroup Rhabdomyosarcoma Study (IRS) IV regimen with associated hematologic and hepatic toxicity, and infertility. Here, we analyze the efficacy of 45 Gray (Gy) local radiotherapy (RT) in patients with Group III orbital embryonal rhabdomyosarcoma (ERMS) enrolled on the COG low-risk study ARST0331. Sixty-two patients with Group III orbital ERMS were treated on ARST0331 with four cycles of vincristine (VCR), dactinomycin (DACT), and cyclophosphamide (CPM; VAC, total cumulative CPM dose 4.8 g/m2 ) followed by four cycles of VCR and DACT over 22 weeks. Forty-five Gray of radiation was administered in 25 fractions beginning at week 13 of therapy. Fifty-three patients were evaluable for this response analysis; seven had missing week 12 response evaluation data and two had progressive disease prior to starting RT. Median follow-up was 7.8 years. None of the 15 patients with radiographic complete response (CR) compared to 6 of the 38 patients with <CR after 12 weeks of VAC chemotherapy had local recurrences (P = 0.11). There was no difference in overall survival by response at week 12 (P = 0.52). For patients with Group III orbital ERMS achieving a CR following VAC chemotherapy that includes modest dose CPM, 45 Gy may be sufficient for durable failure-free survival. However, for those with <CR treated with the ARST0331 systemic therapy, a different local therapy approach may be needed to achieve the control rate of IRS-IV without its toxicity.", "To analyze the effect of reduced-dose radiotherapy on local control in children with low-risk rhabdomyosarcoma (RMS) treated in the Children's Oncology Group D9602 study. Patients with low-risk RMS were nonrandomly assigned to receive radiotherapy doses dependent on the completeness of surgical resection of the primary tumor (clinical group) and the presence of involved regional lymph nodes. After resection, most patients with microscopic residual and uninvolved nodes received 36 Gy, those with involved nodes received 41.4 to 50.4 Gy, and those with orbital primary tumors received 45 Gy. All patients received vincristine and dactinomycin, with cyclophosphamide added for patient subsets with a higher risk of relapse in Intergroup Rhabdomyosarcoma Study Group III and IV studies. Three hundred forty-two patients were eligible for analysis; 172 received radiotherapy as part of their treatment. The cumulative incidence of local/regional failure was 15% in patients with microscopic involved margins when cyclophosphamide was not part of the treatment regimen and 0% when cyclophosphamide was included. The cumulative incidence of local/regional failure was 14% in patients with orbital tumors. Protocol-specified omission of radiotherapy in girls with Group IIA vaginal tumors (n = 5) resulted in three failures for this group. In comparison with Intergroup Rhabdomyosarcoma Study Group III and IV results, reduced-dose radiotherapy does not compromise local control for patients with microscopic tumor after surgical resection or with orbital primary tumors when cyclophosphamide is added to the treatment program. Girls with unresected nonbladder genitourinary tumors require radiotherapy for postsurgical residual tumor for optimal local control to be achieved." ]
Telehealth-Based Social Rhythm Therapy for Bipolar Disorder
Social rhythm irregularities are associated with increased bipolar disorder symptoms and suicide risk. This study was the first to examine the feasibility and acceptability of a 12-week social rhythm therapy (SRT) delivered predominantly via telehealth (three in-person sessions, nine via video teleconferencing) to adolescents and young adults with bipolar disorder. The primary aim was to determine the feasibility and acceptability of SRT delivered predominantly via telehealth. Secondary aims were to explore the intervention's impacts on social rhythm regularity, mood symptoms, and suicide propensity.
[ "Bipolar disorder requires psychiatric medications, but even guideline-concordant treatment fails to bring many patients to remission or keep them euthymic. To address this gap, researchers have developed adjunctive psychotherapies. The purpose of this paper is to critically review the evidence for the efficacy of manualized psychosocial interventions for bipolar disorder. We conducted a search of the literature to examine recent (2007-present), randomized controlled studies of the following psychotherapy interventions for bipolar disorder: psychoeducation (PE), cognitive behavioral therapy (CBT), interpersonal and social rhythm therapy (IPSRT), dialectical behavior therapy (DBT), mindfulness-based cognitive therapy (MBCT), and family therapies such as family focused therapy (FFT). All of the psychotherapy interventions appear to be effective in reducing depressive symptoms. Psychoeducation and CBT are associated with increased time to mood episode relapse or recurrence. MBCT has demonstrated a particular effectiveness in improving depressive and anxiety symptoms. Online psychotherapy interventions, programs combining one or more psychotherapy interventions, and targeted interventions centering on particular symptoms have been the focus of recent, randomized controlled studies in bipolar disorder. Psychotherapy interventions for the treatment of bipolar disorder have substantial evidence for efficacy. The next challenge will to disseminate these psychotherapies into the community.", "Decision-making between mental health clinicians and patients is under-researched. We tested whether mental health patients are more satisfied with a decision made (i) using their preferred decision-making style and (ii) with a clinician with the same decision-making style preference. As part of the CEDAR Study (ISRCTN75841675), a convenience sample of 445 patients with severe mental illness from six European countries were assessed for desired clinical decision-making style (rated by patients and paired clinicians), decision-specific experienced style and satisfaction. Patients who experienced more involvement in decision-making than they desired rated higher satisfaction (OR=2.47, P=0.005, 95% CI 1.32-4.63). Decisions made with clinicians whose decision-making style preference was for more active involvement than the patient preference were rated with higher satisfaction (OR=3.17, P=0.003, 95% CI 1.48-6.82). More active involvement in decision-making than the patient stated as desired was associated with higher satisfaction. A clinical orientation towards empowering, rather than shared, decision-making may maximise satisfaction.", "Mentally ill patients in crisis presenting to critical access hospital emergency rooms often face exorbitant wait times to be evaluated by a trained mental health provider. Patients may be discharged from the hospital before receiving an evaluation or boarded in a hospital bed for observation, reducing quality and increasing costs. This study examined the effectiveness of an emergency telemental health evaluation service implemented in a rural hospital emergency room. Retrospective data collection was implemented to consider patients presenting to the emergency room for 212 days prior to telemedicine interventions and for 184 days after. The study compared measures of time to treatment, length of stay (regardless of inpatient or outpatient status), and door-to-consult time. There were 24 patients seen before telemedicine was implemented and 38 seen using telemedicine. All patients had a mental health evaluation ordered by a physician and completed by a mental health specialist. Significant reductions in all three time measures were observed. Mean and median times to consult were reduced from 16.2 h (standard deviation=13.2 h) and 14.2 h, respectively, to 5.4 h (standard deviation =6.4 h) and 2.6 h. Similar reductions in length of stay and door-to-consult times were observed. By t tests, use of telemedicine was associated with a statistically significant reduction in all three outcome measures. Telemedicine appears to be an effective intervention for mentally ill patients by providing more timely access to mental health evaluations in rural hospital emergency departments.", "Bipolar disorder (BD) is one of the most burdensome mental disorders, with a lifetime prevalence of 2.4%, with a prevalence of 0.6% for bipolar type I and 0.4% for bipolar type II. Several interventions have been developed to implement the treatment strategy of bipolar disorder, including the Interpersonal and Social Rhythm Therapy (IPSRT). This intervention has been specifically developed to manage patients' stressful life events, improve the disruptions of social and circadian rhythms and increase adherence to medications. The aim of the present study is to assess the efficacy of IPSRT on affective and anxiety psychopathology, social functioning, response to pharmacological treatment and affective morbidity index (AMI) in BD patients. BD patients were consecutively recruited at the Mood Disorder Unit of the University of Campania \"Luigi Vanvitelli\" and randomly assigned to the experimental group receiving the IPSRT or to the Treatment as Usual (TAU) group. Patients were assessed at baseline, after 3 and 6 months with several validated assessment tools and with the affective morbidity index. At the end of the intervention, compared to controls, patients from the experimental group reported a significant improvement in anxious depressive and manic symptomatology, global functioning; and response to mood stabilizers. Patients in the IPSRT group reported a reduction at the AMI score. IPSRT has been confirmed to be effective in improving the clinical symptomology of BD patients and in improving the affective morbidity index. Further studies with longer follow-up are needed in order to assess the stability of the results.Trial registration The study was approved by the local ethical review board (N001567/28.01.2018).", "This randomized, controlled clinical trial compared the effect of interpersonal and social rhythm therapy (IPSRT) to that of specialist supportive care (SSC) on depressive outcomes (primary), social functioning, and mania outcomes over 26-78 weeks in young people with bipolar disorder receiving psychopharmacological treatment. Subjects were aged 15-36 years, recruited from a range of sources, and the patient groups included bipolar I disorder, bipolar II disorder, and bipolar disorder not otherwise specified. Exclusion criteria were minimal. Outcome measures were the Longitudinal Interval Follow-up Evaluation and the Social Adjustment Scale. Paired-sample t-tests were used to determine the significance of change from baseline to outcome period. Analyses of covariance were used to determine the impact of therapy, impact of lifetime and current comorbidity, interaction between comorbidity and therapy, and impact of age at study entry on depression. A group of 100 participants were randomized to IPSRT (n = 49) or SSC (n = 51). The majority had bipolar I disorder (78%) and were female (76%), with high levels of comorbidity. After treatment, both groups had improved depressive symptoms, social functioning, and manic symptoms. Contrary to our hypothesis, there was no significant difference between therapies. There was no impact of lifetime or current Axis I comorbidity or age at study entry. There was a relative impact of SSC for patients with current substance use disorder. IPSRT and SSC used as an adjunct to pharmacotherapy appear to be effective in reducing depressive and manic symptoms and improving social functioning in adolescents and young adults with bipolar disorder and high rates of comorbidity. Identifying effective treatments that particularly address depressive symptoms is important in reducing the burden of bipolar disorder." ]
what is fragile x syndrome
Whilst up to 60% of males with fragile X syndrome (FXS) meet criteria for autism spectrum disorder (ASD), the prevalence and nature of ASD in females with FXS remains unclear.
[ "Parents enrolling in a national survey of families of children with fragile X (FX) reported whether each of their children had been diagnosed or treated for developmental delay or eight conditions frequently associated with FX: attention problems, hyperactivity, aggressiveness, self-injury, autism, seizures, anxiety, or depression. This article reports results for 976 full mutation males, 259 full mutation females, 57 premutation males, and 199 premutation females. Co-occurring conditions were frequently reported for all FMR1 gene variations. The number of co-occurring conditions experienced was strongly associated with parent reports of their child's ability to learn, adaptability, and quality of life. Most individuals with the full mutation experienced multiple co-occurring conditions, with a modal number of 4 for males and 2 for females. Most (>80%) full mutation males and females had been diagnosed or treated for attention problems. Premutation males, when compared with a matched group of non-FX males, were more likely to have been diagnosed or treated for developmental delay, attention problems, aggression, seizures, autism, and anxiety. Premutation females were more likely to have been diagnosed or treated for attention problems, anxiety, depression, and developmental delay. Clusters of conditions were identified, seeming to occur in an additive fashion. Self-injury, autism, and seizures rarely occurred in isolation, but were more likely in individuals who also had problems with attention, anxiety, and hyperactivity. The findings provide a reference point for future studies on the prevalence and nature of co-occurring conditions in FX; suggest the possibility that certain conditions cluster together; provide evidence that male and female carriers experience elevated rates of co-occurring conditions compared with matched groups of non-carrier children; and emphasize the importance of including an assessment of co-occurring conditions in any clinical evaluation of individuals with abnormal variation in the FMR1 gene.", "To examine longitudinally the adaptive behavior patterns in fragile X syndrome. Caregivers of 275 children and adolescents with fragile X syndrome and 225 typically developing children and adolescents (2-18 years) were interviewed with the Vineland Adaptive Behavior Scales every 2 to 4 years as part of a prospective longitudinal study. Standard scores of adaptive behavior in people with fragile X syndrome are marked by a significant decline over time in all domains for males and in communication for females. Socialization skills are a relative strength as compared with the other domains for males with fragile X syndrome. Females with fragile X syndrome did not show a discernible pattern of developmental strengths and weaknesses. This is the first large-scale longitudinal study to show that the acquisition of adaptive behavior slows as individuals with fragile X syndrome age. It is imperative to ensure that assessments of adaptive behavior skills are part of intervention programs focusing on childhood and adolescence in this condition.", "The ability to indicate a failure to understand a message is a critical pragmatic (social) language skill for managing communication breakdowns and supporting successful communicative exchanges. The current study examined the ability to signal noncomprehension across different types of confusing message conditions in children and adolescents with fragile X syndrome (FXS), Down syndrome (DS), autism spectrum disorder (ASD), and typical development (TD). Controlling for nonverbal mental age and receptive vocabulary skills, youth with comorbid FXS and ASD and those with DS were less likely than TD controls to signal noncomprehension of confusing messages. Youth with FXS without ASD and those with idiopathic ASD did not differ from controls. No sex differences were detected in any group. Findings contribute to current knowledge of pragmatic profiles in different forms of genetically-based neurodevelopmental disorders associated with intellectual disability, and the role of sex in the expression of such profiles. Upon completion of this article, readers will have learned about: (1) the social-communicative profiles of youth with FXS, DS, and ASD, (2) the importance of signaling noncomprehension in response to a confusing message, and (3) the similarities and differences in noncomprehension signaling in youth with FXS (with and without ASD), DS, idiopathic ASD, and TD.", "Few studies have examined the relationship between autistic symptomatology and competence in independent living skills in adolescents and young adults with fragile X syndrome (FXS). In this study, 70 individuals with FXS, aged 15-25 years, and 35 matched controls were administered direct measures of independent living skills and autistic symptomatology. Results showed that higher levels of autistic symptomatology were associated with lower levels of competence in independent living skills in individuals with FXS, but not in controls. These data indicated that the relationship between autistic symptomatology and independent living skills was syndrome-specific. Early intervention strategies that address autistic symptomatology are sorely needed to improve functional outcomes in this population.", "We used National Fragile X Survey data in order to examine reported self-injurious behavior (SIB) to (a) generate lifetime and point prevalence estimates, (b) document detailed features of SIB (frequency, types, location, severity) in relation to gender, and (c) compare comorbid conditions between matched pairs (SIB vs. no SIB). Results indicate significant gender differences in frequency, topography, and location of SIB as well as sleep difficulties, comorbid conditions, pain sensitivity, and seizures. Matched pair comparisons (SIB vs. no SIB) revealed differences for males in sensory and attention problems, hyperactivity, aggression, autism, and anxiety and for females, in autism, attention, and anxiety. These results further clarify gender differences as well as comorbidity patterns between children with fragile X syndrome with and without SIB.", "Fragile X syndrome, caused by mutations in a single gene of the X chromosome (FMR1), is associated with neurobehavioral characteristics including social deficits with peers, social withdrawal, gaze aversion, inattention, hyperactivity, anxiety, depression, and autistic behavior. However, there is considerable variability in the behavioral and psychiatric problems among children with this condition. The purpose of this study was to measure genetic and environmental factors influencing behavior problems and autistic symptoms in children with fragile X syndrome. We conducted an in-home evaluation of 120 children (80 boys and 40 girls) with the fragile X full mutation and their unaffected siblings, including measurements of the FMR1 protein (FMRP), quality of the home environment, maternal and paternal psychopathology, effectiveness of educational and therapeutic services, and child behavior problems. Results of multiple regression analyses showed that for boys with fragile X, effectiveness of educational and therapeutic services and parental psychological problems predicted internalizing and externalizing types of problems, while the quality of the home environment predicted autistic behavior. For girls with fragile X, the results emphasized significant effects of FMRP on behavior, in particular social withdrawal and anxious/depressed behavior. These findings are among the first to link FMRP expression to behavior. They also emphasize the significance of home- and school-based environmental variables in the neurobehavioral phenotype and help to lay the foundation for studies designed to identify specific interventions for reducing problem behavior in children with fragile X syndrome.", "We examined autistic behavior in a cross-sectional sample of 179 children with fragile X syndrome (FXS) and a longitudinal subset of 116 children using the Childhood Autism Rating Scale (CARS) to (a) determine a prevalence of autistic behavior in FXS, (b) examine the stability of autistic ratings over time, and (c) assess the association between the fragile X mental retardation protein (FMRP) and autistic behavior. Approximately 21% of the sample of 129 children (25.9% of boys) scored at or above the cutoff for autism. CARS scores increased slowly, yet significantly, over time, and low levels of FMRP were associated with higher mean levels of autistic behavior as measured by the CARS." ]
Differentially expressed genes in the longissimus thoracis muscle of Korean cattle
This study compared differentially expressed genes (DEGs) between groups with high and low numbers of fine marbling particles (NFMP) in the longissimus thoracis muscle (LT) of Korean cattle to understand the molecular events associated with fine marbling particle formation.
[ "Adipocytes store triglyceride during periods of nutritional affluence and release free fatty acids during fasting through coordinated cycles of lipogenesis and lipolysis. While much is known about the acute regulation of these processes during fasting and feeding, less is understood about the transcriptional basis by which adipocytes control lipid handling. Here, we show that interferon regulatory factor 4 (IRF4) is a critical determinant of the transcriptional response to nutrient availability in adipocytes. Fasting induces IRF4 in an insulin- and FoxO1-dependent manner. IRF4 is required for lipolysis, at least in part due to direct effects on the expression of adipocyte triglyceride lipase and hormone-sensitive lipase. Conversely, reduction of IRF4 enhances lipid synthesis. Mice lacking adipocyte IRF4 exhibit increased adiposity and deficient lipolysis. These studies establish a link between IRF4 and the disposition of calories in adipose tissue, with consequences for systemic metabolic homeostasis.", "Lipid metabolism is tightly controlled by the nutritional state of the organism. Nutrient-rich conditions increase lipogenesis, whereas nutrient deprivation promotes fat oxidation. In this study, we identify the mitochondrial sirtuin, SIRT4, as a regulator of lipid homeostasis. SIRT4 is active in nutrient-replete conditions to repress fatty acid oxidation while promoting lipid anabolism. SIRT4 deacetylates and inhibits malonyl CoA decarboxylase (MCD), an enzyme that produces acetyl CoA from malonyl CoA. Malonyl CoA provides the carbon skeleton for lipogenesis and also inhibits fat oxidation. Mice lacking SIRT4 display elevated MCD activity and decreased malonyl CoA in skeletal muscle and white adipose tissue. Consequently, SIRT4 KO mice display deregulated lipid metabolism, leading to increased exercise tolerance and protection against diet-induced obesity. In sum, this work elucidates SIRT4 as an important regulator of lipid homeostasis, identifies MCD as a SIRT4 target, and deepens our understanding of the malonyl CoA regulatory axis.", "We evaluated whether castration affects bone morphogenetic protein 2 (BMP2) level and the expression of its signaling molecules in Korean cattle bulls. We also checked whether castration affects the expression of muscle fiber type and oxidative and glycolytic enzyme genes. Enzyme-linked immunosorbent assays revealed that steers had higher plasma BMP2 and leptin concentrations than bulls. Quantitative real-time PCR showed that steers had higher mRNA levels of the lysyl oxidase gene, a downstream target of the BMP signaling pathway, in the longissimus thoracis (LT) muscle. Steers had higher adipogenic peroxisome proliferator-activated receptor gamma and lipogenic fatty acid binding protein 4 mRNA levels in the LT than bulls. Steers had lower mRNA levels for several muscle fiber type 1 genes and fiber type 2A myosin heavy chain 2 gene than bulls. Steers had higher mRNA levels of the glycolytic enzyme phosphoglycerate kinase 1 gene than bulls. Transcript levels of oxidative enzyme genes did not differ between bulls and steers. Regression analysis revealed a positive association between plasma BMP2 levels and intramuscular fat (IMF) content in the steer group. These findings suggest that upregulation of the BMP signaling pathway in response to castration induces increased adipogenic gene expression, contributing to the increased IMF deposition observed in castrated animals.", "The rate of endogenous glucose production (EGP) is important in understanding the pathophysiology of Type II (non-insulin-dependent) diabetes mellitus, the aetiology of its complications, and the identification of potential therapeutic targets. A great deal of effort has therefore been expended in its evaluation. Most measurements in humans have been made using tracers, or labelled analogues of glucose. Experimental strategies have included the injection and the infusion of such tracers which were often primed to achieve constant concentrations of the label more quickly. Primers have either been fixed or adjusted to the ambient glycaemia in each diabetic subject. Analyses were carried out using steady-state or non-steady-state calculations, the latter based on a one-compartment model or higher order systems. The principal finding of this review is that all approaches yield the same EGP when an appropriate model of the system is used. Under basal conditions, a single compartment model is sufficient to evaluate EGP, but the estimation of the volume of distribution, V, from individual data is critical in obtaining consistent results. Other sources of variation arose from the length of the fasting period and the patient population being studied. Overall, in Type II diabetes, EGP is frequently high in the morning and decreases gradually to rates comparable to healthy control subjects. This can be a very delayed response to a preceding meal, but more likely corresponds to an accentuated circadian rhythm in glucose production. Metabolic clearance of glucose, on the other hand, is decreased in diabetes, and remains so during the course of the day.", "Glucose transporter 4 (GLUT4) is the major insulin-regulated glucose transporter expressed mainly in muscle and adipose tissue. GLUT4 is stored in a poorly characterized intracellular vesicular compartment and translocates to the cell surface in response to insulin stimulation resulting in an increased glucose uptake. This process is essential for the maintenance of normal glucose homeostasis and involves a complex interplay of trafficking events and intracellular signaling cascades. Recent studies have identified sortilin as an essential element for the formation of GLUT4 storage vesicles during adipogenesis and Golgi-localized gamma-ear-containing Arf-binding protein (GGA) as a key coat adaptor for the entry of newly synthesized GLUT4 into the specialized compartment. Insulin-stimulated GLUT4 translocation from this compartment to the plasma membrane appears to require the Akt/protein kinase B substrate termed AS160 (Akt substrate of 160kDa). In addition, the VPS9 domain-containing protein Gapex-5 in complex with CIP4 appears to function as a Rab31 guanylnucleotide exchange factor that is necessary for insulin-stimulated GLUT4 translocation. Here, we attempt to summarize recent advances in GLUT4 vesicle biogenesis, intracellular trafficking and membrane fusion." ]
Nonalcoholic fatty liver disease and hepatocellular carcinoma
Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease worldwide, with a broad spectrum ranging from simple steatosis to advanced stage of nonalcoholic steatohepatitis (NASH). Although there are many undergoing clinical trials for NAFLD treatment, there is no currently approved treatment. NAFLD accounts as a major causing factor for the development of hepatocellular carcinoma (HCC), and its incidence rises accompanying the prevalence of obesity and diabetes. Reprogramming of antidiabetic and anti-obesity medicine is a major treatment option for NAFLD and NASH. Liver inflammation and cellular death, with or without fibrosis account for the progression of NAFLD to NASH. Therefore, molecules and signaling pathways involved in hepatic inflammation, fibrosis, and cell death are critically important targets for the therapy of NAFLD and NASH. In addition, the avoidance of aberrant infiltration of inflammatory cytokines by treating with
[ "There is no known treatment for fatty liver, a ubiquitous cause of chronic liver disease. However, because it is associated with hyperinsulinemia and insulin-resistance, insulin-sensitizing agents might be beneficial. To evaluate this possibility, insulin-resistant ob/ob mice with fatty livers were treated with metformin, an agent that improves hepatic insulin-resistance. Metformin improved fatty liver disease, reversing hepatomegaly, steatosis and aminotransferase abnormalities. The therapeutic mechanism likely involves inhibited hepatic expression of tumor necrosis factor (TNF) alpha and TNF-inducible factors that promote hepatic lipid accumulation and ATP depletion. These findings suggest a mechanism of action for metformin and identify novel therapeutic targets in insulin-resistant states.", "SsnB previously showed a promising role to lessen liver inflammation observed in a mouse model of NAFLD. Since NAFLD can progress to fibrosis, studies were designed to unravel its role in attenuating NAFLD associated fibrosis. Using both in vivo and in vitro approaches, the study probed the possible mechanisms that underlined the role of SsnB in mitigating fibrosis. Mechanistically, SsnB, a TLR4 antagonist, decreased TLR4-PI3k akt signaling by upregulating PTEN protein expression. It also decreased MDM2 protein activation and increased p53 and p21 gene and protein expression. SsnB also downregulated pro-fibrogenic hedgehog signaling pathway, inhibited hepatic stellate cell proliferation and induced apoptosis in hepatic stellate cells, a mechanism that was LPS dependent. Further, SsnB decreased fibrosis by antagonizing TLR4 induced TGFβ signaling pathway. Alternatively, SsnB augmented BAMBI (a TGFβ pseudo-receptor) expression in mice liver by inhibiting TLR4 signaling pathway and thus reduced TGFβ signaling, resulting in decreased hepatic stellate cell activation and extracellular matrix deposition. In vitro experiments on human hepatic stellate cell line showed that SsnB increased gene and protein expression of BAMBI. It also decreased nuclear co-localization of phospho SMAD2/3 and SMAD4 protein and thus attenuated TGFβ signaling in vitro. We also observed a significant decrease in phosphorylation of SMAD2/3 protein, decreased STAT3 activation, alteration of focal adhesion protein and stress fiber disassembly upon SsnB administration in hepatic stellate cells which further confirmed the antagonistic effect of SsnB on TLR4-induced fibrogenesis.", "Nonalcoholic fatty liver disease (NAFLD) is an obesity-related disorder that is rapidly increasing in incidence and is considered the hepatic manifestation of the metabolic syndrome. The gut microbiome plays a role in metabolism and maintaining gut barrier integrity. Studies have found differences in the microbiota between NAFLD and healthy patients and increased intestinal permeability in patients with NAFLD. Fecal microbiota transplantation (FMT) can be used to alter the gut microbiome. It was hypothesized that an FMT from a thin and healthy donor given to patients with NAFLD would improve insulin resistance (IR), hepatic proton density fat fraction (PDFF), and intestinal permeability. Twenty-one patients with NAFLD were recruited and randomized in a ratio of 3:1 to either an allogenic (n = 15) or an autologous (n = 6) FMT delivered by using an endoscope to the distal duodenum. IR was calculated by HOMA-IR, hepatic PDFF was measured by MRI, and intestinal permeability was tested using the lactulose:mannitol urine test. Additional markers of metabolic syndrome and the gut microbiota were examined. Patient visits occurred at baseline, 2, 6 weeks, and 6 months post-FMT. There were no significant changes in HOMA-IR or hepatic PDFF in patients who received the allogenic or autologous FMT. Allogenic FMT patients with elevated small intestinal permeability (>0.025 lactulose:mannitol, n = 7) at baseline had a significant reduction 6 weeks after allogenic FMT. FMT did not improve IR as measured by HOMA-IR or hepatic PDFF but did have the potential to reduce small intestinal permeability in patients with NAFLD.", "Activation of hepatic stellate cells is the key event in the liver fibrosis. miRs have been shown to play fundamental role in diverse biological and pathological processes. In the present study, we investigated the fibrogenic role of miR-21 in human hepatic stellate LX-2 cells and explored underlying mechanisms. The results showed that treatment of LX-2 cells with platelet-derived growth factor (PDGF)-BB significantly stimulated α1(I) collagen mRNA synthesis and the protein expression of α-SMA, which are characteristics of activation of hepatic stellate cells and simultaneously increased miR-21 expression. Downregulation of miR-21 expression by transfection of anti-miR-21 into LX-2 cells prevented PDGF-BB-induced LX-2 cell activation. Overexpression of miR-21 expression alone also stimulated LX-2 cell activation, while downregulation of miR-21 expression suppressed LX-2 cell activation. miR-21 also played a role in mRNA expression and activity of matrix metalloproteinase 2 (MMP2) in LX-2 cells. Moreover, overexpression of miR-21 decreased protein expression of PTEN in LX-2 cells, resulting in activation of the Akt. Inhibition of Akt signaling by specific inhibitor LY 294002 blocked miR-21-induced fibrogenic effects in LX-2 cells. In summary, miR-21 is an important mediator in LX-2 cell activation. The fibrogenic effects of miR-21 on LX-2 cell activation are mediated through PTEN/Akt pathway. miR-21 may be a potential novel molecular target for the liver fibrosis.", "The botanical product silymarin, an extract of milk thistle, is commonly used by patients to treat chronic liver disease and may be a treatment for NASH due to its antioxidant properties. We aimed to assess the safety and efficacy of higher than customary doses of silymarin in non-cirrhotic patients with NASH. This exploratory randomized double-blind placebo controlled multicenter Phase II trial tested a proprietary standardized silymarin preparation (Legalon®, Rottapharm|Madaus, Mylan) and was conducted at 5 medical centers in the United States. Eligible adult patients had liver biopsy within 12 months showing NASH without cirrhosis with NAFLD Activity Score (NAS) ≥4 per site pathologist's assessment. Participants were randomized to Legalon® 420 mg, 700 mg, or placebo t.i.d. for 48 weeks. The primary endpoint was histological improvement ≥2 points in NAS. Of 116 patients screened, 78 were randomized. There were no significant differences in adverse events among the treatment groups. After 48-50 weeks, 4/27 (15%) in the 700 mg dose, 5/26 (19%) participants randomized to 420 mg, and 3/25 (12%) of placebo recipients reached the primary endpoint (p = 0.79) among all randomized participants, indicating no benefit from silymarin in the intention to treat analysis Review by a central pathologist demonstrated that a substantial number of participants (49, 63%) did not meet histological entry criteria and that fibrosis stage improved most in the placebo treated group, although not significantly different from other groups. Silymarin (Legalon®) at the higher than customary doses tested in this study is safe and well tolerated. The effect of silymarin in patients with NASH remains inconclusive due to the substantial number of patients who entered the study but did not meet entry histological criteria, the lack of a statistically significant improvement in NAS of silymarin treated patients, and the unanticipated effect of placebo on fibrosis indicate the need for additional clinical trials. Trial Registration: clinicaltrials.gov, Identifier: NCT00680407.", "Non-alcoholic fatty liver disease (NAFLD) affects 20%-40% of the general population in developed countries and is an increasingly important cause of hepatocellular carcinoma. Electronic medical records facilitate large-scale epidemiological studies, existing NAFLD scores often require clinical and anthropometric parameters that may not be captured in those databases. To develop and validate a laboratory parameter-based machine learning model to detect NAFLD for the general population. We randomly divided 922 subjects from a population screening study into training and validation groups; NAFLD was diagnosed by proton-magnetic resonance spectroscopy. On the basis of machine learning from 23 routine clinical and laboratory parameters after elastic net regulation, we evaluated the logistic regression, ridge regression, AdaBoost and decision tree models. The areas under receiver-operating characteristic curve (AUROC) of models in validation group were compared. Six predictors including alanine aminotransferase, high-density lipoprotein cholesterol, triglyceride, haemoglobin A1c , white blood cell count and the presence of hypertension were selected. The NAFLD ridge score achieved AUROC of 0.87 (95% CI 0.83-0.90) and 0.88 (0.84-0.91) in the training and validation groups respectively. Using dual cut-offs of 0.24 and 0.44, NAFLD ridge score achieved 92% (86%-96%) sensitivity and 90% (86%-93%) specificity with corresponding negative and positive predictive values of 96% (91%-98%) and 69% (59%-78%), and 87% of overall accuracy among 70% of classifiable subjects in the validation group; 30% of subjects remained indeterminate. NAFLD ridge score is a simple and robust reference comparable to existing NAFLD scores to exclude NAFLD patients in epidemiological studies.", "Wnt ligands regulate metabolic pathways, and dysregulation of Wnt signaling contributes to chronic inflammatory disease. A knowledge gap exists concerning the role of aberrant Wnt signaling in non-alcoholic steatohepatitis (NASH), which exhibits metabolic syndrome and inflammation. Using a mouse model of methionine-choline deficient diet (MCDD)-induced NASH, we investigated the Wnt signaling pathways in relation to hepatic glucose oxidation. Mice fed the MCD diet for 6 weeks developed prominent NASH marked by macrovesicular steatosis, inflammation and lipid peroxidation. qPCR analysis reveals differential hepatic expression of canonical and non-canonical Wnt ligands. While expression of Wnt3a was decreased in NASH vs chow diet control, expression of Wnt5a and Wnt11 were increased 3 fold and 15 fold, respectively. Consistent with activation of non-canonical Wnt signaling, expression of the alternative Wnt receptor ROR2 was increased 5 fold with no change in LRP6 expression. Activities of the metabolic enzymes glucokinase, phosphoglucoisomerase, glyceraldehyde-3-phosphate dehydrogenase, pyruvate kinase, and pyruvate dehydrogenase were all elevated by MCDD. NASH-driven glucose oxidation was accompanied by a 6-fold increase in lactate dehydrogenase (LDH)-B with no change in LDH-A. In addition, glucose-6-phosphate dehydrogenase, the regulatory and NADPH-producing enzyme of the pentose phosphate pathway, was elevated in NASH. These data support a role of accelerated glucose oxidation in the development of NASH, which may be driven by non-canonical Wnt signaling.", "We aimed to elucidate the mechanism underlying the anti-dyslipidemic effect of compound-T3, a farnesoid X receptor antagonist, by investigating its effects on hepatic lipid metabolism in non-human primates. We administered lipid-lowering drugs for 7 days to cynomolgus monkeys receiving a high-fat diet, and subsequently measured the levels of lipid parameters in plasma, feces, and hepatic tissue fluids. Compound-T3 (0.3 and 3mg/kg p.o.) significantly decreased the plasma levels of non-high-density lipoprotein (non-HDL) cholesterol and apolipoprotein B in a dose-dependent manner. It also decreased the mRNA levels of hepatic small heterodimer partner-1, induced the mRNA expression of hepatic cholesterol 7α-hydroxylase, reduced hepatic cholesterol and triglyceride levels, increased fecal bile acid excretion, and upregulated the expression of hepatic low-density lipoprotein (LDL) receptor. Furthermore, compound-T3 significantly increased plasma HDL cholesterol and apolipoprotein A-I levels. The mRNA expression levels of hepatic apolipoprotein A-I tended to increase after compound-T3 treatment. Compound-T3 also induced accumulation of hepatic bile acids and decreased the mRNA expression levels of the hepatic bile acid export pump. The effects of cholestyramine (300mg/kg p.o.) on the plasma and hepatic lipid parameters were similar to those of compound-T3, and it increased fecal bile acid levels without causing accumulation of hepatic bile acids. These findings suggest that LDL receptor-mediated hepatic LDL incorporation due to cholesterol catabolism catalyzed by cholesterol 7α-hydroxylase decreases plasma non-HDL cholesterol levels. Upregulation of hepatic apolipoprotein A-I mRNA expression may partially contribute to the increase in HDL cholesterol levels mediated by compound-T3.", "Non-alcoholic steatohepatitis (NASH) is a form of progressive fatty liver disease that is strongly associated with insulin resistance, which suggests that insulin sensitizing agents such as metformin may be beneficial for NASH. To assess the effects of metformin on insulin sensitivity, body composition, serum alanine aminotransferase (ALT) levels and liver histology in patients with NASH. Patients underwent liver biopsy, metabolic profiling and imaging studies before and at the end 48 weeks of metformin (2000 mg/day) therapy. The primary endpoint was a three-point improvement in the histological NASH activity index. Of 28 patients enrolled, 26 (13 females; average age 44 years) completed 48 weeks of treatment and underwent repeat metabolic studies, imaging and liver biopsy. Thirty per cent achieved a histological response. Most patients lost weight, the average being 6 kg. There was a marked association between weight loss and improvements in NASH activity index and ALT levels (both, P < 0.01). Insulin sensitivity also improved, but the degree of change did not correlate with histological improvement. Metformin leads to improvements in liver histology and ALT levels in 30% of patients with NASH, probably by its effects in causing weight loss.", "We investigated whether metformin hydrochloride has sustained beneficial metabolic and (cardio) vascular effects in patients with type 2 diabetes mellitus (DM2). We studied 390 patients treated with insulin in the outpatient clinics of 3 hospitals in a randomized, placebo-controlled trial with a follow-up period of 4.3 years. Either metformin hydrochloride, 850 mg, or placebo (1-3 times daily) was added to insulin therapy. The primary end point was an aggregate of microvascular and macrovascular morbidity and mortality. The secondary end points were microvascular and macrovascular morbidity and mortality, as separate aggregate scores. In addition, effects on hemoglobin A(1c) (HbA(1c)), insulin requirement, lipid levels, blood pressure, body weight, and body mass index were analyzed. Metformin treatment prevented weight gain (mean weight gain, -3.07 kg [range, -3.85 to -2.28 kg]; P < .001), improved glycemic control (mean reduction in HbA(1c) level, 0.4% percentage point [95% CI, 0.55-0.25]; P < .001) (where CI indicates confidence interval), despite the aim of similar glycemic control in both groups, and reduced insulin requirements (mean reduction, 19.63 IU/d [95% CI, 24.91-14.36 IU/d]; P < .001). Metformin was not associated with an improvement in the primary end point. It was, however, associated with an improvement in the secondary, macrovascular end point (hazard ratio, 0.61 (95% CI, 0.40-0.94; P = .02), which was partly explained by the difference in weight. The number needed to treat to prevent 1 macrovascular end point was 16.1 (95% CI, 9.2-66.6). Metformin, added to insulin in patients with DM2, improved body weight, glycemic control, and insulin requirements but did not improve the primary end point. Metformin did, however, reduce the risk of macrovascular disease after a follow-up period of 4.3 years. These sustained beneficial effects support the policy to continue metformin treatment after the introduction of insulin in any patient with DM2, unless contraindicated. Trial Registration ClinicalTrials.gov Identifier: NCT00375388." ]
Prevalence of low birth weight and macrosomia in Chinese children under 6 years in 2013
Low birth weight (< 2500 g; LBW) and macrosomia (> 4000 g) are both adverse birth outcomes with high health risk in short- or long-term period. However, national prevalence estimates of LBW and macrosomia varied partially due to methodology limits in China. The aim of this study is to estimate the prevalence of LBW and macrosomia after taking potential birth weight heaping into consideration in Chinese children under 6 years in 2013. The data were from a nationally representative cross-sectional survey in mainland China in 2013, which consists of 32,276 eligible records. Birth weight data and socio-demographic information was collected using standard questionnaires. Birth weight distributions were examined and LBW and macrosomia estimates were adjusted for potential heaping. The overall prevalence of LBW of Chinese children younger than 6 years was 5.15% in 2013, with 4.57% in boys and 5.68% in girls. LBW rate was higher for children who were minority ethnicity, had less educated mothers, mothers aged over 35 years or under 20 years, or were in lower income household than their counterparts. The overall prevalence of macrosomia of Chinese children younger than 6 years was 7.35% in 2013, with 8.85% in boys and 5.71% in girls. The prevalence of macrosomia increased with increasing maternal age, educational level and household income level. Both LBW and macrosomia varied among different regions and socio-economic groups around China. It is found that estimates based on distribution adjustment might be more accurate and could be used as the foundation for policy-decision and health resource allocation. It would be needed to take potential misclassification of birth weight data arising from heaping into account in future studies.
[ "To assess the accuracy of parental recall of birth weight in a British population and to investigate whether social class and age of the child significantly influence the accuracy of recalled birth weight. A questionnaire was given to parents whose children were participating in a blood pressure study and the hospital records were retrieved to check the birth weight data. At the time of the study, the children (n = 649) ranged in age from 6 to 15 years. Seventy five per cent of the recalled birth weights were within 50 g of that recorded in the hospital records. No significant associations were found between the difference in birth weights (recalled birth weight minus hospital record) and social class of the parents or age of the child at time of data collection. This large study shows that parental recall of birth weight is good across the social classes and up to 16 years after delivery. There was no evidence of systematic bias, which would prejudice results of studies on the relation of birth weight to adult hypertension.", "This study investigates the patterns of recording birth weight data in retrospective surveys and their influence on birth weight estimates in less developed countries. We hypothesise that the method of reporting birth weight in surveys influences the classification of infants in the low birth weight category. Population-level data from Demographic and Health Surveys conducted in six selected countries representing different regions of the world were used. Birth weight data were reported in the survey from either an official health card or from mother's memory. Birth weight distributions were examined in detail and revised low birth weight estimates were calculated accounting for potential heaping and data inconsistencies. There were substantial differences in the distribution of birth weights by method of reporting. The percentage of infants with low birth weight was higher in all six countries for birth weight recalled from memory than when reported from a health card. Health cards displayed less clustering on certain digits than memory recalled weights, but were still highly heaped in certain countries. Heaping of birth weight data on multiples of 500 g was also observed irrespective of any differences in method of reporting. The study concludes that the method of recording birth weight data can affect birth weight estimates in developing countries. Health systems in poor countries should initiate efforts to systematically monitor the recording of birth weight data ensuring for both quality and comparability at the international levels.", "Nutrition services and education, provided as components of normal prenatal care, have a key role in preventing preterm delivery and low birth weight (LBW). To determine the influence of these components on a woman's risk of having a LBW infant, the authors examined groups of patients who were receiving the services. Bivariate analyses were made of 9,024 prenatal charts of single births. Most women received nutrition education, prescriptions for nutrient supplements, screenings for anemia, and dietary assessments. A greater proportion of the women at high risk received the interventions than did women at lower risk. The presence of educational components and assays for anemia were associated with a lower risk of a LBW delivery in the total group and in the high risk groups.", "The purpose of this study was to assess the utility of using maternal assessments of infant birth size as proxy measures for birth weight in Ecuador, a country in which a sizeable proportion of births take place at home, where birth weight is typically not recorded. Four thousand and seventy-eight women who experienced a live singleton birth between January 1992 and August 1994 were interviewed in the Ecuador Demographic and Maternal-Child Health Survey. All women were asked if their child was weighed at birth, his/her weight, and what they considered to be his/her birth size relative to other newborns. The consistency between birth size and birth weight measures was assessed, and the differences between infants with and without reported birth weights were explored. The authors conclude that maternal assessments of birth size are poor proxy indicators of birth weight. Estimates of low birth weight based on maternal assessments of birth size as very small should be recognized as underestimates of the actual prevalence of low birth weight. Moreover, infants for whom birth weights are missing should not be considered similar to those for whom weight was reported. Those without reported birth weights are more likely to be low birth weight. Thus, relying solely on reports of numeric birth weight will underestimate the prevalence of low birth weight.", "To analyze the incidence of low birth weight and identify the influencing factors in China in 2006. The national survey was performed by stratified random cluster sampling method in 43 cities and counties in 14 provinces. The subjects were all live neonates during May to October in 2006. Their body weight was measured according to the standardization conducted by the national research team, while the information of all infants was investigated by questionnaires. Non-conditional logistic regression was used to analyze the influencing factors. Among 18 554 infants investigated, the incidence of low birth weight was 4.6% in 2006 in China, being 3.2%, 4.4%, and 6.3% in eastern middle and western areas respectively. The incidence of low birth weight were 3.9% in urban and 4.8% in rural. The results of logistic regression analysis suggested that maternal education (OR = 1.48; 95% CI: 1.181 approximately 1.861), body mass index (BMI) before pregnancy (OR = 1.52; 95% CI: 1.229 - 1.876), body weight gain in gestation period (OR = 1.57; 95% CI: 1.246 - 1.965), gestational weeks (OR = 20.16; 95% CI: 15.456 - 26.297), multiple birth (OR = 12.11; 95% CI: 9.229 - 15.893), gestation syndrome, and nutrition instruction (OR = 0.66; 95% CI: 0.550 - 0.798) were associated with low birth weight significantly. The main factors resulting in low birth weight in neonates are maternal education, BMI before pregnancy, body weight gain in gestation period, pregnancy age, multiple birth, gestation syndrome, and nutrition instruction.", "Adverse birth outcomes such as preterm birth, low-birth weight, and infant mortality continue to disproportionately affect black and poor infants in the United States. Improvements in healthcare quality and access have not eliminated these disparities. The objective of this review was to consider societal factors, including suboptimal education, income inequality, and residential segregation, that together lead to toxic environmental exposures and psychosocial stress. Many toxic chemicals, as well as psychosocial stress, contribute to the risk of adverse birth outcomes and black women often are more highly exposed than white women. The extent to which environmental exposures combine with stress and culminate in racial disparities in birth outcomes has not been quantified but is likely substantial. Primary prevention of adverse birth outcomes and elimination of disparities will require a societal approach to improve education quality, income equity, and neighborhoods." ]
Impact of single nucleotide polymorphisms on the role of Lipopolysaccharide-binding protein in inflammation
Inflammation, which is induced by the immune response, is recognized as the driving factor in many diseases, including infections and inflammatory diseases, metabolic disorders and cancers. Genetic variations in pivotal genes associated with the immune response, particularly single nucleotide polymorphisms (SNPs), may account for predisposition and clinical outcome of diseases. Lipopolysaccharide (LPS)-binding protein (LBP) functions as an enhancer of the host response to LPS, the main component of the outer membrane of gram-native bacteria. Given the crucial role of LBP in inflammation, we will review the impact of SNPs in the
[ "Host genetic factors have previously been found to act as determinants of differential susceptibility to major infectious diseases. It is less clear whether such polymorphisms may also impose on pathogen recognition in mucosal overgrowth conditions such as bacterial vaginosis, an anaerobic overgrowth condition characterised by the presence of a vaginal biofilm consisting of the Gram-positive anaerobes Gardnerella vaginalis and Atopobium vaginae. We selected 34 single nucleotide polymorphisms pertaining to 9 genes involved with Toll-like receptor-mediated pathogen recognition and/or regulation (LBP, CD14, TLR1, TLR2, TLR4, TLR6, MD2, CARD15 and SIGIRR) and assessed in a nested case-control study their putative association with bacterial vaginosis, as diagnosed by Gram staining, and with the vaginal carriage of A. vaginae and G. vaginalis, as determined by species-specific PCR, among 144 pregnant women. Carriage of G. vaginalis during early pregnancy was associated with the -1155A>G substitution in the promoter region of the MD2 gene (p=0.041). The presence of A. vaginae during the first half of the pregnancy was significantly associated with the CD14 intron 2 1342G>T (p=0.039), the TLR1 exon 4 743A>G (p=0.038), and the CARD15 exon 4 14772A>T (p=0.012) polymorphisms, and marginally significantly associated with the LBP exon13 26842C>T (p=0.056), the CD14 promoter -260C>T (p=0.052), and the TLR1 promoter -7202A>G (p=0.062) polymorphisms. However, no association between gene polymorphisms and bacterial vaginosis as such could be documented. Our data suggest that some degree of genetic susceptibility involving pathogen recognition may occur with the key bacterial vaginosis organism, A. vaginae.", "Lipoteichoic acid (LTA) derived from Streptococcus pneumoniae, purified employing a chloroform/methanol protocol, and from Staphylococcus aureus, prepared by the recently described butanol extraction procedure, was investigated regarding its interaction with lipopolysaccharide (LPS)-binding protein (LBP), CD14, Toll-like receptors (TLRs)-2 and -4, and MD-2. LTA from both organisms induced cytokine synthesis in human mononuclear phagocytes. Activation was LBP- and CD14-dependent, and formation of complexes of LTA with LBP and soluble CD14 as well as catalytic transfer of LTA to CD14 by LBP was verified by PhastGel(TM) native gel electrophoresis. Human embryonic kidney (HEK) 293/CD14 cells and Chinese hamster ovary (CHO) cells were responsive to LTA only after transfection with TLR-2. Additional transfection with MD-2 did not affect stimulation of these cells by LTA. Our data suggest that innate immune recognition of LTA via LBP, CD14, and TLR-2 represents an important mechanism in the pathogenesis of systemic complications in the course of infectious diseases brought about by the clinically most important Gram-positive pathogens. However, the involvement of TLR-4 and MD-2 in this process was ruled out.", "Significant evidence of linkage to type 2 diabetes (T2D) has been shown in a relatively broad region on chromosome 20q, where the hepatocyte nuclear factor-4alpha (HNF4A) has been noted as a positional candidate. To systematically evaluate genetic susceptibility to T2D in the relevant region, we examined the disease association by using 1145 SNPs in two-step screening in the Japanese population. The marker screening enabled us to identify significant disease association in the lipopolysaccharide binding protein (LBP) but not in the HNF4A locus. In a 17.7-Mb interval screened, the strongest association was identified for a SNP, rs2232592, located in the intron of LBP, with an estimated odds ratio of 1.73 (95% CI 1.30-2.31) (P=0.0002) in the whole study panel involving 675 case and 474 control subjects. Our data suggest that the LBP gene may confer genetic susceptibility to T2D and this warrants further replication study.", "We sought to characterize polymorphisms in the proximal coding region of the lipopolysaccharide binding protein gene and to determine whether a previously reported variant was associated with sepsis complicated by organ failure or shock after trauma. We used multiple analytical methods, including pyrosequencing, restriction fragment length polymorphism, and sequencing to characterize the proximal coding region. We also reexamined a prospective cohort of severely injured patients and healthy control individuals. The single nucleotide polymorphism at nucleotide 292 does not exist as previously reported. Instead, the adjacent nucleotide (291) was observed to be polymorphic. In 151 trauma patients, 37 (25%) developed severe sepsis, and 19 (13%) died. Thirteen of 50 (26%) C-allele carriers and 24 of 101 (24%) TT homozygotes developed severe sepsis. Unadjusted and adjusted analyses did not demonstrate any associations between genotype and severe sepsis, septic shock, or death. In conclusion, a single nucleotide polymorphism in the lipopolysaccharide binding protein coding region that was reported to exist at the 292 position and to result in an amino acid substitution actually exists at the adjacent 291 position and does not result in an amino acid substitution. Furthermore, this polymorphism does not appear to be associated with complicated sepsis after trauma.", "Pediatric septic shock continues to be an important public health problem. Several investigative groups have applied genetic and genomic approaches as a means of identifying novel pathways and therapeutic targets, discovery of sepsis-related biomarkers, and identification of septic shock subclasses. This review will highlight studies in pediatric sepsis with a focus on gene association studies and genome-wide expression profiling. A summary of published literature involving gene association and expression profiling studies specifically involving pediatric sepsis and septic shock. Several polymorphisms of genes broadly involved in inflammation, immunity, and coagulation have been linked with susceptibility to sepsis, or outcome of sepsis in children. Many of these studies involve meningococcemia, and the strongest association involves a functional polymorphism of the plasminogen activator inhibitor-1 promoter region and meningococcal sepsis. Expression profiling studies in pediatric septic shock have identified zinc supplementation and inhibition of matrix metalloproteinase-8 activity as potential, novel therapeutic approaches in sepsis. Studies focused on discovery of sepsis-related biomarkers have identified interleukin-8 as a robust outcome biomarker in pediatric septic shock. Additional studies have demonstrated the feasibility and clinical relevance of gene expression-based subclassification of pediatric septic shock. Pediatric sepsis and septic shock are increasingly being studied by genetic and genomic approaches and the accumulating data hold the promise of enhancing our future approach to this ongoing clinical problem.", "The aim of the study was to identify the dependency structure of genetic variants that can influence the outcome for paediatric patients with sepsis. We evaluated the role of single nucleotide polymorphisms for five genes: bactericidal permeability increasing protein (BPI; rs5743507), lipopolysaccharide-binding protein (LBP; rs2232618), toll-like receptor 4 (TLR4; rs4986790), heat shock protein 70 (HSP 70; rs2227956), and interleukin 6 (IL-6; rs1800795) in 598 children aged 0 to 19 years that were admitted to a paediatric intensive care unit with fever, systemic inflammatory response syndrome, sepsis, severe sepsis, septic shock, or multiple organ dysfunction syndrome. A control group of 529 healthy individuals was included. Multi-way contingency tables were constructed and statistically evaluated using log-linear models. Typical gene combinations were found for both study groups. Detailed analyses of the five studied gene profiles revealed significant differences in sepsis survival. Stratification into high-risk, intermediate-risk, and low-risk groups of paediatric patients can predict the severity of sepsis. Analysis of single nucleotide polymorphisms for five genes can be used as a predictor of sepsis outcome in children.", "Helicobacter pylori infection is associated with the development of a chronic inflammatory response, which may induce peptic ulcers, gastric cancer (GC), and mucosa-associated lymphoid tissue (MALT) lymphoma. Chronic H. pylori infection promotes the genetic instability of gastric epithelial cells and interferes with the DNA repair systems in host cells. Colonization of the stomach with H. pylori is an important cause of non-cardia GC and gastric MALT lymphoma. The reduction of GC development in patients who underwent anti-H. pylori eradication schemes has also been well described. Individual susceptibility to GC development depends on the host's genetic predisposition, H. pylori virulence factors, environmental conditions, and geographical determinants. Biological determinants are urgently sought to predict the clinical course of infection in individuals with confirmed H. pylori infection. Possible candidates for such biomarkers include genetic aberrations such as single-nucleotide polymorphisms (SNPs) found in various cytokines/growth factors (e.g., IL-1β, IL-2, IL-6, IL-8, IL-10, IL-13, IL-17A/B, IFN-γ, TNF, TGF-β) and their receptors (IL-RN, TGFR), innate immunity receptors (TLR2, TLR4, CD14, NOD1, NOD2), enzymes involved in signal transduction cascades (PLCE1, PKLR, PRKAA1) as well as glycoproteins (MUC1, PSCA), and DNA repair enzymes (ERCC2, XRCC1, XRCC3). Bacterial determinants related to GC development include infection with CagA-positive (particularly with a high number of EPIYA-C phosphorylation motifs) and VacA-positive isolates (in particular s1/m1 allele strains). The combined genotyping of bacterial and host determinants suggests that the accumulation of polymorphisms favoring host and bacterial features increases the risk for precancerous and cancerous lesions in patients." ]
Reversible protein phosphorylation in plant receptor kinase
Reversible protein phosphorylation is a widespread post-translational modification fundamental for signaling across all domains of life. Tyrosine (Tyr) phosphorylation has recently emerged as being important for plant receptor kinase (RK)-mediated signaling, particularly during plant immunity. How Tyr phosphorylation regulates RK function is however largely unknown. Notably, the expansion of protein Tyr phosphatase and SH2 domain-containing protein families, which are the core of regulatory phospho-Tyr (pTyr) networks in choanozoans, did not occur in plants. Here, we summarize the current understanding of plant RK Tyr phosphorylation focusing on the critical role of a pTyr site ('VIa-Tyr') conserved in several plant RKs. Furthermore, we discuss the possibility of metazoan-like pTyr signaling modules in plants based on atypical components with convergent biochemical functions.
[ "The discovery of Toll-like receptors (TLRs) as components that recognize conserved structures in pathogens has greatly advanced understanding of how the body senses pathogen invasion, triggers innate immune responses and primes antigen-specific adaptive immunity. Although TLRs are critical for host defense, it has become apparent that loss of negative regulation of TLR signaling, as well as recognition of self molecules by TLRs, are strongly associated with the pathogenesis of inflammatory and autoimmune diseases. Furthermore, it is now clear that the interaction between TLRs and recently identified cytosolic innate immune sensors is crucial for mounting effective immune responses. Here we describe the recent advances that have been made by research into the role of TLR biology in host defense and disease.", "Brassinosteroids (BRs) are essential growth-promoting hormones that regulate many aspects of plant growth and development. Two leucine-rich repeat receptor-like kinases (LRR-RLKs) are involved in BR perception and signal transduction: brassinosteroid insensitive 1 (BRI1), which is the BR receptor, and its coreceptor BRI1-associated kinase 1 (BAK1). Both proteins are classified as serine/threonine protein kinases, but here we report that recombinant cytoplasmic domains of BRI1 and BAK1 also autophosphorylate on tyrosine residues and thus are dual-specificity kinases. With BRI1, Tyr-831 and Tyr-956 are identified as autophosphorylation sites in vitro and in vivo. Interestingly, Tyr-956 in kinase subdomain V is essential for activity, because the Y956F mutant is catalytically inactive and thus this site cannot be simply manipulated by mutagenesis. In contrast, Tyr-831 in the juxtamembrane domain is not essential for kinase activity but plays an important role in BR signaling in vivo, because expression of BRI1(Y831F)-Flag in transgenic bri1-5 plants results in plants with larger leaves (but altered leaf shape) and early flowering relative to plants expressing wild-type BRI1-Flag. Acidic substitutions of Tyr-831 restored normal leaf size (but not shape) and normal flowering time. This is an example where a specific tyrosine residue has been shown to play an important role in vivo in plant receptor kinase function. Interestingly, 6 additional LRR-RLKs (of the 23 tested) were also found to autophosphorylate on tyrosine in addition to serine and threonine, suggesting that tyrosine signaling should be considered with other plant receptor kinases as well.", "Tyrosine phosphorylation of proteins was discovered in 1979, but this posttranslational modification had been \"invented\" by evolution more than a billion years ago in single-celled eukaryotic organisms that were the antecedents of the first multicellular animals. Because sophisticated cell-cell communication is a sine qua non for the existence of multicellular organisms, the development of cell-surface receptor systems that use tyrosine phosphorylation for transmembrane signal transduction and intracellular signaling seems likely to have been a crucial event in the evolution of metazoans. Like all types of protein phosphorylation, tyrosine phosphorylation serves to regulate proteins in multiple ways, including causing electrostatic repulsion and inducing allosteric transitions, but the most important function of phosphotyrosine (P.Tyr) is to serve as a docking site that promotes a specific interaction between a tyrosine phosphorylated protein and another protein that contains a P.Tyr-binding domain, such as an SH2 or PTB domain. Such docking interactions are essential for signal transduction downstream from receptor tyrosine kinases (RTKs) on the cell surface, which are activated on binding a cognate extracellular ligand, and, as a consequence, elicit specific cellular outcomes.", "Multicellular animals use a three-part molecular toolkit to mediate phospho-tyrosine signaling: Tyrosine kinases (TyrK), protein tyrosine phosphatases (PTP), and Src Homology 2 (SH2) domains function, respectively, as \"writers,\" \"erasers,\" and \"readers\" of phospho-tyrosine modifications. How did this system of three components evolve, given their interdependent function? Here, we examine the usage of these components in 41 eukaryotic genomes, including the newly sequenced genome of the choanoflagellate, Monosiga brevicollis, the closest known unicellular relative to metazoans. This analysis indicates that SH2 and PTP domains likely evolved earliest-a handful of these domains are found in premetazoan eukaryotes lacking tyrosine kinases, most likely to deal with limited tyrosine phosphorylation cross-catalyzed by promiscuous Ser/Thr kinases. Modern TyrK proteins, however, are only observed in two lineages, metazoans and choanoflagellates. These two lineages show a dramatic coexpansion of all three domain families. Concurrent expansion of the three domain families is consistent with a stepwise evolutionary model in which preexisting SH2 and PTP domains were of limited utility until the appearance of the TyrK domain in the last common ancestor of metazoans and choanoflagellates. The emergence of the full three-component signaling system, with its dramatically increased encoding potential, may have contributed to the advent of metazoan multicellularity.", "The Interactive Tree Of Life (https://itol.embl.de) is an online tool for the display, manipulation and annotation of phylogenetic and other trees. It is freely available and open to everyone. The current version introduces four new dataset types, together with numerous new features. Annotation options have been expanded and new control options added for many display elements. An interactive spreadsheet-like editor has been implemented, providing dataset creation and editing directly in the web interface. Font support has been rewritten with full support for UTF-8 character encoding throughout the user interface. Google Web Fonts are now fully supported in the tree text labels. iTOL v4 is the first tool which supports direct visualization of Qiime 2 trees and associated annotations. The user account system has been streamlined and expanded with new navigation options, and currently handles >700 000 trees from more than 40 000 individual users. Full batch access has been implemented allowing programmatic upload and export of trees and annotations.", "The availability of large volumes of genomic sequences presents an unprecedented proteomic challenge to characterize the structure and function of various protein motifs. Primary structural alignment is often unable to accurately identify a given motif due to sequence divergence; however, with the aid of secondary structural prediction for analysis, it becomes feasible to explore protein motifs on a proteome-wide scale. Here we report the use of secondary structural alignment to characterize the Src homology 2 (SH2) domains of both conventional and divergent sequences and divide them into two groups, Src-type and STAT-type. In addition to the basic \"alphabetabetabetaalpha\" structure (betaBeta), the Src-type SH2 domain contains an extra beta-strand (betaE or betaE-betaF motif). Alternatively, the linker domain-conjugated SH2 domain in STAT contains the alphaB' motif. Combining BLAST data from betaBeta core motif sequences with predicted secondary structural alignment, we have screened for SH2 domains in various eukaryotic model systems including Arabidopsis, Dictyostelium, and Saccharomyces. Two novel genes carrying the linker-SH2 domain of STAT were discovered and subsequently cloned from Arabidopsis. These genes, designated as STAT-type linker-SH2 domain factors (STATL), are found in a wide array of vascular and nonvascular plants, suggesting that the linker-SH2 domain evolved prior to the divergence of plants and animals. Using this approach, we expanded the number of putative SH2 domain-bearing genes in Dictyostelium and comparatively studied the secondary structural profiles of both typical and atypical SH2 domains. Our results indicate that the linker-SH2 domain of the transcription factor STAT is one of the most ancient and fully developed functional domains, serving as a template for the continuing evolution of the SH2 domain essential for phosphotyrosine signal transduction.", "The design, implementation, and capabilities of an extensible visualization system, UCSF Chimera, are discussed. Chimera is segmented into a core that provides basic services and visualization, and extensions that provide most higher level functionality. This architecture ensures that the extension mechanism satisfies the demands of outside developers who wish to incorporate new features. Two unusual extensions are presented: Multiscale, which adds the ability to visualize large-scale molecular assemblies such as viral coats, and Collaboratory, which allows researchers to share a Chimera session interactively despite being at separate locales. Other extensions include Multalign Viewer, for showing multiple sequence alignments and associated structures; ViewDock, for screening docked ligand orientations; Movie, for replaying molecular dynamics trajectories; and Volume Viewer, for display and analysis of volumetric data. A discussion of the usage of Chimera in real-world situations is given, along with anticipated future directions. Chimera includes full user documentation, is free to academic and nonprofit users, and is available for Microsoft Windows, Linux, Apple Mac OS X, SGI IRIX, and HP Tru64 Unix from http://www.cgl.ucsf.edu/chimera/." ]
Reconstruction of electrical conductivity and electric field distributions using diffusion tensor magnetic resonance electrical impedance tomography
Diffusion tensor magnetic resonance electrical impedance tomography (DT-MREIT) is a newly developed technique that combines MR-based measurements of magnetic flux density with diffusion tensor MRI (DT-MRI) data to reconstruct electrical conductivity tensor distributions. DT-MREIT techniques normally require injection of two independent current patterns for unique reconstruction of conductivity characteristics. In this paper, we demonstrate an algorithm that can be used to reconstruct the position dependent scale factor relating conductivity and diffusion tensors, using flux density data measured from only one current injection. We demonstrate how these images can also be used to reconstruct electric field and current density distributions. Reconstructions were performed using a mimetic algorithm and simulations of magnetic flux density from complementary electrode montages, combined with a small-scale machine learning approach. In a biological tissue phantom, we found that the method reduced relative errors between single-current and two-current DT-MREIT results to around 10%. For in vivo human experimental data the error was about 15%. These results suggest that incorporation of machine learning may make it easier to recover electrical conductivity tensors and electric field images during neuromodulation therapy without the need for multiple current administrations.
[ "The conductivity of the human skull was measured both in vitro and in vivo. The in vitro measurement was performed on a sample of fresh skull placed within a saline environment. For the in vivo measurement a small current was passed through the head by means of two electrodes placed on the scalp. The potential distribution thus generated on the scalp was measured in two subjects for two locations of the current injecting electrodes. Both methods revealed a skull conductivity of about 0.015 [symbol: see text]/m. For the conductivities of the brain, the skull and the scalp a ratio of 1:1/15:1 was found. This is consistent with some of the reports on conductivities found in the literature, but differs considerably from the ratio 1:1/80:1 commonly used in neural source localization. An explanation is provided for this discrepancy, indicating that the correct ratio is 1:1/15:1.", "Magnetic resonance electrical impedance tomography (MREIT) is to provide cross-sectional images of the conductivity distribution sigma of a subject. While injecting current into the subject, we measure one component Bz of the induced magnetic flux density B = (Bx, By, Bz) using an MRI scanner. Based on the relation between (inverted delta)2 Bz and inverted delta sigma, the harmonic Bz algorithm reconstructs an image of sigma using the measured Bz data from multiple imaging slices. After we obtain sigma, we can reconstruct images of current density distributions for any given current injection method. Following the description of the harmonic Bz algorithm, this paper presents reconstructed conductivity and current density images from computer simulations and phantom experiments using four recessed electrodes injecting six different currents of 26 mA. For experimental results, we used a three-dimensional saline phantom with two polyacrylamide objects inside. We used our 0.3 T (tesla) experimental MRI scanner to measure the induced Bz. Using the harmonic Bz algorithm, we could reconstruct conductivity and current density images with 82 x 82 pixels. The pixel size was 0.6 x 0.6 mm2. The relative L2 errors of the reconstructed images were between 13.8 and 21.5% when the signal-to-noise ratio (SNR) of the corresponding MR magnitude images was about 30. The results suggest that in vitro and in vivo experimental studies with animal subjects are feasible. Further studies are requested to reduce the amount of injection current down to less than 1 mA for human subjects.", "This paper presents a deep learning method for faster magnetic resonance imaging (MRI) by reducing k-space data with sub-Nyquist sampling strategies and provides a rationale for why the proposed approach works well. Uniform subsampling is used in the time-consuming phase-encoding direction to capture high-resolution image information, while permitting the image-folding problem dictated by the Poisson summation formula. To deal with the localization uncertainty due to image folding, a small number of low-frequency k-space data are added. Training the deep learning net involves input and output images that are pairs of the Fourier transforms of the subsampled and fully sampled k-space data. Our experiments show the remarkable performance of the proposed method; only 29[Formula: see text] of the k-space data can generate images of high quality as effectively as standard MRI reconstruction with the fully sampled data.", "Transcranial direct current stimulation (tDCS) is a promising brain modulation technique for several disease conditions. With this technique, some portion of the current penetrates through the scalp to the cortex and modulates cortical excitability, but a recent human cadaver study questions the amount. This insufficient intracerebral penetration of currents may partially explain the inconsistent and mixed results in tDCS studies to date. Experimental validation of a transcranial alternating current stimulation-generated electric field (EF) in vivo has been performed on the cortical (using electrocorticography, ECoG, electrodes), subcortical (using stereo electroencephalography, SEEG, electrodes) and deeper thalamic/subthalamic levels (using DBS electrodes). However, tDCS-generated EF measurements have never been attempted. We aimed to demonstrate that tDCS generates biologically relevant EF as deep as the subthalamic level in vivo. Patients with movement disorders who have implanted deep brain stimulation (DBS) electrodes serve as a natural experimental model for thalamic/subthalamic recordings of tDCS-generated EF. We measured voltage changes from DBS electrodes and body resistance from tDCS electrodes in three subjects while applying direct current to the scalp at 2 mA and 4 mA over two tDCS montages. Voltage changes at the level of deep nuclei changed proportionally with the level of applied current and varied with different tDCS montages. Our findings suggest that scalp-applied tDCS generates biologically relevant EF. Incorporation of these experimental results may improve finite element analysis (FEA)-based models.", "The aim of magnetic resonance electrical impedance tomography (MREIT) is to visualize the electrical properties, conductivity or current density of an object by injection of current. Recently, the prolonged data acquisition time when using the injected current nonlinear encoding (ICNE) method has been advantageous for measurement of magnetic flux density data, Bz, for MREIT in the signal-to-noise ratio (SNR). However, the ICNE method results in undesirable side artifacts, such as blurring, chemical shift and phase artifacts, due to the long data acquisition under an inhomogeneous static field. In this paper, we apply the ICNE method to a gradient and spin echo (GRASE) multi-echo train pulse sequence in order to provide the multiple k-space lines during a single RF pulse period. We analyze the SNR of the measured multiple B(z) data using the proposed ICNE-Multiecho MR pulse sequence. By determining a weighting factor for B(z) data in each of the echoes, an optimized inversion formula for the magnetic flux density data is proposed for the ICNE-Multiecho MR sequence. Using the ICNE-Multiecho method, the quality of the measured magnetic flux density is considerably increased by the injection of a long current through the echo train length and by optimization of the voxel-by-voxel noise level of the B(z) value. Agarose-gel phantom experiments have demonstrated fewer artifacts and a better SNR using the ICNE-Multiecho method. Experimenting with the brain of an anesthetized dog, we collected valuable echoes by taking into account the noise level of each of the echoes and determined B(z) data by determining optimized weighting factors for the multiply acquired magnetic flux density data.", "In this paper we demonstrate in the intact human the possibility of a non-invasive modulation of motor cortex excitability by the application of weak direct current through the scalp. Excitability changes of up to 40 %, revealed by transcranial magnetic stimulation, were accomplished and lasted for several minutes after the end of current stimulation. Excitation could be achieved selectively by anodal stimulation, and inhibition by cathodal stimulation. By varying the current intensity and duration, the strength and duration of the after-effects could be controlled. The effects were probably induced by modification of membrane polarisation. Functional alterations related to post-tetanic potentiation, short-term potentiation and processes similar to postexcitatory central inhibition are the likely candidates for the excitability changes after the end of stimulation. Transcranial electrical stimulation using weak current may thus be a promising tool to modulate cerebral excitability in a non-invasive, painless, reversible, selective and focal way.", "In the hippocampus and neocortex, high-frequency (tetanic) stimulation of an afferent pathway leads to long-term potentiation (LTP) of synaptic transmission. In the hippocampus it has recently been shown that long-term depression (LTD) of excitatory transmission can also be induced by certain combinations of synaptic activation. In most hippocampal and all neocortical pathways studied so far, the induction of LTP requires the activation of N-methyl-D-aspartate (NMDA) receptor-gated conductances. Here we report that LTD can occur in neurons of slices of the rat visual cortex and that the same tetanic stimulation can induce either LTP or LTD depending on the level of depolarization of the postsynaptic neuron. By applying intracellular current injections or pharmacological disinhibition to modify the depolarizing response of the postsynaptic neuron to tetanic stimulation, we show that the mechanisms of induction of LTD and LTP are both postsynaptic. LTD is obtained if postsynaptic depolarization exceeds a critical level but remains below a threshold related to NMDA receptor-gated conductances, whereas LTP is induced if this second threshold is reached." ]
Mechanisms of action of trastuzumab
Trastuzumab as a first HER2-targeted therapy for the treatment of HER2-positive breast cancer patients was introduced in 1998. Although trastuzumab has opened a new avenue to treat patients with HER2-positive breast cancer and other types of cancer, some patients are not responsive or become resistant to this treatment. So far, several mechanisms have been suggested for the mode of action of trastuzumab; however, the findings regarding these mechanisms are controversial. In this review, we aimed to provide a detailed insight into the various mechanisms of action of trastuzumab.
[ "Trastuzumab is a humanized monoclonal antibody (mAb) currently used for the treatment of breast cancer (BC) patients with HER-2 overexpressing tumor subtype. Previous data reported the involvement of FcγRIIIA/IIA gene polymorphisms and/or antibody-dependent cellular cytotoxicity (ADCC) in the therapeutic efficacy of trastuzumab, although results on these issues are still controversial. This study was aimed to evaluate in vitro the functional relationships among FcγRIIIA/IIA polymorphisms, ADCC intensity and HER-2 expression on tumor target cells and to correlate them with response to trastuzumab. Twenty-five patients with HER-2 overexpressing BC, receiving trastuzumab in a neoadjuvant (NEO) or metastatic (MTS) setting, were genotyped for the FcγRIIIA 158V>F and FcγRIIA 131H>R polymorphisms by a newly developed pyrosequencing assay and by multiplex Tetra-primer-ARMS PCR, respectively. Trastuzumab-mediated ADCC of patients' peripheral blood mononuclear cells (PBMCs) was evaluated prior to therapy and measured by (51)Chromium release using as targets three human BC cell lines showing different levels of reactivity with trastuzumab. We found that the FcγRIIIA 158F and/or the FcγRIIA 131R variants, commonly reported as unfavorable in BC, may actually behave as ADCC favorable genotypes, in both the NEO (P ranging from 0.009 to 0.039 and from 0.007 to 0.047, respectively) and MTS (P ranging from 0.009 to 0.032 and P = 0.034, respectively) patients. The ADCC intensity was affected by different levels of trastuzumab reactivity with BC target cells. In this context, the MCF-7 cell line, showing the lowest reactivity with trastuzumab, resulted the most suitable cell line for evaluating ADCC and response to trastuzumab. Indeed, we found a statistically significant correlation between an increased frequency of patients showing ADCC of MCF-7 and complete response to trastuzumab in the NEO setting (P = 0.006). Although this study was performed in a limited number of patients, it would indicate a correlation of FcγR gene polymorphisms to the ADCC extent in combination with the HER-2 expression levels on tumor target cells in BC patients. However, to confirm our findings further experimental evidences obtained from a larger cohort of BC patients are mandatory.", "Women with HER2-overexpressing breast cancers have poor prognosis, and many are resistant to the HER2 monoclonal antibody trastuzumab. A subgroup of HER2-overexpressing tumors also express p95HER2, an amino terminally truncated receptor that has kinase activity. Because p95HER2 cannot bind to trastuzumab but should be responsive to the HER2 tyrosine kinase inhibitor lapatinib, we compared the sensitivity of tumors expressing p95HER2 and tumors expressing the full-length HER2 receptor to these agents. MCF-7 and T47D breast cancer cells were stably transfected with either full-length HER2 or p95HER2. We studied the effects of trastuzumab and lapatinib on receptor signaling, cell proliferation, and the growth of xenograft tumors. A paraffin-based immunofluorescence assay was developed to study the association between p95HER2 expression and sensitivity to trastuzumab in patients with advanced breast cancer. All statistical tests were two-sided. Treatment of p95HER2-expressing cells with lapatinib inhibited p95HER2 phosphorylation, reduced downstream phosphorylation of Akt and mitogen-activated protein kinases, inhibited cell growth (MCF-7p95HER2 clones, lapatinib versus control, mean growth inhibition = 57.6% versus 22.6%, difference = 35%, 95% confidence interval [CI] = 22.5% to 47.3%; P<.001; T47Dp95HER2 clones, lapatinib versus control, mean growth inhibition = 36.8% versus 20%, difference = 16.8%, 95% CI = 11.3% to 22.3%, P<.001), and inhibited growth of MCF-7p95HER2 xenograft tumors (lapatinib versus control, mean = 288.8 versus 435 mm3, difference = 146.2 mm3, CI = 73.8 to 218.5 mm3, P = .002). By contrast, treatment with trastuzumab had no effect on any of these parameters. Of 46 patients with metastatic breast cancer who were treated with trastuzumab, only one of nine patients (11.1%) expressing p95HER2 responded to trastuzumab (with a partial response), whereas 19 of the 37 patients (51.4%) with tumors expressing full-length HER2 achieved either a complete (five patients) or a partial (14 patients) response (P = .029). Breast tumors that express p95HER2 are resistant to trastuzumab and may require alternative or additional anti-HER2-targeting strategies.", "The constitutive activation of signal transducer and activator of transcription 3 (Stat3) is frequently detected in breast cancer cell lines but not in normal breast epithelial cells. Stat3 has been classified as an oncogene, because constitutively active Stat3 can mediate oncogenic transformation in cultured cells and tumor formation in nude mice. Since Stat3 appears to play an important role in breast cancer, it is of interest to investigate Stat3-regulated genes and elucidate Stat3-mediated oncogenesis. In this study, we investigated the Stat3-regulated genes in human breast epithelial cells. Upon overexpression of Stat3-C, a constitutively active Stat3 form, in nonmalignant telomerase immortalized breast (TERT) cells, the total mRNA was extracted and subjected to Affymetrix microarray analysis. Our results showed that mitogen-activated protein kinase kinase 5 (MEK5) was markedly induced (more than 22-fold increase, P<0.001) by Stat3-C expression. RT-PCR result also demonstrated that MEK5 mRNA was significantly induced by Stat3-C in TERT cells. The upregulation of MEK5 by Stat3-C was further confirmed by Western blot in MCF10A breast epithelial cells. Furthermore, in MDA-MB-435s breast carcinoma cells, which express high levels of activated Stat3 and MEK5, MEK5 protein was significantly reduced by using Stat3 short interfering RNA. The reduction of MEK5 was consistent with Stat3 knockdown in this breast carcinoma cell line. We also investigated MEK5 expression in different breast carcinoma cell lines and breast cancer tissues using tissue array analysis. Compared with nonmalignant breast epithelial cells or normal tissues without constitutively active Stat3 signaling, MEK5 protein levels are remarkably higher in breast carcinoma cell lines and cancer tissues with constitutively activated Stat3. Taken together, our findings suggest that constitutively active Stat3 upregulates MEK5 in the breast epithelial cells. MEK5 may be one of the Stat3-regulated genes and plays its essential roles in oncogenesis mediated by aberrantly activated Stat3 signaling in breast carcinomatosis and malignancies.", "Grb2-associated binder-1 (Gab1) is a scaffolding/docking protein and contains a Pleckstrin homology domain and potential binding sites for Src homology (SH) 2 and SH3 domains. Gab1 is tyrosine phosphorylated and associates with protein tyrosine phosphatase SHP2 and p85 phosphatidylinositol 3-kinase on stimulation with various cytokines and growth factors, including interleukin-6. We previously demonstrated that interleukin-6-related cytokine, leukemia inhibitory factor (LIF), induced cardiac hypertrophy through gp130. In this study, we report the role of Gab1 in gp130-mediated cardiac hypertrophy. Stimulation with LIF induced tyrosine phosphorylation of Gab1, and phosphorylated Gab1 interacted with SHP2 and p85 in cultured cardiomyocytes. We constructed three kinds of adenovirus vectors, those carrying wild-type Gab1 (AdGab1WT), mutated Gab1 lacking SHP2 binding site (AdGab1F627/659), and beta-galactosidase (Adbeta-gal). Compared with cardiomyocytes infected with Adbeta-gal, longitudinal elongation of cardiomyocytes induced by LIF was enhanced in cardiomyocytes infected with AdGab1WT but inhibited in cardiomyocytes infected with AdGab1F627/659. Upregulation of BNP mRNA expression by LIF was evoked in cardiomyocytes infected with Adbeta-gal and AdGab1WT but not in cardiomyocytes infected with AdGab1F627/659. In contrast, Gab1 repressed skeletal alpha-actin mRNA expression through interaction with SHP2. Furthermore, activation of extracellular signal-regulated kinase 5 (ERK5) was enhanced in cardiomyocytes infected with AdGab1WT compared with cardiomyocytes infected with Adbeta-gal but repressed in cardiomyocytes infected with AdGab1F627/659. Coinfection of AdGab1WT with adenovirus vector carrying dominant-negative ERK5 abrogated longitudinal elongation of cardiomyocytes induced by LIF. Taken together, these findings indicate that Gab1-SHP2 interaction plays a crucial role in gp130-dependent longitudinal elongation of cardiomyoctes through activation of ERK5.", "A large-scale RNA interference screen to discover genes involved in trastuzumab resistance in breast cancer identified only PTEN as a modulator of drug sensitivity. Oncogenic mutants of PIK3CA (activator of the same pathway and frequently mutated in breast cancer) also conferred resistance to trastuzumab in cell culture. In a cohort of 55 breast cancer patients, activation of the PI3K pathway, as judged by the presence of oncogenic PIK3CA mutations or low PTEN expression, was associated with poor prognosis after trastuzumab therapy, and the combined analysis of PTEN and PIK3CA identified twice as many patients at increased risk for progression compared to PTEN alone. Thus, assessment of PI3K pathway activation may provide a biomarker to identify patients unlikely to respond to trastuzumab-based therapy.", "The mechanisms by which signals are transmitted across the plasma membrane to regulate signaling are largely unknown for receptors with single-pass transmembrane domains such as the epidermal growth factor receptor (EGFR). A crystal structure of the extracellular domain of EGFR dimerized by epidermal growth factor (EGF) reveals the extended, rod-like domain IV and a small, hydrophobic domain IV interface compatible with flexibility. The crystal structure and disulfide cross-linking suggest that the 7-residue linker between the extracellular and transmembrane domains is flexible. Disulfide cross-linking of the transmembrane domain shows that EGF stimulates only moderate association in the first two α-helical turns, in contrast to association throughout the membrane over five α-helical turns in glycophorin A and integrin. Furthermore, systematic mutagenesis to leucine and phenylalanine suggests that no specific transmembrane interfaces are required for EGFR kinase activation. These results suggest that linkage between ligand-induced dimerization and tyrosine kinase activation is much looser than was previously envisioned.", "ADAM (a disintegrin and metalloprotease) proteins are membrane-anchored metalloproteases that process and shed the ectodomains of membrane-anchored growth factors, cytokines and receptors. ADAMs also have essential roles in fertilization, angiogenesis, neurogenesis, heart development and cancer. Research on ADAMs and their role in protein ectodomain shedding is emerging as a fertile ground for gathering new insights into the functional regulation of membrane proteins." ]
The role of diazotrophs in coral physiology and reef biogeochemistry
The role of diazotrophs in coral physiology and reef biogeochemistry remains poorly understood, in part because N
[ "The removal of macroalgal biomass is critical to the health of coral reef ecosystems. Previous studies on relatively intact reefs with diverse and abundant fish communities have quantified rapid removal of macroalgae by herbivorous fishes, yet how these findings relate to degraded reef systems where fish diversity and abundance are markedly lower and algal biomass substantially higher, is unclear. We surveyed roving herbivorous fish communities and quantified their capacity to remove the dominant macroalga Sargassum ilicifolium on seven reefs in Singapore; a heavily degraded urbanized reef system. The diversity and abundance of herbivorous fishes was extremely low, with eight species and a mean abundance ~1.1 individuals 60 m-2 recorded across reefs. Consumption of S. ilicifolium varied with distance from Singapore's main port with consumption being 3- to 17-fold higher on reefs furthest from the port (Pulau Satumu: 4.18 g h-1; Kusu Island: 2.38 g h-1) than reefs closer to the port (0.35-0.78 g h-1). Video observations revealed a single species, Siganus virgatus, was almost solely responsible for removing S. ilicifolium biomass, accounting for 83% of the mass-standardized bites. Despite low herbivore diversity and intense urbanization, macroalgal removal by fishes on some Singaporean reefs was directly comparable to rates reported for other inshore Indo-Pacific reefs.", "The microbial fixation of N2 is the largest source of biologically available nitrogen (N) to the oceans. However, it is the most energetically expensive N-acquisition process and is believed inhibited when less energetically expensive forms, like dissolved inorganic N (DIN), are available. Curiously, the cosmopolitan N2-fixing UCYN-A/haptophyte symbiosis grows in DIN-replete waters, but the sensitivity of their N2 fixation to DIN is unknown. We used stable isotope incubations, catalyzed reporter deposition fluorescence in-situ hybridization (CARD-FISH), and nanoscale secondary ion mass spectrometry (nanoSIMS), to investigate the N source used by the haptophyte host and sensitivity of UCYN-A N2 fixation in DIN-replete waters. We demonstrate that under our experimental conditions, the haptophyte hosts of two UCYN-A sublineages do not assimilate nitrate (NO3-) and meet little of their N demands via ammonium (NH4+) uptake. Instead the UCYN-A/haptophyte symbiosis relies on UCYN-A N2 fixation to supply large portions of the haptophyte's N requirements, even under DIN-replete conditions. Furthermore, UCYN-A N2 fixation rates, and haptophyte host carbon fixation rates, were at times stimulated by NO3- additions in N-limited waters suggesting a link between the activities of the bulk phytoplankton assemblage and the UCYN-A/haptophyte symbiosis. The results suggest N2 fixation may be an evolutionarily viable strategy for diazotroph-eukaryote symbioses, even in N-rich coastal or high latitude waters.", "Scleractinian corals vary in response to rapid shifts in the marine environment and changes in reef community structure post-disturbance reveal a clear relationship between coral performance and morphology. With exceptions, massive corals are thought to be more tolerant and branching corals more vulnerable to changing environmental conditions, notably thermal stress. The typical responses of massive and branching coral taxa, respectively, are well documented; however, the biological and functional characteristics that underpin this variation are not well understood. We address this gap by comparing multiple biological attributes that are correlated with skeletal architecture in two perforate (having porous skeletal matrices with intercalating tissues) and two imperforate coral species (Montipora aequituberculata, Porites lobata, Pocillopora damicornis, and Seriatopora hystrix) representing three morphotypes. Our results reveal inherent biological heterogeneity among corals and the potential for perforate skeletons to create complex, three-dimensional internal habitats that impact the dynamics of the symbiosis. Patterns of tissue thickness are correlated with the concentration of symbionts within narrow regions of tissue in imperforate corals versus broad distribution throughout the larger tissue area in perforate corals. Attributes of the perforate and environmentally tolerant P. lobata were notable, with tissues ∼5 times thicker than in the sensitive, imperforate species P. damicornis and S. hystrix. Additionally, P. lobata had the lowest baseline levels of superoxide and Symbiodinium that provisioned high levels of energy. Given our observations, we hypothesize that the complexity of the visually obscured internal environment has an impact on host-symbiont dynamics and ultimately on survival, warranting further scientific investigation.", "The interrogation of genetic markers in environmental meta-barcoding studies is currently seriously hindered by the lack of taxonomically curated reference data sets for the targeted genes. The Protist Ribosomal Reference database (PR(2), http://ssu-rrna.org/) provides a unique access to eukaryotic small sub-unit (SSU) ribosomal RNA and DNA sequences, with curated taxonomy. The database mainly consists of nuclear-encoded protistan sequences. However, metazoans, land plants, macrosporic fungi and eukaryotic organelles (mitochondrion, plastid and others) are also included because they are useful for the analysis of high-troughput sequencing data sets. Introns and putative chimeric sequences have been also carefully checked. Taxonomic assignation of sequences consists of eight unique taxonomic fields. In total, 136 866 sequences are nuclear encoded, 45 708 (36 501 mitochondrial and 9657 chloroplastic) are from organelles, the remaining being putative chimeric sequences. The website allows the users to download sequences from the entire and partial databases (including representative sequences after clustering at a given level of similarity). Different web tools also allow searches by sequence similarity. The presence of both rRNA and rDNA sequences, taking into account introns (crucial for eukaryotic sequences), a normalized eight terms ranked-taxonomy and updates of new GenBank releases were made possible by a long-term collaboration between experts in taxonomy and computer scientists.", "By PCR (polymerase chain reaction) amplification and cloning, we have identified four group II self-splicing introns encoding proteins related to reverse transcriptases in natural Escherichia coli isolates belonging to the ECOR collection. One intron, IntD, interrupts a DNA sequence virtually identical to that of the previously described IS3411 Insertion Sequence. A second intron, IntC, is located within an open reading frame that is closely related to a reading frame in the T-DNA of Agrobacterium tumefaciens. Finally, introns IntA and IntB are inserted at two distinct sites in one of the Rhs elements of E. coli. A comparison of their open reading frames shows that the two Rhs introns are more closely related to each other than to any other known group II intron: this suggests that transposition of group II introns may occur preferentially in cis, along the same piece of DNA.", "High-throughput sequencing of PCR-amplified taxonomic markers (like the 16S rRNA gene) has enabled a new level of analysis of complex bacterial communities known as microbiomes. Many tools exist to quantify and compare abundance levels or OTU composition of communities in different conditions. The sequencing reads have to be denoised and assigned to the closest taxa from a reference database. Common approaches use a notion of 97% similarity and normalize the data by subsampling to equalize library sizes. In this paper, we show that statistical models allow more accurate abundance estimates. By providing a complete workflow in R, we enable the user to do sophisticated downstream statistical analyses, whether parametric or nonparametric. We provide examples of using the R packages dada2, phyloseq, DESeq2, ggplot2 and vegan to filter, visualize and test microbiome data. We also provide examples of supervised analyses using random forests and nonparametric testing using community networks and the ggnetwork package.", "The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101,632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic placement, identification of related sequences, probe and primer testing, data navigation and subalignment download are provided. The RDP-II email address for questions or comments is rdpstaff@msu.edu." ]
Epithelial-mesenchymal transition in carcinoma.
Epithelial cell plasticity, a hallmark of carcinoma progression, results in local and distant cancer dissemination. Carcinoma cell plasticity can be achieved through epithelial-mesenchymal transition (EMT), with cells positioned seemingly indiscriminately across the spectrum of EMT phenotypes. Different degrees of plasticity are achieved by transcriptional regulation and feedback-loops, which confer carcinoma cells with unique properties of tumor propagation and therapy resistance. Decoding the molecular and cellular basis of EMT in carcinoma should enable the discovery of new therapeutic strategies against cancer. In this review, we discuss the different attributes of plasticity in carcinoma and highlight the role of the canonical TGFβ receptor signaling pathway in the acquisition of plasticity. We emphasize the potential stochasticity of stemness in carcinoma in relation to plasticity and provide data from recent clinical trials that seek to target plasticity.
[ "Collective invasion of cancer cells is the key process of circulating tumor cell (CTC) cluster formation, and greatly contributes to metastasis. Cancer stem-like cells (CSC) have a distinct advantage of motility for metastatic dissemination. To verify the role of CSC in the collective invasion, we performed 3D assays to investigate the collective invasion from cancer cell spheroids. The results demonstrated that CSC can significantly promote both collective and single-cell invasion. Further study showed that CSC prefer to move outside and lead the collective invasion. More interestingly, approximately 60% of the leader CSC in collective invasion co-expressed both epithelial and mesenchymal genes, while only 4% co-expressed in single invasive CSC, indicating that CSC with hybrid epithelial/mesenchymal phenotype play a key role in cancer cell collective invasion.", "Transforming growth factor β (TGF-β) plays an important role in cancer. Monoclonal antibodies (mAb) designed to specifically block the TGF-β ligands, are expected to inhibit tumor progression in patients with metastatic cancer. TβM1 is a humanized mAb optimized for neutralizing activity against TGF-β1. The objective of this clinical trial was to assess the safety and tolerability of TβM1 in patients with metastatic cancer. In this phase I, uncontrolled, non-randomized, dose-escalation study, 18 eligible adult patients who had measurable disease per RECIST and a performance status of ≤ 2 on the ECOG scale were administered TβM1 intravenously over 10 min at doses of 20, 60, 120 and 240 mg on day 1 of each 28-day cycle. Safety was assessed by adverse events (as defined by CTCAE version 3.0) and possible relationship to study drug, dose-limiting toxicities and laboratory changes. Systemic drug exposure and pharmacodynamic (PD) parameters were assessed. TβM1 was safe when administered once monthly. The pharmacokinetic (PK) profile was consistent with a mAb with a mean elimination half-life approximately 9 days. Although anticipated changes in PD markers such as serum VEGF, bFGF and mRNA expression of SMAD7 were observed in whole-blood, suggesting activity of TβM1 on the targeted pathway, these changes were not consistent to represent a PD effect. Additionally, despite the presence of an activated TGF-β1 expression signature in patients' whole blood, the short dosing duration did not translate into significant antitumor effect in the small number of patients investigated in this study.", "Transforming growth factor-β (TGFβ) suppresses tumor formation since it inhibits cell growth and promotes apoptosis. However, in advanced cancers TGFβ elicits tumor promoting effects through its ability to induce epithelial-mesenchymal transition (EMT) which enhances invasiveness and metastasis; in addition, TGFβ exerts tumor promoting effects on non-malignant cells of the tumor, including suppression of immune surveillance and stimulation of angiogenesis. TGFβ promotes EMT by transcriptional and posttranscriptional regulation of a group of transcription factors that suppresses epithelial features, such as expression of components of cell junctions and polarity complexes, and enhances mesenchymal features, such as production of matrix molecules and several cytokines and growth factors that stimulate cell migration. The EMT program has certain similarities with the stem cell program. Inducers and effectors of EMT are interesting targets for the development of improved diagnosis, prognosis and therapy of cancer.", "Purpose: Head and neck squamous cell carcinoma (HNSCC) is comprised of heterogeneous populations of cells, and CD271 (NGFR; p75NTR) has been associated with a tumor-initiating cell subpopulation. This study assessed the role of CD271 in modulating metastatic behavior in HNSCC.Experimental Design: CD271 was overexpressed in murine and human oral squamous cell carcinoma cells to assess the impact of CD271 activation on the invasive and metastatic phenotype of these cells, using in vitro and orthotopic in vivo modeling. Treatment with human nerve growth factor (NGF) to activate CD271, as well as shRNA knockdown of the CD271-upregulated Snai2 expression, was used to assess the mechanism of the CD271-induced invasive phenotype. Relevance of CD271 expression in human HNSCC was evaluated in patient-derived xenografts (PDX) and primary human oral cancers, annotated with clinical behavior characteristics and survival data.Results: Forced expression of CD271 resulted in a more invasive and metastatic phenotype. Slug, an epithelial-to-mesenchymal transition (EMT)-related transcription factor, encoded by Snai2, was highly expressed in MOC2-CD271 and HSC3-CD271, compared with respective parental cells. CD271 activation by NGF conferred enhanced invasiveness in CD271-overexpressing cells, which was abrogated by Snai2 knockdown. In PDXs and primary human HNSCC, CD271 expression correlated with higher Snai2 expression, greater nodal metastasis, and shorter disease-free survival.Conclusions: Activation of CD271 results in upregulation of Snai2/Slug, which, in turn, results in a more invasive phenotype and an enhanced capacity for metastasis to regional lymph nodes. These findings point to CD271 as a promising, therapeutic target for oral cancer metastasis. Clin Cancer Res; 24(3); 674-83. ©2017 AACR.", "Clear-cell renal cell carcinoma (ccRCC) exhibits a broad range of metastatic phenotypes that have not been systematically studied to date. Here, we analyzed 575 primary and 335 metastatic biopsies across 100 patients with metastatic ccRCC, including two cases sampledat post-mortem. Metastatic competence was afforded by chromosome complexity, and we identify 9p loss as a highly selected event driving metastasis and ccRCC-related mortality (p = 0.0014). Distinct patterns of metastatic dissemination were observed, including rapid progression to multiple tissue sites seeded by primary tumors of monoclonal structure. By contrast, we observed attenuated progression in cases characterized by high primary tumor heterogeneity, with metastatic competence acquired gradually and initial progression to solitary metastasis. Finally, we observed early divergence of primitive ancestral clones and protracted latency of up to two decades as a feature of pancreatic metastases.", "Activation of metastatic reprogramming is critical for tumour metastasis. However, more detailed knowledge of the underlying mechanism is needed to enable targeted intervention. Here, we show that paraspeckle component 1 (PSPC1), identified in an aberrant 13q12.11 locus, is upregulated and associated with poor survival in patients with cancer. PSPC1 promotes tumorigenesis, epithelial-to-mesenchymal transition (EMT), stemness and metastasis in multiple cell types and in spontaneous mouse cancer models. PSPC1 is the master activator for transcription factors of EMT and stemness and accompanies c-Myc activation to facilitate tumour growth. PSPC1 increases transforming growth factor-β1 (TGF-β1) secretion through an interaction with phosphorylated and nuclear Smad2/3 to potentiate TGF-β1 autocrine signalling. Moreover, PSPC1 acts as a contextual determinant of the TGF-β1 pro-metastatic switch to alter Smad2/3 binding preference from tumour-suppressor to pro-metastatic genes. Having validated the PSPC1-Smads-TGF-β1 axis in various cancers, we conclude that PSPC1 is a master activator of pro-metastatic switches and a potential target for anti-metastasis drugs.", "Treatment of prostate cancer (PC) by androgen suppression promotes the emergence of aggressive variants that are androgen receptor (AR) independent. Here we identify the transcription factor ONECUT2 (OC2) as a master regulator of AR networks in metastatic castration-resistant prostate cancer (mCRPC). OC2 acts as a survival factor in mCRPC models, suppresses the AR transcriptional program by direct regulation of AR target genes and the AR licensing factor FOXA1, and activates genes associated with neural differentiation and progression to lethal disease. OC2 appears active in a substantial subset of human prostate adenocarcinoma and neuroendocrine tumors. Inhibition of OC2 by a newly identified small molecule suppresses metastasis in mice. These findings suggest that OC2 displaces AR-dependent growth and survival mechanisms in many cases where AR remains expressed, but where its activity is bypassed. OC2 is also a potential drug target in the metastatic phase of aggressive PC.", "Tumor cell plasticity exhibited as an epithelial-mesenchymal transition (EMT) has been identified as a major obstacle for the effective treatment of many cancers. This process, which involves the dedifferentiation of epithelial tumor cells towards a motile, metastatic, and mesenchymal tumor phenotype, mediates resistance to conventional therapies and small-molecule targeted therapies. In this review, we highlight current research correlating the role of tumor plasticity with resistance to current immunotherapy approaches and discuss future and ongoing combination immunotherapy strategies to reduce tumor cell plasticity-driven resistance in cancer.", "The role of epithelial-to-mesenchymal transition (EMT) in metastasis is a longstanding source of debate, largely owing to an inability to monitor transient and reversible EMT phenotypes in vivo. Here we establish an EMT lineage-tracing system to monitor this process in mice, using a mesenchymal-specific Cre-mediated fluorescent marker switch system in spontaneous breast-to-lung metastasis models. We show that within a predominantly epithelial primary tumour, a small proportion of tumour cells undergo EMT. Notably, lung metastases mainly consist of non-EMT tumour cells that maintain their epithelial phenotype. Inhibiting EMT by overexpressing the microRNA miR-200 does not affect lung metastasis development. However, EMT cells significantly contribute to recurrent lung metastasis formation after chemotherapy. These cells survived cyclophosphamide treatment owing to reduced proliferation, apoptotic tolerance and increased expression of chemoresistance-related genes. Overexpression of miR-200 abrogated this resistance. This study suggests the potential of an EMT-targeting strategy, in conjunction with conventional chemotherapies, for breast cancer treatment.", "We have shown that preoperative plasma levels of transforming growth factor-beta(1) (TGF-beta(1)), interleukin 6 (IL)-6, and its receptor (IL-6sR) are associated with prostate cancer progression and metastasis. The objectives of this study were to confirm these findings and to examine the association of changes in plasma levels of these markers after surgery with disease progression in a large consecutive cohort of patients. Plasma levels of TGF-beta(1), IL-6, and IL-6sR were measured pre- and postoperatively (6-8 weeks after surgery) in 302 consecutive patients who underwent radical prostatectomy for clinically localized disease. Pre- and postoperative levels of TGF-beta(1) were significantly elevated in patients with extraprostatic extension, seminal vesicle involvement, and metastases to lymph nodes. In contrast, preoperative levels of IL-6 and IL-6sR, but not postoperative levels, were significantly associated with tumor volume, prostatectomy Gleason sum, and metastases to lymph nodes. In a postoperative model that included pre- and postoperative TGF-beta(1), IL-6, and IL-6sR and standard postoperative parameters, postoperative TGF-beta(1) and prostatectomy Gleason sum were significant predictors of overall and aggressive disease progression. Although, for all patients, plasma levels of all three markers declined significantly after prostate removal, for patients that experienced disease progression, only IL-6 and IL-6sR levels decreased significantly. For patients undergoing radical prostatectomy, preoperative plasma levels of TGF-beta(1) and IL-6sR are associated with metastases to regional lymph nodes, presumed occult metastases at the time of primary treatment, and disease progression. After prostate removal, postoperative TGF-beta(1) level increases in value over preoperative levels for the prediction of disease progression." ]
Robust Variable Selection for Meta-Analysis of High-Dimensional Datasets
High-throughput omics data are becoming more and more popular in various areas of science. Given that many publicly available datasets address the same questions, researchers have applied meta-analysis to synthesize multiple datasets to achieve more reliable results for model estimation and prediction. Due to the high dimensionality of omics data, it is also desirable to incorporate variable selection into meta-analysis. Existing meta-analyzing variable selection methods are often sensitive to the presence of outliers, and may lead to missed detections of relevant covariates, especially for lasso-type penalties. In this paper, we develop a robust variable selection algorithm for meta-analyzing high-dimensional datasets based on logistic regression. We first search an outlier-free subset from each dataset by borrowing information across the datasets with repeatedly use of the least trimmed squared estimates for the logistic model and together with a hierarchical bi-level variable selection technique. We then refine a reweighting step to further improve the efficiency after obtaining a reliable non-outlier subset. Simulation studies and real data analysis show that our new method can provide more reliable results than the existing meta-analysis methods in the presence of outliers.
[ "We have established a method for systematic integration of multiple microarray datasets. The method was applied to two different sets of cancer profiling studies. The change of gene expression in cancer was expressed as 'effect size', a standardized index measuring the magnitude of a treatment or covariate effect. The effect sizes were combined to obtain the estimate of the overall mean. The statistical significance was determined by a permutation test extended to multiple datasets. It was shown that the data integration promotes the discovery of small but consistent expression changes with increased sensitivity and reliability. The effect size methods provided the efficient modeling framework for addressing interstudy variation as well. Based on the result of homogeneity tests, a fixed effects model was adopted for one set of datasets that had been created in controlled experimental conditions. By contrast, a random effects model was shown to be appropriate for the other set of datasets that had been published by independent groups. We also developed an alternative modeling procedure based on a Bayesian approach, which would offer flexibility and robustness compared to the classical procedure.", "In genetic and genomic studies, gene-environment (G×E) interactions have important implications. Some of the existing G×E interaction methods are limited by analyzing a small number of G factors at a time, by assuming linear effects of E factors, by assuming no data contamination, and by adopting ineffective selection techniques. In this study, we propose a new approach for identifying important G×E interactions. It jointly models the effects of all E and G factors and their interactions. A partially linear varying coefficient model is adopted to accommodate possible nonlinear effects of E factors. A rank-based loss function is used to accommodate possible data contamination. Penalization, which has been extensively used with high-dimensional data, is adopted for selection. The proposed penalized estimation approach can automatically determine if a G factor has an interaction with an E factor, main effect but not interaction, or no effect at all. The proposed approach can be effectively realized using a coordinate descent algorithm. Simulation shows that it has satisfactory performance and outperforms several competing alternatives. The proposed approach is used to analyze a lung cancer study with gene expression measurements and clinical variables. Copyright © 2015 John Wiley & Sons, Ltd.", "A drastic amount of data have been and are being generated in bioinformatics studies. In the analysis of such data, the standard modeling approaches can be challenged by the heavy-tailed errors and outliers in response variables, the contamination in predictors (which may be caused by, for instance, technical problems in microarray gene expression studies), model mis-specification and others. Robust methods are needed to tackle these challenges. When there are a large number of predictors, variable selection can be as important as estimation. As a generic variable selection and regularization tool, penalization has been extensively adopted. In this article, we provide a selective review of robust penalized variable selection approaches especially designed for high-dimensional data from bioinformatics and biomedical studies. We discuss the robust loss functions, penalty functions and computational algorithms. The theoretical properties and implementation are also briefly examined. Application examples of the robust penalization approaches in representative bioinformatics and biomedical studies are also illustrated.", "The analysis of survival endpoints subject to right-censoring is an important research area in statistics, particularly among econometricians and biostatisticians. The two most popular semiparametric models are the proportional hazards model and the accelerated failure time (AFT) model. Rank-based estimation in the AFT model is computationally challenging due to optimization of a non-smooth loss function. Previous work has shown that rank-based estimators may be written as solutions to linear programming (LP) problems. However, the size of the LP problem is O(n2 + p) subject to n2 linear constraints, where n denotes sample size and p denotes the dimension of parameters. As n and/or p increases, the feasibility of such solution in practice becomes questionable. Among data mining and statistical learning enthusiasts, there is interest in extending ordinary regression coefficient estimators for low-dimensions into high-dimensional data mining tools through regularization. Applying this recipe to rank-based coefficient estimators leads to formidable optimization problems which may be avoided through smooth approximations to non-smooth functions. We review smooth approximations and quasi-Newton methods for rank-based estimation in AFT models. The computational cost of our method is substantially smaller than the corresponding LP problem and can be applied to small- or large-scale problems similarly. The algorithm described here allows one to couple rank-based estimation for censored data with virtually any regularization and is exemplified through four case studies." ]
The effect of hyperphosphorylated tau on neocortical neuronal structure during hibernation in the Syrian hamster
The dendritic spines of pyramidal cells are the main postsynaptic target of excitatory glutamatergic synapses. Morphological alterations have been described in hippocampal dendritic spines during hibernation-a state of inactivity and metabolic depression that occurs via a transient neuronal tau hyperphosphorylation. Here, we have used the hibernating Syrian hamster to investigate the effect of hyperphosphorylated tau regarding neocortical neuronal structure. In particular, we examined layer Va pyramidal neurons. Our results indicate that hibernation does not promote significant changes in dendritic spine density. However, tau hyperphosphorylated neurons show a decrease in complexity, an increase in the tortuosity of the apical dendrites, and an increase in the diameter of the basal dendrites. Tau protein hyperphosphorylation and aggregation have been associated with loss or alterations of dendritic spines in neurodegenerative diseases, such as Alzheimer's disease (AD). Our results may shed light on the correlation between tau hyperphosphorylation and the neuropathological processes in AD. Moreover, we observed changes in the length and area of the apical and basal dendritic spines during hibernation regardless of tau hyperphosphorylation. The morphological changes observed here also suggest region specificity, opening up debate about a possible relationship with the differential brain activity registered in these regions in previous studies.
[ "Markov kinetic models were used to synthesize a complete description of synaptic transmission, including opening of voltage-dependent channels in the presynaptic terminal, release of neurotransmitter, gating of postsynaptic receptors, and activation of second-messenger systems. These kinetic schemes provide a more general framework for modeling ion channels than the Hodgkin-Huxley formalism, supporting a continuous spectrum of descriptions ranging from the very simple and computationally efficient to the highly complex and biophysically precise. Examples are given of simple kinetic schemes based on fits to experimental data that capture the essential properties of voltage-gated, synaptic and neuromodulatory currents. The Markov formalism allows the dynamics of ionic currents to be considered naturally in the larger context of biochemical signal transduction. This framework can facilitate the integration of a wide range of experimental data and promote consistent theoretical analysis of neural mechanisms from molecular interactions to network computations.", "We introduce a novel computational model of hippocampal pyramidal cells physiology based on an up-to-date, detailed description of passive and active biophysical properties and real dendritic morphology. This model constitutes a modification of a previous (1995) model which included complex calcium dynamics and Na(+), K(+), and Ca(2+) currents. Changes reflect recently acquired experimental knowledge regarding the types and spatial distributions of these currents. The updated model responds to simulated somatic current clamp stimulation with a train of spikes (burst). The shape of the burst reproduces the characteristic behavior observed experimentally, similarly to the previous model. However, an analysis of dendritic membrane voltage distribution during the burst shows that the mechanisms underlying this somatic behavior are dramatically different in the two models. In the previous model, all spikes were generated in the soma and backpropagated in the dendrites. In the updated model, in contrast, only the first spike is initiated somatically. The second somatic spike is preceded by a dendritic spike (triggered by the first spike backpropagation), which propagates both backward and forward, reaching the soma just before the rise of the second somatic spike. The third and fourth spikes are similarly caused by a complex spatio-temporal interplay between somatic and dendritic depolarization. These results suggest that the distribution of ionic currents recently characterized in hippocampal pyramidal cells can support both somatic and dendritic spike initiation. In addition, these simulations demonstrate that models with considerably different distributions of active conductances can reproduce the same experimental bursting behavior with distinct biophysical mechanisms.", "Action potentials evoke calcium transients in dendrites of neocortical pyramidal neurons with time constants of < 100 ms at physiological temperature. This time period may not be sufficient for inflowing calcium ions to equilibrate with all present Ca2+-binding molecules. We therefore explored nonequilibrium dynamics of Ca2+ binding to numerous Ca2+ reaction partners within a dendritelike compartment using numerical simulations. After a brief Ca2+ influx, the reaction partner with the fastest Ca2+ binding kinetics initially binds more Ca2+ than predicted from chemical equilibrium, while companion reaction partners bind less. This difference is consolidated and may result in bypassing of slow reaction partners if a Ca2+ clearance mechanism is active. On the other hand, slower reaction partners effectively bind Ca2+ during repetitive calcium current pulses or during slower Ca2+ influx. Nonequilibrium Ca2+ distribution can further be enhanced through strategic placement of the reaction partners within the compartment. Using the Ca2+ buffer EGTA as a competitor of fluo-3, we demonstrate competitive Ca2+ binding within dendrites experimentally. Nonequilibrium calcium dynamics is proposed as a potential mechanism for differential and conditional activation of intradendritic targets.", "Most neurons in the mammalian CNS encode and transmit information via action potentials. Knowledge of where these electrical events are initiated and how they propagate within neurons is therefore fundamental to an understanding of neuronal function. While work from the 1950s suggested that action potentials are initiated in the axon, many subsequent investigations have suggested that action potentials can also be initiated in the dendrites. Recently, experiments using simultaneous patch-pipette recordings from different locations on the same neuron have been used to address this issue directly. These studies show that the site of action potential initiation is in the axon, even when synaptic activation is powerful enough to elicit dendritic electrogenesis. Furthermore, these and other studies also show that following initiation, action potentials actively backpropagate into the dendrites of many neuronal types, providing a retrograde signal of neuronal output to the dendritic tree.", "A key goal in neuroscience is to explain how the operations of a neuron emerge from sets of active channels with specific dendritic distributions. If general principles can be identified for these distributions, dendritic channels should reflect the computational role of a given cell type within its functional neural circuit. Here, we discuss insights from experimental and computational data on the distribution of voltage-gated channels in dendrites, and attempt to derive rules for how their interactions implement different dendritic functions. We propose that this type of analysis will be important for understanding behavioural processes in terms of single-neuron properties, and that it constitutes a step towards a 'functional proteomics' of nerve cells, which will be essential for defining neuronal phenotypes.", "There is growing interest in understanding calcium dynamics in dendrites, both experimentally and computationally. Many processes influence these dynamics, but in dendrites there is a strong contribution of morphology because the peak calcium levels are strongly determined by the surface to volume ratio (SVR) of each branch, which is inversely related to branch diameter. In this study we explore the predicted variance of dendritic calcium concentrations due to local changes in dendrite diameter and how this is affected by the modeling approach used. We investigate this in a model of dendritic calcium spiking in different reconstructions of cerebellar Purkinje cells and in morphological analysis of neocortical and hippocampal pyramidal neurons. We report that many published models neglect diameter-dependent effects on calcium concentration and show how to implement this correctly in the NEURON simulator, both for phenomenological pool based models and for implementations using radial 1D diffusion. More detailed modeling requires simulation of 3D diffusion and we demonstrate that this does not dissipate the local concentration variance due to changes of dendritic diameter. In many cases 1D diffusion of models of calcium buffering give a good approximation provided an increased morphological resolution is implemented.", "Bursts of dendritic calcium spikes play an important role in excitability and synaptic plasticity in many types of neurons. In single Purkinje cells, spontaneous and synaptically evoked dendritic calcium bursts come in a variety of shapes with a variable number of spikes. The mechanisms causing this variability have never been investigated thoroughly. In this study, a detailed computational model using novel simulation routines is applied to identify the roles that stochastic ion channels, spatial arrangements of ion channels, and stochastic intracellular calcium have toward producing calcium burst variability. Consistent with experimental recordings from rats, strong variability in the burst shape is observed in simulations. This variability persists in large model sizes in contrast to models containing only voltage-gated channels, where variability reduces quickly with increase of system size. Phase plane analysis of Hodgkin-Huxley spikes and of calcium bursts identifies fluctuation in phase space around probabilistic phase boundaries as the mechanism determining the dependence of variability on model size. Stochastic calcium dynamics are the main cause of calcium burst fluctuations, specifically the calcium activation of mslo/BK-type and SK2 channels. Local variability of calcium concentration has a significant effect at larger model sizes. Simulations of both spontaneous and synaptically evoked calcium bursts in a reconstructed dendrite show, in addition, strong spatial and temporal variability of voltage and calcium, depending on morphological properties of the dendrite. Our findings suggest that stochastic intracellular calcium mechanisms play a crucial role in dendritic calcium spike generation and are therefore an essential consideration in studies of neuronal excitability and plasticity." ]
HLA-B*57:01 prevalence in individuals with HIV-1 in West and Central Africa
The presence of the human leukocyte antigen HLA-B*57:01 is associated with the development of a hypersensitivity reaction to abacavir (ABC). Limited data exist on HLA-B*57:01 prevalence in individuals with HIV-1 in Africa. This study aimed to estimate HLA-B*57:01 prevalence in individuals with HIV-1 in West and Central Africa.
[ "Currently, there are very few guidelines linking the results of pharmacogenetic tests to specific therapeutic recommendations. Therefore, the Royal Dutch Association for the Advancement of Pharmacy established the Pharmacogenetics Working Group with the objective of developing pharmacogenetics-based therapeutic (dose) recommendations. After systematic review of the literature, recommendations were developed for 53 drugs associated with genes coding for CYP2D6, CYP2C19, CYP2C9, thiopurine-S-methyltransferase (TPMT), dihydropyrimidine dehydrogenase (DPD), vitamin K epoxide reductase (VKORC1), uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1), HLA-B44, HLA-B*5701, CYP3A5, and factor V Leiden (FVL).", "To determine the frequencies of HLA-B alleles in Ugandan patients in the NORA substudy of the DART trial and to compare HLA-B allele frequencies in those with and without clinically diagnosed hypersensitivity reaction (HSR). DNA-based HLA-B genotyping was used to determine HLA alleles in 247 participants who received abacavir, including all six participants ('cases') with clinically diagnosed abacavir HSR. The incidence of clinical abacavir HSR in this double-blinded study was 2.0% (6/300) in the abacavir group. As HLA-B*5701 was absent throughout the entire cohort, including the six HSR 'cases', an association could not be established between HLA-B*5701 and clinically diagnosed abacavir HSR. No other HLA-B*57 alleles were present among the six 'cases'. HLA-B*5703 was the most frequent HLA-B*57 allele among the abacavir-tolerant participants. The rate of clinical HSR was low, which may reflect the expected 2-3% clinical false-positive rate seen in previous double-blind randomized studies. The presumption that these cases may be false-positive abacavir HSR is supported by the fact that no HLA-B*5701 alleles were found in the abacavir group. Implementation of prospective HLA-B*5701 screening must be based on benefit/risk considerations within local practice. Clinical risk management remains paramount.", "Human leukocyte antigen B (HLA-B) is responsible for presenting peptides to immune cells and plays a critical role in normal immune recognition of pathogens. A variant allele, HLA-B*57:01, is associated with increased risk of a hypersensitivity reaction to the anti-HIV drug abacavir. In the absence of genetic prescreening, hypersensitivity affects ~6% of patients and can be life-threatening with repeated dosing. We provide recommendations (updated periodically at http://www.pharmkgb.org) for the use of abacavir based on HLA-B genotype.", "The HLA system is the most polymorphic of all human genetic systems. The frequency of HLA class I alleles and their linkage disequilibrium patterns differ significantly among human populations as shown in studies using serologic methods. Many DNA-defined alleles with identical serotypes may have variable frequencies in different populations. We typed HLA-A, B, and C loci at the allele level by PCR-based methods in 1,296 unrelated subjects from five major outbred groups living in the U.S.A (African, AFAM; Caucasians, CAU; Asian, ORI; Hispanic, HIS, and North American Natives, NAI). We detected 46, 100 and 32 HLA-A, B, and C alleles, respectively. ORI and HIS presented more alleles at each of these loci. There was lack of correlation between the levels of heterozygosity and the number of alleles detected in each population. In AFAM, heterozygosity (>90%) is maximized at all class I loci. HLA-A had the lowest heterozygosity in all populations but CAU. Tight LD was observed between HLA-B and C alleles. AFAM had weaker or nonexistent associations between alleles of HLA-A and B than other populations. Analysis of the genetic distances between these and other populations showed a close relationship between specific US populations and a population from their original continents. ORI exhibited the largest genetic distance with all the other U.S. groups and were closer to NAI. Evidence of admixture with CAU was observed for AFAM and HIS. HIS also had significant frequencies of AFAM and Mexican Indian alleles. Differences in both LD and heterozygosity levels suggest distinct evolutionary histories of the HLA loci in the geographical regions from where the U.S. populations originated." ]
Neutrophil swarming is a conserved process in zebrafish immunity
Neutrophils are rapidly recruited to inflammatory sites where their coordinated migration forms clusters, a process termed neutrophil swarming. The factors that modulate early stages of neutrophil swarming are not fully understood, requiring the development of new in vivo models. Using transgenic zebrafish larvae to study endogenous neutrophil migration in a tissue damage model, we demonstrate that neutrophil swarming is a conserved process in zebrafish immunity, sharing essential features with mammalian systems. We show that neutrophil swarms initially develop around an individual pioneer neutrophil. We observed the violent release of extracellular cytoplasmic and nuclear fragments by the pioneer and early swarming neutrophils. By combining in vitro and in vivo approaches to study essential components of neutrophil extracellular traps (NETs), we provide in-depth characterisation and high-resolution imaging of the composition and morphology of these release events. Using a photoconversion approach to track neutrophils within developing swarms, we identify that the fate of swarm-initiating pioneer neutrophils involves extracellular chromatin release and that the key NET components gasdermin, neutrophil elastase, and myeloperoxidase are required for the swarming process. Together our findings demonstrate that release of cellular components by pioneer neutrophils is an initial step in neutrophil swarming at sites of tissue injury.
[ "A group of 100 totally or subtotally myeloperoxidase (MPO)-deficient individuals was compared to a reference population of 118 probands selected at random. Data for a protective effect of the deficiency against cardiovascular damage are presented. On the other hand, a significantly higher occurrence of severe infections and chronic inflammatory processes was noted among the deficient patients. An increased incidence of cancer among the MPO-deficient individuals was not demonstrated.", "In response to infection, polymorphonuclear neutrophils (PMN) are recruited in the infectious sites, and employ three major strategies to fight against the microbes including phagocytosis, degranulation, and neutrophil extracellular traps (NETs). NETs are a meshwork of chromatin fibers mixed with granule-derived antimicrobial peptides and enzymes, which trap and kill the bacteria extracellularly. In this study, by using a mouse sepsis model, we identified a novel mechanism by which NETs induce macrophage (Mϕ) pyroptosis, a caspase-1-dependent regulated cell death. We show that NET-derived HMGB1, acting through RAGE and dynamin-dependent signaling, triggers an intra-Mϕ cascade of molecular events including cathepsin B (CatB) release from the ruptured lysosomes, followed by pyroptosome formation and caspase-1 activation, and subsequent Mϕ pyroptosis. The study further demonstrates that Mϕ pyroptosis augments inflammatory responses following sepsis. These findings shed light on the proinflammatory role of NETs in mediating PMN-Mϕ interaction, which therefore influences the progress of inflammation following infection.", "Activated neutrophils use myeloperoxidase (MPO) to generate an array of potent toxic oxidants. In the current studies we used genetically altered mice deficient in MPO to investigate the role of the enzyme in host defense against the Gram-negative bacterium Klebsiella pneumoniae, an important human pathogen. For comparison, we used mice deficient in the antimicrobial molecule, neutrophil elastase (NE). When challenged i.p., mice deficient in either MPO or NE were markedly more susceptible to bacterial infection and death. In vitro studies suggested that MPO impairs the morphology of bacteria in a distinctive way. Of importance, our in vitro studies found that MPO mediated oxidative inactivation of NE, an enzyme that has been widely implicated in the pathogenesis of various tissue-destructive diseases. This pathway of oxidative inactivation may be physiologically relevant, because activated neutrophils isolated from MPO-deficient mice exhibited increased elastase activity. Our observations provide strong evidence that MPO, like NE, is a key player in the killing of K. pneumoniae bacteria. They also suggest that MPO may modulate NE to protect the host from the tissue-degrading activity of this proteinase.", "Neutrophils are central to the pathology of inflammatory diseases, where they can damage host tissue through release of reactive oxygen metabolites and proteases, and drive inflammation via secretion of cytokines and chemokines. Many cytokines, such as those generated during inflammation, can induce a similar \"primed\" phenotype in neutrophils, but it is unknown if different cytokines utilise common or cytokine-specific pathways to induce these functional changes. Here, we describe the transcriptomic changes induced in control human neutrophils during priming in vitro with pro-inflammatory cytokines (TNF-α and GM-CSF) using RNA-seq. Priming led to the rapid expression of a common set of transcripts for cytokines, chemokines and cell surface receptors (CXCL1, CXCL2, IL1A, IL1B, IL1RA, ICAM1). However, 580 genes were differentially regulated by TNF-α and GM-CSF treatment, and of these 58 were directly implicated in the control of apoptosis. While these two cytokines both delayed apoptosis, they induced changes in expression of different pro- and anti-apoptotic genes. Bioinformatics analysis predicted that these genes were regulated via differential activation of transcription factors by TNF-α and GM-CSF and these predictions were confirmed using functional assays: inhibition of NF-κB signalling abrogated the protective effect of TNF-α (but not that of GM-CSF) on neutrophil apoptosis, whereas inhibition of JAK/STAT signalling abrogated the anti-apoptotic effect of GM-CSF, but not that of TNF-α (p<0.05). These data provide the first characterisation of the human neutrophil transcriptome following GM-CSF and TNF-α priming, and demonstrate the utility of this approach to define functional changes in neutrophils following cytokine exposure. This may provide an important, new approach to define the molecular properties of neutrophils after in vivo activation during inflammation.", "The neutrophil enzyme myeloperoxidase (MPO) is a major enzyme made by neutrophils to generate antimicrobial and immunomodulatory compounds, notably hypochlorous acid (HOCl), amplifying their capacity for destroying pathogens and regulating inflammation. Despite its roles in innate immunity, the importance of MPO in preventing infection is unclear, as individuals with MPO deficiency are asymptomatic with the exception of an increased risk of candidiasis. Dysregulation of MPO activity is also linked with inflammatory conditions such as atherosclerosis, emphasising a need to understand the roles of the enzyme in greater detail. Consequently, new tools for investigating granular dynamics in vivo can provide useful insights into how MPO localises within neutrophils, aiding understanding of its role in preventing and exacerbating disease. The zebrafish is a powerful model for investigating the immune system in vivo, as it is genetically tractable, and optically transparent. To visualise MPO activity within zebrafish neutrophils, we created a genetic construct that expresses human MPO as a fusion protein with a C-terminal fluorescent tag, driven by the neutrophil-specific promoter lyz. After introducing the construct into the zebrafish genome by Tol2 transgenesis, we established the Tg(lyz:Hsa.MPO-mEmerald,cmlc2:EGFP)sh496 line, and confirmed transgene expression in zebrafish neutrophils. We observed localisation of MPO-mEmerald within a subcellular location resembling neutrophil granules, mirroring MPO in human neutrophils. In Spotless (mpxNL144) larvae-which express a non-functional zebrafish myeloperoxidase-the MPO-mEmerald transgene does not disrupt neutrophil migration to sites of infection or inflammation, suggesting that it is a suitable line for the study of neutrophil granule function. We present a new transgenic line that can be used to investigate neutrophil granule dynamics in vivo without disrupting neutrophil behaviour, with potential applications in studying processing and maturation of MPO during development.", "Leukocyte migration through activated venular walls is a fundamental immune response that is prerequisite to the entry of effector cells such as neutrophils, monocytes, and effector T cells to sites of infection, injury, and stress within the interstitium. Stimulation of leukocytes is instrumental in this process with enhanced temporally controlled leukocyte adhesiveness and shape-changes promoting leukocyte attachment to the inner wall of blood vessels under hydrodynamic forces. This initiates polarized motility of leukocytes within and through venular walls and transient barrier disruption facilitated sequentially by stimulated vascular cells, i.e., endothelial cells and their associated pericytes. Perivascular cells such as macrophages and mast cells that act as tissue inflammatory sentinels can also directly and indirectly regulate the exit of leukocytes from the vascular lumen. In this review, we discuss current knowledge and open questions regarding the mechanisms involved in the interactions of different effector leukocytes with peripheral vessels in extralymphoid organs.", "Staphylococcus aureus is highly adapted to its host and has evolved many strategies to resist opsonization and phagocytosis. Even after uptake by neutrophils, S. aureus shows resistance to killing, which suggests the presence of phagosomal immune evasion molecules. With the aid of secretome phage display, we identified a highly conserved protein that specifically binds and inhibits human myeloperoxidase (MPO), a major player in the oxidative defense of neutrophils. We have named this protein \"staphylococcal peroxidase inhibitor\" (SPIN). To gain insight into inhibition of MPO by SPIN, we solved the cocrystal structure of SPIN bound to a recombinant form of human MPO at 2.4-Å resolution. This structure reveals that SPIN acts as a molecular plug that prevents H2O2 substrate access to the MPO active site. In subsequent experiments, we observed that SPIN expression increases inside the neutrophil phagosome, where MPO is located, compared with outside the neutrophil. Moreover, bacteria with a deleted gene encoding SPIN showed decreased survival compared with WT bacteria after phagocytosis by neutrophils. Taken together, our results demonstrate that S. aureus secretes a unique proteinaceous MPO inhibitor to enhance survival by interfering with MPO-mediated killing." ]
The potential of statins in the treatment of cancer
As competitive HMG-CoA reductase (HMGCR) inhibitors, statins not only reduce cholesterol and improve cardiovascular risk, but also exhibit pleiotropic effects that are independent of their lipid-lowering effects. Among them, the anti-cancer properties of statins have attracted much attention and indicated the potential of statins as repurposed drugs for the treatment of cancer. A large number of clinical and epidemiological studies have described the anticancer properties of statins, but the evidence for anticancer effectiveness of statins is inconsistent. It may be that certain molecular subtypes of cancer are more vulnerable to statin therapy than others. Whether statins have clinical anticancer effects is still an active area of research. Statins appear to enhance the efficacy and address the shortcomings associated with conventional cancer treatments, suggesting that statins should be considered in the context of combined therapies for cancer. Here, we present a comprehensive review of the potential of statins in anti-cancer treatments. We discuss the current understanding of the mechanisms underlying the anti-cancer properties of statins and their effects on different malignancies. We also provide recommendations for the design of future well-designed clinical trials of the anti-cancer efficacy of statins.
[ "Our previous studies have demonstrated that atorvastatin induces autophagy in the androgen receptor negative prostate cancer PC3 cells through inhibition of geranylgeranyl biosynthesis [Parikh et al., Prostate. 70(9): 971-981 (2010)]. This study attempts to elucidate the molecular mechanism underlying atorvastatin-induced autophagy in PC3 cells. PC3 cells were treated with atorvastatin, in combination with the inhibitors for transcription, protein translation, PI-3 kinase, mTOR, and MAP kinases. The atorvastatin-induced elevation of LC3-II was inhibited by both the translational and the transcriptional inhibitors, suggesting that the inhibition of geranylgeranyl biosynthesis by atorvastatin activates transcription of LC3, which results in elevation of LC3-II and activation of autophagy. RT-PCR and quantitative PCR assays showed that atorvastatin enhanced expression of LC3 mRNA, and addition of geranylgeraniol along with atorvastatin to the medium eliminated the enhancement, confirming the activation of transcription of LC3 is caused by atorvastatin-mediated inhibition of geranylgeranyl biosynthesis. Further, we found that both the MEK1/2 inhibitor U0126 and the JNK inhibitor SP600125, inhibited the atorvastatin-induced elevation of LC3-II, suggesting that the effect of atorvastatin on autophagy is mediated by the Erk and JNK pathways. Taken together, atorvastatin induces autophagy in prostate cancer PC3 cells through activation of LC3 transcription.", "Most women with ovarian cancer have a poor prognosis, but studies have reported an association between statin use and improved survival. We investigated the potential survival benefit of statins in women with ovarian cancer using data from the Ovarian cancer Prognosis and Lifestyle study, a prospective study of Australian women aged 18 to 79 years, diagnosed with ovarian cancer from 2012 to 2015 and followed for 5 to 8 years. We obtained information from patient-completed questionnaires and medical records. We defined exposure based on prediagnosis use, as most women used statins continuously (prediagnosis and postdiagnosis) and few started using statins postdiagnosis. We measured survival from date of first treatment (surgery or neoadjuvant chemotherapy) until date of death or last follow-up. We used Cox regression to calculate hazard ratios (HR) and 95% confidence intervals (CI), adjusting for potential confounders. To reduce bias due to confounding by indication, we also applied inverse probability of treatment weighting (IPTW). Of 955 eligible women, 21% reported statin use before diagnosis. Statin users had a slightly better survival (HR = 0.90, 95% CI = 0.70-1.15) that was driven by lipophilic statin use (HR = 0.82, 95% CI = 0.61-1.11), with no association for hydrophilic statins (HR = 1.04, 95% CI = 0.72-1.49). The IPTW model weighted to all women with ovarian cancer also suggested a possible reduction in mortality associated with lipophilic statins (HR = 0.80, 95% CI = 0.54-1.21). In analyses restricted to women with hyperlipidaemia, the HRs were further from the null. Our findings are consistent with previous evidence, suggesting that lipophilic statins might improve ovarian cancer survival. Further investigation, in larger cohorts, or preferably in a randomised trial, is required.", "There is increasing evidence that statins, which are widely used in lowering serum cholesterol and the incidence of cardiovascular diseases, also exhibits anti-tumour properties. The underlying mechanisms by which statins-induced cancer cell death, however, remain incompletely understood. In this study, we explored the anti-tumour mechanisms of a lipophilic statin, lovastatin, in MCF-7 breast cancer cells. Lovastatin inhibited cell proliferation and induced cell apoptosis. Lovastatin caused p21 elevation while reduced cyclin D1 and survivin levels. Lovastatin also increased p53 phosphorylation, acetylation and its reporter activities. Results from chromatin immunoprecipitation analysis showed that p53 binding to the survivin promoter region was increased, while Sp1 binding to the region was decreased, in MCF-7 cells after lovastatin exposure. These actions were associated with liver kinase B1 (LKB1), AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (p38MAPK) activation. Lovastatin's enhancing effects on p53 activation, p21 elevation and survivin reduction were significantly reduced in the presence of p38MAPK signalling inhibitor. Furthermore, LKB1-AMPK signalling blockade abrogated lovastatin-induced p38MAPK and p53 phosphorylation. Together these results suggest that lovastatin may activate LKB1-AMPK-p38MAPK-p53-survivin cascade to cause MCF-7 cell death. The present study establishes, at least in part, the signalling cascade by which lovastatin induces breast cancer cell death.", "In preclinical models, statins showed vaccine adjuvant activities and synergized with PD-1 inhibitors. We analyzed the impact of statin treatment on clinical outcome in thoracic cancer patients treated with PD-1 inhibitors. A total of 82 malignant pleural mesothelioma (MPM) and 179 advanced non-small cell lung cancer (aNSCLC) patients treated with PD-1 inhibitors as second or further line treatment were examined. Seventy-seven MPM patients treated with standard chemotherapy were analyzed as control cohort. Objective response rate (ORR), progression-free survival (PFS), and overall survival (OS) were calculated. Among 253 patients with available data, statin use was associated with increased ORR (32% versus 18%, P = .02), PFS (median 6.7 versus 2.9 months, hazard ratio [HR] 0.57, 95% CI 0.39-0.83, P < .01), and OS (median 13.1 versus 8.7 months, HR 0.67, 95% CI 0.45-1.00, P = .05). In the control MPM cohort treated with chemotherapy (n = 77), no association was found. MPM patients who used statins showed improved ORR (22% versus 6%, P = .05), PFS (median 6.7 versus 2.4 months, P < .01), and OS (median not reached versus 6.0 months, P = .01). In aNSCLC patients, statin use was associated with improved ORR (40% versus 22%, P = .04) and PFS (median 7.8 versus 3.6 months, P = .03), but no significant difference in OS was found (median 13.1 versus 10.1 months, P = .30). Multivariable analysis confirmed the correlation between statin use and better PFS and OS in MPM and better PFS in aNSCLC. In the whole cohort, high but not low/moderate-intensity statins were associated with better OS compared to no user (P = .02 and P = .59, respectively). Our study showed that statins are associated with better clinical outcome in MPM and aNSCLC patients treated with PD-1 inhibitors in an intensity-dependent manner.", "A reduction in the availability of cholesterol may limit the cellular proliferation required for cancer growth and metastasis. We tested the hypothesis that statin use begun before a cancer diagnosis is associated with reduced cancer-related mortality. We assessed mortality among patients from the entire Danish population who had received a diagnosis of cancer between 1995 and 2007, with follow-up until December 31, 2009. Among patients 40 years of age or older, 18,721 had used statins regularly before the cancer diagnosis and 277,204 had never used statins. Multivariable-adjusted hazard ratios for statin users, as compared with patients who had never used statins, were 0.85 (95% confidence interval [CI], 0.83 to 0.87) for death from any cause and 0.85 (95% CI, 0.82 to 0.87) for death from cancer. Adjusted hazard ratios for death from any cause according to the defined daily statin dose (the assumed average maintenance dose per day) were 0.82 (95% CI, 0.81 to 0.85) for a dose of 0.01 to 0.75 defined daily dose per day, 0.87 (95% CI, 0.83 to 0.89) for 0.76 to 1.50 defined daily dose per day, and 0.87 (95% CI, 0.81 to 0.91) for higher than 1.50 defined daily dose per day; the corresponding hazard ratios for death from cancer were 0.83 (95% CI, 0.81 to 0.86), 0.87 (95% CI, 0.83 to 0.91), and 0.87 (95% CI, 0.81 to 0.92). The reduced cancer-related mortality among statin users as compared with those who had never used statins was observed for each of 13 cancer types. Statin use in patients with cancer is associated with reduced cancer-related mortality. This suggests a need for trials of statins in patients with cancer.", "Statin use has been suggested to improve prognosis in cancer patients, however, for ovarian cancer, the evidence is sparse. From the Danish Cancer Registry, we identified patients aged 30-84 years with a histologically verified first diagnosis of epithelial ovarian cancer between 2000 and 2013. Data on filled prescriptions, death, and potential confounding factors were obtained from nationwide registers. Cox proportional hazard regression models were used to calculate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association between post-diagnostic statin use and all-cause or ovarian cancer-specific mortality. Among 4,419 patients with epithelial ovarian cancer, post-diagnostic statin use was not statistically significantly associated with all-cause (HR: 0.90, 95% CI: 0.78-1.04) or ovarian cancer-specific mortality (HR: 0.90, 95% CI: 0.76-1.08). There was little evidence of a dose-response relationship and the neutral associations persisted in sensitivity analyses. In women with endometrioid or clear cell tumour histology, cancer-specific mortality was reduced by 30-40% among statin users compared to non-users, however the analyses were limited by small numbers. Significantly reduced mortality with statin use was observed in subcohorts of new users of statins and of patients not using low-dose aspirin. In conclusion, we found no strong evidence of an association between post-diagnostic statin use and reduced mortality in ovarian cancer patients. However, our finding of potential differential susceptibility to statins among patients with different histologic types of ovarian cancer warrants further evaluation.", "Statins are among the most frequently prescribed drugs because of their efficacy and low toxicity in treating hypercholesterolemia. Recently, statins have been reported to inhibit the proliferative activity of cancer cells, especially those with TP53 mutations. Because TP53 mutations occur in almost all ovarian high-grade serous carcinoma (HGSC), we determined whether statins suppressed tumor growth in animal models of ovarian cancer. Two ovarian cancer mouse models were used. The first one was a genetically engineered model, mogp-TAg, in which the promoter of oviduct glycoprotein-1 was used to drive the expression of SV40 T-antigen in gynecologic tissues. These mice spontaneously developed serous tubal intraepithelial carcinomas (STICs), which are known as ovarian cancer precursor lesions. The second model was a xenograft tumor model in which human ovarian cancer cells were inoculated into immunocompromised mice. Mice in both models were treated with lovastatin, and effects on tumor growth were monitored. The molecular mechanisms underlying the antitumor effects of lovastatin were also investigated. Lovastatin significantly reduced the development of STICs in mogp-TAg mice and inhibited ovarian tumor growth in the mouse xenograft model. Knockdown of prenylation enzymes in the mevalonate pathway recapitulated the lovastatin-induced antiproliferative phenotype. Transcriptome analysis indicated that lovastatin affected the expression of genes associated with DNA replication, Rho/PLC signaling, glycolysis, and cholesterol biosynthesis pathways, suggesting that statins have pleiotropic effects on tumor cells. The above results suggest that repurposing statin drugs for ovarian cancer may provide a promising strategy to prevent and manage this devastating disease.", "Statins have been shown to be a beneficial treatment as chemotherapy and target therapy for lung cancer. This study aimed to investigate the effectiveness of statins in combination with epidermal growth factor receptor-tyrosine kinase inhibitor therapy for the resistance and mortality of lung cancer patients. A population-based cohort study was conducted using the Taiwan Cancer Registry database. From January 1, 2007, to December 31, 2012, in total 792 non-statins and 41 statins users who had undergone EGFR-TKIs treatment were included in this study. All patients were monitored until the event of death or when changed to another therapy. Kaplan-Meier estimators and Cox proportional hazards regression models were used to calculate overall survival. We found that the mortality was significantly lower in patients in the statins group compared with patients in the non-statins group (4-y cumulative mortality, 77.3%; 95% confidence interval (CI), 36.6%-81.4% vs. 85.5%; 95% CI, 78.5%-98%; P = .004). Statin use was associated with a reduced risk of death in patients the group who had tumor sizes <3 cm (hazard ratio [HR], 0.51, 95% CI, 0.29-0.89) and for patients in the group who had CCI scores <3 (HR, 0.6; 95% CI, 0.41-0.88; P = .009). In our study, statins were found to be associated with prolonged survival time in patients with lung cancer who were treated with EGFR-TKIs and played a synergistic anticancer role.", "The mevalonate pathway for cholesterol biosynthesis and protein prenylation has been implicated in various aspects of tumor development and progression. Certain classes of drugs, such as statins and bisphosphonates, inhibit mevalonate metabolism and therefore have also been tested as antitumor agents. This concept is strongly supported by the recent finding that mutant p53, which is present in more than half of all human cancers, can significantly upregulate mevalonate metabolism and protein prenylation in carcinoma cells. The first evidence that mevalonate pathway inhibitors may have the potential to reverse the malignant phenotype has already been obtained. Moreover, recently discovered immunomodulatory properties of statins and bisphosphonates may also contribute to their known anticancer effects. Drug-induced inhibition of protein prenylation may induce sequential cellular stress responses, including the unfolded protein response and autophagy, that eventually translate into inflammasome-dependent and caspase-1-mediated activation of innate immunity. This review focuses on these novel capabilities of mevalonate pathway inhibitors to beneficially affect tumor biology and contribute to tumor immune surveillance.", "Background and Aims: Statins are the first-line medication to treating hypercholesterolemia. Several studies have investigated the impact of statins on the risk of hepatocellular carcinoma (HCC). However, the extent to which statins may prevent HCC remains uncertain. Therefore, we performed a meta-analysis of relevant studies to quantify the magnitude of the association between statins use and the risk of HCC. Methods: A systematic literature search of PubMed, EMBASE, Google Scholar, Web of Science, and Scopus was performed for studies published between January 1, 1990, and September 1, 2019, with no restriction of language. Two reviewers independently evaluated the literature and included observational and experimental studies that reported the association between statin use and HCC risk. The random-effect model was used to calculate the overall risk ratio (RR) with a 95% confidence interval (CI), and the heterogeneity among the studies was assessed using the Q statistic and I2 statistic. The Newcastle Ottawa Scale (NOS) was also used to evaluate the quality of the included studies. Results: A total of 24 studies with 59,073 HCC patients was identified. Statin use was associated with a reduced risk of HCC development (RR: 0.54, 95% CI: 0.47-0.61, I2 = 84.39%) compared with nonusers. Moreover, the rate of HCC reduction was also significant among patients with diabetes (RR: 0.44, 95% CI: 0.28-0.70), liver cirrhosis (RR: 0.36, 95% CI: 0.30-0.42), and antiviral therapy (RR: 0.21, 95% CI: 0.08-0.59) compared with nonusers. Conclusion: This study serves as additional evidence supporting the beneficial inhibitory effect of statins on HCC incidence. The subgroup analyses of this study also highlight that statins are significantly associated with a reduced risk of HCC and may help to direct future prevention efforts. Additional large clinical studies are needed to determine whether statins are associated with a lower risk of HCC." ]
ABO Blood Phenotype and COVID-19 Severity in a Hispanic Population
This study investigates the association between ABO blood phenotype and COVID-19 severity, measured by intensive care unit admission, need for intubation, hospitalization length and death. It further explores clinical predictors of COVID-19 severity within a primarily Hispanic demographic in San Diego County.
[ "ABO rs495828 polymorphism has recently been associated with risk of hypertension and cough induced by angiotensin-converting enzyme (ACE) inhibitors, which could be due to low ACE plasma activity. To study whether ABO rs495828 is associated with ACE activity. The association between ABO genotype and phenotype, and differences in ACE activity between the ABO phenotype groups were also studied. We genotyped 168 subjects for rs495828. ACE plasma activity and ABO histo-blood group were measured in all minor allele homozygous subjects (TT) that agreed to participate in the study (n=8) and in age- and gender-matched heterozygous subjects (GT; n=8) and major allele homozygous subjects (GG; n=8). A non-significant trend was found in ACE activity among rs495828 genotype groups; however the polymorphism was significantly associated with ABO phenotype (p=0.007), which in turn was associated with ACE activity (p=0.029). These results provide new evidence for the ABO-ACE relationship. Although the genetic marker studied here may be involved somehow, ABO phenotype is shown to be a better predictor of ACE plasma activity.", "Obesity has reached epidemic proportions in the United States and in much of the westernized world, contributing to considerable morbidity. Several of these obesity-related morbidities are associated with greater risk for death with coronavirus disease 2019 (COVID-19). Severe acute respiratory syndrome coronavirus 2 penetrates human cells through direct binding with angiotensin-converting enzyme 2 receptors on the cell surface. Angiotensin-converting enzyme 2 expression in adipose tissue is higher than that in lung tissue, which means that adipose tissue may be vulnerable to COVID-19 infection. Obese patients also have worse outcomes with COVID-19 infection, including respiratory failure, need for mechanical ventilation, and higher mortality. Clinicians need to be more aggressive when treating obese, especially severely obese, patients with COVID-19 infection.", "The severity and outcome of coronavirus disease 2019 (COVID-19) largely depends on a patient's age. Adults over 65 years of age represent 80% of hospitalizations and have a 23-fold greater risk of death than those under 65. In the clinic, COVID-19 patients most commonly present with fever, cough and dyspnea, and from there the disease can progress to acute respiratory distress syndrome, lung consolidation, cytokine release syndrome, endotheliitis, coagulopathy, multiple organ failure and death. Comorbidities such as cardiovascular disease, diabetes and obesity increase the chances of fatal disease, but they alone do not explain why age is an independent risk factor. Here, we present the molecular differences between young, middle-aged and older people that may explain why COVID-19 is a mild illness in some but life-threatening in others. We also discuss several biological age clocks that could be used in conjunction with genetic tests to identify both the mechanisms of the disease and individuals most at risk. Finally, based on these mechanisms, we discuss treatments that could increase the survival of older people, not simply by inhibiting the virus, but by restoring patients' ability to clear the infection and effectively regulate immune responses.", "The outbreak of a novel coronavirus (2019-nCoV) represents a pandemic threat that has been declared a public health emergency of international concern. The CoV spike (S) glycoprotein is a key target for vaccines, therapeutic antibodies, and diagnostics. To facilitate medical countermeasure development, we determined a 3.5-angstrom-resolution cryo-electron microscopy structure of the 2019-nCoV S trimer in the prefusion conformation. The predominant state of the trimer has one of the three receptor-binding domains (RBDs) rotated up in a receptor-accessible conformation. We also provide biophysical and structural evidence that the 2019-nCoV S protein binds angiotensin-converting enzyme 2 (ACE2) with higher affinity than does severe acute respiratory syndrome (SARS)-CoV S. Additionally, we tested several published SARS-CoV RBD-specific monoclonal antibodies and found that they do not have appreciable binding to 2019-nCoV S, suggesting that antibody cross-reactivity may be limited between the two RBDs. The structure of 2019-nCoV S should enable the rapid development and evaluation of medical countermeasures to address the ongoing public health crisis." ]
Remainder cholesterol-related risk beyond low-density lipoprotein cholesterol and apoB in patients without known atherosclerotic cardiovascular disease
Emerging evidence suggests that remnant cholesterol (RC) promotes atherosclerotic cardiovascular disease (ASCVD). We aimed to estimate RC-related risk beyond low-density lipoprotein cholesterol (LDL-C) and apolipoprotein B (apoB) in patients without known ASCVD.
[ "Low-density lipoprotein cholesterol (LDL-C) is the traditional measure of risk attributable to LDL. Non-high-density lipoprotein cholesterol (NHDL-C), apolipoprotein B (apoB), and LDL particle number (LDL-P) are alternative measures of LDL-related risk. However, the clinical utility of these measures may only become apparent among individuals for whom levels are inconsistent (discordant) with LDL-C. LDL-C was measured directly, NHDL-C was calculated, apoB was measured with immunoassay, and LDL-P was measured with nuclear magnetic resonance spectroscopy among 27 533 healthy women (median follow-up 17.2 years; 1070 incident coronary events). Participants were grouped by median LDL-C (121 mg/dL) and each of NHDL-C, apoB, and LDL-P. Discordance was defined as LDL-C greater than or equal to the median and the alternative measure less than the median, or vice versa. Despite high LDL-C correlations with NHDL-C, apoB, and LDL-P (r=0.910, 0.785, and 0.692; all P<0.0001), prevalence of LDL-C discordance as defined by median cut points was 11.6%, 18.9%, and 24.3% for NHDL-C, apoB, and LDL-P, respectively. Among women with LDL-C less than the median, coronary risk was underestimated for women with discordant (greater than or equal to the median) NHDL-C (age-adjusted hazard ratio, 2.92; 95% confidence interval, 2.33-3.67), apoB (2.48, 2.01-3.07), or LDL-P (2.32, 1.88-2.85) compared with women with concordant levels. Conversely, among women with LDL-C greater than or equal to the median, risk was overestimated for women with discordant (less than the median) NHDL-C (0.40, 0.29-0.57), apoB (0.34, 0.26-0.46), or LDL-P (0.42, 0.33-0.53). After multivariable adjustment for potentially mediating factors, including HDL cholesterol and triglycerides, coronary risk remained underestimated or overestimated by ≈20% to 50% for women with discordant levels. For women with discordant LDL-related measures, coronary risk may be underestimated or overestimated when LDL-C alone is used. http://www.clinicaltrials.gov. Unique identifier: NCT00000479.", "High plasma levels of nonfasting triglycerides are associated with an increased risk of ischemic cardiovascular disease. Whether lifelong low levels of nonfasting triglycerides owing to mutations in the gene encoding apolipoprotein C3 (APOC3) are associated with a reduced risk of ischemic cardiovascular disease in the general population is unknown. Using data from 75,725 participants in two general-population studies, we first tested whether low levels of nonfasting triglycerides were associated with reduced risks of ischemic vascular disease and ischemic heart disease. Second, we tested whether loss-of-function mutations in APOC3, which were associated with reduced levels of nonfasting triglycerides, were also associated with reduced risks of ischemic vascular disease and ischemic heart disease. During follow-up, ischemic vascular disease developed in 10,797 participants, and ischemic heart disease developed in 7557 of these 10,797 participants. Participants with nonfasting triglyceride levels of less than 1.00 mmol per liter (90 mg per deciliter) had a significantly lower incidence of cardiovascular disease than those with levels of 4.00 mmol per liter (350 mg per deciliter) or more (hazard ratio for ischemic vascular disease, 0.43; 95% confidence interval [CI], 0.35 to 0.54; hazard ratio for ischemic heart disease, 0.40; 95% CI, 0.31 to 0.52). Heterozygosity for loss-of-function mutations in APOC3, as compared with no APOC3 mutations, was associated with a mean reduction in nonfasting triglyceride levels of 44% (P<0.001). The cumulative incidences of ischemic vascular disease and ischemic heart disease were reduced in heterozygotes as compared with noncarriers of APOC3 mutations (P=0.009 and P=0.05, respectively), with corresponding risk reductions of 41% (hazard ratio, 0.59; 95% CI, 0.41 to 0.86; P=0.007) and 36% (hazard ratio, 0.64; 95% CI, 0.41 to 0.99; P=0.04). Loss-of-function mutations in APOC3 were associated with low levels of triglycerides and a reduced risk of ischemic cardiovascular disease. (Funded by the European Union and others.).", "Both C-reactive protein and low-density lipoprotein (LDL) cholesterol levels are elevated in persons at risk for cardiovascular events. However, population-based data directly comparing these two biologic markers are not available. C-reactive protein and LDL cholesterol were measured at base line in 27,939 apparently healthy American women, who were then followed for a mean of eight years for the occurrence of myocardial infarction, ischemic stroke, coronary revascularization, or death from cardiovascular causes. We assessed the value of these two measurements in predicting the risk of cardiovascular events in the study population. Although C-reactive protein and LDL cholesterol were minimally correlated (r=0.08), base-line levels of each had a strong linear relation with the incidence of cardiovascular events. After adjustment for age, smoking status, the presence or absence of diabetes mellitus, categorical levels of blood pressure, and use or nonuse of hormone-replacement therapy, the relative risks of first cardiovascular events according to increasing quintiles of C-reactive protein, as compared with the women in the lowest quintile, were 1.4, 1.6, 2.0, and 2.3 (P<0.001), whereas the corresponding relative risks in increasing quintiles of LDL cholesterol, as compared with the lowest, were 0.9, 1.1, 1.3, and 1.5 (P<0.001). Similar effects were observed in separate analyses of each component of the composite end point and among users and nonusers of hormone-replacement therapy. Overall, 77 percent of all events occurred among women with LDL cholesterol levels below 160 mg per deciliter (4.14 mmol per liter), and 46 percent occurred among those with LDL cholesterol levels below 130 mg per deciliter (3.36 mmol per liter). By contrast, because C-reactive protein and LDL cholesterol measurements tended to identify different high-risk groups, screening for both biologic markers provided better prognostic information than screening for either alone. Independent effects were also observed for C-reactive protein in analyses adjusted for all components of the Framingham risk score. These data suggest that the C-reactive protein level is a stronger predictor of cardiovascular events than the LDL cholesterol level and that it adds prognostic information to that conveyed by the Framingham risk score.", "Despite strong and consistent prospective associations of elevated low-density lipoprotein (LDL) cholesterol concentration with incident coronary and cerebrovascular disease, data for incident peripheral artery disease (PAD) are less robust. Atherogenic dyslipidemia characterized by increased small LDL particle (LDL-P) concentration, rather than total LDL cholesterol content, along with elevated triglyceride-rich lipoproteins and low high-density lipoprotein (HDL) cholesterol (HDL-C), may be the primary lipid driver of PAD risk. The study population was a prospective cohort study of 27 888 women ≥45 years old free of cardiovascular disease at baseline and followed for a median of 15.1 years. We tested whether standard lipid concentrations, as well as nuclear magnetic resonance spectroscopy-derived lipoprotein measures, were associated with incident symptomatic PAD (n=110) defined as claudication and/or revascularization. In age-adjusted analyses, while LDL cholesterol was not associated with incident PAD, we found significant associations for increased total and small LDL-P concentrations, triglycerides, and concentrations of very LDL (VLDL) particle (VLDL-P) subclasses, increased total cholesterol (TC):HDL-C, low HDL-C, and low HDL particle (HDL-P) concentration (all P for extreme tertile comparisons <0.05). Findings persisted in multivariable-adjusted models comparing extreme tertiles for elevated total LDL-P (adjusted hazard ratio [HRadj] 2.03; 95% CI, 1.14-3.59), small LDL-P (HRadj 2.17; 95% CI, 1.10-4.27), very large VLDL-P (HRadj 1.68; 95% CI, 1.06-2.66), medium VLDL-P (HRadj 1.98; 95% CI, 1.15-3.41), and TC:HDL-C (HRadj, 3.11; 95% CI, 1.67-5.81). HDL was inversely associated with risk; HRadj for extreme tertiles of HDL-C and HDL-P concentration were 0.30 ( P trend < 0.0001) and 0.29 ( P trend < 0.0001), respectively. These components of atherogenic dyslipidemia, including small LDL-P, medium and very large VLDL-P, TC:HDL-C, HDL-C, and HDL-P, were more strongly associated with incident PAD than incident coronary and cerebrovascular disease. Finally, the addition of LDL-P and HDL-P concentration to TC:HDL-C measures identified women at heightened PAD risk. In this prospective study, nuclear magnetic resonance-derived measures of LDL-P, but not LDL cholesterol, were associated with incident PAD. Other features of atherogenic dyslipidemia, including elevations in TC:HDL-C, elevations in triglyceride-rich lipoproteins, and low standard and nuclear magnetic resonance-derived measures of HDL, were significant risk determinants. These data help clarify prior inconsistencies and may elucidate a unique lipoprotein signature for PAD compared to coronary and cerebrovascular disease. URL: https://www.clinicaltrials.gov/ . Unique Identifier: NCT00000479.", "How mild-to-moderate hypertriglyceridemia (2-10 mmol/L; 177-886 mg/dL) potentially causes acute pancreatitis is unknown; however, cellular studies indicate that inflammation might be a driver of disease progression. We tested the hypotheses that (a) mild-to-moderate hypertriglyceridemia is associated with low-grade inflammation and that (b) the association between mild-to-moderate hypertriglyceridemia and risk of acute pancreatitis depends on low-grade inflammation. From the Copenhagen General Population Study and the Copenhagen City Heart Study, 117865 men and women 20-100+ years of age with measurements of nonfasting plasma triglycerides at baseline were followed prospectively for development of acute pancreatitis. After multivariable adjustment, a 1 mmol/L (89 mg/dL) higher nonfasting triglyceride concentration was associated with 17% (95% CI, 16%-18%, P = 3 × 10-17) higher plasma C-reactive protein (CRP) and a 4.2% (4.0%-4.4%, P = 6 × 10-17) higher blood leukocyte count. Higher concentrations of nonfasting triglycerides were associated almost linearly with higher risk of acute pancreatitis (P for trend = 5 × 10-6), with hazard ratios of 1.5 (95% CI, 0.9-2.5), 2.0 (95% CI, 1.1-3.6), 2.2 (95% CI, 1.0-4.7), 4.2 (95% CI, 1.6-11.5), and 7.7 (95% CI, 3.0-19.8) in individuals with nonfasting triglycerides of 1.00-1.99 mmol/L (89-176 mg/dL; 46% of the population), 2.00-2.99 mmol/L (177-265 mg/dL; 17%), 3.00-3.99 mmol/L (266-353 mg/dL; 6%), 4.00-4.99 mmol/L (354-442 mg/dL; 2%), and ≥5mmol/L(443 mg/dL; 2%), respectively, vs individuals with <1 mmol/L (89 mg/dL; 27%). The association with risk of acute pancreatitis appeared more pronounced in individuals with CRP of ≥1.39 mg/L (P for trend = 0.001) and leukocytes of ≥7 × 109/L (P = 2 × 10-4) than in those with CRP <1.39 mg/L (P = 0.03) and leukocytes <7 × 109/L (P = 0.04); however, there was no formal evidence of statistical interaction (P = 0.38 for CRP and P = 0.41 for leukocytes). Mild-to-moderate hypertriglyceridemia is associated with low-grade inflammation and higher risk of acute pancreatitis. The association between mild-to-moderate hypertriglyceridemia and risk of acute pancreatitis is possibly partly mediated by low-grade inflammation.", "The Multi-Ethnic Study of Atherosclerosis was initiated in July 2000 to investigate the prevalence, correlates, and progression of subclinical cardiovascular disease (CVD) in a population-based sample of 6,500 men and women aged 45-84 years. The cohort will be selected from six US field centers. Approximately 38% of the cohort will be White, 28% African-American, 23% Hispanic, and 11% Asian (of Chinese descent). Baseline measurements will include measurement of coronary calcium using computed tomography; measurement of ventricular mass and function using cardiac magnetic resonance imaging; measurement of flow-mediated brachial artery endothelial vasodilation, carotid intimal-medial wall thickness, and distensibility of the carotid arteries using ultrasonography; measurement of peripheral vascular disease using ankle and brachial blood pressures; electrocardiography; and assessments of microalbuminuria, standard CVD risk factors, sociodemographic factors, life habits, and psychosocial factors. Blood samples will be assayed for putative biochemical risk factors and stored for use in nested case-control studies. DNA will be extracted and lymphocytes will be immortalized for genetic studies. Measurement of selected subclinical disease indicators and risk factors will be repeated for the study of progression over 7 years. Participants will be followed through 2008 for identification and characterization of CVD events, including acute myocardial infarction and other coronary heart disease, stroke, peripheral vascular disease, and congestive heart failure; therapeutic interventions for CVD; and mortality.", "As the approach to low-density lipoprotein cholesterol (LDL-C) lowering becomes increasingly intensive, accurate assessment of LDL-C at very low levels warrants closer attention in individualized clinical efficacy and safety evaluation. We aimed to assess the accuracy of LDL-C estimation at very low levels by the Friedewald equation, the de facto clinical standard, and compare its accuracy with a novel, big data-derived LDL-C estimate. In 191,333 individuals with Friedewald LDL-C < 70 mg/dL, we compared the accuracy of Friedewald and novel LDL-C values in relation to direct measurements by Vertical Auto Profile ultracentrifugation. We examined differences (estimate minus ultracentrifugation) and classification according to levels initiating additional safety precautions per clinical practice guidelines. Friedewald values were less than ultracentrifugation measurement, with a median difference (25th to 75th percentile) of -2.4 (-7.4 to 0.6) at 50-69 mg/dL, -7.0 (-16.2 to -1.2) at 25-39 mg/dL, and -29.0 (-37.4 to -19.6) at < 15 mg/dL. The respective values by novel estimation were -0.1 (-1.5 to 1.3), -1.1 (-2.5 to 0.3), and -2.7 (-4.9 to 0.0) mg/dL. Among those with Friedewald LDL-C < 15, 15 to < 25, and 25 to < 40 mg/dL, the classification was discordantly low in 94.9%, 82.6%, and 59.9% of individuals as compared with 48.3%, 42.4%, and 22.4% by novel estimation. Estimation of even lower LDL-C values (by Friedewald and novel methods) is even more inaccurate. More often than not, a Friedewald value < 40 mg/dL is underestimated, which translates into unnecessary safety alarms that could be reduced in half by estimation using our novel method." ]
Spontaneous hyperadrenocorticism in a beagle dog.
A 6-month-old female beagle dog, assigned to the low-dose group in a toxicity study, was evaluated for compound toxicity, and spontaneous hyperadrenocorticism was suspected. The animal had an externally apparent distended abdomen on clinical examination upon arrival. Pre-dose clinical pathology showed slightly higher erythroid parameters and stress leukogram on hematology; plasma biochemistry showed higher total protein, gamma-glutamyl transferase, total cholesterol, and triglyceride levels than the reference data. On necropsy, a prominent increase in adipose tissues of the subcutis and abdomen and increased weight of the adrenal gland and liver were observed. Histopathology revealed diffuse hyperplasia of adrenocortical cells in the zona fasciculata and reticularis, cortical atrophy of the thymus, and abundant glycogen accumulation in the hepatocytes. These findings were incidental and not test-substance-related. Electron microscopy of the adrenocortical cells in the zona fasciculata revealed decreased typical translucent lipid droplets, increased electron-dense lipid droplets, and abundant smooth endoplasmic reticulum and lysosomes. Additionally, increased numbers of various sizes and forms of mitochondria with tubular, vesicular, or lamellar cristae compared to that of normal animals were observed. These ultrastructural characteristics of the adrenocortical cells suggested hyperfunction. The pre-dose plasma cortisol levels were slightly higher than those of other females assigned to the toxicity study, while plasma adrenocorticotropic hormone levels were within the normal range. These findings indicate that hyperadrenocorticism is a possible cause of the systemic changes in this case.
[ "The use of zebrafish (Danio rerio) as an animal model for experimental studies of stress has increased rapidly over the years. Although many physiologic and behavioral characteristics associated with stress have been defined in zebrafish, the effects of stress on hematologic parameters have not been described. The purpose of our study was to induce a rise in endogenous cortisol through various acute and chronic stressors and compare the effects of these stressors on peripheral WBC populations. Acutely stressed fish underwent dorsal or full-body exposure to air for 3 min, repeated every 30 min over the course of 90 min. Chronically stressed fish underwent exposure to stressors twice daily over a period of 5 d. After the last stressful event, fish were euthanized, and whole blood and plasma were obtained. A drop of whole blood was used to create a blood smear, which was subsequently stained with a modified Wright-Giemsa stain and a 50-WBC differential count determined. Plasma cortisol levels were determined by using a commercially available ELISA. Endogenous cortisol concentrations were significantly higher in both stressed groups as compared with control fish. Acutely stressed fish demonstrated significant lymphopenia, monocytosis, and neutrophilia, compared with unstressed, control fish. Chronic stress induced lymphopenia and monocytosis but no significant changes in relative neutrophil populations in zebrafish. The changes in both stressed groups most likely are due to increases in endogenous cortisol concentrations and represent the first description of a stress leukogram in zebrafish.", "This report offers a consensus opinion on the diagnosis of spontaneous canine hyperadrenocorticism. The possibility that a patient has hyperadrenocorticism is based on the history and physical examination. Endocrine tests should be performed only when clinical signs consistent with HAC are present. None of the biochemical screening or differentiating tests for hyperadrenocorticism are perfect. Imaging can also play a role. Awareness of hyperadrenocorticism has heightened over time. Thus, case presentation is more subtle. Due to the changes in manifestations as well as test technology the Panel believes that references ranges should be reestablished. The role of cortisol precursors and sex hormones in causing a syndrome of occult hyperadrenocorticism remains unclear.", "Anxiety and depression are major chronic mood disorders, and the etiopathology for each appears to be repeated exposure to diverse unpredictable stress factors. Most of the studies on anxiety and related mood disorders are performed in rodents, and a good model is chronic unpredictable stress (CUS). In this study, we have attempted to understand the molecular basis of the neuroglial and behavioral changes underlying CUS-induced mood disorders in the simplest vertebrate model, the zebrafish, Danio rerio. Zebrafish were subjected to a CUS paradigm in which two different stressors were used daily for 15 days, and thorough behavioral analyses were performed to assess anxiety and related mood disorder phenotypes using the novel tank test, shoal cohesion and scototaxis. Fifteen days of exposure to chronic stressors appears to induce an anxiety and related mood disorder phenotype. Decreased neurogenesis, another hallmark of anxiety and related disorders in rodents, was also observed in this zebrafish model. The common molecular markers of rodent anxiety and related disorders, corticotropin-releasing factor (CRF), calcineurin (ppp3r1a) and phospho cyclic AMP response element binding protein (pCREB), were also replicated in the fish model. Finally, using 2DE FTMS/ITMSMS proteomics analyses, 18 proteins were found to be deregulated in zebrafish anxiety and related disorders. The most affected process was mitochondrial function, 4 of the 18 differentially regulated proteins were mitochondrial proteins: PHB2, SLC25A5, VDAC3 and IDH2, as reported in rodent and clinical samples. Thus, the zebrafish CUS model and proteomics can facilitate not only uncovering new molecular targets of anxiety and related mood disorders but also the routine screening of compounds for drug development.", "Naturally occurring hypercortisolism, also known as Cushing's syndrome, is a common endocrine disorder in dogs that can be caused by an adenocorticotrophic hormone (ACTH)-producing pituitary adenoma (pituitary-dependent hypercortisolism, PDH; 80-85% of cases), or by an adrenocortical tumor (ACT; 15-20% of cases). To determine the optimal treatment strategy, differentiating between these two main causes is essential. Good treatment options are surgical removal of the causal tumor, i.e. hypophysectomy for PDH and adrenalectomy for an ACT, or radiotherapy in cases with PDH. Because these options are not without risks, not widely available and not suitable for every patient, pharmacotherapy is often used. In cases with PDH, the steroidogenesis inhibitor trilostane is most often used. In cases with an ACT, either trilostane or the adrenocorticolytic drug mitotane can be used. Although mostly effective, both treatments have disadvantages. This review discusses the current treatment options for canine hypercortisolism, and considers their mechanism of action, efficacy, adverse effects, and effect on survival. In addition, developments in both adrenal-targeting and pituitary-targeting drugs that have the potential to become future treatment options are discussed, as a more selective and preferably also tumor-targeted approach could have many advantages for both PDH and ACTs.", "In higher vertebrates, mineralo- (aldosterone) and glucocorticoids (cortisol/corticosterone) exert their multiple actions via specific transcription factors, glucocorticoid (GR) and mineralocorticoid (MR) receptors. Teleostean fishes lack aldosterone and mineral regulatory processes seem under dominant control by cortisol. Despite the absence of the classical mineralocorticoid aldosterone, teleostean fishes do have an MR with cortisol and possibly 11-deoxycorticosterone (DOC) (as alternative for aldosterone) as predominant ligands. We studied corticoid receptors in common carp (Cyprinus carpio L). Through homology cloning and bioinformatic analysis, we found duplicated GR genes and a single MR gene. The GR genes likely result from a major genomic duplication event in the teleostean lineage; we propose that the gene for a second MR was lost. Transactivation studies show that the carp GRs and MR have comparable affinity for cortisol; the MR has significantly higher sensitivity to DOC, and this favours a role for DOC as MR ligand in fish physiology. mRNA of the GRs and the MR is expressed in forebrain (in pallial areas homologous to mammalian hippocampus), corticotrophin-releasing hormone (CRH) cells in the pre-optic nucleus (NPO) and pituitary pars distalis ACTH cells, three key neural/endocrine components of the stress axis. After exposure to prolonged and strong (not to mild acute) stressors, mRNA levels of both GRs and MR become down-regulated in the brain, but not in the NPO CRH cells or pituitary ACTH cells. Our data predicts a function in stress physiology for all CRs and suggest telencephalon as a first line cortisol target in stress.", "To analyse primary haemostasis in the zebrafish we have identified and characterized the zebrafish thrombocyte by morphologic, immunologic and functional approaches. Novel methods were developed for harvesting zebrafish blood with preservation of thrombocytes, and assaying whole blood adhesion/aggregation responses in microtitre plates. Light and electron microscopy of the thrombocyte illustrated morphological characteristics including the formation of aggregates, pseudopodia, and surface-connected vesicles analagous to the platelet canalicular system. Immunostaining with polyclonal antisera versus human platelet glycoproteins demonstrated the presence of glycoprotein Ib and IIb/IIIa-like complexes on the thrombocyte surface. Whole blood assays for adhesion/aggregation and ATP release showed ristocetin-induced adhesion without ATP release, and platelet agonist (collagen, arachidonic acid) induced aggregation with ATP release. Blood harvested from zebrafish treated with aspirin demonstrated inhibition of arachidonic acid induced aggregation and agonist induced ATP release, consistent with at least partial dependence on an intact cyclo oxygenase pathway. The combined morphologic immunologic and functional evidence suggest that the zebrafish thrombocyte is the haemostatic homologue of the mammalian platelet. Conservation of major haemostatic pathways involved in platelet function and coagulation suggests that the zebrafish is a relevant model for mammalian haemostasis and thrombosis.", "The consumption of probiotics has become increasingly popular as a means to try to improve health and well-being. Not only are probiotics considered beneficial to digestive health, but increasing evidence suggests direct and indirect interactions between gut microbiota (GM) and the central nervous system (CNS). Here, adult zebrafish were supplemented with Lactobacillus plantarum to determine the effects of probiotic treatment on structural and functional changes of the GM, as well as host neurological and behavioral changes. L. plantarum administration altered the β-diversity of the GM while leaving the major core architecture intact. These minor structural changes were accompanied by significant enrichment of several predicted metabolic pathways. In addition to GM modifications, L. plantarum treatment also significantly reduced anxiety-related behavior and altered GABAergic and serotonergic signaling in the brain. Lastly, L. plantarum supplementation provided protection against stress-induced dysbiosis of the GM. These results underscore the influence commensal microbes have on physiological function in the host, and demonstrate bidirectional communication between the GM and the host." ]
Correlation between Notum, osteocytes apoptosis, and cortical bone quality in glucocorticoid-induced osteoporosis
The apoptosis of mature osteocytes is the main factor causing damage to the microstructure of cortical bone in glucocorticoid-induced osteoporosis (GIOP). Our previous research found damaged areas and empty osteocytes lacunae in the tibial cortical bone of GIOP mice. However, the specific mechanism has not been clarified. Recently, a study showed that the quality of the cortical bone significantly increased by knocking out Notum, a gene encoding α/β hydrolase. However, it is not clear whether Notum affects cortical bone remodeling by participating in glucocorticoids (GCs)-induced apoptosis of osteocytes. The present study aimed to explore the correlation between Notum, osteocytes apoptosis, and cortical bone quality in GIOP. Prednisolone acetate was intragastrically administered to mice for two weeks. Histochemical staining was applied to evaluate changes in GIOP and Notum expression. Osteocytes were stimulated with prednisolone, and cell viability was assessed via CCK8. Hoechst 33342/PI staining, flow cytometry, RT-PCR, and western blot were used to detect osteocytes apoptosis, siRNA transfection efficiency, and expressions of pathway related factors. The results showed that the number of empty osteocytes lacunae increased in GIOP mice. TUNEL-stained apoptotic osteocytes and Notum immuno-positive osteocytes were also observed. Furthermore, prednisolone was found to promote Notum expression and osteocytes apoptosis in vitro. Knocking down Notum via siRNA partially restored osteocytes apoptosis and phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/glycogen synthase kinase-3β (GSK3β)/β-catenin pathway. These findings showed GCs-induced osteocytes apoptosis by promoting Notum expression and inhibiting PI3K/AKT/GSK3β/β-catenin pathway. Thus, Notum might be a potential therapeutic target for the treatment of GIOP.
[ "The last decade has provided a virtual explosion of data on the molecular biology and function of osteocytes. Far from being the \"passive placeholder in bone,\" this cell has been found to have numerous functions, such as acting as an orchestrator of bone remodeling through regulation of both osteoclast and osteoblast activity and also functioning as an endocrine cell. The osteocyte is a source of soluble factors not only to target cells on the bone surface but also to target distant organs, such as kidney, muscle, and other tissues. This cell plays a role in both phosphate metabolism and calcium availability and can remodel its perilacunar matrix. Osteocytes compose 90% to 95% of all bone cells in adult bone and are the longest lived bone cell, up to decades within their mineralized environment. As we age, these cells die, leaving behind empty lacunae that frequently micropetrose. In aged bone such as osteonecrotic bone, empty lacunae are associated with reduced remodeling. Inflammatory factors such as tumor necrosis factor and glucocorticoids used to treat inflammatory disease induce osteocyte cell death, but by different mechanisms with potentially different outcomes. Therefore, healthy, viable osteocytes are necessary for proper functionality of bone and other organs.", "Mechanical loading of the skeleton is essential for the development, growth, and maintenance of strong, weight-bearing bones. Bone strength is plastic and can be modulated in adults, as illustrated by the increased bone mass in the playing arms of athletes as compared with their nonplaying arms. Our studies have shown that mechanical loading improves bone strength by inducing bone formation in regions of high strain energy. Therefore, bone tissue has a mechanosensing apparatus that directs osteogenesis to where it is most needed to increase bone strength. The most likely sensors of mechanical loading are the osteocytes, which are visco-elastically coupled to the bone matrix so that their biological response increases with loading rate; thus, increasing loading frequency improves the responsiveness of bone to loading. The osteocyte-specific protein sclerostin, an inhibitor of the Wnt signaling pathway, appears to be one of the mediators of the mechanical loading response. Mechanical loading suppresses osteocyte sclerostin secretion, which allows Wnt signaling-dependent bone formation to occur. Intracellular calcium signaling, adenosine triphosphate signaling, and signaling through second messengers, such as prostaglandins and nitric oxide, precede sclerostin secretion. Stretch-activated ion channels and focal adhesion proteins may play a role in triggering these pathways upstream of sclerostin. In particular, focal adhesion kinase and proline-rich tyrosine kinase 2 appear to be sensors of mechanical loads in bone cells.", "Low bone mass and strength lead to fragility fractures, for example, in elderly individuals affected by osteoporosis or children with osteogenesis imperfecta. A decade ago, rare human mutations affecting bone negatively (osteoporosis-pseudoglioma syndrome) or positively (high-bone mass phenotype, sclerosteosis and Van Buchem disease) have been identified and found to all reside in components of the canonical WNT signaling machinery. Mouse genetics confirmed the importance of canonical Wnt signaling in the regulation of bone homeostasis, with activation of the pathway leading to increased, and inhibition leading to decreased, bone mass and strength. The importance of WNT signaling for bone has also been highlighted since then in the general population in numerous genome-wide association studies. The pathway is now the target for therapeutic intervention to restore bone strength in millions of patients at risk for fracture. This paper reviews our current understanding of the mechanisms by which WNT signalng regulates bone homeostasis.", "Serum phosphate levels are regulated by PTH and the fibroblast growth factor 23 (Fgf23)/Klotho endocrine system, which both affect expression of Npt2a and thus the apical reabsorption of phosphate in the proximal renal tubules. In addition to Fgf23, secreted frizzled-related protein 4 (Sfrp4) has recently been implicated as an additional phosphate regulator in vivo and in vitro. Here we demonstrate that ablation of the Sfrp4 gene in mice does not lead to altered serum or urine phosphate levels. Furthermore, Sfrp4 is unable to compensate for the absence of Fgf23 or Klotho because double knockouts have a similar biochemical profile and phenotype as animals with ablation of Fgf23 or Klotho alone. Taken together, our data suggest that Sfrp4 does not contribute to the long-term regulation of serum phosphate levels in mice." ]
The Mediating Role of Alertness and Perceived Credibility of Information in the COVID-19 Pandemic in Serbia
COVID-19 pandemic is a long-lasting process associated with dynamic changes within society and in individual psychological responses. Effective communication of measures by credible sources throughout the epidemic is one of the crucial factors for the containment of the disease, and the official communication about pandemics is straightforwardly directed toward changes in behavior via engagement in (self-)protective measures. Calls for the adherence to these measures are aimed at the general population, but people's reactions to these calls vary depending on, for example, their individual differences in cognitive and emotional responses to the situation. The focus of our study was the general narrative about the epidemic as conveyed by both state officials and media outlets in times of decreased social contacts due to the quarantine, in which relying on these sources of information is even more pivotal. Our aim was to explore the stability of the proposed mediational model during the course of the epidemic in Serbia. In the model, we tested the relationship between perceived credibility of information (PCI) and two types of protective behavior-the actual self-protective behavior (ASPB) and the hypothetical protective behavior (HPB), as well as the potential mediating role of alertness in these relationships time-wise. A cross-sectional study (
[ "We review recent findings on temporal focus-the degree to which individuals think about the past, present, and/or future. Hypothetically, focusing on each time period could be beneficial as one can learn from the past, savor the present moment, and plan for the future. Yet research demonstrates that characteristically thinking about the past is disadvantageous, thinking about the future is advantageous, and thinking about the present has mixed outcomes. This paper examines these findings to consider where individuals should focus their attention in time, highlighting established (e.g., country level differences) and emerging (e.g., temporal focus profiles) research on the topic.", "The novel corona virus infection (COVID-19) quickly became a pandemic state. Identifying characteristics of \"possible super spreaders\", suggested as a dominant cause of rapid spreading transmission, will help us to design proper prevention strategies. We conducted a nation-wide online survey to investigate the relationship of perception and anxiety levels about COVID-19 to the possible risk behaviors for spread of the virus in Japan. We recruited a total of 4,000 citizens, who responded to the questionnaire including several questions regarding the level of fear and anxiety about COVID-19, infection preventive behaviors and access to media with trust level about the virus as well as some demographic and socioeconomic data during March 27th and 28th, 2020. Thirteen-point-three percent of the participants rated \"1\" on a nine-point Likert with respect to the knowledge about COVID-19. Ten-point-one percent and 11.7% presented no anxiety of being infected and transmission to others. Ten-point-eight percent showed no worry about symptomatic aggravation. Eight-point-one percent had no serious concern about expanding infection. The distribution of these items was highly correlated with each other. Participants with the low level of knowledge about COVID-19 were likely to less frequently access any information sources and neither trust them. They were less anxious about their health status, and less likely to put precautionary behaviors such as washing hands and avoiding crowded spaces, suggested by statistical analyses. The present study suggests that it is greatly important to enlighten those have no concerns about this crisis of COVID-19 and modify their risk behavior via various ways, in order to prevent and control this viral pandemic. This study was funded by the management grand provided to Chiba University Graduate School of Medicine and the Japan Society for the Promotion of Science KAKENHI grants.", "This paper goes beyond detecting specific themes within Zika-related chatter on Twitter, to identify the key actors who influence the diffusive process through which some themes become more amplified than others. We collected all Zika-related tweets during the 3 months immediately after the first U.S. case of Zika. After the tweets were categorized into 12 themes, a cross-section were grouped into weekly datasets, to capture 12 amplifier/user groups, and analyzed by 4 amplification modes: mentions, retweets, talkers, and Twitter-wide amplifiers. We analyzed 3,057,130 tweets in the United States and categorized 4997 users. The most talked about theme was Zika transmission (~58%). News media, public health institutions, and grassroots users were the most visible and frequent sources and disseminators of Zika-related Twitter content. Grassroots users were the primary sources and disseminators of conspiracy theories. Social media analytics enable public health institutions to quickly learn what information is being disseminated, and by whom, regarding infectious diseases. Such information can help public health institutions identify and engage with news media and other active information providers. It also provides insights into media and public concerns, accuracy of information on Twitter, and information gaps. The study identifies implications for pandemic preparedness and response in the digital era and presents the agenda for future research and practice.", "The current outbreak of COVID-19 coronavirus infection among humans in Wuhan (China) and its spreading around the globe is heavily impacting on the global health and mental health. Despite all resources employed to counteract the spreading of the virus, additional global strategies are needed to handle the related mental health issues. Published articles concerning mental health related to the COVID-19 outbreak and other previous global infections have been considered and reviewed. This outbreak is leading to additional health problems such as stress, anxiety, depressive symptoms, insomnia, denial, anger and fear globally. Collective concerns influence daily behaviors, economy, prevention strategies and decision-making from policy makers, health organizations and medical centers, which can weaken strategies of COVID-19 control and lead to more morbidity and mental health needs at global level.", "Severe acute respiratory syndrome (SARS)-related risk perceptions, knowledge, precautionary actions, and information sources were studied in the Netherlands during the 2003 SARS outbreak. Although respondents were highly aware of the SARS outbreak, the outbreak did not result in unnecessary precautionary actions or fears." ]
Fragile X-related protein 1 promotes GDF-15 mRNA decay in human trophoblasts
Fragile X-related protein 1 (FXR1) is an RNA-binding protein that can regulate specific mRNA decay in cells. Our previous study showed that FXR1 expression was significantly decreased in trophoblasts from patients with unexplained recurrent spontaneous abortion (RSA); however, the role of FXR1 in trophoblast function during early placenta development has not been fully elucidated. In this study, we found that knockdown of FXR1 using siRNA effectively inhibited the migration of HTR-8 cells and extravillous trophoblast (EVT) outgrowth in an ex vivo extravillous explant culture model. Furthermore, through analysis of a panel of cytokines, we found that the GDF-15 protein was upregulated after knockdown of FXR1 in HTR-8/SVneo cells. This was further confirmed by western blotting and immunofluorescence in HTR-8/SVneo cells and an extravillous explant. Our data also showed that FXR1 expression was downregulated and GDF-15 was upregulated in chorionic villous tissues from RSA patients compared with those from healthy controls (HCs). Further, immunohistochemistry showed a strong expression of GDF-15 in chorionic villous tissue in the RSA group, which was mainly distributed in villous trophoblasts (CTBs) and syncytiotrophoblasts (STBs). Moreover, knockdown of GDF-15 enhanced the migration of HTR-8 cells, while overexpression of GDF-15 using plasmid or treatment with recombinant human GDF-15 protein inhibited trophoblast migration. Importantly, RNA-binding protein immunoprecipitation showed that FXR1 directly bound to the 3'-UTR of GDF-15 mRNA to promote GDF-15 mRNA decay. Together, our data provide new insight into the function of FXR1 in human placenta via regulation of GDF-15 expression in trophoblasts and suggest a possible pathological process involved in RSA.
[ "FXR1 is one of the two known homologues of FMR1. FXR1 shares a high degree of sequence homology with FMR1 and also encodes two KH domains and an RGG domain, conferring RNA-binding capabilities. In comparison with FMRP, very little is known about the function of FXR1P in vivo. Mouse knockout (KO) models exist for both Fmr1 and Fxr2. To study the function of Fxr1 in vivo, we generated an Fxr1 KO mouse model. Homozygous Fxr1 KO neonates die shortly after birth most likely due to cardiac or respiratory failure. Histochemical analyses carried out on both skeletal and cardiac muscles show a disruption of cellular architecture and structure in E19 Fxr1 neonates compared with wild-type (WT) littermates. In WT E19 skeletal and cardiac muscles, Fxr1p is localized to the costameric regions within the muscles. In E19 Fxr1 KO littermates, in addition to the absence of Fxr1p, costameric proteins vinculin, dystrophin and alpha-actinin were found to be delocalized. A second mouse model (Fxr1 + neo), which expresses strongly reduced levels of Fxr1p relative to WT littermates, does not display the neonatal lethal phenotype seen in the Fxr1 KOs but does display a strongly reduced limb musculature and has a reduced life span of approximately 18 weeks. The results presented here point towards a role for Fxr1p in muscle mRNA transport/translation control similar to that seen for Fmrp in neuronal cells.", "Macrophage inhibitory cytokine-1 (MIC-1) is a recently described divergent member of the transforming growth factor-ss superfamily. MIC-1 transcription up-regulation is associated with macrophage activation, and this observation led to its cloning. Northern blots indicate that MIC-1 is also present in human placenta. A sensitive sandwich enzyme-linked immunosorbent assay for the quantification of MIC-1 was developed and used to examine the role of this cytokine in pregnancy. High levels of MIC-1 are present in the sera of pregnant women. The level rises substantially with progress of gestation. MIC-1 can also be detected, in large amounts, in amniotic fluid and placental extracts. In addition, the BeWo placental trophoblastic cell line was found to constitutively express the MIC-1 transcript and secrete large amounts of MIC-1. These findings suggest that the placental trophoblast is a major source of the MIC-1 present in maternal serum and amniotic fluid. We suggest that MIC-1 may promote fetal survival by suppressing the production of maternally derived proinflammatory cytokines within the uterus.", "Members of the transforming growth factor-beta (TGF-beta) superfamily of growth and differentiation factors have been identified in a wide variety of organisms, ranging from invertebrates to mammals. Bone morphogenetic proteins (BMPs) constitute a subgroup of proteins belonging to the TGF-beta superfamily. BMPs were initially identified by their ability to induce endochondral bone formation at ectopic sites, suggesting a critical role for this family in development and regeneration of the skeleton. They are also expressed at a variety of nonskeletal sites during development, suggesting possible extraskeletal roles for these proteins. We cloned a novel member of the BMP family that is expressed at high levels in the placenta and the prostate and that we have designated as prostate-derived factor (PDF). Based on cDNA sequence analysis, the predicted PDF protein contains two cysteines in addition to the seven conserved cysteines that are the hallmark of the members of the TGF-beta superfamily. In addition, Northern blot hybridization to poly(A)+ RNA showed low levels of expression in the kidney and pancreas. We further characterized the expression of this member of the BMP family by in situ hybridization and immunohistochemistry. These results show high expression in the terminal villae of the placenta. The expression of the protein as visualized by immunohistochemistry shows an expression pattern identical to that of the message in the terminal villae of the placenta. In day 18 rat embryos, protein expression was also seen in the skin and in the cartilaginous tissue of developing skeleton. Orchidectomy and dihydrotestosterone treatment of rats revealed that PDF expression is regulated by androgens in the prostate. In addition, subcutaneous implantation of recombinant PDF induced cartilage formation and the early stages of endochondral bone formation. These data indicate that PDF has a functional relationship to the BMPs.", "Macrophage inhibitory cytokine-1 (MIC-1) is part of the TGF-beta superfamily. Raised concentrations of MIC-1 in serum arise in several disease states, can be detected in normal individuals, and can partly be genetically determined. We aimed to investigate whether MIC-1 has a role in atherothrombosis. We did a prospective, nested, case-control study in 27628 initially healthy women. Of these women, we established baseline concentrations of MIC-1 in 257 who subsequently had myocardial infarction, stroke, or died from a cardiovascular event (cases) and in 257 matched for age and smoking status, who did not report cardiovascular disease during 4-year follow-up (controls). We also assessed polymorphisms in the MIC-1 gene (MIC-1 H and MIC-1 D) in all 514 women. MIC-1 concentrations were higher at baseline in women who subsequently had cardiovascular events than in those who did not (618 vs 538 pg/mL, p=0.0002). Concentrations above the 90th percentile (>856 pg/mL) were associated with a 2.7-fold increase in risk (95% CI 1.6-4.9, p=0.001). This effect was independent of traditional cardiovascular risk factors and at least additive to that of C-reactive protein. There was no significant association between MIC-1 polymorphism and vascular events. MIC-1 could be a novel target for cardiovascular disease prevention.", "Growth-differentiation factor 15 (GDF-15), a stress-responsive transforming growth factor-beta-related cytokine, is emerging as a new risk marker in patients with cardiovascular disease. We explored GDF-15 in preeclampsia and in diabetic pregnancies, because these conditions are associated with augmented risk for cardiovascular disease, both in mother and in offspring. Plasma from pregnant women (n=267; controls: n=59, preeclampsia: n=85, diabetes mellitus: n=112, and superimposed preeclampsia in diabetes mellitus: n=11), fetal plasma (n=72), and amniotic fluid (n=99) were analyzed by immunoassay for GDF-15. Placental GDF-15 mRNA and protein expression levels were analyzed by quantitative real-time PCR and immunoblots in 78 and 18 pregnancies, respectively. Conditioned media from preeclamptic (n=6) and control (n=6) villous placenta explants were analyzed by immunoassay for GDF-15. Median maternal GDF-15 concentration was elevated in those with diabetes mellitus, as compared with controls (91 549 versus 79 875 ng/L; P=0.02). Median GDF-15 concentration was higher in patients with preeclampsia than in controls in term maternal blood samples (127 061 versus 80 319 ng/L; P<0.001). In the fetal circulation and amniotic fluid, GDF-15 was elevated in preeclampsia and superimposed preeclampsia in diabetes mellitus, as compared with controls. GDF-15 placental mRNA expression was elevated in preeclampsia, as compared with controls (P=0.002). Placenta immunoblots confirmed a single GDF-15 protein band, and a time-dependent increase in GDF-15 protein was detected in the conditioned media. Our study is the first to show that GDF-15 is dysregulated, both in preeclampsia and in diabetic pregnancies. The mechanisms and diagnostic implications of these findings remain to be explored.", "Aberrant expression of RNA-binding proteins has profound implications for cellular physiology and the pathogenesis of human diseases such as cancer. We previously identified the Fragile X-Related 1 gene (FXR1) as one amplified candidate driver gene at 3q26-29 in lung squamous cell carcinoma (SCC). FXR1 is an autosomal paralog of Fragile X mental retardation 1 and has not been directly linked to human cancers. Here we demonstrate that FXR1 is a key regulator of tumor progression and its overexpression is critical for nonsmall cell lung cancer (NSCLC) cell growth in vitro and in vivo. We identified the mechanisms by which FXR1 executes its regulatory function by forming a novel complex with two other oncogenes, protein kinase C, iota and epithelial cell transforming 2, located in the same amplicon via distinct binding mechanisms. FXR1 expression is a candidate biomarker predictive of poor survival in multiple solid tumors including NSCLCs. Because FXR1 is overexpressed and associated with poor clinical outcomes in multiple cancers, these results have implications for other solid malignancies.", "Studies of extravillous trophoblasts and placental bed spiral arteries are essential for a better understanding of pathological pregnancies such as preeclampsia, intrauterine growth restriction and diabetes mellitus. A major challenge is to obtain representative and sufficient tissue for morphological and functional investigations. Currently, tissue material is mostly harvested by placental bed biopsy (PBB). We describe a new suction method to obtain a larger volume of decidual tissue from the placental bed. Tissue was harvested in 51 cesarean sections by vacuum suction of the placental bed. Sections from formalin-fixed, paraffin-embedded tissue were routinely stained with hematoxylin and eosin (H&E), immunostained with a panel of antibodies and morphologically examined for the presence of trophoblasts and spiral arteries. The results were compared with those from archive material from PBBs and placental basal plate sections (BPSs). Short-term adverse events were registered for the study patients. Long-term complications were registered from medical charts of 151 women having undergone the decidual suction method (DSM), with a follow-up of 38-60 months. In 86% (n = 44), one random section from the decidual suction material demonstrated at least one spiral artery. In 37% (n = 19), six or more spiral arteries were present. All sections revealed extravillous trophoblasts. No short- or long-term morbidity was recorded. The decidual suction method represents an important improvement in the work to obtain sufficient decidual tissue for morphological and functional studies of extravillous trophoblast function and spiral artery adaptation. The method is safe, as no short- or long-term complications were registered." ]
Clusterin as the major ABri- and ADan-binding protein in familial British and Danish dementias
Familial British and Danish dementias (FBD and FDD) share striking neuropathological similarities with Alzheimer's disease (AD), including intraneuronal neurofibrillary tangles as well as parenchymal and vascular amyloid deposits. Multiple amyloid associated proteins with still controversial role in amyloidogenesis colocalize with the structurally different amyloid peptides ABri in FBD, ADan in FDD, and Aβ in AD. Genetic variants and plasma levels of one of these associated proteins, clusterin, have been identified as risk factors for AD. Clusterin is known to bind soluble Aβ in biological fluids, facilitate its brain clearance, and prevent its aggregation. The current work identifies clusterin as the major ABri- and ADan-binding protein and provides insight into the biochemical mechanisms leading to the association of clusterin with ABri and ADan deposits. Mirroring findings in AD, the studies corroborate clusterin co-localization with cerebral parenchymal and vascular amyloid deposits in both disorders. Ligand affinity chromatography with downstream Western blot and amino acid sequence analyses unequivocally identified clusterin as the major ABri- and ADan-binding plasma protein. ELISA highlighted a specific saturable binding of clusterin to ABri and ADan with low nanomolar Kd values within the same range as those previously demonstrated for the clusterin-Aβ interaction. Consistent with its chaperone activity, thioflavin T binding assays clearly showed a modulatory effect of clusterin on ABri and ADan aggregation/fibrillization properties. Our findings, together with the known multifunctional activity of clusterin and its modulatory activity on the complex cellular pathways leading to oxidative stress, mitochondrial dysfunction, and the induction of cell death mechanisms - all known pathogenic features of these protein folding disorders - suggests the likelihood of a more complex role and a translational potential for the apolipoprotein in the amelioration/prevention of these pathogenic mechanisms.
[ "Molecular chaperons or amyloid-associated proteins (AAPs) are deposited in vascular and parenchymal amyloid lesions in Alzheimer's disease (AD) and other amyloidoses. AAPs, such as apolipoprotein E (ApoE) or apolipoprotein J (ApoJ) have been strongly implicated in the pathogenesis of AD in vitro and in vivo. Furthermore the possession of the ApoE in4 allele is a well-studied risk factor for AD. In view of the similarities between AD and both familial British dementia (FBD) and familial Danish dementia (FDD), we investigated the presence of AAPs in these two diseases to understand better their role in the general process of amyloidogenesis. Immunohistochemistry for ApoE, ApoJ, serum amyloid P (SAP), alpha-1-antichymotrypsin, cystatin C, heparan sulphate proteoglycans, such as agrin, perlecan, syndecans, glypican-1 and for heparan sulphate glycosaminoglycan (HS GAG) side chains was carried out together with immunohistochemical preparations specific to the amyloid subunits. Significant or extensive staining for ApoE, ApoJ, agrin, glypican-1 and HS GAG side chains was found in both amyloid (fibrillar) and preamyloid (nonfibrillar) deposits in FBD and FDD. The remaining AAPs, including SAP, were predominantly found in amyloid lesions. Only very weak staining was present in a small proportion of the amyloid lesions using perlecan immunohistochemistry. These findings suggest that the deposition patterns of AAPs in FBD and FDD are mostly similar to those in AD. The presence of AAPs in the preamyloid lesions supports the notion that chaperon molecules may play a role in the early steps of fibrillogenesis.", "Familial British dementia (FBD) is an early-onset non-amyloid-β (Aβ) cerebral amyloidosis that presents with severe cognitive decline and strikingly similar neuropathological features to those present in Alzheimer's disease (AD). FBD is associated with a T to A single nucleotide transition in the stop codon of a gene encoding BRI2, leading to the production of an elongated precursor protein. Furin-like proteolytic processing at its C-terminus releases a longer-than-normal 34 amino acid peptide, ABri, exhibiting amyloidogenic properties not seen in its 23 amino acid physiologic counterpart Bri1-23. Deposited ABri exhibits abundant post-translational pyroglutamate (pE) formation at the N-terminus, a feature seen in truncated forms of Aβ found in AD deposits, and co-exists with neurofibrillary tangles almost identical to those found in AD. We tested the impact of the FBD mutation alone and in conjunction with the pE post-translational modification on the structural properties and associated neurotoxicity of the ABri peptide. The presence of pE conferred to the ABri molecule enhanced hydrophobicity and accelerated aggregation/fibrillization properties. ABri pE was capable of triggering oxidative stress, loss of mitochondrial membrane potential and activation of caspase-mediated apoptotic mechanisms in neuronal cells, whereas homologous peptides lacking the elongated C-terminus and/or the N-terminal pE were unable to induce similar detrimental cellular pathways. The data indicate that the presence of N-terminal pE is not in itself sufficient to induce pathogenic changes in the physiologic Bri1-23 peptides but that its combination with the ABri mutation is critical for the molecular pathogenesis of FBD.", "We analyzed postmortem tissues of sporadic amyotrophic lateral sclerosis (SALS) for mRNA levels of two inflammatory proteins, complement C1qB and clusterin (apoJ). By Northern blot hybridization, SALS was associated with increased mRNA for C1qB and clusterin in the motor cortex (Brodmann area A4), but not in superior temporal cortex (A17), relative to neurologically normal controls. By in situ hybridization, SALS spinal cords showed increased C1qB and clusterin mRNA in areas undergoing neurodegeneration. This evidence implicates inflammatory mechanisms during neurodegenerative processes in SALS.", "Apoptosis is strictly connected to the pathogenesis of many human diseases, including neoplastic, neurodegenerative or cardiovascular diseases. It is a highly programmed cell death which can be activated by various factors. Mitochondria play a key role in the apoptotic process; their damage, which involves permeabilization of the outer mitochondrial membrane, activates a series of events that lead to cell death. Of the two proposed signaling pathways of apoptosis, i.e. the 'extrinsic' and the 'intrinsic' pathway, the latter is assumed to initiate in mitochondria. Its activation involves release of cytochrome c and other pro-apoptotic factors from the mitochondrial intermembrane space. In the cytosol, cytochrome c exerts its pro-apoptotic action. It binds to the apoptosis protease activation factor (APAf-1) and forms a complex indicated as 'apoptosome'. The complex-induced activation of pro-caspase 9 initiates an enzymatic reaction cascade leading to the execution of apoptosis in cells. This review provides an overview of the key role played by mitochondria and cytochrome c in the activation of the apoptotic process.", "Pyroglutamate (pGlu)-modified amyloid peptides have been identified in sporadic and familial forms of Alzheimer's disease (AD) and the inherited disorders familial British and Danish Dementia (FBD and FDD). In this study, we characterized the aggregation of amyloid-β protein Aβ37, Aβ38, Aβ40, Aβ42 and ADan species in vitro, which were modified by N-terminal pGlu (pGlu-Aβ3-x, pGlu-ADan) or possess the intact N-terminus (Aβ1-x, ADan). The pGlu-modification confers rapid formation of oligomers and short fibrillar aggregates. In accordance with these observations, the pGlu-modified Aβ38, Αβ40 and Αβ42 species inhibit hippocampal long term potentiation of synaptic response, but pGlu-Aβ3-42 showing the highest effect. Among the unmodified Aβ peptides, only Aβ1-42 exhibites such propensity, which was similar to pGlu-Aβ3-38 and pGlu-Aβ3-40. Likewise, the amyloidogenic peptide pGlu-ADan impaired synaptic potentiation more pronounced than N-terminal unmodified ADan. The results were validated using conditioned media from cultivated HEK293 cells, which express APP variants favoring the formation of Aβ1-x, Aβ3-x or N-truncated pGlu-Aβ3-x species. Hence, we show that the ability of different amyloid peptides to impair synaptic function apparently correlates to their potential to form oligomers as a common mechanism. The pGlu-modification is apparently mediating a higher surface hydrophobicity, as shown by 1-anilinonaphtalene-8-sulfonate fluorescence, which enforces potential to interfere with neuronal physiology.", "The involvement of apolipoproteins, such as the ApoE4 isoform, in Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA) highlights the fact that certain lipid carriers may participate in soluble β-amyloid (Aβ) transport. Our general aim was to characterize the soluble levels of the apolipoproteins apoE, apoA1 and apoJ/clusterin and their genotype status in patients with CAA. We analyzed the genotypes frequency of APOA1 (rs5069, rs670), CLU (rs11136000, rs1532278, rs7012010, rs9331888) and APOE (rs429358, rs7412) in a cohort of patients with CAA-associated intracerebral hemorrhage (ICH) (n = 59) and compared the results with those from hypertension-associated ICH (n = 42), AD patients (n = 73) and controls (n = 88). In a subgroup of patients, we also determined the plasma concentrations of apoE, apoA1 and apoJ/clusterin. We found increased plasma apoJ/clusterin levels in CAA patients compared to AD patients or controls after adjusting for sex and age (CAA vs. controls, p = 0.033; CAA vs. AD, p = 0.013). ApoA1 levels were not altered between groups, although a strong correlation was observed between plasma Aβ(1-40) and apoA1 among CAA patients (r = 0.583, p = 0.007). Regarding plasma apoE concentration, a robust association between circulating levels and genotype status was confirmed (p < 0.001). Whereas the APOE4 frequency was higher in AD (p < 0.001) and CAA (p = 0.013), the APOA1 and CLU genotypes were not different among groups. In the CAA cohort, the risk-linked CLU variant (C) rs11136000 was associated with white matter hyperintensities (p = 0.045) and the presence of lobar microbleeds (p = 0.023) on MRI. In summary, our findings suggest that apoA1 may act as a physiological transporter of Aβ(1-40) and that apoJ/clusterin appears to be a chaperone related to distinctive lesions in CAA brains.", "Fibronectin (Fn) is an adhesive glycoprotein that plays an important role in reticuloendothelial system functioning. Fn binds several macromolecules, it is found in cryoprecipitates obtained from patients with different diseases and it interacts in vitro with immune complexes. The interaction between Fn and polyclonal IgG was characterized by ligand affinity chromatography. After IgG was modified by attachment to a solid matrix or heat aggregation, it was able to interact with either soluble or immobilized Fn. The binding was highly influenced by ionic strength and pH. The estimated affinity constants were 3.0 x 10(6)/M when soluble Fn was applied to solid phase IgG and 2.3 x 10(7)/M when aggregated IgG interacted with immobilized Fn. The interaction may be relevant in situations in which immune complexes are involved." ]
In different large-scale clinic outcome trials, sodium (Na)
In different large-scale clinic outcome trials, sodium (Na
[ "Exposure of neonatal rat cardiac myocytes to ouabain concentrations that caused partial inhibition of Na+/K+-ATPase but no loss of viability, increased c-fos and c-jun mRNAs and the transcription factor AP-1. The increased mRNAs were proportional to the extent of inhibition of Na+/K+-ATPase and the resulting rise in steady state intracellular Ca2+ concentration. The rapid and sustained increase of c-fos mRNA was shown to be due to increased transcriptional rate. Induction of c-fos by ouabain was prevented when either extracellular or intracellular Ca2+ was lowered and was attenuated by pretreatment of myocytes with a phorbol ester under conditions known to down-regulate protein kinase C. Exposure to ouabain for 24-48 h also increased total transcriptional activity and protein content of myocytes. The findings suggest that the same signal responsible for the positive inotropic action of ouabain, i.e. net influx of Ca2+ caused by partial inhibition of Na+/K+-ATPase, also initiates the rapid protein kinase C-dependent inductions of the early-response genes, the subsequent regulations of other cardiac genes by the resulting transcription factors, and stimulation of myocyte growth. Whether these hitherto unrecognized effects of cardiac glycosides are obtained in the intact heart and their relevance to the therapeutic uses of these drugs remain to be determined.", "Background Canagliflozin is a sodium-glucose cotransporter 2 inhibitor that reduces glycemia as well as blood pressure, body weight, and albuminuria in people with diabetes. We report the effects of treatment with canagliflozin on cardiovascular, renal, and safety outcomes. Methods The CANVAS Program integrated data from two trials involving a total of 10,142 participants with type 2 diabetes and high cardiovascular risk. Participants in each trial were randomly assigned to receive canagliflozin or placebo and were followed for a mean of 188.2 weeks. The primary outcome was a composite of death from cardiovascular causes, nonfatal myocardial infarction, or nonfatal stroke. Results The mean age of the participants was 63.3 years, 35.8% were women, the mean duration of diabetes was 13.5 years, and 65.6% had a history of cardiovascular disease. The rate of the primary outcome was lower with canagliflozin than with placebo (occurring in 26.9 vs. 31.5 participants per 1000 patient-years; hazard ratio, 0.86; 95% confidence interval [CI], 0.75 to 0.97; P<0.001 for noninferiority; P=0.02 for superiority). Although on the basis of the prespecified hypothesis testing sequence the renal outcomes are not viewed as statistically significant, the results showed a possible benefit of canagliflozin with respect to the progression of albuminuria (hazard ratio, 0.73; 95% CI, 0.67 to 0.79) and the composite outcome of a sustained 40% reduction in the estimated glomerular filtration rate, the need for renal-replacement therapy, or death from renal causes (hazard ratio, 0.60; 95% CI, 0.47 to 0.77). Adverse reactions were consistent with the previously reported risks associated with canagliflozin except for an increased risk of amputation (6.3 vs. 3.4 participants per 1000 patient-years; hazard ratio, 1.97; 95% CI, 1.41 to 2.75); amputations were primarily at the level of the toe or metatarsal. Conclusions In two trials involving patients with type 2 diabetes and an elevated risk of cardiovascular disease, patients treated with canagliflozin had a lower risk of cardiovascular events than those who received placebo but a greater risk of amputation, primarily at the level of the toe or metatarsal. (Funded by Janssen Research and Development; CANVAS and CANVAS-R ClinicalTrials.gov numbers, NCT01032629 and NCT01989754 , respectively.).", "Cytosolic sodium ([Na+]i) is increased in heart failure (HF). We hypothesize that up-regulation of Na+/H+-exchanger (NHE) in heart failure is causal to the increase of [Na+]i and underlies disturbance of cytosolic calcium ([Ca2+]i) handling. Heart failure was induced in rabbits by combined volume and pressure overload. Age-matched animals served as control. [Na+]i, cytosolic calcium [Ca2+]i and cytosolic pH (pH(i)) were measured in isolated left ventricular midmural myocytes with SBFI, indo-1 and SNARF. SR calcium content was measured as the response of [Ca2+]i to rapid cooling (RC). Calcium after-transients were elicited by cessation of rapid stimulation (3 Hz) in the presence of 100 nmol/l noradrenalin. NHE and Na+/K+-ATPase activity were inhibited with 10 micromol/l cariporide and 100 micromol/l ouabain, respectively. At all stimulation rates (0-3 Hz) [Na+]i and diastolic [Ca2+]i were significantly higher in HF than in control. With increasing frequency [Na+]i and diastolic [Ca2+]i progressively increased in HF and control, and the calcium transient amplitude (measured as total calcium released from SR) decreased in HF and increased in control. In HF (at 2 Hz), SR calcium content was reduced by 40% and the calcium gradient across the SR membrane by 60%. Fractional systolic SR calcium release was 90% in HF and 60% in control. In HF the rate of pH(i) recovery following acid loading was much faster at all pH(i) and NHE dependent sodium influx was almost twice as high as in control. In HF cariporide (10 micromol/l, 5 min) reduced [Na+]i and end diastolic [Ca2+]i to almost control values, and reversed the relation between calcium transient amplitude and stimulation rate from negative to positive. It increased SR calcium content and SR membrane gradient and decreased fractional systolic SR depletion to 60%. Cariporide greatly reduced the susceptibility to develop calcium after-transients. In control animals, cariporide had only minor effects on all these parameters. Increase of [Na+]i with ouabain in control myocytes induced abnormal calcium handling as found in HF. In HF up-regulation of NHE activity is causal to increased [Na+]i and secondarily to disturbed diastolic, systolic and SR calcium handling. Specific inhibition of NHE partly normalized [Na+]i, end diastolic [Ca2+]i, and SR calcium handling and reduced the incidence of calcium after-transients. Chronic treatment with specific NHE inhibitors may provide a useful future therapeutic option in treatment of developing hypertrophy and heart failure.", "One proposed role of glomerular mesangial cells is the regulation of glomerular blood flow by contraction. Alterations in the contractile activity of mesangial cells could lead to alterations in glomerular hemodynamics and then to glomerular injury. In this study, the effects of glucose and insulin on the contractile response of cloned homogeneous cultures of rat glomerular mesangial cells to angiotensin II were examined. Cells were cultured in normal-glucose medium (D-glucose at 200 mg/dl) and normal-glucose medium with added insulin (4 microgram/ml). To mimic the diabetic state, cells were cultured in high-glucose medium (D-glucose at 550 mg/dl) and high-glucose medium with added insulin. The media contained 20% fetal calf serum. Cells were grown for at least 1 wk in medium prior to contraction experiments. All clones of mesangial cells grown in the presence of additional insulin, in either normal- or high-glucose media, underwent contraction when treated with angiotensin II (0.001-10 microM). Seventy-five percent of the cells contracted. Not one contracted cell was seen in cultures grown without insulin in the medium, even when exposed to 10 microM angiotensin II. From these data, it appears that insulin may be required for the contractile response of mesangial cells to angiotensin II. Loss of contractile activity by mesangial cells in low- or no-insulin conditions (e.g., juvenile diabetes mellitus) could lead to a marked increase in glomerular blood flow, ultimately resulting in glomerulosclerosis.", "In NaCl-loaded Dahl salt-sensitive (DS) rats the transient stimulation of brain endogenous ouabain (EO) precedes the increase in renal excretion of marinobufagenin (MBG), a vasoconstrictor and natriuretic. In hypertensive DS rats, EO raises blood pressure (BP) via an ATII-sensitive pathway. We hypothesized that an NaCl-induced increase in MBG is linked to the EO-stimulated ATII pathway. We studied the effects of 3 h of NaCl loading (17 mmol/kg, intraperitoneally) in male DS rats treated with antibodies to MBG or ouabain, or with losartan (25 mg/kg). NaCl loading alone induced a transient stimulation of pituitary EO (22.4 +/- 1.8 versus 12.2 +/- 1.3 pmol/g) and ATII (39.4 +/- 2.8 versus 18.4 +/- 3.2 ng/g), a sustained increase in MBG excretion (5.2 +/- 0.6 versus 1.1 +/- 0.2 pmol/h), a 40% inhibition of the renal sodium pump, a natriuretic response, a 35 mmHg increase in systolic BP, and an increase in adrenocortical ATII and MBG levels and in plasma norepinephrine. The anti-MBG antibody reduced the natriuresis (36%) and BP (40 mmHg), and restored renal sodium pump activity. The anti-ouabain antibody prevented the increase in pituitary ATII, reduced MBG excretion, natriuresis and BP, increased sodium pump activity, and prevented increases in plasma norepinephrine, pituitary and adrenocortical ATII, and adrenocortical MBG. Losartan mimicked the effects of the anti-ouabain antibody, but did not affect the excretion of EO. In adrenocortical cells of DS rats, ATII stimulated MBG secretion, and losartan blocked this effect. In response to NaCl loading, brain EO, via an AT1 receptor pathway and probably via sympathetic activation, stimulates adrenocortical MBG, which inhibits the renal sodium pump and elevates BP.", "Three lines of evidence led to our suggestion in 1976 that sodium pump inhibitors are involved in volume expanded hypertension. These were 1) pressor activity of low renin hypertensive blood 2) natriuretic and sodium pump inhibiting activities of volume expanded blood and 3) potassium vasoactivity which was blocked by ouabain and suppressed potassium vasodilatation, myocardial Na-K-ATPase, and artery, vein and WBC sodium pumps in low renin hypertension. This led to bioassay of plasma from acutely volume expanded dogs and from dogs with one-kidney, one wrapped hypertension for sodium pump inhibiting activity that acts on arteries. Positive results were reported in 1980. The assay was also positive in rats with one-kidney, one clip and reduced renal mass hypertension (but not in rats with spontaneous or salt sensitive hypertension) and in humans with acute volume expansion and low renin essential hypertension (but not in humans with normal renin hypertension). Thus the inhibitor which acts on the sodium pump in arteries appears to be present only in low renin hypertension.", "Patients with chronic kidney disease have a high risk of adverse kidney and cardiovascular outcomes. The effect of dapagliflozin in patients with chronic kidney disease, with or without type 2 diabetes, is not known. We randomly assigned 4304 participants with an estimated glomerular filtration rate (GFR) of 25 to 75 ml per minute per 1.73 m2 of body-surface area and a urinary albumin-to-creatinine ratio (with albumin measured in milligrams and creatinine measured in grams) of 200 to 5000 to receive dapagliflozin (10 mg once daily) or placebo. The primary outcome was a composite of a sustained decline in the estimated GFR of at least 50%, end-stage kidney disease, or death from renal or cardiovascular causes. The independent data monitoring committee recommended stopping the trial because of efficacy. Over a median of 2.4 years, a primary outcome event occurred in 197 of 2152 participants (9.2%) in the dapagliflozin group and 312 of 2152 participants (14.5%) in the placebo group (hazard ratio, 0.61; 95% confidence interval [CI], 0.51 to 0.72; P<0.001; number needed to treat to prevent one primary outcome event, 19 [95% CI, 15 to 27]). The hazard ratio for the composite of a sustained decline in the estimated GFR of at least 50%, end-stage kidney disease, or death from renal causes was 0.56 (95% CI, 0.45 to 0.68; P<0.001), and the hazard ratio for the composite of death from cardiovascular causes or hospitalization for heart failure was 0.71 (95% CI, 0.55 to 0.92; P = 0.009). Death occurred in 101 participants (4.7%) in the dapagliflozin group and 146 participants (6.8%) in the placebo group (hazard ratio, 0.69; 95% CI, 0.53 to 0.88; P = 0.004). The effects of dapagliflozin were similar in participants with type 2 diabetes and in those without type 2 diabetes. The known safety profile of dapagliflozin was confirmed. Among patients with chronic kidney disease, regardless of the presence or absence of diabetes, the risk of a composite of a sustained decline in the estimated GFR of at least 50%, end-stage kidney disease, or death from renal or cardiovascular causes was significantly lower with dapagliflozin than with placebo. (Funded by AstraZeneca; DAPA-CKD ClinicalTrials.gov number, NCT03036150.)." ]
Associations between cerebral white matter hyperintensity volume, brain iron concentration and cerebral blood flow
Cerebral white matter hyperintensities (WMHs) represent macrostructural brain damage associated with various etiologies. However, the relative contributions of various etiologies to WMH volume, as assessed via different neuroimaging measures, is not well-understood. Here, we explored associations between three potential early markers of white matter hyperintensity volume. Specifically, the unique variance in total and regional WMH volumes accounted for by white matter microstructure, brain iron concentration and cerebral blood flow (CBF) was assessed. Regional volumes explored were periventricular and deep regions. Eighty healthy older adults (ages 60-86) were scanned at 3 Tesla MRI using fluid-attenuated inversion recovery, diffusion tensor imaging (DTI), multi-echo gradient-recalled echo and pseudo-continuous arterial spin labeling sequences. In a stepwise regression model, DTI-based radial diffusivity accounted for significant variance in total WMH volume (adjusted
[ "White matter (WM) injury in carbon monoxide (CO) intoxication is thought to be related to delayed cognitive sequelae. To determine if microstructural changes in WM are responsible for the delayed onset of cognitive symptoms, we performed diffusion tensor imaging (DTI) in patients with CO intoxication. DTI was performed in 14 patients with delayed sequelae after CO intoxication and in 16 sex- and age-matched healthy volunteers. The fractional anisotropy (FA) and apparent diffusion coefficient (ADC) of several WM regions were measured. We also determined the correlation between FA of the selected WM and neuropsychological rating scores for the CO intoxication group. FA of patients with CO intoxication decreased in the corpus callosum, orbitofrontal WM, high frontal WM, parietal WM, and temporal lobes in comparison with the corresponding regions of healthy controls. FA of the WM in the occipital lobe and internal capsule of patients was not significantly different from that in controls. ADCs of all measured WM increased significantly in patients exposed to CO. High correlations were found between the FA of all selected WM and the Mini-Mental State Examination score (gamma = 0.631, P = .016) and the digit span backward task (gamma = 0.759, P = .001). CO intoxication may cause FA decline in associated cortical areas. This observation indicates microstructural WM pathology in CO intoxication, which is related to delayed cognitive encephalopathy.", "Infarcts of the corpus callosum have not been well documented in the radiologic literature. We present five cases that were unusual in either their clinical or radiologic presentation or both. Biopsies were performed in three of the five cases, and in time, all lesions evolved in a pattern consistent with infarct. Recognition of the varied clinical and radiologic presentation of infarcts of the corpus callosum will obviate the need for biopsy in most patients.", "The vascularization of the corpus callosum in Man is studied in 20 brains. Their vascular system is injected with Indian ink and gelatin. The corpus callosum is drained by callosal veins and callosocingulate veins towards the deep venous system of the brain. Most of these veins run downwards and join together at the central level of the corpus callosum. They then form the subependymal veins, which form the septal veins and the medial atrial vein. All these vessels are tributaries of the internal cerebral veins.", "There has been much recent interest in using magnetic resonance diffusion imaging to provide information about anatomical connectivity in the brain, by measuring the anisotropic diffusion of water in white matter tracts. One of the measures most commonly derived from diffusion data is fractional anisotropy (FA), which quantifies how strongly directional the local tract structure is. Many imaging studies are starting to use FA images in voxelwise statistical analyses, in order to localise brain changes related to development, degeneration and disease. However, optimal analysis is compromised by the use of standard registration algorithms; there has not to date been a satisfactory solution to the question of how to align FA images from multiple subjects in a way that allows for valid conclusions to be drawn from the subsequent voxelwise analysis. Furthermore, the arbitrariness of the choice of spatial smoothing extent has not yet been resolved. In this paper, we present a new method that aims to solve these issues via (a) carefully tuned non-linear registration, followed by (b) projection onto an alignment-invariant tract representation (the \"mean FA skeleton\"). We refer to this new approach as Tract-Based Spatial Statistics (TBSS). TBSS aims to improve the sensitivity, objectivity and interpretability of analysis of multi-subject diffusion imaging studies. We describe TBSS in detail and present example TBSS results from several diffusion imaging studies.", "There is increasing evidence that iron is involved in the mechanisms that underlie many neurodegenerative diseases. Conditions such as neuroferritinopathy and Friedreich ataxia are associated with mutations in genes that encode proteins that are involved in iron metabolism, and as the brain ages, iron accumulates in regions that are affected by Alzheimer's disease and Parkinson's disease. High concentrations of reactive iron can increase oxidative-stress induced neuronal vulnerability, and iron accumulation might increase the toxicity of environmental or endogenous toxins. By studying the accumulation and cellular distribution of iron during ageing, we should be able to increase our understanding of these neurodegenerative disorders and develop new therapeutic strategies.", "Iron accumulation has been implicated in the pathogenesis of demyelinating diseases. Therefore, we hypothesized that abnormal high cerebral iron deposition may be involved in the development of white matter hyperintensities (WMHs). We used R2* relaxometry to assess whether iron levels in different brain regions correlate with the severity of WMHs. This technique has been recently validated in a postmortem study to demonstrate in vivo brain iron accumulation in a quantitative manner. Fifty-two consecutive WMH patients and 30 healthy controls with 3-T magnetic resonance imaging (MRI) were reviewed in this study. We measured WMH volume (as a marker of the severity of WMHs) on MRI, and the transverse relaxation rate R2*, as an estimate of iron content in seven brain regions. We found that R2* in globus pallidus was associated with WMH volume after adjusting for sociodemographic variables (partial correlation coefficient = 0.521, P < 0.001) and in a multivariate analysis adjusted for common vascular risk factors (partial correlation coefficient = 0.572, P = 0.033). Regional R2* in globus pallidus was also significantly higher in WMHs than in controls (P = 0.042). Iron content in globus pallidus, as assessed by R2* relaxometry, is independently linked to the severity of WMHs in our cohort of patients, suggesting that iron deposition in the brain may play a role in the pathogenesis of WMHs. This may provide prognostic information on patients with WMHs and may have implications for therapeutic interventions in WMHs.", "The corpus callosum is the largest white matter structure in the brain, consisting of 200-250 million contralateral axonal projections and the major commissural pathway connecting the hemispheres of the human brain. The pathology of the corpus callosum includes a wide variety of entities that arise from different causes such as congenital, inflammatory, tumoural, degenerative, infectious, metabolic, traumatic, vascular and toxic agents. The corpus callosum, or a specific part of it, can be affected selectively. Numerous pathologies of the corpus callosum are encountered during CT and MRI. The aim of this study is to facilitate a better understanding and thus treatment of the pathological entities of the corpus callosum by categorising them according to their causes and their manifestations in MR and CT imaging. Familiarity with its anatomy and pathology is important to the radiologist in order to recognise its disease at an early stage and help the clinician establish the optimal therapeutic approach.", "The characterization and differentiation of central nervous system (CNS) lymphoma has important diagnostic, therapeutic, and prognostic significance. The purpose of this study is to characterize the diffusion-weighted imaging (DWI) and MR spectroscopic (MRS) findings in CNS lymphoma. Twenty consecutive patients (male [n= 12], female [n= 8]) with histopathologically proven CNS lymphoma were retrospectively evaluated during this study from July 2005 to April 2007. Patients included immunocompromised (n= 9) and immunocompetent (n= 11) individuals. MR Imaging (pretreatment n= 13), pre- and post-treatment (n= 7) included DWI (n= 20) (b = 1000s/mm2) and ADC (apparent diffusion coefficient) maps of all patients. MRS was performed (n= 10) with PRESS (point-resolved spectroscopy) sequence (multivoxel n= 8, single voxel n= 2) with a TE of 144 msec. All patients were histopathologically confirmed to have lymphoma by biopsy. Areas of restricted diffusion were observed in 90 % (n= 18/20) on pretreatment scans. The diffusion restriction was variable on post-treatment scans. Median metabolite ratios in 10 patients were Cho/Cr- 2.12, NAA/Cho - .49, and NAA/Cr - 1.64. Presence of lactate or lipid was noted in 90 % (n= 9/10). Sites of lesion location were subcortical white matter (n= 6), basal ganglia (n= 4), corpus callosum (n= 3), extra-axial space including cavernous sinus (n= 5), cerebellum (n= 1), and lateral ventricle (n= 1). Restricted diffusion is a consistent imaging finding in CNS lymphoma in immunocompetent patients. Spectroscopy is helpful in initial imaging diagnosis and post-treatment surveillance. These lesions are usually paraventricular in location. MR imaging appearances differ among immunocompetent and immunosuppressed individuals in most cases." ]
Bimolecular stoichiometric triple-bond metathesis of molybdenum alkylidyne complexes
Molybdenum alkylidyne complexes with a trisilanolate podand ligand framework ("canopy catalysts") are the arguably most selective catalysts for alkyne metathesis known to date. Among them, complex 1 a endowed with a fence of lateral methyl substituents on the silicon linkers is the most reactive, although fairly high loadings are required in certain applications. It is now shown that this catalyst decomposes readily via a bimolecular pathway that engages the Mo≡CR entities in a stoichiometric triple-bond metathesis event to furnish RC≡CR and the corresponding dinuclear complex, 8, with a Mo≡Mo core. In addition to the regular analytical techniques,
[ "A new family of structurally well-defined molybdenum alkylidyne catalysts for alkyne metathesis, which is distinguished by a tripodal trisilanolate ligand architecture, is presented. Complexes of type 1 combine the virtues of previous generations of silanolate-based catalysts with a significantly improved functional group tolerance. They are easy to prepare on scale; the modularity of the ligand synthesis allows the steric and electronic properties to be fine-tuned and hence the application profile of the catalysts to be optimized. This opportunity is manifested in the development of catalyst 1f, which is as reactive as the best ancestors but exhibits an unrivaled scope. The new catalysts work well in the presence of unprotected alcohols and various other protic groups. The chelate effect entails even a certain stability toward water, which marks a big leap forward in metal alkylidyne chemistry in general. At the same time, they tolerate many donor sites, including basic nitrogen and numerous heterocycles. This aspect is substantiated by applications to polyfunctional (natural) products. A combined spectroscopic, crystallographic, and computational study provides insights into structure and electronic character of complexes of type 1. Particularly informative are a density functional theory (DFT)-based chemical shift tensor analysis of the alkylidyne carbon atom and 95Mo NMR spectroscopy; this analytical tool had been rarely used in organometallic chemistry before but turns out to be a sensitive probe that deserves more attention. The data show that the podand ligands render a Mo-alkylidyne a priori more electrophilic than analogous monodentate triarylsilanols; proper ligand tuning, however, allows the Lewis acidity as well as the steric demand about the central atom to be adjusted to the point that excellent performance of the catalyst is ensured.", "A new type of molybdenum alkylidyne catalysts for alkyne metathesis is described, which is distinguished by an unconventional podand topology. These structurally well-defined complexes are easy to make on scale and proved to be tolerant toward numerous functional groups; even certain protic substituents were found to be compatible. The new catalysts were characterized by X-ray crystallography and by spectroscopic means, including 95 Mo NMR.", "Alkyne metathesis represents a rapidly emerging synthetic method that has shown great potential in small molecule and polymer synthesis. However, its practical use has been impeded by the limited availability of user-friendly catalysts and their generally high moisture/air sensitivity. Herein, we report an alkyne metathesis catalyst system that can operate under open-air conditions with a broad substrate scope and excellent yields. These catalysts are composed of simple multidentate tris(2-hydroxyphenyl)methane ligands, which can be easily prepared in multi-gram scale. The catalyst substituted with electron withdrawing cyano groups exhibits the highest activity at room temperature with excellent functional group tolerance (-OH, -CHO, -NO2, pyridyl). More importantly, the catalyst provides excellent yields (typically >90%) in open air, comparable to those operating under argon. When dispersed in paraffin wax, the active catalyst can be stored on a benchtop under ambient conditions without any decrease in activity for one day (retain 88% after 3 days). This work opens many possibilities for developing highly active user-friendly alkyne metathesis catalysts that can function in open air.", "In dynamic covalent synthesis, kinetic traps are perceived as disadvantageous, hindering the system from reaching its thermodynamic equilibrium. Here we present the near-quantitative preparation of tetrahedral cages from simple tritopic precursors using alkyne metathesis. While the cages are the presumed thermodynamic sink, we experimentally demonstrate that the products no longer exchange their vertices once they have formed. The example reported here illustrates that kinetically trapped products may facilitate high yields of complex products from dynamic covalent synthesis." ]
The 3-hydroxypropionate/4-hydroxybutyrate cycle in Thaumarchaeota
Ammonia-oxidizing archaea of the phylum Thaumarchaeota are among the most abundant organisms that exert primary control of oceanic and soil nitrification and are responsible for a large part of dark ocean primary production. They assimilate inorganic carbon via an energetically efficient version of the 3-hydroxypropionate/4-hydroxybutyrate cycle. In this cycle, acetyl-CoA is carboxylated to succinyl-CoA, which is then converted to two acetyl-CoA molecules with 4-hydroxybutyrate as the key intermediate. This conversion includes the (
[ "Human brain short chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) was found to catalyze the oxidation of 17beta-estradiol and dihydroandrosterone as well as alcohols. Mitochondria have been demonstrated to be the proper location of this NAD+-dependent dehydrogenase in cells, although its primary structure is identical to an amyloid beta-peptide binding protein reportedly associated with the endoplasmic reticulum (ERAB). This fatty acid beta-oxidation enzyme was identified as a novel 17beta-hydroxysteroid dehydrogenase responsible for the inactivation of sex steroid hormones. The catalytic rate constant of the purified enzyme was estimated to be 0.66 min-1 with apparent Km values of 43 and 50 microM for 17beta-estradiol and NAD+, respectively. The catalytic efficiency of this enzyme for the oxidation of 17beta-estradiol was comparable with that of peroxisomal 17beta-hydroxysteroid dehydrogenase type 4. As a result, the human SCHAD gene product, a single-domain multifunctional enzyme, appears to function in two different pathways of lipid metabolism. Because the catalytic functions of human brain short chain L-3-hydroxyacyl-CoA dehydrogenase could weaken the protective effects of estrogen and generate aldehydes in neurons, it is proposed that a high concentration of this enzyme in brain is a potential risk factor for Alzheimer's disease.", "A novel L-3-hydroxyacyl-CoA dehydrogenase from pig liver has been cloned, expressed, purified, and characterized. This enzyme is a homodimer with a molecular mass of 65.6 kDa, and is distinguished from the dehydrogenase of pig heart by its structural features and catalytic properties. Its subunit, consisting of 302 amino acid residues, has two additional residues in a key region of the active center while it lacks a sequence of seven residues in the NAD+-binding domain, when compared with the subunit of pig heart enzyme. In addition, there are substitutions of four single residues. The catalytic efficiency of pig liver dehydrogenase was significantly greater than that of the heart enzyme for short-chain substrate, but its catalytic rates declined with an increase in substrate chain-lengths. The distinction between pig liver and heart dehydrogenases cannot be attributed to a species difference, and thus it is concluded that there exist different isoforms of monofunctional L-3-hydroxyacyl-CoA dehydrogenases in pig. High level expression of mitochondrial L-3-hydroxyacyl-CoA dehydrogenase in Escherichia coli has provided a very convenient way to purify this important beta-oxidation enzyme. There is substantial homology between pig liver dehydrogenase and various multifunctional beta-oxidation enzymes in the active center of these enzymes; a consensus sequence, HX3PX1-3MXLXE, is proposed as the signature sequence of l-3-hydroxyacyl-CoA dehydrogenases.", "CLUSTAL X is a new windows interface for the widely-used progressive multiple sequence alignment program CLUSTAL W. The new system is easy to use, providing an integrated system for performing multiple sequence and profile alignments and analysing the results. CLUSTAL X displays the sequence alignment in a window on the screen. A versatile sequence colouring scheme allows the user to highlight conserved features in the alignment. Pull-down menus provide all the options required for traditional multiple sequence and profile alignment. New features include: the ability to cut-and-paste sequences to change the order of the alignment, selection of a subset of the sequences to be realigned, and selection of a sub-range of the alignment to be realigned and inserted back into the original alignment. Alignment quality analysis can be performed and low-scoring segments or exceptional residues can be highlighted. Quality analysis and realignment of selected residue ranges provide the user with a powerful tool to improve and refine difficult alignments and to trap errors in input sequences. CLUSTAL X has been compiled on SUN Solaris, IRIX5.3 on Silicon Graphics, Digital UNIX on DECstations, Microsoft Windows (32 bit) for PCs, Linux ELF for x86 PCs, and Macintosh PowerMac.", "In this study (S)-3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase (H16_A0461/FadB', gene ID: 4247876) from one of two active fatty acid degradation operons of Ralstonia eutropha H16 has been heterologously expressed in Escherichia coli, purified as protein possessing a His-Tag and initially characterized. FadB' is an enzyme with two catalytic domains exhibiting a single monomeric structure and possessing a molecular weight of 86 kDa. The C-terminal part of the enzyme harbors enoyl-CoA hydratase activity and is able to convert trans-crotonyl-CoA to 3-hydroxybutyryl-CoA. The N-terminal part of FadB' comprises an NAD(+) binding site and is responsible for 3-hydroxyacyl-CoA dehydrogenase activity converting (S)-3-hydroxybutyryl-CoA to acetoacetyl-CoA. Enoyl-CoA hydratase activity was detected spectrophotometrically with trans-crotonyl-CoA. (S)-3-Hydroxyacyl-CoA dehydrogenase activity was measured in both directions with acetoacetyl-CoA and 3-hydroxybutyryl-CoA. FadB' was found to be strictly stereospecific to (S)-3-hydroxybutyryl-CoA and to prefer NAD(+). The K m value for acetoacetyl-CoA was 48 μM and V max 149 μmol mg(-1) min(-1). NADP(H) was utilized at a rate of less than 10% in comparison to activity with NAD(H). FadB' exhibited optimal activity at pH 6-7 and the activity decreased at alkaline and acidic pH values. Acetyl-CoA, propionyl-CoA and CoA were found to have an inhibitory effect on FadB'. This study is a first report on biochemical properties of purified (S)-stereospecific 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase with the inverted domain order from R. eutropha H16. In addition to fundamental information about FadB' and fatty acid metabolism, FadB' might be also interesting for biotechnological applications.", "3-Hydroxybutyryl-CoA dehydrogenase is an enzyme involved in the synthesis of the biofuel n-butanol by converting acetoacetyl-CoA to 3-hydroxybutyryl-CoA. To investigate the molecular mechanism of n-butanol biosynthesis, we determined crystal structures of the Ralstonia eutropha-derived 3-hydroxybutyryl-CoA dehydrogenase (RePaaH1) in complex with either its cofactor NAD(+) or its substrate acetoacetyl-CoA. While the biologically active structure is dimeric, the monomer of RePaaH1 comprises two separated domains with an N-terminal Rossmann fold and a C-terminal helical bundle for dimerization. In this study, we show that the cofactor-binding site is located on the Rossmann fold and is surrounded by five loops and one helix. The binding mode of the acetoacetyl-CoA substrate was found to be that the adenosine diphosphate moiety is not highly stabilized compared with the remainder of the molecule. Residues involved in catalysis and substrate binding were further confirmed by site-directed mutagenesis experiments, and kinetic properties of RePaaH1were examined as well. Our findings contribute to the understanding of 3-hydroxybutyryl-CoA dehydrogenase catalysis, and will be useful in enhancing the efficiency of n-butanol biosynthesis by structure based protein engineering.", "A new approach to rapid sequence comparison, basic local alignment search tool (BLAST), directly approximates alignments that optimize a measure of local similarity, the maximal segment pair (MSP) score. Recent mathematical results on the stochastic properties of MSP scores allow an analysis of the performance of this method as well as the statistical significance of alignments it generates. The basic algorithm is simple and robust; it can be implemented in a number of ways and applied in a variety of contexts including straightforward DNA and protein sequence database searches, motif searches, gene identification searches, and in the analysis of multiple regions of similarity in long DNA sequences. In addition to its flexibility and tractability to mathematical analysis, BLAST is an order of magnitude faster than existing sequence comparison tools of comparable sensitivity." ]
what is mcc
Merkel cell carcinoma (MCC) is a rare, highly aggressive malignancy which lacks high-level evidence-based treatment guidelines.
[ "Knowledge regarding behavior of and prognostic factors for Merkel cell carcinoma (MCC) is limited. We sought to further understand the characteristics, behavior, prognostic factors, and optimal treatment of MCC. A multicenter, retrospective, consecutive study of patients with known primary MCC was completed. Overall survival and survival free of locoregional recurrence were calculated and statistical analysis of characteristics and outcomes was performed. Among the 240 patients, the mean age at diagnosis was 70.1 years, 168 (70.0%) were male, and the majority was Caucasian. The most common location was head and neck (111, 46.3%). Immunosuppressed patients had significantly worse survival, with an overall 3-year survival of 43.4% compared with 68.1% in immunocompetent patients. In our study, patients with stage II disease had improved overall survival versus those with stage I disease, in a statistically significant manner. Patients with stage III disease had significantly worse survival compared with stage I and with stage II. Primary tumor size did not predict nodal involvement. The data presented represent one of the largest series of primary MCC in the literature and confirm that MCC of all sizes has metastatic potential, supporting sentinel lymph node biopsy for all primary MCC. Because of the unpredictable natural history of MCC, we recommend individualization of care based on the details of each patient's tumor and clinical presentation.", "The first consensus Merkel cell carcinoma (MCC) staging system was published in 2010. New information on the clinical course prompts review of MCC staging. A total of 9387 MCC cases from the National Cancer Data Base Participant User File with follow-up and staging data (1998-2012) were analyzed. Prognostic differences based on clinical and pathological staging were evaluated. Survival estimates were compared by disease extent. Sixty-five percent of cases presented with local disease, whereas 26 and 8 % presented with nodal and distant disease. Disease extent at presentation was predictive of 5-year overall survival (OS) with estimates of 51, 35, and 14 % for local, nodal, and distant disease. Tumor burden at the regional nodal basin was predictive of 5-year OS with estimates of 40 and 27 % for clinically occult and clinically detected nodal disease. For local disease, we confirm improved prognosis when the regional nodal basin was negative by pathological compared with clinical staging. We identified 336 cases with clinically detected nodal disease and unknown primary tumor and showed improved prognosis over cases presenting with concurrent primary tumor (OS estimates of 42 vs. 27 %). Analysis of a national dataset of MCC cases validates the predictive value of disease extent at presentation. Separation of clinical and pathological stage groups and regrouping of unknown primary tumors are supported by the analysis. The revised staging system provides more accurate prognostication and has been formally accepted by the AJCC staging committee for inclusion in the 8th edition.", "Knowledge is limited regarding unknown primary Merkel cell carcinoma (UPMCC). We sought to document the characteristics and behavior of UPMCC, and determine the most appropriate treatment. A multicenter, retrospective, consecutive study reviewing patients given a diagnosis of UPMCC between 1981 and 2008 was completed. In addition, a literature review of cases of UPMCC was performed. In all, 23 patients with UPMCC are described and 34 cases from previous reports are compiled. Among the 23 new cases of UPMCC, the average age at diagnosis was 66.0 years; the majority of patients were male (87%) and Caucasian (100% of those reported). One patient was immunosuppressed, and 39% had a history of other cancer. After the initial biopsy, 16 patients had further evaluation of the involved lymph node basin. Half of these had additional positive nodes (8 of 16). The majority of patients had lymph node basin involvement only (78%), whereas 22% had lymph node basin and distant metastasis. The most common lymph node basin involved was inguinal. The median size of the involved lymph node at diagnosis was 5.0 cm. At 2 years, the overall survival of stage IIIB UPMCC was significantly improved versus stage IIIB known primary Merkel cell carcinoma (MCC): 76.9% to 36.4%. Limited number of cases and retrospective review are limitations. Our data demonstrate improved overall survival in patients with stage IIIB UPMCC versus those with stage IIIB known primary MCC. Because of the unpredictable natural history of UPMCC, we recommend individualization of care based on the details of each patient's clinical presentation." ]
CRISPR/Cas9 and Parkinson's disease
Recently, genome-editing technology like clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 has improved the translational gap in the treatments mediated through gene therapy. The advantages of the CRISPR system, such as, work in the living cells and tissues, candidate this technique for the employing in experiments and the therapy of central nervous system diseases. Parkinson's disease (PD) is a widespread, disabling, neurodegenerative disease induced by dopaminergic neuron loss and linked to progressive motor impairment. Pathophysiological basis knowledge of PD has modified the PD classification model and expresses in the sporadic and familial types. Analyses of the earliest genetic linkage have shown in PD the inclusion of synuclein alpha (SNCA) genomic duplication and SNCA mutations in the familial types of PD pathogenesis. This review analyzes the structure, development, and function in genome editing regulated through the CRISPR/Cas9. Also, it explains the genes associated with PD pathogenesis and the appropriate modifications to favor PD. This study follows the direction by understanding the PD linking analyses in which the CRISPR technique is applied. Finally, this study explains the limitations and future trends of CRISPR service in relation to the genome-editing process in PD patients' induced pluripotent stem cells.
[ "Genetic studies of Parkinson's disease over the last decade or more have revolutionized our understanding of this condition. α-Synuclein was the first gene to be linked to Parkinson's disease, and is arguably the most important: the protein is the principal constituent of Lewy bodies, and variation at its locus is the major genetic risk factor for sporadic disease. Intriguingly, duplications and triplications of the locus, as well as point mutations, cause familial disease. Therefore, subtle alterations of α-synuclein expression can manifest with a dramatic phenotype. We outline the clinical impact of α-synuclein locus multiplications, and the implications that this has for Parkinson's disease pathogenesis. Finally, we discuss potential strategies for disease-modifying therapies for this currently incurable disorder.", "We have previously linked families with autosomal-dominant, late-onset parkinsonism to chromosome 12p11.2-q13.1 (PARK8). By high-resolution recombination mapping and candidate gene sequencing in 46 families, we have found six disease-segregating mutations (five missense and one putative splice site mutation) in a gene encoding a large, multifunctional protein, LRRK2 (leucine-rich repeat kinase 2). It belongs to the ROCO protein family and includes a protein kinase domain of the MAPKKK class and several other major functional domains. Within affected carriers of families A and D, six post mortem diagnoses reveal brainstem dopaminergic degeneration accompanied by strikingly diverse pathologies. These include abnormalities consistent with Lewy body Parkinson's disease, diffuse Lewy body disease, nigral degeneration without distinctive histopathology, and progressive supranuclear palsy-like pathology. Clinical diagnoses of Parkinsonism with dementia or amyotrophy or both, with their associated pathologies, are also noted. Hence, LRRK2 may be central to the pathogenesis of several major neurodegenerative disorders associated with parkinsonism.", "Phosphatase and tensin homolog-induced putative kinase 1 gene mutations have been associated with autosomal recessive early-onset Parkinson's disease. To date, no neuropathological reports have been published from patients with Parkinson's disease with both phosphatase and tensin homolog-induced putative kinase 1 gene copies mutated. We analysed the coding region of phosphatase and tensin homolog-induced putative kinase 1 gene in a large Spanish family with six members with parkinsonism. The phenotype was characterized by an early-onset (mean: 31.6, standard deviation: 9.6 years, range: 14-45 years), slowly progressive levodopa-responsive parkinsonism, initial gait impairment and psychiatric symptoms. We identified two segregating pathogenic phosphatase and tensin homolog-induced putative kinase 1 mutations that were either in homozygous or heterozygous compound state in all affected family members. We found an exon 7 deletion (g.16089_16383del293; c.1252_1488del) and a novel+1U1-dependent 5' splice-site mutation in exon 7 (g.16378G>A; c.1488+1G>A). Leukocyte-derived messenger RNA analysis showed that both mutations caused exon 7 skipping and c.1488+1G>A also lead to an in-frame transcript with a 33 base-pair deletion (p.L485_R497del) resulting from activation of a 5' cryptic exon 7 splice site. Single photon emission computed tomography quantification of striatal dopamine transporter binding (123I-Ioflupane) revealed a posterior-anterior gradient similar to that of idiopathic Parkinson's disease, but there was no correlation between striatal reduced uptake and disease duration. Post-mortem neuropathological examination of an early-onset Parkinson's disease carrier of two heterozygous compound phosphatase and tensin homolog-induced putative kinase 1 mutations showed neuronal loss in the substantia nigra pars compacta, Lewy bodies and aberrant neurites in the reticular nuclei of the brainstem, substantia nigra pars compacta and Meynert nucleus, but the locus ceruleus and the amygdala were spared. This is the first neuropathological report of the brain from an early-onset phosphatase and tensin homolog-induced putative kinase 1-linked parkinsonism showing that mutated phosphatase and tensin homolog-induced putative kinase 1 protein induces Lewy body pathology. Unbalanced preservation of the locus ceruleus may well play a role in the slow evolution of motor symptoms and, probably, in the psychiatric symptoms often encountered in Parkinson's disease associated with phosphatase and tensin homolog-induced putative kinase 1 mutation.", "PARKIN, an E3 ligase mutated in familial Parkinson's disease, promotes mitophagy by ubiquitinating mitochondrial proteins for efficient engagement of the autophagy machinery. Specifically, PARKIN-synthesized ubiquitin chains represent targets for the PINK1 kinase generating phosphoS65-ubiquitin (pUb), which constitutes the mitophagy signal. Physiological regulation of PARKIN abundance, however, and the impact on pUb accumulation are poorly understood. Using cells designed to discover physiological regulators of PARKIN abundance, we performed a pooled genome-wide CRISPR/Cas9 knockout screen. Testing identified genes individually resulted in a list of 53 positive and negative regulators. A transcriptional repressor network including THAP11 was identified and negatively regulates endogenous PARKIN abundance. RNAseq analysis revealed the PARKIN-encoding locus as a prime THAP11 target, and THAP11 CRISPR knockout in multiple cell types enhanced pUb accumulation. Thus, our work demonstrates the critical role of PARKIN abundance, identifies regulating genes, and reveals a link between transcriptional repression and mitophagy, which is also apparent in human induced pluripotent stem cell-derived neurons, a disease-relevant cell type.", "Rab proteins are small molecular weight guanosine triphosphatases involved in the regulation of vesicular trafficking.(1) Three of 4 X-linked RAB genes are specific to the brain, including RAB39B. Recently, Wilson et al.(2) reported that mutations in RAB39B cause X-linked intellectual disability (ID) and pathologically confirmed Parkinson disease (PD). They identified a ∼45-kb deletion resulting in the complete loss of RAB39B in an Australian kindred and a missense mutation in a large Wisconsin kindred. Here, we report an additional affected man with typical PD and mild mental retardation harboring a new truncating mutation in RAB39B.", "Several studies report an association between REM Sleep Behavior Disorder (RBD) and neurodegenerative diseases, in particular synucleinopathies. Interestingly, the onset of RBD precedes the development of neurodegeneration by several years. This review and meta-analysis aims to establish the rate of conversion of RBD into neurodegenerative diseases. Longitudinal studies were searched from the PubMed, Web of Science, and SCOPUS databases. Using random-effect modeling, we performed a meta-analysis on the rate of RBD conversions into neurodegeneration. Furthermore, we fitted a Kaplan-Meier analysis and compared the differences between survival curves of different diseases with log-rank tests. The risk for developing neurodegenerative diseases was 33.5% at five years follow-up, 82.4% at 10.5 years and 96.6% at 14 years. The average conversion rate was 31.95% after a mean duration of follow-up of 4.75 ± 2.43 years. The majority of RBD patients converted to Parkinson's Disease (43%), followed by Dementia with Lewy Bodies (25%). The estimated risk for RBD patients to develop a neurodegenerative disease over a long-term follow-up is more than 90%. Future studies should include control group for the evaluation of REM sleep without atonia as marker for neurodegeneration also in non-clinical population and target RBD as precursor of neurodegeneration to develop protective trials.", "Protein aggregates and damaged organelles are tagged with ubiquitin chains to trigger selective autophagy. To initiate mitophagy, the ubiquitin kinase PINK1 phosphorylates ubiquitin to activate the ubiquitin ligase parkin, which builds ubiquitin chains on mitochondrial outer membrane proteins, where they act to recruit autophagy receptors. Using genome editing to knockout five autophagy receptors in HeLa cells, here we show that two receptors previously linked to xenophagy, NDP52 and optineurin, are the primary receptors for PINK1- and parkin-mediated mitophagy. PINK1 recruits NDP52 and optineurin, but not p62, to mitochondria to activate mitophagy directly, independently of parkin. Once recruited to mitochondria, NDP52 and optineurin recruit the autophagy factors ULK1, DFCP1 and WIPI1 to focal spots proximal to mitochondria, revealing a function for these autophagy receptors upstream of LC3. This supports a new model in which PINK1-generated phospho-ubiquitin serves as the autophagy signal on mitochondria, and parkin then acts to amplify this signal. This work also suggests direct and broader roles for ubiquitin phosphorylation in other autophagy pathways." ]
Validation of canine serum cortisol determination with the Immulite 2000 Xpi cortisol immunoassay
We report the results of validation of canine serum cortisol determination with the Immulite 2000 Xpi cortisol immunoassay (Siemens), with characterization of precision (CV), accuracy (spiking-recovery [SR] bias), and observed total error (TEo = bias + 2CV) across the reportable range, specifically at the most common interpretation thresholds for dynamic testing. Imprecision increased at increasing rate with decreasing serum cortisol concentration and bias was low, resulting in increasing TEo with decreasing serum cortisol concentration. Inter-laboratory comparison study allowed for determination of range-based bias (RB) and average bias (AB). At 38.6 and 552 nmol/L (1.4 and 20 μg/dL), between-run CV was 10% and 7.5%, respectively, and TEo ~30% and ~20%, respectively (TEo remained similar regardless of the considered bias: SR, RB, or AB). These analytical performance parameters should be considered in the interpretation of results and for future expert consensus discussions to determine recommendations for allowable total error (TEa). Importantly, the commonly used thresholds for interpretation of results were determined ~40 y ago with different methods of measurements and computation, hence updating is desirable. Quality control material (QCM) had between-run imprecision of 4% for QCM1 and 7% for QCM2; the bias was minimal for both levels. Acceptable QC rules are heavily dependent on the desired TEa for the QCM system (TEa
[ "In a contemporary clinical laboratory it is very common to have to assess the agreement between two quantitative methods of measurement. The correct statistical approach to assess this degree of agreement is not obvious. Correlation and regression studies are frequently proposed. However, correlation studies the relationship between one variable and another, not the differences, and it is not recommended as a method for assessing the comparability between methods.
 In 1983 Altman and Bland (B&A) proposed an alternative analysis, based on the quantification of the agreement between two quantitative measurements by studying the mean difference and constructing limits of agreement.
 The B&A plot analysis is a simple way to evaluate a bias between the mean differences, and to estimate an agreement interval, within which 95% of the differences of the second method, compared to the first one, fall. Data can be analyzed both as unit differences plot and as percentage differences plot.
 The B&A plot method only defines the intervals of agreements, it does not say whether those limits are acceptable or not. Acceptable limits must be defined a priori, based on clinical necessity, biological considerations or other goals.
 The aim of this article is to provide guidance on the use and interpretation of Bland Altman analysis in method comparison studies.", "Determining a simple quality control (QC) rule for daily performance monitoring depends on the desired total allowable error (TEa) for the measurand. When no consensus TEa exists, the classical approach of QC rule validation cannot be used. Using the results of previous canine serum and urine cortisol validation studies on the Immulite 2000 Xpi, we applied a reverse engineering approach to QC rule determination, arbitrarily imposing sigma = 5, and determining the resulting TEa for the QC material (QCM; TEaQCM) and the resulting probability of error detection (Ped) for each QC rule. For the simple QC rule 12.5S with Ped = 0.96 and probability of false rejection (Pfr) = 0.03, the associated TEaQCM were 20% and 35% for serum and 28% and 24% for urine QCM1 and QCM2. If these levels of TEaQCM are acceptable for interpretation of patient sample results, then users can internally validate the 12.5S QC rule, provided that their QCM CVs and biases are similar to ours. Otherwise, more stringent QC rules can be validated by using a lower sigma to lower the TEaQCM. With spiked samples (relevant cortisol concentrations in the veterinary patient matrix) at 38.6 and 552 nmol/L of cortisol, TEaQCM at sigma = 5 were much higher (54% and 40% for serum; 90.3% and 42.8% for urine). Spiked samples generate TEa that is probably too high to be suitable for daily QC monitoring; however, it is crucial to verify spiked sample observed total error (TEo; 26% and 18% for serum, 60% and 30% for urine) < TEaQCM, and to use spiked sample TEo for patient result interpretation. In the absence of consensus TEa for cortisol in dogs, we suggest the use of a 12.5S rule, provided that users accept the associated level of TEaQCM also as clinical TEa for results interpretation.", "Species-specific plasma or serum pools are considered the ideal standard material for quality control materials (QCM) instead of commercially available human QCM. However, using plasma or serum pools is limited by volume restrictions, degradation over time, and a narrow range of analyte concentrations. Concentrations of QCM analytes should be consistent or commutable with those from species-specific plasma/serum samples, and the precision from plasma pools should be comparable or interchangeable with commercial human QCM. The aims of this study were to determine the commutability and interchangeability of 2 levels of commercial QCM (MAS chemTRAK-H [CT]) with feline plasma pools (PP) from normal and renal disease cats measured using a commercial laboratory analyzer and a veterinary in-house analyzer. Agreement between the 2 analyzers was assessed for 16 analytes by correlation and Passing-Bablok regression analyses of feline plasma samples. The difference between each CT data point and the regression line (residuals) was determined and standardized, and CT were considered 'commutable' with PP if the standardized residual was within a range of -3 to 3. Coefficients of variation (CVs) for CT and PP for 16 analytes on 2 analyzers were compared by bootstrap analysis to determine interchangeability. Most CT analytes were within the range of patient plasma sample analytes, thus commutable. Only 2 analytes had equivalent precision for both levels of CT and both levels of PP, and 5 additional analytes had similar precision for at least one level of CT compared to at least one level of PP. The QCM assessed is commutable to feline PP within the tested ranges for 2 particular analyzers. Commutability does not grant interchangeability.", "Procedures for the statistical evaluation of method comparisons and instrument tests often have a requirement for distributional properties of the experimental data, but this requirement is frequently not met. In our paper we propose a new linear regression procedure with no special assumptions regarding the distribution of the samples and the measurement errors. The result does not depend on the assignment of the methods (instruments) to X and Y. After testing a linear relationship between X and Y confidence limits are given for the slope beta and the intercept alpha; they are used to determine whether there is only a chance difference between beta and 1 and between alpha and 0. The mathematical background is amplified separately in an appendix.", "The biochemical characterization of 22 cases of pituitary-dependent hyperadrenocorticism in the dog, is reported. The principal characteristics of the disease include excessive and non-rhythmic production of cortisol, decreased sensitivity of the hypothalamic-pituitary system to the suppressive effects of dexamethasone, decreased responsiveness of the pituitary-adrenocortical system to the stimulus of insulin-induced hypoglycaemia and increased responsiveness of the system to stimulation with lysine-vasopressin. From these observations it is concluded that pituitary-dependent hyperadrenocorticism in the dog is a valid model for study of the pathogenesis of the disease in man. For the diagnosis of hyperadrenocorticism itself, the measurement of the concentration of corticosteroids in a single sample of plasma obtained 8 h after intravenous injection of 0.01 mg dexamethasone/kg was sufficient. The level of 11-hydroxycorticosteroids was less than 140 nmol/1 plasma in normal dogs, whereas higher values were found in dogs with hyperadrenocorticism. For purposes of differential diagnosis, measurement of the level of corticosteroids in the plasma both before and 4 h after intravenous injection of 0.05 mg dexamethasone/kg is adequage: suppression is obtained only in cases of pituitary-dependent hyperadrenocorticism.", "In clinical measurement comparison of a new measurement technique with an established one is often needed to see whether they agree sufficiently for the new to replace the old. Such investigations are often analysed inappropriately, notably by using correlation coefficients. The use of correlation is misleading. An alternative approach, based on graphical techniques and simple calculations, is described, together with the relation between this analysis and the assessment of repeatability.", "The comparison of methods experiment is important part in process of analytical methods and instruments validation. Passing and Bablok regression analysis is a statistical procedure that allows valuable estimation of analytical methods agreement and possible systematic bias between them. It is robust, non-parametric, non sensitive to distribution of errors and data outliers. Assumptions for proper application of Passing and Bablok regression are continuously distributed data and linear relationship between data measured by two analytical methods. Results are presented with scatter diagram and regression line, and regression equation where intercept represents constant and slope proportional measurement error. Confidence intervals of 95% of intercept and slope explain if their value differ from value zero (intercept) and value one (slope) only by chance, allowing conclusion of method agreement and correction action if necessary. Residual plot revealed outliers and identify possible non-linearity. Furthermore, cumulative sum linearity test is performed to investigate possible significant deviation from linearity between two sets of data. Non linear samples are not suitable for concluding on method agreement." ]
Proline metabolism in cancer: a review
Proline is a non-essential amino acid with key roles in protein structure/function and maintenance of cellular redox homeostasis. It is available from dietary sources, generated de novo within cells, and released from protein structures; a noteworthy source being collagen. Its catabolism within cells can generate ATP and reactive oxygen species (ROS). Recent findings suggest that proline biosynthesis and catabolism are essential processes in disease; not only due to the role in new protein synthesis as part of pathogenic processes but also due to the impact of proline metabolism on the wider metabolic network through its significant role in redox homeostasis. This is particularly clear in cancer proliferation and metastatic outgrowth. Nevertheless, the precise identity of the drivers of cellular proline catabolism and biosynthesis, and the overall cost of maintaining appropriate balance is not currently known. In this review, we explore the major drivers of proline availability and consumption at a local and systemic level with a focus on cancer. Unraveling the main factors influencing proline metabolism in normal physiology and disease will shed light on new effective treatment strategies.
[ "Muscle protein breakdown (MPB) is an important metabolic component of muscle remodeling, adaptation to training, and increasing muscle mass. Degradation of muscle proteins occurs via the integration of three main systems-autophagy and the calpain and ubiquitin-proteasome systems. These systems do not operate independently, and the regulation is complex. Complete degradation of a protein requires some combination of the systems. Determination of MPB in humans is technically challenging, leading to a relative dearth of information. Available information on the dynamic response of MPB primarily comes from stable isotopic methods with expression and activity measures providing complementary information. It seems clear that resistance exercise increases MPB, but not as much as the increase in muscle protein synthesis. Both hyperaminoacidemia and hyperinsulinemia inhibit the post-exercise response of MPB. Available data do not allow a comprehensive examination of the mechanisms behind these responses. Practical nutrition recommendations for interventions to suppress MPB following exercise are often made. However, it is likely that some degree of increased MPB following exercise is an important component for optimal remodeling. At this time, it is not possible to determine the impact of nutrition on any individual muscle protein. Thus, until we can develop and employ better methods to elucidate the role of MPB following exercise and the response to nutrition, recommendations to optimize post exercise nutrition should focus on the response of muscle protein synthesis. The aim of this review is to provide a comprehensive examination of the state of knowledge, including methodological considerations, of the response of MPB to exercise and nutrition in humans.", "Tumors kill patients not only through well-characterized perturbations to their local environment but also through poorly understood pathophysiological interactions with distant tissues. Here, we use a Drosophila tumor model to investigate the elusive mechanisms underlying such long-range interactions. Transplantation of tumors into adults induces robust wasting of adipose, muscle, and gonadal tissues that are distant from the tumor, phenotypes that resemble the cancer cachexia seen in human patients. Notably, malignant, but not benign, tumors induce peripheral wasting. We identify the insulin growth factor binding protein (IGFBP) homolog ImpL2, an antagonist of insulin signaling, as a secreted factor mediating wasting. ImpL2 is sufficient to drive tissue loss, and insulin activity is reduced in peripheral tissues of tumor-bearing hosts. Importantly, knocking down ImpL2, specifically in the tumor, ameliorates wasting phenotypes. We propose that the tumor-secreted IGFBP creates insulin resistance in distant tissues, thus driving a systemic wasting response.", "Metabolite transport is a major function of the retinal pigment epithelium (RPE) to support the neural retina. RPE dysfunction plays a significant role in retinal degenerative diseases. We have used mass spectrometry with 13C tracers to systematically study nutrient consumption and metabolite transport in cultured human fetal RPE. LC/MS-MS detected 120 metabolites in the medium from either the apical or basal side. Surprisingly, more proline is consumed than any other nutrient, including glucose, taurine, lipids, vitamins, or other amino acids. Besides being oxidized through the Krebs cycle, proline is used to make citrate via reductive carboxylation. Citrate, made either from 13C proline or from 13C glucose, is preferentially exported to the apical side and is taken up by the retina. In conclusion, RPE cells consume multiple nutrients, including glucose and taurine, but prefer proline, and they actively synthesize and export metabolic intermediates to the apical side to nourish the outer retina.", "Although genomewide RNA expression analysis has become a routine tool in biomedical research, extracting biological insight from such information remains a major challenge. Here, we describe a powerful analytical method called Gene Set Enrichment Analysis (GSEA) for interpreting gene expression data. The method derives its power by focusing on gene sets, that is, groups of genes that share common biological function, chromosomal location, or regulation. We demonstrate how GSEA yields insights into several cancer-related data sets, including leukemia and lung cancer. Notably, where single-gene analysis finds little similarity between two independent studies of patient survival in lung cancer, GSEA reveals many biological pathways in common. The GSEA method is embodied in a freely available software package, together with an initial database of 1,325 biologically defined gene sets.", "Fibrosis is defined by the overgrowth, hardening, and/or scarring of various tissues and is attributed to excess deposition of extracellular matrix components including collagen. Fibrosis is the end result of chronic inflammatory reactions induced by a variety of stimuli including persistent infections, autoimmune reactions, allergic responses, chemical insults, radiation, and tissue injury. Although current treatments for fibrotic diseases such as idiopathic pulmonary fibrosis, liver cirrhosis, systemic sclerosis, progressive kidney disease, and cardiovascular fibrosis typically target the inflammatory response, there is accumulating evidence that the mechanisms driving fibrogenesis are distinct from those regulating inflammation. In fact, some studies have suggested that ongoing inflammation is needed to reverse established and progressive fibrosis. The key cellular mediator of fibrosis is the myofibroblast, which when activated serves as the primary collagen-producing cell. Myofibroblasts are generated from a variety of sources including resident mesenchymal cells, epithelial and endothelial cells in processes termed epithelial/endothelial-mesenchymal (EMT/EndMT) transition, as well as from circulating fibroblast-like cells called fibrocytes that are derived from bone-marrow stem cells. Myofibroblasts are activated by a variety of mechanisms, including paracrine signals derived from lymphocytes and macrophages, autocrine factors secreted by myofibroblasts, and pathogen-associated molecular patterns (PAMPS) produced by pathogenic organisms that interact with pattern recognition receptors (i.e. TLRs) on fibroblasts. Cytokines (IL-13, IL-21, TGF-beta1), chemokines (MCP-1, MIP-1beta), angiogenic factors (VEGF), growth factors (PDGF), peroxisome proliferator-activated receptors (PPARs), acute phase proteins (SAP), caspases, and components of the renin-angiotensin-aldosterone system (ANG II) have been identified as important regulators of fibrosis and are being investigated as potential targets of antifibrotic drugs. This review explores our current understanding of the cellular and molecular mechanisms of fibrogenesis.", "Cancer cells demand excess nutrients to support their proliferation, but how tumours exploit extracellular amino acids during systemic metabolic perturbations remain incompletely understood. Here, we use a Drosophila model of high-sugar diet (HSD)-enhanced tumourigenesis to uncover a systemic host-tumour metabolic circuit that supports tumour growth. We demonstrate coordinate induction of systemic muscle wasting with tumour-autonomous Yorkie-mediated SLC36-family amino acid transporter expression as a proline-scavenging programme to drive tumourigenesis. We identify Indole-3-propionic acid as an optimal amino acid derivative to rationally target the proline-dependency of tumour growth. Insights from this whole-animal Drosophila model provide a powerful approach towards the identification and therapeutic exploitation of the amino acid vulnerabilities of tumourigenesis in the context of a perturbed systemic metabolic network." ]
Prostate cancer is caused by genomic aberration in normal epithelial cells
Prostate cancer is caused by genomic aberrations in normal epithelial cells, however clinical translation of findings from analyses of cancer cells alone has been very limited. A deeper understanding of the tumour microenvironment is needed to identify the key drivers of disease progression and reveal novel therapeutic opportunities.
[ "Hypoxia is a common phenomenon occurring in the majority of human tumors and has been proved to play an important role in tumor progression. However, it remains unclear that whether the action of hypoxia on macrophages is a main driving force of hypoxia-mediated aggressive tumor behaviors. In the present study, we observe that high density of M2 macrophages is associated with metastasis in adenocarcinoma Non-Small Cell Lung Cancer (NSCLC) patients. By applying the in vivo hypoxia model, the results suggest that intermittent hypoxia significantly promotes the metastasis of Lewis lung carcinoma (LLC), accompanied with more CD209+ macrophages infiltrated in primary tumor tissue. More intriguingly, by skewing macrophages polarization away from the M1- to a tumor-promoting M2-like phenotype, hypoxia and IL-6 cooperate to enhance the LLC metastasis both in vitro and in vivo. In addition, we also demonstrate that skewing of macrophage M2 polarization by hypoxia relies substantially on activation of ERK signaling. Collectively, these observations unveil a novel tumor hypoxia concept involving the macrophage phenotype shift and provide direct evidence for lung cancer intervention through modulating the phenotype of macrophages.", "Intraductal carcinoma (IDC) and cribriform architecture (CA) represent unfavorable subpathologies in localized prostate cancer. We recently showed that IDC shares a clonal ancestry with the adjacent glandular adenocarcinoma. We investigated for the co-occurrence of \"aggression\" factors, genomic instability and hypoxia, and performed gene expression profiling of these tumors. A total of 1325 men were treated for localized prostate cancer from four academic institutions (University Health Network, CHU de Québec-Université Laval, Memorial Sloan Kettering Cancer Center [MSKCC], and Erasmus Medical Center). Pathological specimens were centrally reviewed. Gene copy number and expression, and intraprostatic oxygenation were assessed. IDC/CA was separately assessed for biochemical relapse risk in the Canadian and MSKCC cohorts. Both cohorts were pooled for analyses on metastasis. Presence of IDC/CA independently predicted for increased risks of biochemical relapse (HRCanadian 2.17, p<0.001; HRMSKCC 2.32, p=0.0035) and metastasis (HRpooled 3.31, p<0.001). IDC/CA+ cancers were associated with an increased percentage of genome alteration (PGA [median] 7.2 vs 3.0, p<0.001), and hypoxia (64.0% vs 45.5%, p=0.17). Combinatorial genomic-pathological indices offered the strongest discrimination for metastasis (C-index 0.805 [clinical+IDC/CA+PGA] vs 0.786 [clinical+IDC/CA] vs 0.761 [clinical]). Profiling of mRNA abundance revealed that long noncoding RNA, SChLAP1, was the only gene expressed at >3-fold higher (p<0.0001) in IDC/CA+ than in IDC/CA- tumors, independently corroborated by increased SChLAP1 RNA in situ hybridization signal. Optimal treatment intensification for IDC/CA+ prostate cancer requires prospective testing. The poor outcome associated with IDC and CA subpathologies is associated with a constellation of genomic instability, SChLAP1 expression, and hypoxia. We posit a novel concept in IDC/CA+ prostate cancer, \"nimbosus\" (gathering of stormy clouds, Latin), which manifests as increased metastatic capacity and lethality. A constellation of unfavorable molecular characteristics co-occur with intraductal and cribriform subpathologies in prostate cancer. Modern imaging for surveillance and treatment intensification trials should be considered in this adverse subgroup.", "Sphingosine-1-phosphate (S1P) is a bioactive lipid mediator that regulates many processes in inflammation and cancer. S1P is a ligand for five G-protein-coupled receptors, S1PR1 to -5, and also has important intracellular actions. Previously, we showed that intracellular S1P is involved in tumor necrosis factor alpha (TNF)-induced NF-κB activation in melanoma cell lines that express filamin A (FLNA). Here, we show that extracellular S1P activates NF-κB only in melanoma cells that lack FLNA. In these cells, S1P, but not TNF, promotes IκB kinase (IKK) and p65 phosphorylation, IκBα degradation, p65 nuclear translocation, and NF-κB reporter activity. NF-κB activation induced by S1P was mediated via S1PR1 and S1PR2. Exogenous S1P enhanced the phosphorylation of protein kinase Cδ (PKCδ), and its downregulation reduced S1P-induced the phosphorylation of IKK and p65. In addition, silencing of Bcl10 also inhibited S1P-induced IKK phosphorylation. Surprisingly, S1P reduced Akt activation in melanoma cells that express FLNA, whereas in the absence of FLNA, high phosphorylation levels of Akt were maintained, enabling S1P-mediated NF-κB signaling. In accord, inhibition of Akt suppressed S1P-mediated IKK and p65 phosphorylation and degradation of IκBα. Hence, these results support a negative role of FLNA in S1P-mediated NF-κB activation in melanoma cells through modulation of Akt.", "The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features.", "Prostate cancer is a leading cause of morbidity and cancer-related death worldwide. Androgen deprivation therapy (ADT) is the cornerstone of management for advanced disease. The use of these therapies is associated with multiple side effects, including metabolic syndrome and truncal obesity. At the same time, obesity has been associated with both prostate cancer development and disease progression, linked to its effects on chronic inflammation at a tissue level. The connection between ADT, obesity, inflammation and prostate cancer progression is well established in clinical settings; however, an understanding of the changes in adipose tissue at the molecular level induced by castration therapies is missing. Here, we investigated the transcriptional changes in periprostatic fat tissue induced by profound ADT in a group of patients with high-risk tumours compared to a matching untreated cohort. We find that the deprivation of androgen is associated with a pro-inflammatory and obesity-like adipose tissue microenvironment. This study suggests that the beneficial effect of therapies based on androgen deprivation may be partially counteracted by metabolic and inflammatory side effects in the adipose tissue surrounding the prostate.", "Macrophages infiltrating solid tumors exhibit a tumor-supporting phenotype and are critical for tumor development. Little is known which tumor-derived signal provokes this phenotype shift and how these signals are interpreted in macrophages to support tumor growth. We used the supernatant of apoptotic cells and noticed transcriptional, nuclear factor of activated T cells-dependent up-regulation of hypoxia-inducible factor (HIF)-1alpha mRNA, subsequent protein expression, and HIF-1 activity. Blocking calcineurin with cyclosporine A attenuated nuclear factor of activated T cells binding during electrophoretic mobility shift assay analysis and circumvented the HIF-1alpha mRNA increase. Knockdown experiments, receptor analysis, and antibody neutralization pointed to sphingosine-1-phosphate and transforming growth factor-beta as the initiators of the HIF-1 response. The use of macrophages from conditional HIF-1alpha knockout mice revealed that macrophages, under the impact of apoptotic cell supernatants, use HIF-1 to produce factors that induce CD31 expression in murine embryonic stem cells. Our study supports the notion that soluble factors produced from apoptotic tumor cells activate the HIF-1 system under normoxia in macrophages to enhance their tumor-promoting capacity by, for example, releasing vascular endothelial growth factor. This shows the importance of HIF-1-elicited responses in regulatory macrophages under normoxia.", "RNA-seq has been extensively used for transcriptome study. Quality control (QC) is critical to ensure that RNA-seq data are of high quality and suitable for subsequent analyses. However, QC is a time-consuming and complex task, due to the massive size and versatile nature of RNA-seq data. Therefore, a convenient and comprehensive QC tool to assess RNA-seq quality is sorely needed. We developed the RSeQC package to comprehensively evaluate different aspects of RNA-seq experiments, such as sequence quality, GC bias, polymerase chain reaction bias, nucleotide composition bias, sequencing depth, strand specificity, coverage uniformity and read distribution over the genome structure. RSeQC takes both SAM and BAM files as input, which can be produced by most RNA-seq mapping tools as well as BED files, which are widely used for gene models. Most modules in RSeQC take advantage of R scripts for visualization, and they are notably efficient in dealing with large BAM/SAM files containing hundreds of millions of alignments. RSeQC is written in Python and C. Source code and a comprehensive user's manual are freely available at: http://code.google.com/p/rseqc/." ]
Prognostic value of epithelial-mesenchymal transition-related long non-coding RNAs in gliomas
Epithelial-mesenchymal transition (EMT)-related long non-coding RNAs (lncRNAs) may be exploited as potential therapeutic targets in gliomas. However, the prognostic value of EMT-related lncRNAs in gliomas is unclear. We obtained lncRNAs from The Cancer Genome Atlas and constructed EMT-related lncRNA co-expression networks to identify EMT-related lncRNAs. The Chinese Glioma Genome Atlas (CGGA) was used for validation. Gene set enrichment and principal component analyses were used for functional annotation. The EMT-lncRNA co-expression networks were constructed. A real-time quantitative polymerase chain reaction assay was performed to validate the bioinformatics results. A nine-EMT-related lncRNAs (HAR1A, LINC00641, LINC00900, MIR210HG, MIR22HG, PVT1, SLC25A21-AS1, SNAI3-AS1, and SNHG18) signature was identified in patients with glioma. Patients in the low-risk group had a longer overall survival (OS) than those in the high-risk group (P < 0.0001). Additionally, patients in the high-risk group showed no deletion of chromosomal arms 1p and/or 19q, isocitrate dehydrogenase wild type, and higher World Health Organization grade. Moreover, the signature was identified as an independent factor and was significantly associated with OS (P = 0.041, hazard ratio = 1.806). These findings were further validated using the CGGA dataset. The low- and high-risk groups showed different EMT statuses based on principal component analysis. To study the regulatory function of lncRNAs, a lncRNA-mediated ceRNA network was constructed, which showed that complex interactions of lncRNA-miRNA-mRNA may be a potential cause of EMT progression in gliomas. This study showed that the nine-EMT-related lncRNA signature has a prognostic value in gliomas.
[ "'Gain' of supernumerary copies of the 8q24.21 chromosomal region has been shown to be common in many human cancers and is associated with poor prognosis. The well-characterized myelocytomatosis (MYC) oncogene resides in the 8q24.21 region and is consistently co-gained with an adjacent 'gene desert' of approximately 2 megabases that contains the long non-coding RNA gene PVT1, the CCDC26 gene candidate and the GSDMC gene. Whether low copy-number gain of one or more of these genes drives neoplasia is not known. Here we use chromosome engineering in mice to show that a single extra copy of either the Myc gene or the region encompassing Pvt1, Ccdc26 and Gsdmc fails to advance cancer measurably, whereas a single supernumerary segment encompassing all four genes successfully promotes cancer. Gain of PVT1 long non-coding RNA expression was required for high MYC protein levels in 8q24-amplified human cancer cells. PVT1 RNA and MYC protein expression correlated in primary human tumours, and copy number of PVT1 was co-increased in more than 98% of MYC-copy-increase cancers. Ablation of PVT1 from MYC-driven colon cancer line HCT116 diminished its tumorigenic potency. As MYC protein has been refractory to small-molecule inhibition, the dependence of high MYC protein levels on PVT1 long non-coding RNA provides a much needed therapeutic target.", "Several molecular mechanisms contribute directly and mechanically to the loss of epithelial phenotype. During epithelial-mesenchymal transition (EMT), adherens junctions and desmosomes are at least partially dissociated. At the same time, a massive cytoskeleton reorganization takes place, involving the rho family and the remodeling of the actin microfilament mesh. Numerous pathways have been described in vitro that control phenotype transition in specific cell models. In vivo developmental studies suggest that transcriptional control, activated by a specific pathway involving Ras, Src and potentially the Wnt pathway, is an essential step. Recent functional and localization experiments indicate that the slug/snail family of transcription factors functions overall as an epithelial phenotype repressor and could represent a key EMT contributor.", "In mammals and other eukaryotes most of the genome is transcribed in a developmentally regulated manner to produce large numbers of long non-coding RNAs (ncRNAs). Here we review the rapidly advancing field of long ncRNAs, describing their conservation, their organization in the genome and their roles in gene regulation. We also consider the medical implications, and the emerging recognition that any transcript, regardless of coding potential, can have an intrinsic function as an RNA.", "Snail1 is the founding member of the Snail superfamily of zinc-finger transcription factors, which also includes Snail2 (Slug) and Snail3 (Smuc). The superfamily is involved in cell differentiation and survival, two processes central in cancer research. Encoded by the SNAI1 gene located on human chromosome 20q13.2, Snail1 is composed of 264 amino acids and usually acts as a transcriptional repressor. Phosphorylation and nuclear localization of Snail1, governed by PI3K and Wnt signaling pathways crosstalk, are critical in Snail1's regulation. Snail1 has a pivotal role in the regulation of epithelial-mesenchymal transition (EMT), the process by which epithelial cells acquire a migratory, mesenchymal phenotype, as a result of its repression of E-cadherin. Snail1-induced EMT involves the loss of E-cadherin and claudins with concomitant upregulation of vimentin and fibronectin, among other biomarkers. While essential to normal developmental processes such as gastrulation, EMT is associated with metastasis, the cancer stem cell phenotype, and the regulation of chemo and immune resistance in cancer. Snail1 expression is a common sign of poor prognosis in metastatic cancer, and tumors with elevated Snail1 expression are disproportionately difficult to eradicate by current therapeutic treatments. The significance of Snail1 as a prognostic indicator, its involvement in the regulation of EMT and metastasis, and its roles in both drug and immune resistance point out that Snail1 is an attractive target for tumor growth inhibition and a target for sensitization to cytotoxic drugs.", "Cell cycle machinery controls not only cell growth but also cell survival and death. For example, overexpression of c-Myc or E2F1, which are involved in G1/S transition, causes apoptosis under certain conditions. Furthermore, endogenous E2F1 also participates in apoptosis, as evidenced by the defect of apoptosis in E2F1-deficient mice. Candidate molecules that mediate c-Myc- and E2F1-enhanced apoptosis include p14/p19ARF, ornithine decarboxylase and lactate dehydrogenase-A (for c-Myc) as well as p14/p19ARF, p73, Apaf-1 and caspase-3 (for E2F1). c-Myc also activates the CD95/Fas-FADD-mediated death signal. c-Myc and E2F1 inhibit NF-kappaB activities induced by TNFalpha or reactive oxygen species. Therefore, c-Myc and E2F1 regulate cell growth and death not only by inducing transcription but also by modulating signal transduction pathways.", "Balancing signals derived from the TGFbeta family is crucial for regulating cell proliferation and differentiation, and in establishing the embryonic axis during development. TGFbeta/BMP signaling leads to the activation and nuclear translocation of Smad proteins, which activate transcription of specific target genes by recruiting P/CAF and p300. The two members of the ZEB family of zinc finger factors (ZEB-1/deltaEF1 and ZEB-2/SIP1) regulate TGFbeta/BMP signaling in opposite ways: ZEB-1/deltaEF1 synergizes with Smad-mediated transcriptional activation, while ZEB-2/SIP1 represses it. Here we report that these antagonistic effects by the ZEB proteins arise from the differential recruitment of transcriptional coactivators (p300 and P/CAF) and corepressors (CtBP) to the Smads. Thus, while ZEB-1/deltaEF1 binds to p300 and promotes the formation of a p300-Smad transcriptional complex, ZEB-2/SIP1 acts as a repressor by recruiting CtBP. This model of regulation by ZEB proteins also functions in vivo, where they have opposing effects on the regulation of TGFbeta family-dependent genes during Xenopus development.", "The aim of the present study was to analyze the expression of Zinc finger E-box Binding homeobox 2 (ZEB2) in glioma and to explore the molecular mechanisms of ZEB2 that regulate cell proliferation, migration, invasion, and apoptosis. Expression of ZEB2 in 90 clinicopathologically characterized glioma patients was analyzed by immunohistochemistry. Furthermore, siRNA targeting ZEB2 was transfected into U251 and U87 glioma cell lines in vitro and proliferation, migration, invasion, and apoptosis were examined separately by MTT assay, Transwell chamber assay, flow cytometry, and western blot. The expression level of ZEB2 protein was significantly increased in glioma tissues compared to normal brain tissues (P<0.001). In addition, high levels of ZEB2 protein were positively correlated with pathology grade classification (P = 0.024) of glioma patients. Knockdown of ZEB2 by siRNA suppressed cell proliferation, migration and invasion, as well as induced cell apoptosis in glioma cells. Furthermore, ZEB2 downregulation was accompanied by decreased expression of CDK4/6, Cyclin D1, Cyclin E, E2F1, and c-myc, while p15 and p21 were upregulated. Lowered expression of ZEB2 enhanced E-cadherin levels but also inhibited β-Catenin, Vimentin, N-cadherin, and Snail expression. Several apoptosis-related regulators such as Caspase-3, Caspase-6, Caspase-9, and Cleaved-PARP were activated while PARP was inhibited after ZEB2 siRNA treatment. Overexpression of ZEB2 is an unfavorable factor that may facilitate glioma progression. Knockdown ZEB2 expression by siRNA suppressed cell proliferation, migration, invasion and promoted cell apoptosis in glioma cells.", "Gliomas represent approximately 30% of all central nervous system tumors and 80% of malignant brain tumors. To understand the molecular mechanisms underlying the malignant progression of low-grade gliomas with mutations in IDH1 (encoding isocitrate dehydrogenase 1), we studied paired tumor samples from 41 patients, comparing higher-grade, progressed samples to their lower-grade counterparts. Integrated genomic analyses, including whole-exome sequencing and copy number, gene expression and DNA methylation profiling, demonstrated nonlinear clonal expansion of the original tumors and identified oncogenic pathways driving progression. These include activation of the MYC and RTK-RAS-PI3K pathways and upregulation of the FOXM1- and E2F2-mediated cell cycle transitions, as well as epigenetic silencing of developmental transcription factor genes bound by Polycomb repressive complex 2 in human embryonic stem cells. Our results not only provide mechanistic insight into the genetic and epigenetic mechanisms driving glioma progression but also identify inhibition of the bromodomain and extraterminal (BET) family as a potential therapeutic approach.", "Cancer pathogenesis is restricted by stresses that compromise cell division and survival. In this study, we identify miR-708, a little studied member of a set of microRNAs that have been implicated in stress control, as an important tumor suppressor in renal cell carcinoma (RCC). miR-708 expression was attenuated widely in human RCC specimens. Restoration of miR-708 expression in RCC cell lines decreased cell growth, clonability, invasion, and migration and elicited a dramatic increase in apoptosis. Moreover, intratumoral delivery of miR-708 was sufficient to trigger in vivo regression of established tumors in murine xenograft models of human RCC. Investigation of the targets of miR-708 identified the inhibitor of apoptosis protein survivin as important. siRNA-mediated knockdown of survivin partially phenocopied miR-708 overexpression suggesting that the proapoptotic role of miR-708 may be mediated primarily through survivin regulation. Additionally, we identified the E-cadherin regulators ZEB2 and BMI1 as likely miR-708 targets. Taken together, our findings define a major tumor suppressive role for miR-708, which may offer an attractive new target for prognostic and therapeutic intervention in RCC.", "Numerous cell lines derived from human tumors are not HeLa contaminants. Of 192 lines established in this or other laboratories, 169 lines were found to be G6PD type B. Twenty-three lines were type A as HeLa; three of these were of Negroid origin. There is reasonable doubt that the remaining 20 lines will all be shown to be confounded with HeLa." ]
Cdc42 regulates polarized cell growth and morphogenesis
The highly conserved small GTPase Cdc42 regulates polarized cell growth and morphogenesis from yeast to humans. We previously reported that Cdc42 activation exhibits oscillatory dynamics at cell tips of
[ "Motile eukaryotic cells polarize in response to external signals. Numerous mechanisms have been suggested to account for this symmetry breaking and for the ensuing robust polarization. Implicated in this process are various proteins that are recruited to the plasma membrane and segregate at an emergent front or back of the polarizing cell. Among these are PI3K, PTEN, and members of the Rho family GTPases such as Cdc42, Rac, and Rho. Many such proteins, including the Rho GTPases, cycle between active membrane-bound forms and inactive cytosolic forms. In previous work, we have shown that this property, together with appropriate crosstalk, endows a biochemical circuit (Cdc42, Rac, and Rho) with the property of inherent polarizability. Here we show that this property is present in an even simpler system comprised of a single active/inactive protein pair with positive feedback to its own activation. The simplicity of this minimal system also allows us to explain the mechanism using insights from mathematical analysis. The basic idea resides in a well-known property of reaction-diffusion systems with bistable kinetics, namely, propagation of fronts. However, it crucially depends on exchange between active and inactive forms of the chemicals with unequal rates of diffusion, and overall conservation to pin the waves into a stable polar distribution. We refer to these dynamics as wave-pinning and we show that this phenomenon is distinct from Turing-instability-generated pattern formation that occurs in reaction-diffusion systems that appear to be very similar. We explain the mathematical basis of the phenomenon, relate it to spatial segregation of Rho GTPases, and show how it can account for spatial amplification and maintenance of polarity, as well as sensitivity to new stimuli typical in polarization of eukaryotic cells.", "Rho-GTPases are master regulators of polarity establishment and cell morphology. Positive feedback enables concentration of Rho-GTPases into clusters at the cell cortex, from where they regulate the cytoskeleton. Different cell types reproducibly generate either one (e.g. the front of a migrating cell) or several clusters (e.g. the multiple dendrites of a neuron), but the mechanistic basis for unipolar or multipolar outcomes is unclear. The design principles of Rho-GTPase circuits are captured by two-component reaction-diffusion models based on conserved aspects of Rho-GTPase biochemistry. Some such models display rapid winner-takes-all competition between clusters, yielding a unipolar outcome. Other models allow prolonged co-existence of clusters. We investigate the behavior of a simple class of models and show that while the timescale of competition varies enormously depending on model parameters, a single factor explains a large majority of this variation. The dominant factor concerns the degree to which the maximal active GTPase concentration in a cluster approaches a \"saturation point\" determined by model parameters. We suggest that both saturation and the effect of saturation on competition reflect fundamental properties of the Rho-GTPase polarity machinery, regardless of the specific feedback mechanism, which predict whether the system will generate unipolar or multipolar outcomes.", "In eukaryotes, cell polarity is essential for cell proliferation, differentiation, and development. It is regulated in 3 steps: establishment, maintenance, and transition. Compared to current knowledge of establishment and maintenance, the mechanism regulating the transition of cell polarity is poorly understood. In fission yeast during the G2 phase, growth polarity undergoes a dramatic transition, from monopolar to bipolar growth (termed NETO: new end take off). In this study, we screened systematically for protein kinases related to NETO using a genome-wide kinase deletion library. Analysis of these deletions suggested that 35 and 2 kinases had a putative positive and a negative role, respectively, in NETO. Moreover, 5 kinases were required for NETO-delay in the G1-arrested cdc10 mutant. These results suggest that many signaling pathways are involved in the regulation of NETO.", "Schizosaccharomyces pombe cdc42(+) regulates cell morphology and polarization of the actin cytoskeleton. Scd1p/Ral1p is the only described guanine nucleotide exchange factor (GEF) for Cdc42p in S. pombe. We have identified a new GEF, named Gef1p, specifically regulating Cdc42p. Gef1p binds to inactive Cdc42p but not to other Rho GTPases in two-hybrid assays. Overexpression of gef1(+) increases specifically the GTP-bound Cdc42p, and Gef1p is capable of stimulating guanine nucleotide exchange of Cdc42p in vitro. Overexpression of gef1(+) causes changes in cell morphology similar to those caused by overexpression of the constitutively active cdc42G12V allele. Gef1p localizes to the septum. gef1(+) deletion is viable but causes a mild cell elongation and defects in bipolar growth and septum formation, suggesting a role for Gef1p in the control of cell polarity and cytokinesis. The double mutant gef1delta scd1delta is not viable, indicating that they share an essential function as Cdc42p activators. However, both deletion and overexpression of either gef1(+) or scd1(+) causes different morphological phenotypes, which suggest different functions. Genetic evidence revealed a link between Gef1p and the signaling pathway of Shk1/Orb2p and Orb6p. In contrast, no genetic interaction between Gef1p and Shk2p-Mkh1p pathway was observed.", "The highly conserved small GTPase Cdc42p is a key regulator of cell polarity and cytoskeletal organization in eukaryotic cells. Multiple effectors of Cdc42p have been identified, although it is unclear how their activities are coordinated to produce particular cell behaviors. One strategy used to address the contributions made by different effector pathways downstream of small GTPases has been the use of \"effector-loop\" mutants of the GTPase that selectively impair only a subset of effector pathways. We now report the generation and preliminary characterization of a set of effector-loop mutants of Saccharomyces cerevisiae CDC42. These mutants define genetically separable pathways influencing actin or septin organization. We have characterized the phenotypic defects of these mutants and the binding defects of the encoded proteins to known yeast Cdc42p effectors in vitro. The results suggest that these effectors cannot account for the observed phenotypes, and therefore that unknown effectors exist that affect both actin and septin organization. The availability of partial function alleles of CDC42 in a genetically tractable system serves as a useful starting point for genetic approaches to identify such novel effectors.", "Regulation of polarised cell growth is essential for many cellular processes including spatial coordination of cell morphology changes during the division cycle. We present a mathematical model of the core mechanism responsible for the regulation of polarised growth dynamics during the fission yeast cell cycle. The model is based on the competition of growth zones localised at the cell tips for a common substrate distributed uniformly in the cytosol. We analyse the bifurcations in this model as the cell length increases, and show that the growth activation dynamics provides an explanation for the new-end take-off (NETO) as a saddle-node bifurcation at which the cell sharply switches from monopolar to bipolar growth. We study the parameter sensitivity of the bifurcation diagram and relate qualitative changes of the growth pattern, e.g. delayed or absent NETO, to previously observed mutant phenotypes. We investigate the effects of imperfect asymmetric cell division, and show that this leads to distinct growth patterns that provide experimentally testable predictions for validating the presented competitive growth zone activation model. Finally we discuss extension of the model for describing mutant cells with more than two growth zones.", "The small GTP-binding proteins of the Rho family, consisting of the Rho, Rac, and Cdc42 subfamilies, are implicated in various cell functions, such as cell shape change, cell motility and cytokinesis, through reorganization of actin cytoskeleton. Rho GDI is a general regulator which forms a complex with the GDP-bound inactive form of the Rho family members and inhibits their activation. We have purified Rho GDI from the yeast Saccharomyces cerevisiae, cloned its gene, and named it RDII (Rho GD). In this study, we have further characterized yeast Rho GDI. Rho GDI was found in the cytosol by immunoblot and immunofluorescence microscopic analyses. Rho1p and Cdc42p were co-immunoprecipitated with Rho GDI from the cytosol. This immunoprecipitated Rho1p was mainly bound to GDP. In the disruption mutant of Rho GDI, which did not show any apparent phenotype, both Rho1p and Cdc42p were also present in the cytosol. These results indicate that yeast Rho GDI possesses properties similar to those of mammalian Rho GDI, and that there is a cytosolic factor which functionally substitutes for Rho GDI in yeast." ]
Immune checkpoint inhibitors and hyperprogressive disease
Immunotherapy, which takes advantage of the immune system to eliminate cancer cells, has been widely studied and applied in oncology. Immune checkpoint inhibitors (ICIs) prevent the immune system from being turned off before cancer cells are eliminated. They have proven to be among the most promising and effective immunotherapies, with significant survival benefits and durable responses in diverse tumor types. However, an increasing number of retrospective studies have found that some patients treated with ICIs experience unusual responses, including accelerated proliferation of tumor cells and rapid progression of the disease, with poor outcomes. Such unexpected adverse events are termed hyperprogressive disease (HPD), and their occurrence suggests that ICIs are detrimental to a subset of cancer patients. HPD is common, with an incidence ranging between 4 and 29% in several cancer types. However, the mechanisms of HPD remain poorly understood, and no clinical predictive factors of HPD have been identified. In this review, we summarize current findings, including retrospective studies and case reports, and focus on several key issues including the defining characteristics, predictive biomarkers, potential mechanisms of HPD, and strategies for avoiding HPD after ICI treatment.
[ "Longitudinal circulating tumor DNA (ctDNA) has been shown to predict response and survival in patients with metastatic melanoma treated with anti-programmed cell death 1 (PD-1) antibodies. Pseudoprogression, defined as radiologic finding of disease progression prior to response, has been a challenge to clinicians. To establish whether ctDNA at baseline and up to week 12 of treatment can differentiate between the radiologic findings of pseudoprogression and true progression in patients with metastatic melanoma. This explorative biomarker study examined circulating BRAF and NRAS mutations in a cohort of 125 patients with melanoma receiving PD-1 antibodies alone or in combination with ipilimumab between July 3, 2014, and May 24, 2016. Pseudoprogression was defined retrospectively as radiologic progression not confirmed as progressive disease at the next radiologic assessment. Plasma samples of ctDNA at baseline and while receiving treatment were taken for analysis prospectively over the first 12 weeks of treatment. Favorable ctDNA profile (undetectable ctDNA at baseline or detectable ctDNA at baseline followed by >10-fold decrease) and unfavorable ctDNA profile (detectable ctDNA at baseline that remained stable or increased) were correlated with response and prognosis. Early differentiation of pseudoprogression from true progression using longitudinal ctDNA profile. According to guidelines by Response Evaluation Criteria in Solid Tumors (RECIST), progressive disease occurred in 29 of the 125 patients (23.2%). Of the 29 patients, 17 (59%) were 65 years or younger, 18 (62%) were men, 9 (31%) had pseudoprogression, and 20 (69%) had true progression. Of the 9 patients (7%) with confirmed pseudoprogression, all patients had a favorable ctDNA profile. At a median follow-up of 110 weeks, 7 of 9 patients (78%) were alive. All but 2 patients with true progression had an unfavorable ctDNA profile. Sensitivity of ctDNA for predicting pseudoprogression was 90% (95% CI, 68%-99%) and specificity was 100% (95% CI, 60%-100%). The 1-year survival for patients with RECIST-defined progressive disease and favorable ctDNA was 82% vs 39% for unfavorable ctDNA (hazard ratio [HR], 4.8; 95% CI, 1.6-14.3; P = .02). Overall survival was longer in patients with a partial response (54 of 125 patients [43%]) compared with patients with progressive disease and a favorable ctDNA profile (11 of 125 patients [9%]; HR, 0.09; 95% CI, 0.01-0.80; P < .01). The results demonstrate that ctDNA profiles can accurately differentiate pseudoprogression from true progression of disease in patients with melanoma treated with PD-1 antibodies. Results of this blood test performed at regular intervals during systemic treatment reflect tumor biology and have potential as a powerful biomarker to predict long-term response and survival.", "Ipilimumab, a fully human monoclonal antibody that blocks cytotoxic T-lymphocyte antigen-4, has demonstrated an improvement in overall survival in two phase III trials of patients with advanced melanoma. The primary objective of the current trial was to prospectively explore candidate biomarkers from the tumor microenvironment for associations with clinical response to ipilimumab. In this randomized, double-blind, phase II biomarker study (ClinicalTrials.gov NCT00261365), 82 pretreated or treatment-naïve patients with unresectable stage III/IV melanoma were induced with 3 or 10 mg/kg ipilimumab every 3 weeks for 4 doses; at Week 24, patients could receive maintenance doses every 12 weeks. Efficacy was evaluated per modified World Health Organization response criteria and safety was assessed continuously. Candidate biomarkers were evaluated in tumor biopsies collected pretreatment and 24 to 72 hours after the second ipilimumab dose. Polymorphisms in immune-related genes were also evaluated. Objective response rate, response patterns, and safety were consistent with previous trials of ipilimumab in melanoma. No associations between genetic polymorphisms and clinical activity were observed. Immunohistochemistry and histology on tumor biopsies revealed significant associations between clinical activity and high baseline expression of FoxP3 (p = 0.014) and indoleamine 2,3-dioxygenase (p = 0.012), and between clinical activity and increase in tumor-infiltrating lymphocytes (TILs) between baseline and 3 weeks after start of treatment (p = 0.005). Microarray analysis of mRNA from tumor samples taken pretreatment and post-treatment demonstrated significant increases in expression of several immune-related genes, and decreases in expression of genes implicated in cancer and melanoma. Baseline expression of immune-related tumor biomarkers and a post-treatment increase in TILs may be positively associated with ipilimumab clinical activity. The observed pharmacodynamic changes in gene expression warrant further analysis to determine whether treatment-emergent changes in gene expression may be associated with clinical efficacy. Further studies are required to determine the predictive value of these and other potential biomarkers associated with clinical response to ipilimumab.", "Cancer growth and progression are associated with immune suppression. Cancer cells have the ability to activate different immune checkpoint pathways that harbor immunosuppressive functions. Monoclonal antibodies that target immune checkpoints provided an immense breakthrough in cancer therapeutics. Among the immune checkpoint inhibitors, PD-1/PD-L1 and CTLA-4 inhibitors showed promising therapeutic outcomes, and some have been approved for certain cancer treatments, while others are under clinical trials. Recent reports have shown that patients with various malignancies benefit from immune checkpoint inhibitor treatment. However, mainstream initiation of immune checkpoint therapy to treat cancers is obstructed by the low response rate and immune-related adverse events in some cancer patients. This has given rise to the need for developing sets of biomarkers that predict the response to immune checkpoint blockade and immune-related adverse events. In this review, we discuss different predictive biomarkers for anti-PD-1/PD-L1 and anti-CTLA-4 inhibitors, including immune cells, PD-L1 overexpression, neoantigens, and genetic and epigenetic signatures. Potential approaches for further developing highly reliable predictive biomarkers should facilitate patient selection for and decision-making related to immune checkpoint inhibitor-based therapies.", "Programmed Death-1 (PD-1) has received considerable attention as a key regulator of CD8(+) T cell exhaustion during chronic infection and cancer because blockade of this pathway partially reverses T cell dysfunction. Although the PD-1 pathway is critical in regulating established \"exhausted\" CD8(+) T cells (TEX cells), it is unclear whether PD-1 directly causes T cell exhaustion. We show that PD-1 is not required for the induction of exhaustion in mice with chronic lymphocytic choriomeningitis virus (LCMV) infection. In fact, some aspects of exhaustion are more severe with genetic deletion of PD-1 from the onset of infection. Increased proliferation between days 8 and 14 postinfection is associated with subsequent decreased CD8(+) T cell survival and disruption of a critical proliferative hierarchy necessary to maintain exhausted populations long term. Ultimately, the absence of PD-1 leads to the accumulation of more cytotoxic, but terminally differentiated, CD8(+) TEX cells. These results demonstrate that CD8(+) T cell exhaustion can occur in the absence of PD-1. They also highlight a novel role for PD-1 in preserving TEX cell populations from overstimulation, excessive proliferation, and terminal differentiation.", "Significant anti-tumor responses have been reported in a small subset of cancer patients treated with the immunotherapeutic agent anti-CTLA-4 antibody. All clinical trials to date, comprising over 3,000 patients, have been conducted in the metastatic disease setting, which allows for correlation of drug administration with clinical outcome but has limited analyses of intermediate biomarkers to indicate whether the drug has impacted human immune responses within the tumor microenvironment. We conducted a pre-surgical clinical trial in six patients with localized bladder cancer, which allowed for correlation of drug administration with biomarkers in both blood and tumor tissues but did not permit correlation with clinical outcome. We found that CD4 T cells from peripheral blood and tumor tissues of all treated patients had markedly increased expression of inducible costimulator (ICOS). These CD4(+)ICOS(hi) T cells produced IFN-gamma (IFNgamma) and could recognize the tumor antigen NY-ESO-1. Increase in CD4(+)ICOS(hi) cells led to an increase in the ratio of effector to regulatory T cells. To our knowledge, these are the first immunologic changes reported in both tumor tissues and peripheral blood as a result of treatment with anti-CTLA-4 antibody, and they may be used to guide dosing and scheduling of this agent to improve clinical responses.", "A 63-year-old female presented to her primary physician with numbness and weakness in her left leg, which progressed over several days to involve her entire lower extremities. MRI of the spine and brain revealed multiple metastases. The patient received ipilimumab and after 3 months experienced intermittent confusion and focal seizures. Electroencephalogram and MRI scans of the spine and brain, followed by surgical removal of a left frontal cortical brain metastasis and subsequent histological and pathological analyses. Metastatic melanoma from an unknown primary tumor. The patient was treated with ipilimumab on a compassionate-use program and dexamethasone, celecoxib, and levetiracetam to treat the symptoms and seizures. Postoperative stereotactic radiosurgery was initiated.", "Macrophages constitute a major component of tumor-infiltrating immune cells. M2 macrophages have been reported to promote tumor progression through promoting tumor angiogenesis and metastasis and regulating T-cell function. Here, we identified a protumorigenic subset of macrophages that constitutively expressed programmed cell death 1 (PD1) and accumulated in advanced-stage gastric cancer (GC). These PD1+ tumor-associated macrophages (TAMs) exhibited an M2-like surface profile, with a significant increase in the expression of CD206, IL-10, and CCL1, and a clear decrease in the expression of MHC class II, CD64, and IL-12 and the ability to phagocytose ovalbumin. Moreover, PD1+ TAMs can suppress CD8+ T-cell function and this immunosuppressive activity can effectively be enhanced upon triggering PD1 signal. GC-derived exosomes effectively educated monocytes to differentiate into PD1+ TAMs with M2 phenotypic and functional characteristics. Together, our results are the first to show that GC-derived exosomes can effectively induce PD1+ TAM generation, and these cells can produce a large number of IL-10, impair CD8+ T-cell function, and thereby create conditions that promote GC progression. Thus, methods in which immunotherapy is combined with targeting PD1+ TAMs and tumor-derived exosomes should be used to restore immune function in GC patients.", "Delayed responses observed with immune checkpoint blockade (ICB) present a challenge for patients with peritoneal malignancies, who risk early symptomatic disease progression requiring treatment discontinuation. While efforts are ongoing to define the biomarkers of response, it is equally important to identify patients at risk for early discontinuation. We sought to investigate the timing of disease progression in epithelial ovarian cancer (EOC) patients treated with ICB and to identify pre-treatment clinical parameters associated with early discontinuation. Retrospective analysis was performed on EOC patients treated with ICB at MSKCC from January 2013 to May 2017. Cutoffs for early and very early discontinuation due to disease progression were defined at 12 and 8 weeks, respectively. Univariate and multivariate logistic regression models were built based on pre-treatment clinical variables. Of 108 identified patients, 89 were included in the analysis. Forty-six (51.7%) patients discontinued therapy early, 30 of which (33.7%) discontinued therapy very early. Eight patients (9.0%) died within 12 weeks of ICB initiation from disease progression. In multivariate analyses, bulky peritoneal disease (p = 0.009, OR: 4.94) and liver parenchymal metastases (p = 0.001, OR: 8.08) were associated with early discontinuation. Liver parenchymal metastases (p = 0.001, OR 6.64), and high neutrophil-to-lymphocyte ratio (p = 0.021, OR: 3.54), were associated with very early discontinuation. Over 50% of EOC patients suffer disease progression requiring early discontinuation of ICB. Pre-treatment prognostic clinical characteristics may identify patients at highest risk for early discontinuation due to disease progression and warrant caution in using these agents in late line patients with advanced disease.", "Despite the success of monotherapies based on blockade of programmed cell death 1 (PD-1) in human melanoma, most patients do not experience durable clinical benefit. Pre-existing T-cell infiltration and/or the presence of PD-L1 in tumours may be used as indicators of clinical response; however, blood-based profiling to understand the mechanisms of PD-1 blockade has not been widely explored. Here we use immune profiling of peripheral blood from patients with stage IV melanoma before and after treatment with the PD-1-targeting antibody pembrolizumab and identify pharmacodynamic changes in circulating exhausted-phenotype CD8 T cells (Tex cells). Most of the patients demonstrated an immunological response to pembrolizumab. Clinical failure in many patients was not solely due to an inability to induce immune reinvigoration, but rather resulted from an imbalance between T-cell reinvigoration and tumour burden. The magnitude of reinvigoration of circulating Tex cells determined in relation to pretreatment tumour burden correlated with clinical response. By focused profiling of a mechanistically relevant circulating T-cell subpopulation calibrated to pretreatment disease burden, we identify a clinically accessible potential on-treatment predictor of response to PD-1 blockade.", "Inhibitors of the PD-1/PD-L1 immune checkpoint have become a standard of care in non-small cell lung cancer (NSCLC). Patient selection, currently based on PD-L1 expression on tumor tissue, is limited by its temporal and spatial heterogeneity. We hypothesized that liquid biopsy with PD-L1 analysis on circulating tumor cells (CTCs) might overcome this limitation. Blood samples were prospectively collected from patients with advanced NSCLC before nivolumab treatment and at the time of progression. CTCs were isolated using a cell size-based technology. PD-L1 expression was assessed by immunofluorescence on CTCs and immunohistochemistry on tissue biopsies. 113 specimens from 96 patients were collected. Baseline PD-L1 expression could be assessed on 72% and 93% of tissue and CTC, respectively. CTCs were more frequently found to be PD-L1 positive than tissue (83% vs. 41%) and no correlation was observed between tissue and CTC PD-L1 expression (r = 0.04, p = 0.77). Pre-treatment high CTC number was associated with increased risk of death and progression (HR1.06, p = 0.03 for OS; HR1.05, p = 0.02 for PFS). The presence of pre-treatment PD-L1+CTC was not significantly correlated with outcomes but a higher baseline PD-L1+ CTC number (≥1%) was observed in the \"non-responders\" group (PFS <6 months) (p = 0.04) and PD-L1+CTC were seen in all patients at progression. Assessment of PD-L1 expression in CTCs is feasible and CTCs are more often positive than in tissue. Pre-treatment PD-L1+CTCs are associated with bad prognosis in patients treated with PD-1 inhibitors." ]
Molecular Targeting of TROAP in Clear Cell Renal Cell Carcinoma
Clear cell renal cell carcinoma (ccRCC) is a subtype of renal cell cancer with the highest mortality, infiltration, and metastasis rate, threatening human health. Despite oncogenic role of TROAP in various cancers, its function in ccRCC remains to be unraveled. The differentially expressed mRNAs (DEmRNAs) and miRNAs (DEmiRNAs) were obtained by analyzing the related data sets of ccRCC in TCGA. The expression levels of mRNAs and miRNAs in the cell were detected by qRT-PCR, while the protein levels were characterized by western blot. The viability, migratory and invasive abilities of ccRCC cells were determined by MTT, wound healing and cell invasion assays. The combination of miRNA target site prediction and dual-luciferase reporter gene assay verified the binding relationship between miR-532-3p and TROAP. Research on ccRCC displayed that TROAP expression was upregulated, while miR-532-3p was down-regulated. Besides, upregulation of TROAP could accelerate viability, migratory and invasive potentials of ccRCC cells. On the contrary, miR-532-3p could downregulate TROAP level, but TROAP upregulation reversed the viability, migration, and invasion of ccRCC cells. MiR-532-3p could attenuate the viability, migration and invasion of ccRCC cells by targeting TROAP. This may generate novel insights into molecular therapeutic targets for ccRCC.
[ "Hepatocellular carcinoma (HCC) is one of the most deadly cancers in the world due to its high metastatic potential. By using the isobaric tags for relative and absolute quantitation (iTRAQ)-based quantitative N-glycoproteomic analysis, 26 differentially expressed serum glycoproteins derived from defined stages in orthotopic xenograft tumor model were identified. Among them, expression level of soluble EGFR (sEGFR) was verified in HCC cell lines. We found that non-metastasis HCC cell lines express significantly more sEGFR than HCC cell lines with metastasis potential both in cell lysates and culture media. Serum samples from 28 non-metastatic HCC patients and 28 metastatic HCC patients were assayed. Compared with the non-metastatic HCC group, serum level of sEGFR in metastatic HCC group was statistically lower (p<0.01). All these results provide evidence that sEGFR is a potential candidate for metastasis-associated biomarkers of HCC. The related molecular mechanism deserves to be further explored.", "Purpose: Trophinin-associated protein (TROAP) is a cytoplasmic protein that plays a significant role in the processes of embryo transplantation and microtubule regulation. However, the relevant survival analysis and cancer progression analysis have not yet been reported. Methods: Eighteen matched pairs of tumor and adjacent non-tumor samples were evaluated to detect the TROAP mRNA level. Immunohistochemistry (IHC) was used to evaluate the TROAP expression in 108 hepatocellular carcinoma patients who underwent surgical resection. Meanwhile, data from the TCGA database was statistically evaluated. Results: In the present study, we detected a significant increase in the TROAP mRNA level in tumor tissues when compared with adjacent non-tumor tissues. Moreover, the upregulation of TROAP was associated with increased serum AFP and GGT; the greater the tumor number was, the larger the tumor size, differentiation grade, and cancer embolus in clinical analysis. In HCC patients, elevated TROAP expression in the primary tumor was positively related to clinical severity, such as poor overall survival and disease-free survival. In addition, both univariate and multivariate survival analysis validated that TROAP expression was a promising independent risk factor for overall survival and disease-free survival in HCC patients. Furthermore, the results derived from the analysis of data from the TCGA database were consistent with previous results. Altogether, our results show that TROAP is a novel crucial regulator of HCC progression and is a potential therapeutic biomarker for HCC patients. Conclusions: Elevated TROAP expression predicted a poor prognosis, and TROAP may serve as a potential biomarker for application in oncotherapy.", "Renal cell carcinoma (RCC) denotes cancer originated from the renal epithelium and accounts for >90% of cancers in the kidney. The disease encompasses >10 histological and molecular subtypes, of which clear cell RCC (ccRCC) is most common and accounts for most cancer-related deaths. Although somatic VHL mutations have been described for some time, more-recent cancer genomic studies have identified mutations in epigenetic regulatory genes and demonstrated marked intra-tumour heterogeneity, which could have prognostic, predictive and therapeutic relevance. Localized RCC can be successfully managed with surgery, whereas metastatic RCC is refractory to conventional chemotherapy. However, over the past decade, marked advances in the treatment of metastatic RCC have been made, with targeted agents including sorafenib, sunitinib, bevacizumab, pazopanib and axitinib, which inhibit vascular endothelial growth factor (VEGF) and its receptor (VEGFR), and everolimus and temsirolimus, which inhibit mechanistic target of rapamycin complex 1 (mTORC1), being approved. Since 2015, agents with additional targets aside from VEGFR have been approved, such as cabozantinib and lenvatinib; immunotherapies, such as nivolumab, have also been added to the armamentarium for metastatic RCC. Here, we provide an overview of the biology of RCC, with a focus on ccRCC, as well as updates to complement the current clinical guidelines and an outline of potential future directions for RCC research and therapy.", "Developmentally restricted differentiation antigens or cancer-placental antigens, tastin and bystin, are components of an adhesion molecule that plays a critical role in the implantation of the embryo to the uterus. Cell adhesion molecules have been implicated in the metastasis of carcinomas and could be critical targets for immunotherapy in epithelial ovarian carcinomas (EOCs). Our objectives were to define the expression of tastin and bystin proteins in EOCs. Expression of tastin and bystin mRNA in a panel of human tissues and 70 EOC specimens was investigated using qualitative polymerase chain reaction. Amplification products were confirmed by sequencing. Validation of results was performed using immunohistochemical analysis of tastin and bystin applied on a tissue microarray of 202 EOC tissues. The distribution of tastin and bystin expression and clinicopathologic variables were analyzed. Survival probabilities were estimated using the Kaplan-Meier method and statistical significance was determined by performing the logrank test. Expression of tastin and bystin was restricted to placental and testis tissue by qualitative polymerase chain reaction. Of the 70 EOC specimens tested with polymerase chain reaction, 89% and 94% expressed tastin and bystin, respectively. Immunoexpressions of tastin and bystin protein were observed in 69% and 80 % of the ovarian tumors, respectively. Tastin and bystin expression in Stage I/II disease were 66% and 67% compared with 69% and 81% in Stage III/IV disease, respectively. The tissue-restricted expression of tastin and bystin and their abundant expression in EOCs and advanced-stage disease make these developmentally restricted antigens attractive targets for antigen-specific immunotherapy in EOCs.", "Recent evidence suggests that hepatocellular carcinoma (HCC) is organized by a subset of cells with stem cell features (cancer stem cells; CSCs). CSCs are considered a pivotal target for the eradication of cancer, and liver CSCs have been identified by the use of various stem cell markers. However, little information is known about the expression patterns and characteristics of marker-positive CSCs, hampering the development of personalized CSC-targeted therapy. Here, we show that CSC markers EpCAM and CD90 are independently expressed in liver cancer. In primary HCC, EpCAM+ and CD90+ cells resided distinctively, and gene-expression analysis of sorted cells suggested that EpCAM+ cells had features of epithelial cells, whereas CD90+ cells had those of vascular endothelial cells. Clinicopathological analysis indicated that the presence of EpCAM+ cells was associated with poorly differentiated morphology and high serum alpha-fetoprotein (AFP), whereas the presence of CD90+ cells was associated with a high incidence of distant organ metastasis. Serial xenotransplantation of EpCAM+ /CD90+ cells from primary HCCs in immune-deficient mice revealed rapid growth of EpCAM+ cells in the subcutaneous lesion and a highly metastatic capacity of CD90+ cells in the lung. In cell lines, CD90+ cells showed abundant expression of c-Kit and in vitro chemosensitivity to imatinib mesylate. Furthermore, CD90+ cells enhanced the motility of EpCAM+ cells when cocultured in vitro through the activation of transforming growth factor beta (TGF-β) signaling, whereas imatinib mesylate suppressed TGFB1 expression in CD90+ cells as well as CD90+ cell-induced motility of EpCAM+ cells. Our data suggest the discrete nature and potential interaction of EpCAM+ and CD90+ CSCs with specific gene-expression patterns and chemosensitivity to molecular targeted therapy. The presence of distinct CSCs may determine the clinical outcome of HCC.", "Studies were done on analysis of biological processes in the same high expression (fold change ≥2) activated PTHLH feedback-mediated cell adhesion gene ontology (GO) network of human hepatocellular carcinoma (HCC) compared with the corresponding low expression activated GO network of no-tumor hepatitis/cirrhotic tissues (HBV or HCV infection). Activated PTHLH feedback-mediated cell adhesion network consisted of anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolism, cell adhesion, cell differentiation, cell-cell signaling, G-protein-coupled receptor protein signaling pathway, intracellular transport, metabolism, phosphoinositide-mediated signaling, positive regulation of transcription, regulation of cyclin-dependent protein kinase activity, regulation of transcription, signal transduction, transcription, and transport in HCC. We proposed activated PTHLH coupling feedback phosphoinositide to G-protein receptor signal-induced cell adhesion network. Our hypothesis was verified by the different activated PTHLH feedback-mediated cell adhesion GO network of HCC compared with the corresponding inhibited GO network of no-tumor hepatitis/cirrhotic tissues, or the same compared with the corresponding inhibited GO network of HCC. Activated PTHLH coupling feedback phosphoinositide to G-protein receptor signal-induced cell adhesion network included BUB1B, GNG10, PTHR2, GNAZ, RFC4, UBE2C, NRXN3, BAP1, PVRL2, TROAP, and VCAN in HCC from GEO dataset using gene regulatory network inference method and our programming.", "Hepatitis B virus (HBV) contributes to hepatocellular carcinoma (HCC) development through direct and indirect mechanisms. HBV DNA integration into the host genome occurs at early steps of clonal tumor expansion and induces both genomic instability and direct insertional mutagenesis of diverse cancer-related genes. Prolonged expression of the viral regulatory protein HBx and/or altered versions of the preS/S envelope proteins dysregulates cell transcription and proliferation control and sensitizes liver cells to carcinogenic factors. Accumulation of preS1 large envelope proteins and/or preS2/S mutant proteins activates the unfold proteins response, that can contribute to hepatocyte transformation. Epigenetic changes targeting the expression of tumor suppressor genes occur early in the development of HCC. A major role is played by the HBV protein, HBx, which is recruited on cellular chromatin and modulates chromatin dynamics at specific gene loci. Compared with tumors associated with other risk factors, HBV-related tumors have a higher rate of chromosomal alterations, p53 inactivation by mutations and overexpression of fetal liver/hepatic progenitor cells genes. The WNT/β-catenin pathway is also often activated but HBV-related tumors display a low rate of activating β-catenin mutations. HBV-related HCCs may arise on non-cirrhotic livers, further supporting the notion that HBV plays a direct role in liver transformation by triggering both common and etiology specific oncogenic pathways in addition to stimulating the host immune response and driving liver chronic necro-inflammation." ]
The long non-coding RNA plasmacytoma variant translocation1 and argonaute 1 axis promote ovarian cancer progression through sponging miR-148a-3p
Ovarian cancer is a lethal gynaecologic malignancy with poor diagnosis and prognosis. The long non-coding RNA plasmacytoma variant translocation1 (PVT1) and argonaute 1 (AGO1) are associated with carcinogenesis and chemoresistance; however, the relationship between PVT1 and AGO1 and the downstream mechanisms in ovarian cancer remains poorly known. PVT1 and AGO1 expression was assessed through RT-qPCR and Western blotting in both human tissues and cell lines. The viability and proliferation of ovarian cancer cells were determined by CCK-8 assay and TUNEL assay in vitro and immunohistochemistry in vivo. Cell invasion and migration were investigated through transwell and wound-healing assays. The roles and mechanisms of AGO1 on cell functions were further probed via gain- and loss-of-function analysis. We reveal that PVT1 expression was significantly increased in ovarian cancer tissues which is associated with advanced FIGO stage, lymph-node metastasis, poor survival rate, and high expression of AGO1. PVT1 or AGO1 knockdown significantly reduced the cell viability and increased the cell apoptosis and inhibited ovarian tumour growth and proliferation. Furthermore, we discovered that PVT1 up-regulated the expression of AGO1 and thus regulated the transforming growth factor-β (TGF-β) pathway to promote ovarian cancer progression through sponging miR-148a-3p. Additionally, the activation of ERK1/2, smad2 and smad4 is observed to be related to the PVT1/miR-148a-3p/AGO1/TGF-β pathway-induced cascades. Taken together, the present study reveals that PVT1/miR-148a/AGO1 axis plays an important role in the progression of ovarian cancer and emphasize the potential as a target of value for ovarian cancer therapy.
[ "Ovarian cancer is a leading cause of cancer deaths among women. Effective targets to treat advanced epithelial ovarian cancer (EOC) and biomarkers to predict treatment response are still lacking because of the complexity of pathways involved in ovarian cancer progression. Here we show that miR-181a promotes TGF-β-mediated epithelial-to-mesenchymal transition via repression of its functional target, Smad7. miR-181a and phosphorylated Smad2 are enriched in recurrent compared with matched-primary ovarian tumours and their expression is associated with shorter time to recurrence and poor outcome in patients with EOC. Furthermore, ectopic expression of miR-181a results in increased cellular survival, migration, invasion, drug resistance and in vivo tumour burden and dissemination. In contrast, miR-181a inhibition via decoy vector suppression and Smad7 re-expression results in significant reversion of these phenotypes. Combined, our findings highlight an unappreciated role for miR-181a, Smad7, and the TGF-β signalling pathway in high-grade serous ovarian cancer.", "Argonaute is at the heart of all effector complexes in RNA interference. In the classical RNAi pathway Argonaute functions as the Slicer enzyme that cleaves an mRNA target directed by a complementary siRNA. Two recently described Argonaute protein subfamilies mediate distinct functions in RNAi. The Piwi subfamily functions in the germline through a novel class of small RNAs that are longer than Argonaute-specific siRNAs and miRNAs. Piwi-interacting RNAs (piRNAs) carry a 2'-O-methylation on their 3' end and appear to be synthesized by a Piwi Slicer dependent mechanism. Piwi/piRNA complexes in mammals and flies are directly linked to the control of transposable elements during germline development. Amplified RNAi in C. elegans is mediated by secondary siRNAs selectively bound to secondary Argonautes (SAGOs) that belong to a worm-specific Argonaute subfamily (WAGO). Secondary siRNAs are 5' triphosphorylated that may allow specific loading into SAGO complexes that are rate limiting for RNAi in C. elegans. Interestingly, SAGOs lack conserved Slicer amino acid residues and probably act in a Slicer-independent fashion.", "Small RNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs) can silence target genes through several different effector mechanisms. Whereas siRNA-directed mRNA cleavage is increasingly understood, the mechanisms by which miRNAs repress protein synthesis are obscure. Recent studies have revealed the existence of specific cytoplasmic foci, referred to herein as processing bodies (P-bodies), which contain untranslated mRNAs and can serve as sites of mRNA degradation. Here we demonstrate that Argonaute proteins--the signature components of the RNA interference (RNAi) effector complex, RISC--localize to mammalian P-bodies. Moreover, reporter mRNAs that are targeted for translational repression by endogenous or exogenous miRNAs become concentrated in P-bodies in a miRNA-dependent manner. These results provide a link between miRNA function and mammalian P-bodies and suggest that translation repression by RISC delivers mRNAs to P-bodies, either as a cause or as a consequence of inhibiting protein synthesis.", "MicroRNAs (miRNAs) are small, noncoding RNAs with important functions in development, cell differentiation, and regulation of cell cycle and apoptosis. MiRNA expression is deregulated in cancer by a variety of mechanisms including amplification, deletion, mutation, and epigenetic silencing. Several studies have now shown that miRNAs are involved in the initiation and progression of cancer. In this review, we briefly describe miRNA biogenesis and discuss how miRNAs can act as oncogenes and tumor suppressors. We also address the role of miRNAs in the diagnosis, prognosis, and treatment of cancer.", "Short RNAs mediate gene silencing, a process associated with virus resistance, developmental control and heterochromatin formation in eukaryotes. RNA silencing is initiated through Dicer-mediated processing of double-stranded RNA into small interfering RNA (siRNA). The siRNA guide strand associates with the Argonaute protein in silencing effector complexes, recognizes complementary sequences and targets them for silencing. The PAZ domain is an RNA-binding module found in Argonaute and some Dicer proteins and its structure has been determined in the free state. Here, we report the 2.6 A crystal structure of the PAZ domain from human Argonaute eIF2c1 bound to both ends of a 9-mer siRNA-like duplex. In a sequence-independent manner, PAZ anchors the 2-nucleotide 3' overhang of the siRNA-like duplex within a highly conserved binding pocket, and secures the duplex by binding the 7-nucleotide phosphodiester backbone of the overhang-containing strand and capping the 5'-terminal residue of the complementary strand. On the basis of the structure and on binding assays, we propose that PAZ might serve as an siRNA-end-binding module for siRNA transfer in the RNA silencing pathway, and as an anchoring site for the 3' end of guide RNA within silencing effector complexes.", "Recent compelling evidence indicates that mutation, aberrant expression, and dysregulation of microRNA (miRNA) biogenesis are implicated in cancer development and progression. Based on the important role of miRNA biogenesis pathway in carcinogenesis, we hypothesized that genetic variations in this pathway genes may play a role as susceptibility factors for breast cancer. To test this hypothesis, we investigated the associations between 41 single nucleotide polymorphisms (SNPs) in 14 genes involved in miRNA biogenesis pathway and breast cancer risk in a case-control study of 559 Korean breast cancer cases and 567 controls frequency-matched by age. In all women, 3 SNPs (AGO1 rs595055, AGO2 rs3864659, and p68 rs1991401) were significantly associated with breast cancer risk. In stratified analysis by menopausal status, altered risk associations were observed for 7 SNPs in postmenopausal breast cancer. When subjects were grouped by the number of high-risk genotypes, we found a progressive increase in gene-dosage effect (P (trend) = 9.46E-7). The protective effects of AGO2 rs3864659 and HIWI rs11060845 were more pronounced in progesterone receptor-positive (PR+) cancer than in progesterone receptor-negative (PR-) cancer (odds ratio (OR), 0.50; 95% confidence interval (CI), 0.30-0.84 vs. OR, 0.94; 95% CI, 0.60-1.84; P (heterogeneity) = 0.04 and OR, 0.57; 95% CI, 0.37-0.88 vs. OR, 0.97; 95% CI, 0.65-1.44; P (heterogeneity) = 0.02, respectively), and the DROSHA rs644236 had stronger association with estrogen receptor-negative (ER-) cancer than for estrogen receptor-positive (ER+) cancer (OR, 1.39; 95% CI, 1.08-1.78 vs. OR, 1.05; 95% CI, 0.85-1.29; P (heterogeneity) = 0.04). Our results suggest that genetic variants in miRNA biogenesis pathway genes may be associated with breast cancer risk, and the modifiable effects might be different according to the menopausal status and hormone receptor status.", "Argonaute (Ago) family proteins are multidomain proteins expressed in prokaryotic and eukaryotic organisms. In eukaryotes, Ago proteins are most well known for their roles in RNA silencing. In prokaryotes, the functions of Ago proteins are unknown, but based on their similarity to eukaryotic Ago proteins, they could be involved in nucleic acid-directed regulatory pathways related to RNA silencing. Recent structural and biochemical studies have shed new light on the function of this family of proteins. These studies reveal how these proteins recognize and cleave RNA and suggest a function for prokaryotic family members.", "RNAi has made an enormous impact on biology in a very short period of time. It became an extraordinarily useful and simple tool for gene silencing, even as its fascinating mechanism was gradually unraveling. Understanding the mechanism of RNAi-related pathways, including both transcriptional and posttranscriptional gene silencing and even processes such as DNA elimination in Tetrahymena, have benefited from an incredible marriage of genetics, biochemistry, molecular biology, bioinformatics and finally structural biology. Structural biology played a key role in deciphering the role that a central player--the Argonaute protein--has in all RNAi processes.", "MicroRNAs are posttranscriptional regulators of messenger RNA synthesis that are intracellularly processed and transferred by the microRNA-regulating machinery consisting of Drosha, Dicer, and Argonaute. The present study analyzed the expression and clinical role of the microRNA-regulating machinery in advanced-stage ovarian carcinoma. Drosha, Dicer, Argonaute 1, and Argonaute 2 messenger RNA levels were analyzed in 144 specimens (82 effusions, 33 primary carcinomas, and 29 solid metastases) using quantitative polymerase chain reaction. Dicer, Argonaute 1, and Argonaute 2 protein levels were analyzed in 103 of the above specimens by Western blotting. Argonaute 1, Argonaute 2, and Drosha messenger RNAs were overexpressed in effusions compared with primary carcinomas and solid metastases (P<.001), whereas Argonaute 1 protein expression was highest in solid metastases (P=.004). Significantly higher expression of all 4 messenger RNAs was found in effusions compared with primary carcinomas (P<.001 to P=.006), whereas Argonaute 2 messenger RNA (P=.002), Drosha messenger RNA (P=.009), and Dicer protein (P=.006) were overexpressed in solid metastases compared with primary carcinomas. Drosha, Dicer, Argonaute 1, and Argonaute 2 messenger RNAs and protein levels in effusions were unrelated to clinicopathologic parameters. In primary carcinomas, higher levels of 3 messenger RNAs were significantly associated with high-grade histology (P=.003 for Dicer and P=.01 for Drosha and Argonaute 1). Higher Argonaute 2 messenger RNA levels in prechemotherapy effusions were related to shorter progression-free survival (P=.049), a finding that retained its significance in multivariate Cox analysis (P=.046). In conclusion, Drosha, Dicer, Argonaute 1, and Argonaute 2 are differentially expressed at different metastatic sites in ovarian carcinoma compared with primary carcinomas, suggesting a role for these molecules in tumor progression. Their clinical role in metastatic ovarian carcinoma merits further research.", "Germ-line stem cells (GSCs) serve as the source for gametogenesis in diverse organisms. We cloned and characterized the Drosophila piwi gene and showed that it is required for the asymmetric division of GSCs to produce and maintain a daughter GSC but is not essential for the further differentiation of the committed daughter cell. Genetic mosaic and RNA in situ analyses suggest that piwi expression in adjacent somatic cells regulates GSC division. piwi encodes a highly basic novel protein, well conserved during evolution. We isolated piwi homologs in Caenorhabditis elegans and humans and also identified Arabidopsis piwi-like genes known to be required for meristem cell maintenance. Decreasing C. elegans piwi expression reduces the proliferation of GSC-equivalent cells. Thus, piwi represents a novel class of genes required for GSC division in diverse organisms." ]
B-box proteins as signal integrators between light and temperature in tomato plants
Perceiving incoming environmental information is critical for optimizing plant growth and development. Multiple B-box proteins (BBXs) play essential roles in light-dependent developmental processes in plants. However, whether BBXs function as a signal integrator between light and temperature in tomato plants remains elusive. In this study, 31
[ "In rice, OsBBX14, a B-box (BBX) transcription factor, reportedly delays heading. Here, we revealed that OsBBX14 positively regulates rice photomorphogenesis. The OsBBX14-overexpressing (OsBBX14-OX) seedlings were hypersensitive to light, especially blue light, and exhibited dwarfism, while the OsBBX14 knock-out plants (osbbx14) were taller than wild-type plants under blue light. Histological analyses indicated that the observed dwarfism was mainly due to decreased cell length. Additionally, OsBBX14 abundance (mRNA and protein levels) was influenced by different light wavelengths in a time-dependent manner. The expression levels of HY5Ls (LONG HYPOCOTYL 5 LIKE) and ELIPs (EARLY LIGHT-INDUCIBLE PROTEIN) genes, whose Arabidopsis thaliana homologs function as positive regulators in the light signaling pathway, were significantly upregulated in OsBBX14-OX lines. In contrast, the expression of genes related to cell wall organization and dwarfism was downregulated in OsBBX14-OX lines. Chromatin immunoprecipitation (ChIP) assays confirmed that OsBBX14 binds to the T/G-box of HY5L1 (LONG HYPOCOTYL 5 LIKE 1) promoter. LUC complementation imaging (LCI) results suggested that OsBBX14 had physical interaction with OsCRY2 protein. Collectively, in response to blue light, OsBBX14 promotes photomorphogenesis, probably by directly or indirectly regulating the expression of HY5L1 or other genes related to cell wall organization and dwarfism.", "B-box-containing (BBX) proteins play critical roles in a variety of cellular and developmental processes in plants. BBX21 (also known as SALT TOLERANCE HOMOLOG2), which contains two B-box domains in tandem at the N terminus, has been previously demonstrated as a key component involved in the COP1-HY5 signaling hub. However, the exact molecular and physiological roles of B-box domains in BBX21 are largely unclear. Here, we found that structurally disruption of the second B-box domain, but not the first one, in BBX21 completely abolishes its biological and physiological activity in conferring hyperphotomorphogenetic phenotype in Arabidopsis (Arabidopsis thaliana). Intact B-box domains in BBX21 are not required for interaction with COP1 and its degradation by COP1 via the 26S proteasome system. However, disruption of the second B-box of BBX21 nearly impairs its ability for binding of T/G-box within the HY5 promoter both in vitro and in vivo, as well as controlling HY5 and HY5-regulated gene expression in Arabidopsis seedlings. Taken together, this study provides a mechanistic framework in which BBX21 directly binds to the T/G-box present in the HY5 promoter possibly through its second B-box domain, which in turn controls HY5 and HY5-regulated gene expression to promote photomorphogenesis.", "Arabidopsis thaliana CALMODULIN7 (CAM7), a unique member of the calmodulin gene family, plays a crucial role as a transcriptional regulator in seedling development. The elongated HYPOCOTYL5 (HY5) bZIP protein, an integrator of multiple signaling pathways, also plays an important role in photomorphogenic growth and light-regulated gene expression. CAM7 acts synergistically with HY5 to promote photomorphogenesis at various wavelengths of light. Although the genetic relationships between CAM7 and HY5 in light-mediated seedling development have been demonstrated, the molecular connectivity between CAM7 and HY5 is unknown. Furthermore, whereas HY5-mediated gene regulation has been fairly well investigated, the transcriptional regulation of HY5 is largely unknown. Here, we report that HY5 expression is regulated by HY5 and CAM7 at various wavelengths of light and also at various stages of development. In vitro and in vivo DNA-protein interaction studies suggest that HY5 and CAM7 bind to closely located T/G- and E-box cis-acting elements present in the HY5 promoter, respectively. Furthermore, CAM7 and HY5 physically interact and regulate the expression of HY5 in a concerted manner. Taken together, these results demonstrate that CAM7 and HY5 directly interact with the HY5 promoter to mediate the transcriptional activity of HY5 during Arabidopsis seedling development.", "Ethylene signaling plays important roles in multiple aspects of plant growth and development. Its functions in abiotic stress responses remain largely unknown. Here, we report that alteration of ethylene signaling affected plant salt-stress responses. A type II ethylene receptor homolog gene NTHK1 (Nicotiana tabacum histidine kinase 1) from tobacco (N. tabacum) conferred salt sensitivity in NTHK1-transgenic Arabidopsis (Arabidopsis thaliana) plants as judged from the phenotypic change, the relative electrolyte leakage, and the relative root growth under salt stress. Ethylene precursor 1-aminocyclopropane-1-carboxylic acid suppressed the salt-sensitive phenotype. Analysis of Arabidopsis ethylene receptor gain-of-function mutants further suggests that receptor function may lead to salt-sensitive responses. Mutation of EIN2, a central component in ethylene signaling, also results in salt sensitivity, suggesting that EIN2-mediated signaling is beneficial for plant salt tolerance. Overexpression of the NTHK1 gene or the receptor gain-of-function activated expression of salt-responsive genes AtERF4 and Cor6.6. In addition, the transgene NTHK1 mRNA was accumulated under salt stress, suggesting a posttranscriptional regulatory mechanism. These findings imply that ethylene signaling may be required for plant salt tolerance.", "We report the characterization of low-temperature-induced transcription factors in grapevine (Vitis vinifera). Four transcription factors were identified in low-temperature-treated grapevine. The expression of V. vinifera C-repeat-binding factors, VvCBF2, VvCBF4, and VvCBFL, and V. vinifera B-box-type zinc finger protein, VvZFPL, was immediately induced and upregulated in leaves by the low-temperature treatment. Similar induction of the gene expression was observed in low-temperature-treated stems and flowers, although VvZFPL was constitutively expressed in flowers. Tendrils expressed all the four genes constitutively. In berry skin, VvCBF2 and VvCBFL were induced by the low-temperature treatment before the onset of véraison, while only VvCBF2 was induced under the low-temperature condition after the onset of véraison. The overexpression of VvCBF2 and VvZFPL in Arabidopsis plants led to longer hypocotyls than the control plants. The rosette leaves of these plants were smaller and had lower chlorophyll contents than those of the control plants, resulting in a pale green color. Finally, the VvCBF2- and VvZFPL-overexpressing plants revealed growth retardation. These results suggest that VvCBF2 and VvZFPL may affect photomorphogenesis and growth in grapevine. Meanwhile, no morphological changes were detected in the VvCBF4- and VvCBFL-overexpressing plants. The cold tolerance test demonstrated that all of the overexpressing plants remained viable and noticeably healthy compared with the control plants even after exposure to severe cold treatment, suggesting that VvCBF2, VvCBF4, VvCBFL, or VvZFPL may enhance cold tolerance in grapevine." ]
Rare diseases in rheumatology.
Rare diseases (RDs) affect less than 5/10,000 people in Europe and fewer than 200,000 individuals in the United States. In rheumatology, RDs are heterogeneous and lack systemic classification. Clinical courses involve a variety of diverse symptoms, and patients may be misdiagnosed and not receive appropriate treatment. The objective of this study was to identify and classify some of the most important RDs in rheumatology. We also attempted to determine their combined prevalence to more precisely define this area of rheumatology and increase awareness of RDs in healthcare systems. We conducted a comprehensive literature search and analyzed each disease for the specified criteria, such as clinical symptoms, treatment regimens, prognoses, and point prevalences. If no epidemiological data were available, we estimated the prevalence as 1/1,000,000. The total point prevalence for all RDs in rheumatology was estimated as the sum of the individually determined prevalences.
[ "We have previously described anti-KS autoantibodies and provided evidence that they are directed against asparaginyl-transfer RNA (tRNA) synthetase (AsnRS). The aim of the present study was to identify patients with anti-AsnRS autoantibodies and elucidate the clinical significance of this sixth antisynthetase antibody. In particular, we studied whether it was associated with the syndrome of myositis (polymyositis or dermatomyositis [DM]), interstitial lung disease (ILD), arthritis, and other features that had been previously associated with the 5 other anti-aminoacyl-tRNA synthetase autoantibodies. More than 2,500 sera from patients with connective tissue disease (including myositis and ILD) and controls were examined for anti-AsnRS autoantibodies by immunoprecipitation (IP). Positive and control sera were tested for the ability to inhibit AsnRS by preincubation of the enzyme source with the serum. The HLA class II (DRB1, DQA1, DQB1, DPB1) alleles were identified from restriction fragment length polymorphism of polymerase chain reaction-amplified genomic DNA. Anti-AsnRS antibodies were identified in the sera of 8 patients (5 Japanese, 1 American, 1 German, and 1 Korean) by IP of the same distinctive set of tRNA and protein that differed from those precipitated by the other 5 antisynthetases, and these antibodies showed specific inhibition of AsnRS activity. Two of these patients had DM, but 7 of 8 (88%) had ILD. Four patients (50%) had arthritis, and 1 had Raynaud's phenomenon. This antisynthetase was very rare among myositis patients (present in 0% of Japanese myositis patients), but it was found in 3% of Japanese ILD patients. Thus, most patients with anti-AsnRS had chronic ILD with or without features of connective tissue disease. Interestingly, all 4 Japanese patients tested had DR2 (DRB1*1501/1502), compared with 33% of healthy controls. These results indicate that anti-AsnRS autoantibodies, like anti-alanyl-tRNA synthetase autoantibodies, have a stronger association with ILD than with myositis and may be associated with the DR2 phenotype.", "The aim of this study was to investigate the clinicopathological characteristics of interstitial lung disease (ILD) patients with anti-aminoacyl-tRNA synthetase (anti-ARS) autoantibodies. Patients and Methods We examined 14 ILD patients with anti-ARS autoantibodies between 2004 and 2007 and retrospectively investigated their clinical, radiographic, and pathological findings. Anti-Jo-1 antibodies were the most common (10 of 14), followed by anti-OJ, anti-KS, and anti-EJ (1 each for 3 patients); 1 patient with polymyositis had both anti-Jo-1 and anti-PL-12 antibodies. Ten patients had a chronic clinical course, whereas 4 presented with subacute deterioration. Of 8 patients with myositis, 1 (12.5%) had myositis-preceding ILD, 3 (37.5%) had ILD-preceding myositis, and 4 (50%) had simultaneous onset. Chest high-resolution computed tomography frequently showed lung-base predominant ground glass opacities (GGO) with volume loss. The results of surgical lung biopsies indicated that 4 patients had nonspecific interstitial pneumonia (NSIP) and/or organizing pneumonia (OP) patterns. All but 1 received corticosteroid therapy, and 6 patients were also given cyclosporin. The mean duration of follow-up was 22 months (range, 5-47 months). ILD improved in 9 patients and stabilized in 3; however, in 1 patient, it initially improved during 6 months, then progressively worsened despite treatment, and finally resulted in death. These results indicate that ILD patients with anti-ARS antibodies usually have a chronic clinical course, lung-base predominant GGO with volume loss, NSIP and/or OP patterns, and a good response to corticosteroid treatment; however, some have a rapidly worsening course and recurrence, despite therapy.", "The clinical and laboratory characteristics of seven patients with anti-aminoacyl-tRNA synthetase (ARS) autoantibodies, specifically anti-OJ (anti-isoleucyl-tRNA synthetase), were examined and compared with previously published findings. Serum samples from 1135 Japanese patients with various autoimmune diseases and 48 normal individuals were screened for anti-OJ antibodies using RNA and protein immunoprecipitation assays. The patients whose sera contained anti-OJ antibodies were assessed regarding clinical symptoms, clinical course, laboratory findings, chest radiography and chest computed tomography. Sera from seven patients were found to contain anti-OJ antibodies. These autoantibodies were associated with interstitial lung disease (ILD) and myositis. The diagnoses of the seven patients were idiopathic interstitial pneumonias (IIPs) in three, polymyositis (PM) in three and PM-rheumatoid arthritis (RA) overlap in the remaining one. All patients had ILD, but muscle weakness and polyarthritis were seen only in four. Raynaud's phenomenon and sclerodactyly were absent in all patients. These results indicate that the presence of anti-OJ autoantibodies may distinguish a subtype of anti-ARS syndrome that is more closely associated with ILD than myositis or Raynaud's phenomenon.", "Antisynthetase syndrome (ASS) is a rare chronic autoimmune disorder (2-3 times more common in women than in men), associated with interstitial lung disease (the most important feature), dermatomyositis (DM), and polymyositis (PM). The cause of ASS is unknown. Recent developments in immunology have improved our knowledge and it is now possible to classify ASS according to the presence of myositis specific autoantibodies. The hallmark of ASS is the presence of serum autoantibodies directed against aminoacyl-tRNA synthetases (anti-ARS involved in protein synthesis). ASS is due to IgG antibodies directed against the enzyme synthase. Antisynthetase antibodies (ASAb) include: anti-histidyl- (anti-Jo-1, being the best known), anti-threonyl- (anti-PL-7), anti-alanyl (anti-PL-12), anti-isoleucyl- (anti-OJ), anti-glycyl- (anti-EJ), anti-asparaginyl- (anti-KS), anti-Wa, anti-tyrosil- (anti-YRS), anti-phenylalanyl-transfer RNA synthetase (anti-Zo), and anti-signal recognition particle (anti-SRP). Anti-Jo-1 is the most common ASAb (in ~20-30% of PM/DM patients).", "To describe the clinical spectrum associated with aminoacyl-transfer RNA synthetase (ARS) autoantibodies in patients with idiopathic inflammatory myositis defined according to Peter and Bohan's criteria. Cohort studies were selected from MEDLINE and Embase up to August 2013. Two investigators independently extracted data on study design, patient characteristics, and clinical features (interstitial lung disease [ILD], fever, mechanic's hands [MH], Raynaud's phenomenon [RPh], arthralgia, sclerodactyly, cancer and dermatomyositis-specific rash) according to the presence of myositis-specific (anti-aminoacyl-transfer RNA synthetase [ARS], anti-signal recognition particle [anti-SRP] and anti-Mi2) and myositis-associated (anti-PM/Scl, anti-U1-RNP and anti-Ku) autoantibodies. 27 studies (3487 patients) were included in the meta-analysis. Arthralgia (75%, CI 67-81) and ILD (69%, CI 63-74) were the most prevalent clinical signs associated with anti-ARS autoantibodies. Anti-Mi2 and anti-SRP autoantibodies were associated with few extramuscular signs. ARS autoantibodies were identified in 13% of patients with cancer-associated myositis (5-25). Patients with non-anti-Jo1 ARS had greater odds of presenting fever (RR 0.63, CI 0.52-0.90) and ILD (RR 0.87, CI 0.81-0.93) compared to those with anti-Jo1 autoantibodies. The frequencies of myositis (RR 1.60, CI 1.38-1.85), arthralgia (RR 1.52, CI 1.32-1.76) and MH (RR 1.47, CI 1.11-1.94) were almost 50% higher in patients with anti-Jo1 compared to non-anti-Jo1 ARS autoantibodies. Patients with anti-PM/Scl differed from those with anti-ARS autoantibodies by a greater prevalence of RPh (RR 0.70, CI 0.53-0.94) and sclerodactyly (RR 0.47, CI 0.25-0.89). ILD was less frequent in patients with anti-U1-RNP autoantibodies (RR 3.35, CI 1.07-10.43). No difference was observed between anti-ARS and myositis-associated autoantibodies for other outcomes. The presence of anti-ARS autoantibodies delimits a heterogeneous subset of patients with a high prevalence of myositis, MH, arthralgia in anti-Jo1 patients, and RPh and fever in non-anti-Jo1 patients. The clinical signs of populations positive for anti-PM/Scl and anti-ARS autoantibodies largely overlap, especially with regard to ILD, challenging the clinical delimitation of the antisynthetase syndrome.", "Myositis-specific autoantibodies (MSAs) are a useful tool in diagnosis, defining clinical subsets and predicting prognosis of dermatomyositis (DM) and polymyositis (PM). In this study, we identified a novel MSA reactive with 155 and 140 kDa nuclear proteins [anti-155/140 antibody (Ab)] and determined the clinical feature of DM patients positive for this autoantibody (autoAb). Sera from 52 Japanese patients with DM, 9 with PM, 48 with systemic lupus erythematosus (SLE), 126 with systemic sclerosis and 18 with idiopathic interstitial pneumonia were examined by immunoprecipitation assays. Positive sera were further characterized by immunodepletion and immunofluorescence staining. Seven of the 52 (13%) Japanese patients with DM immunoprecipitated 155 and 140 kDa proteins from 35S-labelled K562 leukaemia cell extract. No patients with SLE, systemic sclerosis or idiopathic interstitial pneumonia as well as healthy controls were positive for this autoAb. Patients with anti-155/140 Ab developed heliotrope rash, Gottron's papules or sign and flagellate erythema significantly more frequently than those negative. Notably, internal malignancy was found at significantly higher frequency in those positive than those negative (71 vs 11%; P < 0.005). In contrast, none of these patients positive for this autoAb had interstitial lung disease. This novel MSA is associated with cancer-associated DM and may serve as a diagnostic serological marker for this specific subset.", "In patients with myositis, the lung is commonly involved, and the presence of anti-aminoacyl-tRNA synthetase (anti-ARS) antibodies marks the presence or predicts the development of interstitial lung disease (ILD). A distinct clinical entity-antisynthetase syndrome-is characterized by the presence of anti-ARS antibodies, myositis, ILD, fever, arthritis, Raynaud's phenomenon, and mechanic's hands. The most common anti-ARS antibody is anti-Jo-1. More recently described anti-ARS antibodies might confer a phenotype that is distinct from that of anti-Jo-1-positive patients and is characterized by a lower incidence of myositis and a higher incidence of ILD. Among patients with antisynthetase syndrome-related ILD, the response to immunosuppressive medications is generally, but not universally, favorable.", "To elucidate the clinical importance of the anti-signal recognition particle (SRP) autoantibody in patients with myositis. Retrospective systematic assessment of the clinical, laboratory and histological characteristics of 23 anti-SRP-positive patients from six European centres. Data were compared with a large group of anti-SRP-negative patients with myositis published previously. Clinically, patients with anti-SRP autoantibodies often had a severe symmetric proximal muscle weakness resulting in marked disability, dysphagia and highly elevated levels of serum creatine kinase. Three patients had typical dermatomyositis rashes. The disease was associated with the occurrence of extramuscular signs and symptoms including interstitial lung disease. No association was found with an increased risk of cardiac involvement, and the disease carried a reasonably favourable prognosis with most patients responding to treatment. None of the patients had the typical histological features of myositis. Most muscle biopsy specimens showed the presence of necrotic muscle fibres and no inflammatory infiltrates. Anti-SRP autoantibodies are associated with a syndrome of a necrotising myopathy in the spectrum of immune-mediated myopathies that differs from typical polymyositis. Further studies are needed to elucidate the pathogenesis and to clarify the role of the anti-SRP autoantibodies in this unique disease.", "Myositis autoantibodies continue to be the subject of substantial interest, with several significant recent developments. Recent studies have emphasized that anti-Jo-1 or other antisynthetases can be associated with interstitial lung disease, even in the absence of myositis. Anti-Jo-1 autoantibody levels were shown to correlate with disease activity over time. Immunization of mice with anti-Jo-1 led to muscle and lung inflammation, reminiscent of human disease. The complexity of the antibody picture in myositis continues to increase. Several new autoantibodies have been described or better characterized. Among these were a new antisynthetase reactive with phenylalanyl-transfer RNA synthetase (anti-Zo); an autoantibody that immunoprecipitates 155- and 140-kD proteins and was common in children but seemed to be associated with malignancy in adults; and an autoantibody to a small ubiquitin-like modifier--activating enzyme associated with dermatomyositis and interstitial lung disease. These findings have significant clinical implications and suggest promising areas of further research.", "Whipple's disease is a chronic infection caused by the actinomycete Tropheryma whipplei. We conducted a randomized controlled trial of the efficacy of antimicrobials that are able to cross the blood-brain barrier and to which T whipplei is susceptible. Patients from central Europe with previously untreated Whipple's disease (n = 40) were assigned randomly to groups given daily infusions of either ceftriaxone (1 x 2 g, 20 patients) or meropenem (3 x 1 g, 20 patients) for 14 days, followed by oral trimethoprim-sulfamethoxazole for 12 months. The primary outcome measured was maintenance of remission for 3 years, determined by a composite index of clinical and laboratory data as well as histology. All patients were observed for the entire follow-up period (median, 89 mo; range, 71-128 mo); all achieved clinical and laboratory remission. Remission was maintained in all patients during the time of observation, except for 2 who died from unrelated causes. A single patient with asymptomatic cerebrospinal infection who was resistant to both treatments responded to chloroquine and minocycline. The odds ratio for the end point (remission for at least 3 years) was 0.95 (95% confidence interval, 0.05-16.29; P = 1.0). This was a randomized controlled trial to show that treatment with ceftriaxone or meropenem, followed by trimethoprim-sulfamethoxazole, cures patients with Whipple's disease. One asymptomatic individual with infection of the cerebrospinal fluid required additional therapy." ]
Clinical Outcomes of Long-Term Care Residents with Dementia with and without Agitation
To describe characteristics and compare clinical outcomes including falls, fractures, infections, and neuropsychiatric symptoms (NPS) among long-term care residents with dementia with and without agitation.
[ "The objective of this study is to compare cognitive decline of elderly people after entering an institution with that of elders living in the community with similar clinical conditions. The Personnes Agées QUID (PAQUID) cohort is a prospective population-based study which included, at baseline, 3777 community-dwelling people aged 65 years and older. Participants were followed-up for 22 years. Among those who were nondemented and living at home at baseline, 2 groups were compared: participants who entered a nursing home during study follow-up (n = 558) and those who remained living at home (n = 3117). Cognitive decline was assessed with Mini-Mental State Examination (MMSE), Benton visual retention test, and verbal fluency Isaacs Set Test. After controlling for numerous potential confounders, including baseline MMSE and instrumental activities of daily living scores, incident dementia, depressive symptoms, and chronic diseases, nursing home placement was significantly associated with a lower score on MMSE between the last visit before and after institutionalization (difference of 2.8 points, P < .0001) and greater further cognitive decline after institutionalization (difference of 0.7 point per year, P < .0001). Similar results were found for the Benton memory test. In a second series of analysis in which the persons who became demented over the study follow-up were excluded, the results remained unchanged. The present study suggests that institutionalized elderly people present a greater cognitive decline than persons remaining in the community. The reasons of that decline remain unclear and may be related to physical and psychological effects of institutionalization in elderly people.", "This article describes the met and unmet needs of elderly residents of nursing care (NC) and residential care (RC) settings. Thirty-four residents of an RC home and 40 residents of two NC settings were assessed. Each resident and a respective staff member were interviewed using the Camberwell Assessment of Need for the Elderly (CANE) to indicate the resident's current met and unmet needs. The Clifton Assessment Procedure for the Elderly-Behaviour Rating Scale (CAPE-BRS) was completed by the staff member to indicate the participant's current level of dependency. In addition, the Mini-Mental State Examination was administered to participants and DSM-IV diagnosis was recorded. A high number of needs were found in both RC and NC settings, the level of dependency being proportional to level of need. There was a core set of needs in both samples related to difficulties with accommodation, food preparation, and self-care. Both NC and RC homes were meeting these needs; however, RC residents had a significantly greater level of unmet need for suitable day-time activities. The greatest predictor of type of setting was gender and there were significantly more females in RC. Controlling for gender, participants in NC had greater levels of dependency, particularly problems with apathy and social skills, as measured on the CAPE-BRS. It is possible that-the greater level of social needs in NC residents had led to their placement in the more specialized NC settings. On the other hand, NC settings may be left caring for a group of residents that, because of their specific needs, have been difficult to place into RC. These findings have clinical implications for the future development of continuing care for the elderly. This study also highlighted that there is a substantial need for specialist services to address the unmet needs in these two types of continuing-care settings, such as interventions for social disturbances in NC and suitable daytime activities in RC. The CANE is a useful instrument to evaluate such needs in long-term-care settings.", "Unmet needs are becoming acknowledged as better predictors of the worst prognostic outcomes than common measures of functional or cognitive decline. Their accurate assessment is a pivotal component of effective care delivery, particularly in institutionalized care where little is known about the needs of its residents, many of whom suffer from dementia and show complex needs. The aims of this study were to describe the needs of an institutionalized sample and to analyze its relationship with demographic and clinical characteristics. A cross-sectional study was conducted with a sample from three nursing homes. All residents were assessed with a comprehensive protocol that included Mini-Mental State Examination (MMSE), Geriatric Depression Scale (GDS-15), Neuropsychiatric Inventory (NPI) and Adults and Older Adults Functional Inventory (IAFAI). To identify needs, the Camberwell Assessment of Need for the Elderly (CANE) was used. The final sample included 175 residents with a mean age of 81 standard deviation (SD = 10) years. From these, 58.7% presented cognitive deficit (MMSE) and 45.2% depressive symptoms (GDS). Statistically significant negative correlations were found between MMSE score and met (r s = -0.425), unmet (r s = -0.369) and global needs (r s = -0.565). Data also showed significant correlations between depressive symptoms and unmet (r s = 0.683) and global needs (r s = 0.407), and between behavioral and psychological symptoms (BPSD) and unmet (r s = 0.181) and global needs (r s = 0.254). Finally, significant correlations between functional impairment and met (r s = 0.642), unmet (r s = 0.505) and global needs (r s = 0.796) were also found. These results suggest that in this sample, more unmet needs are associated with the worst outcomes measured. This is consistent with previous findings and seems to demonstrate that the needs of those institutionalized elderly remain under-diagnosed and untreated.", "Long-term care demographic and industry trends challenge provision of effective care and infection prevention. A systematic review was conducted to identify and evaluate cost estimates reported in the scientific literature of structure and processes intended to prevent infection among residents and staff of long-term care facilities (LTCFs). The small volume of publications regarding cost of infection prevention in LTCFs does not lead to recommendations for specific infection prevention practices. Cost-effectiveness research is needed to inform nurse executives' decisions on how best to prevent infections. Nurse executives should consider costs as well as health outcomes when generating new policy regarding procedures or products related to infection prevention. Administrators should cautiously evaluate the recommendations of published studies containing a cost estimation based on the quality of the estimate in addition to assessing applicability of the results to their own facility and resident population." ]
How do I find the genus of a plant?
The genus
[ "To study the tempo and pattern of mitochondrial gene loss in plants, DNAs from 280 genera of flowering plants were surveyed for the presence or absence of 40 mitochondrial protein genes by Southern blot hybridization. All 14 ribosomal protein genes and both sdh genes have been lost from the mitochondrial genome many times (6 to 42) during angiosperm evolution, whereas only two losses were detected among the other 24 genes. The gene losses have a very patchy phylogenetic distribution, with periods of stasis followed by bursts of loss in certain lineages. Most of the oldest groups of angiosperms are still mired in a prolonged stasis in mitochondrial gene content, containing nearly the same set of genes as their algal ancestors more than a billion years ago. In sharp contrast, other plants have rapidly lost many or all of their 16 mitochondrial ribosomal protein and sdh genes, thereby converging on a reduced gene content more like that of an animal or fungus than a typical plant. In these and many lineages with more modest numbers of losses, the rate of ribosomal protein and sdh gene loss exceeds, sometimes greatly, the rate of mitochondrial synonymous substitutions. Most of these mitochondrial gene losses are probably the consequence of gene transfer to the nucleus; thus, rates of functional gene transfer also may vary dramatically in angiosperms.", "Ophiocordycipitaceae is a diverse fungal family comprising multiple ecologically, economically, medicinally, and culturally important fungal species; however, only four species of the family have available mitochondrial genomes (mitogenomes). In this study, the complete mitogenome of the nematode endoparasitic fungus Hirsutella vermicola in Ophiocordycipitaceae was sequenced, and a comparative mitogenomic analysis of Ophiocordycipitaceae was performed. We found that the 53,793-bp circular mitogenome of H. vermicola, except for standard fungal mitochondrial genes, harbors seven introns acquired possibly through lateral transfer from other fungi and three free-standing open reading frames (ORFs) coding for hypothetical proteins. Phylogenetic analysis based on concatenated mitochondrial protein sequences confirmed its placement in Ophiocordycipitaceae. Comparison on five mitogenomes of Ophiocordycipitaceae revealed great variation on their sizes, from 35.2 kb in Tolypocladium ophioglossoides to 157.5 kb in Ophiocordyceps sinensis, mainly due to variable numbers of introns (from 7 to 54) as well as variable lengths of intergenic regions. The five mitogenomes, however, are highly syntenic to each other in terms of gene order, the presence of an intronic ORF encoding ribosomal protein S3 within rnl, and the nad2/nad3 joining pattern. Our study is the first report of the mitogenome of H. vermicola and has facilitated the understanding of mitogenome evolution of Ophiocordycipitaceae.", "A strategy has been developed for the construction of a validated, comprehensive composite protein sequence database. Entries are amalgamated from primary source data bases by a largely automated set of processes in which redundant and trivially different entries are eliminated. A modular approach has been adopted to allow scientific judgement to be used at each stage of database processing and amalgamation. Source databases are assigned a priority depending on the quality of sequence validation and commenting. Rejection of entries from the lower priority database, in each pairwise comparison of databases, is carried out according to optionally defined redundancy criteria based on sequence segment mismatches. Efficient algorithms for this methodology are embodied in the COMPO software system. COMPO has been applied for over 2 years in construction and regular updating of the OWL composite protein sequence database from the source databases NBRF-PIR, SWISS-PROT, a GenBank translation retrieved from the feature tables, NBRF-NEW, NEWAT86, PSD-KYOTO and the sequences contained in the Brookhaven protein structure databank. OWL is part of the ISIS integrated data resource of protein sequence and structure [Akrigg et al. (1988) Nature, 335, 745-746]. The modular nature of the integration process greatly facilitates the frequent updating of OWL following releases of the source databases. The extent of redundancy in these sources is revealed by the comparison process. The advantages of a robust composite database for sequence similarity searching and information retrieval are discussed.", "We present version 6 of the DNA Sequence Polymorphism (DnaSP) software, a new version of the popular tool for performing exhaustive population genetic analyses on multiple sequence alignments. This major upgrade incorporates novel functionalities to analyze large data sets, such as those generated by high-throughput sequencing technologies. Among other features, DnaSP 6 implements: 1) modules for reading and analyzing data from genomic partitioning methods, such as RADseq or hybrid enrichment approaches, 2) faster methods scalable for high-throughput sequencing data, and 3) summary statistics for the analysis of multi-locus population genetics data. Furthermore, DnaSP 6 includes novel modules to perform single- and multi-locus coalescent simulations under a wide range of demographic scenarios. The DnaSP 6 program, with extensive documentation, is freely available at http://www.ub.edu/dnasp.", "The natural occurrence of Pisolithus tinctorius has been confirmed in 33 countries of the world and in 38 states in the United States. This ectomycorrhizal fungus is found associated with various tree species in nurseries, urban areas, orchards, forests, and strip-mined spoils. Experiments have proved that this fungal symbiont forms ectomycorrhizae with Abies procera, Betula pendula, Carya illnoensis, 11 species of Eucalyptus, 30 species of Pinus, Pseudotsuga menziesii var. meniziesii, 2 species of Quercus, and Tsuga heterophylla. Pisolithus has also been reported growing under natural conditions in association with three additional species of Betula, two species of Eucalyptus, nine species of Pinus, and eight species of Quercus, Populus tremuloides, Pseudotsuga grandidenta, and Salix humilis. This fungal symbiont has great potential in forestation efforts because of (1) the availability of practical techniques for artificially introducing in into nursery soils; (2) its ability to improve tree survival and growth in the nursery and the field; (3) its near worldwide distribution on a variety of sites; and (4) its broad host range encompassing many of the world's most important tree species.", "Variations in mitochondrial DNA (mtDNA) have been fundamental for understanding human evolution and are causative for a plethora of inherited mitochondrial diseases, but the mutation signatures of germline mtDNA and their value in understanding mitochondrial pathogenicity remain unknown. Here, we carried out a systematic analysis of mutation patterns in germline mtDNA based on 97,566 mtDNA variants from 45,494 full-length sequences and revealed a highly non-stochastic and replication-coupled mutation signature characterized by nucleotide-specific mutation pressure (G > T>A > C) and position-specific selection pressure, suggesting the existence of an intensive mutation-selection interplay in germline mtDNA. We provide evidence that this mutation-selection interplay has strongly shaped the mtDNA sequence during evolution, which not only manifests as an oriented alteration of amino acid compositions of mitochondrial encoded proteins, but also explains the long-lasting mystery of CpG depletion in mitochondrial genome. Finally, we demonstrated that these insights may be integrated to better understand the pathogenicity of disease-implicated mitochondrial variants.", "The maize mitochondrial genome does not contain a gene coding for ribosomal protein S14. In this paper we show that the functional rps14 gene was translocated to the nucleus and acquired the signals conferring expression and product targeting to the mitochondrion in a way not previously described. Transferred rps14 was found integrated between both exons of a gene encoding the iron-sulphur subunit of the respiratory complex II (sdh2). Sdh2 exon 1 and rps14 were separated by a typical plant nuclear intron that was spliced to give a mature poly(A)+ mRNA of 1.4 kb. This processed mRNA encoded a chimeric SDH2 (truncated)-RPS14 polypeptide, and we show that this chimeric polypeptide is targeted into isolated plant mitochondria, where it is proteolytically processed in a complex way. An alternative splicing event utilizing the same 5' splice site and a different downstream 3' splice site generated a second mature poly(A)+ mRNA of 1.3 kb that contained both sdh2 exons. This sdh2 transcript encoded an SDH2 polypeptide highly conserved compared with its homologues in other organisms, and it contained the three cysteine-rich clusters that made up the three non-heme iron-sulphur centres responsible for electron transport. To our knowledge, these results constitute the first evidence of alternative splicing playing a role in the expression and targeting of two mitochondrial proteins with different functions from the same gene." ]
Ikarugamycin regulates tumor necrosis factor- expression
Ikarugamycin (IK) is an antibiotic which has been reported to have a variety of functions, such as inhibition of clathrin-mediated endocytosis (CME), anti-tumor effects and regulation of the immune system. Whether IK influences cytokine production is poorly understood. We have investigated the relationship between IK and production of tumor necrosis factor-α (TNF). TNF plays a pivotal role in pathogenesis of many diseases. Although the dynamics of soluble TNF (sTNF) has been widely explored so far, the functions of the membrane form of TNF (mTNF) have not been fully elucidated. We demonstrated that IK increases the amount of mTNF and prolongs the duration of TNF expression. This effect is unrelated to the shedding activity of disintegrin and metalloproteinase domain-containing protein 17 (ADAM 17). Our results revealed that there is a mechanism to terminate inflammation at the cellular level which IK dysregulates. Furthermore, IK can be a tool to study TNF signaling due to its effect of increasing mTNF expression.
[ "Human transmembrane tumor necrosis factor (pro-TNF) was examined for protein acylation. The cDNA encoding pro-TNF was expressed in both COS-1 cells and Sf9 cells and metabolic labeling with [(3)H]myristic or [(3)H]palmitic acid was attempted. The 17 kDa mature TNF secreted from the transfected cells was not labeled, whereas the 26 kDa pro-TNF was specifically labeled with [(3)H]palmitic acid. The [(3)H]palmitic acid labeling of pro-TNF was eliminated by treatment with hydroxylamine, indicating that the labeling was due to palmitoylation of a cysteine residue via a thioester bond. Site-directed mutagenesis of the two cysteine residues residing in the leader sequence of pro-TNF demonstrated that palmitoylation of pro-TNF occurs solely at Cys-47, located at the boundary between the transmembrane and cytoplasmic domains of pro-TNF. Thus, pro-TNF interacts with the plasma membrane via both its proteinaceous transmembrane domain and a lipid anchor.", "To follow endocytosis in BY-2 cells we made use of fluorescent nano beads. Beads with 20nm in diameter were internalised rapidly and accumulated partially in compartments also labelled by the endocytic marker FM4-64. Studies in BY-2 cells and protoplasts revealed that larger beads (100nm) were excluded from uptake into turgescent and plasmolysed cells while protoplasts were able to internalise beads with a diameter of up to 1000nm. Endocytosis of beads was only partially inhibited by the clathrin-specific inhibitor Ikarugamycin and strongly blocked by wortmannin. These results imply that uptake of beads involves clathrin-dependent and clathrin-independent endocytic mechanisms and supports the hypothesis that clathrin-independent endocytosis plays a general role in plants.", "Although tumor necrosis factor (TNF) initially came to prominence because of its anti-tumor activity, most attention is now focused on its proinflammatory actions. TNF appears to play a critical role in both early and late events involved in inflammation, from localizing the noxious agent and amplifying the cellular and mediator responses at the local site and systemically, to editing (e.g., apoptosis) injured cells or effete immune cells and repairing inflammatory damage. We have generated mice deficient in TNF (TNF-/- mice) and have begun to examine the multiple functions attributed to TNF. TNF-/- mice develop normally and have no gross structural or morphological abnormalities. As predicted, they are highly susceptible to challenge with an infectious agent (Candida albicans), are resistant to the lethality of minute doses of lipopolysaccharide (LPS) following D-galactosamine treatment, have a deficiency in granuloma development, and do not form germinal centers after immunization. Phagocytic activity of macrophages appears relatively normal, as do T cell functions, as measured by proliferation, cytokine release, and cytotoxicity. B cell response to thymus-independent antigens is normal, but the Ig response to thymus-dependent antigen is reduced. Surprisingly, cytokine production induced by LPS appears essentially intact, with the exception of reduced colony-stimulating factor activity. Other unexpected findings coming from our initial analysis are as follows. (i) TNF has low toxicity in TNF-/- mice. (ii) TNF-/- mice show an anomalous late response to heat-killed Corynebacterium parvum. In contrast to the prompt response (granuloma formation, hepatosplenomegaly) and subsequent resolution phase in C. parvum-injected TNF+/+ mice, similarly treated TNF-/- mice show little or no initial response, but then develop a vigorous, disorganized inflammatory response leading to death. These results suggest that TNF has an essential homeostatic role in limiting the extent and duration of an inflammatory process-i.e., an anti-inflammatory function. (iii) In contrast to the expectation that TNF+/+ mice and TNF+/- mice would have identical phenotypes, TNF+/- mice showed increased susceptibility to high-dose LPS lethality, increased susceptibility to Candida challenge, and delayed resolution of the C. parvum-induced inflammatory process, indicating a strong gene dose requirement for different actions of TNF.", "Membrane traffic in activated macrophages is required for two critical events in innate immunity: proinflammatory cytokine secretion and phagocytosis of pathogens. We found a joint trafficking pathway linking both actions, which may economize membrane transport and augment the immune response. Tumor necrosis factor alpha (TNFalpha) is trafficked from the Golgi to the recycling endosome (RE), where vesicle-associated membrane protein 3 mediates its delivery to the cell surface at the site of phagocytic cup formation. Fusion of the RE at the cup simultaneously allows rapid release of TNFalpha and expands the membrane for phagocytosis.", "Ikarugamycin (IKA) is a previously discovered antibiotic, which has been shown to inhibit the uptake of oxidized low-density lipoproteins in macrophages. Furthermore, several groups have previously used IKA to inhibit clathrin-mediated endocytosis (CME) in plant cell lines. However, detailed characterization of IKA has yet to be performed. Consequently, we performed biochemistry and microscopy experiments to further characterize the effects of IKA on CME. We show that IKA has an IC50 of 2.7 μm in H1299 cells and acutely inhibits CME, but not other endocytic pathways, in a panel of cell lines. Although long-term incubation with IKA has cytotoxic effects, the short-term inhibitory effects on CME are reversible. Thus, IKA can be a useful tool for probing routes of endocytic trafficking." ]
Integrating Sleeping Sickness Surveillance into the Primary Healthcare System in the Democratic Republic of the Congo
We integrated sleeping sickness case detection into the primary healthcare system in 2 health districts in the Democratic Republic of the Congo. We replaced a less field-friendly serologic test with a rapid diagnostic test, which was followed up by human African trypanosomiasis microscopic testing, and used a mixed costing methodology to estimate costs from a healthcare provider perspective. We screened a total of 18,225 persons and identified 27 new cases. Average financial cost (i.e., actual expenditures) was US $6.70/person screened and $4,464/case diagnosed and treated. Average economic cost (i.e., value of resources foregone that could have been used for other purposes) was $9.40/person screened and $6,138/case diagnosed and treated. Our study shows that integrating sleeping sickness surveillance into the primary healthcare system is feasible and highlights challenges in completing the diagnostic referral process and developing a context-adapted diagnostic algorithm for the large-scale implementation of this strategy in a sustainable and low-cost manner.
[ "In the 1960s, it appeared that human African trypanosomiasis (HAT) could be effectively controlled, but by the beginning of the twenty-first century several decades of neglect had led to alarming numbers of reported new cases, with an estimated 300 000 people infected. The World Health Organization (WHO) responded with a series of initiatives aimed at bringing HAT under control again. Since 2001, the pharmaceutical companies that produce drugs for HAT have committed themselves to providing them free of charge to WHO for distribution for the treatment of patients. In addition, funds have been provided to WHO to support national sleeping sickness control programmes to boost control and surveillance of the disease. That, coupled with bilateral cooperation and the work of nongovernmental organizations, helped reverse the upward trend in HAT prevalence. By 2012, the number of reported cases was fewer than 8000. This success in bringing HAT under control led to its inclusion in the WHO Roadmap for eradication, elimination and control of neglected tropical diseases, with a target set to eliminate the disease as a public health problem by 2020. A further target has been set, by countries in which HAT is endemic, to eliminate gambiense HAT by reducing the incidence of infection to zero in a defined geographical area. This report provides information about new diagnostic approaches, new therapeutic regimens and better understanding of the distribution of the disease with high-quality mapping. The roles of human and animal reservoirs and the tsetse fly vectors that transmit the parasites are emphasized. The new information has formed the basis for an integrated strategy with which it is hoped that elimination of gambiense HAT will be achieved. The report also contains recommendations on the approaches that will lead to elimination of the disease.", "Human African trypanosomiases caused by the Trypanosoma brucei gambiense parasite is a lethal disease targeted for eradication. One of the main disease control strategies is active case-finding through outreach campaigns. In 2014, a new method for active screening was developed with mini, motorcycle-based, teams. This study compares the cost of two active case-finding approaches, namely the traditional mobile teams and mini mobile teams, in the two health districts of the Democratic Republic of the Congo. The financial and economic costs of both approaches were estimated from a health care provider perspective. Cost and operational data were collected for 12 months for 1 traditional team and 3 mini teams. The cost per person screened and diagnosed was calculated and univariate sensitivity analysis was conducted to identify the main cost drivers. During the study period in total 264,630 people were screened, and 23 HAT cases detected. The cost per person screened was lower for a mini team than for a traditional team in the study setting (US$1.86 versus US$2.08). A comparable result was found in a scenario analysis, assuming both teams would operate in a similar setting, with the cost per person screened by a mini team 15% lower than the cost per person screened by a traditional team (1.86 $ vs 2.14$). The main explanations for this lower cost are that mini teams work with fewer human resources, cheaper means of transportation and do not perform the Capillary Tube Centrifugation test or card agglutination test dilutions. Active HAT screening with mini mobile teams has a lower cost and could be a cost-effective alternative for active case-finding. Further research is needed to determine if mini mobile teams have similar or better yields than traditional mobile teams in terms of detections and cases successfully treated.", "To review current and emerging tools for Gambiense HAT control and elimination, and propose strategies that integrate these tools with epidemiological evidence. We reviewed the scientific literature to identify contemporary and emerging tools and strategies for controlling and eliminating Gambiense HAT. Through an iterative process involving key stakeholders, we then developed comprehensive scenarios leading to elimination, considering both established and new tools for diagnosis, case treatment and vector control. Core components of all scenarios include detecting and treating cases with established or emerging techniques. Relatively more intensive scenarios incorporate vector control. New tools considered include tiny targets for tsetse fly control, use of rapid diagnostic tests and oral treatment with fexinidazole or oxaboroles. Scenarios consider the time when critical new tools are expected to become ready for deployment by national control programmes. Based on a review of the latest epidemiological data, we estimate the various interventions to cover 1,380,600 km(2) and 56,986,000 people. A number of new tools will fill critical gaps in the current armamentarium for diagnosing and treating Gambiense HAT. Deploying these tools in endemic areas will facilitate the comprehensive and sustainable control of the disease considerably and contribute to the ultimate goal of elimination." ]
Alantolactone is a potent inhibitor of the ROS-YAP pathway.
Yes-associated protein 1 (YAP1) and its paralogue PDZ-binding motif (TAZ) play pivotal roles in cell proliferation, migration, and invasion, and abnormal activation of these TEAD transcriptional coactivators is found in diverse cancers in humans and mice. Targeting YAP1/TAZ signaling is thus a promising therapeutic avenue but, to date, few selective YAP1/TAZ inhibitors have been effective against cancer cells either in vitro or in vivo. We screened chemical libraries for potent YAP1/TAZ inhibitors using a highly sensitive luciferase reporter system to monitor YAP1/TAZ-TEAD transcriptional activity in cells. Among 29 049 low-molecular-weight compounds screened, we obtained nine hits, and the four of these that were the most effective shared a core structure with the natural product alantolactone (ALT). We also tested 16 other structural derivatives of ALT and found that natural ALT was the most efficient at increasing ROS-induced LATS kinase activities and thus YAP1/TAZ phosphorylation. Phosphorylated YAP1/TAZ proteins were subject to nuclear exclusion and proteosomic degradation such that the growth of ALT-treated tumor cells was inhibited both in vitro and in vivo. Our data show for the first time that ALT can be used to target the ROS-YAP pathway driving tumor cell growth and so could be a potent anticancer drug.
[ "The Hippo signaling pathway is a vital suppressor of tumorigenesis that is often inactivated in human cancers. In normal cells, the Hippo pathway is triggered by external forces such as cell crowding, or changes to the extracellular matrix or cell polarity. Once activated, Hippo signaling down-regulates transcription supported by the paralogous cofactors YAP1 and TAZ. The Hippo pathway's functions in normal and cancer biology have been dissected by studies of mutant mice with null or conditional tissue-specific mutations of Hippo signaling elements. In this review, we attempt to systematically summarize results that have been gleaned from detailed in vivo characterizations of these mutants. Our goal is to describe the physiological roles of Hippo signaling in several normal organ systems, as well as to emphasize how disruption of the Hippo pathway, and particularly hyperactivation of YAP1/TAZ, can be oncogenic.", "Mitochondrial respiratory function is frequently impaired in human cancers. However, the mechanisms by which mitochondrial dysfunction contributes to tumour progression remain elusive. Here we show in Drosophila imaginal epithelium that defects in mitochondrial function potently induce tumour progression of surrounding tissue in conjunction with oncogenic Ras. Our data show that Ras activation and mitochondrial dysfunction cooperatively stimulate production of reactive oxygen species, which causes activation of c-Jun amino (N)-terminal kinase (JNK) signalling. JNK cooperates with oncogenic Ras to inactivate the Hippo pathway, leading to upregulation of its targets Unpaired (an interleukin-6 homologue) and Wingless (a Wnt homologue). Mitochondrial dysfunction in Ras-activated cells further cooperates with Ras signalling in neighbouring cells with normal mitochondrial function, causing benign tumours to exhibit metastatic behaviour. Our findings provide a mechanistic basis for interclonal tumour progression driven by mitochondrial dysfunction and oncogenic Ras.", "Chagas disease is caused by infection with the protozoan parasite Trypanosoma cruzi (T. cruzi). It was originally a Latin American endemic health problem, but now is expanding worldwide as a result of increasing migration. The currently available drugs for Chagas disease, benznidazole and nifurtimox, provoke severe adverse effects, and thus the development of new drugs is urgently required. Ubiquinone (UQ) is essential for respiratory chain and redox balance in trypanosomatid protozoans, therefore we aimed to provide evidence that inhibitors of the UQ biosynthesis have trypanocidal activities. In this study, inhibitors of the human COQ7, a key enzyme of the UQ synthesis, were tested for their trypanocidal activities because they were expected to cross-react and inhibit trypanosomal COQ7 due to their genetic homology. We show the trypanocidal activity of a newly found human COQ7 inhibitor, an oxazinoquinoline derivative. The structurally similar compounds were selected from the commercially available compounds by 2D and 3D ligand-based similarity searches. Among 38 compounds selected, 12 compounds with the oxazinoquinoline structure inhibited significantly the growth of epimastigotes of T. cruzi. The most effective 3 compounds also showed the significant antitrypanosomal activity against the mammalian stage of T. cruzi at lower concentrations than benznidazole, a commonly used drug today. We found that epimastigotes treated with the inhibitor contained reduced levels of UQ9. Further, the growth of epimastigotes treated with the inhibitors was partially rescued by UQ10 supplementation to the culture medium. These results suggest that the antitrypanosomal mechanism of the oxazinoquinoline derivatives results from inhibition of the trypanosomal UQ synthesis leading to a shortage of the UQ pool. Our data indicate that the UQ synthesis pathway of T. cruzi is a promising drug target for Chagas disease.", "The precise control of the cell cycle requires regulation by many intrinsic and extrinsic factors. Whether the metabolic status of the cell exerts a direct control over cell cycle checkpoints is not well understood. We isolated a mutation, tenured (tend), in a gene encoding cytochrome oxidase subunit Va. This mutation causes a drop in intracellular ATP to levels sufficient to maintain cell survival, growth, and differentiation, but not to enable progression through the cell cycle. Analysis of this gene in vivo and in cell lines shows that a specific pathway involving AMPK and p53 is activated that causes elimination of Cyclin E, resulting in cell cycle arrest. We demonstrate that in multiple tissues the mitochondrion has a direct and specific role in enforcing a G1-S cell cycle checkpoint during periods of energy deprivation." ]